
Sample records for californium 240

  1. Californium-252 progress, report No. 7, April 1971

    Energy Technology Data Exchange (ETDEWEB)


    This report contains discusses of the following topics on Californium-252: First sales of californium-252; encapsulation services discussed; three new participants in market evaluation program; summer training programs to use californium; Californium-252 shipping casks available; Californium-252 questions and answers, radiotherapy; neutron radiography; natural resources exploration; nuclear safeguards; process control; dosimetry; neutron radiography; neutron shielding; and nuclear safeguards.

  2. Historical review of californium-252 discovery and development (United States)

    Stoddard, D. H.

    This paper discusses the discovery and history of californium 252. This isotope may be synthesized by irradiating plutonium 239, plutonium 242, americium 243, or curium 244 with neutrons in a nuclear reactor. Various experiments and inventions involving (252)Cf conducted at the Savannah River Plant are discussed. The evolution of radiotherapy using californium 252 is reviewed.

  3. Californium-252: a remarkable versatile radioisotope

    Energy Technology Data Exchange (ETDEWEB)

    Osborne-Lee, I.W.; Alexander, C.W.


    A product of the nuclear age, Californium-252 ({sup 252}Cf) has found many applications in medicine, scientific research, industry, and nuclear science education. Californium-252 is unique as a neutron source in that it provides a highly concentrated flux and extremely reliable neutron spectrum from a very small assembly. During the past 40 years, {sup 252}Cf has been applied with great success to cancer therapy, neutron radiography of objects ranging from flowers to entire aircraft, startup sources for nuclear reactors, fission activation for quality analysis of all commercial nuclear fuel, and many other beneficial uses, some of which are now ready for further growth. Californium-252 is produced in the High Flux Isotope Reactor (HFIR) and processed in the Radiochemical Engineering Development Center (REDC), both of which are located at the Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee. The REDC/HFIR facility is virtually the sole supplier of {sup 252}Cf in the western world and is the major supplier worldwide. Extensive exploitation of this product was made possible through the {sup 252}Cf Market Evaluation Program, sponsored by the United States Department of Energy (DOE) [then the Atomic Energy Commission (AEC) and later the Energy Research and Development Administration (ERDA)]. This program included training series, demonstration centers, seminars, and a liberal loan policy for fabricated sources. The Market Evaluation Program was instituted, in part, to determine if large-quantity production capability was required at the Savannah River Laboratory (SRL). Because of the nature of the product and the means by which it is produced, {sup 252}Cf can be produced only in government-owned facilities. It is evident at this time that the Oak Ridge research facility can meet present and projected near-term requirements. The production, shipment, and sales history of {sup 252}Cf from ORNL is summarized herein.

  4. Production, Distribution, and Applications of Californium-252 Neutron Sources

    Energy Technology Data Exchange (ETDEWEB)

    Balo, P.A.; Knauer, J.B.; Martin, R.C.


    The radioisotope {sup 252}Cf is routinely encapsulated into compact, portable, intense neutron sources with a 2.6-year half-life. A source the size of a person's little finger can emit up to 10{sup 11} neutrons/s. Californium-252 is used commercially as a reliable, cost-effective neutron source for prompt gamma neutron activation analysis (PGNAA) of coal, cement, and minerals, as well as for detection and identification of explosives, laud mines, and unexploded military ordnance. Other uses are neutron radiography, nuclear waste assays, reactor start-up sources, calibration standards, and cancer therapy. The inherent safety of source encapsulations is demonstrated by 30 years of experience and by U.S. Bureau of Mines tests of source survivability during explosions. The production and distribution center for the U. S Department of Energy (DOE) Californium Program is the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL). DOE sells The radioisotope {sup 252}Cf is routinely encapsulated into compact, portable, intense neutron sources with a 2.6- year half-life. A source the size of a person's little finger can emit up to 10 neutrons/s. Californium-252 is used commercially as a reliable, cost-effective neutron source for prompt gamma neutron activation analysis (PGNAA) of coal, cement, and minerals, as well as for detection and identification of explosives, laud mines, and unexploded military ordnance. Other uses are neutron radiography, nuclear waste assays, reactor start-up sources, calibration standards, and cancer therapy. The inherent safety of source encapsulations is demonstrated by 30 years of experience and by U.S. Bureau of Mines tests of source survivability during explosions. The production and distribution center for the U. S Department of Energy (DOE) Californium Program is the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory(ORNL). DOE sells {sup 252}Cf to commercial

  5. Application of TSH bioindicator for studying the biological efficiency of neutrons from californium-252 source

    Energy Technology Data Exchange (ETDEWEB)

    Cebulska-Wasilewska, A.; Rekas, K. [Institute of Nuclear Physics, Cracow (Poland); Kim, J.K. [Korea Atomic Energy Research Inst., Taejon (Korea, Republic of)


    The effectiveness of neutrons from a Californium-252 source in the induction of various abnormalities in the Tradescantia clone 4430 stamen hair cells (TSH-assay) was studied. The special attention was paid to check whether any enhancement in effects caused by process of boron neutron capture is visible in the cells enriched with boron ions. Two chemicals (borax and BSH) were applied to introduce boron-10 ions into cells. Inflorescence, normal or pretreated with chemicals containing boron, were irradiated in the air with neutrons from a Cf-252 source at KAERI, Taejon, Korea. To estimate the relative biological effectiveness (RBE) in the induction of gene mutations of the neutron beam under the study, Tradescantia inflorescences, without any chemical pretreatment, were irradiated with various doses of X-rays. The ranges of radiation doses used were 0-0.1 Gy in neutrons and 0-0.5 Gy in X-rays. After the time needed to complete the postirradiation repair Tradescantia cuttings were transferred to Cracow, where screening of gene and lethal; mutations, cell cycle alterations in somatic cells have been done, and dose response relationships were figured. The maximal RBE values were estimated in the range of 4.6-6.8. Alterations of RBE value were observed; from 6.8 to 7.8 in the case of plants pretreated with 240 ppm of B-10 from borax, and 4.6 to 6.1 in the case of 400 ppm of B-10 from BSH. Results showed a slight, although statistically insignificant increase in biological efficacy of radiation from the Cf-252 source in samples pretreated with boron containing chemicals. (author)

  6. Unusual structure, bonding and properties in a californium borate

    Energy Technology Data Exchange (ETDEWEB)

    Polinski, Matthew J.; Garner, Edward B.; Maurice, Rémi; Planas, Nora; Stritzinger, Jared T.; Parker, T. Gannon; Cross, Justin N.; Green, Thomas D.; Alekseev, Evgeny V.; Van Cleve, Shelley M.; Depmeier, Wulf; Gagliardi, Laura; Shatruk, Michael; Knappenberger, Kenneth L.; Liu, Guokui; Skanthakumar, S.; Soderholm, Lynda; Dixon, David A.; Albrecht-Schmitt, Thomas E.


    The participation of the valence orbitals of actinides in bonding has been debated for decades. Recent experimental and computational investigations demonstrated the involvement of 6p, 6d and/or 5f orbitals in bonding. However, structural and spectroscopic data, as well as theory, indicate a decrease in covalency across the actinide series, and the evidence points to highly ionic, lanthanide-like bonding for late actinides. Here we show that chemical differentiation between californium and lanthanides can be achieved by using ligands that are both highly polarizable and substantially rearrange on complexation. A ligand that suits both of these desired properties is polyborate. We demonstrate that the 5f, 6d and 7p orbitals are all involved in bonding in a Cf(III) borate, and that large crystal-field effects are present. Synthetic, structural and spectroscopic data are complemented by quantum mechanical calculations to support these observations.

  7. Biomedical neutron research at the Californium User Facility for neutron science

    Energy Technology Data Exchange (ETDEWEB)

    Martin, R.C. [Oak Ridge National Lab., TN (United States); Byrne, T.E. [Roane State Community College, Harriman, TN (United States); Miller, L.F. [Univ. of Tennessee, Knoxville, TN (United States)


    The Californium User Facility for Neutron Science has been established at Oak Ridge National Laboratory (ORNL). The Californium User Facility (CUF) is a part of the larger Californium Facility, which fabricates and stores compact {sup 252}Cf neutron sources for worldwide distribution. The CUF can provide a cost-effective option for research with {sup 252}Cf sources. Three projects at the CUF that demonstrate the versatility of {sup 252}Cf for biological and biomedical neutron-based research are described: future establishment of a {sup 252}Cf-based neutron activation analysis system, ongoing work to produce miniature high-intensity, remotely afterloaded {sup 252}Cf sources for tumor therapy, and a recent experiment that irradiated living human lung cancer cells impregnated with experimental boron compounds to test their effectiveness for boron neutron capture therapy.

  8. Apparatus for the measurement of total body nitrogen using prompt neutron activation analysis with californium-252. (United States)

    Mackie, A; Hannan, W J; Smith, M A; Tothill, P


    Details of clinical apparatus designed for the measurement of total body nitrogen (as an indicator of body protein), suitable for the critically ill, intensive-care patient are presented. Californium-252 radio-isotopic neutron sources are used, enabling a nitrogen measurement by prompt neutron activation analysis to be made in 40 min with a precision of +/- 3.2% for a whole body dose equivalent of 0.145 mSv. The advantages of Californium-252 over alternative neutron sources are discussed. A comparison between two irradiation/detection geometries is made, leading to an explanation of the geometry adopted for the apparatus. The choice of construction and shielding materials to reduce the count rate at the detectors and consequently to reduce the pile-up contribution to the nitrogen background is discussed. Salient features of the gamma ray spectroscopy system to reduce spectral distortion from pulse pile-up are presented.

  9. 240 degrees: why not? (United States)

    Hambye, A S; Dobbeleir, A; Stulens, E; Vervaet, A; Vandevivere, J; Franken, P R


    Single photon emission tomographic imaging of myocardial perfusion with 99Tcm-labelled agents is usually performed with single-detector gamma camera systems and 180 degrees anterior data collection. With multi-detector systems, reconstruction over 180 degrees and 360 degrees has been reported. We used a data set of normal subjects to compare both reconstruction methods. In addition, we tested an alternative approach, reconstructing data from 240 degrees acquisitions, excluding the right posterior views, which provide little myocardial information and which are responsible for a reduced signal-to-noise ratio. On the transverse slices, the known apical distortion with the 180 degrees reconstruction was not noted with the 360 degrees or 240 degrees reconstructions. Using semi-quantitative analysis of apical, mid-ventricular and basal short-axis slices, almost complete overlap was observed between the 240 degrees and 360 degrees circumferential profiles of our 20 normal volunteers, except in the inferior wall where a reduction in activity was noted. However, this finding was less pronounced with the 240 degrees than with the 180 degrees reconstruction. The frequent reduction in activity in the anterior wall was more prominent with the 180 degrees than with the 240 degrees and 360 degrees reconstructions. A 240 degrees acquisition represents a useful compromise between 180 degrees and 360 degrees imaging protocols when a single-detector device is used, allowing more homogeneous tracer distribution and a reduction in the apical distortion without material change of contrast or doubling of the acquisition time.

  10. Safety Analysis Report for Packaging (SARP) of the Oak Ridge National Laboratory TRU Californium Shipping Container

    Energy Technology Data Exchange (ETDEWEB)

    Box, W.D.; Shappert, L.B.; Seagren, R.D.; Klima, B.B.; Jurgensen, M.C.; Hammond, C.R.; Watson, C.D.


    An analytical evaluation of the Oak Ridge National Laboratory TRU Californium Shipping Container was made in order to demonstrate its compliance with the regulations governing off-site shipment of packages that contain radioactive material. The evaluation encompassed five primary categories: structural integrity, thermal resistance, radiation shielding, nuclear criticality safety, and quality assurance. The results of this evaluation demonstrate that the container complies with the applicable regulations.

  11. 46 CFR 184.240 - Gas systems. (United States)


    ... 46 Shipping 7 2010-10-01 2010-10-01 false Gas systems. 184.240 Section 184.240 Shipping COAST... CONTROL AND MISCELLANEOUS SYSTEMS AND EQUIPMENT Cooking and Heating § 184.240 Gas systems. Cooking systems... 6-5.4. Note to § 184.240: The ABYC and NFPA standards referenced in this section require the posting...

  12. Study of the shielding for spontaneous fission sources of Californium-252; Estudio de blindaje para fuentes de fision espontanea de Californio-252

    Energy Technology Data Exchange (ETDEWEB)

    Davila R, I


    A shielding study is made to attenuate, until maximum permissible levels, the neutrons radiation and photons emitted by spontaneous fission coming from a source of Californium-252. The compound package by a database (Library DLC-23) and the ANISNW code is used, in it version for personal computer. (Author)

  13. 40 CFR 240.203 - General design. (United States)


    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false General design. 240.203 Section 240.203 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR... design. ...

  14. 40 CFR 240.207 - Aesthetics. (United States)


    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Aesthetics. 240.207 Section 240.207 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR THE THERMAL PROCESSING OF SOLID WASTES Requirements and Recommended Procedures § 240.207 Aesthetics. ...

  15. 12 CFR 19.240 - Inflation adjustments. (United States)


    ... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Inflation adjustments. 19.240 Section 19.240... PROCEDURE Civil Money Penalty Inflation Adjustments § 19.240 Inflation adjustments. (a) The maximum amount... Civil Penalties Inflation Adjustment Act of 1990 (28 U.S.C. 2461 note) as follows: ER10NO08.001 (b) The...

  16. 40 CFR 240.204 - Water quality. (United States)


    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Water quality. 240.204 Section 240.204 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR THE THERMAL PROCESSING OF SOLID WASTES Requirements and Recommended Procedures § 240.204 Water quality. ...

  17. 8 CFR 240.63 - Application process. (United States)


    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Application process. 240.63 Section 240.63 Aliens and Nationality DEPARTMENT OF HOMELAND SECURITY IMMIGRATION REGULATIONS PROCEEDINGS TO DETERMINE... Cancellation of Removal Under Section 203 of Pub. L. 105-100 § 240.63 Application process. (a) Form and fees...

  18. 40 CFR 240.209 - Safety. (United States)


    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Safety. 240.209 Section 240.209 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR THE THERMAL PROCESSING OF SOLID WASTES Requirements and Recommended Procedures § 240.209 Safety. ...

  19. 40 CFR 240.205 - Air quality. (United States)


    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Air quality. 240.205 Section 240.205 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR THE THERMAL PROCESSING OF SOLID WASTES Requirements and Recommended Procedures § 240.205 Air quality. ...

  20. 16 CFR 240.6 - Interstate commerce. (United States)


    ...(d) and 2(e) of the Act. (The commerce standard for sections 2 (d) and (e) is at least as inclusive... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Interstate commerce. 240.6 Section 240.6... ALLOWANCES AND OTHER MERCHANDISING PAYMENTS AND SERVICES § 240.6 Interstate commerce. The term interstate...

  1. Simulation and design of an electron beam ion source charge breeder for the californium rare isotope breeder upgrade

    Directory of Open Access Journals (Sweden)

    Clayton Dickerson


    Full Text Available An electron beam ion source (EBIS will be constructed and used to charge breed ions from the californium rare isotope breeder upgrade (CARIBU for postacceleration into the Argonne tandem linear accelerator system (ATLAS. Simulations of the EBIS charge breeder performance and the related ion transport systems are reported. Propagation of the electron beam through the EBIS was verified, and the anticipated incident power density within the electron collector was identified. The full normalized acceptance of the charge breeder with a 2 A electron beam, 0.024π  mm mrad for nominal operating parameters, was determined by simulating ion injection into the EBIS. The optics of the ion transport lines were carefully optimized to achieve well-matched ion injection, to minimize emittance growth of the injected and extracted ion beams, and to enable adequate testing of the charge bred ions prior to installation in ATLAS.

  2. Extraction of Trivalent Actinides and Lanthanides from Californium Campaign Rework Solution Using TODGA-based Solvent Extraction System

    Energy Technology Data Exchange (ETDEWEB)

    Benker, Dennis [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Delmau, Laetitia Helene [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Dryman, Joshua Cory [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)


    This report presents the studies carried out to demonstrate the possibility of quantitatively extracting trivalent actinides and lanthanides from highly acidic solutions using a neutral ligand-based solvent extraction system. These studies stemmed from the perceived advantage of such systems over cationexchange- based solvent extraction systems that require an extensive feed adjustment to make a low-acid feed. The targeted feed solutions are highly acidic aqueous phases obtained after the dissolution of curium targets during a californium (Cf) campaign. Results obtained with actual Cf campaign solutions, but highly diluted to be manageable in a glove box, are presented, followed by results of tests run in the hot cells with Cf campaign rework solutions. It was demonstrated that a solvent extraction system based on the tetraoctyl diglycolamide molecule is capable of quantitatively extracting trivalent actinides from highly acidic solutions. This system was validated using actual feeds from a Cf campaign.

  3. Beyond Californium-A Neutron Generator Alternative for Dosimetry and Instrument Calibration in the U.S. (United States)

    Piper, Roman K; Mozhayev, Andrey V; Murphy, Mark K; Thompson, Alan K


    Evaluations of neutron survey instruments, area monitors, and personal dosimeters rely on reference neutron radiations, which have evolved from the heavy reliance on (α,n) sources to a shared reliance on (α,n) and the spontaneous fission neutrons of californium-252 (Cf). Capable of producing high dose equivalent rates from an almost point source geometry, the characteristics of Cf are generally more favorable when compared to the use of (α,n) and (γ,n) sources or reactor-produced reference neutron radiations. Californium-252 is typically used in two standardized configurations: unmoderated, to yield a fission energy spectrum; or with the capsule placed within a heavy-water moderating sphere to produce a softened spectrum that is generally considered more appropriate for evaluating devices used in nuclear power plant work environments. The U.S. Department of Energy Cf Loan/Lease Program, a longtime origin of affordable Cf sources for research, testing and calibration, was terminated in 2009. Since then, high-activity sources have become increasingly cost-prohibitive for laboratories that formerly benefited from that program. Neutron generators, based on the D-T and D-D fusion reactions, have become economically competitive with Cf and are recognized internationally as important calibration and test standards. Researchers from the National Institute of Standards and Technology and the Pacific Northwest National Laboratory are jointly considering the practicality and technical challenges of implementing neutron generators as calibration standards in the U.S. This article reviews the characteristics of isotope-based neutron sources, possible isotope alternatives to Cf, and the rationale behind the increasing favor of electronically generated neutron options. The evaluation of a D-T system at PNNL has revealed characteristics that must be considered in adapting generators to the task of calibration and testing where accurate determination of a dosimetric quantity is

  4. Californium-252 Brachytherapy Combined With External-Beam Radiotherapy for Cervical Cancer: Long-Term Treatment Results

    Energy Technology Data Exchange (ETDEWEB)

    Lei Xin; Qian Chengyuan; Qing Yi; Zhao Kewei; Yang Zhengzhou; Dai Nan; Zhong Zhaoyang; Tang Cheng; Li Zheng; Gu Xianqing; Zhou Qian; Feng Yan; Xiong Yanli; Shan Jinlu [Cancer Center, Research Institute of Surgery and Daping Hospital, Third Military Medical University, Chongqing (China); Wang Dong, E-mail: [Cancer Center, Research Institute of Surgery and Daping Hospital, Third Military Medical University, Chongqing (China)


    Purpose: To observe, by retrospective analysis, the curative effects and complications due to californium-252 ({sup 252}Cf) neutron intracavitary brachytherapy (ICBT) combined with external-beam radiotherapy (EBRT) in the treatment of cervical cancer. Methods and Materials: From February 1999 to December 2007, 696 patients with cervical cancer (Stages IB to IIIB) were treated with {sup 252}Cf-ICBT in combination of EBRT. Of all, 31 patients were at Stage IB, 104 at IIA, 363 at IIB, 64 at IIIA, and 134 at IIIB. Californium-252 ICBT was delivered at 7-12 Gy per insertion per week, with a total dose of 29-45 Gy to reference point A in three to five insertions. The whole pelvic cavity was treated with 8-MV X-ray external irradiation at 2 Gy per fraction, four times per week. After 16-38 Gy of external irradiation, the center of the whole pelvic field was blocked with a 4-cm-wide lead shield, with a total external irradiation dose of 44-56 Gy. The total treatment course was 5 to 6 weeks. Results: Overall survival rate at 3 and 5 years for all patients was 76.0% and 64.9%, respectively. Disease-free 3- and 5-year survival rates of patients were 71.2% and 58.4%, respectively. Late complications included vaginal contracture and adhesion, radiation proctitis, radiation cystitis, and inflammatory bowel, which accounted for 5.8%, 7.1%, 6.2%, and 4.9%, respectively. Univariate analysis results showed significant correlation of stage, age, histopathologic grade, and lymph node status with overall survival. Cox multiple regression analysis showed that the independent variables were stage, histopathologic grade, tumor size, and lymphatic metastasis in all patients. Conclusion: Results of this series suggest that the combined use of {sup 252}Cf-ICBT with EBRT is an effective method for treatment of cervical cancer.

  5. Dicty_cDB: SLC240 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC240 (Link to dictyBase) - - - Contig-U16365-1 SLC240Z (Link... to Original site) - - SLC240Z 540 - - - - Show SLC240 Library SL (Link to library) Clone ID SLC240 (Link Representative seq. ID SLC24...0Z (Link to Original site) Representative DNA sequence >SLC240 (SLC240Q) /CSM/SL/SLC2-B/SLC240Q.Seq.d/ XXXXX...Amino Acid sequence (All Frames) Frame A: ---crfinclcckfslindqfsfiis*lsfiiswfiiii

  6. 31 CFR 240.4 - Presentment guarantees. (United States)


    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Presentment guarantees. 240.4 Section 240.4 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE... Treasury check, not a counterfeit check. (e) Electronic check. If the check is an electronic check, that...

  7. 40 CFR 240.100 - Scope. (United States)


    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Scope. 240.100 Section 240.100 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR THE THERMAL... technological limitation. (d) Pursuant to section 211 of the Solid Waste Disposal Act, as amended, these...

  8. 7 CFR 958.240 - Assessment rate. (United States)


    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Assessment rate. 958.240 Section 958.240 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and Orders; Fruits, Vegetables, Nuts), DEPARTMENT OF AGRICULTURE ONIONS GROWN IN CERTAIN DESIGNATED COUNTIES IN IDAHO, AND MALHEUR COUNTY,...

  9. 21 CFR 173.240 - Isopropyl alcohol. (United States)


    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Isopropyl alcohol. 173.240 Section 173.240 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN... the extraction of spice, at a level not to exceed 50 parts per million. (b) In lemon oil as a residue...

  10. 7 CFR 57.240 - Detaining product. (United States)


    ... product, and the custodian or owner shall be given a written notice of such detention. Only authorized... 7 Agriculture 3 2010-01-01 2010-01-01 false Detaining product. 57.240 Section 57.240 Agriculture... AGRICULTURAL MARKETING ACT OF 1946 AND THE EGG PRODUCTS INSPECTION ACT (CONTINUED) INSPECTION OF EGGS (EGG...

  11. C(240)-----The most Chemically Inert Fullerene? (United States)

    Haddon, R. C.; Scuseria, G. E.; Smalley, R. E.


    The reactivity of the fullerenes is primarily a function of their strain, as measured by the pyramidalization angle or curvature of the conjugated carbon atoms. The development of faceting in the structure of large icosahedral fullerenes leads to a minimum in the value of the maximum fullerene pyramidalization angle that lies in the vicinity of C-240. On this basis it is argued that C-240 will be the most chemically inert fullerene. This observation explains the production of [10,10] single-walled nanotubes because a C-240 hemisphere is required for the nucleation of such tubes.

  12. Long-term effects of an intracavitary treatment with californium-252 on normal tissue. [Swine, /sup 226/Ra

    Energy Technology Data Exchange (ETDEWEB)

    Sullivan, M.F.; Beamer, J.L.; Mahony, T.D.; Cross, F.T.; Lund, J.E.; Endres, G.W.R.


    About one hundred fifty swine were exposed to either radium-226 or californium-252 sources in the uterine cervix to determine an RBE for both acute and long-term effects. That value for early changes in the tissues at risk in the treatment of cervical cancer was between 6.2 and 6.8. The incidence of complications increased with time after exposure, especially among animals treated with /sup 252/Cf. Analysis of rectal injury showed that ulceration occurred frequently within a year postexposure at doses between 1600 and 2400 rad calculated at 2 cm lateral to the source midline. Fat necrosis and smooth muscle atrophy, resulting in a local rectal stricture, were delayed changes observed in some animals. The lower ureter was the site for a greater frequency of complications than the GI tract. Ureteral stricture often occurred at doses of 1200 rad from /sup 252/Cf and 7000 rad from /sup 226/Ra. Observation of delayed effects in the uterine-cervix in animals held up to 4 years postexposure indicate that the RBE for /sup 252/Cf may be increased to a value as high as 18, while repair may have even decreased it to about 5.6 in the rectum. Fifty swine are still being observed for long-term effects after doses above 800 rad from /sup 252/Cf and 5000 rad from /sup 226/Ra.

  13. Dicty_cDB: SLB240 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLB240 (Link to dictyBase) - G01905 DDB0216342 Contig-U01115-1 | Contig-U16357-1 SLB...240P (Link to Original site) SLB240F 367 SLB240Z 159 SLB240P 526 - - Show SLB240 Libra...ry SL (Link to library) Clone ID SLB240 (Link to dictyBase) Atlas ID - NBRP ID G01905 dictyBase ID Representative seq. ID SLB240P (Link to Original site) R...epresentative DNA sequence >SLB240 (SLB240Q) /CSM/SL/SLB2-B/SLB240Q.Seq.d/ CAACAATATGAAACCTGAAGATGCAAACGCTGC

  14. 16 CFR 240.14 - Meeting competition. (United States)


    ... ALLOWANCES AND OTHER MERCHANDISING PAYMENTS AND SERVICES § 240.14 Meeting competition. A seller charged with... offered on an area-wide basis, to those offered to new as well as old customers, and regardless of whether...

  15. Dicty_cDB: VHB240 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHB240 (Link to dictyBase) - - - Contig-U10749-1 | Contig-U16540-1 VHB...240P (Link to Original site) VHB240F 505 VHB240Z 185 VHB240P 670 - - Show VHB240 Library VH (Link to library) Clone ID VHB...49-1 | Contig-U16540-1 Original site URL Representative seq. ID VHB240P (Link to Original site) Representative DNA sequence >VHB240 (VHB...240Q) /CSM/VH/VHB2-B/VHB240Q.Seq.d/ ACTCTAACGTACCTAAAAATGAAAAGAAACACTAACGTCAGCTCATCCCGTAGAAAGTCA

  16. Ab initio full-potential study of mechanical properties and magnetic phase stability of californium monopnictides (CfN and CfP)

    Energy Technology Data Exchange (ETDEWEB)

    Amari, S., E-mail: [Faculté des Sciences de la Nature et de la Vie, Université Hassiba Benbouali, Chlef, 02000 (Algeria); Bouhafs, B. [Laboratoire de Modélisation et Simulation en Sciences des Matériaux, Université Djillali Liabès de Sidi Bel-Abbés, Sidi Bel-Abbés, 22000 (Algeria)


    Based on the first-principles methods, the structural, elastic, electronic, properties and magnetic ordering of californium monopnictides CfX (X = P) have been studied using the full-potential augmented plane wave plus local orbitals (FP-L/APW + lo) method within the framework of density functional theory (DFT). The electronic exchange correlation energy is described by generalized gradient approximation GGA and GGA+U (U is the Hubbard correction). The GGA+U method is applied to the rare-earth 5f states. We have calculated the lattice parameters, bulk modulii and the first pressure derivatives of the bulk modulii. The elastic properties of the studied compounds are only investigated in the most stable calculated phase. In order to gain further information, we have calculated Young’s modulus, shear modulus, anisotropy factor and Kleinman parameter by the aid of the calculated elastic constants. The results mainly show that californium monopnictides CfX (X = P) have an antiferromagnetic spin ordering. Density of states (DOS) and charge densities for both compounds are also computed in the NaCl (B1) structure.

  17. 14 CFR 240.1 - Interpretation. (United States)


    ... REGULATIONS INSPECTION OF ACCOUNTS AND PROPERTY § 240.1 Interpretation. (a) In the exercise of the authority... said office in accordance with the laws of the United States and regulations thereunder, and his... these credentials will result in penalties as provided by law. United States of America, Civil...

  18. 27 CFR 24.240 - General. (United States)


    ... other suitable container, which will not contaminate the wine. Specifically authorized materials and... TREASURY LIQUORS WINE Storage, Treatment and Finishing of Wine § 24.240 General. Wine will be stored on bonded wine premises in buildings or tanks constructed and secured in accordance with the provisions of...

  19. Low-Dose-Rate Californium-252 Neutron Intracavitary Afterloading Radiotherapy Combined With Conformal Radiotherapy for Treatment of Cervical Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Zhang Min [Department of Oncology, Armed Police Hospital of Hangzhou, Hangzhou, Zhejiang Province (China); Xu Hongde [Cancer Center, Armed Police Hospital of Hangzhou, Hangzhou, Zhejiang Province (China); Pan Songdan; Lin Shan; Yue Jianhua [Department of Oncology, Armed Police Hospital of Hangzhou, Hangzhou, Zhejiang Province (China); Liu Jianren, E-mail: [Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang Province (China)


    Purpose: To study the efficacy of low-dose-rate californium-252 ({sup 252}Cf) neutron intracavitary afterloading radiotherapy (RT) combined with external pelvic RT for treatment of cervical cancer. Methods and Materials: The records of 96 patients treated for cervical cancer from 2006 to 2010 were retrospectively reviewed. For patients with tumors {<=}4 cm in diameter, external beam radiation was performed (1.8 Gy/day, five times/week) until the dose reached 20 Gy, and then {sup 252}Cf neutron intracavitary afterloading RT (once/week) was begun, and the frequency of external beam radiation was changed to four times/week. For patients with tumors >4 cm, {sup 252}Cf RT was performed one to two times before whole-pelvis external beam radiation. The tumor-eliminating dose was determined by using the depth limit of 5 mm below the mucosa as the reference point. In all patients, the total dose of the external beam radiation ranged from 46.8 to 50 Gy. For {sup 252}Cf RT, the dose delivered to point A was 6 Gy/fraction, once per week, for a total of seven times, and the total dose was 42 Gy. Results: The mean {+-} SD patient age was 54.7 {+-} 13.7 years. Six patients had disease assessed at stage IB, 13 patients had stage IIA, 49 patients had stage IIB, 3 patients had stage IIIA, 24 patients had stage IIIB, and 1 patient had stage IVA. All patients obtained complete tumor regression (CR). The mean {+-} SD time to CR was 23.5 {+-} 3.4 days. Vaginal bleeding was fully controlled in 80 patients within 1 to 8 days. The mean {+-} SD follow-up period was 27.6 {+-} 12.7 months (range, 6-48 months). Five patients died due to recurrence or metastasis. The 3-year survival and disease-free recurrence rates were 89.6% and 87.5 %, respectively. Nine patients experienced mild radiation proctitis, and 4 patients developed radiocystitis. Conclusions: Low-dose-rate {sup 252}Cf neutron RT combined with external pelvic RT is effective for treating cervical cancer, with a low incidence of

  20. 40 CFR 240.201 - Solid wastes excluded. (United States)


    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Solid wastes excluded. 240.201 Section 240.201 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR THE THERMAL PROCESSING OF SOLID WASTES Requirements and Recommended Procedures § 240.201 Solid...

  1. 40 CFR 240.200 - Solid wastes accepted. (United States)


    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Solid wastes accepted. 240.200 Section 240.200 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID WASTES GUIDELINES FOR THE THERMAL PROCESSING OF SOLID WASTES Requirements and Recommended Procedures § 240.200 Solid...

  2. 31 CFR 240.3 - Electronic checks and substitute checks. (United States)


    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Electronic checks and substitute checks. 240.3 Section 240.3 Money and Finance: Treasury Regulations Relating to Money and Finance... OF CHECKS DRAWN ON THE UNITED STATES TREASURY General Provisions § 240.3 Electronic checks and...

  3. 16 CFR 240.2 - Applicability of the law. (United States)


    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Applicability of the law. 240.2 Section 240.2 Commercial Practices FEDERAL TRADE COMMISSION GUIDES AND TRADE PRACTICE RULES GUIDES FOR ADVERTISING ALLOWANCES AND OTHER MERCHANDISING PAYMENTS AND SERVICES § 240.2 Applicability of the law. (a) The substantive provisions of section 2 (d) and (e)...

  4. 16 CFR 240.4 - Definition of customer. (United States)


    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Definition of customer. 240.4 Section 240.4... ALLOWANCES AND OTHER MERCHANDISING PAYMENTS AND SERVICES § 240.4 Definition of customer. A customer is any... “customer” is any buyer of the seller's product for resale who purchases from or through a wholesaler or...

  5. 17 CFR 240.16c-4 - Derivative securities. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Derivative securities. 240.16c-4 Section 240.16c-4 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED... Exchange Act of 1934 Exemption of Certain Transactions from Section 16(c) § 240.16c-4 Derivative securities...

  6. 17 CFR 240.13d-7 - Dissemination. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Dissemination. 240.13d-7 Section 240.13d-7 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED... Exchange Act of 1934 Regulation 13d-G § 240.13d-7 Dissemination. One copy of the Schedule filed pursuant to...

  7. 17 CFR 240.16c-1 - Brokers. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Brokers. 240.16c-1 Section 240... Act of 1934 Exemption of Certain Transactions from Section 16(c) § 240.16c-1 Brokers. Any transaction... a broker of an order for an account in which the broker has no direct or indirect interest. ...

  8. TRAP230/ARC240 and TRAP240/ARC250 Mediator subunits are functionally conserved through evolution


    Samuelsen, Camilla O.; Baraznenok, Vera; Khorosjutina, Olga; Spåhr, Henrik; Kieselbach, Thomas; Holmberg, Steen; Gustafsson, Claes M.


    In Saccharomyces cerevisiae Mediator, a subgroup of proteins (Srb8, Srb9, Srb10, and Srb11) form a module, which is involved in negative regulation of transcription. Homologues of Srb10 and Srb11 are found in some mammalian Mediator preparations, whereas no clear homologues have been reported for Srb8 and Srb9. Here, we identify a TRAP240/ARC250 homologue in Schizosaccharomyces pombe and demonstrate that this protein, spTrap240, is stably associated with a larger form of Mediator, which...

  9. 15 CFR 240.1 - Title of act. (United States)


    ... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false Title of act. 240.1 Section 240.1 Commerce and Foreign Trade Regulations Relating to Commerce and Foreign Trade NATIONAL INSTITUTE OF... § 240.1 Title of act. The act, “Pub. L. 228, 64th Congress,” approved August 23, 1916 (39 Stat. 530; 15...

  10. 7 CFR 205.240-205.269 - [Reserved (United States)


    ... 7 Agriculture 3 2010-01-01 2010-01-01 false [Reserved] 205.240-205.269 Section 205.240-205.269 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) ORGANIC FOODS PRODUCTION ACT PROVISIONS NATIONAL ORGANIC PROGRAM...

  11. 49 CFR 240.125 - Criteria for testing knowledge. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Criteria for testing knowledge. 240.125 Section... Elements of the Certification Process § 240.125 Criteria for testing knowledge. (a) Each railroad's program... locomotive service to determine that the person has sufficient knowledge of the railroad's rules and...

  12. 17 CFR 240.17Ad-14 - Tender agents. (United States)


    ... Section 240.17Ad-14 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED... Exchange Act of 1934 Supervised Investment Bank Holding Company Rules § 240.17Ad-14 Tender agents. (a) Establishing book-entry depository accounts. When securities of a subject company have been declared eligible...

  13. 49 CFR Appendix F to Part 240 - Medical Standards Guidelines (United States)


    ... requirements of §§ 240.121 and 240,207. (2) In determining whether a person has the visual acuity that meets or... methods for determining whether a person has the ability to recognize and distinguish among the colors... initial test of the person's color vision; the initial test is one conducted in accordance with one of the...

  14. 49 CFR 240.229 - Requirements for joint operations territory. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Requirements for joint operations territory. 240... ENGINEERS Implementation of the Certification Process § 240.229 Requirements for joint operations territory... operating skills concerning the joint operations territory; and (iv) That the person certified as a...

  15. 16 CFR 240.13 - Customer's and third party liability. (United States)


    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Customer's and third party liability. 240.13... ADVERTISING ALLOWANCES AND OTHER MERCHANDISING PAYMENTS AND SERVICES § 240.13 Customer's and third party liability. (a) Customer's liability: Sections 2 (d) and (e) apply to sellers and not to customers. However...

  16. 49 CFR 240.127 - Criteria for examining skill performance. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Criteria for examining skill performance. 240.127... Elements of the Certification Process § 240.127 Criteria for examining skill performance. (a) Each railroad... have procedures for examining the performance skills of a person being evaluated for qualification as a...

  17. 40 CFR 86.240-94 - Exhaust sample analysis. (United States)


    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false Exhaust sample analysis. 86.240-94 Section 86.240-94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS... 1994 and Later Model Year Gasoline-Fueled New Light-Duty Vehicles, New Light-Duty Trucks and New Medium...

  18. 17 CFR 240.17Ad-9 - Definitions. (United States)


    ... record differences. (b) Master securityholder file is the official list of individual securityholder... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Definitions. 240.17Ad-9... Exchange Act of 1934 Supervised Investment Bank Holding Company Rules § 240.17Ad-9 Definitions. As used in...

  19. 42 CFR 455.240 - Conflict of interest resolution. (United States)


    ... 42 Public Health 4 2010-10-01 2010-10-01 false Conflict of interest resolution. 455.240 Section... § 455.240 Conflict of interest resolution. (a) Review Board: CMS may establish a Conflicts of Interest Review Board to assist in resolving organizational conflicts of interest. (b) Resolution: Resolution of...

  20. 17 CFR 240.16b-6 - Derivative securities. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Derivative securities. 240.16b... Exchange Act of 1934 Exemption of Certain Transactions from Section 16(b) § 240.16b-6 Derivative securities... transaction within the six months prior to the date the price is fixed. (b) The closing of a derivative...

  1. 46 CFR 132.240 - Stowage of semiportable fire extinguishers. (United States)


    ... 46 Shipping 4 2010-10-01 2010-10-01 false Stowage of semiportable fire extinguishers. 132.240... FIRE-PROTECTION EQUIPMENT Portable and Semiportable Fire Extinguishers § 132.240 Stowage of semiportable fire extinguishers. The frame or support of each semiportable fire extinguisher of size III, IV...

  2. 50 CFR 665.240 - Hawaii crustacean fisheries. [Reserved (United States)


    ... 50 Wildlife and Fisheries 9 2010-10-01 2010-10-01 false Hawaii crustacean fisheries. 665.240 Section 665.240 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND ATMOSPHERIC ADMINISTRATION, DEPARTMENT OF COMMERCE (CONTINUED) FISHERIES IN THE WESTERN PACIFIC Hawaii...

  3. Dicty_cDB: VSC240 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VS (Link to library) VSC240 (Link to dictyBase) - - - Contig-U16150-1 VSC240E (Link to Original site)...- - - - - - VSC240E 197 Show VSC240 Library VS (Link to library) Clone ID VSC240 (Link to dictyBase)...morsitans (Tseatse fly) EST from adult infected midgut library, clone Tse10d07_p1c. 56 2e-04 1 BX566524 |BX566524...morsitans (Tseatse fly) EST from adult infected midgut library, clone Tse82g02_p1c. 56 2e-04 1 BX564737 |BX564737...morsitans (Tseatse fly) EST from adult infected midgut library, clone Tse73d07_p1c. 56 2e-04 1 BX548476 |BX548476

  4. TRAP230/ARC240 and TRAP240/ARC250 Mediator subunits are functionally conserved through evolution

    DEFF Research Database (Denmark)

    Samuelsen, Camilla O; Baraznenok, Vera; Khorosjutina, Olga


    In Saccharomyces cerevisiae Mediator, a subgroup of proteins (Srb8, Srb9, Srb10, and Srb11) form a module, which is involved in negative regulation of transcription. Homologues of Srb10 and Srb11 are found in some mammalian Mediator preparations, whereas no clear homologues have been reported......Srb8) regulate the same distinct subset of genes and have indistinguishable phenotypic characteristics. Importantly, Mediator containing the spSrb8/spTrap240/spSrb10/spSrb11 subunits is isolated only in free form, devoid of RNA polymerase II. In contrast, Mediator lacking this module associates...

  5. Californium-252 neutron intracavity brachytherapy alone for T1N0 low-lying rectal adenocarcinoma: A definitive anal sphincter-preserving radiotherapy (United States)

    Xiong, Yanli; Shan, Jinlu; Liu, Jia; Zhao, Kewei; Chen, Shu; Xu, Wenjing; Zhou, Qian; Yang, Mei; Lei, Xin


    This study evaluated the 4-year results of 32 patients with T1N0 low-lying rectal adenocarcinoma treated solely with californium-252 (Cf-252) neutron intracavity brachytherapy (ICBT). Patients were solicited into the study from January 2008 to June 2011. All the patients had refused surgery or surgery was contraindicated. The patients were treated with Cf-252 neutron ICBT using a novel 3.5-cm diameter off-axis 4-channel intrarectal applicator designed by the authors. The dose reference point was defined on the mucosa surface, with a total dose of 55–62 Gy-eq/4 f (13–16 Gy-eq/f/wk). All the patients completed the radiotherapy in accordance with our protocol. The rectal lesions regressed completely, and the acute rectal toxicity was mild (≤G2). The 4-year local control, overall survival, disease-free survival, and late complication (≥G2) rates were 96.9%, 90.6%, 87.5% and 15.6%, respectively. No severe late complication (≥G3) occurred. The mean follow-up was 56.1 ± 16.0 months. At the end of last follow-up, 29 patients remained alive. The mean survival time was 82.1 ± 2.7 months. Cf-252 neutron ICBT administered as the sole treatment (without surgery) for patients with T1N0 low-lying rectal adenocarcinoma is effective with acceptable late complications. Our study and method offers a definitive anal sphincter-preserving radiotherapy for T1N0 low-lying rectal adenocarcinoma patients. PMID:28094790

  6. 17 CFR 240.10A-2 - Auditor independence. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Auditor independence. 240.10A... Exchange Act of 1934 Reports Under Section 10a § 240.10A-2 Auditor independence. It shall be unlawful for an auditor not to be independent under § 210.2-01(c)(2)(iii)(B), (c)(4), (c)(6), (c)(7), and § 210.2...

  7. Safety evaluation of Lactobacillus pentosus strain b240. (United States)

    Szabo, Nancy J; Dolan, Laurie C; Burdock, George A; Shibano, Takashi; Sato, Shin-ichi; Suzuki, Hiroshi; Uesugi, Tohru; Yamahira, Satoko; Toba, Masamichi; Ueno, Hirofumi


    Lactobacillus pentosus has a long history of use in cooked and uncooked fermented foods. Viable and heat-killed nonviable preparations of L. pentosus strain b240 were evaluated for short term and subchronic toxicity and genotoxic potential. Dose levels were determined through acute oral toxicity tests with viable (LD(50)>2500 mg/kg) and nonviable (LD(50)>2000 mg/kg) b240. In the short term study, rats received 2500 mg/kg/day (∼1.7×10(11)cfu/kg/day) viable b240 for 28 days. In the subchronic study, rats received 500, 1000 or 2000 mg/kg/day (up to ∼3.0×10(12) cfu equivalents/kg/day) nonviable b240 for 91 days followed by a 28-day recovery. No mortalities occurred. No treatment-related effects were identified for general condition, body weight, food-water consumption, ophthalmology, urinalysis, hematology, blood chemistry, organ weights, histopathology and gross pathology. Although statistically significant effects were noted for several endpoints in the short term and subchronic studies, none were related to the test materials. The NOAEL for nonviable b240 was 2000 mg/kg/day, the highest dose tested. Additionally, nonviable b240 (≤ 5000 μg/plate) was not mutagenic in Salmonella typhimurium or Escherichia coli tester strains nor did nonviable b240 orally administered to rats at levels ≤ 2000 mg/kg/day for two days, induce a clastogenic response. Copyright © 2010 Elsevier Ltd. All rights reserved.

  8. 49 CFR Appendix E to Part 240 - Recommended Procedures for Conducting Skill Performance Tests (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Recommended Procedures for Conducting Skill... LOCOMOTIVE ENGINEERS Pt. 240, App. E Appendix E to Part 240—Recommended Procedures for Conducting Skill Performance Tests FRA requires (see § 240.127 and § 240.211) that locomotive engineers be given a skill...

  9. Pu-239 and Pu-240 inventories and Pu-240/ Pu-239 atom ratios in the water column off Sanriku, Japan. (United States)

    Yamada, Masatoshi; Zheng, Jian; Aono, Tatsuo


    A magnitude 9.0 earthquake and subsequent tsunami occurred in the Pacific Ocean off northern Honshu, Japan, on 11 March 2011 which caused severe damage to the Fukushima Dai-ichi Nuclear Power Plant. This accident has resulted in a substantial release of radioactive materials to the atmosphere and ocean, and has caused extensive contamination of the environment. However, no information is available on the amounts of radionuclides such as Pu isotopes released into the ocean at this time. Investigating the background baseline concentration and atom ratio of Pu isotopes in seawater is important for assessment of the possible contamination in the marine environment. Pu-239 (half-life: 24,100 years), Pu-240 (half-life: 6,560 years) and Pu-241 (half-life: 14.325 years) mainly have been released into the environment as the result of atmospheric nuclear weapons testing. The atom ratio of Pu-240/Pu-239 is a powerful fingerprint to identify the sources of Pu in the ocean. The Pu-239 and Pu-240 inventories and Pu-240/Pu-239 atom ratios in seawater samples collected in the western North Pacific off Sanriku before the accident at Fukushima Dai-ichi Nuclear Power Plant will provide useful background baseline data for understanding the process controlling Pu transport and for distinguishing additional Pu sources. Seawater samples were collected with acoustically triggered quadruple PVC sampling bottles during the KH-98-3 cruise of the R/V Hakuho-Maru. The Pu-240/Pu-239 atom ratios were measured with a double-focusing SF-ICP-MS, which was equipped with a guard electrode to eliminate secondary discharge in the plasma and to enhance overall sensitivity. The Pu-239 and Pu-240 concentrations were 2.07 and 1.67 mBq/m3 in the surface water, respectively, and increased with depth; a subsurface maximum was identified at 750 m depth, and the concentrations decreased with depth, then increased at the bottom layer. The total Pu-239+240 inventory in the entire water column (depth interval 0

  10. 17 CFR 240.16a-4 - Derivative securities. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Derivative securities. 240.16a....16a-4 Derivative securities. (a) For purposes of section 16 of the Act, both derivative securities and... securities, except that the acquisition or disposition of any derivative security shall be separately...

