WorldWideScience

Sample records for californium 251 target

  1. [Apoptosis of glioma cell line U251 induced by small interfering RNA targeting survivin].

    Science.gov (United States)

    Xu, Ru-xiang; Tu, Yan-yang; Jiang, Xiao-dan; Feng, Jiang-nan; Huang, Jun

    2006-04-01

    To construct recombinant expression vectors of small interfering RNA (siRNA) targeting survivin and investigate apoptosis of glioma cell line U251 mediated by the survivin-targeting siRNA. According to the sequence of the coding region of survivin gene, two strings of 19 nucleotides of inverted sequence flanking the loop sequence of two complementary 9-base oligonucleotides were designed and synthesized to form hairpin construct as the DNA templates for the target siRNA. The siRNA templates were cloned into siRNA expression vector pGenesil-1, and the resulted vector pGenesil-1/survivin was transfected into U251 cells using Metafectene following the standard protocols. Real-time PCR and Western blotting were performed to evaluate survivin gene silencing induced by siRNA transfection at the RNA and protein levels, respectively. Flow cytometry analysis with Annexin-V/PI double staining was used to determine the cell apoptosis. Real-time RT-PCR and Western blotting revealed significantly lowered survivin expression at both RNA and protein levels in transfected U251 cells, which exhibited a significantly higher apoptosis rate after transfection as shown by flow cytometry analysis. RNA interference mediated by the siRNA expression vector pGenesi-l/survivin can significantly reduce survivin expression and induce remarkable apoptosis in U251 cells.

  2. Californium-252 progress, report No. 7, April 1971

    Energy Technology Data Exchange (ETDEWEB)

    1971-12-31

    This report contains discusses of the following topics on Californium-252: First sales of californium-252; encapsulation services discussed; three new participants in market evaluation program; summer training programs to use californium; Californium-252 shipping casks available; Californium-252 questions and answers, radiotherapy; neutron radiography; natural resources exploration; nuclear safeguards; process control; dosimetry; neutron radiography; neutron shielding; and nuclear safeguards.

  3. Functionalized nano-graphene oxide particles for targeted fluorescence imaging and photothermy of glioma U251 cells.

    Science.gov (United States)

    Li, Zhong-Jun; Li, Chao; Zheng, Mei-Guang; Pan, Jia-Dong; Zhang, Li-Ming; Deng, Yue-Fei

    2015-01-01

    This study was to prepare the functionalized nano-graphene oxide (nano-GO) particles, and observe targeted fluorescence imaging and photothermy of U251 glioma cells under near infrared (NIR) exposure. The functionalized nano-GO-Tf-FITC particles were prepared and then were incubated with U251 glioma cells. Estimation of CCK8 cell activity was adopted for measurement of cytotoxicity. The effect of fluorescein imaging was detected by fluorescence microscope with anti-CD71-FITC as a control. Finally, we detected the killing efficacy with flow cytometry after an 808 nm NIR exposure. Both nano-GO-Tf-FITC group and CD71-FITC group exhibited green-yellow fluorescence, while the control group without the target molecule nano-GO-FITC was negative. The nano-GO-Tf-FITC was incubated with U251 cells at 0.1 mg/ml, 1.0 mg/ml, 3.0 mg/ml and 5.0 mg/ml. After 48 h of incubation, the absorbance was 0.747 ± 0.031, 0.732 ± 0.043, 0.698 ± 0.051 and 0.682 ± 0.039, while the absorbance of control group is 0.759 ± 0.052. There is no significant difference between the nano-GO-FITC groups and control group. In addition, the apoptosis and death index of nano-GO-Tf-FITC group was significantly higher than that of nano-GO-FITC and blank control group (P nano-GO-Tf-FITC particles with good biological compatibility and low cytotoxicity are successfully made, which have an observed effect of target imaging and photothermal therapy on glioma U251 cells.

  4. Quantitative Proteomic Profiling of Tachyplesin I Targets in U251 Gliomaspheres

    Directory of Open Access Journals (Sweden)

    Xuan Li

    2017-01-01

    Full Text Available Tachyplesin I is a cationic peptide isolated from hemocytes of the horseshoe crab and its anti-tumor activity has been demonstrated in several tumor cells. However, there is limited information providing the global effects and mechanisms of tachyplesin I on glioblastoma multiforme (GBM. Here, by using two complementary proteomic strategies (2D-DIGE and dimethyl isotope labeling-based shotgun proteomics, we explored the effect of tachyplesin I on the proteome of gliomaspheres, a three-dimensional growth model formed by a GBM cell line U251. In total, the expression levels of 192 proteins were found to be significantly altered by tachyplesin I treatment. Gene ontology (GO analysis revealed that many of them were cytoskeleton proteins and lysosomal acid hydrolases, and the mostly altered biological process was related to cellular metabolism, especially glycolysis. Moreover, we built protein–protein interaction network of these proteins and suggested the important role of DNA topoisomerase 2-alpha (TOP2A in the signal-transduction cascade of tachyplesin I. In conclusion, we propose that tachyplesin I might down-regulate cathepsins in lysosomes and up-regulate TOP2A to inhibit migration and promote apoptosis in glioma, thus contribute to its anti-tumor function. Our results suggest tachyplesin I is a potential candidate for treatment of glioma.

  5. Historical review of californium-252 discovery and development

    Science.gov (United States)

    Stoddard, D. H.

    This paper discusses the discovery and history of californium 252. This isotope may be synthesized by irradiating plutonium 239, plutonium 242, americium 243, or curium 244 with neutrons in a nuclear reactor. Various experiments and inventions involving (252)Cf conducted at the Savannah River Plant are discussed. The evolution of radiotherapy using californium 252 is reviewed.

  6. MiR-133b contributes to arsenic-induced apoptosis in U251 glioma cells by targeting the hERG channel.

    Science.gov (United States)

    Wang, Jian; Li, Yongli; Jiang, Chuanlu

    2015-04-01

    Substantial evidence indicates that the human ether-a-go-go-related gene potassium channel (hERG, Kv11.1, KCNH2) is overexpressed in human glioblastoma multiforme (GBM) specimens and plays an essential role in the malignant proliferation of glioma cells. However, its upstream regulator in glioma cells is not fully elucidated. The present study was designed to determine whether the expression of hERG gene is regulated by miR-133b or miR-34a, thereby contributing to the anti-proliferation effect of arsenic trioxide (ATO) in U251 human glioma cells. Real-time polymerase chain reactions (qRT-PCR) and Western blot results demonstrated that hERG mRNA and protein levels were dramatically upregulated in clinical GBM specimens. Conversely, both miR-133b and miR-34a were markedly downregulated in clinical GBM specimens by qRT-PCR. The hERG gene was a direct target of miR-133b and miR-34a by bioinformatics analyses and luciferase reporter assays. Moreover, ATO, which is an emerging chemotherapy drug for glioma disease, remarkably elevated the level of miR-133b, but not miR-34a in U251 glioma cells. The level of miR-133b upstream transactivator serum response factor (SRF) was also suppressed by ATO. The transfection of anti-miR-133b oligonucleotide (AMO-133b) remarkably prevented the decrease of hERG protein by 5 μM ATO treatment for 24 h in U251 cells, whereas anti-miR-34a oligonucleotide (AMO-34a) did not exhibit recuperated effect. Finally, the transient overexpression by miR-133b mimics and treatment with the hERG channel-specific blocker E4031 markedly facilitated the ATO inhibition of proliferation of and induced apoptosis in U251 cells, whereas AMO-miR-133b attenuated these changes. Our study provided the evidence for the pathological role of miR-133b and miR-34a in the development of GBM and thus expanded our understanding of the hERG gene expression and ATO chemotherapeutic roles of miRNAs. Targeting miR-133b/hERG pathway may be a new strategy for chemotherapy of

  7. Californium-252: a remarkable versatile radioisotope

    Energy Technology Data Exchange (ETDEWEB)

    Osborne-Lee, I.W.; Alexander, C.W.

    1995-10-10

    A product of the nuclear age, Californium-252 ({sup 252}Cf) has found many applications in medicine, scientific research, industry, and nuclear science education. Californium-252 is unique as a neutron source in that it provides a highly concentrated flux and extremely reliable neutron spectrum from a very small assembly. During the past 40 years, {sup 252}Cf has been applied with great success to cancer therapy, neutron radiography of objects ranging from flowers to entire aircraft, startup sources for nuclear reactors, fission activation for quality analysis of all commercial nuclear fuel, and many other beneficial uses, some of which are now ready for further growth. Californium-252 is produced in the High Flux Isotope Reactor (HFIR) and processed in the Radiochemical Engineering Development Center (REDC), both of which are located at the Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee. The REDC/HFIR facility is virtually the sole supplier of {sup 252}Cf in the western world and is the major supplier worldwide. Extensive exploitation of this product was made possible through the {sup 252}Cf Market Evaluation Program, sponsored by the United States Department of Energy (DOE) [then the Atomic Energy Commission (AEC) and later the Energy Research and Development Administration (ERDA)]. This program included training series, demonstration centers, seminars, and a liberal loan policy for fabricated sources. The Market Evaluation Program was instituted, in part, to determine if large-quantity production capability was required at the Savannah River Laboratory (SRL). Because of the nature of the product and the means by which it is produced, {sup 252}Cf can be produced only in government-owned facilities. It is evident at this time that the Oak Ridge research facility can meet present and projected near-term requirements. The production, shipment, and sales history of {sup 252}Cf from ORNL is summarized herein.

  8. Production, Distribution, and Applications of Californium-252 Neutron Sources

    Energy Technology Data Exchange (ETDEWEB)

    Balo, P.A.; Knauer, J.B.; Martin, R.C.

    1999-10-03

    The radioisotope {sup 252}Cf is routinely encapsulated into compact, portable, intense neutron sources with a 2.6-year half-life. A source the size of a person's little finger can emit up to 10{sup 11} neutrons/s. Californium-252 is used commercially as a reliable, cost-effective neutron source for prompt gamma neutron activation analysis (PGNAA) of coal, cement, and minerals, as well as for detection and identification of explosives, laud mines, and unexploded military ordnance. Other uses are neutron radiography, nuclear waste assays, reactor start-up sources, calibration standards, and cancer therapy. The inherent safety of source encapsulations is demonstrated by 30 years of experience and by U.S. Bureau of Mines tests of source survivability during explosions. The production and distribution center for the U. S Department of Energy (DOE) Californium Program is the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL). DOE sells The radioisotope {sup 252}Cf is routinely encapsulated into compact, portable, intense neutron sources with a 2.6- year half-life. A source the size of a person's little finger can emit up to 10 neutrons/s. Californium-252 is used commercially as a reliable, cost-effective neutron source for prompt gamma neutron activation analysis (PGNAA) of coal, cement, and minerals, as well as for detection and identification of explosives, laud mines, and unexploded military ordnance. Other uses are neutron radiography, nuclear waste assays, reactor start-up sources, calibration standards, and cancer therapy. The inherent safety of source encapsulations is demonstrated by 30 years of experience and by U.S. Bureau of Mines tests of source survivability during explosions. The production and distribution center for the U. S Department of Energy (DOE) Californium Program is the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory(ORNL). DOE sells {sup 252}Cf to commercial

  9. Unusual structure, bonding and properties in a californium borate

    Energy Technology Data Exchange (ETDEWEB)

    Polinski, Matthew J.; Garner, Edward B.; Maurice, Rémi; Planas, Nora; Stritzinger, Jared T.; Parker, T. Gannon; Cross, Justin N.; Green, Thomas D.; Alekseev, Evgeny V.; Van Cleve, Shelley M.; Depmeier, Wulf; Gagliardi, Laura; Shatruk, Michael; Knappenberger, Kenneth L.; Liu, Guokui; Skanthakumar, S.; Soderholm, Lynda; Dixon, David A.; Albrecht-Schmitt, Thomas E.

    2014-03-23

    The participation of the valence orbitals of actinides in bonding has been debated for decades. Recent experimental and computational investigations demonstrated the involvement of 6p, 6d and/or 5f orbitals in bonding. However, structural and spectroscopic data, as well as theory, indicate a decrease in covalency across the actinide series, and the evidence points to highly ionic, lanthanide-like bonding for late actinides. Here we show that chemical differentiation between californium and lanthanides can be achieved by using ligands that are both highly polarizable and substantially rearrange on complexation. A ligand that suits both of these desired properties is polyborate. We demonstrate that the 5f, 6d and 7p orbitals are all involved in bonding in a Cf(III) borate, and that large crystal-field effects are present. Synthetic, structural and spectroscopic data are complemented by quantum mechanical calculations to support these observations.

  10. Extraction of Trivalent Actinides and Lanthanides from Californium Campaign Rework Solution Using TODGA-based Solvent Extraction System

    Energy Technology Data Exchange (ETDEWEB)

    Benker, Dennis [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Delmau, Laetitia Helene [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Dryman, Joshua Cory [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2017-07-01

    This report presents the studies carried out to demonstrate the possibility of quantitatively extracting trivalent actinides and lanthanides from highly acidic solutions using a neutral ligand-based solvent extraction system. These studies stemmed from the perceived advantage of such systems over cationexchange- based solvent extraction systems that require an extensive feed adjustment to make a low-acid feed. The targeted feed solutions are highly acidic aqueous phases obtained after the dissolution of curium targets during a californium (Cf) campaign. Results obtained with actual Cf campaign solutions, but highly diluted to be manageable in a glove box, are presented, followed by results of tests run in the hot cells with Cf campaign rework solutions. It was demonstrated that a solvent extraction system based on the tetraoctyl diglycolamide molecule is capable of quantitatively extracting trivalent actinides from highly acidic solutions. This system was validated using actual feeds from a Cf campaign.

  11. Biomedical neutron research at the Californium User Facility for neutron science

    Energy Technology Data Exchange (ETDEWEB)

    Martin, R.C. [Oak Ridge National Lab., TN (United States); Byrne, T.E. [Roane State Community College, Harriman, TN (United States); Miller, L.F. [Univ. of Tennessee, Knoxville, TN (United States)

    1997-04-01

    The Californium User Facility for Neutron Science has been established at Oak Ridge National Laboratory (ORNL). The Californium User Facility (CUF) is a part of the larger Californium Facility, which fabricates and stores compact {sup 252}Cf neutron sources for worldwide distribution. The CUF can provide a cost-effective option for research with {sup 252}Cf sources. Three projects at the CUF that demonstrate the versatility of {sup 252}Cf for biological and biomedical neutron-based research are described: future establishment of a {sup 252}Cf-based neutron activation analysis system, ongoing work to produce miniature high-intensity, remotely afterloaded {sup 252}Cf sources for tumor therapy, and a recent experiment that irradiated living human lung cancer cells impregnated with experimental boron compounds to test their effectiveness for boron neutron capture therapy.

  12. Beyond Californium-A Neutron Generator Alternative for Dosimetry and Instrument Calibration in the U.S.

    Science.gov (United States)

    Piper, Roman K; Mozhayev, Andrey V; Murphy, Mark K; Thompson, Alan K

    2017-09-01

    Evaluations of neutron survey instruments, area monitors, and personal dosimeters rely on reference neutron radiations, which have evolved from the heavy reliance on (α,n) sources to a shared reliance on (α,n) and the spontaneous fission neutrons of californium-252 (Cf). Capable of producing high dose equivalent rates from an almost point source geometry, the characteristics of Cf are generally more favorable when compared to the use of (α,n) and (γ,n) sources or reactor-produced reference neutron radiations. Californium-252 is typically used in two standardized configurations: unmoderated, to yield a fission energy spectrum; or with the capsule placed within a heavy-water moderating sphere to produce a softened spectrum that is generally considered more appropriate for evaluating devices used in nuclear power plant work environments. The U.S. Department of Energy Cf Loan/Lease Program, a longtime origin of affordable Cf sources for research, testing and calibration, was terminated in 2009. Since then, high-activity sources have become increasingly cost-prohibitive for laboratories that formerly benefited from that program. Neutron generators, based on the D-T and D-D fusion reactions, have become economically competitive with Cf and are recognized internationally as important calibration and test standards. Researchers from the National Institute of Standards and Technology and the Pacific Northwest National Laboratory are jointly considering the practicality and technical challenges of implementing neutron generators as calibration standards in the U.S. This article reviews the characteristics of isotope-based neutron sources, possible isotope alternatives to Cf, and the rationale behind the increasing favor of electronically generated neutron options. The evaluation of a D-T system at PNNL has revealed characteristics that must be considered in adapting generators to the task of calibration and testing where accurate determination of a dosimetric quantity is

  13. 36 CFR 251.86 - Parties.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Parties. 251.86 Section 251.86 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE LAND USES Appeal of Decisions Relating to Occupancy and Use of National Forest System Lands § 251.86 Parties. Only the following...

  14. 7 CFR 251.6 - Distribution plan.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Distribution plan. 251.6 Section 251.6 Agriculture... GENERAL REGULATIONS AND POLICIES-FOOD DISTRIBUTION THE EMERGENCY FOOD ASSISTANCE PROGRAM § 251.6 Distribution plan. Link to an amendment published at 74 FR 62474, Nov. 30, 2009. (a) Contents of the plan. The...

  15. 36 CFR 251.96 - Intervention.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Intervention. 251.96 Section... of Decisions Relating to Occupancy and Use of National Forest System Lands § 251.96 Intervention. (a... discretionary review level (§ 251.87(d)) shall be denied. (b) To request intervention in a first-level appeal...

  16. 20 CFR 704.251 - DCCA endorsement.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false DCCA endorsement. 704.251 Section 704.251... Columbia Workmen's Compensation Act § 704.251 DCCA endorsement. The following form of endorsement... reversed by appropriate appellate authority as provided for by said Act. This endorsement shall not be...

  17. 14 CFR 29.251 - Vibration.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Vibration. 29.251 Section 29.251... STANDARDS: TRANSPORT CATEGORY ROTORCRAFT Flight Miscellaneous Flight Requirements § 29.251 Vibration. Each part of the rotorcraft must be free from excessive vibration under each appropriate speed and power...

  18. 14 CFR 27.251 - Vibration.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Vibration. 27.251 Section 27.251... STANDARDS: NORMAL CATEGORY ROTORCRAFT Flight Miscellaneous Flight Requirements § 27.251 Vibration. Each part of the rotorcraft must be free from excessive vibration under each appropriate speed and power...

  19. 42 CFR 2.51 - Medical emergencies.

    Science.gov (United States)

    2010-10-01

    ... and time of the disclosure; and (4) The nature of the emergency (or error, if the report was to FDA... 42 Public Health 1 2010-10-01 2010-10-01 false Medical emergencies. 2.51 Section 2.51 Public... OF ALCOHOL AND DRUG ABUSE PATIENT RECORDS Disclosures Without Patient Consent § 2.51 Medical...

  20. 48 CFR 251.205 - Contract clause.

    Science.gov (United States)

    2010-10-01

    ... Fleet Management System (IFMS) Vehicles 251.205 Contract clause. Use the clause at 252.251-7001, Use of Interagency Fleet Management System (IFMS)Vehicles and Related Services, in solicitations and contracts which include the clause at FAR 52.251-2, Interagency Fleet Management System (IFMS) Vehicles and Related...

  1. 49 CFR 234.251 - Standby power.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Standby power. 234.251 Section 234.251 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION..., Inspection, and Testing Inspections and Tests § 234.251 Standby power. Standby power shall be tested at least...

  2. Cannabinoid receptor antagonists AM251 and AM630 activate TRPA1 in sensory neurons

    Science.gov (United States)

    Patil, Mayur; Patwardhan, Amol; Salas, Margaux M.; Hargreaves, Kenneth M.; Akopian, Armen N.

    2011-01-01

    Cannabinoid receptor antagonists have been utilized extensively in vivo as well as in vitro, but their selectivity has not been fully examined. We investigated activation of sensory neurons by two cannabinoid antagonists – AM251 and AM630. AM251 and AM630 activated trigeminal (TG) sensory neurons in a concentration-dependent fashion (threshold 1 μM). AM251 and AM630 responses are mediated by the TRPA1 channel in a majority (90–95%) of small-to-medium TG sensory neurons. AM630 (1–100 μM), but not AM251, was a significantly more potent agonist in cells co-expressing both TRPA1 and TRPV1 channels. We next evaluated AM630 and AM251 effects on TRPV1- and TRPA1-mediated responses in TG neurons. Capsaicin (CAP) effects were inhibited by pre-treatment with AM630, but not AM251. Mustard oil (MO) and WIN55,212-2 (WIN) TRPA1 mediated responses were also inhibited by pre-treatment with AM630, but not AM251 (25uM each). Co-treatment of neurons with WIN and either AM630 or AM251 had opposite effects: AM630 sensitized WIN responses, whereas AM251 inhibited WIN responses. WIN-induced inhibition of CAP responses in sensory neurons was reversed by AM630 pre-treatment and AM251 co-treatment (25μM each), as these conditions inhibit WIN responses. Hindpaw injections of AM630 and AM251 did not produce nocifensive behaviors. However, both compounds modulated CAP-induced thermal hyperalgesia in wild-type mice and rats, but not TRPA1 null-mutant mice. AMs also partially regulate WIN inhibition of CAP-induced thermal hyperalgesia in a TRPA1-dependent fashion. In summary, these findings demonstrate alternative targets for the cannabinoid antagonists, AM251 and AM630, in peripheral antihyperalgesia which involve certain TRP channels. PMID:21645531

  3. Apparatus for the measurement of total body nitrogen using prompt neutron activation analysis with californium-252.

    Science.gov (United States)

    Mackie, A; Hannan, W J; Smith, M A; Tothill, P

    1988-01-01

    Details of clinical apparatus designed for the measurement of total body nitrogen (as an indicator of body protein), suitable for the critically ill, intensive-care patient are presented. Californium-252 radio-isotopic neutron sources are used, enabling a nitrogen measurement by prompt neutron activation analysis to be made in 40 min with a precision of +/- 3.2% for a whole body dose equivalent of 0.145 mSv. The advantages of Californium-252 over alternative neutron sources are discussed. A comparison between two irradiation/detection geometries is made, leading to an explanation of the geometry adopted for the apparatus. The choice of construction and shielding materials to reduce the count rate at the detectors and consequently to reduce the pile-up contribution to the nitrogen background is discussed. Salient features of the gamma ray spectroscopy system to reduce spectral distortion from pulse pile-up are presented.

  4. Safety Analysis Report for Packaging (SARP) of the Oak Ridge National Laboratory TRU Californium Shipping Container

    Energy Technology Data Exchange (ETDEWEB)

    Box, W.D.; Shappert, L.B.; Seagren, R.D.; Klima, B.B.; Jurgensen, M.C.; Hammond, C.R.; Watson, C.D.

    1980-01-01

    An analytical evaluation of the Oak Ridge National Laboratory TRU Californium Shipping Container was made in order to demonstrate its compliance with the regulations governing off-site shipment of packages that contain radioactive material. The evaluation encompassed five primary categories: structural integrity, thermal resistance, radiation shielding, nuclear criticality safety, and quality assurance. The results of this evaluation demonstrate that the container complies with the applicable regulations.

  5. 36 CFR 251.121 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Definitions. 251.121 Section... Revenue-Producing Visitor Services in Alaska § 251.121 Definitions. In addition to the definitions in... partnership, limited partnership, joint venture, or individual entrepreneurship, a beneficial ownership of or...

  6. 7 CFR 251.2 - Administration.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Administration. 251.2 Section 251.2 Agriculture... Administration. (a) Food and Nutrition Service. Within the United States Department of Agriculture (the... this section, any information on changes in program administration, including any changes resulting...

  7. 37 CFR 2.51 - Drawing required.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Drawing required. 2.51... COMMERCE RULES OF PRACTICE IN TRADEMARK CASES Drawing § 2.51 Drawing required. (a) In an application under section 1(a) of the Act, the drawing of the mark must be a substantially exact representation of the mark...

  8. 36 CFR 251.57 - Rental fees.

    Science.gov (United States)

    2010-07-01

    ... covering more than one year. (3) A base cabin user fee for a recreation residence use shall be 5 percent of... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Rental fees. 251.57 Section... Uses § 251.57 Rental fees. (a) Except as otherwise provided in this part or when specifically...

  9. 40 CFR 25.1 - Introduction.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Introduction. 25.1 Section 25.1 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GENERAL PUBLIC PARTICIPATION IN PROGRAMS UNDER THE... Introduction. This part sets forth minimum requirements and suggested program elements for public participation...

  10. 48 CFR 251.202 - Authorization.

    Science.gov (United States)

    2010-10-01

    ... OF DEFENSE CONTRACT MANAGEMENT USE OF GOVERNMENT SOURCES BY CONTRACTORS Contractor Use of Interagency Fleet Management System (IFMS) Vehicles 251.202 Authorization. (a)(2)(A) See FAR 28.307-2(c) for policy...

  11. Dicty_cDB: SLJ251 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLJ251 (Link to dictyBase) - - - Contig-U13343-1 | Contig-U15969-1 SLJ...251P (Link to Original site) SLJ251F 186 SLJ251Z 244 SLJ251P 430 - - Show SLJ251 Library SL (Link to library) Clone ID SLJ...43-1 | Contig-U15969-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLJ2-C/SLJ...251Q.Seq.d/ Representative seq. ID SLJ251P (Link to Original site) Representative DNA sequence >SLJ251 (SLJ...251Q) /CSM/SL/SLJ2-C/SLJ251Q.Seq.d/ AAAGCAATATTTATTTAATTTTTTAAAAAAAAAGAATCAAATAAAATAGAGTAACAATAT

  12. 29 CFR 1910.251 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR OCCUPATIONAL SAFETY AND HEALTH STANDARDS Welding, Cutting and Brazing § 1910.251 Definitions. As used in this subpart: (a) Welder and welding operator mean any operator of electric or gas welding and cutting...

  13. Pharmacokinetics and metabolism of the staurosporine analogue CGP 41 251 in mice.

    Science.gov (United States)

    van Gijn, R; van Tellingen, O; Haverkate, E; Kettenes-van den Bosch, J J; Bult, A; Beijnen, J H

    1999-01-01

    Studies with CGP 41 251 (I), an N-benzoylstaurosporine derivative and PKC-alpha inhibitor, revealed that oral administration of 400 microg/day of the compound to wild type mice on four successive days reversed multi drug resistance (Killion et al. Oncology Research 7: 453-459, 1995). In our study, the same regimen of administration was followed with the primary objective to establish the pharmacokinetics and metabolism of the compound and to substantiate at which plasma concentrations of CGP 41 251 multi drug resistance (MDR) reversal can be expected. Concentrations of CGP 41 251 and metabolites in plasma were determined by a validated high performance liquid chromatography (HPLC) method with fluorescence detection. Structural characterization of the metabolites was performed with HPLC and mass spectrometric detection. In our experiment extensive metabolism of CGP 41 251 was found. The presence of five hydroxylated metabolites of CGP 41 251 (I) was confirmed and two metabolites were structurally elucidated as CGP 50 750 (III) and CGP 52 421 (V). Maximal concentrations of 73 ng/ml, 1.9 ng/ml and 126 ng/ml for CGP 41 251 (I), III and V were found, respectively. The mass spectra of the other three metabolites indicate that these are oxidized nitrogens or hydroxylated compounds. As yet, the oxidation or hydroxylation sites have not been established. This study has revealed new information about CGP 41 251 pharmacokinetics and metabolism. Target levels between 10-100 ng/ml may be important to achieve in further clinical trials with CGP 41 251 as MDR modulator.

  14. 48 CFR 2452.251-70 - Contractor employee travel.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Contractor employee travel. 2452.251-70 Section 2452.251-70 Federal Acquisition Regulations System DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Texts of Provisions and Clauses 2452.251-70 Contractor employee travel...

  15. 37 CFR 251.23 - FOIA and Privacy Act.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false FOIA and Privacy Act. 251.23 Section 251.23 Patents, Trademarks, and Copyrights COPYRIGHT OFFICE, LIBRARY OF CONGRESS COPYRIGHT... Access to and Inspection of Records § 251.23 FOIA and Privacy Act. Freedom of Information Act and Privacy...

  16. 27 CFR 25.1 - Production and removal of beer.

    Science.gov (United States)

    2010-04-01

    ... beer. 25.1 Section 25.1 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS BEER Scope of Regulations § 25.1 Production and removal of beer. The regulations in this part relate to beer and cereal beverages and cover the location, construction, equipment...

  17. 37 CFR 251.30 - Basic obligations of arbitrators.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Basic obligations of arbitrators. 251.30 Section 251.30 Patents, Trademarks, and Copyrights COPYRIGHT OFFICE, LIBRARY OF CONGRESS... arbitrators may accept gifts of nominal value or gifts from friends and family as specified in § 251.34(b). (5...

  18. 38 CFR 17.251 - The Subcommittee on Academic Affairs.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false The Subcommittee on Academic Affairs. 17.251 Section 17.251 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS MEDICAL Grants for Exchange of Information § 17.251 The Subcommittee on Academic Affairs. There is...

  19. 20 CFR 632.251 - Eligibility for funds.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Eligibility for funds. 632.251 Section 632.251 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF LABOR INDIAN AND NATIVE AMERICAN EMPLOYMENT AND TRAINING PROGRAMS Summer Youth Employment and Training Programs § 632.251...

  20. Application of TSH bioindicator for studying the biological efficiency of neutrons from californium-252 source

    Energy Technology Data Exchange (ETDEWEB)

    Cebulska-Wasilewska, A.; Rekas, K. [Institute of Nuclear Physics, Cracow (Poland); Kim, J.K. [Korea Atomic Energy Research Inst., Taejon (Korea, Republic of)

    1997-12-31

    The effectiveness of neutrons from a Californium-252 source in the induction of various abnormalities in the Tradescantia clone 4430 stamen hair cells (TSH-assay) was studied. The special attention was paid to check whether any enhancement in effects caused by process of boron neutron capture is visible in the cells enriched with boron ions. Two chemicals (borax and BSH) were applied to introduce boron-10 ions into cells. Inflorescence, normal or pretreated with chemicals containing boron, were irradiated in the air with neutrons from a Cf-252 source at KAERI, Taejon, Korea. To estimate the relative biological effectiveness (RBE) in the induction of gene mutations of the neutron beam under the study, Tradescantia inflorescences, without any chemical pretreatment, were irradiated with various doses of X-rays. The ranges of radiation doses used were 0-0.1 Gy in neutrons and 0-0.5 Gy in X-rays. After the time needed to complete the postirradiation repair Tradescantia cuttings were transferred to Cracow, where screening of gene and lethal; mutations, cell cycle alterations in somatic cells have been done, and dose response relationships were figured. The maximal RBE values were estimated in the range of 4.6-6.8. Alterations of RBE value were observed; from 6.8 to 7.8 in the case of plants pretreated with 240 ppm of B-10 from borax, and 4.6 to 6.1 in the case of 400 ppm of B-10 from BSH. Results showed a slight, although statistically insignificant increase in biological efficacy of radiation from the Cf-252 source in samples pretreated with boron containing chemicals. (author)

  1. 48 CFR 952.251-70 - Contractor employee travel discounts.

    Science.gov (United States)

    2010-10-01

    ... discounts. 952.251-70 Section 952.251-70 Federal Acquisition Regulations System DEPARTMENT OF ENERGY CLAUSES... Contractor employee travel discounts. As prescribed in 951.7002, insert the following clause: Contractor Employee Travel Discounts (AUG 2009) (a) The Contractor shall take advantage of travel discounts offered to...

  2. 14 CFR 23.251 - Vibration and buffeting.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Vibration and buffeting. 23.251 Section 23... Requirements § 23.251 Vibration and buffeting. There must be no vibration or buffeting severe enough to result in structural damage, and each part of the airplane must be free from excessive vibration, under any...

  3. 40 CFR 265.251 - Protection from wind.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Protection from wind. 265.251 Section... FACILITIES Waste Piles § 265.251 Protection from wind. The owner or operator of a pile containing hazardous waste which could be subject to dispersal by wind must cover or otherwise manage the pile so that wind...

  4. 37 CFR 251.35 - Outside employment and other activities.

    Science.gov (United States)

    2010-07-01

    ... activities. 251.35 Section 251.35 Patents, Trademarks, and Copyrights COPYRIGHT OFFICE, LIBRARY OF CONGRESS... the arbitrator's knowledge and acquiescence to the arbitrator's parent, sibling, spouse, child, or..., including any charitable organization, on the basis of designation, recommendation, or other specification...

  5. 36 CFR 251.83 - Decisions not appealable.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Decisions not appealable. 251.83 Section 251.83 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE LAND... such as wildfires, severe wind, earthquakes, and flooding when the Regional Forester or, in situations...

  6. 8 CFR 251.2 - Notification of illegal landings.

    Science.gov (United States)

    2010-01-01

    ... the United States shall inform the immigration officer in charge of the port where the illegal landing... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Notification of illegal landings. 251.2 Section 251.2 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY IMMIGRATION REGULATIONS ARRIVAL AND...

  7. Study of the shielding for spontaneous fission sources of Californium-252; Estudio de blindaje para fuentes de fision espontanea de Californio-252

    Energy Technology Data Exchange (ETDEWEB)

    Davila R, I

    1991-06-15

    A shielding study is made to attenuate, until maximum permissible levels, the neutrons radiation and photons emitted by spontaneous fission coming from a source of Californium-252. The compound package by a database (Library DLC-23) and the ANISNW code is used, in it version for personal computer. (Author)

  8. Protein engineering of cyclodextrin glycosyltransferase from Bacillus circulans strain 251

    NARCIS (Netherlands)

    Penninga, Dirk

    1996-01-01

    An enormous diversity of molecular functions in living organisms is carried out by proteins. Our studies have focussed on the functional analysis of a starch-converting enzyme, cyclodextrin glycosyltransferase (CGTase) from Bacillus circulans strain 251. Zie: Summary

  9. Simulation and design of an electron beam ion source charge breeder for the californium rare isotope breeder upgrade

    Directory of Open Access Journals (Sweden)

    Clayton Dickerson

    2013-02-01

    Full Text Available An electron beam ion source (EBIS will be constructed and used to charge breed ions from the californium rare isotope breeder upgrade (CARIBU for postacceleration into the Argonne tandem linear accelerator system (ATLAS. Simulations of the EBIS charge breeder performance and the related ion transport systems are reported. Propagation of the electron beam through the EBIS was verified, and the anticipated incident power density within the electron collector was identified. The full normalized acceptance of the charge breeder with a 2 A electron beam, 0.024π  mm mrad for nominal operating parameters, was determined by simulating ion injection into the EBIS. The optics of the ion transport lines were carefully optimized to achieve well-matched ion injection, to minimize emittance growth of the injected and extracted ion beams, and to enable adequate testing of the charge bred ions prior to installation in ATLAS.

  10. Californium-252 Brachytherapy Combined With External-Beam Radiotherapy for Cervical Cancer: Long-Term Treatment Results

    Energy Technology Data Exchange (ETDEWEB)

    Lei Xin; Qian Chengyuan; Qing Yi; Zhao Kewei; Yang Zhengzhou; Dai Nan; Zhong Zhaoyang; Tang Cheng; Li Zheng; Gu Xianqing; Zhou Qian; Feng Yan; Xiong Yanli; Shan Jinlu [Cancer Center, Research Institute of Surgery and Daping Hospital, Third Military Medical University, Chongqing (China); Wang Dong, E-mail: dongwang64@hotmail.com [Cancer Center, Research Institute of Surgery and Daping Hospital, Third Military Medical University, Chongqing (China)

    2011-12-01

    Purpose: To observe, by retrospective analysis, the curative effects and complications due to californium-252 ({sup 252}Cf) neutron intracavitary brachytherapy (ICBT) combined with external-beam radiotherapy (EBRT) in the treatment of cervical cancer. Methods and Materials: From February 1999 to December 2007, 696 patients with cervical cancer (Stages IB to IIIB) were treated with {sup 252}Cf-ICBT in combination of EBRT. Of all, 31 patients were at Stage IB, 104 at IIA, 363 at IIB, 64 at IIIA, and 134 at IIIB. Californium-252 ICBT was delivered at 7-12 Gy per insertion per week, with a total dose of 29-45 Gy to reference point A in three to five insertions. The whole pelvic cavity was treated with 8-MV X-ray external irradiation at 2 Gy per fraction, four times per week. After 16-38 Gy of external irradiation, the center of the whole pelvic field was blocked with a 4-cm-wide lead shield, with a total external irradiation dose of 44-56 Gy. The total treatment course was 5 to 6 weeks. Results: Overall survival rate at 3 and 5 years for all patients was 76.0% and 64.9%, respectively. Disease-free 3- and 5-year survival rates of patients were 71.2% and 58.4%, respectively. Late complications included vaginal contracture and adhesion, radiation proctitis, radiation cystitis, and inflammatory bowel, which accounted for 5.8%, 7.1%, 6.2%, and 4.9%, respectively. Univariate analysis results showed significant correlation of stage, age, histopathologic grade, and lymph node status with overall survival. Cox multiple regression analysis showed that the independent variables were stage, histopathologic grade, tumor size, and lymphatic metastasis in all patients. Conclusion: Results of this series suggest that the combined use of {sup 252}Cf-ICBT with EBRT is an effective method for treatment of cervical cancer.

  11. 36 CFR 251.102 - Applicability and effective date.

    Science.gov (United States)

    2010-07-01

    ... administration of written instruments authorizing occupancy and use of National Forest System lands made on or... AGRICULTURE LAND USES Appeal of Decisions Relating to Occupancy and Use of National Forest System Lands § 251... authorizing occupancy and use of National Forest System lands shall be subject to appeal under the provisions...

  12. 14 CFR 25.251 - Vibration and buffeting.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Vibration and buffeting. 25.251 Section 25... Vibration and buffeting. (a) The airplane must be demonstrated in flight to be free from any vibration and... airplane must be demonstrated in flight to be free from excessive vibration under any appropriate speed and...

  13. 36 CFR 251.9 - Management of Municipal Watersheds.

    Science.gov (United States)

    2010-07-01

    ... LAND USES Miscellaneous Land Uses Natural Resources Control § 251.9 Management of Municipal Watersheds... forth in subpart B of this part. (e) Any municipal watershed management agreements, special use... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Management of Municipal...

  14. Phenotype abnormality: 251 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available lant flowering stage in environment of long day length regimen in environment of long day length regimen htt... 251 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u1ria224u757i delayed whole p

  15. 37 CFR 251.45 - Discovery and prehearing motions.

    Science.gov (United States)

    2010-07-01

    ... than overnight express mail on the same day the pleading is filed. (ii) Subject to § 251.64, the... section, designate a 45-day period for precontroversy discovery and exchange of documents. The period will... proceeding must effect actual delivery of a complete copy of its written direct case on each of the other...

  16. 28 CFR 25.1 - Purpose and authority.

    Science.gov (United States)

    2010-07-01

    ... Instant Criminal Background Check System § 25.1 Purpose and authority. The purpose of this subpart is to... Instant Criminal Background Check System (NICS) to be contacted by any licensed importer, licensed... procedures for persons who have been denied the right to obtain a firearm as a result of a NICS background...

  17. Long-term effects of an intracavitary treatment with californium-252 on normal tissue. [Swine, /sup 226/Ra

    Energy Technology Data Exchange (ETDEWEB)

    Sullivan, M.F.; Beamer, J.L.; Mahony, T.D.; Cross, F.T.; Lund, J.E.; Endres, G.W.R.

    1976-01-01

    About one hundred fifty swine were exposed to either radium-226 or californium-252 sources in the uterine cervix to determine an RBE for both acute and long-term effects. That value for early changes in the tissues at risk in the treatment of cervical cancer was between 6.2 and 6.8. The incidence of complications increased with time after exposure, especially among animals treated with /sup 252/Cf. Analysis of rectal injury showed that ulceration occurred frequently within a year postexposure at doses between 1600 and 2400 rad calculated at 2 cm lateral to the source midline. Fat necrosis and smooth muscle atrophy, resulting in a local rectal stricture, were delayed changes observed in some animals. The lower ureter was the site for a greater frequency of complications than the GI tract. Ureteral stricture often occurred at doses of 1200 rad from /sup 252/Cf and 7000 rad from /sup 226/Ra. Observation of delayed effects in the uterine-cervix in animals held up to 4 years postexposure indicate that the RBE for /sup 252/Cf may be increased to a value as high as 18, while repair may have even decreased it to about 5.6 in the rectum. Fifty swine are still being observed for long-term effects after doses above 800 rad from /sup 252/Cf and 5000 rad from /sup 226/Ra.

  18. 7 CFR 1726.251 - Prior approved contract modification related to price escalation on transmission equipment...

    Science.gov (United States)

    2010-01-01

    ... escalation on transmission equipment, generation equipment, and generation construction contracts. 1726.251 Section 1726.251 Agriculture Regulations of the Department of Agriculture (Continued) RURAL UTILITIES... escalation on transmission equipment, generation equipment, and generation construction contracts. (a...

  19. 46 CFR 251.11 - Applications under Title VI, Merchant Marine Act, 1936, as amended.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 8 2010-10-01 2010-10-01 false Applications under Title VI, Merchant Marine Act, 1936, as amended. 251.11 Section 251.11 Shipping MARITIME ADMINISTRATION, DEPARTMENT OF TRANSPORTATION... AID § 251.11 Applications under Title VI, Merchant Marine Act, 1936, as amended. (a) Applications...

  20. 37 CFR 251.72 - Declaration of controversy: Initiation of arbitration proceeding.

    Science.gov (United States)

    2010-07-01

    ...: Initiation of arbitration proceeding. 251.72 Section 251.72 Patents, Trademarks, and Copyrights COPYRIGHT OFFICE, LIBRARY OF CONGRESS COPYRIGHT ARBITRATION ROYALTY PANEL RULES AND PROCEDURES COPYRIGHT ARBITRATION ROYALTY PANEL RULES OF PROCEDURE Royalty Fee Distribution Proceedings § 251.72 Declaration of...

  1. 37 CFR 251.64 - Disposition of petition; initiation of arbitration proceeding.

    Science.gov (United States)

    2010-07-01

    ...; initiation of arbitration proceeding. 251.64 Section 251.64 Patents, Trademarks, and Copyrights COPYRIGHT OFFICE, LIBRARY OF CONGRESS COPYRIGHT ARBITRATION ROYALTY PANEL RULES AND PROCEDURES COPYRIGHT ARBITRATION ROYALTY PANEL RULES OF PROCEDURE Rate Adjustment Proceedings § 251.64 Disposition of petition...

  2. 38 CFR 3.251 - Income of parents; dependency and indemnity compensation.

    Science.gov (United States)

    2010-07-01

    ...; dependency and indemnity compensation. 3.251 Section 3.251 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS ADJUDICATION Pension, Compensation, and Dependency and Indemnity Compensation Dependency, Income and Estate § 3.251 Income of parents; dependency and indemnity compensation. (a) Annual...

  3. 37 CFR 251.54 - Assessment of costs of arbitration panels.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Assessment of costs of arbitration panels. 251.54 Section 251.54 Patents, Trademarks, and Copyrights COPYRIGHT OFFICE, LIBRARY OF... OF PROCEDURE Procedures of Copyright Arbitration Royalty Panels § 251.54 Assessment of costs of...

  4. Ab initio full-potential study of mechanical properties and magnetic phase stability of californium monopnictides (CfN and CfP)

    Energy Technology Data Exchange (ETDEWEB)

    Amari, S., E-mail: siham_amari@yahoo.fr [Faculté des Sciences de la Nature et de la Vie, Université Hassiba Benbouali, Chlef, 02000 (Algeria); Bouhafs, B. [Laboratoire de Modélisation et Simulation en Sciences des Matériaux, Université Djillali Liabès de Sidi Bel-Abbés, Sidi Bel-Abbés, 22000 (Algeria)

    2016-09-15

    Based on the first-principles methods, the structural, elastic, electronic, properties and magnetic ordering of californium monopnictides CfX (X = P) have been studied using the full-potential augmented plane wave plus local orbitals (FP-L/APW + lo) method within the framework of density functional theory (DFT). The electronic exchange correlation energy is described by generalized gradient approximation GGA and GGA+U (U is the Hubbard correction). The GGA+U method is applied to the rare-earth 5f states. We have calculated the lattice parameters, bulk modulii and the first pressure derivatives of the bulk modulii. The elastic properties of the studied compounds are only investigated in the most stable calculated phase. In order to gain further information, we have calculated Young’s modulus, shear modulus, anisotropy factor and Kleinman parameter by the aid of the calculated elastic constants. The results mainly show that californium monopnictides CfX (X = P) have an antiferromagnetic spin ordering. Density of states (DOS) and charge densities for both compounds are also computed in the NaCl (B1) structure.

  5. Downregulation of ROCK2 through nanocomplex sensitizes the cytotoxic effect of temozolomide in U251 glioma cells.

    Directory of Open Access Journals (Sweden)

    Xiaojun Wen

    Full Text Available Rho-associated coiled-coil kinase 2 (ROCK2 is an attractive therapeutic target because it is overexpressed in many malignancies, including glioma. Therefore, we designed the current study to determine whether the downregulation of ROCK2 would sensitize the cytotoxic effect of temozolomide (TMZ in U251 cells.Glycol-polyethyleneimine (PEG-PEI was used to deliver siROCK2 to U251 cells, and the physical characteristics of the PEG-PEI/siROCK2 complex (referred to as the siROCK2 complex were investigated. The transfection efficiency and cell uptake were determined by flow cytometry (FCM and confocal laser microscopy (CLSM, respectively. U251 cells were then treated with 100 μM TMZ, siROCK2 complexes or their combination. The apoptosis rate and cell migration were measured by FCM and wound-healing assay, respectively. The levels of Bax, Bcl-2, cleaved caspase-3, MMP-2, and MMP-9 were detected to analyze the degrees of apoptosis and migration.Our results revealed that the characteristics of the siROCK2 complexes depended closely on the N/P ratios. PEG-PEI served as a good vector for siROCK2 and exhibited low cytotoxicity toward U251 cells. The CLSM assay showed that the siROCK2 complexes were successfully uptaken and that both the protein and mRNA levels of ROCK2 were significantly suppressed. Furthermore, the combination treatment induced a higher apoptosis rate and markedly increased the gap distance of U251 cells in the wound-healing assay. Levels of the proapoptotic proteins Bax and cleaved caspase-3 were significantly increased, whereas levels of the antiapoptotic protein Bcl-2 and the migration-related proteins MMP-2 and MMP-9 were significantly reduced by the combination treatment compared with either treatment alone.In conclusion, our results demonstrate that the combination of TMZ and siROCK2 effectively induces apoptosis and inhibits the migration of U251 cells. Therefore, the combination of TMZ and siROCK2 complex is a potential therapeutic

  6. Low-Dose-Rate Californium-252 Neutron Intracavitary Afterloading Radiotherapy Combined With Conformal Radiotherapy for Treatment of Cervical Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Zhang Min [Department of Oncology, Armed Police Hospital of Hangzhou, Hangzhou, Zhejiang Province (China); Xu Hongde [Cancer Center, Armed Police Hospital of Hangzhou, Hangzhou, Zhejiang Province (China); Pan Songdan; Lin Shan; Yue Jianhua [Department of Oncology, Armed Police Hospital of Hangzhou, Hangzhou, Zhejiang Province (China); Liu Jianren, E-mail: liujianren0571@hotmail.com [Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang Province (China)

    2012-07-01

    Purpose: To study the efficacy of low-dose-rate californium-252 ({sup 252}Cf) neutron intracavitary afterloading radiotherapy (RT) combined with external pelvic RT for treatment of cervical cancer. Methods and Materials: The records of 96 patients treated for cervical cancer from 2006 to 2010 were retrospectively reviewed. For patients with tumors {<=}4 cm in diameter, external beam radiation was performed (1.8 Gy/day, five times/week) until the dose reached 20 Gy, and then {sup 252}Cf neutron intracavitary afterloading RT (once/week) was begun, and the frequency of external beam radiation was changed to four times/week. For patients with tumors >4 cm, {sup 252}Cf RT was performed one to two times before whole-pelvis external beam radiation. The tumor-eliminating dose was determined by using the depth limit of 5 mm below the mucosa as the reference point. In all patients, the total dose of the external beam radiation ranged from 46.8 to 50 Gy. For {sup 252}Cf RT, the dose delivered to point A was 6 Gy/fraction, once per week, for a total of seven times, and the total dose was 42 Gy. Results: The mean {+-} SD patient age was 54.7 {+-} 13.7 years. Six patients had disease assessed at stage IB, 13 patients had stage IIA, 49 patients had stage IIB, 3 patients had stage IIIA, 24 patients had stage IIIB, and 1 patient had stage IVA. All patients obtained complete tumor regression (CR). The mean {+-} SD time to CR was 23.5 {+-} 3.4 days. Vaginal bleeding was fully controlled in 80 patients within 1 to 8 days. The mean {+-} SD follow-up period was 27.6 {+-} 12.7 months (range, 6-48 months). Five patients died due to recurrence or metastasis. The 3-year survival and disease-free recurrence rates were 89.6% and 87.5 %, respectively. Nine patients experienced mild radiation proctitis, and 4 patients developed radiocystitis. Conclusions: Low-dose-rate {sup 252}Cf neutron RT combined with external pelvic RT is effective for treating cervical cancer, with a low incidence of

  7. 36 CFR 251.123 - Most directly affected Native Corporation determination.

    Science.gov (United States)

    2010-07-01

    ... Corporations may submit such additional information as they consider relevant. (b) Upon receipt of all... Corporation determination. 251.123 Section 251.123 Parks, Forests, and Public Property FOREST SERVICE... affected Native Corporation determination. (a) Before issuance of the first special use authorization for a...

  8. 37 CFR 251.36 - Pre-arbitration and post-arbitration employment restrictions.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Pre-arbitration and post-arbitration employment restrictions. 251.36 Section 251.36 Patents, Trademarks, and Copyrights COPYRIGHT OFFICE, LIBRARY OF CONGRESS COPYRIGHT ARBITRATION ROYALTY PANEL RULES AND PROCEDURES COPYRIGHT...

  9. Impact of pEGFP mediated ING4 gene on growth of glioma U251 ...

    African Journals Online (AJOL)

    To investigate the impact of the inhibitor of growth family 4 (ING4) on growth of glioma cells (U251 cells) and its potential molecular mechanism, total RNA was extracted from the embryonic tissues and ING4 was amplified by RT-PCR and cloned into pEGFP-C2 vector. U251 cells were transfected with eukaryotic expression ...

  10. 37 CFR 251.6 - Composition and selection of Copyright Arbitration Royalty Panels.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Composition and selection of Copyright Arbitration Royalty Panels. 251.6 Section 251.6 Patents, Trademarks, and Copyrights COPYRIGHT OFFICE, LIBRARY OF CONGRESS COPYRIGHT ARBITRATION ROYALTY PANEL RULES AND PROCEDURES COPYRIGHT...

  11. 37 CFR 251.2 - Purpose of Copyright Arbitration Royalty Panels.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Purpose of Copyright Arbitration Royalty Panels. 251.2 Section 251.2 Patents, Trademarks, and Copyrights COPYRIGHT OFFICE, LIBRARY OF CONGRESS COPYRIGHT ARBITRATION ROYALTY PANEL RULES AND PROCEDURES COPYRIGHT ARBITRATION ROYALTY...

  12. 37 CFR 251.7 - Actions of Copyright Arbitration Royalty Panels.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Actions of Copyright Arbitration Royalty Panels. 251.7 Section 251.7 Patents, Trademarks, and Copyrights COPYRIGHT OFFICE, LIBRARY OF CONGRESS COPYRIGHT ARBITRATION ROYALTY PANEL RULES AND PROCEDURES COPYRIGHT ARBITRATION ROYALTY...

  13. 7 CFR 2.51 - Deputy Under Secretary for Food Safety.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 1 2010-01-01 2010-01-01 false Deputy Under Secretary for Food Safety. 2.51 Section 2... Safety § 2.51 Deputy Under Secretary for Food Safety. Pursuant to § 2.18, and subject to policy guidance... Secretary for Food Safety to the Deputy Under Secretary for Food Safety, to be exercised only during the...

  14. 7 CFR 58.251 - Dry buttermilk and dry buttermilk product.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Dry buttermilk and dry buttermilk product. 58.251 Section 58.251 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) REGULATIONS...

  15. TWOS - TIME WARP OPERATING SYSTEM, VERSION 2.5.1

    Science.gov (United States)

    Bellenot, S. F.

    1994-01-01

    The Time Warp Operating System (TWOS) is a special-purpose operating system designed to support parallel discrete-event simulation. TWOS is a complete implementation of the Time Warp mechanism, a distributed protocol for virtual time synchronization based on process rollback and message annihilation. Version 2.5.1 supports simulations and other computations using both virtual time and dynamic load balancing; it does not support general time-sharing or multi-process jobs using conventional message synchronization and communication. The program utilizes the underlying operating system's resources. TWOS runs a single simulation at a time, executing it concurrently on as many processors of a distributed system as are allocated. The simulation needs only to be decomposed into objects (logical processes) that interact through time-stamped messages. TWOS provides transparent synchronization. The user does not have to add any more special logic to aid in synchronization, nor give any synchronization advice, nor even understand much about how the Time Warp mechanism works. The Time Warp Simulator (TWSIM) subdirectory contains a sequential simulation engine that is interface compatible with TWOS. This means that an application designer and programmer who wish to use TWOS can prototype code on TWSIM on a single processor and/or workstation before having to deal with the complexity of working on a distributed system. TWSIM also provides statistics about the application which may be helpful for determining the correctness of an application and for achieving good performance on TWOS. Version 2.5.1 has an updated interface that is not compatible with 2.0. The program's user manual assists the simulation programmer in the design, coding, and implementation of discrete-event simulations running on TWOS. The manual also includes a practical user's guide to the TWOS application benchmark, Colliding Pucks. TWOS supports simulations written in the C programming language. It is designed

  16. Modulation of voltage-gated Na+ and K+ channels by pumiliotoxin 251D: a "joint venture" alkaloid from arthropods and amphibians.

    Science.gov (United States)

    Vandendriessche, Thomas; Abdel-Mottaleb, Yousra; Maertens, Chantal; Cuypers, Eva; Sudau, Alexander; Nubbemeyer, Udo; Mebs, Dietrich; Tytgat, Jan

    2008-03-01

    Certain amphibians provide themselves with a chemical defense by accumulating lipophilic alkaloids into skin glands from dietary arthropods. Examples of such alkaloids are pumiliotoxins (PTXs). In general, PTXs are known as positive modulators of voltage-gated sodium channels (VGSCs). Unlike other PTXs, PTX 251D does not share this characteristic. However, mice and insect studies showed that PTX 251D is highly toxic and to date the basis of its toxicity remains unknown. In this work, we searched for the possible target of PTX 251D. The toxin was therefore made synthetically and tested on four VGSCs (mammalian rNa(v)1.2/beta(1), rNa(v)1.4/beta(1), hNa(v)1.5/beta(1) and insect Para/tipE) and five voltage-gated potassium channels (VGPCs) (mammalian rK(v)1.1-1.2, hK(v)1.3, hK(v)11.1 (hERG) and insect Shaker IR) expressed heterologously in Xenopus laevis oocytes, using the two-electrode voltage clamp technique. PTX 251D not only inhibited the Na(+) influx through the mammalian VGSCs but also affected the steady-state activation and inactivation. Interestingly, in the insect ortholog, the inactivation process was dramatically affected. Additionally, PTX 251D inhibited the K(+) efflux through all five tested VGPCs and slowed down the deactivation kinetics of the mammalian VGPCs. hK(v)1.3 was the most sensitive channel, with an IC(50) value 10.8+/-0.5 microM. To the best of our knowledge this is the first report of a PTX affecting VGPCs.

  17. 29 CFR 779.251 - Goods that have lost their out-of-State identity.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false Goods that have lost their out-of-State identity. 779.251... Coverage Interstate Inflow Test Under Prior Act § 779.251 Goods that have lost their out-of-State identity... been processed or manufactured so as to have lost their identity as out-of-State goods before they are...

  18. AM251 Suppresses Epithelial-Mesenchymal Transition of Renal Tubular Epithelial Cells.

    Directory of Open Access Journals (Sweden)

    Tomoyo Yoshinaga

    Full Text Available Epithelial-mesenchymal transition (EMT of renal tubular epithelial cells is one of the causative mechanisms of kidney fibrosis. In our study, we screened lipophilic compounds using a lipid library including approximately 200 lipids to identify those that suppressed EMT induced by a transforming growth factor (TGF-β1 stimulus. Initial screening was performed with the immortalized HK-2 renal tubule epithelial cell line. The most promising compounds were further tested in RPTEC primary renal tubule epithelial cells. We found that the synthetic lipid AM251 suppressed two hallmark events associated with EMT, the upregulation of collagen 1A1 (COL1A1 and downregulation of E-cadherin. Though AM251 is known to act as an antagonist for the cannabinoid receptor type 1 (CB1 and an agonist for the G protein-coupled receptor 55 (GRP55, the suppression of EMT by AM251 was not mediated through either receptor. Microarray analyses revealed that AM251 inhibited induction of several EMT transcription factors such as SNAIL1, which is the key inducer of EMT, and the AP-1 transcription factors FOSB and JUNB. Activation of SMAD2/3 and p38 mitogen-activated protein kinase (MAPK was inhibited by AM251, with greater inhibition of the latter, indicating that AM251 acted upstream of SMAD/p38 MAPK in the TGF-β signaling pathway. Our findings regarding the effects of AM251 on the TGF-β signaling pathway may inform development of a novel therapeutic agent suppressing EMT, thus preventing kidney fibrosis.

  19. Downregulation of HIF-1a sensitizes U251 glioma cells to the temozolomide (TMZ) treatment

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Jun-Hai [Department of Neurosurgery, Xinqiao Hospital, Third Military Medical University, Chongqing 400037 (China); Ma, Zhi-Xiong [National Institute of Biological Sciences, Beijing 102206 (China); Huang, Guo-Hao; Xu, Qing-Fu; Xiang, Yan [Department of Neurosurgery, Xinqiao Hospital, Third Military Medical University, Chongqing 400037 (China); Li, Ningning; Sidlauskas, Kastytis [Division of Neuropathology and Department of Neurodegenerative Disease, Institute of Neurology, University College London, London WC1N 3BG (United Kingdom); Zhang, Eric Erquan [National Institute of Biological Sciences, Beijing 102206 (China); Lv, Sheng-Qing, E-mail: lvsq0518@hotmail.com [Department of Neurosurgery, Xinqiao Hospital, Third Military Medical University, Chongqing 400037 (China)

    2016-05-01

    Purpose: The aim of this study was to investigate the effect of downregulation of HIF-1α gene on human U251 glioma cells and examine the consequent changes of TMZ induced effects and explore the molecular mechanisms. Methods: U251 cell line stably expressing HIF-1α shRNA was acquired via lentiviral vector transfection. The mRNA and protein expression alterations of genes involved in our study were determined respectively by qRT-PCR and Western blot. Cell proliferation was measured by MTT assay and colony formation assay, cell invasion/migration capacity was determined by transwell invasion assay/wound healing assay, and cell apoptosis was detected by flow cytometry. Results: We successfully established a U251 cell line with highly efficient HIF-1α knockdown. HIF-1a downregulation sensitized U251 cells to TMZ treatment and enhanced the proliferation-inhibiting, invasion/migration-suppressing, apoptosis-inducing and differentiation-promoting effects exerted by TMZ. The related molecular mechanisms demonstrated that expression of O{sup 6}-methylguanine DNA methyltransferase gene (MGMT) and genes of Notch1 pathway were significantly upregulated by TMZ treatment. However, this upregulation was abrogated by HIF-1α knockdown. We further confirmed important regulatory roles of HIF-1α in the expression of MGMT and activation of Notch1 pathways. Conclusion: HIF-1α downregulation sensitizes U251 glioma cells to the temozolomide treatment via inhibiting MGMT expression and Notch1 pathway activation. - Highlights: • TMZ caused more significant proliferation inhibition and apoptosis in U251 cells after downregulating HIF-1α. • Under TMZ treatment, HIF-1 downregulated U251 cells exhibited weaker mobility and more differentiated state. • TMZ caused MGMT over-expression and Notch1 pathway activation, which could be abrogated by HIF-1α downregulation.

