WorldWideScience

Sample records for californium 242

  1. Historical Review of Californium-252 Discovery and Development

    Science.gov (United States)

    Stoddard, D. H.

    1985-01-01

    This paper discusses the discovery and history of californium 252. This isotope may be synthesized by irradiating plutonium 239, plutonium 242, americium 243, or curium 244 with neutrons in a nuclear reactor. Various experiments and inventions involving Cf conducted at the Savannah River Plant are discussed. The evolution of radiotherapy using californium 252 is reviewed. (PLG)

  2. Historical review of californium-252 discovery and development

    International Nuclear Information System (INIS)

    This paper discusses the discovery and history of californium 252. This isotope may be synthesized by irradiating plutonium 239, plutonium 242, americium 243, or curium 244 with neutrons in a nuclear reactor. Various experiments and inventions involving 252Cf conducted at the Savannah River Plant are discussed. The evolution of radiotherapy using californium 252 is reviewed

  3. Magnetism in californium

    International Nuclear Information System (INIS)

    A SQUID-based magnetic susceptometer has been constructed for studying small radioactive samples at temperatures below 350 K and in magnetic fields up to 50 kilogauss. The device has been used to study californium (element 98) in a number of solid-state forms: the dhcp metal, several oxides (Cf2O3 in both the bcc and monoclinic structures, Cf7O12, CfO2 and BaCfO3), several monopnictides (CfN, CfAs and CfSb) and the trichloride (in both the hexagonal and orthorhombic structures). All of these materials were studied in polycrystalline form, and hexagonal CfCl3 was studied in single-crystal form as well. The susceptometer has the sensitivity to measure samples containing less than 10 micrograms of californium. The magnetic susceptibilities of all of the californium materials at temperatures above about 100 K are described well by the Curie-Weiss relationship. This behavior is consistent with the assumption that the magnetic 5f electrons are localized and that the paramagnetic behavior can be interpreted in terms of the properties of the free ion. The measured values of the effective paramagnetic moment, μ/sub eff/, for all the californium materials that were studied are reasonably consistent with theoretical values based on intermediate coupling models. All of the californium materials showed some indications of cooperative magnetic effects. The dhcp metal was observed to order ferromagnetically at 52 K, and all of the californium compounds studied showed signs of antiferromagnetic ordering, mostly at temperatures below 25 K. 91 refs., 50 figs., 19 tabs

  4. Californium Multiplier (CFX)

    International Nuclear Information System (INIS)

    The availability of 252Cf as an economical high-intensity neutron source has made it possible to construct compact neutron irradiation devices with widespread applications. The simplest such device consists of a single 252Cf source within a moderating and shielding medium. Higher neutron flux levels can be attained either through the use of more 252Cf or through source multiplication by means of a subcritical uranium assembly. Although the use of larger 252Cf sources to achieve higher neutron flux is technically straightforward, an economic penalty is paid as the source strength is increased. Larger californium sources imply larger initial investments to cover the cost of source material and larger operating costs resulting from the decay of the 252Cf source. A Californium Multiplier, the CFX, which produces a flux enhancement of 30 when compared to a conventional moderated 252Cf system has been designed, licensed, built, and tested by IRT Corporation. Such systems are now available on a commercial basis for both neutron radiography and neutron activation analysis. The first commercial CFX system was installed at the Research Laboratories of Eastman Kodak Company in Rochester, NY, in March 1975. This device, using 1 mg of 252Cf, is very stable and the neutron flux generated by the CFX is very reproducible. The performance characteristics of this system are summarized

  5. Californium--palladium metal neutron source material

    Science.gov (United States)

    Dahlen, B.L.; Mosly, W.C. Jr.; Smith, P.K.; Albenesius, E.L.

    1974-01-22

    Californium, as metal or oxide, is uniformly dispersed throughout a noble metal matrix, provided in compact, rod or wire form. A solution of californium values is added to palladium metal powder, dried, blended and pressed into a compact having a uni-form distribution of californium. The californium values are decomposed to californium oxide or metal by heating in an inert or reducing atmosphere. Sintering the compact to a high density closes the matrix around the dispersed californium. The sintered compact is then mechanically shaped into an elongated rod or wire form. (4 claims, no drawings) (Official Gazette)

  6. Californium-252 progress, report No. 7, April 1971

    Energy Technology Data Exchange (ETDEWEB)

    1971-12-31

    This report contains discusses of the following topics on Californium-252: First sales of californium-252; encapsulation services discussed; three new participants in market evaluation program; summer training programs to use californium; Californium-252 shipping casks available; Californium-252 questions and answers, radiotherapy; neutron radiography; natural resources exploration; nuclear safeguards; process control; dosimetry; neutron radiography; neutron shielding; and nuclear safeguards.

  7. Californium Electrodepositions at Oak Ridge National Laboratory

    Energy Technology Data Exchange (ETDEWEB)

    Boll, Rose Ann [ORNL

    2015-01-01

    Electrodepositions of californium isotopes were successfully performed at Oak Ridge National Laboratory (ORNL) during the past year involving two different types of deposition solutions, ammonium acetate (NH4C2H3O2) and isobutanol ((CH3)2CHCH2OH). A californium product that was decay enriched in 251Cf was recovered for use in super-heavy element (SHE) research. This neutron-rich isotope, 251Cf, provides target material for SHE research for the potential discovery of heavier isotopes of Z=118. The californium material was recovered from aged 252Cf neutron sources in storage at ORNL. These sources have decayed for over 30 years, thus providing material with a very high 251Cf-to-252Cf ratio. After the source capsules were opened, the californium was purified and then electrodeposited using the isobutanol method onto thin titanium foils for use in an accelerator at the Joint Institute for Nuclear Research in Dubna, Russia. Another deposition method, ammonium acetate, was used to produce a deposition containing 1.7 0.1 Ci of 252Cf onto a stainless steel substrate. This was the largest single electrodeposition of 252Cf ever prepared. The 252Cf material was initially purified using traditional ion exchange media, such as AG50-AHIB and AG50-HCl, and further purified using a TEVA-NH4SCN system to remove any lanthanides, resulting in the recovery of 3.6 0.1 mg of purified 252Cf. The ammonium acetate deposition was run with a current of 1.0 amp, resulting in a 91.5% deposition yield. Purification and handling of the highly radioactive californium material created additional challenges in the production of these sources.

  8. Californium-252: a remarkable versatile radioisotope

    Energy Technology Data Exchange (ETDEWEB)

    Osborne-Lee, I.W.; Alexander, C.W.

    1995-10-10

    A product of the nuclear age, Californium-252 ({sup 252}Cf) has found many applications in medicine, scientific research, industry, and nuclear science education. Californium-252 is unique as a neutron source in that it provides a highly concentrated flux and extremely reliable neutron spectrum from a very small assembly. During the past 40 years, {sup 252}Cf has been applied with great success to cancer therapy, neutron radiography of objects ranging from flowers to entire aircraft, startup sources for nuclear reactors, fission activation for quality analysis of all commercial nuclear fuel, and many other beneficial uses, some of which are now ready for further growth. Californium-252 is produced in the High Flux Isotope Reactor (HFIR) and processed in the Radiochemical Engineering Development Center (REDC), both of which are located at the Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee. The REDC/HFIR facility is virtually the sole supplier of {sup 252}Cf in the western world and is the major supplier worldwide. Extensive exploitation of this product was made possible through the {sup 252}Cf Market Evaluation Program, sponsored by the United States Department of Energy (DOE) [then the Atomic Energy Commission (AEC) and later the Energy Research and Development Administration (ERDA)]. This program included training series, demonstration centers, seminars, and a liberal loan policy for fabricated sources. The Market Evaluation Program was instituted, in part, to determine if large-quantity production capability was required at the Savannah River Laboratory (SRL). Because of the nature of the product and the means by which it is produced, {sup 252}Cf can be produced only in government-owned facilities. It is evident at this time that the Oak Ridge research facility can meet present and projected near-term requirements. The production, shipment, and sales history of {sup 252}Cf from ORNL is summarized herein.

  9. Californium-252: a remarkable versatile radioisotope

    International Nuclear Information System (INIS)

    A product of the nuclear age, Californium-252 (252Cf) has found many applications in medicine, scientific research, industry, and nuclear science education. Californium-252 is unique as a neutron source in that it provides a highly concentrated flux and extremely reliable neutron spectrum from a very small assembly. During the past 40 years, 252Cf has been applied with great success to cancer therapy, neutron radiography of objects ranging from flowers to entire aircraft, startup sources for nuclear reactors, fission activation for quality analysis of all commercial nuclear fuel, and many other beneficial uses, some of which are now ready for further growth. Californium-252 is produced in the High Flux Isotope Reactor (HFIR) and processed in the Radiochemical Engineering Development Center (REDC), both of which are located at the Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee. The REDC/HFIR facility is virtually the sole supplier of 252Cf in the western world and is the major supplier worldwide. Extensive exploitation of this product was made possible through the 252Cf Market Evaluation Program, sponsored by the United States Department of Energy (DOE) [then the Atomic Energy Commission (AEC) and later the Energy Research and Development Administration (ERDA)]. This program included training series, demonstration centers, seminars, and a liberal loan policy for fabricated sources. The Market Evaluation Program was instituted, in part, to determine if large-quantity production capability was required at the Savannah River Laboratory (SRL). Because of the nature of the product and the means by which it is produced, 252Cf can be produced only in government-owned facilities. It is evident at this time that the Oak Ridge research facility can meet present and projected near-term requirements. The production, shipment, and sales history of 252Cf from ORNL is summarized herein

  10. Californium-252 Neutron Therapy in China

    International Nuclear Information System (INIS)

    Californium-252 brachytherapy, believed to be the most successful source for neutron therapy, gives most of the cures as well as long-term and complication-free survivals. Chinese radiation oncologists were interested in californium neutron therapy (Cf-NT) in the early 1980s, but 252Cf sources for medical use were not available in China until 1992 when a californium joint venture was established by the China Institute of Atomic Energy (Beijing) and the Research Institute for Nuclear Reactors (Dimitrovgrad) of Russia. In 1995, 25 seeds of 252Cf with a strength of 3 μg each were sent to China for preclinical investigation. Three years later, a high dose rate (HDR) 252Cf source was imported and transferred into a home-made remote after-loader for intracavitary treatment in Chongqing, and a clinical trail was started in February 1999. This is the first time that Cf-NT was performed for cancer patients in China. Since then, Cf-NT in China has developed rapidly. It is estimated that one-tenth of those radiation oncology centers with brachytherapy practice will be equipped with californium units in 5 yr. That means more than 30 units will be in use in hospitals. That is significant compared with other countries, but it is just one, on average, for each province or one per 40 million people in China. Progress also has been achieved in the 252Cf treatment delivery equipment. Preliminary clinical trails showed complete response observed in all cases treated, with a rapid clearance of tumors and mild reactions in normal tissues. The short-term results are quite encouraging. To deal with problems due to the demand for Cf-NT in China, attention should be paid to the following particulars: (1) A high-strength miniature source is needed for HDR/MDR interstitial therapy to extend the Cf-NT coverage. (2) Basic work on radiophysics and radiobiology needs to be done, including source calibration, clinical dosimetry, clinical RBE determination, and Cf-NT quality assurance

  11. Californium-252 sales and loans at Oak Ridge National Laboratory

    International Nuclear Information System (INIS)

    The production and distribution in the United States of 252Cf has recently been consolidated at the Oak Ridge National Laboratory (ORNL). The 252Cf Industrial Sales/Loan Program and the 252Cf University Load Program, which were formerly located at the Savannah River Plant (SRP), have been combined with the californium production and distribution activities of the Transuranium Element Production Program at ORNL. Californium-252 is sold to commercial users in the form of bulk californium oxide, palladium-californium alloy pellets, or alloy wires. Neutron source capsules, which are fabricated for loans to DOE or other US government agencies, are still available in all forms previously available. The consolidation of all 252Cf distribution activities at the production site is expected to result in better service to users. In particular, customers for neutrons sources will be ale to select from a wider range of neutron source forms, including custom designs, through a single contact point

  12. Californium-252 encapsulation at the Savannah River Laboratory

    International Nuclear Information System (INIS)

    More than 1 g of the neutron-emitting isotope californium-252 has been encapsulated at SRL for worldwide medical, industrial, and research uses. Bulk sales packages have been prepared for the USDOE sales program since 1971. Doubly-encapsulated sources have been prepared for USDOE's market evaluation program since 1968. Californium-252 sources for loan and sales packages satisfy the criteria for Special Form Radioactive Material. Encapsulation is performed in special neutron-shielded containment facilities at SRL. Development of improved source and shipping package designs and processes is continuing. 17 figures

  13. Production, distribution and applications of californium-252 neutron sources

    International Nuclear Information System (INIS)

    The radioisotope 252Cf is routinely encapsulated into compact, portable, intense neutron sources with a 2.6-yr half-life. A source the size of a person's little finger can emit up to 1011 neutrons s-1. Californium-252 is used commercially as a reliable, cost-effective neutron source for prompt gamma neutron activation analysis (PGNAA) of coal, cement and minerals, as well as for detection and identification of explosives, land mines and unexploded military ordnance. Other uses are neutron radiography, nuclear waste assays, reactor start-up sources, calibration standards and cancer therapy. The inherent safety of source encapsulations is demonstrated by 30 yr of experience and by US Bureau of Mines tests of source survivability during explosions. The production and distribution center for the US Department of Energy (DOE) Californium Program is the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL). DOE sells 252Cf to commercial reencapsulators domestically and internationally. Sealed 252Cf sources are also available for loan to agencies and subcontractors of the US government and to universities for educational, research and medical applications. The REDC has established the Californium User Facility (CUF) for Neutron Science to make its large inventory of 252Cf sources available to researchers for irradiations inside uncontaminated hot cells. Experiments at the CUF include a land mine detection system, neutron damage testing of solid-state detectors, irradiation of human cancer cells for boron neutron capture therapy experiments and irradiation of rice to induce genetic mutations

  14. Production, distribution and applications of californium-252 neutron sources.

    Science.gov (United States)

    Martin, R C; Knauer, J B; Balo, P A

    2000-01-01

    The radioisotope 252Cf is routinely encapsulated into compact, portable, intense neutron sources with a 2.6-yr half-life. A source the size of a person's little finger can emit up to 10(11) neutrons s(-1). Californium-252 is used commercially as a reliable, cost-effective neutron source for prompt gamma neutron activation analysis (PGNAA) of coal, cement and minerals, as well as for detection and identification of explosives, land mines and unexploded military ordinance. Other uses are neutron radiography, nuclear waste assays, reactor start-up sources, calibration standards and cancer therapy. The inherent safety of source encapsulations is demonstrated by 30 yr of experience and by US Bureau of Mines tests of source survivability during explosions. The production and distribution center for the US Department of Energy (DOE) Californium Program is the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL). DOE sells 252Cf to commercial reencapsulators domestically and internationally. Sealed 252Cf sources are also available for loan to agencies and subcontractors of the US government and to universities for educational, research and medical applications. The REDC has established the Californium User Facility (CUF) for Neutron Science to make its large inventory of 252Cf sources available to researchers for irradiations inside uncontaminated hot cells. Experiments at the CUF include a land mine detection system, neutron damage testing of solid-state detectors, irradiation of human cancer cells for boron neutron capture therapy experiments and irradiation of rice to induce genetic mutations. PMID:11003521

  15. Production, Distribution, and Applications of Californium-252 Neutron Sources

    Energy Technology Data Exchange (ETDEWEB)

    Balo, P.A.; Knauer, J.B.; Martin, R.C.

    1999-10-03

    The radioisotope {sup 252}Cf is routinely encapsulated into compact, portable, intense neutron sources with a 2.6-year half-life. A source the size of a person's little finger can emit up to 10{sup 11} neutrons/s. Californium-252 is used commercially as a reliable, cost-effective neutron source for prompt gamma neutron activation analysis (PGNAA) of coal, cement, and minerals, as well as for detection and identification of explosives, laud mines, and unexploded military ordnance. Other uses are neutron radiography, nuclear waste assays, reactor start-up sources, calibration standards, and cancer therapy. The inherent safety of source encapsulations is demonstrated by 30 years of experience and by U.S. Bureau of Mines tests of source survivability during explosions. The production and distribution center for the U. S Department of Energy (DOE) Californium Program is the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL). DOE sells The radioisotope {sup 252}Cf is routinely encapsulated into compact, portable, intense neutron sources with a 2.6- year half-life. A source the size of a person's little finger can emit up to 10 neutrons/s. Californium-252 is used commercially as a reliable, cost-effective neutron source for prompt gamma neutron activation analysis (PGNAA) of coal, cement, and minerals, as well as for detection and identification of explosives, laud mines, and unexploded military ordnance. Other uses are neutron radiography, nuclear waste assays, reactor start-up sources, calibration standards, and cancer therapy. The inherent safety of source encapsulations is demonstrated by 30 years of experience and by U.S. Bureau of Mines tests of source survivability during explosions. The production and distribution center for the U. S Department of Energy (DOE) Californium Program is the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory(ORNL). DOE sells {sup 252}Cf to commercial

  16. Production of extra pure curium and californium preparations

    International Nuclear Information System (INIS)

    Preparations of curium-244,245,248 and californium-249,252 are used for the production of ionizing radiation sources for different applications and fundamental nuclear-physical investigations, placing high requirements on the radiochemical and chemical purity of the preparations. Extraction chromatography using di-(2-ethylhexyl)phosphoric acid (D2EHPA) as extractant was chosen to prepare extra pure curium and californium preparations. In order to identify the optimal conditions of Cm-Cf separation and to remove impurities from them (reagent and other impurities), investigations were performed into the effect of impurities (Na+, Ca2+, Al3+, Fe2+, Fe3+ taken as example), extractant and eluent concentration and solution flow rate on the efficiency of mutual purification of Cm and Cf. Both theoretical and experimental estimations were made of the maximum concentration at which the impurities do not affect the process. The conditions chosen allow mutual purification of milligram amounts of Cm and Cf from impurity elements at E(pur) =102 - 103 during a single chromatographic cycle (E(pur) =>103) using a column with 5 - 10 cm3 volume. In this case the production yield exceeds 98%. The purification of milligram amounts of curium and californium from fission products (lanthanides in general, cerium in particular) was performed in D2EHPA-decane-PbO2-HNO3 and D2EHPA-decane-DTPA-H3-Cit extraction chromatography systems. In order to establish the optimal conditions, the effect of [D2EHPA] and eluent on the mutual purification of Cm and Cf and on their purification from cerium and impurity elements was studied in the D2EHPA-decane-PbO2-HNO3 system. During a single chromatographic cycle the mutual purification factors of TPE and of their purification from impurity cations achieve 102-103, from cerium - E(pur) > 10. In the D2EHPA-decane-DTPA-H3Cit system, the effect of concentration of extractant and eluent pH on the efficiency of Cm and Cf purification from lanthanides was

  17. Prompt neutron spectrum of the spontaneous fission of californium-252

    International Nuclear Information System (INIS)

    The californium-252 spontaneous fission neutron spectrum was measured in the energy range of 0.01 to 10 MeV by the time-of-flight technique using various neutron detectors. The measurements of 252Cf neutron spectrum at energies of 0.01 to 5 MeV were performed as a function of fission fragment kinetic energy. The mean neutron spectrum energy in the range of 0.7 to 10 MeV was found from the results of measurements. The irregularity in the 252Cf neutron spectrum in the neutron energy range of less than 0.7 MeV compared to theoretical values is discussed. The mechanism of 252Cf neutron emission is also discussed on the basis of neutron yield angle measurements. 12 references

  18. Separation of californium from actinides and lanthanides in aqueous solution by electrochemical formation of amalgams

    International Nuclear Information System (INIS)

    The electrochemical reduction of transneptunium elements (Pu to Cf) and rare earths (Eu, Tm) from aqueous complexing solutions to amalgams was studied over a wide range of cathodic potentials in order to achieve optimal separation of californium. The reduction in acetate media (pH 4.5-4.6) at potentials around -1.7 to -1.9 V1 leads to a quantitative extraction of californium into the mercury phase, while more negative potentials are required for the reduction of the lighter transuranium elements and of the lanthanides. Hence, the optimal conditions for the separation of californium from the investigated actinides and lanthanides were determined. Separation factors α between 25 and 90 were found except in the case of Cf/Eu, where poor values (α varying from 7 to 12) were observed. More negative cathodic potentials decrease the selectivity of the reduction process. A similar study with lithium citrate solutions (pH ∝6) shows that satisfactory separation of californium from lighter and heavier actinides is achievable. A separation factor of 88 is obtained for Cf/Am at -1.98 V. The anodic stripping of mixed amalgams (Pu, Am, Cm, Bk, Tm and Cf) Hg in nitric and acetic acid soultions at potentials ranging from +0.1 to -0.7 V proceeds slowly and proved to be ineffective for the separation of californium from light actinides under conditions described. (orig.)

  19. 48 CFR 242.7302 - Requirements.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Requirements. 242.7302 Section 242.7302 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT.../Pension Review 242.7302 Requirements. Follow the procedures at PGI 242.7302 to determine if a CIPR...

  20. 48 CFR 242.7303 - Responsibilities.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Responsibilities. 242.7303 Section 242.7303 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT.../Pension Review 242.7303 Responsibilities. Follow the procedures at PGI 242.7303 when conducting a CIPR....

  1. Biomedical neutron research at the Californium User Facility for neutron science

    International Nuclear Information System (INIS)

    The Californium User Facility for Neutron Science has been established at Oak Ridge National Laboratory (ORNL). The Californium User Facility (CUF) is a part of the larger Californium Facility, which fabricates and stores compact 252Cf neutron sources for worldwide distribution. The CUF can provide a cost-effective option for research with 252Cf sources. Three projects at the CUF that demonstrate the versatility of 252Cf for biological and biomedical neutron-based research are described: future establishment of a 252Cf-based neutron activation analysis system, ongoing work to produce miniature high-intensity, remotely afterloaded 252Cf sources for tumor therapy, and a recent experiment that irradiated living human lung cancer cells impregnated with experimental boron compounds to test their effectiveness for boron neutron capture therapy

  2. Biomedical neutron research at the Californium User Facility for neutron science

    Energy Technology Data Exchange (ETDEWEB)

    Martin, R.C. [Oak Ridge National Lab., TN (United States); Byrne, T.E. [Roane State Community College, Harriman, TN (United States); Miller, L.F. [Univ. of Tennessee, Knoxville, TN (United States)

    1997-04-01

    The Californium User Facility for Neutron Science has been established at Oak Ridge National Laboratory (ORNL). The Californium User Facility (CUF) is a part of the larger Californium Facility, which fabricates and stores compact {sup 252}Cf neutron sources for worldwide distribution. The CUF can provide a cost-effective option for research with {sup 252}Cf sources. Three projects at the CUF that demonstrate the versatility of {sup 252}Cf for biological and biomedical neutron-based research are described: future establishment of a {sup 252}Cf-based neutron activation analysis system, ongoing work to produce miniature high-intensity, remotely afterloaded {sup 252}Cf sources for tumor therapy, and a recent experiment that irradiated living human lung cancer cells impregnated with experimental boron compounds to test their effectiveness for boron neutron capture therapy.

  3. Emergence of californium as the second transitional element in the actinide series.

    Science.gov (United States)

    Cary, Samantha K; Vasiliu, Monica; Baumbach, Ryan E; Stritzinger, Jared T; Green, Thomas D; Diefenbach, Kariem; Cross, Justin N; Knappenberger, Kenneth L; Liu, Guokui; Silver, Mark A; DePrince, A Eugene; Polinski, Matthew J; Van Cleve, Shelley M; House, Jane H; Kikugawa, Naoki; Gallagher, Andrew; Arico, Alexandra A; Dixon, David A; Albrecht-Schmitt, Thomas E

    2015-01-01

    A break in periodicity occurs in the actinide series between plutonium and americium as the result of the localization of 5f electrons. The subsequent chemistry of later actinides is thought to closely parallel lanthanides in that bonding is expected to be ionic and complexation should not substantially alter the electronic structure of the metal ions. Here we demonstrate that ligation of californium(III) by a pyridine derivative results in significant deviations in the properties of the resultant complex with respect to that predicted for the free ion. We expand on this by characterizing the americium and curium analogues for comparison, and show that these pronounced effects result from a second transition in periodicity in the actinide series that occurs, in part, because of the stabilization of the divalent oxidation state. The metastability of californium(II) is responsible for many of the unusual properties of californium including the green photoluminescence. PMID:25880116

  4. Fissile analysis of Hanford waste using Californium Multiplier/Delayed Neutron Counter system

    International Nuclear Information System (INIS)

    Measurement of low-level (10 ng/g or lower) fissile material (mainly plutonium) in Hanford waste and process samples is becoming increasingly important. A system has been designed consisting of a Californium Multiplier (CFX) and a Delayed Neutron Counter (DNC) to characterize these samples. This report describes hardware and analytical capability of the CFX/DNC system

  5. 32 CFR 242.7 - Responsibilities.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Responsibilities. 242.7 Section 242.7 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) MISCELLANEOUS... SCIENCES § 242.7 Responsibilities. (a) The President of the University shall: (1) Develop and...

  6. 7 CFR 58.242 - Product adulteration.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Product adulteration. 58.242 Section 58.242... Procedures § 58.242 Product adulteration. All necessary precautions shall be taken throughout the entire operation to prevent the adulteration of one product with another. The commingling of one type of liquid...

  7. 25 CFR 242.7 - Suspension.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Suspension. 242.7 Section 242.7 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR FISH AND WILDLIFE COMMERCIAL FISHING ON RED LAKE INDIAN RESERVATION § 242.7 Suspension. All commercial fishing operations may be suspended by order of the Secretary at...

  8. 17 CFR 242.406 - Undermargined accounts.

    Science.gov (United States)

    2010-04-01

    ...) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Customer Margin Requirements for Security Futures § 242.406 Undermargined accounts. (a) Failure to satisfy margin call. If any... Regulation (§§ 242.400 through 242.406), section 220.4(d) of Regulation T (12 CFR 220.4(d))...

  9. 25 CFR 242.4 - Fishing.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Fishing. 242.4 Section 242.4 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR FISH AND WILDLIFE COMMERCIAL FISHING ON RED LAKE INDIAN RESERVATION § 242.4 Fishing. (a) Enrolled members of the Red Lake Band of Chippewa Indians may take fish at any...

  10. 33 CFR 242.3 - References.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false References. 242.3 Section 242.3 Navigation and Navigable Waters CORPS OF ENGINEERS, DEPARTMENT OF THE ARMY, DEPARTMENT OF DEFENSE FLOOD PLAIN MANAGEMENT SERVICES PROGRAM ESTABLISHMENT OF FEES FOR COST RECOVERY § 242.3 References. The references...

  11. New berkelium isotope: 242Bk

    International Nuclear Information System (INIS)

    A new isotope of berkelium, 242Bk, was produced with a cross section of approx. 10 μb in reactions of boron on uranium and nitrogen on thorium. It decays by electron capture with a half-life of 7 +- 1.3 minutes. The branching ratio for this isotope for alpha decay is less than 1% and that for spontaneous fission is less than 0.03%. 2 figures, 2 tables

  12. 242-A evaporator hazards assessment

    International Nuclear Information System (INIS)

    This document establishes the technical basis in support of Emergency Planning activities for the 242-A Evaporator, on the Hanford Site. Through this document the technical basis for the development of facility specific Emergency Action Levels and the Emergency Planning Zone is demonstrated. The evaporator sues a conventional, forced-circulation, vacuum evaporation system to concentrate radioactive waste solutions. This concentration results in the reduction in waste volume and reduces the number of double-shelled tanks required to store the waste

  13. Emergence of californium as the second transitional element in the actinide series

    OpenAIRE

    Cary, Samantha K.; Vasiliu, Monica; Baumbach, Ryan E.; Stritzinger, Jared T.; GREEN, THOMAS D.; Diefenbach, Kariem; Cross, Justin N.; Knappenberger, Kenneth L.; Liu, Guokui; Silver, Mark A.; DePrince, A. Eugene; Polinski, Matthew J.; Van Cleve, Shelley M.; House, Jane H.; Kikugawa, Naoki

    2015-01-01

    A break in periodicity occurs in the actinide series between plutonium and americium as the result of the localization of 5f electrons. The subsequent chemistry of later actinides is thought to closely parallel lanthanides in that bonding is expected to be ionic and complexation should not substantially alter the electronic structure of the metal ions. Here we demonstrate that ligation of californium(III) by a pyridine derivative results in significant deviations in the properties of the resu...

  14. 48 CFR 242.7301 - General.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false General. 242.7301 Section 242.7301 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE CONTRACT MANAGEMENT CONTRACT ADMINISTRATION AND AUDIT SERVICES Contractor Insurance/Pension...

  15. 24 CFR 242.61 - Management.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Management. 242.61 Section 242.61... Management. The mortgagor shall provide for management of the hospital in a manner satisfactory to HUD. (a) Contract Management of Hospital. The mortgagor shall not execute a management agreement or any...

  16. 42 CFR 24.2 - Allocation.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Allocation. 24.2 Section 24.2 Public Health PUBLIC....2 Allocation. (a) The Secretary, within the number authorized in the PHS Act, shall determine the... may advise the Secretary to make adjustments to the allocation at any time. (c) The majority of...

  17. 24 CFR 242.82 - Energy conservation.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Energy conservation. 242.82 Section... INSURANCE FOR HOSPITALS Miscellaneous Requirements § 242.82 Energy conservation. Construction, mechanical equipment, and energy and metering selections shall provide cost-effective energy conservation in...

  18. Dicty_cDB: SSA242 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSA242 (Link to dictyBase) - G00584 DDB0206451 Contig-U04342-1 SSA...242E (Link to Original site) SSA242F 327 SSA242Z 501 SSA242P 828 SSA242E 622 Show SSA242 Library SS (Lin...Contig Contig-U04342-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SS/SSA2-B/SSA...242Q.Seq.d/ Representative seq. ID SSA242E (Link to Original site) Representative DNA sequence >SSA242 (SSA...242Q) /CSM/SS/SSA2-B/SSA242Q.Seq.d/ CAAAAAAATGGGACATGATATTAAAGCAATTATAGGTTTTTCTTGCGCATTTGCAGTTGG

  19. Spontaneous Partitioning of Californium from Curium: Curious Cases from the Crystallization of Curium Coordination Complexes

    Energy Technology Data Exchange (ETDEWEB)

    Cary, Samantha K.; Silver, Mark A.; Liu, Guokui; Wang, Jamie C.; Bogart, Justin A.; Stritzinger, Jared T.; Arico, Alexandra A.; Hanson, Kenneth; Schelter, Eric J.; Albrecht-Schmitt, Thomas E.

    2015-12-07

    The reaction of 248CmCl3 with excess 2,6-pyridinedicarboxylic acid (DPA) under mild solvothermal conditions results in crystallization of the tris-chelate complex Cm(HDPA)3·H2O. Approximately half of the curium remains in solution at the end of this process, and evaporation of the mother liquor results in crystallization of the bis-chelate complex [Cm(HDPA)- (H2DPA)(H2O)2Cl]Cl·2H2O. 248Cm is the daughter of the α decay of 252Cf and is extracted in high purity from this parent. However, trace amounts of 249,250,251Cf are still present in all samples of 248Cm. During the crystallization of Cm(HDPA)3·H2O and [Cm(HDPA)(H2DPA)(H2O)2Cl]Cl·2H2O, californium(III) spontaneously separates itself from the curium complexes and is found doped within crystals of DPA in the form of Cf(HDPA)3. These results add to the growing body of evidence that the chemistry of californium is fundamentally different from that of earlier actinides.

  20. 48 CFR 242.002 - Interagency agreements.

    Science.gov (United States)

    2010-10-01

    .../Chief Financial Officer), from non-DoD organizations, except for— (A) Quality assurance, contract... subcontracts awarded by the Small Business Administration under FAR subpart 19.8; and (C) Quality assurance and..., DEPARTMENT OF DEFENSE CONTRACT MANAGEMENT CONTRACT ADMINISTRATION AND AUDIT SERVICES 242.002...

  1. 48 CFR 242.7203 - Review procedures.

    Science.gov (United States)

    2010-10-01

    ... plan; and (C) Any decision to reduce progress payments or disallow costs on vouchers. (ii) The... portion of withheld amounts commensurate with the contractor's progress in making corrections. However... Management and Accounting System 242.7203 Review procedures. (a) Criteria for conducting reviews. Conduct...

  2. A Syllabus for Biol 242--Human Anatomy.

    Science.gov (United States)

    Jacob, Willis H.

    This document is the fall and spring semester course syllabus of Biology 242--Human Anatomy at Southern University (Louisiana). Sections include: (1) Descriptive Information; (2) Specification of Course Goals and Objectives; (3) Readings; (4) Description of Instructional Procedures; (5) Course Requirements; (6) Course Schedule; (7) Evaluation of…

  3. 32 CFR 242b.3 - Notice.

    Science.gov (United States)

    2010-07-01

    ... SCIENCES § 242b.3 Notice. (a) Notice of all meetings of the Board shall be sent by the Secretary to each...-four hours before the meeting, shall be sufficient notice of any meeting. The recital by the Secretary...) Public announcement of meetings shall conform to the Public Meeting Procedures of the Board of...

  4. 42 CFR 438.242 - Health information systems.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Health information systems. 438.242 Section 438.242... Measurement and Improvement Standards § 438.242 Health information systems. (a) General rule. The State must ensure, through its contracts, that each MCO and PIHP maintains a health information system that...

  5. Determination of the242 m Am nuclear moments

    Science.gov (United States)

    Bekk, K.; Göring, S.; Kälber, W.; Meisel, G.; Rebel, H.; Sameh, A. Ali

    1988-09-01

    The hyperfine structure of Am atoms was investigated in an atomic beam by laser spectroscopy. The observed splittings were evaluated with respect to the magnetic dipole and electric quadrupole moments of242 m Am. The results are: μ I (242 m Am)=+0.97(5)nm, Q(242 m Am)=+6.5(2.0)b.

  6. Determination of the 242mAm nuclear moments

    International Nuclear Information System (INIS)

    The hyperfine structure of Am atoms was investigated in an atomic beam by laser spectroscopy. The observed splittings were evaluated with respect to the magnetic dipole and electric quadrupole moments of 242mAm. The results are: μI(242mAm) = +0.97(5) nm, Q(242mAm) = +6.5(2.0) b. (orig.)

  7. 24 CFR 242.63 - Additional indebtedness and leasing.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Additional indebtedness and leasing. 242.63 Section 242.63 Housing and Urban Development Regulations Relating to Housing and Urban... Requirements § 242.63 Additional indebtedness and leasing. The mortgagor shall not enter into any...

  8. 25 CFR 242.10 - Fishing equipment limitations.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Fishing equipment limitations. 242.10 Section 242.10 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR FISH AND WILDLIFE COMMERCIAL FISHING ON RED LAKE INDIAN RESERVATION § 242.10 Fishing equipment limitations. (a) Any variety of fish may be taken...

  9. 25 CFR 242.5 - Disposition of unmarketable fish.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Disposition of unmarketable fish. 242.5 Section 242.5 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR FISH AND WILDLIFE COMMERCIAL FISHING ON RED LAKE INDIAN RESERVATION § 242.5 Disposition of unmarketable fish. All unmarketable live fish...

  10. 25 CFR 242.12 - Authority to lease.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Authority to lease. 242.12 Section 242.12 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR FISH AND WILDLIFE COMMERCIAL FISHING ON RED LAKE INDIAN RESERVATION § 242.12 Authority to lease. The Band, with the approval of the Secretary, may execute a lease...

  11. 32 CFR 242b.7 - Officers of the University.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Officers of the University. 242b.7 Section 242b...) MISCELLANEOUS GENERAL PROCEDURES AND DELEGATIONS OF THE BOARD OF REGENTS OF THE UNIFORMED SERVICES UNIVERSITY OF THE HEALTH SCIENCES § 242b.7 Officers of the University. (a) Dean of the University. (1) The...

  12. 36 CFR 242.12 - Local advisory committees.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Local advisory committees. 242.12 Section 242.12 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF AGRICULTURE..., the particular Regional Council in carrying out its function as set forth in § 242.11. (b)...

  13. 32 CFR 242b.2 - Meetings of the Board.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Meetings of the Board. 242b.2 Section 242b.2... THE HEALTH SCIENCES § 242b.2 Meetings of the Board. (a) Regular meetings. (1) The Board shall hold at... determined by the Board, meetings shall be held at the offices of the University, 4301 Jones Bridge...

  14. Evaluation of neutron data for plutonium-242

    International Nuclear Information System (INIS)

    The evaluation of neutron data for 242Pu is made in the energy region from 10-5 eV up to 20 MeV. The results of the evaluation are compiled in the ENDF/B-VI format. This work is performed under the Project Agreement CIS-03-95 with the International Science and Technology Center (Moscow). The Financing Party for the Project is Japan. The evaluation was requested by Japan Nuclear Data Center (JAERI). (author)

  15. Manganese determination om minerals by activation analysis, using the californium-252 as a neutron source

    International Nuclear Information System (INIS)

    Neutron Activation Analysis, using a Californium-252 neutron source, has been applied for the determination of manganese in ores such as pyrolusite, rodonite (manganese silicate)' and blending used in dry-batteries The favorable nuclear properties of manganese, such as high thermal neutron cross-section for the reaction 55Mn (n.gamma)56 Mn, high concentration of manganese in the matrix and short half - life of 56Mn, are an ideal combination for non-destructive analysis of manganese in ores. Samples and standards of manganese dioxide were irradiated for about 20 minutes, followed by a 4 to 15 minutes decay and counted in a single channel pulse-height discrimination using a NaI(Tl) scintillation detector. Counting time was equal to 10 minutes. The interference of nuclear reactions 56Fe(n,p)56Mn and 59 Co (n, α)56 were studied, as well as problems in connection with neutron shadowing during irradiation, gamma-rays attenuation during counting and influence of granulometry of samples. One sample,was also analysed by wet-chemical method (sodium bismuthate) in order to compare results. As a whole, i t was shown that the analytical method of neutron activation for manganese in ores and blending, is a method simple, rapid and with good precision and accuracy. (author)

  16. Long-term effects of an intracavitary treatment with californium-252 on normal tissue

    International Nuclear Information System (INIS)

    About one hundred fifty swine were exposed to either radium-226 or californium-252 sources in the uterine cervix to determine an RBE for both acute and long-term effects. That value for early changes in the tissues at risk in the treatment of cervical cancer was between 6.2 and 6.8. The incidence of complications increased with time after exposure, especially among animals treated with 252Cf. Analysis of rectal injury showed that ulceration occurred frequently within a year postexposure at doses between 1600 and 2400 rad calculated at 2 cm lateral to the source midline. Fat necrosis and smooth muscle atrophy, resulting in a local rectal stricture, were delayed changes observed in some animals. The lower ureter was the site for a greater frequency of complications than the GI tract. Ureteral stricture often occurred at doses of 1200 rad from 252Cf and 7000 rad from 226Ra. Observation of delayed effects in the uterine-cervix in animals held up to 4 years postexposure indicate that the RBE for 252Cf may be increased to a value as high as 18, while repair may have even decreased it to about 5.6 in the rectum. Fifty swine are still being observed for long-term effects after doses above 800 rad from 252Cf and 5000 rad from 226Ra

  17. Calibration of 242 Pu Tracer by Mass Spectrometry%质谱法标定242 Pu指示剂

    Institute of Scientific and Technical Information of China (English)

    李冬梅; 徐江; 杜丽丽

    2014-01-01

    将高纯242 Pu浓度标准溶液与239 Pu混合,质谱法测量R239/242(A)先标定四水硫酸钚中239 Pu的浓度;再将四水硫酸钚与待标定的242 Pu指示剂混合,测量R239/242(A),标定242 Pu 指示剂的浓度。质谱测量还可标定得到242 Pu指示剂中的钚同位素丰度。采用两次同位素稀释质谱法标定242 Pu 指示剂快捷简便,可在2日内完成。测量精度高,242 Pu浓度的相对合成标准不确定度为0.75%,该指示剂可满足高精度分析工作的需求。%242 Pu is commonly employed as tracer for determination of 239 Pu in environmental samples.The 239 Pu concentration in Pu(SO4 )2 ·4H2 O solution was determined by isotope dilution-mass spectrometry (ID-MS)using a high pure 242 Pu spike.Then the 242 Pu tracer in our laboratary was calibrated by ID-MS using the calibrated 239 Pu solution as spike.By meas-uring the atom ratio of 239 Pu to 242 Pu twice by ID-MS,the concentration and abundance of the 242 Pu tracer in laboratary were finally calibrated.This method was proved to be efficient with high precision.The process could be finished within two days with an uncertainty of 0.75%. The calibrated 242 Pu tracer in laboratory could meet the demand of high-precision analysis.

  18. Determination of the /sup 242m/Am nuclear moments

    Energy Technology Data Exchange (ETDEWEB)

    Bekk, K.; Goering, S.; Kaelber, W.; Meisel, G.; Rebel, H.; Sameh, A.A.

    1988-07-01

    The hyperfine structure of Am atoms was investigated in an atomic beam by laser spectroscopy. The observed splittings were evaluated with respect to the magnetic dipole and electric quadrupole moments of /sup 242m/Am. The results are: ..mu../sub I/(/sup 242m/Am) = +0.97(5) nm, Q(/sup 242m/Am) = +6.5(2.0) b.

  19. 242-A evaporator safety analysis report

    Energy Technology Data Exchange (ETDEWEB)

    CAMPBELL, T.A.

    1999-05-17

    This report provides a revised safety analysis for the upgraded 242-A Evaporator (the Evaporator). This safety analysis report (SAR) supports the operation of the Evaporator following life extension upgrades and other facility and operations upgrades (e.g., Project B-534) that were undertaken to enhance the capabilities of the Evaporator. The Evaporator has been classified as a moderate-hazard facility (Johnson 1990). The information contained in this SAR is based on information provided by 242-A Evaporator Operations, Westinghouse Hanford Company, site maintenance and operations contractor from June 1987 to October 1996, and the existing operating contractor, Waste Management Hanford (WMH) policies. Where appropriate, a discussion address the US Department of Energy (DOE) Orders applicable to a topic is provided. Operation of the facility will be compared to the operating contractor procedures using appropriate audits and appraisals. The following subsections provide introductory and background information, including a general description of the Evaporator facility and process, a description of the scope of this SAR revision,a nd a description of the basic changes made to the original SAR.

  20. 242-A evaporator safety analysis report

    International Nuclear Information System (INIS)

    This report provides a revised safety analysis for the upgraded 242-A Evaporator (the Evaporator). This safety analysis report (SAR) supports the operation of the Evaporator following life extension upgrades and other facility and operations upgrades (e.g., Project B-534) that were undertaken to enhance the capabilities of the Evaporator. The Evaporator has been classified as a moderate-hazard facility (Johnson 1990). The information contained in this SAR is based on information provided by 242-A Evaporator Operations, Westinghouse Hanford Company, site maintenance and operations contractor from June 1987 to October 1996, and the existing operating contractor, Waste Management Hanford (WMH) policies. Where appropriate, a discussion address the US Department of Energy (DOE) Orders applicable to a topic is provided. Operation of the facility will be compared to the operating contractor procedures using appropriate audits and appraisals. The following subsections provide introductory and background information, including a general description of the Evaporator facility and process, a description of the scope of this SAR revision,a nd a description of the basic changes made to the original SAR

  1. Application of TSH bioindicator for studying the biological efficiency of neutrons from californium-252 source

    Energy Technology Data Exchange (ETDEWEB)

    Cebulska-Wasilewska, A.; Rekas, K. [Institute of Nuclear Physics, Cracow (Poland); Kim, J.K. [Korea Atomic Energy Research Inst., Taejon (Korea, Republic of)

    1997-12-31

    The effectiveness of neutrons from a Californium-252 source in the induction of various abnormalities in the Tradescantia clone 4430 stamen hair cells (TSH-assay) was studied. The special attention was paid to check whether any enhancement in effects caused by process of boron neutron capture is visible in the cells enriched with boron ions. Two chemicals (borax and BSH) were applied to introduce boron-10 ions into cells. Inflorescence, normal or pretreated with chemicals containing boron, were irradiated in the air with neutrons from a Cf-252 source at KAERI, Taejon, Korea. To estimate the relative biological effectiveness (RBE) in the induction of gene mutations of the neutron beam under the study, Tradescantia inflorescences, without any chemical pretreatment, were irradiated with various doses of X-rays. The ranges of radiation doses used were 0-0.1 Gy in neutrons and 0-0.5 Gy in X-rays. After the time needed to complete the postirradiation repair Tradescantia cuttings were transferred to Cracow, where screening of gene and lethal; mutations, cell cycle alterations in somatic cells have been done, and dose response relationships were figured. The maximal RBE values were estimated in the range of 4.6-6.8. Alterations of RBE value were observed; from 6.8 to 7.8 in the case of plants pretreated with 240 ppm of B-10 from borax, and 4.6 to 6.1 in the case of 400 ppm of B-10 from BSH. Results showed a slight, although statistically insignificant increase in biological efficacy of radiation from the Cf-252 source in samples pretreated with boron containing chemicals. (author)

  2. Application of TSH bioindicator for studying the biological efficiency of neutrons from californium-252 source

    International Nuclear Information System (INIS)

    The effectiveness of neutrons from a Californium-252 source in the induction of various abnormalities in the Tradescantia clone 4430 stamen hair cells (TSH-assay) was studied. The special attention was paid to check whether any enhancement in effects caused by process of boron neutron capture is visible in the cells enriched with boron ions. Two chemicals (borax and BSH) were applied to introduce boron-10 ions into cells. Inflorescence, normal or pretreated with chemicals containing boron, were irradiated in the air with neutrons from a Cf-252 source at KAERI, Taejon, Korea. To estimate the relative biological effectiveness (RBE) in the induction of gene mutations of the neutron beam under the study, Tradescantia inflorescences, without any chemical pretreatment, were irradiated with various doses of X-rays. The ranges of radiation doses used were 0-0.1 Gy in neutrons and 0-0.5 Gy in X-rays. After the time needed to complete the postirradiation repair Tradescantia cuttings were transferred to Cracow, where screening of gene and lethal; mutations, cell cycle alterations in somatic cells have been done, and dose response relationships were figured. The maximal RBE values were estimated in the range of 4.6-6.8. Alterations of RBE value were observed; from 6.8 to 7.8 in the case of plants pretreated with 240 ppm of B-10 from borax, and 4.6 to 6.1 in the case of 400 ppm of B-10 from BSH. Results showed a slight, although statistically insignificant increase in biological efficacy of radiation from the Cf-252 source in samples pretreated with boron containing chemicals. (author)

  3. Oxygen enhancement ratio (OER) and therapeutic gain factor (GF) for californium-252 at low dose rate

    International Nuclear Information System (INIS)

    The potential benefit of the introduction of californium-252 in interstitial and intracavitary therapy is related to the greater efficiency of its neutron emission against anoxic cancer cells. In that respect, the oxygen enhancement ratio (OER) of the 252Cf emission has been determined for a continuous low dose rate irradiation. The biological system is growth inhibition in Vicia faba bean roots. A new Vicia faba ''BelB'' strain has been used, which better tolerates long periods (up to about 10 hours) of anoxia. In a first series of experiments, for a 252Cf (Dsub(n+γ)) dose rate of 0.11 Gy.h-1, an OER of 1.4+-0.1 was observed (the γ contribution Dγ to the total absorbed dose Dsub(n+γ) was 0.35 at the position of the root tips). In a second series of experiments, in somewhat different geometrical conditions with a 252Cf (Dsub(n+γ)) dose rate of 0.13 Gy.h-1, an OER of 1.5+-0.1 was observed (Dγ/Dsub(n+γ)=0.42). The OER values observed for similar irradiation times, with iridium-192 γ-rays, were 2.3+-0.2 and 2.6+-0.1 respectively, which leads to therapeutic gain factors (GF) of 1.6 and 1.7 respectively. These GF values are slightly lower than those previously obtained (GF=1.8) on the same system, with d(50)-Be p(75)-Be and 15 MeV neutron beams

  4. Clinical Report on Californium-252 Neutron Intraluminal Brachytherapy Combined with External Irradiation for Cervical Carcinoma Treatment

    Institute of Scientific and Technical Information of China (English)

    Huanyu Zhao; Keming Wang; Jian Sun; Xin Geng; Weiming Zhang

    2006-01-01

    OBJECTIVE To observe the curative effects and complications of californium-252 (252Cf) neutron intraluminal brachytherapy (IBT) combined with external irradiation (El) for treatment of cervical carcinoma.METHODS From December 2000 to December 2004, 128 cases of cervical carcinoma staged into ⅡA~ⅢB according to the International Federation of Gynecology and Obstetrics (FIGO) standards were treated with 252Cf neutron IBT using 8~10 Gy per fraction, once a week. The total dose at reference A point was 36~40 Gy in 4~5 fractions. From the second day after 252Cf neutron IBT treatment, the whole pelvic cavity was treated with 60Co γ-ray El, applying 2 Gy per fraction, 4 times per week. After 20~25 Gy of El, the center of the whole pelvic field was blocked with 4 cm of lead in width. The total dose of El was 45~50 Gy.RESULTS The short-term therapeutic effects were CR 95.3% and PR 4.7%. The 3 and 5-year local control rates were 93.5% and 87.9%. The overall 3-year survival rate was 87.5% and for Stages Ⅱ and Ⅲ , 90.9%and 81.5% respectively; the overall 5-year survival rate was 70% and for Stages Ⅱ and Ⅲ, 76.2% and 61% respectively. The rate of radiation complications was 4.7% for radiation cystitis, 7.8% for radiation proctitis, 6.3%for vagina contracture and adhesion and 5.5% for protracted radiation proctitis.CONCLUSION An combination of 252Cf neutron IBT with El for treatment of cervical carcinoma can be well-tolerated by cervical carcinoma patients. The rate of local tumor control is high and radiation complications are few.

  5. Divalent and trivalent gas-phase coordination complexes of californium: evaluating the stability of Cf(ii).

    Science.gov (United States)

    Dau, Phuong D; Shuh, David K; Sturzbecher-Hoehne, Manuel; Abergel, Rebecca J; Gibson, John K

    2016-08-01

    The divalent oxidation state is increasingly stable relative to the trivalent state for the later actinide elements, with californium the first actinide to exhibit divalent chemistry under moderate conditions. Although there is evidence for divalent Cf in solution and solid compounds, there are no reports of discrete complexes in which Cf(II) is coordinated by anionic ligands. Described here is the divalent Cf methanesulfinate coordination complex, Cf(II)(CH3SO2)3(-), prepared in the gas phase by reductive elimination of CH3SO2 from Cf(III)(CH3SO2)4(-). Comparison with synthesis of the corresponding Sm and Cm complexes reveals reduction of Cf(III) and Sm(III), and no evidence for reduction of Cm(III). This reflects the comparative 3+/2+ reduction potentials: Cf(3+) (-1.60 V) ≈ Sm(3+) (-1.55 V) ≫ Cm(3+) (-3.7 V). Association of O2 to the divalent complexes is attributed to formation of superoxides, with recovery of the trivalent oxidation state. The new gas-phase chemistry of californium, now the heaviest element to have been studied in this manner, provides evidence for Cf(II) coordination complexes and similar chemistry of Cf and Sm. PMID:27424652

  6. 242-A evaporator safety analysis report

    International Nuclear Information System (INIS)

    In compliance with DOE Orders, an update of the 242-A SAR has been prepared, as documented in the referenced ECN. Several categories of changes were identified for inclusion in this revision of the SAR. These categories will be utilized to simplify the discussion of the changes for this USQ document. However, it is important to note that no new tests or experiments were included in this revision of the SAR. Editorial changes and/or informational updates to Chapters 9 and 11 were included as part of this revision. However, no changes to Operational Safety Requirements (OSRs) contained in Chapter 11 were required. General categories of changes included in this revision are listed

  7. 40 CFR 61.242-10 - Standards: Delay of repair.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Standards: Delay of repair. 61.242-10... Leaks (Fugitive Emission Sources) § 61.242-10 Standards: Delay of repair. (a) Delay of repair of equipment for which leaks have been detected will be allowed if repair within 15 days is...

  8. 17 CFR 242.101 - Activities by distribution participants.

    Science.gov (United States)

    2010-04-01

    ... certain other sections. Transactions complying with §§ 242.103 or 242.104; or (3) Odd-lot transactions... standardized index; or (7) De minimis transactions. Purchases during the restricted period, other than by a... quotation system or electronic communications network; or (6) Basket transactions. (i) Bids or purchases,...

  9. 40 CFR 86.242-94 - Records required.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Records required. 86.242-94 Section 86.242-94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED... Later Model Year Gasoline-Fueled New Light-Duty Vehicles, New Light-Duty Trucks and New...

  10. 24 CFR 242.45 - Early commencement of work.