  11. 40 CFR 98.240 - Definition of the source category. (United States)


    ... (CONTINUED) MANDATORY GREENHOUSE GAS REPORTING Petrochemical Production § 98.240 Definition of the source... makes methanol, hydrogen, and/or ammonia from synthesis gas is part of the petrochemical source category... category. (f) A process that produces a petrochemical from bio-based feedstock is not part of the...

  12. Phenotype-gene: 240 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 240 decreased Plant J. 52(5):850-64. decreased speed

  13. 16 CFR 240.5 - Definition of competing customers. (United States)


    ... ADVERTISING ALLOWANCES AND OTHER MERCHANDISING PAYMENTS AND SERVICES § 240.5 Definition of competing customers... quality at the same functional level of distribution regardless of whether they purchase directly from the... grocery store and a discount department store. If these stores compete with each other, any allowance...

  14. 46 CFR 127.240 - Means of escape. (United States)


    ... GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS CONSTRUCTION AND ARRANGEMENTS Particular Construction and Arrangements § 127.240 Means of escape. (a) Except as provided by paragraphs (l... horizontal, greater than 70 degrees but not more than 90 degrees. (g) No means may be provided for locking...

  15. Processing of Niobium-Lined M240 Machine Gun Barrels (United States)


    metals. In particular, cobalt - chromium alloys offer a great deal of potential as liner materials.12,19 Nevertheless, the current results represents...12. Montgomery JS, Garner J, Keppinger R, Eichhorst C, de Rosset WS. Tests of M249 barrels made with a cobalt - chromium alloy . Aberdeen Proving...Pittsburgh, PA. 19. Leto VE, Klimm BD, Hespos MR, Garron RF. Flowformed cobalt alloy barrel testing on the M240 machine gun. Picatinny Arsenal (NJ

  16. Postural control in a simulated saturation dive to 240 msw.


    Goplen, Frederik Kragerud; Aasen, T. B.; Nordahl, Stein Helge G


    INTRODUCTION: There is evidence that increased ambient pressure causes an increase in postural sway. This article documents postural sway at pressures not previously studied and discusses possible mechanisms. METHODS: Eight subjects participated in a dry chamber dive to 240 msw (2.5 MPa) saturation pressure. Two subjects were excluded due to unilateral caloric weakness before the dive. Postural sway was measured on a force platform. The path length described by the center of pr...

  17. Californium-252 Program Equipment Evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Chattin, Fred Rhea [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Wilson, Kenton [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Ezold, Julie G. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)


    To successfully continue the 252Cf production and meet the needs of the customers, a comprehensive evaluation of the Building 7920 processing equipment was requested to identify equipment critical to the operational continuity of the program.

  18. 24 CFR 5.240 - Family disclosure of income information to the responsible entity and verification. (United States)


    ... information to the responsible entity and verification. 5.240 Section 5.240 Housing and Urban Development... Participants § 5.240 Family disclosure of income information to the responsible entity and verification. (a...; WAIVERS Disclosure and Verification of Social Security Numbers and Employer Identification Numbers...

  19. 17 CFR 240.12f-1 - Applications for permission to reinstate unlisted trading privileges. (United States)


    ... reinstate unlisted trading privileges. 240.12f-1 Section 240.12f-1 Commodity and Securities Exchanges... Rules and Regulations Under the Securities Exchange Act of 1934 Unlisted Trading § 240.12f-1 Applications for permission to reinstate unlisted trading privileges. (a) An application to reinstate unlisted...

  20. 17 CFR 240.12f-3 - Termination or suspension of unlisted trading privileges. (United States)


    ... unlisted trading privileges. 240.12f-3 Section 240.12f-3 Commodity and Securities Exchanges SECURITIES AND... Regulations Under the Securities Exchange Act of 1934 Unlisted Trading § 240.12f-3 Termination or suspension of unlisted trading privileges. (a) The issuer of any security for which unlisted trading privileges...

  1. 17 CFR 240.17i-8 - Notification provisions for supervised investment bank holding companies. (United States)


    ... obligations of a material affiliate; (5) The supervised investment bank holding company files a Form 8-K... supervised investment bank holding companies. 240.17i-8 Section 240.17i-8 Commodity and Securities Exchanges... Company Rules § 240.17i-8 Notification provisions for supervised investment bank holding companies. (a) A...

  2. 49 CFR 240.209 - Procedures for making the determination on knowledge. (United States)


    ... knowledge. 240.209 Section 240.209 Transportation Other Regulations Relating to Transportation (Continued... determination on knowledge. (a) Each railroad, prior to initially certifying or recertifying any person as an... with the requirements of § 240.125 of this part, demonstrated sufficient knowledge of the railroad's...

  3. 40 CFR 408.240 - Applicability; description of the mechanized clam processing subcategory. (United States)


    ... mechanized clam processing subcategory. 408.240 Section 408.240 Protection of Environment ENVIRONMENTAL... SOURCE CATEGORY Mechanized Clam Processing Subcategory § 408.240 Applicability; description of the mechanized clam processing subcategory. The provisions of this subpart are applicable to discharges resulting...

  4. 17 CFR 240.16a-9 - Stock splits, stock dividends, and pro rata rights. (United States)


    ..., and pro rata rights. 240.16a-9 Section 240.16a-9 Commodity and Securities Exchanges SECURITIES AND... Government Securities Dealers § 240.16a-9 Stock splits, stock dividends, and pro rata rights. The following... acquisition of rights, such as shareholder or pre-emptive rights, pursuant to a pro rata grant to all holders...

  5. 17 CFR 240.17Ad-13 - Annual study and evaluation of internal accounting control. (United States)


    ... internal accounting control. 240.17Ad-13 Section 240.17Ad-13 Commodity and Securities Exchanges SECURITIES... Company Rules § 240.17Ad-13 Annual study and evaluation of internal accounting control. (a) Accountant's... accountant concerning the transfer agent's system of internal accounting control and related procedures for...

  6. 17 CFR 240.13a-20 - Plain English presentation of specified information. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Plain English presentation of specified information. 240.13a-20 Section 240.13a-20 Commodity and Securities Exchanges SECURITIES AND... Regulations Under the Securities Exchange Act of 1934 Other Reports § 240.13a-20 Plain English presentation of...

  7. 17 CFR 240.15d-20 - Plain English presentation of specified information. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Plain English presentation of specified information. 240.15d-20 Section 240.15d-20 Commodity and Securities Exchanges SECURITIES AND... Regulations Under the Securities Exchange Act of 1934 Other Reports § 240.15d-20 Plain English presentation of...

  8. 17 CFR 240.17Ad-21T - Operational capability in a Year 2000 environment. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Operational capability in a Year 2000 environment. 240.17Ad-21T Section 240.17Ad-21T Commodity and Securities Exchanges SECURITIES... Company Rules § 240.17Ad-21T Operational capability in a Year 2000 environment. (a) This section applies...

  9. 17 CFR 240.10b-16 - Disclosure of credit terms in margin transactions. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Disclosure of credit terms in margin transactions. 240.10b-16 Section 240.10b-16 Commodity and Securities Exchanges SECURITIES AND... § 240.10b-16 Disclosure of credit terms in margin transactions. (a) It shall be unlawful for any broker...

  10. 49 CFR 240.213 - Procedures for making the determination on completion of training program. (United States)


    ... completion of training program. 240.213 Section 240.213 Transportation Other Regulations Relating to... making the determination on completion of training program. (a) Each railroad, prior to the initial... documentation showing that: (1) The person completed a training program that complies with § 240.123 of this...

  11. 17 CFR 240.3b-15 - Definition of ancillary portfolio management securities activities. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Definition of ancillary portfolio management securities activities. 240.3b-15 Section 240.3b-15 Commodity and Securities Exchanges... Rules and Regulations Under the Securities Exchange Act of 1934 Definitions § 240.3b-15 Definition of...

  12. 17 CFR 240.13b2-1 - Falsification of accounting records. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Falsification of accounting records. 240.13b2-1 Section 240.13b2-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE... Required Reports § 240.13b2-1 Falsification of accounting records. No person shall directly or indirectly...

  13. 17 CFR 240.3b-13 - Definition of eligible OTC derivative instrument. (United States)


    ... derivative instrument. 240.3b-13 Section 240.3b-13 Commodity and Securities Exchanges SECURITIES AND EXCHANGE... Under the Securities Exchange Act of 1934 Definitions § 240.3b-13 Definition of eligible OTC derivative... derivative instrument means any contract, agreement, or transaction that: (1) Provides, in whole or in part...

  14. 17 CFR 240.14d-4 - Dissemination of tender offers to security holders. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Dissemination of tender offers to security holders. 240.14d-4 Section 240.14d-4 Commodity and Securities Exchanges SECURITIES AND... Regulations Under the Securities Exchange Act of 1934 Regulation 14d § 240.14d-4 Dissemination of tender...

  15. 17 CFR 240.17i-6 - Reporting requirements for supervised investment bank holding companies. (United States)


    ... company regularly provides to the persons responsible for managing risk for the affiliate group that the... supervised investment bank holding companies. 240.17i-6 Section 240.17i-6 Commodity and Securities Exchanges... Company Rules § 240.17i-6 Reporting requirements for supervised investment bank holding companies. (a...

  16. 17 CFR 240.17a-8 - Financial recordkeeping and reporting of currency and foreign transactions. (United States)


    ... and Reports of Certain Stabilizing Activities § 240.17a-8 Financial recordkeeping and reporting of... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Financial recordkeeping and reporting of currency and foreign transactions. 240.17a-8 Section 240.17a-8 Commodity and Securities...

  17. Photoinduced Charge Separation in the Carbon Nano-Onion C60@C240. (United States)

    Voityuk, Alexander A; Solà, Miquel


    The double-shell fullerene C60@C240 formed by inclusion of C60 into C240 is the smallest stable carbon nano-onion. In this article, we analyze in detail the character of the excited states of C60@C240 in terms of exciton localization and charge transfer between the inner and outer shells. The unique structure of the buckyonion leads to a large electrostatic stabilization of charge-separated (CS) states in the C60@C240. As a result, the CS states C60(+)@C240(-) lie in the same region of the electronic spectrum (2.4-2.6 eV) as strongly absorbing locally excited states and, therefore, can be effectively populated. The CS states C60(-)@C240(+) are found to be 0.5 eV higher in energy than the CS states C60(+)@C240(-). Unlike the situation observed in donor-acceptor systems, the energies of the CS states in C60@C240 do not practically depend on the environment polarity. This leads to exceptionally small reorganization energies for electron transfer between the shells. Electronic couplings for photoinduced charge-separation and charge-recombination processes are calculated. The absolute rate of the formation of the CS state C60(+)@C240(-) is estimated at ∼4 ps(-1). The electronic features found in C60@C240 are likely to be shared by other carbon nano-onions.

  18. 17 CFR 240.15c3-3a - Exhibit A-formula for determination reserve requirement of brokers and dealers under § 240.15c3-3. (United States)


    ... determination reserve requirement of brokers and dealers under § 240.15c3-3. 240.15c3-3a Section 240.15c3-3a... Rules Relating to Over-The-Counter Markets § 240.15c3-3a Exhibit A—formula for determination reserve requirement of brokers and dealers under § 240.15c3-3. Credits Debits 1. Free credit balances and other credit...

  19. Manganese determination om minerals by activation analysis, using the californium-252 as a neutron source; Determinacao de manganes em minerios, por analise por ativacao, usando californio-252 como fonte de neutrons

    Energy Technology Data Exchange (ETDEWEB)

    Cardoso, Antonio


    Neutron Activation Analysis, using a Californium-252 neutron source, has been applied for the determination of manganese in ores such as pyrolusite, rodonite (manganese silicate)' and blending used in dry-batteries The favorable nuclear properties of manganese, such as high thermal neutron cross-section for the reaction {sup 55}Mn (n.gamma){sup 56} Mn, high concentration of manganese in the matrix and short half - life of {sup 56}Mn, are an ideal combination for non-destructive analysis of manganese in ores. Samples and standards of manganese dioxide were irradiated for about 20 minutes, followed by a 4 to 15 minutes decay and counted in a single channel pulse-height discrimination using a NaI(Tl) scintillation detector. Counting time was equal to 10 minutes. The interference of nuclear reactions {sup 56}Fe(n,p){sup 56}Mn and {sup 59} Co (n, {alpha}){sup 56} were studied, as well as problems in connection with neutron shadowing during irradiation, gamma-rays attenuation during counting and influence of granulometry of samples. One sample,was also analysed by wet-chemical method (sodium bismuthate) in order to compare results. As a whole, i t was shown that the analytical method of neutron activation for manganese in ores and blending, is a method simple, rapid and with good precision and accuracy. (author)

  20. Design of a homogeneous subcritical nuclear reactor based on thorium with a source of californium 252; Diseno de un reactor nuclear subcritico homogeneo a base de Torio con una fuente de Californio 252

    Energy Technology Data Exchange (ETDEWEB)

    Delgado H, C. E.; Vega C, H. R. [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas, Zac. (Mexico); Sajo B, L., E-mail: [Universidad Simon Bolivar, Laboratorio de Fisica Nuclear, Apdo. 89000, 1080A Caracas (Venezuela, Bolivarian Republic of)


    Full text: One of the energy alternatives to fossil fuels which do not produce greenhouse gases is the nuclear energy. One of the drawbacks of this alternative is the generation of radioactive wastes of long half-life and its relation to the generation of nuclear materials to produce weapons of mass destruction. An option to these drawbacks of nuclear energy is to use Thorium as part of the nuclear fuel which it becomes in U{sup 233} when capturing neutrons, that is a fissile material. In this paper Monte Carlo methods were used to design a homogeneous subcritical reactor based on thorium. As neutron reflector graphite was used. The reactor core is homogeneous and is formed of 70% light water as moderator, 12% of enriched uranium UO{sub 2}(NO{sub 3}){sub 4} and 18% of thorium Th(NO{sub 3}){sub 4} as fuel. To start the nuclear fission chain reaction an isotopic source of californium 252 was used with an intensity of 4.6 x 10{sup 7} s{sup -1}. In the design the value of the effective multiplication factor, whose value turned out k{sub eff} <1 was calculated. Also, the neutron spectra at different distances from the source and the total fluence were calculated, as well as the values of the ambient dose equivalent in the periphery of the reactor. (Author)

  1. 17 CFR 240.14d-9 - Recommendation or solicitation by the subject company and others. (United States)


    ... shall mail a copy of the Schedule to each national securities exchange where the class of securities is... commenced under § 240.14d-2; and (2) The communication is filed under cover of Schedule 14D-9 (§ 240.14d-101.... The box on the front of Schedule 14D-9 (§ 240.14d-101) indicating that the filing contains pre...

  2. 17 CFR 240.12b-5 - Determination of affiliates of banks. (United States)


    ... banks. 240.12b-5 Section 240.12b-5 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION... Securities Exchange Act of 1934 General § 240.12b-5 Determination of affiliates of banks. In determining whether a person is an “affiliate” or “parent” of a bank or whether a bank is a “subsidiary” or “majority...

  3. The B.D.-240 and the Future of the Peralta Community College District. (United States)

    Selo, Peter A.

    This document examines the position of the Peralta Community College District as defined by the Budget Division-240 (B.D.-240), a statistical projection prepared annually by the California Department of Finance which measures the current and future student load on California community college districts. This load is used as an index of the demand…

  4. 33 CFR 96.240 - What functional requirements must a safety management system meet? (United States)


    ... requirements must a safety management system meet? The functional requirements of a safety management system... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false What functional requirements must a safety management system meet? 96.240 Section 96.240 Navigation and Navigable Waters COAST GUARD...

  5. 49 CFR 178.55 - Specification 4B240ET welded or brazed cylinders. (United States)


    ... repairs to longitudinal joints is permitted. (3) Welding procedures and operators must be qualified in... 49 Transportation 2 2010-10-01 2010-10-01 false Specification 4B240ET welded or brazed cylinders... SPECIFICATIONS FOR PACKAGINGS Specifications for Cylinders § 178.55 Specification 4B240ET welded or brazed...

  6. 17 CFR 240.12d2-1 - Suspension of trading. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Suspension of trading. 240... Securities Exchange Act of 1934 Suspension of Trading, Withdrawal, and Striking from Listing and Registration § 240.12d2-1 Suspension of trading. (a) A national securities exchange may suspend from trading a...

  7. 33 CFR 138.240 - Procedure for calculating limit of liability adjustments for inflation. (United States)


    ... of liability adjustments for inflation. 138.240 Section 138.240 Navigation and Navigable Waters COAST... calculating limit of liability adjustments for inflation. (a) Formula for calculating a cumulative percent... every three years from the year the limits of liability were last adjusted for inflation, the Director...

  8. 20 CFR 404.240 - Old-start method-general. (United States)


    ....240 Employees' Benefits SOCIAL SECURITY ADMINISTRATION FEDERAL OLD-AGE, SURVIVORS AND DISABILITY INSURANCE (1950- ) Computing Primary Insurance Amounts Old-Start Method of Computing Primary Insurance Amounts § 404.240 Old-start method—general. If you had all or substantially all your social security...

  9. 17 CFR 240.10A-3 - Listing standards relating to audit committees. (United States)


    ... issuer regarding accounting, internal accounting controls, or auditing matters; and (ii) The confidential... committee under paragraph (b)(4) of this section; and (iii) Ordinary administrative expenses of the audit... audit committees. 240.10A-3 Section 240.10A-3 Commodity and Securities Exchanges SECURITIES AND EXCHANGE...

  10. 17 CFR 240.14d-8 - Exemption from statutory pro rata requirements. (United States)


    ... rata requirements. 240.14d-8 Section 240.14d-8 Commodity and Securities Exchanges SECURITIES AND... rata requirements. Notwithstanding the pro rata provisions of section 14(d)(6) of the Act, if any... taken up and paid for as nearly as may be pro rata, disregarding fractions, according to the number of...

  11. 40 CFR 1068.240 - What are the provisions for exempting new replacement engines? (United States)


    ... engines we regulate under 40 CFR part 1039 with a per-cylinder displacement at or above 7.0 liters. (ii) Marine compression-ignition engines we regulate under 40 CFR part 1042 with a per-cylinder displacement... new replacement engines? 1068.240 Section 1068.240 Protection of Environment ENVIRONMENTAL PROTECTION...

  12. 17 CFR 240.17Ac3-1 - Withdrawal from registration with the Commission. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Withdrawal from registration with the Commission. 240.17Ac3-1 Section 240.17Ac3-1 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) GENERAL RULES AND REGULATIONS, SECURITIES EXCHANGE ACT OF 1934 Rules and Regulations Under the Securities Exchange...

  13. 17 CFR 240.0-3 - Filing of material with the Commission. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Filing of material with the Commission. 240.0-3 Section 240.0-3 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) GENERAL RULES AND REGULATIONS, SECURITIES EXCHANGE ACT OF 1934 Rules and Regulations Under the Securities Exchange Act of 1934 Rules...

  14. 17 CFR 240.12d1-4 - Date of receipt of certification by Commission. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Date of receipt of certification by Commission. 240.12d1-4 Section 240.12d1-4 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) GENERAL RULES AND REGULATIONS, SECURITIES EXCHANGE ACT OF 1934 Rules and Regulations Under the Securities Exchange Act...

  15. 24 CFR 1000.240 - When is a local cooperation agreement required for affordable housing activities? (United States)


    ... housing activities? The requirement for a local cooperation agreement applies only to rental and lease-purchase homeownership units assisted with IHBG funds which are owned by the Indian tribe or TDHE. ... agreement required for affordable housing activities? 1000.240 Section 1000.240 Housing and Urban...

  16. 47 CFR 15.240 - Operation in the band 433.5-434.5 MHz. (United States)


    ... identification number as the device. (e) To prevent interference to Federal Government radar systems, operation... 47 Telecommunication 1 2010-10-01 2010-10-01 false Operation in the band 433.5-434.5 MHz. 15.240... Intentional Radiators Radiated Emission Limits, Additional Provisions § 15.240 Operation in the band 433.5-434...

  17. 17 CFR 240.12b-12 - Requirements as to paper, printing and language. (United States)


    ..., printing and language. 240.12b-12 Section 240.12b-12 Commodity and Securities Exchanges SECURITIES AND... paper, printing and language. (a) Statements and reports shall be filed on good quality, unglazed white... at least 2 points. (d)(1) All Exchange Act filings and submissions must be in the English language...

  18. 49 CFR 240.123 - Criteria for initial and continuing education. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Criteria for initial and continuing education. 240... ENGINEERS Component Elements of the Certification Process § 240.123 Criteria for initial and continuing education. (a) Each railroad's program shall include criteria and procedures for implementing this section...

  19. 17 CFR 240.0-8 - Application of rules to registered broker-dealers. (United States)


    ... registered broker-dealers. 240.0-8 Section 240.0-8 Commodity and Securities Exchanges SECURITIES AND EXCHANGE... registered broker-dealers. Any provision of any rule or regulation under the Act which prohibits any act... business by any broker or dealer registered pursuant to section 15(b) of the Act, or any person acting on...

  20. 9 CFR 2.40 - Attending veterinarian and adequate veterinary care (dealers and exhibitors). (United States)


    ... on problems of animal health, behavior, and well-being is conveyed to the attending veterinarian; (4... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Attending veterinarian and adequate veterinary care (dealers and exhibitors). 2.40 Section 2.40 Animals and Animal Products ANIMAL AND PLANT...

  1. 43 CFR 46.240 - Establishing time limits for the NEPA process. (United States)


    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Establishing time limits for the NEPA process. 46.240 Section 46.240 Public Lands: Interior Office of the Secretary of the Interior... agencies to meet established time frames. (b) Time limits should reflect the availability of Department and...

  2. D2-40 in breast cancer: should we detect more vascular emboli? (United States)

    de Mascarel, Isabelle; MacGrogan, Gaëtan; Debled, Marc; Sierankowski, Ghislaine; Brouste, Véronique; Mathoulin-Pélissier, Simone; Mauriac, Louis


    Peritumoral emboli assessed on hematoxylin-eosin-stained slides are taken into account for treatment of patients with operable breast cancer. We assessed whether immunostaining with D2-40 improves the prognostic significance of emboli in a group of tumors with a large immunohistochemical sampling and a long-term follow-up. Topography, number, and extension of hematoxylin-eosin and D2-40 emboli were compared in 94 node-negative breast cancers (median number of immunostained slides per tumor: 3). Metastasis-free survival of patients with or without hematoxylin-eosin and/or D2-40 emboli were evaluated (median follow-up of 178 months). Hematoxylin-eosin emboli were detected in 14 (15%) tumors and were located at distance from the tumor. D2-40 emboli were detected in 39 (41%) tumors and was often multiple (n=30), extensive (n=23), located within (n=13), close to (n=10) or at distance from the tumor (n=16). The 12 distant hematoxylin-eosin and D2-40 emboli were located in the same vessels (seven missed at the first hematoxylin-eosin examination and secondarily diagnosed by D2-40 staining). A difference in metastasis-free survival was found only between patients with no D2-40 emboli and those with distant D2-40 emboli (P=0.02). D2-40 emboli located within or close to the tumor had no prognostic value. Comparing the metastasis-free survival of patients with or without hematoxylin-eosin emboli, the prognostically unfavorable significance of hematoxylin-eosin emboli was improved when taking into account the seven patients with missed emboli at the first examination and secondarily diagnosed by D2-40 staining (P=0.006 vs 0.003). To conclude, D2-40 increases the diagnostic sensitivity of emboli in breast carcinoma and the high incidence of D2-40 emboli might be related to the number of immunostained slides per case. Nevertheless, only distant D2-40+ emboli had a prognostic impact. In practice, D2-40 might be useful to detect missed hematoxylin-eosin emboli especially in cases

  3. Human triosephosphate isomerase deficiency resulting from mutation of Phe-240

    Energy Technology Data Exchange (ETDEWEB)

    Minling Chang; Xiaoyun Wu; Maquat, L.E. (Roswell Park Cancer Inst., Buffalo, NY (United States)); Artymiuk, P.J. (Univ. of Sheffield (United Kingdom)); Hollan, S. (National Inst. of Hematology and Blood Transfusion, Budapest (Hungary)); Lammi, A. (Children' s Hospital, Sydney (Australia))


    Triosephosphate isomerase (TPI; D-glyceraldehyde-3-phosphate ketolisomerase [E.C.]) deficiency is an autosomal recessive disorder that typically results in chronic, nonspherocytic hemolytic anemia and in neuromuscular impairment. The molecular basis of this disease was analyzed for one Hungarian family and for two Australian families by localizing the defects in TPI cDNA and by determining how each defect affects TPI gene expression. The Hungarian family is noteworthy in having the first reported case of an individual, A. Jo., who harbors two defective TPI alleles but who does not manifest neuromuscular disabilities. This family was characterized by two mutations that have never been described. One is a missense mutation within codon 240 (TTC [Phe][r arrow]CTC [Leu]), which creates a thermolabile protein, as indicated by the results of enzyme activity assays using cell extracts. This substitution, which changes a phylogenetically conserved amino acid, may affect enzyme activity by dusrupting intersubunit contacts or substrate binding, as deduced from enzyme structural studies. The other mutation has yet to be localized but reduces the abundance of TPI mRNA 10--20-fold. Each of the Australian families was characterized by a previously described mutation within codon 104 (GAG [Glu][r arrow]GAC [Asp]), which also results in thermolabile protein. 49 refs., 6 figs., 1 tab.

  4. Restaurant No. 1 seating capacity increases by 240

    CERN Multimedia

    Laëtitia Pedroso


    These days you need patience when looking for a seat in Restaurant No. 1 to eat your lunch. The opening of the new dining room, which will increase the restaurant’s seating capacity by 240, should alleviate the problem and improve service.   The new restaurant area. For the past several years the number of people using Restaurant No. 1 has grown steadily. Now, for a change, the restaurant itself is growing. Luz Lopez-Hernandez, leader of the project in the GS Department, explains: “Enlarging the restaurant has been on the GS Department's agenda for several years, but the project really got off the ground in 2009. Once it was approved and the design completed, construction itself only took seven months.” Seven months later, the restaurant extension is indeed on the verge of opening. One of the people who will be particularly happy is Joël Nallet, who manages the Novae restaurant: “I am thrilled, because until now, even if we managed to increase...

  5. Detection of lymphovascular invasion by D2-40 (podoplanin) immunoexpression in endometrial cancer. (United States)

    Weber, Sarah K; Sauerwald, Axel; Pölcher, Martin; Braun, Michael; Debald, Manuel; Serce, Nuran Bektas; Kuhn, Walther; Brunagel-Walgenbach, Giesela; Rudlowski, Christian


    Lymph node involvement is a major feature in tumor spread of endometrial cancer and predicts prognosis. Therefore, evaluation of lymph vessel invasion (LVI) in tumor tissue as a predictor for lymph node metastasis is of great importance. Immunostaining of D2-40 (podoplanin), a specific marker for lymphatic endothelial cells, might be able to increase the detection rate of LVI compared with conventional hematoxylin-eosin (H-E) staining. The aim of this retrospective study was to analyze the eligibility of D2-40-based LVI evaluation for the prediction of lymph node metastases and patients' outcome. Immunohistochemical staining with D2-40 monoclonal antibodies was performed on paraffin-embedded tissue sections of 182 patients with primary endometrioid adenocarcinoma treated in 1 gynecologic cancer center. Tumors were screened for the presence of LVI. Correlations with clinicopathological features and clinical outcome were assessed. Immunostaining of D2-40 significantly increased the frequency LVI detection compared with conventional H-E staining. Lymph vessel invasion was identified by D2-40 in 53 (29.1%) of 182 tumors compared with 34 (18.3%) of 182 carcinomas by routine H-E staining (P = 0.001). D2-40 LVI was detectable in 81.0% (17/21) of nodal-positive tumors and significantly predicted lymph node metastasis (P = 0.001). Furthermore, D2-40 LVI was an independent prognostic factor for patients overall survival considering tumor stage, lymph node involvement, and tumor differentiation (P < 0.01). D2-40-negative tumors confined to the inner half of the myometrium showed an excellent outcome (5-year overall survival, 97.8%). D2-40-based LVI assessment improves the histopathological detection of lymphovascular invasion in endometrial cancer. Furthermore, LVI is of prognostic value and predicts lymph node metastasis. D2-40 LVI detection might help to select endometrial cancer patients who will benefit from a lymphadenectomy.

  6. Inhibition of ACCase220 and ACCase240 isozymes from sethoxydim-resistant and -susceptible maize hybrids. (United States)

    Incledon, B J; Hall, J C


    Acetyl-coenzyme A carboxylase (ACCase) isozymes were separated from cyclohexanedione-resistant and -susceptible maize. ACCase240 from resistant maize was 3.7-, >77-, and 12.8-fold more resistant to inhibition by clethodim, sethoxydim, and tralkoxydim, respectively, than ACCase240 from susceptible maize. The resistant ACCase240 preparation had 3.0-fold more protein and 14.5-fold lower specific activity than susceptible ACCase240. Resistant ACCase240 has a V(max) 5.5-fold lower than that of susceptible ACCase240, whereas apparent K(m) values were similar. ACCase220 from resistant maize was >25- and 7.2-fold more resistant to inhibition by sethoxydim and tralkoxydim, respectively, than susceptible ACCase220 but was inhibited to the same extent by clethodim. In summary, sethoxydim-resistant corn has an altered herbicide-resistant ACCase220 isozyme and increased expression of a less efficient, herbicide-resistant ACCase240 isozyme. However, to what extent alteration of both isozymes contributes to sethoxydim resistance is not clear.

  7. Lactobacillus pentosus strain b240 suppresses pneumonia induced by Streptococcus pneumoniae in mice. (United States)

    Tanaka, A; Seki, M; Yamahira, S; Noguchi, H; Kosai, K; Toba, M; Morinaga, Y; Miyazaki, T; Izumikawa, K; Kakeya, H; Yamamoto, Y; Yanagihara, K; Tashiro, T; Kohda, N; Kohno, S


    Oral administration of probiotics has been known to improve inflammatory responses against infectious diseases. Here, we describe the inhibitory effect of oral intake of heat-killed Lactobacillus pentosus strain b240 (b240) on pneumococcal pneumonia in a murine experimental model.  The mice treated with oral b240 for 21 days before Streptococcus pneumoniae infection exhibited prolonged survival time and less body weight loss, compared with saline-treated control mice. Mild pneumonia with significantly reduced secretion of inflammatory cytokines/chemokines according to related mitogen-activated protein kinase signalling molecules (phosphorylated c-Jun N-terminal kinase) was found in b240-treated mice, whereas severe pneumonia with hypercytokinemia was evident in control mice. Prominent reduction in the number of pneumococci and elevated expression of Toll-like receptor 2 and 4 in the lung tissues was concomitantly noted in b240-treated mice. These findings indicate that b240 has inhibitory effects on pneumococcal pneumonia induced by Strep. pneumoniae infection and improves inflammatory tissue responses, resulting in reduced damages to the respiratory tissues. These results demonstrate that oral administration of b240 might protect host animals from Strep. pneumoniae infection by augmentation of innate immune response. © 2011 The Authors. Letters in Applied Microbiology © 2011 The Society for Applied Microbiology.

  8. 17 CFR 240.10b5-2 - Duties of trust or confidence in misappropriation insider trading cases. (United States)


    ... in misappropriation insider trading cases. 240.10b5-2 Section 240.10b5-2 Commodity and Securities... Devices and Contrivances § 240.10b5-2 Duties of trust or confidence in misappropriation insider trading... of insider trading under Section 10(b) of the Act and Rule 10b-5. The law of insider trading is...

  9. 49 CFR 240.115 - Criteria for consideration of prior safety conduct as a motor vehicle operator. (United States)


    ... CERTIFICATION OF LOCOMOTIVE ENGINEERS Component Elements of the Certification Process § 240.115 Criteria for... 49 Transportation 4 2010-10-01 2010-10-01 false Criteria for consideration of prior safety conduct as a motor vehicle operator. 240.115 Section 240.115 Transportation Other Regulations Relating to...

  10. 17 CFR 240.19c-3 - Governing off-board trading by members of national securities exchanges. (United States)


    ... members of national securities exchanges. 240.19c-3 Section 240.19c-3 Commodity and Securities Exchanges... Members § 240.19c-3 Governing off-board trading by members of national securities exchanges. The rules of each national securities exchange shall provide as follows: (a) No rule, stated policy or practice of...

  11. 17 CFR 240.19c-5 - Governing the multiple listing of options on national securities exchanges. (United States)


    ... of options on national securities exchanges. 240.19c-5 Section 240.19c-5 Commodity and Securities... of Exchange Members § 240.19c-5 Governing the multiple listing of options on national securities exchanges. (a) The rules of each national securities exchange that provides a trading market in standardized...

  12. 49 CFR Appendix B to Part 240 - Procedures for Submission and Approval of Locomotive Engineer Qualification Programs (United States)


    ... Locomotive Engineer Qualification Programs B Appendix B to Part 240 Transportation Other Regulations Relating... QUALIFICATION AND CERTIFICATION OF LOCOMOTIVE ENGINEERS Pt. 240, App. B Appendix B to Part 240—Procedures for Submission and Approval of Locomotive Engineer Qualification Programs This appendix establishes procedures...

  13. 17 CFR 240.15c3-3 - Customer protection-reserves and custody of securities. (United States)


    ... and custody of securities. 240.15c3-3 Section 240.15c3-3 Commodity and Securities Exchanges SECURITIES... Markets § 240.15c3-3 Customer protection—reserves and custody of securities. (a) Definitions. For the...) Notwithstanding paragraph (k)(2)(i) of this section, a broker or dealer that retains custody of securities that...

  14. 17 CFR 240.17i-3 - Withdrawal from supervision by the Commission as a supervised investment bank holding company. (United States)


    ... material risks to the supervised investment bank holding company and to any associated person of the... the Commission as a supervised investment bank holding company. 240.17i-3 Section 240.17i-3 Commodity... Investment Bank Holding Company Rules § 240.17i-3 Withdrawal from supervision by the Commission as a...

  15. 17 CFR 240.15g-2 - Penny stock disclosure document relating to the penny stock market. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Penny stock disclosure document relating to the penny stock market. 240.15g-2 Section 240.15g-2 Commodity and Securities Exchanges... Section 15(d) of the Act § 240.15g-2 Penny stock disclosure document relating to the penny stock market...

  16. 17 CFR 240.15b7-1 - Compliance with qualification requirements of self-regulatory organizations. (United States)


    ... § 240.15b7-1 Compliance with qualification requirements of self-regulatory organizations. No registered... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Compliance with qualification requirements of self-regulatory organizations. 240.15b7-1 Section 240.15b7-1 Commodity and Securities Exchanges...

  17. 17 CFR 240.15a-2 - Exemption of certain securities of cooperative apartment houses from section 15(a). (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Exemption of certain securities of cooperative apartment houses from section 15(a). 240.15a-2 Section 240.15a-2 Commodity and... Securities from Section 15(a) § 240.15a-2 Exemption of certain securities of cooperative apartment houses...

  18. 17 CFR 240.15Ca1-1 - Notice of government securities broker-dealer activities. (United States)


    ... securities broker-dealer activities. 240.15Ca1-1 Section 240.15Ca1-1 Commodity and Securities Exchanges... Brokers and Government Securities Dealers § 240.15Ca1-1 Notice of government securities broker-dealer activities. (a) Every government securities broker or government securities dealer that is a broker or dealer...

  19. 17 CFR 240.15Ca2-3 - Registration of successor to registered government securities broker or government securities... (United States)


    ... registered government securities broker or government securities dealer. 240.15Ca2-3 Section 240.15Ca2-3... Registration of Government Securities Brokers and Government Securities Dealers § 240.15Ca2-3 Registration of successor to registered government securities broker or government securities dealer. (a) In the event that...

  20. 17 CFR 240.15b11-1 - Registration by notice of security futures product broker-dealers. (United States)


    ... security futures product broker-dealers. 240.15b11-1 Section 240.15b11-1 Commodity and Securities Exchanges... Rules and Regulations Under the Securities Exchange Act of 1934 Registration of Brokers and Dealers § 240.15b11-1 Registration by notice of security futures product broker-dealers. (a) A broker or dealer...

  1. 7 CFR 240.6 - Funds for States which have phased out facilities. (United States)


    ... NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS CASH IN LIEU OF DONATED FOODS § 240.6... of meals served in the current school year, rather than on the number of meals served in the...

  2. 17 CFR 240.17a-1 - Recordkeeping rule for national securities exchanges, national securities associations... (United States)


    ... national securities exchanges, national securities associations, registered clearing agencies and the... Certain Stabilizing Activities § 240.17a-1 Recordkeeping rule for national securities exchanges, national...) Every national securities exchange, national securities association, registered clearing agency and the...

  3. Kasiinomeistri Playtechi omanikud müüvad aktsiaid 240 miljoni dollari eest

    Index Scriptorium Estoniae


    Iisraeli ärilehe Globes andmeil müüvad internetikasiinode arendamise ja haldamisega tegeleva Playtechi omanikud esmase avaliku müügi käigus aktsiaid 240 milj. USA dollari eest. Lisa: Kasumlik äritegevus

  4. 40 CFR 60.240 - Applicability and designation of affected facility. (United States)


    ... Performance for the Phosphate Fertilizer Industry: Granular Triple Superphosphate Storage Facilities § 60.240... subpart apply is each granular triple superphosphate storage facility. For the purpose of this subpart...

  5. The clinical significance of the tumor cell D2-40 immunoreactivity in non-small cell lung cancer. (United States)

    Kadota, Kyuichi; Huang, Cheng-Long; Liu, Dage; Nakashima, Nariyasu; Yokomise, Hiroyasu; Ueno, Masaki; Haba, Reiji


    A monoclonal antibody D2-40 has been widely used for tumor lymphangiogenesis and lymphatic vessel invasion (LVI) in human cancers. However, the clinical significance of the tumor cell D2-40 immunoreactivity has not been clearly understood. We evaluated the tumor cell D2-40 immunoreactivity in non-small cell lung cancer (NSCLC). One hundred and forty-seven NSCLC patients were investigated. Immunohistochemistry using D2-40 was performed to evaluate the tumor cell D2-40 immunoreactivity, micro-lymphatic vessel density (Micro-LVD) and LVI. The intratumoral microvessels density (MVD) was evaluated by the CD34-immunostaining, and tumor proliferation was evaluated by the Ki-67-immunostaining. The percentage of D2-40-positive tumor cells was significantly higher in squamous cell carcinomas than in adenocarcinomas (P<0.0001), and all D2-40-strong tumors were squamous cell carcinomas. The percentage of D2-40-strong tumors was significantly higher in moderately to poorly differentiated tumors than in well-differentiated tumors (P=0.0332). Furthermore, the Ki-67 proliferation index in D2-40-strong tumors was significantly the highest. However, the tumor cell D2-40 immunoreactivity was not associated with Micro-LVD, LVI, or MVD. Regarding the patient survival, the overall survival was significantly lower in patients with D2-40-strong tumors than in patients with D2-40-negative or D2-40-weak tumors (P=0.0005). Multivariate analyses also revealed the tumor cell D2-40 immunoreactivity to be a significant prognostic factor of poor prognosis for NSCLC patients (P=0.0007). The D2-40 immunostaining is useful to identify aggressive squamous cell carcinomas of the lung. Copyright 2009 Elsevier Ireland Ltd. All rights reserved.

  6. High-/sup 240/Pu sector experiments in ZPPR assembly 4

    Energy Technology Data Exchange (ETDEWEB)

    McFarlane, H F; Beck, C L


    The complete high-/sup 240/Pu fuel experiment in ZPPR assembly 4 is reviewed. Results of criticality, enrichment, small-sample perturbation, sodium void, /sup 238/U Doppler, control rod substitution and reaction rate measurements are presented. Comparison of these measured values with calculated results are included where possible. The relationship between the ZPPR high-/sup 240/Pu fuel experiments and the results obtained in previous critical experience is considered.

  7. 17 CFR 240.15c1-8 - Sales at the market. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Sales at the market. 240.15c1... Securities Exchange Act of 1934 Rules Relating to Over-The-Counter Markets § 240.15c1-8 Sales at the market... securities exchange that such security is being offered to such customer “at the market” or at a price...

  8. 17 CFR 240.15c3-1e - Deductions for market and credit risk for certain brokers or dealers (Appendix E to 17 CFR 240... (United States)


    ... compliance, and operational risks, and how that system satisfies the requirements of § 240.15c3-4; and (xiii... is in compliance with other applicable rules promulgated under the Act and by self-regulatory..., the broker's or dealer's compliance with its internal risk management controls, and the ultimate...

  9. Towards saturation of the electron-capture delayed fission probability: The new isotopes 240Es and 236Bk

    Directory of Open Access Journals (Sweden)

    J. Konki


    Full Text Available The new neutron-deficient nuclei 240Es and 236Bk were synthesised at the gas-filled recoil separator RITU. They were identified by their radioactive decay chains starting from 240Es produced in the fusion–evaporation reaction 209Bi(34S,3n240Es. Half-lives of 6(2s and 22−6+13s were obtained for 240Es and 236Bk, respectively. Two groups of α particles with energies Eα=8.19(3MeV and 8.09(3MeV were unambiguously assigned to 240Es. Electron-capture delayed fission branches with probabilities of 0.16(6 and 0.04(2 were measured for 240Es and 236Bk, respectively. These new data show a continuation of the exponential increase of ECDF probabilities in more neutron-deficient isotopes.

  10. 17 CFR 240.15b7-3T - Operational capability in a Year 2000 environment. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Operational capability in a Year 2000 environment. 240.15b7-3T Section 240.15b7-3T Commodity and Securities Exchanges SECURITIES... § 240.15b7-3T Operational capability in a Year 2000 environment. (a) This section applies to every...

  11. 17 CFR 240.15b1-3 - Registration of successor to registered broker or dealer. (United States)


    ... registered broker or dealer. 240.15b1-3 Section 240.15b1-3 Commodity and Securities Exchanges SECURITIES AND... Regulations Under the Securities Exchange Act of 1934 Registration of Brokers and Dealers § 240.15b1-3 Registration of successor to registered broker or dealer. (a) In the event that a broker or dealer succeeds to...

  12. The IMM Face Database - An Annotated Dataset of 240 Face Images

    DEFF Research Database (Denmark)

    Nordstrøm, Michael M.; Larsen, Mads; Sierakowski, Janusz

    This note describes a dataset consisting of 240 annotated monocular images of 40 different human faces. Points of correspondence are placed on each image so the dataset can be readily used for building statistical models of shape. Format specifications and terms of use are also given in this note....

  13. 17 CFR 240.14a-16 - Internet availability of proxy materials. (United States)


    ... holder to access and review the proxy materials before voting; (3) The Internet Web site address where... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Internet availability of proxy... Under the Securities Exchange Act of 1934 Regulation 14a: Solicitation of Proxies § 240.14a-16 Internet...

  14. 6 CFR 27.240 - Review and approval of security vulnerability assessments. (United States)


    ... CHEMICAL FACILITY ANTI-TERRORISM STANDARDS Chemical Facility Security Program § 27.240 Review and approval of security vulnerability assessments. (a) Review and Approval. The Department will review and... 6 Domestic Security 1 2010-01-01 2010-01-01 false Review and approval of security vulnerability...

  15. Computational exploration of Fe55@C240-catalyzed Fischer-Tropsch synthesis. (United States)

    Cilpa-Karhu, Geraldine; Laasonen, Kari


    Single-shell carbon-encapsulated iron nanoparticles (SCEINs), Fe@C, have been shown to be charge-transfer complexes that can act as effective catalysts in the hydrogen and oxygen evolution reactions. A new generation of Fe-based catalysts for Fischer-Tropsch synthesis (FTS) which resembles SCEINs, e.g. single carbide nanoparticles encapsulated in carbon shells, has demonstrated enhanced activity and stability for FTS as compared to other carbon-supported Fe-based FTS. Thus the catalytic ability of SCEINs for the water splitting reactions and the Fe-based FTS catalyst with SCEINs-like features stimulated our exploration of SCEINs-catalyzed FTS. We performed ab initio DFT calculations using a realistic SCEINs model system Fe55@C240 to investigate for the first time the adsorption of the main reactants in FTS (CO and H/H2) and further to evaluate the catalytic ability of Fe55@C240 by reproducing the key steps of the well-known Fe-based FTS mechanisms (carbide, enol and CO insertion). Our calculations revealed: (i) a determinant role of Fe in enhancing CO adsorption (ii) strong cooperative effects with the adsorbates that stabilize the binding (iii) a less favourable two-sites reaction on Fe55@C240 due to preferential positions of the reactants farther to each other which prevent enol and carbide FTS mechanisms. We propose therefore a possible CO insertion path for hydrocarbon growth on Fe55@C240.