  20. Pengaruh Bionematisida Berbahan Aktif Jamur Paecilomyces lilacinus Strain 251 terhadap Serangan Pratylenchus coffeae pada Kopi Robusta

    Directory of Open Access Journals (Sweden)

    Soekadar Wiryadiputra

    2002-07-01

    Full Text Available Experiment on the effect of P. lilacinus on the infestation of P. coffeae on robusta coffee was conducted in Sumber Asin Experimental Garden, Malang. The treatments were dosages of bionematicide i.e. : 0 (control, 0.25, 0.50, 1.00, 2.00, and 4.00 g; carbofuran (3 % active ingredient 50 g/plant and organic soil treatment (OST at 100 g/plant. Each treatment was replicated four times, and each replication consists of five coffee trees. The results in second year observation revealed that the population of P. coffeae in the roots on PL 251 treatments was not significantly different compared to the control, whereas in soil samples the population of both P. coffeae and Rotylenchulus reniformis inclined to be lower than the control, although they were not statistically significant. The lowest infestation was observed on PL 251 treatment at a dosage level of 4.00 g/tree. On nematode infestation, no significant difference on treatments of carbofuran and OST compared to the control. The yield of green coffee (market coffee was the highest on the treatment of PL 251 at a dosage of 4.00 g/tree and significantly higher than the control and carbofuran treatments, with increasing levels of 225.3 and 198.9%, respectively. Keywords: bionematicide Paecilomyces lilacinus strain 251 (PL 251, Pratylenchus coffeae, Rotylenchulus reniformis

  1. All-trans retinoic acid influences viability, migration and adhesion of U251 glioblastoma cells

    Directory of Open Access Journals (Sweden)

    Marjanović-Vićentić Jelena

    2017-01-01

    Full Text Available Glioblastoma (GBM is one of the most aggressive and deadly forms of cancer. Literature data reveals that all-trans retinoic acid (ATRA has anticancer effects on different types of tumor cells. However, data about the effects of ATRA on glioblastoma cells are contradictory. In this study, we examined whether ATRA treatment affects features of human glioblastoma U251 cells. To that end, the cells were treated with different concentrations of ATRA. Results obtained by MTT and the crystal violet assays imply that ATRA affected the viability of U251 glioblastoma cells in a dose- and time-dependent manner. Fluorescence staining of microtubule cytoskeleton protein α-tubulin revealed that ATRA induced changes in cell morphology. Using semi-quantitative RT-PCR we found that the expression of SOX3 and GFAP genes, as markers of neural differentiation, was not changed upon ATRA treatment. Thus, the observed changes in cell morphology after ATRA treatment are not associated with neural differentiation of U251 glioblastoma cells. The scratch-wound healing assay revealed that ATRA changed the mode of U251 cell migration from collective to single cell motility. The cell-matrix adhesion assay demonstrated that the pharmacologically relevant concentration of ATRA lowered the cell-matrix adhesion capability of U251 cells. In conclusion, our results imply that further studies are needed before ATRA could be considered for the treatment of glioblastoma. [Project of the Serbian Ministry of Education, Science and Technological Development, Grant no. 173051

  2. Californium-252 neutron intracavity brachytherapy alone for T1N0 low-lying rectal adenocarcinoma: A definitive anal sphincter-preserving radiotherapy

    Science.gov (United States)

    Xiong, Yanli; Shan, Jinlu; Liu, Jia; Zhao, Kewei; Chen, Shu; Xu, Wenjing; Zhou, Qian; Yang, Mei; Lei, Xin

    2017-01-01

    This study evaluated the 4-year results of 32 patients with T1N0 low-lying rectal adenocarcinoma treated solely with californium-252 (Cf-252) neutron intracavity brachytherapy (ICBT). Patients were solicited into the study from January 2008 to June 2011. All the patients had refused surgery or surgery was contraindicated. The patients were treated with Cf-252 neutron ICBT using a novel 3.5-cm diameter off-axis 4-channel intrarectal applicator designed by the authors. The dose reference point was defined on the mucosa surface, with a total dose of 55–62 Gy-eq/4 f (13–16 Gy-eq/f/wk). All the patients completed the radiotherapy in accordance with our protocol. The rectal lesions regressed completely, and the acute rectal toxicity was mild (≤G2). The 4-year local control, overall survival, disease-free survival, and late complication (≥G2) rates were 96.9%, 90.6%, 87.5% and 15.6%, respectively. No severe late complication (≥G3) occurred. The mean follow-up was 56.1 ± 16.0 months. At the end of last follow-up, 29 patients remained alive. The mean survival time was 82.1 ± 2.7 months. Cf-252 neutron ICBT administered as the sole treatment (without surgery) for patients with T1N0 low-lying rectal adenocarcinoma is effective with acceptable late complications. Our study and method offers a definitive anal sphincter-preserving radiotherapy for T1N0 low-lying rectal adenocarcinoma patients. PMID:28094790

  3. NF-κB inhibitor reverses temozolomide resistance in human glioma TR/U251 cells.

    Science.gov (United States)

    Wang, Xuan; Jia, Lili; Jin, Xiaohua; Liu, Qian; Cao, Wei; Gao, Xiangdong; Yang, Mingfeng; Sun, Baoliang

    2015-06-01

    Glioblastoma multiforme (GBM) demonstrates an unsatisfactory clinical prognosis due to the intrinsic or acquired resistance to temozolomide (TMZ) exhibited by the tumors. One possible cause of TMZ resistance in GBM is the overexpression of O6-methylguanine-DNA methyltransferase (MGMT), which can repair the TMZ-induced guanine damage in DNA. Additionally, excessive activated NF-κB is reported to be a component of the major inflammatory transcription pathway that is associated with TMZ resistance in GBM. However, the association between the NF-κB pathway and MGMT expression in GBM cells is unknown. Therefore, in the present study, the TMZ resistant (TR) U251 cell line (TR/U251) was successfully constructed to detect how the TR/U251 cell line and the parental U251 cell line each interact with TMZ in vitro. The TR/U251 cells were approximately five times more resistant to TMZ compared with the parental cells. Furthermore, it was found that the NF-κB inhibitor BAY 11-7082 suppressed the expression of MGMT in TR/U251 cells and enhanced TMZ-induced cytotoxicity and apoptosis, thereby indicating that the NF-κB pathway and MGMT interact to promote TMZ resistance. The inhibition of NF-κB may be a promising strategy to reverse drug resistance in TR glioma cells. The present results propose a potential mechanism for using the NF-κB inhibitor BAY 11-7082 as a potential therapy for the treatment of TR glioma. Although BAY 11-7082 is a well-known NF-κB inhibitor, the present study further investigated its underlying mechanisms through a series of new experiments.

  4. Rational Design of Cyclodextrin Glycosyltransferase from Bacillus circulans Strain 251 to Increase α-Cyclodextrin Production

    NARCIS (Netherlands)

    Veen, Bart A. van der; Uitdehaag, Joost C.M.; Penninga, Dirk; Alebeek, Gert-Jan W.M. van; Smith, Loraine M.; Dijkstra, Bauke W.; Dijkhuizen, Lubbert

    2000-01-01

    Cyclodextrin glycosyltransferases (CGTase) (EC 2.4.1.19) are extracellular bacterial enzymes that generate cyclodextrins from starch. All known CGTases produce mixtures of α, β, and γ-cyclodextrins. A maltononaose inhibitor bound to the active site of the CGTase from Bacillus circulans strain 251

  5. 37 CFR 251.73 - Deduction of costs of distribution proceedings.

    Science.gov (United States)

    2010-07-01

    ... PANEL RULES OF PROCEDURE Royalty Fee Distribution Proceedings § 251.73 Deduction of costs of... distributions of royalty fees are made, deduct the reasonable costs incurred by the Library of Congress and the... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Deduction of costs of...

  6. 48 CFR 52.251-2 - Interagency Fleet Management System Vehicles and Related Services.

    Science.gov (United States)

    2010-10-01

    ... CLAUSES Text of Provisions and Clauses 52.251-2 Interagency Fleet Management System Vehicles and Related Services. As prescribed in 51.205, insert the following clause: Interagency Fleet Management System... to obtain interagency fleet management system vehicles and related services for use in the...

  7. 30 CFR 251.7 - Test drilling activities under a permit.

    Science.gov (United States)

    2010-07-01

    ... opportunity to participate in the test drilling through a signed agreement on a cost-sharing basis. You may... original share cost. (3) Providing opportunity for participation in a shallow test drilling project. When... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Test drilling activities under a permit. 251.7...

  8. 5 CFR 251.301 - Associations of management officials and/or supervisors.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Associations of management officials and... ORGANIZATIONS Dues Withholding § 251.301 Associations of management officials and/or supervisors. Dues withholding for associations of management officials and/or supervisors is covered in 5 CFR 550.331. ...

  9. Risk modification of colorectal cancer susceptibility by interleukin-8 -251T>A polymorphism in Malaysians

    Science.gov (United States)

    Mustapha, Mohd Aminudin; Shahpudin, Siti Nurfatimah Mohd; Aziz, Ahmad Aizat Abdul; Ankathil, Ravindran

    2012-01-01

    AIM: To investigate the allele and genotype frequencies and associated risk of interleukin (IL)-8 -251T>A polymorphism on colorectal cancer (CRC) susceptibility risk. METHODS: Peripheral blood samples of 255 normal controls and 255 clinically and histopathologically confirmed CRC patients were genotyped for IL-8 -251T>A polymorphism employing allele-specific polymerase chain reaction. The relative association of variant allele and genotypes with CRC susceptibility risk was determined by calculating the odds ratios (ORs). Corresponding χ2 tests on the CRC patients and controls were carried out and 95% confidence intervals (CIs) were determined using Fisher’s exact test. The allele frequencies and its risk association were calculated using FAMHAP, haplotype association analysis software. RESULTS: On comparing the frequencies of genotypes of patients and controls, the homozygous variant AA was significantly higher in CRC patients (P = 0.002) compared to controls. Investigation on the association of the polymorphic genotypes with CRC susceptibility risk, showed that the homozygous variant IL-8 -251AA had a significantly increased risk with OR 3.600 (95% CI: 1.550-8.481, P = 0.001). In the case of allele frequencies, variant allele A of IL-8 -251 showed a significantly increased risk of CRC predisposition with OR 1.32 (95% CI: 1.03-1.69, P = 0.003). CONCLUSION: Variant allele and genotype of IL-8 (-251T>A) was significantly associated with CRC susceptibility risk and could be considered as a high-risk variant for CRC predisposition. PMID:22690076

  10. 78 FR 14633 - Sequestration Order for Fiscal Year 2013 Pursuant to Section 251A of the Balanced Budget and...

    Science.gov (United States)

    2013-03-06

    ... Management and Budget in its report to the Congress of March 1, 2013. Pursuant to sections 250(c)(6), 251A... authority, and obligation limitations. All sequestrations shall be made in strict accordance with the requirements of section 251A of the Act and the specifications of the Office of Management and Budget's report...

  11. 78 FR 22407 - Sequestration Order for Fiscal Year 2014 Pursuant to Section 251A of the Balanced Budget and...

    Science.gov (United States)

    2013-04-15

    ... Management and Budget in its report to the Congress of April 10, 2013. All sequestrations shall be made in strict accordance with the requirements of section 251A of the Act and the specifications of the Office of Management and Budget's report of April 10, 2013, prepared pursuant to section 251A(11) of the Act...

  12. 36 CFR 251.10 - Prohibition of location of mining claims within certain areas in the Norbeck Wildlife Preserve...

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Prohibition of location of mining claims within certain areas in the Norbeck Wildlife Preserve, South Dakota. 251.10 Section 251.10... areas in the Norbeck Wildlife Preserve, South Dakota. The location of mining claims in such areas within...

  13. A mutation of cdc-25.1 causes defects in germ cells but not in somatic tissues in C. elegans.

    Science.gov (United States)

    Kim, Jiyoung; Lee, Ah-Reum; Kawasaki, Ichiro; Strome, Susan; Shim, Yhong-Hee

    2009-07-31

    By screening C. elegans mutants for severe defects in germline proliferation, we isolated a new loss-of-function allele of cdc-25.1, bn115. bn115 and another previously identified loss-of-function allele nr2036 do not exhibit noticeable cell division defects in the somatic tissues but have reduced numbers of germ cells and are sterile, indicating that cdc-25.1 functions predominantly in the germ line during postembryonic development, and that cdc-25.1 activity is probably not required in somatic lineages during larval development. We analyzed cell division of germ cells and somatic tissues in bn115 homozygotes with germline-specific anti-PGL-1 immunofluorescence and GFP transgenes that express in intestinal cells, in distal tip cells, and in gonadal sheath cells, respectively. We also analyzed the expression pattern of cdc-25.1 with conventional and quantitative RT-PCR. In the presence of three other family members of cdc-25 in C. elegans defects are observed only in the germ line but not in the somatic tissues in cdc-25.1 single mutants, and cdc-25.1 is expressed predominantly, if not exclusively, in the germ line during postembryonic stages. Our findings indicate that the function of cdc-25.1 is unique in the germ line but likely redundant with other members in the soma.

  14. Californium-252 Program Equipment Evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Chattin, Fred Rhea [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Wilson, Kenton [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Ezold, Julie G. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2017-12-01

    To successfully continue the 252Cf production and meet the needs of the customers, a comprehensive evaluation of the Building 7920 processing equipment was requested to identify equipment critical to the operational continuity of the program.

  15. Synergistic Effects of the in cis T251I and P587L Mitochondrial DNA Polymerase γ Disease Mutations.

    Science.gov (United States)

    DeBalsi, Karen L; Longley, Matthew J; Hoff, Kirsten E; Copeland, William C

    2017-03-10

    Human mitochondrial DNA (mtDNA) polymerase γ (Pol γ) is the only polymerase known to replicate the mitochondrial genome. The Pol γ holoenzyme consists of the p140 catalytic subunit (POLG) and the p55 homodimeric accessory subunit (POLG2), which enhances binding of Pol γ to DNA and promotes processivity of the holoenzyme. Mutations within POLG impede maintenance of mtDNA and cause mitochondrial diseases. Two common POLG mutations usually found in cis in patients primarily with progressive external ophthalmoplegia generate T251I and P587L amino acid substitutions. To determine whether T251I or P587L is the primary pathogenic allele or whether both substitutions are required to cause disease, we overproduced and purified WT, T251I, P587L, and T251I + P587L double variant forms of recombinant Pol γ. Biochemical characterization of these variants revealed impaired DNA binding affinity, reduced thermostability, diminished exonuclease activity, defective catalytic activity, and compromised DNA processivity, even in the presence of the p55 accessory subunit. However, physical association with p55 was unperturbed, suggesting intersubunit affinities similar to WT. Notably, although the single mutants were similarly impaired, a dramatic synergistic effect was found for the double mutant across all parameters. In conclusion, our analyses suggest that individually both T251I and P587L substitutions functionally impair Pol γ, with greater pathogenicity predicted for the single P587L variant. Combining T251I and P587L induces extreme thermal lability and leads to synergistic nucleotide and DNA binding defects, which severely impair catalytic activity and correlate with presentation of disease in patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  16. Further studies on pumiliotoxin 251D and hydroquinone content of the skin secretion of Melanophryniscus species (Anura, Bufonidae) from Uruguay.

    Science.gov (United States)

    Mebs, Dietrich; Maneyro, Raúl; Pogoda, Werner

    2007-07-01

    In whole animal ethanolic extracts from adult specimens of Melanophryniscus atroluteus (27 specimens) and M. devincenzii (16 specimens) as well as of two egg clutches and four tadpole samples from the latter species, the major alkaloid pumiliotoxin (PTX) 251D and hydroquinone were assayed quantitatively by gas chromatography/mass spectrometry. All toad extracts contained high concentrations of PTX 251D and hydroquinone and exhibited considerable variation in the content of these compounds among individual specimens. The extracts of the eggs and tadpoles were entirely free of alkaloids as well as hydroquinone, pointing to a dietary origin of these compounds.

  17. Manganese determination om minerals by activation analysis, using the californium-252 as a neutron source; Determinacao de manganes em minerios, por analise por ativacao, usando californio-252 como fonte de neutrons

    Energy Technology Data Exchange (ETDEWEB)

    Cardoso, Antonio

    1976-07-01

    Neutron Activation Analysis, using a Californium-252 neutron source, has been applied for the determination of manganese in ores such as pyrolusite, rodonite (manganese silicate)' and blending used in dry-batteries The favorable nuclear properties of manganese, such as high thermal neutron cross-section for the reaction {sup 55}Mn (n.gamma){sup 56} Mn, high concentration of manganese in the matrix and short half - life of {sup 56}Mn, are an ideal combination for non-destructive analysis of manganese in ores. Samples and standards of manganese dioxide were irradiated for about 20 minutes, followed by a 4 to 15 minutes decay and counted in a single channel pulse-height discrimination using a NaI(Tl) scintillation detector. Counting time was equal to 10 minutes. The interference of nuclear reactions {sup 56}Fe(n,p){sup 56}Mn and {sup 59} Co (n, {alpha}){sup 56} were studied, as well as problems in connection with neutron shadowing during irradiation, gamma-rays attenuation during counting and influence of granulometry of samples. One sample,was also analysed by wet-chemical method (sodium bismuthate) in order to compare results. As a whole, i t was shown that the analytical method of neutron activation for manganese in ores and blending, is a method simple, rapid and with good precision and accuracy. (author)

  18. Design of a homogeneous subcritical nuclear reactor based on thorium with a source of californium 252; Diseno de un reactor nuclear subcritico homogeneo a base de Torio con una fuente de Californio 252

    Energy Technology Data Exchange (ETDEWEB)

    Delgado H, C. E.; Vega C, H. R. [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas, Zac. (Mexico); Sajo B, L., E-mail: ce_delgado89@hotmail.com [Universidad Simon Bolivar, Laboratorio de Fisica Nuclear, Apdo. 89000, 1080A Caracas (Venezuela, Bolivarian Republic of)

    2015-10-15

    Full text: One of the energy alternatives to fossil fuels which do not produce greenhouse gases is the nuclear energy. One of the drawbacks of this alternative is the generation of radioactive wastes of long half-life and its relation to the generation of nuclear materials to produce weapons of mass destruction. An option to these drawbacks of nuclear energy is to use Thorium as part of the nuclear fuel which it becomes in U{sup 233} when capturing neutrons, that is a fissile material. In this paper Monte Carlo methods were used to design a homogeneous subcritical reactor based on thorium. As neutron reflector graphite was used. The reactor core is homogeneous and is formed of 70% light water as moderator, 12% of enriched uranium UO{sub 2}(NO{sub 3}){sub 4} and 18% of thorium Th(NO{sub 3}){sub 4} as fuel. To start the nuclear fission chain reaction an isotopic source of californium 252 was used with an intensity of 4.6 x 10{sup 7} s{sup -1}. In the design the value of the effective multiplication factor, whose value turned out k{sub eff} <1 was calculated. Also, the neutron spectra at different distances from the source and the total fluence were calculated, as well as the values of the ambient dose equivalent in the periphery of the reactor. (Author)

  19. 40 CFR 147.251 - EPA-administered program-Class I, III, IV and V wells and Indian lands.

    Science.gov (United States)

    2010-07-01

    ... INJECTION CONTROL PROGRAMS California § 147.251 EPA-administered program—Class I, III, IV and V wells and Indian lands. (a) Contents. The UIC program in the State of California for Class I, III, IV and V wells... 40 Protection of Environment 22 2010-07-01 2010-07-01 false EPA-administered program-Class I, III...

  20. 48 CFR 252.251-7001 - Use of Interagency Fleet Management System (IFMS) vehicles and related services.

    Science.gov (United States)

    2010-10-01

    ... Fleet Management System (IFMS) vehicles and related services. As prescribed in 251.205, use the following clause: Use of Interagency Fleet Management System (IFMS) Vehicles and Related Services (DEC 1991... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Use of Interagency Fleet...

  1. 46 CFR 251.21 - Applications under sections 803, 804, 805 (a) and (d), and 605 (b), Merchant Marine Act, 1936.

    Science.gov (United States)

    2010-10-01

    ...), and 605 (b), Merchant Marine Act, 1936. 251.21 Section 251.21 Shipping MARITIME ADMINISTRATION... (b), Merchant Marine Act, 1936. Form VI-B of instructions is the required form for the preparation of... chapter (General Order 86)) and (d), and 605(b), Merchant Marine Act, 1936 (49 Stat. 2012, 2013, 2003; 46...

  2. Molecular profiling of MPS1 gene silencing in U251 glioma cell line

    Directory of Open Access Journals (Sweden)

    Uma Shankavaram

    2015-12-01

    Full Text Available Aneuploidy has been recognized as a common characteristic of cancers. Aneuploidy frequently results from errors of the mitotic checkpoint, the major cell cycle control mechanism that acts to prevent chromosome missegregation. Mutation of the genes that control chromosome segregation during mitosis may explain the high rate of chromosomal instability and aneuploidy, a characteristic of most solid tumors, including glioblastoma (GBM (Gordon et al., 2012 [1]; Singh et al., 2012 [2]. Monopolar spindle 1 (MPS1 is an essential spindle assembly checkpoint kinase that is overexpressed in several human cancers (Kilpinen et al., 2010 [3]; Mills et al., 1992 [4]; Yuan et al., 2006 [5]. In our previous publication, we have shown the role of MPS1 kinase in DNA repair and enhanced radiosensitivity in GBM (Maachani et al., 2015 [6]. Here, we provide methodological and analytical details of that study, to compare mRNA expression profile of siMPS1-silenced U251 cells with untransfected control, and siRNA control (siNeg at 6, 24, and 48 h after transfection. The raw data of this study is deposited in Gene Expression Omnibus under the accession number GSE57091.

  3. Variants in 6q25.1 Are Associated with Mammographic Density in Malaysian Chinese Women.

    Science.gov (United States)

    Mariapun, Shivaani; Ho, Weang Kee; Kang, Peter Choon Eng; Li, Jingmei; Lindström, Sara; Yip, Cheng Har; Teo, Soo Hwang

    2016-02-01

    Mammographic density is an established risk factor for breast cancer and has a strong heritable component. Genome-wide association studies (GWAS) for mammographic density conducted in women of European descent have identified several genetic associations, but none of the studies have been tested in Asians. We sought to investigate whether these genetic loci, and loci associated with breast cancer risk and breast size, are associated with mammographic density in an Asian cohort. We conducted genotyping by mass spectrometry in 1,189 women (865 Chinese, 187 Indian, and 137 Malay). Quantitative measurements of mammographic density were performed using ImageJ, a fully automated thresholding technique. The associations of SNPs to densities were analyzed using linear regression models. We successfully evaluated the associations of 36 SNPs with mammographic densities. After adjusting for age, body mass index, parity, and menopausal status, we found that in our cohort of 865 Malaysian Chinese, three SNPs in the 6q25.1 region near ESR1 (rs2046210, rs12173570, and rs10484919) that were associated with mammographic density, breast cancer risk, or breast size in previous GWAS were significantly associated with both percentage density and absolute dense area. We could not replicate the most significant association found previously in European women (rs10995190, ZNF365 gene) because the minor allele was absent for Asian women. We found that the directions of genetic associations were similar to those reported in Caucasian women. Our results show that even in Asian women with lower population risk to breast cancer, there is shared heritability between mammographic density and breast cancer risk. ©2015 American Association for Cancer Research.

  4. VLBA 24 and 43 GHz observations of massive binary black hole candidate PKS 1155 + 251

    Science.gov (United States)

    Yang, Xiaolong; Liu, Xiang; Yang, Jun; Mi, Ligong; Cui, Lang; An, Tao; Hong, Xiaoyu; Ho, Luis C.

    2017-10-01

    PKS 1155+251 is a radio-loud quasar source at z = 0.203. Observations using very long baseline interferometry (VLBI) at ∼2, 5, 8 and 15 GHz show that the structure of the radio source is quite complicated on parsec scales and that the outer hotspots are apparently undergoing a significant contraction. Because these results cannot be fully explained based on the compact symmetric object (CSO) scenario with a radio core located between the northern and southern complexes, we made observations with the Very Long Baseline Array (VLBA) at 24 and 43 GHz to search for compact substructures and alternative interpretations. The results show that the radio core revealed in the previous VLBI observations remains compact with a flat spectrum in our sub-milli-arcsecond-resolution images; the northern lobe emission becomes faint at 24 GHz and is mostly resolving out at 43 GHz; the southern complex is more bright but has been resolved into the brightest southern-end (S1) and jet or tail alike components westwards. Explaining the southern components aligned westward with a standard CSO scenario alone remains a challenge. As for the flatter spectral index of the southern-end component S1 between 24 and 43 GHz in our observations and the significant 15 GHz VLBA flux variability of S1, an alternative scenario is that the southern complex may be powered by a secondary black hole residing at S1. But more sensitive and high-resolution VLBI monitoring is required to discriminate the CSO and the binary black hole scenarios.

  5. Synthesis, spectral analysis and anti-bacterial study of N-substituted derivatives of 2-(5-(1-(phenylsulfonylpiperidin-4-yl-1,3,4-oxadiazol-2-ylthioacetamide

    Directory of Open Access Journals (Sweden)

    Hira Khalid

    2016-09-01

    Full Text Available 1,3,4-Oxadiazole bearing compounds are one of the most attractive class for researchers due to their biological activities. In the undertaken research, a number of N-substituted derivatives of 2-(5-(1-(phenylsulfonylpiperidin-4-yl-1,3,4-oxadiazol-2-ylthioacetamide (6a–n were synthesized through a series of steps. The reaction of benzenesulfonyl chloride with ethyl isonipecotate yielded ethyl 1-(phenylsulfonylpiperidin-4-carboxylate (1, which was further converted into 1-(phenylsulfonylpiperidin-4-carbohydrazide (2 and 5-(1-(phenylsulfonylpiperidin-4-yl-1,3,4-oxadiazol-2-thiol (3 respectively. The target compounds 6a–n were synthesized by the reaction of compound 3 with different N-aralkyl/aryl substituted 2-bromoacetamides (5a–n in the presence of a weak base and polar aprotic solvent. The structures of the synthesized compounds were elucidated through 1H-NMR, IR and mass spectral data. The synthesized compounds were screened against Gram-negative and Gram-positive bacteria and exhibited moderate to talented activity.

  6. Target Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — [Part of the ATLAS user facility.] The Physics Division operates a target development laboratory that produces targets and foils of various thickness and substrates,...

  7. Preparation of iodine-123 labeled AM251: a potential SPECT radioligand for the brain cannabinoid CB1 receptor

    Energy Technology Data Exchange (ETDEWEB)

    Lan, Ruoxi; Makriyannis, Alexandros [Connecticut Univ., Molecular and Cell Biology Dept., Storrs, CT (United States); Gatley, S.J. [Brookhaven National Lab., Medical Dept., Upton, NY (United States)

    1996-10-01

    We report the synthesis and labeling with iodine-123 of N-(piperidin-1-yl)-5-(4-iodophenyl)-1-(2, 4-dichlorophenyl)-4-methyl-1H-pyrazole-3-carboxamide (AM251). This compound is an analog of the recently described cannabinoid receptor antagonist, SR141716A, in which a 4-chlorophenyl group is replaced by 4-iodophenyl. Labeling in good yield (62%) and radiochemical purity (> 95%), and high specific activity (> 2500 Ci/mmol) was achieved by an iododestannylation reaction using the tributyltin precursor, no carrier added I-123 iodide, and chloramine-T. (author).

  8. CDC-25.1 controls the rate of germline mitotic cell cycle by counteracting WEE-1.3 and by positively regulating CDK-1 in Caenorhabditis elegans.

    Science.gov (United States)

    Yoon, Sunghee; Kawasaki, Ichiro; Shim, Yhong-Hee

    2012-04-01

    In Caenorhabditis elegans, cdc-25.1 loss-of-function mutants display a lack of germline proliferation. We found that the proliferation defect of cdc-25.1 mutants was suppressed by wee-1.3 RNAi. Further, among the seven cdk and seven cyclin homologs examined, cdk-1 and cyb-3 RNAi treatment caused the most severe germline proliferation defects in an rrf-1 mutant background, which were similar to those of the cdc-25.1 mutants. In addition, while RNAi of cyd-1 and cye-1 caused significant germline proliferation defects, RNAi of cdk-2 and cdk-4 did not. Compared with the number of germ nuclei in wee-1.3(RNAi) worms, the number in wee-1.3(RNAi);cdk-1(RNAi) and wee-1.3(RNAi);cyb-3(RNAi) worms further decreased to the level of cdk-1(RNAi) and cyb-3(RNAi) worms, respectively, indicating that cdk-1 and cyb-3 are epistatic and function downstream of cdc-25.1 and wee-1.3 in the control of the cell cycle. BrdU labeling of adult worms showed that, while 100% of the wild-type germ nuclei in the mitotic region incorporated BrdU when labeled for more than 12 h at 20°C, a small fraction of the cdc-25.1 mutant germ nuclei failed to incorporate BrdU even when labeled for 68 h. These results indicate that CDC-25.1 is required for maintaining proper rate of germline mitotic cell cycle. We propose that CDC-25.1 regulates the rate of germline mitotic cell cycle by counteracting WEE-1.3 and by positively controlling CDK-1, which forms a complex primarily with CYB-3, but also possibly with CYD-1 and CYE-1.

  9. Convergent synthesis of new N -substituted 2-{[5-(1H -indol-3-ylmethyl-1,3,4-oxadiazol-2-yl]sulfanyl}acetamides as suitable therapeutic agents

    Directory of Open Access Journals (Sweden)

    Kaniz Rubab

    2015-12-01

    Full Text Available abstract A series of N-substituted 2-{[5-(1H-indol-3-ylmethyl-1,3,4-oxadiazol-2-yl]sulfanyl}acetamides (8a-w was synthesized in three steps. The first step involved the sequential conversion of 2-(1H-indol-3-ylacetic acid (1 to ester (2 followed by hydrazide (3 formation and finally cyclization in the presence of CS2 and alcoholic KOH yielded 5-(1H-indole-3-yl-methyl-1,3,4-oxadiazole-2-thiol (4. In the second step, aryl/aralkyl amines (5a-w were reacted with 2-bromoacetyl bromide (6 in basic medium to yield 2-bromo-N-substituted acetamides (7a-w. In the third step, these electrophiles (7a-w were reacted with 4 to afford the target compounds (8a-w. Structural elucidation of all the synthesized derivatives was done by 1H-NMR, IR and EI-MS spectral techniques. Moreover, they were screened for antibacterial and hemolytic activity. Enzyme inhibition activity was well supported by molecular docking results, for example, compound 8q exhibited better inhibitory potential against α-glucosidase, while 8g and 8b exhibited comparatively better inhibition against butyrylcholinesterase and lipoxygenase, respectively. Similarly, compounds 8b and 8c showed very good antibacterial activity against Salmonella typhi, which was very close to that of ciprofloxacin, a standard antibiotic used in this study. 8c and 8l also showed very good antibacterial activity against Staphylococcus aureus as well. Almost all compounds showed very slight hemolytic activity, where 8p exhibited the least. Therefore, the molecules synthesized may have utility as suitable therapeutic agents.

  10. Effect of plant resistance and BioAct WG (Purpureocillium lilacinum strain 251) on Meloidogyne incognita in a tomato-cucumber rotation in a greenhouse.

    Science.gov (United States)

    Giné, Ariadna; Sorribas, Francisco J

    2017-05-01

    The effectiveness of combining resistant tomato with BioAct WG (Purpureocillium lilacinum strain 251, Pl251) against Meloidogyne incognita was assessed in a tomato-cucumber rotation in a greenhouse over 2 years. Additionally, the enzymatic activity of the fungus, the percentage of fungal egg and juvenile parasitism, cardinal temperatures and the effect of water potential on mycelial growth and the soil receptivity to Pl251 were determined in vitro. Plant resistance was the only factor that suppressed nematode and crop yield losses. Percentage of egg parasitism in plots treated with BioAct WG was less than 2.6%. However, under in vitro conditions, Pl251 showed protease, lipase and chitinase activities and parasitised 94.5% of eggs, but no juveniles. Cardinal temperatures were 14.2, 24-26 and 35.4 °C. The maximum Pl251 mycelial growth was at -0.25 MPa and 25 °C. Soil temperatures and water potential in the greenhouse were in the range of the fungus. However, soil receptivity was lower in greenhouse soil, irrespective of sterilisation, than in sterilised sand. Plant resistance was the only factor able to suppress nematode densities, disease severity and yield losses, and to protect the following cucumber crop. Environmental factors involved in soil receptivity could have negatively affected fungus effectiveness. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  11. Dynamics of viral replication in blood and lymphoid tissues during SIVmac251 infection of macaques

    Directory of Open Access Journals (Sweden)

    Mannioui Abdelkrim

    2009-01-01

    Full Text Available Abstract Background Extensive studies of primary infection are crucial to our understanding of the course of HIV disease. In SIV-infected macaques, a model closely mimicking HIV pathogenesis, we used a combination of three markers -- viral RNA, 2LTR circles and viral DNA -- to evaluate viral replication and dissemination simultaneously in blood, secondary lymphoid tissues, and the gut during primary and chronic infections. Subsequent viral compartmentalization in the main target cells of the virus in peripheral blood during the chronic phase of infection was evaluated by cell sorting and viral quantification with the three markers studied. Results The evolutions of viral RNA, 2LTR circles and DNA levels were correlated in a given tissue during primary and early chronic infection. The decrease in plasma viral load principally reflects a large decrease in viral replication in gut-associated lymphoid tissue (GALT, with viral RNA and DNA levels remaining stable in the spleen and peripheral lymph nodes. Later, during chronic infection, a progressive depletion of central memory CD4+ T cells from the peripheral blood was observed, accompanied by high levels of viral replication in the cells of this subtype. The virus was also found to replicate at this point in the infection in naive CD4+ T cells. Viral RNA was frequently detected in monocytes, but no SIV replication appeared to occur in these cells, as no viral DNA or 2LTR circles were detected. Conclusion We demonstrated the persistence of viral replication and dissemination, mostly in secondary lymphoid tissues, during primary and early chronic infection. During chronic infection, the central memory CD4+ T cells were the major site of viral replication in peripheral blood, but viral replication also occurred in naive CD4+ T cells. The role of monocytes seemed to be limited to carrying the virus as a cargo because there was an observed lack of replication in these cells. These data may have important

  12. Common alleles at 6q25.1 and 1p11.2 are associated with breast cancer risk for BRCA1 and BRCA2 mutation carriers

    NARCIS (Netherlands)

    A.C. Antoniou (Antonis); C. Kartsonaki (Christiana); O. Sinilnikova (Olga); P. Soucy (Penny); L. McGuffog (Lesley); S. Healey (Sue); A. Lee (Andrew); P. Peterlongo (Paolo); S. Manoukian (Siranoush); B. Peissel (Bernard); D. Zaffaroni (D.); E. Cattaneo (Elisa); M. Barile (Monica); V. Pensotti (Valeria); B. Pasini (Barbara); R. Dolcetti (Riccardo); G. Giannini (Giuseppe); A.L. Putignano; L. Varesco (Liliana); P. Radice (Paolo); P.L. Mai (Phuong); M.H. Greene (Mark); I.L. Andrulis (Irene); G. Glendon (Gord); H. Ozcelik (Hilmi); M. Thomassen (Mads); A-M. Gerdes (Anne-Marie); T.A. Kruse (Torben); U.B. Jensen; D. Cruger (Dorthe); M.A. Caligo (Maria); Y. Laitman (Yael); R. Milgrom (Roni); B. Kaufman (Bella); S. Paluch-Shimon (Shani); E. Friedman (Eitan); N. Loman (Niklas); K. Harbst (Katja); A. Lindblom (Annika); B. Melin (Beatrice); K.L. Nathanson (Katherine); S.M. Domchek (Susan); R. Rebbeck (Timothy); A. Jakubowska (Anna); J. Lubinski (Jan); J. Gronwald (Jacek); T. Huzarski (Tomasz); T. Byrski (Tomasz); C. Cybulski (Cezary); B. Górski (Bohdan); A. Osorio (Ana); T.R. Cajal; F. Fostira (Florentia); R. Andres (Raquel); J. Benitez (Javier); U. Hamann (Ute); F.B.L. Hogervorst (Frans); M.A. Rookus (Matti); M.J. Hooning (Maartje); M.R. Nelen (Marcel); R.B. van der Luijt (Rob); T.A.M. van Os (Theo); C.J. van Asperen (Christi); P. Devilee (Peter); H. Meijers-Heijboer (Hanne); E.B.G. Garcia; S. Peock (Susan); M. Cook (Margaret); D. Frost; R. Platte (Radka); J. Leyland (Jean); D.G. Evans (Gareth); F. Lalloo (Fiona); R. Eeles (Rosalind); L. Izatt (Louise); R. Davidson (Rosemarie); D. Eccles (Diana); K.-R. Ong; F. Douglas (Fiona); J. Paterson (Joan); M.J. Kennedy (John); Z. Miedzybrodzka (Zosia); A.K. Godwin (Andrew); D. Stoppa-Lyonnet (Dominique); B. Buecher (Bruno); M. Belotti (Muriel); C. Tirapo (Carole); S. Mazoyer (Sylvie); L. Barjhoux (Laure); C. Lasset (Christine); D. Leroux (Dominique); L. Faivre (Laurence); M. Bronner (Myriam); F. Prieur (Fabienne); C. Nogues (Catherine); E. Rouleau (Etienne); P. Pujol (Pascal); I. Coupier (Isabelle); M. Frenay (Marc); J. Hopper (John); M.J. Daly (Mark); M-B. Terry (Mary-beth); E.M. John (Esther); S.S. Buys (Saundra); Y. Yassin (Yosuf); A. Miron (Alexander); D. Goldgar (David); C.F. Singer (Christian); M.-K. Tea; G. Pfeiler (Georg); C. Dressler (Catherina); T.V.O. Hansen (Thomas); L. Jønson (Lars); B. Ejlertsen (Bent); R.B. Barkardottir (Rosa); T. Kircchoff (Tomas); K. Offit (Kenneth); M. Piedmonte (Marion); G.C. Rodriguez (Gustavo); L. Small (Laurie); J.F. Boggess (John); S.V. Blank (Stephanie); J. Basil (Jack); M. Azodi (Masoud); A.E. Toland (Amanda); M. Montagna (Marco); S. Tognazzo (Silvia); S. Agata (Simona); E.N. Imyanitov (Evgeny); R. Janavicius (Ramunas); C. Lazaro (Conxi); I. Blanco (Ignacio); P.D.P. Pharoah (Paul); L. Sucheston (Lara); B.Y. Karlan (Beth); C.S. Walsh (Christine); E. Olah (Edith); A. Bozsik (Aniko); S.-H. Teo; J.L. Seldon (Joyce); M.S. Beattie (Mary); E.J. van Rensburg (Elizabeth); M.D. Sluiter (Michelle); O. Diez (Orland); R.K. Schmutzler (Rita); B. Wapenschmidt (Barbara); C.W. Engel (Christoph); A. Meindl (Alfons); I. Ruehl (Ina); R. Varon-Mateeva (Raymonda); K. Kast (Karin); H. Deissler (Helmut); D. Niederacher (Dieter); N. Arnold (Norbert); D. Gadzicki (Dorothea); I. Schönbuchner (Ines); T. Caldes (Trinidad); M. de La Hoya (Miguel); H. Nevanlinna (Heli); K. Aittomäki (Kristiina); M. Dumont (Martine); J. Chiquette (Jocelyne); M. Tischkowitz (Marc); G. Chenevix-Trench (Georgia); J. Beesley (Jonathan); A.B. Spurdle (Amanda); S.L. Neuhausen (Susan); Y.C. Ding (Yuan); Z. Fredericksen (Zachary); X. Wang (Xing); V.S. Pankratz (Shane); F.J. Couch (Fergus); J. Simard (Jacques); D.F. Easton (Douglas); G. Chenevix-Trench (Georgia); P. Karlsson (Per); M. Nordling (Margareta); A. Bergman (Annika); Z. Einbeigi (Zakaria); M. Stenmark-Askmalm (M.); S. Liedgren (Sigrun); Å. Borg (Åke); H. Olsson (Hans); U. Kristoffersson (Ulf); H. Jernström (H.); K. Henriksson (Karin); A. von Wachenfeldt (Anna); A. Liljegren (Annelie); G. Barbany-Bustinza (Gisela); J. Rantala (Johanna); H. Grönberg (Henrik); E.-L. Stattin; M. Emanuelsson (Monica); R.R. Brandell; N. Dahl (Niklas); S. Verhoef; M. Verheus (Martijn); L.J. van 't Veer (Laura); F.E. van Leeuwen; J.M. Collee (Margriet); A.M.W. van den Ouweland (Ans); A. Jager (Agnes); M.M.A. Tilanus-Linthorst (Madeleine); C.M. Seynaeve (Caroline); J.T. Wijnen (Juul); M.P. Vreeswijk (Maaike); R.A.E.M. Tollenaar (Rob); M.J. Ligtenberg (Marjolijn); N. Hoogerbrugge (Nicoline); M.G.E.M. Ausems (Margreet); C.M. Aalfs (Cora); J.J.P. Gille (Jan); Q. Waisfisz (Quinten); E.B. Gómez García (Encarna); C.E. van Roozendaal (Cees); M.J. Blok (Marinus); B. Caanen; J.C. Oosterwijk; A.H. van der Hout (Annemarie); M.J. Mourits; H.F. Vasen (Hans); H. Gregory (Helen); P.J. Morrison (Patrick); L. Jeffers (Lisa); T.J. Cole (Trevor); C. McKeown (Carole); J. Hoffman (Jonathan); A. Donaldson (Alan); S. Downing (Sarah); A. Taylor (Amy); A. Murray (Alexandra); M.T. Rogers (Mark); E. McCann (Emma); M.E. Porteous (Mary); S. Drummond (Sarah); C. Brewer (Carole); E. Kivuva (Emma); A. Searle (Anne); S. Goodman (Selina); K. Hill (Kathryn); V. Murday (Victoria); N. Bradshaw (Nicola); L. Snadden (Lesley); M. Longmuir (Mark); C. Watt (Catherine); S. Gibson (Sarah); E. Haque (Eshika); E. Tobias (Ed); A. Duncan (Alexis); C. Jacobs (Chris); C. Langman (Caroline); A. Whaite (Anna); H. Dorkins (Huw); J. Barwell (Julian); C. Chu (Chengbin); J. Miller (Julie); I.O. Ellis (Ian); C. Houghton (Catherine); L. Side (Lucy); A. Male (Alison); C. Berlin (Cheryl); J. Eason (Jacqueline); R. Collier (Rebecca); O. Claber (Oonagh); I. Jobson (Irene); L.J. Walker (Lisa); D. McLeod (Diane); D. Halliday (Dorothy); S. Durell (Sarah); B. Stayner (Barbara); S. Shanley (Susan); N. Rahman (Nazneen); R. Houlston (Richard); E. Bancroft (Elizabeth); L. D'Mello (Lucia); E. Page (Elizabeth); A. Ardern-Jones (Audrey); K. Kohut (Kelly); J. Wiggins (Jennifer); E. Castro (Elena); A. Mitra (Anita); L. Robertson (Lisa); O. Quarrell (Oliver); C. Bardsley (Cathryn); H. Ehrencrona (Hans); S.V. Hodgson (Shirley); D.E. Barton (David); S. Goff (Sheila); G. Brice (Glen); L. Winchester (Lizzie); C. Eddy (Charlotte); V. Tripathi (Vishakha); V. Attard (Virginia); A. Lucassen (Anneke); G. Crawford (Gillian); D. McBride (Donna); S. Smalley (Sarah); J.W. Adlard (Julian); B. Arver (Brita Wasteson)

    2011-01-01

    textabstractTwo single nucleotide polymorphisms (SNPs) at 6q25.1, near the ESR1 gene, have been implicated in the susceptibility to breast cancer for Asian (rs2046210) and European women (rs9397435). A genome-wide association study in Europeans identified two further breast cancer susceptibility

  13. Common alleles at 6q25.1 and 1p11.2 are associated with breast cancer risk for BRCA1 and BRCA2 mutation carriers

    NARCIS (Netherlands)

    Antoniou, Antonis C.; Kartsonaki, Christiana; Sinilnikova, Olga M.; Soucy, Penny; McGuffog, Lesley; Healey, Sue; Lee, Andrew; Peterlongo, Paolo; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Cattaneo, Elisa; Barile, Monica; Pensotti, Valeria; Pasini, Barbara; Dolcetti, Riccardo; Giannini, Giuseppe; Putignano, Anna Laura; Varesco, Liliana; Radice, Paolo; Mai, Phuong L.; Greene, Mark H.; Andrulis, Irene L.; Glendon, Gord; Ozcelik, Hilmi; Thomassen, Mads; Gerdes, Anne-Marie; Kruse, Torben A.; Birk Jensen, Uffe; Crüger, Dorthe G.; Caligo, Maria A.; Laitman, Yael; Milgrom, Roni; Kaufman, Bella; Paluch-Shimon, Shani; Friedman, Eitan; Loman, Niklas; Harbst, Katja; Lindblom, Annika; Arver, Brita; Ehrencrona, Hans; Melin, Beatrice; Nathanson, Katherine L.; Domchek, Susan M.; Rebbeck, Timothy; Jakubowska, Ania; Lubinski, Jan; Gronwald, Jacek; Huzarski, Tomasz; Byrski, Tomasz; Cybulski, Cezary; Gorski, Bohdan; Osorio, Ana; Ramón Y Cajal, Teresa; Fostira, Florentia; Andrés, Raquel; Benitez, Javier; Hamann, Ute; Hogervorst, Frans B.; Rookus, Matti A.; Hooning, Maartje J.; Nelen, Marcel R.; van der Luijt, Rob B.; van Os, Theo A. M.; van Asperen, Christi J.; Devilee, Peter; Meijers-Heijboer, Hanne E. J.; Gómez Garcia, Encarna B.; Peock, Susan; Cook, Margaret; Frost, Debra; Platte, Radka; Leyland, Jean; Evans, D. Gareth; Lalloo, Fiona; Eeles, Ros; Izatt, Louise; Adlard, Julian; Davidson, Rosemarie; Eccles, Diana; Ong, Kai-Ren; Cook, Jackie; Douglas, Fiona; Paterson, Joan; Kennedy, M. John; Miedzybrodzka, Zosia; Godwin, Andrew; Stoppa-Lyonnet, Dominique; Buecher, Bruno; Belotti, Muriel; Tirapo, Carole; Mazoyer, Sylvie; Barjhoux, Laure; Lasset, Christine; Leroux, Dominique; Faivre, Laurence; Bronner, Myriam; Prieur, Fabienne; Nogues, Catherine; Rouleau, Etienne; Pujol, Pascal; Coupier, Isabelle; Frénay, Marc; Hopper, John L.; Daly, Mary B.; Terry, Mary B.; John, Esther M.; Buys, Saundra S.; Yassin, Yosuf; Miron, Alexander; Goldgar, David; Singer, Christian F.; tea, Muy-Kheng; Pfeiler, Georg; Dressler, Anne Catharina; Hansen, Thomas v O.; Jønson, Lars; Ejlertsen, Bent; Barkardottir, Rosa Bjork; Kirchhoff, Tomas; Offit, Kenneth; Piedmonte, Marion; Rodriguez, Gustavo; Small, Laurie; Boggess, John; Blank, Stephanie; Basil, Jack; Azodi, Masoud; Toland, Amanda Ewart; Montagna, Marco; Tognazzo, Silvia; Agata, Simona; Imyanitov, Evgeny; Janavicius, Ramunas; Lazaro, Conxi; Blanco, Ignacio; Pharoah, Paul D. P.; Sucheston, Lara; Karlan, Beth Y.; Walsh, Christine S.; Olah, Edith; Bozsik, Aniko; teo, Soo-Hwang; Seldon, Joyce L.; Beattie, Mary S.; van Rensburg, Elizabeth J.; Sluiter, Michelle D.; Diez, Orland; Schmutzler, Rita K.; Wappenschmidt, Barbara; Engel, Christoph; Meindl, Alfons; Ruehl, Ina; Varon-Mateeva, Raymonda; Kast, Karin; Deissler, Helmut; Niederacher, Dieter; Arnold, Norbert; Gadzicki, Dorothea; Schönbuchner, Ines; Caldes, Trinidad; de la Hoya, Miguel; Nevanlinna, Heli; Aittomäki, Kristiina; Dumont, Martine; Chiquette, Jocelyne; Tischkowitz, Marc; Chen, Xiaoqing; Beesley, Jonathan; Spurdle, Amanda B.; Neuhausen, Susan L.; Chun Ding, Yuan; Fredericksen, Zachary; Wang, Xianshu; Pankratz, Vernon S.; Couch, Fergus; Simard, Jacques; Easton, Douglas F.; Chenevix-Trench, Georgia; Gregory, Helen; Morrison, Patrick; Jeffers, Lisa; Cole, Trevor; McKeown, Carole; Hoffman, Jonathan; Donaldson, Alan; Downing, Sarah; Taylor, Amy; Murray, Alexandra; Rogers, Mark T.; McCann, Emma; John Kennedy, M.; Barton, David; East, South; Porteous, Mary; Drummond, Sarah; Brewer, Carole; Kivuva, Emma; Searle, Anne; Goodman, Selina; Hill, Kathryn; Murday, Victoria; Bradshaw, Nicola; Snadden, Lesley; Longmuir, Mark; Watt, Catherine; Gibson, Sarah; Haque, Eshika; Tobias, Ed; Duncan, Alexis; Jacobs, Chris; Langman, Caroline; Whaite, Anna; Dorkins, Huw; Barwell, Julian; Chu, Carol; Miller, Julie; Ellis, Ian; Gareth Evans, D.; Taylor, Jane; Thames, N. E.; Side, Lucy; Male, Alison; Berlin, Cheryl; Eason, Jacqueline; Collier, Rebecca; Claber, Oonagh; Jobson, Irene; Walker, Lisa; McLeod, Diane; Halliday, Dorothy; Durell, Sarah; Stayner, Barbara; Shanley, Susan; Rahman, Nazneen; Houlston, Richard; Bancroft, Elizabeth; D'Mello, Lucia; Page, Elizabeth; Ardern-Jones, Audrey; Kohut, Kelly; Wiggins, Jennifer; Castro, Elena; Mitra, Anita; Robertson, Lisa; Quarrell, Oliver; Bardsley, Cathryn; Hodgson, Shirley; Goff, Sheila; Brice, Glen; Winchester, Lizzie; Eddy, Charlotte; Tripathi, Vishakha; Attard, Virginia; Lucassen, Anneke; Crawford, Gillian; McBride, Donna; Smalley, Sarah; Sutter, Christian; Preisler-Adams, Sabine; Fiebig, Britta; Heinritz, Wolfram; Schäfer, Dieter; Köhler, Juliane; Bérard, Léon; Sinilnikova, Olga; Verny-Pierre, Carole; Giraud, Sophie; Léone, Mélanie; Gauthier-Villars, Marion; Houdayer, Claude; Moncoutier, Virginie; de Pauw, Antoine; Bressac-de-Paillerets, Brigitte; Remenieras, Audrey; Byrde, Véronique; Caron, Olivier; Lenoir, Gilbert; Bignon, Yves-Jean; Uhrhammer, Nancy; Bonadona, Valérie; Hardouin, Agnés; Berthet, Pascaline; Sobol, Hagay; Bourdon, Violaine; Noguchi, Tetsuro; Eisinger, François; Coulet, Florence; Colas, Chrystelle; Soubrier, Florent; Peyrat, Jean-Philippe; Fournier, Joëlle; Révillion, Françoise; Vennin, Philippe; Adenis, Claude; Lidereau, Rosette; Demange, Liliane; Muller, Daniéle; Fricker, Jean-Pierre; Longy, Michel; Sevenet, Nicolas; Toulas, Christine; Guimbaud, Rosine; Gladieff, Laurence; Feillel, Viviane; Dreyfus, Hélène; Rebischung, Christine; Coron, Fanny; Lebrun, Marine; Ferrer, Sandra Fert; Vénat-Bouvet, Laurence; Delnatte, Capucine; Mortemousque, Isabelle; Lynch, Henry T.; Snyder, Carrie L.; Hogervorst, F. B. L.; Verhoef, S.; Verheus, M.; van ‘t Veer, L. J.; van Leeuwen, F. E.; Rookus, M. A.; Collée, M.; van den Ouweland, A. M. W.; Jager, A.; Hooning, M. J.; Tilanus-Linthorst, M. M. A.; Seynaeve, C.; van Asperen, C. J.; Wijnen, J. T.; Vreeswijk, M. P.; Tollenaar, R. A.; Devilee, P.; Ligtenberg, M. J.; Hoogerbrugge, N.; Ausems, M. G.; van der Luijt, R. B.; Aalfs, C. M.; Gille, J. J. P.; Waisfisz, Q.; Gomez-Garcia, E. B.; van Roozendaal, C. E.; Blok, Marinus J.; Caanen, B.; Oosterwijk, J. C.; van der Hout, A. H.; Mourits, M. J.; Vasen, H. F.; Karlsson, Per; Nordling, Margareta; Bergman, Annika; Einbeigi, Zakaria; Stenmark-Askmalm, Marie; Liedgren, Sigrun; Borg, Åke; Olsson, Håkan; Kristoffersson, Ulf; Jernström, Helena; Henriksson, Karin; von Wachenfeldt, Anna; Liljegren, Annelie; Barbany-Bustinza, Gisela; Rantala, Johanna; Grönberg, Henrik; Stattin, Eva-Lena; Emanuelsson, Monica; Brandell, Richard Rosenquist; Dahl, Niklas

    2011-01-01

    Two single nucleotide polymorphisms (SNPs) at 6q25.1, near the ESR1 gene, have been implicated in the susceptibility to breast cancer for Asian (rs2046210) and European women (rs9397435). A genome-wide association study in Europeans identified two further breast cancer susceptibility variants:

  14. Antiproton Target

    CERN Multimedia

    1980-01-01

    Antiproton target used for the AA (antiproton accumulator). The first type of antiproton production target used from 1980 to 1982 comprised a rod of copper 3mm diameter and 120mm long embedded in a graphite cylinder that was itself pressed into a finned aluminium container. This assembly was air-cooled and it was used in conjunction with the Van der Meer magnetic horn. In 1983 Fermilab provided us with lithium lenses to replace the horn with a view to increasing the antiproton yield by about 30%. These lenses needed a much shorter target made of heavy metal - iridium was chosen for this purpose. The 50 mm iridium rod was housed in an extension to the original finned target container so that it could be brought very close to the entrance to the lithium lens. Picture 1 shows this target assembly and Picture 2 shows it mounted together with the lithium lens. These target containers had a short lifetime due to a combination of beam heating and radiation damage. This led to the design of the water-cooled target in...

  15. WITHDRAWN: Dual targeting of glioma U251 cells and neovasculature with a nanoparticle encoding vasohibin and RGD peptides prevents tumor angiogenesis and inhibits tumor growth.

    Science.gov (United States)

    Chen, Hongjie; Yuan, Bangqing; Wang, Shousen; Zhen, Zhaocong; Liu, Zheng

    2011-06-01

    This article has been withdrawn at the request of the author(s) and editor. The Publisher apologizes for any inconvenience this may cause. The full Elsevier Policy on Article Withdrawal can be found at http://www.elsevier.com/locate/withdrawalpolicy. Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  16. Spectroscopy of odd Z trans-fermium nuclei: the nuclear structure of Md{sup 251}; Spectroscopie des transfermiums impairs en proton: la structure du noyau de {sup 251}Md

    Energy Technology Data Exchange (ETDEWEB)

    Chatillon, A

    2005-10-01

    The objective of this thesis was to determine the structure of trans-fermium nuclei (Z 100) with odd proton number, which remained largely unexplored. These nuclei were produced in fusion-evaporation reactions with small cross sections below 1 {mu}b. The experimental methods of Recoil-Tagging and Recoil-Decay-Tagging were used for their identification. In order to identify the active orbitals in this mass region, {sup 255}Lr, {sup 251}M1d and {sup 247}Es nuclei have been studied by decay spectroscopy at the University of Jyvaskyla and at GANIL with the LISE spectrometer and the {alpha}-electron detector BEST coupled to four CLover detectors from the EXOGAM array. New states have been observed in each of the isotopes, and their configuration has been proposed. The collective properties were also studied in two experiments using prompt {gamma} and electron spectroscopy, combining the JUROGAM and SACRED arrays, respectively, with the recoil separator RITU and the GREAT spectrometer at its focal plane. A rotational band has been observed for the first time in a proton-odd trans-fermium nucleus. The interpretation of this collective structure is based on the theoretical HFB calculations. (author)

  17. Biological function analysis of monoclonal antibodies against human granulins in vitro using U251 cells as a model.

    Science.gov (United States)

    Li, Yanqing; Li, Ya; Ye, Mingfu; Wang, Dongyang; Zhao, Junli; Sun, Xiaohong; Mao, Qinwen; Xia, Haibin

    2017-02-01

    Progranulin (PGRN), a highly glycosylated, secreted 593 amino acid precursor protein, is a multifunctional molecule that is critical for early embryogenesis, wound repair, inflammatory and tumorigenesis. PGRN can be proteolytically cleaved into seven cysteine-rich granulin (Grn) peptides: G, F, B, A, C, D and E. Both PGRN and its constituent Grn peptides have been implicated in a wide variety of biological activities. However, their functions are far from clear, and the lack of granulin domain-specific antibodies has hindered the progress of the functional study of PGRN and Grns. Monoclonal antibodies against GrnB, GrnA, GrnC and GrnF have been previously developed by our laboratory. In this study, we generated monoclonal antibodies (MAbs) against GrnD, GrnG and GrnE by using recombinant proteins HSA-GrnG, HSA-GrnD and HSA-GrnE as immunogens, and characterized them by indirect ELISA, Western blot and immunocytochemistry. Furthermore, the neutralizing activities of the MAbs against seven Grns were tested in vitro using the U251 cell line. This full antibody panel of MAbs against seven Grns will be a valuable tool for elucidating the biological roles of PGRN and Grns in different physiopathological processes, which will further promote the development of PGRN-based clinical diagnosis and therapy. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Autosomal recessive spastic paraplegia (SPG45) with mental retardation maps to 10q24.3-q25.1.

    Science.gov (United States)

    Dursun, Umut; Koroglu, Cigdem; Kocasoy Orhan, Elif; Ugur, Sibel Aylin; Tolun, Aslihan

    2009-10-01

    Hereditary spastic paraplegias (HSPs) are characterized by progressive spasticity in the lower limbs. They are clinically heterogeneous, and pure forms as well as complicated forms with other accompanying clinical findings are known. HSPs are also genetically heterogeneous. We performed clinical and genetic studies in a consanguineous family with five affected members. A genome scan using 405 microsatellite markers for eight members of the family identified candidate gene loci, and subsequent fine mapping in 16 members identified the gene locus responsible for the HSP. The clinical manifestations were very early onset spastic paraplegia (SPG) accompanied by mental retardation and ocular signs. The gene locus was identified as the interval 102.05-106.64 Mbp on chromosome 10. Gene MRPL43 was analyzed in the patients. No mutation but high levels of mRNA were detected. We have mapped a novel autosomal recessive complicated form of HSP (SPG45) to a 4.6-Mbp region at 10q24.3-q25.1 with multipoint logarithm of odds scores >4.5.

  19. Low dose rectal inoculation of rhesus macaques by SIV smE660 or SIVmac251 recapitulates

    Energy Technology Data Exchange (ETDEWEB)

    Hraber, Peter [Los Alamos National Laboratory; Giorgi, Elena E [Los Alamos National Laboratory; Keele, Brandon [UNIV OF ALABAMA; Li, Hui [UNIV OF ALABAMA; Learn, Gerald [UNIV OF ALABAMA

    2008-01-01

    We recently developed a novel strategy to identify transmitted HIV-1 genomes in acutely infected humans using single-genome amplification and a model of random virus evolution. Here, we used this approach to determine the molecular features of simian immunodeficiency virus (SIV) transmission in 18 experimentally infected Indian rhesus macaques. Animals were inoculated intrarectally (i.r.) or intravenously (i.v.) with stocks of SIVmac251 or SIVsmE660 that exhibited sequence diversity typical of early-chronic HIV-1 infection. 987 full-length SIV env sequences (median of 48 per animal) were determined from plasma virion RNA 1--5 wk after infection. i.r. inoculation was followed by productive infection by one or a few viruses (median 1; range 1--5) that diversified randomly with near starlike phylogeny and a Poisson distribution of mutations. Consensus viral sequences from ramp-up and peak viremia were identical to viruses found in the inocula or differed from them by only one or a few nucleotides, providing direct evidence that early plasma viral sequences coalesce to transmitted/founder viruses. i.v. infection was >2,000-fold more efficient than i.r. infection, and viruses transmitted by either route represented the full genetic spectra of the inocula. These findings identify key similarities in mucosal transmission and early diversification between SIV and HIV-1, and thus validate the SIV-macaque mucosal infection model for HIV-1 vaccine and microbicide research.

  20. The effects of intracerebroventricular AM-251, a CB1-receptor antagonist, and ACEA, a CB1-receptor agonist, on penicillin-induced epileptiform activity in rats.

    Science.gov (United States)

    Kozan, Ramazan; Ayyildiz, Mustafa; Agar, Erdal

    2009-07-01

    Several results support the conclusion that the cannabinoid system has a role in generation and cessation of epileptic seizures. The aim of this study was to evaluate the effects of intracerebroventricular AM-251 [N-(piperidin-1-yl)-5-(4-iodophenyl)-1-(2,4-dichlorophenyl)-4-methyl-1H-pyrazole-3-carboxamide], a CB1-receptor antagonist, and ACEA (arachidonyl-2-chloroethylamide), a CB1-receptor agonist, on penicillin-induced epileptiform activity in rats. In the first set of experiments, 30 min after penicillin injection, AM-251, at doses of 0.125, 0.25, 0.5, and 1 μg, was administered intracerebroventricularly (i.c.v.). In the second set of experiments, 30 min after penicillin injection, ACEA, at doses of 2.5, 5, 7.5, and 15 μg (i.c.v.), was administered. In the third set of experiments, AM-251, at doses of 0.125 and 0.25 μg (i.c.v.), was administered 10 min before ACEA (7.5 μg, i.c.v.) injection. ACEA, at a dose of 7.5 μg, significantly decreased the frequency of penicillin-induced epileptiform activity without changing the amplitude. ACEA, at doses of 2.5, 5, and 15 μg, had no impact on either frequency or amplitude of epileptiform activity. AM-251, at doses of 0.25 and 0.50 μg, significantly increased the frequency of epileptiform activity. AM-251, at a dose of 0.25 μg (i.c.v.), was the most effective in changing the frequency of penicillin-induced epileptiform activity, and it also caused status epilepticus-like activity. AM-251, at doses of 0.125 and 0.25 μg, 10 min before ACEA (7.5 μg), reversed the anticonvulsant action of ACEA. The results of the present study provide electrophysiologic evidence for the role of CB1 receptors in regulating the frequency of epileptiform activity in the model of penicillin-induced epilepsy. To elucidate the precise mechanism of cannabinoid action in the brain during seizure, more advanced electrophysiologic and neurochemical studies are required.

  1. A clinical epidemiological study of 251 cases of amyotrophic lateral sclerosis in the south of Brazil Estudo clínico epidemiológico de 251 casos de esclerose lateral amiotrófica no sul do Brasil

    Directory of Open Access Journals (Sweden)

    Lineu Cesar Werneck

    2007-06-01

    Full Text Available OBJECTIVE: To study the clinical forms of amyotrophic lateral sclerosis (ALS and the possible presence of risk factors in order to verify if there is any difference between cases in Paraná, Brazil. METHOD: We studied 251 cases, all of which fulfilled the diagnosis criteria proposed in El Escorial (WFN. Between 1977 and 2004, 157 male and 94 female patients were examined. RESULTS: 220 cases were classified as ALS-Spinal Onset (ALS-SO, 24 as ALS-Bulbar Onset (ALS-BO and 7 as Familial ALS. The mean age at time of evaluation was 54.4±12.3 years, and symptoms had started 17.9±15.7months previously. In the group studied, statistical relationships were found between heavy occupations and males; previous surgeries and females; ALS-BO and dysphagia and dysarthria in females; and ALS-SO and males, cramps, weakness, muscle atrophy, hypertonia, increased deep tendon reflex and abnormal gait. CONCLUSION: The average age at time of evaluation was lower than that registered in the literature but similar to the Brazilian series. Domestic work and heavy occupations appear to be related to precocious perception of the symptoms by interference with daily functions. The socioeconomically higher classes seek medical care early. There was no relationship with exposure to toxic agents or trauma.OBJETIVO: Estudar as formas clínicas de esclerose lateral amiotrófica (ELA e possíveis fatores de risco, a fim de verificar se existem diferenças entre os casos do Paraná, Brasil. MÉTODO: Estudamos 251 casos entre 1977 e 2004, que preencheram os critérios propostos em El Escorial (WFN, sendo 157 do sexo masculino e 94 do feminino. RESULTADOS: Foram classificados como ELA de início espinhal (ELA-IE 220 casos, ELA de início bulbar (ELA-IB 24 casos e 7 casos como ELA familiar. A idade média na avaliação foi 54,4±12,3 anos cujos sintomas iniciaram 17,9 ±15,7 meses antes. Foram encontradas relações estatísticas entre ocupação que demandam esforços físicos com

  2. Targeted Learning

    CERN Document Server

    van der Laan, Mark J

    2011-01-01

    The statistics profession is at a unique point in history. The need for valid statistical tools is greater than ever; data sets are massive, often measuring hundreds of thousands of measurements for a single subject. The field is ready to move towards clear objective benchmarks under which tools can be evaluated. Targeted learning allows (1) the full generalization and utilization of cross-validation as an estimator selection tool so that the subjective choices made by humans are now made by the machine, and (2) targeting the fitting of the probability distribution of the data toward the targe

  3. Common alleles at 6q25.1 and 1p11.2 are associated with breast cancer risk for BRCA1 and BRCA2 mutation carriers

    DEFF Research Database (Denmark)

    Antoniou, Antonis C; Kartsonaki, Christiana; Sinilnikova, Olga M

    2011-01-01

    Two single nucleotide polymorphisms (SNPs) at 6q25.1, near the ESR1 gene, have been implicated in the susceptibility to breast cancer for Asian (rs2046210) and European women (rs9397435). A genome-wide association study in Europeans identified two further breast cancer susceptibility variants: rs...... is currently unknown. To address this, we genotyped these SNPs in BRCA1 and BRCA2 mutation carriers from 42 studies from the Consortium of Investigators of Modifiers of BRCA1/2. In the analysis of 14 123 BRCA1 and 8053 BRCA2 mutation carriers of European ancestry, the 6q25.1 SNPs (r(2) = 0.14) were...... to a better understanding of the biology of tumour development in these women....