    Science.gov (United States)

    2010-04-01

    ... review under 24 CFR 242.79. The work must meet all requirements and guidelines as if it were approved for... review under 24 CFR 242.79, previous participation review, and the agreement to certain conditions by the applicant. HUD will not approve such request until it has completed the environmental review under 24...

  11. 12 CFR 303.242 - Exercise of trust powers.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Exercise of trust powers. 303.242 Section 303... PROCEDURES Other Filings § 303.242 Exercise of trust powers. (a) Scope. This section contains the procedures to be followed by a state nonmember bank to seek the FDIC's prior consent to exercise trust...

  12. 40 CFR 61.242-7 - Standards: Valves.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Standards: Valves. 61.242-7 Section 61... (Fugitive Emission Sources) § 61.242-7 Standards: Valves. (a) Each valve shall be monitored monthly to...) If an instrument reading of 10,000 ppm or greater is measured, a leak is detected. (c)(1) Any...

  13. 7 CFR 1220.242 - Books and records.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Books and records. 1220.242 Section 1220.242 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE SOYBEAN PROMOTION, RESEARCH,...

  14. 40 CFR 60.242 - Standard for fluorides.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 6 2010-07-01 2010-07-01 false Standard for fluorides. 60.242 Section... Industry: Granular Triple Superphosphate Storage Facilities § 60.242 Standard for fluorides. (a) On and... atmosphere from any affected facility any gases which contain total fluorides in excess of 0.25...

  15. 24 CFR 242.72 - Leasing of hospital.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Leasing of hospital. 242.72 Section... INSURANCE FOR HOSPITALS Miscellaneous Requirements § 242.72 Leasing of hospital. Leasing of a hospital in its entirety is prohibited. Notwithstanding this prohibition, any proposal in which leasing of...

  16. 36 CFR 242.26 - Subsistence taking of wildlife.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Subsistence taking of wildlife. 242.26 Section 242.26 Parks, Forests, and Public Property FOREST SERVICE, DEPARTMENT OF...; however, the harvester must be a Federally qualified subsistence user with customary and traditional...

  17. Solving the Hydration Structure of the Heaviest Actinide Aqua Ion Known: The Californium(III) Case

    Energy Technology Data Exchange (ETDEWEB)

    Den Auwer, Ch.; Guillaumont, D. [CEA Marcoule, Nucl Energy Div, Radiochem Proc Dept, SCPS LILA, 30 (France); Galbis, E.; Pappalardo, Rafael R.; Marcos Sanchez, E. [Univ Seville, Dept Quim Fis, E-41012 Seville (Spain); Hernandez-Cobos, J. [Inst Ciencias Fis, Cuernavaca 62251, Morelos (Mexico); Le Naour, C.; Simoni, E. [Univ Paris Sud, Inst Phys Nucl Orsay, Paris (France)

    2010-07-01

    In summary, the first MC simulation of the trivalent cation of californium, based on an exchangeable hydrated ion-water intermolecular potential, has been shown to extend and improve the hydrated ion model. Likewise, the CfL{sub III}-edge EXAFS spectrum of an acidic 1 mm Cf(ClO{sub 4}){sub 3} aqueous solution recorded under optimized experimental conditions has greatly improved the signal/noise ratio of the only previously recorded spectrum. The comparison of the experimental EXAFS spectrum with the two computed ones, obtained from two different intermolecular potentials that predict eight (BP86) or nine (MP2) water molecules in the first coordination shell, leads to the conclusion that the lowest hydration number is preferred. Then, as Cf{sup III} is the heaviest actinide aqua ion for which there is experimental information, the actinide contraction is supported by the present study. (For U{sup III}, R{sub U-O}=2.56 Angstroms, and CN=9{+-}1; for Pu{sup III}, R{sub Pu-O}=2.51 Angstroms and CN=9{+-}1; for Cm{sup III}, R{sub Cm-O}=2.47 Angstroms and CN=9{+-}1). The role of the second hydration shell is important in defining the structure and dynamics of the Cf{sup III} aqua ion, but the contribution of second-shell water molecules to the EXAFS signal as back-scatters is marginal. Finally, this work gives an illustrative example of the benefits which can be achieved from the combination of experimental X-ray absorption spectroscopy and computer simulations. The usefulness of the simultaneous analysis of the results as well as the importance of the structural statistical average has been clearly demonstrated herein. Each technique independently was not adequate. We believe that this study traces out a still poorly explored combined methodology which may be extremely useful for many other complexes and chemical problems. A systematic theoretical and experimental examination of the other known actinide cations on the same basis should be undertaken to confirm the

  18. The immunoradiometric assay for carbohydrate antigen CA-242

    International Nuclear Information System (INIS)

    Using 125I-labelled monoclonal antibody (C242) against carbohydrate antigen CA-242, the sandwich immunoradiometric assay (IRMA) was developed. In preliminary clinical application of this method, the results of serum CA-242 measurements were 2.5 ± 4.5 U/ml for 77 normal individuals, 3.5 ± 7.0 U/ml for 128 cases of benign diseases, and 56.0 ± 91.3 U/ml for 210 cases of malignant tumors. The CA-242 values of patients with malignant tumors were significantly higher than that of patients with benign diseases. Taking 12 U/ml as normal upper limit, the positive detective rates of pancreatic and colorectal cancers were 86.6% and 62.0% respectively, while the false positive rate for normal individuals was 4%

  19. 17 CFR 242.204 - Close-out requirement.

    Science.gov (United States)

    2010-04-01

    ... 600(b)(64) of Regulation NMS (17 CFR 242.600(b)(64)). Regulation ATS—Alternative Trading Systems...) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation...

  20. 242-A Campaign 99-1 process control plan

    Energy Technology Data Exchange (ETDEWEB)

    LE, E.Q.

    1999-08-25

    242-A Evaporator 99-1 will process approximately one million gallons of waste from tank 102-AW in June 1999. The process control Plan provides a general description of activities, which will occur during 242-A Evaporator Campaign 99-1 and to document analyses conducted to demonstrate that 102-AW waste is acceptable for processing. Predict is a registered trademark of Risk Decisions England Corporation, United Kingdom.

  1. 17 CFR 242.302 - Recordkeeping requirements for alternative trading systems.

    Science.gov (United States)

    2010-04-01

    ... alternative trading systems. 242.302 Section 242.302 Commodity and Securities Exchanges SECURITIES AND... SECURITY FUTURES Regulation Ats-Alternative Trading Systems § 242.302 Recordkeeping requirements for alternative trading systems. To comply with the condition set forth in paragraph (b)(8) of § 242.301,...

  2. 48 CFR 252.242-7004 - Material management and accounting system.

    Science.gov (United States)

    2010-10-01

    ... accounting system. 252.242-7004 Section 252.242-7004 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.242-7004 Material management and accounting system. As prescribed in 242.7204, use the following caluse: Material Management and Accounting System (JUL 2009)...

  3. Measurement of the 242Pu neutron capture cross section

    Science.gov (United States)

    Buckner, M. Q.; Wu, C. Y.; Henderson, R. A.; Bucher, B.; Bredeweg, T. A.; Baramsai, B.; Couture, A.; Jandel, M.; Mosby, S.; O'Donnell, J. M.; Ullmann, J. L.; Chyzh, A.; Dance Collaboration

    2015-10-01

    Precision (n,f) and (n, γ) cross sections are important for the network calculations of the radiochemical diagnostic chain for the U.S. DOE's Stockpile Stewardship Program. 242Pu(n, γ) cross section is relevant to the network calculations of Pu and Am. Additionally, new reactor concepts have catalyzed considerable interest in the measurement of improved cross sections for neutron-induced reactions on key actinides. To date, little or no experimental data has been reported on 242Pu(n, γ) for incident neutron energy below 50 keV. A new measurement of the 242Pu(n, γ) reaction was performed with the DANCE together with an improved PPAC for fission-fragment detection at LANSCE during FY14. The relative scale of the 242Pu(n, γ) cross section spans four orders of magnitude for incident neutron energies from thermal to ~ 30 keV. The absolute scale of the 242Pu(n, γ) cross section is set according to the measured 239Pu(n,f) resonance at 7.8 eV; the target was spiked with 239Pu for this measurement. The absolute 242Pu(n, γ) neutron capture cross section is ~ 30% higher than the cross section reported in ENDF for the 2.7 eV resonance. Latest results to be reported. Funded by U.S. DOE Contract No. DE-AC52-07NA27344 (LLNL) and DE-AC52-06NA25396 (LANL). U.S. DOE/NNSA Office of Defense Nuclear Nonproliferation Research and Development. Isotopes (ORNL).

  4. Development of electron beam ion source charge breeder for rare isotopes at Californium Rare Isotope Breeder Upgrade

    Energy Technology Data Exchange (ETDEWEB)

    Kondrashev, S.; Dickerson, C.; Levand, A.; Ostroumov, P. N.; Pardo, R. C.; Savard, G.; Vondrasek, R. [Physics Division, Argonne National Laboratory, Argonne, Illinois 60439 (United States); Alessi, J.; Beebe, E.; Pikin, A. [Collider-Accelerator Department, Brookhaven National Laboratory, Upton, New York 11973 (United States); Kuznetsov, G. I.; Batazova, M. A. [Budker Institute of Nuclear Physics, Novosibirsk 630090 (Russian Federation)

    2012-02-15

    Recently, the Californium Rare Isotope Breeder Upgrade (CARIBU) to the Argonne Tandem Linac Accelerator System (ATLAS) was commissioned and became available for production of rare isotopes. Currently, an electron cyclotron resonance ion source is used as a charge breeder for CARIBU beams. To further increase the intensity and improve the purity of neutron-rich ion beams accelerated by ATLAS, we are developing a high-efficiency charge breeder for CARIBU based on an electron beam ion source (EBIS). The CARIBU EBIS charge breeder will utilize the state-of-the-art EBIS technology recently developed at Brookhaven National Laboratory (BNL). The electron beam current density in the CARIBU EBIS trap will be significantly higher than that in existing operational charge-state breeders based on the EBIS concept. The design of the CARIBU EBIS charge breeder is nearly complete. Long-lead components of the EBIS such as a 6-T superconducting solenoid and an electron gun have been ordered with the delivery schedule in the fall of 2011. Measurements of expected breeding efficiency using the BNL Test EBIS have been performed using a Cs{sup +} surface ionization ion source for external injection in pulsed mode. In these experiments we have achieved {approx}70% injection/extraction efficiency and breeding efficiency into the most abundant charge state of {approx}17%.

  5. Development of electron beam ion source charge breeder for rare isotopes at Californium Rare Isotope Breeder Upgrade

    Energy Technology Data Exchange (ETDEWEB)

    Kondrashev S.; Alessi J.; Dickerson, C.; Levand, A.; Ostroumov, P.N.; Pardo, R.C.; Savard, G.; Vondrasek, R.; Beebe, E.; Pikin, A.; Kuznetsov, G.I.; Batazova, M.A.

    2012-02-03

    Recently, the Californium Rare Isotope Breeder Upgrade (CARIBU) to the Argonne Tandem Linac Accelerator System (ATLAS) was commissioned and became available for production of rare isotopes. Currently, an electron cyclotron resonance ion source is used as a charge breeder for CARIBU beams. To further increase the intensity and improve the purity of neutron-rich ion beams accelerated by ATLAS, we are developing a high-efficiency charge breeder for CARIBU based on an electron beam ion source (EBIS). The CARIBU EBIS charge breeder will utilize the state-of-the-art EBIS technology recently developed at Brookhaven National Laboratory (BNL). The electron beam current density in the CARIBU EBIS trap will be significantly higher than that in existing operational charge-state breeders based on the EBIS concept. The design of the CARIBU EBIS charge breeder is nearly complete. Long-lead components of the EBIS such as a 6-T superconducting solenoid and an electron gun have been ordered with the delivery schedule in the fall of 2011. Measurements of expected breeding efficiency using the BNL Test EBIS have been performed using a Cs{sup +} surface ionization ion source for external injection in pulsed mode. In these experiments we have achieved {approx}70% injection/extraction efficiency and breeding efficiency into the most abundant charge state of {approx}17%.

  6. Long-term effects of an intracavitary treatment with californium-252 on normal tissue. [Swine, /sup 226/Ra

    Energy Technology Data Exchange (ETDEWEB)

    Sullivan, M.F.; Beamer, J.L.; Mahony, T.D.; Cross, F.T.; Lund, J.E.; Endres, G.W.R.

    1976-01-01

    About one hundred fifty swine were exposed to either radium-226 or californium-252 sources in the uterine cervix to determine an RBE for both acute and long-term effects. That value for early changes in the tissues at risk in the treatment of cervical cancer was between 6.2 and 6.8. The incidence of complications increased with time after exposure, especially among animals treated with /sup 252/Cf. Analysis of rectal injury showed that ulceration occurred frequently within a year postexposure at doses between 1600 and 2400 rad calculated at 2 cm lateral to the source midline. Fat necrosis and smooth muscle atrophy, resulting in a local rectal stricture, were delayed changes observed in some animals. The lower ureter was the site for a greater frequency of complications than the GI tract. Ureteral stricture often occurred at doses of 1200 rad from /sup 252/Cf and 7000 rad from /sup 226/Ra. Observation of delayed effects in the uterine-cervix in animals held up to 4 years postexposure indicate that the RBE for /sup 252/Cf may be increased to a value as high as 18, while repair may have even decreased it to about 5.6 in the rectum. Fifty swine are still being observed for long-term effects after doses above 800 rad from /sup 252/Cf and 5000 rad from /sup 226/Ra.

  7. 16 CFR 24.2 - Deception as to composition.

    Science.gov (United States)

    2010-01-01

    ... LEATHER AND IMITATION LEATHER PRODUCTS § 24.2 Deception as to composition. It is unfair or deceptive to... or deceptive to use the unqualified term “leather” or other unqualified terms suggestive of leather... advertising of such products irrespective of the media used whenever statements, representations,...

  8. 36 CFR 242.18 - Regulation adoption process.

    Science.gov (United States)

    2010-07-01

    ... and B of this part shall be accepted by the Secretary of the Interior in accordance with 43 CFR part... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Regulation adoption process... SUBSISTENCE MANAGEMENT REGULATIONS FOR PUBLIC LANDS IN ALASKA Program Structure § 242.18 Regulation...

  9. 24 CFR 242.58 - Books, accounts, and financial statements.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Books, accounts, and financial... Requirements § 242.58 Books, accounts, and financial statements. (a) Books and accounts. The mortgagor's books... Agreement. (f) Books of management agents. The books and records of management agents, lessees,...

  10. 24 CFR 242.2 - Program financial self-sufficiency.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Program financial self-sufficiency... self-sufficiency and actuarial soundness; i.e., to avoid mortgage defaults and claims for insurance... AUTHORITIES MORTGAGE INSURANCE FOR HOSPITALS General Eligibility Requirements § 242.2 Program financial...

  11. 48 CFR 52.242-17 - Government Delay of Work.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Government Delay of Work....242-17 Government Delay of Work. As prescribed in 42.1305(c), insert the following clause in... services, or for supplies that are commercial or modified-commercial items. Government Delay of Work...

  12. Electron-capture delayed fission properties of 242Es

    International Nuclear Information System (INIS)

    Electron-capture delayed fission of 242Es produced via the 233U(14N,5n)242Es reaction at 87 MeV (on target) was observed to decay with a half-life of 11±3 s, consistent with the reported α-decay half-life of 242Es of 16-4+6 s. The mass-yield distribution of the fission fragments is highly asymmetric. The average pre-neutron emission total kinetic energy of the fragments was measured to be 183±18 MeV. Based on the ratio of the measured number of fission events to the measured number of α decays from the electron-capture daughter 242Cf (100% α branch), the probability of delayed fission was determined to be 0.006±0.002. This value for the delayed fission probability fits the experimental trend of increasing delayed fission probability with increasing Q value for electron capture. (c) 2000 The American Physical Society

  13. 40 CFR 98.242 - GHGs to report.

    Science.gov (United States)

    2010-07-01

    ... Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) MANDATORY GREENHOUSE GAS REPORTING Petrochemical Production § 98.242 GHGs to report. You must report the information in paragraphs (a) through (c) of this section: (a) CO2 CH4, and N2O process emissions from each...

  14. 17 CFR 242.607 - Customer account statements.

    Science.gov (United States)

    2010-04-01

    ... (CONTINUED) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Nms-Regulation of the National Market System § 242.607 Customer account statements. (a) No broker... the purchase or sale of, or direct orders for purchase or sale of, any NMS stock or a...

  15. 17 CFR 242.606 - Disclosure of order routing information.

    Science.gov (United States)

    2010-04-01

    ... (CONTINUED) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Nms-Regulation of the National Market System § 242.606 Disclosure of order routing information. (a... calendar quarter a report on its routing of non-directed orders in NMS securities during that quarter....

  16. 17 CFR 242.600 - NMS security designation and definitions.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false NMS security designation and... (CONTINUED) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Nms-Regulation of the National Market System § 242.600 NMS security designation and...

  17. 17 CFR 242.604 - Display of customer limit orders.

    Science.gov (United States)

    2010-04-01

    ... (CONTINUED) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Nms-Regulation of the National Market System § 242.604 Display of customer limit orders. (a) Specialists and OTC market makers. For all NMS stocks: (1) Each member of a national securities exchange...

  18. 17 CFR 242.605 - Disclosure of order execution information.

    Science.gov (United States)

    2010-04-01

    ... (CONTINUED) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Nms-Regulation of the National Market System § 242.605 Disclosure of order execution information... covered orders in NMS stocks that it received for execution from any person. Such report shall be...

  19. 48 CFR 52.242-14 - Suspension of Work.

    Science.gov (United States)

    2010-10-01

    ... the work is, for an unreasonable period of time, suspended, delayed, or interrupted (1) by an act of... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Suspension of Work. 52.242... Suspension of Work. As prescribed in 42.1305(a), insert the following clause in solicitations and...

  20. 17 CFR 242.405 - Withdrawal of margin.

    Science.gov (United States)

    2010-04-01

    ... account after such withdrawal is sufficient to satisfy the required margin for the security futures and...) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Customer Margin Requirements for Security Futures § 242.405 Withdrawal of margin. (a) By the customer. Except as...

  1. 10 CFR 431.242 - Test Procedures [Reserved

    Science.gov (United States)

    2010-01-01

    ... upstream of the draft control device of an individual, automatically operated, fossil fuel-fired appliance... intended for installation in the venting system of an individual, automatically operated, fossil fuel-fired... EQUIPMENT Unit Heaters § 431.242 Definitions concerning unit heaters. Unit heater means a self-contained...

  2. 48 CFR 952.242-70 - Technical direction.

    Science.gov (United States)

    2010-10-01

    ... required for contract performance; (4) Changes any of the expressed terms, conditions or specifications of...) Performance of the work under this contract shall be subject to the technical direction of the DOE Contracting... FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions and Clauses 952.242-70...

  3. Process Control Plan for 242-A Evaporator Campaign

    International Nuclear Information System (INIS)

    The wastes in tanks 107-AP and 108-AP are designated as feed for 242-A Evaporator Campaign 2000-1, which is currently scheduled for the week of April 17, 2000. Waste in tanks 107-AP and 108-AP is predominantly comprised of saltwell liquor from 200 West Tank Farms

  4. 36 CFR 242.24 - Customary and traditional use determinations.

    Science.gov (United States)

    2010-07-01

    ... AGRICULTURE SUBSISTENCE MANAGEMENT REGULATIONS FOR PUBLIC LANDS IN ALASKA Board Determinations § 242.24... Brown Bear Residents of Unit 9D and 10 (Unimak Island). Unit 9E Brown Bear Residents of Chignik, Chignik..., and Egegik. Unit 9D Caribou Residents of Unit 9D, Akutan, and False Pass. Unit 9E Caribou Residents...

  5. 17 CFR 242.303 - Record preservation requirements for alternative trading systems.

    Science.gov (United States)

    2010-04-01

    ... requirements for alternative trading systems. 242.303 Section 242.303 Commodity and Securities Exchanges... REQUIREMENTS FOR SECURITY FUTURES Regulation Ats-Alternative Trading Systems § 242.303 Record preservation requirements for alternative trading systems. (a) To comply with the condition set forth in paragraph (b)(9)...

  6. 24 CFR 242.90 - Eligibility of mortgages covering hospitals in certain neighborhoods.

    Science.gov (United States)

    2010-04-01

    ... hospitals in certain neighborhoods. 242.90 Section 242.90 Housing and Urban Development Regulations Relating... UNDER NATIONAL HOUSING ACT AND OTHER AUTHORITIES MORTGAGE INSURANCE FOR HOSPITALS Miscellaneous Requirements § 242.90 Eligibility of mortgages covering hospitals in certain neighborhoods. (a) A...

  7. 17 CFR 242.102 - Activities by issuers and selling security holders during a distribution.

    Science.gov (United States)

    2010-04-01

    ... selling security holders during a distribution. 242.102 Section 242.102 Commodity and Securities Exchanges... REQUIREMENTS FOR SECURITY FUTURES Regulation M § 242.102 Activities by issuers and selling security holders... or on behalf of an issuer or selling security holder, it shall be unlawful for such person, or...

  8. 46 CFR 308.306 - Second Seamen's War Risk Policy, Form MA-242.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 8 2010-10-01 2010-10-01 false Second Seamen's War Risk Policy, Form MA-242. 308.306... RISK INSURANCE Second Seamen's War Risk Insurance § 308.306 Second Seamen's War Risk Policy, Form MA-242. (a) The standard form of Second Seamen's War Risk Policy Form MA-242, may be obtained from...

  9. 48 CFR 242.771 - Independent research and development and bid and proposal costs.

    Science.gov (United States)

    2010-10-01

    ... SERVICES Indirect Cost Rates 242.771 Independent research and development and bid and proposal costs. ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Independent research and development and bid and proposal costs. 242.771 Section 242.771 Federal Acquisition Regulations System...

  10. 19 CFR 24.2 - Persons authorized to receive Customs collections.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Persons authorized to receive Customs collections. 24.2 Section 24.2 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY CUSTOMS FINANCIAL AND ACCOUNTING PROCEDURE § 24.2 Persons authorized to...

  11. 17 CFR 242.602 - Dissemination of quotations in NMS securities.

    Science.gov (United States)

    2010-04-01

    ... NMS securities. 242.602 Section 242.602 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Nms-Regulation of the National Market System § 242.602 Dissemination of quotations...

  12. 48 CFR 352.242-72 - Native American Graves Protection and Repatriation Act.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Native American Graves Protection and Repatriation Act. 352.242-72 Section 352.242-72 Federal Acquisition Regulations System HEALTH AND HUMAN SERVICES CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Texts of Provisions and Clauses 352.242-72 Native...

  13. Fission cross section for 242Am.met

    International Nuclear Information System (INIS)

    The neutron-induced fission cross section for 242Am.met (152y) was measured at the Livermore 100-MeV electron linac in the neutron energy range of 0.01 eV to 20 MeV. Fission fragments were detected using a hemispherical fission chamber. The neutron flux was measured below 10 keV using lithium glass scintillators. Above 10 keV, the 242Am.met fission cross section was measured relative to the 235U fission cross section. Below 20 eV, the data were fit with a sum of single-level Breit-Wigner resonances. Results for the distribution of fission widths, the average fission width, and the average level spacing are presented. The fission cross section in the 100 keV to 20 MeV range is compared with previous measurements

  14. Observation of cold fission in 242Pu spontaneous fission

    International Nuclear Information System (INIS)

    Coincidence γ-ray data from the spontaneous fission of 242Pu were collected at the Lawrence Berkeley Laboratory high purity Ge (HPGe) array, GAMMASPHERE. Data from several cold-fission (0 neutron emission) isotopic pairs were observed and are presented. An interesting trend in the fractional population of cold-fission events was observed and is discussed. Relative yields of Zr-Xe, Sr-Ba, and Mo-Te pairs were measured. The Zr-Xe system has the most complete data set. Some speculations on the trend in the number of neutrons emitted as a function of the mass of the Xe isotope populated are presented. Comparisons between the yields from the spontaneous fission of 242Pu and the yields from thermal-neutron-induced fission of 241Pu are also presented. copyright 1996 The American Physical Society

  15. 40 CFR 180.242 - Thiabendazole; tolerances for residues.

    Science.gov (United States)

    2010-07-01

    ... Expiration/Revocation Date Apple, wet pomace 12.0 None Avocado1 10.0 None Banana, postharvest 3.0 None Bean..., tops 10.0 12/25/10 Cantaloupe1 15.0 None Carrot, roots, postharvest 10.0 None Citrus, oil 15.0 None... inadvertent residues. Editorial Note: For Federal Register citations affecting § 180.242, see the List of...

  16. Hanford facility dangerous waste permit application, 242-A evaporator

    International Nuclear Information System (INIS)

    The Hanford Facility Dangerous Waste Permit Application is considered to be a single application organized into a General Information Portion (document number DOE/RL-91-28) and a Unit-Specific Portion. The scope of the Unit-Specific Portion is limited to Part B permit application documentation submitted for individual, 'operating' treatment, storage, and/or disposal units, such as the 242-A Evaporator (this document, DOE/RL-90-42)

  17. 242-A evaporator quality assurance project plan: Revision 1

    Energy Technology Data Exchange (ETDEWEB)

    Tucker, B.J.

    1994-11-04

    The scope of this quality assurance project plan (Plan) is sampling and analytical services including, but not limited to, sample receipt, handling and storage, analytical measurements, submittal of data deliverables, archiving selected portions of samples, returning unneeded sample material to Westinghouse Hanford Company (WHC), and/or sample disposal associated with candidate feed samples and process condensate compliance samples. Sampling and shipping activities are also included within the scope. The purpose of this project is to provide planning, implementation, and assessment guidance for achieving established data quality objectives measurement parameters. This Plan requires onsite and offsite laboratories to conform to that guidance. Laboratory conformance will help ensure that quality data are being generated and therefore, that the 242-A evaporator is operating in a safe and compliant manner. The 242-A evaporator feed stream originates from double-shell tanks (DSTs) identified as candidate feed tanks. The 242-A evaporator reduces the volume of aqueous waste contained in DSTs by boiling off water and sending it to the Liquid Effluent Retention Facility (LERF) storage basin before further treatment. The slurry product is returned to DSTs. Evaporation results in considerable savings by reducing the volume of mixed waste for disposal.

  18. 242-A Evaporator waste analysis plan. Revision 4

    International Nuclear Information System (INIS)

    This waste analysis plan (WAP) provides the plan for obtaining information needed for proper waste handling and processing in the 242-A Evaporator located on the Hanford Site. Regulatory and safety issues are addressed by establishing boundary conditions for waste received and treated at the 242-A Evaporator. The boundary conditions are set by establishing limits for items such as potential exothermic reactions, waste compatibility, and control of vessel vent organic emissions. Boundary conditions are also set for operational considerations and to ensure waste acceptance at receiving facilities. The issues that are addressed in this plan include prevention of exotherms in the waste, waste compatibility, vessel vent emissions, and compatibility with the liner in the Liquid Effluent Retention Facility (LERF). The 242-A Evaporator feed stream is separated into two liquid streams: a concentrated slurry stream and a process condensate. A gaseous exhaust stream is also produced. The slurry contains the majority of the radionuclides and inorganic constituents. This stream is pumped back to the double shell tanks (DSTs) and stored for further treatment after being concentrated to target levels. The process condensate (PC) is primarily water that contains trace amounts of organic material and a greatly reduced concentration of radionuclides. The process condensate is presently stored in the (LERF) until it can be further processed in the Effluent Treatment Facility once it is operational

  19. Ab initio full-potential study of mechanical properties and magnetic phase stability of californium monopnictides (CfN and CfP)

    Science.gov (United States)

    Amari, S.; Bouhafs, B.

    2016-09-01

    Based on the first-principles methods, the structural, elastic, electronic, properties and magnetic ordering of californium monopnictides CfX (X = P) have been studied using the full-potential augmented plane wave plus local orbitals (FP-L/APW + lo) method within the framework of density functional theory (DFT). The electronic exchange correlation energy is described by generalized gradient approximation GGA and GGA+U (U is the Hubbard correction). The GGA+U method is applied to the rare-earth 5f states. We have calculated the lattice parameters, bulk modulii and the first pressure derivatives of the bulk modulii. The elastic properties of the studied compounds are only investigated in the most stable calculated phase. In order to gain further information, we have calculated Young's modulus, shear modulus, anisotropy factor and Kleinman parameter by the aid of the calculated elastic constants. The results mainly show that californium monopnictides CfX (X = P) have an antiferromagnetic spin ordering. Density of states (DOS) and charge densities for both compounds are also computed in the NaCl (B1) structure.

  20. CO observations of high-z radio galaxies MRC 2104-242 and MRC 0943-242 : spectral-line performance of the Compact Array Broadband Backend

    NARCIS (Netherlands)

    Emonts, B. H. C.; Norris, R. P.; Feain, I.; Miley, G.; Sadler, E. M.; Villar-Martin, M.; Mao, M. Y.; Oosterloo, T. A.; Ekers, R. D.; Stevens, J. B.; Wieringa, M. H.; Coppin, K. E. K.; Tadhunter, C. N.

    2011-01-01

    We present the first 7-mm observations of two high-redshift, Ly alpha-bright radio galaxies (MRC 2104-242 and MRC 0943-242) performed with the 2 x 2 GHz instantaneous bandwidth of the Compact Array Broadband Backend (CABB) at the Australia Telescope Compact Array (ATCA). The aim was to search for (C

  1. 242-A Control System device logic software documentation. Revision 2

    Energy Technology Data Exchange (ETDEWEB)

    Berger, J.F.

    1995-05-19

    A Distributive Process Control system was purchased by Project B-534. This computer-based control system, called the Monitor and Control System (MCS), was installed in the 242-A Evaporator located in the 200 East Area. The purpose of the MCS is to monitor and control the Evaporator and Monitor a number of alarms and other signals from various Tank Farm facilities. Applications software for the MCS was developed by the Waste Treatment System Engineering Group of Westinghouse. This document describes the Device Logic for this system.

  2. Clinical evaluation of serum tumour marker CA 242 in non-small cell lung cancer.

    OpenAIRE

    Pujol, J L; Cooper, E H; Lehmann, M.; Purves, D. A.; Dan-Aouta, M.; Midander, J.; Godard, P.; Michel, F B

    1993-01-01

    CA 242, a novel tumour carbohydrate antigen present in serum (upper limit of normal values: 20.0 U ml-1), has been measured in a group of 102 pathologically confirmed non-small cell lung cancer patients. The aim of the present prospective study was to identify any relationship between pre-treatment serum CA 242 level and different features of lung cancer including prognosis. Serum CA 242 was measured using the delayed europium lanthanide fluoroimmunometric assay. Sensitivity and specificity w...

  3. Preoperative serum levels of CEA and CA 242 in colorectal cancer.

    OpenAIRE

    Carpelan-Holmström, M; Haglund, C.; Kuusela, P.; Järvinen, H; Roberts, P. J.

    1995-01-01

    Preoperative serum levels of CEA and CA 242 were determined in 260 patients with colorectal cancer and in 92 patients with benign colorectal diseases. The overall sensitivity of the CEA test was 43% and of the CA 242 test 39%. The corresponding specificities were 90% and 87% respectively, using 5 ng ml-1 as cut-off level for CEA and 20 U ml-1 for CA 242. The sensitivity of CEA was 26%, 32%, 38% and 77% for Dukes A, B, C and D colorectal cancer, and the sensitivity of CA 242 was 26%, 26%, 40% ...

  4. Comparative study of CA242 and CA19-9 for the diagnosis of pancreatic cancer.

    OpenAIRE

    Kawa, S; Tokoo, M.; Hasebe, O.; Hayashi, K.; Imai, H; Oguchi, H.; Kiyosawa, K; Furuta, S; Homma, T

    1994-01-01

    A comparative study of a new tumour marker, CA242, and CA19-9 was conducted with special reference to their diagnostic usefulness in pancreatic cancer. CA242 showed sensitivity similar to that of CA19-9 for overall cases and early cases (stage I tumour) of pancreatic cancer. For other malignancies, the positive rates of CA242 were lower than those of CA19-9 except for colorectal cancer. An important characteristics of CA242 was that it was only slightly and infrequently elevated in the sera o...

  5. 242-A campaign 95-1 post run document

    Energy Technology Data Exchange (ETDEWEB)

    Guthrie, M.D.

    1996-02-12

    The 242-A Evaporator Campaign 95-1 was started on June 6, 1995 and finished July 27, 1995. An overall Waste Volume Reduction (WVR) of 8.18 million liters (2.16 mGAL OR 87.6% WVRF) was achieved from 9.35 million liters (2.47 Mgal) of processable waste contained in 108-AP, 107-AP, 106-AW and 102-AW. Slurry generated from Campaign 95-1 consisted of 1.05 million liters (278,000 gal) of dilute double-shell slurry feed (DDSSF) with a SpG of approximately 1.34. Total process condensate discharged to LERF was 10.3 million liters (2.72 Mgal), achieving a condensate/WVR efficiency ratio of 1.26. Total throughout for Campaign 95-1 was 18.1 million liters (4.79 Mgal). B Pond discharges from steam condensate and cooling water were 15.8 and 583 million liters (4.17 and 154 Mgal) respectively. Based on 145 hours of unplanned downtime, the 242-A Evaporator maintained an operating efficiency of 86% during the 49 day campaign.

  6. 242A Distributed Control System Year 2000 Acceptance Test Report

    International Nuclear Information System (INIS)

    This report documents acceptance test results for the 242-A Evaporator distributive control system upgrade to D/3 version 9.0-2 for year 2000 compliance. This report documents the test results obtained by acceptance testing as directed by procedure HNF-2695. This verification procedure will document the initial testing and evaluation of the potential 242-A Distributed Control System (DCS) operating difficulties across the year 2000 boundary and the calendar adjustments needed for the leap year. Baseline system performance data will be recorded using current, as-is operating system software. Data will also be collected for operating system software that has been modified to correct year 2000 problems. This verification procedure is intended to be generic such that it may be performed on any D/3(trademark) (GSE Process Solutions, Inc.) distributed control system that runs with the VMSTM (Digital Equipment Corporation) operating system. This test may be run on simulation or production systems depending upon facility status. On production systems, DCS outages will occur nine times throughout performance of the test. These outages are expected to last about 10 minutes each

  7. 242A Distributed Control System Year 2000 Acceptance Test Report

    Energy Technology Data Exchange (ETDEWEB)

    TEATS, M.C.

    1999-08-31

    This report documents acceptance test results for the 242-A Evaporator distributive control system upgrade to D/3 version 9.0-2 for year 2000 compliance. This report documents the test results obtained by acceptance testing as directed by procedure HNF-2695. This verification procedure will document the initial testing and evaluation of the potential 242-A Distributed Control System (DCS) operating difficulties across the year 2000 boundary and the calendar adjustments needed for the leap year. Baseline system performance data will be recorded using current, as-is operating system software. Data will also be collected for operating system software that has been modified to correct year 2000 problems. This verification procedure is intended to be generic such that it may be performed on any D/3{trademark} (GSE Process Solutions, Inc.) distributed control system that runs with the VMSTM (Digital Equipment Corporation) operating system. This test may be run on simulation or production systems depending upon facility status. On production systems, DCS outages will occur nine times throughout performance of the test. These outages are expected to last about 10 minutes each.

  8. 242-A campaign 95-1 post run document

    International Nuclear Information System (INIS)

    The 242-A Evaporator Campaign 95-1 was started on June 6, 1995 and finished July 27, 1995. An overall Waste Volume Reduction (WVR) of 8.18 million liters (2.16 mGAL OR 87.6% WVRF) was achieved from 9.35 million liters (2.47 Mgal) of processable waste contained in 108-AP, 107-AP, 106-AW and 102-AW. Slurry generated from Campaign 95-1 consisted of 1.05 million liters (278,000 gal) of dilute double-shell slurry feed (DDSSF) with a SpG of approximately 1.34. Total process condensate discharged to LERF was 10.3 million liters (2.72 Mgal), achieving a condensate/WVR efficiency ratio of 1.26. Total throughout for Campaign 95-1 was 18.1 million liters (4.79 Mgal). B Pond discharges from steam condensate and cooling water were 15.8 and 583 million liters (4.17 and 154 Mgal) respectively. Based on 145 hours of unplanned downtime, the 242-A Evaporator maintained an operating efficiency of 86% during the 49 day campaign

  9. Anatomy of a controversy: Application of the Langevin technique to the analysis of the Californium-252 Source-Driven Noise Analysis method for subcriticality determination

    International Nuclear Information System (INIS)

    The expressions for the power spectral density of the noise equivalent sources have been calculated explicitly for the (a) stochastic transport equation, (b) the one-speed transport equaton, (c) the one-speed P1 equations, (d) the one-speed diffusion equation and (e) the point kinetic equation. The stochastic nature of Fick's law in (d) has been emphasized. The Langevin technique has been applied at various levels of approximation to the interpretation of the Californium-252 Source-Driven Noise Analysis (CSDNA) experiment for determining the reactivity in subcritical media. The origin of the controversy surrounding this method has been explained. The foundations of the CSDNA method as a viable experimental technique to infer subcriticality from a measured ratio of power spectral densities of the outputs of two neutron detectors and a third external source detector has been examined by solving the one-speed stochastic diffusion equation for a point external Californium-252 source and two detectors in an infinite medium. The expression relating reactivity to the measured ratio of PSDs was found to depend implicitly on k itself. Through a numerical analysis fo this expression, the authors have demonstrated that for a colinear detector-source-detector configuration for neutron detectors far from the source, the expression for the subcritical multiplication factor becomes essentially insensitive to k, hence, demonstrating some possibility for the viability of this technique. However, under more realistic experimental conditions, i.e., for finite systems in which diffusion theroy is not applicable, the measurement of the subcritical multiplication factor from a single measured ratio of PSDs, without extensive transport calculations, remains doubtful

  10. 48 CFR 53.242-1 - Novation and change-of-name agreements (SF 30).

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Novation and change-of-name agreements (SF 30). 53.242-1 Section 53.242-1 Federal Acquisition Regulations System FEDERAL...-of-name agreements (SF 30). SF 30, Amendment of Solicitation/Modification of Contract. SF...

  11. 40 CFR 61.242-4 - Standards: Pressure relief devices in gas/vapor service.

    Science.gov (United States)

    2010-07-01

    ... devices in gas/vapor service. (a) Except during pressure releases, each pressure relief device in gas... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Standards: Pressure relief devices in gas/vapor service. 61.242-4 Section 61.242-4 Protection of Environment ENVIRONMENTAL PROTECTION...

  12. 48 CFR 242.1403 - Shipping documents covering f.o.b. origin shipments.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Shipping documents... SERVICES Traffic and Transportation Management 242.1403 Shipping documents covering f.o.b. origin shipments....242-7003, Application for U.S. Government Shipping Documentation/Instructions. (ii) The...

  13. 24 CFR 242.81 - Lead-based paint poisoning prevention.

    Science.gov (United States)

    2010-04-01

    ... prevention. Requirements set forth in 24 CFR part 35 apply to this program. ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Lead-based paint poisoning prevention. 242.81 Section 242.81 Housing and Urban Development Regulations Relating to Housing and...

  14. 25 CFR 242.2 - Authority to engage in commercial fishing.

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Authority to engage in commercial fishing. 242.2 Section... FISHING ON RED LAKE INDIAN RESERVATION § 242.2 Authority to engage in commercial fishing. No person shall engage in commercial fishing in the waters of the Red Lakes on the Red Lake Indian Reservation in...

  15. Organic emission calculations for the 242-A evaporator vessel vent system

    Energy Technology Data Exchange (ETDEWEB)

    Bowman, M.R.

    1996-06-20

    This document contains historical calculations originally published in the 242-A Evaporator Dangerous Waste Permit Application, DOE/RL-90-42, Rev 0. They are being released as a supporting document, along with brief explanatory information, to be used as a reference in Rev 1 of the permit application and in other supporting documents, such as the 242-A Evaporator Data Quality Objectives.

  16. 20 CFR 404.242 - Use of old-start primary insurance amount as guaranteed alternative.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Use of old-start primary insurance amount as guaranteed alternative. 404.242 Section 404.242 Employees' Benefits SOCIAL SECURITY ADMINISTRATION FEDERAL OLD-AGE, SURVIVORS AND DISABILITY INSURANCE (1950- ) Computing Primary Insurance Amounts...

  17. 36 CFR 242.6 - Licenses, permits, harvest tickets, tags, and reports.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 2 2010-07-01 2010-07-01 false Licenses, permits, harvest tickets, tags, and reports. 242.6 Section 242.6 Parks, Forests, and Public Property FOREST SERVICE... permits (Federal Subsistence Registration Permit or Federal Designated Harvester Permit) required...

  18. Californium-252 neutron sources

    International Nuclear Information System (INIS)

    Major production programs for the Savannah River reactors and the High Flux Isotopes Reactor at Oak Ridge have made 252Cf one of the most available and, at the USAEC's sales price of $10/μg, one of the least-expensive isotopic neutron sources. Reactor production has totaled approximately 2 g, and, based on expected demand, an additional 10 g will be produced in the next decade. The approximately 800 mg chemically separated to date has been used to prepare over 600 neutron sources. Most, about 500, have been medical sources containing 1 to 5 μg of 252Cf plated in needles for experimental cancer therapy studies. The remainder have generally been point sources containing 10 μg to 12 mg of oxide for activation, well logging, or radiography uses. Bulk sources have also been supplied to the commercial encapsulators. The latest development has been the production of 252Cf cermet wire which can be cut into almost contamination-free lengths of the desired 252Cf content. Casks are available for transport of sources up to 50 mg. Subcritical assemblies have been developed to multiply the source neutrons by a factor of 10 to 40, and collimators and thermalizers have also been extensively developed to shape the neutron flux and energy distributions for special applications. (U.S.)

  19. Consistent Data Assimilation of Isotopes: 242Pu and 105Pd

    Energy Technology Data Exchange (ETDEWEB)

    G. Palmiotti; H. Hiruta; M. Salvatores

    2012-09-01

    In this annual report we illustrate the methodology of the consistent data assimilation that allows to use the information coming from integral experiments for improving the basic nuclear parameters used in cross section evaluation. A series of integral experiments are analyzed using the EMPIRE evaluated files for 242Pu and 105Pd. In particular irradiation experiments (PROFIL-1 and -2, TRAPU-1, -2 and -3) provide information about capture cross sections, and a critical configuration, COSMO, where fission spectral indexes were measured, provides information about fission cross section. The observed discrepancies between calculated and experimental results are used in conjunction with the computed sensitivity coefficients and covariance matrix for nuclear parameters in a consistent data assimilation. The results obtained by the consistent data assimilation indicate that not so large modifications on some key identified nuclear parameters allow to obtain reasonable C/E. However, for some parameters such variations are outside the range of 1 s of their initial standard deviation. This can indicate a possible conflict between differential measurements (used to calculate the initial standard deviations) and the integral measurements used in the statistical data adjustment. Moreover, an inconsistency between the C/E of two sets of irradiation experiments (PROFIL and TRAPU) is observed for 242Pu. This is the end of this project funded by the Nuclear Physics Program of the DOE Office of Science. We can indicate that a proof of principle has been demonstrated for a few isotopes for this innovative methodology. However, we are still far from having explored all the possibilities and made this methodology to be considered proved and robust. In particular many issues are worth further investigation: • Non-linear effects • Flexibility of nuclear parameters in describing cross sections • Multi-isotope consistent assimilation • Consistency between differential and integral

  20. 242Am/sup m/ fission cross section

    International Nuclear Information System (INIS)

    The neutron-induced fission cross section of 242Am/sup m/ has been measured over the energy region from 10-3 eV to approx.20 MeV in a series of experiments utilizing a linac-produced ''white'' neutron source and a monoenergetic source of 14.1 MeV neutrons. The cross section was measured relative to that of 235U in the thermal (0.001 to approx.3 eV) and high energy (1 keV to approx.20 MeV) regions and normalized to the ENDF/B-V 235U(n,f) evaluated cross section. In the resonance energy region (0.5 eV to 10 keV) the neutron flux was measured using thin lithium glass scintillators and the relative cross section thus obtained was normalized to the thermal energy measurement. This procedure allowed a consistency check between the thermal and high energy data. The cross section data have a statistical accuracy of approx.0.5% at thermal energies and in the 1-MeV energy region, and a systematic uncertainty of approx.5%. We confirmed that 242Am/sup m/ has the largest thermal fission cross section known with a 2200 m/sec value of 6328 b. Results of a Breit-Wigner sum-of-single-levels analysis of 48 fission resonances up to 20 eV are presented and the connection of these resonance properties to the large thermal cross section is discussed. Our measurements are compared with previously reported results

  1. In vitro evaluation of the antimicrobial activity of HM-242, a novel antiseptic compound.

    Science.gov (United States)

    Okunishi, Junji; Nishihara, Yutaka; Maeda, Shirou; Ikeda, Masahiro

    2009-09-01

    The antimicrobial activities of N(4)-octyl-6,6-dimethyl-N(2)-(4-methylbenzyl)-1,6-dihydro-1,3,5-triazine-2,4-diamine (HM-242), a novel synthetic compound, were compared with those of chlorhexidine gluconate (CHG). HM-242 was a more potent microbicide than CHG in vitro; however, its minimal inhibitory concentrations were similar. In particular, HM-242 killed various Gram-positive bacteria, including methicillin-resistant Staphylococcus aureus and vancomycin-resistant Enterococcus faecalis, both efficiently and rapidly. HM-242 also showed potent virucidal activity against enveloped viruses such as influenza virus and herpes simplex virus. These characteristics suggest that HM-242 may well be useful as an antiseptic.

  2. 24 CFR 1000.242 - When does the requirement for exemption from taxation apply to affordable housing activities?

    Science.gov (United States)

    2010-04-01

    ... exemption from taxation apply to affordable housing activities? 1000.242 Section 1000.242 Housing and Urban... ACTIVITIES Indian Housing Plan (IHP) § 1000.242 When does the requirement for exemption from taxation apply to affordable housing activities? The requirement for exemption from taxation applies only to...

  3. 27 CFR 24.242 - Authority to use greater quantities of decolorizing material in juice or wine.

    Science.gov (United States)

    2010-04-01

    ... quantities of decolorizing material in juice or wine. 24.242 Section 24.242 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS WINE Storage, Treatment and Finishing of Wine § 24.242 Authority to use greater quantities of decolorizing material...

  4. Californium interrogation prompt neutron (CIPN) instrument for non-destructive assay of spent nuclear fuel-Design concept and experimental demonstration

    Science.gov (United States)

    Henzlova, D.; Menlove, H. O.; Rael, C. D.; Trellue, H. R.; Tobin, S. J.; Park, Se-Hwan; Oh, Jong-Myeong; Lee, Seung-Kyu; Ahn, Seong-Kyu; Kwon, In-Chan; Kim, Ho-Dong

    2016-01-01

    This paper presents results of the first experimental demonstration of the Californium Interrogation Prompt Neutron (CIPN) instrument developed within a multi-year effort launched by the Next Generation Safeguards Initiative Spent Fuel Project of the United States Department of Energy. The goals of this project focused on developing viable non-destructive assay techniques with capabilities to improve an independent verification of spent fuel assembly characteristics. For this purpose, the CIPN instrument combines active and passive neutron interrogation, along with passive gamma-ray measurements, to provide three independent observables. This paper describes the initial feasibility demonstration of the CIPN instrument, which involved measurements of four pressurized-water-reactor spent fuel assemblies with different levels of burnup and two initial enrichments. The measurements were performed at the Post-Irradiation Examination Facility at the Korea Atomic Energy Institute in the Republic of Korea. The key aim of the demonstration was to evaluate CIPN instrument performance under realistic deployment conditions, with the focus on a detailed assessment of systematic uncertainties that are best evaluated experimentally. The measurements revealed good positioning reproducibility, as well as a high degree of insensitivity of the CIPN instrument's response to irregularities in a radial burnup profile. Systematic uncertainty of individual CIPN instrument signals due to assembly rotation was found to be orientation in the instrument.

  5. Process control plan for 242-A Evaporator Campaign 94-2

    Energy Technology Data Exchange (ETDEWEB)

    Le, E.Q.

    1994-09-01

    242-A Evaporator Campaign 94-2 will process approximately 3.42 million gallons of dilute waste from tanks 101-AP, 107-AP, 108AP, 102-AW, and 106-AW. The process control plant describes activities which will occur during Campaign 94-2. This document also addresses compliance with the tank farm waste compatibility program, the 242-A radiological source term, the criticality prevention specifications, and effluent discharge limits.

  6. Comparative study of CA242 and CA19-9 in chronic pancreatitis.

    OpenAIRE

    Furuya, N; Kawa, S; Hasebe, O.; Tokoo, M.; Mukawa, K.; Maejima, S.; Oguchi, H.

    1996-01-01

    CA242 has been proved to be useful in the diagnosis of pancreatic cancer. The aim of the present study was to clarify the mechanisms contributing to the high specificity of CA242 as compared with CA19-9 resulting from scarce serum elevation of this antigen in patients with chronic pancreatitis by correlating serum levels and endoscopic retrograde choledocho-pancreatography (ERCP) findings and by immunohistochemical analysis. Serum CA19-9 levels were significantly elevated in patients with cal...

  7. CO observations of high-z radio galaxies MRC 2104-242 and MRC 0943-242: spectral-line performance of the Compact Array Broadband Backend

    CERN Document Server

    Emonts, B H C; Feain, I; Miley, G; Sadler, E M; Villar-Martin, M; Mao, M Y; Oosterloo, T A; Ekers, R D; Stevens, J B; Wieringa, M H; Coppin, K E K; Tadhunter, C N

    2011-01-01

    We present the first 7-millimetre observations of two high-redshift, Lya-bright radio galaxies (MRC 2104-242 and MRC 0943-242) performed with the 2 x 2 GHz instantaneous bandwidth of the Compact Array Broadband Backend (CABB) at the Australia Telescope Compact Array (ATCA). The aim was to search for 12CO(1-0) emission in these systems and test the millimetre capabilities of CABB for performing spectral line observations at high redshifts. We show that the stable band and enhanced velocity coverage of CABB, combined with hybrid array configurations, provide the ATCA with excellent 7-mm capabilities that allow reliable searches for the ground transition of CO at high redshifts. In this paper we explicitly discuss the calibration procedures used to reach our results. We set a firm upper limit to the mass of molecular gas in MRC 2104-242 (z = 2.5) of M(H2) < 2 x 10^10 (alpha_x/0.8) M_sun. For MRC 0943-242 (z=2.9) we derive an upper limit of M(H2) < 6 x 10^10 (alpha_x/0.8) M_sun. We also find a tentative 3-s...

  8. Serum level of TSGF,CA242 and CA19-9 in pancreatic cancer

    Institute of Scientific and Technical Information of China (English)

    Jing-Ting Jiang; Chang-Ping Wu; Hai-Feng Deng; Ming-Yang Lu; Jun Wu; Hong-Yu Zhang; Wen-Hui Sun; Mei Ji

    2004-01-01

    AIM: To establish a method to detect the expression of the tumor specific growth factor TSGF, CA242 and CA19-9 in serum and evaluate their value in diagnosis of pancreatic cancer.METHODS: ELISA and Biochemical colorimetric assay were used to detect the serum content of TSGF, CA242 and CA19-9 in 200 normal cases, 52 pancreatitis patients and 96 pancreatic cancer patients.RESULTS: The positive likelihood ratios of TSGF, CA242and CA19-9 were 5.4, 12.6 and 6.3, respectively, and their negative likelihood ratios were 0.10, 0.19 and 0.17,respectively. With single tumor marker diagnosed pancreatic cancer, the highest sensitivity and specificity of TSGF were 91.6% and 93.5%. In combined test with 3 markers, when all of them were positive, the sensitivity changed to 77.0%and the specificity and the positive predictive value were 100%. The levels of TSGF and CA242 were significantly higher in the patients with pancreatic cancer of head than those in the patients with pancreatic cancer of body, tail and whole pancreas, but the expression of CA19-9 had no correlation with the positions of the pancreatic cancer. The sensitivity of TSGF, CA242 and CA19-9 was increased with the progress in stages of pancreatic cancer. In stage I, the sensitivity of TSGF was markedly higher than CA242 and CA19-9.CONCLUSION: The combined use of TSGF, CA242 and CA19-9 expressions can elevate the specificity for pancreatic cancer diagnosis. And it shows that it plays an important role to differentiate positions and tissue typing. It is a forepart diagnosis for the pancreatic cancer by combination checking.There is very important correlation between the three markers and the pancreatic cancer.