  16. 17 CFR 240.11a-1 - Regulation of floor trading. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Regulation of floor trading... Securities Exchange Act of 1934 Adoption of Floor Trading Regulation (rule 11a-1) § 240.11a-1 Regulation of floor trading. (a) No member of a national securities exchange, while on the floor of such exchange...

  17. Volikogu kergitas kruntide alghinna Olümpia vastas 240 miljoni kroonini / Askur Alas

    Index Scriptorium Estoniae

    Alas, Askur, 1973-


    Tallinna linnavolikogu tõstis 26. jaanuari istungil Juhkentali 1b, 3d ja 3e kruntide avaliku enampakkumise alghinna 78 miljonilt kroonilt 240 miljonile. Kruntidele on lubatud ehitada üks kuni 30-korruseline ning mitu 3-8 korruselist hoonet. Kaart: Ala detailplaneering

  18. Pu-239+240 and Cs-137 in Montenegro soil: their correlation and origin. (United States)

    Antovic, Nevenka M; Vukotic, Perko; Svrkota, Nikola; Andrukhovich, Sergey K


    The (239+240)Pu activity concentrations in soil from Montenegro (six samples from three localities) have been measured for the first time. The alpha and gamma-spectrometric measurements are used to determine the (239+240)Pu/(137)Cs activity ratio, and it was found to be with an average of 0.02 and standard deviation of 0.007. This average activity ratio was applied to estimate (239+240)Pu in soil samples from the other 21 localities at which (137)Cs activity concentrations were measured. In this research obtained (either experimentally or estimated) (239+240)Pu activity concentrations (0.036-8.265 Bq kg(-1)) are comparable with those measured in some other European countries. On the basis of the results obtained in the present study and a survey of relevant literature, it is possible to conclude that Chernobyl contribution to (137)Cs contamination of Montenegro soils is dominant, whilst Pu contamination comes from the global fallout of nuclear weapon tests. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. 17 CFR 240.14a-4 - Requirements as to proxy. (United States)


    ... persons making the solicitation do not know, a reasonable time before the solicitation, are to be... elected. Provided, however, That nothing in this section 240.14a-4 shall prevent any person soliciting in... authority to vote for nominees named in the registrant's proxy statement, so long as the soliciting party...

  20. 42 CFR 438.240 - Quality assessment and performance improvement program. (United States)


    ... 42 Public Health 4 2010-10-01 2010-10-01 false Quality assessment and performance improvement... Performance Improvement Measurement and Improvement Standards § 438.240 Quality assessment and performance... PIHP have an ongoing quality assessment and performance improvement program for the services it...

  1. High-/sup 240/Pu fuel worth in the Fast Test Reactor Engineering Mockup

    Energy Technology Data Exchange (ETDEWEB)

    Daughtry, J.W.; Dobbin, K.D.


    Reactivity effects associated with the replacement of low-/sup 240/Pu fuel with high-/sup 240/Pu fuel were calculated and compared to measurements made in the FTR Engineering Mockup Critical (EMC). When the Pu and U isotopic compositions were changed in a way that increased the amounts of /sup 240/Pu and /sup 241/Pu and reduced the amounts of /sup 239/Pu and /sup 238/U while conserving total fissile mass and total fertile mass, the reactivity effect was positive. Calculation-to-experiment bias factors were obtained for this type of change and for the replacement of Fe/sub 2/O/sub 3/ with U/sub 3/O/sub 8/ in subassembly-size zones of the EMC. The k/sub e/--k/sub c/ bias decreased when high-/sup 240/Pu fuel was introduced and increased when Fe/sub 2/O/sub 3/ was replaced with U/sub 3/O/sub 8/. When the two changes were combined, their effects on the k/sub e/ --k/sub c/ bias tended to cancel out. The work described is related to plans for the utilization of light water reactor discharge Pu in the FTR.

  2. 17 CFR 240.13d-1 - Filing of Schedules 13D and 13G. (United States)


    ... not be necessary to file a Schedule 13G unless the percentage of the class of equity security... of the class of equity securities prior to the end of the calendar year, the initial Schedule 13G... a class of equity securities in a statement on Schedule 13G (§ 240.13d-102) pursuant to paragraph (b...

  3. Presence of plutonium isotopes, {sup 239}Pu and {sup 240}Pu, in soils from Chile

    Energy Technology Data Exchange (ETDEWEB)

    Chamizo, E., E-mail: [Centro Nacional de Aceleradores, Avda. Thomas Alba Edison, 7, 41092 Sevilla (Spain); Garcia-Leon, M., E-mail: [Departamento de Fisica Atomica, Molecular y Nuclear, Universidad de Sevilla, Avda. Reina Mercedes sn, 41012 Seville (Spain); Peruchena, J.I., E-mail: [Centro Nacional de Aceleradores, Avda. Thomas Alba Edison, 7, 41092 Sevilla (Spain); Cereceda, F., E-mail: [Laboratorio de Quimica Ambiental, Centro de Tecnologias Ambientales (CETAM), Universidad Tecnica Federico Santa Maria, Casilla 110-V, Valparaiso (Chile); Vidal, V., E-mail: [Laboratorio de Quimica Ambiental, Centro de Tecnologias Ambientales (CETAM), Universidad Tecnica Federico Santa Maria, Casilla 110-V, Valparaiso (Chile); Pinilla, E., E-mail: [Departamento de Quimica Analitica, Facultad de Ciencias, Universidad de Extremadura, Avda. de Elvas sn, 06071 Badajoz (Spain); Miro, C., E-mail: [Departamento de Fisica Aplicada, Universidad de Extremadura, Avda. de la Universidad sn, 10071 Caceres (Spain)


    Plutonium is present in every environmental compartment, due to a variety of nuclear activities. The Southern Hemisphere has received about 20% of the global {sup 239}Pu and {sup 240}Pu environmental inventory, with an important contribution of the so-called tropospheric fallout from both the atmospheric nuclear tests performed in the French Polynesia and in Australia by France and United Kingdom, respectively. In this work we provide new data on the impact of these tests to South America through the study of {sup 239}Pu and {sup 240}Pu in soils from different areas of Northern, Central and Southern Chile. The obtained results point out to the presence of debris from the French tests in the 20-40 Degree-Sign Southern latitude range, with {sup 240}Pu/{sup 239}Pu atomic ratios quite heterogeneous and ranging from 0.02 to 0.23. They are significantly different from the expected one for the global fallout in the Southern Hemisphere for the 30-53 Degree-Sign S latitude range (0.185 {+-} 0.047), but they follow the same trend as the reported values by the Department of Energy of United States for other points with similar latitudes. The {sup 239+240}Pu activity inventories show as well a wider variability range in that latitude range, in agreement with the expected heterogeneity of the contamination.

  4. Improved MOX fuel calculations using new Pu-239, Am-241 and Pu-240 evaluations


    Schillebeeckx P.; Leal L.; De Saint Jean C.; Vidal J.F.; Peneliau Y.; Blaise P.; Leconte P.; Bernard D.; Bouland O.; Noguere G.; Kopecky S.; Lampoudis C.


    Several studies based on the JEFF-3.1.1 nuclear data library show a systematic overestimation of the critical keff for core configurations of MOX fuel assemblies. The present work investigates possible improvements of the C/E results by using new evaluations for Am-241, Pu-239 and Pu-240.

  5. Improved MOX fuel calculations using new Pu-239, Am-241 and Pu-240 evaluations (United States)

    Noguere, G.; Bouland, O.; Bernard, D.; Leconte, P.; Blaise, P.; Peneliau, Y.; Vidal, J. F.; De Saint Jean, C.; Leal, L.; Schillebeeckx, P.; Kopecky, S.; Lampoudis, C.


    Several studies based on the JEFF-3.1.1 nuclear data library show a systematic overestimation of the critical keff for core configurations of MOX fuel assemblies. The present work investigates possible improvements of the C/E results by using new evaluations for Am-241, Pu-239 and Pu-240.

  6. Improved MOX fuel calculations using new Pu-239, Am-241 and Pu-240 evaluations

    Directory of Open Access Journals (Sweden)

    Schillebeeckx P.


    Full Text Available Several studies based on the JEFF-3.1.1 nuclear data library show a systematic overestimation of the critical keff for core configurations of MOX fuel assemblies. The present work investigates possible improvements of the C/E results by using new evaluations for Am-241, Pu-239 and Pu-240.

  7. 17 CFR 240.3b-14 - Definition of cash management securities activities. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Definition of cash management... Under the Securities Exchange Act of 1934 Definitions § 240.3b-14 Definition of cash management securities activities. The term cash management securities activities means securities activities that are...

  8. 17 CFR 240.14a-3 - Information to be furnished to security holders. (United States)


    ... report shall contain information relating to the registrant's industry segments, classes of similar... holders, proxy statement or Notice of Internet Availability of Proxy Materials, as described in § 240.14a... report to security holders, proxy statement or Notice of Internet Availability of Proxy Materials, as...

  9. 7 CFR 2.40 - Deputy Under Secretary for Farm and Foreign Agricultural Services. (United States)


    ... the Under Secretary for Farm and Foreign Agricultural Services § 2.40 Deputy Under Secretary for Farm... made to the Deputy Under Secretary for Farm and Foreign Agricultural Services, to be exercised only... 7 Agriculture 1 2010-01-01 2010-01-01 false Deputy Under Secretary for Farm and Foreign...

  10. 17 CFR 240.16b-7 - Mergers, reclassifications, and consolidations. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Mergers, reclassifications...) § 240.16b-7 Mergers, reclassifications, and consolidations. (a) The following transactions shall be..., pursuant to a merger, reclassification or consolidation, in exchange for a security of a company that...

  11. 17 CFR 240.16a-3 - Reporting transactions and holdings. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Reporting transactions and... Dealers § 240.16a-3 Reporting transactions and holdings. (a) Initial statements of beneficial ownership of... beneficial ownership required by that section shall be filed on Form 4. Annual statements shall be filed on...

  12. 17 CFR 240.16b-3 - Transactions between an issuer and its officers or directors. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Transactions between an issuer... Rules and Regulations Under the Securities Exchange Act of 1934 Exemption of Certain Transactions from Section 16(b) § 240.16b-3 Transactions between an issuer and its officers or directors. (a) General. A...

  13. An Evaluation of an LCD Display With 240 Hz Frame Rate for Visual Psychophysics Experiments. (United States)

    Shi, Lin


    Recently, a few LCD displays with 240 Hz frame rate have appeared on the market. I evaluated a LCD display with 240 Hz frame rate in terms of its temporal characteristics, progression between frames, and chromatic characteristics. The display showed (a) accurate frame durations at millisecond level, (b) gradual transition between adjacent frames, and (c) acceptable chromatic characteristics.

  14. 17 CFR 240.3a12-1 - Exemption of certain mortgages and interests in mortgages. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Exemption of certain mortgages and interests in mortgages. 240.3a12-1 Section 240.3a12-1 Commodity and Securities Exchanges... Exemption of certain mortgages and interests in mortgages. Mortgages, as defined in section 302(d) of the...

  15. 17 CFR 240.17Ad-18 - Year 2000 Reports to be made by certain transfer agents. (United States)


    ... software designed to address Year 2000 Problems (including testing with other transfer agents, other... software that will address Year 2000 Problems; (5) Whether the transfer agent has written contingency plans... by certain transfer agents. 240.17Ad-18 Section 240.17Ad-18 Commodity and Securities Exchanges...

  16. 17 CFR 240.3a12-8 - Exemption for designated foreign government securities for purposes of futures trading. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Exemption for designated foreign government securities for purposes of futures trading. 240.3a12-8 Section 240.3a12-8 Commodity and... trading. (a) When used in this Rule, the following terms shall have the meaning indicated: (1) The term...

  17. 17 CFR 240.19c-1 - Governing certain off-board agency transactions by members of national securities exchanges. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Governing certain off-board agency transactions by members of national securities exchanges. 240.19c-1 Section 240.19c-1 Commodity... members of national securities exchanges. The rules of each national securities exchange shall provide as...

  18. 17 CFR 240.14e-7 - Unlawful tender offer practices in connection with roll-ups. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Unlawful tender offer practices in connection with roll-ups. 240.14e-7 Section 240.14e-7 Commodity and Securities Exchanges... tender offer practices in connection with roll-ups. In order to implement section 14(h) of the Act (15 U...

  19. 17 CFR 240.0-10 - Small entities under the Securities Exchange Act for purposes of the Regulatory Flexibility Act. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Small entities under the Securities Exchange Act for purposes of the Regulatory Flexibility Act. 240.0-10 Section 240.0-10 Commodity... Regulatory Flexibility Act. For purposes of Commission rulemaking in accordance with the provisions of...

  20. 33 CFR 148.240 - How does a State or a person intervene in a formal hearing? (United States)


    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false How does a State or a person intervene in a formal hearing? 148.240 Section 148.240 Navigation and Navigable Waters COAST GUARD... issues; and (3) Designate the name and address of a person who can be served if the petition is granted...

  1. 17 CFR 240.17a-23 - Recordkeeping and reporting requirements relating to broker-dealer trading systems. (United States)


    ... requirements relating to broker-dealer trading systems. 240.17a-23 Section 240.17a-23 Commodity and Securities... relating to broker-dealer trading systems. (a) Scope of section. This section shall apply to any registered broker or dealer that acts as the sponsor of a broker-dealer trading system. (b) Definitions. For...

  2. 17 CFR 240.3a4-1 - Associated persons of an issuer deemed not to be brokers. (United States)


    ... issuer deemed not to be brokers. 240.3a4-1 Section 240.3a4-1 Commodity and Securities Exchanges... Associated persons of an issuer deemed not to be brokers. (a) An associated person of an issuer of securities shall not be deemed to be a broker solely by reason of his participation in the sale of the securities...

  3. Large particle flux of 239+240Pu on the continental margin of the East China Sea

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Masatoshi; Aono, Tatsuo [Nakaminato Laboratory for Marine Radioecology, Environmental Radiation Protection Research Group, Research Center for Radiation Safety, National Institute of Radiological Sciences, Isozaki 3609, Hitachinaka, 311-1202 Ibaraki (Japan)


    Settling particles were collected from three locations in the East China Sea continental margin and analyzed for 239+240Pu. Two types of sediment traps were used, cylindrical traps and conical time-series traps. Surface sediment samples collected from five locations were also analyzed for 239+240Pu. Data from cylindrical traps showed there was a clear tendency for total mass fluxes to increase with depth at all three stations, and there was an especially large increase near the bottom. 239+240Pu concentrations in settling particles increased with depth from 1.76 mBq/g at 97-m depth to 3.00 mBq/g at 120-m depth and ranged from approximately 3 to 4 mBq/g at depths greater than 120 m. 239+240Pu concentrations collected in the near-bottom traps were approximately two times higher than those in the underlying surface sediments. Like total mass fluxes there was a clear tendency for 239+240Pu fluxes to increase with depth at every station, and the highest 239+240Pu fluxes were observed near the bottom. 239+240Pu concentrations in the time-series traps had little variation throughout the sampling period, though the total mass fluxes showed a large variation. A high variability of 239+240Pu fluxes occurred in very short period of time (1/2 day). The large fluxes of 239+240Pu might be attributed to episodic lateral transport of particles that flow down the continental slope with the nepheloid layer which was considered to be significant for 239+240Pu transport on the continental slope in the East China Sea.

  4. 17 CFR 240.13e-4 - Tender offers by issuers. (United States)


    ... English, to the Commission on Form CB (§ 249.480 of this chapter) by the first business day after... by U.S. holders: i. Calculate the U.S. ownership as of a date no more than 60 days before and no more..., options and convertible securities; iii. Use the method of calculating record ownership in § 240.12g3-2(a...

  5. 17 CFR 240.3a51-1 - Definition of “penny stock”. (United States)


    ... Securities Exchange Act of 1934 Miscellaneous Exemptions § 240.3a51-1 Definition of “penny stock”. For purposes of section 3(a)(51) of the Act, the term “penny stock” shall mean any equity security other than a security: (a) That is an NMS stock, as defined in § 242.600(b)(47), provided that: (1) The security is...

  6. A 240W Monolithic Class-D Audio Amplifier Output Stage

    DEFF Research Database (Denmark)

    Nyboe, Flemming; Kaya, Cetin; Risbo, Lars


    A single-channel class-D audio amplifier output stage outputs 240W undipped into 4Omega 0.1% open-loop THD+N allows using the device in a fully-digital audio signal path with no feedback. The output current capability is plusmn18A and the part is fabricated in a 0.4mum/1.8mum high-voltage Bi...

  7. 17 CFR 240.16a-5 - Odd-lot dealers. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Odd-lot dealers. 240.16a-5....16a-5 Odd-lot dealers. Transactions by an odd-lot dealer (a) in odd-lots as reasonably necessary to carry on odd-lot transactions, or (b) in round lots to offset odd-lot transactions previously or...

  8. Neutron induced fission cross section measurements of 240Pu and 242Pu (United States)

    Belloni, F.; Eykens, R.; Heyse, J.; Matei, C.; Moens, A.; Nolte, R.; Plompen, A. J. M.; Richter, S.; Sibbens, G.; Vanleeuw, D.; Wynants, R.


    Accurate neutron induced fission cross section of 240Pu and 242Pu are required in view of making nuclear technology safer and more efficient to meet the upcoming needs for the future generation of nuclear power plants (GEN-IV). The probability for a neutron to induce such reactions figures in the NEA Nuclear Data High Priority Request List [1]. A measurement campaign to determine neutron induced fission cross sections of 240Pu and 242Pu at 2.51 MeV and 14.83 MeV has been carried out at the 3.7 MV Van De Graaff linear accelerator at Physikalisch-Technische Bundesanstalt (PTB) in Braunschweig. Two identical Frisch Grid fission chambers, housing back to back a 238U and a APu target (A = 240 or A = 242), were employed to detect the total fission yield. The targets were molecular plated on 0.25 mm aluminium foils kept at ground potential and the employed gas was P10. The neutron fluence was measured with the proton recoil telescope (T1), which is the German primary standard for neutron fluence measurements. The two measurements were related using a De Pangher long counter and the charge as monitors. The experimental results have an average uncertainty of 3-4% at 2.51 MeV and for 6-8% at 14.81 MeV and have been compared to the data available in literature.

  9. Neutron induced fission cross section measurements of 240Pu and 242Pu

    Directory of Open Access Journals (Sweden)

    Belloni F.


    Full Text Available Accurate neutron induced fission cross section of 240Pu and 242Pu are required in view of making nuclear technology safer and more efficient to meet the upcoming needs for the future generation of nuclear power plants (GEN-IV. The probability for a neutron to induce such reactions figures in the NEA Nuclear Data High Priority Request List [1]. A measurement campaign to determine neutron induced fission cross sections of 240Pu and 242Pu at 2.51 MeV and 14.83 MeV has been carried out at the 3.7 MV Van De Graaff linear accelerator at Physikalisch-Technische Bundesanstalt (PTB in Braunschweig. Two identical Frisch Grid fission chambers, housing back to back a 238U and a APu target (A = 240 or A = 242, were employed to detect the total fission yield. The targets were molecular plated on 0.25 mm aluminium foils kept at ground potential and the employed gas was P10. The neutron fluence was measured with the proton recoil telescope (T1, which is the German primary standard for neutron fluence measurements. The two measurements were related using a De Pangher long counter and the charge as monitors. The experimental results have an average uncertainty of 3–4% at 2.51 MeV and for 6–8% at 14.81 MeV and have been compared to the data available in literature.

  10. Measurement of the ${240}$Pu(n,f) reaction cross-section

    CERN Multimedia

    Following proposal CERN-INTC-2010-042 / INTC-P-280 (“Measurement of the fission cross-section of $^{240}$Pu and $^{242}$Pu at CERN’s n_TOF Facility”), the parallel measurement of the $^{240}$Pu(n,f) and $^{242}$Pu(n,f) reaction cross-sections was carried out at n_TOF EAR-1. While the $^{242}$Pu measurement was successful, unexpected sample-induced damage to the detectors caused by the high α-activity of the 240Pu samples resulted in a deterioration of the detector performance over the data taking period of several months, which compromised the measurement. This obstacle can be eliminated by performing the measurement in EAR-2, where the higher neutron flux will allow collecting data in a much shorter time, thus preventing the degradation of the detectors. In addition to this obvious advantage, the measurement would also benefit from the stronger suppression of the sample-induced α-background, due to the shorter times-of-flight involved.

  11. Weldability examination of ASTM A 240 S41500 martensitic stainless steel by thermal cycles simulation testings

    Directory of Open Access Journals (Sweden)

    Alberto Velázquez-del Rosario


    Full Text Available The weldability assets of ASTM A 240 S41500 (ASTM A 240/A 240M martensitic stainless steel are presented through the study of the effects of single and double thermal weld cycles on mechanical properties and microstructure of base metal (BM and the artificial heat affected zone (HAZ created by thermal weld simulations. For single cycles, separate peak temperatures of 1000 ºC/12 s and 1350 ºC/12 s (cooling times: 12 s in both cases were evaluated, whilst two combinations of peak temperatures: (1350 ºC/5 s + 1000 ºC/5 s ºC and (1350 ºC/12 s + 1000 ºC/12 s ºC (cooling times: 5 s and 12 s, were applied for double cycles. Post weld heat treatment (PWHT with short and long holding times were applied and Vickers hardness, impact toughness and metallographic examinations were used in order to assess mechanical and metallographic properties in the as-simulated (no heat treated and postweld heat treated conditions. Best properties of the welded joint for double thermal weld cycles with long holding times were reached, which reveals the good weldability and applicability of the tested material in post weld heat treated conditions.

  12. 240 GHz EPR Studies of Intrinsic Defects in 4H SiC (United States)

    Konovalov, V. V.; Zvanut, M. E.; van Tol, J.; Brunel, L.-C.


    Intrinsic defects may strongly influence the conductivity and optical behavior of SiC. Several groups have reported 9.5 GHz EPR studies of a carbon vacancy in electron irradiated p-type and as-grown nominally semi-insulating SiC. Recently, Son et al. interpreted two lines in a 95 GHz EPR spectrum as a carbon vacancy and silicon antisite. We report 240 GHz EPR studies of intrinsic defects in as-grown 4H SiC provided by Cree Inc. The ID-1 line we observed earlier at 9.5 GHz and assigned to a carbon vacancy was resolved at 240 GHz into two lines, ID-1a and ID-1b. As the temperature decreased from 80 to 4 K, with H//c-axis the g-value of ID-1a remained constant at 2.00307, but the g-value of ID-1b decreased from 2.00272 to 2.00235. Concomitantly, the intensity of ID-1a decreased while that of ID-1b increased. Although our data are close to Son’s 95 GHz spectrum, preliminary interpretation of the highly resolved lines obtained at 240 GHz does not suggest a silicon antisite. Illumination with IR light quenches both ID-1a and ID-1b simultaneously, indicating close defect levels. The work is supported by the ONR.

  13. 17 CFR 240.3a12-7 - Exemption for certain derivative securities traded otherwise than on a national securities exchange. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Exemption for certain derivative securities traded otherwise than on a national securities exchange. 240.3a12-7 Section 240.3a12-7... Miscellaneous Exemptions § 240.3a12-7 Exemption for certain derivative securities traded otherwise than on a...

  14. 17 CFR 240.15Ca2-1 - Application for registration as a government securities broker or government securities dealer. (United States)


    ... as a government securities broker or government securities dealer. 240.15Ca2-1 Section 240.15Ca2-1... Registration of Government Securities Brokers and Government Securities Dealers § 240.15Ca2-1 Application for registration as a government securities broker or government securities dealer. (a) An application for...

  15. Deconvolution of 238,239,240Pu conversion electron spectra measured with a silicon drift detector. (United States)

    Pommé, S; Marouli, M; Paepen, J; Marković, N; Pöllänen, R


    Internal conversion electron (ICE) spectra of thin 238,239,240Pu sources, measured with a windowless Peltier-cooled silicon drift detector (SDD), were deconvoluted and relative ICE intensities were derived from the fitted peak areas. Corrections were made for energy dependence of the full-energy-peak counting efficiency, based on Monte Carlo simulations. A good agreement was found with the theoretically expected internal conversion coefficient (ICC) values calculated from the BrIcc database. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  16. A new ascarid species in cynodont coprolite dated of 240 million years

    Directory of Open Access Journals (Sweden)



    Full Text Available Cynodonts represent the transition from reptiles to mammals. They are classified as synapsids, or tetrapod animals with mammalian characteristics. We present here the finding of helminth eggs in a coprolite identified as of cynodont origin dated of nearly 240 million years. Microscopy revealed the presence of very well preserved intestinal parasite eggs. Up to now we identified an ascarid egg by morphological characteristics. Based on a previous description of the new genus Ascarites Poinar Jr and Boucot 2006 in coprolites of iguanodons from Belgium, we propose a new species, Ascarites rufferi n.sp. in cynodonts, a host that inhabited the Southern Region of Brazil in the Triassic period.

  17. {sup 240}Pu/239Pu isotopic ratios and 239+240Pu total measurements in surface and deep waters around Mururoa and Fangataufa atolls compared with Rangiroa atoll (French Polynesia)

    Energy Technology Data Exchange (ETDEWEB)

    Chiappini, R.; Pointurier, F.; Millies-Lacroix, J.C.; Lepetit, G.; Hemet, P. [Commissariat a l' Energie Atomique, Direction DAM-Ile de-France, Departement Analyse et Surveillance de l' Environnement. BP 12, 91680 Bruyeres-le-Chatel (France)


    The average values of 240Pu/239Pu mass isotopic ratios of plutonium deposited in Mururoa and Fangataufa atoll sediments by French atmospheric nuclear tests range from 3.5 to 5%. In order to assess the near field and far field influence of those deposits in the open ocean, two water profiles were measured for 239+240Pu and 240Pu/239Pu using, for the first time, an Inductively Coupled Plasma Mass Spectrometer which was developed to achieve femtogram detection limits. One site was located at the limit of the French territorial waters, which is 22 km distant from Mururoa. The second site was located close to Rangiroa atoll, at a distance of approximately 1200-km from French nuclear test sites. The sample volumes were approximately 500 litres and plutonium was purified prior to mass spectrometry and alpha spectrometry measurements. In Rangiroa, the 239+240Pu profile is comparable with those already determined in world open oceans but the maximum detected activity, 9 mBq/m{sup 3} at 500-600 m is a lot lower than those measured in the northern hemisphere. 240Pu/239Pu ratios were measured between 500 and 1000 m and were not statistically different from the typical 0.18{+-}0.01 ratio which characterises the global fallout. Consequently, any influence of plutonium from the tests in Mururoa and Fangataufa is not apparent at Rangiroa. The vertical distribution of 239+240Pu near Mururoa shows similar changes with depth but with a slight increase in concentration. 240Pu/239Pu mass ratios vary with depth, from 7 to 10% in the upper 500 m and in the deep waters (below 1000 m) to 15-16% between 600 and 1000 m. A contribution from plutonium deposited in the sediments at Mururoa and Fangataufa is observed at the limit of territorial waters, especially in surface and deep waters.

  18. Baseline Caesium-137 and Plutonium-239+240 inventory assessment for Central Europe (United States)

    Meusburger, Katrin; Borelli, Pasquale; Evrard, Olivier; Ketterer, Michael; Mabit, Lionel; van Oost, Kristof; Alewell, Christine; Panagos, Panos


    Artificial fallout radionuclides (FRNs) such as Caesium-137 and Plutonium-239+240 released as products of the thermonuclear weapons testing that took place from the mid-1950s to the early 1980s and from nuclear power plant accidents (e.g. Chernobyl) are useful tools to quantify soil redistribution. In combination with geostatistics, FRNs may have the potential to bridge the gap between small scale process oriented studies and modelling that simplifies processes and effects over large spatial scales. An essential requirement for the application of FRNs as soil erosion tracers is the establishment of the baseline fallout at undisturbed sites before its comparison to those inventories found at sites undergoing erosion/accumulation. For this purpose, undisturbed topsoil (0-20cm) samples collected in 2009 within the framework of the Land Use/Cover Area frame Survey (LUCAS) have been measured by gamma-spectrometry and ICP-MS to determine 137Cs (n=145) and 239+240Pu (n=108) activities. To restrict the analysis to undisturbed reference sites a geospatial database query selecting only sites having a slope angle Chernobyl fallout. The establishment of such baseline inventory map will provide a unique opportunity to assess soil redistribution for a comparable time-frame (1953-2009) following a harmonised methodological protocol across national boundaries.

  19. Measurement of Angular-Momentum-Dependent Fission Probabilities of 240Pu (United States)

    Koglin, Johnathon; Burke, Jason; Jovanovic, Igor


    An experimental technique using the surrogate reaction method has been developed to measure fission probabilities of actinides as a function of angular momentum state of the fissioning nucleus near the fission barrier. In this work, the 240Pu (α ,α' f) reaction was used as a surrogate for 239Pu (n , f) . An array of 12 silicon telescopes positioned at 10 degree intervals from 40 to 140 degrees detect the outgoing reaction particle for identification and measurement of the excitation energy. The angular momentum state is determined by measuring the angular distribution of fission fragments. The expected distributions are predicted from the Wigner d function. An array of 50 photovoltaic (solar) cells detects fission fragments with 10-degree granularity. The solar cells are sensitive to fission fragments but have no response to light ions. Relative contributions from different angular momentum states are extracted from the measured distributions and compared across all α particle scattering angles to determine fission probability at a specific angular momentum state. The first experiment using this technique was recently completed using 37 MeV α particles incident on 240Pu. First results will be discussed. This work performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344. This material is based upon work supported by the U.S. Department of Homeland Security under Grant Award Nu.

  20. A multi-radionuclide approach to evaluate the suitability of {sup 239+240}Pu as soil erosion tracer

    Energy Technology Data Exchange (ETDEWEB)

    Meusburger, Katrin, E-mail: [Environmental Geosciences, University of Basel, Bernoullistrasse 30, CH-4056 Basel (Switzerland); Mabit, Lionel, E-mail: [Soil and Water Management and Crop Nutrition Laboratory, FAO/IAEA Agriculture & Biotechnology Laboratory, IAEA Laboratories, Seibersdorf (Austria); Ketterer, Michael, E-mail: [Chemistry Department, Metropolitan State University of Denver, CO (United States); Park, Ji-Hyung, E-mail: [Department of Environmental Science & Engineering, Ewha Womans University, Seoul 120-750 (Korea, Republic of); Sandor, Tarjan [Radioanalytical Reference Laboratory, Central Agricultural Office Food and Feed Safety Directorate (Hungary); Porto, Paolo, E-mail: [Dipartimento di AGRARIA, Università degli Studi “Mediterranea” di Reggio Calabria (Italy); Alewell, Christine, E-mail: [Environmental Geosciences, University of Basel, Bernoullistrasse 30, CH-4056 Basel (Switzerland)


    Fallout radionuclides have been used successfully worldwide as tracers for soil erosion, but relatively few studies exploit the full potential of plutonium (Pu) isotopes. Hence, this study aims to explore the suitability of the plutonium isotopes {sup 239}Pu and {sup 240}Pu as a method to assess soil erosion magnitude by comparison to more established fallout radionuclides such as {sup 137}Cs and {sup 210}Pb{sub ex}. As test area an erosion affected headwater catchment of the Lake Soyang (South Korea) was selected. All three fallout radionuclides confirmed high erosion rates for agricultural sites (> 25 t ha{sup −1} yr{sup −1}). Pu isotopes further allowed determining the origin of the fallout. Both {sup 240}Pu/{sup 239}Pu atomic ratios and {sup 239+240}Pu/{sup 137}Cs activity ratios were close to the global fallout ratio. However, the depth profile of the {sup 239+240}Pu/{sup 137}Cs activity ratios in undisturbed sites showed lower ratios in the top soil increments, which might be due to higher migration rates of {sup 239+240}Pu. The activity ratios further indicated preferential transport of {sup 137}Cs from eroded sites (higher ratio compared to the global fallout) to the depositional sites (smaller ratio). As such the {sup 239+240}Pu/{sup 137}Cs activity ratio offered a new approach to parameterize a particle size correction factor that can be applied when both {sup 137}Cs and {sup 239+240}Pu have the same fallout source. Implementing this particle size correction factor in the conversion of {sup 137}Cs inventories resulted in comparable estimates of soil loss for {sup 137}Cs and {sup 239+240}Pu. The comparison among the different fallout radionuclides highlights the suitability of {sup 239+240}Pu through less preferential transport compared to {sup 137}Cs and the possibility to gain information regarding the origin of the fallout. In conclusion, {sup 239+240}Pu is a promising soil erosion tracer, however, since the behaviour i.e. vertical migration in the

  1. UV absorbance of the human cornea in the 240- to 400-nm range. (United States)

    Kolozsvári, Lajos; Nógrádi, Antal; Hopp, Béla; Bor, Zsolt


    To determine the UV absorbance of the corneal layers (epithelium, Bowman layer, stroma) in the 240- to 400-nm range. Consecutive slices (100 microm) of human cadaveric corneas were cut, and the UV absorbance of each sample was determined in a scanning spectrophotometer. In some cases the epithelium was scraped off and its absorbance measured separately. The investigation of the UV-B absorption of consecutive corneal slices revealed evidence that UV-B absorption is 1.8 times higher in the anterior 100 microm of the human cornea than in the posterior layers. The UV absorbance of the posterior layers was uniform, showing no further structural dependence. The epithelium and Bowman layer are both effective absorbers of UV-B radiation. These results suggest that the anterior corneal layers are particularly important in preventing damage by UV-B radiation.

  2. Wide – Ranging Influence of Mischmetal on Properties of GP240GH Cast Steel

    Directory of Open Access Journals (Sweden)

    Kasińska J.


    Full Text Available This paper presents influence of rare earth metals (REM on the properties of GP240GH cast carbon steel. The research has been performed on successive industrial melts. Each time ca 2000 kg of liquid metal was modified. The rare earth metals were put into the ladle during tapping of heat melt from the furnace. Because of this the amount of sulphur in the cast steel was decreased and the non-metallic inclusion morphology was significantly changed. It was found that non metallic inclusions the cracking mechanism of Charpy specimens and the impact strength were all changed. The following properties were tested: mechanical properties (σy, σUTS, plastic properties (necking, elongation and impact strength (SCI. In the three-point bend test the KJC stress intensity factor was evaluated.

  3. Wide – Ranging Influence of Mischmetal on Properties of GP240GH Cast Steel

    Directory of Open Access Journals (Sweden)

    J. Kasińska


    Full Text Available This paper presents influence of rare earth metals (REM on the properties of GP240GH cast carbon steel. The research has beenperformed on successive industrial melts. Each time ca 2000 kg of liquid metal was modified. The rare earth metals were put into the ladle during tapping of heat melt from the furnace. Because of this the amount of sulphur in the cast steel was decreased and the non-metallic inclusion morphology was significantly changed. It was found that non metallic inclusions the cracking mechanism of Charpy specimens and the impact strength were all changed. The following properties were tested: mechanical properties (y, UTS, plastic properties (necking, elongation and impact strength (SCI. In the three-point bend test the KJC stress intensity factor was evaluated.

  4. Microscopic Calculation of 240Pu Scission with a Finite-Range Effective Force

    Energy Technology Data Exchange (ETDEWEB)

    Younes, W; Gogny, D


    Hartree-Fock-Bogoliubov calculations of hot fission in {sup 240}Pu have been performed with a newly-implemented code that uses the D1S finite-range effective interaction. The hot-scission line is identified in the quadrupole-octupole-moment coordinate space. Fission-fragment shapes are extracted from the calculations. A benchmark calculation for {sup 226}Th is obtained and compared to results in the literature. In addition, technical aspects of the use of HFB calculations for fission studies are examined in detail. In particular, the identification of scission configurations, the sensitivity of near-scission calculations to the choice of collective coordinates in the HFB iterations, and the formalism for the adjustment of collective-variable constraints are discussed. The power of the constraint-adjustment algorithm is illustrated with calculations near the critical scission configurations with up to seven simultaneous constraints.

  5. Metamaterial composite bandpass filter with an ultra-broadband rejection bandwidth of up to 240 terahertz

    DEFF Research Database (Denmark)

    Strikwerda, Andrew; Zalkovskij, Maksim; Lorenzen, Dennis Lund


    We present a metamaterial, consisting of a cross structure and a metal mesh filter, that forms a composite with greater functional bandwidth than any terahertz (THz) metamaterial to date. Metamaterials traditionally have a narrow usable bandwidth that is much smaller than common THz sources......, such as photoconductive antennas and difference frequency generation. The composite structure shown here expands the usable bandwidth to exceed that of current THz sources. To highlight the applicability of this combination, we demonstrate a series of bandpass filters with only a single pass band, with a central...... frequency (f) that is scalable from 0.86–8.51 THz, that highly extinguishes other frequencies up to >240 THz. The performance of these filters is demonstrated in experiment, using both air biased coherent detection and a Fourier transform infrared spectrometer (FTIR), as well as in simulation. We present...

  6. Next Generation Security for the 10,240 Processor Columbia System (United States)

    Hinke, Thomas; Kolano, Paul; Shaw, Derek; Keller, Chris; Tweton, Dave; Welch, Todd; Liu, Wen (Betty)


    This presentation includes a discussion of the Columbia 10,240-processor system located at the NASA Advanced Supercomputing (NAS) division at the NASA Ames Research Center which supports each of NASA's four missions: science, exploration systems, aeronautics, and space operations. It is comprised of 20 Silicon Graphics nodes, each consisting of 512 Itanium II processors. A 64 processor Columbia front-end system supports users as they prepare their jobs and then submits them to the PBS system. Columbia nodes and front-end systems use the Linux OS. Prior to SC04, the Columbia system was used to attain a processing speed of 51.87 TeraFlops, which made it number two on the Top 500 list of the world's supercomputers and the world's fastest "operational" supercomputer since it was fully engaged in supporting NASA users.

  7. 17 CFR 240.10b5-1 - Trading “on the basis of” material nonpublic information in insider trading cases. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Trading âon the basis ofâ material nonpublic information in insider trading cases. 240.10b5-1 Section 240.10b5-1 Commodity and... Deceptive Devices and Contrivances § 240.10b5-1 Trading “on the basis of” material nonpublic information in...

  8. Historical changes in 239Pu and 240Pu sources in sedimentary records in the East China Sea: Implications for provenance and transportation

    DEFF Research Database (Denmark)

    Wang, Jinlong; Baskaran, Mark; Hou, Xiaolin


    the East China Sea (ECS) collected in the summer of 2013 (August 6–28). The 239+240Pu activity concentrations in surface sediment samples were found to range between 0.048 and 0.492 Bqkg−1and the 240Pu/239Pu atom ratios showed a similar trend as that of the 239,240Pu activities; the Pu atom ratios ranged...

  9. 17 CFR 240.13d-102 - Schedule 13G-Information to be included in statements filed pursuant to § 240.13d-1(b), (c), and... (United States)


    ... Act of 1940 or the beneficiaries of employee benefit plan, pension fund or endowment fund is not... Investment Company IV Investment Adviser IA Employee Benefit Plan or Endowment Fund EP Parent Holding Company... fund in accordance with § 240.13d-1(b)(1)(ii)(F); (g) A parent holding company or control person in...

  10. Radioecologycal study of 239/240Pu in Bangka Island and Muria Peninsula: Determination of 239/240Pu in marine sediment and seawater as part of baseline data collecting for sitting of candidates of first Indonesia NPP (United States)

    Suseno, Heny; Wisnubroto, Djarot S.


    Radioisotope Pu-239/240 are alpha emitting nuclides important indicators of radioactive contamination of the marine environment. Global fallout is the main source of plutonium in the marine environment. There are very limited study on 239/240Pu in Indonesia coastal environments. The data of this radioisotopes is needed for baseline data of nuclear power plant (NPP) site candidates both in Bangka Island and Muria Peninsula. Bottom sediments play an important role in radioecological studies of the marine environment because a large proportion of radioactive substances entering the sea is adsorbed over time onto suspended particulate matter and deposited in sediments. Plutonium is particle reactive and deposited in marine sediment. Radioisotope 239/240Pu was determinated by alpha spectrometry after radiochemical procedure that was performed in both water and marine sediment from Bangka Island and Muria Peninsula. The sediment baseline of concentration 239/240Pu in Bangka Island and Muria Peninsula were range from 0.013 to 0.021 and 0.018 to 0.024 respectively. The water baseline concentration this isotope were range from 2.73 to 4.05 mBq.m-3 and 2.98 to 4.50 mBq.m-3.

  11. ZPR-6 assembly 7 high {sup 240}Pu core experiments : a fast reactor core with mixed (Pu,U)-oxide fuel and a centeral high{sup 240}Pu zone.

    Energy Technology Data Exchange (ETDEWEB)

    Lell, R. M.; Morman, J. A.; Schaefer, R.W.; McKnight, R.D.; Nuclear Engineering Division


    ZPR-6 Assembly 7 (ZPR-6/7) encompasses a series of experiments performed at the ZPR-6 facility at Argonne National Laboratory in 1970 and 1971 as part of the Demonstration Reactor Benchmark Program (Reference 1). Assembly 7 simulated a large sodium-cooled LMFBR with mixed oxide fuel, depleted uranium radial and axial blankets, and a core H/D near unity. ZPR-6/7 was designed to test fast reactor physics data and methods, so configurations in the Assembly 7 program were as simple as possible in terms of geometry and composition. ZPR-6/7 had a very uniform core assembled from small plates of depleted uranium, sodium, iron oxide, U{sub 3}O{sub 8} and Pu-U-Mo alloy loaded into stainless steel drawers. The steel drawers were placed in square stainless steel tubes in the two halves of a split table machine. ZPR-6/7 had a simple, symmetric core unit cell whose neutronic characteristics were dominated by plutonium and {sup 238}U. The core was surrounded by thick radial and axial regions of depleted uranium to simulate radial and axial blankets and to isolate the core from the surrounding room. The ZPR-6/7 program encompassed 139 separate core loadings which include the initial approach to critical and all subsequent core loading changes required to perform specific experiments and measurements. In this context a loading refers to a particular configuration of fueled drawers, radial blanket drawers and experimental equipment (if present) in the matrix of steel tubes. Two principal core configurations were established. The uniform core (Loadings 1-84) had a relatively uniform core composition. The high {sup 240}Pu core (Loadings 85-139) was a variant on the uniform core. The plutonium in the Pu-U-Mo fuel plates in the uniform core contains 11% {sup 240}Pu. In the high {sup 240}Pu core, all Pu-U-Mo plates in the inner core region (central 61 matrix locations per half of the split table machine) were replaced by Pu-U-Mo plates containing 27% {sup 240}Pu in the plutonium

  12. Assessing the Impact of 240-Credit-Hour Programme for Urban Primary School Teachers of English in China (United States)

    Ping, Wang


    This action research explores a 240-credit-hour training programme in urban Chinese primary school educational settings. A survey of 90 primary school teachers of English was conducted via classroom observation and questionnaires focusing on their reflection on the training programme. Analyses of variance were applied by comparison and contrast.…

  13. 17 CFR 240.13a-11 - Current reports on Form 8-K (§ 249.308 of this chapter). (United States)


    ... American Depositary Receipts for securities of any foreign issuer, or investment companies required to file... such investment companies are required to file notice of a blackout period pursuant to § 245.104 of..., every registrant subject to § 240.13a-1 shall file a current report on Form 8-K within the period...

  14. 17 CFR 240.17a-6 - Right of national securities exchange, national securities association, registered clearing... (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Right of national securities exchange, national securities association, registered clearing agency or the Municipal Securities... and Reports of Certain Stabilizing Activities § 240.17a-6 Right of national securities exchange...

  15. 17 CFR 240.17Ad-10 - Prompt posting of certificate detail to master securityholder files, maintenance of accurate... (United States)


    ... between co-transfer agents and recordkeeping transfer agents, maintenance of current control book... Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) GENERAL RULES AND... Supervised Investment Bank Holding Company Rules § 240.17Ad-10 Prompt posting of certificate detail to master...

  16. Deconvolution of 238,239,240Pu conversion electron spectra measured with a silicon drift detector

    DEFF Research Database (Denmark)

    Pommé, S.; Marouli, M.; Paepen, J.


    Internal conversion electron (ICE) spectra of thin 238,239,240Pu sources, measured with a windowless Peltier-cooled silicon drift detector (SDD), were deconvoluted and relative ICE intensities were derived from the fitted peak areas. Corrections were made for energy dependence of the full-energy-...

  17. 17 CFR 240.17a-25 - Electronic submission of securities transaction information by exchange members, brokers, and... (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Electronic submission of... Preservation of Records and Reports of Certain Stabilizing Activities § 240.17a-25 Electronic submission of... transaction information for transactions involving entities that trade using multiple accounts: (1)(i) If part...

  18. 17 CFR 240.17i-4 - Internal risk management control system requirements for supervised investment bank holding... (United States)


    ... Supervised Investment Bank Holding Company Rules § 240.17i-4 Internal risk management control system...) As part of its internal risk management control system, a supervised investment bank holding company... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Internal risk management...

  19. 17 CFR 240.15c3-4 - Internal risk management control systems for OTC derivatives dealers. (United States)


    ...-Counter Markets § 240.15c3-4 Internal risk management control systems for OTC derivatives dealers. (a) An... derivatives dealer's internal risk management control system shall include the following elements: (1) A risk control unit that reports directly to senior management and is independent from business trading units; (2...