  4. PDF 25(1)

    African Journals Online (AJOL)

    AISA

    Evaluation du comportement de nouvelles variétés de riz au Gabon. Nizigiyimana A. 1993. Détermination et carac- térisation des phases de sensibilité aux basses températures chez le riz (Oryza sativa L.).Thèse de doctorat en sciences,. UCL. Louvain-la-Neuve. 131 p. Nwilene F. E., Nwanze K. F. and O. Okhidievbie. 2006.

  5. PDF 25(1)

    African Journals Online (AJOL)

    AISA

    2003). Par ailleurs leur commercialisation fait l'objet généralement de circuits courts (Moustier et Fleury, 2003), aux conditions d'accès nécessitant peu de moyens, et générant de fait de nombreux emplois pour des populations marginalisées des villes. Les revenus générés par la vente contribuent à la sécurité alimentaire.

  6. Neonatal Caffeine Treatment and Respiratory Function at 11 Years in Children under 1,251 g at Birth.

    Science.gov (United States)

    Doyle, Lex W; Ranganathan, Sarath; Cheong, Jeanie L Y

    2017-11-15

    Caffeine in the newborn period shortens the duration of assisted ventilation and reduces the incidence of bronchopulmonary dysplasia, but its effects on respiratory function in later childhood are unknown. To determine if children born with birth weight less than 1,251 g who were treated with neonatal caffeine had improved respiratory function at 11 years of age compared with children treated with placebo. Children enrolled in the CAP (Caffeine for Apnea of Prematurity) randomized controlled trial and assessed at the Royal Women's Hospital in Melbourne at 11 years of age had expiratory flow rates measured according to the standards of the American Thoracic Society. Values were converted to z-scores predicted for age, height, ethnicity, and sex. Parents completed questionnaires related to their child's respiratory health. A total of 142 children had expiratory flows measured. Expiratory flows were better in the caffeine group, by approximately 0.5 SD for most variables (e.g., FEV 1 ; mean z-score, -1.00 vs. -1.53; mean difference, 0.54; 95% confidence interval, 0.14-0.94; P = 0.008). Fewer children in the caffeine group had values for FVC below the fifth centile (11% vs. 28%; odds ratio, 0.31; 95% confidence interval, 0.12-0.77; P = 0.012). When adjusted for bronchopulmonary dysplasia, the difference in flow rates between groups diminished. Caffeine treatment in the newborn period improves expiratory flow rates in midchildhood, which seems to be achieved by improving respiratory health in the newborn period. Follow-up lung function testing in adulthood is vital for these individuals. Future placebo-controlled randomized trials of neonatal caffeine are unlikely. Clinical trial registered with www.clinicaltrials.gov (NCT00182312).

  7. Risk Factors for Pedicle Flap Complications in 251 Elderly Chinese Patients Who Underwent Oral and Maxillofacial Reconstruction.

    Science.gov (United States)

    Fang, Zao; Tian, Zhuowei; Zhang, Chenping; Sun, Jian; Hu, Jingzhou; He, Yue

    2016-10-01

    To determine risk factors for pedicle flap complications in elderly patients undergoing oral and maxillofacial reconstruction. The authors designed and implemented a retrospective cohort study and enrolled a sample of patients at least 75 years old who underwent resection of oral and maxillofacial tumors and pedicle flap reconstruction from January 2004 through December 2013. The primary predictor variable was reconstructive technique grouped into 5 types of pedicle flap. The difference among groups was tested with the χ(2) test and t test. The primary outcome variable was the presence of flap complication, which was divided into minor and major groups. Other variables were grouped into the following sets: demographic, operative, and adjuvant treatments. Univariate, bivariate, and regression statistics were computed and statistical significance was set at a P value less than .05. The study sample was composed of 251 patients with a mean age of 78 years and 62.95% were men. Of these, 68.13% had various preoperative systemic diseases. With regard to flap type, 120 underwent reconstruction with a pectoralis major myocutaneous flap, 5 with a submental island flap, 4 with a submandibular gland flap, 13 with a platysma myocutaneous flap, and 109 with a sternocleidomastoid flap. TNM stage (negative correlation) and smoking (positive correlation) correlated with flap type. There were 48 complications, of which 32 were minor and 16 were major; flap failure was observed in only 1 patient. Risk factors associated with complications were types of pedicle flap, age, heart score, hypertension, diabetes, postoperative hypoproteinemia, and drug-induced liver injury. The pedicle flap is suitable and safe for the reconstruction of defects caused by the ablation of oral and maxillofacial tumors in elderly patients. Preoperative evaluation of positive risk factors, including type of surgery and systemic conditions, is very important for the selection of an appropriate flap for such

  8. A limited number of simian immunodeficiency virus (SIV) env variants are transmitted to rhesus macaques vaginally inoculated with SIVmac251.

    Science.gov (United States)

    Stone, Mars; Keele, Brandon F; Ma, Zhong-Min; Bailes, Elizabeth; Dutra, Joseph; Hahn, Beatrice H; Shaw, George M; Miller, Christopher J

    2010-07-01

    Single-genome amplification (SGA) and sequencing of HIV-1 RNA in plasma of acutely infected humans allows the identification and enumeration of transmitted/founder viruses responsible for productive systemic infection. Use of this strategy as a means for identifying transmitted viruses suggested that intrarectal simian immunodeficiency virus (SIV) inoculation of macaques recapitulates key features of human rectal infection. However, no studies have used the SGA strategy to identify vaginally transmitted virus(es) in macaques or to determine how early SIV diversification in vaginally infected animals compares with HIV-1 in humans. We used SGA to amplify 227 partial env sequences from a SIVmac251 challenge stock and from seven rhesus macaques at the earliest plasma viral RNA-positive time point after low- and high-dose intravaginal inoculation. Sequences were analyzed phylogenetically to determine the relationship of transmitted/founder viruses within and between each animal and the challenge stock. In each animal, discrete low-diversity env sequence lineages were evident, and these coalesced phylogenetically to identical or near-identical env sequences in the challenge stock, thus confirming the validity of the SGA sequencing and modeling strategy for identifying vaginally transmitted SIV. Between 1 and 10 viruses were responsible for systemic infection, similar to humans infected by sexual contact, and the set of viruses transmitted to the seven animals studied represented the full genetic constellation of the challenge stock. These findings recapitulate many of the features of sexual HIV-1 transmission in women. Furthermore, the SIV rhesus macaque model can be used to understand the factors that influence the transmission of single versus multiple SIV variants.

  9. Multiple Independent Loci at Chromosome 15q25.1 Affect Smoking Quantity: a Meta-Analysis and Comparison with Lung Cancer and COPD

    OpenAIRE

    Saccone, Nancy L.; Culverhouse, Robert C.; Schwantes-An, Tae-Hwi; Cannon, Dale S.; Chen, Xiangning; Cichon, Sven; Giegling, Ina; Han, Shizhong; Han, Younghun; Keskitalo-Vuokko, Kaisu; Kong, Xiangyang; Landi, Maria Teresa; Ma, Jennie Z.; Short, Susan E.; Stephens, Sarah H.

    2010-01-01

    Recently, genetic association findings for nicotine dependence, smoking behavior, and smoking-related diseases converged to implicate the chromosome 15q25.1 region, which includes the CHRNA5-CHRNA3-CHRNB4 cholinergic nicotinic receptor subunit genes. In particular, association with the nonsynonymous CHRNA5 SNP rs16969968 and correlates has been replicated in several independent studies. Extensive genotyping of this region has suggested additional statistically distinct signals for nicotine de...

  10. Identifying involvement of Lys251/Asp252 pair in electron transfer and associated proton transfer at the quinone reduction site of Rhodobacter capsulatus cytochrome bc1.

    Science.gov (United States)

    Kuleta, Patryk; Sarewicz, Marcin; Postila, Pekka; Róg, Tomasz; Osyczka, Artur

    2016-10-01

    Describing dynamics of proton transfers in proteins is challenging, but crucial for understanding processes which use them for biological functions. In cytochrome bc1, one of the key enzymes of respiration or photosynthesis, proton transfers engage in oxidation of quinol (QH2) and reduction of quinone (Q) taking place at two distinct catalytic sites. Here we evaluated by site-directed mutagenesis the contribution of Lys251/Asp252 pair (bacterial numbering) in electron transfers and associated with it proton uptake to the quinone reduction site (Qi site). We showed that the absence of protonable group at position 251 or 252 significantly changes the equilibrium levels of electronic reactions including the Qi-site mediated oxidation of heme bH, reverse reduction of heme bH by quinol and heme bH/Qi semiquinone equilibrium. This implicates the role of H-bonding network in binding of quinone/semiquinone and defining thermodynamic properties of Q/SQ/QH2 triad. The Lys251/Asp252 proton path is disabled only when both protonable groups are removed. With just one protonable residue from this pair, the entrance of protons to the catalytic site is sustained, albeit at lower rates, indicating that protons can travel through parallel routes, possibly involving water molecules. This shows that proton paths display engineering tolerance for change as long as all the elements available for functional cooperation secure efficient proton delivery to the catalytic site. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  11. POTENTIAL ANXIOGENIC EFFECTS OF CANNABINOID CB1 RECEPTOR ANTAGONISTS/INVERSE AGONISTS IN RATS: COMPARISONS BETWEEN AM4113, AM251, AND THE BENZODIAZEPINE INVERSE AGONIST FG-7142

    Science.gov (United States)

    Sink, KS; Segovia, KN; Sink, J; Randall, PA; Collins, LE; Correa, M; Markus, EJ; Vemuri, VK; Makriyannis, A; Salamone, JD

    2010-01-01

    Cannabinoid CB1 inverse agonists suppress food-motivated behaviors, but may also induce psychiatric effects such as depression and anxiety. To evaluate behaviors potentially related to anxiety, the present experiments assessed the CB1 inverse agonist AM251 (2.0 – 8.0 mg/kg), the CB1 antagonist AM4113 (3.0 – 12.0 mg/kg), and the benzodiazepine inverse agonist FG-7142 (10.0 – 20.0 mg/kg), using the open field test and the elevated plus maze. Although all three drugs affected open field behavior, these effects were largely due to actions on locomotion. In the elevated plus maze, FG-7142 and AM251 both produced anxiogenic effects. FG-7142 and AM251 also significantly increased c-Fos activity in the amygdala and nucleus accumbens shell. In contrast, AM4113 failed to affect performance in the plus maze, and did not induce c-Fos immunoreactivity. The weak effects of AM4113 are consistent with biochemical data showing that AM4113 induces little or no intrinsic cellular activity. This research may lead to the development of novel appetite suppressants with reduced anxiogenic effects. PMID:20015619

  12. Actinide targets for the synthesis of super-heavy elements

    Energy Technology Data Exchange (ETDEWEB)

    Roberto, J.B., E-mail: robertojb@ornl.gov; Alexander, C.W.; Boll, R.A.; Burns, J.D.; Ezold, J.G.; Felker, L.K.; Hogle, S.L.; Rykaczewski, K.P.

    2015-12-15

    Since 2000, six new super-heavy elements with atomic numbers 113 through 118 have been synthesized in hot fusion reactions of {sup 48}Ca beams on actinide targets. These target materials, including {sup 242}Pu, {sup 244}Pu, {sup 243}Am, {sup 245}Cm, {sup 248}Cm, {sup 249}Cf, and {sup 249}Bk, are available in very limited quantities and require specialized production and processing facilities resident in only a few research centers worldwide. This report describes the production and chemical processing of heavy actinide materials for super-heavy element research, current availabilities of these materials, and related target fabrication techniques. The impact of actinide materials in super-heavy element discovery is reviewed, and strategies for enhancing the production of rare actinides including {sup 249}Bk, {sup 251}Cf, and {sup 254}Es are described.

  13. Characterization of Mycobacterium leprae Genotypes in China--Identification of a New Polymorphism C251T in the 16S rRNA Gene.

    Science.gov (United States)

    Yuan, Youhua; Wen, Yan; You, Yuangang; Xing, Yan; Li, Huanying; Weng, Xiaoman; Wu, Nan; Liu, Shuang; Zhang, Shanshan; Zhang, Wenhong; Zhang, Ying

    2015-01-01

    Leprosy continues to be prevalent in some mountainous regions of China, and genotypes of leprosy strains endemic to the country are not known. Mycobacterium lepromatosis is a new species that was discovered in Mexico in 2008, and it remains unclear whether this species exists in China. Here, we conducted PCR- restriction fragment length polymorphism (RFLP) analysis to classify genotypes of 85 DNA samples collected from patients from 18 different provinces. All 171 DNA samples from skin biopsies of leprosy patients were tested for the presence of Mycobacterium leprae and Mycobacterium lepromatosis by amplifying the 16S rRNA gene using nested PCR, followed by DNA sequencing. The new species M. lepromatosis was not found among the 171 specimens from leprosy patients in 22 provinces in China. However, we found three SNP genotypes among 85 leprosy patients. A mutation at C251T in the 16S rRNA gene was found in 76% of the strains. We also found that the strains that showed the 16S rRNA C251T mutation belonged to SNP type 3, whereas strains without the point mutation belonged to SNP type 1. The SNP type 3 leprosy strains were observed in patients from both the inner and coastal regions of China, but the SNP type 1 strains were focused only in the coastal region. This indicated that the SNP type 3 leprosy strains were more prevalent than the SNP type 1 strains in China. In addition, the 16S rRNA gene sequence mutation at C251T also indicated a difference in the geographical distribution of the strains. To our knowledge, this is the first report of a new polymorphism in 16S rRNA gene in M. leprae in China. Our findings shed light on the prevalent genotypes and provide insight about leprosy transmission that are important for leprosy control in China.

  14. Spectroscopic and structural elucidation of merocyanine dye 2,5-[1-metyl-4-[2-(4-hydroxyphenyl)ethenyl)]piridinium]-hexane tetraphenylborate. Aggregation processes

    Science.gov (United States)

    Koleva, Bojidarka B.; Stoyanov, Stanimir; Kolev, Tsonko; Petkov, Ivan; Spiteller, Michael

    2008-12-01

    Structural and spectroscopic elucidation of merocyanine dye, 2,5-[1-metyl-4-[2-(4-hydroxyphenyl)ethenyl)]piridinium]-hexane tetraphenylborate, is performed in gas and condense phase by means of solution and solid-state conventional and linear-polarized IR-spectroscopy of oriented colloids in nematic liquid crystal suspension, UV-vis and fluorescence methods, HPLC MS/MS tandem and ESI mass spectrometry, 1H, 13C and 1H- 1H COSY NMR, TGV and DSC methods. Quantum chemical DFT calculations are performed for structural optimization and spectroscopic properties prediction.

  15. Low autocrine interferon beta production as a gene therapy approach for AIDS: Infusion of interferon beta-engineered lymphocytes in macaques chronically infected with SIVmac251

    Directory of Open Access Journals (Sweden)

    Dormont Dominique

    2004-09-01

    Full Text Available Abstract Background The aim of this study was to evaluate gene therapy for AIDS based on the transduction of circulating lymphocytes with a retroviral vector giving low levels of constitutive macaque interferon β production in macaques chronically infected with a pathogenic isolate of SIVmac251. Results Two groups of three animals infected for more than one year with a pathogenic primary isolate of SIVmac251 were included in this study. The macaques received three infusions of their own lymphocytes transduced ex vivo with the construct encoding macaque IFN-β (MaIFN-β or with a vector carrying a version of the MaIFN-β gene with a deletion preventing translation of the mRNA. Cellular or plasma viremia increased transiently following injection in most cases, regardless of the retroviral construct used. Transduced cells were detected only transiently after each infusion, among the peripheral blood mononuclear cells of all the animals, with copy numbers of 10 to 1000 per 106 peripheral mononuclear cells. Conclusion Long-term follow-up indicated that the transitory presence of such a small number of cells producing such small amounts of MaIFN-β did not prevent animals from the progressive decrease in CD4+ cell count typical of infection with simian immunodeficiency virus. These results reveal potential pitfalls for future developments of gene therapy strategies of HIV infection.

  16. Serial Cervicovaginal exposures with Replication-deficient SIVsm induce higher Dendritic Cell (pDC) and CD4+ T-Cell Infiltrates not associated with prevention but a More Severe SIVmac251 Infection of Rhesus Macaques

    Science.gov (United States)

    ABDULHAQQ, Shaheed A.; MARTINEZ, Melween I.; KANG, Guobin; FOULKES, Andrea S.; RODRIGUEZ, Idia V.; NICHOLS, Stephanie M.; HUNTER, Meredith; SARIOL, Carlos A.; RUIZ, Lynnette A.; ROSS, Brian N.; YIN, Xiangfan; SPEICHER, David W.; HAASE, Ashley T.; MARX, Preston A.; LI, Qinsheng; KRAISELBURD, Edmundo N.; MONTANER, Luis J.

    2014-01-01

    Objective Intravaginal exposure to SIV acutely recruits IFN-α producing plasmacytoid dendritic cells (pDC) and CD4+ T-lymphocyte targets to the endocervix of nonhuman primates. We tested the impact of repeated cervicovaginal exposures to noninfectious, defective SIV particles over 72 hrs on a subsequent cervicovaginal challenge with replication-competent SIV. Methods 34 Female Indian Rhesus macaques were given a three-day, twice-daily vaginal exposures to either SIVsmB7, a replication-deficient derivative of SIVsmH3 produced by a CEMX174 cell clone (n=16), or to CEM supernatant controls (n=18). On the fourth day, animals were either euthanized to assess cervicovaginal immune cell infiltration or intravaginally challenged with SIVmac251. Challenged animals were tracked for plasma viral load and CD4 counts and euthanized at 42 days post infection. Results At the time of challenge, macaques exposed to SIVsmB7, had higher levels of cervical CD123 pDCs (p=0.032) and CD4+ T-Cells (p=0.036) than those exposed to CEM control. Vaginal tissues showed a significant increase in CD4+ T-Cell infiltrates (p=0.048), and a trend towards increased CD68+ cellular infiltrates. After challenge, 12 SIVsmB7-treated macaques showed 2.5-fold greater daily rate of CD4 decline (p=0.0408), and viral load rise (p=0.0036) as compared to 12 control animals. Conclusions Repeated non-productive exposure to viral particles within a short daily timeframe did not protect against infection in spite of pDC recruitment, resulting instead in an accelerated CD4+ T-Cell loss with an increased rate of viral replication PMID:24226059

  17. MEET ISOLDE - Target Production

    CERN Multimedia

    2017-01-01

    MEET ISOLDE - Target Production. Everything at ISOLDE starts with a target and the target production team realise on more then 50 years of experience to build and develop new targets for ISOLDE’s wide physics program.

  18. Common alleles at 6q25.1 and 1p11.2 are associated with breast cancer risk for BRCA1 and BRCA2 mutation carriers

    Science.gov (United States)

    Antoniou, Antonis C; Kartsonaki, Christiana; Sinilnikova, Olga M.; Soucy, Penny; McGuffog, Lesley; Healey, Sue; Lee, Andrew; Peterlongo, Paolo; Manoukian, Siranoush; Peissel, Bernard; Zaffaroni, Daniela; Cattaneo, Elisa; Barile, Monica; Pensotti, Valeria; Pasini, Barbara; Dolcetti, Riccardo; Giannini, Giuseppe; Laura Putignano, Anna; Varesco, Liliana; Radice, Paolo; Mai, Phuong L.; Greene, Mark H.; Andrulis, Irene L.; Glendon, Gord; Ozcelik, Hilmi; Thomassen, Mads; Gerdes, Anne-Marie; Kruse, Torben A.; Birk Jensen, Uffe; Crüger, Dorthe G.; Caligo, Maria A.; Laitman, Yael; Milgrom, Roni; Kaufman, Bella; Paluch-Shimon, Shani; Friedman, Eitan; Loman, Niklas; Harbst, Katja; Lindblom, Annika; Arver, Brita; Ehrencrona, Hans; Melin, Beatrice; Nathanson, Katherine L.; Domchek, Susan M.; Rebbeck, Timothy; Jakubowska, Ania; Lubinski, Jan; Gronwald, Jacek; Huzarski, Tomasz; Byrski, Tomasz; Cybulski, Cezary; Gorski, Bohdan; Osorio, Ana; Ramón y Cajal, Teresa; Fostira, Florentia; Andrés, Raquel; Benitez, Javier; Hamann, Ute; Hogervorst, Frans B.; Rookus, Matti A.; Hooning, Maartje J.; Nelen, Marcel R.; van der Luijt, Rob B.; van Os, Theo A.M.; van Asperen, Christi J.; Devilee, Peter; Meijers-Heijboer, Hanne E.J.; Gómez Garcia, Encarna B.; Peock, Susan; Cook, Margaret; Frost, Debra; Platte, Radka; Leyland, Jean; Gareth Evans, D.; Lalloo, Fiona; Eeles, Ros; Izatt, Louise; Adlard, Julian; Davidson, Rosemarie; Eccles, Diana; Ong, Kai-ren; Cook, Jackie; Douglas, Fiona; Paterson, Joan; John Kennedy, M.; Miedzybrodzka, Zosia; Godwin, Andrew; Stoppa-Lyonnet, Dominique; Buecher, Bruno; Belotti, Muriel; Tirapo, Carole; Mazoyer, Sylvie; Barjhoux, Laure; Lasset, Christine; Leroux, Dominique; Faivre, Laurence; Bronner, Myriam; Prieur, Fabienne; Nogues, Catherine; Rouleau, Etienne; Pujol, Pascal; Coupier, Isabelle; Frénay, Marc; Hopper, John L.; Daly, Mary B.; Terry, Mary B.; John, Esther M.; Buys, Saundra S.; Yassin, Yosuf; Miron, Alexander; Goldgar, David; Singer, Christian F.; Tea, Muy-Kheng; Pfeiler, Georg; Catharina Dressler, Anne; Hansen, Thomas v.O.; Jønson, Lars; Ejlertsen, Bent; Bjork Barkardottir, Rosa; Kirchhoff, Tomas; Offit, Kenneth; Piedmonte, Marion; Rodriguez, Gustavo; Small, Laurie; Boggess, John; Blank, Stephanie; Basil, Jack; Azodi, Masoud; Ewart Toland, Amanda; Montagna, Marco; Tognazzo, Silvia; Agata, Simona; Imyanitov, Evgeny; Janavicius, Ramunas; Lazaro, Conxi; Blanco, Ignacio; Pharoah, Paul D.P.; Sucheston, Lara; Karlan, Beth Y.; Walsh, Christine S.; Olah, Edith; Bozsik, Aniko; Teo, Soo-Hwang; Seldon, Joyce L.; Beattie, Mary S.; van Rensburg, Elizabeth J.; Sluiter, Michelle D.; Diez, Orland; Schmutzler, Rita K.; Wappenschmidt, Barbara; Engel, Christoph; Meindl, Alfons; Ruehl, Ina; Varon-Mateeva, Raymonda; Kast, Karin; Deissler, Helmut; Niederacher, Dieter; Arnold, Norbert; Gadzicki, Dorothea; Schönbuchner, Ines; Caldes, Trinidad; de la Hoya, Miguel; Nevanlinna, Heli; Aittomäki, Kristiina; Dumont, Martine; Chiquette, Jocelyne; Tischkowitz, Marc; Chen, Xiaoqing; Beesley, Jonathan; Spurdle, Amanda B.; Neuhausen, Susan L.; Chun Ding, Yuan; Fredericksen, Zachary; Wang, Xianshu; Pankratz, Vernon S.; Couch, Fergus; Simard, Jacques; Easton, Douglas F.; Chenevix-Trench, Georgia

    2011-01-01

    Two single nucleotide polymorphisms (SNPs) at 6q25.1, near the ESR1 gene, have been implicated in the susceptibility to breast cancer for Asian (rs2046210) and European women (rs9397435). A genome-wide association study in Europeans identified two further breast cancer susceptibility variants: rs11249433 at 1p11.2 and rs999737 in RAD51L1 at 14q24.1. Although previously identified breast cancer susceptibility variants have been shown to be associated with breast cancer risk for BRCA1 and BRCA2 mutation carriers, the involvement of these SNPs to breast cancer susceptibility in mutation carriers is currently unknown. To address this, we genotyped these SNPs in BRCA1 and BRCA2 mutation carriers from 42 studies from the Consortium of Investigators of Modifiers of BRCA1/2. In the analysis of 14 123 BRCA1 and 8053 BRCA2 mutation carriers of European ancestry, the 6q25.1 SNPs (r2 = 0.14) were independently associated with the risk of breast cancer for BRCA1 mutation carriers [hazard ratio (HR) = 1.17, 95% confidence interval (CI): 1.11–1.23, P-trend = 4.5 × 10−9 for rs2046210; HR = 1.28, 95% CI: 1.18–1.40, P-trend = 1.3 × 10−8 for rs9397435], but only rs9397435 was associated with the risk for BRCA2 carriers (HR = 1.14, 95% CI: 1.01–1.28, P-trend = 0.031). SNP rs11249433 (1p11.2) was associated with the risk of breast cancer for BRCA2 mutation carriers (HR = 1.09, 95% CI: 1.02–1.17, P-trend = 0.015), but was not associated with breast cancer risk for BRCA1 mutation carriers (HR = 0.97, 95% CI: 0.92–1.02, P-trend = 0.20). SNP rs999737 (RAD51L1) was not associated with breast cancer risk for either BRCA1 or BRCA2 mutation carriers (P-trend = 0.27 and 0.30, respectively). The identification of SNPs at 6q25.1 associated with breast cancer risk for BRCA1 mutation carriers will lead to a better understanding of the biology of tumour development in these women. PMID:21593217

  19. Chronic Δ(9)-Tetrahydrocannabinol Administration Reduces IgE(+)B Cells but Unlikely Enhances Pathogenic SIVmac251 Infection in Male Rhesus Macaques of Chinese Origin.

    Science.gov (United States)

    Wei, Qiang; Liu, Li; Cong, Zhe; Wu, Xiaoxian; Wang, Hui; Qin, Chuan; Molina, Patricia; Chen, Zhiwei

    2016-09-01

    Delta9-tetrahydrocannabinol (Δ(9)-THC) is the major psychoactive component of the cannabis plant. Δ(9)-THC has been used in the active ingredient of Marinol as an appetite stimulant for AIDS patients. Its impact on progression of HIV-1 infection, however, remains debatable. Previous studies indicated that Δ(9)-THC administration enhanced HIV-1 infection in huPBL-SCID mice but seemingly decreased early mortality in simian immunodeficiency virus (SIV) infected male Indian-derived rhesus macaques. Here, we determine the chronic effect of Δ(9)-THC administration using 0.32 mg/kg or placebo (PBO), i.m., twice daily for 428 days on SIVmac251 infected male Chinese-derived rhesus macaques. Sixteen animals were divided into four study groups: Δ(9)-THC(+)SIV(+), Δ(9)-THC(+)SIV(-), PBO/SIV(+) and PBO/SIV(-) (n = 4/group). One-month after daily Δ(9)-THC or PBO administrations, macaques in groups one and three were challenged intravenously with pathogenic SIVmac251/CNS, which was isolated from the brain of a Chinese macaque with end-staged neuroAIDS. No significant differences in peak and steady state plasma viral loads were seen between Δ(9)-THC(+)SIV(+) and PBO/SIV(+) macaques. Regardless of Δ(9)-THC, all infected macaques displayed significant drop of CD4/CD8 T cell ratio, loss of CD4(+) T cells and higher persistent levels of Ki67(+)CD8(+) T cells compared with uninfected animals. Moreover, long-term Δ(9)-THC treatment reduced significantly the frequency of circulating IgE(+)B cells. Only one Δ(9)-THC(+)SIV(+) macaque died of simian AIDS with paralyzed limbs compared with two deaths in the PBO/SIV(+) group during the study period. These findings indicate that chronic Δ(9)-THC administration resulted in reduction of IgE(+)B cells, yet it unlikely enhanced pathogenic SIVmac251/CNS infection in male Rhesus macaques of Chinese origin.

  20. Chronic Δ9-tetrahydrocannabinol administration reduces IgE+B cells but unlikely enhances pathogenic SIVmac251 infection in male Rhesus macaques of Chinese origin

    Science.gov (United States)

    Wu, Xiaoxian; Wang, Hui; Qin, Chuan; Molina, Patricia; Chen, Zhiwei

    2016-01-01

    Delta9-tetrahydrocannabinol (Δ9-THC) is the major psychoactive component of the cannabis plant. Δ9-THC has been used in the active ingredient of Marinol as an appetite stimulant for AIDS patients. Its impact on progression of HIV-1 infection, however, remains debatable. Previous studies indicated that Δ9-THC administration enhanced HIV-1 infection in huPBL-SCID mice but seemingly decreased early mortality in simian immunodeficiency virus (SIV) infected male Indian-derived rhesus macaques. Here, we determine the chronic effect of Δ9-THC administration (0.32mg/kg or placebo-PBO, i.m., twice daily for 428 days) on SIVmac251 infected male Chinese-derived rhesus macaques. Sixteen animals were divided into four study groups: Δ9-THC+SIV+, Δ9-THC+SIV−, placebo (PBO)/SIV+ and PBO/SIV− (n=4/group). One-month after daily Δ9-THC or PBO administrations, macaques in groups one and three were challenged intravenously with pathogenic SIVmac251/CNS, which was isolated from the brain of a Chinese macaque with end-staged neuroAIDS. No significant differences in peak and steady state plasma viral loads were seen between Δ9-THC and PBO infected macaques. Regardless of Δ9-THC, all infected macaques displayed significant drop of CD4/CD8 T cell ratio, loss of CD4+ T cells and higher persistent levels of Ki67+CD8+ T cells when compared to uninfected animals. Moreover, long-term Δ9-THC treatment reduced significantly the frequency of circulating IgE+B cells. Only one infected macaque in the Δ9-THC+SIV+ group died of simian AIDS with paralyzed limbs as compared with two deaths in the PBO/SIV+ group during the study period. These findings indicate that chronic Δ9-THC administration resulted in reduction of IgE+B cells, yet it unlikely enhanced pathogenic SIVmac251/CNS infection in male Rhesus macaques of Chinese origin. PMID:27109234

  1. Targeting effect of microRNA on CD133 and its impact analysis on proliferation and invasion of glioma cells.

    Science.gov (United States)

    Zhao, C; Ma, Z G; Mou, S L; Yang, Y X; Zhang, Y H; Yao, W C

    2017-03-30

    MiR-200b, a member of the microRNA-200 family, has been identified to be capable of suppressing glioma cell growth through targeting CREB1 or CD133. However, whether miR-200b affects the biological behavior (proliferation, invasion, and migration) of glioma cells is poorly understood. The aim of this study was to evaluate the effect of miR-200b on the biological behavior of glioma cells in vitro. MiRNA-200b mimics, miRNA-200b inhibitor, and mimic control were transfected into conventionally cultured glioma U251 cells, followed by measuring the expression of miR-200b and CD133 in transfected cells by RT-PCR; effect of miR-200b on CD133 mRNA 3'-UTR luciferase activity by luciferase reporter assay; proliferation activity of transfected U251 cells by MTT method; and changes in U251 cell invasion and migration by Transwell method after transfection. Compared to that in the miRNA-200b inhibitor, mimic control, and blank control groups, miRNA-200b expression was significantly increased and CD133 mRNA expression was significantly decreased in the mimic miRNA-200b group in a time-dependent manner (P glioma cells possibly through targeting CD133.

  2. Common alleles at 6q25.1 and 1p11.2 are associated with breast cancer risk for BRCA1 and BRCA2 mutation carriers

    DEFF Research Database (Denmark)

    Antoniou, Antonis C; Kartsonaki, Christiana; Sinilnikova, Olga M

    2011-01-01

    11249433 at 1p11.2 and rs999737 in RAD51L1 at 14q24.1. Although previously identified breast cancer susceptibility variants have been shown to be associated with breast cancer risk for BRCA1 and BRCA2 mutation carriers, the involvement of these SNPs to breast cancer susceptibility in mutation carriers......% CI: 0.92-1.02, P-trend = 0.20). SNP rs999737 (RAD51L1) was not associated with breast cancer risk for either BRCA1 or BRCA2 mutation carriers (P-trend = 0.27 and 0.30, respectively). The identification of SNPs at 6q25.1 associated with breast cancer risk for BRCA1 mutation carriers will lead...

  3. Noradrenaline increases intracellular glutathione in human astrocytoma U-251 MG cells by inducing glutamate-cysteine ligase protein via β3-adrenoceptor stimulation.

    Science.gov (United States)

    Yoshioka, Yasuhiro; Kadoi, Hisatsugu; Yamamuro, Akiko; Ishimaru, Yuki; Maeda, Sadaaki

    2016-02-05

    Glutathione (GSH) plays a critical role in protecting cells from oxidative damage. Since neurons rely on the supply of GSH from astrocytes to maintain optimal intracellular GSH concentrations, the GSH concentration of astrocytes is important for the survival of neighboring neurons against oxidative stress. The neurotransmitter noradrenaline is known to modulate the functions of astrocytes and has been suggested to have neuroprotective properties in neurodegenerative diseases. To elucidate the mechanisms underlying the neuroprotective properties of noradrenaline, in this study, we investigated the effect of noradrenaline on the concentrations of intracellular GSH in human U-251 malignant glioma (MG; astrocytoma) cells. Treatment of the cells with noradrenaline for 24h concentration-dependently increased their intracellular GSH concentration. This increase was inhibited by a non-selective β-adrenoceptor antagonist propranolol and by a selective β3-adrenoceptor antagonist SR59230A, but not by a non-selective α-adrenoceptor antagonist phenoxybenzamine, or by a selective β1-adrenoceptor antagonist atenolol or by a selective β2-adrenoceptor antagonist butoxamine. In addition, the selective β3-adrenoceptor agonist CL316243 increased the intracellular GSH in U-251 MG cells. Treatment of the cells with noradrenaline (10μM) for 24h increased the protein level of the catalytic subunit of glutamate-cysteine ligase (GCLc), the rate-limiting enzyme of GSH synthesis; and this increase was inhibited by SR59230A. These results thus suggest that noradrenaline increased the GSH concentration in astrocytes by inducing GCLc protein in them via β3-adrenoceptor stimulation. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Racial differences in the association between SNPs on 15q25.1, smoking behavior, and risk of non-small cell lung cancer.

    Science.gov (United States)

    Schwartz, Ann G; Cote, Michele L; Wenzlaff, Angela S; Land, Susan; Amos, Christopher I

    2009-10-01

    Three genome-wide association studies identified a region on chromosome 15q25.1 associated with lung cancer and measures of nicotine addiction. This region includes nicotinic acetylcholine receptor subunit genes CHRNA3 and CHRNA5. These studies were conducted in European or European American populations and do not provide risk estimates for African Americans. The goal of this study was to determine whether recently identified genetic variation in 3 SNPs (rs1051730, rs931794, rs8034191) on chromosome 15q25.1 contributes to risk of lung cancer in African Americans. Data were derived from three case-control studies. Participants included 1058 population-based non-small cell lung cancer cases selected from the Detroit area SEER registry and 1314 controls matched within study by age, race, and sex. Thirty-nine percent of participants were African American. Risk associated with rs1051730 (odds ratio 1.59; 95% confidence interval 1.16-2.19) and rs931794 (odds ratio 1.39; 95% confidence interval 1.09-1.78) increased in ever smoking African Americans adjusting for cigarettes smoked per day. Among white cases, the number of cigarettes smoked varied by genotype at all three SNPs, and when smoking quantity was included in the models, risk was not significantly associated with any of the three SNPs. These findings suggest that SNPs in the CHRNA3 and CHRNA5 region contribute to lung cancer risk, and while variant alleles are less frequent in African Americans, risk in this group may be greater than in whites and less likely to reflect an indirect effect on lung cancer risk through nicotine dependence.

  5. Prevention of drug priming- and cue-induced reinstatement of MDMA-seeking behaviors by the CB1 cannabinoid receptor antagonist AM251.

    Science.gov (United States)

    Nawata, Yoko; Kitaichi, Kiyoyuki; Yamamoto, Tsuneyuki

    2016-03-01

    3,4-Methylenedioxymethamphetamine (MDMA), a methamphetamine (METH) derivative, exhibits METH-like actions at monoamine transporters and positive reinforcing effects in rodents and primates. The purposes of the present study were to determine whether cross-reinstatement would be observed between MDMA and METH and if the cannabinoid receptor, a receptor known to play critical roles in the brain reward system, could modulate MDMA craving. Rats were trained to press a lever for intravenous MDMA (0.3mg/infusion) or METH (0.02mg/infusion) infusions under a fixed ratio 1 schedule paired with drug-associated cues (light and tone). Following drug self-administration acquisition training, rats underwent extinction training (an infusion of saline). Reinstatement tests were performed once the extinction criteria were achieved. In MDMA-trained rats, the MDMA-priming injection (3.2mg/kg, i.p.) or re-exposure to MDMA-associated cues reinstated MDMA-seeking behavior. Additionally, a priming injection of METH (1.0mg/kg, i.p.) also reinstated MDMA-seeking behavior. In contrast, none of the MDMA doses reinstated METH-seeking behavior in the METH-trained rats. The CB1 cannabinoid receptor antagonist AM251 markedly attenuated the MDMA-seeking behaviors induced by MDMA-priming injection or re-exposure to MDMA-associated cues in a dose-dependent manner. These findings show that MDMA has obvious addictive potential for reinstating drug-seeking behavior and that METH can be an effective stimulus for reinstating MDMA-seeking behaviors. Furthermore, based on the attenuating effect of AM251 in the reinstatement of MDMA-seeking behaviors, drugs that suppress CB1 receptors may be used in treatment of MDMA dependence. Copyright © 2016. Published by Elsevier Ireland Ltd.

  6. Radiobiological response of U251MG, CHO-K1 and V79 cell lines to accelerator-based boron neutron capture therapy.

    Science.gov (United States)

    Sato, Eisuke; Zaboronok, Alexander; Yamamoto, Tetsuya; Nakai, Kei; Taskaev, Sergey; Volkova, Olga; Mechetina, Ludmila; Taranin, Alexander; Kanygin, Vladimir; Isobe, Tomonori; Mathis, Bryan J; Matsumura, Akira

    2017-12-21

    In the current article, we provide in vitro efficacy evaluation of a unique accelerator-based neutron source, constructed at the Budker Institute of Nuclear Physics (Novosibirsk, Russian Federation), for boron neutron capture therapy (BNCT), which is particularly effective in the case of invasive cancers. U251MG, CHO-K1 and V79 cells were incubated and irradiated in various concentrations of boric acid with epithermal neutrons for 2-3 h in a plexiglass phantom, using 2.0 MeV proton energy and 1.5-3.0 mA proton current, resulting in a neutron fluence of 2.16 × 1012 cm-2. The survival curves of cells loaded with boron were normalized to those irradiated without boron (to exclude the influence of the fast neutron and gamma dose components) and fit to the linear-quadratic (LQ) model. Colony formation assays showed the following cell survival rates (means ± SDs): CHO-K1: 0.348 ± 0.069 (10 ppm), 0.058 ± 0.017 (20 ppm), 0.018 ± 0.005 (40 ppm); V79: 0.476 ± 0.160 (10 ppm), 0.346 ± 0.053 (20 ppm), 0.078 ± 0.015 (40 ppm); and U251MG: 0.311 ± 0.061 (10 ppm), 0.131 ± 0.022 (20 ppm), 0.020 ± 0.010 (40 ppm). The difference between treated cells and controls was significant in all cases (P BNCT into the clinical phase. © The Author(s) 2017. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.

  7. MiR-18a regulates the proliferation, migration and invasion of human glioblastoma cell by targeting neogenin

    Energy Technology Data Exchange (ETDEWEB)

    Song, Yichen, E-mail: jeff200064017@163.com [Department of Neurosurgery, Shengjing Hospital of China Medical University, Shenyang 110004 (China); Wang, Ping, E-mail: pingwang8000@163.com [Department of Neurobiology, College of Basic Medicine, China Medical University, Shenyang 110001 (China); Institute of Pathology and Pathophysiology, China Medical University, Shenyang 110001 (China); Zhao, Wei, E-mail: 15669746@qq.com [Department of Neurobiology, College of Basic Medicine, China Medical University, Shenyang 110001 (China); Institute of Pathology and Pathophysiology, China Medical University, Shenyang 110001 (China); Yao, Yilong, E-mail: yaoyilong_322@163.com [Department of Neurosurgery, Shengjing Hospital of China Medical University, Shenyang 110004 (China); Liu, Xiaobai, E-mail: paganizonda1991@qq.com [The 96th Class, 7-year Program, China Medical University, Shenyang, Liaoning Province 110001 (China); Ma, Jun, E-mail: majun_724@163.com [Department of Neurobiology, College of Basic Medicine, China Medical University, Shenyang 110001 (China); Institute of Pathology and Pathophysiology, China Medical University, Shenyang 110001 (China); Xue, Yixue, E-mail: xueyixue888@163.com [Department of Neurobiology, College of Basic Medicine, China Medical University, Shenyang 110001 (China); Institute of Pathology and Pathophysiology, China Medical University, Shenyang 110001 (China); Liu, Yunhui, E-mail: liuyh@sj-hospital.org [Department of Neurosurgery, Shengjing Hospital of China Medical University, Shenyang 110004 (China)

    2014-05-15

    MiR-17-92 cluster has recently been reported as an oncogene in some tumors. However, the association of miR-18a, an important member of this cluster, with glioblastoma remains unknown. Therefore, this study aims to investigate the expression of miR-18a in glioblastoma and its role in biological behavior of U87 and U251 human glioblastoma cell lines. Quantitative RT-PCR results showed that miR-18a was highly expressed in glioblastoma tissues and U87 and U251 cell lines compared with that in human brain tissues and primary normal human astrocytes, and the expression levels were increased along with the rising pathological grades of glioblastoma. Neogenin was identified as the target gene of miR-18a by dual-luciferase reporter assays. RT-PCR and western blot results showed that its expression levels were decreased along with the rising pathological grades of glioblastoma. Inhibition of miR-18a expression was established by transfecting exogenous miR-18a inhibitor into U87 and U251 cells, and its effects on the biological behavior of glioblastoma cells were studied using CCK-8 assay, transwell assay and flow cytometry. Inhibition of miR-18a expression in U87 and U251 cells significantly up-regulated neogenin, and dramatically suppressed the abilities of cell proliferation, migration and invasion, induced cell cycle arrest and promoted cellular apoptosis. Collectively, these results suggest that miR-18a may regulate biological behavior of human glioblastoma cells by targeting neogenin, and miR-18a can serve as a potential target in the treatment of glioblastoma. - Highlights: • MiR-18a was highly expressed in glioblastoma tissues and U87 and U251 cell lines. • Neogenin was identified as the target gene of miR-18a. • Neogenin expressions were decreased along with the rising pathological grades of glioblastoma. • Inhibition of miR-18a suppressed biological behavior of glioma cells by up-regulating neogenin.

  8. Extreme event archived in the geological record of the Japan Trench: New results from R/V Sonne Cruise SO-251 towards establishing J-TRACK paleoseismology

    Science.gov (United States)

    Strasser, Michael; Kopf, Achim; Kanamatsu, Toshyia; Moernaut, Jasper; Ikehara, Ken; McHugh, Cecila

    2017-04-01

    Our perspective of subduction zonés earthquake magnitude and recurrence is limited by short historical records. Examining prehistoric extreme events preserved in the geological record is essential towards understanding large earthquakes and assessing the geohazard potential associated with such rare events. The research field of "subaquatic paleoseismology" is a promising approach to investigate deposits from the deep sea, where earthquakes leave traces preserved in stratigraphic succession. However, at present we lack comprehensive data set that allow conclusive distinctions between quality and completeness of the paleoseismic archives as they may relate to different sediment transport, erosion and deposition processes vs. variability of intrinsic seismogenic behavior across different segments. Initially building on what sedimentary deposits were generated from the 2011 Magnitude 9 Tohoku-oki earthquake, the Japan Trench is a promising study area to investigate earthquake-triggered sediment remobilization processes and how they become embedded in the stratigraphic record. Here we present new results from the recent R/V Sonne expedition SO251 that acquired a complete high-resolution bathymetric map of the trench axis and nearly 2000 km of subbottom Parasound profiles, covering the entire along-strike extent of the Japan Trench from 36° to 40.3° N, and groundtruthed by several nearly 10m long piston cores retrieved from the very deep waters (7 to 8 km below sea level): Several smaller submarine landslide (up to several 100's m of lateral extent) can be identified along the trench axis in the new bathymetric data set. These features were either not yet present, or not resolved in the lower-resolution bathymetric dataset acquired before 2011. Sub-bottom acoustic reflection data reveals striking, up to several meter thick, acoustically transparent bodies interbedded in the otherwise parallel reflection pattern of the trench fill basins, providing a temporal and

  9. Replication and functional genomic analyses of the breast cancer susceptibility locus at 6q25.1 generalize its importance in women of chinese, Japanese, and European ancestry.

    Science.gov (United States)

    Cai, Qiuyin; Wen, Wanqing; Qu, Shimian; Li, Guoliang; Egan, Kathleen M; Chen, Kexin; Deming, Sandra L; Shen, Hongbing; Shen, Chen-Yang; Gammon, Marilie D; Blot, William J; Matsuo, Keitaro; Haiman, Christopher A; Khoo, Ui Soon; Iwasaki, Motoki; Santella, Regina M; Zhang, Lina; Fair, Alecia Malin; Hu, Zhibin; Wu, Pei-Ei; Signorello, Lisa B; Titus-Ernstoff, Linda; Tajima, Kazuo; Henderson, Brian E; Chan, Kelvin Y K; Kasuga, Yoshio; Newcomb, Polly A; Zheng, Hong; Cui, Yong; Wang, Furu; Shieh, Ya-Lan; Iwata, Hiroji; Le Marchand, Loic; Chan, Sum Yin; Shrubsole, Martha J; Trentham-Dietz, Amy; Tsugane, Shoichiro; Garcia-Closas, Montserrat; Long, Jirong; Li, Chun; Shi, Jiajun; Huang, Bo; Xiang, Yong-Bing; Gao, Yu-Tang; Lu, Wei; Shu, Xiao-Ou; Zheng, Wei

    2011-02-15

    We evaluated the generalizability of a single nucleotide polymorphism (SNP), rs2046210 (A/G allele), associated with breast cancer risk that was initially identified at 6q25.1 in a genome-wide association study conducted among Chinese women. In a pooled analysis of more than 31,000 women of East-Asian, European, and African ancestry, we found a positive association for rs2046210 and breast cancer risk in Chinese women [ORs (95% CI) = 1.30 (1.22-1.38) and 1.64 (1.50-1.80) for the AG and AA genotypes, respectively, P for trend = 1.54 × 10⁻³⁰], Japanese women [ORs (95% CI) = 1.31 (1.13-1.52) and 1.37 (1.06-1.76), P for trend = 2.51 × 10⁻⁴], and European-ancestry American women [ORs (95% CI) = 1.07 (0.99-1.16) and 1.18 (1.04-1.34), P for trend = 0.0069]. No association with this SNP, however, was observed in African American women [ORs (95% CI) = 0.81 (0.63-1.06) and 0.85 (0.65-1.11) for the AG and AA genotypes, respectively, P for trend = 0.4027]. In vitro functional genomic studies identified a putative functional variant, rs6913578. This SNP is 1,440 bp downstream of rs2046210 and is in high linkage disequilibrium with rs2046210 in Chinese (r(2) = 0.91) and European-ancestry (r² = 0.83) populations, but not in Africans (r² = 0.57). SNP rs6913578 was found to be associated with breast cancer risk in Chinese and European-ancestry American women. After adjusting for rs2046210, the association of rs6913578 with breast cancer risk in African Americans approached borderline significance. Results from this large consortium study confirmed the association of rs2046210 with breast cancer risk among women of Chinese, Japanese, and European ancestry. This association may be explained in part by a putatively functional variant (rs6913578) identified in the region. ©2011 AACR.

  10. Dysport and Botox at a ratio of 2.5:1 units in cervical dystonia: a double-blind, randomized study.

    Science.gov (United States)

    Yun, Ji Young; Kim, Jae Woo; Kim, Hee-Tae; Chung, Sun Ju; Kim, Jong-Min; Cho, Jin Whan; Lee, Jee-Young; Lee, Ha Neul; You, Sooyeoun; Oh, Eungseok; Jeong, Heejeong; Kim, Young Eun; Kim, Han-Joon; Lee, Won Yong; Jeon, Beom S

    2015-02-01

    We aimed to compare Dysport (abobotulinumtoxinA, Ipsen Biopharm, Slough, UK) and Botox (onabotulinumtoxinA, Allergan, Irvine, CA, USA) at a 2.5:1 ratio in the treatment of cervical dystonia (CD). A Dysport/Botox ratio of lower than 3:1 was suggested as a more appropriate conversion ratio, considering its higher efficacy and more frequent incidence of adverse effects not only in the treatment of CD but also in other focal movement disorders. A randomized, double-blind, multicenter, non-inferiority, two-period crossover study was done in CD, with a duration of at least 18 months. Patients were randomly assigned to treatment for the first period with Dysport or Botox, and they were followed up for 16 weeks after the injection. After a 4-week washout period, they were switched to the other formulation and then followed up for 16 weeks. The primary outcome was the changes in the Tsui scale between the baseline value and that at 1 month after each injection. A total of 103 patients were enrolled, and 94 completed the study. Mean changes in the Tsui scale between baseline and 4 weeks after each injection tended to favor Botox; however, this was not statistically significant (4.0 ± 3.9 points for the Dysport treatment vs. 4.8 ± 4.1 points for Botox; 95% confidence interval, -0.1-1.7; P = 0.091). The mean change of the Toronto western spasmodic torticollis rating scale score, the proportion of improvement in clinical global impression and patient global impression, and the incidences of adverse events were not significantly different between the two treatments. With regard to safety and efficacy, Dysport was not inferior to Botox in patients with CD at a conversion factor of 2.5:1. [clinicaltrial.gov: NCT00950664] © The Authors. Movement Disorders published by Wiley Periodicals, Inc. on behalf of International Parkinson and Movement Disorder Society.

  11. Low dose rectal inoculation of rhesus macaques by SIV SME660 or SIV MAC251 recapitulates human mucosal infection by HIV-1

    Energy Technology Data Exchange (ETDEWEB)

    Koraber, Bette [Los Alamos National Laboratory; Perelson, Alan [Los Alamos National Laboratory; Hraber, Peter [Los Alamos National Laboratory; Giorgi, E [Los Alamos National Laboratory; Bhattacharya, T [Los Alamos National Laboratory

    2009-01-01

    Recently, we developed a novel approach to the identification of transmitted or early founder HIV -1 genomes in acutely infected humans based on single genome amplification and sequencing. Here we tested this approach in 18 acutely infected Indian rhesus macaques to determine the molecular features of SIV transmission. Animals were inoculated intrarectally (IR) or intravenously (IV) with stocks of SIVmac251 or SIVsmE660 that exhibited sequence diversity typical of early-chronic HIV -1 infection. 987 full-length SIV env sequences (median of 48 per animal) were determined from plasma virion RNA one to five weeks after infection. IR inoculation was followed by productive infection by one or few viruses (median 1; range 1-5) that diversified randomly with near star-like phylogeny and a Poisson distribution of mutations. Consensus viral sequences from ramp-up and peak viremia were identical to viruses found in the inocula or differed from them by only one or few nuc1eotides, providing direct evidence that early plasma viral sequences coalesce to transmitted/founder virus( es). IV infection was approximately 10,000-fold more efficient than IR infection, and viruses transmitted by either route represented the full genetic spectra of the inocula. These findings identify key similarities in mucosal transmission and early diversification between SIV and HIV -1.

  12. Low-dose rectal inoculation of rhesus macaques by SIVsmE660 or SIVmac251 recapitulates human mucosal infection by HIV-1.

    Science.gov (United States)

    Keele, Brandon F; Li, Hui; Learn, Gerald H; Hraber, Peter; Giorgi, Elena E; Grayson, Truman; Sun, Chuanxi; Chen, Yalu; Yeh, Wendy W; Letvin, Norman L; Mascola, John R; Nabel, Gary J; Haynes, Barton F; Bhattacharya, Tanmoy; Perelson, Alan S; Korber, Bette T; Hahn, Beatrice H; Shaw, George M

    2009-05-11

    We recently developed a novel strategy to identify transmitted HIV-1 genomes in acutely infected humans using single-genome amplification and a model of random virus evolution. Here, we used this approach to determine the molecular features of simian immunodeficiency virus (SIV) transmission in 18 experimentally infected Indian rhesus macaques. Animals were inoculated intrarectally (i.r.) or intravenously (i.v.) with stocks of SIVmac251 or SIVsmE660 that exhibited sequence diversity typical of early-chronic HIV-1 infection. 987 full-length SIV env sequences (median of 48 per animal) were determined from plasma virion RNA 1-5 wk after infection. i.r. inoculation was followed by productive infection by one or a few viruses (median 1; range 1-5) that diversified randomly with near starlike phylogeny and a Poisson distribution of mutations. Consensus viral sequences from ramp-up and peak viremia were identical to viruses found in the inocula or differed from them by only one or a few nucleotides, providing direct evidence that early plasma viral sequences coalesce to transmitted/founder viruses. i.v. infection was >2,000-fold more efficient than i.r. infection, and viruses transmitted by either route represented the full genetic spectra of the inocula. These findings identify key similarities in mucosal transmission and early diversification between SIV and HIV-1, and thus validate the SIV-macaque mucosal infection model for HIV-1 vaccine and microbicide research.

  13. Comment on “Iron isotope fractionation during planetary differentiation” by S. Weyer et al., Earth Planet. Sci. Lett. V240, pages 251 264

    Science.gov (United States)

    Beard, Brian L.; Johnson, Clark M.

    2007-04-01

    A review of published Fe isotope compositions measured for mantle xenoliths and massif-type peridotites demonstrates that the Fe isotope composition of the "mantle" is highly heterogeneous as compared to the narrow Fe isotope range measured for basaltic rocks. The greatest isotopic heterogeneity exists for samples derived from the lithospheric mantle, whereas basalts largely record the isotopic compositions of the asthenospheric mantle. These published Fe isotope data show that the variability measured in mantle samples is too large to be used to accurately determine a planetary Fe isotope composition, and, contrary to the assertions of Weyer et al. [S. Weyer, A. Anbar, G. Brey, C. Münker, K. Mezger, A. Woodland, Iron isotope fractionation during planetary differentiation. Earth Planet. Sci. Lett. 240 (2005) 251-264], there is no evidence that the bulk terrestrial mantle has a different Fe isotope composition relative to terrestrial basaltic magmas. We contend that similar rock types must be compared (i.e., basalt-basalt) when considering possible inter-planetary Fe isotope differences.

  14. Functionalized magnetic nanochains with enhanced MR imaging: A novel nanosystem for targeting and inhibition of early glioma.

    Science.gov (United States)

    Zhang, Yi; Huang, Zhongbing; Wu, Zhi; Yin, Guangfu; Wang, Lei; Gao, Fabao

    2016-04-01

    Absence of efficient targeting limits the application of magnetic nanochains (NCs) in the diagnosis of early brain cancer. Herein, dextran-coated NCs (more than 100 nm length and ∼ 10 nm cores diameter), which were modified by cyclic pentapeptide c(RGDyC) or chlorotoxin (CTX) as the targeting molecules, were fabricated via carbodiimide chemistry and thiol technique. The analysis results revealed that the obtained slender NCs exhibited good biocompatibility, superparamagnetic property, high transverse relaxivity (R2) and longer blood circulation time. The test results of human umbilical vein endothelial cells and U251 human glioma cells indicated that the conjugation of c(RGDyC) could obviously increase the cyto-internalization of c(RGDyC)-NCs, however, CTX modification could significantly enhance accumulation of CTX-NCs in U251 cells, leading to cellular apoptosis. The results of in vivo biodistribution tests and in vivo magnetic resonance (MR) imaging indicated that, although the c(RGDyC)-NCs could target early glioma to some extent and obviously enhance the contrast of MR imaging, CTX-NCs possessed higher tumor-targeting ability and good inhibition effect than the c(RGDyC)-NCs, suggesting that CTX-NCs are promising candidates for the diagnosis and therapy of early glioma. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. Targeted therapies for cancer

    Science.gov (United States)

    ... so they cannot spread. How Does Targeted Therapy Work? Targeted therapy drugs work in a few different ... M. is also a founding member of Hi-Ethics and subscribes to the principles of the Health ...

  16. Reflectance Reference Targets (OTTER)

    Data.gov (United States)

    National Aeronautics and Space Administration — ABSTRACT: Spectral reflectance measurements of flat field targets as reference points representative of pseudo-invariant targets as measured by Spectron SE590...

  17. Reflectance Reference Targets (OTTER)

    Data.gov (United States)

    National Aeronautics and Space Administration — Spectral reflectance measurements of flat field targets as reference points representative of pseudo-invariant targets as measured by Spectron SE590 spectrophotometer

  18. Targets for Precision Measurements

    Science.gov (United States)

    Loveland, W.; Yao, L.; Asner, D. M.; Baker, R. G.; Bundgaard, J.; Burgett, E.; Cunningham, M.; Deaven, J.; Duke, D. L.; Greife, U.; Grimes, S.; Heffner, M.; Hill, T.; Isenhower, D.; Klay, J. L.; Kleinrath, V.; Kornilov, N.; Laptev, A. B.; Massey, T. N.; Meharchand, R.; Qu, H.; Ruz, J.; Sangiorgio, S.; Selhan, B.; Snyder, L.; Stave, S.; Tatishvili, G.; Thornton, R. T.; Tovesson, F.; Towell, D.; Towell, R. S.; Watson, S.; Wendt, B.; Wood, L.

    2014-05-01

    The general properties needed in targets (sources) for high precision, high accuracy measurements are reviewed. The application of these principles to the problem of developing targets for the Fission TPC is described. Longer term issues, such as the availability of actinide materials, improved knowledge of energy losses and straggling and the stability of targets during irradiation are also discussed.

  19. Setting Asset Performance Targets

    NARCIS (Netherlands)

    Green, D.; Hodkiewicz, M.; Masschelein, S.; Schoenmaker, R.; Muruvan, S.

    2015-01-01

    Setting targets is a common way for organisations to establish performance expectations. However the validity of targets is challenged when performance is influenced by factors beyond the control of the manager. This project examines the issue of target setting for a single asset performance measure

  20. Gitonga 243-251.pmd

    African Journals Online (AJOL)

    Prof. Adipala Ekwamu

    vermiculite and glass beads) (SMM). Support matrices (cotton wool, glass beads and vermiculite) were considered as low cost materials (Table 1D). Different sources of water, namely tap, rain and distilled, were used to prepare the media for shoot multiplication. For rooting, MS basal salts was supplemented with 3% sugar ...

  1. Variants located upstream of CHRNB4 on chromosome 15q25.1 are associated with age at onset of daily smoking and habitual smoking.

    Directory of Open Access Journals (Sweden)

    Manav Kapoor

    Full Text Available Several genome-wide association and candidate gene studies have linked chromosome 15q24-q25.1 (a region including the CHRNA5-CHRNA3-CHRNB4 gene cluster with alcohol dependence, nicotine dependence and smoking-related illnesses such as lung cancer and chronic obstructive pulmonary disease. To further examine the impact of these genes on the development of substance use disorders, we tested whether variants within and flanking the CHRNA5-CHRNA3-CHRNB4 gene cluster affect the transition to daily smoking (individuals who smoked cigarettes 4 or more days per week in a cross sectional sample of adolescents and young adults from the COGA (Collaborative Study of the Genetics of Alcoholism families. Subjects were recruited from families affected with alcoholism (either as a first or second degree relative and the comparison families. Participants completed the SSAGA interview, a comprehensive assessment of alcohol and other substance use and related behaviors. Using the Quantitative trait disequilibrium test (QTDT significant association was detected between age at onset of daily smoking and variants located upstream of CHRNB4. Multivariate analysis using a Cox proportional hazards model further revealed that these variants significantly predict the age at onset of habitual smoking among daily smokers. These variants were not in high linkage disequilibrium (0.28

  2. Response of a simian immunodeficiency virus (SIVmac251 to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy

    Directory of Open Access Journals (Sweden)

    Greenhouse Jack

    2010-03-01

    Full Text Available Abstract Background In this study we successfully created a new approach to ART in SIVmac251 infected nonhuman primates. This drug regimen is entirely based on drugs affecting the pre-integration stages of replication and consists of only two nucleotidic/nucleosidic reverse transcriptase inhibitors (Nt/NRTIs and raltegravir, a promising new drug belonging to the integrase strand transfer inhibitor (INSTI class. Results In acutely infected human lymphoid CD4+ T-cell lines MT-4 and CEMx174, SIVmac251 replication was efficiently inhibited by raltegravir, which showed an EC90 in the low nanomolar range. This result was confirmed in primary macaque PBMCs and enriched CD4+ T cell fractions. In vivo monotherapy with raltegravir for only ten days resulted in reproducible decreases in viral load in two different groups of animals. When emtricitabine (FTC and tenofovir (PMPA were added to treatment, undetectable viral load was reached in two weeks, and a parallel increase in CD4 counts was observed. In contrast, the levels of proviral DNA did not change significantly during the treatment period, thus showing persistence of this lentiviral reservoir during therapy. Conclusions In line with the high conservation of the three main amino acids Y143, Q148 and N155 (responsible for raltegravir binding and molecular docking simulations showing similar binding modes of raltegravir at the SIVmac251 and HIV-1 IN active sites, raltegravir is capable of inhibiting SIVmac251 replication both in tissue culture and in vivo. This finding may help to develop effective ART regimens for the simian AIDS model entirely based on drugs adopted for treatment in humans. This ART-treated AIDS nonhuman primate model could be employed to find possible strategies for virus eradication from the body.