  9. Biological Efficiency of Californium-252 Source Evaluated by Comet Assay, Classical Cytogenetics and FISH in Human Lymphocytes Irradiated without and with BSH Pretreatment

    International Nuclear Information System (INIS)

    Biological effectiveness of californium-252 source was evaluated after irradiations in vitro of normal or pre-treated with compound enriched in B-10 ion cells. Peripheral blood lymphocytes were used as a model for human cells. DNA and chromosomal damage were studied to compare biological effectiveness of irradiation. Human blood samples or isolated lymphocytes were irradiated with the isotopic source of 252Cf, at the Faculty of Physics and Nuclear Techniques at the University of Mining and Metallurgy (both neutron source and samples were placed in ''infinite'' polyethylene block). Chemical pretreatment with Na210B12H11SH (BSH) was performed to introduce boron-10 ion into cells in order to check any enhancement effect due to the process of boron neutron capture. Single cell gel electrophoresis also known as the Comet assay was done to investigate the DNA damage. Classical cytogenetic analysis was applied to assess the frequencies of unstable aberrations (dicentrics, rings and a centric fragments). To evaluate the frequencies of stable aberrations the fluorescence in situ hybridisation (FISH) with probes for chromosomes 1, 4 (14.3% of the whole genome) was performed. Linear (or close to linear) increase with radiation dose were observed for the DNA damage and aberration frequencies in lymphocytes both untreated or pre-treated with BSH. Levels of translocations evaluated for the whole genome were comparable with the frequencies of dicentrics and rings. No significant differences were detected due to radiation dose in the frequencies of sister chromatid exchanges (SCE) detected in the second mitosis. No statistically significant differences were observed in various biological end-points between normal or boron pre-treated cells. (author)

  10. Measurement of Neutron Induced and Spontaneous Fission in Pu-242 at DANCE

    Science.gov (United States)

    Chyzh, Andrii; Wu, C. Y.; Henderson, R.; Couture, A.; Lee, H. Y.; Ullmann, J.; O'Donnell, J. M.; Jandel, M.; Haight, R. C.; Bredeweg, T. A.; Dance Collaboration

    2013-10-01

    Neutron capture and fission reactions are important in nuclear engineering and physics. DANCE (Detector for Advanced Neutron Capture Measurement, LANL) combined with PPAC (avalanche technique based fission tagging detector, LLNL) were used to study neutron induced and spontaneous fission in 242Pu. 2 measurements were performed in 2013. The first experiment was done without the incident neutron beam with the fission tagging ability to study γ-rays emitted in the spontaneous fission of 242Pu. The second one - with the neutron beam to measure both the neutron capture and fission reactions. This is the first direct measurement of prompt fission γ-rays in 242Pu. The γ-ray multiplicity, γ-ray energy, and total energy of γ-rays per fission in 242Pu will be presented. These distributions of the 242Pu spontaneous fission will be compared to those in the 241Pu neutron induced fission. This work was performed under the auspices of the US Department of Energy by Los Alamos National Laboratory under Contract DE-AC52-06NA25396 and Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.

  11. CA 242, a new tumour marker for pancreatic cancer: a comparison with CA 19-9, CA 50 and CEA.

    OpenAIRE

    Haglund, C.; Lundin, J; Kuusela, P.; Roberts, P. J.

    1994-01-01

    The serum expression of a novel tumour marker, CA 242, defined by monoclonal antibody C 242, was studied in 179 patients with pancreatic cancer. The results were compared with CA 19-9, CA 50 and CEA. CA 242 is a carbohydrate closely related, but not identical, to CA 19-9 and CA 50. The overall sensitivity of the CA 242 assay was 74%: 55% in stage I, 83% in stage II-III and 78% in stage IV disease. The specificity calculated from 112 patients with benign diseases was 91%. CA 19-9 had a higher ...

  12. Delisting strategy for the Hanford Site 242-A Evaporator PUREX Plant Condensate Treatment Facility

    International Nuclear Information System (INIS)

    This document describes the strategy that the US Department of Energy, Richland Field Office intends to use in preparing the delisting petition for the 242-A Evaporator/PUREX Plant Condensate Treatment Facility. Because the 242-A Evaporator/PUREX Plant Condensate Treatment Facility will not be operational until 1994, the delisting petition will be structured as an up-front petition based on the ''multiple waste treatment facility'' approach outline in the 1985 US Environmental Protection Agency's Petitions to Delist Hazardous Waste. The 242-A evaporator/PUREX Plant Condensate Treatment Facility effluent characterization data will not be available to support the delisting petition, because the delisting petition will be submitted to the US Environmental Protection Agency before start-up of the 242-A Evaporator/PUREX Plant Condensate Treatment Facility. Therefore, the delisting petition will be based on data collected during the pilot plant testing for the 242-A Evaporator/PUREX Plant Condensate Treatment Facility. This pilot plant testing will be conducted on synthetic waste. The composition of the synthetic waste will be based on: (1) constituents of regulatory concern, and (2) on process knowledge. The pilot plant testing will be performed to determine the removal efficiencies of the process equipment at concentrations greater than reasonably could be expected in the actual waste. This strategy document also describes the logic used to develop the synthetic waste, to develop the pilot plant testing program, and to prepare the delisting petition. This strategy document also described how full-scale operating data will be collected during initial operation of the 242-A Evaporator/PUREX Plant Condensate Treatment Facility to verify information presented in the delisting petition

  13. Neutron Induced Fission Measurements of ^242mAm at DANCE

    Science.gov (United States)

    Chyzh, A.; Wu, C. Y.; Macri, R. A.; Agvaanlusan, U.; Parker, W. E.; Wilk, P. A.; Becker, J. A.; Jandel, M.; Bredeweg, T. A.; Fowler, M. M.; Bond, E. M.; Chadwick, M. B.; Clement, R. R.; Couture, A.; O'Donnell, J. M.; Haight, R. C.; Keksis, A. L.; Reifarth, R.; Rundberg, R. S.; Ullmann, J. L.; Vieira, D.; Wilhelmy, J. B.; Wouters, J. M.

    2010-11-01

    Neutron capture and fission reactions on actinieds often present challenges in measuring each of the reaction. Fission tagging detector used along with the Detector for Advanced Neutron Capture Experiments (DANCE) provides a way to measure (n,f) and (n,γ) reactions simultaneously. DANCE was used to measure ^242mAm(n,f) reaction along with a custom made fission-tagging parallel plate avalanche counter (PPAC). The results on fission related γ-ray multiplicity distribution, the ^242mAm(n,f) cross section, and the average γ-ray energy distribution are presented.

  14. Independent Verification of Element 114 Production in the 48Ca+242Pu Reaction

    International Nuclear Information System (INIS)

    Independent verification of the production of element 114 in the reaction of 244-MeV 48Ca with 242Pu is presented. Two chains of time- and position-correlated decays have been assigned to 286114 and 287114. The observed decay modes, half-lives, and decay energies agree with published results. The measured cross sections at a center-of-target energy of 244 MeV for the 242Pu(48Ca,3-4n)287,286114 reactions were 1.4-1.2+3.2 pb each, which are lower than the reported values.

  15. The role of CA-242 and CEA in surveillance following curative resection for colorectal cancer.

    OpenAIRE

    Hall, N. R.; Finan, P. J.; Stephenson, B M; Purves, D. A.; Cooper, E H

    1994-01-01

    This study was undertaken to evaluate the role of a new tumour marker, CA-242, alone or in combination with CEA in the practical management of colorectal cancer patients after potentially curative resection. A cohort of 149 patients who had undergone 'curative' surgery was followed up according to an intensive protocol in order to detect recurrent disease. Over a median tumour marker follow-up period of 24 months there were 25 recurrences in 24 patients. Both CEA and CA-242 alone detected hal...

  16. 17 CFR 242.601 - Dissemination of transaction reports and last sale data with respect to transactions in NMS stocks.

    Science.gov (United States)

    2010-04-01

    ... reports and last sale data with respect to transactions in NMS stocks. 242.601 Section 242.601 Commodity..., AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Nms-Regulation of the... transactions in NMS stocks. (a) Filing and effectiveness of transaction reporting plans. (1) Every...

  17. 40 CFR 436.242 - Effluent limitations guidelines representing the degree of effluent reduction attainable by the...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Effluent limitations guidelines... technology currently available. 436.242 Section 436.242 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) EFFLUENT GUIDELINES AND STANDARDS MINERAL MINING AND PROCESSING POINT SOURCE...

  18. 40 CFR 408.242 - Effluent limitations guidelines representing the degree of effluent reduction attainable by the...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 28 2010-07-01 2010-07-01 true Effluent limitations guidelines representing the degree of effluent reduction attainable by the application of the best practicable control technology currently available. 408.242 Section 408.242 Protection of Environment ENVIRONMENTAL...

  19. Determination of the 242Pu Branching Ratio via Alpha-Gamma Coincidence

    Energy Technology Data Exchange (ETDEWEB)

    Wang, T F

    2012-05-24

    When the burn-up is high, the {sup 242}Pu isotopic content becomes more important. The traditional correlation method will fail. The {sup 242}Pu isotopic content in the sample plays an essential role if the neutron coincidence method is used to quantify the total amount of plutonium. In one of the earlier measurements we had a chance to measure an isotopic pure (> 99.95 %) {sup 242}Pu thick sample and realized that the difference in the branching ratio (BR) value among current nuclear data3) for the two important gamma-rays at 103.5-keV and 158.8-keV. In this study, the thick sample was counted on a 15% ORTEC safeguards type HPGe to further improve BR determination of the 159-keV gamma-ray. Furthermore, we have made a thin {sup 242}Pu sample from the thick sample and performed alpha-gamma coincidence measurements. Our preliminary gamma-ray BR results are 4.37(6) E-4, 2.79(8) E-5, and 2.25(8) E-6 for 44.9-keV, 103.5-keV, and 158.9-keV, respectively.

  20. 48 CFR 1852.242-73 - NASA contractor financial management reporting.

    Science.gov (United States)

    2010-10-01

    ... Provisions and Clauses 1852.242-73 NASA contractor financial management reporting. As prescribed in 1842.7202, insert the following clause: NASA Contractor Financial Management Reporting (NOV 2004) (a) The Contractor shall submit NASA Contractor Financial Management Reports on NASA Forms 533 in accordance with...

  1. Recommendations for the 242Pu content evaluation using a new algorithm

    International Nuclear Information System (INIS)

    Plutonium isotopic determination by gamma spectrometry is an important nondestructive assay (NDA) method widely used by laboratories, operators, and safeguards directorates. Significant improvements have been made in the last few years on plutonium gamma-ray analysis, which have led to a very low discrepancy between gamma measurement and mass spectrometry (≤ ±2%) for the detectable isotopes. This leads to the fact that one important source of error is now the 242Pu content evaluation using correlation with the other isotopes. Moreover, the 242Pu content on the total plutonium is not negligible for typical burnup (it can reach 8 to 10% for burnup of ∼40 GWd/tonne U). This means that a lack of knowledge on the 242Pu content evaluation will generate an important error on the total plutonium mass estimation. The correlation used by many codes (like MGA) is as follows: 242Pu = C240Pu/Pu239241Pu/239Pu. This correlation leads to an average difference between NDA evaluation and mass spectrometry of ∼20%

  2. Determination of the 242Pu Branching Ratio via Alpha-Gamma Coincidence

    International Nuclear Information System (INIS)

    When the burn-up is high, the 242Pu isotopic content becomes more important. The traditional correlation method will fail. The 242Pu isotopic content in the sample plays an essential role if the neutron coincidence method is used to quantify the total amount of plutonium. In one of the earlier measurements we had a chance to measure an isotopic pure (> 99.95 %) 242Pu thick sample and realized that the difference in the branching ratio (BR) value among current nuclear data3) for the two important gamma-rays at 103.5-keV and 158.8-keV. In this study, the thick sample was counted on a 15% ORTEC safeguards type HPGe to further improve BR determination of the 159-keV gamma-ray. Furthermore, we have made a thin 242Pu sample from the thick sample and performed alpha-gamma coincidence measurements. Our preliminary gamma-ray BR results are 4.37(6) E-4, 2.79(8) E-5, and 2.25(8) E-6 for 44.9-keV, 103.5-keV, and 158.9-keV, respectively.

  3. 17 CFR 242.608 - Filing and amendment of national market system plans.

    Science.gov (United States)

    2010-04-01

    ... EXCHANGE COMMISSION (CONTINUED) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Nms-Regulation of the National Market System § 242.608 Filing and amendment of... Regulation NMS and part 240, subpart A of this chapter shall, in addition to compliance with this...

  4. Prompt fission γ -ray spectrum characteristics from 240Pu(sf ) and 242Pu(sf )

    Science.gov (United States)

    Oberstedt, S.; Oberstedt, A.; Gatera, A.; Göök, A.; Hambsch, F.-J.; Moens, A.; Sibbens, G.; Vanleeuw, D.; Vidali, M.

    2016-05-01

    In this paper we present first results for prompt fission γ -ray spectra (PFGS) characteristics from the spontaneous fission (sf) of 240Pu and 242Pu. For 242Pu(sf ) we obtained, after proper unfolding of the detector response, an average energy per photon ɛ¯γ=(0.843 ±0.012 ) MeV, an average multiplicity M¯γ=(6.72 ±0.07 ) , and an average total γ -ray energy release per fission E¯γ ,tot = (5.66 ± 0.06) MeV. The 240Pu(sf ) emission spectrum was obtained by applying a so-called detector-response transformation function determined from the 242Pu spectrum measured in exactly the same geometry. The results are an average energy per photon ɛ¯γ=(0.80 ±0.07 ) MeV, the average multiplicity M¯γ = (8.2 ± 0.4), and an average total γ -ray energy release per fission E¯γ ,tot = (6.6 ± 0.5) MeV. The PFGS characteristics for 242Pu(sf ) are in very good agreement with those from thermal-neutron-induced fission on 241Pu and scales well with the corresponding prompt neutron multiplicity. Our results in the case of 240Pu(sf ), although drawn from a limited number of events, show a significantly enhanced average multiplicity and average total energy, but may be understood from a different fragment yield distribution in 240Pu(sf ) compared to that of 242Pu(sf ).

  5. Analytical services: 222-S characterization of 242-A Evaporator Slurry, Campaign 94-1. Addendum 1A

    International Nuclear Information System (INIS)

    During the 242-A Evaporator's 94-1 campaign, five process samples were collected from the slurry stream for waste characterization. The five samples were collected over a 36 day time span, respectively on May 4, May 9, May 16, May 23, and June 9, 1994. Sample collections were performed per the protocol described in 242-A Evaporator Waste Analysis Plan, WHC-SD-WM-EV-060, Rev. 3 and in 242-A Evaporator Quality Assurance Project Plan, WHC-SD-WM-QAPP-009, Rev. 0. Slurry waste was characterized chemically and radiochemically by the Westinghouse Hanford Company, 222-S Laboratory as directed

  6. Analytical services: 222-S characterization of 242-A Evaporator Slurry, Campaign 94-1. Addendum 1A

    Energy Technology Data Exchange (ETDEWEB)

    1994-09-13

    During the 242-A Evaporator`s 94-1 campaign, five process samples were collected from the slurry stream for waste characterization. The five samples were collected over a 36 day time span, respectively on May 4, May 9, May 16, May 23, and June 9, 1994. Sample collections were performed per the protocol described in 242-A Evaporator Waste Analysis Plan, WHC-SD-WM-EV-060, Rev. 3 and in 242-A Evaporator Quality Assurance Project Plan, WHC-SD-WM-QAPP-009, Rev. 0. Slurry waste was characterized chemically and radiochemically by the Westinghouse Hanford Company, 222-S Laboratory as directed.

  7. Measurement of the 240Am production cross section via proton irradiation of 242Pu

    International Nuclear Information System (INIS)

    A new nuclear reaction for the production of 240Am was experimentally investigated. Targets of 150-500 μg/cm2242Pu on 2 μm Ti were produced through molecular deposition. Five irradiations, in which 242Pu, natTi, and natNi targets were jointly activated with protons from the Lawrence Berkeley National Laboratory 88-Inch Cyclotron produced 240Am, 48V, and 57Ni, respectively. The radioactive decay of these nuclides was monitored using high-purity Ge gamma ray detectors in the weeks following irradiation. A maximum 242Pu(p, 3n)240Am nuclear reaction cross section was measured to be 45 ± 13 mb with 23 MeV protons. While this value is lower than theoretical predictions, it is high enough to be the most viable nuclear reaction for the large-scale production of 240Am. (orig.)

  8. New Superheavy Element Isotopes: 242Pu(48Ca,5n)285114

    International Nuclear Information System (INIS)

    The new, neutron-deficient, superheavy element isotope 285114 was produced in 48Ca irradiations of 242Pu targets at a center-of-target beam energy of 256 MeV (E*=50 MeV). The α decay of 285114 was followed by the sequential α decay of four daughter nuclides, 281Cn, 277Ds, 273Hs, and 269Sg. 265Rf was observed to decay by spontaneous fission. The measured α-decay Q values were compared with those from a macroscopic-microscopic nuclear mass model to give insight into superheavy element shell effects. The 242Pu(48Ca,5n)285114 cross section was 0.6-0.5+0.9 pb.

  9. Sequence and batch language programs and alarm related C Programs for the 242-A MCS

    Energy Technology Data Exchange (ETDEWEB)

    Berger, J.F.

    1996-04-15

    A Distributive Process Control system was purchased by Project B-534, 242-A Evaporator/Crystallizer Upgrades. This control system, called the Monitor and Control system (MCS), was installed in the 242-A evaporator located in the 200 East Area. The purpose of the MCS is to monitor and control the Evaporator and monitor a number of alarms and other signals from various Tank Farm facilities. Applications software for the MCS was developed by the Waste Treatment Systems Engineering (WTSE) group of Westinghouse. The standard displays and alarm scheme provide for control and monitoring, but do not directly indicate the signal location or depict the overall process. To do this, WTSE developed a second alarm scheme.

  10. New Superheavy Element Isotopes: 242Pu(48Ca,5n)285114

    Energy Technology Data Exchange (ETDEWEB)

    Ellison, Paul A; Gregorich, Kenneth E.; Berryman, Jill S.; Bleuel, Darren L.; Clark, Roderick M.; Dragojevic, Irena; Dvorak, Jan; Fallon, Paul; Fineman-Sotomayor, Carolina; Gates, Jacklyn M.; Gothe, Oliver R.; Lee, I-Yang; Loveland, Walter D.; McLaughlin, Joseph P.; Paschalis, Stefanos; Petri, Marina-Kalliopi; Qian, Jing; Stavsetra, Liv; Wiedeking, Mathis; Nitsche, Heino

    2010-10-22

    The new, neutron-deficient, superheavy element isotope {sup 285}114 was produced in {sup 48}Ca irradiations of {sup 242}Pu targets at a center-of-target beam energy of 256 MeV (E* = 50 MeV). The {alpha} decay of {sup 285}114 was followed by the sequential {alpha} decay of four daughter nuclides, {sup 281}Cn, {sup 277}Ds, {sup 273}Hs, and {sup 269}Sg. {sup 265}Rf was observed to decay by spontaneous fission. The measured {alpha}-decay Q values were compared with those from a macroscopic-microscopic nuclear mass model to give insight into superheavy element shell effects. The {sup 242}Pu({sup 48}Ca,5n){sup 285}114 cross section was 0.6{sub -0.5}{sup +0.9} pb.

  11. Clinical evaluation of a new serum tumour marker CA 242 in pancreatic carcinoma.

    OpenAIRE

    Pasanen, P. A.; Eskelinen, M.; Partanen, K.; Pikkarainen, P; Penttilä, I.; Alhava, E

    1992-01-01

    The aim of this study was to evaluate the new monoclonal tumour marker CA 242 in the diagnosis of pancreatic carcinoma and to compare it with the established markers CA 50 and CEA. Serum concentrations were determined in 113 patients with jaundice, in 20 patients with laboratory values suggesting cholestasis, and in 60 patients with a suspicion to have chronic pancreatitis. Twenty-four of these 193 patients had pancreatic carcinoma and two patients had carcinoma of papilla of Vater. The sensi...

  12. Measurement of the 242Pu(n,f cross section at n_TOF

    Directory of Open Access Journals (Sweden)

    Tsinganis A.

    2014-03-01

    Full Text Available Knowledge of neutron cross sections of various plutonium isotopes and other minor actinides is crucial for the design of advanced nuclear systems. The 242Pu(n,f cross sections were measured at the CERN n_TOF facility, taking advantage of the wide energy range (from thermal to GeV and the high instantaneous flux of the neutron beam. In this work, preliminary results are presented along with a theoretical cross section calculation performed with the EMPIRE code.

  13. Reliable determination of 237Np in environmental solid samples using 242Pu as a potential tracer

    DEFF Research Database (Denmark)

    Qiao, Jixin; Hou, Xiaolin; Roos, Per;

    2011-01-01

    onto various AG 1-type anion exchangers; suitability of 242Pu as a tracer for 237Np determination in environmental solid samples; and long-term chemical stability of tetravalent Np. Experimental results revealed that the degree of resin cross-linking has a significant influence on the separation...... efficiency in terms of chemical yields of 237Np and removal of interfering nuclides. Although ca. 30% of sorbed Np onto AG 1-×4 was stripped out during HCl rinsing step for the removal of Th, chemical yield ratios of 237Np to 242Pu were proven steady with an average value of 0.67±0.04 (n=15) under selected......, thereby demonstrating the usefulness of 242Pu as a non-isotopic tracer for 237Np chemical yield monitoring. The on-column separation procedure fosters rapid analysis as required in emergency situations since each individual sample can be handled within 2.5h, and leads to a significant decrease in labor...

  14. Flurbiprofen benzyl nitrate (NBS-242) inhibits the growth of A-431 human epidermoid carcinoma cells and targets β-catenin

    Science.gov (United States)

    Nath, Niharika; Liu, Xiaoping; Jacobs, Lloydine; Kashfi, Khosrow

    2013-01-01

    Background The Wnt/β-catenin/T cell factor (TCF) signaling pathway is important in the development of nonmelanoma skin cancers (NMSCs). Nitric-oxide-releasing nonsteroidal anti-inflammatory drugs (NO-NSAIDs) are chemopreventive agents consisting of a traditional NSAID attached to an NO-releasing moiety through a chemical spacer. Previously we showed that an aromatic spacer enhanced the potency of a particular NO-NSAID compared to an aliphatic spacer. Methods We synthesized an NO-releasing NSAID with an aromatic spacer (flurbiprofen benzyl nitrate, NBS-242), and using the human skin cancer cell line A-431, we evaluated its effects on cell kinetics, Wnt/β-catenin, cyclin D1, and caspase-3. Results NBS-242 inhibited the growth of A-431 cancer cells, being ~15-fold more potent than flurbiprofen and up to 5-fold more potent than NO-flurbiprofen with an aliphatic spacer, the half maximal inhibitory concentrations (IC50) for growth inhibition being 60 ± 4 μM, 320 ± 20 μM, and 880 ± 65 μM for NBS-242, NO-flurbiprofen, and flurbiprofen, respectively. This effect was associated with inhibition of proliferation, accumulation of cells in the G0/G1 phase of the cell cycle, and an increase in apoptotic cell population. NBS-242 cleaved β-catenin both in the cytoplasm and the nucleus of A-431 cells. NBS-242 activated caspase-3 whose activation was reflected in the cleavage of procaspase-3. To test the functional consequence of β-catenin cleavage, we determined the expression of cyclin D1, a Wnt-response gene. NBS-242 reduced cyclin D1 levels in a concentration dependent manner. Conclusion These findings establish a strong inhibitory effect of NBS-242 in A-431 human epidermoid carcinoma cells. NBS-242 modulates parameters that are important in determining cellular mass. PMID:23690679

  15. Project C-018H, 242-A Evaporator/PUREX Plant Process Condensate Treatment Facility, functional design criteria. Revision 3

    International Nuclear Information System (INIS)

    This document provides the Functional Design Criteria (FDC) for Project C-018H, the 242-A Evaporator and Plutonium-Uranium Extraction (PUREX) Plant Condensate Treatment Facility (Also referred to as the 200 Area Effluent Treatment Facility [ETF]). The project will provide the facilities to treat and dispose of the 242-A Evaporator process condensate (PC), the Plutonium-Uranium Extraction (PUREX) Plant process condensate (PDD), and the PUREX Plant ammonia scrubber distillate (ASD)

  16. Functional design criteria for the 242-A evaporator and PUREX [Plutonium-Uranium Extraction] Plant condensate interim retention basin

    International Nuclear Information System (INIS)

    This document contains the functional design criteria for a 26- million-gallon retention basin and 10 million gallons of temporary storage tanks. The basin and tanks will be used to store 242-A Evaporator process condensate, the Plutonium-Uranium Extraction (PUREX) Plant process distillate discharge stream, and the PUREX Plant ammonia scrubber distillate stream. Completion of the project will allow both the 242-A Evaporator and the PUREX Plant to restart. 4 refs

  17. Californium Recovery from Palladium Wire

    Energy Technology Data Exchange (ETDEWEB)

    Burns, Jon D. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)

    2014-08-01

    The recovery of 252Cf from palladium-252Cf cermet wires was investigated to determine the feasibility of implementing it into the cermet wire production operation at Oak Ridge National Laboratory’s Radiochemical Engineering Development Center. The dissolution of Pd wire in 8 M HNO3 and trace amounts of HCl was studied at both ambient and elevated temperatures. These studies showed that it took days to dissolve the wire at ambient temperature and only 2 hours at 60°C. Adjusting the ratio of the volume of solvent to the mass of the wire segment showed little change in the kinetics of dissolution, which ranged from 0.176 mL/mg down to 0.019 mL/mg. A successful chromatographic separation of 153Gd, a surrogate for 252Cf, from Pd was demonstrated using AG 50x8 cation exchange resin with a bed volume of 0.5 mL and an internal diameter of 0.8 cm.

  18. 242-A Evaporator/Liquid Effluent Retention Facility data quality objectives

    Energy Technology Data Exchange (ETDEWEB)

    Von Bargen, B.H.

    1994-09-29

    The purpose of data quality objectives (DQO) is to determine the most cost effective methods of gathering the essential data necessary to make decisions to support successful operation of the facility. The essential data is defined by such information as sample amount, sample location, required analyses, and how sampling and analyses are performed. Successful operation is defined as meeting the campaign objectives while operating within established requirements. This DQO document addresses that portion of the system from 242-A Evaporator candidate feed tanks through discharge of process condensate to the Liquid Effluent Retention of Facility (LERF). Later revisions will incorporate and integrate the entire system, including the Effluent Treatment Facility (ETF).

  19. Pattern of leukemias : a ten-year incidence study of 242 cases.

    Directory of Open Access Journals (Sweden)

    D«SQ»Costa G

    1989-10-01

    Full Text Available This paper presents an analysis of data collected from 242 cases of acute and chronic leukemia observed during a 10-year period. The incidence of childhood leukemia was 26.45%. In the present series, it was 35.95% for ALL, 21.9% AML, 38.4% CML and 2.89% CLL. The incidences of ALL and CML were found comparable to other series from Bombay. The geographical variations in the pattern of leukemias as observed in India are discussed.

  20. Directed mutagenesis of the strongly conserved aspartate 242 in the beta-subunit of Escherichia coli proton-ATPase.

    Science.gov (United States)

    Al-Shawi, M K; Parsonage, D; Senior, A E

    1988-12-25

    Oligonucleotide-directed mutagenesis was used to substitute Asn or Val for residue Asp-242 in the beta-subunit of Escherichia coli F1-ATPase. Asp-242 is strongly conserved in beta-subunits of F1-ATPase enzymes, in a region of sequence which shows homology with numerous nucleotide-binding proteins. By analogy with adenylate kinase (Fry, D.C., Kuby, S.A., and Mildvan, A.S. (1986) Proc. Natl. Acad. Sci. U.S.A. 83, 907-911), beta-Asp-242 of F1-ATPase might participate in catalysis through electrostatic effects on the substrate Mg2+ or through hydrogen bonding to the substrate(s); an acid-base catalytic role is also plausible. The substitutions Asn and Val were chosen to affect the charge, hydrogen-bonding ability, and hydrophobicity of residue beta-Asp-242. Both mutations significantly impaired oxidative phosphorylation rates in vivo and membrane ATPase and ATP-driven proton-pumping activities in vitro. Asn-242 was more detrimental than Val-242. Purified soluble mutant F1-ATPases had normal molecular size and subunit composition, and displayed 7% (beta-Asn-242) and 17% (beta-Val-242) of normal specific Mg-ATPase activity. The relative MgATPase activities of both mutant enzymes showed similar pH dependence to normal. Relative MgATPase and CaATPase activities of normal and mutant enzymes were compared at widely varied pMg and pCa. The mutations had little effect on KM MgATP, but KM CaATP was reduced. The data showed that the carboxyl side-chain of beta-Asp-242 is not involved in catalysis either as a general acid-base catalyst or through direct involvement in any protonation/deprotonation-linked mechanism, nor is it likely to be directly involved in liganding to substrate Mg2+ during the reaction. Specificity constants (kcat/KM) for MgATP and CaATP were reduced in both mutant enzymes, showing that the mutations destabilized interactions between the catalytic nucleotide-binding domain and the transition state.

  1. Tissue expression of the tumour associated antigen CA242 in benign and malignant pancreatic lesions. A comparison with CA 50 and CA 19-9.

    OpenAIRE

    Haglund, C.; Lindgren, J.; Roberts, P. J.; Kuusela, P.; Nordling, S.

    1989-01-01

    The expression of a novel tumour associated antigen CA 242, defined by the monoclonal antibody C 242, was studied by immunoperoxidase staining in formalin-fixed, paraffin-embedded tissue sections from normal pancreata, pancreata with pancreatitis and benign and malignant pancreatic neoplasms. The antigenic determinant of the C 242 antibody is a sialylated carbohydrate structure, related but chemically different from tumour marker antigens CA 19-9 and CA 50. Thirty-eight of 41 (93%) well to mo...

  2. Combined detection of preoperative serum CEA, CA19-9 and CA242 improve prognostic prediction of surgically treated colorectal cancer patients

    OpenAIRE

    Wang, Jingtao; Xiao WANG; Yu, Fudong; Chen, Jian; Zhao, Senlin; Zhang, Dongyuan; YU, Yang; Liu, Xisheng; Tang, Huamei; Peng, Zhihai

    2015-01-01

    We assessed the prognostic significance of preoperative serum carcinoembryonic antigen (CEA), carbohydrate antigen 19-9 (CA19-9) and carbohydrate antigen 242 (CA242) levels in surgically treated colorectal cancer patients. The relationship of preoperative serum CEA, CA19-9 and CA242 levels with disease characteristics was investigated in 310 patients. Correlation between tumor markers was investigated using Pearson correlation test. Univariate and multivariate survival analyses were used to s...

  3. The diagnostic value of joint detection of serum CA19-9, CA125 and CA242 for cholangiocarcinoma

    Institute of Scientific and Technical Information of China (English)

    Cui Da-Peng; Han Lei; Liu Zhen-Xian; Yang He; Zhang Ying-Chun

    2016-01-01

    Objective:To study the diagnostic value of joint detection of serum CA19-9, CA125 and CA242 for cholangiocarcinoma.Methods:A total of 35 patients with cholangiocarcinoma who received surgical resection in our hospital were selected as malignant group, 30 patients with cholelithiasis who received surgical resection in our hospital during the same period were selected as benign group, serum samples were collected before surgery to determine CA19-9, CA125 and CA242 content, and cholangiocarcinoma tissue and normal bile duct tissue were collected after surgery to determine the content of proliferation and invasion molecules. Results:Serum CA19-9, CA125 and CA242 levels of malignant group were significantly higher than those of control group; PROX-1, Ki-67, Bcl-2, Bad, Gab1, LOXL2, TRPM7 and CXCL12 levels in cholangiocarcinoma tissue were higher than those in benign bile duct tissue, and E-cadherin level was lower than that in benign bile duct tissue; serum CA19-9, CA125 and CA242 levels were positively correlated with PROX-1, Ki-67, Bcl-2, Bad, Gab1, LOXL2, TRPM7 and CXCL12 levels, and negatively correlated with E-cadherin level.Conclusion:Joint detection of serum CA19-9, CA125 and CA242 can not only provide reference for the diagnosis of cholangiocarcinoma, but can also provide basis for the evaluation of proliferation, invasion and other malignant biological behaviors.

  4. Measurement of the neutron-induced fission cross sections of /sup 242/Cm and /sup 238/Pu

    International Nuclear Information System (INIS)

    The neutron-induced fission cross sections of /sup 242/Cm and /sup 238/Pu have been measured from 0.1 eV to 100 keV using the Rensselaer Intense Neutron Spectrometer. Fission areas and widths were determined for several resolved low-energy resonances of /sup 242/Cm and /sup 238/Pu. The fission resonance integrals for /sup 242/Cm and /sup 238/Pu were found to be 12.9 +- 0.7 and 15.9 +- 0.6 b, respectively. The gross structure observed in the unresolved energy region of the /sup 242/Cm and /sup 238/Pu fission cross sections is suggestive of intermediate structure, and is consistent with the second well lying 2 to 3 MeV above the first well. The ENDF/B-V library fission cross section of /sup 238/Pu is, in general, not in good agreement with this measurement and a new evaluation is recommended. This is the first reported fission measurement of /sup 242/Cm in the 0.1-eV through 100-keV energy range

  5. Sensitivity and specificity of CA242 in gastro-intestinal cancer. A comparison with CEA, CA50 and CA 19-9.

    OpenAIRE

    Nilsson, O; Johansson, C.; Glimelius, B.; Persson, B.; Nørgaard-Pedersen, B.; Andrén-Sandberg, A.; Lindholm, L.

    1992-01-01

    A serological assay for the quantitative determination of the novel tumour-associated epitope CA242 was developed and used for determination of sensitivity and specificity of CA242 in gastrointestinal cancer. The CA242 assay showed a better tumour specificity than CA50 (and CA 19-9). This was most noticeable in benign hepatobiliary disease. The sensitivity at 90% specificity cut-off level was approximately three times higher for CA242 compared to CA50 in colo-rectal cancer Dukes A, B and C, w...

  6. 232Th、233U、238Pu、240Pu、242Pu、241Am、242Cm、243Cm和244Cm的裂变释放热能研究%Thermal Energy Released in Fission of 232 Th,233 U,238 Pu, 240 Pu,242 Pu,241 Am,242 Cm,243 Cm and 244 Cm

    Institute of Scientific and Technical Information of China (English)

    赵艳飞; 马续波; 陈义学

    2013-01-01

    In the nuclear reactor design ,the precise calculation of thermal fission energy is of great significance .In the pressurized water reactor ,high energy neutron-induced fission rarely occurs ,the isotopes including 233 U ,241 Am and 243 Cm are mostly induced by thermal neutrons ,while the other isotopes such as 232Th ,238Pu ,240Pu ,242Pu ,242Cm and 244 Cm are by fast neutron . In order to carry out this work , the nuclear data extracted from the latest evaluated nuclear data file (ENDF/B-Ⅶ ) were adopted ,and the energy-conservation law for the calculation of total fission energy were used , meanw hile ,with the consideration of capture energy and the correction of βand γ ,the thermal fission energy of nine isotopes was obtained .Compared with the data excerpted from IAEA issued WIMS-D database ,the results are reasonable .The thermal fission energy and its uncertainties of the nine isotopes are :(193.939 ± 0.176) MeV for 232 Th , (200.063 ± 0.084) MeV for 233 U ,(208.786 ± 1.133 ) MeV for 238 Pu ,(211.266 ± 0.220 ) MeV for 240 Pu ,(213.862 ± 0.299 ) MeV for 242 Pu ,(215.077 ± 0.210 ) MeV for 241 Am ,(218.821 ± 0.159) MeV for 242Cm ,(218.525 ± 0.388) MeV for 243Cm ,and (220.067 ± 0.131) MeV for 244 Cm ,respectively .%在核反应堆设计中,对每次裂变释放热能进行精确计算具有重要意义。在压水堆内,高能中子诱发核裂变份额很小,233 U、241 Am、243 Cm主要由热中子诱发裂变,232 T h、238 Pu、240 Pu、242 Pu、242 Cm、244 Cm主要由快中子诱发裂变。本文采用最新的核评价数据库 ENDF/B-Ⅶ,利用质量守恒法计算裂变释放总能,同时研究了中微子带走的能量,中子俘获能及β、γ修正项,最终给出了9种核素裂变释放热能。与IAEA颁布的WIMS-D格式数据库中的裂变释放热能数据的对比表明,本文所用方法计算结果合理。9种核素每次裂变释放热能分别为:232 Th ,(193.939±0.176) MeV ;233 U ,(200.063

  7. Process control plan for 242-A Evaporator Campaign 95-1

    Energy Technology Data Exchange (ETDEWEB)

    Le, E.Q.; Guthrie, M.D.

    1995-05-18

    The wastes from tanks 106-AP, 107-AP, and 106-AW have been selected to be candidate feed wastes for Evaporator Campaign 95-1. The wastes in tank 106-AP and 107-AP are primarily from B-Plant strontium processing and PUREX neutralized cladding removal, respectively. The waste in tank 106-AW originated primarily from the partially concentrated product from 242-A Evaporator Campaign 94-2. Approximately 8.67 million liters of waste from these tanks will be transferred to tank 102-AW during the campaign. Tank 102-AW is the dedicated waste feed tank for the evaporator and currently contains 647,000 liters of processable waste. The purpose of the 242-A Evaporator Campaign 95-1 Process Control Plan (hereafter referred to as PCP) is to certify that the wastes in tanks 106-AP, 107-AP, 102-AW, and 106-AW are acceptable for processing through evaporator and provide a general description of process strategies and activities which will take place during Campaign 95-1. The PCP also summarizes and presents a comprehensive characterization of the wastes in these tanks.

  8. Direct Detection of Pu-242 with a Metallic Magnetic Calorimeter Gamma-Ray Detector

    Science.gov (United States)

    Bates, C.; Pies, C.; Kempf, S.; Hengstler, D.; Fleischmann, A.; Gastaldo, L.; Enss, C.; Friedrich, S.

    2016-07-01

    Cryogenic high-resolution γ -ray detectors can improve the accuracy of non-destructive assay (NDA) of nuclear materials in cases where conventional high-purity germanium detectors are limited by line overlap or by the Compton background. We have improved the performance of gamma detectors based on metallic magnetic calorimeters (MMCs) by separating the 0.5 × 2 × 0.25 mm3 Au absorber from the Au:Er sensor with sixteen 30-\\upmu m-diameter Au posts. This ensures that the entire γ -ray energy thermalizes in the absorber before heating the Au:Er sensor, and improves the energy resolution at 35 mK to as low as 90 eV FWHM at 60 keV. This energy resolution enables the direct detection of γ -rays from Pu-242, an isotope that cannot be measured by traditional NDA and whose concentration is therefore inferred through correlations with other Pu isotopes. The Pu-242 concentration of 11.11 ± 0.42 % measured by NDA with MMCs agrees with mass spectrometry results and exceeds the accuracy of correlation measurements.

  9. Tumour associated antigen CA-50, CA-242 immunoradiometric assay (IRMA) in genitourinary malignancy and gastrointestinal carcinoma early diagnosis

    International Nuclear Information System (INIS)

    Tumour markers CA-50 and CA-242 were measured by immunometric assay (IRMA) to investigate their usefulness in the diagnosis of cancer of the pancreas, biliary tract, liver, breast, lung, gastrointestinal and genitourinary systems. The cutoff points, derived from studies on normal subjects and those with proven benign disease, were 20 u/ml and 12 u/ml for CA-50 and CA-242 respectively. Both markers were found to be generally useful with significant differences between malignant and non malignant disease. The highest positive rates, were found in cancers of the pancreas and gall bladder. The overall rate of false positives was low. It is concluded that measurements of CA-50 and CA-242 are useful in the detection of malignancy, particularly of the pancreas and biliary tract. 2 figs, 2 tabs

  10. Design of a homogeneous subcritical nuclear reactor based on thorium with a source of californium 252; Diseno de un reactor nuclear subcritico homogeneo a base de Torio con una fuente de Californio 252

    Energy Technology Data Exchange (ETDEWEB)

    Delgado H, C. E.; Vega C, H. R. [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas, Zac. (Mexico); Sajo B, L., E-mail: ce_delgado89@hotmail.com [Universidad Simon Bolivar, Laboratorio de Fisica Nuclear, Apdo. 89000, 1080A Caracas (Venezuela, Bolivarian Republic of)

    2015-10-15

    Full text: One of the energy alternatives to fossil fuels which do not produce greenhouse gases is the nuclear energy. One of the drawbacks of this alternative is the generation of radioactive wastes of long half-life and its relation to the generation of nuclear materials to produce weapons of mass destruction. An option to these drawbacks of nuclear energy is to use Thorium as part of the nuclear fuel which it becomes in U{sup 233} when capturing neutrons, that is a fissile material. In this paper Monte Carlo methods were used to design a homogeneous subcritical reactor based on thorium. As neutron reflector graphite was used. The reactor core is homogeneous and is formed of 70% light water as moderator, 12% of enriched uranium UO{sub 2}(NO{sub 3}){sub 4} and 18% of thorium Th(NO{sub 3}){sub 4} as fuel. To start the nuclear fission chain reaction an isotopic source of californium 252 was used with an intensity of 4.6 x 10{sup 7} s{sup -1}. In the design the value of the effective multiplication factor, whose value turned out k{sub eff} <1 was calculated. Also, the neutron spectra at different distances from the source and the total fluence were calculated, as well as the values of the ambient dose equivalent in the periphery of the reactor. (Author)

  11. Tumor markers CA19-9, CA242 and CEA in the diagnosis of pancreatic cancer: a meta-analysis

    OpenAIRE

    Zhang, Yimin; Yang, Jun; Li, Hongjuan; WU, YIHUA; Zhang, Honghe; Chen, Wenhu

    2015-01-01

    Background: Pancreatic cancer has the worst prognosis and early detection is crucial for improving patient prognosis. Therefore, we performed a meta-analysis to evaluate and compare the sensitivity and specificity of single test of CA19-9, CA242, and CEA, as well as combination test in pancreatic cancer detection. Methods: We searched PubMed, Embase, Medline, and Wanfang databases for studies that evaluated the diagnostic validity of CA19-9, CA242, and CEA between January 1990 and September 2...

  12. 17q24.2 microdeletions: a new syndromal entity with intellectual disability, truncal obesity, mood swings and hallucinations

    OpenAIRE

    Vergult, Sarah; Dauber, Andrew; Chiaie, Barbara Delle; Van Oudenhove, Elke; Simon, Marleen; Rihani, Ali; Loeys, Bart; Hirschhorn, Joel; Pfotenhauer, Jean; Phillips, John A.; Mohammed, Shehla; Ogilvie, Caroline; Crolla, John; Mortier, Geert; Menten, Björn

    2011-01-01

    Although microdeletions of the long arm of chromosome 17 are being reported with increasing frequency, deletions of chromosome band 17q24.2 are rare. Here we report four patients with a microdeletion encompassing chromosome band 17q24.2 with a smallest region of overlap of 713 kb containing five Refseq genes and one miRNA. The patients share the phenotypic characteristics, such as intellectual disability (4/4), speech delay (4/4), truncal obesity (4/4), seizures (2/4), hearing loss (3/4) and ...

  13. THE FLAMMABILITY ANALYSIS AND TIME TO REACH LOWER FLAMMABILITY LIMIT CALCULATIONS ON THE WASTE EVAPORATION AT 242-A EVAPORATOR

    Energy Technology Data Exchange (ETDEWEB)

    HU TA

    2007-10-31

    This document describes the analysis of the waste evaporation process on the flammability behavior. The evaluation calculates the gas generation rate, time to reach 25% and 100% of the lower flammability limit (LFL), and minimum ventilation rates for the 242-A Evaporator facility during the normal evaporation process and when vacuum is lost. This analysis performs flammability calculations on the waste currently within all 28 double-shell tanks (DST) under various evaporation process conditions to provide a wide spectrum of possible flammable gas behavior. The results of this analysis are used to support flammable gas control decisions and support and upgrade to Documented Safety Analysis for the 242-A Evaporator.

  14. Flurbiprofen benzyl nitrate (NBS-242 inhibits the growth of A-431 human epidermoid carcinoma cells and targets ß-catenin

    Directory of Open Access Journals (Sweden)

    Nath N

    2013-05-01

    Full Text Available Niharika Nath,1,2 Xiaoping Liu,3 Lloydine Jacobs,1 Khosrow Kashfi1,3 1Department of Physiology, Pharmacology, and Neuroscience, Sophie Davis School of Biomedical Education, City University of New York Medical School, New York, NY, USA; 2Department of Life Sciences, New York Institute of Technology, New York, NY, USA; 3Division of Cancer Prevention, Department of Medicine, Stony Brook University, Stony Brook, NY, USA Background: The Wnt/ß-catenin/T cell factor (TCF signaling pathway is important in the development of nonmelanoma skin cancers (NMSCs. Nitric-oxide-releasing nonsteroidal anti-inflammatory drugs (NO-NSAIDs are chemopreventive agents consisting of a traditional NSAID attached to an NO-releasing moiety through a chemical spacer. Previously we showed that an aromatic spacer enhanced the potency of a particular NO-NSAID compared to an aliphatic spacer. Methods: We synthesized an NO-releasing NSAID with an aromatic spacer (flurbiprofen benzyl nitrate, NBS-242, and using the human skin cancer cell line A-431, we evaluated its effects on cell kinetics, Wnt/ß-catenin, cyclin D1, and caspase-3. Results: NBS-242 inhibited the growth of A-431 cancer cells, being ~15-fold more potent than flurbiprofen and up to 5-fold more potent than NO-flurbiprofen with an aliphatic spacer, the half maximal inhibitory concentrations (IC50 for growth inhibition being 60 ± 4 µM, 320 ± 20 µM, and 880 ± 65 µM for NBS-242, NO-flurbiprofen, and flurbiprofen, respectively. This effect was associated with inhibition of proliferation, accumulation of cells in the G0/G1 phase of the cell cycle, and an increase in apoptotic cell population. NBS-242 cleaved ß-catenin both in the cytoplasm and the nucleus of A-431 cells. NBS-242 activated caspase-3 whose activation was reflected in the cleavage of procaspase-3. To test the functional consequence of ß-catenin cleavage, we determined the expression of cyclin D1, a Wnt-response gene. NBS-242 reduced cyclin D1 levels

  15. Measurement of the $^{240,242}$Pu(n,f) cross section at the CERN n_TOF facility

    CERN Document Server

    Tsinganis, A; Guerrero, C; Colonna, N; Calviani, M; Vlastou, R; Andriamonje, S; Vlachoudis, V; Gunsing, F; Massimi, C; Altstadt, S; Andrzejewski, J; Audouin, L; Barbagallo, M; Bécares, V; Becvár, F; Belloni, F; Billowes, J; Boccone, V; Bosnar, D; Brugger, M; Calviño, F; Cano-Ott, D; Carrapiço, C; Cerutti, F; Chin, M; Cortés, G; Cortés-Giraldo, M A; Diakaki, M; Domingo-Pardo, C; Duran, I; Dressler, R; Dzysiuk, N; Eleftheriadis, C; Ferrari, A; Fraval, K; Ganesan, S; García, A R; Giubrone, G; Gómez-Hornillos, M B; Gonçalves, I F; González-Romero, E; Griesmayer, E; Gurusamy, P; Hernández-Prieto, A; Jenkins, D G; Jericha, E; Kadi, Y; Käppeler, F; Karadimos, D; Kivel, N; Koehler, P; Kokkoris, M; Krtiˇcka, M; Kroll, J; Lampoudis, C; Langer, C; Leal-Cidoncha, E; Lederer, C; Leeb, H; Leong, L S; Losito, R; Mallick, A; Manousos, A; Marganiec, J; Martínez, T; Mastinu, P F; Mastromarco, M; Meaze, M; Mendoza, E; Mengoni, A; Milazzo, P M; Mingrone, F; Mirea, M; Mondalaers, W; Paradela, C; Pavlik, A; Perkowski, J; Plompen, A; Praena, J; Quesada, J M; Rauscher, T; Reifarth, R; Riego, A; Robles, M S; Roman, F; Rubbia, C; Sabaté-Gilarte, M; Sarmento, R; Saxena, A; Schillebeeckx, P; Schmidt, S; Schumann, D; Tagliente, G; Tain, J L; Tarrío, D; Tassan-Got, L; Valenta, S; Vannini, G; Variale, V; Vaz, P; Ventura, A; Versaci, R; Vermeulen, M J; Wallner, A; Ware, T; Weigand, M; Weiss, C; Wright, T; Zugec, P

    2014-01-01

    Knowledge of neutron cross sections of various plutonium isotopes and other minor actinides is crucial for the design of advanced nuclear systems. The $^{240 , 242}$Pu(n,f) cross sections were measured at the CERN n_TOF facility, taking advantage of the wide energy range (from thermal to GeV) and the high instantaneous f ux of the neutron beam. In this work, preliminary results for $^{242}$Pu are presented along with a theoretical cross section calculation performed with the EMPIRE code.

  16. MR imaging of musculoskeletal tumors and tumor mimickers with intravenous gadolinium: experience with 242 patients

    International Nuclear Information System (INIS)

    Purpose. This pictorial essay reviews our experience with MR scans with gadolinium in patients with musculoskeletal tumors and tumor mimickers. Design. Review of 242 MR scans obtained in the initial evaluation of a possible primary musculoskeletal neoplasm. All scans included a T1-weighted, fat-suppressed sequence following intravenous administration of gadolinium. Results. MR scans with gadolinium did not contribute to differential diagnosis or patient management in 89% of the patients in this series. However, intravenous gadolinium did assist in guiding the biopsy of bulky lesions and evaluating treated tumor beds for possible recurrence. MR scans with gadolinium were sometimes helpful when the differential diagnosis included synovitis, Morton's neuroma or intramuscular myxoma, and when it was important to differentiate cystic from solid lesions. Conclusions. Routine use of gadolinium in every initial MR examination of a possible musculoskeletal mass is not warranted. However, there are appropriate selected indications for gadolinium administration as outlined above. (orig.). With 19 figs., 1 tab

  17. Fission cross section measurement of Am-242m using lead slowing-down spectrometer

    Energy Technology Data Exchange (ETDEWEB)

    Kai, Tetsuya; Kobayashi, Katsuhei; Yamamoto, Shuji; Fujita, Yoshiaki [Kyoto Univ., Kumatori, Osaka (Japan). Research Reactor Inst.; Kimura, Itsuro; Ohkawachi, Yasushi; Wakabayashi, Toshio

    1998-03-01

    By making use of double fission chamber and lead slowing-down spectrometer coupled to an electron linear accelerator, fission cross section for the {sup 242m}Am(n,f) reaction has been measured relative to that for the {sup 235}U(n,f) reaction in the energy range from 0.1 eV to 10 keV. The measured result was compared with the evaluated nuclear data appeared in ENDF/B-VI and JENDL-3.2, of which evaluated data were broadened by the energy resolution function of the spectrometer. Although the JENDL-3.2 data seem to be a little smaller than the present measurement, good agreement can be seen in the general shape and the absolute values. The ENDF/B-VI data are larger more than 50 % than the present values above 3 eV. (author)

  18. Gamma-ray studies of the spontaneous fission of 242Pu and 252Cr using gammasphere

    International Nuclear Information System (INIS)

    The authors report on the new results on 242Pu and 252Cf spontaneous fission gamma-rays with emphasis on the dependence of spin distributions on numbers of neutrons emitted. The analysis has concentrated first on extracting relative intensities of ground rotational transitions as a function of number of neutrons emitted. open-quotes Cold fissionclose quotes, or zero-neutron fission, is observed in a number of fissioning systems. Some isotopic series show a trend of decreasing fragment average spin with increasing numbers of neutrons emitted, contrary to the initial expectations of a simple quantal model based on neck thickness expected at scission. A simple open-quotes atomic orbitalclose quotes model plus Coulomb excitation is compared with the data. Preliminary results from an April 1994 run using 36 Ge detectors in Early Implementation of Gammasphere coupled with 4 neutron detectors and 1 X-ray detector are shown

  19. MR imaging of musculoskeletal tumors and tumor mimickers with intravenous gadolinium: experience with 242 patients

    Energy Technology Data Exchange (ETDEWEB)

    May, D.A. [Department of Radiology, Wilford Hall USAF Medical Center, San Antonio, TX (United States)]|[WHMC/PSRD, Lackland AFB, TX (United States); Good, R.B. [Department of Radiology, Wilford Hall USAF Medical Center, San Antonio, TX (United States); Smith, D.K. [Department of Radiology, Wilford Hall USAF Medical Center, San Antonio, TX (United States); Parsons, T.W. [Department of Orthopaedic Surgery, Wilford Hall USAF Medical Center, San Antonio, TX (United States)

    1997-01-01

    Purpose. This pictorial essay reviews our experience with MR scans with gadolinium in patients with musculoskeletal tumors and tumor mimickers. Design. Review of 242 MR scans obtained in the initial evaluation of a possible primary musculoskeletal neoplasm. All scans included a T1-weighted, fat-suppressed sequence following intravenous administration of gadolinium. Results. MR scans with gadolinium did not contribute to differential diagnosis or patient management in 89% of the patients in this series. However, intravenous gadolinium did assist in guiding the biopsy of bulky lesions and evaluating treated tumor beds for possible recurrence. MR scans with gadolinium were sometimes helpful when the differential diagnosis included synovitis, Morton`s neuroma or intramuscular myxoma, and when it was important to differentiate cystic from solid lesions. Conclusions. Routine use of gadolinium in every initial MR examination of a possible musculoskeletal mass is not warranted. However, there are appropriate selected indications for gadolinium administration as outlined above. (orig.). With 19 figs., 1 tab.