  20. Suitability of 239+240Pu and 137Cs as tracers for soil erosion assessment in mountain grasslands. (United States)

    Alewell, Christine; Meusburger, Katrin; Juretzko, Gregor; Mabit, Lionel; Ketterer, Michael E


    Anthropogenic radionuclides have been distributed globally due to nuclear weapons testing, nuclear accidents, nuclear weapons fabrication, and nuclear fuel reprocessing. While the negative consequences of this radioactive contamination are self-evident, the ubiquitous fallout radionuclides (FRNs) distribution form the basis for the use as tracers in ecological studies, namely for soil erosion assessment. Soil erosion is a major threat to mountain ecosystems worldwide. We compare the suitability of the anthropogenic FRNs, 137Cs and 239+240Pu as soil erosion tracers in two alpine valleys of Switzerland (Urseren Valley, Canton Uri, Central Swiss Alps and Val Piora, Ticino, Southern Alps). We sampled reference and potentially erosive sites in transects along both valleys. 137Cs measurements of soil samples were performed with a Li-drifted Germanium detector and 239+240Pu with ICP-MS. Our data indicates a heterogeneous deposition of the 137Cs, since most of the fallout origins from the Chernobyl April/May 1986 accident, when large parts of the European Alps were still snow-covered. In contrast, 239+240Pu fallout originated mainly from 1950s to 1960s atmospheric nuclear weapons tests, resulting in a more homogenous distribution and thus seems to be a more suitable tracer in mountainous grasslands. Soil erosion assessment using 239+240Pu as a tracer pointed to a huge dynamic and high heterogeneity of erosive processes (between sedimentation of 1.9 and 7 t ha(-1) yr(-1) and erosion of 0.2-16.4 t ha(-1) yr(-1) in the Urseren Valley and sedimentation of 0.4-20.3 t ha(-1) yr(-1) and erosion of 0.1-16.4 t ha(-1) yr(-1) at Val Piora). Our study represents a novel and successful application of 239+240Pu as a tracer of soil erosion in a mountain environment. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

  1. 17 CFR 240.15a-4 - Forty-five day exemption from registration for certain members of national securities exchanges. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Forty-five day exemption from registration for certain members of national securities exchanges. 240.15a-4 Section 240.15a-4 Commodity and... national securities exchanges. (a) A natural person who is a member of a national securities exchange shall...

  2. 41 CFR 102-38.240 - What happens to the deposit bond if the bidder defaults or wants to withdraw his/her bid? (United States)


    ... deposit bond if the bidder defaults or wants to withdraw his/her bid? 102-38.240 Section 102-38.240 Public... happens to the deposit bond if the bidder defaults or wants to withdraw his/her bid? (a) When a bid... to withdraw his/her bid, you should return the deposit bond to the bidder. Late Bids ...

  3. 17 CFR 240.12f-2 - Extending unlisted trading privileges to a security that is the subject of an initial public... (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Extending unlisted trading privileges to a security that is the subject of an initial public offering. 240.12f-2 Section 240.12f-2... initial public offering. (a) General provision. A national securities exchange may extend unlisted trading...

  4. 17 CFR 240.17i-2 - Notice of intention to be supervised by the Commission as a supervised investment bank holding... (United States)


    ... prohibited by law or otherwise, the supervised investment bank holding company will cooperate with the... law. (2) Commission determination. (i) An investment bank holding company shall become a supervised... supervised by the Commission as a supervised investment bank holding company. 240.17i-2 Section 240.17i-2...

  5. Historical changes in 239Pu and 240Pu sources in sedimentary records in the East China Sea: Implications for provenance and transportation (United States)

    Wang, Jinlong; Baskaran, Mark; Hou, Xiaolin; Du, Jinzhou; Zhang, Jing


    Concentrations and isotopic compositions of plutonium (Pu) are widely used for its source identification and to determine transport processes of Pu-associated particulate matter and water. We investigated the concentrations of 239Pu and 240Pu and their ratios in a number of sediment samples from the East China Sea (ECS) collected in the summer of 2013 (August 6-28). The 239+240Pu activity concentrations in surface sediment samples were found to range between 0.048 and 0.492 Bq kg-1 and the 240Pu/239Pu atom ratios showed a similar trend as that of the 239, 240Pu activities; the Pu atom ratios ranged from 0.158 to 0.297 and were mostly higher than the mean global fallout value of 0.18. The 239, 240Pu inventories in the ECS varied widely, from 2 to 807 Bq m-2, with the highest values commonly found in the coastal areas. In the Yangtze Estuary, the mean 239+240Pu activity concentration is close to the estimated value of the suspended material from the Yangtze River catchment (0.18 Bq kg-1), and the 240Pu/239Pu atom ratio was found to be ∼0.18, which indicates that the Yangtze River input is the dominant source of Pu for this area. The total annual Yangtze River input of 239+240Pu was estimated to be 2.4 ×1010 Bq, which is small compared to the total amount of 239+240Pu buried, 3.1 ×1013 Bq in the whole ECS. The Pacific Proving Ground input appears to be the dominant source of Pu to the ECS, accounting for 45%-52% of the total inventory. The fractional amount of 239+240Pu scavenged from the total 239+240Pu transported by the Kuroshio Current (KC) and Taiwan Warm Current (TWC) into ECS sediments is estimated to be ∼10%. Our study shows that the 240Pu/239Pu atom ratio is useful not only to obtain a better insight of the biogeochemistry influenced by the KC, but also to trace the long-range transport of other particle-reactive species. Besides, the sedimentation rates obtained based on the penetration depths of 239+240Pu and vertical profiles of excess 210Pb agree

  6. UV absorbance of a bioengineered corneal stroma substitute in the 240-400 nm range. (United States)

    Ionescu, Ana-Maria; de la Cruz Cardona, Juan; González-Andrades, Miguel; Alaminos, Miguel; Campos, Antonio; Hita, Enrique; del Mar Pérez, María


    To determine the UV absorbance of a bioengineered human corneal stroma construct based on fibrin and fibrin-agarose scaffolds in the 240-400 nm range. Three types of artificial substitutes of the human corneal stroma were developed by tissue engineering using fibrin and fibrin with 0.1% and 0.2% agarose scaffolds with human keratocytes immersed within. After 28 days of culture, the UV absorbance of each sample was determined using a spectrophotometer. The thickness of corneal stroma samples was determined by light microscope. For all the 3 types of corneal stroma substitutes studied, the range of the UV absorbance values was similar to that of the native human corneal stroma, although the fibrin with 0.1% agarose stroma substitute had the best UV filtering properties. The higher UV absorbance of the artificial substitute of the human corneal stroma was in the UV-B and -A ranges, suggesting that these artificial tissues could have potential clinical usefulness and proper UV light-absorption capabilities. Our data suggest that the bioengineered human corneal substitute of fibrin with 0.1% agarose is an effective absorber of harmful UV radiation and could therefore be potentially useful.

  7. Clindamycin versus cloxacillin in the treatment of 240 open fractures. A randomized prospective study. (United States)

    Vasenius, J; Tulikoura, I; Vainionpää, S; Rokkanen, P


    Systemic administration of antibiotics is recommended and has proved to lower infection rates in open fractures. However, no antibiotic has proved to be superior to any other. In a prospective study 227 patients with 240 open fractures were randomized to receive either clindamycin or cloxacillin for infection prevention. The overall infection rate was 15%. Infection occurred in 9.3% of the clindamycin treated and in 20% of the cloxacillin treated fractures (p Gustillo Type I and II open fractures all the pathogens causing infection were gram-positive, while in the Type III open fractures 21 pathogens (57%) were gram-positive and 16 (43%) gram-negative. In the clindamycin treated fractures the infection rates in Type I and II open fractures were 3.3 and 1.8%, respectively, while in the cloxacillin group they were 20 and 3.8%, respectively. Both clindamycin and cloxacillin showed low effectiveness in the treatment of Type III open fractures, the highest infection rates being 75 and 67%, respectively (Type III B). Clindamycin provides good antimicrobic coverage against the most common pathogens causing Type I and II open fracture infections. In the treatment of Type III open fractures additional administration of an antibiotic with good gram-negative coverage is recommended.

  8. Fission dynamics of 240Cf* formed in 34,36S induced reactions

    Directory of Open Access Journals (Sweden)

    Jain Deepika


    Full Text Available We have studied the entrance channel effects in the decay of Compound nucleus 240Cf* formed in 34S+206Pb and 36S+204Pb reactions by using energy density dependent nuclear proximity potential in the framework of dynamical cluster-decay model (DCM. At different excitation energies, the fragmentation potential and preformation probability of decaying fragments are almost identical for both the entrance channels, which seem to suggest that decay is independent of its formation and entrance channel excitation energy. It is also observed that, with inclusion of deformation effects upto quadrupole within the optimum orientation approach, the fragmentation path governing potential energy surfaces gets modified significantly. Beside this, the fission mass distribution of Cf* isotopes is also investigated. The calculated fission cross-sections using SIII force for both the channels find nice agreement with the available experimental data for deformed choice of fragments, except at higher energies. In addition to this, the comparative analysis with Blocki based nuclear attraction is also worked out. It is observed that Blocki proximity potential accounts well for the CN decay at all energies whereas the use of EDF based nuclear potential suggests the presence of some non-compound nucleus process (such as quasi-fission (qf at higher energies.

  9. Radio AGN in 13,240 galaxy clusters from the Sloan Digital Sky Survey

    Energy Technology Data Exchange (ETDEWEB)

    Croft, S; de Vries, W; Becker, R


    We correlate the positions of 13,240 Brightest Cluster Galaxies (BCGs) with 0.1 {le} z {le} 0.3 from the maxBCG catalog with radio sources from the FIRST survey to study the sizes and distributions of radio AGN in galaxy clusters. We find that 19.7% of our BCGs are radio-loud, and this fraction depends on the stellar mass of the BCG, and to a lesser extent on the richness of the parent cluster (in the sense of increasing radio loudness with increasing mass). The intrinsic size of the radio emission associated with the BCGs peaks at 55 kpc, with a tail extending to 200 kpc. The radio power of the extended sources places them on the divide between FR I and FR II type sources, while sources compact in the radio tend to be somewhat less radio-luminous. We also detect an excess of radio sources associated with the cluster, instead of with the BCG itself, extending out to {approx} 1.4 kpc.

  10. Widespread pollution of the South American atmosphere predates the industrial revolution by 240 years (United States)

    Uglietti, Chiara; Gabrielli, Paolo; Cooke, Colin; Vallelonga, Paul; Thompson, Lonnie


    In the Southern Hemisphere, evidence for preindustrial atmospheric pollution is restricted to a few geological archives of low temporal resolution that record trace element deposition originating from past mining and metallurgical operations in South America. Therefore the timing and the spatial impact of these activities on the past atmosphere remain poorly constrained. Here we present an annually resolved ice-core record (793-1989 AD) from the high altitude drilling site of Quelccaya (Peru) that archives preindustrial and industrial variations in trace elements. During the pre-colonial period (i.e., pre-1532 AD), the deposition of trace elements was mainly dominated by the fallout of aeolian dust and of ash from occasional volcanic eruptions indicating that metallurgic production during the Inca Empire (1438-1532 AD) had a negligible impact on the South American atmosphere. In contrast, a widespread anthropogenic signal is evident after 1540 AD, which corresponds with the beginning of colonial mining and metallurgy in Peru and Bolivia, 240 years prior to the Industrial Revolution. This shift was due to a major technological transition for silver extraction in South America (1572 AD), from lead-based smelting to mercury amalgamation, which precipitated a massive increase in mining activities. However, deposition of toxic trace metals during the Colonial era was still several factors lower than 20th century pollution that was unprecedented over the entirety of human history.

  11. Measurement of 240Pu Angular Momentum Dependent Fission Probabilities Using the (α ,α') Reaction (United States)

    Koglin, Johnathon; Burke, Jason; Fisher, Scott; Jovanovic, Igor


    The surrogate reaction method often lacks the theoretical framework and necessary experimental data to constrain models especially when rectifying differences between angular momentum state differences between the desired and surrogate reaction. In this work, dual arrays of silicon telescope particle identification detectors and photovoltaic (solar) cell fission fragment detectors have been used to measure the fission probability of the 240Pu(α ,α' f) reaction - a surrogate for the 239Pu(n , f) - and fission fragment angular distributions. Fission probability measurements were performed at a beam energy of 35.9(2) MeV at eleven scattering angles from 40° to 140°e in 10° intervals and at nuclear excitation energies up to 16 MeV. Fission fragment angular distributions were measured in six bins from 4.5 MeV to 8.0 MeV and fit to expected distributions dependent on the vibrational and rotational excitations at the saddle point. In this way, the contributions to the total fission probability from specific states of K angular momentum projection on the symmetry axis are extracted. A sizable data collection is presented to be considered when constraining microscopic cross section calculations.

  12. Characteristics of 240 Chinese father-child pairs with malignant disease. (United States)

    Liu, Ju; Li, Ni; Chang, Sheng; Xu, Zhi-Jian; Zhang, Kai


    To obtain a screening and early detection reference for individuals who have a family history of cancer on the paternal side, we collected and analyzed data from 240 pairs in which both fathers and their children were diagnosed with cancer. Disease categories of fathers and sons were similar to that of the general population of China, whereas daughters were different from general female population with high incidence of breast cancer and gynecological cancer. Sons were more likely than daughters to have the same type of cancer, or to have cancer in the same organ system as their fathers (P daughters developed malignant diseases 11 and 16 years earlier than their fathers, respectively (P daughters). Daughters developed malignant diseases 5 years earlier than sons (P fathersfathers were diagnosed with cancer. Lung cancer should be investigated in both men and women, whilst screening should focus on cancer of the digestive system in men and on breast and gynecological cancer (ovary, uterine and cervical cancer) in women.

  13. SEGUE: A Spectroscopic Survey of 240,000 stars with g=14-20

    Energy Technology Data Exchange (ETDEWEB)

    Yanny, Brian; /Fermilab; Rockosi, Constance; /UC, Santa Cruz; Newberg, Heidi Jo; /Rensselaer Poly.; Knapp, Gillian R.; /Princeton U.; Adelman-McCarthy, Jennifer K.; /Fermilab; Alcorn, Bonnie; /Fermilab; Allam, Sahar S.; /Fermilab; Prieto, Carlos Allende; /Texas U. /University Coll. London; An, Deokkeun; /Ohio State U.; Anderson, Kurt S.J.; /Apache Point Observ. /New Mexico State U.; Anderson, Scott; /Washington U., Seattle


    The Sloan Extension for Galactic Understanding and Exploration (SEGUE) Survey obtained {approx}240,000 moderate-resolution (R {approx} 1800) spectra from 3900 {angstrom} to 9000 {angstrom} of fainter Milky Way stars (14.0 < g < 20.3) of a wide variety of spectral types, both main-sequence and evolved objects, with the goal of studying the kinematics and populations of our Galaxy and its halo. The spectra are clustered in 212 regions spaced over three quarters of the sky. Radial velocity accuracies for stars are {sigma}(RV) {approx} 4 km s{sup -1} at g < 18, degrading to {sigma}(RV) {approx} 15 km s{sup -1} at g {approx} 20. For stars with signal-to-noise ratio >10 per resolution element, stellar atmospheric parameters are estimated, including metallicity, surface gravity, and effective temperature. SEGUE obtained 3500 deg{sup 2} of additional ugriz imaging (primarily at low Galactic latitudes) providing precise multicolor photometry ({sigma}(g, r, i) {approx} 2%), ({sigma}(u, z) {approx} 3%) and astrometry ({approx}0.1) for spectroscopic target selection. The stellar spectra, imaging data, and derived parameter catalogs for this survey are publicly available as part of Sloan Digital Sky Survey Data Release 7.

  14. Widespread pollution of the South American atmosphere predates the industrial revolution by 240 y. (United States)

    Uglietti, Chiara; Gabrielli, Paolo; Cooke, Colin A; Vallelonga, Paul; Thompson, Lonnie G


    In the Southern Hemisphere, evidence for preindustrial atmospheric pollution is restricted to a few geological archives of low temporal resolution that record trace element deposition originating from past mining and metallurgical operations in South America. Therefore, the timing and the spatial impact of these activities on the past atmosphere remain poorly constrained. Here we present an annually resolved ice core record (A.D. 793-1989) from the high-altitude drilling site of Quelccaya (Peru) that archives preindustrial and industrial variations in trace elements. During the precolonial period (i.e., pre-A.D. 1532), the deposition of trace elements was mainly dominated by the fallout of aeolian dust and of ash from occasional volcanic eruptions, indicating that metallurgic production during the Inca Empire (A.D. 1438-1532) had a negligible impact on the South American atmosphere. In contrast, a widespread anthropogenic signal is evident after around A.D. 1540, which corresponds with the beginning of colonial mining and metallurgy in Peru and Bolivia, ∼240 y before the Industrial Revolution. This shift was due to a major technological transition for silver extraction in South America (A.D. 1572), from lead-based smelting to mercury amalgamation, which precipitated a massive increase in mining activities. However, deposition of toxic trace metals during the Colonial era was still several factors lower than 20th century pollution that was unprecedented over the entirety of human history.

  15. A microrod-resonator Brillouin laser with 240 Hz absolute linewidth

    CERN Document Server

    Loh, William; Cole, Daniel C; Coillet, Aurelien; Baynes, Fred N; Papp, Scott B; Diddams, Scott A


    We demonstrate an ultralow-noise microrod-resonator based laser that oscillates on the gain supplied by the stimulated Brillouin scattering optical nonlinearity. Microresonator Brillouin lasers are known to offer an outstanding frequency noise floor, which is limited by fundamental thermal fluctuations. Here, we show experimental evidence that thermal effects also dominate the close-to-carrier frequency fluctuations. The 6-mm diameter microrod resonator used in our experiments has a large optical mode area of ~100 {\\mu}m$^2$, and hence its 10 ms thermal time constant filters the close-to-carrier optical frequency noise. The result is an absolute laser linewidth of 240 Hz with a corresponding white-frequency noise floor of 0.1 Hz$^2$/Hz. We explain the steady-state performance of this laser by measurements of its operation state and of its mode detuning and lineshape. Our results highlight a mechanism for noise that is common to many microresonator devices due to the inherent coupling between intracavity power...

  16. Closure Report for Corrective Action Unit 240: Area 25 Vehicle Washdown Nevada Test Site, Nevada

    Energy Technology Data Exchange (ETDEWEB)

    D. L. Gustafason


    The Area 25 Vehicle Washdown, Corrective Action Unit (CAU) 240, was clean-closed following the approved Corrective Action Decision Document closure alternative and in accordance with the Federal Facility Agreement and Consent Order (FFACO, 1996). The CAU consists of thee Corrective Action Sites (CASs): 25-07-01 - Vehicle Washdown Area (Propellant Pad); 25-07-02 - Vehicle Washdown Area (F and J Roads Pad); and 25-07-03 - Vehicle Washdown Station (RADSAFE Pad). Characterization activities indicated that only CAS 25-07-02 (F and J Roads Pad) contained constituents of concern (COCs) above action levels and required remediation. The COCs detected were Total Petroleum Hydrocarbons (TPH) as diesel, cesium-137, and strontium-90. The F and J Roads Pad may have been used for the decontamination of vehicles and possibly disassembled engine and reactor parts from Test Cell C. Activities occurred there during the 1960s through early 1970s. The F and J Roads Pad consisted of a 9- by 5-meter (m) (30- by 15-foot [ft]) concrete pad and a 14- by 13-m (46-by 43-ft) gravel sump. The clean-closure corrective action consisted of excavation, disposal, verification sampling, backfilling, and regrading. Closure activities began on August 21, 2000, and ended on September 19, 2000. Waste disposal activities were completed on December 12, 2000. A total of 172 cubic meters (223 cubic yards) of impacted soil was excavated and disposed. The concrete pad was also removed and disposed. Verification samples were collected from the bottom and sidewalls of the excavation and analyzed for TPH diesel and 20-minute gamma spectroscopy. The sample results indicated that all impacted soil above remediation standards was removed. The closure was completed following the approved Corrective Action Plan. All impacted waste was disposed in the Area 6 Hydrocarbon Landfill. All non-impacted debris was disposed in the Area 9 Construction Landfill and the Area 23 Sanitary Landfill.


    Energy Technology Data Exchange (ETDEWEB)

    Archambault, S. [Physics Department, McGill University, Montreal, QC H3A 2T8 (Canada); Aune, T. [Department of Physics and Astronomy, University of California, Los Angeles, CA 90095 (United States); Behera, B.; Chen, X.; Federici, S. [DESY, Platanenallee 6, D-15738 Zeuthen (Germany); Beilicke, M.; Bugaev, V. [Department of Physics, Washington University, St. Louis, MO 63130 (United States); Benbow, W.; Cerruti, M. [Fred Lawrence Whipple Observatory, Harvard-Smithsonian Center for Astrophysics, Amado, AZ 85645 (United States); Berger, K. [Department of Physics and Astronomy and the Bartol Research Institute, University of Delaware, Newark, DE 19716 (United States); Bird, R. [School of Physics, University College Dublin, Belfield, Dublin 4 (Ireland); Biteau, J. [Santa Cruz Institute for Particle Physics and Department of Physics, University of California, Santa Cruz, CA 95064 (United States); Byrum, K. [Argonne National Laboratory, 9700 South Cass Avenue, Argonne, IL 60439 (United States); Cardenzana, J. V [Department of Physics and Astronomy, Iowa State University, Ames, IA 50011 (United States); Ciupik, L. [Astronomy Department, Adler Planetarium and Astronomy Museum, Chicago, IL 60605 (United States); Connolly, M. P. [School of Physics, National University of Ireland Galway, University Road, Galway (Ireland); Cui, W. [Department of Physics, Purdue University, West Lafayette, IN 47907 (United States); Dumm, J. [School of Physics and Astronomy, University of Minnesota, Minneapolis, MN 55455 (United States); Errando, M. [Department of Physics and Astronomy, Barnard College, Columbia University, NY 10027 (United States); Falcone, A., E-mail: [Department of Astronomy and Astrophysics, 525 Davey Lab, Pennsylvania State University, University Park, PA 16802 (United States); Collaboration: VERITAS Collaboration; Fermi LAT Collaboration; and others


    We present deep VERITAS observations of the blazar PKS 1424+240, along with contemporaneous Fermi Large Area Telescope, Swift X-ray Telescope, and Swift UV Optical Telescope data between 2009 February 19 and 2013 June 8. This blazar resides at a redshift of z ≥ 0.6035, displaying a significantly attenuated gamma-ray flux above 100 GeV due to photon absorption via pair-production with the extragalactic background light. We present more than 100 hr of VERITAS observations over three years, a multiwavelength light curve, and the contemporaneous spectral energy distributions. The source shows a higher flux of (2.1 ± 0.3) × 10{sup –7} photons m{sup –2} s{sup –1} above 120 GeV in 2009 and 2011 as compared to the flux measured in 2013, corresponding to (1.02 ± 0.08) × 10{sup –7} photons m{sup –2} s{sup –1} above 120 GeV. The measured differential very high energy (VHE; E ≥ 100 GeV) spectral indices are Γ = 3.8 ± 0.3, 4.3 ± 0.6 and 4.5 ± 0.2 in 2009, 2011, and 2013, respectively. No significant spectral change across the observation epochs is detected. We find no evidence for variability at gamma-ray opacities of greater than τ = 2, where it is postulated that any variability would be small and occur on timescales longer than a year if hadronic cosmic-ray interactions with extragalactic photon fields provide a secondary VHE photon flux. The data cannot rule out such variability due to low statistics.

  18. Complete Genome Sequence of the Complex Carbohydrate-Degrading Marine Bacterium, Saccharophagus degradans strain 2-40

    Energy Technology Data Exchange (ETDEWEB)

    Weiner, Ronald M [University of Maryland; TaylorII, Larry E [University of Maryland; Henrissat, Bernard [Universite d' Aix-Marseille I & II; Hauser, Loren John [ORNL; Land, Miriam L [ORNL; Coutinho, Pedro M [Universite d' Aix-Marseille I & II; Rancurel, Corinne [Universite d' Aix-Marseille I & II; Saunders, Elizabeth H [Los Alamos National Laboratory (LANL); Longmire, Atkinson G [University of Maryland; Zhang, Haitao [University of Maryland; Bayer, Ed [Weizmann Institute of Science, Rehovot, Israel; Gilbert, Harry J [University of Newcastle upon Tyne; Larimer, Frank W [ORNL; Zhulin, Igor B [University of Tennessee, Knoxville (UTK) & Oak Ridge National Laboratory (ORNL); Ekborg, Nathan A. [University of Maryland; Lamed, Raphael [Tel Aviv University; Richardson, P M [U.S. Department of Energy, Joint Genome Institute; Borovok, Ilya [Tel Aviv University; Hutcheson, Steven [University of Maryland


    The marine bacterium Saccharophagus degradans strain 2-40 (Sde 2-40) is emerging as a vanguard of a recently discovered group of marine and estuarine bacteria that recycles complex polysaccharides (CP). We report its complete genome sequence, analysis of which identifies an unusually large number of enzymes that degrade >10 CP. Not only is this an extraordinary range of catabolic capability, but many of the enzymes contain domains and features - some unusual, others unique - that are believed to facilitate depolymerization of CP. This is the first sequenced genome of a marine bacterium that can degrade plant cell walls, an important component of the carbon cycle that is not well characterized in the marine environment.

  19. Complete genome sequence of the complex carbohydrate-degrading marine bacterium, Saccharophagus degradans strain 2-40 T.

    Directory of Open Access Journals (Sweden)

    Ronald M Weiner


    Full Text Available The marine bacterium Saccharophagus degradans strain 2-40 (Sde 2-40 is emerging as a vanguard of a recently discovered group of marine and estuarine bacteria that recycles complex polysaccharides. We report its complete genome sequence, analysis of which identifies an unusually large number of enzymes that degrade >10 complex polysaccharides. Not only is this an extraordinary range of catabolic capability, many of the enzymes exhibit unusual architecture including novel combinations of catalytic and substrate-binding modules. We hypothesize that many of these features are adaptations that facilitate depolymerization of complex polysaccharides in the marine environment. This is the first sequenced genome of a marine bacterium that can degrade plant cell walls, an important component of the carbon cycle that is not well-characterized in the marine environment.

  20. Nuclear weapons produced 236U, 239Pu and 240Pu archived in a Porites Lutea coral from Enewetak Atoll. (United States)

    Froehlich, M B; Tims, S G; Fallon, S J; Wallner, A; Fifield, L K


    A slice from a Porites Lutea coral core collected inside the Enewetak Atoll lagoon, within 15 km of all major nuclear tests conducted at the atoll, was analysed for 236U, 239Pu and 240Pu over the time interval 1952-1964 using a higher time resolution than previously reported for a parallel slice from the same core. In addition two sediment samples from the Koa and Oak craters were analysed. The strong peaks in the concentrations of 236U and 239Pu in the testing years are confirmed to be considerably wider than the flushing time of the lagoon. This is likely due to the growth mechanism of the coral. Following the last test in 1958 atom concentrations of both 236U and 239Pu decreased from their peak values by more than 95% and showed a seasonal signal thereafter. Between 1959 and 1964 the weighted average of the 240Pu/239Pu atom ratio is 0.124 ± 0.008 which is similar to that in the lagoon sediments (0.129 ± 0.006) but quite distinct from the global fallout value of ∼0.18. This, and the high 239,240Pu and 236U concentrations in the sediments, provides clear evidence that the post-testing signal in the coral is dominated by remobilisation of the isotopes from the lagoon sediments rather than from global fallout. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Estimation of 240Pu Mass in a Waste Tank Using Ultra-Sensitive Detection of Radioactive Xenon Isotopes from Spontaneous Fission

    Energy Technology Data Exchange (ETDEWEB)

    Bowyer, Ted W. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Gesh, Christopher J. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Haas, Derek A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Hayes, James C. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Mahoney, Lenna A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Meacham, Joseph E. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Mendoza, Donaldo P. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Olsen, Khris B. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Prinke, Amanda M. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Reid, Bruce D. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Woods, Vincent T. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)


    We report on a technique to detect and quantify the amount of 240Pu in a large tank used to store nuclear waste from plutonium production at the Hanford nuclear site. While the contents of this waste tank are known from previous grab sample measurements, our technique could allow for determination of the amount of 240Pu in the tank without costly sample retrieval and analysis of this highly radioactive material. This technique makes an assumption, which was confirmed, that 240Pu dominates the spontaneous fissions occurring in the tank.

  2. Luminous and high-frequency peaked blazars: the origin of the γ-ray emission from PKS 1424+240 (United States)

    Cerruti, M.; Benbow, W.; Chen, X.; Dumm, J. P.; Fortson, L. F.; Shahinyan, K.


    Context. The current generation of ground-based Cherenkov telescopes, together with the LAT instrument on-board the Fermi satellite, have greatly increased our knowledge of γ-ray blazars. Among them, the high-frequency-peaked BL Lacertae object (HBL) PKS 1424+240 (z ≃ 0.6) is the farthest persistent emitter of very-high-energy (VHE; E ≥ 100 GeV) γ-ray photons. Current emission models can satisfactorily reproduce typical blazar emission assuming that the dominant emission process is synchrotron-self-Compton (SSC) in HBLs; and external-inverse-Compton (EIC) in low-frequency-peaked BL Lacertae objects and flat-spectrum-radio-quasars. Alternatively, hadronic models are also able to correctly reproduce the γ-ray emission from blazars, although they are in general disfavored for bright quasars and rapid flares. Aims: The blazar PKS 1424+240 is a rare example of a luminous HBL, and we aim to determine which is the emission process most likely responsible for its γ-ray emission. This will impact more generally our comprehension of blazar emission models, and how they are related to the luminosity of the source and the peak frequency of the spectral energy distribution. Methods: We have investigated different blazar emission models applied to the spectral energy distribution of PKS 1424+240. Among leptonic models, we study a one-zone SSC model (including a systematic study of the parameter space), a two-zone SSC model, and an EIC model. We then investigated a blazar hadronic model, and finally a scenario in which the γ-ray emission is associated with cascades in the line-of-sight produced by cosmic rays from the source. Results: After a systematic study of the parameter space of the one-zone SSC model, we conclude that this scenario is not compatible with γ-ray observations of PKS 1424+240. A two-zone SSC scenario can alleviate this issue, as well as an EIC solution. For the latter, the external photon field is assumed to be the infra-red radiation from the dusty

  3. Corrective Action Decision Document for Corrective Action Unit 240: Area 25 Vehicle Washdown, Nevada Test Site, Nevada

    Energy Technology Data Exchange (ETDEWEB)

    US Department of Energy Nevada Operations Office


    This Corrective Action Decision Document identifies and rationalizes the U.S. Department of Energy, Nevada Operations Offices's selection of a recommended corrective action alternative (CAA) appropriate to facilitate the closure of Corrective Action Unit (CAU) 240: Area 25 Vehicle Washdown, Nevada Test Site, Nevada. This corrective action investigation was conducted in accordance with the Corrective Action Investigation Plan for CAU 240 as developed under the Federal Facility Agreement and Consent Order. Located in Area 25 at the Nevada Test Site in Nevada, CAU 240 is comprised of three Corrective Action Sites (CASs): 25-07-01, Vehicle Washdown Area (Propellant Pad); 25-07-02, Vehicle Washdown Area (F and J Roads Pad); and 25-07-03, Vehicle Washdown Station (RADSAFE Pad). In March 1999, the corrective action investigation was performed to detect and evaluate analyte concentrations against preliminary action levels (PALs) to determine contaminants of concern (COCs). There were no COCs identified at CAS 25-07-01 or CAS 25-07-03; therefore, there was no need for corrective action at these two CASs. At CAS 25-07-02, diesel-range organics and radionuclide concentrations in soil samples from F and J Roads Pad exceeded PALs. Based on this result, potential CAAs were identified and evaluated to ensure worker, public, and environmental protection against potential exposure to COCs in accordance with Nevada Administrative Code 445A. Following a review of potential exposure pathways, existing data, and future and current operations in Area 25, two CAAs were identified for CAU 240 (CAS 25-07-02): Alternative 1 - No Further Action and Alternative 2 - Clean Closure by Excavation and Disposal. Alternative 2 was identified as the preferred alternative. This alternative was judged to meet all requirements for the technical components evaluated, compliance with all applicable state and federal regulations for closure of the site, as well as minimizing potential future exposure

  4. Excess Lead-210 and Plutonium-239+240: Two suitable radiogenic soil erosion tracers for mountain grassland sites. (United States)

    Meusburger, K; Porto, P; Mabit, L; La Spada, C; Arata, L; Alewell, C


    The expected growing population and challenges associated with globalisation will increase local food and feed demands and enhance the pressure on local and regional upland soil resources. In light of these potential future developments it is necessary to define sustainable land use and tolerable soil loss rates with methods applicable and adapted to mountainous areas. Fallout-radionuclides (FRNs) are proven techniques to increase our knowledge about the status and resilience of agro-ecosystems. However, the use of the Caesium-137 ( 137 Cs) method is complicated in the European Alps due to its heterogeneous input and the timing of the Chernobyl fallout, which occurred during a few single rain events on partly snow covered ground. Other radioisotopic techniques have been proposed to overcome these limitations. The objective of this study is to evaluate the suitability of excess Lead-210 ( 210 Pb ex ) and Plutonium-239+240 ( 239+240 Pu) as soil erosion tracers for three different grassland management types at the steep slopes (slope angles between 35 and 38°) located in the Central Swiss Alps. All three FRNs identified pastures as having the highest mean (± standard deviation) net soil loss of -6.7 ± 1.1, -9.8 ± 6.8 and -7.0 ± 5.2 Mg ha -1 yr -1 for 137 Cs, 210 Pb ex and 239+240 Pu, respectively. A mean soil loss of -5.7 ± 1.5, -5.2 ± 1.5 and-5.6 ± 2.1 was assessed for hayfields and the lowest rates were established for pastures with dwarf-shrubs (-5.2 ± 2.5, -4.5 ± 2.5 and -3.3 ± 2.4 Mg ha -1 yr -1 for 137 Cs, 210 Pb ex and 239+240 Pu, respectively). These rates, evaluated at sites with an elevated soil erosion risk exceed the respective soil production rates. Among the three FRN methods used, 239+240 Pu appears as the most promising tracer in terms of measurement uncertainty and reduced small scale variability (CV of 13%). Despite a higher level of uncertainty, 210 Pb ex produced comparable results, with a wide range of erosion rates sensitive to changes

  5. Formation and distribution of fragments in the spontaneous fission of 240Pu (United States)

    Sadhukhan, Jhilam; Zhang, Chunli; Nazarewicz, Witold; Schunck, Nicolas


    Background: Fission is a fundamental decay mode of heavy atomic nuclei. The prevalent theoretical approach is based on mean-field theory and its extensions where fission is modeled as a large amplitude motion of a nucleus in a multidimensional collective space. One of the important observables characterizing fission is the charge and mass distribution of fission fragments. Purpose: The goal of this Rapid Communication is to better understand the structure of fission fragment distributions by investigating the competition between the static structure of the collective manifold and the stochastic dynamics. In particular, we study the characteristics of the tails of yield distributions, which correspond to very asymmetric fission into a very heavy and a very light fragment. Methods: We use the stochastic Langevin framework to simulate the nuclear evolution after the system tunnels through the multidimensional potential barrier. For a representative sample of different initial configurations along the outer turning-point line, we define effective fission paths by computing a large number of Langevin trajectories. We extract the relative contribution of each such path to the fragment distribution. We then use nucleon localization functions along effective fission pathways to analyze the characteristics of prefragments at prescission configurations. Results: We find that non-Newtonian Langevin trajectories, strongly impacted by the random force, produce the tails of the fission fragment distribution of 240Pu. The prefragments deduced from nucleon localizations are formed early and change little as the nucleus evolves towards scission. On the other hand, the system contains many nucleons that are not localized in the prefragments even near the scission point. Such nucleons are distributed rapidly at scission to form the final fragments. Fission prefragments extracted from direct integration of the density and from the localization functions typically differ by more than

  6. Determination of Plutonium Activity Concentrations and 240Pu/239Pu Atom Ratios in Brown Algae (Fucus distichus) Collected from Amchitka Island, Alaska.

    Energy Technology Data Exchange (ETDEWEB)

    Hamilton, T F; Brown, T A; Marchetti, A A; Martinelli, R E; Kehl, S R


    Plutonium-239 ({sup 239}Pu) and plutonium-240 ({sup 240}Pu) activity concentrations and {sup 240}Pu/{sup 239}Pu atom ratios are reported for Brown Algae (Fucus distichus) collected from the littoral zone of Amchitka Island (Alaska) and at a control site on the Alaskan peninsula. Plutonium isotope measurements were performed in replicate using Accelerator Mass Spectrometry (AMS). The average {sup 240}Pu/{sup 239}Pu atom ratio observed in dried Fucus d. collected from Amchitka Island was 0.227 {+-} 0.007 (n=5) and compares with the expected {sup 240}Pu/{sup 239}Pu atom ratio in integrated worldwide fallout deposition in the Northern Hemisphere of 0.1805 {+-} 0.0057 (Cooper et al., 2000). In general, the characteristically high {sup 240}Pu/{sup 239}Pu content of Fucus d. analyzed in this study appear to indicate the presence of a discernible basin-wide secondary source of plutonium entering the marine environment. Of interest to the study of plutonium source terms within the Pacific basin are reports of elevated {sup 240}Pu/{sup 239}Pu atom ratios in fallout debris from high-yield atmospheric nuclear tests conducted in the Marshall Islands during the 1950s (Diamond et al., 1960), the wide range of {sup 240}Pu/{sup 239}Pu atom ratio values (0.19 to 0.34) observed in sea water, sediments, coral and other environmental media from the North Pacific Ocean (Hirose et al., 1992; Buesseler, 1997) and updated estimates of the relative contributions of close-in and intermediate fallout deposition on oceanic inventories of radionuclidies, especially in the Northern Pacific Ocean (Hamilton, 2004).

  7. Targeting of Micelles and Liposomes Loaded with the Pro-Apoptotic Drug, NCL-240, into NCI/ADR-RES Cells in a 3D Spheroid Model. (United States)

    Pattni, Bhushan S; Nagelli, Srikar G; Aryasomayajula, Bhawani; Deshpande, Pranali P; Kulkarni, Abhijit; Hartner, William C; Thakur, Ganesh; Degterev, Alexei; Torchilin, Vladimir P


    To develop transferrin (Tf)-targeted delivery systems for the pro-apoptotic drug, NCL-240, and to evaluate the efficacy of this delivery system in ovarian cancer NCI/ADR-RES cells, grown in vitro in a 3D spheroid model. Tf-targeted PEG-PE-based micellar and ePC/CHOL-based liposomal delivery systems for NCL-240 were prepared. NCI/ADR-RES cells were used to generate spheroids by a non-adhesive liquid overlay technique. Spheroid growth and development were monitored by size (diameter) analysis and H&E staining. The targeted formulations were compared to untargeted ones in terms of their degree of spheroid association and penetration. A cell viability analysis with NCL-240-loaded micelles and liposomes was performed to assess the effectiveness of Tf-targeting. Tf-targeted polymeric micelles and Tf-targeted liposomes loaded with NCL-240 were prepared. NCI/ADR-RES cells generated spheroids that demonstrated the presence of a distinct necrotic core along with proliferating cells in the spheroid periphery, partly mimicking in vivo tumors. The Tf-targeted micelles and liposomes had a deeper spheroid penetration as compared to the untargeted delivery systems. Cell viability studies using the spheroid model demonstrated that Tf-mediated targeting markedly improved the cytotoxicity profile of NCL-240. Transferrin targeting enhanced delivery and effectiveness of micelles and liposomes loaded with NCL-240 against NCI/ADR-RES cancer cells in a 3D spheroid model.

  8. Comparative migration behaviour of {sup 90}Sr, {sup 239+240}Pu and {sup 241}Am in mineral and organic soils of France

    Energy Technology Data Exchange (ETDEWEB)

    Solovitch-Vella, N. [IRSN Cadarache, BP3 13115, Saint-Paul-lez Durance cedex (France); Pourcelot, L. [IRSN Cadarache, BP3 13115, Saint-Paul-lez Durance cedex (France)], E-mail:; Chen, V.T. [IRSN Cadarache, BP3 13115, Saint-Paul-lez Durance cedex (France); Froidevaux, P. [Institut de Radiophysique Appliquee, Grand Pre 1, 1007 Lausanne (Switzerland); Gauthier-Lafaye, F.; Stille, P. [Centre de Geochimie de la Surface-CNRS, 1, rue Blessig 67083, Strasbourg cedex (France); Aubert, D. [CEFREM, Universite de Perpignan 52, Avenue Paul Alduy, 66860 Perpignan (France)


    The vertical migration of {sup 90}Sr, {sup 239+240}Pu and {sup 241}Am has been studied in two types of soils in France (acid forest soil in the Vosges Mountains and organic-rich alkaline wetland in the Mercantour area). In order to interpret the different migration behaviour of radionuclides, the combination of two approaches are proposed - a statistical study of the evolution of radionuclide ratios ({sup 241}Am/{sup 239+240}Pu, {sup 90}Sr/{sup 239+240}Pu) with depth and a calculation of the radionuclide migration rates. Migration behaviour of {sup 90}Sr, {sup 239+240}Pu and {sup 241}Am is significantly different in the Vosges and Mercantour soils. In the Mercantour soil {sup 241}Am was found to be less mobile than {sup 239+240}Pu. In both profiles {sup 90}Sr is more mobile than {sup 239+240}Pu. The high sand content (55-60%) and weathering processes of cations in the Vosges soil are thought to be responsible for the larger migration rates of radionuclides in depth, while the high organic matter content (>70%) of Mercantour soil is thought to be responsible for the stronger retention of {sup 241}Am in the first 10 cm of the soil.

  9. Estimation of Plutonium-240 Mass in Waste Tanks Using Ultra-Sensitive Detection of Radioactive Xenon Isotopes from Spontaneous Fission

    Energy Technology Data Exchange (ETDEWEB)

    Bowyer, Theodore W. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Gesh, Christopher J. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Haas, Daniel A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Hayes, James C. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Johns, Jesse M. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Lukins, Craig D. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Mahoney, Lenna A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Meacham, Joseph E. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Mendoza, Donaldo P. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Olsen, Khris B. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Prinke, Amanda M. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Reid, Bruce D. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Sevigny, Gary J. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Sinkov, Sergey I. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Woods, Vincent T. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)


    This report details efforts to develop a technique which is able to detect and quantify the mass of 240Pu in waste storage tanks and other enclosed spaces. If the isotopic ratios of the plutonium contained in the enclosed space is also known, then this technique is capable of estimating the total mass of the plutonium without physical sample retrieval and radiochemical analysis of hazardous material. Results utilizing this technique are reported for a Hanford Site waste tank (TX-118) and a well-characterized plutonium sample in a laboratory environment.

  10. The Radio Frequency Environment at 240-270 MHz with Application to Signal-of-Opportunity Remote Sensing (United States)

    Piepmeier, Jeffrey R.; Vega, Manuel; Fritts, Matthew; Du Toit, Cornelis; Knuble, Joseph; Lin, Yao-Cheng; Nold, Benjamin; Garrison, James


    Low frequency observations are desired for soil moisture and biomass remote sensing. Long wavelengths are needed to penetrate vegetation and Earths land surface. In addition to the technical challenges of developing Earth observing spaceflight instruments operating at low frequencies, the radio frequency spectrum allocated to remote sensing is limited. Signal-of-opportunity remote sensing offers the chance to use existing signals exploiting their allocated spectrum to make Earth science measurements. We have made observations of the radio frequency environment around 240-270 MHz and discuss properties of desired and undesired signals.

  11. Improved absorption cross-sections of oxygen in the wavelength region 205-240 nm of the Herzberg continuum (United States)

    Yoshino, K.; Cheung, A. S.-C.; Esmond, J. R.; Parkinson, W. H.; Freeman, D. E.


    The laboratory values of the Herzberg continuum absorption cross-section of oxygen at room temperature from Cheung et al. (1986) and Jenouvrier et al. (1986) are compared and analyzed. It is found that there is no discrepancy between the absolute values of these two sets of independent measurements. The values are combined in a linear least-squares fit to obtain improved values of the Herzberg continuum cross-section of oxygen at room temperature throughout the wavelength region 205-240 nm. The results are compared with in situ and other laboratory measurements.

  12. Measurement of the $^{240,242}$Pu(n,f) cross section at the CERN n_TOF facility

    CERN Document Server

    Tsinganis, A; Guerrero, C; Colonna, N; Calviani, M; Vlastou, R; Andriamonje, S; Vlachoudis, V; Gunsing, F; Massimi, C; Altstadt, S; Andrzejewski, J; Audouin, L; Barbagallo, M; Bécares, V; Becvár, F; Belloni, F; Billowes, J; Boccone, V; Bosnar, D; Brugger, M; Calviño, F; Cano-Ott, D; Carrapiço, C; Cerutti, F; Chin, M; Cortés, G; Cortés-Giraldo, M A; Diakaki, M; Domingo-Pardo, C; Duran, I; Dressler, R; Dzysiuk, N; Eleftheriadis, C; Ferrari, A; Fraval, K; Ganesan, S; García, A R; Giubrone, G; Gómez-Hornillos, M B; Gonçalves, I F; González-Romero, E; Griesmayer, E; Gurusamy, P; Hernández-Prieto, A; Jenkins, D G; Jericha, E; Kadi, Y; Käppeler, F; Karadimos, D; Kivel, N; Koehler, P; Kokkoris, M; Krtiˇcka, M; Kroll, J; Lampoudis, C; Langer, C; Leal-Cidoncha, E; Lederer, C; Leeb, H; Leong, L S; Losito, R; Mallick, A; Manousos, A; Marganiec, J; Martínez, T; Mastinu, P F; Mastromarco, M; Meaze, M; Mendoza, E; Mengoni, A; Milazzo, P M; Mingrone, F; Mirea, M; Mondalaers, W; Paradela, C; Pavlik, A; Perkowski, J; Plompen, A; Praena, J; Quesada, J M; Rauscher, T; Reifarth, R; Riego, A; Robles, M S; Roman, F; Rubbia, C; Sabaté-Gilarte, M; Sarmento, R; Saxena, A; Schillebeeckx, P; Schmidt, S; Schumann, D; Tagliente, G; Tain, J L; Tarrío, D; Tassan-Got, L; Valenta, S; Vannini, G; Variale, V; Vaz, P; Ventura, A; Versaci, R; Vermeulen, M J; Wallner, A; Ware, T; Weigand, M; Weiss, C; Wright, T; Zugec, P


    Knowledge of neutron cross sections of various plutonium isotopes and other minor actinides is crucial for the design of advanced nuclear systems. The $^{240 , 242}$Pu(n,f) cross sections were measured at the CERN n_TOF facility, taking advantage of the wide energy range (from thermal to GeV) and the high instantaneous f ux of the neutron beam. In this work, preliminary results for $^{242}$Pu are presented along with a theoretical cross section calculation performed with the EMPIRE code.