  3. Glucocorticoid Treatment at Moderate Doses of SIVmac251-Infected Rhesus Macaques Decreases the Frequency of Circulating CD14+CD16++ Monocytes But Does Not Alter the Tissue Virus Reservoir

    Science.gov (United States)

    Moniuszko, Marcin; Liyanage, Namal P.M.; Doster, Melvin N.; Parks, Robyn Washington; Grubczak, Kamil; Lipinska, Danuta; McKinnon, Katherine; Brown, Charles; Hirsch, Vanessa; Vaccari, Monica; Gordon, Shari; Pegu, Poonam; Fenizia, Claudio; Flisiak, Robert; Grzeszczuk, Anna; Dabrowska, Milena; Robert-Guroff, Marjorie; Silvestri, Guido; Stevenson, Mario; McCune, Joseph

    2015-01-01

    Abstract Subsets of CD16-positive monocytes produce proinflammatory cytokines and expand during chronic infection with the human immunodeficiency virus type 1 (HIV). HIV-infected macrophage in tissues may be long lived and contribute to the establishment and maintenance of the HIV reservoir. We found that the (intermediate) CD14++CD16+ and (nonclassical) CD14+CD16++ monocyte subsets are significantly expanded during infection of Rhesus macaques with pathogenic SIVmac251 but not during infection of sooty mangabeys with the nonpathogenic isolate SIVSM. In vitro glucocorticoid (GC) treatment of peripheral blood mononuclear cells (PBMCs) from uninfected or SIVmac251-infected Rhesus macaques and HIV-infected patients treated or not with antiretroviral therapy (ART) resulted in a significant decrease in the frequency of both CD16-positive monocyte subsets. Short-term in vivo treatment with high doses of GC of chronically SIVmac251-infected macaques resulted in a significant decrease in the CD14+CD16++ population and, to a lesser extent, in the CD14++CD16+ monocytes, as well as a significant decrease in the number of macrophages in tissues. Surprisingly, treatment of SIVmac251-infected macaques with ART significantly increased the CD14++CD16+ population and the addition of GC resulted in a significant decrease in only the CD14+CD16++ subset. No difference in SIV DNA levels in blood, lymph nodes, gut, and spleen was found between the groups treated with ART or ART plus GC. Thus, it appears that high doses of GC treatment in the absence of ART could affect both CD16-positive populations in vivo. Whether the efficacy of this treatment at higher doses to decrease virus levels outweighs its risks remains to be determined. PMID:24432835

  4. A Pilot Study into the Effects of the CB1 Cannabinoid Receptor Agonist WIN55,212-2 or the Antagonist/Inverse Agonist AM251 on Sleep in Rats

    Directory of Open Access Journals (Sweden)

    Anushka V. Goonawardena

    2011-01-01

    Full Text Available The plant cannabinoid Δ9-tetrahydrocannabinol and the endocannabinoid anandamide increase the amount of sleep via a CB1 receptor mediated mechanism. Here, we explored the use of a novel electroencephalogram (EEG recording device based on wireless EEG microchip technology (Neurologger in freely-moving rats, and its utility in experiments of cannabinoids-induced alterations of EEG/vigilance stages. EEG was recorded through epidural electrodes placed above pre-frontal and parietal cortex (overlaying the dorsal hippocampus. As cannabinoids, we acutely administered the full synthetic CB1 receptor agonist, WIN55,212-2 (1 mg/kg, and the antagonist/inverse agonist, AM251 (2 mg/kg, either alone or together through the intraperitoneal route. WIN55,212-2 increased the total amount of NREM sleep and the length of each NREM bout, but this was unlikely due to CB1 receptor activation since it was not prevented by AM251. However, WIN55,212-2 also lowered overall EEG spectral power especially in theta and alpha frequency bands during wakefulness and NREM sleep, and this effect was reversed by AM251. The antagonist/inverse agonist caused no sleep alterations by itself and moderately increased spectral power in Theta, alpha and beta frequency bands during NREM sleep when administered on its own. Implications of endocannabinoid modulation of the sleep-wake cycle and its possible interactions with other transmitter systems are considered.

  5. Automated absolute activation analysis with californium-252 sources

    Energy Technology Data Exchange (ETDEWEB)

    MacMurdo, K.W.; Bowman, W.W.

    1978-09-01

    A 100-mg /sup 252/Cf neutron activation analysis facility is used routinely at the Savannah River Laboratory for multielement analysis of many solid and liquid samples. An absolute analysis technique converts counting data directly to elemental concentration without the use of classical comparative standards and flux monitors. With the totally automated pneumatic sample transfer system, cyclic irradiation-decay-count regimes can be pre-selected for up to 40 samples, and samples can be analyzed with the facility unattended. An automatic data control system starts and stops a high-resolution gamma-ray spectrometer and/or a delayed-neutron detector; the system also stores data and controls output modes. Gamma ray data are reduced by three main programs in the IBM 360/195 computer: the 4096-channel spectrum and pertinent experimental timing, counting, and sample data are stored on magnetic tape; the spectrum is then reduced to a list of significant photopeak energies, integrated areas, and their associated statistical errors; and the third program assigns gamma ray photopeaks to the appropriate neutron activation product(s) by comparing photopeak energies to tabulated gamma ray energies. Photopeak areas are then converted to elemental concentration by using experimental timing and sample data, calculated elemental neutron capture rates, absolute detector efficiencies, and absolute spectroscopic decay data. Calculational procedures have been developed so that fissile material can be analyzed by cyclic neutron activation and delayed-neutron counting procedures. These calculations are based on a 6 half-life group model of delayed neutron emission; calculations include corrections for delayed neutron interference from /sup 17/O. Detection sensitivities of < or = 400 ppB for natural uranium and 8 ppB (< or = 0.5 (nCi/g)) for /sup 239/Pu were demonstrated with 15-g samples at a throughput of up to 140 per day. Over 40 elements can be detected at the sub-ppM level.

  6. Metastable charge-transfer state of californium(iii) compounds.

    Science.gov (United States)

    Liu, Guokui; Cary, Samantha K; Albrecht-Schmitt, Thomas E

    2015-06-28

    Among a series of anomalous physical and chemical properties of Cf(iii) compounds revealed by recent investigations, the present work addresses the characteristics of the optical spectra of An(HDPA)3·H2O (An = Am, Cm, and Cf), especially the broadband photoluminescence from Cf(HDPA)3·H2O induced by ligand-to-metal charge transfer (CT). As a result of strong ion-ligand interactions and the relative ease of reducing Cf(iii) to Cf(ii), a CT transition occurs at low energy (transfer state undergoes radiative and non-radiative relaxations. Broadening of the CT transition arises from strong vibronic coupling and hole-charge interactions in the valence band. The non-radiative relaxation of the metastable CT state results from a competition between phonon-relaxation and thermal tunneling that populates the excited states of Cf(iii).

  7. Development of distributed target

    CERN Document Server

    Yu Hai Jun; Li Qin; Zhou Fu Xin; Shi Jin Shui; Ma Bing; Chen Nan; Jing Xiao Bing

    2002-01-01

    Linear introduction accelerator is expected to generate small diameter X-ray spots with high intensity. The interaction of the electron beam with plasmas generated at the X-ray converter will make the spot on target increase with time and debase the X-ray dose and the imaging resolving power. A distributed target is developed which has about 24 pieces of thin 0.05 mm tantalum films distributed over 1 cm. due to the structure adoption, the distributed target material over a large volume decreases the energy deposition per unit volume and hence reduces the temperature of target surface, then reduces the initial plasma formalizing and its expansion velocity. The comparison and analysis with two kinds of target structures are presented using numerical calculation and experiments, the results show the X-ray dose and normalized angle distribution of the two is basically the same, while the surface of the distributed target is not destroyed like the previous block target

  8. Assessment of the toll-like receptor 4 Asp299Gly, Thr399Ile and interleukin-8 -251 polymorphisms in the risk for the development of distal gastric cancer

    Directory of Open Access Journals (Sweden)

    Maldonado-Garza Hector J

    2007-04-01

    Full Text Available Abstract Background The intensity of the inflammation induced by Helicobacter pylori colonization is associated with the development of distal gastric cancer (GC. The host response to H. pylori has been related to genetic polymorphisms that influence both innate and adaptive immune responses. Our aim was to investigate whether the presence of the TLR4 Asp299Gly, TLR4 Thr399Ile and IL-8-251 A/T polymorphisms had any influence in the development of distal GC in a Mexican population. Methods We studied 337 patients that were divided in two groups: 78 patients with histologically confirmed distal GC and 259 non-cancer controls. The presence of H. pylori in the control population was defined by positive results of at least two of four diagnostic tests: serology, histology, rapid urease test and culture. Human DNA was purified and genotyped for TLR4 Asp299Gly polymorphism by pyrosequencing, for TLR4 Thr399Ile by PCR-RFLP and for IL8-251 by the amplification refractory mutation system (ARMS-PCR. Results The non-cancer control group was found to be in Hardy-Weinberg equilibrium at the polymorphic loci studied (chi-square H-W = 0.58 for IL8-251, 0.42 for TLR4 Asp299Gly and 0.17 for TLR4 Thr399Ile. The frequencies of mutated alleles (homozygous plus heterozygous were compared between cases and controls. We found no significant difference for TLR4- Asp299Gly [the 7.7% of distal GC patients and 7.7 % non-cancer controls (p = 0.82] and for TLR4 Thr399Ile [the 1.3% of GC patients and the 5% of the control population (p = 0.2]. In contrast, for IL-8-251 A/T, 80.77% of the GC patients and 66.4% in the control group age and gender matched had at least one copy of mutated allele (OR = 2.12, 95% CI = 1.1–4.2 (p = 0.023. Conclusion This study showed that the IL8-251*A allele could be related to the development of distal gastric cancer in this Mexican population.

  9. Identification of epidermal growth factor receptor-positive glioblastoma using lipid-encapsulated targeted superparamagnetic iron oxide nanoparticles in vitro

    Directory of Open Access Journals (Sweden)

    Huai-Lu Chen

    2017-11-01

    Full Text Available Abstract Background Targeted superparamagnetic iron oxide (SPIO nanoparticles have emerged as a promising biomarker detection tool for molecular magnetic resonance (MR image diagnosis. To identify patients who could benefit from Epidermal growth factor receptor (EGFR-targeted therapies, we introduce lipid-encapsulated SPIO nanoparticles and hypothesized that anti-EGFR antibody cetuximab conjugated of such nanoparticles can be used to identify EGFR-positive glioblastomas in non-invasive T2 MR image assays. The newly introduced lipid-coated SPIOs, which imitate biological cell surface and thus inherited innate nonfouling property, were utilized to reduce nonspecific binding to off-targeted cells and prevent agglomeration that commonly occurs in nanoparticles. Results The synthesized targeted EGFR-antibody-conjugated SPIO (EGFR-SPIO nanoparticles were characterized using dynamic light scattering, zeta potential assays, gel electrophoresis mobility shift assays, transmission electron microscopy (TEM images, and cell line affinity assays, and the results showed that the conjugation was successful. The targeting efficiency of the synthesized EGFR-SPIO nanoparticles was confirmed through Prussian blue staining and TEM images by using glioblastoma cell lines with high or low EGFR expression levels. The EGFR-SPIO nanoparticles preferentially targeted U-251 cells, which have high EGFR expression, and were internalized by cells in a prolonged incubation condition. Moreover, the T2 MR relaxation time of EGFR-SPIO nanoparticles could be used for successfully identifying glioblastoma cells with elevated EGFR expression in vitro and distinguishing U-251 cells from U-87MG cells, which have low EFGR expression. Conclusion These findings reveal that the lipid-encapsulated EGFR-SPIO nanoparticles can specifically target cells with elevated EGFR expression in the three tested human glioblastoma cell lines. The results of this study can be used for noninvasive

  10. Inertial Confinement fusion targets

    Science.gov (United States)

    Hendricks, C. D.

    1982-01-01

    Inertial confinement fusion (ICF) targets are made as simple flat discs, as hollow shells or as complicated multilayer structures. Many techniques were devised for producing the targets. Glass and metal shells are made by using drop and bubble techniques. Solid hydrogen shells are also produced by adapting old methods to the solution of modern problems. Some of these techniques, problems, and solutions are discussed. In addition, the applications of many of the techniques to fabrication of ICF targets is presented.

  11. Target Window Reliability

    Energy Technology Data Exchange (ETDEWEB)

    Woloshun, Keith Albert [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-02-11

    The target window design implemented and tested in experiments at ANL have performed without failure for the available beam of 6 mm FWHM on a 12 mm diameter target. However, scaling that design to a 25 mm diameter target size for a 12 mm FWHM beam has proven problematic. Combined thermal and mechanical (pressure induced) stresses and strains are too high to maintain the small coolant gaps and provide adequate fatigue lifetime.

  12. The ISOLDE target robots

    CERN Multimedia

    Maximilein Brice

    2002-01-01

    ISOLDE targets need to be changed frequently, around 80 times per year. The high radiation levels do not permit this to be done by human hands and the target changes are effected by 2 industrial robots (picture _01). On the left, in the distance, the front-end of the GPS (General Purpose Separator) is seen, while the HRS (High Resolution Separator) is at the right. Also seen are the doors to the irradiated-target storage.

  13. ESR1 is co-expressed with closely adjacent uncharacterised genes spanning a breast cancer susceptibility locus at 6q25.1.

    Directory of Open Access Journals (Sweden)

    Anita K Dunbier

    2011-04-01

    Full Text Available Approximately 80% of human breast carcinomas present as oestrogen receptor α-positive (ER+ve disease, and ER status is a critical factor in treatment decision-making. Recently, single nucleotide polymorphisms (SNPs in the region immediately upstream of the ER gene (ESR1 on 6q25.1 have been associated with breast cancer risk. Our investigation of factors associated with the level of expression of ESR1 in ER+ve tumours has revealed unexpected associations between genes in this region and ESR1 expression that are important to consider in studies of the genetic causes of breast cancer risk. RNA from tumour biopsies taken from 104 postmenopausal women before and after 2 weeks treatment with an aromatase (oestrogen synthase inhibitor was analyzed on Illumina 48K microarrays. Multiple-testing corrected Spearman correlation revealed that three previously uncharacterized open reading frames (ORFs located immediately upstream of ESR1, C6ORF96, C6ORF97, and C6ORF211 were highly correlated with ESR1 (Rs =  0.67, 0.64, and 0.55 respectively, FDR<1 × 10(-7. Publicly available datasets confirmed this relationship in other groups of ER+ve tumours. DNA copy number changes did not account for the correlations. The correlations were maintained in cultured cells. An ERα antagonist did not affect the ORFs' expression or their correlation with ESR1, suggesting their transcriptional co-activation is not directly mediated by ERα. siRNA inhibition of C6ORF211 suppressed proliferation in MCF7 cells, and C6ORF211 positively correlated with a proliferation metagene in tumours. In contrast, C6ORF97 expression correlated negatively with the metagene and predicted for improved disease-free survival in a tamoxifen-treated published dataset, independently of ESR1. Our observations suggest that some of the biological effects previously attributed to ER could be mediated and/or modified by these co-expressed genes. The co-expression and function of these genes may be

  14. Mucosal B Cells Are Associated with Delayed SIV Acquisition in Vaccinated Female but Not Male Rhesus Macaques Following SIVmac251 Rectal Challenge.

    Directory of Open Access Journals (Sweden)

    Iskra Tuero

    2015-08-01

    Full Text Available Many viral infections, including HIV, exhibit sex-based pathogenic differences. However, few studies have examined vaccine-related sex differences. We compared immunogenicity and protective efficacy of monomeric SIV gp120 with oligomeric SIV gp140 in a pre-clinical rhesus macaque study and explored a subsequent sex bias in vaccine outcome. Each immunization group (16 females, 8 males was primed twice mucosally with replication-competent Ad-recombinants encoding SIVsmH4env/rev, SIV239gag and SIV239nefΔ1-13 and boosted twice intramuscularly with SIVmac239 monomeric gp120 or oligomeric gp140 in MF59 adjuvant. Controls (7 females, 5 males received empty Ad and MF59. Up to 9 weekly intrarectal challenges with low-dose SIVmac251 were administered until macaques became infected. We assessed vaccine-induced binding, neutralizing, and non-neutralizing antibodies, Env-specific memory B cells and plasmablasts/plasma cells (PB/PC in bone marrow and rectal tissue, mucosal Env-specific antibodies, and Env-specific T-cells. Post-challenge, only one macaque (gp140-immunized remained uninfected. However, SIV acquisition was significantly delayed in vaccinated females but not males, correlated with Env-specific IgA in rectal secretions, rectal Env-specific memory B cells, and PC in rectal tissue. These results extend previous correlations of mucosal antibodies and memory B cells with protective efficacy. The gp140 regimen was more immunogenic, stimulating elevated gp140 and cyclic V2 binding antibodies, ADCC and ADCP activities, bone marrow Env-specific PB/PC, and rectal gp140-specific IgG. However, immunization with gp120, the form of envelope immunogen used in RV144, the only vaccine trial to show some efficacy, provided more significant acquisition delay. Further over 40 weeks of follow-up, no gp120 immunized macaques met euthanasia criteria in contrast to 7 gp140-immunized and 2 control animals. Although males had higher binding antibodies than females, ADCC

  15. Multiple Independent Loci at Chromosome 15q25.1 Affect Smoking Quantity: a Meta-Analysis and Comparison with Lung Cancer and COPD

    Science.gov (United States)

    Saccone, Nancy L.; Culverhouse, Robert C.; Schwantes-An, Tae-Hwi; Cannon, Dale S.; Chen, Xiangning; Cichon, Sven; Giegling, Ina; Han, Shizhong; Han, Younghun; Keskitalo-Vuokko, Kaisu; Kong, Xiangyang; Landi, Maria Teresa; Ma, Jennie Z.; Short, Susan E.; Stephens, Sarah H.; Stevens, Victoria L.; Sun, Lingwei; Wang, Yufei; Wenzlaff, Angela S.; Aggen, Steven H.; Breslau, Naomi; Broderick, Peter; Chatterjee, Nilanjan; Chen, Jingchun; Heath, Andrew C.; Heliövaara, Markku; Hoft, Nicole R.; Hunter, David J.; Jensen, Majken K.; Martin, Nicholas G.; Montgomery, Grant W.; Niu, Tianhua; Payne, Thomas J.; Peltonen, Leena; Pergadia, Michele L.; Rice, John P.; Sherva, Richard; Spitz, Margaret R.; Sun, Juzhong; Wang, Jen C.; Weiss, Robert B.; Wheeler, William; Witt, Stephanie H.; Yang, Bao-Zhu; Caporaso, Neil E.; Ehringer, Marissa A.; Eisen, Tim; Gapstur, Susan M.; Gelernter, Joel; Houlston, Richard; Kaprio, Jaakko; Kendler, Kenneth S.; Kraft, Peter; Leppert, Mark F.; Li, Ming D.; Madden, Pamela A. F.; Nöthen, Markus M.; Pillai, Sreekumar; Rietschel, Marcella; Rujescu, Dan; Schwartz, Ann; Amos, Christopher I.; Bierut, Laura J.

    2010-01-01

    Recently, genetic association findings for nicotine dependence, smoking behavior, and smoking-related diseases converged to implicate the chromosome 15q25.1 region, which includes the CHRNA5-CHRNA3-CHRNB4 cholinergic nicotinic receptor subunit genes. In particular, association with the nonsynonymous CHRNA5 SNP rs16969968 and correlates has been replicated in several independent studies. Extensive genotyping of this region has suggested additional statistically distinct signals for nicotine dependence, tagged by rs578776 and rs588765. One goal of the Consortium for the Genetic Analysis of Smoking Phenotypes (CGASP) is to elucidate the associations among these markers and dichotomous smoking quantity (heavy versus light smoking), lung cancer, and chronic obstructive pulmonary disease (COPD). We performed a meta-analysis across 34 datasets of European-ancestry subjects, including 38,617 smokers who were assessed for cigarettes-per-day, 7,700 lung cancer cases and 5,914 lung-cancer-free controls (all smokers), and 2,614 COPD cases and 3,568 COPD-free controls (all smokers). We demonstrate statistically independent associations of rs16969968 and rs588765 with smoking (mutually adjusted p-values<10−35 and <10−8 respectively). Because the risk alleles at these loci are negatively correlated, their association with smoking is stronger in the joint model than when each SNP is analyzed alone. Rs578776 also demonstrates association with smoking after adjustment for rs16969968 (p<10−6). In models adjusting for cigarettes-per-day, we confirm the association between rs16969968 and lung cancer (p<10−20) and observe a nominally significant association with COPD (p = 0.01); the other loci are not significantly associated with either lung cancer or COPD after adjusting for rs16969968. This study provides strong evidence that multiple statistically distinct loci in this region affect smoking behavior. This study is also the first report of association between rs588765

  16. Multiple independent loci at chromosome 15q25.1 affect smoking quantity: a meta-analysis and comparison with lung cancer and COPD.

    Directory of Open Access Journals (Sweden)

    Nancy L Saccone

    2010-08-01

    Full Text Available Recently, genetic association findings for nicotine dependence, smoking behavior, and smoking-related diseases converged to implicate the chromosome 15q25.1 region, which includes the CHRNA5-CHRNA3-CHRNB4 cholinergic nicotinic receptor subunit genes. In particular, association with the nonsynonymous CHRNA5 SNP rs16969968 and correlates has been replicated in several independent studies. Extensive genotyping of this region has suggested additional statistically distinct signals for nicotine dependence, tagged by rs578776 and rs588765. One goal of the Consortium for the Genetic Analysis of Smoking Phenotypes (CGASP is to elucidate the associations among these markers and dichotomous smoking quantity (heavy versus light smoking, lung cancer, and chronic obstructive pulmonary disease (COPD. We performed a meta-analysis across 34 datasets of European-ancestry subjects, including 38,617 smokers who were assessed for cigarettes-per-day, 7,700 lung cancer cases and 5,914 lung-cancer-free controls (all smokers, and 2,614 COPD cases and 3,568 COPD-free controls (all smokers. We demonstrate statistically independent associations of rs16969968 and rs588765 with smoking (mutually adjusted p-values<10(-35 and <10(-8 respectively. Because the risk alleles at these loci are negatively correlated, their association with smoking is stronger in the joint model than when each SNP is analyzed alone. Rs578776 also demonstrates association with smoking after adjustment for rs16969968 (p<10(-6. In models adjusting for cigarettes-per-day, we confirm the association between rs16969968 and lung cancer (p<10(-20 and observe a nominally significant association with COPD (p = 0.01; the other loci are not significantly associated with either lung cancer or COPD after adjusting for rs16969968. This study provides strong evidence that multiple statistically distinct loci in this region affect smoking behavior. This study is also the first report of association between rs588765

  17. Multiple independent loci at chromosome 15q25.1 affect smoking quantity: a meta-analysis and comparison with lung cancer and COPD.

    Science.gov (United States)

    Saccone, Nancy L; Culverhouse, Robert C; Schwantes-An, Tae-Hwi; Cannon, Dale S; Chen, Xiangning; Cichon, Sven; Giegling, Ina; Han, Shizhong; Han, Younghun; Keskitalo-Vuokko, Kaisu; Kong, Xiangyang; Landi, Maria Teresa; Ma, Jennie Z; Short, Susan E; Stephens, Sarah H; Stevens, Victoria L; Sun, Lingwei; Wang, Yufei; Wenzlaff, Angela S; Aggen, Steven H; Breslau, Naomi; Broderick, Peter; Chatterjee, Nilanjan; Chen, Jingchun; Heath, Andrew C; Heliövaara, Markku; Hoft, Nicole R; Hunter, David J; Jensen, Majken K; Martin, Nicholas G; Montgomery, Grant W; Niu, Tianhua; Payne, Thomas J; Peltonen, Leena; Pergadia, Michele L; Rice, John P; Sherva, Richard; Spitz, Margaret R; Sun, Juzhong; Wang, Jen C; Weiss, Robert B; Wheeler, William; Witt, Stephanie H; Yang, Bao-Zhu; Caporaso, Neil E; Ehringer, Marissa A; Eisen, Tim; Gapstur, Susan M; Gelernter, Joel; Houlston, Richard; Kaprio, Jaakko; Kendler, Kenneth S; Kraft, Peter; Leppert, Mark F; Li, Ming D; Madden, Pamela A F; Nöthen, Markus M; Pillai, Sreekumar; Rietschel, Marcella; Rujescu, Dan; Schwartz, Ann; Amos, Christopher I; Bierut, Laura J

    2010-08-05

    Recently, genetic association findings for nicotine dependence, smoking behavior, and smoking-related diseases converged to implicate the chromosome 15q25.1 region, which includes the CHRNA5-CHRNA3-CHRNB4 cholinergic nicotinic receptor subunit genes. In particular, association with the nonsynonymous CHRNA5 SNP rs16969968 and correlates has been replicated in several independent studies. Extensive genotyping of this region has suggested additional statistically distinct signals for nicotine dependence, tagged by rs578776 and rs588765. One goal of the Consortium for the Genetic Analysis of Smoking Phenotypes (CGASP) is to elucidate the associations among these markers and dichotomous smoking quantity (heavy versus light smoking), lung cancer, and chronic obstructive pulmonary disease (COPD). We performed a meta-analysis across 34 datasets of European-ancestry subjects, including 38,617 smokers who were assessed for cigarettes-per-day, 7,700 lung cancer cases and 5,914 lung-cancer-free controls (all smokers), and 2,614 COPD cases and 3,568 COPD-free controls (all smokers). We demonstrate statistically independent associations of rs16969968 and rs588765 with smoking (mutually adjusted p-values<10(-35) and <10(-8) respectively). Because the risk alleles at these loci are negatively correlated, their association with smoking is stronger in the joint model than when each SNP is analyzed alone. Rs578776 also demonstrates association with smoking after adjustment for rs16969968 (p<10(-6)). In models adjusting for cigarettes-per-day, we confirm the association between rs16969968 and lung cancer (p<10(-20)) and observe a nominally significant association with COPD (p = 0.01); the other loci are not significantly associated with either lung cancer or COPD after adjusting for rs16969968. This study provides strong evidence that multiple statistically distinct loci in this region affect smoking behavior. This study is also the first report of association between rs588765 (and

  18. Targeting the tumor microenvironment

    Energy Technology Data Exchange (ETDEWEB)

    Kenny, P.A.; Lee, G.Y.; Bissell, M.J.

    2006-11-07

    Despite some notable successes cancer remains, for the most part, a seemingly intractable problem. There is, however, a growing appreciation that targeting the tumor epithelium in isolation is not sufficient as there is an intricate mutually sustaining synergy between the tumor epithelial cells and their surrounding stroma. As the details of this dialogue emerge, new therapeutic targets have been proposed. The FDA has already approved drugs targeting microenvironmental components such as VEGF and aromatase and many more agents are in the pipeline. In this article, we describe some of the 'druggable' targets and processes within the tumor microenvironment and review the approaches being taken to disrupt these interactions.

  19. Target Assembly Facility

    Data.gov (United States)

    Federal Laboratory Consortium — The Target Assembly Facility integrates new armor concepts into actual armored vehicles. Featuring the capability ofmachining and cutting radioactive materials, it...

  20. Targeting MT1-MMP as an ImmunoPET-Based Strategy for Imaging Gliomas.

    Directory of Open Access Journals (Sweden)

    A G de Lucas

    Full Text Available A critical challenge in the management of Glioblastoma Multiforme (GBM tumors is the accurate diagnosis and assessment of tumor progression in a noninvasive manner. We have identified Membrane-type 1 matrix metalloproteinase (MT1-MMP as an attractive biomarker for GBM imaging since this protein is actively involved in tumor growth and progression, correlates with tumor grade and is closely associated with poor prognosis in GBM patients. Here, we report the development of an immunoPET tracer for effective detection of MT1-MMP in GBM models.An anti-human MT1-MMP monoclonal antibody (mAb, LEM2/15, was conjugated to p-isothiocyanatobenzyl-desferrioxamine (DFO-NCS for 89Zr labeling. Biodistribution and PET imaging studies were performed in xenograft mice bearing human GBM cells (U251 expressing MT1-MMP and non-expressing breast carcinoma cells (MCF-7 as negative control. Two orthotopic brain GBM models, patient-derived neurospheres (TS543 and U251 cells, with different degrees of blood-brain barrier (BBB disruption were also used for PET imaging experiments.89Zr labeling of DFO-LEM2/15 was achieved with high yield (>90% and specific activity (78.5 MBq/mg. Biodistribution experiments indicated that 89Zr-DFO-LEM2/15 showed excellent potential as a radiotracer for detection of MT1-MMP positive GBM tumors. PET imaging also indicated a specific and prominent 89Zr-DFO-LEM2/15 uptake in MT1-MMP+ U251 GBM tumors compared to MT1-MMP- MCF-7 breast tumors. Results obtained in orthotopic brain GBM models revealed a high dependence of a disrupted BBB for tracer penetrance into tumors. 89Zr-DFO-LEM2/15 showed much higher accumulation in TS543 tumors with a highly disrupted BBB than in U251 orthotopic model in which the BBB permeability was only partially increased. Histological analysis confirmed the specificity of the immunoconjugate in all GBM models.A new anti MT1-MMP-mAb tracer, 89Zr-DFO-LEM2/15, was synthesized efficiently. In vivo validation showed high

  1. Target visibility for multiple maneuvering target tracking

    Science.gov (United States)

    Sabordo, Madeleine G.; Aboutanios, Elias

    2015-05-01

    We present a recursion of the probability of target visibility and its applications to analysis of track life and termination in the context of Global Nearest Neighbour (GNN) approach and Probability Hypothesis Density (PHD) filter. In the presence of uncertainties brought about by clutter; decisions to retain a track, terminate it or initialise a new track are based on probability, rather than on distance criterion or estimation error. The visibility concept is introduced into a conventional data-association-oriented multitarget tracker, the GNN; and a random finite set based-tracker, the PHD filter, to take into account instances when targets become invisible or occluded by obstacles. We employ the natural logarithmof the Dynamic Error Spectrum to assess the performance of the trackers with and without probability of visibility incorporated. Simulation results show that the performance of the GNN tracker with visibility concept incorporated is significantly enhanced.

  2. Frozen spin targets

    CERN Document Server

    Parsons, A S L

    1976-01-01

    Describes six projects which use the frozen-spin principle: Helium-3 R.M.S. and longitudinally polarized frozen spin targets at Rutherford Laboratory, and the frozen spin targets at KEK, Saclay and the one used by the CERN-Helsinki collaboration. (7 refs).

  3. Seedling root targets

    Science.gov (United States)

    Diane L. Haase

    2011-01-01

    Roots are critical to seedling performance after outplanting. Although root quality is not as quick and simple to measure as shoot quality, target root characteristics should be included in any seedling quality assessment program. This paper provides a brief review of root characteristics most commonly targeted for operational seedling production. These are: root mass...

  4. Strategic Targeted Advertising

    NARCIS (Netherlands)

    A. Galeotti; J.L. Moraga-Gonzalez (José Luis)

    2003-01-01

    textabstractWe present a strategic game of pricing and targeted-advertising. Firms can simultaneously target price advertisements to different groups of customers, or to the entire market. Pure strategy equilibria do not exist and thus market segmentation cannot occur surely. Equilibria exhibit

  5. Segmented Target Design

    Science.gov (United States)

    Merhi, Abdul Rahman; Frank, Nathan; Gueye, Paul; Thoennessen, Michael; MoNA Collaboration

    2013-10-01

    A proposed segmented target would improve decay energy measurements of neutron-unbound nuclei. Experiments like this have been performed at the National Superconducting Cyclotron Laboratory (NSCL) located at Michigan State University. Many different nuclei are produced in such experiments, some of which immediately decay into a charged particle and neutron. The charged particles are bent by a large magnet and measured by a suite of charged particle detectors. The neutrons are measured by the Modular Neutron Array (MoNA) and Large Multi-Institutional Scintillation Array (LISA). With the current target setup, a nucleus in a neutron-unbound state is produced with a radioactive beam impinged upon a beryllium target. The resolution of these measurements is very dependent on the target thickness since the nuclear interaction point is unknown. In a segmented target using alternating layers of silicon detectors and Be-targets, the Be-target in which the nuclear reaction takes place would be determined. Thus the experimental resolution would improve. This poster will describe the improvement over the current target along with the status of the design. Work supported by Augustana College and the National Science Foundation grant #0969173.

  6. The CNGS target

    CERN Multimedia

    Patrice Loïez

    2005-01-01

    The CERN Neutrinos to Gran Sasso (CNGS) target ‘magazine’ of five target units. Each unit contains a series of 10-cm long graphite rods distributed over a length of 2 m. It is designed to maximize the number of secondary particles produced and hence the number of neutrinos. One unit is used at a time to prevent over heating.

  7. Targeted therapy in lymphoma

    Directory of Open Access Journals (Sweden)

    Cavalli Franco

    2010-11-01

    Full Text Available Abstract Discovery of new treatments for lymphoma that prolong survival and are less toxic than currently available agents represents an urgent unmet need. We now have a better understanding of the molecular pathogenesis of lymphoma, such as aberrant signal transduction pathways, which have led to the discovery and development of targeted therapeutics. The ubiquitin-proteasome and the Akt/mammalian target of rapamycin (mTOR pathways are examples of pathological mechanisms that are being targeted in drug development efforts. Bortezomib (a small molecule protease inhibitor and the mTOR inhibitors temsirolimus, everolimus, and ridaforolimus are some of the targeted therapies currently being studied in the treatment of aggressive, relapsed/refractory lymphoma. This review will discuss the rationale for and summarize the reported findings of initial and ongoing investigations of mTOR inhibitors and other small molecule targeted therapies in the treatment of lymphoma.

  8. Targets and teamwork

    DEFF Research Database (Denmark)

    Skinner, Timothy C; Lange, Karin S; Hoey, Hilary

    2017-01-01

    with less disagreement about recommended targets. Multiple regression analysis indicated that teams reporting higher HbA1c targets and more target disagreement had parents reporting higher treatment targets. This seemed to partially account for center differences in Hb1Ac. Conclusions: The diabetes care....... Research Design and Methods: Children, under the age of 11 with type 1 diabetes and their parents treated at the study centers participated. Clinical, medical, and demographic data were obtained, along with blood sample for centralized assay. Parents and all members of the diabetes care team completed...... questionnaires on treatment targets for hemoglobin A1c (HbA1c) and recommended frequency of blood glucose monitoring. Results: Totally 1113 (53% male) children (mean age 8.0±2.1years) from 18 centers in 17 countries, along with parents and 113 health-care professionals, participated. There were substantial...

  9. Combination of Helicobacter pylori infection and the interleukin 8 -251 T > A polymorphism, but not the mannose-binding lectin 2 codon 54 G > A polymorphism, might be a risk factor of gastric cancer.

    Science.gov (United States)

    Chang, Young Woon; Oh, Chi Hyuk; Kim, Jung-Wook; Lee, Jae Won; Park, Mi Ju; Shim, Jae-Jun; Lee, Chang Kyun; Jang, Jae-Young; Dong, Seok Ho; Kim, Hyo Jong; Kim, Sung Soo; Kim, Byung-Ho

    2017-05-30

    Mannose-binding lectin (MBL) acts in the innate immune response to Helicobacter pylori. Interleukin 8 (IL-8) is a potent cytokine produced by gastric epithelial cells in response to H. pylori. We aimed to investigate whether polymorphisms in MBL2 and IL-8 influence susceptibility to H. pylori infection, and the associations of these polymorphisms with the risk of gastroduodenal diseases in a Korean population. We consecutively enrolled 176 H. pylori-negative control subjects, 221 subjects with H. pylori-positive non-atrophic gastritis, 52 mild atrophic gastritis (AG), 61 severe AG, 175 duodenal ulcer, and 283 gastric cancer (GC). Allele-specific PCR-RFLP was conducted for polymorphisms in MBL2 exon 1 (codon 52, 54, and 57) and IL-8 -251 T > A. IL-8 levels in gastric mucosal tissues and serum MBL levels were measured by enzyme-linked immunosorbent assay. MBL2 exon 1 polymorphic variants were found only in codon 54, and the allele frequencies did not differ significantly between the control and disease groups. Although serum MBL levels in codon 54 A/A mutants were markedly low, it did not influence susceptibility to H. pylori infection or the risk of gastroduodenal diseases. IL-8 levels were significantly different between T/T wild type, T/A heterozygote, and A/A mutant genotypes. IL-8 -251 A allele carriers (A/A + T/A) showed increased IL-8 levels, and were significantly associated with the risk of severe AG and GC. We suggest that a combination of H. pylori infection and the IL-8 -251 T > A polymorphism might increase the risk of severe AG and GC in a Korean population.

  10. AA antiproton production target

    CERN Multimedia

    CERN PhotoLab

    1979-01-01

    The first version of the antiproton production target was a tungsten rod, 11 cm long and 3 mm in diameter. The rod was embedded in graphite, pressure-seated into an outer casing of stainless steel. At the entrance to the target assembly was a scintillator screen, imprinted with circles every 5 mm in radius, which allowed to precisely aim the 26 GeV high-intensity proton beam from the PS onto the centre of the target rod. The scintillator screen was a 1 mm thick plate of Cr-doped alumina. See also 7903034 and 7905091.

  11. Target Price Accuracy

    Directory of Open Access Journals (Sweden)

    Alexander G. Kerl

    2011-04-01

    Full Text Available This study analyzes the accuracy of forecasted target prices within analysts’ reports. We compute a measure for target price forecast accuracy that evaluates the ability of analysts to exactly forecast the ex-ante (unknown 12-month stock price. Furthermore, we determine factors that explain this accuracy. Target price accuracy is negatively related to analyst-specific optimism and stock-specific risk (measured by volatility and price-to-book ratio. However, target price accuracy is positively related to the level of detail of each report, company size and the reputation of the investment bank. The potential conflicts of interests between an analyst and a covered company do not bias forecast accuracy.

  12. Optimal exploration target zones

    CSIR Research Space (South Africa)

    Debba, Pravesh

    2008-09-01

    Full Text Available This research describes a quantitative methodology for deriving optimal exploration target zones based on a probabilistic mineral prospectivity map. In order to arrive at out objective, we provide a plausible answer to the following question: "Which...

  13. Delays in thick targets

    CERN Document Server

    Bennett, J R J

    2002-01-01

    The delays in the emission of radioactive particles from a thick target bombarded by high-energy protons is discussed in relation to the basic physical processes of diffusion and effusion through the target and ioniser. The delay time, relative to the decay time, is crucial to the efficiency of particle release at the exit of the ioniser. The principles of minimizing the delay times are discussed with reference to a mathematical model of the process, and some experimental examples are given.

  14. An ISOLDE target unit

    CERN Multimedia

    Maximilien Brice

    2002-01-01

    A good dozen different targets are available for ISOLDE, made of different materials and equipped with different kinds of ion-sources, according to the needs of the experiments. Each separator (GPS: general purpose; HRS: high resolution) has its own target. Because of the high radiation levels, robots effect the target changes, about 80 times per year. In the standard unit shown in picture _01, the target is the cylindrical object in the front. It contains uranium-carbide kept at a temperature of 2200 deg C, necessary for the isotopes to be able to escape. At either end, one sees the heater current leads, carrying 700 A. The Booster beam, some 3E13 protons per pulse, enters the target from left. The evaporated isotope atoms enter a hot-plasma ion source (the black object behind the target). The whole unit sits at 60 kV potential (pulsed in synchronism with the arrival of the Booster beam) which accelerates the ions (away from the viewer) towards one of the 2 separators.

  15. Burglar Target Selection

    Science.gov (United States)

    Townsley, Michael; Bernasco, Wim; Ruiter, Stijn; Johnson, Shane D.; White, Gentry; Baum, Scott

    2015-01-01

    Objectives: This study builds on research undertaken by Bernasco and Nieuwbeerta and explores the generalizability of a theoretically derived offender target selection model in three cross-national study regions. Methods: Taking a discrete spatial choice approach, we estimate the impact of both environment- and offender-level factors on residential burglary placement in the Netherlands, the United Kingdom, and Australia. Combining cleared burglary data from all study regions in a single statistical model, we make statistical comparisons between environments. Results: In all three study regions, the likelihood an offender selects an area for burglary is positively influenced by proximity to their home, the proportion of easily accessible targets, and the total number of targets available. Furthermore, in two of the three study regions, juvenile offenders under the legal driving age are significantly more influenced by target proximity than adult offenders. Post hoc tests indicate the magnitudes of these impacts vary significantly between study regions. Conclusions: While burglary target selection strategies are consistent with opportunity-based explanations of offending, the impact of environmental context is significant. As such, the approach undertaken in combining observations from multiple study regions may aid criminology scholars in assessing the generalizability of observed findings across multiple environments. PMID:25866418

  16. The Sinuous Target

    Energy Technology Data Exchange (ETDEWEB)

    Zwaska, R. [Fermilab

    2015-06-01

    We report on the concept for a target material comprised of a multitude of interlaced wires of small dimension. This target material concept is primarily directed at high-power neutrino targets where the thermal shock is large due to small beam sizes and short durations; it also has applications to other high-power targets, particularly where the energy deposition is great or a high surface area is preferred. This approach ameliorates the problem of thermal shock by engineering a material with high strength on the micro-scale, but a very low modulus of elasticity on the meso-scale. The low modulus of elasticity is achieved by constructing the material of spring-like wire segments much smaller than the beam dimension. The intrinsic bends of the wires will allow them to absorb the strain of thermal shock with minimal stress. Furthermore, the interlaced nature of the wires provides containment of any segment that might become loose. We will discuss the progress on studies of analogue materials and fabrication techniques for sinuous target materials.

  17. NEMO is essential for Kaposi's sarcoma-associated herpesvirus-encoded vFLIP K13-induced gene expression and protection against death receptor-induced cell death, and its N-terminal 251 residues are sufficient for this process.

    Science.gov (United States)

    Tolani, Bhairavi; Matta, Hittu; Gopalakrishnan, Ramakrishnan; Punj, Vasu; Chaudhary, Preet M

    2014-06-01

    Kaposi's sarcoma-associated herpesvirus-encoded viral FLICE inhibitory protein (vFLIP) K13 was originally believed to protect virally infected cells against death receptor-induced apoptosis by interfering with caspase 8/FLICE activation. Subsequent studies revealed that K13 also activates the NF-κB pathway by binding to the NEMO/inhibitor of NF-κB (IκB) kinase gamma (IKKγ) subunit of an IKK complex and uses this pathway to modulate the expression of genes involved in cellular survival, proliferation, and the inflammatory response. However, it is not clear if K13 can also induce gene expression independently of NEMO/IKKγ. The minimum region of NEMO that is sufficient for supporting K13-induced NF-κB has not been delineated. Furthermore, the contribution of NEMO and NF-κB to the protective effect of K13 against death receptor-induced apoptosis remains to be determined. In this study, we used microarray analysis on K13-expressing wild-type and NEMO-deficient cells to demonstrate that NEMO is required for modulation of K13-induced genes. Reconstitution of NEMO-null cells revealed that the N-terminal 251 amino acid residues of NEMO are sufficient for supporting K13-induced NF-κB but fail to support tumor necrosis factor alpha (TNF-α)-induced NF-κB. K13 failed to protect NEMO-null cells against TNF-α-induced cell death but protected those reconstituted with the NEMO mutant truncated to include only the N-terminal 251 amino acid residues [the NEMO(1-251) mutant]. Taken collectively, our results demonstrate that NEMO is required for modulation of K13-induced genes and the N-terminal 251 amino acids of NEMO are sufficient for supporting K13-induced NF-κB. Finally, the ability of K13 to protect against TNF-α-induced cell death is critically dependent on its ability to interact with NEMO and activate NF-κB. Kaposi's sarcoma-associated herpesvirus-encoded vFLIP K13 is believed to protect virally infected cells against death receptor-induced apoptosis and to

  18. Setting reference targets

    Energy Technology Data Exchange (ETDEWEB)

    Ruland, R.E.

    1997-04-01

    Reference Targets are used to represent virtual quantities like the magnetic axis of a magnet or the definition of a coordinate system. To explain the function of reference targets in the sequence of the alignment process, this paper will first briefly discuss the geometry of the trajectory design space and of the surveying space, then continue with an overview of a typical alignment process. This is followed by a discussion on magnet fiducialization. While the magnetic measurement methods to determine the magnetic centerline are only listed (they will be discussed in detail in a subsequent talk), emphasis is given to the optical/mechanical methods and to the task of transferring the centerline position to reference targets.

  19. Targeted Therapy of CLL.

    Science.gov (United States)

    Al-Sawaf, Othman; Fischer, Kirsten; Eichhorst, Barbara; Hallek, Michael

    2016-01-01

    The landscape of chronic lymphocytic leukemia (CLL) has undergone profound changes in the past years. First, the addition of CD20-targeting antibodies to conventional chemotherapy has improved the therapeutic outcome in the majority of CLL patients. Since the establishment of the critical role of the B cell receptor signaling pathway in the pathogenesis of CLL, several agents have been developed to target this pathway. Ibrutinib and idelalisib, 2 potent kinase inhibitors, have both become available for CLL therapy in the first and second line. Additionally, the observation of high expression levels of the anti-apoptotic mitochondrial protein Bcl-2 in CLL has led to the development of venetoclax, a BH3 mimetic compound that inhibits Bcl-2 and has shown high efficacy in CLL. This short review summarizes preclinical and clinical data on currently available agents in CLL and provides an outlook on upcoming new challenges in the targeted therapy of CLL. © 2016 S. Karger GmbH, Freiburg.

  20. Modelling Recycling Targets

    DEFF Research Database (Denmark)

    Hill, Amanda Louise; Leinikka Dall, Ole; Andersen, Frits M.

    2014-01-01

    Within the European Union (EU) a paradigm shift is currently occurring in the waste sector, where EU waste directives and national waste strategies are placing emphasis on resource efficiency and recycling targets. The most recent Danish resource strategy calculates a national recycling rate of 22......% for household waste, and sets an ambitious goal of a 50% recycling rate by 2020. This study integrates the recycling target into the FRIDA model to project how much waste and from which streams should be diverted from incineration to recycling in order to achieve the target. Furthermore, it discusses how...... the existing technological, organizational and legislative frameworks may affect recycling activities. The results of the analysis show that with current best practice recycling rates, the 50% recycling rate cannot be reached without recycling of household biowaste. It also shows that all Danish municipalities...

  1. MicroRNA-184 inhibits cell proliferation and invasion, and specifically targets TNFAIP2 in Glioma.

    Science.gov (United States)

    Cheng, Zhe; Wang, Hang Zhou; Li, Xuetao; Wu, Zhiwu; Han, Yong; Li, Yanyan; Chen, Guilin; Xie, Xueshun; Huang, Yulun; Du, Ziwei; Zhou, Youxin

    2015-03-26

    miRNA-184 is an oncogene in human hepatocellular carcinoma but acts as a tumor suppressor in tongue squamous cell carcinoma. Studies have shown that miR-184 was down-regulated in glioma and TNFα-induced protein 2 (TNFAIP2) was closely related to tumorigenesis. This study aimed to determine the functions of miR-184 in glioma and the mechanisms of miRNA-184-TNFAIP2 mediated glioma progression. Real-time reverse-transcription PCR detected expression of miR-184 and TNFAIP2. U87 and U251 cells were transfected with miR-184 mimic, inhibitor, or negative control miRNA, and their invasion abilities were assayed. Cellular proliferation was measured by the cell counting kit-8 assay. miR-184 effects on glioma cell apoptosis and cell cycle were assessed by flow cytometer. Biological information software have predicted that miR-184 could target TNFα-induced protein 2 (TNFAIP2), Which was further validated by Western blot and qRT-PCR in glioma cells. In vivo, U87 cells transduced with either lentiviral over-expressed miR-184 or control lentivirus were injected into nude mice subcutaneously and intracranial respectively. Expression of miR-184 was significantly lower in glioma tissues and cell-lines compared to normal brain tissues. Protein and mRNA expression of TNFAIP2 were inversely correlated with miR-184 in glioma. In vitro, proliferation and invasion abilities were also decreased in U87 and U251 cells after transfection with miR-184 mimic. In vivo, the xenografted tumor size in the miR-184 overexpressing group were smaller than the miR-NC group. Concordantly, U87 and U251 cells transfected with miR-184 mimic had a higher apoptosis rate, triggering an accumulation of cells at the G0/G1 phase and decreased cells in S-phase. miR-184 could regulate TNFAIP2 expression and affected its translation in glioma. miR-184 could also inhibit glioma progression and might serve as a novel therapeutic target in glioma.

  2. Optimal exploration target zones

    CSIR Research Space (South Africa)

    Debba, Pravesh

    2008-09-01

    Full Text Available , Carranza, Stein, van der Meer Introduction to Remote Sensing Background and Objective of the study Methodology Results Optimal Exploration Target Zones Pravesh Debba1, Emmanual M.J. Carranza2, Alfred Stein2, Freek D. van der Meer2 1CSIR, Logistics... and Quantitative Methods, CSIR Built Environment 2International Institute for Geo-Information Science and Earth Observation (ITC), Hengelosestraat 99, P.O. Box 6, 7500AA Enschede, The Netherlands Optimal Exploration Target Zones Debba, Carranza, Stein, van der Meer...

  3. AA antiproton production target

    CERN Multimedia

    CERN PhotoLab

    1979-01-01

    The first version of the antiproton production target was a tungsten rod, 11 cm long (actually a row of 11 rods, each 1 cm long) and 3 mm in diameter. The rod was embedded in graphite, pressure-seated into an outer casing made of stainless steel. The casing had fins for forced-air cooling. In this picture, the 26 GeV high-intensity beam from the PS enters from the right, where a scintillator screen, with circles every 5 mm in radius, permits precise aim at the target centre. See also 7903034 and 7905094.

  4. A novel splice-site mutation in angiotensin I-converting enzyme (ACE gene, c.3691+1G>A (IVS25+1G>A, causes a dramatic increase in circulating ACE through deletion of the transmembrane anchor.

    Directory of Open Access Journals (Sweden)

    Alexandre Persu

    Full Text Available BACKGROUND: Angiotensin-converting enzyme (ACE (EC 4.15.1 metabolizes many biologically active peptides and plays a key role in blood pressure regulation and vascular remodeling. Elevated ACE levels are associated with different cardiovascular and respiratory diseases. METHODS AND RESULTS: Two Belgian families with a 8-16-fold increase in blood ACE level were incidentally identified. A novel heterozygous splice site mutation of intron 25 - IVS25+1G>A (c.3691+1G>A - cosegregating with elevated plasma ACE was identified in both pedigrees. Messenger RNA analysis revealed that the mutation led to the retention of intron 25 and Premature Termination Codon generation. Subjects harboring the mutation were mostly normotensive, had no left ventricular hypertrophy or cardiovascular disease. The levels of renin-angiotensin-aldosterone system components in the mutated cases and wild-type controls were similar, both at baseline and after 50 mg captopril. Compared with non-affected members, quantification of ACE surface expression and shedding using flow cytometry assay of dendritic cells derived from peripheral blood monocytes of affected members, demonstrated a 50% decrease and 3-fold increase, respectively. Together with a dramatic increase in circulating ACE levels, these findings argue in favor of deletion of transmembrane anchor, leading to direct secretion of ACE out of cells. CONCLUSIONS: We describe a novel mutation of the ACE gene associated with a major familial elevation of circulating ACE, without evidence of activation of the renin-angiotensin system, target organ damage or cardiovascular complications. These data are consistent with the hypothesis that membrane-bound ACE, rather than circulating ACE, is responsible for Angiotensin II generation and its cardiovascular consequences.

  5. Aquaporin-2 membrane targeting

    DEFF Research Database (Denmark)

    Olesen, Emma T B; Fenton, Robert A

    2017-01-01

    The targeting of the water channel aquaporin-2 (AQP2) to the apical plasma membrane of kidney collecting duct principal cells is regulated mainly by the antidiuretic peptide hormone arginine vasopressin (AVP). This process is of crucial importance for the maintenance of body water homeostasis...

  6. ISOLDE back on target

    CERN Multimedia

    Anaïs Schaeffer

    2014-01-01

    Today, Friday 1 August, the ISOLDE installation, supplied by the beams of the PS Booster, restarted its physics programme. After a shutdown of almost a year and a half, there was a real buzz in the air as the first beam of protons hit the target of the first post-LS1 ISOLDE experiment.   One of the new target-handling robots installed by ISOLDE during LS1. Many improvements have been made to the ISOLDE installation during LS1. One of the main projects was the installation of new robots for handling the targets (see photo 1). “Our targets are bombarded by protons from the PS Booster’s beams and become very radioactive,” explains Maria Jose Garcia Borge, spokesperson for the ISOLDE collaboration. “They therefore need to be handled carefully, which is where the robots come in. The robots we had until now were already over 20 years old and were starting to suffer from the effects of radiation. So LS1 was a perfect opportunity to replace them with more moder...

  7. Microenvironmental targets in sarcoma

    Directory of Open Access Journals (Sweden)

    Monika eEhnman

    2015-11-01

    Full Text Available Sarcomas are rare malignant tumors affecting all age groups. They are typically classified according to their resemblance to corresponding normal tissue. Their heterogeneous features, for example in terms of disease-driving genetic aberrations and body location, complicate both disease classification and development of novel treatment regimens. Many years of failure of improved patient outcome in clinical trials has lead to the conclusion that novel targeted therapies are likely needed in combination with current multimodality regimens. Sarcomas have not, in contrast to the common carcinomas, been the subject for larger systematic studies on how tumor behavior relates to characteristics of the tumor microenvironment. There is consequently an urgent need for identifying suitable molecular targets, not only in tumor cells, but also in the tumor microenvironment. This review discusses preclinical and clinical data about potential molecular targets in sarcomas. Studies on targeted therapies involving the tumor microenvironment are prioritized. A greater understanding of the biological context is expected to facilitate more successful design of future clinical trials in sarcoma.

  8. Target Heart Rates

    Science.gov (United States)

    ... is your level of intensity? When is the best time of day to work out? Target Heart Rates Warm Up, Cool Down See More >> Getting Active Getting Started - Tips for Long-term Exercise Success Get Moving: Easy Tips to Get Active! ...

  9. Targeted Therapy for Melanoma

    Energy Technology Data Exchange (ETDEWEB)

    Quinn, Thomas [Alphamed, Jackson, TN (United States); Moore, Herbert [Alphamed, Jackson, TN (United States)

    2016-12-05

    The research project, entitled ”Targeted Therapy for Melanoma,” was focused on investigating the use of kidney protection measures to lower the non-specific kidney uptake of the radiolabeled Pb-DOTA-ReCCMSH peptide. Previous published work demonstrated that the kidney exhibited the highest non-target tissue uptake of the 212Pb/203Pb radiolabeled melanoma targeting peptide DOTA-ReCCMSH. The radiolabeled alpha-melanocyte stimulating hormone (α-MSH) peptide analog DOTA-Re(Arg11)CCMSH, which binds the melanocortin-1 receptor over-expressed on melanoma tumor cells, has shown promise as a PRRT agent in pre-clinical studies. High tumor uptake of 212Pb labeled DOTA-Re(Arg11)CCMSH resulted in tumor reduction or eradication in melanoma therapy studies. Of particular note was the 20-50% cure rate observed when melanoma mice were treated with alpha particle emitter 212Pb. However, as with most PRRT agents, high radiation doses to the kidneys where observed. To optimize tumor treatment efficacy and reduce nephrotoxicity, the tumor to kidney uptake ratio must be improved. Strategies to reduce kidney retention of the radiolabeled peptide, while not effecting tumor uptake and retention, can be broken into several categories including modification of the targeting peptide sequence and reducing proximal tubule reabsorption.

  10. Target Chamber Manipulator

    Science.gov (United States)

    Tantillo, Anthony; Watson, Matthew

    2015-11-01

    A system has been developed to allow remote actuation of sensors in a high vacuum target chamber used with a particle accelerator. Typically, sensors of various types are placed into the target chamber at specific radial and angular positions relative to the beam line and target. The chamber is then evacuated and the experiments are performed for those sensor positions. Then, the chamber is opened, the sensors are repositioned to new angles or radii, and the process is repeated, with a separate pump-down cycle for each set of sensor positions. The new sensor positioning system allows scientists to pre-set the radii of up to a dozen sensors, and then remotely actuate their angular positions without breaking the vacuum of the target chamber. This reduces the time required to reposition sensors from 6 hours to 1 minute. The sensors are placed into one of two tracks that are separately actuated using vacuum-grade stepping motors. The positions of the sensors are verified using absolute optical rotary encoders, and the positions are accurate to 0.5 degrees. The positions of the sensors are electronically recorded and time-stamped after every change. User control is through a GUI using LabVIEW.

  11. Active Target Simulation

    Science.gov (United States)

    Smith, Nathan; Draznik, Peter; Frank, Nathan

    2012-10-01

    We have simulated an existing experimental design to determine the resolution improvement upon energy measurements of neutron unbound nuclei. A number of experiments of this type have been performed at the National Superconducting Cyclotron Laboratory (NSCL), located at Michigan State University. An excited nucleus is typically produced with a radioactive beam interacting with a passive Beryllium target. Many different nuclei are produced in experiment, each of which immediately decays into a charged particle and neutron. The charged particles are detected and the neutrons interact in scintillation detectors such as the Modular Neutron Array (MoNA) and Large Multi-Institutional Scintillation Array (LISA). In our simulation, we have constructed an active target that provides additional information such that the point of nuclear interaction within the target may be determined. This information improves the resolution in decay energy measurements of neutron unbound isotopes. This presentation will cover some aspects of the simulation process, as well as showing some of the results that demonstrate the simulated improvement over a passive target.

  12. Fine-mapping of the 5p15.33, 6p22.1-p21.31, and 15q25.1 regions identifies functional and histology-specific lung cancer susceptibility loci in African-Americans.

    Science.gov (United States)

    Walsh, Kyle M; Gorlov, Ivan P; Hansen, Helen M; Wu, Xifeng; Spitz, Margaret R; Zhang, Huifeng; Lu, Emily Y; Wenzlaff, Angela S; Sison, Jennette D; Wei, Chongjuan; Lloyd, Stacy M; Chen, Wei; Frazier, Marsha L; Seldin, Michael F; Bierut, Laura J; Bracci, Paige M; Wrensch, Margaret R; Schwartz, Ann G; Wiencke, John K; Amos, Christopher I

    2013-02-01

    Genome-wide association studies of European and East Asian populations have identified lung cancer susceptibility loci on chromosomes 5p15.33, 6p22.1-p21.31, and 15q25.1. We investigated whether these regions contain lung cancer susceptibly loci in African-Americans and refined previous association signals by using the reduced linkage disequilibrium observed in African-Americans. 1,308 African-American cases and 1,241 African-American controls from 3 centers were genotyped for 760 single-nucleotide polymorphisms (SNP) spanning 3 regions, and additional SNP imputation was carried out. Associations between polymorphisms and lung cancer risk were estimated using logistic regression, stratified by tumor histology where appropriate. The strongest associations were observed on 15q25.1 in/near CHRNA5, including a missense substitution [rs16969968: OR, 1.57; 95% confidence interval (CI), 1.25-1.97; P, 1.1 × 10(-4)) and variants in the 5'-UTR. Associations on 6p22.1-p21.31 were histology specific and included a missense variant in BAT2 associated with squamous cell carcinoma (rs2736158: OR, 0.64; 95% CI, 0.48-0.85; P, 1.82 × 10(-3)). Associations on 5p15.33 were detected near TERT, the strongest of which was rs2735940 (OR, 0.82; 95% CI, 0.73-0.93; P, 1.1 × 10(-3)). This association was stronger among cases with adenocarcinoma (OR, 0.75; 95% CI, 0.65-0.86; P, 8.1 × 10(-5)). Polymorphisms in 5p15.33, 6p22.1-p21.31, and 15q25.1 are associated with lung cancer in African-Americans. Variants on 5p15.33 are stronger risk factors for adenocarcinoma and variants on 6p21.33 associated only with squamous cell carcinoma. Results implicate the BAT2, TERT, and CHRNA5 genes in the pathogenesis of specific lung cancer histologies.

  13. Physics of polarized targets

    CERN Document Server

    Niinikoski, Tapio

    2014-01-01

    For developing, building and operating solid polarized targets we need to understand several fields of physics that have seen sub stantial advances during the last 50 years. W e shall briefly review a selection of those that are important today. These are: 1) quantum statistical methods to describe saturation and relaxation in magnetic resonance; 2) equal spin temperature model for dy namic nuclear polarization; 3 ) weak saturation during NMR polarization measurement; 4 ) refrigeration using the quantum fluid properties of helium isotopes. These, combined with superconducting magnet technologies, permit today to reach nearly complete pola rization of almost any nuclear spins. Targets can be operated in frozen spin mode in rather low and inhomogeneous field of any orientation, and in DNP mode in beams of high intensity. Beyond such experiments of nuclear and particle physics, applications a re also emerging in macromolecular chemistry and in magnetic resonance imaging. This talk is a tribute to Michel Borghini...

  14. Emerging Targets in Photopharmacology.

    Science.gov (United States)

    Lerch, Michael M; Hansen, Mickel J; van Dam, Gooitzen M; Szymanski, Wiktor; Feringa, Ben L

    2016-09-05

    The field of photopharmacology uses molecular photoswitches to establish control over the action of bioactive molecules. It aims to reduce systemic drug toxicity and the emergence of resistance, while achieving unprecedented precision in treatment. By using small molecules, photopharmacology provides a viable alternative to optogenetics. We present here a critical overview of the different pharmacological targets in various organs and a survey of organ systems in the human body that can be addressed in a non-invasive manner. We discuss the prospects for the selective delivery of light to these organs and the specific requirements for light-activatable drugs. We also aim to illustrate the druggability of medicinal targets with recent findings and emphasize where conceptually new approaches have to be explored to provide photopharmacology with future opportunities to bring "smart" molecular design ultimately to the realm of clinical use. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Inflation Targeting: Provisional Results

    Directory of Open Access Journals (Sweden)

    Cerna, Silviu

    2010-06-01

    Full Text Available Inflation targeting monetary policy framework that requires the central bank to achieve a low inflation has contributed to price stability in industrialized countries. As well as the other developing countries, ex communist countries have also tried to apply this strategy, which was susceptible to increase monetary policy transparency and to determine authorities to make necessary reforms in order to pass from a planned to a market economy. In Romania, inflation targeting has contributed, to a large extent, to price increase smoothening, without affecting economic growth. Knowing the factors that have determined this unquestionable success allows for not only understanding the Romanian transition process, but also draw some useful conclusions in view of the necessary actions for adopting the euro.

  16. Foucault on targets.

    Science.gov (United States)

    Lynch, John

    2004-01-01

    This paper seeks to gain an insight into the behavior of a large NHS trust, in its attempt to meet a 90 percent patient access target, in a week long national audit in March 2003. Why did individuals act in dramatically different ways to their norm over this period. The work of Michel Foucault is used to explore these issues. The discourses of power, knowledge, discipline and governmentality are identified as key foucaudian themes that offer an alternative interpretation of how individuals behave in their place of work. The importance of the historical context of discourse within the NHS cannot be underestimated in shaping the behavior of individuals and groups today. Power and knowledge permeate NHS organizations through disciplinary practices and dressage. Governmentality seeks to maintain the status quo through disciplinary processes such as national healthcare targets. The natural response of NHS organizations is therefore, to seek order and conformity rather than disorder and conflict.

  17. Antibodies Targeting EMT

    Science.gov (United States)

    2017-10-01

    VLDL uptake and redistribution of lipids to cells for energy metabolism and cell signaling. ApoE overexpression has shown to be associated with a...involved in testosterone and estradiol biosynthesis, as well as prostaglandin F synthesis and has previously been implicated in cancer progression, AKR1C2...is involved in androgen metabolism and is a potential drug target for prostate cancer. AKR1C4 is involved in bile acid synthesis but has not yet

  18. Explosive Target Balances

    OpenAIRE

    Potrafke, Niklas; Reischmann, Markus

    2013-01-01

    Using the new unit root test by Phillips et al. (2011) we show that the Target balances of the German Bundesbank have been exploding from the beginning of 2009 to the beginning of 2013. By implementing a full-allotment policy and reducing the required minimum quality of collaterals in October 2008, the European Central Bank (ECB) refinanced credits in the GIIPS countries to a large extent. Private capital flowed out of the GIIPS countries (Greece, Italy, Ireland, Portugal and Spain), and the ...