  20. High-level waste storage tank farms/242-A evaporator Standards/Requirements Identification Document (S/RID), Volume 5

    Energy Technology Data Exchange (ETDEWEB)

    1994-04-01

    The High-Level Waste Storage Tank Farms/242-A Evaporator Standards/Requirements Identification Document (S/RID) is contained in multiple volumes. This document (Volume 5) outlines the standards and requirements for the Fire Protection and Packaging and Transportation sections.

  1. High-level waste storage tank farms/242-A evaporator Standards/Requirements Identification Document (S/RID), Volume 2

    Energy Technology Data Exchange (ETDEWEB)

    1994-04-01

    The High-Level Waste Storage Tank Farms/242-A Evaporator Standards/Requirements Document (S/RID) is contained in multiple volumes. This document (Volume 2) presents the standards and requirements for the following sections: Quality Assurance, Training and Qualification, Emergency Planning and Preparedness, and Construction.

  2. High-level waste storage tank farms/242-A evaporator Standards/Requirements Identification Document (S/RID), Volume 2

    International Nuclear Information System (INIS)

    The High-Level Waste Storage Tank Farms/242-A Evaporator Standards/Requirements Document (S/RID) is contained in multiple volumes. This document (Volume 2) presents the standards and requirements for the following sections: Quality Assurance, Training and Qualification, Emergency Planning and Preparedness, and Construction

  3. High-level waste storage tank farms/242-A evaporator Standards/Requirements Identification Document (S/RID)

    International Nuclear Information System (INIS)

    The High-Level Waste Storage Tank Farms/242-A Evaporator Standards/Requirements Identification Document (S/RID) is contained in multiple volumes. This document (Volume 3) presents the standards and requirements for the following sections: Safeguards and Security, Engineering Design, and Maintenance

  4. High-level waste storage tank farms/242-A evaporator Standards/Requirements Identification Document (S/RID), Volume 4

    International Nuclear Information System (INIS)

    The High-Level Waste Storage Tank Farms/242-A Evaporator Standards/Requirements Identification Document (S/RID) is contained in multiple volumes. This document (Volume 4) presents the standards and requirements for the following sections: Radiation Protection and Operations

  5. High-level waste storage tank farms/242-A evaporator Standards/Requirements Identification Document (S/RID), Volume 4

    Energy Technology Data Exchange (ETDEWEB)

    1994-04-01

    The High-Level Waste Storage Tank Farms/242-A Evaporator Standards/Requirements Identification Document (S/RID) is contained in multiple volumes. This document (Volume 4) presents the standards and requirements for the following sections: Radiation Protection and Operations.

  6. 17 CFR 242.603 - Distribution, consolidation, and display of information with respect to quotations for and...

    Science.gov (United States)

    2010-04-01

    ..., and display of information with respect to quotations for and transactions in NMS stocks. 242.603...) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Nms... with respect to quotations for and transactions in NMS stocks. (a) Distribution of information. (1)...

  7. High-level waste storage tank farms/242-A evaporator Standards/Requirements Identification Document (S/RID)

    Energy Technology Data Exchange (ETDEWEB)

    1994-04-01

    The High-Level Waste Storage Tank Farms/242-A Evaporator Standards/Requirements Identification Document (S/RID) is contained in multiple volumes. This document (Volume 3) presents the standards and requirements for the following sections: Safeguards and Security, Engineering Design, and Maintenance.

  8. High level waste storage tank farms/242-A evaporator Standards/Requirements Identification Document (S/RID), Volume 6

    Energy Technology Data Exchange (ETDEWEB)

    1994-04-01

    The High-Level Waste Storage Tank Farms/242-A Evaporator Standards/Requirements Identification Document (S/RID) is contained in multiple volumes. This document (Volume 6) outlines the standards and requirements for the sections on: Environmental Restoration and Waste Management, Research and Development and Experimental Activities, and Nuclear Safety.

  9. High-level waste storage tank farms/242-A evaporator Standards/Requirements Identification Document (S/RID), Volume 5

    International Nuclear Information System (INIS)

    The High-Level Waste Storage Tank Farms/242-A Evaporator Standards/Requirements Identification Document (S/RID) is contained in multiple volumes. This document (Volume 5) outlines the standards and requirements for the Fire Protection and Packaging and Transportation sections

  10. High level waste storage tank farms/242-A evaporator Standards/Requirements Identification Document (S/RID), Volume 6

    International Nuclear Information System (INIS)

    The High-Level Waste Storage Tank Farms/242-A Evaporator Standards/Requirements Identification Document (S/RID) is contained in multiple volumes. This document (Volume 6) outlines the standards and requirements for the sections on: Environmental Restoration and Waste Management, Research and Development and Experimental Activities, and Nuclear Safety

  11. Combination of cetuximab and PP242 synergistically suppress the progression of wild-type KRAS colorectal carcinoma

    Directory of Open Access Journals (Sweden)

    Cheng L

    2015-11-01

    Full Text Available Lei Cheng,1,* Zuguang Xia,2,3,* Xinyu Bian,1 Guangchao Li,4 Jing Hu,1 Ya Cao,5 Qing Wang,1 Xiaoping Qian1 1Comprehensive Cancer Center of Drum-Tower Hospital, Medical School of Nanjing University, Clinical Cancer Institute of Nanjing University, Nanjing, 2Department of Medical Oncology, Fudan University Shanghai Cancer Center, Shanghai, 3Department of Oncology, Shanghai Medical College, Fudan University, Shanghai, 4School of Bioscience and Bioengineering, South China University of Technology, Guangzhou, Guangdong, 5Department of Biological Science and Technology and State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing, People’s Republic of China *These authors contributed equally to this work Abstract: Mammalian target of rapamycin (mTOR has been shown to be overactive in human colorectal cancer, but the first-generation mTOR inhibitor, rapamycin, has failed to show clinical efficacy against colorectal cancer. On the other hand, although the second-generation mTOR inhibitor, PP242, has exerted substantial efficacy, it was revealed that independent inhibition by PP242 was transient, which could lead to positive-feedback loop to EGFR. Using wild-type KRAS colorectal cancer cells as models, we investigate the treatment efficacy of a widely used anti-EGFR monoclonal antibody, cetuximab, and PP242, alone or in combination in vitro and in vivo. Results of cell viability assays confirmed the synergistic inhibitory effect of PP242 and cetuximab on the survival of Caco-2 and HT-29 cells. Moreover, the ability of cancer-cell invasion and proliferation was also significantly inhibited by the combination therapy when compared with cetuximab or PP242 alone. Interestingly, the percentage of CD44-positive cancer cells was substantially decreased by the combination therapy in comparison with PP242 alone through fluorescence-activated cell sorting. The growth of cancer stem-like cell spheres in vitro was

  12. Comparison of a new tumour marker CA 242 with CA 19-9, CA 50 and carcinoembryonic antigen (CEA) in digestive tract diseases.

    OpenAIRE

    Kuusela, P.; Haglund, C.; Roberts, P. J.

    1991-01-01

    The levels of CA 242, a new tumour marker of carbohydrate nature, were measured in sera of 185 patients with malignancies of the digestive tract and of 123 patients with benign digestive tract diseases. High percentages of elevated CA 242 levels (greater than 20 U ml-1) were recorded in patients with pancreatic and biliary cancers (68%). The sensitivity was somewhat lower than that of CA 19-9 (76%) and CA 50 (73%). On the other hand, in benign pancreatic and biliary tract diseases the CA 242 ...

  13. Effect Of Cooling Rate On Thermal And Mechanical Properties Of Cu-%24.2Mn Alloy

    International Nuclear Information System (INIS)

    In this research, different heat and mechanical treatments have been applied to the Cu-%24.2Mn and some samples have been obtained from this alloy. On these samples, phase transformations have been formed by thermal and mechanical effect. Morphological, mechanical and crystallographic properties of the phase transformations have been examined by using different physical methods. Austenite phase has been obtained in the samples which have been applied slow and rapid cooling according to the SEM analysis. It has been observed that the grain size obtained by the rapid cooling is smaller than the grain size obtained by the slow cooling. Therefore, it has been concluded that the cooling process differences, changes the grain size of the alloy. Compression stress has been applied to the alloy in order to search the deformation effect on the austenite phase transformation. The structural features of the phase transformations have been examined. Slip lines and martensite structural were observed on the surface of the alloys after the deformation. Changes in phase structure of the alloy are also examined by means of XRD technique.

  14. Fast, Low-ionization Emission Regions of the Planetary Nebula M2-42

    Science.gov (United States)

    Danehkar, A.; Parker, Q. A.; Steffen, W.

    2016-02-01

    Spatially resolved observations of the planetary nebula M2-42 (PN G008.2-04.8) obtained with the Wide Field Spectrograph on the Australian National University 2.3 m telescope have revealed the remarkable features of bipolar collimated jets emerging from its main structure. Velocity-resolved channel maps derived from the [N ii] λ6584 emission line disentangle different morphological components of the nebula. This information is used to develop a three-dimensional morpho-kinematic model, which consists of an equatorial dense torus and a pair of asymmetric bipolar outflows. The expansion velocity of about 20 km s-1 is measured from the spectrum integrated over the main shell. However, the deprojected velocities of the jets are found to be in the range of 80-160 km s-1 with respect to the nebular center. It is found that the mean density of the collimated outflows, 595 ± 125 cm-3, is five times lower than that of the main shell, 3150 cm-3, whereas their singly ionized nitrogen and sulfur abundances are about three times higher than those determined from the dense shell. The results indicate that the features of the collimated jets are typical of fast, low-ionization emission regions.

  15. Fast, low-ionization emission regions of the planetary nebula M2-42

    CERN Document Server

    Danehkar, A; Steffen, W

    2016-01-01

    Spatially resolved observations of the planetary nebula M2-42 (PN G008.2-04.8) obtained with the Wide Field Spectrograph on the Australian National University 2.3 m telescope have revealed the remarkable features of bipolar collimated jets emerging from its main structure. Velocity-resolved channel maps derived from the [N II] $\\lambda$6584 emission line disentangle different morphological components of the nebula. This information is used to develop a three-dimensional morpho-kinematic model, which consists of an equatorial dense torus and a pair of asymmetric bipolar outflows. The expansion velocity of about 20 km s$^{-1}$ is measured from the spectrum integrated over the main shell. However, the deprojected velocities of the jets are found to be in the range of 80-160 km s$^{-1}$ with respect to the nebular center. It is found that the mean density of the collimated outflows, 595 $\\pm$ 125 cm$^{-3}$, is five times lower than that of the main shell, 3150 cm$^{-3}$, whereas their singly ionized nitrogen and ...

  16. The Mysterious Morphology of MRC0943-242 as Revealed by ALMA and MUSE

    CERN Document Server

    Gullberg, Bitten; Lehnert, Matthew D; Vernet, Joel; Bacon, Roland; Drouart, Guillaume; Emonts, Bjorn; Galametz, Audrey; Ivison, Rob; Nesvadba, Nicole P H; Richard, Johan; Seymour, Nick; Stern, Daniel; Wylezalek, Dominika

    2015-01-01

    We present a pilot study of the z=2.923 radio galaxy MRC0943-242, where we for the first time combine information from ALMA and MUSE data cubes. Even with modest integration times, we disentangle an AGN and a starburst dominated set of components. These data reveal a highly complex morphology, as the AGN, starburst, and molecular gas components show up as widely separated sources in dust continuum, optical continuum and CO line emission observations. CO(1-0) and CO(8-7) line emission suggest that there is a molecular gas reservoir offset from both the dust and the optical continuum that is located ~90kpc from the AGN. The UV line emission has a complex structure in emission and absorption. The line emission is mostly due to i) a large scale ionisation cone energised by the AGN, ii) a Ly-alpha emitting bridge of gas between the radio galaxy and a heavily star-forming set of components. Strangely, the ionisation cone has no Ly-alpha emission. We find this is due to an optically thick layer of neutral gas with u...

  17. New measurement of the 242Pu(n,γ cross section at n_TOF

    Directory of Open Access Journals (Sweden)

    Lerendegui-Marco J.

    2016-01-01

    Full Text Available The use of MOX fuel (mixed-oxide fuel made of UO2 and PuO2 in nuclear reactors allows substituting a large fraction of the enriched Uranium by Plutonium reprocessed from spent fuel. With the use of such new fuel composition rich in Pu, a better knowledge of the capture and fission cross sections of the Pu isotopes becomes very important. In particular, a new series of cross section evaluations have been recently carried out jointly by the European (JEFF and United States (ENDF nuclear data agencies. For the case of 242Pu, the two only neutron capture time-of-flight measurements available, from 1973 and 1976, are not consistent with each other, which calls for a new time-of flight capture cross section measurement. In order to contribute to a new evaluation, we have perfomed a neutron capture cross section measurement at the n_TOF-EAR1 facility at CERN using four C6D6 detectors, using a high purity target of 95 mg. The preliminary results assessing the quality and limitations (background, statistics and γ-flash effects of this new experimental data are presented and discussed, taking into account that the aimed accuracy of the measurement ranges between 7% and 12% depending on the neutron energy region.

  18. Common variants on 8p12 and 1q24.2 confer risk of schizophrenia

    DEFF Research Database (Denmark)

    Shi, Yongyong; Li, Zhiqiang; Xu, Qi;

    2011-01-01

    Schizophrenia is a severe mental disorder affecting ~1% of the world population, with heritability of up to 80%. To identify new common genetic risk factors, we performed a genome-wide association study (GWAS) in the Han Chinese population. The discovery sample set consisted of 3,750 individuals...... with schizophrenia and 6,468 healthy controls (1,578 cases and 1,592 controls from northern Han Chinese, 1,238 cases and 2,856 controls from central Han Chinese, and 934 cases and 2,020 controls from the southern Han Chinese). We further analyzed the strongest association signals in an additional independent cohort...... of 4,383 cases and 4,539 controls from the Han Chinese population. Meta-analysis identified common SNPs that associated with schizophrenia with genome-wide significance on 8p12 (rs16887244, P = 1.27 × 10(-10)) and 1q24.2 (rs10489202, P = 9.50 × 10(-9)). Our findings provide new insights...

  19. Comparison of evaluations for 235U, 239Pu, 240Pu, 241Pu and 242Pu with integral measurements

    International Nuclear Information System (INIS)

    The evaluations for 235U, 239Pu, 240Pu, 241Pu and 242Pu are considered. Intercomparison is made of the neutron cross section data from INDL/A, ENDL-84, ENDF/B-5 and ENDF/B-6 (where applicable). Integral measurements of the spectrum averaged cross sections are compared to the values derived from evaluated data libraries. (author). 40 refs, 49 figs, 11 tabs

  20. Measurement of the 242Pu(n,f) Cross Section at the CERN n_TOF Facility

    CERN Document Server

    Tsinganis, A; Guerrero, C; Colonna, N; Calviani, M; Vlastou, R; Andriamonje, S; Vlachoudis, V; Gunsing, F; Massimi, C; Altstadt, S; Andrzejewski, J; Audouin, L; Barbagallo, M; Bécares, V; Bečvář, F; Belloni, F; Billowes, J; Boccone, V; Bosnar, D; Brugger, M; Calviño, F; Cano-Ott, D; Carrapiço, C; Cerutti, F; Chin, M; Cortés, G; Cortés-Giraldo, M A; Diakaki, M; Domingo-Pardo, C; Duran, I; Dressler, R; Dzysiuk, N; Eleftheriadis, C; Ferrari, A; Fraval, K; Ganesan, S; García, A R; Giubrone, G; Gómez-Hornillos, M B; Gonçalves, I F; González-Romero, E; Griesmayer, E; Gurusamy, P; Hernández-Prieto, A; Jenkins, D G; Jericha, E; Kadi, Y; Käppeler, F; Karadimos, D; Kivel, N; Koehler, P; Kokkoris, M; Krtička, M; Kroll, J; Lampoudis, C; Langer, C; Leal-Cidoncha, E; Lederer, C; Leeb, H; Leong, L S; Losito, R; Mallick, A; Manousos, A; Marganiec, J; Martínez, T; Massimi, C; Mastinu, P F; Mastromarco, M; Meaze, M; Mendoza, E; Mengoni, A; Milazzo, P M; Mingrone, F; Mirea, M; Mondalaers, W; Paradela, C; Pavlik, A; Perkowski, J; Plompen, A; Praena, J; Quesada, J M; Rauscher, T; Reifarth, R; Riego, A; Robles, M S; Roman, F; Rubbia, C; Sabaté-Gilarte, M; Sarmento, R; Saxena, A; Schillebeeckx, P; Schmidt, S; Schumann, D; Tagliente, G; Tain, J L; Tarrío, D; Tassan-Got, L; Valenta, S; Vannini, G; Variale, V; Vaz, P; Ventura, A; Versaci, R; Vermeulen, M J; Wallner, A; Ware, T; Weigand, M; Weiss, C; Wright, T; Žugec, P

    2014-01-01

    The accurate knowledge of relevant nuclear data is crucial for the design of advanced nuclear systems. These data include neutron cross sections of various plutonium isotopes and other minor actinides. The Pu-242(n,f) cross section was measured at the CERN n\\_TOF facility, taking advantage of the wide energy range (from thermal to GeV) and the high instantaneous flux of the neutron beam. Preliminary results for the measurement are presented.

  1. Association between NADPH Oxidase p22phox C242T Polymorphism and Ischemic Cerebrovascular Disease: A Meta-Analysis

    OpenAIRE

    Li, Bing-Hu; Zhang, Li-li; Zhang, Bei-Bei; Yin, Yan-Wei; Dai, Li-Meng; Pi, Yan; Guo, Lu; Chang-yue GAO; Fang, Chuan-Qin; Wang, Jing-Zhou; Li, Jing-Cheng

    2013-01-01

    Background Epidemiological studies have evaluated the association between nicotinamide adenine dinucleotide phosphate (NADPH) oxidase p22phox C242T polymorphism and risk of ischemic cerebrovascular disease (ICVD), but the results remain inconclusive. This meta-analysis was therefore designed to clarify these controversies. Methodology/Principal Findings Systematic searches of electronic databases Embase, PubMed and Web of Science, as well as hand searching of the references of identified arti...

  2. Identification of a genetic locus for ichthyosis vulgaris on chromosome 10q22.3-q24.2.

    Science.gov (United States)

    Liu, Ping; Yang, Qingyu; Wang, Xu; Feng, Aiping; Yang, Tao; Yang, Rong; Wang, Pengyun; Yuang, Mingxiong; Liu, Mugen; Liu, Jing Yu; Wang, Qing K

    2008-06-01

    Ichthyosis vulgaris (IV) is one of the most commonly inherited disorders and has an estimated prevalence rate of 2.29% in China. To date, only one gene responsible for IV, the filaggrin gene (FLG), was identified, but genetic heterogeneity exists. In this study, two Chinese families with autosomal-dominant IV were genetically characterized. The FLG gene was first excluded as the disease-causing gene in the two families. The larger family was then characterized by genome-wide linkage analysis to identify a new genetic locus for IV. Significant linkage was identified with markers on chromosome 10q22.3-q24.2 with a maximum LOD score of 3.19. No other markers showed a LOD score of >1.5. Fine mapping defined the new genetic locus within a 20.7 cM region between markers D10S569 and D10S1709. The second family also showed positive linkage to the same 10q22.3-q24.2 region. The combined maximum LOD score in the two families was 3.95. Identification of linkage in two independent families provides strong genetic evidence that a previously unreported gene for IV is located on chromosome 10q22.3-q24.2. Future studies of the candidate genes at the 10q IV locus will identify a specific gene, which will provide insights into the pathogenesis of IV.

  3. Diagnostic value of combined determination of serum tumor markers (NSE, CA-242, TPA, CEA) levels in patients with lung cancer

    International Nuclear Information System (INIS)

    Objective: To investigate the diagnostic value of combined determination of serum NSE, CA242, tissue polypeptide antigen (TPA) and CEA levels in patients with primary lung cancer. Methods: Serum NSE, CA242, TPA and CEA levels were determined with ELISA in (1) 102 patients with various types of primary lung carcinoma (adenocarcinoma 38, squamous cell carcinoma 32, small cell lung carcinoma 32) (2) 33 patients with open lung T. B. and (3) 30 controls. Results: (1) In patients with lung cancer, serum levels of all the four markers were increased and significantly higher than their respective values in patients with open lung T.B. and controls. (2) Positive rate of combined any two markers were 75% for adenocarcinoma, 50% for squamous cell carcinoma and 65% for small cell lung carcinoma, while false positive rate was only 9% for T.B patients and none for the controls. (3) The most appropriate single marker for each specific type of lung cancer was: NSE for SCLC (sensitivity 72%, specificity 97%, CA242 for adenocarcinoma sensitivity 62%, specificity 90%). Conclusion: Combined determination of these tumor markers would improve the sensitivity and specificity for diagnosis of primary lung carcinoma. (authors)

  4. The Solubility of 242PuO2 in the Presence of Aqueous Fe(II): The Impact of Precipitate Preparation

    Energy Technology Data Exchange (ETDEWEB)

    Felmy, Andrew R.; Moore, Dean A.; Buck, Edgar C.; Conradson, Steven D.; Kukkadapu, Ravi K.; Sweet, Lucas E.; Abrecht, David G.; Ilton, Eugene S.

    2014-01-28

    The solubility of different forms of precipitated 242PuO2(am) were examined in solutions containing aqueous Fe(II) over a range of pH values. The first series of 242PuO2(am) suspensions were prepared from a 242Pu(IV) stock that had been treated with thenoyltrifluoroacetone (TTA) to remove the 241Am originating from the decay of 241Pu. These 242PuO2(am) suspensions showed much higher solubilities at the same pH value and Fe(II) concentration than previous studies using 239PuO2(am). X ray absorption fine structure (XAFS) spectroscopy of the precipitates showed a substantially reduced Pu-Pu backscatter over that previously observed in 242PuO2(am) precipitates, indicating that the 242PuO2(am) precipitates purified using TTA lacked the long range order previously found in 239PuO2(am) precipitates. The Pu(IV) stock solution was subsequently repurified using an ion exchange resin and an additional series of 242PuO2(am) precipitates prepared. These suspensions showed higher redox potentials and total aqueous Pu concentrations than the TTA purified stock solution. The higher redox potential and aqueous Pu concentrations were in general agreement with previous studies on 242PuO2(am) precipitates, presumably due to the removal of possible organic compounds originally present in the TTA purified stock. 242PuO2(am) suspensions prepared with both stock solutions showed almost identical solubilities in Fe(II) containing solutions even though the initial aqueous Pu concentrations before the addition of Fe(II) were orders of magnitude different. By examining the solubility of 242PuO2(am) prepared from both stocks in this way we have essentially approached equilibrium from both the undersaturated and oversaturated

  5. Measurement of Am-242 fission yields at the Lohengrin spectrometer; improvement and Benchmarking of the semi-empirical code GEF

    International Nuclear Information System (INIS)

    The study of fission yields has a major impact on the characterization and understanding of the fission process and is mandatory for reactor applications. While the yields are known for the major actinides (U-235, Pu-239) in the thermal neutron-induced fission, only few measurements were performed on Am-242. Moreover, the two main data libraries do not agree among each other on the light peak. Am-241 and Am-242 are nuclei of interest for the MOX-fuel reactors and for the reduction of nuclear waste radiotoxicity using transmutation reactions. Thus, a campaign of precise measurement of the fission mass yields from the reaction Am-241(2n,f) was performed at the Lohengrin mass spectrometer (ILL, France) for both the light and the heavy peak. Forty-one masses were measured. Moreover, the measurement of the isotopic fission yields on the heavy peak by gamma-ray spectrometry led to the extraction of 20 independent isotopic yields. Our measurement was also meant to determine whether there is a difference in fission yields between the Am-242 isomeric state and its ground state as it exists in fission cross sections. The experimental method used to answer this question is based on the measurement a set of fission mass yields as a function of the ratio of Am-242gs to Am-242m fission rate. Results show that the mass yields are independent of the fission rate ratio. A future experimental campaign is proposed to observe a possible influence on the isomeric yields. The theoretical models are nowadays unable to predict the fission yields with enough accuracy and therefore we have to rely on experimental data and phenomenological models. The accuracy of the predictions of the semi empirical GEF fission model predictions makes it a useful tool for evaluation. This thesis also presents the physical content and part of the development of this model. Validation of the kinetic energy distributions, isomeric yields and fission yields predictions was performed. The extension of the GEF

  6. The mysterious morphology of MRC0943-242 as revealed by ALMA and MUSE

    Science.gov (United States)

    Gullberg, Bitten; De Breuck, Carlos; Lehnert, Matthew D.; Vernet, Joël; Bacon, Roland; Drouart, Guillaume; Emonts, Bjorn; Galametz, Audrey; Ivison, Rob; Nesvadba, Nicole P. H.; Richard, Johan; Seymour, Nick; Stern, Daniel; Wylezalek, Dominika

    2016-02-01

    We present a pilot study of the z = 2.923 radio galaxy MRC0943-242, where we combine information from ALMA and MUSE data cubes for the first time. Even with modest integration times, we disentangle the AGN and starburst dominated components. These data reveal a highly complex morphology as the AGN, starburst, and molecular gas components show up as widely separated sources in dust continuum, optical continuum, and CO line emission observations. CO(1-0) and CO(8-7) line emission suggest that there is a molecular gas reservoir offset from both the dust and the optical continuum that is located ~90 kpc from the AGN. The UV line emission has a complex structure in emission and absorption. The line emission is mostly due to a large scale ionisation cone energised by the AGN, and a Lyα emitting bridge of gas between the radio galaxy and a heavily star-forming set of components. Strangely, the ionisation cone has no Lyα emission. We find this is due to an optically thick layer of neutral gas with unity covering fraction spread out over a region of at least ~100 kpc from the AGN. Other less thick absorption components are associated with Lyα emitting gas within a few tens of kpc from the radio galaxy and are connected by a bridge of emission. We speculate that this linear structure of dust, Lyα and CO emission, and the redshifted absorption seen in the circum nuclear region may represent an accretion flow feeding gas into this massive AGN host galaxy.

  7. 242周期夫精宫腔人工授精临床观察

    Institute of Scientific and Technical Information of China (English)

    梅园园; 彭璇; 雷美云

    2012-01-01

    目的比较分析自然周期和促排卵两种方式行夫精官腔人工授精(IUI)的妊娠结局。方法回顾性分析242周期IUI患者的临床资料,其中160周期以促排卵方式行IUI,82周期采用自然周期行IUI,随访所有患者的妊娠结局。结果促排卵方式行IUI的妊娠率较自然周期组高,但两组比较无统计学差异.P〉O.05;促排卵组发生OHSS、LUFS及多胎并发症比自然周期组高,但两组比较亦无统计学差异,P〉0.05。结论虽然采用促排卵方式行IUI能提高患者妊娠率,但发生OHSS,LFUS和多胎并发症比自然周期组也高。自然周期符合自身卵泡生长规律,并可减少药物对卵巢的刺激,节约经济成本,也是值得一定推广的IUI方式。

  8. Diagnostic value of combined determinations of serum CA19-9, CA242 and CA50 levels in patients with pancreatic cancer

    International Nuclear Information System (INIS)

    Objective: To explore the diagnostic value of combined determinations of serum CA19-9, CA242 and CA50 levels in patients with pancreatic cancer. Methods: Serum CA19-9, CA242 and CA50 levels were determined with RIA in 120 patients with pancreatic cancer, 50 patients with chronic pancreatitis and 80 controls. Results: The serum levels of CA19-9, CA242 and CA50 in patients with pancreatic cancer were significantly higher than those in patients with pancreatitis and controls. With CA19-9, the diagnostic sensitivity and specificity for pancreatic cnrcinoma was 82.0% and 78.6% respectively. With CA242, the diagnostic sensitivity and specificity for pancreatic carcinoma was 78.5% and 81.6% respectively. With CA50, the diagnostic sensitivity and specificity for pancreatic carcinoma was 52.7% and 74.6% respectively. With combined determinations of CA19-9, CA242 and CA50, the sensitivity and specificity was enhanced to 96.82% and 98.75% respectively. Conclusion: Combined detection of CA19-9, CA242 and CA50 is clinically useful for early diagnosis of pancreatic cancer. (authors)

  9. The solubility of {sup 242}PuO{sub 2} in the presence of aqueous Fe(II). The impact of precipitate preparation

    Energy Technology Data Exchange (ETDEWEB)

    Felmy, Andrew R.; Moore, Dean A.; Buck, Edgar; Kukkadapu, Ravi; Sweet, Lucas; Abrecht, David; Ilton, Eugene S. [Pacific Northwest National Laboratory, Richland, WA (United States); Conrados, Steven D. [Los Alamos National Laboratory, Los Alamos, NM (United States)

    2014-07-01

    The solubility of different forms of precipitated {sup 242}PuO{sub 2}(am) were examined in solutions containing aqueous Fe(II) over a range of pH values. The first series of {sup 242}PuO{sub 2}(am) suspensions were prepared from a {sup 242}Pu(IV) stock that had been treated with thenoyltrifluoroacetone (TTA) to remove the {sup 241}Am originating from the decay of {sup 241}Pu. These {sup 242}PuO{sub 2}(am) suspensions showed much higher solubilities at the same pH value and Fe(II) concentration than previous studies using {sup 239}PuO{sub 2}(am). X-ray absorption fine structure (XAFS) spectroscopy of the precipitates showed a substantially reduced Pu-Pu backscatter over that previously observed in {sup 239}PuO{sub 2}(am) precipitates, indicating that the {sup 242}PuO{sub 2}(am) precipitates purified using TTA lacked the long range order previously found in{sup 239}PuO{sub 2}(am) precipitates. The Pu(IV) stock solution was subsequently re-purified using an ion exchange resin and an additional series of {sup 242}PuO{sub 2}(am) precipitates prepared. These suspensions showed higher redox potentials and total aqueous Pu concentrations than the TTA purified stock solution. The higher redox potential and aqueous Pu concentrations were in general agreement with previous studies on {sup 242}PuO{sub 2}(am) precipitates, presumably due to the removal of possible organic compounds originally present in the TTA purified stock. {sup 242}PuO{sub 2}(am) suspensions prepared with both stock solutions showed almost identical solubilities in Fe(II) containing solutions even though the initial aqueous Pu concentrations before the addition of Fe(II) were orders of magnitude different. By examining the solubility of {sup 242}PuO{sub 2}(am) prepared from both stocks in this way we have essentially approached equilibrium from both the undersaturated and oversaturated conditions. The final aqueous Pu concentrations are predictable using a chemical equilibrium model which includes the

  10. 242例未行准分子激光原位角膜磨镶术患者角膜因素分析%Analysis of 242 cases which unable to carry out LASIK

    Institute of Scientific and Technical Information of China (English)

    王林; 张庆生; 王忠海

    2014-01-01

    Objective Analyze the cornea factors which result in unable to carry out the LASIK operation .Method Do retrospective analysis research and summarize 242 patients’ medical records who did not undergo LASIK because of factors in the cornea.Results In total 242 cases, 112 patient’s corneal thickness less than normal that account for the to-tal 46.3%, 87 cases of suspected keratoconus that make up 36.0%of the total, 5 cases (2.1%) of keratoconus , 25 ca-ses (10.3%) are wearing orthokeratology lens , 8 cases (3.3%) are fell ill with keratitis, 5 cases (2.0%) are due to some other corneal problems .Conclusion Corneal factors are the main reasons for unable to carry out the LASIK opera-tions , carry out strict check work on patients ’ cornea to know the relevant indications and contraindications before the oper -ation is very critical to improve the safety of the LASIK operations .%探讨因角膜因素未行准分子激光原位角膜磨镶术( LASIK)的原因。方法回顾分析242例因角膜因素未行LASIK的原因。结果在242例因角膜因素未行LASIK中,角膜厚度不足112例(46.3%),可疑圆锥角膜87例(36.0%),圆锥角膜5例(2.1%),佩戴角膜塑形镜25例(10.3%),角膜炎8例(3.3%),其它角膜因素5例(2.0%)。结论角膜因素是未行LASIK的主要原因,严格的手术前角膜筛查,掌握手术的适应证与禁忌证,可以提高LASIK手术的安全性。

  11. Evaluation of 242Pu data for the incident neutron energy range 5-20 MeV

    International Nuclear Information System (INIS)

    Models, procedures and parameters are presented for the calculation of neutron cross sections, the neutron angular distributions and the neutron energy distributions of 242Pu in the energy range 5-20 MeV. The interaction takes place through direct interaction and compound nucleus mechanism. For heavy deformed nucleus the direct interaction was treated with the coupled channel process, using the ECIS code. For the compound nucleus mechanism, a statistical treatment was used for fission, neutron elastic and inelastic scattering, radiative capture, (n,2n), (n,3n), (n,4n) cross section calculations, using the GNASH code. (R.P.)

  12. Synthesis of novel 2-(4-(2-morpholinoethoxy)phenyl)-N-phenylacetamide analogues and their antimicrobial study

    Indian Academy of Sciences (India)

    H P Jayadevappa; G Nagendrappa; S Umesh; S Chandrashekar

    2012-09-01

    A new class of potential biologically active 2-(4-(2-morpholinoethoxy)phenyl)-N-phenylacetamides has been synthesized from hydroxyphenylacetic acid. The products were characterized through IR, 1H NMR, mass spectral studies and elemental analysis. The compounds were screened for antimicrobial activity by disc agar diffusion technique. The potency of compounds is tested against variety of fungal and bacterial strains in comparison to clotrimazole and streptomycin, respectively. Some of the synthesized compounds exhibit superior in vitro activity compared to the standard drugs.

  13. Sequence and batch language programs and alarm-related ``C`` programs for the 242-A MCS. Revision 2

    Energy Technology Data Exchange (ETDEWEB)

    Berger, J.F.

    1995-03-01

    A Distributive Process Control system was purchased by Project B-534, ``242-A Evaporator/Crystallizer Upgrades``. This control system, called the Monitor and Control System (MCS), was installed in the 242-A Evaporator located in the 200 East Area. The purpose of the MCS is to monitor and control the Evaporator and monitor a number of alarms and other signals from various Tank Farm facilities. Applications software for the MCS was developed by the Waste Treatment Systems Engineering (WTSE) group of Westinghouse. The standard displays and alarm scheme provide for control and monitoring, but do not directly indicate the signal location or depict the overall process. To do this, WTSE developed a second alarm scheme which uses special programs, annunciator keys, and process graphics. The special programs are written in two languages; Sequence and Batch Language (SABL), and ``C`` language. The WTSE-developed alarm scheme works as described below: SABL relates signals and alarms to the annunciator keys, called SKID keys. When an alarm occurs, a SABL program causes a SKID key to flash, and if the alarm is of yellow or white priority then a ``C`` program turns on an audible horn (the D/3 system uses a different audible horn for the red priority alarms). The horn and flashing key draws the attention of the operator.

  14. High-level waste storage tank farms/242-A evaporator standards/requirements identification document (S/RID), Vol. 4

    Energy Technology Data Exchange (ETDEWEB)

    1994-04-01

    Radiation protection of personnel and the public is accomplished by establishing a well defined Radiation Protection Organization to ensure that appropriate controls on radioactive materials and radiation sources are implemented and documented. This Requirements Identification Document (RID) applies to the activities, personnel, structures, systems, components, and programs involved in executing the mission of the Tank Farms. The physical boundaries within which the requirements of this RID apply are the Single Shell Tank Farms, Double Shell Tank Farms, 242-A Evaporator-Crystallizer, 242-S, T Evaporators, Liquid Effluent Retention Facility (LERF), Purgewater Storage Facility (PWSF), and all interconnecting piping, valves, instrumentation, and controls. Also included is all piping, valves, instrumentation, and controls up to and including the most remote valve under Tank Farms control at any other Hanford Facility having an interconnection with Tank Farms. The boundary of the structures, systems, components, and programs to which this RID applies, is defined by those that are dedicated to and/or under the control of the Tank Farms Operations Department and are specifically implemented at the Tank Farms.

  15. 17q24.2 microdeletions: a new syndromal entity with intellectual disability, truncal obesity, mood swings and hallucinations.

    Science.gov (United States)

    Vergult, Sarah; Dauber, Andrew; Delle Chiaie, Barbara; Van Oudenhove, Elke; Simon, Marleen; Rihani, Ali; Loeys, Bart; Hirschhorn, Joel; Pfotenhauer, Jean; Phillips, John A; Mohammed, Shehla; Ogilvie, Caroline; Crolla, John; Mortier, Geert; Menten, Björn

    2012-05-01

    Although microdeletions of the long arm of chromosome 17 are being reported with increasing frequency, deletions of chromosome band 17q24.2 are rare. Here we report four patients with a microdeletion encompassing chromosome band 17q24.2 with a smallest region of overlap of 713 kb containing five Refseq genes and one miRNA. The patients share the phenotypic characteristics, such as intellectual disability (4/4), speech delay (4/4), truncal obesity (4/4), seizures (2/4), hearing loss (3/4) and a particular facial gestalt. Hallucinations and mood swings were also noted in two patients. The PRKCA gene is a very interesting candidate gene for many of the observed phenotypic features, as this gene plays an important role in many cellular processes. Deletion of this gene might explain the observed truncal obesity and could also account for the hallucinations and mood swings seen in two patients, whereas deletion of a CACNG gene cluster might be responsible for the seizures observed in two patients. In one of the patients, the PRKAR1A gene responsible for Carney Complex and the KCNJ2 gene causal for Andersen syndrome are deleted. This is the first report of a patient with a whole gene deletion of the KCNJ2 gene. PMID:22166941

  16. High-level waste storage tank farms/242-A evaporator standards/requirements identification document (S/RID), Vol. 4

    International Nuclear Information System (INIS)

    Radiation protection of personnel and the public is accomplished by establishing a well defined Radiation Protection Organization to ensure that appropriate controls on radioactive materials and radiation sources are implemented and documented. This Requirements Identification Document (RID) applies to the activities, personnel, structures, systems, components, and programs involved in executing the mission of the Tank Farms. The physical boundaries within which the requirements of this RID apply are the Single Shell Tank Farms, Double Shell Tank Farms, 242-A Evaporator-Crystallizer, 242-S, T Evaporators, Liquid Effluent Retention Facility (LERF), Purgewater Storage Facility (PWSF), and all interconnecting piping, valves, instrumentation, and controls. Also included is all piping, valves, instrumentation, and controls up to and including the most remote valve under Tank Farms control at any other Hanford Facility having an interconnection with Tank Farms. The boundary of the structures, systems, components, and programs to which this RID applies, is defined by those that are dedicated to and/or under the control of the Tank Farms Operations Department and are specifically implemented at the Tank Farms

  17. 242Pu as tracer for simultaneous determination of 237Np and 239,240Pu in environmental samples

    DEFF Research Database (Denmark)

    Chen, Q.J.; Dahlgaard, H.; Nielsen, S.P.;

    2002-01-01

    A procedure has been developed using Pu-242 as tracer for simultaneous determination of Np-237 and Pu-239,Pu-240 in environmental samples. The validity of the method has been demonstrated by ICPMS and alpha-spectroscopy for up to 10 gram soil and sediment, seawater up to 200 litres. The paper...... describes a suitable chemical procedure for Np and Pu including a quantitative pre-concentration of neptunium and plutonium, preparation of Np4+ and Pu4+, NP(NO3)(6)(2-) and Pu(NO3)(6)(2-), The ratio of Np-237/Pu-242 (or Np-237/Pu-239) before and after the procedure has been determined using 10 g soil (free...... from Np and Pu) R-before/R-after = 1.004 +/- 3.3% (S.D n = 20) and 1 litre seawater R-before/R-after = 1.019+/-1.9% (S.D., n = 12). Results from the intercomparison samples LAEA-135, LAEA-381 and from environmental samples are presented....

  18. Relationship between peripheral and mesenteric serum levels of CEA and CA 242 with staging and histopathological variables in colorectal adenocarcinoma Níveis séricos periféricos e mesentéricos de CEA e CA 242, estadiamento e variáveis histopatológicas no adenocarcinoma colorretal

    OpenAIRE

    Mauro Lamelas Cardoso; Luís Cesar Fernandes; Su Bong Kim; Delcio Matos

    2009-01-01

    PURPOSE: To compare histopathological variables and staging in colorectal adenocarcinoma cases with CEA and CA 242 in peripheral and mesenteric blood. METHODS: In 169 individuals underwent surgery for colorectal cancer, CEA and CA 242 were analyzed and compared to mesenteric and peripheral blood and correlated with macroscopic tumor's morphology and size, degree of cell differentiation, venous, neural and lymphatic involvement and TNM classification. RESULTS: There was a difference between th...

  19. Research on the controlling of rare earth permanent magnet brushless DC motor based on TMS320C242%基于TMS320C242的稀土永磁无刷直流电机控制系统研究

    Institute of Scientific and Technical Information of China (English)

    董艺

    2012-01-01

    对用TMS320C242控制稀土永磁无刷直流电机(REPMBLDCM)进行了深入的探讨。作为驱动设备,稀土永磁无刷直流电机在很多方面性能优于普通直流电机;作为控制核心,TMS320C242无论是集成度还是控制速度都远超普通的单片机。所以用TMS320C242控制REPMBLDCM可获得极为优秀的控制效果和驱动性能。%A deep discussion has been made on how to control rare earth permanent magnet brushless DC motor with TMS320C242. As a driving device, rare earth permanent magnet brushless DC motor is superior to the common DC motor in many ways. As a core of the control system, TMS320C242 is far more superior to the common single chip microcontroller unit whether on its integration or its controlling speed. Therefore, excellent control effects and driving properties can be obtained by adopting TMS320C242 to control REPMBLDCM.

  20. Relationship between peripheral and mesenteric serum levels of CEA and CA 242 with staging and histopathological variables in colorectal adenocarcinoma Níveis séricos periféricos e mesentéricos de CEA e CA 242, estadiamento e variáveis histopatológicas no adenocarcinoma colorretal

    Directory of Open Access Journals (Sweden)

    Mauro Lamelas Cardoso

    2009-10-01

    Full Text Available PURPOSE: To compare histopathological variables and staging in colorectal adenocarcinoma cases with CEA and CA 242 in peripheral and mesenteric blood. METHODS: In 169 individuals underwent surgery for colorectal cancer, CEA and CA 242 were analyzed and compared to mesenteric and peripheral blood and correlated with macroscopic tumor's morphology and size, degree of cell differentiation, venous, neural and lymphatic involvement and TNM classification. RESULTS: There was a difference between the mesenteric (M and peripheral (P serum levels of CEA (p=0.020. Higher levels of markers were correlated with venous invasion CEA (P p=0.013, CEA (M p=0.05, CA 242 (M p=0.005 and CA 242 (P p=0.038; with advanced staging CEA (P OBJETIVO: Comparar variáveis histopatológicas e graus de estadiamento do adenocarcinoma colorretal com níveis sanguíneos periféricos e mesentéricos de CEA e CA-242. MÉTODOS: Em 169 doentes submetidos ao tratamento cirúrgico por adenocarcinoma colorretal, CEA e CA-242 foram analisados e comparados quanto aos níveis sanguíneos periféricos e mesentéricos e correlacionados com o tamanho e a morfologia macroscópica do tumor, grau de diferenciação celular, invasões venosa, linfática, neural e a classificação TNM. RESULTADOS: Verificou-se diferença significante entre o nível sérico mesentérico e periférico de CEA (p= 0,02. Níveis séricos mais elevados dos marcadores foram observados e correlacionados com invasão venosa, CEA (P p=0,013, CEA(M, p=0,05, CA-242 (M p=0,005 e CA-242 (P p=0,038. Grau de estadiamento TNM avançado foi associado com CEA(P < CEA(M p<0,05, CA-242(P < CA-242(M p<0,05. Nas maiores dimensões tumorais constatou-se CEA(P < CEA(M p=0,001 e CA 242 (P < CA 242 (M (p < 0.001. O CA 242 periférico e mesentérico aumentados associaram-se com a invasão neural, p=0.014 e p=0.003, respectivamente. CONCLUSÕES: O nível sérico mesentérico de CEA é superior ao nível sérico periférico. Os níveis s

  1. I. Nuclear Production Reaction and Chemical Isolation Procedure for 240Am II. New Superheavy Element Isotopes: 242Pu(48Ca,5n)285-114

    OpenAIRE

    Ellison, Paul Andrew

    2011-01-01

    Part I discusses the study of a new nuclear reaction and chemical separation procedure for the production of 240Am. Thin 242Pu, natTi, and natNi targets were coincidently activated with protons from the 88-Inch Cyclotron, producing 240Am, 48V, and 57Ni, respectively. The radioactive decay of these isotopes was monitored using high-purity Ge gamma ray detectors in the weeks following irradiation. The excitation function for the 242Pu(p, 3n)240Am nuclear reaction was measured to be lower than t...

  2. Measurement of the fission cross-section of $^{240}$Pu and $^{242}$Pu at CERN's n_TOF Facility

    CERN Multimedia

    Pavlik, A F; Gonzalez romero, E M

    The n_TOF Collaboration proposes to continue the fission program, already started in 2002-2004, taking advantage of the newly constructed Work Sector Type A, with the measurement of the two isotopes : $^{240}$ Pu and $^{242}$ Pu. They are both of major importance for reactor physics applications and are included in the Nuclear Energy Agency (NEA) High Priority List [1], in the NEA WPEC Subgroup 26 Report on the accuracy of nuclear data for advanced reactor designe [2] and in the EU 6$^{th}$ Framework Programme IP-EUROTRANS/NUDATRA reports [3]. Based on those requests, the measurement of the fission cross-section of the two Pu isotopes is one of the objectives of the project ANDES of the FP7 EURATOM program [4].

  3. Coulomb excitation of a 242Am isomeric target: E2 and E3 strengths, rotational alignment, and collective enhancement

    International Nuclear Information System (INIS)

    A 98% pure 242mAm (K=5-, t1/2=141 years) isomeric target was Coulomb excited with a 170.5-MeV 40Ar beam. The selectivity of Coulomb excitation, coupled with the sensitivity of Gammasphere plus CHICO, was sufficient to identify 46 new states up to spin 18(ℎ/2π) in at least four rotational bands; 11 of these new states lie in the isomer band, 13 in a previously unknown yrast Kπ=6- rotational band, and 13 in a band tentatively identified as the predicted yrast Kπ=5+ band. The rotational bands based on the Kπ=5- isomer and the 6- bandhead were populated by Coulomb excitation with unexpectedly equal cross sections. The γ-ray yields are reproduced by Coulomb excitation calculations using a two-particle plus rotor model (PRM), implying nearly complete ΔK=1 mixing of the two almost-degenerate rotational bands, but recovering the Alaga rule for the unperturbed states. The degeneracy of the 5- and 6- bands allows for precise determination of the mixing interaction strength V, which approaches the strong-mixing limit; this agrees with the 50% attenuation of the Coriolis matrix element assumed in the model calculations. The fractional admixture of the IKπ=66- state in the nominal 65- isomer band state is measured within the PRM as 45.6-1.1+0.3%. The E2 and M1 strengths coupling the 5- and 6- bands are enhanced significantly by the mixing, while E1 and E2 couplings to other low-K bands are not measurably enhanced. The yields of the 5+ band are reproduced by an E3 strength of ≅15 W.u., competitive with the interband E2 strength. Alignments of the identified two-particle Nilsson states in 242Am are compared with the single-particle alignments in 241Am.

  4. Clinical analysis of 242 cases of renal transplantations from China donation after citizen death%公民逝世后器官捐献肾移植242例临床分析

    Institute of Scientific and Technical Information of China (English)

    昌盛; 徐晶; 蒋继贫; 陈知水

    2015-01-01

    目的 分析单中心公民逝世后器官捐献(DCD)供肾移植的短期临床效果.方法 对2010年11月至2014年12月31日实施的242例DCD供肾移植的临床资料进行回顾性研究,统计术后1年受者和移植肾存活率,计算术后各类并发症发生率,并观察婴幼儿或儿童以及老年(年龄>60岁)供者供肾移植的临床特点.结果 共计183例DCD捐献者,供者年龄为2d至68岁,其中中国一类(国际标准化脑死亡器官捐献)供者102例,中国二类(国际标准化心死亡器官捐献)供者22例,中国三类(中国过渡时期脑-心双死亡标准器官捐献)供者59例.最终捐献247个肾脏用于移植,实施肾移植242例,其中单肾移植237例,双肾移植5例.受者年龄为(43.3±21.8)岁(12~64岁).术后1年受者总体存活率为93.8%(227/242),低于既往传统尸体肾移植95.4%的存活率,但差异无统计学意义(P>0.05).术后1年移植肾总体存活率为90.5%(219/242),低于既往传统尸体肾移植94.3%的存活率(P<0.05).术后DGF的发生率为33.1%(80/242),高于既往传统尸体肾移植23.6%的发生率(P<0.05).而术后1年急性排斥反应发生率、间质性肺炎发生率以及尿瘘、输尿管梗阻、心脑血管意外等并发症发生率与既往传统尸体肾移植相比较,差异无统计学意义(P>0.05).婴幼儿及儿童供肾移植总体结果良好,移植肾体积在术后3个月之内生长至接近成人肾脏大小.老年供肾弃用率高于总弃用率(P<0.05),但总体移植效果良好.结论 对于DCD供肾移植,严格筛选供者、加强供者濒死期器官维护、综合评估器官质量是提高受者长期存活、降低术后并发症发生率的关键.未成年供者供肾移植是解决供肾短缺的一条可行途径,无论是双肾移植还是单肾移植,均可获得优良的远期效果.而年龄>60岁供者供肾尽管弃用率较高,但只要肾脏质量评估得当,并不影响短期疗效.%Objective To

  5. C242T Polymorphism in CYBA Gene (p22phox and Risk of Coronary Artery Disease in a Population of Caucasian Italians

    Directory of Open Access Journals (Sweden)

    Sabina Nasti

    2006-01-01

    Full Text Available Background: specific polymorphisms of genes regulating intracellular redox balance and oxidative stress are related to atherogenesis. Some studies have identified a relationship between progression of atherosclerosis and C242T mutation in CYBA gene coding for p22phox, a subunit of the NADH/NADPH oxidase system.

  6. High-level waste storage tank farms/242-A evaporator Standards/Requirements Identification Document (S/RID), Volume 7. Revision 1

    International Nuclear Information System (INIS)

    The High-Level Waste Storage Tank Farms/242-A Evaporator Standards/Requirements Identification Document (S/RID) is contained in multiple volumes. This document (Volume 7) presents the standards and requirements for the following sections: Occupational Safety and Health, and Environmental Protection

  7. High-level waste storage tank farms/242-A evaporator Standards/Requirements Identification Document (S/RID), Volume 7. Revision 1

    Energy Technology Data Exchange (ETDEWEB)

    Burt, D.L.

    1994-04-01

    The High-Level Waste Storage Tank Farms/242-A Evaporator Standards/Requirements Identification Document (S/RID) is contained in multiple volumes. This document (Volume 7) presents the standards and requirements for the following sections: Occupational Safety and Health, and Environmental Protection.

  8. Method for Determination of Neptunium in Large-Sized Urine Samples Using Manganese Dioxide Coprecipitation and 242Pu as Yield Tracer

    DEFF Research Database (Denmark)

    Qiao, Jixin; Hou, Xiaolin; Roos, Per

    2013-01-01

    A novel method for bioassay of large volumes of human urine samples using manganese dioxide coprecipitation for preconcentration was developed for rapid determination of 237Np. 242Pu was utilized as a nonisotopic tracer to monitor the chemical yield of 237Np. A sequential injection extraction...