  13. 240-GHz continuously frequency-tuneable Nd:YVO₄/LBO laser with two intra-cavity locked etalons. (United States)

    Radnatarov, Daba; Kobtsev, Sergey; Khripunov, Sergey; Lunin, Vladimir


    This work reports for the first time on study of a single-frequency Nd:YVO4 laser with intra-cavity frequency doubling, in which quasi-continuous frequency tuning over an ultra-broad range is implemented with two intra-cavity locked etalons and automatic stitching between ranges of smooth scanning of the laser's output frequency. The proposed and demonstrated method allowed to continuously tune the output frequency of the studied 1.5-W Nd:YVO4/LBO laser over a record-breaking broad range of 240 GHz at 532 nm.

  14. Distribution and migration of 239+240Pu in abiotic components of the Black Sea ecosystems during the post-Chernobyl period. (United States)

    Tereshchenko, N N; Gulin, S B; Proskurnin, V Yu


    Distribution of 239,240Pu in abiotic components (water and bottom sediment) of the Black Sea ecosystems was studied during the post-Chernobyl period at different offshore and near-shore locations. The trends of these radionuclides accumulation by sediments were analyzed. The spatial-temporal changes in the 239,240Pu distribution as well as effective half-life for these radionuclides in the Black Sea surface water in deep-sea area are presented. The estimations of the average annual removal fluxes of the 239,240Pu into the bottom sediments were obtained. The Black Sea sediments were characterized by a higher 239,240Pu concentration factor (Cf ≈ n·104-n·106) and radiocapacity factor (F(239,240Pu) was about 99.9% on the shelf, 94.5-99.1% on deep-sea basin for silty and 94.6-98.9% on the shelf for sandy bottom sediments) as compared with Cf and F for 137Cs and 90Sr. Silty bottom sediments play the role of 239,240Pu main depot in the Black Sea ecosystem. The studied radioecological characteristics of Pu allowed us to define the type of plutonium biogeochemical behavior in the Black Sea as a pedotropic one. The results of this complex radioecological monitoring of 239+240Pu contamination in the Black Sea and their analysis makes it possible to understand the plutonium redistribution pathways which will enable to carry out the tracing of its migration within the ecosystems. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Effects of exchange-correlation potentials on the density-functional description of C60 versus C240 photoionization (United States)

    Choi, Jinwoo; Chang, EonHo; Anstine, Dylan M.; Madjet, Mohamed El-Amine; Chakraborty, Himadri S.


    We study the photoionization properties of the C60 versus C240 molecule in a spherical jellium frame of the density-functional method. Two prototypical approximations of the exchange-correlation (xc) functional are used: (i) the Gunnarsson-Lundqvist parametrization [Gunnarsson and Lundqvist, Phys. Rev. B 13, 4274 (1976), 10.1103/PhysRevB.13.4274] with a correction for the electron self-interaction (SIC) introduced artificially from the outset and (ii) a gradient-dependent augmentation of approximation (i) using the van Leeuwen and Baerends model potential [van Leeuwen and Baerends, Phys. Rev. A 49, 2421 (1994), 10.1103/PhysRevA.49.2421], in lieu of SIC, that restores electrons' asymptotic properties intrinsically within the formalism. Ground-state results from the two schemes for both molecules show differences in the shapes of mean-field potentials and bound-level properties. The choice of an xc scheme also significantly alters the dipole single-photoionization cross sections obtained by an ab initio method that incorporates linear-response dynamical correlations. Differences in the structures and ionization responses between C60 and C240 uncover the effect of molecular size on the underlying physics. Analysis indicates that the collective plasmon resonances with the gradient-based xc option produce results noticeably closer to the experimental data available for C60.

  16. Pu-239/Pu-240 isotope ratios determined using high resolution emission spectroscopy in a laser-induced plasma (United States)

    Smith, Coleman A.; Martinez, Max A.; Veirs, D. Kirk; Cremers, David A.


    Laser-induced breakdown spectroscopy (LIBS) has been applied for the determination of plutonium isotope ratios through direct observation of atomic emission from laser-induced plasmas at high resolution. The Pu-239/Pu-240 isotope shift of -0.355 cm -1 from the plutonium atomic line at 594.52202 nm (Blaise et al., The Atomic Spectrum of Plutonium, Argonne National Laboratory Report ANL-83-95, 1984) is clearly resolved in our plasma conditions. Atomic emission is dispersed through a 2-m spectrometer in double pass mode and collected on an electronically gated, intensified charge-coupled device (ICCD) camera. The integrated peak areas obtained from curve-fitting closely match the Pu-239/Pu-240 isotopic ratios obtained from standard methods of thermal ionization mass spectrometry and gamma spectrometry. The observed plutonium linewidths were 0.19 cm -1 (0.0067 nm). These linewidths are within the experimental error of the ideal instrument-limited linewidth, which is calculated to be 0.15 cm -1 (0.0052 nm) based upon the known modulation transfer function for the ICCD system. This linewidth should allow LIBS to be applicable for isotopic ratio measurements for all of the light actinides.

  17. Activity ratios of {sup 137}Cs, {sup 90}Sr and {sup 239+240}Pu in environmental samples

    Energy Technology Data Exchange (ETDEWEB)

    Bossew, P. [European Commission - DG Joint Research Centre, Institute for Environment and Sustainability (IES), I-21020 Ispra (Vatican City State, Holy See,) (Italy)], E-mail:; Lettner, H. [Institute of Physics and Biophysics, University of Salzburg, Hellbrunner Strasse 34, A-5020 Salzburg (Austria)], E-mail:; Hubmer, A.; Erlinger, C.; Gastberger, M. [Institute of Physics and Biophysics, University of Salzburg, Hellbrunner Strasse 34, A-5020 Salzburg (Austria)


    Both global and Chernobyl fallout have resulted in environmental contamination with radionuclides such as {sup 137}Cs, {sup 90}Sr and {sup 239+240}Pu. In environmental samples, {sup 137}Cs and {sup 239+240}Pu can be divided into the contributions of either source, if also the isotopes {sup 134}Cs and {sup 238}Pu are measurable, based on the known isotopic ratios in global and Chernobyl fallout. No analogous method is available for {sup 90}Sr. The activity ratios of Sr to Cs and Pu, respectively, are known for the actual fallout mainly from air filter measurements; but due to the high mobility of Sr in the environment, compared to Cs and Pu, these ratios generally do not hold for the inventory many years after deposition. In this paper we suggest a method to identify the mean contributions of global and Chernobyl fallout to total Sr in soil, sediment and cryoconite samples from Alpine and pre-Alpine regions of Austria, based on a statistical evaluation of Sr/Cs/Pu radionuclide activity ratios. Results are given for Sr:Cs, Sr:Pu and Cs:Pu ratios. Comparison with fallout data shows a strong depletion of Sr against Cs and Pu.

  18. Discovery of Very High Energy Gamma Rays from PKS 1424+240 and Multiwavelength Constraints on its Redshift

    Energy Technology Data Exchange (ETDEWEB)

    Acciari, V.A.; /Harvard-Smithsonian Ctr. Astrophys.; Aliu, E.; /Delaware U., Bartol Inst.; Arlen, T.; /UCLA; Aune, T.; /UC, Santa Cruz; Bautista, M.; /McGill U.; Beilicke, M. /Washington U., St. Louis; Benbow, W.; /Harvard-Smithsonian Ctr. Astrophys.; Bottcher, M.; /Ohio U.; Boltuch, D.; /Delaware U., Bartol Inst.; Bradbury, S.M.; /Leeds U.; Buckley, J.H.; /Washington U., St. Louis; Bugaev, V.; /Washington U., St. Louis; Byrum, K.; /Argonne; Cannon, A.; /University Coll., Dublin; Cesarini, A.; /Natl. U. of Ireland, Galway; Chow, Y.C.; /UCLA; Ciupik, L.; /Roosevelt U., Chicago; Cogan, P.; /McGill U.; Cui, W.; /Purdue U.; Duke, C.; /Grinnell Coll.; Falcone, A.; /Penn State U. /Purdue U. /Utah U. /Roosevelt U., Chicago /Harvard-Smithsonian Ctr. Astrophys. /Purdue U. /Natl. U. of Ireland, Galway /Utah U. /University Coll., Dublin /McGill U. /Roosevelt U., Chicago /McGill U. /Delaware U., Bartol Inst. /Utah U. /Chicago U., EFI /Iowa State U. /Roosevelt U., Chicago /DePauw U. /Utah U. /Pittsburg State U. /Washington U., St. Louis /Iowa State U. /Natl. U. of Ireland, Galway /Utah U. /McGill U. /Washington U., St. Louis /McGill U. /McGill U. /Purdue U. /Anderson U. /Galway-Mayo Inst. of Tech. /Iowa State U. /UCLA; /more authors..


    We report the first detection of very-high-energy (VHE) gamma-ray emission above 140GeV from PKS 1424+240, a BL Lac object with an unknown redshift. The photon spectrum above 140GeV measured by VERITAS is well described by a power law with a photon index of 3.8 {+-}0.5{sub stat} {+-} 0.3{sub syst} and a flux normalization at 200 GeV of (5.1 {+-} 0.9{sub stat} {+-} 0.5{sub syst}) x 10{sup -11} TeV{sup -1} cm{sup -2} s{sup -1}, where stat and syst denote the statistical and systematical uncertainty, respectively. The VHE flux is steady over the observation period between MJD 54881 and 55003 (2009 February 19 to June 21). Flux variability is also not observed in contemporaneous high energy observations with the Fermi Large Area Telescope (LAT). Contemporaneous X-ray and optical data were also obtained from the Swift XRT and MDM observatory, respectively. The broadband spectral energy distribution (SED) is well described by a one-zone synchrotron self-Compton (SSC) model favoring a redshift of less than 0.1. Using the photon index measured with Fermi in combination with recent extragalactic background light (EBL) absorption models it can be concluded from the VERITAS data that the redshift of PKS 1424+240 is less than 0.66.

  19. Automated absolute activation analysis with californium-252 sources

    Energy Technology Data Exchange (ETDEWEB)

    MacMurdo, K.W.; Bowman, W.W.


    A 100-mg /sup 252/Cf neutron activation analysis facility is used routinely at the Savannah River Laboratory for multielement analysis of many solid and liquid samples. An absolute analysis technique converts counting data directly to elemental concentration without the use of classical comparative standards and flux monitors. With the totally automated pneumatic sample transfer system, cyclic irradiation-decay-count regimes can be pre-selected for up to 40 samples, and samples can be analyzed with the facility unattended. An automatic data control system starts and stops a high-resolution gamma-ray spectrometer and/or a delayed-neutron detector; the system also stores data and controls output modes. Gamma ray data are reduced by three main programs in the IBM 360/195 computer: the 4096-channel spectrum and pertinent experimental timing, counting, and sample data are stored on magnetic tape; the spectrum is then reduced to a list of significant photopeak energies, integrated areas, and their associated statistical errors; and the third program assigns gamma ray photopeaks to the appropriate neutron activation product(s) by comparing photopeak energies to tabulated gamma ray energies. Photopeak areas are then converted to elemental concentration by using experimental timing and sample data, calculated elemental neutron capture rates, absolute detector efficiencies, and absolute spectroscopic decay data. Calculational procedures have been developed so that fissile material can be analyzed by cyclic neutron activation and delayed-neutron counting procedures. These calculations are based on a 6 half-life group model of delayed neutron emission; calculations include corrections for delayed neutron interference from /sup 17/O. Detection sensitivities of < or = 400 ppB for natural uranium and 8 ppB (< or = 0.5 (nCi/g)) for /sup 239/Pu were demonstrated with 15-g samples at a throughput of up to 140 per day. Over 40 elements can be detected at the sub-ppM level.

  20. Metastable charge-transfer state of californium(iii) compounds. (United States)

    Liu, Guokui; Cary, Samantha K; Albrecht-Schmitt, Thomas E


    Among a series of anomalous physical and chemical properties of Cf(iii) compounds revealed by recent investigations, the present work addresses the characteristics of the optical spectra of An(HDPA)3·H2O (An = Am, Cm, and Cf), especially the broadband photoluminescence from Cf(HDPA)3·H2O induced by ligand-to-metal charge transfer (CT). As a result of strong ion-ligand interactions and the relative ease of reducing Cf(iii) to Cf(ii), a CT transition occurs at low energy (transfer state undergoes radiative and non-radiative relaxations. Broadening of the CT transition arises from strong vibronic coupling and hole-charge interactions in the valence band. The non-radiative relaxation of the metastable CT state results from a competition between phonon-relaxation and thermal tunneling that populates the excited states of Cf(iii).

  1. Development of transferrin targeted NCL-240 micelles and their evaluation using in-vitro 3D cancer cell culture (spheroid) models (United States)

    Nagelli, Srikar Goud

    The main objective of this project was to develop targeted micellar delivery systems of a novel cytotoxic drug (NCL-240; a second generation DM-PIT-1 analog) and to evaluate their efficacy using optimized 3D cell culture spheroid models. Spheroids were optimized for several cancer cell lines using a range of techniques such as non-adhesive liquid overlay method, hanging drop method, and co-culturing. Transferrin (Tf)-conjugated NCL-240 micelles were prepared with varying Tf amounts and their cytotoxicities were evaluated using the optimized spheroid models. The uptake and penetration of the formulations were also studied using confocal microscopy. The results indicated that the concentration of NCL-240 micelles required to achieve the same cytotoxicity was relatively higher in spheroids compared to the monolayers. Also, In NCI-ADR-RES, Tf-targeted NCL-240 micelles were shown to have a significant increase in cytotoxicity compared to untargeted NCL-240 micelles. Even the penetration and uptake studies indicated that targeting improves the uptake and penetration of formulations. However, in U87-MG spheroids, there was a significant difference in cell viability among micelles compared to free drug but no significant benefit due to targeting was observed. The same formulations penetrated lesser in U87-MG spheroids compared to NCI-ADR-RES spheroids. This study thereby emphasizes the importance of drug screening in spheroid models as the penetration dynamics are varying from cell line to cell line because of the 3D structure.

  2. Distribution and source of 129I, 239,240Pu, 137Cs in the environment of Lithuania

    DEFF Research Database (Denmark)

    Ezerinskis, Z.; Hou, Xiaolin; Druteikiene, R.


    Fifty five soil samples collected in the Lithuania teritory in 2011 and 2012 were analyzed for 129I, 137Cs and Pu isotopes in order to investigate the level and distribution of artificial radioactivity in Lithuania. The activity and atomic ratio of 238Pu/239,240Pu, 129I/127I and 131I/137Cs were...... used to identify the origin of these radionuclides. The 238Pu/239þ240Pu and 240Pu/239Pu ratios in the soil samples analyzed varied in the range of 0.02e0.18 and 0.18e0.24, respectively, suggesting the global fallout as the major source of Pu in Lithuania. The values of 109 to 106 for 129I/127I atomic...

  3. Atmospheric input of ¹³⁷Cs and 239,240Pu isotopes in Korea after the Fukushima nuclear power plant accident. (United States)

    Oh, Jung-Suk; Lee, Sang-Han; Choi, Jong-Ki; Lee, Jong-Man; Lee, Kyung-Bum; Park, Tae-Soon


    Caesium isotopes ((134)Cs and (137)Cs) and (239,240)Pu in rainwater and dry deposition have been analyzed by Korea Research Institute of Standards and Science (KRISS) since the Fukushima nuclear power plant (NPP) accident in March 2011. The concentrations of (239,240)Pu and (137)Cs in the rainwater are 2.6±1.0 to 15±3 µBq/kg and 0.01 to 0.36 mBq/kg, respectively. The concentrations are concordant to those observed before the Fukushima NPP accident, on the other hand, the monthly depositional flux of (239,240)Pu and (137)Cs are much lower than the amounts observed after Fukushima NPP accident and in Monaco in 1998-2001. This confirms that the Fukushima NPP accident caused no significant impact in Korea. © 2013 The Authors. Published by Elsevier Ltd All rights reserved.

  4. Comparative study of scattered radiation levels from 80-kVp and 240-kVp x rays in the surgical intensive care unit

    Energy Technology Data Exchange (ETDEWEB)

    Herman, M.W.; Patrick, J.; Tabrisky, J.


    The levels of scattered radiation from 80-kVp and 240-kVp mobile x-ray units were measured in the surgical intensive care unit (ICU). The intensity of scatter of the 240-kVp x rays does not decrease with distance as rapidly as with the 80-kVp beam. In an ICU with four beds, the weekly radiation exposure at the nurses's station approximated 0.05 mR (0.13 x 10/sup -7/ C/kg) for the 80-kVp beam and 0.2 mR (0.52 x 10/sup -7/ C/kg) for the 240-kVp beam. Thus, the annual exposure from either unit would be well below the Maximum Permissible Exposure for nonoccupational workers.

  5. References to Studies of 137Cs, 90Sr and 239+240Pu in the Pacific Ocean a Bibliography

    Energy Technology Data Exchange (ETDEWEB)

    Noshkin, V.E.


    This report contains a listing of publications known to this author on reported concentrations, reviews and discussions of {sup 137}Cs, {sup 90}Sr and {sup 239+240}Pu in seawater, sediment and the biota from parts of the North and South Pacific Ocean. Each reference has been assigned an accession number consisting of the first three letters of the first author's last name followed by the first letter of the first name, the year of the publication and an assigned number. Studies in both the coastal areas and the open ocean are included as well as those providing data within lagoons of coral atolls. Some references to the radionuclides in the Indian Ocean are also provided.

  6. Measurement of the fission cross-section of $^{240}$Pu and $^{242}$Pu at CERN's n_TOF Facility

    CERN Multimedia

    Pavlik, A F; Gonzalez romero, E M

    The n_TOF Collaboration proposes to continue the fission program, already started in 2002-2004, taking advantage of the newly constructed Work Sector Type A, with the measurement of the two isotopes : $^{240}$ Pu and $^{242}$ Pu. They are both of major importance for reactor physics applications and are included in the Nuclear Energy Agency (NEA) High Priority List [1], in the NEA WPEC Subgroup 26 Report on the accuracy of nuclear data for advanced reactor designe [2] and in the EU 6$^{th}$ Framework Programme IP-EUROTRANS/NUDATRA reports [3]. Based on those requests, the measurement of the fission cross-section of the two Pu isotopes is one of the objectives of the project ANDES of the FP7 EURATOM program [4].

  7. Aberrant Expression of Calretinin, D2-40 and Mesothelin in Mucinous and Non-Mucinous Colorectal Carcinomas and Relation to Clinicopathological Features and Prognosis. (United States)

    Foda, Abd AlRahman Mohammad; El-Hawary, Amira Kamal; Hamed, Hazem


    CRC is a heterogeneous disease in terms of morphology, invasive behavior, metastatic capacity, and clinical outcome. Recently, many so-called mesothelial markers, including calretinin, D2-40, WT1, thrombomodulin, mesothelin, and others, have been certified. The aim of this study was to assess the immunohistochemical expression of calretinin and other mesothelial markers (D2-40 and mesothelin) in colorectal mucinous adenocarcinoma (MA) and non mucinous adenocarcinoma (NMA) specimens and relation to clinicopathological features and prognosis using manual tissue microarray technique. We studied tumor tissue specimens from 150 patients with colorectal MA and NMA who underwent radical surgery from January 2007 to January 2012. High-density manual tissue microarrays were constructed using a modified mechanical pencil tip technique, and paraffin sections were submitted for immunohistochemistry using Calretinin, D2-40 and mesothelin expressions. We found that NMA showed significantly more calretinin and D2-40 expression than MA In contrast, no statistically significant difference between NMA and MA was detected in mesothelin expression. There were no statistically significant relations between any of the clinicopathological or histological parameters and any of the three markers. In a univariate analysis, neither calretinin nor D2-40 expressions showed any significant relations to DFS or OS. However, mesothelin luminal expression was significantly associated with worse DFS. Multivariate Cox regression analysis proved that luminal mesothelin expression was an independent negative prognostic factor in NMA. In conclusion, Calretinin, D2-40 and mesothelin are aberrantly expressed in a proportion of CRC cases with more expression in NMA than MA. Aberrant expression of these mesothelial markers was not associated with clinicopathological or histological features of CRCs. Only mesothelin expression appears to be a strong predictor of adverse prognosis.

  8. Assessment of nivolumab benefit-risk profile of a 240-mg flat dose relative to a 3-mg/kg dosing regimen in patients with advanced tumors. (United States)

    Zhao, X; Suryawanshi, S; Hruska, M; Feng, Y; Wang, X; Shen, J; Vezina, H E; McHenry, M B; Waxman, I M; Achanta, A; Bello, A; Roy, A; Agrawal, S


    Nivolumab 3 mg/kg every 2 weeks (Q2W) has shown benefit versus the standard of care in melanoma, non-small cell lung cancer (NSCLC), and renal cell carcinoma (RCC). However, flat dosing is expected to shorten preparation time and improve ease of administration. With knowledge of nivolumab safety, efficacy, and pharmacokinetics across a wide dose range in body weight (BW) dosing, assessment of the benefit-risk profile of a 240-mg flat dose relative to the approved 3-mg/kg dose was approached by quantitative clinical pharmacology. A flat dose of 240 mg was selected based on its equivalence to the 3-mg/kg dose at the median BW of ∼80 kg in patients in the nivolumab program. The benefit-risk profile of nivolumab 240 mg was evaluated by comparing exposures at 3 mg/kg Q2W and 240 mg Q2W across BW and tumor types; clinical safety at 3 mg/kg Q2W by BW and exposure quartiles in melanoma, NSCLC, and RCC; and safety and efficacy at 240 mg Q2W relative to 3 mg/kg Q2W in melanoma, NSCLC, and RCC. The median nivolumab exposure and its distribution at 240 mg Q2W were similar to 3 mg/kg Q2W in the simulated population. Safety analyses did not demonstrate a clinically meaningful relationship between BW or nivolumab exposure quartiles and frequency or severity of adverse events. The predicted safety and efficacy were similar across nivolumab exposure ranges achieved with 3 mg/kg Q2W or 240 mg Q2W flat dose. Based on population pharmacokinetic modeling, established flat exposure-response relationships for efficacy and safety, and clinical safety, the benefit-risk profile of nivolumab 240 mg Q2W was comparable to 3 mg/kg Q2W. The quantitative clinical pharmacology approach provided evidence for regulatory decision-making on dose modification, obviating the need for an independent clinical study.

  9. Detection of lymphovascular invasion in early breast cancer by D2-40 (podoplanin): a clinically useful predictor for axillary lymph node metastases.

    NARCIS (Netherlands)

    Braun, M.; Flucke, U.; Debald, M.; Walgenbach-Bruenagel, G.; Walgenbach, K.J.; Holler, T.; Polcher, M.; Wolfgarten, M.; Sauerwald, A.; Keyver-Paik, M.; Kuhr, M.; Buttner, R.; Kuhn, W.


    PURPOSE: The aim of this study was to investigate the use of D2-40 for the detection of lymphovascular invasion (LVI) in node positive and negative early breast cancer. LVI is associated with axillary lymph node metastases (ALNM) and a long-term prognostic factor. A precise identification of LVI

  10. Isoscalar giant dipole resonance in Zr-90, Sn-116, Sm-144 and Pb-208 excited by 240 MeV alpha particle scattering

    NARCIS (Netherlands)

    Clark, HL; Lui, YW; Youngblood, DH; Bachtr, K; Garg, U; Harakeh, MN; Kalantar-Nayestanaki, N


    The giant resonance regions of Zr-90, Sn-116, Sm-144 and (208)pb were investigated using 240 MeV a particle scattering at small angles including 0 degrees. E1 strengths corresponding to 91+/-11%, 89+/-10%, 105+/-12% and 95+/-13% of the isoscalar E1 energy-weighted sum rule were identified between 18

  11. Increased detection of lymphatic vessel invasion by D2-40 (podoplanin) in early breast cancer: possible influence on patient selection for accelerated partial breast irradiation.

    NARCIS (Netherlands)

    Debald, M.; Polcher, M.; Flucke, U.E.; Walgenbach-Brunagel, G.; Walgenbach, K.J.; Holler, T.; Wolfgarten, M.; Rudlowski, C.; Buttner, R.; Schild, H.; Kuhn, W.; Braun, M.


    PURPOSE: Several international trials are currently investigating accelerated partial breast irradiation (APBI) for patients with early-stage breast cancer. According to existing guidelines, patients with lymphatic vessel invasion (LVI) do not qualify for APBI. D2-40 (podoplanin) significantly

  12. 17 CFR 240.17a-19 - Form X-17A-19 Report by national securities exchanges and registered national securities... (United States)


    ... national securities exchanges and registered national securities associations of changes in the membership... Certain Stabilizing Activities § 240.17a-19 Form X-17A-19 Report by national securities exchanges and registered national securities associations of changes in the membership status of any of their members...

  13. 239+240Pu and 137Cs concentrations for zooplankton and nekton in the Northwest Pacific and Antarctic Oceans (1993-1996). (United States)

    Hong, G H; Kim, Y I; Lee, S H; Cooper, L W; Choe, S M; Tkalin, A V; Lee, A; Kim, S H; Chung, C S; Hirose, K


    The concentrations of 239+240Pu and 137Cs in zooplankton and nekton in the Northwest Pacific and Southern Oceans were measured during the period 1993-1996. The object of the sampling was to assess the potential impacts of existing submerged anthropogenic-radioactive materials in the western North Pacific as well as the East China Sea. Samples from the Bransfield Strait of the Antarctic Ocean provided a control source impacted by only atmospheric bomb fallout. No particularly elevated levels of 239+240Pu were found in zooplankton samples from the Northwest Pacific, although significantly lower levels of 239+240Pu were found in three mixed zooplankton samples from the Bransfield Strait. The body burden of 239+240Pu in zooplankton appears to reflect concentrations in ambient seawater with some variation. Some additional measurements of 137Cs in fish are also reported here to complement existing databases and for future reference in the regional marine environmental radioactivity monitoring effort.

  14. 20 CFR 666.240 - Under what circumstances may a sanction be applied to a State that fails to achieve negotiated... (United States)


    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Under what circumstances may a sanction be....240 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF LABOR PERFORMANCE... indicators for the same program in two successive years, the amount of the succeeding year's allocation for...

  15. 17 CFR 240.14a-7 - Obligations of registrants to provide a list of, or mail soliciting material to, security holders. (United States)


    ... beneficial holders, separated by type of holder and class, owning securities in the same class or classes as... Internet Availability of Proxy Materials (as described in § 240.14a-16), furnished by the security holder... single copy of the proxy statement or Notice of Internet Availability of Proxy Materials furnished by the...

  16. 17 CFR 240.14d-5 - Dissemination of certain tender offers by the use of stockholder lists and security position... (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Dissemination of certain... Regulation 14d § 240.14d-5 Dissemination of certain tender offers by the use of stockholder lists and... exclusively in the dissemination of tender offer materials to security holders in connection with the bidder's...

  17. 17 CFR 240.15g-3 - Broker or dealer disclosure of quotations and other information relating to the penny stock market. (United States)


    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Broker or dealer disclosure of... Certain Issuers from Section 15(d) of the Act § 240.15g-3 Broker or dealer disclosure of quotations and other information relating to the penny stock market. (a) Requirement. It shall be unlawful for a broker...

  18. {sup 239+240}Pu and 137Cs concentrations in fish, cephalopods, crustaceans, shellfish, and algae collected around the Japanese coast in the early 1990s

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, M.; Aono, T.; Hirano, S. [Geochemical Research Section, Research Center for Radioecology, National Institute of Radiological Sciences, Isozaki 3609, Hitachinaka, Ibaraki (Japan)


    Marine organisms, i.e. fish, cephalopods, crustaceans, shellfish, and algae, were collected in the early 1990s along the Sea of Japan coast and the Japanese Pacific coast and analyzed for their 239+240Pu and 137Cs concentrations. The 239+240Pu concentrations in muscle of fish were below 0.4 mBq/kg wet wt. and the lowest among the analyzed marine organisms. Most 137Cs concentrationsin muscle of fish ranged from 100 to 300 mBq/kg wet wt. Higher concentrations of 239+240Pu, ranging from 1.6 to 5.7 mBq/kg wet wt., were observed in viscera of cephalopods than in their muscle. The 239+240Pu concentrations in whole soft tissues of bivalves varied approximately one order of magnitude from 0.8 to 6.1 mBq/kg wet wt., while 137Cs concentrations had little variation, being approximately 60 mBq/kg wet wt. The 239+240Pu concentrations in algae had a wide variation, ranging from 1.7 to 42.3 mBq/kg wet wt., and were higher than those of the other marine organisms. No statistically significant difference in mean concentrations of 239+240Pu was detected among the whole soft tissues of bivalves, viscera of cephalopods and crustaceans, and whole bodies of cephalopods and crustaceans within the 95% confidence limit. The mean concentrations of 137Cs became higher in the order, cephalopods and crustaceans and bivalves, algae, viscera of fish, muscles of fish. The mean concentrations of 239+240Pu were comparable for algae collected along the Japan Sea coast and the Pacific coast. Furthermore, the difference in mean concentrations of 137Cs in algae between the Japan Sea coast and the Pacific coast was not statistically significant within the 95% confidence limit. These results can be considered to indicate no definite influence from radioactive dumping into the Japan Sea by the former USSR and Russia with respect to radioactive pollution of marine organisms collected along the Japanese coast.

  19. Quantification of gastrointestinal liquid volumes and distribution following a 240 mL dose of water in the fasted state. (United States)

    Mudie, Deanna M; Murray, Kathryn; Hoad, Caroline L; Pritchard, Susan E; Garnett, Martin C; Amidon, Gordon L; Gowland, Penny A; Spiller, Robin C; Amidon, Gregory E; Marciani, Luca


    The rate and extent of drug dissolution and absorption from solid oral dosage forms is highly dependent upon the volumes and distribution of gastric and small intestinal water. However, little is known about the time courses and distribution of water volumes in vivo in an undisturbed gut. Previous imaging studies offered a snapshot of water distribution in fasted humans and showed that water in the small intestine is distributed in small pockets. This study aimed to quantify the volume and number of water pockets in the upper gut of fasted healthy humans following ingestion of a glass of water (240 mL, as recommended for bioavailability/bioequivalence (BA/BE) studies), using recently validated noninvasive magnetic resonance imaging (MRI) methods. Twelve healthy volunteers underwent upper and lower abdominal MRI scans before drinking 240 mL (8 fluid ounces) of water. After ingesting the water, they were scanned at intervals for 2 h. The drink volume, inclusion criteria, and fasting conditions matched the international standards for BA/BE testing in healthy volunteers. The images were processed for gastric and intestinal total water volumes and for the number and volume of separate intestinal water pockets larger than 0.5 mL. The fasted stomach contained 35 ± 7 mL (mean ± SEM) of resting water. Upon drinking, the gastric fluid rose to 242 ± 9 mL. The gastric water volume declined rapidly after that with a half emptying time (T50%) of 13 ± 1 min. The mean gastric volume returned back to baseline 45 min after the drink. The fasted small bowel contained a total volume of 43 ± 14 mL of resting water. Twelve minutes after ingestion of water, small bowel water content rose to a maximum value of 94 ± 24 mL contained within 15 ± 2 pockets of 6 ± 2 mL each. At 45 min, when the glass of water had emptied completely from the stomach, total intestinal water volume was 77 ± 15 mL distributed into 16 ± 3 pockets of 5 ± 1 mL each. MRI provided unprecedented insights into

  20. Corrective Action Investigation Plan for Corrective Action Unit 240: Area 25 Vehicle Washdown Nevada Test Site, Nevada

    Energy Technology Data Exchange (ETDEWEB)



    This Corrective Action Investigation Plan (CAIP) has been developed in accordance with the Federal Facility Agreement and Consent Order (FFACO) that was agreed to by the US Department of Energy, Nevada Operations Office (DOE/NV); the State of Nevada Division of Environmental Protection (NDEP); and the US Department of Defense (FFACO, 1996). The CAIP is a document that provides or references all of the specific information for investigation activities associated with Corrective Action Units (CAUs) or Corrective Action Sites (CASs). According to the FFACO, CASs are sites potentially requiring corrective action(s) and may include solid waste management units or individual disposal or release sites (FFACO, 1996). Corrective Action Units consist of one or more CASs grouped together based on geography, technical similarity, or agency responsibility for the purpose of determining corrective actions. This CAIP contains the environmental sample collection objectives and the criteria for conducting site investigation activities at CAU 240, Area 25 Vehicle Washdown, which is located on the Nevada Test Site (NTS).

  1. (236)U and (239,)(240)Pu ratios from soils around an Australian nuclear weapons test site. (United States)

    Tims, S G; Froehlich, M B; Fifield, L K; Wallner, A; De Cesare, M


    The isotopes (236)U, (239)Pu and (240)Pu are present in surface soils as a result of global fallout from nuclear weapons tests carried out in the 1950's and 1960's. These isotopes potentially constitute artificial tracers of recent soil erosion and sediment movement. Only Accelerator Mass Spectrometry has the requisite sensitivity to measure all three isotopes at these environmental levels. Coupled with its relatively high throughput capabilities, this makes it feasible to conduct studies of erosion across the geographical extent of the Australian continent. In the Australian context, however, global fallout is not the only source of these isotopes. As part of its weapons development program the United Kingdom carried out a series of atmospheric and surface nuclear weapons tests at Maralinga, South Australia in 1956 and 1957. The tests have made a significant contribution to the Pu isotopic abundances present in the region around Maralinga and out to distances ∼1000 km, and impact on the assessment techniques used in the soil and sediment tracer studies. Quantification of the relative fallout contribution derived from detonations at Maralinga is complicated owing to significant contamination around the test site from numerous nuclear weapons safety trials that were also carried out around the site. We show that (236)U can provide new information on the component of the fallout that is derived from the local nuclear weapons tests, and highlight the potential of (236)U as a new fallout tracer. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.

  2. MM-MDS: a multidimensional scaling database with similarity ratings for 240 object categories from the Massive Memory picture database. (United States)

    Hout, Michael C; Goldinger, Stephen D; Brady, Kyle J


    Cognitive theories in visual attention and perception, categorization, and memory often critically rely on concepts of similarity among objects, and empirically require measures of "sameness" among their stimuli. For instance, a researcher may require similarity estimates among multiple exemplars of a target category in visual search, or targets and lures in recognition memory. Quantifying similarity, however, is challenging when everyday items are the desired stimulus set, particularly when researchers require several different pictures from the same category. In this article, we document a new multidimensional scaling database with similarity ratings for 240 categories, each containing color photographs of 16-17 exemplar objects. We collected similarity ratings using the spatial arrangement method. Reports include: the multidimensional scaling solutions for each category, up to five dimensions, stress and fit measures, coordinate locations for each stimulus, and two new classifications. For each picture, we categorized the item's prototypicality, indexed by its proximity to other items in the space. We also classified pairs of images along a continuum of similarity, by assessing the overall arrangement of each MDS space. These similarity ratings will be useful to any researcher that wishes to control the similarity of experimental stimuli according to an objective quantification of "sameness."

  3. Halo excitations in fragmentation of sup 6 He at 240 MeV/u on carbon and lead targets

    CERN Document Server

    Aleksandrov, D V; Axelsson, L; Baumann, T; García-Borge, M J; Chulkov, L V; Cub, J; Dostal, W; Eberlein, B; Elze, T W; Emling, H; Geissel, H; Goldberg, V Z; Grünschloss, A; Hellström, M; Holeczek, J; Holzmann, R; Jonson, B; Kratz, J V; Kraus, G; Kulessa, R; Leifels, Y; Leistenschneider, A; Leth, T; Markenroth, K G; Meister, M; Mukha, I; Münzenberg, G; Nickel, F; Nilsson, T; Nyman, G H; Petersen, B; Pfützner, M; Pribora, V N; Richter, A; Riisager, K; Scheidenberger, C; Schrieder, G; Schwab, W; Simon, H; Smedberg, M H; Stroth, J; Surowiec, A; Tengblad, O; Zhukov, M V


    Dissociation of a 240 MeV/u beam of sup 6 He, incident on carbon and lead targets, has been studied in kinematically complete experiments to investigate low-lying excitation modes in the halo nucleus sup 6 He. It is shown that alignment effects characterize the inelastic scattering and allow an unambiguous assignment of the spin of a narrow resonance observed in the excitation energy spectrum. The differential cross sections for the sup 6 He inelastic scattering on carbon and lead targets were deduced from the measured momenta of the two neutrons and the alpha-particle. An analysis of these distributions shows that quadrupole and, possibly, monopole excitations characterize the hadronic interaction, while the dipole mode is dominating in Coulomb dissociation. Neither theoretically predicted new resonance states in sup 6 He nor nuclear excitation of a dipole mode were found. Direct evidence has been obtained for strong suppression of Coulomb post-acceleration in direct Coulomb breakup in a lead target.

  4. Pages 240 - 241.pmd

    African Journals Online (AJOL)


    of deterioration in cognitive function and inability to cope with the school environment. A disease similar to nodding syndrome was first reported in Uganda by Raper 4 ... as nutrition rehabilitation improves the quality of life, though not a cure. On going studies in northern. Uganda speculate that the disease is associated with.

  5. Fate and transport of plutonium-239 + 240 and Americium-241 in the soil of Rocky Flats, Colorado

    Energy Technology Data Exchange (ETDEWEB)

    Litaor, M.I.; Barth, G.R.; Zika, E.M. [Univ. of Colorado, Boulder, CO (United States)


    Actinides contamination of soils around Rocky Flats, CO, resulted from leaking drums of Pu-contaminated oil stored at an outdoor site. The transport of these actinides through the soil to groundwater was studied using an advanced monitoring system (MS). The fully automated, remotely controlled MS gathered real-time data on soil water content, groundwater level, and timing of gravitationally flowing water. Controlled rain simulations coupled with measurements of volume flux and actinide activities provided essential information about the fate and transport of Pu-239 + 240 and Am-241. Volume fluxes at most sampling locations were similar, regardless of the antecedent moisture or the duration, frequency, and intensity of the simulated rain. Actinide activities were not correlated with the measured volume flux, or the duration, frequency, and intensity of the simulated rain. Flow was facilitated primarily via macropore channeling. The relatively short residence time precluded a continuous interaction between the soil and the flowing water, which minimized the movement of actinides in the soil. Actinide activities in the interstitial water collected from the upper 20 cm of the soil were significantly higher (P>0.001) than water collected at deeper sampling depths (20-70 cm). Actinide activity in water samples from the deepest sampling depth (40-70 cm) did not exceed 0.4 Bq/L. These results suggest that, under the experimental conditions, the movement of actinides was restricted to the top 20 cm. A transport mechanism involving discrete Pu oxide particles, coupled with macropore channeling is proposed to explain the observed actinide activities in the soil. 31 refs., 6 figs., 7 tabs.

  6. Assinatura da deposição atmosférica de testes nucleares em sedimentos da costa brasileira (240+239Pu e 137Cs

    Directory of Open Access Journals (Sweden)

    Christian J. Sanders


    Full Text Available The aim of this review is to take a look at Cold War era nuclear tests signatures found in Brazilian coastal sediments. Both137Cs and 240+239Pu signatures have been documented in mangrove, coastal mudflats and continental shelf sediments, associated with above ground nuclear tests beginning in the 1950's. The dates associated to the anthropogenic radionuclide signatures 137Cs and 240+239Pu along sediment columns are confirmed by 210Pb geochronology in many of the studies highlighted in this review. The results outlined in this review characterize the extent to which nuclear fallout products reach the Brazilian coast in quantities sufficient for detection, allowing the use of these radioisotopes as geochronometers.

  7. 17 CFR 240.3a12-6 - Definition of “common trust fund” as used in section 3(a)(12) of the Act. (United States)


    ... § 240.3a12-6 Definition of “common trust fund” as used in section 3(a)(12) of the Act. The term common trust fund as used in section 3(a)(12) of the Act (15 U.S.C. 78c(a)(12)) shall include a common trust..., That: (a) The common trust fund is operated in compliance with the same state and federal regulatory...

  8. Time-resolved record of 236U and 239,240Pu isotopes from a coral growing during the nuclear testing program at Enewetak Atoll (Marshall Islands). (United States)

    Froehlich, M B; Chan, W Y; Tims, S G; Fallon, S J; Fifield, L K


    A comprehensive series of nuclear tests were carried out by the United States at Enewetak Atoll in the Marshall Islands, especially between 1952 and 1958. A Porites Lutea coral that was growing in the Enewetak lagoon within a few km of all of the high-yield tests contains a continuous record of isotopes, which are of interest (e.g. 14C, 236U, 239,240Pu) through the testing period. Prior to the present work, 14C measurements at ∼2-month resolution had shown pronounced peaks in the Δ14C data that coincided with the times at which tests were conducted. Here we report measurements of 236U and 239,240Pu on the same coral using accelerator mass spectrometry, and again find prominent peaks in the concentrations of these isotopes that closely follow those in 14C. Consistent with the 14C data, the magnitudes of these peaks do not, however, correlate well with the explosive yields of the corresponding tests, indicating that smaller tests probably contributed disproportionately to the debris that fell in the lagoon. Additional information about the different tests can also be obtained from the 236U/239Pu and 240Pu/239Pu ratios, which are found to vary dramatically over the testing period. In particular, the first thermonuclear test, Ivy-Mike, has characteristic 236U/239Pu and 240Pu/239Pu signatures which are diagnostic of the first arrival of nuclear test material in various archives. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Lymph vascular invasion in invasive mammary carcinomas identified by the endothelial lymphatic marker D2-40 is associated with other indicators of poor prognosis

    Directory of Open Access Journals (Sweden)

    Rocha Gislene FS


    Full Text Available Abstract Background Immunohistochemical studies of lymphatic vessels have been limited by a lack of specific markers. Recently, the novel D2-40 antibody, which selectively marks endothelium of lymphatic vessels, was released. The aim of our study is to compare lymphatic and blood vessel invasion detected by hematoxylin and eosin (H&E versus that detected by immunohistochemistry, relating them with morphologic and molecular prognostic factors. Methods We selected 123 cases of invasive mammary carcinomas stratified into three subgroups according to axillary lymph node status: macrometastases, micrometastases, and lymph node negative. Lymphatic (LVI and blood (BVI vessel invasion were evaluated by H&E and immunohistochemistry using the D2-40 and CD31 antibodies, and related to histologic tumor type and grade, estrogen and progesterone receptors, E-cadherin, Ki67, p53, and Her2/neu expression. Results LVI was detected in H&E-stained sections in 17/123 cases (13.8%, and in D2-40 sections in 35/123 cases (28.5% (Kappa = 0.433. BVI was detected in H&E-stained sections in 5/123 cases (4.1%, and in CD31 stained sections in 19/123 cases (15.4% (Kappa = 0.198. LVI is positively related to higher histologic grade (p = 0.013, higher Ki67 expression (p = 0.00013, and to the presence of macrometastases (p = 0.002, and inversely related to estrogen (p = 0.0016 and progesterone (p = 0.00017 receptors expression. Conclusion D2-40 is a reliable marker of lymphatic vessels and is a useful tool for lymphatic emboli identification in immunostained sections of breast carcinomas with higher identification rates than H&E. Lymphatic vessel invasion was related to other features (high combined histologic grade, high Ki67 score, negative hormone receptors expression associated with worse prognosis, probable reflecting a potential for lymphatic metastatic spread and aggressive behavior.

  10. The Serendipitous Discovery of a Group or Cluster of Young Galaxies at z2.40 in Deep Hubble Space Telescope WFPC2 Images (United States)

    Pascarelle, S. M.; Windhorst, R. A.; Driver, S. P.; Ostrander, E. J.; Keel, W. C.


    We report the serendipitous discovery of a group or cluster of young galaxies at z ~= 2.40 in a 24 orbit Hubble Space Telescope/WFPC2 exposure of the field around the weak radio galaxy 53W002. Potential cluster members were identified on ground-based narrowband redshifted Ly alpha images and confirmed via spectroscopy. In addition to the known weak radio galaxy 53W002 at z = 2.390, two other objects were found to have excess narrowband Ly alpha emission at z ~= 2.40. Both have been spectroscopically confirmed, and one clearly contains a weak active galactic nucleus (AGN). They are located within 1' of 53W002 or ~0.23 h^{-1}100 Mpc (q0 = 0.5) at z ~= 2.40, which is the physical scale of a group or small cluster of galaxies. Profile fitting of the WFPC2 images shows that the objects are very compact, with scale lengths ~= 0."1 (~=0.39 h^{-1}100 kpc), and are rather faint (luminosities < L*), implying that they may be subgalactic-sized objects. We discuss these results in the context of galaxy and cluster evolution and the role that weak AGNs may play in the formation of young galaxies.