  19. Implementing Target Value Design.

    Science.gov (United States)

    Alves, Thais da C L; Lichtig, Will; Rybkowski, Zofia K

    2017-04-01

    An alternative to the traditional way of designing projects is the process of target value design (TVD), which takes different departure points to start the design process. The TVD process starts with the client defining an allowable cost that needs to be met by the design and construction teams. An expected cost in the TVD process is defined through multiple interactions between multiple stakeholders who define wishes and others who define ways of achieving these wishes. Finally, a target cost is defined based on the expected profit the design and construction teams are expecting to make. TVD follows a series of continuous improvement efforts aimed at reaching the desired goals for the project and its associated target value cost. The process takes advantage of rapid cycles of suggestions, analyses, and implementation that starts with the definition of value for the client. In the traditional design process, the goal is to identify user preferences and find solutions that meet the needs of the client's expressed preferences. In the lean design process, the goal is to educate users about their values and advocate for a better facility over the long run; this way owners can help contractors and designers to identify better solutions. This article aims to inform the healthcare community about tools and techniques commonly used during the TVD process and how they can be used to educate and support project participants in developing better solutions to meet their needs now as well as in the future.

  20. β-asarone inhibited cell growth and promoted autophagy via P53/Bcl-2/Bclin-1 and P53/AMPK/mTOR pathways in Human Glioma U251 cells.

    Science.gov (United States)

    Wang, Nanbu; Zhang, Qinxin; Luo, Laiyu; Ning, Baile; Fang, Yongqi

    2018-03-01

    Glioma is the most common type of primary brain tumor and has an undesirable prognosis. Autophagy plays an important role in cancer therapy, but it is effect is still not definite. P53 is an important tumor suppressor gene and protein that is closely to autophagy. Our aim was to study the effect of β-asarone on inhibiting cell proliferation in human glioma U251 cells and to detect the effect of the inhibition on autophagy through the P53 signal pathway. For cell growth, the cells were divided into four groups: the model, β-asarone, temozolomide (TMZ), and co-administration groups. For cell autoghapy and the P53 pathway, the cells were divided into six groups: the model, β-asarone, 3MA, Rapa, Pifithrin-µ, and NSC groups. The counting Kit-8 assay and flow cytometry (FCM) were then used to measure the cell proliferation and cycle. Electron microscopy was used to observe autophagosome formation. Cell immunohistochemistry/-immunofluorescence, FCM and Western blot (WB) were used to examine the expression of Beclin-1 and P53. The levels of P53 and GAPDH mRNA were detected by RT-PCR. Using WB, we determined autophagy-related proteins Beclin-1, LC3-II/I, and P62 and those of the P53 pathway-related proteins P53, Bcl-2, mTOR, P-mTOR, AMPK, P-AMPK, and GAPDH. We got the results that β-asarone changed the cellular morphology, inhibited cell proliferation, and enhanced the expression of P53, LC3-II/I, Beclin-1, AMPK, and pAMPK while inhibiting the expression of P62, Bcl-2, mTOR, and pmTOR. All the data suggested that β-asarone could reduce the cell proliferation and promote autophagy possible via the P53 pathway in U251 cells. © 2017 Wiley Periodicals, Inc.

  1. Differences in time of virus appearance in the blood and virus-specific immune responses in intravenous and intrarectal primary SIVmac251 infection of rhesus macaques; a pilot study

    Directory of Open Access Journals (Sweden)

    Washington Parks Robyn

    2001-07-01

    Full Text Available Abstract Background HIV-I can be transmitted by intravenous inoculation of contaminated blood or blood product or sexually through mucosal surfaces. Here we performed a pilot study in the SIVmac251 macaque model to address whether the route of viral entry influences the kinetics of the appearance and the size of virus-specific immune in different tissue compartments. Methods For this purpose, of 2 genetically defined Mamu-A*01-positive macaques, 1 was exposed intravenously and the other intrarectally to the same SIVmac251 viral stock and virus-specific CD8+ T-cells were measured within the first 12 days of infection in the blood and at day 12 in several tissues following euthanasia. Results Virus-specific CD8+ T-cell responses to Gag, Env, and particularly Tat appeared earlier in the blood of the animal exposed by the mucosal route than in the animal exposed intravenously. The magnitude of these virus-specific responses was consistently higher in the systemic tissues and GALT of the macaque exposed by the intravenous route, suggesting a higher viral burden in the tissues as reflected by the faster appearance of virus in plasma. Differences in the ability of the virus-specific CD8+ T-cells to respond in vitro to specific peptide stimulation were also observed and the greatest proliferative ability was found in the GALT of the animal infected by the intrarectal route. Conclusions These data may suggest that the natural mucosal barrier may delay viral spreading. The consequences of this observation, if confirmed in studies with a larger number of animals, may have implications in vaccine development.

  2. Inflation targeting and core inflation

    OpenAIRE

    Julie Smith

    2005-01-01

    This paper examines the interaction of core inflation and inflation targeting as a monetary policy regime. Interest in core inflation has grown because of inflation targeting. Core inflation is defined in numerous ways giving rise to many potential measures; this paper defines core inflation as the best forecaster of inflation. A cross-country study finds before the start of inflation targeting, but not after, core inflation differs between non-inflation targeters and inflation targeters. Thr...

  3. Targeted therapy for sarcomas

    Directory of Open Access Journals (Sweden)

    Forscher C

    2014-03-01

    Full Text Available Charles Forscher,1 Monica Mita,2 Robert Figlin3 1Sarcoma Program, Samuel Oschin Comprehensive Cancer Institute, Cedars-Sinai Medical Center, Los Angeles, CA, USA; 2Experimental Therapeutics Program, Samuel Oschin Comprehensive Cancer Institute, Cedars-Sinai Medical Center, Los Angeles, CA, USA; 3Academic Development Program, Samuel Oschin Comprehensive Cancer Institute, and Division of Hematology/Oncology, Cedars-Sinai Medical Center, Los Angeles, CA, USA Abstract: Sarcomas are tumors of mesenchymal origin that make up approximately 1% of human cancers. They may arise as primary tumors in either bone or soft tissue, with approximately 11,280 soft tissue tumors and 2,650 bone tumors diagnosed each year in the United States. There are at least 50 different subtypes of soft tissue sarcoma, with new ones described with ever-increasing frequency. One way to look at sarcomas is to divide them into categories on the basis of their genetic make-up. One group of sarcomas has an identifiable, relatively simple genetic signature, such as the X:18 translocation seen in synovial sarcoma or the 11:22 translocation seen in Ewing's sarcoma. These specific abnormalities often lead to the presence of fusion proteins, such as EWS-FLI1 in Ewing's sarcoma, which are helpful as diagnostic tools and may become therapeutic targets in the future. Another group of sarcomas is characterized by complex genetic abnormalities as seen in leiomyosarcoma, osteosarcoma, and undifferentiated sarcoma. It is important to keep these distinctions in mind when contemplating the development of targeted agents for sarcomas. Different abnormalities in sarcoma could be divided by tumor subtype or by the molecular or pathway abnormality. However, some existing drugs or drugs in development may interfere with or alter more than one of the presented pathways. Keywords: sarcoma, targeted agents, tyrosine kinase inhibitors, mTor inhibition

  4. Meeting the Aichi targets

    DEFF Research Database (Denmark)

    Funk, Stephan M; Conde, Dalia Amor; Lamoreux, John

    2017-01-01

    &s), is an excellent opportunity to achieve the Aichi 2020 Targets T11 (protected areas) and T12 (preventing species extinctions). AZE taxa have small, single-site populations that are especially vulnerable to human-induced extinctions, particularly for the many amphibians. We show that AZEs&s can be protected...... feasibly and cost-effectively, but action is urgent. We argue that the Alliance, whose initial main aim was to identify AZEs&s, must be followed up by a second-generation initiative that directs and co-ordinates AZE conservation activities on the ground. The prominent role of zoos, conservation NGOs...

  5. Polarized scintillator targets

    Science.gov (United States)

    van den Brandt, B.; Bunyatova, E. I.; Hautle, P.; Konter, J. A.; Mango, S.

    2000-05-01

    The hydrogen nuclei in an organic scintillator have been polarized to more than 80% and the deuterons in its fully deuterated version to 24%. The scintillator, doped with TEMPO, has been polarized dynamically in a field of 2.5 T in a vertical dilution refrigerator in which a plastic lightguide transports the scintillation light from the sample in the mixing chamber to a photomultiplier outside the cryostat. Sizeable solid samples with acceptable optical properties and light output have been prepared and successfully operated as "live" polarized targets in nuclear physics experiments.

  6. Polarized scintillator targets

    Energy Technology Data Exchange (ETDEWEB)

    Brandt, B. van den E-mail: vandenbrandt@psi.ch; Bunyatova, E.I.; Hautle, P.; Konter, J.A.; Mango, S

    2000-05-21

    The hydrogen nuclei in an organic scintillator have been polarized to more than 80% and the deuterons in its fully deuterated version to 24%. The scintillator, doped with TEMPO, has been polarized dynamically in a field of 2.5 T in a vertical dilution refrigerator in which a plastic lightguide transports the scintillation light from the sample in the mixing chamber to a photomultiplier outside the cryostat. Sizeable solid samples with acceptable optical properties and light output have been prepared and successfully operated as 'live' polarized targets in nuclear physics experiments.

  7. Targeting Prostate Cancer Metastasis

    Science.gov (United States)

    2015-09-01

    achieve this goal, we cultured high-invasive prostate cancer PC3 cells and treated them with the drugs/inhibitors that were proposed to target WASF3...groups (treated by DMSO), either treated by 100 μM CYT997 or 10 μM Dasatinib suppressed the cells to spread throughout the fish body (Fig. 4). As...have scr eened t he e f fect s o f mor e t han 40 drugs on invasion using cul tur ed prost ate cancer cells and f ound t hat tar geting multiple

  8. Targeting Nuclear Thymidylate Biosynthesis

    Science.gov (United States)

    Chon, James; Stover, Patrick J.; Field, Martha S.

    2016-01-01

    Thymidylate (dTMP) biosynthesis plays an essential and exclusive function in DNA synthesis and proper cell division, and therefore has been an attractive therapeutic target. Folate analogues, known as antifolates, and nucleotide analogs that inhibit the enzymatic action of the de novo thymidylate biosynthesis pathway and are commonly used in cancer treatment. In this review, we examine the mechanisms by which the antifolate 5-fluorouracil, as well as other dTMP synthesis inhibitors, function in cancer treatment in light of emerging evidence that dTMP synthesis occurs in the nucleus. Nuclear localization of the de novo dTMP synthesis pathway requires modification of the pathway enzymes by the small ubiquitin-like modifier (SUMO) protein. SUMOylation is required for nuclear localization of the de novo dTMP biosynthesis pathway, and disruption in the SUMO pathway inhibits cell proliferation in several cancer models. We summarize evidence that the nuclear localization of the dTMP biosynthesis pathway is a critical factor in the efficacy of antifolate-based therapies that target dTMP synthesis. PMID:27876557

  9. Targeted corneal transplantation.

    Science.gov (United States)

    Jhanji, Vishal; Mehta, Jod S; Sharma, Namrata; Sharma, Bhavana; Vajpayee, Rasik B

    2012-07-01

    Corneal transplantation surgery has moved from an era of conventional penetrating keratoplasty to selective replacement of the diseased corneal layer with complementary healthy donor corneal tissue. Anterior lamellar transplantation surgeries do not involve replacement of corneal endothelium, consequently eliminating the occurrence of endothelial rejection. Similarly, in diseases affecting the corneal endothelium, selective replacement with a lamellar lenticule bearing healthy endothelium provides better outcomes in terms of ocular surface, lesser astigmatism and quick visual recovery. In addition to the advantages of enhanced surgical outcomes, targeted corneal transplantation allows the use of one donor cornea for more than one recipient, thereby offering a viable solution to the problem of paucity of donor corneas. Evolving techniques of corneal transplantation have enabled better utilization of donor corneal tissue. Anterior lamellar as well as endothelial keratoplasty surgeries have become first-choice surgeries in appropriately selected cases. This review briefly discusses some of these novel surgical techniques. A better understanding of targeted corneal transplantation would lead to adaptation of the concept of component corneal surgery. This would further enable the corneal surgeons to circumvent the problem of donor corneal shortage especially in the developing world.

  10. Fixed target beams

    CERN Document Server

    Kain, V; Cettour-Cave, S; Cornelis, K; Fraser, M A; Gatignon, L; Goddard, B; Velotti, F

    2017-01-01

    The CERN SPS (Super Proton Synchrotron) serves asLHC injector and provides beam for the North Area fixedtarget experiments. At low energy, the vertical acceptancebecomes critical with high intensity large emittance fixed tar-get beams. Optimizing the vertical available aperture is a keyingredient to optimize transmission and reduce activationaround the ring. During the 2016 run a tool was developed toprovide an automated local aperture scan around the entirering.The flux of particles slow extracted with the1/3inte-ger resonance from the Super Proton Synchrotron at CERNshould ideally be constant over the length of the extractionplateau, for optimum use of the beam by the fixed target ex-periments in the North Area. The extracted intensity is con-trolled in feed-forward correction of the horizontal tune viathe main SPS quadrupoles. The Mains power supply noiseat 50 Hz and harmonics is also corrected in feed-forwardby small amplitude tune modulation at the respective fre-quencies with a dedicated additional quad...

  11. Old Drug, New Target

    Science.gov (United States)

    Andrews, William J.; Panova, Tatiana; Normand, Christophe; Gadal, Olivier; Tikhonova, Irina G.; Panov, Konstantin I.

    2013-01-01

    Transcription by RNA polymerase I (Pol-I) is the main driving force behind ribosome biogenesis, a fundamental cellular process that requires the coordinated transcription of all three nuclear polymerases. Increased Pol-I transcription and the concurrent increase in ribosome biogenesis has been linked to the high rates of proliferation in cancers. The ellipticine family contains a number of potent anticancer therapeutic agents, some having progressed to stage I and II clinical trials; however, the mechanism by which many of the compounds work remains unclear. It has long been thought that inhibition of Top2 is the main reason behind the drugs antiproliferative effects. Here we report that a number of the ellipticines, including 9-hydroxyellipticine, are potent and specific inhibitors of Pol-I transcription, with IC50 in vitro and in cells in the nanomolar range. Essentially, the drugs did not affect Pol-II and Pol-III transcription, demonstrating a high selectivity. We have shown that Pol-I inhibition occurs by a p53-, ATM/ATR-, and Top2-independent mechanism. We discovered that the drug influences the assembly and stability of preinitiation complexes by targeting the interaction between promoter recognition factor SL1 and the rRNA promoter. Our findings will have an impact on the design and development of novel therapeutic agents specifically targeting ribosome biogenesis. PMID:23293027

  12. Quantum state targeting

    Science.gov (United States)

    Rudolph, Terry; Spekkens, Robert W.

    2004-11-01

    We introduce a primitive for quantum cryptography that we term “state targeting.” We show that increasing one’s probability of success in this task above a minimum amount implies an unavoidable increase in the probability of a particular kind of failure. This is analogous to the unavoidable disturbance to a quantum state that results from gaining information about its identity, and can be shown to be a purely quantum effect. We solve various optimization problems for state targeting that are useful for the security analysis of two-party cryptographic tasks implemented between remote antagonistic parties. Although we focus on weak coin flipping, the results are significant for other two-party protocols, such as strong coin flipping, partially binding and concealing bit commitment, and bit escrow. Furthermore, the results have significance not only for the traditional notion of security in cryptography, that of restricting a cheater’s ability to bias the outcome of the protocol, but also for a different notion of security that arises only in the quantum context, that of cheat sensitivity. Finally, our analysis leads to some interesting secondary results, namely, a generalization of Uhlmann’s theorem and an operational interpretation of the fidelity between two mixed states.

  13. Target Housing Material Options

    Energy Technology Data Exchange (ETDEWEB)

    Woloshun, Keith Albert [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-02-11

    With gas cooling, heat transfer coefficients are low compared to water. The benefit of gas from a heat transfer point of view is that there is really no upper temperature limit for the coolant, as compared to water, which is limited ultimately by the critical point, and in practice the critical heat flux. In our case with parallel flow channels, water is limited to even lower operating limits by nucleate boiling. So gas can get as hot as the containment material will allow, but to get the density and heat transfer up to something reasonable, we must also increase pressure, thus increasing stress on the containment, namely the front and back faces. We are designing to ASME BPVC, which, for most materials allows a maximum stress of UTS/3. So we want the highest possible UTS. For reference, the front face stress in the 12 mm target at 300 psi was about 90 MPa. The inconel 718 allowable stress at 900°C is 1/3 of 517 or 172 MPa. So we are in a very safe place, but the uTS is dropping rapidly with temperature above 900°C. As we increase target diameter, the challenge will be to keep the stress down. We are probably looking at keeping the allowable at or above the present value, and at as high a temperature as possible.

  14. Targeting adipose tissue

    Directory of Open Access Journals (Sweden)

    Haas Bodo

    2012-10-01

    Full Text Available Abstract Two different types of adipose tissues can be found in humans enabling them to respond to starvation and cold: white adipose tissue (WAT is generally known and stores excess energy in the form of triacylglycerol (TG, insulates against cold, and serves as a mechanical cushion. Brown adipose tissue (BAT helps newborns to cope with cold. BAT has the capacity to uncouple the mitochondrial respiratory chain, thereby generating heat rather than adenosine triphosphate (ATP. The previously widely held view was that BAT disappears rapidly after birth and is no longer present in adult humans. Using positron emission tomography (PET, however, it was recently shown that metabolically active BAT occurs in defined regions and scattered in WAT of the adult and possibly has an influence on whole-body energy homeostasis. In obese individuals adipose tissue is at the center of metabolic syndrome. Targeting of WAT by thiazolidinediones (TZDs, activators of peroxisome proliferator-activated receptor γ (PPARγ a ‘master’ regulator of fat cell biology, is a current therapy for the treatment of type 2 diabetes. Since its unique capacity to increase energy consumption of the body and to dissipate surplus energy as heat, BAT offers new perspectives as a therapeutic target for the treatment of obesity and associated diseases such as type 2 diabetes and metabolic syndrome. Recent discoveries of new signaling pathways of BAT development give rise to new therapeutic possibilities in order to influence BAT content and activity.

  15. Targeting adipose tissue.

    Science.gov (United States)

    Haas, Bodo; Schlinkert, Paul; Mayer, Peter; Eckstein, Niels

    2012-10-27

    Two different types of adipose tissues can be found in humans enabling them to respond to starvation and cold: white adipose tissue (WAT) is generally known and stores excess energy in the form of triacylglycerol (TG), insulates against cold, and serves as a mechanical cushion. Brown adipose tissue (BAT) helps newborns to cope with cold. BAT has the capacity to uncouple the mitochondrial respiratory chain, thereby generating heat rather than adenosine triphosphate (ATP). The previously widely held view was that BAT disappears rapidly after birth and is no longer present in adult humans. Using positron emission tomography (PET), however, it was recently shown that metabolically active BAT occurs in defined regions and scattered in WAT of the adult and possibly has an influence on whole-body energy homeostasis. In obese individuals adipose tissue is at the center of metabolic syndrome. Targeting of WAT by thiazolidinediones (TZDs), activators of peroxisome proliferator-activated receptor γ (PPARγ) a 'master' regulator of fat cell biology, is a current therapy for the treatment of type 2 diabetes. Since its unique capacity to increase energy consumption of the body and to dissipate surplus energy as heat, BAT offers new perspectives as a therapeutic target for the treatment of obesity and associated diseases such as type 2 diabetes and metabolic syndrome. Recent discoveries of new signaling pathways of BAT development give rise to new therapeutic possibilities in order to influence BAT content and activity.

  16. Low intensity beam target unit

    CERN Multimedia

    CERN PhotoLab

    1976-01-01

    This is a wheel fitted with many targets around its periphery (each with three longitudinally arranged thin rods) of which one is placed into the beam via a rotation of the wheel. Upstream of each target is placed a luminescent screen, aligbed on each target axis and viewed with a TV camera, to make sure that one is hitting the target. This target unit was probably used to study target's behaviour (like beam heating). Gualtiero Del Torre stands on the left, Pierre Gerdil on the right.

  17. Issues in Target Tracking

    Science.gov (United States)

    2010-05-01

    simulations we take as ground truth that the target moves at 10m/s heading west and 5m/s heading north, starting from ( 5000m , 35000m). The emitted frequency is... runs , the estimated initial and final positions fall into the 99% confidence region. −1 −0.8 −0.6 −0.4 −0.2 0 0.2 0.4 0.6 0.8 1 x 10 4 0 0.5 1 1.5 2 2.5...position of trajectories. “F”: final position of trajectories. Right: The true and estimated trajectories from 100 Monte Carlo runs for Johnson noise

  18. Bradycardia During Targeted Temperature Management

    DEFF Research Database (Denmark)

    Thomsen, Jakob Hartvig; Nielsen, Niklas; Hassager, Christian

    2016-01-01

    OBJECTIVES: Bradycardia is common during targeted temperature management, likely being a physiologic response to lower body temperature, and has recently been associated with favorable outcome following out-of-hospital cardiac arrest in smaller observational studies. The present study sought...... to confirm this finding in a large multicenter cohort of patients treated with targeted temperature management at 33°C and explore the response to targeted temperature management targeting 36°C. DESIGN: Post hoc analysis of a prospective randomized study. SETTING: Thirty-six ICUs in 10 countries. PATIENTS......: We studied 447 (targeted temperature management = 33°C) and 430 (targeted temperature management = 36°C) comatose out-of-hospital cardiac arrest patients with available heart rate data, randomly assigned in the targeted temperature management trial from 2010 to 2013. INTERVENTIONS: Targeted...

  19. Characterization of solid hydrogen targets

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, M.C. [British Columbia Univ., Vancouver, BC (Canada); Bailey, J.M.; Mulhauser, F. [Chester Technology (United Kingdom); Beer, G.A.; Douglas, J.L.; Knowles, P.E.; Maier, M.; Mason, G.R.; Olin, A.; Porcelli, T.A. [Victoria Univ., BC (Canada); Beveridge, J.L.; Marshall, G.M. [British Columbia Univ., Vancouver, BC (Canada). TRIUMF Facility; Huber, T.M. [Gustavus Adolphus Coll., St. Peter, MN (United States); Jacot-Guillarmod, R. [Fribourg Univ. (Switzerland); Kammel, P. [Lawrence Berkeley Lab., CA (United States); Kim, S.K. [Jeonbuk National Univ., Jeonju City (Korea, Republic of); Kunselman, A.R. [Wyoming Univ., Laramie, WY (United States); Martoff, C.J. [Temple Univ., Philadelphia, PA (United States); Petitjean, C. [Paul Scherrer Inst. (PSI), Villigen (Switzerland); Zmeskal, J. [Oesterreichische Akademie der Wissenschaften, Vienna (Austria)

    1996-10-01

    In experiments using the TRIUMF solid hydrogen target system, the knowledge of the target thickness and uniformity is often essential in order to extract physical parameters from the data. We have characterized the thickness and uniformity of frozen targets using the energy loss of alpha particles. An accuracy of {approx}5% was achieved, a limit imposed by the uncertainty in the stopping powers. The details of the method are described, and the thickness calibration of the target is presented. (orig.). 11 refs.

  20. Targeting cancer cells with the natural compound obtusaquinone.

    Science.gov (United States)

    Badr, Christian E; Van Hoppe, Stephanie; Dumbuya, Hawasatu; Tjon-Kon-Fat, Lee-Ann; Tannous, Bakhos A

    2013-05-01

    Tumor cells present high levels of oxidative stress. Cancer therapeutics exploiting such biochemical changes by increasing reactive oxygen species (ROS) production or decreasing intracellular ROS scavengers could provide a powerful treatment strategy. To test the effect of our compound, obtusaquinone (OBT), we used several cell viability assays on seven different glioblastoma (GBM) cell lines and primary cells and on 12 different cell lines representing various cancer types in culture as well as on subcutaneous (n = 7 mice per group) and two intracranial GBM (n = 6-8 mice per group) and breast cancer (n = 6 mice per group) tumor models in vivo. Immunoblotting, immunostaining, flow cytometry, and biochemical assays were used to investigate the OBT mechanism of action. Histopathological analysis (n = 2 mice per group) and blood chemistry (n = 2 mice per group) were used to test for any compound-related toxicity. Statistical tests were two-sided. OBT induced rapid increase in intracellular ROS levels, downregulation of cellular glutathione levels and increase in its oxidized form, and activation of cellular stress pathways and DNA damage, subsequently leading to apoptosis. Oxidative stress is believed to be the main mechanism through which this compounds targets cancer cells. OBT was well tolerated in mice, slowed tumor growth, and statistically prolonged survival in GBM tumor models. The ratio of median survival in U251 intracranial model in OBT vs control was 1.367 (95% confidence interval [CI] of ratio = 1.031 to 1.367, P = .008). Tumor growth inhibition was also observed in a mouse breast cancer model (average tumor volume per mouse, OBT vs control: 36.3 vs 200.4mm(3), difference = 164.1mm(3), 95% CI =72.6 to 255.6mm(3), P = .005). Given its properties and efficacy in cancer killing, our results suggest that OBT is a promising cancer therapeutic.

  1. Target noise in overlay metrology

    Science.gov (United States)

    Seligson, Joel L.; Adel, Mike E.; Izikson, Pavel; Levinski, Vladimir; Yaffe, Dan

    2004-05-01

    We have developed a method for calculating the statistical effects of spatial noise on the overlay measurement extracted from a given overlay target. The method has been applied to two kinds of overlay targets on three process layers, and the new metric, Target Noise, has been shown to correlate well to the random component of Overlay Mark Fidelity. A significant difference in terms of robustness has been observed between AIM targets and conventional Frame-in-Frame targets. The results fit well into the spatial noise hierarchy presented in this paper.

  2. EURISOL High Power Targets

    CERN Document Server

    Kadi, Y; Lindroos, M; Ridikas, D; Stora, T; Tecchio, L; CERN. Geneva. BE Department

    2009-01-01

    Modern Nuclear Physics requires access to higher yields of rare isotopes, that relies on further development of the In-flight and Isotope Separation On-Line (ISOL) production methods. The limits of the In-Flight method will be applied via the next generation facilities FAIR in Germany, RIKEN in Japan and RIBF in the USA. The ISOL method will be explored at facilities including ISAC-TRIUMF in Canada, SPIRAL-2 in France, SPES in Italy, ISOLDE at CERN and eventually at the very ambitious multi-MW EURISOL facility. ISOL and in-flight facilities are complementary entities. While in-flight facilities excel in the production of very short lived radioisotopes independently of their chemical nature, ISOL facilities provide high Radioisotope Beam (RIB) intensities and excellent beam quality for 70 elements. Both production schemes are opening vast and rich fields of nuclear physics research. In this article we will introduce the targets planned for the EURISOL facility and highlight some of the technical and safety cha...

  3. The target effect: visual memory for unnamed search targets.

    Science.gov (United States)

    Thomas, Mark D; Williams, Carrick C

    2014-01-01

    Search targets are typically remembered much better than other objects even when they are viewed for less time. However, targets have two advantages that other objects in search displays do not have: They are identified categorically before the search, and finding them represents the goal of the search task. The current research investigated the contributions of both of these types of information to the long-term visual memory representations of search targets. Participants completed either a predefined search or a unique-object search in which targets were not defined with specific categorical labels before searching. Subsequent memory results indicated that search target memory was better than distractor memory even following ambiguously defined searches and when the distractors were viewed significantly longer. Superior target memory appears to result from a qualitatively different representation from those of distractor objects, indicating that decision processes influence visual memory.

  4. Guidance and targeting for the Strategic Target System

    Science.gov (United States)

    White, John E.

    Guidance algorithms and targeting procedures for the Strategic Target System (STARS) launch vehicle are described. The STARS vehicle is a three stage booster, based partly upon retired Polaris A3 missile assets, which is intended to support development and testing of the Strategic Defense Initiative by delivering target payloads to the vicinity of the Kwajalein Atoll. STARS will be launched from the Kauai Test Facility located on Kauai, Hawaii. The STARS guidance objective is to deliver payloads to a prescribed target location with maximum accuracy at intercontinental ballistic missile velocities. Mission objectives are achieved with a combination of guidance algorithms.

  5. Contributions of Mamu-A*01 status and TRIM5 allele expression, but not CCL3L copy number variation, to the control of SIVmac251 replication in Indian-origin rhesus monkeys.

    Directory of Open Access Journals (Sweden)

    So-Yon Lim

    2010-06-01

    Full Text Available CCL3 is a ligand for the HIV-1 co-receptor CCR5. There have recently been conflicting reports in the literature concerning whether CCL3-like gene (CCL3L copy number variation (CNV is associated with resistance to HIV-1 acquisition and with both viral load and disease progression following infection with HIV-1. An association has also been reported between CCL3L CNV and clinical sequelae of the simian immunodeficiency virus (SIV infection in vivo in rhesus monkeys. The present study was initiated to explore the possibility of an association of CCL3L CNV with the control of virus replication and AIDS progression in a carefully defined cohort of SIVmac251-infected, Indian-origin rhesus monkeys. Although we demonstrated extensive variation in copy number of CCL3L in this cohort of monkeys, CCL3L CNV was not significantly associated with either peak or set-point plasma SIV RNA levels in these monkeys when MHC class I allele Mamu-A*01 was included in the models or progression to AIDS in these monkeys. With 66 monkeys in the study, there was adequate power for these tests if the correlation of CCL3L and either peak or set-point plasma SIV RNA levels was 0.34 or 0.36, respectively. These findings call into question the premise that CCL3L CNV is important in HIV/SIV pathogenesis.

  6. Contributions of Mamu-A*01 status and TRIM5 allele expression, but not CCL3L copy number variation, to the control of SIVmac251 replication in Indian-origin rhesus monkeys.

    Science.gov (United States)

    Lim, So-Yon; Chan, Tiffany; Gelman, Rebecca S; Whitney, James B; O'Brien, Kara L; Barouch, Dan H; Goldstein, David B; Haynes, Barton F; Letvin, Norman L

    2010-06-24

    CCL3 is a ligand for the HIV-1 co-receptor CCR5. There have recently been conflicting reports in the literature concerning whether CCL3-like gene (CCL3L) copy number variation (CNV) is associated with resistance to HIV-1 acquisition and with both viral load and disease progression following infection with HIV-1. An association has also been reported between CCL3L CNV and clinical sequelae of the simian immunodeficiency virus (SIV) infection in vivo in rhesus monkeys. The present study was initiated to explore the possibility of an association of CCL3L CNV with the control of virus replication and AIDS progression in a carefully defined cohort of SIVmac251-infected, Indian-origin rhesus monkeys. Although we demonstrated extensive variation in copy number of CCL3L in this cohort of monkeys, CCL3L CNV was not significantly associated with either peak or set-point plasma SIV RNA levels in these monkeys when MHC class I allele Mamu-A*01 was included in the models or progression to AIDS in these monkeys. With 66 monkeys in the study, there was adequate power for these tests if the correlation of CCL3L and either peak or set-point plasma SIV RNA levels was 0.34 or 0.36, respectively. These findings call into question the premise that CCL3L CNV is important in HIV/SIV pathogenesis.

  7. Production of {sup 256}Lr in the {sup 249,250,251}Cf + {sup 11}B, {sup 243}Am + {sup 18}O, and {sup 248}Cm + {sup 14}N reactions

    Energy Technology Data Exchange (ETDEWEB)

    Sato, N.; Sato, T.K.; Asai, M. [Japan Atomic Energy Agency, Ibaraki (Japan). Advanced Science Research Center; and others

    2014-04-01

    Production cross-sections of the isotope {sup 256}Lr in the {sup 249,250,251}Cf + {sup 11}B, {sup 243}Am + {sup 18}O, and {sup 248}Cm + {sup 14}N reactions were measured using a He/KCl gas-jet transport system and a rotating wheel a-particle detection apparatus. The α-particle energy of {sup 256}Lr was distributed from 8.3 to 8.7 MeV and its half-life, T{sub 1/2}, was measured to be 28 ± 1 s. The maximum cross sections in the {sup 249}Cf({sup 11}B, 4n){sup 256}Lr and {sup 243}Am({sup 18}O, 5n){sup 256}Lr reactions were determined to be 122 ± 36 nb at the beam energy of 63 MeV and 26 ± 7 nb at 96 MeV, respectively. In the {sup 248}Cm({sup 14}N, 6n){sup 256}Lr reaction, the cross section was measured to be 27 ± 10 nb at 91 MeV. (orig.)

  8. Oxide Fiber Targets at ISOLDE

    CERN Document Server

    Köster, U; Carminati, D; Catherall, R; Cederkäll, J; Correia, J G; Crepieux, B; Dietrich, M; Elder, K; Fedosseev, V; Fraile-Prieto, L M; Franchoo, S; Fynbo, H O U; Georg, U; Giles, T; Joinet, A; Jonsson, O C; Kirchner, R; Lau, C; Lettry, Jacques; Maier, H J; Mishin, V I; Oinonen, M; Peräjärvi, K; Ravn, H L; Rinaldi, T; Santana-Leitner, M; Wahl, U; Weissman, L

    2003-01-01

    Many elements are rapidly released from oxide matrices. Some oxide powder targets show a fast sintering, thus losing their favorable release characteristics. Loosely packed oxyde fiber targets are less critical since they may maintain their open structure even when starting to fuse together at some contact points. The experience with various oxyde fiber targets (titania, zirconia, ceria and thoria) used in the last years at ISOLDE is reviewed. For short-lived isotopes of Cu, Ga and Xe the zirconia and ceria targets respectively provided significantly higher yields than any other target (metal foils, oxide powders, etc.) tested before. Titania fibers, which were not commercially available, were produced in a relic process by impregnation of a rayon felt in a titanium chloride solution and subsequent calcination by heating the dried felt in air. Thoria fibers were obtained either by the same process or by burning commercial gas lantern mantle cloth. In the future a beryllia fiber target could be used to produce...

  9. Therapeutic Targeting of Telomerase

    Directory of Open Access Journals (Sweden)

    Kathrin Jäger

    2016-07-01

    Full Text Available Telomere length and cell function can be preserved by the human reverse transcriptase telomerase (hTERT, which synthesizes the new telomeric DNA from a RNA template, but is normally restricted to cells needing a high proliferative capacity, such as stem cells. Consequently, telomerase-based therapies to elongate short telomeres are developed, some of which have successfully reached the stage I in clinical trials. Telomerase is also permissive for tumorigenesis and 90% of all malignant tumors use telomerase to obtain immortality. Thus, reversal of telomerase upregulation in tumor cells is a potential strategy to treat cancer. Natural and small-molecule telomerase inhibitors, immunotherapeutic approaches, oligonucleotide inhibitors, and telomerase-directed gene therapy are useful treatment strategies. Telomerase is more widely expressed than any other tumor marker. The low expression in normal tissues, together with the longer telomeres in normal stem cells versus cancer cells, provides some degree of specificity with low risk of toxicity. However, long term telomerase inhibition may elicit negative effects in highly-proliferative cells which need telomerase for survival, and it may interfere with telomere-independent physiological functions. Moreover, only a few hTERT molecules are required to overcome senescence in cancer cells, and telomerase inhibition requires proliferating cells over a sufficient number of population doublings to induce tumor suppressive senescence. These limitations may explain the moderate success rates in many clinical studies. Despite extensive studies, only one vaccine and one telomerase antagonist are routinely used in clinical work. For complete eradication of all subpopulations of cancer cells a simultaneous targeting of several mechanisms will likely be needed. Possible technical improvements have been proposed including the development of more specific inhibitors, methods to increase the efficacy of vaccination

  10. Target Acquisition Methodology Enhancement (TAME)

    Science.gov (United States)

    1989-03-01

    acquisition probability from COMINT, PCOM , against all communications type targets, is determined offline by a stochastic model for subsequent...of PN over all replications. F-4 f. Computes overall acquisition probability, PCOM , against all communications type targets as C: PCOM = (1. - PN...NNET where NNET denotes the number of nets which the target is in. F-6. TOTAL ACQUISITION PROBABILITY. With PNCj and PCOM computed as above, the

  11. Guidance system for laser targets

    Science.gov (United States)

    Porter, Gary D.; Bogdanoff, Anatoly

    1978-01-01

    A system for guiding charged laser targets to a predetermined focal spot of a laser along generally arbitrary, and especially horizontal, directions which comprises a series of electrostatic sensors which provide inputs to a computer for real time calculation of position, velocity, and direction of the target along an initial injection trajectory, and a set of electrostatic deflection means, energized according to a calculated output of said computer, to change the target trajectory to intercept the focal spot of the laser which is triggered so as to illuminate the target of the focal spot.

  12. Targeted nanotechnology for cancer imaging.

    Science.gov (United States)

    Toy, Randall; Bauer, Lisa; Hoimes, Christopher; Ghaghada, Ketan B; Karathanasis, Efstathios

    2014-09-30

    Targeted nanoparticle imaging agents provide many benefits and new opportunities to facilitate accurate diagnosis of cancer and significantly impact patient outcome. Due to the highly engineerable nature of nanotechnology, targeted nanoparticles exhibit significant advantages including increased contrast sensitivity, binding avidity and targeting specificity. Considering the various nanoparticle designs and their adjustable ability to target a specific site and generate detectable signals, nanoparticles can be optimally designed in terms of biophysical interactions (i.e., intravascular and interstitial transport) and biochemical interactions (i.e., targeting avidity towards cancer-related biomarkers) for site-specific detection of very distinct microenvironments. This review seeks to illustrate that the design of a nanoparticle dictates its in vivo journey and targeting of hard-to-reach cancer sites, facilitating early and accurate diagnosis and interrogation of the most aggressive forms of cancer. We will report various targeted nanoparticles for cancer imaging using X-ray computed tomography, ultrasound, magnetic resonance imaging, nuclear imaging and optical imaging. Finally, to realize the full potential of targeted nanotechnology for cancer imaging, we will describe the challenges and opportunities for the clinical translation and widespread adaptation of targeted nanoparticles imaging agents. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Targets and Secondary Beam Extraction

    Science.gov (United States)

    Noah, Etam

    2014-02-01

    Several applications make use of secondary beams of particles generated by the interaction of a primary beam of particles with a target. Spallation neutrons, bremsstrahlung photon-produced neutrons, radioactive ions and neutrinos are available to users at state-of-the-art facilities worldwide. Plans for even higher secondary beam intensities place severe constraints on the design of targets. This article reports on the main targetry challenges and highlights a variety of solutions for targetry and secondary beam extraction. Issues related to target station layout, instrumentation at the beam-target interface, safety and radioprotection are also discussed.

  14. Achieving Plant CRISPR Targeting that Limits Off-Target Effects

    Directory of Open Access Journals (Sweden)

    Jeffrey D. Wolt

    2016-11-01

    Full Text Available The CRISPR-Cas9 system (clustered regularly interspaced short palindromic repeats with associated Cas9 protein has been used to generate targeted changes for direct modification of endogenous genes in an increasing number of plant species; but development of plant genome editing has not yet fully considered potential off-target mismatches that may lead to unintended changes within the genome. Assessing the specificity of CRISPR-Cas9 for increasing editing efficiency as well as the potential for unanticipated downstream effects from off-target mutations is an important regulatory consideration for agricultural applications. Increasing genome-editing specificity entails developing improved design methods that better predict the prevalence of off-target mutations as a function of genome composition and design of the engineered ribonucleoprotein (RNP. Early results from CRISPR-Cas9 genome editing in plant systems indicate that the incidence of off-target mutation frequencies is quite low; however, by analyzing CRISPR-edited plant lines and improving both computational tools and reagent design, it may be possible to further decrease unanticipated effects at potential mismatch sites within the genome. This will provide assurance that CRISPR-Cas9 reagents can be designed and targeted with a high degree of specificity. Improved and experimentally validated design tools for discriminating target and potential off-target positions that incorporate consideration of the designed nuclease fidelity and selectivity will help to increase confidence for regulatory decision making for genome-edited plants.

  15. Literature evidence in open targets - a target validation platform.

    Science.gov (United States)

    Kafkas, Şenay; Dunham, Ian; McEntyre, Johanna

    2017-06-06

    We present the Europe PMC literature component of Open Targets - a target validation platform that integrates various evidence to aid drug target identification and validation. The component identifies target-disease associations in documents and ranks the documents based on their confidence from the Europe PMC literature database, by using rules utilising expert-provided heuristic information. The confidence score of a given document represents how valuable the document is in the scope of target validation for a given target-disease association by taking into account the credibility of the association based on the properties of the text. The component serves the platform regularly with the up-to-date data since December, 2015. Currently, there are a total number of 1168365 distinct target-disease associations text mined from >26 million PubMed abstracts and >1.2 million Open Access full text articles. Our comparative analyses on the current available evidence data in the platform revealed that 850179 of these associations are exclusively identified by literature mining. This component helps the platform's users by providing the most relevant literature hits for a given target and disease. The text mining evidence along with the other types of evidence can be explored visually through https://www.targetvalidation.org and all the evidence data is available for download in json format from https://www.targetvalidation.org/downloads/data .

  16. Transverse target spin asymmetries on a proton target at COMPASS

    CERN Document Server

    Richter, Andreas

    2009-01-01

    Transversity and transverse momentum-dependent parton distribution functions (TMDs) are been measured in semi-inclusive deep inelastic scattering (SIDIS) by using a transversely polarized target at the COMPASS experiment. COMPASS is a fixed target experiment at the CERN M2 beamline, which provides a 160GeV/c polarized m+ beam. In the years 2002-2004 COMPASS has collected data with a transversely polarized deuteron 6LiD target. In 2007, COMPASS has used for the first time a proton NH3 target. To access transversity COMPASS has used three different quark polarimeters: the Collins effect, responsible for an azimuthal asymmetry in the single hadron distribution, azimuthal target spin asymmetries of charged hadron pairs and the transverse polarisation of L hyperons. Beside this also the Sivers asymmetry arising from the correlation between the transverse nucleon spin and the quark intrinsic transverse momentum was measured. European

  17. Treating rheumatoid arthritis to target

    DEFF Research Database (Denmark)

    Smolen, Josef S; Aletaha, Daniel; Bijlsma, Johannes W J

    2010-01-01

    BACKGROUND: Aiming at therapeutic targets has reduced the risk of organ failure in many diseases such as diabetes or hypertension. Such targets have not been defined for rheumatoid arthritis (RA). OBJECTIVE: /st> To develop recommendations for achieving optimal therapeutic outcomes in RA. METHODS...

  18. Treating rheumatoid arthritis to target

    DEFF Research Database (Denmark)

    Smolen, Josef S; Breedveld, Ferdinand C; Burmester, Gerd R

    2016-01-01

    BACKGROUND: Reaching the therapeutic target of remission or low-disease activity has improved outcomes in patients with rheumatoid arthritis (RA) significantly. The treat-to-target recommendations, formulated in 2010, have provided a basis for implementation of a strategic approach towards this t...

  19. Saccadic adaptation to moving targets.

    Directory of Open Access Journals (Sweden)

    Katharina Havermann

    Full Text Available Saccades are so called ballistic movements which are executed without online visual feedback. After each saccade the saccadic motor plan is modified in response to post-saccadic feedback with the mechanism of saccadic adaptation. The post-saccadic feedback is provided by the retinal position of the target after the saccade. If the target moves after the saccade, gaze may follow the moving target. In that case, the eyes are controlled by the pursuit system, a system that controls smooth eye movements. Although these two systems have in the past been considered as mostly independent, recent lines of research point towards many interactions between them. We were interested in the question if saccade amplitude adaptation is induced when the target moves smoothly after the saccade. Prior studies of saccadic adaptation have considered intra-saccadic target steps as learning signals. In the present study, the intra-saccadic target step of the McLaughlin paradigm of saccadic adaptation was replaced by target movement, and a post-saccadic pursuit of the target. We found that saccadic adaptation occurred in this situation, a further indication of an interaction of the saccadic system and the pursuit system with the aim of optimized eye movements.

  20. Saccadic adaptation to moving targets.

    Science.gov (United States)

    Havermann, Katharina; Volcic, Robert; Lappe, Markus

    2012-01-01

    Saccades are so called ballistic movements which are executed without online visual feedback. After each saccade the saccadic motor plan is modified in response to post-saccadic feedback with the mechanism of saccadic adaptation. The post-saccadic feedback is provided by the retinal position of the target after the saccade. If the target moves after the saccade, gaze may follow the moving target. In that case, the eyes are controlled by the pursuit system, a system that controls smooth eye movements. Although these two systems have in the past been considered as mostly independent, recent lines of research point towards many interactions between them. We were interested in the question if saccade amplitude adaptation is induced when the target moves smoothly after the saccade. Prior studies of saccadic adaptation have considered intra-saccadic target steps as learning signals. In the present study, the intra-saccadic target step of the McLaughlin paradigm of saccadic adaptation was replaced by target movement, and a post-saccadic pursuit of the target. We found that saccadic adaptation occurred in this situation, a further indication of an interaction of the saccadic system and the pursuit system with the aim of optimized eye movements.

  1. Target recognition by wavelet transform

    CERN Document Server

    Li Zheng Dong; He Wu Liang; Pei Chun Lan; Peng Wen; SongChen; Zheng Xiao Dong

    2002-01-01

    Wavelet transform has an important character of multi-resolution power, which presents pyramid structure, and this character coincides the way by which people distinguish object from coarse to fineness and from large to tiny. In addition to it, wavelet transform benefits to reducing image noise, simplifying calculation, and embodying target image characteristic point. A method of target recognition by wavelet transform is provided

  2. ISOLDE target zone control room

    CERN Multimedia

    2016-01-01

    Operating the ISOLDE target handling robots from the dedicated control room in building 197. Monitors showing the movements of the robots (GPS in this case) in the target zone. The footage shows the actual operation by the operator as well as the different equipment such as camera electronics, camera motor controls, camera monitors and Kuka robot controls touch panel.

  3. Targeted marketing and public health.

    Science.gov (United States)

    Grier, Sonya A; Kumanyika, Shiriki

    2010-01-01

    Targeted marketing techniques, which identify consumers who share common needs or characteristics and position products or services to appeal to and reach these consumers, are now the core of all marketing and facilitate its effectiveness. However, targeted marketing, particularly of products with proven or potential adverse effects (e.g., tobacco, alcohol, entertainment violence, or unhealthful foods) to consumer segments defined as vulnerable raises complex concerns for public health. It is critical that practitioners, academics, and policy makers in marketing, public health, and other fields recognize and understand targeted marketing as a specific contextual influence on the health of children and adolescents and, for different reasons, ethnic minority populations and other populations who may benefit from public health protections. For beneficial products, such understanding can foster more socially productive targeting. For potentially harmful products, understanding the nature and scope of targeted marketing influences will support identification and implementation of corrective policies.

  4. Oxide fiber targets at ISOLDE

    DEFF Research Database (Denmark)

    Köster, U.; Bergmann, U.C.; Carminati, D.

    2003-01-01

    Many elements are rapidly released from oxide matrices. Some oxide powder targets show a fast sintering, thus losing their favorable release characteristics. Loosely packed oxide fiber targets are less critical since they may maintain their open structure even when starting to fuse together at some...... contact points. The experience with various oxide fiber targets (titania, zirconia, ceria and thoria) used in the last years at ISOLDE is reviewed. For short-lived isotopes of Cu, Ga and Xe the zirconia and ceria targets respectively provided significantly higher yields than any other target (metal foils......, oxide powders, etc.) tested before. Titania fibers, which were not commercially available, were produced in a relic process by impregnation of a rayon felt in a titanium chloride solution and subsequent calcination by heating the dried felt in air. Thoria fibers were obtained either by the same process...

  5. The Bering Target Tracking Instrumentation

    DEFF Research Database (Denmark)

    Denver, Troelz; Jørgensen, John Leif; Betto, Maurizio

    2003-01-01

    The key science instrument on the Bering satellite mission is a relative small telescope with an entrance aperture of 300 mm and a focal length between 500 and 1000 mm. The detection of potential targets is performed by one of the target scanning advanced stellar compasses (ASCs). This procedure...... results in a simple prioritized list of right ascension, declination, proper motion and intensity of each prospective target. The telescope itself has a dedicated ASC Camera Head Unit (CHU) mounted on the secondary mirror, largely co-aligned with the telescope. This CHU accurately determines the telescope......'s pointing direction. To achieve fast tracking over a large solid angle, the telescope pointing is achieved by means of a folding mirror in the optical pathway. When a prospective target approaches the telescope FOV, the ASC on the secondary will guide the folding mirror into position such that the target...

  6. High speed cryogenic monodisperse targets

    Science.gov (United States)

    Boukharov, A.; Vishnevkii, E.

    2017-11-01

    The basic possibility of creation of high speed cryogenic monodisperse targets is shown. According to calculations at input of thin liquid cryogenic jets with a velocity of bigger 100 m/s in vacuum the jets don’t manage to freeze at distance to 1 mm and can be broken into monodisperse drops. Drops due to evaporation are cooled and become granules. High speed cryogenic monodisperse targets have the following advantages: direct input in vacuum (there is no need for a chamber of a triple point chamber and sluices), it is possible to use the equipment of a cluster target, it is possible to receive targets with a diameter of D 100m/s), exact synchronization of the target hitting moment in a beam with the moment of sensors turning on.

  7. 36 CFR 251.58 - Cost recovery.

    Science.gov (United States)

    2010-07-01

    ... or mitigate damage to real property, or to mitigate hazards or dangers to public health and safety resulting from an act of God, an act of war, or negligence of the United States; (iv) The application is for...

  8. Publications | Page 251 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Changes in hydrological extremes will have implications on the design of future hydraulic structures, flood plain development, and water resource management. This study assesses the potential impact of climate change on extreme hydrological events in the Akaki River catchment area in and around... Understanding the ...

  9. 37 CFR 251.13 - Closed meetings.

    Science.gov (United States)

    2010-07-01

    ...) Interfere with enforcement proceedings; or (2) Deprive a person of the right to a fair trial or impartial... confidential source or, in the case of a criminal investigation or a national security intelligence... participation in a civil action or proceeding or in an action in a foreign court or international tribunal, or...

  10. 36 CFR 251.53 - Authorities.

    Science.gov (United States)

    2010-07-01

    ... events and distribution of noncommercial printed materials, under the act of June 4, 1897, 30 Stat. 35... transportation and distribution of solid materials, and facilities for the storage of such materials in... U.S.C. 470aa). (n) Operation of nordic and alpine ski areas and facilities for up to 40 years and...

  11. 15 CFR 904.251 - Evidence.

    Science.gov (United States)

    2010-01-01

    ... the agency as an expert body. Where a decision or part thereof rests on official notice of a material... relevant material or source, whether or not submitted by a party. (2) Exhibits in a foreign language must...

  12. 36 CFR 251.51 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... land. Secretary—the Secretary of Agriculture. Ski area—a site and attendant facilities expressly developed to accommodate alpine or nordic skiing and from which the preponderance of revenue is generated by the sale of lift tickets and fees for ski rentals, for skiing instruction and trail passes for the use...

  13. Publications | Page 251 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Through books, articles, research publications, and studies, we aim to widen the impact of our investment and advance development research. ... Dr Peter Daszak and Dr Margot Parkes agree that the International Association for Ecology and Health (EcoHealth) stands to gain tremendously through partnering with other ...

  14. 24 CFR 203.251 - Definitions.

    Science.gov (United States)

    2010-04-01

    ...) Debentures means registered, transferable securities in certificated or book entry form which are valid and binding obligations, issued in the name of the Mutual Mortgage Insurance Fund in accordance with the... to be used within an automated underwriting system (AUS). TOTAL is a tool to assist the mortgagee in...

  15. 251 - 258_Hajara_Mobile exhaust

    African Journals Online (AJOL)

    pc

    of stomata, pore length and pore breadth in the polluted sites was low site. Furthermore ... light and C02 concentration (Wood and Kelly, 1995). Atmospheric ... pollution. For comparison, collections were done also from a relatively clean area which is Kano state. Botanical garden located inside the Kano State. Zoological ...

  16. Reference: 251 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available ing complexes mediate ATP-dependent alterations of DNA-histone contacts. The minimal functional core of cons...t, and reduced fertility. Plants carrying atswi3d mutations display severe dwarfism, alterations in the numb

  17. Publications | Page 251 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    "We need [the EcoHealth] journal to help articulate what ecohealth is and to encourage the growth of the community," said Dr Bruce Wilcox, the publication's ... Cutting down consumption of non-food items, borrowing from informal markets, and increased dependence on friends and family are common strategies perceived ...

  18. 16 CFR 251.1 - The guide.

    Science.gov (United States)

    2010-01-01

    ... and Labeling Regulation Regarding ‘Cents-Off’ and Guides Against Deceptive Pricing.”) (b) Meaning of... the product or service in the geographic market or trade area in which he is making a “Free” or...

  19. 7 CFR 251.5 - Eligibility determinations.

    Science.gov (United States)

    2010-01-01

    ... funds, must ensure that an organization applying for participation in the program meets the definition... predominantly needy persons. State agencies may establish a higher standard than “predominantly” and may..., however, require organizations to employ a means test to determine that recipients are needy, or to keep...

  20. 40 CFR 60.251 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... instrument that operates on triboelectric, light scattering, light transmittance, or other effect to... PERFORMANCE FOR NEW STATIONARY SOURCES Standards of Performance for Coal Preparation and Processing Plants... reference—see § 60.17), and coal refuse. (e) Coal preparation and processing plant means any facility...

  1. 30 CFR 251.1 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... occurrence means the direct or indirect detection during drilling operations of any liquid or gaseous..., geopressured-geothermal and associated resources, and all other minerals which are authorized by an Act of..., gas, and sulphur mean oil, gas, sulphur, geopressured-geothermal, and associated resources. Outer...

  2. 7 CFR 1951.251 - Purpose.

    Science.gov (United States)

    2010-01-01

    ... need for continued Agency supervision, further credit, and graduation. All loan accounts will be... REGULATIONS (CONTINUED) SERVICING AND COLLECTIONS Analyzing Credit Needs and Graduation of Borrowers § 1951... Development Loan Funds, and Rural Rental Housing loans made to build or acquire new units pursuant to...

  3. 7 CFR 251.3 - Definitions.

    Science.gov (United States)

    2010-01-01

    ... following categories: (i) Emergency feeding organizations (including food banks, food pantries and soup kitchens); (ii) Charitable institutions (including hospitals and retirement homes); (iii) Summer camps for... congregate Nutrition sites and projects that provide home-delivered meals; and (v) Disaster relief programs...

  4. 7 CFR 251.10 - Miscellaneous provisions.

    Science.gov (United States)

    2010-01-01

    ..., disposal, and inventory of commodities received under this part that they, in turn, distribute to eligible... accessible at all times for use during management evaluation reviews, audits or investigations. (b... because of race, color, national origin, sex, age, or handicap. (d) Reports—(1) Submission of Form FNS-667...

  5. 42 CFR 84.251 - Required components.

    Science.gov (United States)

    2010-10-01

    ... Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES OCCUPATIONAL SAFETY AND HEALTH... indicator; (3) Cartridge with end-of-service-life indicator; (4) Harness; (5) Attached blower; and (6) Breathing tube. (b) The components of each vinyl chloride respirator shall meet the minimum construction...

  6. 37 CFR 251.31 - Financial interests.

    Science.gov (United States)

    2010-07-01

    ... or blind trust which might have an interest in a prohibited entity but whose decisions to invest or... own interests: (1) The arbitrator's spouse; (2) The arbitrator's minor child; (3) The arbitrator's...

  7. Tracking Target and Spiral Waves

    DEFF Research Database (Denmark)

    Jensen, Flemming G.; Sporring, Jon; Nielsen, Mads

    2002-01-01

    A new algorithm for analyzing the evolution of patterns of spiral and target waves in large aspect ratio chemical systems is introduced. The algorithm does not depend on finding the spiral tip but locates the center of the pattern by a new concept, called the spiral focus, which is defined...... by the evolutes of the actual spiral or target wave. With the use of Gaussian smoothing, a robust method is developed that permits the identification of targets and spirals foci independently of the wave profile. Examples of an analysis of long image sequences from experiments with the Belousov...

  8. Targeted intraoperative radiotherapy in oncology

    CERN Document Server

    Keshtgar, Mohammed; Wenz, Frederik

    2014-01-01

    Targeted intraoperative radiotherapy is a major advance in the management of cancer patients. With an emphasis on practical aspects, this book offers an ideal introduction to this innovative  technology for clinicians.

  9. Hyperspectral-Augmented Target Tracking

    National Research Council Canada - National Science Library

    Soliman, Neil A

    2008-01-01

    ... air with the capability to seek, monitor, and destroy mobile terrorist targets in hostile territory. One such capability recognizes and persistently tracks multiple moving vehicles in complex, highly ambiguous urban environments...

  10. After treat-to-target

    DEFF Research Database (Denmark)

    Wakefield, Richard J; D'Agostino, Maria Antonietta; Naredo, Esperanza

    2012-01-01

    have recently formed a research network - the Targeted Ultrasound Initiative (TUI) group. The statement proposes that targeting therapy to PD activity provides superior outcomes compared with treating to clinical targets alone and introduces the rationale for a new randomised trial using targeted...... defined by clinical remission criteria (disease activity score, simplified disease activity index, etc) does not always equate to the complete absence of inflammation as measured by new sensitive imaging techniques such as ultrasound (US) . There is evidence that imaging synovitis is frequently found...... in these patients and associated with adverse clinical and functional outcomes. This article reviews the data regarding remission, ultrasound imaging and outcomes in patients with RA to provide the background to a consensus statement from an international collaboration of ultrasonographers and rheumatologists who...

  11. After treat-to-target

    DEFF Research Database (Denmark)

    Wakefield, Richard J; D'Agostino, Maria Antonietta; Naredo, Esperanza

    2012-01-01

    have recently formed a research network--the Targeted Ultrasound Initiative (TUI) group. The statement proposes that targeting therapy to PD activity provides superior outcomes compared with treating to clinical targets alone and introduces the rationale for a new randomised trial using targeted...... defined by clinical remission criteria (disease activity score, simplified disease activity index, etc) does not always equate to the complete absence of inflammation as measured by new sensitive imaging techniques such as ultrasound (US) . There is evidence that imaging synovitis is frequently found...... in these patients and associated with adverse clinical and functional outcomes. This article reviews the data regarding remission, ultrasound imaging and outcomes in patients with RA to provide the background to a consensus statement from an international collaboration of ultrasonographers and rheumatologists who...

  12. Targeted therapy for pediatric glioma

    NARCIS (Netherlands)

    Olow, A.K.

    2015-01-01

    This thesis assesses molecular underpinnings of responses to promising targeted agents for pediatric tumors of Central Nervous System (CNS), incorporating preclinical testing of novel and translatable combination therapies to define the best therapy for each tumor cell specific molecular aberration.

  13. Physics of Automatic Target Recognition

    CERN Document Server

    Sadjadi, Firooz

    2007-01-01

    Physics of Automatic Target Recognition addresses the fundamental physical bases of sensing, and information extraction in the state-of-the art automatic target recognition field. It explores both passive and active multispectral sensing, polarimetric diversity, complex signature exploitation, sensor and processing adaptation, transformation of electromagnetic and acoustic waves in their interactions with targets, background clutter, transmission media, and sensing elements. The general inverse scattering, and advanced signal processing techniques and scientific evaluation methodologies being used in this multi disciplinary field will be part of this exposition. The issues of modeling of target signatures in various spectral modalities, LADAR, IR, SAR, high resolution radar, acoustic, seismic, visible, hyperspectral, in diverse geometric aspects will be addressed. The methods for signal processing and classification will cover concepts such as sensor adaptive and artificial neural networks, time reversal filt...

  14. National Ignition Facility Target Chamber

    Energy Technology Data Exchange (ETDEWEB)

    Wavrik, R W; Cox, J R; Fleming, P J

    2000-10-05

    On June 11, 1999 the Department of Energy dedicated the single largest piece of the National Ignition Facility (NIF) at Lawrence Livermore National Laboratory (LLNL) in Livermore, California. The ten (10) meter diameter aluminum target high vacuum chamber will serve as the working end of the largest laser in the world. The output of 192 laser beams will converge at the precise center of the chamber. The laser beams will enter the chamber in two by two arrays to illuminate 10 millimeter long gold cylinders called hohlraums enclosing 2 millimeter capsule containing deuterium, tritium and isotopes of hydrogen. The two isotopes will fuse, thereby creating temperatures and pressures resembling those found only inside stars and in detonated nuclear weapons, but on a minute scale. The NIF Project will serve as an essential facility to insure safety and reliability of our nation's nuclear arsenal as well as demonstrating inertial fusion's contribution to creating electrical power. The paper will discuss the requirements that had to be addressed during the design, fabrication and testing of the target chamber. A team from Sandia National Laboratories (SNL) and LLNL with input from industry performed the configuration and basic design of the target chamber. The method of fabrication and construction of the aluminum target chamber was devised by Pitt-Des Moines, Inc. (PDM). PDM also participated in the design of the chamber in areas such as the Target Chamber Realignment and Adjustment System, which would allow realignment of the sphere laser beams in the event of earth settlement or movement from a seismic event. During the fabrication of the target chamber the sphericity tolerances had to be addressed for the individual plates. Procedures were developed for forming, edge preparation and welding of individual plates. Construction plans were developed to allow the field construction of the target chamber to occur parallel to other NIF construction activities. This

  15. Theoretical aspects of inflation targeting

    Directory of Open Access Journals (Sweden)

    Obradović Jelena

    2014-01-01

    Full Text Available Inflation targeting is one of the possible strategies used by central banks during conducting monetary policy. The basic characteristics, advantages and disadvantages of inflation targeting will be presented in this paper. The focus is on the the presentation and interpretation of the understanding of this strategy from the perspective of monetarist and Keynesian theory, the theory of rational expectations, and methodological analysis of the strategy in light of the game theory using payoff matrix.

  16. Targeted immunotherapy in Hodgkin lymphoma

    DEFF Research Database (Denmark)

    Hutchings, Martin

    2015-01-01

    In this issue of Blood, Rothe et al introduce a new principle of targeted Hodgkin lymphoma (HL) immunotherapy in their report from a phase 1 study of the bispecific anti-CD30/CD16A antibody construct AFM13.......In this issue of Blood, Rothe et al introduce a new principle of targeted Hodgkin lymphoma (HL) immunotherapy in their report from a phase 1 study of the bispecific anti-CD30/CD16A antibody construct AFM13....

  17. Targeting the nuclear RNA exosome

    DEFF Research Database (Denmark)

    Meola, Nicola; Jensen, Torben Heick

    2017-01-01

    Centrally positioned in nuclear RNA metabolism, the exosome deals with virtually all transcript types. This 3'-5' exo- and endo-nucleolytic degradation machine is guided to its RNA targets by adaptor proteins that enable substrate recognition. Recently, the discovery of the 'Poly(A) tail exosome...... targeting (PAXT)' connection as an exosome adaptor to human nuclear polyadenylated transcripts has relighted the interest of poly(A) binding proteins (PABPs) in both RNA productive and destructive processes....

  18. The Bering Autonomous Target Detection

    DEFF Research Database (Denmark)

    Jørgensen, John Leif; Denver, Troelz; Betto, Maurizio

    2003-01-01

    An autonomous asteroid target detection and tracking method has been developed. The method features near omnidirectionality and focus on high speed operations and completeness of search of the near space rather than the traditional faint object search methods, employed presently at the larger...... telescopes. The method has proven robust in operation and is well suited for use onboard spacecraft. As development target for the method and the associated instrumentation the asteroid research mission Bering has been used. Onboard a spacecraft, the autonomous detection is centered around the fully...... autonomous star tracker the Advanced Stellar Compass (ASC). One feature of this instrument is that potential targets are registered directly in terms of date, right ascension, declination, and intensity, which greatly facilitates both tracking search and registering. Results from ground and inflight tests...