  9. I. Nuclear Production Reaction and Chemical Isolation Procedure for Americium-240 II. New Superheavy Element Isotopes: Plutonium-242(Calcium-48,5n)(285)114

    Science.gov (United States)

    Ellison, Paul Andrew

    2011-12-01

    Part I discusses the study of a new nuclear reaction and chemical separation procedure for the production of 240Am. Thin 242Pu, natTi, and natNi targets were coincidently activated with protons from the 88-Inch Cyclotron, producing 240Am, 48V, and 57Ni, respectively. The radioactive decay of these isotopes was monitored using high-purity Ge gamma ray detectors in the weeks following irradiation. The excitation function for the 242 Pu(p, 3n)240Am nuclear reaction was measured to be lower than theoretical predictions, but high enough to be the most viable nuclear reaction for the large-scale production of 240 Am. Details of the development of a chemical separation procedure for isolating 240Am from proton-irradiated 242Pu are discussed. The separation procedure, which includes two anion exchange columns and two extraction chromatography columns, was experimentally investi- gated using tracer-level 241Am, 239Pu, and model proton-induced fission products 95Zr, 95Nb, 125Sb, and 152Eu. The separation procedure was shown to have an Am/Pu separation factor of >2x10 7 and an Am yield of ˜70%. The separation procedure was found to purify the Am sample from >99.9% of Eu, Zr, Nb, and Sb. The procedure is well suited for the processing of ˜1 gram of proton-irradiated 242Pu to produce a neutron-induced fission target consisting of tens of nanograms of 240Am. Part II describes the use of the Berkeley Gas-filled Separator at the Lawrence Berkeley National Laboratory 88-Inch Cyclotron for the study of the 242Pu(48Ca,5n)285114 nuclear re- action. The new, neutron-deficient, superheavy element isotope 285114 was produced in 48Ca irradiations of 242Pu targets at a center-of-target beam energy of 256 MeV ( E* = 50 MeV). The alpha decay of 285114 was followed by the sequential alpha decay of four daughter nuclides, 281Cn, 277Ds, 273Hs, and 269 Sg. 265Rf was observed to decay by spontaneous fission. The measured alpha-decay Q-values were compared with those from a macroscopic

  10. A novel deletion in 2q24.1q24.2 in a girl with mental retardation and generalized hypotonia: a case report

    Directory of Open Access Journals (Sweden)

    Palumbo Orazio

    2012-01-01

    Full Text Available Abstract Background Chromosomal imbalances, recognized as the major cause of mental retardation, are often due to submicroscopic deletions or duplications not evidenced by conventional cytogenetic methods. To date, interstitial deletion of long arm of chromosome 2 have been reported for more than 100 cases, although studies reporting small interstitial deletions involving the 2q24.1q24.2 region are rare. With the widespread clinical use of comparative genomic hybridization chromosomal microarray technology, several cryptic chromosome imbalances have outlined new genotype-phenotype correlations and isolated a number of distinctive clinical conditions. Results here we report on a girl with mental retardation and generalized hypotonia. A genome-wide screen for copy number variations (CNVs using single nucleotide polymorphisms (SNPs array revealed a 7.5 Mb interstitial deletion of chromosome region 2q24.1q24.2 encompassing 59 genes, which was absent in parents. The gene content analysis of the deleted region and review of the literature revealed the presence of some genes that may be indicated as good candidate in generating the main clinical features of the patient. Discussion the present case represents a further patient described in the literature with an interstitial deletion of chromosome 2q24.1q24.2. Our patient shares some clinical features with the previously reported patients carriers of overlapping 2q24 deletion. Although more cases are needed to delineate the full-blown phenotype of 2q24.1q24.2 deletion syndrome, published data and present observation suggest that hemizygosity of this region results in a clinically recognizable phenotype. Considering these clinical and cytogenetic similarities, we suggest the existence of an emerging syndrome associated to 2q24.1q24.2 region.

  11. Deep vlt spectroscopy of high redshift radio galaxy MRC 2104{242: evidence for a metallicity gradient

    Directory of Open Access Journals (Sweden)

    R. Overzier

    2002-01-01

    Full Text Available En esta contribuci on vamos a presentar observaciones espectrosc opicas profundas del VLT (siglas en ingl es: Very Large Telescope del halo gigante de l neas de emisi on alrededor de la radiogalaxia MRC 2104{242 a z = 2:49. La morfolog a del halo viene determinado por dos regiones espaciales resueltas. Ly se extiende por > 1200 a lo largo del radioeje, C IV 1549 y He II 1640 se extienden por 800. El espectro total es t pico para radiogalaxias de alto corrimiento al rojo. Es interesante notar que N V 1240 est a presente en el espectro de la regi on asociada con el centro de la galaxia que contiene la radiofuente, la regi on del norte, mientras que est a ausente en la regi on del sur. Usando un modelo de fotoionizaci on simple, la diferencia en la emisi on N V 1240 se puede explicar por un gradiente de metalicidad en el halo. Esto es consistente con un escenario en el cual el halo se form o por un "cooling ow" masivo o tiene su origen en los residuos de la fusi on de dos o m as galaxias. Sin embargo, tambi en podr an ser importantes otros mecanismos como son las interacciones entre jets y nubes y los vientos debido a un \\starburst".

  12. Evaluation of nuclear data for 242Pu in the region of resolved and unresolved resonances (10-5 eV-200 keV)

    International Nuclear Information System (INIS)

    Neutron data for 242Pu are evaluated in the resolved and unresolved resonance regions. In the 10-5-1 keV region, the evaluation is based on the Breit-Wigner resonance parameters. In the unresolved resonance region, all types of average cross-section and width are calculated. The authors quote average parameters and cross-sections in the 1-200 keV region and analyse the errors in the evaluated data. (author)

  13. Receiver operating characteristic (ROC) curve analysis of the tumour markers CEA, CA 50 and CA 242 in pancreatic cancer; results from a prospective study.

    OpenAIRE

    Pasanen, P. A.; Eskelinen, M.; Partanen, K.; Pikkarainen, P; Penttilä, I.; Alhava, E

    1993-01-01

    The serum values of the tumour markers carcinoembryonic antigen (CEA), cancer-associated carboanhydrate antigens CA 50 and CA 242 were evaluated in 193 patients with hepatopancreato-biliary diseases by receiver operating characteristic (ROC) curve analysis in order to compare their diagnostic accuracy in pancreatic cancer (n = 26), and to define optimal cut-off levels for the serum values of these tumour markers in the diagnosis of pancreatic cancer. The ROC analysis showed that all marker te...

  14. The use of tumour markers CEA, CA-195 and CA-242 in evaluating the response to chemotherapy in patients with advanced colorectal cancer.

    OpenAIRE

    Ward, U.; Primrose, J N; Finan, P. J.; Perren, T. J.; Selby, P.; Purves, D. A.; Cooper, E H

    1993-01-01

    Tumour markers CEA, CA-195 and CA-242 were measured in 33 patients undergoing chemotherapy for advanced colorectal cancer. The aim was to determine whether they could be used to accurately monitor the course of the disease, and reduce the need for imaging. Treatment with a 5-fluorouracil based regimen resulted in a partial response in nine patients (27%), whereas the remainder either had disease stabilisation or suffered from progression. Before treatment the CEA was elevated in 85% of patien...

  15. Empiema paraneumónico: caracterización y factores asociados a morbi-mortalidad en 242 casos tratados quirúrgicamente Parapneuminic empyema: characterization and factors associated with morbility and mortality in 242 surgical cases

    Directory of Open Access Journals (Sweden)

    Roberto González L

    2012-03-01

    Full Text Available Objetivos: Describir las características y evaluar los factores asociados a morbi-mortalidad en el empiema paraneumónico (EPN tratado quirúrgicamente. Método: Revisión retrospectiva entre Enero 2000 y Agosto 2006. Se describen características y factores asociados a morbi-mortalidad, se realizó análisis univariado y multivariado utilizando programa SPSS 15.0. Resultados: 242 pacientes tenían EPN (70,6% de los empiemas tratados, 165 (68,2% fueron hombres, edad promedio 52,1 años, 229 (94,6% fueron neumonías adquiridas en la comunidad (NAC y 13 (5,4% intrahospitalarias. Se aisló gérmenes en líquido pleural en 57 (23,6%. Se realizaron 183 (75,6% decorticaciones, 49 (20,2% pleurotomías, 7 (2,9%, cirugías video-asistidas y 3 (1,2% decorticaciones con resección pulmonar. Presentaron complicaciones 65 (26,9%. Fallecieron 16 pacientes (6,6%. Se identificaron variables asociadas a morbi-mortalidad. Conclusiones: El EPN es la causa más frecuente de empiema, la mayoría está asociado a NAC y en pocos se identifican gérmenes. La decorticación es el procedimiento más frecuente. Se identificaron las variables asociadas a morbi-mortalidad en esta serie clínica.Objectives: To describe and evaluate factors associated with morbidity and mortality in surgically treated parapneumonic empyemas (PNE. Method: Retrospective review between January 2000 and August 2006. We described clinical features and we performed univariate and multivariate analysis to find the factors associated with morbidity and mortality. SPSS 15.0 program was used in the statistical analysis. Results: 242 of343 surgically treated empyemas (70.6% were paraneumonic. Of these 165 (68.2% were men, average age 52.1 years, 229 (94.6% were community-acquired pneumonia (CAP and 13 (5.4% nosocomial. Germs were isolated in pleural fluid in 57 (23.6%. Surgical procedures were: 183 (75.6% decortications, 49 (20.2% pleurotomies, 7 (2.9% video-assisted surgery and 3 (1.2% decortications

  16. C242T Polymorphism in CYBA Gene (p22phox) and Risk of Coronary Artery Disease in a Population of Caucasian Italians

    Science.gov (United States)

    Nasti, Sabina; Spallarossa, Paolo; Altieri, Paola; Garibaldi, Silvano; Fabbi, Patrizia; Polito, Luisa; Bacino, Luca; Brunelli, Michele; Brunelli, Claudio; Barsotti, Antonio; Ghigliotti, Giorgio

    2006-01-01

    Background: specific polymorphisms of genes regulating intracellular redox balance and oxidative stress are related to atherogenesis. Some studies have identified a relationship between progression of atherosclerosis and C242T mutation in CYBA gene coding for p22phox, a subunit of the NADH/NADPH oxidase system. Design: we investigated whether the C242T nucleotide transition is associated with the presence of coronary artery disease (CAD) in a population of 494 Caucasian Italians undergoing coronary angiography to diagnose the cause of chest pain. Results: the frequency of the T mutant allele that we found in 276 patients with angiographically documented CAD was significantly higher compared to what we observed in 218 subjects with normal coronary arteries (Controls) (respectively: 0.400 and 0.332, p < 0.01). The prevalence of the T allele was even stronger when we compared: 1) early onset (age ≤55) vs late onset (age ≥65) single-vessel CAD patients (respectively: 0.75 and 0.48, p < 0.05), and 2) the subgroup of CAD patients with at least one ≥98% stenosis in a coronary vessel vs those with no ≥98% stenosis in a coronary vessel (respectively: 0.425 and 0.365, p < 0.05). Conclusions: these results support the increased risk of developing early CAD and of having rapid progression of coronary stenosis in subjects carrying the C242T nucleotide transition among the Italian population. PMID:16788250

  17. De Novo 17q24.2-q24.3 microdeletion presenting with generalized hypertrichosis terminalis, gingival fibromatous hyperplasia, and distinctive facial features.

    Science.gov (United States)

    Afifi, Hanan H; Fukai, Ryoko; Miyake, Noriko; Gamal El Din, Amina A; Eid, Maha M; Eid, Ola M; Thomas, Manal M; El-Badry, Tarek H; Tosson, Angie M S; Abdel-Salam, Ghada M H; Matsumoto, Naomichi

    2015-10-01

    Generalized hypertrichosis is a feature of several genetic disorders, and the nosology of these entities is still provisional. Recent studies have implicated chromosome 17q24.2-q24.3 microdeletion and the reciprocal microduplication in a very rare form of congenital generalized hypertrichosis terminalis (CGHT) with or without gingival hyperplasia. Here, we report on a 5-year-old Egyptian girl born to consanguineous parents. The girl presented with CGHT and gingival hyperplasia for whom we performed detailed clinical, pathological, and molecular studies. The girl had coarse facies characterized by bilateral epicanthic folds, thick and abundant eyelashes, a broad nose, full cheeks, and lips that constituted the distinctive facial features for this syndrome. Biopsy of the gingiva showed epithelial marked acanthosis and hyperkeratosis with hyperplastic thick collagen bundles and dense fibrosis in the underlying tissues. Array analysis indicated a 17q24.2-q24.3 chromosomal microdeletion. We validated this microdeletion by real-time quantitative PCR and confirmed a perfect co-segregation of the disease phenotype within the family. In summary, this study indicates that 17q24.2-q24.3 microdeletion caused CGHT with gingival hyperplasia and distinctive facies, which should be differentiated from the autosomal recessive type that lacks the distinctive facies.

  18. The C242T polymorphism of the p22-phox gene (CYBA is associated with higher left ventricular mass in Brazilian hypertensive patients

    Directory of Open Access Journals (Sweden)

    Krieger José E

    2011-08-01

    Full Text Available Abstract Background Reactive oxygen species have been implicated in the physiopathogenesis of hypertensive end-organ damage. This study investigated the impact of the C242T polymorphism of the p22-phox gene (CYBA on left ventricular structure in Brazilian hypertensive subjects. Methods We cross-sectionally evaluated 561 patients from 2 independent centers [Campinas (n = 441 and Vitória (n = 120] by clinical history, physical examination, anthropometry, analysis of metabolic and echocardiography parameters as well as p22-phox C242T polymorphism genotyping. In addition, NADPH-oxidase activity was quantified in peripheral mononuclear cells from a subgroup of Campinas sample. Results Genotype frequencies in both samples were consistent with the Hardy- Weinberg equilibrium. Subjects with the T allele presented higher left ventricular mass/height2.7 than those carrying the CC genotype in Campinas (76.8 ± 1.6 vs 70.9 ± 1.4 g/m2.7; p = 0.009, and in Vitória (45.6 ± 1.9 vs 39.9 ± 1.4 g/m2.7; p = 0.023 samples. These results were confirmed by stepwise regression analyses adjusted for age, gender, blood pressure, metabolic variables and use of anti-hypertensive medications. In addition, increased NADPH-oxidase activity was detected in peripheral mononuclear cells from T allele carriers compared with CC genotype carriers (p = 0.03. Conclusions The T allele of the p22-phox C242T polymorphism is associated with higher left ventricular mass/height2.7 and increased NADPH-oxidase activity in Brazilian hypertensive patients. These data suggest that genetic variation within NADPH-oxidase components may modulate left ventricular remodeling in subjects with systemic hypertension.

  19. Alpha-decay branching ratios to high-lying excited-states of the 242Cm→238pu→ 234U →230Th→226Rn decay chain

    Institute of Scientific and Technical Information of China (English)

    ZHANG Jin-Juan; XU Chang; REN Zhong-Zhou

    2009-01-01

    We present a systematic calculation on the 0c-decay branching ratios to excited-states of an even-even α-decay chain 242Cm→238pu→234U →230Th→226Rn by the improved barrier penetration approach. The changes of the parities between the parent nuclei and the daughter nuclei are properly taken into account. The theoretical values are compared with the available experimental data and the deviation between them is within a factor of 5 in most cases.

  20. Developing an Anticancer Copper(II) Pro-Drug Based on the His242 Residue of the Human Serum Albumin Carrier IIA Subdomain.

    Science.gov (United States)

    Qi, Jinxu; Zhang, Yao; Gou, Yi; Zhang, Zhenlei; Zhou, Zuping; Wu, Xiaoyang; Yang, Feng; Liang, Hong

    2016-05-01

    To increase delivery efficiency, anticancer activity, and selectivity of anticancer metal agents in vivo, we proposed to develop the anticancer metal pro-drug based on His242 residue of the human serum albumin (HSA) carrier IIA subdomain. To confirm our hypothesis, we prepared two Cu(II) compounds [Cu(P4 mT)Cl and Cu(Bp44 mT)Cl] by modifying Cu(II) compound ligand structure. Studies with two HSA complex structures revealed that Cu(P4 mT)Cl bound to the HSA subdomain IIA via hydrophobic interactions, but Cu(Bp44 mT)Cl bound to the HSA subdomain IIA via His242 replacement of a Cl atom of Cu(Bp44 mT)Cl, and a coordination to Cu(2+). Furthermore, Cu(II) compounds released from HSA could be regulated at different pHs. In vivo data revealed that the HSA-Cu(Bp44 mT) complex increased copper's selectivity and capacity of inhibiting tumor growth compared to Cu(Bp44 mT)Cl alone. PMID:27017838

  1. Thermal neutron capture cross-section measurements of 243Am and 242Pu using the new mini-INCA α- and γ-spectroscopy station

    International Nuclear Information System (INIS)

    In the framework of the Mini-INCA project, dedicated to the study of Minor Actinide transmutation process in high neutron fluxes, an α- and γ-spectroscopy station has been developed and installed at the High Flux Reactor of the Laue-Langevin Institut. This set-up allows short irradiations as well as long irradiations in a high quasi-thermal neutron flux and post-irradiation spectroscopy analysis. It is well suited to measure precisely, in reference to 59Co cross-section, neutron capture cross-sections, for all the actinides, in the thermal energy region. The first measurements using this set-up were done on 243Am and 242Pu isotopes. Cross-section values, at En=0.025eV, were found to be (81.8+/-3.6)b for 243Am and (22.5+/-1.1)b for 242Pu. These values differ from evaluated data libraries by a factor of 9% and 17%, respectively, but are compatible with the most recent measurements, validating by the way the experimental apparatus

  2. Partial trisomy 9p22 to 9p24.2 in combination with partial monosomy 9pter in a Syrian girl

    Directory of Open Access Journals (Sweden)

    Moassass Faten

    2010-10-01

    Full Text Available Abstract Background Partial trisomy of the short arm of chromosome 9 is among the most common autosomal structural chromosomal anomalies leading to chromosomal imbalance in human. Clinical characteristics are craniofacial dysmorphism including hypertelorism, prominent nose, deep-set eyes, and down-slanting palpebral fissures. The degree of clinical severity in partial trisomy 9p roughly correlates with the size of the chromosomal imbalance. Therefore, breakpoints as well as clinical findings need to be precisely defined for differential diagnosis. Results Chromosomes of a young female were analyzed due to primary amenorrhea, short stature, developmental delay and a characteristic facial appearance. Cytogenetic analysis using GTG banding identified a karyotype 46, XX, add(9pter. Surprisingly the application of high resolution molecular cytogenetic techniques characterized a partial trisomy 9p24.2-p22 and partial monosomy 9pter-p24.2. To the best of our knowledge only four similar case were reported by now. Conclusion Attempts for genotype-phenotype correlations for partial trisomy 9p might have been hampered by the fact that more complex, cryptic aberrations were neither considered nor detected in comparable clinical cases.

  3. Methylation Status of SP1 Sites within miR-23a-27a-24-2 Promoter Region Influences Laryngeal Cancer Cell Proliferation and Apoptosis

    Directory of Open Access Journals (Sweden)

    Ye Wang

    2016-01-01

    Full Text Available DNA methylation plays critical roles in regulation of microRNA expression and function. miR-23a-27a-24-2 cluster has various functions and aberrant expression of the cluster is a common event in many cancers. However, whether DNA methylation influences the cluster expression and function is not reported. Here we found a CG-rich region spanning two SP1 sites in the cluster promoter region. The SP1 sites in the cluster were demethylated and methylated in Hep2 cells and HEK293 cells, respectively. Meanwhile, the cluster was significantly upregulated and downregulated in Hep2 cells and HEK293 cells, respectively. The SP1 sites were remethylated and the cluster was significantly downregulated in Hep2 cells into which methyl donor, S-adenosyl-L-methionine, was introduced. Moreover, S-adenosyl-L-methionine significantly increased Hep2 cell viability and repressed Hep2 cell early apoptosis. We also found that construct with two SP1 sites had highest luciferase activity and SP1 specifically bound the gene cluster promoter in vitro. We conclude that demethylated SP1 sites in miR-23a-27a-24-2 cluster upregulate the cluster expression, leading to proliferation promotion and early apoptosis inhibition in laryngeal cancer cells.

  4. ALGUNS ASPECTOS DO MANUSCRITO P-CUG MM 242: OS TENTOS E AS FANTASIAS DE ANTÓNIO CARREIRA E A SUA RELAÇÃO PRÓXIMA COM OS RICERCARI DO LIBRO PRIMO…(1547) DE JACQUES BUUS.

    OpenAIRE

    Oliveira, Filipe

    2011-01-01

    O manuscrito P-Cug MM 242 da Biblioteca Geral da Universidade de Coimbra constitui um dos grandes testemunhos do que foi a realidade da música instrumental em Portugal por volta de meados do século XVI. Em formato de partitura, inclui cópias de motetes, chansons, madrigais e diversas peças instrumentais de alguns dos principais impressos quinhentistas, flamengos e norte italianos. É também no MM 242 que se encontra copiada a totalidade da produção instrumental que até hoje conhecemos de Antón...

  5. Diagnostic value of joint detection of serum CA1 9-9,CA125 and CA242 for cholangiocarci-noma%血清 CA 19-9、CA 125、CA242联合检测对胆管癌诊断价值的评价

    Institute of Scientific and Technical Information of China (English)

    崔大鹏; 韩磊; 刘振显; 杨贺; 张迎春

    2016-01-01

    Objective:To study the diagnostic value of joint detection of serum CA1 9-9,CA125 and CA242 for cholan-giocarcinoma.Methods:A total of 35 patients with cholangiocarcinoma who received surgical resection in our hospital were se-lected as malignant group;30 patients with cholelithiasis who received surgical resection in our hospital during the same period were selected as benign group.Serum samples were collected before surgery to determine CA1 9-9,CA125 and CA242 content;and cholangiocarcinoma tissue and normal bile duct tissue were collected after surgery to determine the content of proliferation and invasion molecules.Results:Serum CA1 9-9,CA125 and CA242 levels of malignant group were significantly higher than those of control group (P <0.05);PROX-1,Ki-67,Bcl-2,Bad,Gab1,LOXL2,TRPM7 and CXCL12 levels in cholangiocar-cinoma tissue were significantly higher than those in benign bile duct tissue (P <0.05);and E-cadherin level was significantly lower than that in benign bile duct tissue (P <0.05);serum CA1 9-9,CA125 and CA242 levels were positively correlated with PROX-1,Ki-67,Bcl-2,Bad,Gab1,LOXL2,TRPM7 and CXCL12 levels,and negatively correlated with E-cadherin level. Conclusions:Joint detection of serum CA1 9-9,CA125 and CA242 can not only provide reference for the diagnosis of cholangio-carcinoma,but also can provide basis for the evaluation of proliferation,invasion and other malignant biological behaviors.%目的::研究血清 CA19-9、CA125、CA242联合检测对胆管癌的诊断价值.方法:选择在我院接受手术切除的35例胆管癌患者作为恶性组,同期在我院接受手术切除的30例胆石症患者作为良性组,术前采集血清标本并测定 CA19-9、CA125、CA242含量,术后采集胆管癌组织和正常胆管组织并测定增殖、侵袭分子的含量.结果:恶性组血清中 CA19-9、CA125、CA242的含量显著高于对照组(P <0.05);胆管癌组织中 PROX-1、Ki-67、Bcl-2、Bad、Gab1、LOXL2、TRPM7、CXCL12

  6. Neutron-induced fission cross sections of 242Pu from 0.3 MeV to 3 MeV

    Science.gov (United States)

    Salvador-Castiñeira, P.; Bryś, T.; Eykens, R.; Hambsch, F.-J.; Göök, A.; Moens, A.; Oberstedt, S.; Sibbens, G.; Vanleeuw, D.; Vidali, M.; Pretel, C.

    2015-10-01

    The majority of the next generation of nuclear power plants (GEN-IV) will work in the fast-neutron-energy region, as opposed to present day thermal reactors. This leads to new and more accurate nuclear-data needs for some minor actinides and structural materials. Following those upcoming demands, the Organisation for Economic Cooperation and Development Nuclear Energy Agency performed a sensitivity study. Based on the latter, an improvement in accuracy from the present 20% to 5% is required for the 242Pu(n ,f ) cross section. Within the same project both the 240Pu(n ,f ) cross section and the 242Pu(n ,f ) cross section were measured at the Van de Graaff accelerator of the Joint Research Centre at the Institute for Reference Materials and Measurements, where quasimonoenergetic neutrons were produced in an energy range from 0.3 MeV up to 3 MeV. A twin Frisch-grid ionization chamber has been used in a back-to-back configuration as fission-fragment detector. The 242Pu(n ,f ) cross section has been normalized to three different isotopes: 237Np(n ,f ) , 235U(n ,f ) , and 238U(n ,f ) . A comprehensive study of the corrections applied to the data and the uncertainties associated is given. The results obtained are in agreement with previous experimental data at the threshold region up to 0.8 MeV. The resonance-like structure at 0.8 to 1.1 MeV, visible in the evaluations and in most previous experimental values, was not reproduced with the same intensity in this experiment. For neutron energies higher than 1.1 MeV, the results of this experiment are slightly lower than the Evaluated Nuclear Data File/B-VII.1 evaluation but in agreement with the experiment of Tovesson et al. (2009) as well as Staples and Morley (1998). Finally, for energies above 1.5 MeV, the results show consistency with the present evaluations.

  7. The synthesis and complex anion-vacancy ordered structure of La0.33Sr0.67MnO2.42

    International Nuclear Information System (INIS)

    The low-temperature topotactic reduction of La0.33Sr0.67MnO3 with NaH results in the formation of La0.33Sr0.67MnO2.42. A combination of neutron powder and electron diffraction data show that La0.33Sr0.67MnO2.42 adopts a novel anion-vacancy ordered structure with a 6-layer OOTOOT' stacking sequence of the 'octahedral' and tetrahedral layers (Pcmb, a=5.5804(1) A, b=23.4104(7) A, c=11.2441(3) A). A significant concentration of anion vacancies at the anion site, which links neighbouring 'octahedral' layers means that only 25% of the 'octahedral' manganese coordination sites actually have 6-fold MnO6 coordination, the remainder being MnO5 square-based pyramidal sites. The chains of cooperatively twisted apex-linked MnO4 tetrahedra adopt an ordered -L-R-L-R- arrangement within each tetrahedral layer. This is the first published example of a fully refined structure of this type which exhibits such intralayer ordering of the twisted tetrahedral chains. The rationale behind the contrasting structures of La0.33Sr0.67MnO2.42 and other previously reported reduced La1-xSrxMnO3-y phases is discussed. - Graphical Abstract: The topotactic reduction of the perovskite phase La0.33Sr0.67MnO3 with NaH yields La0.33Sr0.67MnO2.42(3), which adopts a novel anion vacancy ordered structure with a 6-layer OOTOOT' stacking sequence of the 'octahedral' and tetrahedral layers. The anion site that links the neighbouring octahedral layers is partially occupied so only 25% of the 'octahedral' manganese sites actually have 6-fold MnO6 coordination. Highlights: → Topotactic reduction with NaH to form a mixed valent Mn2+/Mn3+ phase. → Novel layered anion-vacancy ordered structure. → Comparison to related brownmillerite structure types.

  8. Simultaneous measurement of 239Pu, 240Pu, 241Pu, and 242Pu by high resolution inductively coupled plasma mass spectrometer (HR ICP-MS) in marine sediments

    International Nuclear Information System (INIS)

    Transuranics elements are of particular interest in radioecological studies because of their radiotoxicity and their potential use to decipher source fingerprints and transport processes. The simultaneous measurement of 239Pu, 240Pu, 241Pu, and 242Pu in environmental samples requires a specific chemical procedure. This work deals with an analytical procedure which yields a very high grade of purification of Pu suitable for ultra low level detection by HR ICP-MS, from marine sediments. After the elimination of major elements (Fe, Al, Mg...) by a first chromatographic separation, a new device of purification by solvent extraction and concentration by a second chromatographic separation is used to obtain a concentrated and high purified solution of plutonium. The chemical procedure have been validated on IAEA certified sediment samples and on sediment samples collected in the roads of Cherbourg which had been previously analysed by other techniques (a spectrometry and thermo-ionisation mass spectrometer). (author)

  9. Microwave dielectric properties and microstructure of Ba2-xSm4+2x/3Ti8+yO24+2y ceramics

    International Nuclear Information System (INIS)

    The microstructure and microwave dielectric properties of barium samarium titanium oxide Ba2-xSm4+2x/3Ti8+yO24+2y (x=0.1, y=0∼2) ceramics (BST) were investigated. The optimum compositions of BST ceramics were synthesized and discussed base on the structure formula of the tungsten-bronze-type crystal phase. Differential thermal analysis (DTA) was used to select the suitable sintering temperatures. The relative dielectric constant of the BST compositions saturated in a range from 63 to 85. Qxf values of 8500-13000 (GHz) were obtained for various y values in dense samples. The temperature coefficient of resonant frequency τf was adjusted from a negative -12 ppm per deg. C value to a positive value 17 ppm per deg. C. X-ray diffraction, SEM and EDS analysis were used to investigate the microstructure and correlate its relationship with microwave dielectric properties of BST ceramics

  10. Antihyperglycemic and antihyperlipidemic activities of 2-(4-[(2-hydroxybenzyl) amino]-phenyl amino-methyl)-phenol in STZ induced diabetic rats.

    Science.gov (United States)

    Sirasanagandla, Swapna; Kasetti, Ramesh Babu; Shaik, Abdul Nabi; Natava, Rajesh; Surtineni, Venkata Prasad; Cirradur, Suresh Reddy; Chippada, Apparao

    2013-08-01

    Oral administration of 2-(4-[(2-hydroxybenzyl) amino]-phenyl amino-methyl)-phenol (HBPMP) (30 mg/kg) to Streptozotocin (STZ) rats produced significant antidiabetic activity after 6 h of HBPMP administration. Treatment of the STZ rats with HBPMP (30 mg/kg/day) for 30 days resulted in a significant decrease in their Fasting Blood Glucose (FBG), Serum Total Cholesterol (TC), Low Density Lipoprotein-Cholesterol (LDL-C), Very Low Density Lipoprotein-Cholesterol (VLDL-C) and triglycerides (TG) along with an increase in serum High Density Lipoprotein-Cholesterol (HDL-C) levels. Activities of Serum Aspartate transaminase (AST), Alanine transaminase (ALT) and Alkaline phosphatase (ALP) and levels of blood urea and creatinine were improved to near normal levels in the treated STZ rats indicating the protective role of the HBPMP against liver and kidney damage and its non-toxic property. In conclusion, HBPMP possesses antihyperglycemic and antihyperlipidemic activities.

  11. Investigation of the chemical explosion of an ion exchange resin column and resulting americium contamination of personnel in the 242-Z building, August 30, 1976

    Energy Technology Data Exchange (ETDEWEB)

    1976-10-19

    As a result of an explosion in the Waste Treatment Facility, 242-Z Building, 200 West Area of the Hanford Reservation on August 30, 1976, the Manager of the Richland Operations Office (RL), Energy Research and Development Administration (ERDA), appointed an ERDA Committee to conduct a formal investigation and to prepare a report on their findings of this occurrence. The Committee was instructed to conduct the investigation in accordance with ERDAMC 0502, insofar as circumstances would permit, to cover and explain technical elements of the casual sequence(s) of the occurrence, and to describe management systems which should have or could have prevented the occurrence. This report is the result of the investigation and presents the conclusions of the review.

  12. The relationship between NAD(P)H oxidase p22phox C242T polymorphism and stroke in the population of Han nationality of Shanghai city%中国上海汉族人群NAD(P)H氧化酶p22phox亚基C242T基因多态性与脑卒中相关性

    Institute of Scientific and Technical Information of China (English)

    李洪涛; 顾彬; 于芳苹; 赵迎春; 娄晓丽; 梁冬雨

    2013-01-01

    目的:研究NAD(P)H氧化酶p22phox亚基C242T基因多态性与脑卒中的相关性.方法:收集118例脑出血患者、125例脑梗死患者和147例正常对照组,研究对象均来自上海地区汉族人群,3组在年龄、性别构成比、体质指数(BMI)等基线指标均没有明显差异,分别进行血糖、血脂等各项指标的测定,用聚合酶链反应、限制性片段长度多态性分析(PCR-RFLP)和基因测序方法比较其在不同人群中的基因突变频率.结果:脑出血组、脑梗死组CT+ TT基因型(9.3%、9.6%)和T等位基因(4.7%、5.2%),均明显高于对照组(2.0%和1.0%,P< 0.05),脑梗死组中发现1例TT基因型,出血组与正常对照组均未发现TT基因型,与基因测序结果一致.采用二分类Logistic回归分析p22phox亚基C242T基因多态性与脑出血的相关性(β=1.712,OR=5.537,95%CI:1.120~27.381,P=0.036),与脑梗死的相关性(B=1.432,OR=4.187,95%CI:0.934~18.774,P=0.061),表明C242T基因多态性可能是脑出血、脑梗死的危险因素.结论:NAD(P)H氧化酶p22phox亚基C242T多态性与脑出血、脑梗死均有一定的相关性,可能是脑卒中的一个危险因素.但与高血压和饮酒等传统危险因素相比,C242T多态性对脑梗死的影响并不显著.%Objective:To investigate the relationship between the NAD (P)H oxidase p22phox C242T gene polymorphism and stroke.Methods:In this study,118 cases of cerebral hemorrhage,125 cases of cerebral infarction and 147 healthy controls were included,all cases are Han people in Shanghai region of China.Three groups had same baseline features of age,sexual proportion and BMI.Fasting glucose,and serum lipids were tested.The genotype and allele frequencies of the p22phox C242T polymorphism were determined by polymemse chain reaction-restriction fragment length polymorphism (PCR-RFLP) and gene sequencing technology.Results:The CT+TT genotype frequencies in the cecebral hemorrhage group,cerebral infarction group

  13. Hypoxia Enhances the Toxicity of Corexit EC9500A and Chemically Dispersed Southern Louisiana Sweet Crude Oil (MC-242 to Sheepshead Minnow (Cyprinodon variegatus Larvae.

    Directory of Open Access Journals (Sweden)

    Subham Dasgupta

    Full Text Available Oil exploration and production activities are common in the northern Gulf of Mexico as well as many other coastal and near coastal areas worldwide. Seasonal hypoxia is also a common feature in the Northern Gulf, and many other coastal areas, which is likely to increase in severity and extent with continuing anthropogenic nutrient inputs. Hypoxia has well established physiological effects on many organisms, and it has been shown to enhance the toxicity of polycyclic aromatic hydrocarbons (persistent components of petroleum in fish. The goal of this study was to examine the combined effects of hypoxia and exposure to contaminants associated with oil spills. We evaluated the effects of short term (48 hr exposures to Corexit EC9500A, water accommodated fractions (WAF, and chemically enhanced water accommodated fractions (CEWAF prepared from Southern Louisiana Sweet Crude Oil (MC 242 on survival of sheepshead minnow (Cyprinodon variegatus larvae held under normoxic (ambient air or hypoxic (2 mg/L O2 conditions. Results demonstrated that hypoxia significantly enhances mortality observed in response to Corexit or CEWAF solutions. In the latter case, significant interactions between the two stressors were also observed. Our data supports the need to further evaluate the combined stresses imparted by hypoxia and exposure to petroleum hydrocarbons and dispersants.

  14. Apparent molar volumes of aqueous calcium chloride to 250{degrees}C, 400 bars, and from molalities of 0.242 to 6.150

    Energy Technology Data Exchange (ETDEWEB)

    Oakes, C.S.; Bodnar, R.J. [Virginia Polytechnic Inst. and Univ., Blacksburg, VA (United States); Simonson, J.M. [Univ. of California, Berkeley, CA (United States)

    1995-09-01

    Relative densities of CaCl{sub 2}(aq) with 0.242 {le} m/(mol-kg{sup {minus}1}) {le} 6.150 were measured with vibrating-tube densimeters between 25 and 250{degrees}C and near 70 and 400 bars. Apparent molar volumes V{sub {null}} calculated from the measured density differences were represented with the Pitzer ion-interaction treatment, with appropriate expressions chosen for the temperature and pressure dependence of the virial coefficients of the model. It was found that the partial molar volume at infinite dilution V{sub {null}}{sup o}, and the second and third virial coefficients B{sup v} and C{sup v}, were necessary to represent V{sub {null}} near the estimated experimental uncertainty. The ionic-strength dependent {Beta}{sup 1}{sup v} term in the B{sup v} coefficient was included in the fit. The representation for V{sub {null}} has been integrated with respect to pressure to establish the pressure dependence of excess free energies over the temperature range studied. The volumetric data indicate that the logarithm of the mean ionic activity coefficient, ln {gamma}{plus_minus}(CaCl{sub 2}), increases by a maximum of 0.3 at 400 bars, 250{degrees}C, and 6 mol-kg{sup {minus}1} as compared with its value at saturation pressure.

  15. Survey of potential markets for devices using Californium-252

    International Nuclear Information System (INIS)

    Potential applications for devices or systems containing 252Cf in the years from 1975 to 1980 are estimated. The estimated number of devices and associated business value were derived from a survey of 46 industrial, educational and governmental organizations conducted from Jan. to May, 1975. Applications for devices and systems based on 252Cf are expected to increase by a factor of 7 in the 6-y period from 1975 to 1980. The annual business value of 252Cf devices should increase from 1.5 million dollars in 1975 to 10.8 million dollars in 1980. The potential European market should be several times as large as the US market, based on actual sales of 252Cf, which have been two to four times greater in Europe than in the US

  16. Automated absolute activation analysis with californium-252 sources

    Energy Technology Data Exchange (ETDEWEB)

    MacMurdo, K.W.; Bowman, W.W.

    1978-09-01

    A 100-mg /sup 252/Cf neutron activation analysis facility is used routinely at the Savannah River Laboratory for multielement analysis of many solid and liquid samples. An absolute analysis technique converts counting data directly to elemental concentration without the use of classical comparative standards and flux monitors. With the totally automated pneumatic sample transfer system, cyclic irradiation-decay-count regimes can be pre-selected for up to 40 samples, and samples can be analyzed with the facility unattended. An automatic data control system starts and stops a high-resolution gamma-ray spectrometer and/or a delayed-neutron detector; the system also stores data and controls output modes. Gamma ray data are reduced by three main programs in the IBM 360/195 computer: the 4096-channel spectrum and pertinent experimental timing, counting, and sample data are stored on magnetic tape; the spectrum is then reduced to a list of significant photopeak energies, integrated areas, and their associated statistical errors; and the third program assigns gamma ray photopeaks to the appropriate neutron activation product(s) by comparing photopeak energies to tabulated gamma ray energies. Photopeak areas are then converted to elemental concentration by using experimental timing and sample data, calculated elemental neutron capture rates, absolute detector efficiencies, and absolute spectroscopic decay data. Calculational procedures have been developed so that fissile material can be analyzed by cyclic neutron activation and delayed-neutron counting procedures. These calculations are based on a 6 half-life group model of delayed neutron emission; calculations include corrections for delayed neutron interference from /sup 17/O. Detection sensitivities of < or = 400 ppB for natural uranium and 8 ppB (< or = 0.5 (nCi/g)) for /sup 239/Pu were demonstrated with 15-g samples at a throughput of up to 140 per day. Over 40 elements can be detected at the sub-ppM level.

  17. Californium-252 neutron activation facility at the Savannah River Laboratory

    International Nuclear Information System (INIS)

    A neutron irradiation facility has been established to develop new analytical methods and for the support of research programs. A major component of this facility is a 252Cf source which provides both fission spectrum and thermal neutrons. (U.S.)

  18. SOME ASPECTS OF MANUSCRIPT P-CUG MM 242: ANTÓNIO CARREIRA´S KEYBOARD TENTOS AND FANTASIAS IN ITS CLOSE RELATION WITH JACQUES BUUS´S RICERCARI FROM HIS LIBRO PRIMO…(1547).

    OpenAIRE

    Oliveira, Filipe

    2011-01-01

    Manuscript P-Cug MM 242 from the Biblioteca Geral da Universidade de Coimbra contains important evidence regarding mid-sixteenth century instrumental practice in Portugal. In score-format, it includes copies of motets, chansons, madrigals and instrumental works from some of the most important Flemish and North Italian sixteenth century prints. Additionally, it contains all the music that we know so far by the most important sixteenth century Portuguese keyboard composer, António Carreira. The...

  19. A prospective study of serum tumour markers carcinoembryonic antigen, carbohydrate antigens 50 and 242, tissue polypeptide antigen and tissue polypeptide specific antigen in the diagnosis of pancreatic cancer with special reference to multivariate diagnostic score.

    OpenAIRE

    Pasanen, P. A.; Eskelinen, M.; Partanen, K.; Pikkarainen, P; Penttilä, I.; Alhava, E

    1994-01-01

    The aim of this study was to assess by a stepwise multivariate discriminant analysis the value of four current serum tumour markers - carcinoembryonic antigen (CEA), carbohydrate antigen (CA) 50 and CA 242 and tissue polypeptide antigen (TPA) - and a new serum tumour marker, tissue polypeptide specific antigen (TPS), in the diagnosis of pancreatic cancer. The serum values were measured in a prospective series of patients with jaundice, with unjaundiced cholestasis and with a suspicion of chro...

  20. Association of the NAD(P)H oxidase p22 phox gene C242T polymorphism with type 2 diabetes mellitus, diabetic nephropathy, and carotid atherosclerosis with type 2 diabetes mellitus: A meta-analysis

    OpenAIRE

    Tao Li; Hai-feng Xi; Hong-min Luo; Wen-xuan Liu; Xia Gao; Dian-wu Liu; Lei Yang

    2015-01-01

    Background: Several epidemiological studies have evaluated the association between the NAD(P)H oxidase p22 phox gene C242T polymorphism and the risk of type 2 diabetes mellitus (T2DM), diabetic nephropathy (DN), and carotid atherosclerosis with T2DM (CA), but the results are inconclusive. This meta-analysis was therefore designed to clarify these controversies. Methods: Systematic searches were performed using electronic databases such as MEDLINE, PubMed, EMBASE, and China National Knowled...

  1. Independent prognostic value of preoperative serum markers CA 242, specific tissue polypeptide antigen and human chorionic gonadotrophin beta, but not of carcinoembryonic antigen or tissue polypeptide antigen in colorectal cancer.

    OpenAIRE

    Carpelan-Holmström, M; Haglund, C.; Lundin, J; Alfthan, H.; Stenman, U H; Roberts, P. J.

    1996-01-01

    The prognostic value of preoperative serum concentrations of carcinoembryonic antigen (CEA), CA 242, tissue polypeptide antigen (TPA), specific tissue polypeptide antigen (TPS) and human chorionic gonadotrophin beta (hCG beta) in 251 patients with colorectal cancer (39 Dukes' A, 98 Dukes' B, 56 Dukes' C and 58 Dukes' D) was investigated. When using the cut-off levels recommended for diagnostic purposes, there was a significantly longer overall survival in patients with low tumour marker level...

  2. «Some aspects of P-Cug, MM 242: António Carreira’s keyboard tentos and fantasias and their close relationship with Jacques Buus’s ricercari from his Libro primo (1547)»

    OpenAIRE

    Oliveira, Filipe Mesquita de

    2013-01-01

    Manuscript P-Cug MM 242 from the Biblioteca Geral da Universidade de Coimbra contains important evidence regarding mid-sixteenth century instrumental practice in Portugal. In score-format, it includes copies of motets, chansons, madrigals and instrumental works from some of the most important Flemish and North Italian sixteenth century prints. Additionally, it contains all the music that we know so far by the most important sixteenth century Portuguese keyboard composer, António Carreira. The...

  3. SILICATE, WATER TEMPERATURE, FLUORESCENCE, PHOTOSYNTHETIC ACTIVE RADIATION (PAR) and other profile and discrete sample data collected in the Gulf of Alaska on the ALPHA HELIX cruises HX242, HX244 and others as part of the NEP project from 2001-04-18 to 2003-08-11 (NODC Accession 0113348)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0113348 includes profile, discrete sample, biological, chemical and physical data collected aboard the ALPHA HELIX during cruises HX242, HX244,...

  4. SALINITY, WATER TEMPERATURE, FLUORESCENCE, PHOTOSYNTHETIC ACTIVE RADIATION (PAR) and other profile data collected in the Gulf of Alaska on the ALPHA HELIX cruises HX242, HX244 and others as part of the NEP project from 2001-04-18 to 2003-08-11 (NODC Accession 0115255)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0115255 includes profile, biological and physical data collected aboard the ALPHA HELIX during cruises HX242, HX244, HX247, HX271 and HX275 in the...

  5. CHLOROPHYLL A, growth rate and graze rate (or grazing rate) site samples data collected in the Gulf of Alaska on the ALPHA HELIX cruises HX242, HX244 and others as part of the NEP project from 2001-04-18 to 2003-08-10 (NODC Accession 0114241)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC Accession 0114241 includes site samples and biological data collected aboard the ALPHA HELIX during cruises HX242, HX244, HX247, HX271 and HX275 in the Gulf of...

  6. Measurement of the Neutron Capture Cross Sections of $^{233}$U, $^{237}$Np, $^{240,242}$Pu, $^{241,243}$Am and $^{245}$Cm with a Total Absorption Calorimeter at n_TOF

    CERN Multimedia

    Beer, H; Wiescher, M; Cox, J; Rapp, W; Embid, M; Dababneh, S

    2002-01-01

    Accurate and reliable neutron capture cross section data for actinides are necessary for the poper design, safety regulation and precise performance assessment of transmutation devices such as Fast Critical Reactors or Accelerator Driven Systems (ADS). The goal of this proposal is the measurement of the neutron capture cross sections of $^{233}$U, $^{237}$Np, $^{240,242}$Pu, $^{241,243}$Am and $^{245}$Cm at n_TOF with an accuracy of 5~\\%. $^{233}$U plays an essential role in the Th fuel cycle, which has been proposed as a safer and cleaner alternative to the U fuel cycle. The capture cross sections of $^{237}$Np,$^{240,242}$Pu, $^{241,243}$Am and $^{245}$Cm play a key role in the design and optimization of a strategy for the Nuclear Waste Transmutation. A high accuracy can be achieved at n_TOF in such measurements due to a combination of features unique in the world: high instantaneous neutron fluence and excellent energy resolution of the facility, innovative Data Acquisition System based on flash ADCs and t...

  7. Effect of (3,5,6-trimethylpyrazin-2-yl)methyl 2-[4-(2-methylpropyl)phenyl]propanoate (ITE), a newly developed anti-inflammatory drug, on type II collagen-induced arthritis in mice.

    Science.gov (United States)

    Ma, Tao; Cao, Ying-Lin; Xu, Bei-Bei; Zhou, Xiao-Mian

    2004-06-01

    The effect of (3,5,6-trimethylpyrazin-2-yl)methyl 2-[4-(2-methylpropyl)phenyl]propanoate (ITE) on type II collagen (CII)-induced arthritis in mice was studied. Mice were immunized twice with CII, ITE being given orally once a day for 40 d after the 1st immunization. Clinical assessment showed that ITE had no effect on the day of onset of arthritis but did lowered the incidence rate of arthritis and the arthritis score. And ITE had a marked suppressive effect on the mouse hind paw edema induced by CII. ITE suppressed the delayed-type mouse ear skin reaction to CII but had no effect on the level of serum anti-CII antibodies. These results suggest that ITE inhibits the development of CII-induced arthritis in mice by suppressing delayed-type hypersensitivity to CII.

  8. Measurements of Cross Sections and Decay Properties of the Isotopes of Elements 112, 114 and 116 Produced in the Fusion Reactions $^{233,238}$U, $^{242}$Pu, and $^{248}$Cm + $^{48}$Ca

    CERN Document Server

    Oganessian, Yu T; Utyonkov, V K; Lobanov, Yu V; Abdullin, F S; Polyakov, A N; Shirokovsky, I V; Tsyganov, Yu S; Gulbekyan, G G; Bogomolov, S L; Gikal, B N; Mezentsev, A N; Iliev, S; Subbotin, V G; Sukhov, A M; Voinov, A A; Buklanov, G V; Subotic, K M; Zagrebaev, V I; Itkis, M G; Patin, J B; Moody, K J; Wild, J F; Stoyer, M A; Stoyer, N J; Shaughnessy, D A; Kenneally, J M; Wilk, P A; Lougheed, R W; Ilkaev, R I; Vesnovskii, S P

    2004-01-01

    We have studied the dependence of the production cross-sections of the isotopes $^{282,283}$112 and $^{286,287}$114 on the excitation energy of the compound nuclei $^{286}$112 and $^{290}$114. The maximum cross-section values of the \\textit{xn}-evaporation channels for the reaction $^{238}$U($^{48}$Ca, \\textit{xn})$^{286 - x}$112 were measured to be: $\\sigma _{3n}=2.5_{-1.1}^{ + 1.8} $pb and $\\sigma _{4n}=0.6_{ - 0.5}^{ + 1.6} $ pb; for the reaction $^{242}$Pu($^{48}$Ca, \\textit{xn})$^{290 - x}$114: $\\sigma _{2n}\\sim 0.5$ pb, $\\sigma _{3n}=3.6_{- 1.7}^{ + 3.4} $ pb and $\\sigma _{4n}=4.5_{ - 1.9}^{ + 3.6} $ pb. In the reaction $^{233}$U($^{48}$Ca, 2--4$n$)$^{277 - 279}$112 at $E^*=34.9\\pm $2.2 MeV we measured an upper cross-section limit of $\\sigma _{xn} \\leqslant 0.6$ pb. The observed shift of the excitation energy associated with the maximum sum evaporation residue cross section $\\sigma _{\\rm {ER}}(E^*)$ to values significantly higher than that associated with the calculated Coulomb barrier can be caused by ...

  9. Prevalência e padrão de distribuição das doenças cerebrovasculares em 242 idosos, procedentes de um hospital geral, necropsiados em Belo Horizonte, Minas Gerais, no período de 1976 a 1997 Prevalence and types of cerebrovascular diseases in 242 hospitalized elderly patients, autopsied in Belo Horizonte, Minas Gerais, Brazil, from 1976 to 1997

    Directory of Open Access Journals (Sweden)

    José Eymard H. Pittella

    2002-03-01

    Full Text Available OBJETIVO: Descrever a prevalência e os tipos das doenças cerebrovasculares (DCVs em indivíduos idosos necropsiados. MÉTODO: Foram consultados os laudos neuropatológicos de 242 pacientes com idade igual ou superior a 61 anos, procedentes em sua maioria do Hospital das Clínicas da Universidade Federal de Minas Gerais, em Belo Horizonte, Minas Gerais, e necropsiados consecutivamente no período 1976 a 1997. RESULTADO: Os principais grupos de doenças do sistema nervoso central (SNC foram representados por DCVs (71,9%, infecções (12,4%, neoplasias (7,1%, traumatismos crânio-encefálicos (3,7%, doenças nutricionais (2,5% e doenças degenerativas (1,7%. As DCVs mais frequentes foram: aterosclerose (61,2%, doença cerebrovascular hipertensiva (25,6% e infarto cerebral (14,9%. Observou-se aumento da frequência e da gravidade da aterosclerose e da frequência da doença cerebrovascular hipertensiva com o avançar da idade. Houve associação significativa entre doença cerebrovascular hipertensiva e aterosclerose. As DCVs foram clinicamente sintomáticas e as responsáveis diretas pelo óbito em 42,7% e 17,3% dos pacientes, respectivamente. CONCLUSÃO: As DCVs constituíram o principal grupo de doenças do SNC no idoso. A aterosclerose e a doença cerebrovascular hipertensiva foram as principais doenças deste grupo, notando-se aumento de sua frequência com o avançar da idade e associação significativa entre ambas.OBJECTIVE: To describe the prevalence and the types of cerebrovascular diseases (CVDs in autopsied elderly individuals. METHOD: Consecutive clinical charts and neuropathological reports of 242 patients aged 61 years or older were reviewed. The patients died in Hospital das Clínicas, Federal University of Minas Gerais, in Belo Horizonte, Minas Gerais, Brazil, from 1976 to 1997. RESULTS: The prevalent diseases of the central nervous system (CNS found in decreasing order were: CVDs (71.9%, infections (12.4%, neoplasms (7.1%, head

  10. 24 CFR 242.54 - Nondiscrimination.

    Science.gov (United States)

    2010-04-01

    ... all applicable civil rights laws and regulations, including 24 CFR part 200, subpart J (Equal Employment Opportunity), and the Americans with Disabilities Act (42 U.S.C. 12101 et seq.). Racially... and sex discrimination do not affect the eligibility of hospitals for women and children....

  11. 48 CFR 242.7501 - Policy.

    Science.gov (United States)

    2010-10-01

    ... provide reasonable assurance that— (a) Applicable laws and regulations are complied with; (b) The... DEFENSE CONTRACT MANAGEMENT CONTRACT ADMINISTRATION AND AUDIT SERVICES Contractor Accounting Systems...

  12. 24 CFR 242.16 - Applications.

    Science.gov (United States)

    2010-04-01

    ...) Service area definition; (B) Existing or proposed hospital; (C) Designation as sole community provider... mix, market trends, population forecasts, and business climate; (v) The hospital's demonstrated ability to position itself to compete in its marketplace; (vi) Organizational affiliations...

  13. 24 CFR 242.1 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... acquiring new or replacement equipment may be included in the cost of construction. Days of cash on hand..., supplies, tools, books, records (whether in written or electronic form), computer equipment (hardware and... would cause an application to be rejected have been identified, and therefore there appears to be no...

  14. 32 CFR 242.3 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... ADMISSION POLICIES AND PROCEDURES FOR THE SCHOOL OF MEDICINE, UNIFORMED SERVICES UNIVERSITY OF THE HEALTH... advanced (junior-senior level) nonscholarship ROTC. (4) Individuals in attendance at any of the three.... Means the Medical School program of the Uniformed Services University of the Health Sciences. (e)...