  11. {sup 238}Pu, {sup 239+240}Pu and {sup 241}Am levels in the terrestrial and aquatic environment of the Loire and Garonne rivers basins (France)

    Energy Technology Data Exchange (ETDEWEB)

    Rousseau, G.; Mokili, M.B.; Le Roy, C.; Pagano, V. [SUBATECH/IN2P3 (France); Gontier, G.; Boyer, C. [EDF-DPI-DIN-CIDEN (France); Chardon, P. [CNRS/IN2P3 (France); Hemidy, P.Y. [EDF-DPN-UNIE-GPRE-IEV (France)


    Plutonium and americium long-lived alpha emitter isotopes can be found in the environment because of atmospheric global fallout due to thermonuclear tests performed between 1945 and 1980, to the American SNAP 9A satellite explosion in 1964, to the Chernobyl nuclear power plant accident,... In France, the nuclear safety authority does not allow the release of artificial alpha emitters from nuclear power plants. Thus, monitoring is performed to verify the absence of these alpha emitters in liquid discharges to respect the limits set by the regulations. These thresholds ensure a very low dosimetric impact to the population compared to other radionuclides. With the objective of environmental monitoring around nuclear facilities, activity measurements of long-lived alpha emitters are carried out to detect the traces of these radionuclides. Analysis of low activity by alpha spectrometry after chemical steps were performed and used to determine the {sup 238}Pu, {sup 239+240}Pu and {sup 241}Am activities on a large set of environmental solid samples likely to be encountered in environmental monitoring as soils, sediments, terrestrial and aquatic bio-indicators. The samples collected in the terrestrial and aquatic environment of the Loire and Garonne rivers basins (France) was investigated for the 2009-2014 period. It was found that the mean activity concentration of the most frequently detected was for the radionuclide {sup 238}Pu: from <0.00031 to 0.0061 Bq/kg dry in terrestrial samples and from <0.00086 to 0.011 Bq/kg dry in aquatic samples; for the radionuclide {sup 239+240}Pu: from 0.00041 to 0.150 Bq/kg dry in terrestrial samples and from 0.0023 to 0.240 Bq/kg dry in aquatic samples and for the radionuclide {sup 241}Am: from <0.00086 to 0.087 Bq/kg dry in terrestrial samples and from 0.0022 to 0.120 Bq/kg dry in aquatic samples. {sup 238}Pu/{sup 239+240}Pu and {sup 241}Am/{sup 239+240}Pu ratios determined are in accordance with an environmental contamination due to

  12. Fate of 137Cs, 90Sr and 239+240Pu in soil profiles at a water recharge site in Basel, Switzerland. (United States)

    Abraham, Johannes; Meusburger, Katrin; Waldis, Judith Kobler; Ketterer, Michael E; Zehringer, Markus


    An important process in the production of drinking water is the recharge of the withdrawn ground water with river water at protected recharge fields. While it is well known that undisturbed soils are efficiently filtering and adsorbing radionuclides, the goal of this study was to investigate their behaviour in an artificial recharge site that may receive rapid and additional input of radionuclides by river water (particularly when draining a catchment including nuclear power plants (NPP)). Soil profiles of recharge sites were drilled and analysed for radionuclides, specifically radiocesium (137Cs), radiostrontium (90Sr) and plutonium (239+240Pu). The distribution of the analysed radionuclides were compared with an uncultivated reference soil outside the recharge site. The main activity of 137Cs was located in the top soil (4.5-7.5 cm) and reached down to a depth of 84 cm and 48 cm for the recharge and the reference site, respectively. The found activities of 239+240Pu originate from the global fallout after 1950. 239+240Pu appeared to be strongly adsorbed onto soil particles. The shape of the depth profile was similar to 137Cs, but also similar between the recharge and the reference site. In contrast, 90Sr showed a uniform distribution over the entire depth of the recharge and reference profiles indicating that 90Sr already entered the gravel zone and the ground water. Elevated inventories of the radionuclides were observed for the recharge site. The soil of the recharge field exhibited a threefold higher activity of 137Cs compared to the reference soil. Also for 239+240Pu higher inventories where observed for the recharge sites (40%). 90Sr behaved differently, showing similar inventories between reference and recharge site. We estimate that 75-89% of the total inventory of 137Cs in the soil at the recharge site (7.000 Bq/m2) originated from the fallout of the Chernobyl accident and from emissions of Swiss NPPs. This estimate is based on the actual activity

  13. Spatial and temporal variations of plutonium isotopes ({sup 238}Pu and {sup 239,240}Pu) in sediments off the Rhone River mouth (NW Mediterranean)

    Energy Technology Data Exchange (ETDEWEB)

    Lansard, B. [Laboratoire d' Oceanographie et de Biogeochimie, UMR 6535, CNRS/Universite de la Mediterranee, Station Marine d' Endoume, rue de la Batterie des Lions, 13007, Marseille (France)]. E-mail:; Charmasson, S. [Institut de Radioprotection et de Surete Nucleaire, IRSN, Laboratoire d' Etudes Radioecologiques en milieu Continental et Marin, centre IFREMER de Mediterranee, BP 330, zone portuaire de Bregaillon, 83507, La Seyne-sur-Mer Cedex (France); Gasco, C. [Centro de Investigaciones Energeticas, Medioambientales y Tecnologicas, CIEMAT, Departamento de Medio Ambiante, Avenida de la Complutense 22, 28040, Madrid (Spain); Anton, M.P. [Centro de Investigaciones Energeticas, Medioambientales y Tecnologicas, CIEMAT, Departamento de Medio Ambiante, Avenida de la Complutense 22, 28040, Madrid (Spain); Grenz, C. [Laboratoire d' Oceanographie et de Biogeochimie, UMR 6535, CNRS/Universite de la Mediterranee, Station Marine d' Endoume, rue de la Batterie des Lions, 13007, Marseille (France); Arnaud, M. [Institut de Radioprotection et de Surete Nucleaire, IRSN, Laboratoire d' Etudes Radioecologiques en milieu Continental et Marin, centre IFREMER de Mediterranee, BP 330, zone portuaire de Bregaillon, 83507, La Seyne-sur-Mer Cedex (France)


    The dispersion and fate of the Rhone River inputs to the Gulf of Lions (Northwestern Mediterranean Sea) have been studied through the spatial and temporal distributions of plutonium isotopes in continental shelf sediments. Plutonium isotopes ({sup 238}Pu and {sup 239,240}Pu) are appropriate tracers to follow the dispersion of particulate matter due both to their high affinity for particles and their long half-lives. In the Rhone River valley, plutonium isotopes originate from both the weathering of the catchment basin contaminated by global atmospheric fallout, and the liquid effluents released from the Marcoule reprocessing plant since 1961. This work presents a first detailed study on {sup 238}Pu and {sup 239,240}Pu distributions in sediments from the Rhone prodelta to the adjacent continental shelf, since the decommissioning of Marcoule in 1997. The vertical distribution of Pu isotopes has been analysed in a 4.75 m long core sampled in 2001 at the Rhone mouth. Despite this length, plutonium is found at the last 10 cm, manifesting the high sedimentation rate of the prodeltaic area and its ability for trapping fine-grained sediments and associated contaminants. The highest {sup 238}Pu and {sup 239,240}Pu concentrations reached 1.26 and 5.97 Bq kg{sup -1} respectively and were found within the layer 280-290 cm. The {sup 238}Pu/{sup 239,240}Pu activity ratios (AR) demonstrated an efficient and huge trapping of the Pu isotopes derived from Marcoule. The fresh sediments, located on the top of the core, show lower plutonium activity concentrations and lower {sup 238}Pu/{sup 239,240}Pu ratios. This decrease is in close relation with the shut down of the Marcoule reprocessing plant in 1997. In 2001, plutonium isotopes were also analysed in 21 surface sediments located offshore and concentrations ranged from 0.03 to 0.17 Bq kg{sup -1} for {sup 238}Pu and from 0.33 to 1.72 Bq kg{sup -1} for {sup 239,240}Pu. The {sup 238}Pu/{sup 239,240}Pu AR ranged from 0.24 close to the

  14. Comparison of the ENDF/B-V and SOKRATOR evaluations of /sup 235/U, /sup 239/Pu, /sup 240/Pu and /sup 241/Pu at low neutron energies

    Energy Technology Data Exchange (ETDEWEB)

    de Saussure, G.; Wright, R.Q.


    The US and USSR's most recent evaluationsof /sup 235/U, /sup 239/Pu, /sup 240/Pu and /sup 241/Pu are compared over the thermal region and over the first few resonances. The two evaluations rest on essentially the same experimental data base and the differences reflect different approaches to the representation of the cross sections or different weightings of the experimental results. It is found that over the thermal and resolved ranges the two evaluations are very similar. Some differences in approaches are briefly discussed.

  15. Pertubation in the 240Pu/239Pu global fallout ratio in local sediments following the nuclear accidents at Thule (Greenland) and Palomares (Spain)

    DEFF Research Database (Denmark)

    Mitchell, P.I.; León Vintró, L.; Dahlgaard, H.


    in samples of sediment (and soil) collected at Thule (Greenland) and Palomares (Spain), where accidents involving the release and dispersion of plutonium from fractured nuclear weapons occurred in 1968 and 1966, respectively. The Pu-240/Pu-239 ratio was measured by high-resolution alpha spectrometry...... with those reported for weapons-grade plutonium. It is noteworthy that the mean Pu-238/Pu-239 activity ratio in the Thule samples, at 0.0150 +/- 0.0017 (n = 4), was also lower than that measured in the Palomares samples, namely, 0.0275 +/- 0.0012 (n = 4). The Pu-241/Pu-239 ratios were similarly different...

  16. Plants as bio-monitors for Cs-137, Pu-238, Pu-239,240 and K-40 at the Savannah River Site. (United States)

    Caldwell, Eric Frank; Duff, Martine C; Ferguson, Caitlin E; Coughlin, Daniel P


    The Savannah River Site was constructed in South Carolina to produce plutonium (Pu) in the 1950s. Discharges associated with these now-ceased operations have contaminated large areas within the site, particularly streams associated with reactor cooling basins. Evaluating the exposure risk of contamination to an ecosystem requires methodologies that can assess the bioavailability of contaminants. Plants, as primary producers, represent an important mode of transfer of contaminants from soils and sediments into the food chain. The objective of this study was to identify local area plants for their ability to act as bio-monitors of radionuclides. The concentrations of cesium-137 ((137)Cs), potassium-40 ((40)K), (238)Pu and (239,240)Pu in plants and their associated soils were determined using γ and α spectrometry. The ratio of contamination concentration found in the plant relative to the soil was calculated to assess a concentration ratio (CR). The highest CR for (137)Cs was found in Pinus palustris needles (CR of 2.18). The correlation of soil and plant (137)Cs concentration was strong (0.76) and the R(2) (0.58) from the regression was significant (p = 0.006). This suggests the ability to predict the degree of (137)Cs contamination of a soil through analysis of the pine needles. The (238)Pu and (239,240)Pu concentrations were most elevated within the plant roots. Extremely high CR values were found in Sparganium americanum (bur-reed) roots with a value of 5.86 for (238)Pu and 5.66 for (239,240)Pu. The concentration of (40)K was measured as a known congener of (137)C. Comparing (40)K and (137)C concentrations in each plant revealed an inverse relationship for these radioisotopes. Correlating (40)K and (137)Cs was most effective in identifying plants that have a high affinity for (137)Cs uptake. The P. palustris and S. americanum proved to be particularly strong accumulators of all K congeners from the soil. Some species that were measured, warrant further

  17. The Serendipitous Discovery of a Possible Young Galaxy Cluster at z=2.40 in Deep HST/WFPC2 Images (United States)

    Pascarelle, Sebastian M.; Windhorst, Rogier A.; Driver, Simon P.; Ostrander, Eric J.; Mutz, Steven B.; Franklin, Barbara E.; Keel, William C.


    We present evidence from ground-based images and spectroscopy for the existence of a young group or cluster of galaxies at z=2.40. These objects were found in a 24-orbit HST/WFPC2 exposure of the high-redshift weak radio galaxy 53W002 at z=2.390 and its surroundings (see parallel poster by Windhorst and Keel). Possible cluster members were identified from a deep Steward Observatory 90-inch exposure taken through a specially designed narrow-band (150 Angstroms FWHM, lambda_ ¢=4130 Angstroms) filter to detect objects emitting significant redshifted Lyalpha at z=2.40. We also determine their Lyalpha --B and UBVRIgri colors from deep Steward 90-inch and Palomar 200-inch images. In addition to the known weak radio galaxy 53W002 at z=2.390, three other galaxies were found to have excess Lyalpha emission on the (Lyalpha --B) Steward images. One of these was also spectroscopically confirmed recently with the MMT Blue Spectrograph. All three are very blue and compact objects located within one arcminute of 53W002 on the WFPC2 images, or ~ 0.5 Mpc for Ho=50 and qo=0.5 -- the physical scale of a group or small cluster of galaxies. Profile fitting of the WFPC2 images shows that two of the z=2.40 objects have a weak AGN embedded in an exponential disk. 53W002 itself has a weak AGN (containing ~ 20% of the total light) and a rather regular r(1/4) -law profile. The other non-radio emitting object at z=2.40 is a possible merger. We discuss these results in the context of galaxy and cluster evolution, and the role that weak AGN may play in the formation of young galaxies. This work was supported by NASA/HST grant GO-5308-01-94A from STScI, which is operated by AURA, Inc., under NASA contract NAS5-26555.

  18. A modelling study on 137Cs and 239,240Pu behaviour in the Alborán Sea, western Mediterranean. (United States)

    Periáñez, R


    A model for simulating the dispersion processes of 137Cs and 239,240Pu in the Alborán Sea is described. The model consists of two hydrodynamic models: a 2D depth-averaged model and a two-layer model which provide tidal and geostrophic currents, respectively; a sediment transport model which provides suspended particle concentrations and sedimentation rates over the domain; and the radionuclide dispersion model including interactions of dissolved radionuclides with suspended particles and bed sediments. These processes are formulated using kinetic transfer coefficients. The hydrodynamic and sediment models are run and validated in advance, and their results are then used to simulate the dispersion of 137Cs and 239,240Pu, which are introduced from atmospheric fallout. Radionuclide concentrations in the water column and distributions in bed sediments have been compared with measurements in the sea. Both set of data are, in general, in agreement. The model has also been applied to calculate radionuclide fluxes through the Strait of Gibraltar. These computed fluxes have been compared with previous estimations as well.

  19. Phase shift analysis of {sup 12}C+{sup 12}C elastic scattering in the range E{sub lab} = 240 to 2400 MeV

    Energy Technology Data Exchange (ETDEWEB)

    Cha, Moon Hoe [Kangwon National University, Chunchon (Korea, Republic of)


    A phase shift analysis for the {sup 12}C+{sup 12}C system in the range E{sub lab} = 240 to 2400 MeV is performed by using the parametrized phase shift model. The diffractive oscillatory structures observed at forward angles are explained due to the strong interference between the near- and the far-side scattering amplitudes. The negative minima in the deflection curves occurring at angles {theta}{sub nucl} =- 49.92 .deg. {approx} -0.51 .deg. corresponding to energies E{sub lab} = 240 {approx} 2400 MeV, respectively, are shown to indicate the presences of nuclear rainbows. The partial reaction cross-sections are found to increase linearly up to some peak values and thereafter to decrease quadratically to zero. The peak values of partial reaction cross-section are shown to become smaller as the incident energy increases. Since the strong absorption radius becomes smaller as the incident energy decreases, the nuclear density distributions of the {sup 12}C+{sup 12}C system at higher energies are shown to have more overlaps than those at lower energies.

  20. The neutron capture cross sections of {sup 237}Np(n,{gamma}) and {sup 240}Pu(n,{gamma}) and its relevance in the transmutation of nuclear waste

    Energy Technology Data Exchange (ETDEWEB)

    Guerrero, C.; Abbondanno, U.; Aerts, G.; Alvarez, H.; Alvarez-Velarde, F.; Andriamonje, S.; Andrzejewski, J.; Assimakopoulos, P.; Audouin, L.; Badurek, G.; Baumann, P.; Becvar, F.; Berthoumieux, E.; Calvino, F.; Calviani, M.; Cano-Ott, D.; Capote, R.; Carrapico, C.; Cennini, P.; Chepel, V.; Chiaveri, E.; Colonna, N.; Cortes, G.; Couture, A.; Cox, J.; Dahlfors, M.; David, S.; Dillmann, I.; Domingo-Pardo, C.; Dridi, W.; Duran, I.; Eleftheriadis, C.; Embid-Segura, M.; Ferrant, L.; Ferrari, A.; Ferreira-Marques, R.; Fujii, K.; Furman, W.; Goncalves, I.; Gonzalez-Romero, E.; Gramegna, F.; Gunsing, F.; Haas, B.; Haight, R.; Heil, M.; Herrera-Martinez, A.; Igashira, M.; Jericha, E.; Kappeler, F.; Kadi, Y.; Karadimos, D.; Karamanis, D.; Kerveno, M.; Koehler, P.; Kossionides, E.; Krticka, M.; Lampoudis, C.; Leeb, H.; Lindote, A.; Lopes, I.; Lozano, M.; Lukic, S.; Marganiec, J.; Marrone, S.; Martinez, T.; Massimi, C.; Mastinu, P.; Mengoni, A.; Milazzo, P.M.; Moreau, C.; Mosconi, M.; Neves, F.; Oberhummer, H.; O' Brien, S.; Pancin, J.; Papachristodoulou, C.; Papadopoulos, C.; Paradela, C.; Patronis, N.; Pavlik, A.; Pavlopoulos, P.; Perrot, L.; Pigni, M.T.; Plag, R.; Plompen, A.; Plukis, A.; Poch, A.; Praena, J.; Pretel, C.; Quesada, J.; Rauscher, T.; Reifarth, R.; Rubbia, C.; Rudolf, G.; Rullhusen, P.; Salgado, J.; Santos, C.; Sarchiapone, L.; Savvidis, I.; Stephan, C.; Tagliente, G.; Tain, J.L.; Tassan-Got, L.; Tavora, L.; Terlizzi, R.; Vannini, G.; Vaz, P.; Ventura, A.; Villamarin, D.; Vincente, M.C.; Vlachoudis, V.; Vlastou, R.; Voss, F.; Walter, S.; Wiescher, M.; Wisshak, K


    Neutron capture cross sections of actinides are of great relevance for the Transmutation of Nuclear Waste in Accelerator Driven Systems (ADS) and Generation-IV reactors. The neutron capture cross sections of {sup 237}Np and {sup 240}Pu in the range of 1 eV to 2 keV were measured at the n-TOF facility with a Total Absorption Calorimeter. The data have been analyzed with the SAMMY code. The corresponding covariance matrices have been generated. The final cross sections are presented and compared to the previously existing ones.The n-TOF {sup 237}Np {sigma}(n,{gamma}) is in agreement with the evaluated data files below 300 eV and its is lower by 10 to 15% up to 2 keV. This discrepancy with the evaluated data files is also observed in the capture cross section derived from the transmission measurements of Gressier et al. In the case of the {sup 240}Pu {sigma}(n,{gamma}), the n-TOF {sigma}(n,{gamma}) agrees within uncertainties with JENDL-3.3 and JEFF-3.1, except for a group of resonances around 800 eV. Endf/B-VII data are lower than n-TOF and the mentioned evaluations, with differences that increase with neutron energy up to 15-20 per cent.

  1. Análise comparativa da imunoexpressão da proteína p53 (clones DO-7 e PAb-240 em carcinomas de células escamosas intrabucais e labiais Comparative analysis of p53 protein immunostaining (antibodies DO-7 and PAb-240 in oral cavity and lip squamous cell carcinomas

    Directory of Open Access Journals (Sweden)

    José de Assis Silva Júnior


    Full Text Available INTRODUÇÃO: A carcinogênese caracteriza-se como um processo multifatorial, e a inativação da proteína p53 é uma alteração genética comumente observada nos carcinomas de células escamosas de boca (CCEB. OBJETIVO: Analisar e comparar a imunoexpressão da proteína p53, por meio dos clones DO-7 e PAb-240, em CCEB com localização intrabucal e em lábio inferior. MATERIAL E MÉTODOS: Foram selecionados 40 casos de CCEB, sendo 20 de localização intrabucal e 20 em lábio inferior. Foi realizado um estudo imuno-histoquímico utilizando os anticorpos anti-p53 clone DO-7 e PAb-240. A imunoquantificação foi realizada por meio de análise digital de imagem, e os resultados, submetidos a tratamentos estatísticos. RESULTADOS: A imunoexpressão da proteína p53 foi verificada com o anticorpo DO-7 em 13 casos (65% de carcinoma intrabucal e em 19 (95% de carcinoma de lábio inferior. Imunorreatividade para o anticorpo PAb-240 foi observada em 9 casos (45% de lesões intrabucais e em 15 (75% localizados em lábio inferior. Não foram observadas, segundo o teste de Mann-Whitney, diferenças estatisticamente significativas (p > 0,05 na expressão da proteína p53 entre as duas localizações estudadas, independentemente do anticorpo avaliado. Foram identificadas, pelo teste de Wilcoxon, diferenças estatisticamente significativas entre a expressão dos clones DO-7 e PAb-240 em cada um dos grupos analisados (valor p = 0,013 - lábio inferior; valor p = 0,016 - intrabucal. CONCLUSÕES: A expressão da proteína p53 observada nos CCEB, com localizações intrabucais e labiais, sugere a ocorrência de mutações no gene TP53. As diferenças quantitativas obtidas entre os anticorpos estudados, independentemente da localização das lesões, refletem uma especificidade distinta entre os clones DO-7 e PAb-240. O desenvolvimento de mais estudos será fundamental para estabelecer o anticorpo mais adequado para proteína p53 em CCEB

  2. Markers aiding the diagnosis of chondroid tumors: an immunohistochemical study including osteonectin, bcl-2, cox-2, actin, calponin, D2-40 (podoplanin), mdm-2, CD117 (c-kit), and YKL-40

    DEFF Research Database (Denmark)

    Daugaard, Søren; Christensen, Lise H; Høgdall, Estrid


    (s) for the different subgroups. Archival material from three extraskeletal myxoid chondrosarcomas, five chordomas, five chondromyxoid fibromas, five chondroblastomas and 25 chondrosarcomas was stained with antibodies against osteonectin, bcl-2, cox-2, actin, calponin, D2-40 (podoplanin), mdm-2, CD117 (c-kit) and YKL......-40. All 25 chondrosarcomas showed a positive staining reaction for D2-40, none for actin and CD117, and a partial reactivity for bcl-2 (36%). Chondroblastomas (5/5) and chondromyxoid fibromas (2/5) were the only tumors with a positive reaction for actin, and all chondroblastomas (n=5......) and extraskeletal myxoid chondrosarcomas (n=3) were positive for bcl-2. In contrast to all other tumors, two of three extraskeletal myxoid chondrosarcomas were also positive for CD17 and negative for osteonectin, cox-2, mdm-2 and actin. All five chordomas were negative for D2-40 and positive for mdm-2 and YKL-40...

  3. Determination of plutonium isotopes (238Pu, 239Pu, 240Pu, 241Pu) in environmental samples using radiochemical separation combined with radiometric and mass spectrometric measurements

    DEFF Research Database (Denmark)

    Xu, Yihong; Qiao, Jixin; Hou, Xiaolin


    This paper reports an analytical method for the determination of plutonium isotopes (238Pu, 239Pu, 240Pu, 241Pu) in environmental samples using anion exchange chromatography in combination with extraction chromatography for chemical separation of Pu. Both radiometric methods (liquid scintillation...... counting and alpha spectrometry) and inductively coupled plasma mass spectrometry (ICP-MS) were applied for the measurement of plutonium isotopes. The decontamination factors for uranium were significantly improved up to 7.5×105 for 20 g soil compared to the level reported in the literature......, this is critical for the measurement of plutonium isotopes using mass spectrometric technique. Although the chemical yield of Pu in the entire procedure is about 55%, the analytical results of IAEA soil 6 and IAEA-367 in this work are in a good agreement with the values reported in the literature or reference...

  4. Rare earth metals influence on mechanical properties and crack resistance of GP240GH and G17CrMo5-5 cast steels

    Directory of Open Access Journals (Sweden)

    M. Gajewski


    Full Text Available This paper presents results of research on modification influence of REM on mechanical properties and crack resistance of GP240GH cast carbon steel and G17CrMo5-5 high-temperature cast steel. The tests have been performed on successive industrial melts. The rare earth metals were put into the ladle during tapping of heat melt from the furnace. Each time ca 2000 kg of liquid metals were modified. Because of this the amount of sulphur in the cast steel was decreased and the non-metallic inclusion morphology was significantly changed. There were tested mechanical properties (Re,Rm, plastic properties (A5,Z and impact strength (KV, and on the basis of the three-point bend test the KJC stress intensity factor was evaluated. It was noticed that the REM modification brings essential increase of impact strength as well as fracture toughness determined by KJC factor.

  5. Evaluation of 320x240 pixel LEC GaAs Schottky barrier X-ray imaging arrays, hybridized to CMOS readout circuit based on charge integration

    CERN Document Server

    Irsigler, R; Alverbro, J; Borglind, J; Froejdh, C; Helander, P; Manolopoulos, S; O'Shea, V; Smith, K


    320x240 pixels GaAs Schottky barrier detector arrays were fabricated, hybridized to silicon readout circuits, and subsequently evaluated. The detector chip was based on semi-insulating LEC GaAs material. The square shaped pixel detector elements were of the Schottky barrier type and had a pitch of 38 mu m. The GaAs wafers were thinned down prior to the fabrication of the ohmic back contact. After dicing, the chips were indium bump, flip-chip bonded to CMOS readout circuits based on charge integration, and finally evaluated. A bias voltage between 50 and 100 V was sufficient to operate the detector. Results on I-V characteristics, noise behaviour and response to X-ray radiation are presented. Images of various objects and slit patterns were acquired by using a standard dental imaging X-ray source. The work done was a part of the XIMAGE project financed by the European Community (Brite-Euram). (author)

  6. Real-time continuous-wave terahertz line scanner based on a compact 1 × 240 InGaAs Schottky barrier diode array detector. (United States)

    Han, Sang-Pil; Ko, Hyunsung; Kim, Namje; Lee, Won-Hui; Moon, Kiwon; Lee, Il-Min; Lee, Eui Su; Lee, Dong Hun; Lee, Wangjoo; Han, Seong-Tae; Choi, Sung-Wook; Park, Kyung Hyun


    We demonstrate real-time continuous-wave terahertz (THz) line-scanned imaging based on a 1 × 240 InGaAs Schottky barrier diode (SBD) array detector with a scan velocity of 25 cm/s, a scan line length of 12 cm, and a pixel size of 0.5 × 0.5 mm². Foreign substances, such as a paper clip with a spatial resolution of approximately 1 mm that is hidden under a cracker, are clearly detected by this THz line-scanning system. The system consists of the SBD array detector, a 200-GHz gyrotron source, a conveyor system, and several optical components such as a high-density polyethylene cylindrical lens, metal cylindrical mirror, and THz wire-grid polarizer. Using the THz polarizer, the signal-to-noise ratio of the SBD array detector improves because the quality of the source beam is enhanced.

  7. Quantification of Uncertainties due to 235,238U, 239,240,241Pu and Fission Products Nuclear Data Uncertainties for a PWR Fuel Assembly (United States)

    da Cruz, D. F.; Rochman, D.; Koning, A. J.


    Uncertainty analysis on reactivity and discharged inventory for a typical PWR fuel element as a result of uncertainties in 235,238U, 239,240,241Pu, and fission products nuclear data was performed. The Total Monte-Carlo (TMC) method was applied using the deterministic transport code DRAGON. The nuclear data used in this study is from the JEFF-3.1 evaluations, with the exception of the nuclear data files for U, Pu and fission products isotopes, which are taken from the nuclear data library TENDL-2012. Results show that the calculated total uncertainty in keff (as result of uncertainties in nuclear data of the considered isotopes) is virtually independent on fuel burnp and amounts to 700 pcm. The uncertainties in inventory of the discharged fuel is dependent on the element considered and lies in the range 1-15% for most fission products, and is below 5% for the most important actinides.

  8. Development Of VHF (240-270 MHz) Antennas For SoOp (Signal Of Opportunity) Receiver For 6u Cubesat Platforms (United States)

    Joseph, A. T.; Deshpande, M.; O'Neill, P. E.; Miles, L.


    The main goal of this research is to design, fabricate, and test deployable VHF antennas for 6U Cubesat platforms to enable validation of root zone soil moisture (RZSM) estimation algorithms for signal of opportunity (SoOp) remote sensing over the 240-270 MHz frequency band. The proposed work provides a strong foundation for establishing a technology development path for maturing a truly global direct surface soil moisture (SM) and RZSM measurement system (Figure 1) over a variety of land covers with limited density restrictions. In SoOp methodology, signals transmitted by already existing transmitters (known as transmitters of opportunity, in this case the Military Satellite Communication (MilSatCom) System's UHF Follow-On program) are utilized to measure properties of reflecting targets by recording reflected signals using a simple passive microwave receiver.

  9. 240 W high-average-power square-shaped nanosecond all-fiber-integrated laser with near diffraction-limited beam quality. (United States)

    Yu, Hailong; Tao, Rumao; Wang, Xiaolin; Zhou, Pu; Chen, Jinbao


    We report an all-fiber-integrated high-average-power square-shaped nanosecond pulse laser operating at 1068 nm based on the master oscillator power amplifier configuration. The seed source is a passively mode-locked Yb-doped fiber laser with fundamental cavity repetition rate of 1.86 MHz. Output pulses with a square shape can be tuned in pulse width from 271 ps to the nanosecond level. The average output power reaches to 9.21 W after three preamplifiers. Finally, a main amplifier is developed to boost the average output power to 240 W, and the corresponding pulse energy and peak power are ∼ 129.3 μJ and 36 kW, respectively. The efficiency of the main amplifier is ∼ 61.3%, and the beam quality represented by M(2) factors is below 1.3 and 1.2 in the X and Y directions.

  10. 320x240 pixel InGaAs/InP focal plane array for short-wave infrared and visible light imaging (United States)

    Martin, Tara; Dixon, Peter; Gagliardi, Mari-Anne; Masaun, Navneet


    We report on the recent production release of our 320x240 pixel InGaAs/InP focal plane array and camera for visible and short-wavelength infrared light imaging. For this camera, we have fabricated a substrate-removed backside-illuminated InGaAs/InP photodiode array hybridized to a silicon read out integrated circuit (ROIC). Removing the InP substrate from the focal plane array allows visible wavelengths, which would otherwise be absorbed by the InP substrate due to its 920 nm wavelength cut-off, to reach the pixels" active region. Quantum efficiency is approximately 15% at 500 nm, 70% at 850 nm, 85% at 1310 nm and 80% at 1550 nm. This focal plane array is useable for visible imaging as well as imaging eye-safe lasers and is of particular interest for day and low light level imaging as well as hyperspectral imaging.

  11. C22:0- and C24:0-dihydroceramides confer mixed cytotoxicity in T-cell acute lymphoblastic leukemia cell lines.

    Directory of Open Access Journals (Sweden)

    Michael W Holliday

    Full Text Available We previously reported that fenretinide (4-HPR was cytotoxic to acute lymphoblastic leukemia (ALL cell lines in vitro in association with increased levels of de novo synthesized dihydroceramides, the immediate precursors of ceramides. However, the cytotoxic potentials of native dihydroceramides have not been defined. Therefore, we determined the cytotoxic effects of increasing dihydroceramide levels via de novo synthesis in T-cell ALL cell lines and whether such cytotoxicity was dependent on an absolute increase in total dihydroceramide mass versus an increase of certain specific dihydroceramides. A novel method employing supplementation of individual fatty acids, sphinganine, and the dihydroceramide desaturase-1 (DES inhibitor, GT-11, was used to increase de novo dihydroceramide synthesis and absolute levels of specific dihydroceramides and ceramides. Sphingolipidomic analyses of four T-cell ALL cell lines revealed strong positive correlations between cytotoxicity and levels of C22:0-dihydroceramide (ρ = 0.74-0.81, P ≤ 0.04 and C24:0-dihydroceramide (ρ = 0.84-0.90, P ≤ 0.004, but not between total or other individual dihydroceramides, ceramides, or sphingoid bases or phosphorylated derivatives. Selective increase of C22:0- and C24:0-dihydroceramide increased level and flux of autophagy marker, LC3B-II, and increased DNA fragmentation (TUNEL assay in the absence of an increase of reactive oxygen species; pan-caspase inhibition blocked DNA fragmentation but not cell death. C22:0-fatty acid supplemented to 4-HPR treated cells further increased C22:0-dihydroceramide levels (P ≤ 0.001 and cytotoxicity (P ≤ 0.001. These data demonstrate that increases of specific dihydroceramides are cytotoxic to T-cell ALL cells by a caspase-independent, mixed cell death mechanism associated with increased autophagy and suggest that dihydroceramides may contribute to 4-HPR-induced cytotoxicity. The targeted increase of specific acyl chain dihydroceramides

  12. Identity of M2A (D2-40) antigen and gp36 (Aggrus, T1A-2, podoplanin) in human developing testis, testicular carcinoma in situ and germ-cell tumours

    DEFF Research Database (Denmark)

    Sonne, Si Brask; Herlihy, Amy S; Hoei-Hansen, Christina E


    gonocytes and immature Sertoli cells, similar to the expression pattern of M2A antigen, a previously identified marker for CIS and seminoma. This reinforced our previous proposal that M2A (D2-40) antigen was identical to gp36 (podoplanin, Aggrus, T1A-2). Our findings also suggest that podoplanin has...

  13. Mielografia em cães sadios com o meio de contraste ioversol 240 mg I/ml: Resultados clínicos e radiológicos

    Directory of Open Access Journals (Sweden)

    Luciana Virgínia Costa Sarmento


    Full Text Available Este trabalho teve por objetivo avaliar o período de opacificação e a qualidade diagnóstica do ioversol 240 mg I/ml, nas regiões torácica e lombar após sua injeção na cisterna magna, e verificar seus efeitos sobre o sistema nervoso por meio de observações clínicas e neurológicas. Utilizaram-se 30 cães sadios, sem distinção de sexo ou raça, com peso entre 9 e 12 kg, divididos em três grupos de 10 animais cada. Nos animais anestesiados com diazepam e tiopental sódico, o ioversol foi injetado na dose de 0,5 ml/kg. Foram obtidas radiografias cervicais aos cinco minutos para confirmar a injeção do contraste e toracolombares aos 30, 40, 50 e 60 minutos para avaliar o período de opacificação. Exames clínicos e neurológicos foram realizados diariamente até os 7, 14 e 28 dias para os grupos I, II e III respectivamente. Efeitos adversos como movimentos de pedalagem, início de convulsão, espasmos musculares, apnéia, dispnéia e ânsia de vômito foram observados apenas durante o procedimento mielográfico. O ioversol apresentou boas radiopacidade, difusão e miscibilidade com o líquor, oferecendo também a possibilidade de redução de custos, já que pode ser autoclavado. O tempo de opacificação do contraste com valor diagnóstico atingiu 60 minutos em 60% das radiografias torácicas e em 80% das radiografias lombares. Havendo baixa incidência de alterações clínicas e neurológicas, e apropriadas qualidades radiográficas, concluiu-se que o ioversol na concentração de 240 mg I/ml é adequado e seguro para ser utilizado em mielografia de cães.

  14. Radionuclides {sup 137}Cs, {sup 90}Sr, {sup 241}Am and {sup 239+240}Pu in vegetation cover of the former Semipalatinsk test site

    Energy Technology Data Exchange (ETDEWEB)

    Larionova, N. [Institute of Radiation Safety and Ecology (Kazakhstan); Lukashenko, S. [Institute of Radiation Safety and Ecology of the Republican State Enterprise (Kazakhstan)


    The Semipalatinsk Test Site (STS) is one of the largest testing grounds for nuclear weapons. Diverse nuclear explosions were carried out on its territory: 340 underground tests (sites 'Degelen', 'Balapan' and 'Sary-Uzen'), 30 surface and 86 nuclear air explosions (site for radioactive warfare agent (RWA) and 'Experimental Field'). Since the STS was shutdown a large amount of information about current radiological situation in its territory has been collected. In recent years, one of the main problems is gradual transfer of its lands for national economy. Under these conditions, an essential element for prediction of radioactive contamination levels of food products is radionuclides redistribution parameters in soil-plant system used in calculation of doses to the population living within STS territory. Until recently, matter of radionuclides migration from soil to plants has been poorly studied. Individual researches, more or less devoted to this issue occurred in the past, but have virtually no information about accumulation of transuranic radionuclides in plants. More regular studies in this direction have been initiated recently. Between 2007 and 2013 features of artificial radionuclides accumulation in certain plant species under radioactive tunnel watercourses at 'Degelen' site were studied. We've obtained statistically reliable data characterizing accumulation of radionuclides, including {sup 239+240}Pu and {sup 241}Am, in steppe plants at 'Experimental field' site. The content of radionuclides in plants was researched at the RWA site. Comprehensive ecological survey in order to release the lands to the national economic turnover investigated parameters of radionuclides accumulation in steppe grasses at conditionally 'background' areas of STS and some parts of radioactive trace plume caused by the explosion in 1953. To date, all the findings have been generalized. We present an


    Energy Technology Data Exchange (ETDEWEB)

    Qiu, Keping [School of Astronomy and Space Science, Nanjing University, 22 Hankou Road, Nanjing 210093 (China); Zhang, Qizhou [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Menten, Karl M. [Max-Planck-Institut für Radioastronomie, Auf dem Hügel 69, D-53121 Bonn (Germany); Liu, Hauyu B.; Tang, Ya-Wen [Academia Sinica Institute of Astronomy and Astrophysics, P. O. Box 23-141, Taipei 106, Taiwan (China); Girart, Josep M., E-mail: [Institut de Ciències de l' Espai (CSIC-IEEC), Campus UAB, Facultat de Ciències, C5p 2, E-08193 Bellaterra, Catalonia (Spain)


    We report the first detection of an hourglass magnetic field aligned with a well-defined outflow rotation system in a high-mass, star-forming region. The observations were performed with the Submillimeter Array toward G240.31+0.07, which harbors a massive, flattened, and fragmenting molecular cloud core and a wide-angle bipolar outflow. The polarized dust emission at 0.88 mm reveals a clear hourglass-shaped magnetic field aligned within 20° of the outflow axis. Maps of high-density tracing spectral lines, e.g., H{sup 13}CO{sup +} (4-3), show that the core is rotating about its minor axis, which is also aligned with the magnetic field axis. Therefore, both the magnetic field and kinematic properties observed in this region are surprisingly consistent with the theoretical predictions of the classic paradigm of isolated low-mass star formation. The strength of the magnetic field in the plane of sky is estimated to be ∼1.1 mG, resulting in a mass-to-magnetic flux ratio of 1.4 times the critical value and a turbulent-to-ordered magnetic energy ratio of 0.4. We also find that the specific angular momentum almost linearly decreases from r ∼ 0.6 pc to 0.03 pc scales, which is most likely attributed to magnetic braking.

  16. The dwarf phenotype in GH240B mice, haploinsufficient for the autism candidate gene Neurobeachin, is caused by ectopic expression of recombinant human growth hormone.

    Directory of Open Access Journals (Sweden)

    Kim Nuytens

    Full Text Available Two knockout mouse models for the autism candidate gene Neurobeachin (Nbea have been generated independently. Although both models have similar phenotypes, one striking difference is the dwarf phenotype observed in the heterozygous configuration of the GH240B model that is generated by the serendipitous insertion of a promoterless human growth hormone (hGH genomic fragment in the Nbea gene. In order to elucidate this discrepancy, the dwarfism present in this Nbea mouse model was investigated in detail. The growth deficiency in Nbea+/- mice coincided with an increased percentage of fat mass and a decrease in bone mineral density. Low but detectable levels of hGH were detected in the pituitary and hypothalamus of Nbea+/- mice but not in liver, hippocampus nor in serum. As a consequence, several members of the mouse growth hormone (mGH signaling cascade showed altered mRNA levels, including a reduction in growth hormone-releasing hormone mRNA in the hypothalamus. Moreover, somatotrope cells were less numerous in the pituitary of Nbea+/- mice and both contained and secreted significantly less mGH resulting in reduced levels of circulating insulin-like growth factor 1. These findings demonstrate that the random integration of the hGH transgene in this mouse model has not only inactivated Nbea but has also resulted in the tissue-specific expression of hGH causing a negative feedback loop, mGH hyposecretion and dwarfism.

  17. Radioactive foodchains in the subarctic environment. Progress report, August 15, 1975--August 14, 1976. [/sup 137/Cs and /sup 239/Pu, /sup 240/Pu distribution

    Energy Technology Data Exchange (ETDEWEB)

    Miettinen, J K


    Cesium-137 is accumulated in the foodchain lichen-reindeer-man causing high body burdens in Lapps who have reindeer meat as staple food. A group of Finnish Lapps has been whole body counted for /sup 137/Cs annually since 1961. Results of the measurements made in April 1976 show 18 percent decrease in /sup 137/Cs body burdens from the previous year. A dietary study confirmed that there was no mentionable change in the total amount of reindeer meat consumed although winter consumption has slightly decreased and summer consumption increased in recent years. Plutonium analyses of stockpiled lichen and reindeer samples from 1960 to 1973 were begun in 1973; since then the sampling has continued. Lichen had 200 pCi per kg dry weight in 1963 to 1964, 100 pCi/kg in 1966 to 1970, 20 pCi/kg in 1973 to 1975. Biological half-time of plutonium in lichen is 2 years. Reindeer liver contained about 20 pCi per kg fresh weight in 1963, 2 pCi in 1973. The ratio of plutonium in liver to its lifelong total intake gave a lower limit to absorption in reindeer. Of bones, plutonium concentration is highest in teeth, medium high in sternum, vertebra and humerus, and lowest in solid long bones. Human autopsy samples gave for lungs 0.19 liver 0.02 and bone 0.09 pCi /sup 239/ /sup 240/Pu per kg of wet weight.

  18. Measurement of the 240Pu(n,f cross-section at the CERN n_TOF facility: First results from experimental area II (EAR-2

    Directory of Open Access Journals (Sweden)

    Stamatopoulos A.


    Full Text Available The accurate knowledge of the neutron-induced fission cross-sections of actinides and other isotopes involved in the nuclear fuel cycle is essential for the design of advanced nuclear systems, such as Generation-IV nuclear reactors. Such experimental data can also provide the necessary feedback for the adjustment of nuclear model parameters used in the evaluation process, resulting in the further development of nuclear fission models. In the present work, the 240Pu(n,f cross-section was measured at CERN's n_TOF facility relative to the well-known 235U(n,f cross section, over a wide range of neutron energies, from meV to almost MeV, using the time-of-flight technique and a set-up based on Micromegas detectors. This measurement was the first experiment to be performed at n_TOF's new experimental area (EAR-2, which offers a significantly higher neutron flux compared to the already existing experimental area (EAR-1. Preliminary results as well as the experimental procedure, including a description of the facility and the data handling and analysis, are presented.

  19. Measurement of the 240Pu(n,f) cross-section at the CERN n_TOF facility: First results from experimental area II (EAR-2) (United States)

    Stamatopoulos, A.; Tsinganis, A.; Colonna, N.; Vlastou, R.; Kokkoris, M.; Schillebeeckx, P.; Plompen, A.; Heyse, J.; Žugec, P.; Barbagallo, M.; Calviani, M.; Berthoumieux, E.; Chiaveri, E.; Aberle, O.; Andrzejewski, J.; Audouin, L.; Bécares, V.; Bacak, M.; Balibrea, J.; Barros, S.; Bečvář, F.; Beinrucker, C.; Belloni, F.; Billowes, J.; Boccone, V.; Bosnar, D.; Brugger, M.; Caamaño, M.; Calviño, F.; Cano-Ott, D.; Cerutti, F.; Cortés, G.; Cortés-Giraldo, M. A.; Cosentino, L.; Damone, L. A.; Deo, K.; Diakaki, M.; Domingo-Pardo, C.; Dressler, R.; Dupont, E.; Durán, I.; Fernández-Domínguez, B.; Ferrari, A.; Ferreira, P.; Finocchiaro, P.; Frost, R. J. W.; Furman, V.; Göbel, K.; Gómez-Hornillos, M. B.; García, A. R.; Gheorghe, I.; Glodariu, T.; Gonçalves, I. F.; González, E.; Goverdovski, A.; Griesmayer, E.; Guerrero, C.; Gunsing, F.; Harada, H.; Heftrich, T.; Heinitz, S.; Hernández-Prieto, A.; Jenkins, D. G.; Jericha, E.; Käppeler, F.; Kadi, Y.; Katabuchi, T.; Kavrigin, P.; Ketlerov, V.; Khryachkov, V.; Kimura, A.; Kivel, N.; Krtička, M.; Leal-Cidoncha, E.; Lederer, C.; Leeb, H.; Lerendegui-Marco, J.; Licata, M.; Meo, S. Lo; Losito, R.; Macina, D.; Marganiec, J.; Martínez, T.; Massimi, C.; Mastinu, P.; Mastromarco, M.; Matteucci, F.; Mendoza, E.; Mengoni, A.; Milazzo, P. M.; Mingrone, F.; Mirea, M.; Montesano, S.; Musumarra, A.; Nolte, R.; Palomo-Pinto, F. R.; Paradela, C.; Patronis, N.; Pavlik, A.; Perkowski, J.; Porras, J. I.; Praena, J.; Quesada, J. M.; Rauscher, T.; Reifarth, R.; Riego-Perez, A.; Robles, M.; Rubbia, C.; Ryan, J. A.; Sabaté-Gilarte, M.; Saxena, A.; Schmidt, S.; Schumann, D.; Sedyshev, P.; Smith, A. G.; Suryanarayana, S. V.; Tagliente, G.; Tain, J. L.; Tarifeño-Saldivia, A.; Tassan-Got, L.; Valenta, S.; Vannini, G.; Variale, V.; Vaz, P.; Ventura, A.; Vlachoudis, V.; Wallner, A.; Warren, S.; Weigand, M.; Weiss, C.; Wright, T.