  19. Pharmacogenomics of GPCR Drug Targets

    DEFF Research Database (Denmark)

    Hauser, Alexander Sebastian; Chavali, Sreenivas; Masuho, Ikuo

    2017-01-01

    Natural genetic variation in the human genome is a cause of individual differences in responses to medications and is an underappreciated burden on public health. Although 108 G-protein-coupled receptors (GPCRs) are the targets of 475 (∼34%) Food and Drug Administration (FDA)-approved drugs...... and account for a global sales volume of over 180 billion US dollars annually, the prevalence of genetic variation among GPCRs targeted by drugs is unknown. By analyzing data from 68,496 individuals, we find that GPCRs targeted by drugs show genetic variation within functional regions such as drug......- and effector-binding sites in the human population. We experimentally show that certain variants of μ-opioid and Cholecystokinin-A receptors could lead to altered or adverse drug response. By analyzing UK National Health Service drug prescription and sales data, we suggest that characterizing GPCR variants...

  20. INFLATION TARGETING IN EASTERN EUROPE

    Directory of Open Access Journals (Sweden)

    Laurian Lungu

    2006-05-01

    Full Text Available This paper addresses the inflation targeting approach in three transition economies, namely Hungary, Poland and the Czech Republic with the use of Taylor rules as benchmarks. The three economies considered have been successful at achieving disinflation, but deviations of inflation from its target have been persistent in all cases. Except for the Czech Republic, deviations from the Taylor rule are large and persistent, with Hungary displaying the largest fluctuations. Polish interest rates have consistently exceeded those suggested by the Taylor rule and given the prevalence of high unemployment, these undershootings do not augur well for the stability of monetary policy. Finally, the behaviour of Czech interest rates can be remarkably captured by the simple Taylor rule proposed in this paper, suggesting that the Czech National Bank has been the most successful at stabilising inflation and output around their target levels.

  1. Targeting Angiogenesis in Childhood Sarcomas

    Directory of Open Access Journals (Sweden)

    Hemant K. Bid

    2011-01-01

    Full Text Available Angiogenesis and vasculogenesis constitute two processes in the formation of new blood vessels and are essential for progression of solid tumors. Consequently, targeting angiogenesis, and to a lesser extent vasculogenesis, has become a major focus in cancer drug development. Angiogenesis inhibitors are now being tested in pediatric populations whereas inhibitors of vasculogenesis are in an earlier stage of development. Despite the initial enthusiasm for targeting angiogenesis for treatment of cancer, clinical trials have shown only incremental increases in survival, and agents have been largely cytostatic rather than inducing tumor regressions. Consequently, the role of such therapeutic approaches in the context of curative intent for childhood sarcomas is less clear. Here we review the literature on blood vessel formation in sarcomas with a focus on pediatric sarcomas and developments in targeting angiogenesis for treatment of these rare cancers.

  2. Ribosome Assembly as Antimicrobial Target

    Directory of Open Access Journals (Sweden)

    Rainer Nikolay

    2016-05-01

    Full Text Available Many antibiotics target the ribosome and interfere with its translation cycle. Since translation is the source of all cellular proteins including ribosomal proteins, protein synthesis and ribosome assembly are interdependent. As a consequence, the activity of translation inhibitors might indirectly cause defective ribosome assembly. Due to the difficulty in distinguishing between direct and indirect effects, and because assembly is probably a target in its own right, concepts are needed to identify small molecules that directly inhibit ribosome assembly. Here, we summarize the basic facts of ribosome targeting antibiotics. Furthermore, we present an in vivo screening strategy that focuses on ribosome assembly by a direct fluorescence based read-out that aims to identify and characterize small molecules acting as primary assembly inhibitors.

  3. Progress with developing a target for magnetized target fusion

    Energy Technology Data Exchange (ETDEWEB)

    Wysocki, F.J.; Chrien, R.E.; Idzorek, G.; Oona, H.; Whiteson, D.O.; Kirkpatrick, R.C.; Lindemuth, I.R.; Sheehey, P.T.

    1997-09-01

    Magnetized Target Fusion (MTF) is an approach to fusion where a preheated and magnetized plasma is adiabatically compressed to fusion conditions. Successful MTF requires a suitable initial target plasma with an embedded magnetic field of at least 5 T in a closed-field-line topology, a density of roughly 10{sup 18} cm{sup {minus}3}, a temperature of at least 50 eV, and must be free of impurities which would raise radiation losses. Target plasma generation experiments are underway at Los Alamos National Laboratory using the Colt facility; a 0.25 MJ, 2--3 {micro}s rise-time capacitor bank. The goal of these experiments is to demonstrate plasma conditions meeting the minimum requirements for a MTF initial target plasma. In the first experiments, a Z-pinch is produced in a 2 cm radius by 2 cm high conducting wall using a static gas-fill of hydrogen or deuterium gas in the range of 0.5 to 2 torr. Thus far, the diagnostics include an array of 12 B-dot probes, framing camera, gated OMA visible spectrometer, time-resolved monochrometer, filtered silicon photodiodes, neutron yield, and plasma-density interferometer. These diagnostics show that a plasma is produced in the containment region that lasts roughly 10 to 20 {micro}s with a maximum plasma density exceeding 10{sup 18} cm{sup {minus}3}. The experimental design and data are presented.

  4. Targeted Therapies for Pancreatic Cancer

    Directory of Open Access Journals (Sweden)

    Idoroenyi Amanam

    2018-01-01

    Full Text Available Pancreatic cancer is the third leading cause of cancer related death and by 2030, it will be second only to lung cancer. We have seen tremendous advances in therapies for lung cancer as well as other solid tumors using a molecular targeted approach but our progress in treating pancreatic cancer has been incremental with median overall survival remaining less than one year. There is an urgent need for improved therapies with better efficacy and less toxicity. Small molecule inhibitors, monoclonal antibodies and immune modulatory therapies have been used. Here we review the progress that we have made with these targeted therapies.

  5. Harnessing off-target effects

    DEFF Research Database (Denmark)

    Saginc, Gaye; Voellmy, Franziska; Linding, Rune

    2017-01-01

    The 'off-targets' of a drug are often poorly characterized yet could be harnessed in the treatment of complex diseases. A recent study used a small-molecule screening in non-small-cell lung cancer to repurpose an FDA-approved ALK/IGF1R inhibitor and uncover its mechanism of action.......The 'off-targets' of a drug are often poorly characterized yet could be harnessed in the treatment of complex diseases. A recent study used a small-molecule screening in non-small-cell lung cancer to repurpose an FDA-approved ALK/IGF1R inhibitor and uncover its mechanism of action....

  6. The OPERA experiment Target Tracker

    CERN Document Server

    Adam, T; Borer, K.; Campagne, Jean-Eric; Con-Sen, N.; de La Taille, C.; Dick, N.; Dracos, M.; Gaudiot, G.; Goeltzenlichter, T.; Gornushkin, Y.; Grapton, J.-N.; Guyonnet, J.-L.; Hess, M.; Igersheim, R.; Janicsko Csathy, J.; Jollet, C.; Juget, F.; Kocher, H.; Krasnoperov, A.; Krumstein, Z.; Martin-Chassard, G.; Moser, U.; Nozdrin, A.; Olchevski, A.; Porokhovoi, S.; Raux, L.; Sadovski, A.; Schuler, J.; Schutz, H.-U.; Schwab, C.; Smolnikov, A.; Van Beek, G.; Vilain, P.; Walchli, T.; Wilquet, G.; Wurtz, J.

    2007-01-01

    The main task of the Target Tracker detector of the long baseline neutrino oscillation OPERA experiment is to locate in which of the target elementary constituents, the lead/emulsion bricks, the neutrino interactions have occurred and also to give calorimetric information about each event. The technology used consists in walls of two planes of plastic scintillator strips, one per transverse direction. Wavelength shifting fibres collect the light signal emitted by the scintillator strips and guide it to both ends where it is read by multi-anode photomultiplier tubes. All the elements used in the construction of this detector and its main characteristics are described.

  7. Target-Centric Network Modeling

    DEFF Research Database (Denmark)

    Mitchell, Dr. William L.; Clark, Dr. Robert M.

    In Target-Centric Network Modeling: Case Studies in Analyzing Complex Intelligence Issues, authors Robert Clark and William Mitchell take an entirely new approach to teaching intelligence analysis. Unlike any other book on the market, it offers case study scenarios using actual intelligence......, and collaborative sharing in the process of creating a high-quality, actionable intelligence product. The case studies reflect the complexity of twenty-first century intelligence issues by dealing with multi-layered target networks that cut across political, economic, social, technological, and military issues....... Working through these cases, students will learn to manage and evaluate realistic intelligence accounts....

  8. TARGET Imbalances at Record Levels

    DEFF Research Database (Denmark)

    Hallett, Andrew Hughes

    TARGET is the payments system for making settlements between euro area economies and five other EU economies. Cross-border transactions generate claims/surpluses and liabilities/deficits among national central banks which “net out” for the system as a whole. These imbalances are manageable in rel...

  9. Targeted nanoparticles for colorectal cancer

    DEFF Research Database (Denmark)

    Cisterna, Bruno A.; Kamaly, Nazila; Choi, Won Il

    2016-01-01

    Colorectal cancer (CRC) is highly prevalent worldwide, and despite notable progress in treatment still leads to significant morbidity and mortality. The use of nanoparticles as a drug delivery system has become one of the most promising strategies for cancer therapy. Targeted nanoparticles could...

  10. Communicating to heterogeneous target groups

    DEFF Research Database (Denmark)

    Pedersen, Karsten

    very often have to communicate to rather heterogeneous target groups that have little more in common than a certain geographical habitat. That goes against most schoolbook teaching in the field of communication, but is none the less the terms with which that kind of communication has to live...

  11. Emerging targets in treating pain.

    Science.gov (United States)

    Chang, David S; Raghavan, Rahul; Christiansen, Sandy; Cohen, Steven P

    2015-08-01

    To provide an overview on drug targets and emerging pharmacological treatment options for chronic pain. Chronic pain poses an enormous socioeconomic burden for the more than 30% of people who suffer from it, costing over $600 billion per year in the USA. In recent years, there has been a surge in preclinical and clinical research endeavors to try to stem this epidemic. Preclinical studies have identified a wide array of potential targets, with some of the most promising translational research being performed on novel opioid receptors, cannabinoid receptors, selective ion channel blockers, cytokine inhibitors, nerve growth factor inhibitors, N-methyl-D-aspartate receptor antagonists, glial cell inhibitors, and bisphosphonates. There are many obstacles for the development of effective medications to treat chronic pain, including the inherent challenges in identifying pathophysiological mechanisms, the overlap and multiplicity of pain pathways, and off-target adverse effects stemming from the ubiquity of drug target receptor sites and the lack of highly selective receptor ligands. Despite these barriers, the number and diversity of potential therapies have continued to grow, to include disease-modifying and individualized drug treatments.

  12. Tumor targeting via integrin ligands

    Directory of Open Access Journals (Sweden)

    Udaya Kiran eMarelli

    2013-08-01

    Full Text Available Selective and targeted delivery of drugs to tumors is a major challenge for an effective cancer therapy and also to overcome the side effects associated with current treatments. Overexpression of various receptors on tumor cells is a characteristic structural and biochemical aspect of tumors and distinguishes them from physiologically normal cells. This abnormal feature is therefore suitable for selectively directing anticancer molecules to tumors by using ligands that can preferentially recognize such receptors. Several subtypes of integrin receptors that are crucial for cell adhesion, cell signaling, cell viability and motility have been shown to have an upregulated expression on cancer cells. Thus, ligands that recognize specific integrin subtypes represent excellent candidates to be conjugated to drugs or drug carrier systems and be targeted to tumors. In this regard, integrins recognizing the RGD cell adhesive sequence have been extensively targeted for tumor specific drug delivery. Here we review key recent examples on the presentation of RGD-based integrin ligands by means of distinct drug delivery systems, and discuss the prospects of such therapies to specifically target tumor cells.

  13. How are inflation targets set?

    Czech Academy of Sciences Publication Activity Database

    Horváth, R.; Matějů, Jakub

    -, č. 426 (2010), s. 1-35 ISSN 1211-3298 Grant - others:MŠk(CZ) SVV-2010-261801 Institutional research plan: CEZ:MSM0021620846 Keywords : inflation targeting * central bank * credibility Subject RIV: AH - Economics http://www.cerge-ei.cz/pdf/wp/Wp426.pdf

  14. High power neutron production targets

    Energy Technology Data Exchange (ETDEWEB)

    Wender, S. [Los Alamos National Lab., NM (United States)

    1996-06-01

    The author describes issues of concern in the design of targets and associated systems for high power neutron production facilities. The facilities include uses for neutron scattering, accelerator driven transmutation, accelerator production of tritium, short pulse spallation sources, and long pulse spallation sources. Each of these applications requires a source with different design needs and consequently different implementation in practise.

  15. Targeted nanoparticles for colorectal cancer

    DEFF Research Database (Denmark)

    Cisterna, Bruno A.; Kamaly, Nazila; Choi, Won Il

    2016-01-01

    Colorectal cancer (CRC) is highly prevalent worldwide, and despite notable progress in treatment still leads to significant morbidity and mortality. The use of nanoparticles as a drug delivery system has become one of the most promising strategies for cancer therapy. Targeted nanoparticles could ...

  16. Targeted Therapies in Endometrial Cancer

    Directory of Open Access Journals (Sweden)

    Selen Dogan

    2014-04-01

    Full Text Available Endometrial cancer is the most common genital cancer in developed world. It is generally diagnosed in early stage and it has a favorable prognosis. However, advanced staged disease and recurrences are difficult to manage. There are some common genetic alterations related to endometrial carcinogenesis in similar fashion to other cancers. Personalized medicine, which means selection of best suited treatment for an individual, has gain attention in clinical care of patients in recent years. Targeted therapies were developed as a part of personalized or %u201Ctailored%u201D medicine and specifically acts on a target or biologic pathway. There are quite a number of molecular alteration points in endometrial cancer such as PTEN tumor suppressor genes, DNA mismatch repair genes, PI3K/AKT/mTOR pathway and p53 oncogene which all might be potential candidates for tailored targeted therapy. In recent years targeted therapies has clinical application in ovarian cancer patients and in near future with the advent of new agents these %u201Ctailored%u201D drugs will be in market for routine clinical practice in endometrial cancer patients, in primary disease and recurrences as well.

  17. The Automatic Measurement of Targets

    DEFF Research Database (Denmark)

    Höhle, Joachim

    1997-01-01

    The automatic measurement of targets is demonstrated by means of a theoretical example and by an interactive measuring program for real imagery from a réseau camera. The used strategy is a combination of two methods: the maximum correlation coefficient and the correlation in the subpixel range...

  18. Polarized Scintillating Targets at Psi

    Science.gov (United States)

    van den Brandt, B.; Bunyatova, E. I.; Hautle, P.; Konter, J. A.; Mango, S.

    2001-02-01

    Scintillating polarized targets are now routinely available: blocks of 18×18×5 mm scintillating organic polymer, doped with TEMPO, polarized dynamically in a field of 2.5 T in a vertical 3He-4He dilution refrigerator. A 19 mm diameter plastic lightguide transports the scintillation light from the sample in the mixing chamber to a photomultiplier outside the cryostat.

  19. Aptamers for Targeted Drug Delivery

    Directory of Open Access Journals (Sweden)

    Partha Ray

    2010-05-01

    Full Text Available Aptamers are a class of therapeutic oligonucleotides that form specific three-dimensional structures that are dictated by their sequences. They are typically generated by an iterative screening process of complex nucleic acid libraries employing a process termed Systemic Evolution of Ligands by Exponential Enrichment (SELEX. SELEX has traditionally been performed using purified proteins, and cell surface receptors may be challenging to purify in their properly folded and modified conformations. Therefore, relatively few aptamers have been generated that bind cell surface receptors. However, improvements in recombinant fusion protein technology have increased the availability of receptor extracellular domains as purified protein targets, and the development of cell-based selection techniques has allowed selection against surface proteins in their native configuration on the cell surface. With cell-based selection, a specific protein target is not always chosen, but selection is performed against a target cell type with the goal of letting the aptamer choose the target. Several studies have demonstrated that aptamers that bind cell surface receptors may have functions other than just blocking receptor-ligand interactions. All cell surface proteins cycle intracellularly to some extent, and many surface receptors are actively internalized in response to ligand binding. Therefore, aptamers that bind cell surface receptors have been exploited for the delivery of a variety of cargoes into cells. This review focuses on recent progress and current challenges in the field of aptamer-mediated delivery.

  20. Targeted Advertising and Social Status

    NARCIS (Netherlands)

    N. Vikander (Nick)

    2010-01-01

    textabstractThis paper shows how a firm can use non-targeted advertising to exploit consumers' desire for social status. A monopolist sells multiple varieties of a good to consumers who each care about what others believe about his wealth. Advertising allows consumers both to buy different varieties

  1. Polarimetric imaging of underwater targets

    Science.gov (United States)

    Gilerson, Alex; Carrizo, Carlos; Tonizzo, Alberto; Ibrahim, Amir; El-Habashi, Ahmed; Foster, Robert; Ahmed, Samir

    2013-06-01

    Underwater imaging is challenging because of the significant attenuation of light due to absorption and scattering of light in water. Using polarization properties of light is one of the options for improving image quality. We present results of imaging of a polarized target in open ocean (Curacao) and coastal (NY Bight) waters. The target in the shape of a square is divided into several smaller squares, each of which is covered with a polarizing film with different polarization orientations or transmission coefficients was placed on a mirror and imaged under water by a green-band full-Stokes polarimetric video camera at the full range of azimuth angles against the Sun. The values of the Stokes vector components from the images are compared with the modeled image of the target using radiative transfer code for the atmosphere-ocean system combined with the simple imaging model. It is shown that even in clear water the impact of the water body on the polarized underwater image is very significant and retrieval of target polarization characteristics from the image is extremely challenging.

  2. Target selection for direct marketing.

    NARCIS (Netherlands)

    Bult, Jan Roelf

    1993-01-01

    In this thesis we concentrated on the use ol direct mail for targeting potential buyers. The major characteristics that influences the success of a plomotional direct mail campaign are the of-fbr,the communication elements, the timing or sequence of these communication elements, and the list of

  3. Uranium briquettes for irradiation target

    Energy Technology Data Exchange (ETDEWEB)

    Saliba-Silva, Adonis Marcelo; Garcia, Rafael Henrique Lazzari; Martins, Ilson Carlos; Carvalho, Elita Fontenele Urano de; Durazzo, Michelangelo, E-mail: saliba@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)

    2011-07-01

    Direct irradiation on targets inside nuclear research or multiple purpose reactors is a common route to produce {sup 99}Mo-{sup 99m}Tc radioisotopes. Nevertheless, since the imposed limits to use LEU uranium to prevent nuclear armament production, the amount of uranium loaded in target meats has physically increased and new processes have been proposed for production. Routes using metallic uranium thin film and UAl{sub x} dispersion have been used for this purpose. Both routes have their own issues, either by bringing difficulties to disassemble the aluminum case inside hot cells or by generating great amount of alkaline radioactive liquid rejects. A potential route might be the dispersion of powders of LEU metallic uranium and nickel, which are pressed as a blend inside a die and followed by pulse electroplating of nickel. The electroplating provides more strength to the briquettes and creates a barrier for gas evolution during neutronic disintegration of {sup 235}U. A target briquette platted with nickel encapsulated in an aluminum case to be irradiated may be an alternative possibility to replace other proposed targets. This work uses pulse Ni-electroplating over iron powder briquette to simulate the covering of uranium by nickel. The following parameters were applied 10 times for each sample: 900Hz, -0.84A/square centimeters with duty cycle of 0.1 in Watts Bath. It also presented the optical microscopy analysis of plated microstructure section. (author)

  4. Collisional disruptions of rotating targets

    Science.gov (United States)

    Ševeček, Pavel; Broz, Miroslav

    2017-10-01

    Collisions are key processes in the evolution of the Main Asteroid Belt and impact events - i.e. target fragmentation and gravitational reaccumulation - are commonly studied by numerical simulations, namely by SPH and N-body methods. In our work, we extend the previous studies by assuming rotating targets and we study the dependence of resulting size-distributions on the pre-impact rotation of the target. To obtain stable initial conditions, it is also necessary to include the self-gravity already in the fragmentation phase which was previously neglected.To tackle this problem, we developed an SPH code, accelerated by SSE/AVX instruction sets and parallelized. The code solves the standard set of hydrodynamic equations, using the Tillotson equation of state, von Mises criterion for plastic yielding and scalar Grady-Kipp model for fragmentation. We further modified the velocity gradient by a correction tensor (Schäfer et al. 2007) to ensure a first-order conservation of the total angular momentum. As the intact target is a spherical body, its gravity can be approximated by a potential of a homogeneous sphere, making it easy to set up initial conditions. This is however infeasible for later stages of the disruption; to this point, we included the Barnes-Hut algorithm to compute the gravitational accelerations, using a multipole expansion of distant particles up to hexadecapole order.We tested the code carefully, comparing the results to our previous computations obtained with the SPH5 code (Benz and Asphaug 1994). Finally, we ran a set of simulations and we discuss the difference between the synthetic families created by rotating and static targets.

  5. Cellular Targets of Dietary Polyphenol Resveratrol

    National Research Council Canada - National Science Library

    Wu, Joseph M

    2006-01-01

    To test the hypothesis that resveratrol, a grape derived polyphenol, exerts its chemopreventive properties against prostate cancer by interacting with specific cellular targets, denoted resveratrol targeting proteins (RTPs...

  6. North Pacific Targets Program Environmental Assessment

    National Research Council Canada - National Science Library

    2001-01-01

    .... The STPO would provide the Strategic Target System launch vehicle for strategic target launch services from Kodiak Launch Complex, Kodiak Island, Alaska, a commercial rocket launch facility operated...

  7. Targeted nanosystems: Advances in targeted dendrimers for cancer therapy.

    Science.gov (United States)

    Yang, Hu

    2016-02-01

    Dendrimers possess discrete highly compact nanostructures constituted of successive branched layers. Soon after the inception of dendrimers, recognition of their tunable structures and biologically favorable properties provoked a great enthusiasm in delving deeply into the utility of dendrimers for biomedical and pharmaceutical applications. One of the most important nanotechnology applications is the development of nanomedicines for targeted cancer therapies. Tremendous success in targeted therapies has been achieved with the use of dendrimer-based nanomedicines. This article provides a concise review on latest advances in the utility of dendrimers in immunotherapies and hormone therapies. Much basic and clinical research has been done since the invention of dendrimers, which are highly branched nano-sized molecules with the ability to act as carriers in nanomedicine. In this concise review article, the authors highlighted the current use of dendrimers in immunotherapies and hormone therapies in the fight against cancers. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Emerging targets in human lymphoma: targeting the MYD88 mutation

    Directory of Open Access Journals (Sweden)

    Wang JQ

    2013-08-01

    Full Text Available James Q Wang,* Yogesh S Jeelall,* Keisuke Horikawa* Department of Immunology, The John Curtin School of Medical Research, Australian National University, Canberra, ACT, Australia *All authors contributed equally to this manuscript Abstract: B cell neoplasms co-opt the molecular machinery of normal B cells for their survival. Technological advances in cancer genomics has significantly contributed to uncovering the root cause of aggressive lymphomas, revealing a previously unknown link between TLR signaling and B cell neoplasm. Recurrent oncogenic mutations in MYD88 have been found in 39% of the activated B cell-like subtype of diffuse large B cell lymphoma (ABC DLBCL. Interestingly, 29% of ABC DLBCL have a single amino acid substitution of proline for the leucine at position 265 (L265P, and the exact same variant has also been identified in a number of lymphoid malignancies. The MYD88 L265P variant was recently identified in 90% of Wadenstrom's macroglobulinemia patients. These recent developments warrant the need for novel diagnostic tools as well as targeted therapeutics. In this review, we discuss the physiological functions of MYD88 and focus on its role in B cell lymphomas, evaluating the potential for targeting oncogenic MYD88 in lymphoma. Keywords: MYD88, L265P mutation, lymphoma, targeted therapy

  9. Targeting an efficient target-to-target interval for P300 speller brain–computer interfaces

    Science.gov (United States)

    Sellers, Eric W.; Wang, Xingyu

    2013-01-01

    Longer target-to-target intervals (TTI) produce greater P300 event-related potential amplitude, which can increase brain–computer interface (BCI) classification accuracy and decrease the number of flashes needed for accurate character classification. However, longer TTIs requires more time for each trial, which will decrease the information transfer rate of BCI. In this paper, a P300 BCI using a 7 × 12 matrix explored new flash patterns (16-, 18- and 21-flash pattern) with different TTIs to assess the effects of TTI on P300 BCI performance. The new flash patterns were designed to minimize TTI, decrease repetition blindness, and examine the temporal relationship between each flash of a given stimulus by placing a minimum of one (16-flash pattern), two (18-flash pattern), or three (21-flash pattern) non-target flashes between each target flashes. Online results showed that the 16-flash pattern yielded the lowest classification accuracy among the three patterns. The results also showed that the 18-flash pattern provides a significantly higher information transfer rate (ITR) than the 21-flash pattern; both patterns provide high ITR and high accuracy for all subjects. PMID:22350331

  10. Atorvastatin treatment and LDL cholesterol target attainment in patients at very high cardiovascular risk.

    Science.gov (United States)

    Laufs, Ulrich; Karmann, Barbara; Pittrow, David

    2016-09-01

    The use of atorvastatin is rapidly increasing among statins since the introduction of generics. However, only limited data are available on its current use and the effectiveness outside of randomised trials. The aim of the study was to assess low-density lipoprotein (LDL-C) levels in ambulatory patients at very high cardiovascular risk on atorvastatin therapy in physician's offices. A total of 2625 high-risk patients on atorvastatin were included into this cross-sectional study by 539 office-based physicians between June and December 2014. 47.0 % of the patients had documented coronary heart disease (CHD), 25.1 % type 2 diabetes mellitus (DM), and 27.9 % CHD plus concomitant DM. The mean age was 66.1 ± 10.8 years, 62.1 % were male. Atorvastatin at the dose of 10, 20, 40 and 80 mg/day was administered in 15.6, 45.7, 33.9, and 4.8 % of the patients, respectively. The treatment duration was 92.6 ± 109.6 weeks. The mean atorvastatin dose at therapy start was 24.8 ± 15.2 mg/day and at time of documentation 27.9 ± 15.8 mg/day. Low-density lipoprotein cholesterol (LDL-C) LDL-C target. In summary, higher doses of atorvastatin are not frequently used in clinical practice. The LDL-C target level cardiovascular risk.

  11. Newer targeted therapies in psoriasis

    Directory of Open Access Journals (Sweden)

    Sujay Khandpur

    2013-01-01

    Full Text Available Psoriasis is a common, chronic, inflammatory skin disease that can have a significant impact on the quality of life of those who are afflicted due to chronicity of the disease and frequent remissions and relapses. Many available systemic therapies, however, are unsuitable for chronic administration due to the risk of cumulative toxicity. Recent advances in the understanding of the pathophysiology of psoriasis have led to the development of new, genetically engineered, targeted therapies for this disease. These include approaches targeting antigen presentation and co-stimulation, T-cell activation and leukocyte adhesion, action on pro-inflammatory mediators, and modulating the cytokine balance. Although only preliminary data are available so far and there is limited data supporting their use, these trials contribute to a further understanding of the disease and will eventually lead to new therapeutic options for psoriasis.

  12. Moulding calixarenes for biomacromolecule targeting.

    Science.gov (United States)

    Giuliani, Marta; Morbioli, Ilaria; Sansone, Francesco; Casnati, Alessandro

    2015-09-28

    After their successful use as a preorganized platform for the preparation of receptors for metal ions and small neutral molecules over the last 15 years, calixarenes are enjoying a renaissance of popularity as scaffolds for ligands that are able to efficiently and selectively target macromolecules such as proteins/enzymes, nucleic acids and lipids. This feature article summarizes the peculiar factors characterizing the calixarene structure and properties, as well as outlines the main rules that can be used to turn such macrocycles into efficient and successful ligands for these classes of biomacromolecules. Factors that affect the multivalent properties of calixarenes, such as the size, conformation and stereochemical presentation of binding groups or their amphiphilicity and hybrid character, are described in detail with the use of a few selected examples from the literature. Perspectives and applications of these ligands in bionanotechnology and nanomedicine, such as protein sensing and inhibition, gene-delivery, targeted drug-delivery and cell imaging, are also discussed.

  13. Swimbladder on Fish Target Strength

    Directory of Open Access Journals (Sweden)

    Sunardi

    2008-08-01

    Full Text Available This paper discusses of target strength (TS for the Selar boops (Oxeye scad and Megalaspis cordyla (Torpedo scad, the most commercially fish in Malaysia. TS can be determined from in situ measurements and acoustic calculation of fish model. TS value, depth, and position (x-y-z of targeted fish can be viewed from echogram using FQ-80 Analyzer by in situ measurement. X-ray imaged can be deployed to develop the acoustic fish model. The percentage of length and upper surface area for swimbladder to body fish of Selar boops more than Megalaspis cordyla can be measured after X-ray process. The percentage of width and volume of swimbladders to its each body are no significantly difference for both fish. These data of swimbladder physic support the result of in situ measurement which TS of Megalaspis cordyla stronger Selar boops.

  14. Recurring Utterances - Targeting a Breakthrough

    Directory of Open Access Journals (Sweden)

    Jacqueline Stark

    2014-05-01

    The most interesting phenomenon is KB’s production of words from former sessions indicating that they are still ‘active’ and the production of completely novel incorrect words. The observable features indicate that immediate auditory processing is possible in the form of repeating target words. However, as soon as KB must retrieve information from the (semantic lexicon, even after being able to correctly ‘repeat’ the target word several times, he responds with a RU, perseveration, or paraphasia. Several of his productions can be characterized as aphasic confabulations which stem from a memory gap. Thus, although KB’s language impairment is severe, his responses across time indicate that step-by-step a breakthrough is being made.

  15. Remote moving target indication assessment

    Energy Technology Data Exchange (ETDEWEB)

    Canavan, G.H.

    1996-10-01

    The objective of this project was to design and test key components of a sensor to be used on remotely piloted vehicles, aircraft, or satellites for the detection of moving vehicles in cluttered backgrounds. The proposed sensor uses modern large-array focal planes to provide multiple infrared observations of moving targets and capable on-board computers to integrate multiple observations to detect moving targets in background clutter. This combination reduces the size, weight, and cost of the sensor to levels that can be flown on many small unmanned platforms. This effort selected the actual components, integrated them into a test bed, tested the performance of the sensor against realistic generated scenes, and designed a proof-of-concept prototype.

  16. Targeting vaccines to dendritic cells

    DEFF Research Database (Denmark)

    Foged, Camilla; Sundblad, Anne; Hovgaard, Lars

    2002-01-01

    to be far superior to that of B-cells and macrophages. DC are localized at strategic places in the body at sites used by pathogens to enter the organism, and are thereby in an optimal position to capture antigens. In general, vaccination strategies try to mimic the invasiveness of the pathogens. DC...... are considered to play a central role for the provocation of primary immune responses by vaccination. A rational way of improving the potency and safety of new and already existing vaccines could therefore be to direct vaccines specifically to DC. There is a need for developing multifunctional vaccine drug...... delivery systems (DDS) with adjuvant effect that target DC directly and induce optimal immune responses. This paper will review the current knowledge of DC physiology as well as the progress in the field of novel vaccination strategies that directly or indirectly aim at targeting DC....

  17. Poverty, inequality, and geographic targeting

    OpenAIRE

    Simler, Kenneth R.; Nhate, Virgulino

    2005-01-01

    "This paper applies small area estimation techniques to Mozambican data to develop high resolution (subdistrictlevel) poverty and inequality maps...The picture that emerges is one of considerable local-level economic heterogeneity, with the poor living alongside the nonpoor. Rather than finding stark pockets of intense poverty traps in one part of the country and a relative absence of poverty in other parts, the situation is much more nuanced. This suggests that targeting antipoverty efforts ...

  18. Targeting phenotypically tolerant Mycobacterium tuberculosis

    Science.gov (United States)

    Gold, Ben; Nathan, Carl

    2016-01-01

    While the immune system is credited with averting tuberculosis in billions of individuals exposed to Mycobacterium tuberculosis, the immune system is also culpable for tempering the ability of antibiotics to deliver swift and durable cure of disease. In individuals afflicted with tuberculosis, host immunity produces diverse microenvironmental niches that support suboptimal growth, or complete growth arrest, of M. tuberculosis. The physiological state of nonreplication in bacteria is associated with phenotypic drug tolerance. Many of these host microenvironments, when modeled in vitro by carbon starvation, complete nutrient starvation, stationary phase, acidic pH, reactive nitrogen intermediates, hypoxia, biofilms, and withholding streptomycin from the streptomycin-addicted strain SS18b, render M. tuberculosis profoundly tolerant to many of the antibiotics that are given to tuberculosis patients in a clinical setting. Targeting nonreplicating persisters is anticipated to reduce the duration of antibiotic treatment and rate of post-treatment relapse. Some promising drugs to treat tuberculosis, such as rifampicin and bedaquiline, only kill nonreplicating M. tuberculosis in vitro at concentrations far greater than their minimal inhibitory concentrations against replicating bacilli. There is an urgent demand to identify which of the currently used antibiotics, and which of the molecules in academic and corporate screening collections, have potent bactericidal action on nonreplicating M. tuberculosis. With this goal, we review methods of high throughput screening to target nonreplicating M. tuberculosis and methods to progress candidate molecules. A classification based on structures and putative targets of molecules that have been reported to kill nonreplicating M. tuberculosis revealed a rich diversity in pharmacophores. However, few of these compounds were tested under conditions that would exclude the impact of adsorbed compound acting during the recovery phase of

  19. Medium size polarised deuteron target

    Energy Technology Data Exchange (ETDEWEB)

    Kiselev, Yu.F.; Polyakov, V.V.; Kovalev, A.I.; Bunyatova, E.I.; Borisov, N.S.; Trautman, V.Yu.; Werner, K.; Kozlenko, N.G.

    1984-03-01

    A frozen polarised deuteron target based on ethanediol with a high percentage of deuterium is described. Analytical expressions for the NMR spectrum correction for non-linearity of the Q-meter are obtained and a method for the determination of the asymmetry is developed. Experimental results confirm the thermal mixing theory for deuteron and proton spin systems with a dipole-dipole reservoir of electron spins.

  20. Peptide-targeted polymer cancerostatics

    Czech Academy of Sciences Publication Activity Database

    Böhmová, Eliška; Pola, Robert

    2016-01-01

    Roč. 65, Suppl. 2 (2016), S153-S164 ISSN 0862-8408 R&D Projects: GA MŠk(CZ) LO1507 Institutional support: RVO:61389013 Keywords : HPMA copolymers * tumor targeting * peptides Subject RIV: CD - Macromolecular Chemistry Impact factor: 1.461, year: 2016 http://www.biomed.cas.cz/physiolres/pdf/65%20Suppl%202/65_S153.pdf

  1. Coherent Communications, Imaging and Targeting

    Energy Technology Data Exchange (ETDEWEB)

    Stappaerts, E; Baker, K; Gavel, D; Wilks, S; Olivier, S; Brase, J; Olivier, S; Brase, J

    2003-10-03

    Laboratory and field demonstration results obtained as part of the DARPA-sponsored Coherent Communications, Imaging and Targeting (CCIT) program are reviewed. The CCIT concept uses a Phase Conjugation Engine based on a quadrature receiver array, a hologram processor and a spatial light modulator (SLM) for high-speed, digital beam control. Progress on the enabling MEMS SLM, being developed by a consortium consisting of LLNL, academic institutions and small businesses, is presented.

  2. Theranostics Targeting Metastatic Breast Cancer

    Science.gov (United States)

    2016-10-01

    What opportunities for training and professional development has the project provided? Two graduate students and one postdoctoral research associate...hostile immune reaction toward FR-expressing tumors. A series of vaccinations with hapten fluorescein (EC90 vaccine ) admin- istrated with an adjuvant...FITC-conjugated (FITC is flu - orescein isothiocyanate) CA inhibitor acetalozamide (AAZ) targeted CA-IX positive cells (Kd = 12.6 nM). The biodistribution

  3. Targeting inflammation in metabolic syndrome.

    Science.gov (United States)

    Welty, Francine K; Alfaddagh, Abdulhamied; Elajami, Tarec K

    2016-01-01

    The metabolic syndrome (MetS) is comprised of a cluster of closely related risk factors, including visceral adiposity, insulin resistance, hypertension, high triglyceride, and low high-density lipoprotein cholesterol; all of which increase the risk for the development of type 2 diabetes and cardiovascular disease. A chronic state of inflammation appears to be a central mechanism underlying the pathophysiology of insulin resistance and MetS. In this review, we summarize recent research which has provided insight into the mechanisms by which inflammation underlies the pathophysiology of the individual components of MetS including visceral adiposity, hyperglycemia and insulin resistance, dyslipidemia, and hypertension. On the basis of these mechanisms, we summarize therapeutic modalities to target inflammation in the MetS and its individual components. Current therapeutic modalities can modulate the individual components of MetS and have a direct anti-inflammatory effect. Lifestyle modifications including exercise, weight loss, and diets high in fruits, vegetables, fiber, whole grains, and low-fat dairy and low in saturated fat and glucose are recommended as a first line therapy. The Mediterranean and dietary approaches to stop hypertension diets are especially beneficial and have been shown to prevent development of MetS. Moreover, the Mediterranean diet has been associated with reductions in total and cardiovascular mortality. Omega-3 fatty acids and peroxisome proliferator-activated receptor α agonists lower high levels of triglyceride; their role in targeting inflammation is reviewed. Angiotensin-converting enzyme inhibitors, angiotensin receptor blockers, and aldosterone blockers comprise pharmacologic therapies for hypertension but also target other aspects of MetS including inflammation. Statin drugs target many of the underlying inflammatory pathways involved in MetS. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Targeting distress in rheumatic diseases

    OpenAIRE

    Vriezekolk, J.E.

    2011-01-01

    Psychological distress is highly prevalent in patients with rheumatic diseases. It is associated with a variety of negative outcomes, including pain, fatigue, disability, and maladaptive cognitive behavioural coping strategies. In this thesis, psychological distress was studied both as an outcome measure and as a therapeutic target in the context of multidisciplinary rehabilitation. The longitudinal role of coping in psychological distress was systematically reviewed, a questionnaire to asses...

  5. Novel therapies targeting vascular endothelium.

    Science.gov (United States)

    Tousoulis, Dimitris; Antoniades, Charalambos; Koumallos, Nikolaos; Marinou, Kyriakoula; Stefanadi, Elli; Latsios, George; Stefanadis, Christodoulos

    2006-01-01

    Endothelial dysfunction has been identified as a major mechanism involved in all the stages of atherogenesis. Evaluation of endothelial function seems to have a predictive role in humans, and therapeutic interventions improving nitric oxide bioavailability in the vasculature may improve the long-term outcome in healthy individuals, high-risk subjects, or patients with advanced atherosclerosis. Several therapeutic strategies are now available, targeting both the synthesis and oxidative inactivation of nitric oxide (NO) in human vasculature. Statins seem to be currently the most powerful category of these agents, improving endothelial function and decreasing cardiovascular risk after long-term administration. Other cardiovascular agents improving endothelial function in humans are angiotensin-converting enzyme inhibitors/angiotensin receptors blockers, which increase NO bioavailability by modifying the rennin-angiotensin-aldosterone system. Newer therapeutic approaches targeting endothelial dysfunction in specific disease states include insulin sensitizers, L-arginine (the substrate for endothelial NO synthase [eNOS]) as well as substances that target eNOS "coupling," such as folates or tetrahydrobiopterin. Although there are a variety of strategies to improve NO bioavailability in human endothelium, it is still unclear whether they have any direct benefit at a clinical level.

  6. Targeted gene flow for conservation.

    Science.gov (United States)

    Kelly, Ella; Phillips, Ben L

    2016-04-01

    Anthropogenic threats often impose strong selection on affected populations, causing rapid evolutionary responses. Unfortunately, these adaptive responses are rarely harnessed for conservation. We suggest that conservation managers pay close attention to adaptive processes and geographic variation, with an eye to using them for conservation goals. Translocating pre-adapted individuals into recipient populations is currently considered a potentially important management tool in the face of climate change. Targeted gene flow, which involves moving individuals with favorable traits to areas where these traits would have a conservation benefit, could have a much broader application in conservation. Across a species' range there may be long-standing geographic variation in traits or variation may have rapidly developed in response to a threatening process. Targeted gene flow could be used to promote natural resistance to threats to increase species resilience. We suggest that targeted gene flow is a currently underappreciated strategy in conservation that has applications ranging from the management of invasive species and their impacts to controlling the impact and virulence of pathogens. © 2015 Society for Conservation Biology.

  7. Targeted Treatment Options in Mastocytosis

    Directory of Open Access Journals (Sweden)

    Mélanie Vaes

    2017-07-01

    Full Text Available Mastocytosis refers to a heterogeneous group of disorders resulting from the clonal proliferation of abnormal mast cells and their accumulation in the skin (cutaneous mastocytosis when only in the skin, CM or in various organs (systemic mastocytosis, SM. This leads to a wide variety of clinical manifestations resulting from excessive mediator release in CM and benign forms of SM (indolent SM, ISM and from tissue mast cell infiltration causing multiorgan dysfunction and failure in more aggressive subtypes (aggressive SM, ASM, or mast cell leukemia. In addition, SM may be associated with hematological neoplasms (AHN. While treatment of ISM primarily aims at symptom management with anti-mediator therapies, cytoreductive and targeted therapies are needed to control the expansion of neoplastic mast cells in advanced forms of SM, in order to improve overall survival. Mast cell accumulation results from a gain-of-function mutation (mostly the D816V mutation within the KIT tyrosine kinase domain expressed by mast cells and additional genetic and epigenetic mutations may further determine the features of the disease (ASM and AHN. Consequently, tyrosine kinase inhibitors and targeted therapies directed against the oncogenic signaling machinery downstream of KIT are attractive therapeutic approaches. A better understanding of the relative contribution of these genetic and epigenetic events to the molecular pathogenesis of mastocytosis is of particular interest for the development of targeted therapies and therefore to better choose patient subgroups that would best benefit from a given therapeutic strategy.

  8. Unmanned Aircraft Systems (UAS) Sensor and Targeting

    Science.gov (United States)

    2010-07-27

    mission, a pre-determined number of different targets should be shuffled between the target locations in the array. Example targets for this subtest are...UNFOV Ultra Narrow Field of View UTM Universal Transverse Mercator VBLSS Video-Based Laser Scoring System VRT Vertical Reference Target WFOV

  9. Progress with developing a target for magnetized target fusion

    Energy Technology Data Exchange (ETDEWEB)

    Wysocki, F.J.; Chrien, B.E.; Idzorek, G.; Oona, H.; Whiteson, D.O.; Kirkpatrick, R.C.; Lindemuth, I.R.; Sheehey, P.T. [Los Alamos National Lab., NM (United States)

    1997-12-31

    Magnetized Target Fusion (MTF) is an approach to fusion where a preheated and magnetized plasma is adiabatically compressed to fusion conditions. Successful MTF requires a suitable initial target plasma with an embedded magnetic field of at least 5 T in a closed-field-line topology, a density of roughly 10{sup 18} cm{sup {minus}3}, a temperature of at least 50 eV, and must be free of impurities which would raise radiation losses. Target plasma generation experiments are underway at Los Alamos National Laboratory using the Colt facility; a 0.25 MJ, 2--3 {micro}s rise-time capacitor bank. In the first experiments, a Z-pinch is produced in a 2 cm radius by 2 cm high conducting wall using a static gas-fill of hydrogen or deuterium gas in the range of 0.5 to 2 torr. Follow-on experiments will use a frozen deuterium fiber along the axis (without a gas-fill). The diagnostics include B-dot probes, framing camera, gated OMA visible spectrometer, time-resolved monochrometer, silicon photodiodes, neutron yield, and plasma-density interferometer. Operation to date has been with drive current ranging from 0.8 MA to 1.9 MA. Optical diagnostics show that the plasma produced in the containment region lasts roughly 20 to 30 {micro}s, and the B-dot probes show a broad current-profile in the containment region. The experimental design and data will be presented.

  10. Targeted advertising, platform competition and privacy

    OpenAIRE

    Henk Kox; Bas Straathof; Gijsbert Zwart

    2014-01-01

    Targeted advertising can benefit consumers through lower prices for access to websites. Yet, if consumers dislike that websites collect their personal information, their welfare may go down. We study competition for consumers between websites that can show targeted advertisements. We find that more targeting increases competition and reduces the websites' profits, but yet in equilibrium websites choose maximum targeting as they cannot credibly commit to low targeting. A privacy protection pol...

  11. H:\\PMKER 25(1)\\PDF 25(1)\\AKOUANGO.xps

    African Journals Online (AJOL)

    AISA

    L'humanité est en quête de modèles d'exploitation durables des ressources naturelles. C'est dans cette optique que se développe .... dynamique en matière de gestion durable de la faune, avec l'adoption en 2008 d'une loi sur la ... en ressources naturelles et humaines qui, exploitées de bonne manière ne pourraient que.

  12. H:\\PMKER 25(1)\\PDF 25(1)\\ZOBI.xps

    African Journals Online (AJOL)

    AISA

    diamètre montre que l'éclaircie sélective par dévitalisation chimique a un effet positif sur l'accroissement diamétrique des arbres d'espèces commerciales. Cette technique sylvicole profite essentiellement aux arbres de diamètre 1m. Avec une proportion d'espèces commerciales de 46,8 %, le dispositif de Mopri est.

  13. H:\\PMKER 25(1)\\PDF 25(1)\\EMANFO.xps

    African Journals Online (AJOL)

    AISA

    permis de relever la présence de quatre genres de moisissure : Aspergillus, Alternaria, Penicillium et. Fusarium. Certaines espèces appartenant à ces genres sont généralement impliquées dans des mycoses chez les animaux et des maladies fongiques chez les végétaux. Ainsi, les genres Aspergillus et Fusarium sont ...

  14. H:\\PMKER 25(1)\\PDF 25(1)\\ZOBI.xps

    African Journals Online (AJOL)

    AISA

    richness in managed boreal forest ; Effects of stand succession and thinning. For. Ecol. Manage. 257 (5) : 1386 - 1394. Yandell B. S. 1997. Practical data analysis for designed experiments. Chapman and Hall,. New York. 437 p. Zeide B. 1989. Accuracy of equations describing diameter growth. Canadian Journal of. Forest ...

  15. H:\\PMKER 25(1)\\PDF 25(1)\\AMOUKOU.xps

    African Journals Online (AJOL)

    AISA

    Le sésame (Sesamum indicum L.) est une culture oléagineuse faisant l'objet d'un commerce international en plein essor des graines, de l'huile et du tourteau. Au Niger, un engouement des producteurs vers des cultures moins exigeantes en eau et en intrants s'est vite développé pour augmenter leur revenu et renforcer.

  16. H:\\PMKER 25(1)\\PDF 25(1)\\KIKOUN.xps

    African Journals Online (AJOL)

    AISA

    CI Ferké 2 sugar factory from. 2007 to 2012. It was to cut, ... 13,30 %, juice purity decreased from 88,15 to 85,88 % when the reduces sugar content increase from. 2,21 to 3,80 %. ... la plus importante teneur en saccharose. Entre la coupe et le ...

  17. H:\\PMKER 25(1)\\PDF 25(1)\\KOTAIX.xps

    African Journals Online (AJOL)

    AISA

    associées ou non à l'engrais minéral sur, la hauteur des plantes, le diamètre des tiges, le taux de floraison, les dates phénologiques ... The results showed that the treatment T10 (300 Kg ha-1 mineral fertilizer + 3.75 L ha-1 Dragon 1), better improved growth in plant ...... fertilisation : nouveau défi pour l'agriculture moderne.

  18. Hospitals: Soft Target for Terrorism?

    Science.gov (United States)

    De Cauwer, Harald; Somville, Francis; Sabbe, Marc; Mortelmans, Luc J

    2017-02-01

    In recent years, the world has been rocked repeatedly by terrorist attacks. Arguably, the most remarkable were: the series of four coordinated suicide plane attacks on September 11, 2001 on buildings in New York, Virginia, and Pennsylvania, USA; and the recent series of two coordinated attacks in Brussels (Belgium), on March 22, 2016, involving two bombings at the departure hall of Brussels International Airport and a bombing at Maalbeek Metro Station located near the European Commission headquarters in the center of Brussels. This statement paper deals with different aspects of hospital policy and disaster response planning that interface with terrorism. Research shows that the availability of necessary equipment and facilities (eg, personal protective clothing, decontamination rooms, antidotes, and anti-viral drugs) in hospitals clearly is insufficient. Emergency teams are insufficiently prepared: adequate and repetitive training remain necessary. Unfortunately, there are many examples of health care workers and physicians or hospitals being targeted in both political or religious conflicts and wars. Many health workers were kidnapped and/or killed by insurgents of various ideology. Attacks on hospitals also could cause long-term effects: hospital units could be unavailable for a long time and replacing staff could take several months, further compounding hospital operations. Both physical and psychological (eg, posttraumatic stress disorder [PTSD]) after-effects of a terrorist attack can be detrimental to health care services. On the other hand, physicians and other hospital employees have shown to be involved in terrorism. As data show that some offenders had a previous history with the location of the terror incident, the possibility of hospitals or other health care services being targeted by insiders is discussed. The purpose of this report was to consider how past terrorist incidents can inform current hospital preparedness and disaster response planning

  19. Targeted Therapy in Systemic Sclerosis

    Directory of Open Access Journals (Sweden)

    Murray Baron

    2016-10-01

    Full Text Available Targeted therapies use an understanding of the pathophysiology of a disease in an individual patient. Although targeted therapy for systemic sclerosis (SSc, scleroderma has not yet reached the level of patient-specific treatments, recent developments in the understanding of the global pathophysiology of the disease have led to new treatments based on the cells and pathways that have been shown to be involved in the disease pathogenesis. The presence of a B cell signature in skin biopsies has led to the trial of rituximab, an anti-CD20 antibody, in SSc. The well-known properties of transforming growth factor (TGF-β in promoting collagen synthesis and secretion has led to a small trial of fresolimumab, a human IgG4 monoclonal antibody capable of neutralizing TGF-β. Evidence supporting important roles for interleukin-6 in the pathogenesis of SSc have led to a large trial of tocilizumab in SSc. Soluble guanylate cyclase (sGC is an enzyme that catalyzes the production of cyclic guanosine monophosphate (cGMP upon binding of nitric oxide (NO to the sGC molecule. Processes such as cell growth and proliferation are regulated by cGMP. Evidence that sGC may play a role in SSc has led to a trial of riociguat, a molecule that sensitizes sGC to endogenous NO. Tyrosine kinases (TKs are involved in a wide variety of physiologic and pathological processes including vascular remodeling and fibrogenesis such as occurs in SSc. This has led to a trial of nintedanib, a next-generation tyrosine-kinase (TK inhibitor which targets multiple TKs, in SSc.

  20. Downstream targets of WRKY33

    DEFF Research Database (Denmark)

    Petersen, Klaus; Fiil, Berthe Katrine; Mundy, John

    2008-01-01

    Innate immunity signaling pathways in both animals and plants are regulated by mitogen-activated protein kinase (MAPK) cascades. In a recent publication we show that MPK4 and its substrate MKS1 interact with WRKY33 in vivo, and that WRKY33 is released from complexes with MPK4 upon infection. Tran...... immunoprecipitation confirmed that WRKY33 bound the promoter of PAD3 when plants were inoculated with pathogens. Here we further discuss the involvement of two other targets of WRKY33, NUDT6 and ROF2 in defense responses against invading pathogens....

  1. Performance Targets and External Benchmarking

    DEFF Research Database (Denmark)

    Friis, Ivar; Hansen, Allan; Vámosi, Tamás S.

    Research on relative performance measures, transfer pricing, beyond budgeting initiatives, target costing, piece rates systems and value based management has for decades underlined the importance of external benchmarking in performance management. Research conceptualises external benchmarking...... of the ‘inside’ costs of the sub-component, technical specifications of the product, opportunistic behavior from the suppliers and cognitive limitation. These are all aspects that easily can dismantle the market mechanism and make it counter-productive in the organization. Thus, by directing more attention...

  2. The challenge of targeting metastasis.

    Science.gov (United States)

    Fidler, Isaiah J; Kripke, Margaret L

    2015-12-01

    Metastases that are resistant to conventional therapy are the major cause of death from cancer. In most patients, metastasis has already occurred by the time of diagnosis. Thus, the prevention of metastasis is unlikely to be of therapeutic benefit. The biological heterogeneity of metastases presents a major obstacle to treatment. However, the growth and survival of metastases depend on interactions between tumor cells and host homeostatic mechanisms. Targeting these interactions, in addition to the tumor cells, can produce synergistic therapeutic effects against existing metastases.

  3. Introduction to radar target recognition

    CERN Document Server

    Tait, P

    2006-01-01

    This new text provides an overview of the radar target recognition process and covers the key techniques being developed for operational systems. It is based on the fundamental scientific principles of high resolution radar, and explains how the techniques can be used in real systems, taking into account the characteristics of practical radar system designs and component limitations. It also addresses operational aspects, such as how high resolution modes would fit in with other functions such as detection and tracking. Mathematics is kept to a minimum and the complex techniques and issues are

  4. Targeting α-synuclein oligomers

    DEFF Research Database (Denmark)

    van Diggelen, Femke

    2017-01-01

    Parkinson’s Disease (PD) is a complex disease, characterised by degeneration of neocortical, limbic and nigrostriatal neurons. It is unknown what initiates neurodegeneration, but soluble oligomers of the protein α-synuclein (αSn) seem to be particularly toxic, compared to insoluble fibrils....... Although there is currently no cure for PD, αSn oligomers (αSOs) are a potential therapeutic target, but a major drawback it that little is known about the nature of PD-associated αSOs. The scientific literature describes a wide variety of protocols to generate αSOs in vitro, with a subsequent...

  5. LIFE Target Fabrication Research Plan Sept 2008

    Energy Technology Data Exchange (ETDEWEB)

    Miles, R; Biener, J; Kucheyev, S; Montesanti, R; Satcher, J; Spadaccini, C; Rose, K; Wang, M; Hamza, A; Alexander, N; Brown, L; Hund, J; Petzoldt, R; Sweet, W; Goodin, D

    2008-11-10

    The target-system for the baseline LIFE fast-ignition target was analyzed to establish a preliminary estimate for the costs and complexities involved in demonstrating the technologies needed to build a prototype LIFE plant. The baseline fast-ignition target upon which this analysis was developed is shown in Figure 1.0-1 below. The LIFE target-system incorporates requirements for low-cost, high throughput manufacture, high-speed, high accuracy injection of the target into the chamber, production of sufficient energy from implosion and recovery and recycle of the imploded target material residue. None of these functions has been demonstrated to date. Existing target fabrication techniques which lead to current 'hot spot' target costs of {approx}$100,000 per target and at a production rate of 2/day are unacceptable for the LIFE program. Fabrication techniques normally used for low-cost, low accuracy consumer products such as toys must be adapted to the high-accuracy LIFE target. This will be challenge. A research program resulting is the demonstration of the target-cycle technologies needed for a prototype LIFE reactor is expected to cost {approx}$51M over the course of 5 years. The effort will result in targets which will cost an estimated $0.23/target at a rep-rate of 20 Hz or about 1.73M targets/day.

  6. Targeting telomerase with radiolabeled inhibitors.

    Science.gov (United States)

    Waghorn, Philip A; Jackson, Mark R; Gouverneur, Veronique; Vallis, Katherine A

    2017-01-05

    The expression of telomerase in approximately 85% of cancers and its absence in the majority of normal cells makes it an attractive target for cancer therapy. However the lag period between initiation of telomerase inhibition and growth arrest makes direct inhibition alone an insufficient method of treatment. However, telomerase inhibition has been shown to enhance cancer cell radiosensitivity. To investigate the strategy of simultaneously inhibiting telomerase while delivering targeted radionuclide therapy to cancer cells, 123 I-radiolabeled inhibitors of telomerase were synthesized and their effects on cancer cell survival studied. An 123 I-labeled analogue of the telomerase inhibitor MST-312 inhibited telomerase with an IC 50 of 1.58 μM (MST-312 IC 50 : 0.23 μM). Clonogenic assays showed a dose dependant effect of 123 I-MST-312 on cell survival in a telomerase positive cell line, MDA-MB-435. Copyright © 2016 The Authors. Published by Elsevier Masson SAS.. All rights reserved.

  7. Properties of Protein Drug Target Classes

    Science.gov (United States)

    Bull, Simon C.; Doig, Andrew J.

    2015-01-01

    Accurate identification of drug targets is a crucial part of any drug development program. We mined the human proteome to discover properties of proteins that may be important in determining their suitability for pharmaceutical modulation. Data was gathered concerning each protein’s sequence, post-translational modifications, secondary structure, germline variants, expression profile and drug target status. The data was then analysed to determine features for which the target and non-target proteins had significantly different values. This analysis was repeated for subsets of the proteome consisting of all G-protein coupled receptors, ion channels, kinases and proteases, as well as proteins that are implicated in cancer. Machine learning was used to quantify the proteins in each dataset in terms of their potential to serve as a drug target. This was accomplished by first inducing a random forest that could distinguish between its targets and non-targets, and then using the random forest to quantify the drug target likeness of the non-targets. The properties that can best differentiate targets from non-targets were primarily those that are directly related to a protein’s sequence (e.g. secondary structure). Germline variants, expression levels and interactions between proteins had minimal discriminative power. Overall, the best indicators of drug target likeness were found to be the proteins’ hydrophobicities, in vivo half-lives, propensity for being membrane bound and the fraction of non-polar amino acids in their sequences. In terms of predicting potential targets, datasets of proteases, ion channels and cancer proteins were able to induce random forests that were highly capable of distinguishing between targets and non-targets. The non-target proteins predicted to be targets by these random forests comprise the set of the most suitable potential future drug targets, and should therefore be prioritised when building a drug development programme. PMID

  8. Prevention of anxiety disorders and depression by targeting excessive worry and rumination in adolescents and young adults: A randomized controlled trial.

    Science.gov (United States)

    Topper, Maurice; Emmelkamp, Paul M G; Watkins, Ed; Ehring, Thomas

    2017-03-01

    This randomized controlled trial evaluated the efficacy of a preventive intervention for anxiety disorders and depression by targeting excessive levels of repetitive negative thinking (RNT; worry and rumination) in adolescents and young adults. Participants (N = 251, 83.7% female) showing elevated levels of RNT were randomly allocated to a 6-week cognitive-behavioral training delivered in a group, via the internet, or to a waitlist control condition. Self-report measures were collected at pre-intervention, post-intervention, 3 m and 12 m follow-up. Both versions of the preventive intervention significantly reduced RNT (d = 0.53 to 0.89), and symptom levels of anxiety and depression (d = 0.36 to 0.72). Effects were maintained until 12 m follow-up. The interventions resulted in a significantly lower 12 m prevalence rate of depression (group intervention: 15.3%, internet intervention: 14.7%) and generalized anxiety disorder (group intervention: 18.0%, internet intervention: 16.0%), compared to the waitlist (32.4% and 42.2%, respectively). Mediation analyses demonstrated that reductions in RNT mediated the effect of the interventions on the prevalence of depression and generalized anxiety disorder. Results provide evidence for the efficacy of this preventive intervention targeting RNT and support a selective prevention approach that specifically targets a known risk factor to prevent multiple disorders. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Neutron Protection Factor Determination and Validation for a Vehicle Surrogate Using a Californium Fission Source

    Science.gov (United States)

    2017-06-01

    a 4 mm x 4 mm (0.157" x 0.157") LiI(Eu) crystal with 96% enrichment of lithium -6. The crystal is connected to a photomultiplier tube (PMT) which...32 Figure 17. Lithium -6 Iodide, Europium Doped Scintillation Detector. Source: [27...Alamos National Laboratory LiI(Eu) Lithium Iodide Europium Doped LLD Low Level Discriminator LLNL Lawrence Livermore National Laboratory MASH Monte

  10. Bioengineering Strategies for Designing Targeted Cancer Therapies

    Science.gov (United States)

    Wen, Xuejun

    2014-01-01

    The goals of bioengineering strategies for targeted cancer therapies are (1) to deliver a high dose of an anticancer drug directly to a cancer tumor, (2) to enhance drug uptake by malignant cells, and (3) to minimize drug uptake by nonmalignant cells. Effective cancer-targeting therapies will require both passive- and active targeting strategies and a thorough understanding of physiologic barriers to targeted drug delivery. Designing a targeted therapy includes the selection and optimization of a nanoparticle delivery vehicle for passive accumulation in tumors, a targeting moiety for active receptor-mediated uptake, and stimuli-responsive polymers for control of drug release. The future direction of cancer targeting is a combinatorial approach, in which targeting therapies are designed to use multiple targeting strategies. The combinatorial approach will enable combination therapy for delivery of multiple drugs and dual ligand targeting to improve targeting specificity. Targeted cancer treatments in development and the new combinatorial approaches show promise for improving targeted anticancer drug delivery and improving treatment outcomes. PMID:23768509

  11. TARGET 2 and Settlement Finality

    Directory of Open Access Journals (Sweden)

    Ivan MANGATCHEV

    2011-03-01

    Full Text Available This article examines how TARGET 2 as system implements the idea of settlement finality regulated by Directive 98/26 EC of the European parliament and of the Council of 19 May 1998 on settlement finality in payment and securities settlement systems (Settlement Finality Directive and Directive 2009/44/EC of the European parliament and of the Council of 6 May 2009 amending Directive 98/26/EC on settlement finality in payment and securities settlement systems and Directive 2002/47/EC on financial collateral arrangements as regards linked systems and credit claims (Directive 2009/44/EC. As the title of the arti and finality of the settlement in this system.

  12. Terahertz-based target typing.

    Energy Technology Data Exchange (ETDEWEB)

    Lyo, Sungkwun Kenneth; Wanke, Michael Clement; Reno, John Louis; Shaner, Eric Arthur; Grine, Albert D.; Barrick, Todd A.

    2008-09-01

    The purpose of this work was to create a THz component set and understanding to aid in the rapid analysis of transient events. This includes the development of fast, tunable, THz detectors, along with filter components for use with standard detectors and accompanying models to simulate detonation signatures. The signature effort was crucial in order to know the spectral range to target for detection. Our approach for frequency agile detection was to utilize plasmons in the channel of a specially designed field-effect transistor called the grating-gate detector. Grating-gate detectors exhibit narrow-linewidth, broad spectral tunability through application of a gate bias, and no angular dependence in their photoresponse. As such, if suitable sensitivity can be attained, they are viable candidates for Terahertz multi-spectral focal plane arrays.