  15. 17 CFR 242.402 - General provisions.

    Science.gov (United States)

    2010-04-01

    ... Regulation T, U or X of the Board of Governors of the Federal Reserve System (12 CFR parts 220, 221, and 224...) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Customer...

  16. 17 CFR 242.401 - Definitions.

    Science.gov (United States)

    2010-04-01

    ...) Regulation T means Regulation T promulgated by the Board of Governors of the Federal Reserve System, 12 CFR... M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Customer...

  17. 17 CFR 242.403 - Required margin.

    Science.gov (United States)

    2010-04-01

    ...) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Customer Margin... of a customer in a securities account or futures account as set forth in this section. (b) Required... be twenty (20) percent of the current market value of such security future. (2) Offsetting...

  18. 32 CFR 242.5 - Admission procedures.

    Science.gov (United States)

    2010-07-01

    ... qualified applicants, based on aptitude, intelligence, maturity, personality, emotional stability, diligence... military personnel, if required, shall be performed at the individual's supporting military medical facility and reviewed by the Department of Defense Medical Examination Review Board (DoDMERB)....

  19. 36 CFR 242.4 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... and wildlife resources and their habitats in a condition that assures stable and continuing natural... that local rural residents engaged in subsistence uses may be a natural part of that ecosystem... Rivers Systems, National Forest Monument, National Recreation Area, National Conservation Area,...

  20. 43 CFR 24.2 - Purpose.

    Science.gov (United States)

    2010-10-01

    ... new opportunities to foster a “good neighbor” policy with the States. ...: Interior Office of the Secretary of the Interior DEPARTMENT OF THE INTERIOR FISH AND WILDLIFE POLICY: STATE... Policy is to clarify and support the broad authorities and responsibilities of Federal 2 and...

  1. 17 CFR 242.201 - Price test.

    Science.gov (United States)

    2010-04-01

    ... M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Sho.... For the purposes of this section: (1) The term covered security shall mean any NMS stock as defined...

  2. 17 CFR 242.300 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Ats... or more of the capital of the alternative trading system. (g) NMS stock shall have the meaning... NMS stock for purposes of this Regulation ATS. (h) Effective transaction reporting plan shall have...

  3. 19 CFR 10.242 - Definitions.

    Science.gov (United States)

    2010-04-01

    ... of a finding or trimming of non-textile materials, that the finding or trimming is a product of a... Harmonized Tariff Schedule of the United States. Knit-to-Shape Components. “Knit-to-shape,” when used with... or other personal effects during travel) and brief cases, portfolios, school bags,...

  4. 2-[4-(2-Formylphenoxybutoxy]benzaldehyde

    Directory of Open Access Journals (Sweden)

    Aliakbar Dehno Khalaji

    2011-09-01

    Full Text Available In the crystal structure of the title compound, C18H18O4, the full molecule is generated by the application of an inversion centre. The molecule is essentially planar, with an r.m.s. deviation of 0.017 (1 Å for all non-H atoms. The molecules are linked through intermolecular C—H...O interactions to form a molecular sheet parallel to the (overline{1}02 plane.

  5. Measurements of cross sections and decay properties of the isotopes of elements 112, 114, and 116 produced in the fusion reactions 233,238U, 242Pu, and 248Cm+48Ca

    International Nuclear Information System (INIS)

    We have studied the dependence of the production cross sections of the isotopes 282,283112 and 286,287114 on the excitation energy of the compound nuclei 286112 and 290114. The maximum cross section values of the xn-evaporation channels for the reaction 238U(48Ca,xn)286-x112 were measured to be σ3n=2.5-1.1+1.8 pb and σ4n=0.6-0.5+1.6 pb; for the reaction 242Pu(48Ca,xn)290-x114: σ2n∼0.5 pb, σ3n=3.6-1.7+3.4 pb, and σ4n=4.5-1.9+3.6 pb. In the reaction 233U(48Ca,2-4n)277-279112 at E*=34.9=2.2 MeV we measured an upper cross section limit of σxn≤0.6 pb. The observed shift of the excitation energy associated with the maximum sum evaporation residue cross section σER(E*) to values significantly higher than that associated with the calculated Coulomb barrier can be caused by the orientation of the deformed target nucleus in the entrance channel of the reaction. An increase of σER in the reactions of actinide targets with 48Ca is consistent with the expected increase of the survivability of the excited compound nucleus upon closer approach to the closed neutron shell N=184. In the present work we detected 33 decay chains arising in the decay of the known nuclei 282112, 283112, 286114, 287114, and 288114. In the decay of 287114(α)→283112(α)→279110(SF), in two cases out of 22, we observed decay chains of four and five sequential α transitions that end in spontaneous fission of 271Sg (Tα/SF=2.4-1.0+4.3 min) and 267Rf (TSF∼2.3 h), longer decay chains than reported previously. We observed the new nuclide 292116 (Tα=18-6+16 ms,Eα=10.66±0.07 MeV) in the irradiation of the 248Cm target at a higher energy than in previous experiments. The observed nuclear decay properties of the nuclides with Z=104-118 are compared with theoretical nuclear mass calculations and the systematic trends of spontaneous fission properties. As a whole, they give a consistent pattern of decay of the 18 even-Z neutron-rich nuclides with Z=104-118 and N=163-177. The experiments were

  6. The clinical analysis about the dilatation for the stoma narrow after operation of carcinoma of esophago cardia%扩张治疗242例食管贲门癌术后吻合口狭窄疗效分析

    Institute of Scientific and Technical Information of China (English)

    林焕雄; 蔡文

    2010-01-01

    目的 总结扩张治疗食管贲门癌术后吻合口狭窄的临床疗效.方法 采用沙氏扩张器治疗242例吻合口狭窄患者.结果 共行扩张治疗647例次,平均2.67次/人.有效率99.1%,痊愈率达87.6%.结论 采用沙氏扩张器是治疗食管贲门癌术后吻合口狭窄一种安全、简便、有效手段之一.%Objective The author summarizes the clinical curative effect about the dilatation for the stoma narrow after operation of carcinoma of esophago cardia. Methods 242 patients included were expanded with Savary-Gilliard dilator. Results 647 expanding therapies were made, average 2.67 times per patient. The effective rate is 99.1%,the recovery rate is 87.6%. Conclusion The dilatation using Savary-Gilliard dilator is one of the safe, convenient, effective methods in the treatment of stoma narrow after operation of carcinoma of esophago cardia.

  7. Two different zinc(II)-aqua complexes held up by a metal-oxide based support: Synthesis, crystal structure and catalytic activity of [HMTAH]2[{Zn(H2O)5}{Zn(H2O)4}{Mo7O24}].2H2O (HMTAH = protonated hexamethylenetetramine)

    Indian Academy of Sciences (India)

    T Arumuganathan; A Srinivasarao; T Vijay Kumar; Samar K Das

    2008-01-01

    An inorganic−organic hybrid material, [HMTAH]2[{Zn(H2O)5}{Zn(H2O)4}{Mo7O24}].2H2O (1) (where HMTAH = protonated hxamethylenetetramine) has been synthesized and structurally characterized. The compound 1 crystallizes in a monoclinic space group 2/. The crystal data of 1: = 43.12(3), = 12.399(10), = 16.285(13), = 111.131(11), = 8. Its crystal structure shows that two different Zn(II)-aqua complexes, [Zn(H2O)5]2+ and [Zn(H2O)4]2+ are covalently coordinated to a heptamolybdateanion [Mo7O24]6- resulting in an anionic species of polyoxometalate supported zinc-aqua complexes, [{Zn(H2O)}{Zn(H2O)4}{Mo7O24}]2-, that is stabilized with two protonated hexamethylenetetramine cations in the title compound 1. In the crystal structure, both lattice water molecules are found to interact with the heptamolybdate cluster anion and the protonated hexamethylenetetramine cation resulting in an intricate three-dimensional hydrogen bonding network. Interestingly, compound 1 exhibits catalytic activity towards oxidation of some primary alcohols.

  8. OER of californium-252 at low dose rate for growth inhibition in Vicia faba

    International Nuclear Information System (INIS)

    OER of 252Cf, at low dose rate, has been determined for growth inhibition in Vicia faba roots. A new strain ''BelB'' was used; it was found to be more resistant to prolonged anoxia. Two sets of linear 252Cf sources were used (linear activity 0.31 and 0.47 (μg.cm-1)) in somewhat different geometrical arrangements. The (n+γ) 252Cf dose rates at the level of the root tips were 0.11 and 0.13 Gy.h-1 respectively. The relative contribution of the γ component Dsub(γ) to the total absorbed dose Dsub(n+γ) at the level of the root tips was evaluated Dsub(γ)/Dsub(n+γ)=0.35 for the first source-geometry and 0.42 for the second source-geometry. The reference radiation was the γ emission of 192Ir, used in the same geometrical conditions and for similar irradiation times. Irradiations performed in aerobic and anoxic conditions were alternated. OER values of 1.4 +- 0.1 and 1.5 +- 0.1 were observed for the 252Cf emission with the first and second source-geometry respectively. The corresponding OER values for 192Ir were 2.3 +- 0.2 and 2.6 +- 0.1; the derived oxygen gain factors were then equal to 1.6 and 1.7 repectively

  9. Multi-element neutron activation analysis of sediment using a californium-252 source

    International Nuclear Information System (INIS)

    The application of a 252Cf source to the neutron activation analysis of several elements in small (approximately 1.5 in. in dia) cores was studied using high-resolution gamma ray spectroscopy and manual data reduction. (U.S.)

  10. Simultaneous measurement of {sup 239}Pu, {sup 240}Pu, {sup 241}Pu, and {sup 242}Pu by high resolution inductively coupled plasma mass spectrometer (HR ICP-MS) in marine sediments; Mesure des isotopes du plutonium des sediments marins par spectrometrie de masse a plasma couple inductivement haute resolution (HR ICP-MS)

    Energy Technology Data Exchange (ETDEWEB)

    Bruneau, F

    1999-07-01

    Transuranics elements are of particular interest in radioecological studies because of their radiotoxicity and their potential use to decipher source fingerprints and transport processes. The simultaneous measurement of {sup 239}Pu, {sup 240}Pu, {sup 241}Pu, and {sup 242}Pu in environmental samples requires a specific chemical procedure. This work deals with an analytical procedure which yields a very high grade of purification of Pu suitable for ultra low level detection by HR ICP-MS, from marine sediments. After the elimination of major elements (Fe, Al, Mg...) by a first chromatographic separation, a new device of purification by solvent extraction and concentration by a second chromatographic separation is used to obtain a concentrated and high purified solution of plutonium. The chemical procedure have been validated on IAEA certified sediment samples and on sediment samples collected in the roads of Cherbourg which had been previously analysed by other techniques (a spectrometry and thermo-ionisation mass spectrometer). (author)

  11. Raman and absorption spectrophotometric studies of selected lanthanide, californium-doped lanthanide, and actinide trihalides in the solid state

    International Nuclear Information System (INIS)

    The solid-state absorption spectra of Cf(III) ions as a dopant in lanthanide trihalide hosts (LnCl3: Ln = Ce, Sm, and Y; LnBr3: Ln = Ce, Sm, Tb, and Y; LnI3: Ln = Ce and Y) have been recorded. The spectra of Cf(III) have been correlated with the various crystal structures. The phonon Raman spectra and solid-state absorption spectra of PmF3, PmCl3, PmBr3, and two crystal modifications of PmI3 have been recorded. Symmetry assignments have been made for the Raman-active bands for these trihalides and also the sesquioxide. The room-temperature absorption spectra have been correlated to crystal field effects. The symmetry assignments of the Raman-active phonon modes have been made based on polarized Raman spectra from single crystals of YF3-type orthorhombic TbF3 and PuBr3-type orthorhombic NdBr3. Raman spectra of other isostructural lanthanide compounds have been recorded and compared. Symmetry assignments for these compounds have been made by analogy to the single-crystal assignments. Raman spectra have been obtained and catalogued for a number of actinide compounds. Symmetry assignments have been made for the observed Raman-active phonon bands in this work based on the assignments made for isostructural lanthanide compounds. 29 figs., 22 tabs

  12. Oxidation-reduction properties of americium, curium, berkelium, californium, einsteinium and fermium, and thermodynamic consequences for the 5f series

    International Nuclear Information System (INIS)

    The amalgamation of 5f elements from Am to Fm has been studied by using 241Am, 244Cm, 249Bk, 249Cf, 252Cf, 253Es, 254Es, 252Fm and 255Fm with two electrochemical methods, radiocoulometry and radiopolarography, perfectly adapted to investigate extremely diluted solutions when the concentration of electroactive species is as low as 10-16M. The theory of radiocoulometry has been developed in the general cases of reversible and irreversible electrode process. It has been used to interpret the experimental data on the kinetic curves of amalgamation, and to estimate the standard rate constant of the electrode process in complexing medium (citric). On the other hand the radiopolarographic method has been applied to study the mechanism of reduction at the dropping mercury electrode of cations M3+ in aqueous medium to the metal M with formation of amalgam. The results are exploited into two directions: 1- Acquisition of some data concerning the oxidation-reduction properties of elements from Am to Fm. Therefore the standard electrode E0 [M(III-0)] potentials for Bk, Cf and Es, and the standard electrode E0 [M(II-0)] potential for Fm are estimated and the relative stability of each oxidation state (from II to VII) of 5f elements is discussed; 2- Acquisition of unknown thermodynamic data on transcalifornium elements. Correlations between 4f and 5f elements are precised and some divergences appear for the second half of 4f and 5f series (i.e. for 65<=Z<=71 and 97<=Z<=103)

  13. Determination of the optimum-size californium-252 neutron source for borehole capture gamma-ray analysis

    Science.gov (United States)

    Senftle, F.E.; Macy, R.J.; Mikesell, J.L.

    1979-01-01

    The fast- and thermal-neutron fluence rates from a 3.7 ??g 252Cf neutron source in a simulated borehole have been measured as a function of the source-to-detector distance using air, water, coal, iron ore-concrete mix, and dry sand as borehole media. Gamma-ray intensity measurements were made for specific spectral lines at low and high energies for the same range of source-to-detector distances in the iron ore-concrete mix and in coal. Integral gamma-ray counts across the entire spectrum were also made at each source-to-detector distance. From these data, the specific neutron-damage rate, and the critical count-rate criteria, we show that in an iron ore-concrete mix (low hydrogen concentration), 252Cf neutron sources of 2-40 ??g are suitable. The source size required for optimum gamma-ray sensitivity depends on the energy of the gamma ray being measured. In a hydrogeneous medium such as coal, similar measurements were made. The results show that sources from 2 to 20 ??g are suitable to obtain the highest gamma-ray sensitivity, again depending on the energy of the gamma ray being measured. In a hydrogeneous medium, significant improvement in sensitivity can be achieved by using faster electronics; in iron ore, it cannot. ?? 1979 North-Holland Publishing Co.

  14. Research and experimental work at Groote Schuur Hospital and the University of Cape Town using californium-252 sources

    International Nuclear Information System (INIS)

    Experiments have been undertaken to determine the high-LET and low-LET components of the absorbed dose from neutron beams. This is achieved by measuring the fluxes of the high-LET and low-LET radiations in a tissue-equivalent phantom individually and simultaneously using a scintillation probe fitted with a pulse shape discriminator. This system was successfully used with a 22 MeV neutron beam from the T(d,n) reaction and has been employed with 252Cf sources. Results obtained in the low-energy ranges (up to 3 MeV) indicate that the electron counts exceed the high-LET counts by a factor of 2 to 3. These results are related to the absorbed dose. Calculations have also been undertaken to establish whether the Paterson-Parker system could be used for the design of 252Cf treatments and the optimum needle activities to yield the desired dose. Experiments are under way to determine the variation of RBE and OER for 252Cf radiations around the source. The inhibition of root growth in Vicia Faba is being used to determine any such effects. Dose rates comparable to that employed in interstitial radiotherapy are being aimed at. A study of dose fractionation effects is also being undertaken. (author)

  15. 48 CFR 2452.242-71 - Contract management system.

    Science.gov (United States)

    2010-10-01

    ... DEVELOPMENT CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Texts of Provisions and Clauses... parts: (1) Baseline plan. The baseline plan shall consist of: (i) A narrative portion that: (A...) Progress reports. Progress reports shall consist of: (i) A narrative portion that: (A) Provides a...

  16. 48 CFR 1852.242-72 - Observance of legal holidays.

    Science.gov (United States)

    2010-10-01

    ... by Federal statute, Executive Order, or the President's proclamation. (b) When any holiday falls on a Saturday, the preceding Friday is observed. When any holiday falls on a Sunday, the following Monday is... representative. If the Contractor's on-site personnel work during a holiday other than those in paragraph (a)...

  17. Facility effluent monitoring plan for 242-A Evaporator facility

    International Nuclear Information System (INIS)

    A facility effluent monitoring plan is required by the US Department of Energy in DOE Order 5400.1* for any operations that involve hazardous materials and radioactive substances that could affect employee or public safety or the environment. A facility effluent monitoring plan determination was performed during Calendar Year 1991 and the evaluation showed the need for a facility effluent monitoring plan. This document is prepared using the specific guidelines identified in A Guide for Preparing Hanford Site Facility effluent Monitoring Plans, WHC-EP-0438-1**. This facility effluent monitoring plan assesses effluent monitoring systems and evaluates whether they are adequate to ensure the public health and safety as specified in applicable federal, state, and local requirements

  18. Radiative capture on $^{242}$Pu for MOX fuel reactors

    CERN Multimedia

    The use of MOX fuel (mixed-oxide fuel made of UO$_{2}$ and PuO$_{2}$) in nuclear reactors allows substituting a large fraction of the enriched Uranium by Plutonium reprocessed from spent fuel. Indeed around 66% of the plutonium from spent fuel is made of $^{239}$Pu and $^{241}$Pu, which are fissile in thermal reactors. A typical reactor of this type uses a fuel with 7% reprocessed Pu and 93% depleted U, thus profiting from both the spent fuel and the remaining $^{238}$U following the $^{235}$U enrichment. With the use of such new fuel compositions rich in Pu the better knowledge of the capture and fission cross sections of the Pu isotopes becomes very important. This is clearly stated in the recent OECD NEA’s “High Priority Request List” and in the WPEC-26 “Uncertainty and target accuracy assessment for innovative systems using recent covariance data evaluations” report. In particular, a new series of cross section evaluations have been recently carried out jointly by the European (JEFF) and United ...

  19. Preface: phys. stat. sol. (b) 242/1

    Science.gov (United States)

    Ginzburg, V. L.; Maksimov, E. G.

    2005-01-01

    We have accepted with great pleasure the suggestion of the Guest Editor Miodrag Kuli to write a short preface to the special issue of this journal, which is devoted to the role played by electron-phonon interaction (EPI) in high-temperature superconductors (HTSC). From the very beginning, it was absolutely clear to us that there is no metal in which the EPI could be ignored, and high-temperature superconducting compounds cannot be an exception in this respect. We expressed this opinion, in particular, in our early Review Article [1] and in the talk [2] given at the Grenoble M2S HTSC Conference in 1994. We would like to emphasize that we were not in isolation. There have been many other researchers, some authors of this issue among them, who have also considered the EPI as an essential part of the physics of high-temperature superconductors. However, a large part of researchers in the field, including a few famous scientists, have considered the EPI to be irrelevant to high-temperature superconductivity. Up to now, we do not understand the scientific basis for such an opinion. Moreover, that point of view has never been shared by some other famous scientists; in this respect mention should be made of J. Friedel and A. A. Abrikosov.Turning back to physics, we would like to point out some features of high-temperature superconducting cuprates, which should lead to the existence of a strong EPI in these materials. First of all, it is the proximity of these compounds, even in the optimally doped case, to the layered ionic crystals. This fact has been emphasized in our early publications as well as in many papers by other authors, and it is discussed in detail in the Review Article by C. Falter published in this issue. There are other approaches to the HTSC compounds, which allow to consider that a strong EPI exists. They are also based on some peculiarities in the crystalline and chemical structure of these compounds, in particular, on their multiphase nanoscale structure. This point is discussed by J. Phillips in this issue.There are also many experimental indications in favor of the existence of a strong EPI in the HTSC cuprates. For example, the behavior of the electron relaxation, the peculiarities of the phonon spectra, the interaction of the Josephson current with phonons, and the electron mass renormalization. All these phenomena have been discussed in the recent Review Articles [3, 4]. Currently, additional evidence was provided which has thrown new light on the role played by the EPI in HTSC systems. These are the ARPES experiments conducted by the Stanford group, which have given an unambiguous proof of the electron mass renormalization due to the EPI. A Review Article of this group by T. Cuk et al. is also presented in this issue. We should also mention the contribution of L. Pintschovius who presented new interesting results on the electron-phonon coupling effects observed by means of inelastic neutron scattering.A comprehensive discussion of a major part of the electron-phonon coupling effects presented in the Review Articles [1, 3] has been based on the traditional approach of the Eliashberg type. Up to now, we consider this approach to be quite suitable for pursuing a number of goals, mainly for describing properties of the normal state. Nevertheless, we do not disclaim the importance of more detailed investigations of the EPI, which take into account the strong anisotropy, the interplay between electron-phonon and electron-electron interaction, and the non-adiabatic effects. Four Review Articles in this issue, by Schneider, by Rösch, Han, Gunnarsson and Crespi, by Kuli and Dolgov, and by Cappelluti and Pietronero are devoted to different aspects of these problems.To conclude, we would like to emphasize that the main problem related to the mechanism of superconductivity in the HTSC cuprates is the interplay between the strong EPI and the electron exchange and correlation. Unfortunately, previous work did not crack this problem and much effort should be made in the future. We hope that the publication of this issue will aid to attract the attention of many researchers to the investigation of unsolved problems of the EPI in HTSC systems.

  20. 17 CFR 242.100 - Preliminary note; definitions.

    Science.gov (United States)

    2010-04-01

    ... the distribution. (3) In the case of a distribution involving a merger, acquisition, or exchange offer... distribution participant, issuer, or selling security holder in connection with the acquisition or...

  1. Dicty_cDB: VSF242 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available TAATAGAAAATAAT sequence update 2001. 3.22 Translated Amino Acid sequence kxtw*fiipkhrirkt*t*ikeigpstklllygyq...iaptlxffflienn Translated Amino Acid sequence (All Frames) Frame A: kxtw*fiipkhrirkt*t*ikeigpstklllygyqlsrl*...istvtvvepslpfshtpktlsfavhvql lllnqlvvvleslpvvv*dknptkvtvqshqrfqfff**kinnkkkcyvqsnniici*nf iykkk--- ---rtw*fiipkhrirkt*t*ikeigps

  2. 48 CFR 1552.242-72 - Financial administrative contracting officer.

    Science.gov (United States)

    2010-10-01

    ... statements are in compliance with Cost Accounting Standards and FAR part 31; (C) Determine the contractor's compliance with Cost Accounting Standards and disclosure statements, if applicable; and (D) Negotiate price... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Financial...

  3. 48 CFR 3052.242-71 - Dissemination of contract information.

    Science.gov (United States)

    2010-10-01

    ... prescribed in (HSAR) 48 CFR 3042.202-70, insert the following clause: Dissemination of Contract Information... performance of this contract, without the prior written consent of the Contracting Officer. An electronic or... 48 Federal Acquisition Regulations System 7 2010-10-01 2010-10-01 false Dissemination of...

  4. 49 CFR 24.2 - Definitions and acronyms.

    Science.gov (United States)

    2010-10-01

    ... United States as defined in 8 CFR 103.12 and includes: (i) An alien present in the United States who has... date, supported by the presentation and analysis of relevant market information. (4) Business. The term... received or earned by dependent children and full time students under 18 years of age. (See appendix...

  5. Facility effluent monitoring plan for 242-A evaporator facility

    International Nuclear Information System (INIS)

    A facility effluent monitoring plan is required by the U.S. Department of Energy in DOE Order 5400.1 for any operations that involve hazardous materials and radioactive substances that could affect employee or public safety or the environment. A facility effluent monitoring plan determination was performed during Calendar Year 1991 and the evaluation showed the need for a facility effluent monitoring plan. This document is prepared using the specific guidelines identified in A Guide for Preparing Hanford Site Facility Effluent Monitoring Plans, WHC-EP-0438-1. This facility effluent monitoring plan assesses effluent monitoring systems and evaluates whether they are adequate to ensure the public health and safety as specified in applicable federal, state, and local requirements. This facility effluent monitoring plan shall ensure long-range integrity of the effluent monitoring systems by requiring an update whenever a new process or operation introduces new hazardous materials or significant radioactive materials. This document must be reviewed annually even if there are no operational changes, and it must be updated, as a minimum, every three years

  6. 24 CFR 242.79 - Environmental quality determinations and standards.

    Science.gov (United States)

    2010-04-01

    ... Environmental quality determinations and standards. Requirements set forth in 24 CFR part 50, “Protection and Enhancement of Environmental Quality,” 24 CFR part 51, “Environmental Criteria and Standards,” and 24 CFR part... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Environmental...

  7. 50 CFR 216.242 - Permissible methods of taking.

    Science.gov (United States)

    2010-10-01

    ... annually). (G) Blue whale (Balaenoptera musculus)—4005 (an average of 801 annually). (ii) Odontocetes: (A... of 4202 annually). (C) Minke whale (Balaenoptera acutorostrata)—2075 (an average of 415 annually). (D) Sei whale (Balaenoptera borealis)—5285 (an average of 1057 annually). (E) Fin whale...

  8. 48 CFR 652.242-72 - Shipping Instructions.

    Science.gov (United States)

    2010-10-01

    ... from bad cross grain and from knots or knotholes that interfere with nailing or that occupy more than 1... firmly stapled in position to prevent the straps from slipping off the box. Articles must be secured...

  9. Motivation for New Measurements on 241, 242, 243Am Isotopes

    International Nuclear Information System (INIS)

    The initial objective of this work was an updated review on the Am isotopes data since the next official release (3.1) of the JEFF3 evaluated data file is foreseen around June 2005. Alternatively, this work searches for the possible reasons of the observed discrepancies between differential and integral measurement results. In particular, strong differences are encountered on σγth values and epithermal branching ratio values for the 241Am. Although the JEF2.2 validation is used as guide in parallel with a systematic study of all differential and integral results available, the need for new measurements clearly shows up. This paper finally draws up a list of desired and feasible new differential and integral measurements on the Am isotopes

  10. 40 CFR 52.242 - Disapproved rules and regulations.

    Science.gov (United States)

    2010-07-01

    ... regulations. Link to an amendment published at 75 FR 37730, June 30, 2010. (a) The following Air Pollution... Cellular (Foam) Products,” submitted on March 7, 2008 and adopted on September 7, 2007. (2) Antelope Valley Air Pollution Control District. (i) Rule 118, Emergencies, submitted on March 10, 1998. (3)...

  11. 48 CFR 242.202 - Assignment of contract administration.

    Science.gov (United States)

    2010-10-01

    ... Defense Energy Support Center, Defense Logistics Agency. (ii) Contract administration functions for base... subcontract that includes foreign contract military sale (FMS) requirements, the contract...

  12. Dicty_cDB: AFH242 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CA sequence update 2001. 6. 2 Translated Amino Acid sequence claywvyntvysytsl*rii...r*snsynirslnykwss*nwc*sleelktslpisnklqs Frame C: claywvyntvysytsl*riikknkkkek*vmfmill*ldqvfqv*cvvin*krmdikf*

  13. 17 CFR 242.610 - Access to quotations.

    Science.gov (United States)

    2010-04-01

    ...) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Nms... national securities exchange or national securities association to the quotations in an NMS stock displayed... displays quotations in an NMS stock through an SRO display-only facility shall provide a level and cost...

  14. 17 CFR 242.612 - Minimum pricing increment.

    Science.gov (United States)

    2010-04-01

    ...) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Nms... display, rank, or accept from any person a bid or offer, an order, or an indication of interest in any NMS... accept from any person a bid or offer, an order, or an indication of interest in any NMS stock priced...

  15. 17 CFR 242.301 - Requirements for alternative trading systems.

    Science.gov (United States)

    2010-04-01

    ... COMMISSION (CONTINUED) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY... forth in paragraph (b)(3)(ii) of this section, with respect to any NMS stock in which the alternative... volume of 5 percent or more of the aggregate average daily share volume for such NMS stock as reported...

  16. 17 CFR 242.505 - Exclusion for news media.

    Science.gov (United States)

    2010-04-01

    ...) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Ac... registered with the Commission as a broker or dealer or investment adviser. Regulation NMS—Regulation of...

  17. 17 CFR 242.611 - Order protection rule.

    Science.gov (United States)

    2010-04-01

    ...) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Nms... NMS stocks that do not fall within an exception set forth in paragraph (b) of this section and, if... bid was priced higher than a protected offer in the NMS stock. (5) The transaction that...

  18. 48 CFR 242.302 - Contract administration functions.

    Science.gov (United States)

    2010-10-01

    ... solicitation or award. (S-70) Serve as the single point of contact for all Single Process Initiative (SPI... agreements for SPI processes, when authorized by the affected components. (S-71) DCMA has responsibility...

  19. 7 CFR 2.42 - Administrator, Farm Service Agency.

    Science.gov (United States)

    2010-01-01

    ...), except as delegated to the Under Secretary for Food, Nutrition, and Consumer Services in § 2.19 and to... and Consumer Service and the Agricultural Marketing Service in the procurement, handling, payment, and... Older Americans Act of 1965, as amended (42 U.S.C. 3030a), and section 4(a) of the Agriculture...

  20. 36 CFR 242.27 - Subsistence taking of fish.

    Science.gov (United States)

    2010-07-01

    ... crossing; (B) Bonanza Creek; (C) Jim River including Prospect and Douglas Creeks. (x) You may not... south of a line extending east from Cape Douglas (58°51.10' North latitude), west of 150° West longitude...' West longitude), to the northeastern tip of Mary's Island (57°42.40' North latitude, 152°32.00'...

  1. 48 CFR 1852.242-70 - Technical direction.

    Science.gov (United States)

    2010-10-01

    ... Direction (SEP 1993) (a) Performance of the work under this contract is subject to the written technical..., the fixed fee (if any), or the time required for contract performance; (4) Changes any of the expressed terms, conditions, or specifications of the contract; or (5) Interferes with the...

  2. 7 CFR 1951.242 - Servicing delinquent Community Facility loans.

    Science.gov (United States)

    2010-01-01

    ... HOUSING SERVICE, RURAL BUSINESS-COOPERATIVE SERVICE, RURAL UTILITIES SERVICE, AND FARM SERVICE AGENCY... loans. (a) For the purpose of this section, a loan is delinquent when a borrower fails to make all or... 7 Agriculture 14 2010-01-01 2009-01-01 true Servicing delinquent Community Facility loans....

  3. Facility effluent monitoring plan for 242-A evaporator facility

    Energy Technology Data Exchange (ETDEWEB)

    Crummel, G.M.; Gustavson, R.D.

    1995-02-01

    A facility effluent monitoring plan is required by the U.S. Department of Energy in DOE Order 5400.1 for any operations that involve hazardous materials and radioactive substances that could affect employee or public safety or the environment. A facility effluent monitoring plan determination was performed during Calendar Year 1991 and the evaluation showed the need for a facility effluent monitoring plan. This document is prepared using the specific guidelines identified in A Guide for Preparing Hanford Site Facility Effluent Monitoring Plans, WHC-EP-0438-1. This facility effluent monitoring plan assesses effluent monitoring systems and evaluates whether they are adequate to ensure the public health and safety as specified in applicable federal, state, and local requirements. This facility effluent monitoring plan shall ensure long-range integrity of the effluent monitoring systems by requiring an update whenever a new process or operation introduces new hazardous materials or significant radioactive materials. This document must be reviewed annually even if there are no operational changes, and it must be updated, as a minimum, every three years.

  4. Preface: phys. stat. sol. (b) 242/9

    Science.gov (United States)

    Sánchez, Maria

    2005-07-01

    The XVII Latin American Symposium on Solid State Physics took place in the conference rooms of the Convent San Francisco de Asis, in the heart of the Old Havana. The sixteen previous editions were organized in eight different countries; the last two were in Colombia (Cartagena, 1999) and Venezuela (Merida, 2002). After eighteen years the meeting came back to Havana in 2004.The program topics included: Surfaces and interfaces analysis; Spintronics; Magnetism; Materials and energy; Ab-initio methods, simulations and modeling in solids; Nanophysics, nanomaterials and nanotechnology; New materials, properties and applications; Preparation of materials, thin films and characterization; High temperature superconductivity; Techniques of structural analysis in solids. The program included 6 plenary talks, 13 invited talks, 58 oral presentations (in eight sessions) and 200 poster contributions (in four poster sessions).The meeting attracted more than 200 participants from 14 countries. The physica status solidi Young Researcher Award sponsored by Wiley-VCH was conferred at the meeting. This prize was divided between two participants: Clara Calderón (Study of electrical transport properties of ZnO thin films used as front contact of solar cells) from Colombia and Aim?? Pelaiz Barranco (AC behavior in lanthanum modified PZT ferroelectric ceramics) from Cuba. Special Mentions went to Val??rie Halté (Femtosec-ond dynamics of transmission of gold arrays of sub-wavelength holes) from France, Erick Larramendi Cancio (Cd desorption induced by Zn exposure during atomic layer epitaxy of CdxZn1-xTe) and Julio Cesar Rimada Herrera (Quantum and conversion efficiency calculation of AlGaAs/GaAs multiple quantum well solar cells) from Cuba.Nanostructures and in general low dimensional physics related to different systems was a very hot topic during the meeting. Some talks and presentations were devoted to optoelectronic materials and devices. Characterization of solids by different structural and optical techniques together with modeling and simulations were also important subjects of the symposium.The XVIII Symposium will be held in Mexico in 2006.The editors wish to thank all the participants who contributed to the success of the meeting and hope that it helped to develop close links between researchers and institutions of Latin America.

  5. 10 CFR 72.242 - Recordkeeping and reports.

    Science.gov (United States)

    2010-01-01

    ... NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSING REQUIREMENTS FOR THE INDEPENDENT STORAGE OF SPENT NUCLEAR FUEL, HIGH-LEVEL RADIOACTIVE WASTE, AND REACTOR-RELATED GREATER THAN CLASS C WASTE Approval of... fabrication deficiency affects the ability of structures, systems, and components important to safety...

  6. 36 CFR 242.11 - Regional advisory councils.

    Science.gov (United States)

    2010-07-01

    ... Board will identify the interest(s) the applicants propose to represent on the respective Regional... Regional Council. To ensure that each Council represents a diversity of interests, the Board will strive to... councils. (a) The Board shall establish a Regional Council for each subsistence resource region...

  7. Dicty_cDB: CHE242 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CAGATT ATAAT sequence update 2002. 9.10 Translated Amino Acid sequence ---xikrgxanfc*xlsxgkpipxxx*rf*xh*kx*k...nce (All Frames) Frame A: ---xikrgxanfc*xlsxgkpipxxx*rf*xh*kx*kpxskxkkgfpxrsxkvxfsvgkq ikxwwxffrtitfqkespspl...slvkxsl*klkvlitlkmlkprskikkvfxqinkd*slpvnn*kmvxlsqii Frame C: ---x*kgxskfllkxfxxkahpxxxlkvlxtlkxlkaxiqxxkrvs

  8. 47 CFR 90.242 - Travelers' information stations.

    Science.gov (United States)

    2010-10-01

    ... station. (4) For a station employing a conventional radiating antenna(s) (ex. vertical monopole... point on the cable. For a conventional radiating antenna, the estimated field strength contour at 1.5 km...) For each transmitter site, the transmitter's output power, the type of antenna utilized, its...

  9. Radiological Characterization Technical Report on Californium-252 Sealed Source Transuranic Debris Waste for the Off-Site Source Recovery Project at Los Alamos National Laboratory

    Energy Technology Data Exchange (ETDEWEB)

    Feldman, Alexander [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2014-04-24

    This document describes the development and approach for the radiological characterization of Cf-252 sealed sources for shipment to the Waste Isolation Pilot Plant. The report combines information on the nuclear material content of each individual source (mass or activity and date of manufacture) with information and data on the radionuclide distributions within the originating nuclear material. This approach allows for complete and accurate characterization of the waste container without the need to take additional measurements. The radionuclide uncertainties, developed from acceptable knowledge (AK) information regarding the source material, are applied to the summed activities in the drum. The AK information used in the characterization of Cf-252 sealed sources has been qualified by the peer review process, which has been reviewed and accepted by the Environmental Protection Agency.

  10. Accurate determination of Curium and Californium isotopic ratios by inductively coupled plasma quadrupole mass spectrometry (ICP-QMS) in 248Cm samples for transmutation studies

    International Nuclear Information System (INIS)

    The French Atomic Energy Commission has carried out several experiments including the mini-INCA (INcineration of Actinides) project for the study of minor-actinide transmutation processes in high intensity thermal neutron fluxes, in view of proposing solutions to reduce the radiotoxicity of long-lived nuclear wastes. In this context, a Cm sample enriched in 248Cm (∼97 %) was irradiated in thermal neutron flux at the High Flux Reactor (HFR) of the Laue-Langevin Institute (ILL). This work describes a quadrupole ICP-MS (ICP-QMS) analytical procedure for precise and accurate isotopic composition determination of Cm before sample irradiation and of Cm and Cf after sample irradiation. The factors that affect the accuracy and reproducibility of isotopic ratio measurements by ICP-QMS, such as peak centre correction, detector dead time, mass bias, abundance sensitivity and hydrides formation, instrumental background, and memory blank were carefully evaluated and corrected. Uncertainties of the isotopic ratios, taking into account internal precision of isotope ratio measurements, peak tailing, and hydrides formations ranged from 0.3% to 1.3%. This uncertainties range is quite acceptable for the nuclear data to be used in transmutation studies.

  11. 小儿脑性瘫痪242例临床分析%Clinical analysis of 242 cases of children cerebral palsy

    Institute of Scientific and Technical Information of China (English)

    赵蒙

    2003-01-01

    BACKGROUND:Children cerebral palsy not only affects the quality of the affected children's lives but also burdens the family and the society heavily.Therefore, analysis of the disease and its causes from the viewpoint of clinic might helpful in treatment and prevention of the disease.

  12. NATO/CCMS PILOT STUDY - CLEAN PRODUCTS AND PROCESSES (PHASE I) 2000 ANNUAL REPORT, NUMBER 242

    Science.gov (United States)

    This annual report presents the proceedings of the Third Annual NATO/CCMS pilot study meeting in Copenhagen, Denmark. Guest speakers focused on efforts in the area of research of clean products and processes, life cycle analysis, computer tools and pollution prevention.

  13. Biosorption of Americium-242 by saccharomyces cerevisiae: preliminary evaluation and mechanism

    International Nuclear Information System (INIS)

    As an important radioisotope in nuclear industry and other fields, americium-241 is one of the most serious contamination concerns duo to its high radiation toxicity and long half-life. In this experiment, the biosorption of 241Am from solution by a fungus, Saccharomyces cerevisiae (S. cerevisiae), and the effects of various experimental conditions on the biosorption and the mechanism were explored. The preliminary results showed that S. cerevisiae is a very efficient biosorbent. An average of more than 99% of the total 241Am could be removed by S. cerevisiae of 2.1g/L (dry weight) from 241Am solutions of 2.22MBq/L -555 MBq/L (Co). The adsorption equilibrium was achieved within 1 hour and the optimum pH ranged 1-3. The culture times of more than 16 hours were suitable and the efficient adsorption of 241Am by the S. cerevisiae could be noted. The biosorption of 241Am by the decomposed cell wall, protoplasm or cell membrane of S. cerevisiae was same efficient as by the intact fungus, but the some components of S. cerevisiae, such as protein and acylation group had obvious effect on adsorption. When the concentrations of coexistent Eu3+, Nd3+ were 100 times more than that of 241Am, the adsorption rates would drop to 65%. However, most of the investigated acidic ions have no significant influence on the 241Am adsorption but minute change of pH value, while the saturated EDTA can strong inhibit the biosorption of 241Am.. (authors)

  14. 17 CFR 242.404 - Type, form and use of margin.

    Science.gov (United States)

    2010-04-01

    ... other requirement. (e) Alternative collateral valuation for margin equity securities in a futures... other asset permitted under Regulation T to satisfy a margin deficiency in a securities margin account... requirement”); and (iii) Cash, securities, or other assets deposited as margin for the positions in an...

  15. 24 CFR 242.23 - Maximum mortgage amounts and cash equity requirements.

    Science.gov (United States)

    2010-04-01

    ... cost of substantial rehabilitation, plus (ii) Such portion of the outstanding indebtedness as does not... substantial rehabilitation, plus (ii) The actual purchase price of the land and improvements or HUD's estimate (prior to substantial rehabilitation) of the fair market value of such land and improvements,...

  16. 36 CFR 242.16 - Customary and traditional use determination process.

    Science.gov (United States)

    2010-07-01

    ... characterized by efficiency and economy of effort and cost, conditioned by local characteristics; (4) The... generation to generation; (7) A pattern of use in which the harvest is shared or distributed within...

  17. High level waste storage tanks 242-A evaporator standards/requirement identification document

    International Nuclear Information System (INIS)

    This document, the Standards/Requirements Identification Document (S/RIDS) for the subject facility, represents the necessary and sufficient requirements to provide an adequate level of protection of the worker, public health and safety, and the environment. It lists those source documents from which requirements were extracted, and those requirements documents considered, but from which no requirements where taken. Documents considered as source documents included State and Federal Regulations, DOE Orders, and DOE Standards

  18. 242-16H 2H EVAPORATOR POT SAMPLING FINAL REPORT

    Energy Technology Data Exchange (ETDEWEB)

    Krementz, D; William Cheng, W

    2008-06-11

    Due to the materials that are processed through 2H Evaporator, scale is constantly being deposited on the surfaces of the evaporator pot. In order to meet the requirements of the Nuclear Criticality Safety Analysis/Evaluation (NCSA/NCSE) for 2H Evaporator, inspections of the pot are performed to determine the extent of scaling. Once the volume of scale reaches a certain threshold, the pot must be chemically cleaned to remove the scale. Prior to cleaning the pot, samples of the scale are obtained to determine the concentration of uranium and plutonium and also to provide information to assist with pot cleaning. Savannah River National Laboratory (SRNL) was requested by Liquid Waste Organization (LWO) Engineering to obtain these samples from two locations within the evaporator. Past experience has proven the difficulty of successfully obtaining solids samples from the 2H Evaporator pot. To mitigate this risk, a total of four samplers were designed and fabricated to ensure that two samples could be obtained. Samples had previously been obtained from the cone surface directly below the vertical access riser using a custom scraping tool. This tool was fabricated and deployed successfully. A second scraper was designed to obtain sample from the nearby vertical thermowell and a third scraper was designed to obtain sample from the vertical pot wall. The newly developed scrapers both employed a pneumatically actuated elbow. The scrapers were designed to be easily attached/removed from the elbow assembly. These tools were fabricated and deployed successfully. A fourth tool was designed to obtain sample from the opposite side of the pot under the tube bundle. This tool was fabricated and tested, but the additional modifications required to make the tool field-ready could not be complete in time to meet the aggressive deployment schedule. Two samples were obtained near the pot entry location, one from the pot wall and the other from the evaporator feed pipe. Since a third sampler was available and all of the radiological controls were in place, the decision was made to obtain a third sample. The third sampler dropped directly below the riser to obtain a scrape sample from the evaporator cone. Samples were obtained from all of these locations in sufficient quantities to perform the required analysis.

  19. 17 CFR 242.200 - Definition of “short sale” and marking requirements.

    Science.gov (United States)

    2010-04-01

    ... standardized options contracts as defined in 17 CFR 240.9b-1(a)(4); and (2) If and to the extent that the... COMMISSION (CONTINUED) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR...

  20. High level waste storage tanks 242-A evaporator standards/requirement identification document

    Energy Technology Data Exchange (ETDEWEB)

    Biebesheimer, E.

    1996-01-01

    This document, the Standards/Requirements Identification Document (S/RIDS) for the subject facility, represents the necessary and sufficient requirements to provide an adequate level of protection of the worker, public health and safety, and the environment. It lists those source documents from which requirements were extracted, and those requirements documents considered, but from which no requirements where taken. Documents considered as source documents included State and Federal Regulations, DOE Orders, and DOE Standards

  1. 17 CFR 242.609 - Registration of securities information processors: form of application and amendments.

    Science.gov (United States)

    2010-04-01

    ... Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) REGULATIONS M, SHO, ATS, AC, AND NMS AND CUSTOMER MARGIN REQUIREMENTS FOR SECURITY FUTURES Regulation Nms-Regulation of the National Market System §...

  2. Common variants on 8p12 and 1q24.2 confer risk of schizophrenia

    DEFF Research Database (Denmark)

    Shi, Yongyong; Li, Zhiqiang; Xu, Qi;

    2011-01-01

    Schizophrenia is a severe mental disorder affecting ~1% of the world population, with heritability of up to 80%. To identify new common genetic risk factors, we performed a genome-wide association study (GWAS) in the Han Chinese population. The discovery sample set consisted of 3,750 individuals ...

  3. 48 CFR 1252.242-70 - Dissemination of information-educational institutions.

    Science.gov (United States)

    2010-10-01

    ... (TAR) 48 CFR 1242.7000(a), insert the following clause: Dissemination of Information—Educational... provisions of the “Data Rights” and “Patent Rights” clauses of the contract) research results in professional... stating that the published material represents the position of the author(s) and not necessarily that...

  4. 36 CFR 242.25 - Subsistence taking of fish, wildlife, and shellfish: general regulations.

    Science.gov (United States)

    2010-07-01

    ... grizzly bear. Big game means black bear, brown bear, bison, caribou, Sitka black-tailed deer, elk... (Chionoecetes spp.), and Dungeness crab (Cancer magister). Cub bear means a brown or grizzly bear in its first... viscera. For black bear, brown and grizzly bear, “edible meat” means the meat of the front quarter...

  5. Comparative Analysis of the Orphan CRISPR2 Locus in 242 Enterococcus faecalis Strains.

    Directory of Open Access Journals (Sweden)

    Karthik Hullahalli

    Full Text Available Clustered, Regularly Interspaced Short Palindromic Repeats and their associated Cas proteins (CRISPR-Cas provide prokaryotes with a mechanism for defense against mobile genetic elements (MGEs. A CRISPR locus is a molecular memory of MGE encounters. It contains an array of short sequences, called spacers, that generally have sequence identity to MGEs. Three different CRISPR loci have been identified among strains of the opportunistic pathogen Enterococcus faecalis. CRISPR1 and CRISPR3 are associated with the cas genes necessary for blocking MGEs, but these loci are present in only a subset of E. faecalis strains. The orphan CRISPR2 lacks cas genes and is ubiquitous in E. faecalis, although its spacer content varies from strain to strain. Because CRISPR2 is a variable locus occurring in all E. faecalis, comparative analysis of CRISPR2 sequences may provide information about the clonality of E. faecalis strains. We examined CRISPR2 sequences from 228 E. faecalis genomes in relationship to subspecies phylogenetic lineages (sequence types; STs determined by multilocus sequence typing (MLST, and to a genome phylogeny generated for a representative 71 genomes. We found that specific CRISPR2 sequences are associated with specific STs and with specific branches on the genome tree. To explore possible applications of CRISPR2 analysis, we evaluated 14 E. faecalis bloodstream isolates using CRISPR2 analysis and MLST. CRISPR2 analysis identified two groups of clonal strains among the 14 isolates, an assessment that was confirmed by MLST. CRISPR2 analysis was also used to accurately predict the ST of a subset of isolates. We conclude that CRISPR2 analysis, while not a replacement for MLST, is an inexpensive method to assess clonality among E. faecalis isolates, and can be used in conjunction with MLST to identify recombination events occurring between STs.

  6. Comparative Analysis of the Orphan CRISPR2 Locus in 242 Enterococcus faecalis Strains

    OpenAIRE

    Hullahalli, Karthik; Rodrigues, Marinelle; Schmidt, Brendan D.; Li, Xiang; Bhardwaj, Pooja; Palmer, Kelli L.

    2015-01-01

    Clustered, Regularly Interspaced Short Palindromic Repeats and their associated Cas proteins (CRISPR-Cas) provide prokaryotes with a mechanism for defense against mobile genetic elements (MGEs). A CRISPR locus is a molecular memory of MGE encounters. It contains an array of short sequences, called spacers, that generally have sequence identity to MGEs. Three different CRISPR loci have been identified among strains of the opportunistic pathogen Enterococcus faecalis. CRISPR1 and CRISPR3 are as...

  7. High-level waste storage tank farms/242-A evaporator standards/requirements identification document (S/RID), Vol. 5

    Energy Technology Data Exchange (ETDEWEB)

    1994-04-01

    The Fire Protection functional area for the Hanford Site Tank Farm facilities and support structures is based on the application of relevant DOE orders, regulations, and industry codes and standards. The fire protection program defined in this document may be divided into three areas: (1) organizational, (2) administrative programmatic features, and (3) technical features. The information presented in each section is in the form of program elements and orders, regulations, industry codes, and standards that serve as the attributes of a fire protection program for the Tank Farm facilities. Upon completion this document will be utilized as the basis to evaluate compliance of the fire protection program being implemented for the Tank Farm facilities with the requirements of DOE orders and industry codes and standards.

  8. Air Stripping of 1-Butanol During Cleaning of the 242-16H Evaporator: 1. Model Development and Conservative Predictions

    International Nuclear Information System (INIS)

    This report describes an analysis performed using conservative and bounding assumptions. These assumptions lead to a lower bound on the butanol removal rate and an upper bound on the liquid phase butanol concentration

  9. High-level waste storage tank farms/242-A evaporator standards/requirements identification document (S/RID), Vol. 3

    International Nuclear Information System (INIS)

    The Safeguards and Security (S ampersand S) Functional Area address the programmatic and technical requirements, controls, and standards which assure compliance with applicable S ampersand S laws and regulations. Numerous S ampersand S responsibilities are performed on behalf of the Tank Farm Facility by site level organizations. Certain other responsibilities are shared, and the remainder are the sole responsibility of the Tank Farm Facility. This Requirements Identification Document describes a complete functional Safeguards and Security Program that is presumed to be the responsibility of the Tank Farm Facility. The following list identifies the programmatic elements in the S ampersand S Functional Area: Program Management, Protection Program Scope and Evaluation, Personnel Security, Physical Security Systems, Protection Program Operations, Material Control and Accountability, Information Security, and Key Program Interfaces

  10. High-level waste storage tank farms/242-A evaporator standards/requirements identification document (S/RID), Vol. 2

    International Nuclear Information System (INIS)

    The Quality Assurance Functional Area Requirements Identification Document (RID), addresses the programmatic requirements that ensure risks and environmental impacts are minimized, ensure safety, reliability, and performance are maximized through the application of effective management systems commensurate with the risks posed by the Tank Farm Facility and its operation. This RID incorporates guidance intended to provide Tank Farms management with the necessary requirements information to develop, upgrade, or assess the effectiveness of a Quality Assurance Program in the performance of organizational and functional activities. Quality Assurance is defined as all those planned and systematic actions necessary to provide adequate confidence that a facility, structure, system, or component will perform satisfactorily and safely in service. This document will provide the specific requirements to meet DNFSB recommendations and the guidance provided in DOE Order 5700.6C, utilizing industry codes, standards, regulatory guidelines, and industry good practices that have proven to be essential elements for an effective and efficient Quality Assurance Program as the nuclear industry has matured over the last thirty years

  11. High-level waste storage tank farms/242-A evaporator standards/requirements identification document (S/RID), Vol. 7

    International Nuclear Information System (INIS)

    This Requirements Identification Document (RID) describes an Occupational Health and Safety Program as defined through the Relevant DOE Orders, regulations, industry codes/standards, industry guidance documents and, as appropriate, good industry practice. The definition of an Occupational Health and Safety Program as specified by this document is intended to address Defense Nuclear Facilities Safety Board Recommendations 90-2 and 91-1, which call for the strengthening of DOE complex activities through the identification and application of relevant standards which supplement or exceed requirements mandated by DOE Orders. This RID applies to the activities, personnel, structures, systems, components, and programs involved in maintaining the facility and executing the mission of the High-Level Waste Storage Tank Farms

  12. 32 CFR 242.8 - Academic, intellectual, and personal requirements for admission to the first-year class.

    Science.gov (United States)

    2010-07-01

    ... Medicine of the Uniformed Services University of the Health Sciences is on a competitive basis, with... of medicine, contributing to an understanding of human behavior both in sickness and health....

  13. 47 CFR 15.242 - Operation in the bands 174-216 MHz and 470-668 MHz.

    Science.gov (United States)

    2010-10-01

    ... bands 174-216 MHz and 470-668 MHz. (a) The marketing and operation of intentional radiators under the... implementation of the digital television services. The operating frequencies of the part 15 devices may need...