    The accurate knowledge of the neutron-induced fission cross-sections of actinides and other isotopes involved in the nuclear fuel cycle is essential for the design of advanced nuclear systems, such as Generation-IV nuclear reactors. Such experimental data can also provide the necessary feedback for the adjustment of nuclear model parameters used in the evaluation process, resulting in the further development of nuclear fission models. In the present work, the 240Pu(n,f) cross-section was measured at CERN's n_TOF facility relative to the well-known 235U(n,f) cross section, over a wide range of neutron energies, from meV to almost MeV, using the time-of-flight technique and a set-up based on Micromegas detectors. This measurement was the first experiment to be performed at n_TOF's new experimental area (EAR-2), which offers a significantly higher neutron flux compared to the already existing experimental area (EAR-1). Preliminary results as well as the experimental procedure, including a description of the facility and the data handling and analysis, are presented.

  20. Identification of citrullinaemia carrier and detection of a new silent mutation at 240bp position in ASS1 gene of normal Holstein cattle

    Directory of Open Access Journals (Sweden)

    Kotikalapudi Rosaiah


    Full Text Available The autosomal recessive genetic disorders are regularly investigated especially in Indian Holstein and Holstein Crossbred bulls before they entered in semen collection so that a defective gene should not be transmitted to future generations. Bovine citrullinaemia first reported in Australia is a metabolic disorder as one of the enzymes, Argininosuccinate synthetase (ASS involved in urea cycle is impaired in function. The mutation responsible for citrullinemia has been characterized as a single-base substitution at 256bp (C>T in coding exon 3 of argininosuccinate synthetase 1 (ASS1 gene, which converts the CGA (arginine at 86 codon to TGA (stop codon. A Holstein bull during routine molecular screening was found to be carrier for Citrullinaemia that was confirmed by sequencing. This is a fresh case of Citrullinaemia carrier in addition to three cases reported earlier in India. Partial sequencing of coding exon 3 of a normal Holstein revealed a new silent polymorphism at 240bp position that does not change amino acid (Sarine AGC>AGT at 80 codon within exon 3 of ASS1 gene. The sequence of exon 3 of ASS1 gene in a normal Holstein exhibiting a new polymorphism was submitted to NCBI with accession No. KF933365. The presence of citrullinaemia carriers in Indian Holstein, though in very low frequency, emphasizing to continue the investigation of mutant gene in cattle population.

  1. Comment on “Iron isotope fractionation during planetary differentiation” by S. Weyer et al., Earth Planet. Sci. Lett. V240, pages 251 264 (United States)

    Beard, Brian L.; Johnson, Clark M.


    A review of published Fe isotope compositions measured for mantle xenoliths and massif-type peridotites demonstrates that the Fe isotope composition of the "mantle" is highly heterogeneous as compared to the narrow Fe isotope range measured for basaltic rocks. The greatest isotopic heterogeneity exists for samples derived from the lithospheric mantle, whereas basalts largely record the isotopic compositions of the asthenospheric mantle. These published Fe isotope data show that the variability measured in mantle samples is too large to be used to accurately determine a planetary Fe isotope composition, and, contrary to the assertions of Weyer et al. [S. Weyer, A. Anbar, G. Brey, C. Münker, K. Mezger, A. Woodland, Iron isotope fractionation during planetary differentiation. Earth Planet. Sci. Lett. 240 (2005) 251-264], there is no evidence that the bulk terrestrial mantle has a different Fe isotope composition relative to terrestrial basaltic magmas. We contend that similar rock types must be compared (i.e., basalt-basalt) when considering possible inter-planetary Fe isotope differences.

  2. Evaluation of five methods for derivatization and GC determination of a mixture of very long chain fatty acids (C24:0-C36:0). (United States)

    Antolín, Ernesto Méndez; Delange, David Marrero; Canavaciolo, Víctor González


    D003 is a new active ingredient consisting of a mixture of very long chain saturated fatty acids (C(24:0)-C(36:0)) in a definite proportion, which shows antioxidant, antiosteoporotic, antiplatelet and cholesterol-lowering effects in experimental models. Five derivatization methods for determining these fatty acids by gas chromatography (GC), using diazomethane, sulphuric acid-methanol, hydrochloric acid-methanol, boron trifluoride-methanol and N-methyl-N-trimethylsilyltrifluoroacetamide were evaluated. GC analysis was carried out using a BPX-5 wide-bore column and 1-nonadecanoic acid (C(19:0)) as internal standard. Methods were similar on account of the fatty acid content determined (84.2-86.6%). However, whereas the hydrochloric acid-methanol method needed 90 min to complete the derivatization, the other methods only required 10 min. Considering costs, speed, safety and GC response, the method using sulphuric acid-methanol was found the most appropriate for determining these fatty acids. The validation of this method: linearity over a range 40-160%, accuracy assessed through a recovery study, precision within day and inter-day, and specificity, even for samples subject to stress conditions, proved it is suitable for quality control and stability studies of the very long chain fatty acids composing this active ingredient.

  3. 240 elephants in a tunnel; 240 Elefanten in einer Roehre

    Energy Technology Data Exchange (ETDEWEB)

    Roethlein, B.


    The end of 2007 will see particle physicists setting protons on a collision course through the Large Hadron Collider with more energy than ever before. Their intention is to track down the Higgs boson and solve the problem of why the universe contains almost no antimatter. Physicists from the MAX PLANCK INSTITUTE FOR PHYSICS and the MAX PLANCK INSTITUTE FOR NUCLEAR PHYSICS are playing a crucial role in the experiments and their preparation. (orig.)

  4. Measurement of electro-sprayed 238 and 239+240 plutonium isotopes using 4{pi}-alpha spectrometry. Application to environmental samples; Spectrometrie alpha 4{pi} de sources d'actinides realisees par electronebulisation. Developpement et optimisation d'un protocole applique au mesurage des isotopes 238 et 239+240 du plutonium dans l'environnement

    Energy Technology Data Exchange (ETDEWEB)

    Charmoille-Roblot, M. [CEA/Fontenay-aux-Roses, Dept. de Protection de l' Environnement (DPRE), 92 (France)]|[Paris-11 Univ., 91 - Orsay (France)


    A new protocol for plutonium deposition using the electro-spray technique coupled with 4{pi}-{alpha} spectrometry is proposed to improve the detection limit, shorten the counting time. In order to increase the detection efficiency, it was proposed to measure 238 and 239+240 plutonium isotopes electro-sprayed deposit simultaneously on both sides of the source support, that must be as transparent as possible to alpha-emissions, in a two-alpha detectors chamber. A radiochemical protocol was adapted to electro-spray constraints and a very thin carbon foil was selected for 4{pi} -alpha spectrometry. The method was applied to a batch of sediment samples and gave the same results as an electrodeposited source measured using conventional alpha spectrometry with a 25 % gain on counting time and 10 % on plutonium 238 detection limit. Validation and application of the technique have been made on reference samples. (author)

  5. Gclust Server: 240 [Gclust Server

    Lifescience Database Archive (English)

    Full Text Available protein epsilon (14-3-3E) (Mitochondrial import stimulation factor L subunit) (MSF L) ; no annotation 143...protein epsilon (14-3-3E) (Mitochondrial import stimulation factor L subunit) (MSF L) ; no annotation Number

  6. Bevacizumab for advanced cervical cancer: patient-reported outcomes of a randomised, phase 3 trial (NRG Oncology-Gynecologic Oncology Group protocol 240). (United States)

    Penson, Richard T; Huang, Helen Q; Wenzel, Lari B; Monk, Bradley J; Stockman, Sharon; Long, Harry J; Ramondetta, Lois M; Landrum, Lisa M; Oaknin, Ana; Reid, Thomas J A; Leitao, Mario M; Method, Michael; Michael, Helen; Tewari, Krishnansu S


    GOG 240 was a practice-changing randomised phase 3 trial that concluded that chemotherapy plus bevacizumab for advanced cervical cancer significantly improves overall and progression-free survival, and the proportion of patients achieving an overall objective response, compared with chemotherapy alone. In this study, we aimed to analyse patient-reported outcomes in GOG 240. Eligible adult participants (aged ≥18 years) had primary stage IVB or recurrent or persistent carcinoma of the cervix with measurable disease and GOG performance status of 0-1. Participants were randomly assigned by web-based permuted block randomisation (block size 4) in a 1:1:1:1 ratio to the four treatment groups: cisplatin (50 mg/m(2) intravenously on day 1 or 2 of the treatment cycle) and paclitaxel (135 mg/m(2) intravenously over 24 h or 175 mg/m(2) intravenously over 3 h on day 1), with or without bevacizumab (15 mg/kg intravenously on day 1 or 2), or paclitaxel (175 mg/m(2) over 3 h on day 1) and topotecan (0·75 mg/m(2) for 30 min on days 1-3) with or without bevacizumab (15 mg/kg intravenously on day 1). Treatment assignment was concealed at randomisation (everyone was masked to treatment assignment, achieved by the use of a computer encrypted numbering system at the National Cancer Institute) and became open-label when each patient was registered to the trial. Treatment cycles were repeated every 21 days until disease progression or unacceptable toxicity, whichever occurred first. The coprimary endpoints of the trial were overall survival and safety; the primary quality-of-life endpoint was the score on the Functional Assessment of Cancer Therapy-Cervix Trial Outcome Index (FACT-Cx TOI). For our analysis of patient-reported outcomes, participants were assessed before treatment cycles 1, 2, and 5, and at 6 and 9 months after the start of cycle 1, with the FACT-Cx TOI, items from the FACT-GOG-Neurotoxicity subscale, and a worst pain item from the Brief Pain Inventory. All patients who

  7. Comparison of 240 ka long organic carbon and carbonate records along a depth transect in the Timor Sea: Primary signals versus preservation changes (United States)

    Liu, Wei; Baudin, François; Moreno, Eva; Dewilde, Fabien; Caillon, Nicolas; Fang, Nianqiao; Bassinot, Franck


    Total organic carbon (TOC) and calcium carbonate (CaCO3) records from different water depths in the Timor Sea (NE Indian Ocean) are compared in order to better reconstruct past changes in pelagic productivity, highlight the impact of preservation at depth, and unravel the interplay of organic carbon and carbonate sedimentation. New data are presented for core MD01-2376 located at 2376 m depth. These results are compared, over the last 240 ka, with published data on two neighboring cores (MD01-2378, 1783 m and MD98-2166, 3875 m). TOC fluctuations show strong glacial/interglacial variations and Milankovitch-type oscillations (i.e., dominant frequencies centered on the 100, 41, and 23 ka bands), with an enrichment during cold periods that reflects an increase in primary productivity as well as a lesser decomposition of organic matter with depth. During interglacials, TOC values are lower and show a stronger gradient with depth of deposition than during glacials. This suggests an overall better ventilation of deepwater masses and a steeper vertical gradient in the oxygen content, possibly associated to the upward extension of the oxygen-rich deep waters relative to the glacial situation. Temporal fluctuations in the CaCO3 records do not show such a glacial-interglacial pattern but reveal precession- and obliquity-related oscillations. Fluctuations in the 19-23 ka bands are only observed in the shallowest core, while fluctuations in the 41 ka band are clearly expressed in the two deepest cores, suggesting that this signal is more directly related to changes in carbonate preservation at the seafloor.

  8. Amchitka Radiobiological Program. Progress report, January 1977--December 1977. [/sup 3/H, /sup 90/Sr, /sup 239/Pu, /sup 240/Pu, /sup 40/K, /sup 7/Be

    Energy Technology Data Exchange (ETDEWEB)

    Seymour, A.H.; Johnson, A.F.


    The Amchitka Radiobiological Program began in 1970 and is a continuing program to collect biological and environmental samples for radiometric analyses. An account of the program from July 1970, to December 1976, has been given in seven previous progress reports from the Laboratory of Radiation Ecology to the Nevada Operations Office of the U.S. Department of Energy. This report is an account of the program for calendar year 1977. Results of analyses for samples collected in September 1977 have been added to the tables in Nelson and Seymour (1977) that summarize the results of analyses of samples collected from 1970 to 1977, and include analyses for: gamma-emitting radionuclides in air filters, freshwater, birds, lichens, marine algae, marine invertebrates, fish, aufwuchs, and freshwater moss and plants; strontium-90 (/sup 90/Sr) in rats, birds, and soil; /sup 239/ /sup 240/Pu in sand, soil, marine algae, and fish; and tritium (/sup 3/H) in seawater, freshwater, and biological organisms. Monitoring of background radiation with survey instruments was added to the Laboratory's program in 1974, and the results of the four annual surveys since that date are included in this report. Conclusions from the results of the recent analyses are a reiteration of the results stated in Nelson and Seymour (1975a); namely, no new radionuclides are present; the most abundant radionuclides are naturally occurring beryllium-7 (/sup 7/Be) and potassium-40 (/sup 40/K); the trace quantities of fission products and induced radionuclides are from world fallout; and a trace of /sup 3/H contamination remains in some Long Shot ponds, as previously reported.'' It is concluded from the results of analyses of samples collected between September 1969, and September 1977, as reported in this and the seven previous progress reports, that there were no radionuclides of Milrow or Cannikin origin in the water, plants, or animals of Amchitka Island.

  9. Laboratory Study of the OH + Permethylsiloxane (L2, L3, D3, and D4) Reaction Rate Coefficients Between 240 and 370 K (United States)

    Burkholder, J. B.; Bernard, F.; Papadimitriou, V. C.


    The atmospheric chemistry of organosiloxanes has recently been implicated in the formation of new particles as well as regional and indoor air quality. Methylsiloxanes with Sicosmetics, textiles, health care and household products and in industrial applications as solvents and lubricants. They are released into the atmosphere during manufacturing, use, and disposal and have been observed in the atmosphere in ppb levels in certain locations. However, the fundamental chemical properties of this class of compounds, particularly their reactivity with the OH radical, are presently not fully characterized. In this work, the temperature dependence of the rate coefficients for the OH radical reaction with the simplest linear (L2 and L3) and cyclic (D3 and D4) siloxanes were measured: OH + (CH3)3SiOSi(CH3)3 = Products L2OH + [(CH3)3SiO]2Si(CH3)2 = Products L3OH + [-Si(CH3)2O-]3 = Products D3OH + [-Si(CH3)2O-]4 = Products D4OH rate coefficients were measured under pseudo-first conditions in OH over the temperature range 240-370 K using a pulsed laser photolysis-laser induced fluorescence (PLP-LIF) technique and at 296 K using a relative rate method. The present results are compared with available literature data where possible and discrepancies are discussed. The results from this work will be discussed in terms of the atmospheric lifetimes of these methylsiloxanes and the reactivity trends for this class of compound.

  10. Determination of 239Pu and 240Pu isotope ratio for a nuclear bomb particle using X-ray spectrometry in conjunction with γ-ray spectrometry and non-destructive α-particle spectrometry (United States)

    Pöllänen, R.; Ruotsalainen, K.; Toivonen, H.


    A nuclear bomb particle from Thule containing Pu and U was analyzed using X-ray spectrometry in combination with γ-ray spectrometry and non-destructive α-spectrometry. The main objective was to investigate the possibility to determine the 239Pu and 240Pu isotope ratios. Previously, X-ray spectrometry together with the above-mentioned methods has been successfully applied for radiochemically processed samples, but not for individual particles. In the present paper we demonstrate the power of non-destructive analysis. The 239Pu/( 239Pu+ 240Pu) atom ratio for the Thule particle was determined, using two different approaches, to be 0.93±0.07 and 0.91±0.05. These results are consistent with weapons-grade material and the results obtained by other investigators.

  11. Retention and translocation of foliar applied {sup 239,240}Pu and {sup 241}Am, as compared to {sup 137}Cs and {sup 85}Sr, into bean plants (Phaseolus vulgaris)

    Energy Technology Data Exchange (ETDEWEB)

    Henner, P. [Institute for Radioprotection and Nuclear Safety, Environment and Emergency Operations Division, Department for the Study of Radionuclides Behaviour in Ecosystems, Laboratory of Radioecology and Ecotoxicology, IRSN/DPRE/SECRE/LRE, Cadarache Centre, Building 186, BP 3, 13115 Saint-Paul-lez-Durance (France)]. E-mail:; Colle, C. [Institute for Radioprotection and Nuclear Safety, Environment and Emergency Operations Division, Department for the Study of Radionuclides Behaviour in Ecosystems, Laboratory of Radioecology and Ecotoxicology, IRSN/DPRE/SECRE/LRE, Cadarache Centre, Building 186, BP 3, 13115 Saint-Paul-lez-Durance (France); Morello, M. [Institute for Radioprotection and Nuclear Safety, Environment and Emergency Operations Division, Department for the Study of Radionuclides Behaviour in Ecosystems, Laboratory of Radioecology and Ecotoxicology, IRSN/DPRE/SECRE/LRE, Cadarache Centre, Building 186, BP 3, 13115 Saint-Paul-lez-Durance (France)


    Foliar transfer of {sup 241}Am, {sup 239,240}Pu, {sup 137}Cs and {sup 85}Sr was evaluated after contamination of bean plants (Phaseolus vulgaris) at the flowering development stage, by soaking their first two trifoliate leaves into contaminated solutions. Initial retentions of {sup 241}Am (27%) and {sup 239,240}Pu (37%) were higher than those of {sup 137}Cs and {sup 85}Sr (10-15%). Mean fraction of retained activity redistributed among bean organs was higher for {sup 137}Cs (20.3%) than for {sup 239,240}Pu (2.2%), {sup 241}Am (1%) or {sup 85}Sr (0.1%). Mean leaf-to-pod translocation factors (Bq kg{sup -1}dry weight pod/Bq kg{sup -1}dry weight contaminated leaves) were 5.0 x 10{sup -4} for {sup 241}Am, 2.7 x 10{sup -6} for {sup 239,240}Pu, 5.4 x 10{sup -2} for {sup 137}Cs and 3.6 x 10{sup -4} for {sup 85}Sr. Caesium was mainly recovered in pods (12.8%). Americium and strontium were uniformly redistributed among leaves, stems and pods. Plutonium showed preferential redistribution in oldest bean organs, leaves and stems, and very little redistribution in forming pods. Results for americium and plutonium were compared to those of strontium and caesium to evaluate the consistency of the attribution of behaviour of strontium to transuranium elements towards foliar transfer, based on translocation factors, as stated in two radioecological models, ECOSYS-87 and ASTRAL.

  12. Positive Oct -3/4 and D2-40 Immunohistochemical Expression in Germ Cells and Suspected Histology Pattern of Intratubular Germ Cell Neoplasia in Boys with Cryptorchidism Vanish after the Age of 2 Years

    DEFF Research Database (Denmark)

    Thorup, Jorgen; Clasen-Linde, Erik; Cortes, Dina


    , but no increased risk of malignancy.  Materials and Methods  Histology sections from 373 testicular biopsies from 289 boys aged 1 month to 2 years operated for cryptorchidism were incubated with primary antibodies including anti-placental-like-alkaline phosphatase, antiOct-3/4, anti-C-kit, anti-D2-40, and in case...... of repeat biopsy with anti-stem cell factor (SCF) receptor.  Results  The prevalence of Oct-3/4 and D2-40-positive staining of germ cells in testicular biopsies were in age groups less than 6 months, 100% and 50%; 6-12 months, 60% and 17%; and 1-2 years, 12% and 4%. A 1 year, 1-month-old boy with Prader...... months, 3.5 years, and 3 years, 10months, respectively. In all cases, the Oct-3/4 and D2-40 positive germ cells turned negative and the histological pattern normalized completely. The primary biopsies had SCF negative germ cells.  Conclusion  This study is valuable in identifying the age-related change...

  13. Induction of Mitochondrial Changes Associated with Oxidative Stress on Very Long Chain Fatty Acids (C22:0, C24:0, or C26:0-Treated Human Neuronal Cells (SK-NB-E

    Directory of Open Access Journals (Sweden)

    Amira Zarrouk


    Full Text Available In Alzheimer's disease, lipid alterations point towards peroxisomal dysfunctions. Indeed, a cortical accumulation of saturated very long chain fatty acids (VLCFAs: C22:0, C24:0, C26:0, substrates for peroxisomal β-oxidation, has been found in Alzheimer patients. This study was realized to investigate the effects of VLCFAs at the mitochondrial level since mitochondrial dysfunctions play crucial roles in neurodegeneration. On human neuronal SK-NB-E cells treated with C22:0, C24:0, or C26:0 (0.1–20 μM; 48 h, an inhibition of cell growth and mitochondrial dysfunctions were observed by cell counting with trypan blue, MTT assay, and measurement of mitochondrial transmembrane potential (Δψm with DiOC6(3. A stimulation of oxidative stress was observed with DHE and MitoSOX used to quantify superoxide anion production on whole cells and at the mitochondrial level, respectively. With C24:0 and C26:0, by Western blotting, lower levels of mitochondrial complexes III and IV were detected. After staining with MitoTracker and by transmission electron microscopy used to study mitochondrial topography, mass and morphology, major changes were detected in VLCFAs treated-cells: modification of the cytoplasmic distribution of mitochondria, presence of large mitochondria, enhancement of the mitochondrial mass. Thus, VLCFAs can be potential risk factors contributing to neurodegeneration by inducing neuronal damages via mitochondrial dysfunctions.

  14. Modelling Deposition and Erosion rates with RadioNuclides (MODERN) - Part 2: A comparison of different models to convert239+240Pu inventories into soil redistribution rates at unploughed sites. (United States)

    Arata, Laura; Alewell, Christine; Frenkel, Elena; A'Campo-Neuen, Annette; Iurian, Andra-Rada; Ketterer, Michael E; Mabit, Lionel; Meusburger, Katrin


    Sheet erosion is one of the major threats to alpine soils. To quantify its role and impact in the degradation processes of alpine grasslands, the application of Fallout Radionuclides (FRN) showed very promising results. The specific characteristics of plutonium 239 + 240 ( 239+240 Pu), such as the homogeneous fallout distribution, the long half-life and the cost and time effective measurements make this tracer application for investigating soil degradation in Alpine grasslands more suitable than any other FRN (e.g. 137 Cs). However, the conversion of 239+240 Pu inventories into soil erosion rates remains a challenge. Currently available conversion models have been developed mainly for 137 Cs with later adaptation to other FRN (e.g. Excess 210 Pb, and 7 Be), each model being defined for specific land use (ploughed and/or unploughed) and processes (erosion or deposition). As such, they may fail in describing correctly the distribution of Pu isotopes in the soil. A new conversion model, MODERN, with an adaptable algorithm to estimate erosion and deposition rates from any FRN inventory changes was recently proposed (Arata et al., 2016). In this complementary contribution, the authors compare the application of MODERN to other available conversion models. The results show a good agreement between soil redistribution rates obtained from MODERN and from the models currently used by the FRN scientific community (i.e. the Inventory Method). Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  15. A Fibreoptic endoscopic study of upper gastrointestinal bleeding at Bugando Medical Centre in northwestern Tanzania: A retrospective review of 240 cases

    Directory of Open Access Journals (Sweden)

    Jaka Hyasinta


    Full Text Available Abstract Background Upper gastrointestinal (GI bleeding is recognized as a common and potentially life-threatening abdominal emergency that needs a prompt assessment and aggressive emergency treatment. A retrospective study was undertaken at Bugando Medical Centre in northwestern Tanzania between March 2010 and September 2011 to describe our own experiences with fibreoptic upper GI endoscopy in the management of patients with upper gastrointestinal bleeding in our setting and compare our results with those from other centers in the world. Findings A total of 240 patients representing 18.7% of all patients (i.e. 1292 who had fibreoptic upper GI endoscopy during the study period were studied. Males outnumbered female by a ratio of 2.1:1. Their median age was 37 years and most of patients (60.0% were aged 40 years and below. The vast majority of the patients (80.4% presented with haematemesis alone followed by malaena alone in 9.2% of cases. The use of non-steroidal anti-inflammatory drugs, alcohol and smoking prior to the onset of bleeding was recorded in 7.9%, 51.7% and 38.3% of cases respectively. Previous history of peptic ulcer disease was reported in 22(9.2% patients. Nine (3.8% patients were HIV positive. The source of bleeding was accurately identified in 97.7% of patients. Diagnostic accuracy was greater within the first 24 h of the bleeding onset, and in the presence of haematemesis. Oesophageal varices were the most frequent cause of upper GI bleeding (51.3% followed by peptic ulcers in 25.0% of cases. The majority of patients (60.8% were treated conservatively. Endoscopic and surgical treatments were performed in 30.8% and 5.8% of cases respectively. 140 (58.3% patients received blood transfusion. The median length of hospitalization was 8 days and it was significantly longer in patients who underwent surgical treatment and those with higher Rockall scores (P  60 years and in patients with higher Rockall scores and those who

  16. Intercomparison of Pb-210, Cs-137, Pu-239,240 and C-14-Based Chronologies of Recent Sediments - Problems and Challenges (United States)

    Baskaran, M. M.


    Short-lived naturally-occurring Pb-210 and anthropogenically-delivered Cs-137 are the two most extensively utilized chronometers over the time scale of less than a decade to 60 (Cs-137) to 120 yrs (Pb-210) in a variety of environment including terrestrial and aqueous systems and glaciers. Despite all the advances in the field, still major issues, we confront several issues on the robustness of their applications in these environments. Those include: i) how does the temporal and spatial variations of Pb-210 input to an aqueous environment affect the Pb-210 chronology? ii) how well we are able to quantify the multiple source inputs (atmospheric fallout, watershed erosional input, production of Pb-210 from the decay of SGD-derived Rn-222 and Ra-226, etc); iii) How well are we able to sort out a number of processes that affect the vertical profiles of both Cs-137 and Pb-210 which include sediment mixing (biological and/or physical), sediment focusing/erosion due to bottom currents and transport of sediments in subsurface environment and post-depositional mobility of Cs-137 and Pb-210. In this presentation, the following case studies will be discussed: 1) where there is excellent as well non-agreement between Pb-210 and Cs-137-based chronologies; 2) agreement between Cs-137-based chronology with historical time-marker from Hg mining, while no chronology obtainable from Pb-210; 3) agreement between five different methods of dating in a reservoir; 4) evidence of Cs-137 diffusion in some of the sediment cores, but not in all cores in a small reservoir; and 5) evidence of long-term remineralization based on a comparison of C-14-based ages with those of Pb-210, Cs-137 and Pu-239,240-based methods. We also show evidence Cs-137 diffusion based on a set of laboratory-based diffusion experiments under different pore water chemical conditions. A brief discussion on time resolution and error estimation on ages will be discussed. The challenges in the field of `Anthropocene

  17. Process parameters and changes in the microbial community patterns during the first 240 days of an agricultural energy crop digester. (United States)

    Weithmann, Nicolas; Weig, Alfons Rupert; Freitag, Ruth


    Commercial biogas production takes place by complex microbial communities enclosed in controlled "technical ecosystems". Once established, the communities tend to be resilient towards disturbances, although the relative abundance of their members may vary. The start-up phase, during which the community establishes itself, is therefore decisive for the later performance of the reactor. In this study, we followed the first 240 days of a standard agricultural energy crop digester consisting of a 400 m(3) plug flow fermenter and a 1000 m(3) agitated post digester, operated at 40-45 °C. The feed consisted of corn and later grass silage augmented by ground wheat. Changes in both the eubacterial and methanogenic archaeal communities were followed by automated ribosomal intergenic spacer analysis (ARISA). In addition the copy number of the methyl-coenzyme reductase A (mcrA)-genes found in all known methanogens were followed by quantitative PCR, while selected samples from two phases-one early, one late-of the community structure development were subjected to high throughput sequencing. Biogas volume and composition (CH4, CO2, H2, H2S, O2), pH, ammonia-N, and volatile fatty acids (VFA), were measured as part of the routine process control. VFA/TIC values were calculated on this basis. Whereas the total gas production of the plant established itself at about 2500 m(3) biogas per day within the first months, the composition of the microbial communities showed distinct spatial and temporal differences over the investigated time period. Absolute values for DNA isolation procedures are difficult to certify, hence comparative results on community structures obtained using standardized ARISA with identical primers are of value. Moreover, ARISA patterns can be statistically analyzed to identify distinct subgroups and transitions between them as well as serial correlations. Thereby the microbial community and its structural development can be correlated with statistical

  18. Mapping correlations between ventricular expansion and CSF amyloid and tau biomarkers in 240 subjects with Alzheimer's disease, mild cognitive impairment and elderly controls. (United States)

    Chou, Yi-Yu; Leporé, Natasha; Avedissian, Christina; Madsen, Sarah K; Parikshak, Neelroop; Hua, Xue; Shaw, Leslie M; Trojanowski, John Q; Weiner, Michael W; Toga, Arthur W; Thompson, Paul M


    We aimed to improve on the single-atlas ventricular segmentation method of (Carmichael, O.T., Thompson, P.M., Dutton, R.A., Lu, A., Lee, S.E., Lee, J.Y., Kuller, L.H., Lopez, O.L., Aizenstein, H.J., Meltzer, C.C., Liu, Y., Toga, A.W., Becker, J.T., 2006. Mapping ventricular changes related to dementia and mild cognitive impairment in a large community-based cohort. IEEE ISBI. 315-318) by using multi-atlas segmentation, which has been shown to lead to more accurate segmentations (Chou, Y., Leporé, N., de Zubicaray, G., Carmichael, O., Becker, J., Toga, A., Thompson, P., 2008. Automated ventricular mapping with multi-atlas fluid image alignment reveals genetic effects in Alzheimer's disease, NeuroImage 40(2): 615-630); with this method, we calculated minimal numbers of subjects needed to detect correlations between clinical scores and ventricular maps. We also assessed correlations between emerging CSF biomarkers of Alzheimer's disease pathology and localizable deficits in the brain, in 80 AD, 80 mild cognitive impairment (MCI), and 80 healthy controls from the Alzheimer's Disease Neuroimaging Initiative. Six expertly segmented images and their embedded parametric mesh surfaces were fluidly registered to each brain; segmentations were averaged within subjects to reduce errors. Surface-based statistical maps revealed powerful correlations between surface morphology and 4 variables: (1) diagnosis, (2) depression severity, (3) cognitive function at baseline, and (4) future cognitive decline over the following year. Cognitive function was assessed using the mini-mental state exam (MMSE), global and sum-of-boxes clinical dementia rating (CDR) scores, at baseline and 1-year follow-up. Lower CSF Abeta(1-42) protein levels, a biomarker of AD pathology assessed in 138 of the 240 subjects, were correlated with lateral ventricular expansion. Using false discovery rate (FDR) methods, 40 and 120 subjects, respectively, were needed to discriminate AD and MCI from normal groups

  19. HLA-A and -B alleles and haplotypes in 240 index patients with common variable immunodeficiency and selective IgG subclass deficiency in central Alabama

    Directory of Open Access Journals (Sweden)

    Barton James C


    Full Text Available Abstract Background We wanted to quantify HLA-A and -B phenotype and haplotype frequencies in Alabama index patients with common variable immunodeficiency (CVID and selective IgG subclass deficiency (IgGSD, and in control subjects. Methods Phenotypes were detected using DNA-based typing (index cases and microlymphocytotoxicity typing (controls. Results A and B phenotypes were determined in 240 index cases (114 CVID, 126 IgGSD and 1,321 controls and haplotypes in 195 index cases and 751 controls. Phenotyping revealed that the "uncorrected" frequencies of A*24, B*14, B*15, B*35, B*40, B*49, and B*50 were significantly greater in index cases, and frequencies of B*35, B*58, B*62 were significantly lower in index cases. After Bonferroni corrections, the frequencies of phenotypes A*24, B*14, and B*40 were significantly greater in index cases, and the frequency of B*62 was significantly lower in index cases. The most common haplotypes in index cases were A*02-B*44 (frequency 0.1385, A*01-B*08 (frequency 0.1308, and A*03-B*07 (frequency 0.1000, and the frequency of each was significantly greater in index cases than in control subjects ("uncorrected" values of p p p = 0.0166. Most phenotype and haplotype frequencies in CVID and IgGSD were similar. 26.7% of index patients were HLA-haploidentical with one or more other index patients. We diagnosed CVID or IgGSD in first-degree or other relatives of 26 of 195 index patients for whom HLA-A and -B haplotypes had been ascertained; A*01-B*08, A*02-B*44, and A*29-B*44 were most frequently associated with CVID or IgGSD in these families. We conservatively estimated the combined population frequency of CVID and IgGSD to be 0.0092 in adults, based on the occurrence of CVID and IgGSD in spouses of the index cases. Conclusions CVID and IgGSD in adults are significantly associated with several HLA haplotypes, many of which are also common in the Alabama Caucasian population. Immunoglobulin phenotype variability

  20. Neutron Protection Factor Determination and Validation for a Vehicle Surrogate Using a Californium Fission Source (United States)


    a 4 mm x 4 mm (0.157" x 0.157") LiI(Eu) crystal with 96% enrichment of lithium -6. The crystal is connected to a photomultiplier tube (PMT) which...32 Figure 17. Lithium -6 Iodide, Europium Doped Scintillation Detector. Source: [27...Alamos National Laboratory LiI(Eu) Lithium Iodide Europium Doped LLD Low Level Discriminator LLNL Lawrence Livermore National Laboratory MASH Monte

  1. Radiotoxicological analyses of {sup 239+240}Pu and {sup 241}Am in biological samples by anion-exchange and extraction chromatography: a preliminary study for internal contamination evaluations

    Energy Technology Data Exchange (ETDEWEB)

    Ridone, S.; Arginelli, D.; Bortoluzzi, S.; Canuto, G.; Montalto, M.; Nocente, M.; Vegro, M. [Italian National Agency for New Technologies, Energy and the Environment (ENEA), Research Centre of Saluggia, Radiation Protection Institute, Saluggia, VC (Italy)


    Many biological samples (urines and faeces) have been analysed by means of chromatographic extraction columns, utilising two different resins (AG 1-X2 resin chloride and T.R.U.), in order to detect the possible internal contamination of {sup 239{sup +}}{sup 240}Pu and {sup 241}Am, for some workers of a reprocessing nuclear plant in the decommissioning phase. The results obtained show on one hand the great suitability of the first resin for the determination of plutonium, and on the other the great selectivity of the second one for the determination of americium.

  2. Measurement of the Neutron Capture Cross Sections of $^{233}$U, $^{237}$Np, $^{240,242}$Pu, $^{241,243}$Am and $^{245}$Cm with a Total Absorption Calorimeter at n_TOF

    CERN Multimedia

    Beer, H; Wiescher, M; Cox, J; Rapp, W; Embid, M; Dababneh, S


    Accurate and reliable neutron capture cross section data for actinides are necessary for the poper design, safety regulation and precise performance assessment of transmutation devices such as Fast Critical Reactors or Accelerator Driven Systems (ADS). The goal of this proposal is the measurement of the neutron capture cross sections of $^{233}$U, $^{237}$Np, $^{240,242}$Pu, $^{241,243}$Am and $^{245}$Cm at n_TOF with an accuracy of 5~\\%. $^{233}$U plays an essential role in the Th fuel cycle, which has been proposed as a safer and cleaner alternative to the U fuel cycle. The capture cross sections of $^{237}$Np,$^{240,242}$Pu, $^{241,243}$Am and $^{245}$Cm play a key role in the design and optimization of a strategy for the Nuclear Waste Transmutation. A high accuracy can be achieved at n_TOF in such measurements due to a combination of features unique in the world: high instantaneous neutron fluence and excellent energy resolution of the facility, innovative Data Acquisition System based on flash ADCs and t...

  3. Carbonization and liquid crystal (mesophase) development. 14. Co-carbonization of coals with A 240 Ashland petroleum pitch: effects of conditions of carbonization upon optical textures of resultant cokes

    Energy Technology Data Exchange (ETDEWEB)

    Marsh, H.; Gerus-Piasecka, I.; Grint, A.


    This study examines the effect of pitch concentration, rate of heating, soak temperature and time of soak upon the optical texture of cokes prepared from the co-carbonizations of a coal (Oxcroft-Clowne, NCB Rank 802) and three vitrains of NCB Rank 204, 801, 902 with Ashland A240 petroleum pitch. Using the coal (Rank 802) with 10 wt % and 25 wt % additions of pitch caused progressive penetration of the pitch into the coal with a resultant development of a mosaic anisotropy in the coke to replace partially the original coke isotropy. With 50 wt % addition of pitch almost all of the coal particles, 600 to 1100 atm in size, were modified during carbonization. Some pitch coke was formed. For the coal and three vitrains with increasing rates of co-carbonization from 0.5-10 K minat-at1 to 1200 K, using 25 wt % of A240 pitch, resultant cokes showed progressively increased extents of modification. For the two vitrains (Rank 801, 902) soaking at temperatures of 650-690 K caused a decrease in the extent of modification of isotropic coke when compared with the coke of HTT 1200 K. Evidently fast heating rates create the conditions of fluidity necessary for the pitch to modify the coal leading to growth of mesophase and anisotropic coke. (15 refs.)

  4. Expression of vascular endothelial growth factors VEGF- C and D, VEGFR-3, and comparison of lymphatic vessels density labeled with D2-40 antibodies as a prognostic factors in vulvar intraepithelial neoplasia (VIN) and invasive vulvar cancer. (United States)

    Jach, Robert; Dyduch, Grzegorz; Radon-Pokracka, Malgorzata; Przybylska, Paulina; Mika, Marcin; Dulinska-Litewka, Joanna; Zajac, Krzysztof; Huras, Hubert; Streb, Joanna; Stangel-Wojcikiewicz, Klaudia; Dziadek, Olivia; Galarowicz, Bartlomiej


    The aim of this study was to compare the immunohistochemical expression of vascular endothelial growth factors VEGF-C and D, as well as the expression of VEGFR-3 in VIN and vulvar invasive cancer and to compare the density of lymphatic marker D2-40 antibody in both groups, and to compare them with different clinicopathologic features. The study was performed using tissue material and clinical data from 100 women diagnosed with VIN and 100 women diagnosed with invasive vulvar cancer. No significant differences were found in the expression of VEGF-C and -D or VEGFR-3 between those patients with VIN and those with invasive vulvar cancers. Weak expression of VEGF-C was confirmed only in two cases of the analyzed series; in all cases, expression of VEGF-D and VEGFR-3 was observed. The strongest expression of VEGF-D and VEGFR-3 was observed in the group of invasive cancers. The highest density of lymphatic vessels per 2 mm was observed in VIN. In the cancer group, small lymphatic vessels with a narrow oval lumen were observed. Moreover, in two cases of vulvar cancer, the presence of intratumoral lymphatic vessels was observed. These results suggest that lymphangiogenesis begins at the preinvasive stage of vulvar carcinogenesis and suggests the important role of VEGF-C, VEGF-D, VEGFR-3 and LV (D2-40) as prognostic factors in the process of carcinogenesis in the vulvar area.

  5. Long-term variation (1986-1998) of post-Chernobyl 90Sr, 137Cs, 238Pu and (239,240)Pu concentrations in air, depositions to ground, resuspension factors and resuspension rates in south Germany. (United States)

    Rosner, G; Winkler, R


    Annual mean concentrations in air and annual total (wet plus dry) depositions to ground of 90Sr, 137Cs, 238Pu and (239,240)Pu decreased at Neuherberg, south Germany, in the period from July 1986 (i.e. after the end of the initial deposition phase from Chernobyl) to 1998 as follows: 90Sr from 0.77 to 0.05 microBq m(-3), and from 0.82 (1988) to 0.28 Bq m(-2) year(-1); 137Cs from 133 to 2.8 microBq m(-3), and from 116 to 3.8 Bq m(-2) year(-1); 238Pu from 0.95 to 0.063 nBq m(-3), and from 1.0 to 0.23 mBq m(-2) year(-1); (239,240)Pu from 8.1 to 0.53 nBq m(-3), and from 6.4 to 2.1 mBq m(-2) year(-1). The values for the non-caesium radionuclides are compared to the few available data from other stations. After an initial phase which is characterised for a given radionuclide by the varying ratio of the Chernobyl-derived inventory to the earlier, weapons fallout-derived inventory, the time courses of concentrations of 137Cs, 90Sr, 238Pu and (239,240)Pu in air become more or less parallel (from about 1990), despite the considerable differences in the physico-chemical properties of these elements. By contrast, the time series of radionuclide deposition rates show until about 1994 less similarity among each other and with the respective concentration series in air. From 1994, concentrations in air and depositions to ground become nearly constant, or decrease very slowly. At the end of the observation period, resuspension factors between 1.4 x 10(-10) m(-1) and 1.0 x 10(-11) m(-1) are observed for the various nuclides. The time courses of specific activities (Bq g(-1)) as well as the time courses of radionuclide ratios show characteristic differences between air and deposition. The data will be useful in predicting the post-accident behaviour of radionuclides a long time after a large-scale contamination event.

  6. Lymphatic vessel invasion detected by the endothelial lymphatic marker D2-40 (podoplanin is predictive of regional lymph node status and an independent prognostic factor in patients with resected esophageal cancer

    Directory of Open Access Journals (Sweden)

    Jerzy Laudański


    Full Text Available The discovery of markers to lymphatic endothelial cells and the development of novel antibodies to these markers have brought increasing attention to the lymphatics and progress in the understanding of lymphangiogenesis and cancer metastasis. In this study, we investigate the presence of lymphatic vessel invasion (LVI detected by D2-40 immunohistochemical staining in resected esophageal cancer and correlated with clinicopathologic data and patient survival. Sixty nine patients, who had a primary resection of esophageal cancer, were analyzed by univariate and multivariate logistic regression, and univariate and multivariate survival analysis. The total rate of LVI was 72% (50/69. Positive LVI was significantly correlated with lymph node metastasis (p < 0.001, tumor size (p < 0.001, histological grading (p = 0.017, tumor depth (p = 0.001, and stage (p < 0.001. Multivariate logistic analysis identified LVI (p = 0.036 as a predictor of regional lymph node metastasis. On univariate survival analysis, patients with LVI had a significantly shorter disease-free survival, cancer-specific survival and overall survival. Multivariate analysis proved that LVI diagnosed by D2-40 is an independent prognostic factor of both disease-free survival (p = 0.04 and overall survival (p = 0.032 in resected esophageal cancer. These results show that LVI assessment identifies patients at high risk for regional lymph node metastasis and that LVI is an independent prognostic factor in patients with esophageal cancer. (Folia Histochemica et Cytobiologica 2011; Vol. 49, No. 1, pp. 90–97

  7. Sequential determination of natural ({sup 232}Th, {sup 238}U) and anthropogenic ({sup 137}Cs, {sup 90}Sr, {sup 241}Am, {sup 239+240}Pu) radionuclides in environmental matrix

    Energy Technology Data Exchange (ETDEWEB)

    Michel, H.; Levent, D.; Barci, V.; Barci-Funel, G.; Hurel, C. [Laboratoire de Radiochimie, Sciences Analytiques et Environnement (LRSAE), Universite de Nice Sophia-Antipolis 06108 Nice Cedex (France)


    A new sequential method for the determination of both natural (U, Th) and anthropogenic (Sr, Cs, Pu, Am) radionuclides has been developed for application to soil and sediment samples. The procedure was optimised using a reference sediment (IAEA-368) and reference soils (IAEA-375 and IAEA-326). Reference materials were first digested using acids (leaching), 'total' acids on hot plate, and acids in microwave in order to compare the different digestion technique. Then, the separation and purification were made by anion exchange resin and selective extraction chromatography: Transuranic (TRU) and Strontium (SR) resins. Natural and anthropogenic alpha radionuclides were separated by Uranium and Tetravalent Actinide (UTEVA) resin, considering different acid elution medium. Finally, alpha and gamma semiconductor spectrometer and liquid scintillation spectrometer were used to measure radionuclide activities. The results obtained for strontium-90, cesium-137, thorium-232, uranium- 238, plutonium-239+240 and americium-241 isotopes by the proposed method for the reference materials provided excellent agreement with the recommended values and good chemical recoveries. (authors)

  8. High density of peritumoral lymphatic vessels measured by D2-40/podoplanin and LYVE-1 expression in gastric cancer patients: an excellent prognostic indicator or a false friend? (United States)

    Rudno-Rudzinska, Julia; Kielan, Wojciech; Grzebieniak, Zygmunt; Dziegiel, Piotr; Donizy, Piotr; Mazur, Grzegorz; Knakiewicz, Monika; Frejlich, Ewelina; Halon, Agnieszka


    One of the most important prognostic indicators in gastric cancer is the presence of metastases in lymph nodes. Even now, little is known about lymphangiogenesis in neoplastic tissue, and little is also known about the transmission of a neoplastic cell from the tumor mass into a lymphatic vessel. This study examined the relationships between the density of lymphatic vessels (LVD) stained immunohistochemically with lymphatic vessel endothelial hyaluronan receptor-1 (LYVE-1) and D2-40 (podoplanin) antibodies, the expression of vascular endothelial growth factor (VEGF)-C/D, selected clinical and pathomorphological factors, and the 5-year overall survival of gastric cancer patients. Statistical analysis showed no impact of increased intratumoral or peritumoral LVD on gastric cancer patient survival, irrespective of the protein used to stain lymphatic vessels. Analysis showed that the probability of overall survival was decreased in the cases with enhanced VEGF-D immunoreactivity (P = 0.0045). The study showed that the studied markers cannot be used to determine the required extent of the surgical procedure, as they have no statistically significant correlation with the degree of progression of the cancer, the stage of the disease assessed according to the TNM 5th classification of malignant tumors, clinicopathological features, and patient survival. VEGF-D is the only marker that can be regarded as an unfavorable prognostic indicator for patients with advanced gastric cancer.