  13. Gene Therapy Targeting HIV Entry

    Directory of Open Access Journals (Sweden)

    Chuka Didigu

    2014-03-01

    Full Text Available Despite the unquestionable success of antiretroviral therapy (ART in the treatment of HIV infection, the cost, need for daily adherence, and HIV-associated morbidities that persist despite ART all underscore the need to develop a cure for HIV. The cure achieved following an allogeneic hematopoietic stem cell transplant (HSCT using HIV-resistant cells, and more recently, the report of short-term but sustained, ART-free control of HIV replication following allogeneic HSCT, using HIV susceptible cells, have served to both reignite interest in HIV cure research, and suggest potential mechanisms for a cure. In this review, we highlight some of the obstacles facing HIV cure research today, and explore the roles of gene therapy targeting HIV entry, and allogeneic stem cell transplantation in the development of strategies to cure HIV infection.

  14. Targeting Persistent Human Papillomavirus Infection.

    Science.gov (United States)

    Shanmugasundaram, Srinidhi; You, Jianxin

    2017-08-18

    While the majority of Human papillomavirus (HPV) infections are transient and cleared within a couple of years following exposure, 10-20% of infections persist latently, leading to disease progression and, ultimately, various forms of invasive cancer. Despite the clinical efficiency of recently developed multivalent prophylactic HPV vaccines, these preventive measures are not effective against pre-existing infection. Additionally, considering that the burden associated with HPV is greatest in regions with limited access to preventative vaccination, the development of effective therapies targeting persistent infection remains imperative. This review discusses not only the mechanisms underlying persistent HPV infection, but also the promise of immunomodulatory therapeutic vaccines and small-molecular inhibitors, which aim to augment the host immune response against the viral infection as well as obstruct critical viral-host interactions.

  15. Targeting ECM Disrupts Cancer Progression

    DEFF Research Database (Denmark)

    Venning, Freja A; Wullkopf, Lena; Erler, Janine T

    2015-01-01

    Metastatic complications are responsible for more than 90% of cancer-related deaths. The progression from an isolated tumor to disseminated metastatic disease is a multistep process, with each step involving intricate cross talk between the cancer cells and their non-cellular surroundings, the ex...... is summarized. In addition, we highlight the promising (pre-)clinical data showing benefits of targeting these ECM macromolecules to prevent cancer progression.......Metastatic complications are responsible for more than 90% of cancer-related deaths. The progression from an isolated tumor to disseminated metastatic disease is a multistep process, with each step involving intricate cross talk between the cancer cells and their non-cellular surroundings......, the extracellular matrix (ECM). Many ECM proteins are significantly deregulated during the progression of cancer, causing both biochemical and biomechanical changes that together promote the metastatic cascade. In this review, the influence of several ECM proteins on these multiple steps of cancer spread...

  16. Obesity treatment: novel peripheral targets.

    Science.gov (United States)

    Field, Benjamin C T; Chaudhri, Owais B; Bloom, Stephen R

    2009-12-01

    Our knowledge of the complex mechanisms underlying energy homeostasis has expanded enormously in recent years. Food intake and body weight are tightly regulated by the hypothalamus, brainstem and reward circuits, on the basis both of cognitive inputs and of diverse humoral and neuronal signals of nutritional status. Several gut hormones, including cholecystokinin, glucagon-like peptide-1, peptide YY, oxyntomodulin, amylin, pancreatic polypeptide and ghrelin, have been shown to play an important role in regulating short-term food intake. These hormones therefore represent potential targets in the development of novel anti-obesity drugs. This review focuses on the role of gut hormones in short- and long-term regulation of food intake, and on the current state of development of gut hormone-based obesity therapies.

  17. Moringa oleifera Lam: Targeting Chemoprevention.

    Science.gov (United States)

    Karim, Nurul Ashikin Abd; Ibrahim, Muhammad Din; Kntayya, Saie Brindha; Rukayadi, Yaya; Hamid, Hazrulizawati Abd; Razis, Ahmad Faizal Abdull

    2016-01-01

    Moringa oleifera Lam, family Moringaceae, is a perennial plant which is called various names, but is locally known in Malaysia as "murungai" or "kelor". Glucomoringin, a glucosinolate with from M. oleifera is a major secondary metabolite compound. The seeds and leaves of the plant are reported to have the highest amount of glucosinolates. M. oleifera is well known for its many uses health and benefits. It is claimed to have nutritional, medicinal and chemopreventive potentials. Chemopreventive effects of M. oleifera are expected due to the existence of glucosinolate which it is reported to have the ability to induce apoptosis in anticancer studies. Furthermore, chemopreventive value of M. oleifera has been demonstrated in studies utilizing its leaf extract to inhibit the growth of human cancer cell lines. This review highlights the advantages of M. oleifera targeting chemoprevention where glucosinolates could help to slow the process of carcinogenesis through several molecular targets. It is also includes inhibition of carcinogen activation and induction of carcinogen detoxification, anti-inflammatory, anti-tumor cell proliferation, induction of apoptosis and inhibition of tumor angiogenesis. Finally, for synergistic effects of M. oleifera with other drugs and safety, essential for chemoprevention, it is important that it safe to be consumed by human body and works well. Although there is promising evidence about M. oleifera in chemoprevention, extensive research needs to be done due to the expected rise of cancer in coming years and to gain more information about the mechanisms involved in M. oleifera influence, which could be a good source to inhibit several major mechanisms involved in cancer development.

  18. Target therapies in pancreatic carcinoma.

    Science.gov (United States)

    Silvestris, Nicola; Gnoni, Antonio; Brunetti, Anna Elisabetta; Vincenti, Leonardo; Santini, Daniele; Tonini, Giuseppe; Merchionne, Francesca; Maiello, Evaristo; Lorusso, Vito; Nardulli, Patrizia; Azzariti, Amalia; Reni, Michele

    2014-01-01

    Pancreatic ductal adenocarcinoma (PDAC) occurs in the majority of cases with early locoregional spread and distant metastases at diagnosis, leading to dismal prognosis and limited treatment options. Traditional cytotoxic chemotherapy provides only modest benefit to patients with PDAC. Identification of different molecular pathways, overexpressed in pancreatic cancer cells, has provided the opportunity to develop targeted therapies (monoclonal antibodies and small-molecule inhibitors) and peculiar new class of taxanes with a crucial therapeutic role in this cancer setting. A phase III trial has shown that erlotinib in combination with gemcitabine was clinically irrelevant and skin toxicity can be a positive prognostic factor. Moreover, the combination of cetuximab or erlotinib with radiotherapy in advanced pancreatic cancer has shown to be synergistic and a reversal of radio-resistance has been suggested by inhibition of VEGF/EGFR pathway. To overcome EGFR-inhibition therapy resistance several alternative pathways targets are under investigation (IGF- 1R, MMPs, Hedgehog proteins, m-TOR, MEK, COX-2) and provide the rationale for clinical use in phase II/III studies. Also nab-paclitaxel, a new taxanes class, uses high pancreatic albumin-binding protein SPARC levels to act in cancer cells with a less toxic and more effective dose with respect to classic taxanes. Understanding of molecular pathogenesis of pancreatic adenocarcinoma continues to expand. However, many promising data in preclinic and phase I/II trials did not yield promise in phase III trials, suggesting that identification of predictive biomarkers for these new agents is mandatory. The knowledge of biologic and molecular aspects of pancreatic cancer can be the basis for future therapeutic developments.

  19. Combinatorial microRNA target predictions

    DEFF Research Database (Denmark)

    Krek, Azra; Grün, Dominic; Poy, Matthew N.

    2005-01-01

    MicroRNAs are small noncoding RNAs that recognize and bind to partially complementary sites in the 3' untranslated regions of target genes in animals and, by unknown mechanisms, regulate protein production of the target transcript1, 2, 3. Different combinations of microRNAs are expressed...... in different cell types and may coordinately regulate cell-specific target genes. Here, we present PicTar, a computational method for identifying common targets of microRNAs. Statistical tests using genome-wide alignments of eight vertebrate genomes, PicTar's ability to specifically recover published micro......RNA targets, and experimental validation of seven predicted targets suggest that PicTar has an excellent success rate in predicting targets for single microRNAs and for combinations of microRNAs. We find that vertebrate microRNAs target, on average, roughly 200 transcripts each. Furthermore, our results...

  20. Targets and processes for fabricating same

    Science.gov (United States)

    Cowna, Thomas; Malekos, Steven; Korgan, Grant; Adams, Jesse; Sentoku, Yasuhiko; LeGalloudec, Nathalie

    2014-06-10

    In particular embodiments, the present disclosure provides targets including a metal layer and defining a hollow inner surface. The hollow inner surface has an internal apex. The distance between at least two opposing points of the internal apex is less than about 15 .mu.m. In particular examples, the distance is less than about 1 .mu.m. Particular implementations of the targets are free standing. The targets have a number of disclosed shaped, including cones, pyramids, hemispheres, and capped structures. The present disclosure also provides arrays of such targets. Also provided are methods of forming targets, such as the disclosed targets, using lithographic techniques, such as photolithographic techniques. In particular examples, a target mold is formed from a silicon wafer and then one or more sides of the mold are coated with a target material, such as one or more metals.

  1. Cooperative tumour cell membrane targeted phototherapy

    Science.gov (United States)

    Kim, Heegon; Lee, Junsung; Oh, Chanhee; Park, Ji-Ho

    2017-06-01

    The targeted delivery of therapeutics using antibodies or nanomaterials has improved the precision and safety of cancer therapy. However, the paucity and heterogeneity of identified molecular targets within tumours have resulted in poor and uneven distribution of targeted agents, thus compromising treatment outcomes. Here, we construct a cooperative targeting system in which synthetic and biological nanocomponents participate together in the tumour cell membrane-selective localization of synthetic receptor-lipid conjugates (SR-lipids) to amplify the subsequent targeting of therapeutics. The SR-lipids are first delivered selectively to tumour cell membranes in the perivascular region using fusogenic liposomes. By hitchhiking with extracellular vesicles secreted by the cells, the SR-lipids are transferred to neighbouring cells and further spread throughout the tumour tissues where the molecular targets are limited. We show that this tumour cell membrane-targeted delivery of SR-lipids leads to uniform distribution and enhanced phototherapeutic efficacy of the targeted photosensitizer.

  2. Study Identifies New Lymphoma Treatment Target

    Science.gov (United States)

    NCI researchers have identified new therapeutic targets for diffuse large B-cell lymphoma. Drugs that hit these targets are under clinical development and the researchers hope to begin testing them in clinical trials of patients with DLBCL.

  3. On the large COMPASS polarized deuteron target

    CERN Document Server

    Finger, M; Baum, G; Doshita, N; Finger, M Jr; Gautheron, F; Goertz, St; Hasegawa, T; Heckmann, J; Hess, Ch; Horikawa, N; Ishimoto, S; Iwata, T; Kisselev, Y; Koivuniemi, J; Kondo, K; Le Goff, J-M; Magnon, A; Marchand, C; Matsuda, T; Meyer, W; Reicherz, G; Srnka, A

    2006-01-01

    The spin structure of the nucleons is investigated in deep inelastic scattering of a polarized muon beam and a polarized nucleon target in the COMPASS experiment at CERN since 2001. To achieve high luminosities a large solid polarized target is used. The COMPASS polarized target consists of a high cooling power $^{3}$He/$^{4}$He dilution refrigerator capable to maintain working temperature of the target material at about 50mK, a superconducting solenoid and dipole magnet system for longitudinal and transversal magnetic field on the target material, respectively, target cells containing polarizable material, microwave cavities and high power microwave radiation systems for dynamic nuclear polarization and the nuclear magnetic resonance system for nuclear spin polarization measurements. During 2001–2004 experiments superconducting magnet system with opening angle $\\pm$69 mrad, polarized target holder with two target cells and corresponding microwave and NMR systems have been used. For the data taking from 200...

  4. Targeting Cancer with Antisense Oligomers

    Energy Technology Data Exchange (ETDEWEB)

    Hnatowich, DJ

    2008-10-28

    With financial assistance from the Department of Energy, we have shown definitively that radiolabeled antisense DNAs and other oligomers will accumulate in target cancer cells in vitro and in vivo by an antisense mechanism. We have also shown that the number of mRNA targets for our antisense oligomers in the cancer cell types that we have investigated so far is sufficient to provide and antisense image and/or radiotherapy of cancer in mice. These studies have been reported in about 10 publications. However our observation over the past several years has shown that radiolabeled antisense oligomers administered intravenously in their native and naked form will accumulate and be retained in target xenografts by an antisense mechanism but will also accumulate at high levels in normal organs such as liver, spleen and kidneys. We have investigated unsuccessfully several commercially available vectors. Thus the use of radiolabeled antisense oligomers for the imaging of cancer must await novel approaches to delivery. This laboratory has therefore pursued two new paths, optical imaging of tumor and Auger radiotherapy. We are developing a novel method of optical imaging tumor using antisense oligomers with a fluorophore is administered while hybridized with a shorter complementary oligomer with an inhibitor. In culture and in tumored mice that the duplex remains intact and thus nonfluorescent until it encounters its target mRNA at which time it dissociates and the antisense oligomer binds along with its fluorophore to the target. Simultaneous with the above, we have also observed, as have others, that antisense oligomers migrate rapidly and quantitatively to the nucleus upon crossing cell membranes. The Auger electron radiotherapy path results from this observation since the nuclear migration properties could be used effectively to bring and to retain in the nucleus an Auger emitting radionuclide such as 111In or 125I bound to the antisense oligomer. Since the object becomes

  5. [Identification of mutations associated with coronary artery lesion susceptibility in Kawasaki disease by targeted enrichment of genomic region sequencing technique].

    Science.gov (United States)

    Zhu, D Y; Song, S R; Xie, L J; Qiu, F; Yang, J; Xiao, T T; Huang, M

    2017-07-02

    Objective: To screen and identify the mutations in Kawasaki disease by targeted enrichment of genomic region sequencing technique and investigate susceptibility genes associated with coronary artery lesion. Method: This was a case-control study.A total of 114 patients diagnosed as Kawasaki disease treated in Shanghai Children's Hospital between December 2015 and November 2016 were studied and another 45 healthy children who were physically examined in outpatient department were enrolled as control group. Patients were divided into two groups based on the results of echocardiogram. Peripheral venous blood was obtained from patients and controls. Genomic DNA was extracted. SeqCap EZ Choice libraries were prepared by targeted enrichment of genomic region technology. Then the libraries were sequenced to identify susceptibility genes associated with coronary artery lesion in patients diagnosed as Kawasaki disease.Susceptible genes were identified by Burden test, Pearson chi-square test or Fisher's exact probability test. Result: There was statistically significant difference in TNFRSF11B(rs2073618)G>C(p.N3K)mutation and GG/GC/CC genotype between Kawasaki disease group and control group(χ(2)=15.52, P =0.00). There was statistically significant difference in TNFRSF13B(rs34562254)C>T(p.P251L)mutation(χ(2)=10.40, P =0.01)and LEFTY1(rs360057)T>G(p.D322A)mutation(χ(2)=8.505, P =0.01)between patients with coronary artery lesions and those without. Conclusion: Targeted enrichment of genomic region sequencing technology can be used to do primary screening for the susceptible genes associated with coronary artery lesions in Chinese Kawasaki patients and may provide theoretical basis for larger sample investigation of risk prediction score standard in Kawasaki disease.

  6. MiRNA-125a-5p inhibits glioblastoma cell proliferation and promotes cell differentiation by targeting TAZ

    Energy Technology Data Exchange (ETDEWEB)

    Yuan, Jian; Xiao, Gelei [Department of Neurosurgery, Xiangya Hospital, Central South University, Changsha, Hunan 410008 (China); The Institute of Skull Base Surgery & Neuro-oncology at Hunan, Changsha, Hunan 410008 (China); Peng, Gang [Department of Neurosurgery, Xiangya Hospital, Central South University, Changsha, Hunan 410008 (China); Liu, Dingyang [Department of Neurosurgery, Xiangya Hospital, Central South University, Changsha, Hunan 410008 (China); The Institute of Skull Base Surgery & Neuro-oncology at Hunan, Changsha, Hunan 410008 (China); Wang, Zeyou [Cancer Research Institute, Central South University, Changsha, Hunan 410008 (China); Liao, Yiwei; Liu, Qing [Department of Neurosurgery, Xiangya Hospital, Central South University, Changsha, Hunan 410008 (China); The Institute of Skull Base Surgery & Neuro-oncology at Hunan, Changsha, Hunan 410008 (China); Wu, Minghua [The Institute of Skull Base Surgery & Neuro-oncology at Hunan, Changsha, Hunan 410008 (China); Cancer Research Institute, Central South University, Changsha, Hunan 410008 (China); Yuan, Xianrui, E-mail: xry69@163.com [Department of Neurosurgery, Xiangya Hospital, Central South University, Changsha, Hunan 410008 (China); The Institute of Skull Base Surgery & Neuro-oncology at Hunan, Changsha, Hunan 410008 (China)

    2015-02-06

    Highlights: • Expression of miR-125a-5p is inversely correlated with that of TAZ in glioma cells. • MiR-125a-5p represses TAZ expression in glioma cells. • MiR-125a-5p directly targets the 3′ UTR of TAZ mRNA and promotes its degradation. • MiR-125a-5p represses CTGF and survivin via TAZ, and inhibits glioma cell growth. • MiR-125a-5p inhibits the stem cell features of HFU-251 MG cells. - Abstract: Glioblastoma (GBM) is the most lethal brain tumor due to the resistance to conventional therapies, such as radiotherapy and chemotherapy. TAZ, an important mediator of the Hippo pathway, was found to be up-regulated in diverse cancers, including in GBM, and plays important roles in tumor initiation and progression. However, little is known about the regulation of TAZ expression in tumors. In this study, we found that miR-125a-5p is an important regulator of TAZ in glioma cells by directly targeting the TAZ 3′ UTR. MiR-125a-5p levels are inversely correlated with that of TAZ in normal astrocytes and a panel of glioma cell lines. MiR-125a-5p represses the expression of TAZ target genes, including CTGF and survivin, and inhibits cell proliferation and induces the differentiation of GBM cells; whereas over-expression of TAZ rescues the effects of miR-125a-5p. This study revealed a mechanism for TAZ deregulation in glioma cells, and also demonstrated a tumor suppressor role of miR-125a-5p in glioblastoma cells.

  7. Targeted integration of genes in Xenopus tropicalis

    DEFF Research Database (Denmark)

    Shi, Zhaoying; Tian, Dandan; Xin, Huhu

    2017-01-01

    With the successful establishment of both targeted gene disruption and integration methods in the true diploid frog Xenopus tropicalis, this excellent vertebrate genetic model now is making a unique contribution to modelling human diseases. Here, we summarize our efforts on establishing homologous...... recombination-mediated targeted integration in Xenopus tropicalis, the usefulness, and limitation of targeted integration via the homology-independent strategy, and future directions on how to further improve targeted gene integration in Xenopus tropicalis....

  8. Capacitive Sensors And Targets Would Measure Alignments

    Science.gov (United States)

    Jenstrom, Del T.

    1994-01-01

    Multiple capacitive sensors and active targets used to measure distance between, and relative orientation of, two objects. Sensed target signals processed and used by control systems to align objects to be joined. Shapes, sizes, and layouts of sensors and targets optimized for specific application. Particular layout of targets and sensors enables determination of relative position and orientation of two objects in all six degrees of freedom.

  9. 40 CFR 35.9020 - Planning targets.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Planning targets. 35.9020 Section 35... STATE AND LOCAL ASSISTANCE Financial Assistance for the National Estuary Program § 35.9020 Planning targets. The EPA Assistant Administrator for Water develops planning targets each year to help each...

  10. Inflation Targeting and Business Cycle Synchronization

    OpenAIRE

    Flood, Robert P; Rose, Andrew K

    2009-01-01

    Inflation targeting seems to have a small but positive effect on the synchronization of business cycles; countries that target inflation seem to have cycles that move slightly more closely with foreign cycles. Thus the advent of inflation targeting does not explain the decoupling of global business cycles, for two reasons. Indeed business cycles have not in fact become less synchronized across countries.

  11. Starkweather Target Game for Preschool Children.

    Science.gov (United States)

    Starkweather, Elizabeth K.

    The Starkweather Target Game is designed to measure preschool children's willingness to try difficult tasks independent of ability. The game consists of a box-shaped target which responds, when the target is hit by a rolled ball, somewhat like a jack-in-a-box. When the bull's eye is hit, the lid opens and a surprise picture appears. After being…

  12. Vergence facility with stereoscopic and nonstereoscopic targets.

    Science.gov (United States)

    Momeni-Moghaddam, Hamed; Goss, David A; Dehvari, Abubakr

    2014-05-01

    To compare vergence facility with nonstereo and stereo targets in binocular symptomatic and asymptomatic subjects. Sixty-six students were divided into symptomatic and asymptomatic groups according to the Convergence Insufficiency Symptom Survey Questionnaire score. Vergence facility was tested at 40 cm by flipper prism 3Δ BI/12Δ BO (BI, base-in; BO, base-out). The targets used were a nonstereo target (a vertical column of small letter "E" of ~20/30 size), a stereo-local target (fifth set of circles of the Titmus test with stereoacuity of 100 arcsec), and a stereo-global target (page 6 of the TNO test with stereoacuity of 120 arcsec). Repeated-measures analysis of variance showed differences in the mean vergence facility with different targets in all subjects and separately in two symptom groups (p 0.05) but significant for the comparison of stereo-global targets with the other two targets. The receiver operating characteristic curve analysis showed the cutoff points 10.5, 10.5, and 9.75 cycles per minute with nonstereo, stereo-local, and stereo-global targets, respectively. The sensitivity of the three targets used was the same (97%). Specificity was 0.93 or higher with all three targets, with the highest specificity obtained with the stereo-global target (100%). The highest vergence facility was obtained with a nonstereo target and the lowest was obtained with a stereo-global target. High sensitivity with all three targets means that there are few false-negative results with them, and the high specificity is indicative of low false-positive results. Hence, the vergence facility predictive value would be high in diagnosing binocular symptomatic patients using a 3Δ BI/12Δ BO prism flipper at near and a response cutoff of about 10 cycles per minute or less.

  13. Targeted alpha therapy for cancer

    Energy Technology Data Exchange (ETDEWEB)

    Allen, Barry J [Centre for Experimental Radiation Oncology, St George Cancer Care Centre, Gray St, Kogarah 2217, NSW (Australia); Raja, Chand [Centre for Experimental Radiation Oncology, St George Cancer Care Centre, Gray St, Kogarah 2217, NSW (Australia); Rizvi, Syed [Centre for Experimental Radiation Oncology, St George Cancer Care Centre, Gray St, Kogarah 2217, NSW (Australia); Li Yong [Centre for Experimental Radiation Oncology, St George Cancer Care Centre, Gray St, Kogarah 2217, NSW (Australia); Tsui, Wendy [Centre for Experimental Radiation Oncology, St George Cancer Care Centre, Gray St, Kogarah 2217, NSW (Australia); Zhang, David [Centre for Experimental Radiation Oncology, St George Cancer Care Centre, Gray St, Kogarah 2217, NSW (Australia); Song, Emma [Centre for Experimental Radiation Oncology, St George Cancer Care Centre, Gray St, Kogarah 2217, NSW (Australia); Qu, C F [Centre for Experimental Radiation Oncology, St George Cancer Care Centre, Gray St, Kogarah 2217, NSW (Australia); Kearsley, John [Centre for Experimental Radiation Oncology, St George Cancer Care Centre, Gray St, Kogarah 2217, NSW (Australia); Graham, Peter [Centre for Experimental Radiation Oncology, St George Cancer Care Centre, Gray St, Kogarah 2217, NSW (Australia); Thompson, John [Sydney Melanoma Unit, Royal Prince Alfred Hospital, Camperdown 2050 NSW (Australia)

    2004-08-21

    Targeted alpha therapy (TAT) offers the potential to inhibit the growth of micrometastases by selectively killing isolated and preangiogenic clusters of cancer cells. The practicality and efficacy of TAT is tested by in vitro and in vivo studies in melanoma, leukaemia, colorectal, breast and prostate cancers, and by a phase 1 trial of intralesional TAT for melanoma. The alpha-emitting radioisotope used is Bi-213, which is eluted from the Ac-225 generator and chelated to a cancer specific monoclonal antibody (mab) or protein (e.g. plasminogen activator inhibitor-2 PAI2) to form the alpha-conjugate (AC). Stable alpha-ACs have been produced which have been tested for specificity and cytotoxicity in vitro against melanoma (9.2.27 mab), leukaemia (WM60), colorectal (C30.6), breast (PAI2, herceptin), ovarian (PAI2, herceptin, C595), prostate (PAI2, J591) and pancreatic (PAI2, C595) cancers. Subcutaneous inoculation of 1-1.5 million human cancer cells into the flanks of nude mice causes tumours to grow in all mice. Tumour growth is compared for untreated controls, nonspecific AC and specific AC, for local (subcutaneous) and systemic (tail vein or intraperitoneal) injection models. The {sup 213}Bi-9.2.27 AC is injected into secondary skin melanomas in stage 4 patients in a dose escalation study to determine the effective tolerance dose, and to measure kinematics to obtain the equivalent dose to organs. In vitro studies show that TAT is one to two orders of magnitude more cytotoxic to targeted cells than non-specific ACs, specific beta emitting conjugates or free isotopes. In vivo local TAT at 2 days post-inoculation completely prevents tumour formation for all cancers tested so far. Intra-lesional TAT can completely regress advanced sc melanoma but is less successful for breast and prostate cancers. Systemic TAT inhibits the growth of sc melanoma xenografts and gives almost complete control of breast and prostate cancer tumour growth. Intralesional doses up to 450 {mu

  14. microRNA-100 targets SMRT/NCOR2, reduces proliferation, and improves survival in glioblastoma animal models.

    Directory of Open Access Journals (Sweden)

    Bahauddeen M Alrfaei

    Full Text Available Glioblastoma (GBM is the most frequently diagnosed malignant human glioma, and current median patient survival is less than two years despite maximal surgery followed by temozolomide chemoradiation therapies. Novel microRNA-related therapies are now being developed for cancers such as GBM. Differential microRNA expression profiling revealed that miR-100 expression is down-regulated in GBM compared to normal controls. We report that miR-100 expression reduces GBM tumorigenicity. In vitro, four GBM lines (U87, U251, 22T, and 33T demonstrated reduced proliferation 24 hours after transient miR100 overexpression via transfection. miR-100 triggered cell death an average 70% more than scrambled miR controls 24 hours after transient transfection (p < 0.01. miR-100 targeted inhibition of the "silencing mediator of retinoid or thyroid hormone receptor-2" (SMRT/NCOR2 gene was confirmed via reporter assays. Ki67 proliferation index was decreased 40% in tumor xenografts generated from stable miR-100 transfected GBM lines versus controls (p < 0.01. Furthermore, treatment of tumor xenografts with a single pre-mir-100 injection (60 pmol significantly extended survival of mice bearing intracranial GBM xenografts 25% more than scrambled controls (p < 0.01; n=8. These studies establish miR-100's effect on tumor GBM growth, and suggest clinical potential for microRNA-related GBM therapy.

  15. Tantalum/Copper X-Ray Targets

    Science.gov (United States)

    Waters, William J.; Edmonds, Brian

    1993-01-01

    Lewis Research Center developed unique solution to subsidiary problem of fabrication of x-ray target. Plasma spraying enabled fabrication of lightweight, high-performance targets. Power settings, atmosphere-control settings, rate of deposition, and other spraying parameters developed. Thin coats of tantalum successfully deposited on copper targets. Targets performed successfully in tests and satisfied all criteria expressed in terms of critical parameters. Significantly reduces projected costs of fabrication of targets and contributes to development of improved, long-lived, lightweight x-ray system.

  16. Targeting nominal income growth or inflation?

    DEFF Research Database (Denmark)

    Jensen, Henrik

    2002-01-01

    Within a simple New Keynesian model emphasizing forward-looking behavior of private agents, I evaluate optimal nominal income growth targeting versus optimal inflation targeting. When the economy is mainly subject to shocks that do not involve monetary policy trade-offs for society, inflation...... targeting is preferable. Otherwise, nominal income growth targeting may be superior because it induces inertial policy making, which improves the inflation-output-gap trade-off. Somewhat paradoxically, inflation targeting may be relatively less favorable the more society dislikes inflation, and the more...

  17. Improved Targeting of Cancers with Nanotherapeutics

    DEFF Research Database (Denmark)

    Foster, Christian; Watson, Andre; Kaplinsky, Joseph John

    2017-01-01

    Targeted cancer nanotherapeutics offers numerous opportunities for the selective uptake of toxic chemotherapies within tumors and cancer cells. The unique properties of nanoparticles, such as their small size, large surface-to-volume ratios, and the ability to achieve multivalency of targeting...... ligands on their surface, provide superior advantages for nanoparticle-based drug delivery to a variety of cancers. This review highlights various key concepts in the design of targeted nanotherapeutics for cancer therapy, and discusses physicochemical parameters affecting nanoparticle targeting, along...... with recent developments for cancer-targeted nanomedicines....

  18. Graphite target for the spiral project

    Energy Technology Data Exchange (ETDEWEB)

    Putaux, J.C.; Ducourtieux, M.; Ferro, A.; Foury, P.; Kotfila, L.; Mueller, A.C.; Obert, J.; Pauwels, N.; Potier, J.C.; Proust, J. [Paris-11 Univ., 91 - Orsay (France). Inst. de Physique Nucleaire; Bertrand, P. [Grand Accelerateur National d`Ions Lourds (GANIL), 14 - Caen (France); Loiselet, M. [Universite Catholique de Louvain, Louvain-La-Neuve (Belgium)] [and others

    1996-12-31

    A study of the thermal and physical properties of graphite targets for the SPIRAL project is presented. The main objective is to develop an optimized set-up both mechanically and thermally resistant, presenting good release properties (hot targets with thin slices). The results of irradiation tests concerning the mechanical and thermal resistance of the first prototype of SPIRAL target with conical geometry are presented. The micro-structural properties of the graphite target is also studied, in order to check that the release properties are not deteriorated by the irradiation. Finally, the results concerning the latest pilot target internally heated by an electrical current are shown. (author). 5 refs.

  19. The trajectory of the target probability effect.

    Science.gov (United States)

    Hon, Nicholas; Yap, Melvin J; Jabar, Syaheed B

    2013-05-01

    The effect of target probability on detection times is well-established: Even when detection accuracy is high, lower probability targets are detected more slowly than higher probability ones. Although this target probability effect on detection times has been well-studied, one aspect of it has remained largely unexamined: How the effect develops over the span of an experiment. Here, we investigated this issue with two detection experiments that assessed different target probability ratios. Conventional block segment analysis and linear mixed-effects modeling converged on two key findings. First, we found that the magnitude of the target probability effect increases as one progresses through a block of trials. Second, we found, by examining the trajectories of the low- and high-probability targets, that this increase in effect magnitude was driven by the low-probability targets. Specifically, we found that low-probability targets were detected more slowly as a block of trials progressed. Performance to high-probability targets, on the other hand, was largely invariant across the block. The latter finding is of particular interest because it cannot be reconciled with accounts that propose that the target probability effect is driven by the high-probability targets.

  20. Secondary anchor targeted cell release.

    Science.gov (United States)

    Ansari, Ali; Lee-Montiel, Felipe T; Amos, Jennifer R; Imoukhuede, P I

    2015-11-01

    Personalized medicine offers the promise of tailoring therapy to patients, based on their cellular biomarkers. To achieve this goal, cellular profiling systems are needed that can quickly and efficiently isolate specific cell types without disrupting cellular biomarkers. Here we describe the development of a unique platform that facilitates gentle cell capture via a secondary, surface-anchoring moiety, and cell release. The cellular capture system consists of a glass surface functionalized with APTES, d-desthiobiotin, and streptavidin. Biotinylated mCD11b and hIgG antibodies are used to capture mouse macrophages (RAW 264.7) and human breast cancer (MCF7-GFP) cell lines, respectively. The surface functionalization is optimized by altering assay components, such as streptavidin, d-desthiobiotin, and APTES, to achieve cell capture on 80% of the functionalized surface and cell release upon biotin treatment. We also demonstrate an ability to capture 50% of target cells within a dual-cell mixture. This engineering advancement is a critical step towards achieving cell isolation platforms for personalized medicine. © 2015 Wiley Periodicals, Inc.

  1. Targeting ceramide metabolism in obesity.

    Science.gov (United States)

    Aburasayn, Hanin; Al Batran, Rami; Ussher, John R

    2016-08-01

    Obesity is a major health concern that increases the risk for insulin resistance, type 2 diabetes (T2D), and cardiovascular disease. Thus, an enormous research effort has been invested into understanding how obesity-associated dyslipidemia and obesity-induced alterations in lipid metabolism increase the risk for these diseases. Accordingly, it has been proposed that the accumulation of lipid metabolites in organs such as the liver, skeletal muscle, and heart is critical to these obesity-induced pathologies. Ceramide is one such lipid metabolite that accumulates in tissues in response to obesity, and both pharmacological and genetic strategies that reduce tissue ceramide levels yield salutary actions on overall metabolic health. We will review herein why ceramide accumulates in tissues during obesity and how an increase in intracellular ceramide impacts cellular signaling and function as well as potential mechanisms by which reducing intracellular ceramide levels improves insulin resistance, T2D, atherosclerosis, and heart failure. Because a reduction in skeletal muscle ceramide levels is frequently associated with improvements in insulin sensitivity in humans, the beneficial findings reported for reducing ceramides in preclinical studies may have clinical application in humans. Therefore, modulating ceramide metabolism may be a novel, exciting target for preventing and/or treating obesity-related diseases. Copyright © 2016 the American Physiological Society.

  2. Resource implications of a national health target

    DEFF Research Database (Denmark)

    Jones, Peter; Sopina, Liza Elizaveta; Ashton, Toni

    2014-01-01

    Background The Shorter Stays in Emergency Departments health target was introduced in New Zealand in 2009. District Health Boards (DHBs) are expected to meet the target with no additional funding or incentives. The costs of implementing such targets have not previously been studied. Method A survey...... of clinical/service managers in ED throughout New Zealand determined the type and cost of resources used for the target. Responses to the target were classified according to their impact in ED, the hospital and the community. Quantifiable resource changes were assigned a financial value and grouped...... into categories: structure (facilities/beds), staff and processes. Simple statistics were used to describe the data, and the correlation between expenditure and target performance was determined. Results There was 100% response to the survey. Most DHBs reported some expenditure specifically on the target...

  3. Targeting dendritic cells--why bother?

    Science.gov (United States)

    Kreutz, Martin; Tacken, Paul J; Figdor, Carl G

    2013-04-11

    Vaccination is among the most efficient forms of immunotherapy. Although sometimes inducing lifelong protective B-cell responses, T-cell-mediated immunity remains challenging. Targeting antigen to dendritic cells (DCs) is an extensively explored concept aimed at improving cellular immunity. The identification of various DC subsets with distinct functional characteristics now allows for the fine-tuning of targeting strategies. Although some of these DC subsets are regarded as superior for (cross-) priming of naive T cells, controversies still remain about which subset represents the best target for immunotherapy. Because targeting the antigen alone may not be sufficient to obtain effective T-cell responses, delivery systems have been developed to target multiple vaccine components to DCs. In this Perspective, we discuss the pros and cons of targeting DCs: if targeting is beneficial at all and which vaccine vehicles and immunization routes represent promising strategies to reach and activate DCs.

  4. Preliminary study of mercury target structure

    Energy Technology Data Exchange (ETDEWEB)

    Kaminaga, Masanori; Haga, Katsuhiro; Hino, Ryutaro [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Kumasaka, Katsuyuki; Uchida, Shoji; Nakagawa, Toshi; Mori, Seiji; Nishikawa, Akira

    1997-11-01

    Development of a proton accelerator based neutron source (1.5 GeV, 5.3 mA (for neutron source 3.3 mA), thermal power 8 MW) is currently conducted by the Special Task Force for Neutron Science Initiative, JAERI. Preliminary design studies and related R and D of a solid metal target for the first stage (1.5 GeV, 1 mA) and a liquid metal target for both the first and second stages (1.5 GeV, 3.3 mA) are conducted by the Target Group to develop both solid and liquid metal target systems. A few kinds of target structures have been investigated in FY 1996 and the preliminary results for the target structures are described in this paper. Investigation results of alternative materials for the target container are also described in this paper. (author)

  5. Ten-year trends in overweight/obesity among Ontario middle and high school students and their use in establishing baseline measures for government reduction targets.

    Science.gov (United States)

    Allison, Kenneth R; Irving, Hyacinth M; Adlaf, Edward M; Faulkner, Guy E J; Boak, Angela; Manson, Heather E; Hamilton, Hayley A; Ng, Bessie

    2016-03-16

    Public health concern about increasing levels of child/youth overweight and obesity has resulted in initiatives to address this issue. In 2012, the Ontario Ministry of Health and Long-Term Care (MOHLTC) established a target to reduce childhood obesity by 20% within five years. In this paper, we examine trends and establish baseline levels of overweight/obesity to assess the impacts of population-level interventions. We analyzed 10 years (2003-2013) of data accumulated from six cycles of the Ontario Student Drug Use and Health Survey using logistic regression to assess trends in the prevalence of overweight/obesity among middle and high school students. The 2013 data are used to begin monitoring progress toward achieving the MOHLTC target. From 2003 through 2013, the prevalence of overweight/obesity among middle school students in the province remained stable overall and among all subgroups except 7th-grade females, who showed a significant linear decline. Among high school students, the prevalence of overweight/obesity showed a significant linear increase and an increase among 11th graders, females, and 10th- and 11th-grade females specifically. The prevalence remained stable but elevated among 9th- and 12th-grade females as well as among males in all grades. In 2013 (baseline for the MOHLTC target), 25.1% of students in grades 7-12 were overweight or obese, implying a presumed 2018 target of 20.1%. Ten-year trends in overweight/obesity indicate stability among males and significant linear increases in some female subgroups. Also, baseline data (2013) will facilitate the monitoring of future interventions aimed at achieving the 2018 MOHLTC target.

  6. Governing by targets : Reductio ad unum and evolution of the two-degree climate target

    NARCIS (Netherlands)

    Morseletto, Piero; Biermann, Frank|info:eu-repo/dai/nl/176991662; Pattberg, Philipp

    2017-01-01

    Targets are widely employed in environmental governance. In this paper, we investigate the construction of the 2 °C climate target, one of the best known targets in global environmental governance. Our paper examines this target through a historical reconstruction that identifies four different

  7. Using the Dual-Target Cost to Explore the Nature of Search Target Representations

    Science.gov (United States)

    Stroud, Michael J.; Menneer, Tamaryn; Cave, Kyle R.; Donnelly, Nick

    2012-01-01

    Eye movements were monitored to examine search efficiency and infer how color is mentally represented to guide search for multiple targets. Observers located a single color target very efficiently by fixating colors similar to the target. However, simultaneous search for 2 colors produced a dual-target cost. In addition, as the similarity between…

  8. Target definition for shipwreck hunting

    Directory of Open Access Journals (Sweden)

    Kim Paul Kirsner

    2015-10-01

    Full Text Available The research described in the present article was implemented to define the locations of two World War II shipwrecks, the German raider Kormoran, and the Australian light cruiser HMAS Sydney. The paper describes the long and complex trail that led through inefficient oceanographic prediction to ambiguous historical prediction involving a single report and on to precise cognitive prediction based on nine reports from more than 70 survivors, a process that yielded a single target position or ‘mean’ just 2.7 NM (nautical miles from the wreck of Kormoran. Prediction for the position of the wreck of Sydney opened with wishful thinking that she had somehow reached the coast more than 100 NM away when cognitive analysis of the survivor’s reports actually provided the basis for accurate prediction in a position near to the wreck of Kormoran. In the account provided below, the focus on cognitive procedures emerged from, first, a review of a sample of the shipwreck hunts, and, second, growing awareness of the extraordinarily rich database available for this search, and the extent to which it was open to cognitive analysis. This review touches on both the trans-disciplinary and the cognitive or intra-disciplinary issues that so challenged the political entities responsible for supervising of the search for the wrecks of Kormoran and Sydney. One of the theoretical questions that emerged from these debate concerns the model of expertise advanced by Collins (2013. The decomposability of alleged forms of expertise is revealed as a fundamental problem for research projects that might or might not benefit from trans-disciplinary research. Where expertise can be decomposed for operational purposes, the traditional dividing lines between experts and novices, and fools for that matter, are much harder to discern, and require advanced and scientifically informed review.

  9. Target definition for shipwreck hunting.

    Science.gov (United States)

    Kirsner, Kim

    2015-01-01

    The research described in the present article was implemented to define the locations of two World War II shipwrecks, the German raider Kormoran, and the Australian light cruiser HMAS Sydney. The paper describes the long and complex trail that led through inefficient oceanographic prediction to ambiguous historical prediction involving a single report and on to precise cognitive prediction based on nine reports from more than 70 survivors, a process that yielded a single target position or "mean" just 2.7 NM (nautical miles) from the wreck of Kormoran. Prediction for the position of the wreck of Sydney opened with wishful thinking that she had somehow reached the coast more than 100 NM away when cognitive analysis of the survivor's reports actually provided the basis for accurate prediction in a position near to the wreck of Kormoran. In the account provided below, the focus on cognitive procedures emerged from, first, a review of a sample of the shipwreck hunts, and, second, growing awareness of the extraordinarily rich database available for this search, and the extent to which it was open to cognitive analysis. This review touches on both the trans-disciplinary and the cognitive or intra-disciplinary issues that so challenged the political entities responsible for supervising of the search for the wrecks of Kormoran and Sydney. One of the theoretical questions that emerged from these debate concerns the model of expertise advanced by Collins (2013). The decomposability of alleged forms of expertise is revealed as a fundamental problem for research projects that might or might not benefit from trans-disciplinary research. Where expertise can be decomposed for operational purposes, the traditional dividing lines between experts and novices, and fools for that matter, are much harder to discern, and require advanced and scientifically informed review.

  10. Therapeutic targeting of replicative immortality.

    Science.gov (United States)

    Yaswen, Paul; MacKenzie, Karen L; Keith, W Nicol; Hentosh, Patricia; Rodier, Francis; Zhu, Jiyue; Firestone, Gary L; Matheu, Ander; Carnero, Amancio; Bilsland, Alan; Sundin, Tabetha; Honoki, Kanya; Fujii, Hiromasa; Georgakilas, Alexandros G; Amedei, Amedeo; Amin, Amr; Helferich, Bill; Boosani, Chandra S; Guha, Gunjan; Ciriolo, Maria Rosa; Chen, Sophie; Mohammed, Sulma I; Azmi, Asfar S; Bhakta, Dipita; Halicka, Dorota; Niccolai, Elena; Aquilano, Katia; Ashraf, S Salman; Nowsheen, Somaira; Yang, Xujuan

    2015-12-01

    One of the hallmarks of malignant cell populations is the ability to undergo continuous proliferation. This property allows clonal lineages to acquire sequential aberrations that can fuel increasingly autonomous growth, invasiveness, and therapeutic resistance. Innate cellular mechanisms have evolved to regulate replicative potential as a hedge against malignant progression. When activated in the absence of normal terminal differentiation cues, these mechanisms can result in a state of persistent cytostasis. This state, termed "senescence," can be triggered by intrinsic cellular processes such as telomere dysfunction and oncogene expression, and by exogenous factors such as DNA damaging agents or oxidative environments. Despite differences in upstream signaling, senescence often involves convergent interdependent activation of tumor suppressors p53 and p16/pRB, but can be induced, albeit with reduced sensitivity, when these suppressors are compromised. Doses of conventional genotoxic drugs required to achieve cancer cell senescence are often much lower than doses required to achieve outright cell death. Additional therapies, such as those targeting cyclin dependent kinases or components of the PI3K signaling pathway, may induce senescence specifically in cancer cells by circumventing defects in tumor suppressor pathways or exploiting cancer cells' heightened requirements for telomerase. Such treatments sufficient to induce cancer cell senescence could provide increased patient survival with fewer and less severe side effects than conventional cytotoxic regimens. This positive aspect is countered by important caveats regarding senescence reversibility, genomic instability, and paracrine effects that may increase heterogeneity and adaptive resistance of surviving cancer cells. Nevertheless, agents that effectively disrupt replicative immortality will likely be valuable components of new combinatorial approaches to cancer therapy. Copyright © 2015 The Authors

  11. Target detection and tracking in infrared video

    Science.gov (United States)

    Deng, Zhihui; Zhu, Jihong

    2017-07-01

    In this paper, we propose a method for target detection and tracking in infrared video. The target is defined by its location and extent in a single frame. In the initialization process, we use an adaptive threshold to segment the target and then extract the fern feature and normalize it as a template. The detector uses the random forest and fern to detect the target in the infrared video. The random forest and fern is a random combination of 2bit Binary Pattern, which is robust to infrared targets with blurred and unknown contours. The tracker uses the gray-value weighted mean-Shift algorithm to track the infrared target which is always brighter than the background. And the tracker can track the deformed target efficiently and quickly. When the target disappears, the detector will redetect the target in the coming infrared image. Finally, we verify the algorithm on the real-time infrared target detection and tracking platform. The result shows that our algorithm performs better than TLD in terms of recall and runtime in infrared video.

  12. Fluid mechanics aspects of magnetic drug targeting.

    Science.gov (United States)

    Odenbach, Stefan

    2015-10-01

    Experiments and numerical simulations using a flow phantom for magnetic drug targeting have been undertaken. The flow phantom is a half y-branched tube configuration where the main tube represents an artery from which a tumour-supplying artery, which is simulated by the side branch of the flow phantom, branches off. In the experiments a quantification of the amount of magnetic particles targeted towards the branch by a magnetic field applied via a permanent magnet is achieved by impedance measurement using sensor coils. Measuring the targeting efficiency, i.e. the relative amount of particles targeted to the side branch, for different field configurations one obtains targeting maps which combine the targeting efficiency with the magnetic force densities in characteristic points in the flow phantom. It could be shown that targeting efficiency depends strongly on the magnetic field configuration. A corresponding numerical model has been set up, which allows the simulation of targeting efficiency for variable field configuration. With this simulation good agreement of targeting efficiency with experimental data has been found. Thus, the basis has been laid for future calculations of optimal field configurations in clinical applications of magnetic drug targeting. Moreover, the numerical model allows the variation of additional parameters of the drug targeting process and thus an estimation of the influence, e.g. of the fluid properties on the targeting efficiency. Corresponding calculations have shown that the non-Newtonian behaviour of the fluid will significantly influence the targeting process, an aspect which has to be taken into account, especially recalling the fact that the viscosity of magnetic suspensions depends strongly on the magnetic field strength and the mechanical load.

  13. Resistance to Antibiotics Mediated by Target Alterations

    Science.gov (United States)

    Spratt, Brian G.

    1994-04-01

    The development of resistance to antibiotics by reductions in the affinities of their enzymatic targets occurs most rapidly for antibiotics that inactivate a single target and that are not analogs of substrate. In these cases of resistance (for example, resistance to rifampicin), numerous single amino acid substitutions may provide large decreases in the affinity of the target for the antibiotic, leading to clinically significant levels of resistance. Resistance due to target alterations should occur much more slowly for those antibiotics (penicillin, for example) that inactivate multiple targets irreversibly by acting as close analogs of substrate. Resistance to penicillin because of target changes has emerged, by unexpected mechanisms, only in a limited number of species. However, inactivating enzymes commonly provide resistance to antibiotics that, like penicillin, are derived from natural products, although such enzymes have not been found for synthetic antibiotics. Thus, the ideal antibiotic would be produced by rational design, rather than by the modification of a natural product.

  14. High power target developments at ISAC

    CERN Document Server

    Bricault, P G; Dowling, A; Lane, M

    2003-01-01

    TRIUMF, Canada's national research facility for particle and nuclear physics is currently operating the ISAC facility. A high-energy proton beam from the H sup - TRIUMF cyclotron is used to generate short-lived radioactive species in a thick target. An ion source at the target creates a radioactive beam, which is then injected into the ISAC beam lines and accelerator system. The ISAC facility is designed to accept proton beam intensity up to 100 mu A at 500 MeV. At present our target design can only sustains 40 mu A at maximum. Beyond this point the target has to be cooled. A new target equipped with fins has been developed that may sustain proton beam up to 100 mu A. The fined target has been tested off-line and a thermal simulation using ANSYS[reg] has been conducted and the results are reported here.

  15. Neutronic characterization of the MEGAPIE target

    Energy Technology Data Exchange (ETDEWEB)

    Panebianco, Stefano; David, Jean-Christophe; Leray, Sylvie; Letourneau, Alain; Michel-Sendis, Franco; Stankunas, Gediminas [CEA/IRFU, Gif-sur-Yvette (France); Berg, Klara; Filges, Uwe; Groeschel, Friedrich; Luethy, Markus; Scazzi, Selene; Tobler, Leonhard; Zanini, Luca [PSI, Villigen (Switzerland); Eid, Mohamed [CEA/DEN/DM2S/SERMA, Gif-sur-Yvette (France); Guertin, Arnaud; Thiolliere, Nicolas [SUBATECH, Nantes (France); Konobeyev, Alexander Yu. [FZK/IRS, Karlsruhe (Germany); Latge, Christian [CEA/DEN/DTN/DIR, St. Paul Lez Durance (France); Lemaire, Sebastien [CEA/DAM/DCSA/SCGA, Bruyeres-le-Chatel (France)

    2008-07-01

    The MEGAPIE project aimed to design, build and operate a liquid metal spallation neutron target of 1 MW beam power in the SINQ facility at the Paul Scherrer Institut (Villigen, Switzerland). The project is an important step in the road-map towards the demonstration of the Accelerator Driven System (ADS) concept and high power liquid metal targets in general. Following the design phase, an experimental program was defined to provide a complete characterization of the facility by performing a 'mapping' of the neutron flux at different points, from the center of the target to the beam lines. The neutronic performance of the target was studied using different experimental techniques with the goals of validating the Monte Carlo codes used in the design of the target; additionally, the performance was compared with the solid lead targets used before and after the MEGAPIE experiment. (authors)

  16. Neutronic characterization of the MEGAPIE target

    Energy Technology Data Exchange (ETDEWEB)

    Panebianco, Stefano [CEA, Irfu, Centre de Saclay, F-91191 Gif-sur-Yvette (France)], E-mail: Stefano.panebianco@cea.fr; Berg, Klara [Paul Scherrer Institut, CH-5232 Villigen (Switzerland); David, Jean-Christophe [CEA, Irfu, Centre de Saclay, F-91191 Gif-sur-Yvette (France); Eid, Mohamed [CEA/DEN/DM2S/SERMA, Centre de Saclay, F-91194 Gif-sur-Yvette (France); Filges, Uwe; Groeschel, Friedrich [Paul Scherrer Institut, CH-5232 Villigen (Switzerland); Guertin, Arnaud [SUBATECH, Ecole des Mines, F-44307 Nantes (France); Konobeyev, Alexander Yu [Forschungszentrum Karlsruhe, IRS, D-76021 Karlsruhe (Germany); Latge, Christian [CEA/DEN/DTN/DIR, Centre de Cadarache, F-13108 Saint-Paul-lez-Durance (France); Lemaire, Sebastien [CEA, DAM Ile de France, F-91297 Bruyeres le Chatel (France); Leray, Sylvie; Letourneau, Alain [CEA, Irfu, Centre de Saclay, F-91191 Gif-sur-Yvette (France); Luethy, Markus [Paul Scherrer Institut, CH-5232 Villigen (Switzerland); Michel-Sendis, Franco [CEA, Irfu, Centre de Saclay, F-91191 Gif-sur-Yvette (France); Scazzi, Selene [Paul Scherrer Institut, CH-5232 Villigen (Switzerland); Stankunas, Gediminas [CEA, Irfu, Centre de Saclay, F-91191 Gif-sur-Yvette (France); Thiolliere, Nicolas [SUBATECH, Ecole des Mines, F-44307 Nantes (France); Tobler, Leonhard; Zanini, Luca [Paul Scherrer Institut, CH-5232 Villigen (Switzerland)

    2009-04-15

    The MEGAPIE project aimed to design, build and operate a liquid metal spallation neutron target of about 1 MW beam power in the SINQ facility at the Paul Scherrer Institut (Villigen, Switzerland). This project is an important step in the roadmap towards the demonstration of the accelerator driven system (ADS) concept and high power liquid metal targets in general. Following the design phase, an experimental program was defined to provide a complete characterization of the facility by performing a 'mapping' of the neutron flux at different points, from the center of the target to the beam lines. The neutronic performance of the target was studied using different experimental techniques with the goals of validating the Monte Carlo codes used in the design of the target; additionally, the performance was compared with the solid lead targets used before and after the MEGAPIE experiment.

  17. Polarized targets in high energy physics

    Energy Technology Data Exchange (ETDEWEB)

    Cates, G.D. Jr. [Princeton Univ., NJ (United States)

    1994-12-01

    Various approaches are discussed for producing polarized nuclear targets for high energy physics experiments. As a unifying theme, examples are drawn from experiments to measure spin dependent structure functions of nucleons in deep inelastic scattering. This single physics goal has, over roughly two decades, been a driving force in advances in target technology. Actual or planned approaches have included solid targets polarized by dynamic nuclear polarization (DNP), several types of internal targets for use in storage rings, and gaseous {sup 3}He targets polarized by spin-exchange optical pumping. This last approach is the type of target adopted for SLAC E-142, an experiment to measure the spin structure function of the neutron, and is described in detail.

  18. THERMAL OSCILLATIONS IN LIQUID HELIUM TARGETS.

    Energy Technology Data Exchange (ETDEWEB)

    WANG,L.; JIA,L.X.

    2001-07-16

    A liquid helium target for the high-energy physics was built and installed in the proton beam line at the Alternate Gradient Synchrotron of Brookhaven National Laboratory in 2001. The target flask has a liquid volume of 8.25 liters and is made of thin Mylar film. A G-M/J-T cryocooler of five-watts at 4.2K was used to produce liquid helium and refrigerate the target. A thermosyphon circuit for the target was connected to the J-T circuit by a liquid/gas separator. Because of the large heat load to the target and its long transfer lines, thermal oscillations were observed during the system tests. To eliminate the oscillation, a series of tests and analyses were carried out. This paper describes the phenomena and provides the understanding of the thermal oscillations in the target system.

  19. Protection Related to High-power Targets

    CERN Document Server

    Plum, M.A.

    2016-01-01

    Target protection is an important part of machine protection. The beam power in high-intensity accelerators is high enough that a single wayward pulse can cause serious damage. Today's high-power targets operate at the limit of available technology, and are designed for a very narrow range of beam parameters. If the beam pulse is too far off centre, or if the beam size is not correct, or if the beam density is too high, the target can be seriously damaged. We will start with a brief introduction to high-power targets and then move to a discussion of what can go wrong, and what are the risks. Next we will discuss how to control the beam-related risk, followed by examples from a few different accelerator facilities. We will finish with a detailed example of the Oak Ridge Spallation Neutron Source target tune up and target protection.

  20. New insights into Brunner syndrome and potential for targeted therapy

    OpenAIRE

    Palmer, E.; Leffler, M.; Rogers, C.; Shaw, M.; Carroll, R.; Earl, J.; Cheung, N.; Champion, B.; Hu, H.; Haas, S.; Kalscheuer, V.; Gecz, J.; Field, M.

    2016-01-01

    We report two families with Brunner syndrome living in one state of Australia. The first family had a predicted protein-truncating variant of monoamine oxidase A (MAOA) (p.S251KfsX2). Affected males had mild intellectual disability (ID), obsessive behaviour, limited friendships and were introverted and placid during clinical interview. The family disclosed episodic explosive aggression after a diagnosis was made. The second family had a missense variant in MAOA (p.R45W). Affected males had bo...

  1. Visualizing Energy on Target: Molecular Dynamics Simulations

    Science.gov (United States)

    2017-12-01

    ARL-TR-8234 ● DEC 2017 US Army Research Laboratory Visualizing Energy on Target: Molecular Dynamics Simulations by DeCarlos E...return it to the originator. ARL-TR-8234● DEC 2017 US Army Research Laboratory Visualizing Energy on Target: Molecular Dynamics...REPORT TYPE Technical Report 3. DATES COVERED (From - To) 1 October 2015–30 September 2016 4. TITLE AND SUBTITLE Visualizing Energy on Target

  2. ENTERPRISE RESOURCE STRATEGIC PLANNING: TARGET CHOICE TECHNIQUES

    Directory of Open Access Journals (Sweden)

    A. S. Lankin

    2011-01-01

    Full Text Available Choice of the targets is one of most important elements of the resource planning system. Particular feature of the strategic planning is development of future alternatives for the enterprise. Main resource strategic planning cycle elements: examination of principal external and internal environment components; forming the company mission; development of long-term targets; concretization of the long-term targets through short-term aims; examination of strategies and final choice.

  3. Targeting Malignant Brain Tumors with Antibodies

    OpenAIRE

    Rok Razpotnik; Neža Novak; Vladka Čurin Šerbec; Uros Rajcevic

    2017-01-01

    Antibodies have been shown to be a potent therapeutic tool. However, their use for targeting brain diseases, including neurodegenerative diseases and brain cancers, has been limited, particularly because the blood–brain barrier (BBB) makes brain tissue hard to access by conventional antibody-targeting strategies. In this review, we summarize new antibody therapeutic approaches to target brain tumors, especially malignant gliomas, as well as their potential drawbacks. Many different brain deli...

  4. Bioinformatics for cancer immunotherapy target discovery

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Campos, Benito; Barnkob, Mike Stein

    2014-01-01

    therapy target discovery in a bioinformatics analysis pipeline. We describe specialized bioinformatics tools and databases for three main bottlenecks in immunotherapy target discovery: the cataloging of potentially antigenic proteins, the identification of potential HLA binders, and the selection epitopes...... and co-targets for single-epitope and multi-epitope strategies. We provide examples of application to the well-known tumor antigen HER2 and suggest bioinformatics methods to ameliorate therapy resistance and ensure efficient and lasting control of tumors....

  5. Promoting target models by potential measures

    OpenAIRE

    Dubiel, Joerg

    2010-01-01

    Direct marketers use target models in order to minimize the spreading loss of sales efforts. The application of target models has become more widespread with the increasing range of sales efforts. Target models are relevant for offline marketers sending printed mails as well as for online marketers who have to avoid intensity. However business has retained its evaluation since the late 1960s. Marketing decision-makers still prefer managerial performance measures of the economic benefit of a t...

  6. Design of the LBNF Beamline Target Station

    OpenAIRE

    Tariq, S.; Ammigan, K.; Anderson, K.; Buccellato, S. A.; Crowley, C. F.; Hartsell, B. D.; Hurh, P.; Hylen, J.; Kasper, P.; Krafczyk, G. E.; Lee, A.; Lundberg, B.; Marchionni, A; Mokhov, N. V.; Moore, C. D.

    2016-01-01

    The Long Baseline Neutrino Facility (LBNF) project will build a beamline located at Fermilab to create and aim an intense neutrino beam of appropriate energy range toward the DUNE detectors at the SURF facility in Lead, South Dakota. Neutrino production starts in the Target Station, which consists of a solid target, magnetic focusing horns, and the associated sub-systems and shielding infrastructure. Protons hit the target producing mesons which are then focused by the horns into a helium-fil...

  7. Target R and D at JAERI

    Energy Technology Data Exchange (ETDEWEB)

    Hino, Ryutaro [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    1999-03-01

    We proposed a solid and a mercury target concepts through the preliminary conceptual design. To feasible these concepts, analysis and experimental works are being carried out. This paper introduces an outline of present status of target R and D such as heat transfer augmentation experiments for the solid target, mercury flow tests with a loop of maximum flow rate of 15L/min, flow pattern measurements for a cold source moderator etc. as well as preliminary conceptual design works. (author)

  8. Target Language Adaptation of Discriminative Transfer Parsers

    OpenAIRE

    Täckström, Oscar; McDonald, Ryan; Nivre, Joakim

    2013-01-01

    We study multi-source transfer parsing for resource-poor target languages; specifically methods for target language adaptation of delexicalized discriminative graph-based dependency parsers. We first show how recent insights on selective parameter sharing, based on typological and language-family features, can be applied to a discriminative parser by carefully decomposing its model features. We then show how the parser can be relexicalized and adapted using unlabeled target language data and ...

  9. Magnetic confinement system using charged ammonia targets

    Science.gov (United States)

    Porter, Gary D.; Bogdanoff, Anatoly

    1979-01-01

    A system for guiding charged laser targets to a predetermined focal spot of a laser along generally arbitrary, and especially horizontal, directions which comprises a series of electrostatic sensors which provide inputs to a computer for real time calculation of position, velocity, and direction of the target along an initial injection trajectory, and a set of electrostatic deflection means, energized according to a calculated output of said computer, to change the target trajectory to intercept the focal spot of the laser which is triggered so as to illuminate the target of the focal spot.

  10. COST OF ADDRESSING TARGETS OF UNEQUAL VALUE

    Energy Technology Data Exchange (ETDEWEB)

    G.H. CANAVAN

    2001-08-01

    The formalism for evaluating first strike costs and incentives for military targeting generalize to include higher value targets. That introduces two new allocations to the usual allocation between missiles and military targets, but they can be performed analytically. As the number of weapons on each side decreases, the optimal fraction of second strike weapons allocated to military values falls. The shift to high value targets is more pronounced below about 1,000 weapons for nominal parameters. Below 500 weapons the first striker's cost of action drops below its cost of inaction. A strike would induce a second strike of about 250 weapons on high value targets. An increase in the first striker's preference for damage to the other's high value targets increases or a decrease in its preference for preventing damage to its own high value targets decreases first strike costs and stability margins. Including defenses complicates allocations slightly. The main effect is increased attrition of second strikes, particularly at larger defenses, which makes it possible to significantly reduce damage to high value targets. At 1,000 weapons, by 300 to 400 interceptors the first striker's costs are reduced to 30% below that of inaction and the number of weapons delivered on the first striker's high value targets is reduced to about 100.

  11. What makes a good drug target?

    Science.gov (United States)

    Gashaw, Isabella; Ellinghaus, Peter; Sommer, Anette; Asadullah, Khusru

    2012-02-01

    Novel therapeutics in areas with a high unmet medical need are based on innovative drug targets. Although 'biologicals' have enlarged the space of druggable molecules, the number of appropriate drug targets is still limited. Discovering and assessing the potential therapeutic benefit of a drug target is based not only on experimental, mechanistic and pharmacological studies but also on a theoretical molecular druggability assessment, an early evaluation of potential side effects and considerations regarding opportunities for commercialization. This article defines key properties of a good drug target from the perspective of a pharmaceutical company. Copyright © 2011 Elsevier Ltd. All rights reserved.

  12. Uncertainty Prediction in Passive Target Motion Analysis

    Science.gov (United States)

    2016-05-12

    denote the bearing and range from observer 12B to target 10B at time t2 as indicated in FIG. 3. Between times t1 and t2, observer 12A has traveled over...Cartesian coordinates of the target with respect to time , and ?̇? and ?̇? are components of the target velocity. [0007] As is well known, a...as a time interval of constant platform velocity.) [0008] In addition to a point estimate of the current target state, a representation of the

  13. Performance Targets and External Market Prices

    DEFF Research Database (Denmark)

    Hansen, Allan; Friis, Ivar; Vámosi, Tamás S.