  14. High-level waste storage tank farms/242-A evaporator standards/requirements identification document (S/RID), Vol. 6

    International Nuclear Information System (INIS)

    The scope of the Environmental Restoration and Waste Management (EM) Functional Area includes the programmatic controls associated with the management and operation of the Hanford Tank Farm Facility. The driving management organization implementing the programmatic controls is the Tank Farms Waste Management (WM)organization whose responsibilities are to ensure that performance objectives are established; and that measurable criteria for attaining objectives are defined and reflected in programs, policies and procedures. Objectives for the WM Program include waste minimization, establishment of effective waste segregation methods, waste treatment technology development, radioactive (low-level, high-level) hazardous and mixed waste transfer, treatment, and storage, applicability of a corrective action program, and management and applicability of a decontamination and decommissioning (D ampersand D) program in future years

  15. High-level waste storage tank farms/242-A evaporator standards/requirements identification document (S/RID), Vol. 7

    Energy Technology Data Exchange (ETDEWEB)

    1994-04-01

    This Requirements Identification Document (RID) describes an Occupational Health and Safety Program as defined through the Relevant DOE Orders, regulations, industry codes/standards, industry guidance documents and, as appropriate, good industry practice. The definition of an Occupational Health and Safety Program as specified by this document is intended to address Defense Nuclear Facilities Safety Board Recommendations 90-2 and 91-1, which call for the strengthening of DOE complex activities through the identification and application of relevant standards which supplement or exceed requirements mandated by DOE Orders. This RID applies to the activities, personnel, structures, systems, components, and programs involved in maintaining the facility and executing the mission of the High-Level Waste Storage Tank Farms.

  16. 32 CFR 242a.4 - Grounds on which meetings may be closed, or information may be withheld.

    Science.gov (United States)

    2010-07-01

    ...) Disclose the identity of a confidential source and, in the case of a record compiled by a criminal law... international tribunal, or an arbitration, or the initiation, conduct, or disposition by the USUHS of a... closed, or information may be withheld. Except in a case where the Board or a committee finds that...

  17. 0.94 - 2.42 micron ground-based transmission spectra of the hot-Jupiter HD-189733b

    CERN Document Server

    Danielski, C; Waldmann, I P; Hollis, M D J; Tinetti, G; Swain, M R

    2012-01-01

    We present here new transmission spectra of the hot Jupiter HD-189733b using the SpeX instrument on the NASA Infrared Telescope Facility. We obtained two nights of observations where we recorded the primary transit of the planet in the J-, H- and K-bands simultaneously, covering a total spectral range from 0.94 to 2.4 micron. We used Fourier analysis and other de-trending techniques validated previously on other datasets to clean the data. We tested the statistical significance of our results by calculating the auto-correlation function, and we found that, after the detrending, white noise dominates at most frequencies. Additionally, we repeated our analysis on the out-of-transit data only, showing that the residual telluric contamination is well within the error bars. While these techniques are very efficient when multiple nights of observations are combined together, our results prove that even one good night of observations is enough to provide statistically meaningful data, which might appear counterintui...

  18. High-level waste storage tank farms/242-A evaporator standards/requirements identification document (S/RID), Vol. 3

    Energy Technology Data Exchange (ETDEWEB)

    1994-04-01

    The Safeguards and Security (S&S) Functional Area address the programmatic and technical requirements, controls, and standards which assure compliance with applicable S&S laws and regulations. Numerous S&S responsibilities are performed on behalf of the Tank Farm Facility by site level organizations. Certain other responsibilities are shared, and the remainder are the sole responsibility of the Tank Farm Facility. This Requirements Identification Document describes a complete functional Safeguards and Security Program that is presumed to be the responsibility of the Tank Farm Facility. The following list identifies the programmatic elements in the S&S Functional Area: Program Management, Protection Program Scope and Evaluation, Personnel Security, Physical Security Systems, Protection Program Operations, Material Control and Accountability, Information Security, and Key Program Interfaces.

  19. High-level waste storage tank farms/242-A evaporator standards/requirements identification document (S/RID), Vol. 2

    Energy Technology Data Exchange (ETDEWEB)

    1994-04-01

    The Quality Assurance Functional Area Requirements Identification Document (RID), addresses the programmatic requirements that ensure risks and environmental impacts are minimized, ensure safety, reliability, and performance are maximized through the application of effective management systems commensurate with the risks posed by the Tank Farm Facility and its operation. This RID incorporates guidance intended to provide Tank Farms management with the necessary requirements information to develop, upgrade, or assess the effectiveness of a Quality Assurance Program in the performance of organizational and functional activities. Quality Assurance is defined as all those planned and systematic actions necessary to provide adequate confidence that a facility, structure, system, or component will perform satisfactorily and safely in service. This document will provide the specific requirements to meet DNFSB recommendations and the guidance provided in DOE Order 5700.6C, utilizing industry codes, standards, regulatory guidelines, and industry good practices that have proven to be essential elements for an effective and efficient Quality Assurance Program as the nuclear industry has matured over the last thirty years.

  20. Bensaâd Ali (dir., L’eau et ses enjeux au Sahara, Iremam, Karthala, 2011, 242 p.

    Directory of Open Access Journals (Sweden)

    Jean-Louis Marçot

    2011-11-01

    Full Text Available Je dirai en premier ma déception. Comme le suggère Ali Bensaâd à l’entrée du livre qu’il a dirigé, l’enjeu de l’eau au Sahara n’est ni plus ni moins que la conservation de la vie dans ce milieu qui lui est particulièrement hostile - la vie sous tous ses aspects. Or cet enjeu « vital » a été négligé au profit d’une approche micro-géographique. C’est pourtant par cette entrée que le travail collectif aurait pu légitimement intéresser un vaste public. Comment l’eau existe-t-elle à l’état naturel...

  1. High-level waste storage tank farms/242-A evaporator standards/requirements identification document (S/RID), Vol. 1

    Energy Technology Data Exchange (ETDEWEB)

    1994-04-01

    The purpose of this Requirements Identification Document (RID) section is to identify, in one location, all of the facility specific requirements and good industry practices which are necessary or important to establish an effective Issues Management Program for the Tank Farm Facility. The Management Systems Functional Area includes the site management commitment to environmental safety and health (ES&H) policies and controls, to compliance management, to development and management of policy and procedures, to occurrence reporting and corrective actions, resource and issue management, and to the self-assessment process.

  2. Review of RBE and OER values for Cf-neutrons

    International Nuclear Information System (INIS)

    Californium-252, an isotope emitting neutrons, gamma photons and alpha particles, is being investigated for its practical use in intracavitary and interstitial brachytherapy. A review of published RBE and OER values for californium neutrons as a function of dose rate for a variety of biological endpoints is given. (Auth.)

  3. Genotype data: 8 [

    Lifescience Database Archive (English)

    Full Text Available M242C HBHAAABAHHAAAAHHAHHAHHHBHBHHHBHBBBHHHAHHAHBHAHAHHHBHBHHHHBABAABAAHABAHHHAHAHA...AAHHHHHHHBHHBBHBHHABHAAAABHHAAHHBBAHABHHABAH-BHBBAAAHAHBHAAHAAHAABAAABAHAHBBHBHBBHHBHHBAHBHBHBHBHHAHAHAHBAHHA ...

  4. Final characterization and safety screen report of double shell tank 241-AP-104 for 242-A evaporator, campaign 96-1

    International Nuclear Information System (INIS)

    This data package satisfies the requirement for a format IV, final report. It is a follow-up to the 45-day safety screen report for tank AP-104. Evaporator candidate feed from tank 241-AP-104 (hereafter referred to as AP-104) was characterized for physical, inorganic, organic and radiochemical parameters by the Westinghouse Hanford Company, 222-S Laboratory, and by the Battelle Pacific Northwest National Laboratory (PNNL), Analytical Chemistry Laboratory (ACL) as directed by the Tank Sample and Analysis Plan (TSAP), References 1 through 4. Preliminary data in the form of summary analytical tables were provided to the project in advance of this final report to enable early estimation of evaporator operational parameters, using the Predict modeling program. Laboratory analyses at ACL Laboratory was performed according to the TSAP. Analyses were performed at the 222-S Laboratory as defined and specified in the TSAP and the Laboratory's Quality Assurance Plan, References 5 and 6. Any deviations from the instructions documented in the TSAP are discussed in this narrative and are supported with additional documentation. SAMPLING The TSAP, section 2, provided sampling information for waste samples collected from tank AP-104. The bottle-on-a-string method was used to collect liquid grab samples from the tank. Each glass sample bottle was amber, precleaned, and contained approximately 100 milliliters. Each bottle was closed with a teflon seal cap (or teflon septum for volatile organic analysis samples). Field blank samples were prepared by placing deionized water into sampling bottles, lowering the unclosed bottles into the riser for a period of time, retrieving them from the riser, and then closing the bottles with the same types of caps used for the tank samples. None of the samples were preserved by acidification. Upon receipt, the sample bottles destined for organic analyses were placed in a refrigerator. No attempt was made during sampling to assure the complete filling of the bottles so as to exclude all headspace. These actions were consistent with safety procedures, which attempt to limit personnel exposure to hazardous ionizing radiation

  5. Guillermo Banzato (Dir. 2013. Tierras Rurales. Políticas, transacciones y mercados en Argentina, 1780-1914. Rosario. Prohistoria Ediciones. 242 p.

    Directory of Open Access Journals (Sweden)

    Diego Muñiz

    2014-04-01

    Full Text Available La reseña del presente libro brinda un panorama de lo acontecido con los mercados de tierras en diferentes provincias -Buenos Aires, Entre Ríos, Córdoba, Santa Fe, Jujuy, Santiago del Estero y Mendoza- entre los años 1780 y 1914. La investigación realizada por los autores permite observar variables que condicionaron el desarrollo diferenciado de los mercados en las provincias estudiadas. Entre ellas, las posibilidades y estrategias de expansión y consolidación territorial llevadas adelante por los gobiernos provinciales, el proceso de enajenación de tierras públicas (que perseguía diferentes objetivos, entre los cuales se destaca la urgencia de recursos económicos, y el modo en que este accionar del Estado afectó las transacciones entre privados.

  6. On Interpolation Functions of the Generalized Twisted 242X-2009-946569-i1.gif"/>-Euler Polynomials

    OpenAIRE

    Park KyoungHo

    2009-01-01

    The aim of this paper is to construct -adic twisted two-variable Euler-( , )- -functions, which interpolate generalized twisted ( , )-Euler polynomials at negative integers. In this paper, we treat twisted ( , )-Euler numbers and polynomials associated with -adic invariant integral on . We will construct two-variable twisted ( , )-Euler-zeta function and two-variable ( , )- -function in Complex -plane.

  7. Spectrum of Class 242X-2007-027195-i1.gif"/> Operators

    OpenAIRE

    Yuan Jiangtao; Gao Zongsheng

    2007-01-01

    This paper discusses some spectral properties of class operators for , , , and . It is shown that if is a class operator, then the Riesz idempotent of with respect to each nonzero isolated point spectrum is selfadjoint and . Afterwards, we prove that every class operator has SVEP and property , and Weyl's theorem holds for when .

  8. A note on 242X-2002-920209-i1.gif"/> weights: Pasting weights and changing variables

    OpenAIRE

    Riera Mario Pérez

    2002-01-01

    For two weights , on , we show that (the Muckenhoupt class of weights) if and only if and , under the assumption that for every . We also prove a rather general result on pasting weights on that satisfy the condition.

  9. Powers of class 242X-2002-735735-i1.gif"/> operators associated with generalized Aluthge transformation

    OpenAIRE

    Yanagida Masahiro

    2002-01-01

    An operator belongs to class for and if and only if if and only if where is generalized Aluthge transformation of , that is, . Class was introduced by Ito as a generalization of -hyponormality which was introduced by Aluthge and Wang. We shall show that if is a class operator for and , then belongs to class for all positive integer . As an immediate corollary of this result, we shall also show that if is a -hyponormal operator, then is also -hyponormal for all positive integer .

  10. Bounds of Eigenvalues of 242X-2009-852406-i1.gif"/>-Minor Free Graphs

    OpenAIRE

    Fang Kun-Fu

    2009-01-01

    The spectral radius of a graph is the largest eigenvalue of its adjacency matrix. Let be the smallest eigenvalue of . In this paper, we have described the -minor free graphs and showed that (A) let be a simple graph with order . If has no -minor, then . (B) Let be a simple connected graph with order . If has no -minor, then , where equality holds if and only if is isomorphic to .

  11. Approximately 242X-2009-870843-i1.gif"/>-Jordan Homomorphisms on Banach Algebras

    OpenAIRE

    Karimi T; Kaboli Gharetapeh S; Gordji MEshaghi

    2009-01-01

    Let , and let be two rings. An additive map is called -Jordan homomorphism if for all . In this paper, we establish the Hyers-Ulam-Rassias stability of -Jordan homomorphisms on Banach algebras. Also we show that (a) to each approximate 3-Jordan homomorphism from a Banach algebra into a semisimple commutative Banach algebra there corresponds a unique 3-ring homomorphism near to , (b) to each approximate -Jordan homomorphism between two commutative Banach algebras there corresp...

  12. On 242X-2009-921634-i1.gif"/>-Quasiclass A Operators

    OpenAIRE

    Gao Fugen; Fang Xiaochun

    2009-01-01

    An operator is called -quasiclass if for a positive integer , which is a common generalization of quasiclass . In this paper, firstly we prove some inequalities of this class of operators; secondly we prove that if is a -quasiclass operator, then is isoloid and has finite ascent for all complex number at last we consider the tensor product for -quasiclass operators.

  13. Interpolation Functions of 242X-2009-451217-i1.gif"/>-Extensions of Apostol's Type Euler Polynomials

    OpenAIRE

    Kim Young-Hee; Kim Taekyun; Hwang Kyung-Won

    2009-01-01

    The main purpose of this paper is to present new -extensions of Apostol's type Euler polynomials using the fermionic -adic integral on . We define the - -Euler polynomials and obtain the interpolation functions and the Hurwitz type zeta functions of these polynomials. We define -extensions of Apostol type's Euler polynomials of higher order using the multivariate fermionic -adic integral on . We have the interpolation functions of these - -Euler polynomials. We also give -extensions...

  14. On powers of 242X-2000-892676-i1.gif"/>-hyponormal and log-hyponormal operators

    OpenAIRE

    Furuta Takayuki; Yanagida Masahiro

    2000-01-01

    A bounded linear operator on a Hilbert space is said to be -hyponormal for if , and is said to be log-hyponormal if is invertible and . Firstly, we shall show the following extension of our previous result: If is -hyponormal for , then and hold for all positive integer . Secondly, we shall discuss the best possibilities of the following parallel result for log-hypponormal operators by Yamazaki: If is log-hyponormal, then and hold for all positive integer .

  15. Estimates of 242X-2010-435450-i1.gif"/>-Harmonic Conjugate Operator

    OpenAIRE

    Lee Jaesung; Rim KyungSoo

    2010-01-01

    We define the -harmonic conjugate operator and prove that for , there is a constant such that for all if and only if the nonnegative weight satisfies the -condition. Also, we prove that if there is a constant such that for all , then the pair of weights satisfies the -condition.

  16. Transfinite diameter of Bernstein sets in 242X-2002-680202-i1.gif"/>

    OpenAIRE

    Bialas-Cież Leokadia; Jedrzejowski Mieczysław

    2002-01-01

    Let be a compact set in satisfying the following generalized Bernstein inequality: for each such that , for each polynomial of degree where is a constant independent of and , is an infinite set of natural numbers that is also independent of and . We give an estimate for the transfinite diameter of the set : For satisfying the usual Bernstein inequality (i.e., ), we prove that

  17. catena-Poly[[[tetraaquacobalt(II]-μ-4,4′-bipyridine-κ2N:N′] 2-[4-(2-carboxylatoethylphenoxy]acetate

    Directory of Open Access Journals (Sweden)

    Xi-Fang Wang

    2009-07-01

    Full Text Available In the title complex, {[Co(C10H8N2(H2O4](C11H10O5}n, the unique CoII ion lies on an inversion center and is coordinated by two N atoms from two 4,4′-bipyridine ligands and four O atoms from four water molecules in a slightly distorted octahedral coordination geometry. The 4,4′-bipyridine ligands bridge CoII ions into a one-dimensional chain structure. In the crystal structure, intermolecular O—H...O hydrogen bonds link cations and anions into a three-dimensional network. The dianions are completely disordered about an inversion center.

  18. Deborah FITZGERALD, Every Farm A Factory: The Industrial Ideal in American Agriculture, New Haven/Londres, Yale University Press, 2003, 242 p.

    OpenAIRE

    Jas, Nathalie

    2005-01-01

    Historienne de formation et originaire de l’État rural de l’Iowa, Deborah Fitzgerald a consacré son premier livre  à la reconstitution et à l’analyse sur la période 1890-1940 des processus complexes par lesquels les agriculteurs de l’État de l’Illinois ont finalement été amenés à utiliser des semences de maïs hybrides, plus coûteuses — et réclamant également davantage d’engrais et de produits phytosanitaires — que les semences sélectionnées de manière traditionnelle. Elle insistait alors sur ...

  19. SYNTHESIS, COMPUTATIONAL STUDY AND PRELIMINARY PHARMACOLOGICAL EVALUATION OF 2-[4-(2-CHLOROBENZYL/BENZOYL SUBSTITUTED PIPERAZIN-1-YL]-N-PHENYLACETAMIDE: POTENTIAL ANTIPSYCHOTICS

    Directory of Open Access Journals (Sweden)

    Tomar Amita

    2011-06-01

    Full Text Available Benzyl and benzoyl substituted acetamides have been synthesized and evaluated as potential antipsychotic agents. The target compounds (4a-b were prepared by reaction of substituted anilines with chloroacetylchloride which further treated with 2-chlorobenzyl or 2-chlorobenzoyl piperazine in presence of potassium carbonate and potassium iodide as catalyst in acetonitrile. The structures of the target compounds (4a-b were characterized on the basis of their M.P., TLC, IR and 1H-NMR data. Computational studies of target compounds (4a-b were carried out by using software programs. The target compounds showed good similarity with respect to standard drugs. The target compounds (4a-b showed inhibition of 5-HTP induced head twitches behavior and low induction of catalepsy in mice.

  20. Ancient Haplotypes at the 15q24.2 Microdeletion Region Are Linked to Brain Expression of MAN2C1 and Children's Intelligence

    Science.gov (United States)

    Cáceres, Alejandro; Esko, Tõnu; Pappa, Irene; Gutiérrez, Armand; Lopez-Espinosa, Maria-Jose; Llop, Sabrina; Bustamante, Mariona; Tiemeier, Henning; Metspalu, Andres; Wilsonx, James F.; Reina-Castillón, Judith; Shin, Jean; Pausova, Zdenka; Paus, Tomáš; Sunyer, Jordi; Pérez-Jurado, Luis A.; González, Juan R.

    2016-01-01

    The chromosome bands 15q24.1-15q24.3 contain a complex region with numerous segmental duplications that predispose to regional microduplications and microdeletions, both of which have been linked to intellectual disability, speech delay and autistic features. The region may also harbour common inversion polymorphisms whose functional and phenotypic manifestations are unknown. Using single nucleotide polymorphism (SNP) data, we detected four large contiguous haplotype-genotypes at 15q24 with Mendelian inheritance in 2,562 trios, African origin, high population stratification and reduced recombination rates. Although the haplotype-genotypes have been most likely generated by decreased or absent recombination among them, we could not confirm that they were the product of inversion polymorphisms in the region. One of the blocks was composed of three haplotype-genotypes (N1a, N1b and N2), which significantly correlated with intelligence quotient (IQ) in 2,735 children of European ancestry from three independent population cohorts. Homozygosity for N2 was associated with lower verbal IQ (2.4-point loss, p-value = 0.01), while homozygosity for N1b was associated with 3.2-point loss in non-verbal IQ (p-value = 0.0006). The three alleles strongly correlated with expression levels of MAN2C1 and SNUPN in blood and brain. Homozygosity for N2 correlated with over-expression of MAN2C1 over many brain areas but the occipital cortex where N1b homozygous highly under-expressed. Our population-based analyses suggest that MAN2C1 may contribute to the verbal difficulties observed in microduplications and to the intellectual disability of microdeletion syndromes, whose characteristic dosage increment and removal may affect different brain areas. PMID:27355585

  1. (001–002) Proposals to amend Art. 32.2, 23.5, and 24.2 to clarify the treatment of transcribed Greek terminations of epithets

    Science.gov (United States)

    The International Code of Nomenclature for algae, fungi and plants is revised every six years to incorporate decisions of the Nomenclature Section of successive International Botanical Congresses (IBC) on proposals to amend the Code. The proposals in this paper will be considered at the IBC in Shenz...

  2. Final characterization and safety screen report of double shell tank 241-AP-104 for 242-A evaporator, campaign 96-1

    Energy Technology Data Exchange (ETDEWEB)

    Miller, G.L.

    1996-04-19

    This data package satisfies the requirement for a format IV, final report. It is a follow-up to the 45-day safety screen report for tank AP-104. Evaporator candidate feed from tank 241-AP-104 (hereafter referred to as AP-104) was characterized for physical, inorganic, organic and radiochemical parameters by the Westinghouse Hanford Company, 222-S Laboratory, and by the Battelle Pacific Northwest National Laboratory (PNNL), Analytical Chemistry Laboratory (ACL) as directed by the Tank Sample and Analysis Plan (TSAP), References 1 through 4. Preliminary data in the form of summary analytical tables were provided to the project in advance of this final report to enable early estimation of evaporator operational parameters, using the Predict modeling program. Laboratory analyses at ACL Laboratory was performed according to the TSAP. Analyses were performed at the 222-S Laboratory as defined and specified in the TSAP and the Laboratory`s Quality Assurance Plan, References 5 and 6. Any deviations from the instructions documented in the TSAP are discussed in this narrative and are supported with additional documentation. SAMPLING The TSAP, section 2, provided sampling information for waste samples collected from tank AP-104. The bottle-on-a-string method was used to collect liquid grab samples from the tank. Each glass sample bottle was amber, precleaned, and contained approximately 100 milliliters. Each bottle was closed with a teflon seal cap (or teflon septum for volatile organic analysis samples). Field blank samples were prepared by placing deionized water into sampling bottles, lowering the unclosed bottles into the riser for a period of time, retrieving them from the riser, and then closing the bottles with the same types of caps used for the tank samples. None of the samples were preserved by acidification. Upon receipt, the sample bottles destined for organic analyses were placed in a refrigerator. No attempt was made during sampling to assure the complete filling of the bottles so as to exclude all headspace. These actions were consistent with safety procedures, which attempt to limit personnel exposure to hazardous ionizing radiation.

  3. Earth system modelling on system-level heterogeneous architectures: EMAC (version 2.42) on the Dynamical Exascale Entry Platform (DEEP)

    Science.gov (United States)

    Christou, Michalis; Christoudias, Theodoros; Morillo, Julián; Alvarez, Damian; Merx, Hendrik

    2016-09-01

    We examine an alternative approach to heterogeneous cluster-computing in the many-core era for Earth system models, using the European Centre for Medium-Range Weather Forecasts Hamburg (ECHAM)/Modular Earth Submodel System (MESSy) Atmospheric Chemistry (EMAC) model as a pilot application on the Dynamical Exascale Entry Platform (DEEP). A set of autonomous coprocessors interconnected together, called Booster, complements a conventional HPC Cluster and increases its computing performance, offering extra flexibility to expose multiple levels of parallelism and achieve better scalability. The EMAC model atmospheric chemistry code (Module Efficiently Calculating the Chemistry of the Atmosphere (MECCA)) was taskified with an offload mechanism implemented using OmpSs directives. The model was ported to the MareNostrum 3 supercomputer to allow testing with Intel Xeon Phi accelerators on a production-size machine. The changes proposed in this paper are expected to contribute to the eventual adoption of Cluster-Booster division and Many Integrated Core (MIC) accelerated architectures in presently available implementations of Earth system models, towards exploiting the potential of a fully Exascale-capable platform.

  4. Giraut de Borneil, “Quan lo fregz e·l glatz e la neus” (BdT 242.60

    Directory of Open Access Journals (Sweden)

    Pietro G. Beltrami

    2011-12-01

    Full Text Available This paper provides a critical edition, with a new hypothesis concerning two difficult loci, of “Quan lo fregz e·l glatz e la neus”, one of the most significant love songs by Giraut de Borneil. For l. 48 (according to the order of the stanzas in Kolsen’s edition which is confirmed here, I will argue that “gers”, present in nearly all the manuscripts and editions, but never explained satisfactorily and unique from the lexical viewpoint, is a ghost word. Thus I will suggest accepting the lesson of ms. B as a suitable, ancient conjecture: ‘of those who are inside (the beseiged castle and forced to surrender’ que an grans guerriers, ‘who have great enemies’. For l. 58 none of the solutions put forward so far are convincing, thus I will tentatively propose a new conjecture: the lover fears that his life will become plus breus... “que del quint dels quars”, ‘shorter that the fifth of the quarter (of the day’, that is, it will be cut off. This restores a rhetorical figure of repetition that marks the end of each stanza after the second and which has been lost in nearly all the manuscripts and editions. My reading of the text will underline its distinctive aspects: a large number of quite difficult similes, emphasis on the figure of the lover, a lack of the author intervention and of the sententiae and forms of argument that characterise this poet, a fast pace created by the syntactic and rhetorical structure. I will also examine all that may serve to place the text within a particular historical context, although despite the many hypotheses, the only sure element is that it was written for a courtly occasion in the presence of Richard the Lionheart.

  5. Thermodynamic Assessment of Hot Corrosion Mechanisms of Superalloys Hastelloy N and Haynes 242 in Eutectic Mixture of Molten Salts KF and ZrF4

    Energy Technology Data Exchange (ETDEWEB)

    Michael V. Glazoff

    2012-02-01

    The KF - ZrF4 system was considered for the application as a heat exchange agent in molten salt nuclear reactors (MSRs) beginning with the work carried out at ORNL in early fifties. Based on a combination of excellent properties such as thermal conductivity, viscosity in the molten state, and other thermo-physical and rheological properties, it was selected as one of possible candidates for the nuclear reactor secondary heat exchanger loop.

  6. 2.4-2 Management of Educational Technology in Networked Education(Issues on Cross-Cultural Distance Education : Collaborative Research Outcomes and Open Workshops)

    OpenAIRE

    小林, 登志生; コバヤシ, トシオ; Cemil, ULUKAN; Toshio, Kobayashi

    2004-01-01

    Management of educational technology becomes more challenging as education transforms into networked modes thanks to the advancements in information and communication technologies (ICTs). This transformation implies that a deliberate and purposeful approach is needed for effective utilization of educational technology, which involves many organizational aspects that most higher education (HE) leaders do not recognize. Having the latest versions of technology will not solve the problems; rathe...

  7. On Convergence of 242X-2009-170526-i1.gif"/>-Series Involving 242X-2009-170526-i2.gif"/> Basic Hypergeometric Series

    OpenAIRE

    Zhao Xilai; Wang Mingjin

    2009-01-01

    We use inequality technique and the terminating case of the -binomial formula to give some results on convergence of -series involving basic hypergeometric series. As an application of the results, we discuss the convergence for special Thomae -integral.

  8. An Estimate of the Essential Norm of a Composition Operator from 242X-2010-132970-i1.gif"/> to 242X-2010-132970-i2.gif"/> in the Unit Ball

    OpenAIRE

    Zeng Hong-Gang; Zhou Ze-Hua

    2010-01-01

    Abstract Let be the unit ball of and a holomorphic self-map of Let , , , , and let be the composition operator between the space and -Bloch space induced by . This paper gives an estimate of the essential norm of . As a consequence, a necessary and sufficient condition for the composition operator to be compact from to is obtained.

  9. Extensions of the results on powers of 242X-2006-36919-i1.gif"/>-hyponormal and 242X-2006-36919-i2.gif"/>-hyponormal operators

    OpenAIRE

    Yang Changsen; Yuan Jiangtao

    2006-01-01

    Firstly, we will show the following extension of the results on powers of -hyponormal and -hyponormal operators: let and be positive integers, if is -hyponormal for , then: (i) in case , and hold, (ii) in case , and hold. Secondly, we will show an estimation on powers of -hyponormal operators for which implies the best possibility of our results. Lastly, we will show a parallel estimation on powers of -hyponormal operators as follows: let , then the following hold for each positive i...

  10. A new shipping container for an intense neutron emitter

    International Nuclear Information System (INIS)

    Californium-252 is an intense neutron emitter (2.34 x 1012 n/s·g) used in medicine, research, and industry. The western world's sole source of this rare radioisotope is the Californium Facility at Oak Ridge National Laboratory's Radiochemical Engineering Development Center (REDC). A project has been initiated at the REDC to design a new Type B Californium Shipping Container. This effort is essential for future transportation of californium to meet the needs of users all over the world. The shipping container must meet all requirements for transport by motor freight, air, vessel, and rail, both domestic and foreign. There are unique problems in the design, fabrication, and licensing of a new Type B shipping container that will accommodate up to 60 milligrams of californium-252. One of the first challenges in the design phase of the project is the selection of a material to shield the high neutron flux. The more stringent safety precautions of today's world impel us to consider more exotic materials for such a purpose. The candidate materials must be examined not just for their neutron shielding properties, but also in conjunction with other properties such as thermal and structural requirements to withstand the hypothetical accident conditions. The design and building of such a container is a formidable task requiring much planning. The licensing process, with the complex, interactive federal codes, is a special challenge and may be the biggest on the project in terms of time and money

  11. Application of Cf for the quantitative measurement of nuclear reactor fuel materials

    International Nuclear Information System (INIS)

    Sensitive and rapid measurements of the quantity and geometric distribution of nuclear reactor fuel materials can be made using neutrons from californium. The neutron-induced fission rate in these materials may be measured by detection of either prompt radiations from fission or delayed radiations from radioactive fission products. A number of californium-based instruments are presently in use by the nuclear industry for purposes of process control, quality control, nuclear materials safeguards, and environmentl assessment. An Automated Fuel Rod Scanner (AFRS) is used for high-speed measurement of the uniformity of loading and total fissile content of reactor fuel rods. The fuel rods are moved first through an irradiator containing about 1 mg of californium, and subsequently through high-efficiency detectors for the measurement of fission-product gamma-rays. Multiple detectors on each of two irradiation channels are used to reduce the californium source strength requirement. The fuel loading of each 15-mm-long pellet is tested to +-10% on 100% of the plant throughput. By summing the response over length, the total fissile material content of the fuel rod is measured to better than 0.5%. An on-line computer for data processing allows the instrument to measure about 150 rods per hour with a single operator. The same activation concept is used with a 25-μg californium source in a Small Sample Assay System (SSAS) which measures the fissile content of fuel pellet sized samples with a precision of 0.5%

  12. An upper bound for the 242X-2006-25020-i1.gif"/> norm of a GCD-related matrix

    OpenAIRE

    Haukkanen Pentti

    2006-01-01

    We find an upper bound for the norm of the matrix whose entry is , where and are the greatest common divisor and the least common multiple of and and where and are real numbers. In fact, we show that if and , then for all positive integers , where is the Riemann zeta function.

  13. Integral-Type Operators from 242X-2010-789285-i1.gif"/> Spaces to Zygmund-Type Spaces on the Unit Ball

    OpenAIRE

    Yang Congli

    2010-01-01

    Let denote the space of all holomorphic functions on the unit ball . This paper investigates the following integral-type operator with symbol , , , , where is the radial derivative of . We characterize the boundedness and compactness of the integral-type operators from general function spaces to Zygmund-type spaces , where is normal function on .

  14. Comment on ``Measurements of the hydration numbers for halide ions by the mass spectrometric method of field evaporation of ions out of solution'' [Chem. Phys. Lett. 242 (1995) 390

    Science.gov (United States)

    Symons, Martyn C. R.

    2000-08-01

    It has been suggested by Dunsyuryun, Karpov and Morozov that two different terms should be used to describe the solvation of halide ions in aqueous solutions. The term co-ordination number gives the primary `solvation number' (ca. 6), whilst the term hydration number gives the number of water molecules that stay co-ordinated to the anions as they move through the liquid (ca. 2). Here it is suggested that since these two terms are widely used to mean the same thing, it is better not to change one of them. It is also suggested that the number of water molecules that move with ions is variable and ill defined and that it is not appropriate to specify a precise number for this.

  15. A multi-ethnic genome-wide association study identifies novel loci for non-syndromic cleft lip with or without cleft palate on 2p24.2, 17q23 and 19q13

    DEFF Research Database (Denmark)

    Leslie, Elizabeth J; Carlson, Jenna C; Shaffer, John R;

    2016-01-01

    Orofacial clefts (OFCs), which include non-syndromic cleft lip with or without cleft palate (CL/P), are among the most common birth defects in humans, affecting approximately 1 in 700 newborns. CL/P is phenotypically heterogeneous and has a complex etiology caused by genetic and environmental fac...

  16. Composição química do capim-Mombaça (Panicum maximum Jacq. cv. Mombaça adubado com diferentes fontes de fósforo sob pastejo - DOI: 10.4025/actascianimsci.v29i1.242 Chemical composition of Mombaça grass (Panicum maximum Jacq. cv. Mombaça fertilized with different phosphorus on grazing - DOI: 10.4025/actascianimsci.v29i1.242

    Directory of Open Access Journals (Sweden)

    Ulysses Cecato

    2007-11-01

    Full Text Available O objetivo foi avaliar a composição química do Panicum maximum Jacq. cv. Mombaça, adubado com 140 kg ha-1 de P2O5 com diferentes fontes de fósforo, sob pastejo, no período de dezembro de 2002 a abril de 2003, com intervalo de coleta a cada 28 dias. Tratamentos: 1- termofosfato magnesiano Yoorin®; 2-fosfato natural Gafsa®; 3-superfosfato simples + superfosfato triplo (SS + ST; e 4-testemunha. Os teores de proteína bruta na lâmina foliar (PBf e colmo (PBc, nitrogênio insolúvel em detergente ácido (NIDA, fibra em detergente neutro (FDN, fibra em detergente ácido (FDA, celulose (CEL, hemicelulose (HCEL, lignina (LIG, extrato etéreo (EE, cálcio (Ca, fósforo (P, cinzas e carboidratos não-estruturais (CNE, não foram influenciados pela adubação fosfatada. As variáveis PBc, FDNf, FDNc, LIGf, LIGc, CELf, CELc, NIDAf, EEf, EEc, Caf, Cac, Pf, Pc, CINZAc, CNEc, apresentaram efeito do período de coleta. Não ocorreu diferença na composição química da forragem do capim-Mombaça em função das fontes de fósforo utilizadas na adubação da pastagem. As variações qualitativas foram de baixa magnitude.This study aimed to evaluate the chemical composition of Panicum maximum Jacq. cv. Mombaça. Grassland was fertilized with 140 kg ha-1 of P2O5 from different phosphorus sources on grazing, in December, 2002, until April, 2003, with a collection interval of every 28 days. Treatments: 1-Yoorin® magnesium thermophosphate; 2-Gafsa® natural phosphate; 3-simple superphosphate + triple superphosphate (SS + TS and 4-control. Leaf (lCP and stem (sCP crude protein, acid detergent fiber nitrogen (ADFN, neutral detergent fiber (NDF, acid detergent fiber (ADF, cellulose (CEL, hemicellulose (HEM, lignin (LIG, ether extract (EE, calcium (Ca, phosphorus (P, ash (A and non-structural carbohydrates (NSC were not influenced by phosphated fertilization. The variables sCP, lNDF, sNDF, sLIG, lLIG, sCEL, lCEL, lADFN, sEE, lEE, lCa, sCa, lP, sP, sA and sNSC, showed some effects from the collection period. There was no difference in the chemical composition of forage of the grass-Mombaça in function of phosphorus sources used in the pasture. The qualitative variations were of low magnitude.

  17. Magnetic measurements of the transuranium elements. Progress report, January 1, 1984-December 31, 1984

    International Nuclear Information System (INIS)

    Measurements of the magnetic properties of dhcp californium-249 metal indicated the presence of three regions of differing magnetic character. Additional measurements are also reported. Magnetic moments and valence states of terbium in TbF3, BaTbO3, and TbO18 are discussed. Progress on high-field operation of the micro-magnetic susceptometer is reported

  18. Application of PGNAA to preincineration assay of combustible waste for chlorine

    Energy Technology Data Exchange (ETDEWEB)

    Gehrke, R.J.; Pawelko, R.J.; Greenwood, R.C. [Idaho National Engineering Lab., Idaho Falls, ID (United States)

    1995-12-31

    A prompt gamma neutron activation analysis method is being developed for on-stream pre-incineration assay of low level radioactive combustible waste for it`s chlorine content. The assay system consists of three californium 252 sources and a germanium or scintillation gamma-ray spectrometer.

  19. Discovery of Isotopes of the Transuranium Elements with 93 <= Z <= 98

    CERN Document Server

    Fry, C

    2012-01-01

    One hundred and five isotopes of the transuranium elements neptunium, plutonium, americium, curium, berkelium and californium have so far been observed; the discovery of these isotopes is discussed. For each isotope a brief summary of the first refereed publication, including the production and identification method, is presented.

  20. Source storage and transfer cask: Users Guide

    International Nuclear Information System (INIS)

    The storage and shield cask for the dual californium source is designed to shield and transport up to 3.7 mg (2 Ci) of 252Cf. the cask meets Department of Transportation (DOT) license requirements for Type A materials (DOT-7A). The cask is designed to transfer sources to and from the Flourinel and Fuel Storage (FAST) facility delayed-neutron interrogator. Californium sources placed in the cask must be encapsulated in the SR-CF-100 package and attached to Teleflex cables. The cask contains two source locations. Each location contains a gear box that allows a Teleflex cable to be remotely moved by a hand crank into and out of the cask. This transfer procedure permits sources to be easily removed and inserted into the delayed-neutron interrogator and reduces personnel radiation exposure during transfer. The radiation dose rate with the maximum allowable quantity of californium (3.7 mg) in the cask is 30 mR/h at the surface and less than 2 mR/h 1 m from the cask surface. This manual contains information about the cask, californium sources, describes the method to ship the cask, and how to insert and remove sources from the cask. 28 figs

  1. Pediatric Palliative Care: A Personal Story

    Medline Plus

    Full Text Available ... total__ Find out why Close Pediatric Palliative Care: A Personal Story NINRnews Subscribe Subscribed Unsubscribe 242 242 ... later? Sign in to add this video to a playlist. Sign in Share More Report Need to ...

  2. Characterization of berkelium(III) dipicolinate and borate compounds in solution and the solid state.

    Science.gov (United States)

    Silver, Mark A; Cary, Samantha K; Johnson, Jason A; Baumbach, Ryan E; Arico, Alexandra A; Luckey, Morgan; Urban, Matthew; Wang, Jamie C; Polinski, Matthew J; Chemey, Alexander; Liu, Guokui; Chen, Kuan-Wen; Van Cleve, Shelley M; Marsh, Matthew L; Eaton, Teresa M; van de Burgt, Lambertus J; Gray, Ashley L; Hobart, David E; Hanson, Kenneth; Maron, Laurent; Gendron, Frédéric; Autschbach, Jochen; Speldrich, Manfred; Kögerler, Paul; Yang, Ping; Braley, Jenifer; Albrecht-Schmitt, Thomas E

    2016-08-26

    Berkelium is positioned at a crucial location in the actinide series between the inherently stable half-filled 5f(7) configuration of curium and the abrupt transition in chemical behavior created by the onset of a metastable divalent state that starts at californium. However, the mere 320-day half-life of berkelium's only available isotope, (249)Bk, has hindered in-depth studies of the element's coordination chemistry. Herein, we report the synthesis and detailed solid-state and solution-phase characterization of a berkelium coordination complex, Bk(III)tris(dipicolinate), as well as a chemically distinct Bk(III) borate material for comparison. We demonstrate that berkelium's complexation is analogous to that of californium. However, from a range of spectroscopic techniques and quantum mechanical calculations, it is clear that spin-orbit coupling contributes significantly to berkelium's multiconfigurational ground state. PMID:27563098

  3. GETDB: 103550 [GETDB

    Lifescience Database Archive (English)

    Full Text Available onal Institute of Genetics. FM7c Link to clone table - 1 242 Link to cluster table 242 1 Request - cns, mg, good driver...er table 242 Num of clusters 1 Stock Request Request - Embryonic Expression cns, mg, good driver Larval GFP

  4. Measurement of the energy spectra of fission fragments using nuclear track detectors and digital image processing

    International Nuclear Information System (INIS)

    Energy spectra of fission fragments were determined using a Nuclear Track Methodology (NTM) supported by digital image analysis and numerical data processing using a standard personal computer. The analysis of a californium (252Cf) spectrum with this approach shows improvement compared with the values reported previously using the standard procedure, in terms of resolution and accuracy. This new method adds full automation to the technical advantages and cost effectiveness of an NTM.

  5. Neutron multiplicities for the transplutonium nuclides

    International Nuclear Information System (INIS)

    This paper continues, with respect to the transplutonium nuclides, earlier efforts to collate and evaluate data from the scientific literature on the prompt neutron multiplicity distribution from fission and its first moment = ΣnuPnu. The isotopes considered here for which P/sub nu/ and or data (or both) were found in the literature are of americium (Am), curium (Cm), berkelium (Bk), californium (Cf), einsteinium (Es), fermium (Fm), and nobelium (No)

  6. Study of heavy particle decay from superheavy elements by SK model

    International Nuclear Information System (INIS)

    Heavy nuclei usually decay by alpha decay or spontaneous fission. These two decay modes are generally the most probable competing processes. Another less probable decay process is cluster radioactivity in which nuclei from carbon to silicon are emitted from Radium to Californium leading to the most stable daughter nucleus, lead. This work reports such a study using the cubic plus Yukawa plus exponential model of Shanmugam and Kamalaharan (SK)

  7. Properties of neutron sources

    International Nuclear Information System (INIS)

    The Conference presentations were divided into sessions devoted to the following topics: white neutron sources, primarily pulsed (6 papers); fast neutron fields (5 papers); Californium-252 prompt fission neutron spectra (14 papers); monoenergetic sources and filtered beams (11 papers); 14 MeV neutron sources (10 papers); selected special application (one paper); and a general interest session (4 papers). Individual abstracts were prepared separately for the papers

  8. The Majority of Library Clients Still Use Person-to-Person Interaction When Asking Reference Questions. A review of: De Groote, Sandra L. “Questions Asked at the Virtual and Physical Health Sciences Reference Desk: How Do They Compare and What Do They Tell Us?” Medical Reference Services Quarterly 24.2 (Summer 2005: 11-23.

    Directory of Open Access Journals (Sweden)

    Suzanne Pamela Lewis

    2006-03-01

    Full Text Available Objective - To identify similarities and difference in the questions asked at the virtual and physical refernece desks of a helath scienmces library, in order to better undertand user needs and highlight areas for service improvement. Also to retrospectively analyze reference statistics collected over the previous six years. Design - Use study; retrospective study of reference statistics for the period July 1997 to June 2003; literature review. Setting - Large academic helath sciences library in the United States. Subjects - All questions asked at the reference and information desks, plus questions submitted to the University-wide virtual reference service and answered by a health sciences librarian, over a period of one month. The questions were asked by faculty, staff, students and members of the public. Methods - A literature review was carried out to examine the types of information/reference questions typically asked in health sciences libraries both before and after the mass introduction of remote end-user searching of online resources and the establishment of virtual reference services. Next, the reference statistics collected at the University of Illinois at Chicage (UIC Library of the Health Sciences between July 1997 and June 2003 were examined. For most of this period a digital reference service was offered using a listserv address to which patrons would submit email queries. Beginning in March 2003, a formal virtual reference service (chat and email was provided using commercial software. Finally, data was gathered on questions answered by a health sciences librarians, and clients who asked the question, at either the physical or cirtual reference desk, during the month of November 2003 at the UIC Library of the Health Sciences. Library staff completed an online survey form for each question, and if a client asked more than one question, each question was coded individually. Data included: status of client using the service (faculty/staff. undergarduate student, graduate student, non0UIC, unknown; mode of submission (email, chat, phone, in person; and type of question asked (directional, ready reference, in-depth/mediated, instructional, technical, accounts/status and other. In subsequent analysis, the original seven types of questions were further broken down into 19 categories. Main results - It was not possible to undertake a meta-analysis or systematic review of the studies identified in the literature review because of differences in time frames, settings and the categories used to code reference questions. However the following trends emerged: directional questions accounted for between 30 and 35% of questions asked at both the physical and virtual reference desks; the remainder of questions were generally about known item searched, library policies and services, research, dadabase use and quick reference. The statistics collected at UIC Library of the Health Sciences over the period July 1997 to June 2003 were analyzed. Coded reference questions fell into one of four categories; ready reference, in-depth reference, mediated searched and digital reference. There was a noticeable drop in the number of reference questions received in 1999/2000 which reflects trends reported in some of the studies identified in the literature review. The number of mediated searches decreased from 154 in 1997-98 to 4 in 2002/2003, but the number of digital reference questions increased from 0 to 508 in the same period. Statistics were collected over the month of November 2003 for 939 questions asked at the reference and information desks which included: 38 email; 48 chat; 156 phone; and 697 in person. The major findings were as follows: - appoximately 55% of questions were reference questions (33.5% ready reference, 9.7% in-depth/mediated, 9.7% instructional; 30% were directional; and 10% were technical; it is not stated what the remaining 5% of questions were; - library clients who asked the questions comprised graduate students (26%, faculty (24%, undergraduate students (24% and non-UIC patrons (22%; - all groups were most likely to ask their reference questions in person; - graduate students were the largest group of email reference (34%, undergraduates were the largest group to use chat (35% and faculty/staff were the largest group to use the telephone (39%; - 28% of the questions were answered from the library's staff's general knowledge of the library; 22% using the online catalogue or electronic journals list; 22% by referrning the patron to, or using an online database or resource; 13% by referring the patron to another department in the library (such as circulation; 7% by consulting another individual; and 5% by using print resources. Conclusion - The results of the three parts of this study - literature review, study of 1997-2003 statistics, and in-depth collection of statistics for November 2003 - are difficult to compare with each other. However, the general trend emerging from the results is that some kinds of questions asked by health sciences library clients have remained very much the same regardless of the rise of remote end-user searching and the mode of transmission of the questions. These include questions about library policies and services, journal and book holdings, database searching and instructional support. Questions about citation verification and consumer health appear to be decreasing while technical questions and questions about accessing remote databases and online journals are increasing. The majority of reference questions are still asked in person.

  9. Reply to comment on: "Cobeñas, G., Thouret, J.-C., Bonadonna, C., Boivin, P., 2012. The c.2030 yr BP Plinian eruption of El Misti volcano, Peru: Eruption dynamics and hazard implications. Journal of Volcanology and Geothermal Research 241-242, 105-120." by Harpel et al., JVGR 2013

    Science.gov (United States)

    Cobeñas, Gisela; Thouret, Jean-Claude; Bonadonna, Costanza; Boivin, Pierre

    2014-04-01

    The comment provided by Harpel et al. challenges our interpretation of the most recent Plinian eruption of El Misti c.2070 yr BP* situated near the city of Arequipa, Peru (*revised age from our previously stated date of c.2030 BP). In our view, the sequence of deposits points to another example of a Plinian (pumice-rich) tephra fall followed by lithic-rich pyroclastic density currents (PDCs). Locally, late rockslide avalanches have emplaced mass-flow deposits on top of PDCs, while elsewhere post-eruption lahars have led to their remobilization. One of the main criticisms from Harpel et al. was in our interpretation of the deposits as being of PDC origin, rather than post-eruption lahars. We revise each of the diagnostic features that Harpel et al. have used for attributing the deposits to lahars. We present two tables of the revised age of the eruption and criteria based on lithofacies, lithological components, grain-size distribution and statistical indices for each of the c.2070 yr BP-old PDC, lahar and mass-flow deposits. Our maps and simulations of PDCs and lahars, based on two numerical codes with volume inputs from identified deposits around El Misti, do not "fall short" of the hazard assessment goal.

  10. Improving the pharmacokinetic and CYP inhibition profiles of azaxanthene-based glucocorticoid receptor modulators-identification of (S)-5-(2-(9-fluoro-2-(4-(2-hydroxypropan-2-yl)phenyl)-5H-chromeno[2,3-b]pyridin-5-yl)-2-methylpropanamido)-N-(tetrahydro-2H-pyran-4-yl)-1,3,4-thiadiazole-2-carboxamide (BMS-341).

    Science.gov (United States)

    Yang, Michael G; Dhar, T G Murali; Xiao, Zili; Xiao, Hai-Yun; Duan, James J-W; Jiang, Bin; Galella, Michael A; Cunningham, Mark; Wang, Jinhong; Habte, Sium; Shuster, David; McIntyre, Kim W; Carman, Julie; Holloway, Deborah A; Somerville, John E; Nadler, Steven G; Salter-Cid, Luisa; Barrish, Joel C; Weinstein, David S

    2015-05-28

    An empirical approach to improve the microsomal stability and CYP inhibition profile of lead compounds 1a and 1b led to the identification of 5 (BMS-341) as a dissociated glucocorticoid receptor modulator. Compound 5 showed significant improvements in pharmacokinetic properties and, unlike compounds 1a-b, displayed a linear, dose-dependent pharmacokinetic profile in rats. When tested in a chronic model of adjuvant-induced arthritis in rat, the ED50 of 5 (0.9 mg/kg) was superior to that of both 1a and 1b (8 and 17 mg/kg, respectively). PMID:25905990

  11. The Majority of Library Clients Still Use Person-to-Person Interaction When Asking Reference Questions. A review of: De Groote, Sandra L. “Questions Asked at the Virtual and Physical Health Sciences Reference Desk: How Do They Compare and What Do They Tell Us?” Medical Reference Services Quarterly 24.2 (Summer 2005): 11-23.

    OpenAIRE

    Suzanne Pamela Lewis

    2006-01-01

    Objective - To identify similarities and difference in the questions asked at the virtual and physical refernece desks of a helath scienmces library, in order to better undertand user needs and highlight areas for service improvement. Also to retrospectively analyze reference statistics collected over the previous six years. Design - Use study; retrospective study of reference statistics for the period July 1997 to June 2003; literature review. Setting - Large academic helath sciences l...

  12. Radiochemical determination of the neutron capture cross sections of {sup 241}Am irradiated in the JMTR reactor

    Energy Technology Data Exchange (ETDEWEB)

    Shinohara, N.; Hatsukawa, Y.; Hata, K.; Kohno, N. [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    1997-03-01

    The thermal neutron capture cross section {sigma}{sub 0} and Resonance integral I{sub 0} of {sup 241}Am leading to the production of {sup 242m}Am and {sup 242g}Am were measured by radiochemical method. The cross sections obtained in this study are {sigma}{sub 0}=60.9 {+-} 2.6 barn, I{sub 0}=213 {+-} 13 barn for {sup 241}Am(n,{gamma}){sup 242m}Am and {sigma}{sub 0}=736 {+-} 31 barn, I{sub 0}=1684 {+-} 92 barn for {sup 241}Am(n,{gamma}){sup 242g}Am. (author)

  13. Plate Tectonics: A Paradigm under Threat.

    Science.gov (United States)

    Pratt, David

    2000-01-01

    Discusses the challenges confronting plate tectonics. Presents evidence that contradicts continental drift, seafloor spreading, and subduction. Reviews problems posed by vertical tectonic movements. (Contains 242 references.) (DDR)

  14. Dicty_cDB: Contig-U15344-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ctggtagtangggtgttaaangnatcgcttcaancantganggtgananttccngangaa 360 |||||||||||||||||||||||||||||||||||||||||||...||||||||||||||||| Sbjct: 301 ctggtagtangggtgttaaangnatcgcttcaancantganggtgananttccnganga...ntanggcgggnantattttactggttc 365 Query: 301 ctggtagtangggtgttaaangnatcgcttcaancantganggtgananttccngangaa 360 ...242 gtcgttccaantanggcgggtantantttactggntcctggtagtangggtgttaaangn 183 Query: 324 atcgcttcaancantganggtgananttccnganga... atcgcttcaancantganggtgananttccngangaantgatttcattggtggtangttt 123 Query: 384 anga

  15. Neutron nondestructive essay of the plutonium metal parts

    International Nuclear Information System (INIS)

    Based on the principle of neutron multiplicity and data unfolding mathematics, this paper developed the software which can execute the neutron multiplicity analysis, neutron attenuation analysis, parameter calibration, Pu mass solution with the neutron pulse sequence acquisition method. The measurement system consisted of detector,nuclear electronic apparatus, pulsed sequence acquisition and analysis software was tested and calibrated by californium source. Three mental plutonium components with different mass were used for experimental assay and validation, which showed that the assay bias was within 15% against the nominal value of the samples. (authors)

  16. Physical-chemical studies of transuranium elements. Progress report, April 1, 1982-March 31, 1983

    International Nuclear Information System (INIS)

    Progress is reported on the following topics: electrochemical and spectroscopic studies of less-stable higher oxidation states of transuranium elements in complexing aqueous media; spectroscopic and electrochemical studies of selected lanthanides and actinides in molten dimethyl sulfone; spectroelectronchemical studies of the Ce(IV)/Ce(III) couple in aqueous carbonate solutions; characterization of actinide orthophosphates by Raman and absorption spectrophotometries and by x-ray diffraction; relativistic multiple scattering calculations on transuranium element compounds; Raman spectroscopic studies of natural minerals containing the uranyl ion; and solution calorimetry of californium metal

  17. Composition containing transuranic elements for use in the homeopathic treatment of aids

    Energy Technology Data Exchange (ETDEWEB)

    Lustig, D.

    1996-04-18

    A homeopathic remedy consisting of a composition containing one or more transuranic elements, particularly plutonium, for preventing and treating acquired immunodeficiency syndrome (AIDS) in humans, as well as seropositivity for human immunodeficiency virus (HIV). Said composition is characterized in that it uses any chemical or isotopic form of one or more transuranic elements (neptunium, plutonium, americium, curium, berkelium, californium or einsteinium), particularly plutonium, said form being diluted and dynamized according to conventional homeopathic methods, particularly the so-called Hahnemann and Korsakov methods, and provided preferably but not exclusively in the form of lactose and/or saccharose globules or granules impregnated with the active principle of said composition. (author).

  18. TOWARD AN IMPROVED UNDERSTANDING OF STRUCTURE AND MAGNETISM IN NEPTUNIUM AND PLUTONIUM PHOSPHONATES AND SULFONATES

    Energy Technology Data Exchange (ETDEWEB)

    Albrecht-Schmitt, Thomas

    2012-03-01

    This grant supported the exploratory synthesis of new actinide materials with all of the actinides from thorium to californium with the exceptions of protactinium and berkelium. We developed detailed structure-property relationships that allowed for the identification of novel materials with selective ion-exchange, selective oxidation, and long-range magnetic ordering. We found novel bonding motifs and identified periodic trends across the actinide series. We identified structural building units that would lead to desired structural features and novel topologies. We also characterized many different spectroscopic trends across the actinide series. The grant support the preparation of approximately 1200 new compounds all of which were structurally characterized.

  19. NONDESTRUCTIVE IDENTIFICATION OF CHEMICAL WARFARE AGENTS AND EXPLOSIVES BY NEUTRON GENERATOR-DRIVEN PGNAA

    Energy Technology Data Exchange (ETDEWEB)

    T. R. Twomey; A. J. Caffrey; D. L. Chichester

    2007-02-01

    Prompt gamma-ray neutron activation analysis (PGNAA) is now a proven method for the identification of chemical warfare agents and explosives in military projectiles and storage containers. Idaho National Laboratory is developing a next-generation PGNAA instrument based on the new Ortec Detective mechanically-cooled HPGe detector and a neutron generator. In this paper we review PGNAA analysis of suspect chemical warfare munitions, and we discuss the advantages and disadvantages of replacing the californium-252 radioisotopic neutron source with a compact accelerator neutron generator.

  20. Detection of rare earth elements in Powder River Basin sub-bituminous coal ash using laser-induced breakdown spectroscopy (LIBS)

    Energy Technology Data Exchange (ETDEWEB)

    Tran, Phuoc [National Energy Technology Lab. (NETL), Pittsburgh, PA, (United State; Mcintyre, Dustin [National Energy Technology Lab. (NETL), Pittsburgh, PA, (United State

    2015-10-01

    We reported our preliminary results on the use of laser-induced breakdown spectroscopy to analyze the rare earth elements contained in ash samples from Powder River Basin sub-bituminous coal (PRB-coal). We have identified many elements in the lanthanide series (cerium, europium, holmium, lanthanum, lutetium, praseodymium, promethium, samarium, terbium, ytterbium) and some elements in the actinide series (actinium, thorium, uranium, plutonium, berkelium, californium) in the ash samples. In addition, various metals were also seen to present in the ash samples

  1. Composition containing transuranic elements for use in the homeopathic treatment of aids

    International Nuclear Information System (INIS)

    A homeopathic remedy consisting of a composition containing one or more transuranic elements, particularly plutonium, for preventing and treating acquired immunodeficiency syndrome (AIDS) in humans, as well as seropositivity for human immunodeficiency virus (HIV). Said composition is characterized in that it uses any chemical or isotopic form of one or more transuranic elements (neptunium, plutonium, americium, curium, berkelium, californium or einsteinium), particularly plutonium, said form being diluted and dynamized according to conventional homeopathic methods, particularly the so-called Hahnemann and Korsakov methods, and provided preferably but not exclusively in the form of lactose and/or saccharose globules or granules impregnated with the active principle of said composition. (author)

  2. NONDESTRUCTIVE IDENTIFICATION OF CHEMICAL WARFARE AGENTS AND EXPLOSIVES BY NEUTRON GENERATOR-DRIVEN PGNAA

    International Nuclear Information System (INIS)

    Prompt gamma-ray neutron activation analysis (PGNAA) is now a proven method for the identification of chemical warfare agents and explosives in military projectiles and storage containers. Idaho National Laboratory is developing a next-generation PGNAA instrument based on the new Ortec Detective mechanically-cooled HPGe detector and a neutron generator. In this paper we review PGNAA analysis of suspect chemical warfare munitions, and we discuss the advantages and disadvantages of replacing the californium-252 radioisotopic neutron source with a compact accelerator neutron generator

  3. Use of trioctylphosphine oxide for transplutonium element extraction and purification

    International Nuclear Information System (INIS)

    Investigated was extraction of tri-valent curium, berkelium, californium, einsteinium as well as cerium and europium with trioctylphosphin oxide from lactic acid solutions, containing DTPA and aluminium nitrate depending on the aluminium nitrate and TOPO concentrations and nitric acid solutions of variable concentration as well. Under optimum conditions of extraction chromatography of berkelium studied was the distribution of cobalt, nickel, chromium, iron, aluminium, titanium, zirconium and niobium ions, and the coefficients of berkelium purification from cations investigated were determined. The effect of weight quantities of cation impurities on extraction chromatographic yield of berkelium has been investigated. Examples of practice application of the extraction chromatography with the use of TOPO are given

  4. PROCEEDINGS OF THE SYMPOSIUM COMMEMORATING THE 25th ANNIVERSARY OF ELEMENTS 97 and 98 HELD ON JAN. 20, 1975

    Energy Technology Data Exchange (ETDEWEB)

    Seaborg, Glenn T.; Street Jr., Kenneth; Thompson, Stanley G.; Ghiorso, Albert

    1976-07-01

    This volume includes the talks given on January 20, 1975, at a symposium in Berkeley on the occasion of the celebration of the 25th anniversary of the discovery of berkelium and californium. Talks were given at this symposium by the four people involved in the discovery of these elements and by a number of people who have made significant contributions in the intervening years to the investigation of their nuclear and chemical properties. The papers are being published here, without editing, in the form in which they were submitted by the authors in the months following the anniversary symposium, and they reflect rather faithfully the remarks made on that occasion.

  5. Neutron crosstalk between liquid scintillators

    Energy Technology Data Exchange (ETDEWEB)

    Verbeke, J. M. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Prasad, M. K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Snyderman, N. J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2015-05-01

    We propose a method to quantify the fractions of neutrons scattering between liquid scintillators. Using a spontaneous fission source, this method can be utilized to quickly characterize an array of liquid scintillators in terms of crosstalk. The point model theory due to Feynman is corrected to account for these multiple scatterings. Using spectral information measured by the liquid scintillators, fractions of multiple scattering can be estimated, and mass reconstruction of fissile materials under investigation can be improved. Monte Carlo simulations of mono-energetic neutron sources were performed to estimate neutron crosstalk. A californium source in an array of liquid scintillators was modeled to illustrate the improvement of the mass reconstruction.

  6. Study by thermochromatography of fluorides of transuranium elements

    International Nuclear Information System (INIS)

    Thermochromatography was made suitable for fluoride study. So, an investigation of actinide tetrafluorides was accomplished from uranium to californium. Pentavalent and hexavalent fluorospecies of uranium, neptunium, plutonium and ruthenium were studied. Some new compounds have been identified in gaseous phase, whose: PuF5, PuOF3 and PaOF3. Furthermore, some presomptions as for the existence in gaseous phase of EsF4 and of an heptavalent fluorospecies of plutonium have been established. An important analogy between plutonium and ruthenium behaviour with fluorine have been shown, these results could explain the difficulties encountered in the fluoride-volatility processes

  7. Method for measuring multiple scattering corrections between liquid scintillators

    Science.gov (United States)

    Verbeke, J. M.; Glenn, A. M.; Keefer, G. J.; Wurtz, R. E.

    2016-07-01

    A time-of-flight method is proposed to experimentally quantify the fractions of neutrons scattering between scintillators. An array of scintillators is characterized in terms of crosstalk with this method by measuring a californium source, for different neutron energy thresholds. The spectral information recorded by the scintillators can be used to estimate the fractions of neutrons multiple scattering. With the help of a correction to Feynman's point model theory to account for multiple scattering, these fractions can in turn improve the mass reconstruction of fissile materials under investigation.

  8. Dicty_cDB: Contig-U11690-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available = 190/190 (100%) Strand = Plus / Plus Query: 182 gatgnagatatcnttcaaagatttaatccnattagnntggtcntttcnatnaaaccna...aa 241 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 182 gatgnagatatcnttcaaagatttaatccna...ttagnntggtcntttcnatnaaaccnaaa 241 Query: 242 tnggattnntcnattaggccatatnttttnaaan... = 9e-41 Identities = 189/189 (100%) Strand = Plus / Minus Query: 183 atgnagatatcnttcaaagatttaatccna...ttagnntggtcntttcnatnaaaccnaaat 242 ||||||||||||||||||||||||||||||||||||||||||||||||||||||

  9. 49 CFR 24.101 - Applicability of acquisition requirements.

    Science.gov (United States)

    2010-10-01

    ... such properties are not displaced persons, (see §§ 24.2(a)(9)(ii)(E) or (H)), and as such, are not... paragraphs (b)(1) through (5) of this section. Such tenants are considered displaced persons. (See § 24.2(a... projects undertaken by an Agency or person that receives Federal financial assistance but does not...

  10. Flammable gas/slurry growth unreviewed safety question:justification for continued operation for the tank farms at the Hanford site

    Energy Technology Data Exchange (ETDEWEB)

    Leach, C.E., Westinghouse Hanford

    1996-07-31

    This Justification for Continued Operation (JCO) provides a basis for continued operation in 176 high level waste tanks, double contained receiver tanks (DCRTs), catch tanks, 244-AR Vault, 242-S and 242-T Evaporators and inactive miscellaneous underground storage tanks (IMUSTs) relative to flammable gas hazards. Required controls are specified.

  11. 17 CFR 270.17a-7 - Exemption of certain purchase or sale transactions between an investment company and certain...

    Science.gov (United States)

    2010-04-01

    ... such exchange that day; or (3) If the security is not a reported security and is quoted in the NASDAQ...: (1) If the security is an “NMS stock” as that term is defined in 17 CFR 242.600, the last sale price... such security (reported pursuant to 17 CFR 242.602) if there are no reported transactions in...

  12. Dicty_cDB: Contig-U04138-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available pid:none) Sepioteuthis lessoniana mitochondr... 242 7e-63 X55514_13( X55514 |pid:...3e-63 DQ087513_1( DQ087513 |pid:none) Ascaphus montanus strain Wallowa c... 242 7e-63 AB240154_3( AB240154 |

  13. Zebrafish model of tuberous sclerosis complex reveals cell-autonomous and non-cell-autonomous functions of mutant tuberin

    Directory of Open Access Journals (Sweden)

    Seok-Hyung Kim

    2011-03-01

    Tuberous sclerosis complex (TSC is an autosomal dominant disease caused by mutations in either the TSC1 (encodes hamartin or TSC2 (encodes tuberin genes. Patients with TSC have hamartomas in various organs throughout the whole body, most notably in the brain, skin, eye, heart, kidney and lung. To study the development of hamartomas, we generated a zebrafish model of TSC featuring a nonsense mutation (vu242 in the tsc2 gene. This tsc2vu242 allele encodes a truncated Tuberin protein lacking the GAP domain, which is required for inhibition of Rheb and of the TOR kinase within TORC1. We show that tsc2vu242 is a recessive larval-lethal mutation that causes increased cell size in the brain and liver. Greatly elevated TORC1 signaling is observed in tsc2vu242/vu242 homozygous zebrafish, and is moderately increased in tsc2vu242/+ heterozygotes. Forebrain neurons are poorly organized in tsc2vu242/vu242 homozygous mutants, which have extensive gray and white matter disorganization and ectopically positioned cells. Genetic mosaic analyses demonstrate that tsc2 limits TORC1 signaling in a cell-autonomous manner. However, in chimeric animals, tsc2vu242/vu242 mutant cells also mislocalize wild-type host cells in the forebrain in a non-cell-autonomous manner. These results demonstrate a highly conserved role of tsc2 in zebrafish and establish a new animal model for studies of TSC. The finding of a non-cell-autonomous function of mutant cells might help explain the formation of brain hamartomas and cortical malformations in human TSC.

  14. Dicty_cDB: Contig-U12270-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available quences producing significant alignments: (bits) Value N ( C90879 ) Dictyostelium discoideum slug cDNA, clon...e SSJ262. 226 2e-82 5 ( AU038542 ) Dictyostelium discoideum slug cDNA, clone SSH848. 242 3e-79 3 ( C93805 ) ...Dictyostelium discoideum slug cDNA, clone SSL738. 242 3e-79 3 ( AU038033 ) Dictyostelium discoideum slug cDN...A, clone SSH182. 244 5e-77 3 ( C92024 ) Dictyostelium discoideum slug cDNA, clone... SSC175. 242 9e-77 3 ( C89806 ) Dictyostelium discoideum slug cDNA, clone SSG177. 226 1e-75 4 ( AU037712 ) D

  15. Toward Reanalysis of the Tight-Pitch HCLWR-PROTEUS Phase II Experiments

    Directory of Open Access Journals (Sweden)

    Perret Grégory

    2016-01-01

    Spectral index predictions using the three nuclear data libraries agreed within two standard deviations with the measured values. The only exception is the Pu-242-capture-to-Pu-239-fission ratio, which was overestimated with all libraries by more than four standard deviations, i.e. 13%, in the non-moderated configuration. In this configuration, Pu-242 captures are few since the flux spectrum in the Pu-242 capture resonance region (between 1eV and 1keV is small making this spectral index hard to measure. Sensitivity coefficient predictions with both MCNP6 and SERPENT2 were in good agreement.

  16. Pediatric Palliative Care: A Personal Story

    Medline Plus

    Full Text Available ... count__/__total__ Find out why Close Pediatric Palliative Care: A Personal Story NINRnews Subscribe Subscribed Unsubscribe 242 ... and her family. The story demonstrates how palliative care can positively influence a patient's and family's experience ...

  17. Band pass filters. Citations from the NTIS data base

    Science.gov (United States)

    Reed, W. E.

    1980-04-01

    A bibliography containing 242 abstracts addressing the design, fabrication, characterization, and application of band pass filters is presented. Radiofrequency, digital, acoustic surface wave, and X-ray filters are included.

  18. Posthuman Metamorphosis: Narrative and Systems, New

    Directory of Open Access Journals (Sweden)

    Elke D'hoker

    2009-10-01

    Full Text Available Review of Bruce Clarke, Posthuman Metamorphosis: Narrative and Systems, New
    York: Fordham University Press, 2008. 242 pages.
    978-0-8232-2580-8 (hardback
    978-0-8232-2581-5 (paperback

  19. Forms of Becoming: The Evolutionary Biology of Development

    OpenAIRE

    Raymond Pierotti

    2012-01-01

    Review of Forms of Becoming: The Evolutionary Biology of Development. Alessandro Minelli. 2009. Princeton University Press, Princeton and London. Pp. 242, 17 line drawings. US$29.95 (cloth). ISBN 9780691135687.

  20. GETDB: 112973 [GETDB

    Lifescience Database Archive (English)

    Full Text Available rsal, ventral) tr, fb tarsal ring, al, eye, tarsas - - comment1:A, comment2:42F2-...l tarsal ring, al, Adult GFP eye, tarsas Lethality - Also known as - Original Comments comment1:A, comment2:

  1. Socialization Values and Parenting Practices as Predictors of Parental Involvement in Their Children's Educational Process

    NARCIS (Netherlands)

    Kikas, Eve; Tulviste, Tiia; Peets, Kätlin

    2014-01-01

    Research Findings: The purpose of this study was to examine associations between parental socialization values (including inconsistency in values), parenting practices, and parental involvement in their children's education. Altogether 242 Estonian mothers and fathers of first-grade children partici

  2. 26 CFR 1.401(a)(9)-8 - Special rules.

    Science.gov (United States)

    2010-04-01

    ... before January 1, 1984, in accordance with section 242(b)(2) of the Tax Equity and Fiscal Responsibility... by the transferee plan. (c) A merger, spinoff, or consolidation, as defined in § 1.414(l)-1(b),...

  3. Self-reported early trauma as a predictor of adult personality : A study in a military sample

    NARCIS (Netherlands)

    Rademaker, Arthur R.; Vermetten, Eric; Geuze, Elbert; Muilwilk, Anne; Kleber, Rolf J.

    2008-01-01

    Exposure to early trauma has frequently been linked to adult psychopathology, including personality disorders. This cross-sectional study explored the relationship between personality and retrospectively rated levels of early trauma in 242 soldiers. Multiple regression analyses showed a significant

  4. Gravity Data for the State of New Mexico

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The gravity station data (21,242 records) were compiled by the University of Texas at El Paso. This data base was received in October 1984. Principal gravity...

  5. Tumor markers for diagnosis, monitoring of recurrence and prognosis in patients with upper gastrointestinal tract cancer.

    Science.gov (United States)

    Jing, Jie-Xian; Wang, Yan; Xu, Xiao-Qin; Sun, Ting; Tian, Bao-Guo; Du, Li-Li; Zhao, Xian-Wen; Han, Cun-Zhi

    2014-01-01

    To evaluate the value of combined detection of serum CEA, CA19-9, CA24-2, AFP, CA72-4, SCC, TPA and TPS for the clinical diagnosis of upper gastrointestinal tract (GIT) cancer and to analyze the efficacy of these tumor markers (TMs) in evaluating curative effects and prognosis. A total of 573 patients with upper GIT cancer between January 2004 and December 2007 were enrolled in this study. Serum levels of CEA, CA19-9, CA24-2, AFP, CA72-4, SCC, TPA and TPS were examined preoperatively and every 3 months postoperatively by ELISA. The sensitivity of CEA, CA19-9, CA24-2, AFP, CA72-4, SCC, TPA and TPS were 26.8%, 36.2%, 42.9%, 2.84%, 25.4%, 34.6%, 34.2% and 30.9%, respectively. The combined detection of CEA+CA199+CA242+CA724 had higher sensitivity and specificity in gastric cancer (GC) and cardiac cancer, while CEA+CA199+CA242+SCC was the best combination of diagnosis for esophageal cancer (EC). Elevation of preoperative CEA, CA19-9 and CA24-2, SCC and CA72-4 was significantly associated with pathological types (pCEA, CA19-9, CA24-2, CA72-4 and SCC decreased obviously 3 months after operations. When metastasis and recurrence occurred, the levels of TMs significantly increased. On multivariate analysis, high preoperative CA72-4, CA24-2 and SCC served as prognostic factors for cardiac carcinoma, GC and EC, respectively. combined detection of CEA+CA199+CA242+SCC proved to be the most economic and practical strategy in diagnosis of EC; CEA+CA199+CA242+CA724 proved to be a better evaluation indicator for cardiac cancer and GC. CEA and CA19-9, CA24-2, CA72-4 and SCC, examined postoperatively during follow-up, were useful to find early tumor recurrence and metastasis, and evaluate prognosis. AFP, TPA and TPS have no significant value in diagnosis of patients with upper GIT cancer.

  6. Drug: D02350 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D02350 Drug Fenoprofen (USAN/INN) C15H14O3 242.0943 242.2699 D02350.gif Anti-inflammatory...lammatory Drugs Fenoprofen D02350 Fenoprofen (USAN/INN) Anti-inflammatory Agents Nonsteroidal Anti-inflammat...cid derivatives M01AE04 Fenoprofen D02350 Fenoprofen (USAN/INN) USP drug classification [BR:br08302] Analgesics Nonsteroidal Anti-inf...ory Drugs Fenoprofen D02350 Fenoprofen (USAN/INN) Target

  7. Method for fabricating an artificial compound eye

    OpenAIRE

    Duparré, Jacques; Brückner, Andreas; Wippermann, Frank; Zufferey, Jean-Christophe; Floreano, Dario; Franceschini, Nicolas; Viollet, Stéphane; Ruffier, Franck

    2011-01-01

    A method for fabricating an imaging system, the method comprising providing a flexible substrate (200), a first layer (220) comprising a plurality of microlenses (232) and a second layer (240) comprising a plurality of image sensors (242). The method further comprises stacking the first and the second layer (220; 240) onto the flexible substrate (200) by attaching the plurality of image sensors (242) to the flexible substrate, such that each of the plurality of microlenses (232) and image sen...

  8. China's Textile to Encounter Anti-dumping Peak in 2009

    Institute of Scientific and Technical Information of China (English)

    Zhang Qingyong; Wu Shengkui; Wen Duoduo

    2005-01-01

    @@ According to the Paragraph 242of China's WTO Accession Report, by December 31,2008,the importers are still allowed to set limitations on the quantities of the products on which China has abandoned the quotas, basing on the condition that they recognize that the Chinese products imported have disordered their domestic markets. Up till now, the USA, the EU,South Korea, Japan, Canada, India, etc.,have launched legislation process in line with the Paragraph 242.

  9. EST Table: FS916464 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available FS916464 E_FL_fufe_38G11_F_0 10/09/28 54 %/242 aa ref|XP_972061.1| PREDICTED: similar to thymus... 10/09/10 58 %/212 aa gnl|Amel|GB19831-PA 10/09/10 54 %/242 aa gi|91078858|ref|XP_972061.1| PREDICTED: similar to thymus-specific serine protease [Tribolium castaneum] FS916293 fufe ...

  10. Robotics and remote systems applications

    International Nuclear Information System (INIS)

    This article is a review of numerous remote inspection techniques in use at the Savannah River (and other) facilities. These include: (1) reactor tank inspection robot, (2) californium waste removal robot, (3) fuel rod lubrication robot, (4) cesium source manipulation robot, (5) tank 13 survey and decontamination robots, (6) hot gang valve corridor decontamination and junction box removal robots, (7) lead removal from deionizer vessels robot, (8) HB line cleanup robot, (9) remote operation of a front end loader at WIPP, (10) remote overhead video extendible robot, (11) semi-intelligent mobile observing navigator, (12) remote camera systems in the SRS canyons, (13) cameras and borescope for the DWPF, (14) Hanford waste tank camera system, (15) in-tank precipitation camera system, (16) F-area retention basin pipe crawler, (17) waste tank wall crawler and annulus camera, (18) duct inspection, and (19) deionizer resin sampling

  11. Preparation of actinide targets by electrodeposition

    Science.gov (United States)

    Trautmann, N.; Folger, H.

    1989-10-01

    Actinide targets with varying thicknesses on different substrates have been prepared by electrodeposition either from aqueous solutions or from solutions of their nitrates in isopropyl alcohol. With these techniques the actinides can be deposited almost quantitatively on various backing materials within 15 to 30 min. Targets of thorium, uranium, neptunium, plutonium, americium, curium and californium with areal densities from almost carrier-free up to 1.4 mg/cm 2 on thin beryllium, carbon, titanium, tantalum and platinum foils have been prepared. In most cases, prior to the deposition, the actinides had to be purified chemically and for some of them, due to the limited amount of material available, recycling procedures were required. Applications of actinide targets in heavy-ion reactions are briefly discussed.

  12. An atomic beam source for actinide elements: concept and realization

    International Nuclear Information System (INIS)

    For ultratrace analysis of actinide elements and studies of their atomic properties with resonance ionization mass spectroscopy (RIMS), efficient and stable sources of actinide atomic beams are required. The thermodynamics and kinetics of the evaporation of actinide elements and oxides from a variety of metals were considered, including diffusion, desorption, and associative desorption. On this basis various sandwich-type filaments were studied. The most promising system was found to consist of tantalum as the backing material, an electrolytically deposited actinide hydroxide as the source of the element, and a titanium covering layer for its reduction to the metal. Such sandwich sources were experimentally proven to be well suited for the production of atomic beams of plutonium, curium, berkelium and californium at relatively low operating temperatures and with high and reproducible yields. (orig.)

  13. Environmental assessment of the thermal neutron activation explosive detection system for concourse use at US airports

    International Nuclear Information System (INIS)

    This document is an environmental assessment of a system designed to detect the presence of explosives in checked airline baggage or cargo. The system is meant to be installed at the concourse or lobby ticketing areas of US commercial airports and uses a sealed radioactive source of californium-252 to irradiate baggage items. The major impact of the use of this system arises from direct exposure of the public to scattered or leakage radiation from the source and to induced radioactivity in baggage items. Under normal operation and the most likely accident scenarios, the environmental impacts that would be created by the proposed licensing action would not be significant. 44 refs., 19 figs., 18 tabs

  14. Experimental survey of the potential energy surfaces associated with fission

    International Nuclear Information System (INIS)

    Progress in the experimental determination of the properties of the potential energy surface associated with fission is reviewed. The importance of nuclear symmetry effects on the calculation of fission widths is demonstrated. Evidence is presented for the fragmentation of the mass-asymmetric second barrier in the thorium region and the axial asymmetric first barrier in the californium region. Detailed analyses of experimental data suggest the presence of two parallel second barriers; the normal mass-asymmetric, axial-symmetric barrier and a slightly higher mass-symmetric, axial-asymmetric barrier. Experimental barrier parameters are determined systematically and compared with calculations from various theoretical models. Techniques for expanding fission probability measurements to higher energies are discussed. (author)

  15. Populations of selected microbial and fungal species growing on the surface of rape seeds following treatment with desiccants or plant growth regulators.

    Science.gov (United States)

    Frac, Magdalena; Jezierska-Tys, Stefania; Tys, Jerzy

    2010-01-01

    The aim of this study was to determine the effects of desiccants and plant growth regulators on selected microbial species affecting rape seeds, with special emphasis on the growth of fungi and identification of the genus and species composition. The experimental material in the study was seeds of winter rape cv. Californium that were collected from the field during combine harvest. The chemical agents applied, both desiccants and growth regulators, generally decreased the populations of bacteria occurring on the surface of rape seeds. The responses of fungi depended upon the type of agent applied and were manifested as either stimulation or inhibition of the growth of the fungal species. The fungi isolated from the surface of rape seeds were characteristic of those found in the field environment (Cladosporium and Penicillium) and typical for those present on the surface of rape seeds (Alternaria).

  16. Effects of 252Cf neutrons, transmitted through an iron block on human lymphocyte chromosome

    International Nuclear Information System (INIS)

    Chromosome aberration of human peripheral blood lymphocytes exposed to californium-252 (252Cf) neutrons transmitted through a 15 cm thick iron block was analysed. The spectrum of the filtered neutrons ranged from 0.1 to 2MeV with a peak at 0.7 MeV, simulating the Hiroshima atomic bomb neutron spectrum as shown in the Dosimetry System 1986 (DS86). Chromosome aberration frequencies after exposure to filtered and unfiltered 252Cf radiation were compared. Acentric ring chromosomes were significantly increased (p 0.1). The relative biological effectiveness (RBE) of the neutrons with respect to the formation of dicentrics and centric rings was 10.9 and 12.3 in the filtered and unfiltered conditions respectively, but the difference was not statistically significant. These results provide useful information for the re-evaluation of the biological effect of the Hiroshima atomic bomb radiations. (Author)

  17. Reliability of semiconductor and gas-filled diodes for over-voltage protection exposed to ionizing radiation

    Directory of Open Access Journals (Sweden)

    Stanković Koviljka

    2009-01-01

    Full Text Available The wide-spread use of semiconductor and gas-filled diodes for non-linear over-voltage protection results in a variety of possible working conditions. It is therefore essential to have a thorough insight into their reliability in exploitation environments which imply exposure to ionizing radiation. The aim of this paper is to investigate the influence of irradiation on over-voltage diode characteristics by exposing the diodes to californium-252 combined neutron/gamma radiation field. The irradiation of semiconductor over-voltage diodes causes severe degradation of their protection characteristics. On the other hand, gas-filled over-voltage diodes exhibit a temporal improvement of performance. The results are presented with the accompanying theoretical interpretations of the observed changes in over-voltage diode behaviour, based on the interaction of radiation with materials constituting the diodes.

  18. Potential nuclear safeguards applications for neutron generators

    International Nuclear Information System (INIS)

    Many nuclear safeguards inspection instruments use neutron sources to interrogate the fissile material (commonly 235U and 239Pu) to be measured. The neutron sources currently used in these instruments are isotopics such as Californium-252, Americium-Lithium, etc. It is becoming increasingly more difficult to transport isotopic sources from one measurement location to another. This represents a significant problem for the International Atomic Energy Agency (IAEA) safeguards inspectors because they must take their safeguards instruments with them to each nuclear installation to make an independent measurement. Purpose of this paper is to review the possibility of replacing isotopic neutron sources now used in IAEA safeguards instruments with electric neutron sources such as deuterium-tritium (D-T, 14-MeV neutrons) or deuterium-deuterium (D-D, 2-MeV neutrons). The potential for neutron generators to interrogate spent-light water reactor fuel assemblies in storage pools is also reviewed

  19. Off-line commissioning of EBIS and plans for its integration into ATLAS and CARIBU.

    Science.gov (United States)

    Ostroumov, P N; Barcikowski, A; Dickerson, C A; Mustapha, B; Perry, A; Sharamentov, S I; Vondrasek, R C; Zinkann, G

    2016-02-01

    An Electron Beam Ion Source Charge Breeder (EBIS-CB) has been developed at Argonne to breed radioactive beams from the CAlifornium Rare Isotope Breeder Upgrade (CARIBU) facility at Argonne Tandem Linac Accelerator System (ATLAS). The EBIS-CB will replace the existing ECR charge breeder to increase the intensity and significantly improve the purity of reaccelerated radioactive ion beams. The CARIBU EBIS-CB has been successfully commissioned offline with an external singly charged cesium ion source. The performance of the EBIS fully meets the specifications to breed rare isotope beams delivered from CARIBU. The EBIS is being relocated and integrated into ATLAS and CARIBU. A long electrostatic beam transport system including two 180° bends in the vertical plane has been designed. The commissioning of the EBIS and the beam transport system in their permanent location will start at the end of this year. PMID:26932059

  20. Measurements of the neutron capture cross sections and incineration potentials of minor-actinides in high thermal neutron fluxes: Impact on the transmutation of nuclear wastes

    International Nuclear Information System (INIS)

    This thesis comes within the framework of minor-actinide nuclear transmutation studies. First of all, we have evaluated the impact of minor actinide nuclear data uncertainties within the cases of 241Am and 237Np incineration in three different reactor spectra: EFR (fast), GT-MHR (epithermal) and HI-HWR (thermal). The nuclear parameters which give the highest uncertainties were thus highlighted. As a result of fact, we have tried to reduce data uncertainties, in the thermal energy region, for one part of them through experimental campaigns in the moderated high intensity neutron fluxes of ILL reactor (Grenoble). These measurements were focused onto the incineration and transmutation of the americium-241, the curium-244 and the californium-249 isotopes. Finally, the values of 12 different cross sections and the 241Am isomeric branching ratio were precisely measured at thermal energy point. (author)

  1. Environmental assessment of the thermal neutron activation explosive detection system for concourse use at US airports

    Energy Technology Data Exchange (ETDEWEB)

    Jones, C.G.

    1990-08-01

    This document is an environmental assessment of a system designed to detect the presence of explosives in checked airline baggage or cargo. The system is meant to be installed at the concourse or lobby ticketing areas of US commercial airports and uses a sealed radioactive source of californium-252 to irradiate baggage items. The major impact of the use of this system arises from direct exposure of the public to scattered or leakage radiation from the source and to induced radioactivity in baggage items. Under normal operation and the most likely accident scenarios, the environmental impacts that would be created by the proposed licensing action would not be significant. 44 refs., 19 figs., 18 tabs.

  2. Triton and alpha-particle contribution from LiF converter for neutron dosimeter

    CERN Document Server

    Camacho, M E; Balcazar, M

    1999-01-01

    A personnel neutron dosimeter prototype based on chemical and electrochemical etched CR-39 detector, combined with LiF converter, has been calibrated using an ICRP-like phantom, under a heavy-water moderated Californium source neutron spectra; A conversion factor of 1.052+-126 spots cm sup - sup 2 mSv sup - sup 1 was obtained. The sealing properties of the detector holder showed a ten-fold reduction in radon background when it was tested in a high radon atmosphere. A convenient mechanical shock resistance was achieved in LiF converters by sintering to 11 tons pressure LiF powder at 650 deg. C, during one hour.

  3. Nuclear fission and the transuranium elements

    Energy Technology Data Exchange (ETDEWEB)

    Seaborg, G.T.

    1989-02-01

    Many of the transuranium elements are produced and isolated in large quantities through the use of neutrons furnished by nuclear fission reactions: plutonium (atomic number 94) in ton quantities; neptunium (93), americium (95), and curium (96) in kilogram quantities; berkelium (97) in 100 milligram quantities; californium (98) in gram quantities; and einsteinium (99) in milligram quantities. Transuranium isotopes have found many practical applications---as nuclear fuel for the large-scale generation of electricity, as compact, long-lived power sources for use in space exploration, as means for diagnosis and treatment in the medical area, and as tools in numerous industrial processes. Of particular interest is the unusual chemistry and impact of these heaviest elements on the periodic table. This account will feature these aspects. 9 refs., 5 figs.

  4. Measurements of the neutron capture cross sections and incineration potentials of minor-actinides in high thermal neutron fluxes: Impact on the transmutation of nuclear wastes; Mesures des sections efficaces de capture et potentiels d'incineration des actinides mineurs dans les hauts flux de neutrons: Impact sur la transmutation des dechets

    Energy Technology Data Exchange (ETDEWEB)

    Bringer, O

    2007-10-15

    This thesis comes within the framework of minor-actinide nuclear transmutation studies. First of all, we have evaluated the impact of minor actinide nuclear data uncertainties within the cases of {sup 241}Am and {sup 237}Np incineration in three different reactor spectra: EFR (fast), GT-MHR (epithermal) and HI-HWR (thermal). The nuclear parameters which give the highest uncertainties were thus highlighted. As a result of fact, we have tried to reduce data uncertainties, in the thermal energy region, for one part of them through experimental campaigns in the moderated high intensity neutron fluxes of ILL reactor (Grenoble). These measurements were focused onto the incineration and transmutation of the americium-241, the curium-244 and the californium-249 isotopes. Finally, the values of 12 different cross sections and the {sup 241}Am isomeric branching ratio were precisely measured at thermal energy point. (author)

  5. Study of reproducibility of measurements with the spectrometer of Bonner multispheres

    Energy Technology Data Exchange (ETDEWEB)

    Azevedo, G.A.; Pereira, W.W.; Patrao, K.C.S.; Fonseca, E.S., E-mail: geisadeazevedo@gmail.com, E-mail: walsan@ird.gov.br, E-mail: karla@ird.gov.br, E-mail: evaldo@ird.gov.br [Instituto de Radionprotecao e Dosimetria (IRD/CNEN-RJ), Rio de Janeiro, RJ (Brazil)

    2013-07-01

    This work aims to study the metrological behavior of the Bonner Multisphere Spectrometer (BMS) of the LN / LNMRI / IRD - Laboratorio Metrologia de Neutrons / Laboratorio Nacional de Metrologia e Radiacao Ionizante / Instituto de Radioprotecao e Dosimetria, for measurements in repeatability and reproducibility conditions. Initially, a simulation was done by applying the Monte Carlo method, using the MCNP code and respecting the ISO 8529-1 (2001), using the sources of Californium ({sup 252} Cf), Americium-Beryllium ({sup 241} AmBe) and californium in heavy water (Cf + D{sub 2}O), all located at a distance of 100 cm from the neutron detector ({sup 6}Li (Eu) - crystal scintillator). In this program, the counting of neutrons that are captured by the detector was made. The source is located in the center of a sphere of radius 300 cm. Analyzes the impact of these neutrons in a point of the sphere wall, which in this case acted as a neutron detector and from there, it is estimated the number of neutrons that collide in the whole sphere. The purpose is to obtain the neutron count for different energy bands in a solid field of neutrons, since they have a spectrum ranging from a low to a high energy that can also vary within a particular environment. Wishes to obtain new fields with different sources and moderators materials to be used as new reference fields. Measurements are being conducted for these fields, with the aim of analyzing the variability conditions of the measurement (repeatability and reproducibility) in LEN - Laboratorio de Espectrometria de Neutrons of the LN/LMNRI/IRD. Thus, the spectrometer will be used to improve both the knowledge of the spectrum as the standard of neutrons of the lab, proving that a spectrometry is essential for correct measurement.

  6. 241Am (n,gamma) isomer ratio measurement

    Energy Technology Data Exchange (ETDEWEB)

    Bond, Evelyn M [Los Alamos National Laboratory; Vieira, David J [Los Alamos National Laboratory; Moody, Walter A [Los Alamos National Laboratory; Slemmons, Alice K [Los Alamos National Laboratory

    2011-01-05

    The objective of this project is to improve the accuracy of the {sup 242}Cm/{sup 241}Am radiochemistry ratio. We have performed an activation experiment to measure the {sup 241}Am(n,{gamma}) cross section leading to either the ground state of {sup 242g}Am (t{sub 1/2} = 16 hr) which decays to {sup 242}Cm (t{sub 1/2} = 163 d) or the long-lived isomer {sup 242m}Am (t{sub 1/2} = 141 yr). This experiment will develop a new set of americium cross section evaluations that can be used with a measured {sup 242}Cm/{sup 241}Am radiochemical measurement for nuclear forensic purposes. This measurement is necessary to interpret the {sup 242}Cm/{sup 241}Am ratio because a good measurement of this neutron capture isomer ratio for {sup 241}Am does not exist. The targets were prepared in 2007 from {sup 241}Am purified from LANL stocks. Gold was added to the purified {sup 241}Am as an internal neutron fluence monitor. These targets were placed into a holder, packaged, and shipped to Forschungszentrum Karlsruhe, where they were irradiated at their Van de Graff facility in February 2008. One target was irradiated with {approx}25 keV quasimonoenergetic neutrons produced by the {sup 7}Li(p,n) reaction for 3 days and a second target was also irradiated for 3 days with {approx}500 keV neutrons. Because it will be necessary to separate the {sup 242}Cm from the {sup 241}Am in order to measure the amount of {sup 242}Cm by alpha spectrometry, research into methods for americium/curium separations were conducted concurrently. We found that anion exchange chromatography in methanol/nitric acid solutions produced good separations that could be completed in one day resulting in a sample with no residue. The samples were returned from Germany in July 2009 and were counted by gamma spectrometry. Chemical separations have commenced on the blank sample. Each sample will be spiked with {sup 244}Cm, dissolved and digested in nitric acid solutions. One third of each sample will be processed at a time

  7. Anti-inflammatory and anti-amyloidogenic effects of a small molecule, 2,4-bis(p-hydroxyphenyl-2-butenal in Tg2576 Alzheimer’s disease mice model

    Directory of Open Access Journals (Sweden)

    Jin Peng

    2013-01-01

    Full Text Available Abstract Background Alzheimer’s disease (AD is pathologically characterized by excessive accumulation of amyloid-beta (Aβ fibrils within the brain and activation of astrocytes and microglial cells. In this study, we examined anti-inflammatory and anti-amyloidogenic effects of 2,4-bis(p-hydroxyphenyl-2-butenal (HPB242, an anti-inflammatory compound produced by the tyrosine-fructose Maillard reaction. Methods 12-month-old Tg2576 mice were treated with HPB242 (5 mg/kg for 1 month and then cognitive function was assessed by the Morris water maze test and passive avoidance test. In addition, western blot analysis, Gel electromobility shift assay, immunostaining, immunofluorescence staining, ELISA and enzyme activity assays were used to examine the degree of Aβ deposition in the brains of Tg2576 mice. The Morris water maze task was analyzed using two-way ANOVA with repeated measures. Otherwise were analyzed by one-way ANOVA followed by Dunnett’s post hoc test. Results Treatment of HPB242 (5 mg/kg for 1 month significantly attenuated cognitive impairments in Tg2576 transgenic mice. HPB242 also prevented amyloidogenesis in Tg2576 transgenic mice brains. This can be evidenced by Aβ accumulation, BACE1, APP and C99 expression and β-secretase activity. In addition, HPB242 suppresses the expression of inducible nitric oxide synthase (iNOS and cyclooxygenase-2 (COX-2 as well as activation of astrocytes and microglial cells. Furthermore, activation of nuclear factor-kappaB (NF-κB and signal transducer and activator of transcription 1/3 (STAT1/3 in the brain was potently inhibited by HPB242. Conclusions Thus, these results suggest that HPB242 might be useful to intervene in development or progression of neurodegeneration in AD through its anti-inflammatory and anti-amyloidogenic effects.

  8. CLINICAL USE OF COMBINED DETECTION WITH TUMOR MARKERS FOR PANCREATIC CANCER

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Objective To explore the value of clinical use of combined detection with tumor markers for pancreatic cancer. Methods Tumor markers CA242,CA19-9 and CA50 in serum of 32 patinets with pancreatic cancer;26 patients with non-pancreatic digestive tract cancers and 24 patietns with benign pancreatic or biliary tract diseases were measured by immunoradiometric assay (IRMA). Results The levels of three markers in serum and positive rates of patients with pancreatic cancer were higher than those of other patients. The effect of measurement combining CA242 with CA19-9 was the best. The sensitivity ,specificity and accuracy of diagnosis for pancreatic cancer were 92.6%, 73.8% and 81.2% respectively. The levels of CA242 and CA19-9 were positively relative to burden of pancreatic cancer, and serum levels of these two markers of patients with resectable pancreatic cancer were lower than those with unresectable, but on difference was observed for CA50. Conclusion Combined detection of serum CA242 and CA19-9 could prove the effectual indicator for finding the patients with pancreatic cancer in high risk population or for resectable pancreatic cancer. Pre-operative measurement of serum levels of CA242 and CA19-9 is helpful to evaluate the burden of the tumors and possiblity of resect for pancreatic cancers.

  9. Measurement of mass yields from the 241Am(2nth,f reaction at the Lohengrin Spectrometer

    Directory of Open Access Journals (Sweden)

    Köster U.

    2013-03-01

    Full Text Available The study of fission yields has a major impact on the characterization and understanding of the fission process and is mandatory for reactor applications. While the yields are known for the major actinides (235U, 239Pu in the thermal neutron-induced fission, only few measurements have been performed on 242Am. The interest of 242Am concerns the reduction of radiotoxicity of 241Am in nuclear wastes using transmutation reactions. This paper presents the measurement of the fission mass yields from the reaction 241Am(2nth,f performed at the Lohengrin mass spectrometer (ILL, France for both the light and the heavy peaks: a total of 41 mass yields have been measured. The experiment was also meant to determine whether there is a difference in mass yields between the isomeric state and the ground state as it exists in fission and capture cross sections. The method used to address this question is based on a repeated measurement of a set of fission mass yields as a function of the ratio between the 242gAm and the 242mAm fission rates. The presented experiment is also a first step towards the measurement of the isotopic fission yields of 242Am.

  10. A dual mTORC1 and mTORC2 inhibitor shows antitumor activity in esophageal squamous cell carcinoma cells and sensitizes them to cisplatin.

    Science.gov (United States)

    Huang, Yu; Xi, Qingsong; Chen, Yu; Wang, Jing; Peng, Ping; Xia, Shu; Yu, Shiying

    2013-10-01

    The mammalian target of rapamycin (mTOR) signaling pathway is critical for the growth and proliferation of various malignant tumors, including esophageal squamous cell carcinoma (ESCC). Therefore, targeting of mTOR protein is a promising strategy for therapy in this disease. In the present study, we examined the antitumor effects of a specific mTOR kinase inhibitor, PP242, which blocks both mTOR complex 1 (mTORC1) and mTOR complex 2 (mTORC2) pathways, in two ESCC cell lines: Eca-109 and TE-1. We showed that PP242, but not rapamycin, attenuated the activities of both mTORC1 and mTORC2 signaling in ESCC. PP242 inhibited 4E-binding protein-1 phosphorylation and abrogated mTORC1-dependent PI3K/Akt feedback activation. Significantly, PP242 effectively suppressed ESCC cell proliferation, induced apoptosis, and arrested the cell cycle. Furthermore, PP242 promoted cisplatin-induced apoptosis and enhanced the antitumor efficacy of cisplatin in ESCC cells, which was likely to be associated with inhibition of Akt activity. Our results show that simultaneous targeting of both mTORC1 and mTORC2 pathways leads to effective antitumor actions in ESCC, and strongly suggest that dual mTORC1/2 inhibitors should be developed as potential agents for the treatment of ESCC.

  11. A study on the short-term metabolism of curium and its removal with DTPA in the rat

    International Nuclear Information System (INIS)

    The contents of 242Cm in the plasma, liver, skeleton and kidneys were determined from 22.5 minutes to 16 days after the intravenous injection of 242Cm citrate to the rat. The 242Cm injected disappeared from the plasma rapidly and deposited mainly in the liver and skeleton. By analyzing the relationship between the disappearance from the plasma and the accumulation in the organs of injected curium, the initial distribution space, or the actual site of transfer compartment used for dose calculation in the ICRP Publ.30, of curium was identified as the extracellular fluid (ECF). The calculation showed that the difference between the radiation dose to bone surface or red bone marrow from short-lived curium isotopes evaluated under the current ICRP assumption, on one hand, and the same radiation dose, evaluated under the assumption that the actual site of transfer compartment is ECF, on the other, is not negligible. The effect of administration of CaDTPA or ZnDTPA on the retention of 242Cm in organs was studied by changing the time interval between the 242Cm injection and DTPA administration and the amount of DTPA administered. The results obtained showed that 1) DTPA treatment of a person who has incorporated curium into the body should be started as early as possible, 2) the first single prompt DTPA should be administered as Ca salt, and the following multiple delayed DTPA, as the less toxic Zn salt, and 3) the dose of first CaDTPA should be as large as possible within the range not producing its side effect. The study on the mixture of 242Cm and 238Pu showed that these two radioelements are metabolized and removed with DTPA independently. (author)

  12. EST Table: FS904516 [KAIKOcDNA[Archive

    Lifescience Database Archive (English)

    Full Text Available 1461 10/09/10 48 %/243 aa gnl|Amel|GB18846-PA 10/09/10 46 %/242 aa gi|91086187|ref|XP_971225.1| PREDICTED: similar to medulloblastoma...oblastoma antigen MU-MB-50.4 [Tribolium castaneum] gb|EFA06682.1| hypothetical prot...FS904516 E_FL_fufe_02D20_F_0 11/12/09 n.h 10/09/28 46 %/242 aa ref|XP_971225.1| PREDICTED: similar to medull

  13. Reaction 48Ca+208Pb: the capture-fission cross-sections and the mass-energy distributions of fragments above and deep below the Coulomb barrier

    OpenAIRE

    Prokhorova, E. V.; Cherepanov, E. A.; Itkis, M.G.; Kondratiev, N. A.; Kozulin, E. M.; Krupa, L.; Oganessian, Yu.Ts.; Pashkevich, V. V.; Pokrovsky, I. V.; Rusanov, A. Ya.

    2003-01-01

    The capture-fission cross-sections in an energy range of 206-242 MeV of 48Ca-projectiles and mass-energy distributions (MEDs) of reaction products in an energy range of 211-242 MeV have been measured in the 48Ca+208Pb reaction using the double-arm time-of-flight spectrometer CORSET. The MEDs of fragments for heated fission were shown to consist of two components. One component, which is due to classical fusion-fission, is associated with the symmetric fission of the 256No compound nucleus. Th...

  14. Role of blood tumor markers in predicting metastasis and local recurrence after curative resection of colon cancer

    OpenAIRE

    Peng, Yifan; Zhai, Zhiwei; Li, Zhongmin; Wang, Lin; Gu, Jin

    2015-01-01

    Aim: To investigate the prognostic value of carcinoembryonic antigen (CEA), CA199, CA724 and CA242 in peripheral blood and local draining venous blood in colon cancer patients after curative resection. Methods: 92 colon cancer patients who received curative resection were retrospectively analyzed. The CEA, CA199, CA724 and CA242 were detected in peripheral blood and local draining venous blood. Results: Metastasis or local recurrence was found in 29 (29/92, 31.5%) patients during follow-up pe...

  15. Prompt neutron multiplicities for the transplutonium nuclides

    International Nuclear Information System (INIS)

    The direct determination of the average prompt neutron emission values is reviewed, and a method of comparing different sites of neutron emission multiplicity distribution values is described. Measured and recommended values are tabulated for these nuclides: 241Am, 242Am, 242Cm, 243Cm, 244Cm, 246Cm, 247Cm, 248Cm, 250Cm, 245Cm, 249Bk, 246Cf, 249Cf, 250Cf, 252Cf, 254Cf, 251Cf, 253Es, 254Es, 244Fm, 246Fm, 255Fm, 252No, 254Fm, 256Fm, 257Fm. 59 refs., 24 tabs

  16. AcEST: BP919804 [AcEST

    Lifescience Database Archive (English)

    Full Text Available YMU001_000129_D02 242 Adiantum capillus-veneris mRNA. clone: YMU001_000129_D02. BP91980...4 CL1786Contig1 Show BP919804 Clone id YMU001_000129_D02 Library YMU01 Length 242 Definition Adiantum ca...pillus-veneris mRNA. clone: YMU001_000129_D02. Accession BP919804 Tissue type prothallium Developmental stag...otein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919804|Adiantum capillus-veneris m...otein database search programs, Nucleic Acids Res. 25:3389-3402. Query= BP919804|Adiantum capillus-veneris m

  17. Structural Characterization of Heme Environmental Mutants of CgHmuT that Shuttles Heme Molecules to Heme Transporters

    OpenAIRE

    Norifumi Muraki; Chihiro Kitatsuji; Mariko Ogura; Takeshi Uchida; Koichiro Ishimori; Shigetoshi Aono

    2016-01-01

    Corynebacteria contain a heme uptake system encoded in hmuTUV genes, in which HmuT protein acts as a heme binding protein to transport heme to the cognate transporter HmuUV. The crystal structure of HmuT from Corynebacterium glutamicum (CgHmuT) reveals that heme is accommodated in the central cleft with His141 and Tyr240 as the axial ligands and that Tyr240 forms a hydrogen bond with Arg242. In this work, the crystal structures of H141A, Y240A, and R242A mutants were determined to understand ...

  18. Study on burn-up credit and minor actinide in post-irradiation analysis

    International Nuclear Information System (INIS)

    Accuracy of burnup calculation for actinide is very important as to the study of burn-up credit. For minor-actinides such as Am243 and Cm244, however, typical burnup calculation codes are not accurate enough. The accuracy for both nuclides was studied by using the SWAT code. The study showed that the C/E values of both nuclides could be improved at the same time by changing the cross section of Pu242. A study of burnup calculation related to the cross section of Pu242 should be performed to improve the accuracy for both nuclides. (author)

  19. China's Textile to Encounter Anti-dumping Peak in 2009

    Institute of Scientific and Technical Information of China (English)

    Zhang; Qingyong; Wu; Shengkui; Wen; Duoduo

    2005-01-01

      According to the Paragraph 242of China's WTO Accession Report, by December 31,2008,the importers are still allowed to set limitations on the quantities of the products on which China has abandoned the quotas, basing on the condition that they recognize that the Chinese products imported have disordered their domestic markets. Up till now, the USA, the EU,South Korea, Japan, Canada, India, etc.,have launched legislation process in line with the Paragraph 242.……

  20. Nail-patella syndrome—a novel mutation in the LMX1B gene

    OpenAIRE

    Nair, Rajesh R.; Unni, Vavullipathy N.; Indu, Kadevalappil N.; Nampoothiri, Sheela; Mathew, Anil; Kurian, George; Vimala, Avadaiammal

    2013-01-01

    Nail-patella syndrome (NPS) is an autosomal-dominant pleiotropic disorder characterized by dyplasia of finger nails, skeletal anomalies and frequently renal disease. In the reported case, genetic analysis revealed a new missense mutation in the homeodomain of LMX1B, presumed to abolish DNA binding (c.725T>C, p.Val242Ala). A missense mutation at codon 725 was identified, where thymine was replaced by cytosine which led to the replacement of valine by alanine at position 242. It was not detecte...