    In this paper we explore the processes of ‘bringing the market inside the firm’ to set performance targets and benchmark production workers productivity. We analyze attempts to use external suppliers’ bids in target setting in a Danish manufacturing company. The case study illustrates how...... the implementation of external market information in target setting – well known in transfer pricing, relative performance evaluation, beyond budgeting, target costing, piece rates systems and value based management – relate to challenging motivation and information problem. The analysis and discussion of those...

  14. An entropy model with variable target

    OpenAIRE

    K O Jörnsten; Larsson, T; J T Lundgren; Migdalas, A.

    1990-01-01

    In this paper an entropy model with variable target is presented, in which target values are assumed to belong to a specified convex set, so that multiple base-year information and forecasts of future trends can be handled without prior aggregation of such information into one fixed target. Three solution methods for such a model are presented -- one cutting-plane and two search methods -- all of which utilize the fact that entropy models with fixed targets can be solved efficiently. Some com...

  15. Tumour-targeted nanomedicines: principles and practice

    National Research Council Canada - National Science Library

    Lammers, T.G.G.M; Hennink, W.E; Storm, G

    2008-01-01

    .... Various different tumour-targeted nanomedicines have been evaluated over the years, and clear evidence is currently available for substantial improvement of the therapeutic index of anticancer agents...

  16. Selective targeting of epigenetic reader domains.

    Science.gov (United States)

    Greschik, Holger; Schüle, Roland; Günther, Thomas

    2017-05-01

    Epigenetic regulators including writers, erasers, and readers of chromatin marks have been implicated in numerous diseases and are therefore subject of intense academic and pharmaceutical research. While several small-molecule inhibitors targeting writers or erasers are either approved drugs or are currently being evaluated in clinical trials, the targeting of epigenetic readers has lagged behind. Proof-of-principle that epigenetic readers are also relevant drug targets was provided by landmark discoveries of selective inhibitors targeting the BET family of acetyl-lysine readers. More recently, high affinity chemical probes for non-BET acetyl- and methyl-lysine reader domains have also been developed. Areas covered: This article covers recent advances with the identification and validation of inhibitors and chemical probes targeting epigenetic reader domains. Issues related to epigenetic reader druggability, quality requirements for chemical probes, interpretation of cellular action, unexpected cross-talk, and future challenges are also discussed. Expert opinion: Chemical probes provide a powerful means to unravel biological functions of epigenetic readers and evaluate their potential as drug targets. To yield meaningful results, potency, selectivity, and cellular target engagement of chemical probes need to be stringently validated. Future chemical probes will probably need to fulfil additional criteria such as strict target specificity or the targeting of readers within protein complexes.

  17. Two target localization using passive monopulse radar

    KAUST Repository

    Jardak, Seifallah

    2016-02-19

    The simultaneous lobing technique, also known as monopulse technique, has been widely used for fast target localization and tracking purposes. Many works focused on accurately localizing one or two targets laying within a narrow beam centered around the monopulse antenna boresight direction. In this work, however, a new approach uses the outputs of a four quadrant antenna receiver to rapidly localize two point targets present in the hemisphere. A second set of antennas can be required to localize two targets sharing the same elevation or azimuth angles. To combine the outputs of both antenna sets and enhance the estimation performance of the algorithm, two methods are presented and compared.

  18. Postinfarction Myocardial Scarring in Mice: Molecular MR Imaging with Use of a Collagen-targeting Contrast Agent1

    Science.gov (United States)

    Helm, Patrick A.; Caravan, Peter; French, Brent A.; Jacques, Vincent; Shen, Luhua; Xu, Yaqin; Beyers, Ronald J.; Roy, R. Jack; Kramer, Christopher M.; Epstein, Frederick H.

    2008-01-01

    Purpose: To prospectively evaluate a gadolinium-based collagen-targeting contrast agent, EP-3533, for in vivo magnetic resonance (MR) imaging of myocardial fibrosis in a mouse model of healed myocardial infarction (MI). Materials and Methods: All procedures were performed in accordance with protocols approved by the animal care and use committee. MI was induced in eight mice by means of occlusion of the left anterior descending coronary artery followed by reperfusion. Four MR examinations were performed in each animal: one examination before, one examination 1 day after, and two examinations 6 weeks after the MI. For the latter two examinations, electrocardiographically gated inversion-recovery gradient-echo MR images were acquired before and serially (every 5 minutes) after the intravenous injection of either gadopentetate dimeglumine or EP-3533. The image enhancement kinetic properties of the postinfarction scar, normal myocardium, and blood were compared. Results: Dynamic T1-weighted MR imaging revealed the washout time constants for EP-3533 to be significantly longer than those for gadopentetate dimeglumine in regions of postinfarction scarring (mean, 194.8 minutes ±116.8 [standard deviation] vs 25.5 minutes ± 4.2; P < .05) and in normal myocardium (mean, 45.4 minutes ± 16.7 vs 25.1 minutes ± 9.7; P < .05). Findings on postmortem histologic sections stained for collagen correlated well with EP-3533–enhanced areas seen on inversion-recovery MR images. Fifty minutes after EP-3533 injection, the postinfarction scar tissue samples, as compared with the normal myocardium, had a twofold higher concentration of gadolinium. Conclusion: Use of the gadolinium-based collagen-targeting contrast agent, EP-3533, enabled in vivo molecular MR imaging of fibrosis in a mouse model of healed postinfarction myocardial scarring. © RSNA, 2008 PMID:18403626

  19. Targeted advertising, platform competition and privacy

    NARCIS (Netherlands)

    Kox, Henk; Straathof, Bas; Zwart, Gijsbert

    2017-01-01

    Targeted advertising can benefit consumers through lower prices for access to web sites. Yet, if consumers dislike that web sites collect their personal information, their welfare may go down. We study competition for consumers between web sites that can show targeted advertisements. We find that

  20. A rotating target for Ra production

    NARCIS (Netherlands)

    Sohani, M.; Wilschut, H. W.

    2012-01-01

    A target wheel with pyrolytic graphite targets is designed and constructed at the TRI mu P facility to boost the production rate of Ra isotopes. Simulation, design properties and production results are discussed. (C) 2012 Elsevier B.V. All rights reserved.

  1. Technical Design Report, Second Target Station

    Energy Technology Data Exchange (ETDEWEB)

    Galambos, John D. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Anderson, David E. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Bechtol, D. [HDR, Inc., Chattanooga, TN (United States); Bethea, Katie L. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Brown, N. [Barge Waggoner Sumner & Cannon, Inc., Nashville, TN (United States); Carden, W. F. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Chae, Steven M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Clark, A. [Barge Waggoner Sumner & Cannon, Inc., Nashville, TN (United States); Counce, Deborah M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Craft, K. [Barge Waggoner Sumner & Cannon, Inc., Nashville, TN (United States); Crofford, Mark T. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Collins, Richard M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Cousineau, Sarah M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Curry, Douglas E. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Cutler, Roy I. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Dayton, Michael J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Dean, Robert A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Deibele, Craig E. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Doleans, Marc [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Dye, T. [HDR, Inc., Chattanooga, TN (United States); Eason, Bob H. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Eckroth, James A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Fincrock, C. [HDR, Inc., Chattanooga, TN (United States); Fritts, S. [Barge Waggoner Sumner & Cannon, Inc., Nashville, TN (United States); Gallmeier, Franz X. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Gawne, Ken R. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Hartman, Steven M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Herwig, Kenneth W. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Hess, S. [HDR, Inc., Chattanooga, TN (United States); Holmes, Jeffrey A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Horak, Charlie M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Howell, Matthew P. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Iverson, Erik B. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Jacobs, Lorelei L. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Jones, Larry C. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Johnson, B. [HDR, Inc., Chattanooga, TN (United States); Johnson, S. [HDR, Inc., Chattanooga, TN (United States); Kasemir, Kay [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Kim, Sang-Ho [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Laughon, Gregory J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Lu, W. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Mahoney, Kelly L. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Mammosser, John [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); McManamy, T. [McManamy Consulting, Inc., Knoxville, TN (United States); Michilini, M. [HDR, Inc., Chattanooga, TN (United States); Middendorf, Mark E. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); O' Neal, Ed [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Nemec, B. [Barge Waggoner Sumner & Cannon, Inc., Nashville, TN (United States); Peters, Roy Cecil [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Plum, Michael A. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Reagan, G. [Barge Waggoner Sumner & Cannon, Inc., Nashville, TN (United States); Remec, Igor [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Rennich, Mark J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Riemer, Bernie [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Saethre, Robert B. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Schubert, James Phillip [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Shishlo, Andrei P. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Smith, C. Craig [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Strong, William Herb [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Tallant, Kathie M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Tennant, David Alan [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Thibadeau, Barbara M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Trumble, S. [HDR, Inc., Chattanooga, TN (United States); Trotter, Steven M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Wang, Z. [Institute of Modern Physics (IMP), Chinese Academy of Sciences (China); Webb, Steven B. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Williams, Derrick C. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); White, Karen S. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Zhao, Jinkui [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2015-01-01

    The Second Target Station (STS) is a proposed upgrade for SNS. It includes a doubling of the accelerator power and an additional instrument hall. The new instrument hall will receive a 467 kW 10 Hz beam. The parameters and preliminary design aspects of the STS are presented for the accelerator, target systems, instrument hall, instruments and civil construction aspects.

  2. Receptor-targeted metalloradiopharmaceuticals. Final technical report

    Energy Technology Data Exchange (ETDEWEB)

    Green, Mark A.

    2000-03-22

    Copper (II) and platinum (II) coordination complexes were prepared and characterized. These complexes were designed to afford structural homology with steroidal and non-steroidal estrogens for possible use as receptor-targeted radiopharmaceuticals. While weak affinity for the estrogen receptor was detectable, none would appear to have sufficient receptor-affinity for estrogen-receptor-targeted imaging or therapy.

  3. NIF Target Assembly Metrology Methodology and Results

    Energy Technology Data Exchange (ETDEWEB)

    Alger, E. T. [General Atomics, San Diego, CA (United States); Kroll, J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Dzenitis, E. G. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Montesanti, R. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Hughes, J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Swisher, M. [IAP, Livermore, CA (United States); Taylor, J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Segraves, K. [IAP, Livermore, CA (United States); Lord, D. M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Reynolds, J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Castro, C. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Edwards, G. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2011-01-01

    During our inertial confinement fusion (ICF) experiments at the National Ignition Facility (NIF) we require cryogenic targets at the 1-cm scale to be fabricated, assembled, and metrologized to micron-level tolerances. During assembly of these ICF targets, there are physical dimensmetrology is completed using optical coordinate measurement machines that provide repeatable measurements with micron precision, while also allowing in-process data collection for absolute accuracy in assembly. To date, 51 targets have been assembled and metrologized, and 34 targets have been successfully fielded on NIF relying on these metrology data. In the near future, ignition experiments on NIF will require tighter tolerances and more demanding target assembly and metrology capability. Metrology methods, calculations, and uncertainty estimates will be discussed. Target diagnostic port alignment, target position, and capsule location results will be reviewed for the 2009 Energetics Campaign. The information is presented via control charts showing the effect of process improvements that were made during target production. Certain parameters, including capsule position, met the 2009 campaign specifications but will have much tighter requirements in the future. Finally, in order to meet these new requirements assembly process changes and metrology capability upgrades will be necessary.

  4. Inflation targeting and interest rate policy

    NARCIS (Netherlands)

    Verhagen, W.H.

    2001-01-01

    The thesis contains a collection of papers on issues in inflation targeting and its implications for the way interest rates are set. In this respect, the first part deals with two largely positive issues: the effect of inflation forecast targeting on the term structure of interest rates and the

  5. Population ageing and public finance targets

    OpenAIRE

    Heikki Oksanen

    2003-01-01

    The paper incorporates intergenerational fairness into a framework to analyse long-term sustainability of public finances under population ageing. It establishes a link between ageing-related public expenditure projections and public finance targets, thereby clarifying the connection between pension reforms and general government budget balance and debt targets.

  6. Thin Scintillating Polarized Targets for Spin Physics

    Science.gov (United States)

    van den Brandt, B.; Bunyatova, E. I.; Hautle, P.; Konter, J. A.

    2003-07-01

    At PSI polarized scintillating targets are available since 1996. Proton polarizations of more than 80%, and deuteron polarizations of 25% in polystyrene-based scintillators can be reached under optimum conditions in a vertical dilution refrigerator with optical access, suited for nuclear and particle physics experiments. New preparation procedures allow to provide very thin polarizable scintillating targets and widen the spectrum of conceivable experiments.

  7. Harmonic Phase Response of Nonlinear Radar Targets

    Science.gov (United States)

    2015-10-01

    ARL-TR-7513 ● OCT 2015 US Army Research Laboratory Harmonic Phase Response of Nonlinear Radar Targets by Sean F McGowan, Dr...Laboratory Harmonic Phase Response of Nonlinear Radar Targets by Sean F McGowan and Kelly D Sherbondy Sensors and Electron Devices Directorate...

  8. Function and targets of Fusarium oxysporum effectors

    NARCIS (Netherlands)

    Gawehns, F.K.K.

    2014-01-01

    A multi-layered immune system protects plants against pathogens. Adapted pathogens overcome or evade this immune system by secreting small proteins, called effectors. Often susceptibility genes encode host targets for these effectors, and loss-of-function mutations in such target genes can confer

  9. Security analysts' target prices and takeover premiums

    NARCIS (Netherlands)

    Gerritsen, Dirk F.

    2015-01-01

    Most existing studies conclude that the accuracy of analysts' target prices is questionable. In forecasting target prices, analysts estimate a future stock price under the constraint of a time frame of usually 12. months. We exclude this source of uncertainty by focusing on valuations in takeover

  10. ISOLDE target zone control room HD

    CERN Multimedia

    2016-01-01

    Operating the ISOLDE target handling robots from the dedicated control room in building 197. Monitors showing the movements of the robots (GPS in this case) in the target zone. The footage shows the actual operation by the operator as well as the different equipment such as camera electronics, camera motor controls, camera monitors and Kuka robot controls touch panel.

  11. Poverty Targeting Classifications and Distributional Effects

    OpenAIRE

    Elio H Londero

    2004-01-01

    This paper reviews two common definitions of poverty targeted projects, discusses the limitations of poverty targeting classifications, calls for a poverty focused cost-benefit analysis that looks at the main policy constraints affecting the distribution of project benefits, and argues for looking at the distribution of net benefits. Finally, it offers some conclusions for the distributionally-minded applied economists.

  12. The History of Target-Controlled Infusion

    NARCIS (Netherlands)

    Struys, Michel M. R. F.; De Smet, Tom; Glen, John (Iain) B.; Vereecke, Hugo E. M.; Absalom, Anthony R.; Schnider, Thomas W.

    Target-controlled infusion (TCI) is a technique of infusing IV drugs to achieve a user-defined predicted (target) drug concentration in a specific body compartment or tissue of interest. In this review, we describe the pharmacokinetic principles of TCI, the development of TCI systems, and technical

  13. Experimental identification of microRNA targets

    DEFF Research Database (Denmark)

    Ørom, Ulf Andersson; Lund, Anders H

    2009-01-01

    microRNAs are small RNAs that regulate protein synthesis post-transcriptionally. Animal microRNAs recognize their targets by incomplete base pairing to sequence motifs most often present in the 3' untranslated region of their target mRNAs. This partial complementarity vastly expands the repertoire...

  14. Targeted toxins in brain tumor therapy.

    Science.gov (United States)

    Li, Yan Michael; Hall, Walter A

    2010-11-01

    Targeted toxins, also known as immunotoxins or cytotoxins, are recombinant molecules that specifically bind to cell surface receptors that are overexpressed in cancer and the toxin component kills the cell. These recombinant proteins consist of a specific antibody or ligand coupled to a protein toxin. The targeted toxins bind to a surface antigen or receptor overexpressed in tumors, such as the epidermal growth factor receptor or interleukin-13 receptor. The toxin part of the molecule in all clinically used toxins is modified from bacterial or plant toxins, fused to an antibody or carrier ligand. Targeted toxins are very effective against cancer cells resistant to radiation and chemotherapy. They are far more potent than any known chemotherapy drug. Targeted toxins have shown an acceptable profile of toxicity and safety in early clinical studies and have demonstrated evidence of a tumor response. Currently, clinical trials with some targeted toxins are complete and the final results are pending. This review summarizes the characteristics of targeted toxins and the key findings of the important clinical studies with targeted toxins in malignant brain tumor patients. Obstacles to successful treatment of malignant brain tumors include poor penetration into tumor masses, the immune response to the toxin component and cancer heterogeneity. Strategies to overcome these limitations are being pursued in the current generation of targeted toxins.

  15. Misattribution of sensory input reflected in dysfunctional target:non-target ERPs in schizophrenia.

    Science.gov (United States)

    Brown, K; Gordon, E; Williams, L; Bahramali, H; Harris, A; Gray, J; Gonsalvez, C; Meares, R

    2000-11-01

    While numerous studies have found disturbances in the Event-Related Potentials (ERPs) of patients with schizophrenia linked to task relevant target stimuli (most notably a reduction in P300 amplitude), few have examined ERPs to task irrelevant non-targets. We hypothesize, from current models of dysfunction in information processing in schizophrenia, that there will be less difference between ERPs to targets and non-targets in patients with schizophrenia than in controls. EEGs were recorded for 40 subjects with schizophrenia and 40 age and sex matched controls during an auditory oddball reaction time task. ERPs to the targets and non-targets immediately preceding the targets were averaged separately. There was a disturbance in ERPs to targets but also to non-targets (reduced N100 amplitude and earlier P200 latency) and the difference between target and non-target ERP components (N100 and P200 amplitude and P200 latency), was significantly reduced in the schizophrenic group compared with controls. These findings suggest a disturbance in processing task relevant and irrelevant stimuli, consistent with Gray's (1998) hypothesis of misattributions in the 'match:mismatch' of novel (target) and familiar (non-target) sensory input compared with stored information.

  16. Setting conservation targets for sandy beach ecosystems

    Science.gov (United States)

    Harris, Linda; Nel, Ronel; Holness, Stephen; Sink, Kerry; Schoeman, David

    2014-10-01

    Representative and adequate reserve networks are key to conserving biodiversity. This begs the question, how much of which features need to be placed in protected areas? Setting specifically-derived conservation targets for most ecosystems is common practice; however, this has never been done for sandy beaches. The aims of this paper, therefore, are to propose a methodology for setting conservation targets for sandy beach ecosystems; and to pilot the proposed method using data describing biodiversity patterns and processes from microtidal beaches in South Africa. First, a classification scheme of valued features of beaches is constructed, including: biodiversity features; unique features; and important processes. Second, methodologies for setting targets for each feature under different data-availability scenarios are described. From this framework, targets are set for features characteristic of microtidal beaches in South Africa, as follows. 1) Targets for dune vegetation types were adopted from a previous assessment, and ranged 19-100%. 2) Targets for beach morphodynamic types (habitats) were set using species-area relationships (SARs). These SARs were derived from species richness data from 142 sampling events around the South African coast (extrapolated to total theoretical species richness estimates using previously-established species-accumulation curve relationships), plotted against the area of the beach (calculated from Google Earth imagery). The species-accumulation factor (z) was 0.22, suggesting a baseline habitat target of 27% is required to protect 75% of the species. This baseline target was modified by heuristic principles, based on habitat rarity and threat status, with final values ranging 27-40%. 3) Species targets were fixed at 20%, modified using heuristic principles based on endemism, threat status, and whether or not beaches play an important role in the species' life history, with targets ranging 20-100%. 4) Targets for processes and 5

  17. Radiochemical aspects of liquid mercury spallation targets

    CERN Document Server

    Neuhausen, Joerg; Eichler, Bernd; Eller, Martin; Horn, Susanne; Schumann, Dorothea; Stora, Thierry

    2012-01-01

    Liquid metal spallation targets using mercury as target material are used in state-of-the-art high power pulsed neutron sources that have been constructed in the USA and Japan within the last decade. Similar target concepts were also proposed for next generation ISOL, beta-beam and neutrino facilities. A large amount of radioactivity will be induced in the liquid metal during operation caused by the interaction of the target material with the intense proton beam. This radioactivity - carried by a wide range of radioisotopes of all the elements of the periodic table from hydrogen up to thallium - must be considered for the assessment of safe operation and maintenance procedures as well as for a final disposal of the used target material and components. This report presents an overview on chemical investigations performed in our laboratory that deal with the behavior of radionuclides in proton irradiated mercury samples. The solubility of elements in mercury was calculated using thermodynamical data obtained by...

  18. Progress on LMJ targets for ignition

    Energy Technology Data Exchange (ETDEWEB)

    Cherfils-Clerouin, C; Boniface, C; Bonnefille, M; Dattolo, E; Galmiche, D; Gauthier, P; Giorla, J; Laffite, S; Liberatore, S; Loiseau, P; Malinie, G; Masse, L; Masson-Laborde, P E; Monteil, M C; Poggi, F; Seytor, P; Wagon, F; Willien, J L, E-mail: catherine.cherfils@cea.f [CEA, DAM, DIF, F-91297 Arpajon (France)

    2009-12-15

    Targets designed to produce ignition on the Laser Megajoule (LMJ) are being simulated in order to set specifications for target fabrication. The LMJ experimental plans include the attempt of ignition and burn of an ICF capsule with 160 laser beams, delivering up to 1.4 MJ and 380 TW. New targets needing reduced laser energy with only a small decrease in robustness have then been designed for this purpose. Working specifically on the coupling efficiency parameter, i.e. the ratio of the energy absorbed by the capsule to the laser energy, has led to the design of a rugby-ball shaped cocktail hohlraum; with these improvements, a target based on the 240-beam A1040 capsule can be included in the 160-beam laser energy-power space. Robustness evaluations of these different targets shed light on critical points for ignition, which can trade off by tightening some specifications or by preliminary experimental and numerical tuning experiments.

  19. Hydrogen isotope recycling at a tungsten target

    Energy Technology Data Exchange (ETDEWEB)

    Sakamoto, M., E-mail: sakamoto@prc.tsukuba.ac.jp [Plasma Research Center, University of Tsukuba, Tsukuba, Ibaraki 305-8577 (Japan); Nakashima, Y. [Plasma Research Center, University of Tsukuba, Tsukuba, Ibaraki 305-8577 (Japan); Higashizono, Y. [Research Institute for Applied Mechanics, Kyushu University, Kasuga, Fukuoka 816-8580 (Japan); Ogawa, K. [Interdisciplinary Graduate School for Engineering Sciences, Kyushu University, Kasuga, Fukuoka 816-8580 (Japan); Hosoi, K. [Plasma Research Center, University of Tsukuba, Tsukuba, Ibaraki 305-8577 (Japan); Rusinov, A. [Interdisciplinary Graduate School for Engineering Sciences, Kyushu University, Kasuga, Fukuoka 816-8580 (Japan); Takeda, H.; Akabane, Y.; Kohagura, J.; Yoshikawa, M.; Ichimura, M.; Imai, T. [Plasma Research Center, University of Tsukuba, Tsukuba, Ibaraki 305-8577 (Japan)

    2013-07-15

    Hydrogen recycling has been studied focusing on the neutral behavior in front of tungsten target in the plasma–wall interaction simulator APSEDAS and the tandem mirror GAMMA 10. The line intensity of hydrogen Balmer series decreased toward the target corresponding to a decrease in the electron density in APSEDAS. The relative population of n = 3 and n = 4 increased and that of n = 5 and n = 6 decreased just in front of the target (Z < 5 mm). This might be attributed to the reflected atom or reemitted molecule from the target. In GAMMA 10, the intensity of hydrogen Balmer (H{sub α}) line decreased exponentially with distance from the target with two decay lengths: ∼16 mm and ∼53 mm. These two short decay lengths are attributed to the fact that a fraction of the reflected atoms and atoms dissociated from molecules are at excited energy states.

  20. Targeted Radionuclide Therapy of Human Tumors

    Directory of Open Access Journals (Sweden)

    Sergey V. Gudkov

    2015-12-01

    Full Text Available Targeted radionuclide therapy is one of the most intensively developing directions of nuclear medicine. Unlike conventional external beam therapy, the targeted radionuclide therapy causes less collateral damage to normal tissues and allows targeted drug delivery to a clinically diagnosed neoplastic malformations, as well as metastasized cells and cellular clusters, thus providing systemic therapy of cancer. The methods of targeted radionuclide therapy are based on the use of molecular carriers of radionuclides with high affinity to antigens on the surface of tumor cells. The potential of targeted radionuclide therapy has markedly grown nowadays due to the expanded knowledge base in cancer biology, bioengineering, and radiochemistry. In this review, progress in the radionuclide therapy of hematological malignancies and approaches for treatment of solid tumors is addressed.

  1. Delayed neutrons measurement at the MEGAPIE target

    CERN Document Server

    Panebianco, Stefano; Dore, Diane; Ledoux, Xavier; Letourneau, Alain; Prevost, Aurelien; Ridikas, Danas

    2007-01-01

    In the framework of the Neutronic and Nuclear Assessment Task Group of the MEGAPIE experiment we measured the delayed neutron (DN) flux at the top of the target. The measurement was proposed mainly for radioprotection purposes since the DN flux at the top of the target has been estimated to be of the same order of magnitude as the prompt neutron flux. Given the strong model-dependence of DN predictions, the measurement of DN contribution to the total neutron activity at the top of the target was thus desired. Moreover, this measurement is complementary to the DN experiments performed at PNPI (Gatchina) on solid lead and bismuth targets. The DN measurement at MEGAPIE was performed during the start-up phase of the target. In this paper we present a detailed description of the experimental setup and some preliminary results on decay spectra.

  2. Launch window definition for sky target experiments.

    Science.gov (United States)

    Michaud, N. H.

    1973-01-01

    This paper is a brief report on the computer program developed for the Extraterrestrial Physics Barium Ion Cloud (BIC) Project. The mathematical analysis developed for the program along with its programing characteristics are pointed out to show that this program is adaptable to similar sky target projects. Definite viewing constraints are specified so that the chosen ground tracking stations can photograph the behavior of the sky target after its release. Viewing factors include the illumination of the target by the sun, the relative elevation look angle to the target from each tracking station, the solar and lunar depression angles at each tracking station, and the total sky background brightness of the target relative to each tracking station. Numeric values are assigned to each factor through program input. The program output is flexible so that the results of the window calculations can be studied to the depth required.

  3. Target Identification Strategies in Plant Chemical Biology

    Directory of Open Access Journals (Sweden)

    Wim eDejonghe

    2014-07-01

    Full Text Available The current needs to understand gene function in plant biology increasingly require more dynamic and conditional approaches opposed to classic genetic strategies. Gene redundancy and lethality can substantially complicate research, which might be solved by applying a chemical genetics approach. Now understood as the study of small molecules and their effect on biological systems with subsequent target identification, chemical genetics is a fast developing field with a strong history in pharmaceutical research and drug discovery. In plant biology however, chemical genetics is still largely in the starter blocks, with most studies relying on forward genetics and phenotypic analysis for target identification, while studies including direct target identification are limited. Here, we provide an overview of recent advances in chemical genetics in plant biology with a focus on target identification. Furthermore, we discuss different strategies for direct target identification and the possibilities and challenges for plant biology

  4. Radar target identification using multifractal geometry

    Science.gov (United States)

    Quach, Ban; Leung, Henry; Lo, Titus K. Y.; Litva, John

    1996-06-01

    The design of a system to distinguish objects from measurements of their radar backscatter signals has been a topic of considerable investigation. In the identification of a particular target out of a library of possible targets, the difficulty is that the radar signals cannot be fed rawly into a classifier. Some signal processing has to be done to generate the signal features for target identification. In this paper, multifractal geometry is applied to address the practical issue of discrimination between fishing boat, growlers (small pieces of glacial ice) and sea scattered signals, which is important for search-and-rescue operation. An efficient box-counting method is used to compute the generalized dimension and the multifractal spectrum of different targets and sea scattered signals. In an effort to support our study, X-band radar measurements were collected and analyzed to determine the separability of sea surface targets and sea scattered signals using the multifractal geometry.

  5. The Jefferson Lab Frozen Spin Target

    Energy Technology Data Exchange (ETDEWEB)

    Christopher Keith, James Brock, Christopher Carlin, Sara Comer, David Kashy, Josephine McAndrew, David Meekins, Eugene Pasyuk, Joshua Pierce, Mikell Seely

    2012-08-01

    A frozen spin polarized target, constructed at Jefferson Lab for use inside a large acceptance spectrometer, is described. The target has been utilized for photoproduction measurements with polarized tagged photons of both longitudinal and circular polarization. Protons in TEMPO-doped butanol were dynamically polarized to approximately 90% outside the spectrometer at 5 T and 200-300 mK. Photoproduction data were acquired with the target inside the spectrometer at a frozen-spin temperature of approximately 30 mK with the polarization maintained by a thin, superconducting coil installed inside the target cryostat. A 0.56 T solenoid was used for longitudinal target polarization and a 0.50 T dipole for transverse polarization. Spin relaxation times as high as 4000 hours were observed. We also report polarization results for deuterated propanediol doped with the trityl radical OX063.

  6. Peptide Selection for Targeted Protein Quantitation.

    Science.gov (United States)

    Chiva, Cristina; Sabidó, Eduard

    2017-03-03

    Targeted proteomics methods in their different flavors rely on the use of a few peptides as proxies for protein quantitation, which need to be specified either prior to or after data acquisition. However, in contrast with discovery methods that use all identified peptides for a given protein to estimate its abundance, targeted proteomics methods are limited in the number of peptides that are used for protein quantitation. Because only a few peptides per protein are acquired or extracted in targeted experiments, the selection of peptides that are used for targeted protein quantitation becomes crucial. Several rules have been proposed to guide peptide selection for targeted proteomics studies, which have generally been based on the amino acidic composition of the peptide sequences. However, the compliance of these rules does not imply that not-conformed peptides are not reproducibly generated nor do they guarantee that the selected peptides correctly represent the behavior of the protein abundance under different conditions.

  7. Behavioral and neurophysiological aspects of target interception.

    Science.gov (United States)

    Merchant, Hugo; Zarco, Wilbert; Prado, Luis; Pérez, Oswaldo

    2009-01-01

    This chapter focuses on the behavioral and neurophysiological aspects of manual interception. We review the most important elements of an interceptive action from the sensory and cognitive stage to the motor side of this behavior. We describe different spatial and temporal target parameters that can be used to control the interception movement, as well as the different strategies used by the subject to intercept a moving target. We review the neurophysiological properties of the parietofrontal system during target motion processing and during a particular experiment of target interception. Finally, we describe the neural responses associated with the temporal and spatial parameters of a moving target and the possible neurophysiological mechanisms used to integrate this information in order to trigger an interception movement.

  8. Ecosystem Targets - Defining target levels for ecosystem components: a socio-ecological approach

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Ecological indicators can facilitate Ecosystem-based Management, but only if targets for indicators exist. Because targets are an expression of the desired state of...

  9. Multiple Model Adaptive Estimator Target Tracker for Maneuvering Targets in Clutter

    National Research Council Canada - National Science Library

    Smith, Brian D

    2005-01-01

    ...) to be implemented directly. Poorly known or varying target dynamics complicate the design of any tracking filter, and filters using only a single dynamics model can rarely handle anything beyond the most benign target maneuvers...

  10. Search for Two Categories of Target Produces Fewer Fixations to Target-Color Items

    Science.gov (United States)

    Menneer, Tamaryn; Stroud, Michael J.; Cave, Kyle R.; Li, Xingshan; Godwin, Hayward J.; Liversedge, Simon P.; Donnelly, Nick

    2012-01-01

    Searching simultaneously for metal threats (guns and knives) and improvised explosive devices (IEDs) in X-ray images is less effective than 2 independent single-target searches, 1 for metal threats and 1 for IEDs. The goals of this study were to (a) replicate this dual-target cost for categorical targets and to determine whether the cost remains…

  11. Hitting moving targets : A dissociation between the use of the target's speed and direction of motion

    NARCIS (Netherlands)

    Brouwer, Anne Marie; Middelburg, Tom; Smeets, Jeroen B J; Brenner, Eli

    2003-01-01

    Previous work has indicated that people do not use their judgment of a target's speed to determine where to hit it. Instead, they use their judgment of the target's changing position and an expected speed (based on the speed of previous targets). In the present study we investigate whether people

  12. Subcellular drug targeting, pharmacokinetics and bioavailability.

    Science.gov (United States)

    Leucuta, Sorin Emilian

    2014-02-01

    Effective treatment of diseases at the molecular level is possible by directing the drug substance (micromolecular, protein or peptide drugs, DNA, oligonucleotides, siRNA) with the aid of a specialized nanoparticulate carrier, for safe and effective transport to the specific site of action in the cytosol and its organelles including nuclear targeting. To achieve efficient cytosolic delivery of therapeutics or nuclear targeting, different drug delivery systems (DDS) have been developed (macromolecular drug conjugates, chemically or genetically modified proteins, and particulate drug carriers) capable of subcellular internalization overcoming the biological barriers, by passive targeting and especially by active targeting (receptor-targeted delivery). The success depends on the physicochemical nature of DDS, intracellular barriers that these systems need to overcome, the bioavailability of the bioactive drug, biodistribution, the intracellular pharmacokinetics and its influence on the pharmacodynamic effect. Models necessary for this purpose exist but they need to be more developed especially with quantitative treatments, after the development of the means of highlighting the evolution of the drug substance in biophase or at the level of the target cellular organelle by quantitative assays. It is expected that intracellularly targeted drug delivery approaches will be clinically useful using specialized DDSs belonging to the pharmaceutical nanotechnologies.

  13. Hypersonic sliding target tracking in near space

    Directory of Open Access Journals (Sweden)

    Xiang-yu Zhang

    2015-12-01

    Full Text Available To improve the tracking accuracy of hypersonic sliding target in near space, the influence of target hypersonic movement on radar detection and tracking is analyzed, and an IMM tracking algorithm is proposed based on radial velocity compensating and cancellation processing of high dynamic biases under the earth centered earth fixed (ECEF coordinate. Based on the analysis of effect of target hypersonic movement, a measurement model is constructed to reduce the filter divergence which is caused by the model mismatch. The high dynamic biases due to the target hypersonic movement are approximately compensated through radial velocity estimation to achieve the hypersonic target tracking at low systematic biases in near space. The high dynamic biases are further eliminated by the cancellation processing of different radars, in which the track association problem can be solved when the dynamic biases are low. An IMM algorithm based on constant acceleration (CA, constant turning (CT and Singer models is used to achieve the hypersonic sliding target tracking in near space. Simulation results show that the target tracking in near space can be achieved more effectively by using the proposed algorithm.

  14. Design of the LBNF Beamline Target Station

    Energy Technology Data Exchange (ETDEWEB)

    Tariq, S. [Fermilab; Ammigan, K. [Fermilab; Anderson, K.; ; Buccellato, S. A. [Fermilab; Crowley, C. F. [Fermilab; Hartsell, B. D. [Fermilab; Hurh, P. [Fermilab; Hylen, J. [Fermilab; Kasper, P. [Fermilab; Krafczyk, G. E. [Fermilab; Lee, A. [Fermilab; Lundberg, B. [Fermilab; Reitzner, S. D. [Fermilab; Sidorov, V. [Fermilab; Stefanik, A. M. [Fermilab; Tropin, I. S. [Fermilab; Vaziri, K. [Fermilab; Williams, K. [Fermilab; Zwaska, R. M. [Fermilab; Densham, C. [RAL, Didcot

    2016-10-01

    The Long Baseline Neutrino Facility (LBNF) project will build a beamline located at Fermilab to create and aim an intense neutrino beam of appropriate energy range toward the DUNE detectors at the SURF facility in Lead, South Dakota. Neutrino production starts in the Target Station, which consists of a solid target, magnetic focusing horns, and the associated sub-systems and shielding infrastructure. Protons hit the target producing mesons which are then focused by the horns into a helium-filled decay pipe where they decay into muons and neutrinos. The target and horns are encased in actively cooled steel and concrete shielding in a chamber called the target chase. The reference design chase is filled with air, but nitrogen and helium are being evaluated as alternatives. A replaceable beam window separates the decay pipe from the target chase. The facility is designed for initial operation at 1.2 MW, with the ability to upgrade to 2.4 MW, and is taking advantage of the experience gained by operating Fermilab’s NuMI facility. We discuss here the design status, associated challenges, and ongoing R&D and physics-driven component optimization of the Target Station.

  15. Improving pharmacological targeting of AKT in melanoma.

    Science.gov (United States)

    Kuzu, Omer F; Gowda, Raghavendra; Sharma, Arati; Noory, Mohammad A; Dinavahi, Saketh S; Kardos, Gregory; Drabick, Joseph J; Robertson, Gavin P

    2017-09-28

    Targeting AKT with pharmacological agents inhibiting this protein in the melanoma clinic is ineffective. This is a major contradiction considering the substantial preclinical data suggesting AKT as an effective target. Various approaches have been undertaken to unravel this contradiction and drug combinations sought that could resolve this concern. We have shown that genetic targeting AKT3 or WEE1 can be effective for inhibiting tumor growth in preclinical animal models. However, no one has examined whether combining pharmacological agents targeting each of these enzymes could be more effective than inhibiting each alone and enhance the efficacy of targeting AKT in melanoma. This report shows that combining the AKT inhibitors (AZD5363 or MK1775) with the WEE1 inhibitor, AZD5363, can synergistically kill cultured melanoma cells and decrease melanoma tumor growth by greater than 90%. Co-targeting AKT and WEE1 led to enhanced deregulation of the cell cycle and DNA damage repair pathways by modulating the transcription factors p53 and FOXM1, as well as the proteins whose expression is regulated by these two proteins. Thus, this study identifies a unique combination of pharmacological agents and the ratio needed for efficacy that could be used to potentially improve the therapeutic effectiveness of targeting AKT in the clinic. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. COMPASS polarized target for Drell-Yan

    CERN Document Server

    Pešek, M

    2014-01-01

    In the COMPASS Drell–Yan experiment the pion beam with momen tum of 190 GeV/ c and in- tensity up to 10 8 pions/s will interact with transversely polarized proton t arget producing muon pair via Drell–Yan process. The solid-state NH 3 will be polarized by dynamic nuclear polar- ization. Maximum polarization reached during data taking i s expected to be up to 90%. The non-interacting beam and other particles produced inside t he target will be stopped in the hadron absorber after the target. Two target cells, sepparated by a 20 cm gap in between, each 55 cm long and 4 cm in diameter give the target material volume about 691 cm 3 . The target platform needs to be moved by 2.3 m in upstream dire ction from the position used in previous experiments in order to accomodate the absorber. D uring the beam time higher radiation is expected in the area of the control room. Thus a new target r emote control system is needed. The target magnet is undergoing a substantial upgrade. Drell–Yan data taking is expected t...

  17. Systemic Targeted Alpha Radiotherapy for Cancer

    Directory of Open Access Journals (Sweden)

    Allan B. J.

    2013-09-01

    Full Text Available Background: The fundamental principles of internal targeted alpha therapy for cancer were established many decades ago.The high linear energy transfer (LET of alpha radiation to the targeted cancer cellscauses double strand breaks in DNA. At the same time, the short range radiation spares adjacent normal tissues. This targeted approach complements conventional external beam radiotherapy and chemotherapy. Such therapies fail on several fronts, such as lack of control of some primary cancers (e.g.glioblastoma multiformeand to inhibit the development of lethal metastatic cancer after successful treatment of the primary cancer. Objective: This review charts the developing role of systemic high LET, internal radiation therapy. Method: Targeted alpha therapy is a rapidly advancing experimental therapy that holds promise to deliver high cytotoxicity to targeted cancer cells. Initially thought to be indicated for leukemia and micrometastases, there is now evidence that solid tumors can also be regressed. Results: Alpha therapy may be molecular or physiological in its targeting. Alpha emitting radioisotopes such as Bi-212, Bi-213, At-211 and Ac-225 are used to label monoclonal antibodies or proteins that target specifc cancer cells. Alternatively, Radium-233 is used for palliative therapy of breast and prostate cancers because of its bone seeking properties. Conclusion: Preclinical studies and clinical trials of alpha therapy are discussed for leukemia, lymphoma, melanoma, glioblastoma multiforme, bone metastases, ovarian cancer, pancreatic cancer and other cancers.

  18. Gene Therapy and Targeted Toxins for Glioma

    Science.gov (United States)

    Castro, Maria G.; Candolfi, Marianela; Kroeger, Kurt; King, Gwendalyn D.; Curtin, James F.; Yagiz, Kader; Mineharu, Yohei; Assi, Hikmat; Wibowo, Mia; Muhammad, AKM Ghulam; Foulad, David; Puntel, Mariana; Lowenstein, Pedro R.

    2011-01-01

    The most common primary brain tumor in adults is glioblastoma. These tumors are highly invasive and aggressive with a mean survival time of nine to twelve months from diagnosis to death. Current treatment modalities are unable to significantly prolong survival in patients diagnosed with glioblastoma. As such, glioma is an attractive target for developing novel therapeutic approaches utilizing gene therapy. This review will examine the available preclinical models for glioma including xenographs, syngeneic and genetic models. Several promising therapeutic targets are currently being pursued in pre-clinical investigations. These targets will be reviewed by mechanism of action, i.e., conditional cytotoxic, targeted toxins, oncolytic viruses, tumor suppressors/oncogenes, and immune stimulatory approaches. Preclinical gene therapy paradigms aim to determine which strategies will provide rapid tumor regression and long-term protection from recurrence. While a wide range of potential targets are being investigated preclinically, only the most efficacious are further transitioned into clinical trial paradigms. Clinical trials reported to date are summarized including results from conditionally cytotoxic, targeted toxins, oncolytic viruses and oncogene targeting approaches. Clinical trial results have not been as robust as preclinical models predicted; this could be due to the limitations of the GBM models employed. Once this is addressed, and we develop effective gene therapies in models that better replicate the clinical scenario, gene therapy will provide a powerful approach to treat and manage brain tumors. PMID:21453286

  19. Folate targeted polymeric 'green' nanotherapy for cancer

    Science.gov (United States)

    Narayanan, Sreeja; Binulal, N. S.; Mony, Ullas; Manzoor, Koyakutty; Nair, Shantikumar; Menon, Deepthy

    2010-07-01

    The concept of 'green' chemotherapy by employing targeted nanoparticle mediated delivery to enhance the efficacy of phytomedicines is reported. Poly (lactide-co-glycolide) (PLGA) nanoparticles encapsulating a well known nutraceutical namely, grape seed extract (GSE)—'NanoGSE'—was prepared by a nanoprecipitation technique. The drug-loaded nanoparticles of size ~ 100 nm exhibited high colloidal stability at physiological pH. Molecular receptor targeting of this nanophytomedicine against folate receptor over-expressing cancers was demonstrated in vitro by conjugation with a potential cancer targeting ligand, folic acid (FA). Fluorescence microscopy and flow cytometry data showed highly specific cellular uptake of FA conjugated NanoGSE on folate receptor positive cancer cells. Studies were also conducted to investigate the efficiency of targeted (FA conjugated) versus non-targeted (non-FA conjugated) nanoformulations in causing cancer cell death. The IC50 values were lowered by a factor of ~ 3 for FA-NanoGSE compared to the free drug, indicating substantially enhanced bioavailability to the tumor cells, sparing the normal ones. Receptor targeting of FA-NanoGSE resulted in a significant increase in apoptotic index, which was also quantified by flow cytometry and fluorescence microscopy. This in vitro study provides a basis for the use of nanoparticle mediated delivery of anticancer nutraceuticals to enhance bioavailability and effectively target cancer by a 'green' approach.

  20. Targeting tumor suppressor genes for cancer therapy.

    Science.gov (United States)

    Liu, Yunhua; Hu, Xiaoxiao; Han, Cecil; Wang, Liana; Zhang, Xinna; He, Xiaoming; Lu, Xiongbin

    2015-12-01

    Cancer drugs are broadly classified into two categories: cytotoxic chemotherapies and targeted therapies that specifically modulate the activity of one or more proteins involved in cancer. Major advances have been achieved in targeted cancer therapies in the past few decades, which is ascribed to the increasing understanding of molecular mechanisms for cancer initiation and progression. Consequently, monoclonal antibodies and small molecules have been developed to interfere with a specific molecular oncogenic target. Targeting gain-of-function mutations, in general, has been productive. However, it has been a major challenge to use standard pharmacologic approaches to target loss-of-function mutations of tumor suppressor genes. Novel approaches, including synthetic lethality and collateral vulnerability screens, are now being developed to target gene defects in p53, PTEN, and BRCA1/2. Here, we review and summarize the recent findings in cancer genomics, drug development, and molecular cancer biology, which show promise in targeting tumor suppressors in cancer therapeutics. © 2015 WILEY Periodicals, Inc.

  1. Preliminary investigation of solid target geometry

    Energy Technology Data Exchange (ETDEWEB)

    Haga, Katsuhiro; Kaminaga, Masanori; Hino, Ryutaro; Takada, Hiroshi [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Shafiqul, I.M.; Tsuji, Nobumasa; Okamoto, Hutoshi; Kumasaka, Katsuyuki; Hayashi, Katsumi

    1997-11-01

    In this report, we introduce the developing plan for a solid metal target structure. Supposing tantalum as the target material, the temperature distribution and the maximum thermal stress in a tantalum plate of a solid metal target was evaluated under a water cooling condition, using the heat generation rate calculated with the JAERI`s neutron transport code. The calculation results showed that the water velocity was higher than 10 m/s in order to cool the 3mm-thick target plate down to 200degC when the target surface was smooth and heat transfer rate was calculated with the Dittus-Boelter equation. In this case, the maximum thermal stress is 50 MPa at the target plate surface. The coolant water flow distribution in a target vessel was also evaluated for ISIS-type flow channels and the parallel flow channels. In the ISIS-type flow channels, at least 25mm height of the coolant plenum is needed for a uniform flow distribution. The maximum flow velocity difference between the flow gaps in the parallel flow channels was 30%. A heat transfer augmentation experiment was conducted using ribbed-surface flow channel. The heat transfer rate was confirmed to increase up to twice the value of that for a smooth surface. (author)

  2. Degradable Polymersomes for Targeted Drug Delivery

    Science.gov (United States)

    Petersen, Matthew Alan

    Chemotherapy today is often accompanied by major side effects due to delivery of toxic drugs to healthy tissue in addition to diseased cells. Targeted drug delivery offers the possibility of minimizing these side effects by specific delivery to cancer cells using targeted nanocarriers that enhance drug accumulation in tumors and facilitate target-specific cellular uptake. Polymersomes, vesicles self-assembled from polymeric amphiphiles, are an attractive targeted vehicle, as they are capable of encapsulating both hydrophobic and hydrophilic drugs, have lengthy circulation times in vivo, and can employ degradable functionality for triggered release of payload and clearance from the body. This thesis reports on efforts to enhance the capabilities of degradable polymersomes for targeted delivery. First, targeting functionality is incorporated into polymersomes of the block copolymer poly(ethylene oxide)-b-poly(gamma-methyl-epsilon-caprolactone) by incorporating the reactive vinyl sulfone group into the amphiphile's hydrophilic terminus, allowing site-selective reaction with cysteine-functionalized targeting peptides following self-assembly. The performance of targeted delivery using this polymersome is then evaluated in vitro. Binding and delivery to model cell lines for targeted and bystander cells is tracked using nontargeted polymersomes and compared to that for polymersomes using a high- or low-affinity ligand. Polymer degradation is also tracked both in simple media and during cellular delivery. Finally, a new monomer is developed incorporating acid-labile acetal functionality into a cyclic polyester. The polymerization of this monomer to two distinct polymers is also characterized and the degradation behavior of both polymers evaluated.

  3. Protein search for multiple targets on DNA

    Energy Technology Data Exchange (ETDEWEB)

    Lange, Martin [Johannes Gutenberg University, Mainz 55122 (Germany); Department of Chemistry, Rice University, Houston, Texas 77005 (United States); Kochugaeva, Maria [Department of Chemistry, Rice University, Houston, Texas 77005 (United States); Kolomeisky, Anatoly B., E-mail: tolya@rice.edu [Department of Chemistry, Rice University, Houston, Texas 77005 (United States); Center for Theoretical Biological Physics, Rice University, Houston, Texas 77005 (United States)

    2015-09-14

    Protein-DNA interactions are crucial for all biological processes. One of the most important fundamental aspects of these interactions is the process of protein searching and recognizing specific binding sites on DNA. A large number of experimental and theoretical investigations have been devoted to uncovering the molecular description of these phenomena, but many aspects of the mechanisms of protein search for the targets on DNA remain not well understood. One of the most intriguing problems is the role of multiple targets in protein search dynamics. Using a recently developed theoretical framework we analyze this question in detail. Our method is based on a discrete-state stochastic approach that takes into account most relevant physical-chemical processes and leads to fully analytical description of all dynamic properties. Specifically, systems with two and three targets have been explicitly investigated. It is found that multiple targets in most cases accelerate the search in comparison with a single target situation. However, the acceleration is not always proportional to the number of targets. Surprisingly, there are even situations when it takes longer to find one of the multiple targets in comparison with the single target. It depends on the spatial position of the targets, distances between them, average scanning lengths of protein molecules on DNA, and the total DNA lengths. Physical-chemical explanations of observed results are presented. Our predictions are compared with experimental observations as well as with results from a continuum theory for the protein search. Extensive Monte Carlo computer simulations fully support our theoretical calculations.

  4. Proton bombarded reactions of Calcium target nuclei

    Directory of Open Access Journals (Sweden)

    Tel Eyyup

    2017-01-01

    Full Text Available In this study, proton bombarded nuclear reactions calculations of Calcium target nuclei have been investigated in the incident proton energy range of 1–50 MeV. The excitation functions for 40Ca target nuclei reactions have been calculated by using PCROSS nuclear reaction calculation code. Weisskopf-Ewing and the full exciton models were used for equilibrium and for pre-equilibrium calculations, respectively. The excitation functions for 40Ca target nuclei reactions (p,α, (p,n, (p,p have been calculated using the semi-empirical formula Tel et al. [5].

  5. Fixed target issues for the Tevatron Upgrade

    Energy Technology Data Exchange (ETDEWEB)

    Stefanski, R.

    1988-08-29

    The Tevatron Upgrade poses some interesting prospects for the Fixed-Target program if an option to extract the high energy proton beam is preserved. This paper presents a summary of the advantages of increased energy for fixed target experiments, and evaluates some of the more challenging technical issues. In particular, Bottom production, muon and neutrino interactions, and polarized /bar p/ experiments would benefit substantially from a higher energy primary beam. The new Main Injector will also be important for fixed target experiments as a source for test beams and intense kaon and neutrino beams. 4 refs., 2 tabs.

  6. Reduce proton energy spread by target ablation

    CERN Document Server

    Zhao, Shuan; Chen, Jiaer; Yan, Xueqing

    2015-01-01

    It's shown that, with strong target ablation monoenergetic protons along the laser direction is available during the laser aluminum foil interaction, which is different from the classic TNSA theory. When the laser pre-pulse is too strong that the whole target is vaporized, the energetic electrons generated in the gas preplasma will play an important role for the ion acceleration because the sheath field will not be available. These electrons beam, which is highly directional, will setup triangle envelope acceleration field along the laser direction at the target rear, reducing the ion energy spread.

  7. Targets for a Neutral Kaon Beam

    Energy Technology Data Exchange (ETDEWEB)

    Keith, Christopher [Thomas Jefferson National Accelerator Facility (TJNAF), Newport News, VA (United States)

    2016-04-01

    A secondary beam of neutral Kaons is under consideration for Hall D at Jefferson Lab to perform spectroscopic studies of hyperons produced by K 0 L particles scattering from proton and deuteron targets. The proposed physics program would utilize the GlueX detector package currently installed in Hall D. This contribution looks at potential targets for use in the new facility, paying close attention to the existing infrastructure of GlueX and Hall D. Unpolarized cryotargets of liquid hydrogen and deuerium, as well as polarized solid targets of protons and deuterons are examined.

  8. Antiproton production target of the AA

    CERN Multimedia

    Photographic Service; CERN PhotoLab

    1980-01-01

    The target rods were initially of tungsten, later of iridium. Diameters were around 3 mm and the lengths 60-110 mm. The rod is embedded in graphite, pressed into an aluminium body with cooling fins for forced air cooling. The 26 GeV proton beam from the PS was focused to the dimension of the rod. To aim precisely at its centre, the target was fitted with a scintillator screen, with circles at every 5 mm radius. Both scintillator and target had to stand pulses of 1.4E13 protons every 4.8 s, without interruption for many months.

  9. Drug-induced regulation of target expression

    DEFF Research Database (Denmark)

    Iskar, Murat; Campillos, Monica; Kuhn, Michael

    2010-01-01

    Drug perturbations of human cells lead to complex responses upon target binding. One of the known mechanisms is a (positive or negative) feedback loop that adjusts the expression level of the respective target protein. To quantify this mechanism systems-wide in an unbiased way, drug...... further newly identified drug-induced differential regulation of Lanosterol 14-alpha demethylase, Endoplasmin, DNA topoisomerase 2-alpha and Calmodulin 1. The feedback regulation in these and other targets is likely to be relevant for the success or failure of the molecular intervention....

  10. 29 mm Diameter Target Test Report

    Energy Technology Data Exchange (ETDEWEB)

    Woloshun, Keith Albert [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Olivas, Eric Richard [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Dale, Gregory E. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Naranjo, Angela Carol [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Romero, Frank Patrick [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Chemerisov, Sergey [Argonne National Lab. (ANL), Argonne, IL (United States); Gromov, Roman [Argonne National Lab. (ANL), Argonne, IL (United States)

    2017-10-23

    After numerous delays, the test of the 29 mm diameter target was conducted on 8/18/2017. The complete target design report, dated 8/15/2016, is reproduced below for completeness. This describes in detail the 10 disk target with varying thickness disks. The report presents and discusses the test results. In brief summary, there appears to have been multiple instrumentation errors. Measured temperatures, pressures and IR camera window temperature measurement are all suspect. All tests were done at 35 MeV, with 171 μA current, or 6 kW of beam power.

  11. Performance Simulations of Moving Target Search Algorithms

    Directory of Open Access Journals (Sweden)

    Peter K. K. Loh

    2009-01-01

    Full Text Available The design of appropriate moving target search (MTS algorithms for computer-generated bots poses serious challenges as they have to satisfy stringent requirements that include computation and execution efficiency. In this paper, we investigate the performance and behaviour of existing moving target search algorithms when applied to search-and-capture gaming scenarios. As part of the investigation, we also introduce a novel algorithm known as abstraction MTS. We conduct performance simulations with a game bot and moving target within randomly generated mazes of increasing sizes and reveal that abstraction MTS exhibits competitive performance even with large problem spaces.

  12. The Socioeconomic Benefit to Individuals of Achieving the 2020 Targets for Five Preventive Chemotherapy Neglected Tropical Diseases

    Science.gov (United States)

    Luyendijk, Marianne; Fitzpatrick, Christopher; Niessen, Louis; Stolk, Wilma A.; Tediosi, Fabrizio; Rijnsburger, Adriana J.; Bakker, Roel; Hontelez, Jan A. C.; Richardus, Jan H.; Jacobson, Julie; de Vlas, Sake J.; Severens, Johan L.

    2017-01-01

    Background Lymphatic filariasis (LF), onchocerciasis, schistosomiasis, soil-transmitted helminths (STH) and trachoma represent the five most prevalent neglected tropical diseases (NTDs). They can be controlled or eliminated by means of safe and cost-effective interventions delivered through programs of Mass Drug Administration (MDA)—also named Preventive Chemotherapy (PCT). The WHO defined targets for NTD control/elimination by 2020, reinforced by the 2012 London Declaration, which, if achieved, would result in dramatic health gains. We estimated the potential economic benefit of achieving these targets, focusing specifically on productivity and out-of-pocket payments. Methods Productivity loss was calculated by combining disease frequency with productivity loss from the disease, from the perspective of affected individuals. Productivity gain was calculated by deducting the total loss expected in the target achievement scenario from the loss in a counterfactual scenario where it was assumed the pre-intervention situation in 1990 regarding NTDs would continue unabated until 2030. Economic benefits from out-of-pocket payments (OPPs) were calculated similarly. Benefits are reported in 2005 US$ (purchasing power parity-adjusted and discounted at 3% per annum from 2010). Sensitivity analyses were used to assess the influence of changes in input parameters. Results The economic benefit from productivity gain was estimated to be I$251 billion in 2011–2020 and I$313 billion in 2021–2030, considerably greater than the total OPPs averted of I$0.72 billion and I$0.96 billion in the same periods. The net benefit is expected to be US$ 27.4 and US$ 42.8 for every dollar invested during the same periods. Impact varies between NTDs and regions, since it is determined by disease prevalence and extent of disease-related productivity loss. Conclusion Achieving the PCT-NTD targets for 2020 will yield significant economic benefits to affected individuals. Despite large

  13. The Socioeconomic Benefit to Individuals of Achieving the 2020 Targets for Five Preventive Chemotherapy Neglected Tropical Diseases.

    Directory of Open Access Journals (Sweden)

    William K Redekop

    2017-01-01

    Full Text Available Lymphatic filariasis (LF, onchocerciasis, schistosomiasis, soil-transmitted helminths (STH and trachoma represent the five most prevalent neglected tropical diseases (NTDs. They can be controlled or eliminated by means of safe and cost-effective interventions delivered through programs of Mass Drug Administration (MDA-also named Preventive Chemotherapy (PCT. The WHO defined targets for NTD control/elimination by 2020, reinforced by the 2012 London Declaration, which, if achieved, would result in dramatic health gains. We estimated the potential economic benefit of achieving these targets, focusing specifically on productivity and out-of-pocket payments.Productivity loss was calculated by combining disease frequency with productivity loss from the disease, from the perspective of affected individuals. Productivity gain was calculated by deducting the total loss expected in the target achievement scenario from the loss in a counterfactual scenario where it was assumed the pre-intervention situation in 1990 regarding NTDs would continue unabated until 2030. Economic benefits from out-of-pocket payments (OPPs were calculated similarly. Benefits are reported in 2005 US$ (purchasing power parity-adjusted and discounted at 3% per annum from 2010. Sensitivity analyses were used to assess the influence of changes in input parameters.The economic benefit from productivity gain was estimated to be I$251 billion in 2011-2020 and I$313 billion in 2021-2030, considerably greater than the total OPPs averted of I$0.72 billion and I$0.96 billion in the same periods. The net benefit is expected to be US$ 27.4 and US$ 42.8 for every dollar invested during the same periods. Impact varies between NTDs and regions, since it is determined by disease prevalence and extent of disease-related productivity loss.Achieving the PCT-NTD targets for 2020 will yield significant economic benefits to affected individuals. Despite large uncertainty, these benefits far exceed the

  14. Radar automatic target recognition (ATR) and non-cooperative target recognition (NCTR)

    CERN Document Server

    Blacknell, David

    2013-01-01

    The ability to detect and locate targets by day or night, over wide areas, regardless of weather conditions has long made radar a key sensor in many military and civil applications. However, the ability to automatically and reliably distinguish different targets represents a difficult challenge. Radar Automatic Target Recognition (ATR) and Non-Cooperative Target Recognition (NCTR) captures material presented in the NATO SET-172 lecture series to provide an overview of the state-of-the-art and continuing challenges of radar target recognition. Topics covered include the problem as applied to th

  15. TargetMine, an integrated data warehouse for candidate gene prioritisation and target discovery.

    Directory of Open Access Journals (Sweden)

    Yi-An Chen

    Full Text Available Prioritising candidate genes for further experimental characterisation is a non-trivial challenge in drug discovery and biomedical research in general. An integrated approach that combines results from multiple data types is best suited for optimal target selection. We developed TargetMine, a data warehouse for efficient target prioritisation. TargetMine utilises the InterMine framework, with new data models such as protein-DNA interactions integrated in a novel way. It enables complicated searches that are difficult to perform with existing tools and it also offers integration of custom annotations and in-house experimental data. We proposed an objective protocol for target prioritisation using TargetMine and set up a benchmarking procedure to evaluate its performance. The results show that the protocol can identify known disease-associated genes with high precision and coverage. A demonstration version of TargetMine is available at http://targetmine.nibio.go.jp/.

  16. New Cholesterol Fighting Meds Target Key Gene

    Science.gov (United States)

    ... https://medlineplus.gov/news/fullstory_165942.html New Cholesterol Fighting Meds Target Key Gene Two trials show ... New gene-based therapies appear to significantly decrease cholesterol levels in people, and could even cut down ...

  17. Is telomerase a viable target in cancer?

    Science.gov (United States)

    Buseman, C.M.; Wright, W.E.; Shay, J.W.

    2012-01-01

    The ideal cancer treatment would specifically target cancer cells yet have minimal or no adverse effects on normal somatic cells. Telomerase, the ribonucleoprotein reverse transcriptase that maintains the ends of human chromosome, is an attractive cancer therapeutic target for exactly this reason [1]. Telomerase is expressed in more than 85% of cancer cells, making it a nearly universal cancer marker, while the majority of normal somatic cells are telomerase negative. Telomerase activity confers limitless replicative potential to cancer cells, a hallmark of cancer which must be attained for the continued growth that characterizes almost all advanced neoplasms [2]. In this review we will summarize the role of telomeres and telomerase in cancer cells, and how properties of telomerase are being exploited to create targeted cancer therapies including telomerase inhibitors, telomerase-targeted immunotherapies and telomerase-driven virotherapies. A frank and balanced assessment of the current state of telomerase inhibitors with caveats and potential limitations will be included. PMID:21802433

  18. Logarithm laws and shrinking target properties

    Indian Academy of Sciences (India)

    Abstract. We survey some of the recent developments in the study of logarithm laws and shrinking target properties for various families of dynamical systems. We discuss connections to geometry, diophantine approximation and probability theory.

  19. EURISOL Multi-MW Target: Preliminary Study

    CERN Document Server

    A.Herrera-Martínez and Y.Kadi

    This technical note summarises the design calculations performed within Task #2 of the EURopean Isotope Separation On-Line Radioactive Ion Beam Facility Design Study (EURISOL DS).A preliminary study was carried out in order to determine the optimum value of relevant parameters in the target design. Different scenarios were simulated using the Monte Carlo code FLUKA. Namely, sensitivity studies were performed to assess the impact of the projectile particle energy on the neutronics and energy deposition in the spallation target. The optimum target dimension was also studied for every case as well as the proper target material for the liquid metal proton-to-neutron converter, since mercury and lead-bismuth eutectic are reasonable options. The effect of the beam width on the power densities was also evaluated, taking into account the geometrical limitations of the facility. Finally, a comparison between protons and deuterons as primary particles was performed, acknowledging the limitations of using FLUKA for thes...

  20. Nuclear Targeting Terms for Engineers and Scientists

    Energy Technology Data Exchange (ETDEWEB)

    St Ledger, John W. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-02-01

    The Department of Defense has a methodology for targeting nuclear weapons, and a jargon that is used to communicate between the analysts, planners, aircrews, and missile crews. The typical engineer or scientist in the Department of Energy may not have been exposed to the nuclear weapons targeting terms and methods. This report provides an introduction to the terms and methodologies used for nuclear targeting. Its purpose is to prepare engineers and scientists to participate in wargames, exercises, and discussions with the Department of Defense. Terms such as Circular Error Probable, probability of hit and damage, damage expectancy, and the physical vulnerability system are discussed. Methods for compounding damage from multiple weapons applied to one target are presented.