  9. Distribution and inventories of fallout radionuclides (239+240Pu, 137Cs) and 210Pb to study the filling velocity of salt marshes in Doñana National Park (Spain). (United States)

    Gascó, C; Antón, M P; Pozuelo, M; Clemente, L; Rodríguez, A; Yañez, C; González, A; Meral, J


    Within an extensive multinational and multidisciplinary project carried out in Doñana National Park (Spain) to investigate its preservation and regeneration, the filling velocity of the salt marshes has been evaluated through the calculation of their average sediment accumulation rates. (239+240)Pu and (137)Cs from weapons testing fallout and total (210)Pb distribution profiles and inventories have been determined in some of the most characteristic zones of the park, namely, the ponds (or "lucios") and the waterjets (or "caños"). Plutonium inventories range from 16 to 101 Bq m(-2), (137)Cs values fluctuate between 514 and 3,758 Bq m(-2) and unsupported (210)Pb values comprise between 124 and 9398 Bq m(-2). Average sedimentation rates range from 3 to 5 mm y(-1) (1952-2002). These data are higher than those obtained by carbon dating for the period 6,500 AD-present, estimated as 1.5-2 mm y(-1), suggesting an increase in the accumulation of sediments and the alteration of the park's hydrodynamics caused by the re-channeling of the major rivers feeding the salt marshes.

  10. Measurement of the (pressure, density, temperature) relation of two (methane + nitrogen) gas mixtures at temperatures between 240 and 400 K and pressures up to 20 MPa using an accurate single-sinker densimeter

    Energy Technology Data Exchange (ETDEWEB)

    Chamorro, C.R. [Grupo de Termodinamica y Calibracion (TERMOCAL), Dpto. Ingenieria Energetica y Fluidomecanica, E.T.S. de Ingenieros Industriales, Universidad de Valladolid, E-47071 Valladolid (Spain)]. E-mail:; Segovia, J.J. [Grupo de Termodinamica y Calibracion (TERMOCAL), Dpto. Ingenieria Energetica y Fluidomecanica, E.T.S. de Ingenieros Industriales, Universidad de Valladolid, E-47071 Valladolid (Spain); Martin, M.C. [Grupo de Termodinamica y Calibracion (TERMOCAL), Dpto. Ingenieria Energetica y Fluidomecanica, E.T.S. de Ingenieros Industriales, Universidad de Valladolid, E-47071 Valladolid (Spain); Villamanan, M.A. [Grupo de Termodinamica y Calibracion (TERMOCAL), Dpto. Ingenieria Energetica y Fluidomecanica, E.T.S. de Ingenieros Industriales, Universidad de Valladolid, E-47071 Valladolid (Spain); Estela-Uribe, J.F. [Facultad de Ingenieria, Universidad Javeriana-Cali, Calle 18, 118-250 Cali (Colombia); Trusler, J.P.M. [Department of Chemical Engineering, Imperial College London, London SW7 2AZ (United Kingdom)


    Comprehensive (p, {rho}, T) measurements on two gas mixtures of (0.9CH{sub 4} + 0.1N{sub 2}) and (0.8CH{sub 4} + 0.2N{sub 2}) have been carried out at six temperatures between 240 and 400 K and at pressures up to 20 MPa. A total of 108 (p, {rho}, T) data for the first mixture and 134 for the second one are given. These measurements were performed using a compact single-sinker densimeter based on Archimedes' buoyancy principle. The overall uncertainty in density {rho} is estimated to be (1.5 . 10{sup -4} . {rho} + 2 . 10{sup -3} kg . m{sup -3}) (coverage factor k = 2), the uncertainty in temperature T is estimated to be 0.006 K (coverage factor k = 2), and the uncertainty in pressure p is estimated to be 1 . 10{sup -4}.p (coverage factor k = 2). The equipment has been previously checked with pure nitrogen over the whole temperature and pressure working ranges and experimental results (35 values) are given and a comparison with the reference equation of state for nitrogen is presented.

  11. Biochemical and Structural Characterization of a Five-domain GH115 α-Glucuronidase from the Marine Bacterium Saccharophagus degradans 2-40 T

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Weijun [Univ. of Toronto, ON (Canada); Yan, Ruoyu [Univ. of Toronto, ON (Canada); Nocek, Boguslaw P. [Argonne National Lab. (ANL), Argonne, IL (United States); Vuong, Thu V. [Univ. of Toronto, ON (Canada); Di Leo, Rosa [Univ. of Toronto, ON (Canada); Xu, Xiaohui [Univ. of Toronto, ON (Canada); Cui, Hong [Univ. of Toronto, ON (Canada); Gatenholm, Paul [Chalmers Univ. of Technology, Gothenburg (Sweden); Toriz, Guillermo [Chalmers Univ. of Technology, Gothenburg (Sweden); Univ. of Guadalajara (Mexico); Tenkanen, Maija [Univ. of Helsinki (Finland); Savchenko, Alexei [Univ. of Toronto, ON (Canada); Master, Emma R. [Univ. of Toronto, ON (Canada)


    Glucuronic acid (GlcAp) and/or methylglucuronic acid (MeGlcAp) decorate the major forms of xylan in hardwood and coniferous softwoods as well as many cereal grains. Accordingly, the complete utilization of glucuronoxylans or conversion to sugar precursors requires the action of main chain xylanases as well as -glucuronidases that release the - (132)-linked (Me)GlcAp side groups. Herein, a family GH115 enzyme from the marine bacterium Saccharophagus degradans 2-40T, SdeAgu115A, demonstrated activity toward glucuronoxylan and oligomers thereof with preference toward MeGlcAp linked to internal xylopyranosyl residues. Unique biochemical characteristics of NaCl activation were also observed. The crystal structure of SdeAgu115A revealed a five-domain architecture, with an additional insertion C domain that had significant impact on the domain arrangement of SdeAgu115A monomer and its dimerization. The participation of domain C in substrate binding was supported by reduced substrate inhibition upon introducing W773A, W689A, and F696A substitutions within this domain. In addition to Asp-335, the catalytic essentiality of Glu-216 was revealed by site-specific mutagenesis. A primary sequence analysis suggested that the SdeAgu115A architecture is shared by more than half of GH115 members, thus defining a distinct archetype for GH115 enzymes.

  12. The Mla (powdery mildew) resistance cluster is associated with three NBS-LRR gene families and suppressed recombination within a 240-kb DNA interval on chromosome 5S (1HS) of barley. (United States)

    Wei, F; Gobelman-Werner, K; Morroll, S M; Kurth, J; Mao, L; Wing, R; Leister, D; Schulze-Lefert, P; Wise, R P


    Powdery mildew of barley, caused by Erysiphe graminis f. sp. hordei, is a model system for investigating the mechanism of gene-for-gene interaction between large-genome cereals and obligate-fungal pathogens. A large number of loci that confer resistance to this disease are located on the short arm of chromosome 5(1H). The Mla resistance-gene cluster is positioned near the telomeric end of this chromosome arm. AFLP-, RAPD-, and RFLP-derived markers were used to saturate the Mla region in a high-resolution recombinant population segregating for the (Mla6 + Mla14) and (Mla13 + Ml-Ru3) resistance specificities. These tightly linked genetic markers were used to identify and develop a physical contig of YAC and BAC clones spanning the Mla cluster. Three distinct NBS-LRR resistance-gene homologue (RGH) families were revealed via computational analysis of low-pass and BAC-end sequence data derived from Mla-spanning clones. Genetic and physical mapping delimited the Mla-associated, NBS-LRR gene families to a 240-kb interval. Recombination within the RGH families was at least 10-fold less frequent than between markers directly adjacent to the Mla cluster.

  13. Kinetics study of OH radical reactions with n-octane, n-nonane, and n-decane at 240-340 K using the relative rate/discharge flow/mass spectrometry technique. (United States)

    Li, Zhuangjie; Singh, Sumitpal; Woodward, William; Dang, Lan


    The kinetics of the reactions of hydroxyl radical with n-octane (k1), n-nonane (k2), and n-decane (k3) at 240-340 K and a total pressure of approximately 1 Torr has been studied using relative rate combined with discharge flow and mass spectrometer (RR/DF/MS) technique. The rate constant for these reactions was found to be positively dependent on temperature, with an Arrhenius expression of k1 = (2.27 +/- 0.21) x 10(-11)exp[(-296 +/- 27)/T], k2 = (4.35 +/- 0.49) x 10(-11)exp[(-411 +/- 32)/T], and k3 = (2.26 +/- 0.28) x 10(-11)exp[(-160 +/- 36)/T] cm3 molecule(-1) s(-1) (uncertainties taken as 2sigma), respectively. Our results are in good agreement with previous studies at and above room temperature using different techniques. Assuming that the reaction of alkane with hydroxyl radical is the predominant form for loss of these alkanes in the troposphere, the atmospheric lifetime for n-octane, n-nonane, and n-decane is estimated to be about 43, 35, and 28 h, respectively.

  14. Reference: 240 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available k et al. 2005 Aug. Plant Cell 17(8):2397-412. The conversion of castasterone (CS) to brassinolide (BL), a Ba...terologously expressed Arabidopsis thaliana CYP85A2 in yeast mediated the conversion

  15. Publications | Page 240 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Food for the soil: Rock phosphate as fertilizer. If you're a subsistence farmer in sub-Saharan Africa, you probably don't have much extra money for fertilizer. But fertilizer is what you need to enrich the phosphate-poor tropical soil that you till. Phosphorus encourages early rooting,... SIPAZ: peace journalism in rural Colombia.

  16. Publications | Page 240 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Want more? Explore outputs from more than four decades of IDRC-supported research. Visit the IDRC Digital Library now. ... Africa today stands at a crossroads. Behind it lies a sorry record of poverty, poor governance, and exclusion from the global economy. Ahead is the promise of a better future offered it by the New ...

  17. 40 CFR 35.240 - Purpose. (United States)


    ...) Associated program regulations. Associated program regulations are found in 40 CFR parts 162, 170, and 171. ... Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GRANTS AND OTHER FEDERAL ASSISTANCE STATE AND LOCAL ASSISTANCE Environmental Program Grants Pesticide Applicator Certification and Training (section 23(a)(2...

  18. 31 CFR 240.7 - Declination protest. (United States)


    ... presenting bank may offer evidence that the drawer's signature was authentic or was authorized. (4) Checks... contain a material defect or alteration. (c) Procedures for filing a protest. A declination protest must...

  19. 31 CFR 240.2 - Definitions. (United States)


    ... that purports to be an authentic check drawn on the United States Treasury, but in fact is not an authentic check. (g) Days means calendar days. For purposes of computation, the last day of the period will... any prior indorser(s) of a check. (t) Material defect or alteration means: (1) The counterfeiting of a...

  20. 8 CFR 240.60 - Definitions. (United States)


    ... REMOVABILITY OF ALIENS IN THE UNITED STATES Applications for Suspension of Deportation or Special Rule... the principal or derivative asylum application. IIRIRA means the Illegal Immigration Reform and Immigrant Responsibility Act of 1996, enacted as Pub. L. 104-208 (110 Stat. 3009-625). NACARA means the...

  1. 49 CFR 240.7 - Definitions. (United States)


    ... alcohol or a drug or another identifiable and treatable mental or physical disorder involving the abuse of... control equipment that: (1) Functions in response to a person's manipulation and causes the gauges associated with such controls to appropriately respond to the consequences of that manipulation; (2...

  2. Publications | Page 240 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... battle against tobacco in South Africa where smoking has been rated the second highest health concern. Improving natural resource management in Viet Nam's Hong Ha commune. An interdisciplinary research team of scientists and farmers is helping to defeat hunger and poverty in a poor mountain region of Viet Nam, ...

  3. 240-IJBCS-Article-Georges Nobime

    African Journals Online (AJOL)

    Dr Gatsing

    species was found inhabiting eight localities in swamp forests, gallery forests and seasonally-flooded semi- deciduous forests. Two of these are protected areas: the Lama Forest of Benin and the Togodo Reserve of. Togo. Appropriate conservation actions are necessary for the red-bellied guenon, including improved law.

  4. 40 CFR 240.101 - Definitions. (United States)


    ... continuous operation; usually expressed in tons per day. (e) Discharge means water-borne pollutants released to a receiving stream directly or indirectly or to a sewerage system. (f) Emission means gas-borne... disease and must, therefore, be isolated as required by public health agencies; (2) laboratory wastes such...

  5. 46 CFR 121.240 - Gas systems. (United States)


    ... gas (LPG) and compressed natural gas (CNG) must meet the following requirements: (a) The design... testing of each CNG system must meet ABYC A-22, “Marine Compressed Natural Gas (CNG) Systems,” Chapter 6... position adjacent to the appliance. The valve must be located between the fuel tank and the point where the...

  6. Desarrollo del Robot Paralelo Parallix LKF-240

    Directory of Open Access Journals (Sweden)

    Eduardo Castillo Castañeda


    Full Text Available En este trabajo se presenta al robot paralelo PARALLIX LKF-2040 desarrollado en la Instituto Politécnico Nacional y actualmente comercializado en Instituciones de Educación Superior para fortalecer la enseñanza de la mecatrónica. Este mecanismo posee una plataforma fija y otra móvil. Los actuadores están montados en la plataforma fija, reduciendo el cableado y manteniéndolo fuera del espacio de trabajo. La plataforma móvil es el elemento efector y puede ser posicionada en un amplio espacio de trabajo. La estructura del manipulador es ligera, simplificando la dinámica y minimizando el peso a desplazar. Lo anterior, permite utilizar el par generado por los motores sólo para el desplazamiento de la carga. El robot PARALLIX LKF-2040 tiene sus orígenes en la configuración del robot tipo Delta pero tiene articulaciones rotacionales en lugar de esféricas, proporcionando un espacio de trabajo más amplio. Primeramente, se presenta el concepto de robot paralelo y sus ventajas respecto a los robots convencionales tipo serial. Se muestra la estructura geométrica de un robot paralelo tipo 3RSS y se encuentra la solución de su cinemática inversa. También, se presentan los resultados obtenidos del análisis del espacio de trabajo y el diseño de una arquitectura de control de tres ejes para servomotores con encoder incremental en cuadratura. Además, se proponen técnicas novedosas basadas en análisis de imágenes para determinar la precisión y la repetibilidad del robot, así como la rigidez bajo diferentes condiciones de carga.

  7. TMFunction data: 240 [TMFunction[Archive

    Lifescience Database Archive (English)

    Full Text Available D876N ... YES Ligand binding ... Low density lipoprotein receptor Homo sapiens Human Andersen OM, Christense...n LL, Christensen PA, S?rensen ES, Jacobsen C, Moestrup SK, Etzerodt M, Thogersen HC. J

  8. 21 CFR 107.240 - Notification requirements. (United States)


    ... Food Safety and Applied Nutrition (HFS-605), Food and Drug Administration, 5100 Paint Branch Pkwy... display and the request for its display. (ii) Number of consignees responding to the recall communication...

  9. 7 CFR 240.2 - Definitions. (United States)


    ... School Lunch Program. School means (1) an educational unit of high school grade or under except for a... the term: Act means the National School Lunch Act, as amended. Child Care Food Program means the... the National School Lunch Program under part 210 of this chapter but which operates a nonprofit lunch...

  10. Analysis of {sup 236}U and plutonium isotopes, {sup 239,240}Pu, on the 1 MV AMS system at the Centro Nacional de Aceleradores, as a potential tool in oceanography

    Energy Technology Data Exchange (ETDEWEB)

    Chamizo, Elena; López-Lora, Mercedes [Centro Nacional de Aceleradores (Universidad de Sevilla, Consejo Superior de Investigaciones Científicas, Junta de Andalucía), Thomas Alva Edison 7, 41092 Seville (Spain); Villa, María [Departamento de Física Aplicada II, Universidad de Sevilla, Av. Reina Mercedes 4A, 41012 Seville (Spain); Servicio de Radioisótopos, Centro de Investigación, Tecnología e Innovación, Universidad de Sevilla, Av. Reina Mercedes 4B, 41012 Seville (Spain); Casacuberta, Núria [Laboratory of Ion Beam Physics, ETH Zürich, Otto-Stern-Weg 5, CH-8093 Zürich (Switzerland); López-Gutiérrez, José María [Centro Nacional de Aceleradores (Universidad de Sevilla, Consejo Superior de Investigaciones Científicas, Junta de Andalucía), Thomas Alva Edison 7, 41092 Seville (Spain); Departamento de Física Aplicada I, Escuela Universitaria Politécnica, Universidad de Sevilla, Virgen de África 7, 41011 Seville (Spain); Pham, Mai Khanh [IAEA-Environment Laboratories, Monte Carlo 98000 (Monaco)


    The performance of the 1 MV AMS system at the CNA (Centro Nacional de Aceleradores, Seville, Spain) for {sup 236}U and {sup 239,240}Pu measurements has been extensively investigated. A very promising {sup 236}U/{sup 238}U abundance sensitivity of about 3 × 10{sup −11} has been recently achieved, and background figures for {sup 239}Pu of about 10{sup 6} atoms were reported in the past. These promising results lead to the use of conventional low energy AMS systems for the analysis of {sup 236}U and {sup 239}Pu and its further application in environmental studies. First {sup 236}U results obtained on our AMS system for marine samples (sediments and water) are presented here. Results of two new IAEA reference materials (IAEA-410 and IAEA-412, marine sediments from Pacific Ocean) are reported. The obtained {sup 236}U/{sup 239}Pu atom ratios, of 0.12 and 0.022, respectively, show a dependency with the contamination source (i.e. local fallout from the US tests performed at the Bikini Atoll and general fallout). The results obtained for a third IAEA reference material (IAEA-381, seawater from the Irish Sea), are also presented. In the following, the uranium and plutonium isotopic compositions obtained on a set of 5 intercomparison seawater samples from the Arctic Ocean provided by the ETH Zürich are discussed. By comparing them with the obtained results on the 600 kV AMS facility Tandy at the ETH Zürich, we demonstrate the solidity of the CNA technique for {sup 236}U/{sup 238}U determinations at, at least, 7 × 10{sup −10} level. Finally, these results are discussed in their environmental context.

  11. Preventive Strategies for Contrast-Induced Acute Kidney Injury in Patients Undergoing Percutaneous Coronary Procedures: Evidence From a Hierarchical Bayesian Network Meta-Analysis of 124 Trials and 28 240 Patients. (United States)

    Giacoppo, Daniele; Gargiulo, Giuseppe; Buccheri, Sergio; Aruta, Patrizia; Byrne, Robert A; Cassese, Salvatore; Dangas, George; Kastrati, Adnan; Mehran, Roxana; Tamburino, Corrado; Capodanno, Davide


    The effectiveness of currently available effective preventive strategies for contrast-induced acute kidney injury (CIAKI) is a matter of debate. We performed a Bayesian random-effects network meta-analysis of 124 trials (28 240 patients) comparing a total of 10 strategies: saline, statin, N-acetylcysteine (NAC), sodium bicarbonate (NaHCO3), NAC+NaHCO3, ascorbic acid, xanthine, dopaminergic agent, peripheral ischemic preconditioning, and natriuretic peptide. Compared with saline, the risk of CIAKI was reduced by using statin (odds ratio [OR], 0.42; 95% credible interval [CrI], 0.26-0.67), xanthine (OR, 0.32; 95% CrI, 0.17-0.57), ischemic preconditioning (OR, 0.48; 95% CrI, 0.26-0.87), NAC+NaHCO3 (OR, 0.50; 95% CrI, 0.33-0.76), NAC (OR, 0.68; 95% CrI, 0.55-0.84), and NaHCO3 (OR, 0.66; 95% CrI, 0.47-0.90). The benefit of statin therapy was consistent across multiple sensitivity analyses, whereas the efficacy of all the other strategies was questioned by restricting the analysis to high-quality trials. Overall, high heterogeneity was observed for comparisons involving xanthine and ischemic preconditioning, although the impact of NAC and xanthine was probably influenced by publication bias/small-study effect. Hydration alone was the least effective preventive strategy for CIAKI. Meta-regressions did not reveal significant associations with baseline creatinine and contrast volume. In patients with diabetes mellitus, no strategy was found to reduce the incidence of CIAKI. In patients undergoing percutaneous coronary procedures, statin administration is associated with a marked and consistent reduction in the risk of CIAKI compared with saline. Although xanthine, NAC, NaHCO3, NAC+NaHCO3, ischemic preconditioning, and natriuretic peptide may have nephroprotective effects, these results were not consistent across multiple sensitivity analyses. © 2017 American Heart Association, Inc.

  12. Investigation of the effect of food and omeprazole on the relative bioavailability of a single oral dose of 240 mg faldaprevir, a selective inhibitor of HCV NS3/4 protease, in an open-label, randomized, three-way cross-over trial in healthy participants. (United States)

    Wu, Jing; Gießmann, Thomas; Lang, Benjamin; Elgadi, Mabrouk; Huang, Fenglei


    This study was conducted to investigate the effect of food and coadministration of omeprazole on the relative bioavailability (BA) of faldaprevir (FDV). Fifteen healthy participants participated in this open-label, randomized, three-way cross-over study. Faldaprevir was administered as a 240 mg single dose during fasting state, following intake of a high-fat breakfast, or following omeprazole 40 mg q.d. dosing for 5 days. PK samples were collected on the day of faldaprevir administration. We found geometric mean (gMean) AUC0-∞ values for faldaprevir of 48 200, 37 900 and 36 000 ng h/ml under the fed, fasted and omeprazole coadministration conditions respectively. Similarly, gMean Cmax values for faldaprevir were 2600, 2030, 1920 ng/ml under the same respective conditions. The adjusted gMean ratio between the fed and fasted condition was approximately 120% for both AUC0-∞ and Cmax , while the ratio of omeprazole coadministration to fasted condition was approximately 94%. Faldaprevir was safe and well tolerated in the study. Administration of a single dose of 240 mg faldaprevir after high-fat breakfast led to a modest, clinically irrelevant increase in faldaprevir exposure, while coadministration of omeprazole did not influence faldaprevir exposure. © 2016 Royal Pharmaceutical Society, Journal of Pharmacy and Pharmacology.

  13. Global, regional, and national age-sex specific all-cause and cause-specific mortality for 240 causes of death, 1990-2013: a systematic analysis for the Global Burden of Disease Study 2013. (United States)


    Up-to-date evidence on levels and trends for age-sex-specific all-cause and cause-specific mortality is essential for the formation of global, regional, and national health policies. In the Global Burden of Disease Study 2013 (GBD 2013) we estimated yearly deaths for 188 countries between 1990, and 2013. We used the results to assess whether there is epidemiological convergence across countries. We estimated age-sex-specific all-cause mortality using the GBD 2010 methods with some refinements to improve accuracy applied to an updated database of vital registration, survey, and census data. We generally estimated cause of death as in the GBD 2010. Key improvements included the addition of more recent vital registration data for 72 countries, an updated verbal autopsy literature review, two new and detailed data systems for China, and more detail for Mexico, UK, Turkey, and Russia. We improved statistical models for garbage code redistribution. We used six different modelling strategies across the 240 causes; cause of death ensemble modelling (CODEm) was the dominant strategy for causes with sufficient information. Trends for Alzheimer's disease and other dementias were informed by meta-regression of prevalence studies. For pathogen-specific causes of diarrhoea and lower respiratory infections we used a counterfactual approach. We computed two measures of convergence (inequality) across countries: the average relative difference across all pairs of countries (Gini coefficient) and the average absolute difference across countries. To summarise broad findings, we used multiple decrement life-tables to decompose probabilities of death from birth to exact age 15 years, from exact age 15 years to exact age 50 years, and from exact age 50 years to exact age 75 years, and life expectancy at birth into major causes. For all quantities reported, we computed 95% uncertainty intervals (UIs). We constrained cause-specific fractions within each age-sex-country-year group to sum

  14. Global, regional, and national age-sex specific all-cause and cause-specific mortality for 240 causes of death, 1990-2013: a systematic analysis for the Global Burden of Disease Study 2013 (United States)


    Summary Background Up-to-date evidence on levels and trends for age-sex-specific all-cause and cause-specific mortality is essential for the formation of global, regional, and national health policies. In the Global Burden of Disease Study 2013 (GBD 2013) we estimated yearly deaths for 188 countries between 1990, and 2013. We used the results to assess whether there is epidemiological convergence across countries. Methods We estimated age-sex-specific all-cause mortality using the GBD 2010 methods with some refinements to improve accuracy applied to an updated database of vital registration, survey, and census data. We generally estimated cause of death as in the GBD 2010. Key improvements included the addition of more recent vital registration data for 72 countries, an updated verbal autopsy literature review, two new and detailed data systems for China, and more detail for Mexico, UK, Turkey, and Russia. We improved statistical models for garbage code redistribution. We used six different modelling strategies across the 240 causes; cause of death ensemble modelling (CODEm) was the dominant strategy for causes with sufficient information. Trends for Alzheimer’s disease and other dementias were informed by meta-regression of prevalence studies. For pathogen-specific causes of diarrhoea and lower respiratory infections we used a counterfactual approach. We computed two measures of convergence (inequality) across countries: the average relative difference across all pairs of countries (Gini coefficient) and the average absolute difference across countries. To summarise broad findings, we used multiple decrement life-tables to decompose probabilities of death from birth to exact age 15 years, from exact age 15 years to exact age 50 years, and from exact age 50 years to exact age 75 years, and life expectancy at birth into major causes. For all quantities reported, we computed 95% uncertainty intervals (UIs). We constrained cause-specific fractions within each age

  15. Simultaneous measurement of {sup 239}Pu, {sup 240}Pu, {sup 241}Pu, and {sup 242}Pu by high resolution inductively coupled plasma mass spectrometer (HR ICP-MS) in marine sediments; Mesure des isotopes du plutonium des sediments marins par spectrometrie de masse a plasma couple inductivement haute resolution (HR ICP-MS)

    Energy Technology Data Exchange (ETDEWEB)

    Bruneau, F


    Transuranics elements are of particular interest in radioecological studies because of their radiotoxicity and their potential use to decipher source fingerprints and transport processes. The simultaneous measurement of {sup 239}Pu, {sup 240}Pu, {sup 241}Pu, and {sup 242}Pu in environmental samples requires a specific chemical procedure. This work deals with an analytical procedure which yields a very high grade of purification of Pu suitable for ultra low level detection by HR ICP-MS, from marine sediments. After the elimination of major elements (Fe, Al, Mg...) by a first chromatographic separation, a new device of purification by solvent extraction and concentration by a second chromatographic separation is used to obtain a concentrated and high purified solution of plutonium. The chemical procedure have been validated on IAEA certified sediment samples and on sediment samples collected in the roads of Cherbourg which had been previously analysed by other techniques (a spectrometry and thermo-ionisation mass spectrometer). (author)

  16. Comment on “On the role of diurnal tides in contributing to asymmetries in tidal probability distribution functions in areas of predominantly semi-diurnal tide” by P.L. Woodworth, D.L. Blackman, D.T. Pugh and J.M. Vassie [Estuarine, Coastal and Shelf Science 64 (2005) 235 240 (United States)

    Hoitink, A. J. F.; Hoekstra, P.; van Maren, D. S.


    The present paper comments on a recent publication by Woodworth et al. [Woodworth, P.L., Blackman, D.L., Pugh, D.T., Vassie J.M., 2005. On the role of diurnal tides in contributing to asymmetries in tidal probability distribution functions in areas of predominantly semi-diurnal tide. Estuarine, Coastal and Shelf Science 64 (2-3), 235-240.]. It is shown how tidal asymmetries associated with astronomical tides can be accounted for in an extreme sea level analysis, despite the difficulty of deriving probability distribution functions if a large number of tidal constituents are considered. The use of the term spring-neap cycle in a diurnal tidal regime is discussed.

  17. Isoscalar giant dipole resonance in sup 9 sup 0 Zr, sup 1 sup 1 sup 6 Sn, sup 1 sup 4 sup 4 Sm and sup 2 sup 0 sup 8 Pb excited by 240 MeV alpha particle scattering

    CERN Document Server

    Clark, H L; Youngblood, D H; Bachtr, K; Garg, U; Harakeh, M N; Kalantar-Nayestanaki, N


    The giant resonance regions of sup 9 sup 0 Zr, sup 1 sup 1 sup 6 Sn, sup 1 sup 4 sup 4 Sm and sup 2 sup 0 sup 8 Pb were investigated using 240 MeV alpha particle scattering at small angles including 0 deg. E1 strengths corresponding to 91+-11%, 89+-10%, 105+-12% and 95+-13% of the isoscalar E1 energy-weighted sum rule were identified between 18<=E sub x<=31 MeV, 16<=E sub x<=30 MeV, 15<=E sub x<=27 MeV and 15<=E sub x<=25 MeV with centroid energies of 24.8+-0.4 MeV, 22.5+-0.3 MeV, 21.6+-0.3 MeV and 19.3+-0.3 MeV and rms widths of 3.2+-0.2 MeV, 3.5+-0.2 MeV, 3.2+-0.2 MeV and 2.5+-0.2 MeV for sup 9 sup 0 Zr, sup 1 sup 1 sup 6 Sn, sup 1 sup 4 sup 4 Sm and sup 2 sup 0 sup 8 Pb, respectively. Parameters obtained for the isoscalar giant monopole resonance, isoscalar giant quadrupole resonance and high energy octupole resonance are in agreement with accepted values.

  18. A retrospective study of californium-252 neutron brachytherapy combined with EBRT versus 3D-CRT in the treatment of esophageal squamous cell cancer. (United States)

    Wang, Qifeng; Li, Tao; Lang, Jinyi; Wang, Jie; Wang, Jian; Liu, Huiming; Jia, Xitang; Liu, Bo; Wang, C-K Chris


    We conducted a retrospective analysis on 884 patients who were diagnosed with esophageal squamous cell carcinoma (ESCC) and treated with either the neutron brachytherapy in combination with external beam radiotherapy (NBT + EBRT) or 3-dimensional conformal radiation therapy (3D-CRT) to determine the differences in efficacy and morbidity between the two treatment groups. The 884 ESCC patients treated with either NBT + EBRT or 3D-CRT between 2002 and 2012 were retrospectively reviewed and analyzed. Multivariable Cox regression was used to compare oncologic outcomes of the two groups of patients in the context of other clinically relevant variables. The acute and chronic toxicities associated with the two groups were compared using Fisher exact and log-rank tests, respectively. Among the 884 patients, 545 received NBT + EBRT and 339 received 3D-CRT (i.e. EBRT-only). The age range is 39-95 years (median 66). The follow-up time range is 3-145 months (median 32). The analysis shows that the NBT + EBRT group has higher overall survival rate and local control rate than that of the 3D-CRT group. The acute toxicity effects were acceptable for both groups of patients with the NBT + EBRT group showing higher rates of leukopenia and thrombocytopenia and the 3D-CRT group showing higher rates on fistula and massive bleeding. The patients treated with NBT + EBRT showed better oncologic outcomes than those treated with 3D-CRT. The toxicity effects were acceptable for both groups with the NBT + EBRT group showing higher rates on the acute effects and the 3D-CRT group showing higher rates on the late effects.

  19. Accurate determination of Curium and Californium isotopic ratios by inductively coupled plasma quadrupole mass spectrometry (ICP-QMS) in 248Cm samples for transmutation studies

    Energy Technology Data Exchange (ETDEWEB)

    Gourgiotis, A.; Isnard, H.; Aubert, M.; Dupont, E.; AlMahamid, I.; Cassette, P.; Panebianco, S.; Letourneau, A.; Chartier, F.; Tian, G.; Rao, L.; Lukens, W.


    The French Atomic Energy Commission has carried out several experiments including the mini-INCA (INcineration of Actinides) project for the study of minor-actinide transmutation processes in high intensity thermal neutron fluxes, in view of proposing solutions to reduce the radiotoxicity of long-lived nuclear wastes. In this context, a Cm sample enriched in {sup 248}Cm ({approx}97 %) was irradiated in thermal neutron flux at the High Flux Reactor (HFR) of the Laue-Langevin Institute (ILL). This work describes a quadrupole ICP-MS (ICP-QMS) analytical procedure for precise and accurate isotopic composition determination of Cm before sample irradiation and of Cm and Cf after sample irradiation. The factors that affect the accuracy and reproducibility of isotopic ratio measurements by ICP-QMS, such as peak centre correction, detector dead time, mass bias, abundance sensitivity and hydrides formation, instrumental background, and memory blank were carefully evaluated and corrected. Uncertainties of the isotopic ratios, taking into account internal precision of isotope ratio measurements, peak tailing, and hydrides formations ranged from 0.3% to 1.3%. This uncertainties range is quite acceptable for the nuclear data to be used in transmutation studies.

  20. Radiological Characterization Technical Report on Californium-252 Sealed Source Transuranic Debris Waste for the Off-Site Source Recovery Project at Los Alamos National Laboratory

    Energy Technology Data Exchange (ETDEWEB)

    Feldman, Alexander [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)


    This document describes the development and approach for the radiological characterization of Cf-252 sealed sources for shipment to the Waste Isolation Pilot Plant. The report combines information on the nuclear material content of each individual source (mass or activity and date of manufacture) with information and data on the radionuclide distributions within the originating nuclear material. This approach allows for complete and accurate characterization of the waste container without the need to take additional measurements. The radionuclide uncertainties, developed from acceptable knowledge (AK) information regarding the source material, are applied to the summed activities in the drum. The AK information used in the characterization of Cf-252 sealed sources has been qualified by the peer review process, which has been reviewed and accepted by the Environmental Protection Agency.

  1. Dicty_cDB: VFN240 [Dicty_cDB

    Lifescience Database Archive (English)


  2. Annotated bibliography on high-intensity linear accelerators. [240 citations

    Energy Technology Data Exchange (ETDEWEB)

    Jameson, R.A.; Roybal, E.U.


    A technical bibliography covering subjects important to the design of high-intensity beam transport systems and linear accelerators is presented. Space charge and emittance growth are stressed. Subject and author concordances provide cross-reference to detailed citations, which include an abstract and notes on the material. The bibliography resides in a computer database that can be searched for key words and phrases.

  3. 40 CFR 170.240 - Personal protective equipment. (United States)


    ... aprons, chemical-resistant headgear, and protective eyewear. (2) Long-sleeved shirts, short-sleeved... “chemical-resistant headgear” is specified by the product labeling, it shall be either a chemical resistant...-resistant footwear need not be worn. A helmet may be substituted for chemical-resistant headgear. A visor...

  4. Euroopa Liit abistab tsunamipiirkonna riike 240 miljoni euroga / Ahto Lobjakas

    Index Scriptorium Estoniae

    Lobjakas, Ahto, 1970-


    EL-i, USA toetusest hiidlaines kannatada saanud riikidele. Indoneesia pealinnas Jakartas toimuvast katastroofipiirkonna riikide tippkohtumisest võtavad osa ka Euroopa Komisjoni president Jose Manuel Barroso, Luksemburgi peaminister Jean-Claude Juncker, ÜRO peasekretär Kofi Annan ja USA välisminister Colin Powell

  5. 40 CFR Appendix to Part 240 - Recommended Bibliography (United States)


    ... design and operation. Public Health Service Publication No. 2012. Washington, U.S. Government Printing..., Dec. 29, 1970. Washington, U.S. Government Printing Office, 1972. 5. Control techniques for.... Public Health Service Publication No. 2032. Washington, U.S. Government Printing Office, 1970. 17 p. 7...

  6. 17 CFR 240.15d-15 - Controls and procedures. (United States)


    ... materially affect, the issuer's internal control over financial reporting. (e) For purposes of this section... of financial statements for external purposes in accordance with generally accepted accounting... (CONTINUED) GENERAL RULES AND REGULATIONS, SECURITIES EXCHANGE ACT OF 1934 Rules and Regulations Under the...

  7. 17 CFR 240.13a-15 - Controls and procedures. (United States)


    ... materially affect, the issuer's internal control over financial reporting. (e) For purposes of this section... of financial statements for external purposes in accordance with generally accepted accounting... (CONTINUED) GENERAL RULES AND REGULATIONS, SECURITIES EXCHANGE ACT OF 1934 Rules and Regulations Under the...

  8. All projects related to | Page 240 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Topic: Capacity building, Science and Technology, MEDIA, FRENCH SPEAKING AFRICA, JOURNALISM, COMPUTER NETWORKS, BUSINESS ORGANIZATION. Region: Middle East, North of Sahara, South of Sahara, Central Asia, Far East Asia, South Asia, United Kingdom. Program: Networked Economies.

  9. Test of timing properties of the Photek 240 PMT

    Energy Technology Data Exchange (ETDEWEB)

    Ronzhin, A.; Albrow, M.; Demarteau, M.; Pronko, S.; Ramberg, E.; /Fermilab; Zatserklyaniy, A.; /Puerto Rico U., Mayaguez


    Timing measurements of Silicon Photomultipliers (SiPM) at the picosecond level were performed at Fermilab. The core timing resolution of the electronic measurement technique is approximately 2 picoseconds. The single photoelectron time resolution (SPTR) was measured for the signals coming from the SiPM's. A SPTR of about one hundred picoseconds was obtained for SiPM's illuminated by laser pulses. The dependence of the SPTR on applied bias voltage and on the wavelength of the light was measured. A simple model is proposed to explain the difference in the SPTR for blue and red light. A time of flight system based on the SiPM's, with quartz Cherenkov radiators, was tested in a proton beam at Fermilab. The time resolution obtained is 35 picoseconds per SiPM. Finally, requirements for the SiPM's temperature and bias voltage stability to maintain the time resolution are discussed.

  10. 20 CFR 627.240 - On-the-job training. (United States)


    ... participant will learn, and any other separate classroom training that may be provided. (2) The agreement... only upon completion of the objective assessment and individual service strategy in which OJT with such...) Definition. The terms employment agency and employee leasing agency mean an employer that provides regular...

  11. 49 CFR 240.309 - Railroad oversight responsibilities. (United States)


    ... analysis effort. (e) For reporting purposes, information about the nature of detected poor safety conduct... involving occupying main track or a segment of main track without proper authority or permission; (8... (f) For reporting purposes each category of detected poor safety conduct identified in paragraph (d...

  12. 7 CFR 58.240 - Cooling dry products. (United States)



  13. Phenotype abnormality: 240 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available during process named senescence in environment of continuous dark (no light) regimen in environment of continuous dark (no light) reg...imen ... decreased time ... senescence ...

  14. 38 CFR 21.240 - Medical treatment, care and services. (United States)


    ... AFFAIRS (CONTINUED) VOCATIONAL REHABILITATION AND EDUCATION Vocational Rehabilitation and Employment Under... ambulation, and one-hand typewriting; (ii) Orientation, adjustment, mobility and related services; (iii...

  15. 16 CFR 24.0 - Scope and purpose of guides. (United States)


    ....0 Commercial Practices FEDERAL TRADE COMMISSION GUIDES AND TRADE PRACTICE RULES GUIDES FOR SELECT..., ring binders, billfolds, wallets, key cases, coin purses, card cases, French purses, dressing cases... administered by the Federal Trade Commission for the guidance of the public in conducting its affairs in...

  16. 31 CFR 240.1 - Scope of regulations. (United States)


    ... other indorsers of Treasury checks when checks bearing material defects or alterations or forged... that a check is an authentic Treasury check. (c) Nothing in this regulation supercedes the rights or...

  17. 31 CFR 240.9 - Reclamation procedures; reclamation protests. (United States)


    ... evidence that it made all reasonable efforts to ensure that a check is authentic. The reclamation debtor... check does not contain a material defect or alteration. (3) Procedures for filing a protest. A...

  18. Dicty_cDB: AFL240 [Dicty_cDB

    Lifescience Database Archive (English)


  19. 40 CFR 240.211-3 - Recommended procedures: Operations. (United States)


    ... instruments. (13) Problems encountered and methods of solution. (d) An annual report should be prepared which... including at least monthly averages. (3) Number and qualifications of personnel in each job category; total... injuries, their cause and preventive measures instituted. (4) An identification and brief discussion of...

  20. 17 CFR 240.14a-1 - Definitions. (United States)


    ... context otherwise requires: (a) Associate. The term “associate,” used to indicate a relationship with any... trustee or in a similar fiduciary capacity; and (3) Any relative or spouse of such person, or any relative..., trustees or officers. (c) Entity that exercises fiduciary powers. The term “entity that exercises fiduciary...

  1. 17 CFR 240.14c-1 - Definitions. (United States)


    ... to indicate a relationship with any person, means: (1) Any corporation or organization (other than..., trustees or officers. (c) Entity that exercises fiduciary powers. The term “entity that exercises fiduciary..., association or other entity that exercises fiduciary powers which holds securities of record in nominee name...

  2. Dicty_cDB: SSL240 [Dicty_cDB

    Lifescience Database Archive (English)


  3. Dicty_cDB: VFF240 [Dicty_cDB

    Lifescience Database Archive (English)


  4. Dicty_cDB: SLE240 [Dicty_cDB

    Lifescience Database Archive (English)


  5. Dicty_cDB: VFD240 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available alignments: (bits) Value N BD092935 |BD092935.1 Methods and compositions for synthesis of long chain polyunsaturated...acids in plants. 1316 0.0 1 BD082645 |BD082645.1 Methods and compositions for synthesis of long chain polyunsaturated...polyunsaturated fatty acids. 1316 0.0 1 BD082630 |BD082630.1 Methods and compositions for synthesis of long chain poly-unsaturated

  6. 17 CFR 240.16a-1 - Definition of terms. (United States)


    ... same household; provided, however, that the presumption of such beneficial ownership may be rebutted... finance), any other officer who performs a policy-making function, or any other person who performs...

  7. 40 CFR 240.210-3 - Recommended procedures: Operations. (United States)


    ... prominently posted. (g) Equipment manuals, catalogs, spare parts lists, and spare parts should be readily... made for instruction of the staff in proper operation and maintenance procedures. (d) A routine maintenance schedule should be established and followed. (e) As-built engineering drawings of the facility...

  8. 17 CFR 240.9b-1 - Options disclosure document. (United States)


    ... document: (1) A glossary of terms; (2) A discussion of the mechanics of exercising the options; (3) A discussion of the risks of being a holder or writer of the options; (4) The identification of the market or...

  9. 17 CFR 240.14a-6 - Filing requirements. (United States)


    ... Commission the following applicable fee: (1) For preliminary proxy material involving acquisitions, mergers... number of shares authorized to be issued; and/or (7) A vote to approve the compensation of executives as...), no fee shall be required. (j) Merger proxy materials. (1) Any proxy statement, form of proxy or other...

  10. Dicty_cDB: CFK240 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available for diagnosing malaria and immune antigen for suppressing growth of plasmodium. 5...8 3e-16 5 BD183625 |BD183625.1 Material for diagnosing malaria and immune antigen for suppressing growth of plasmodium

  11. Dicty_cDB: VSK240 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available rlvsl*wy altttnyky*i*qrnefqlclvnyfvlffflynncnkidly*IYCHFIIKKK--- ---VIQSMGTPYQGTALAGTWASIGSAVGVGCSANDDLTVDGA...wffn*ll*fgfqcslrmak*wcc***aystrrwcifk*l*rlvsl*wyaltttn yky*i*qrnefqlclvnyfvlffflynncnkidly* Homology vs CSM-...nyky*i*qrnefqlclvnyfvlffflynncnkidly*IYCHFIIKKK--- ---VIQSMGTPYQGTALAGTWASIGSAVGVGCSANDDLTVDGAALWLKSIPADKRAL...ycsrwylgfyw*ccrcwlfck**shc*wcrfmvkinssr*k sfsllynysi*ywffn*ll*fgfqcslrmak*wcc***aystrrwcifk*l*rlvsl*wy alttt

  12. 17 CFR 240.12b-2 - Definitions. (United States)


    ... a subsidiary more than 50 percent of whose outstanding securities representing the right, other than... another person acquired in a single succession or in a series of related successions in each of which the... sale of any class of such securities. However, a person who receives such securities or proceeds either...


    African Journals Online (AJOL)

    therefore to checkmate unnecessary financial spending. This study examines the influence of the variables, peer relations and locus of control, on such spending among University students. Three hundred (144 males and 156 females) participants were used for the study. Their ages ranged between 20-30 years with mean ...

  14. 17 CFR 240.14a-8 - Shareholder proposals. (United States)


    ... proper state law procedures for attending the meeting and/or presenting your proposal. (2) If the company... company rely to exclude my proposal? (1) Improper under state law: If the proposal is not a proper subject for action by shareholders under the laws of the jurisdiction of the company's organization; Note to...


    African Journals Online (AJOL)

    scale of EPQ by Eysenck & Eysenck (1975) = .32. Procedure. The instruments were administered to the participants simultaneously by either of the researchers. They were given to the students who were allowed to either go home with them or to respond to them immediately. Incidental sampling method was used in ...

  16. Dicty_cDB: VHL240 [Dicty_cDB

    Lifescience Database Archive (English)


  17. Dicty_cDB: CHC240 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ENVKTKIQDKEGIPPDQQRLIFAGKQLXDGRTLSDYNIQKESTLHLVPXIXRXYANFCQT LTGXTITLXIEXSDTFXMLXPKSKTXKGFPXIQQRXIFPGKXX---...fspqikrwyanfcqnphw*dyytrs*rf**h* ec*sqnprqrrystrsttshfrr*tiggwsysl*lqhskgihspfssqikrwyanfckns hw*nhy...ENVKTKIQDKEGIPPDQQRLIFAGKQLXDGRTLSDYNIQKESTLHLVPXIXRXYANFCQT LTGXTITLXIEXSDTFXMLXPKSKTXKGFPXIQQRXIFPGKXX---...fspqikrwyanfcqnphw*dyytrs*rf**h* ec*sqnprqrrystrsttshfrr*tiggwsysl*lqhskgihspfssqikrwyanfckns hw*nhy...rtlsdyniqkestlh lvlrixrxrlkxpthk Frame C: laywnanfc*ntywkdhys*srrf**y*kckg*nsrqrryptrsttsyfcw*tigrwsys

  18. 240 Mold Sensitization in Chronic Rhinosinusitis Patients


    Gawlik, Radoslaw; Czecior, Eugeniusz


    Background It is estimated that about 10% of the population have IgE antibodies to common inhalant molds. Exposure to fungal allergens could be linked to the presence and persistence of asthma, rhinitis and atopic dermatitis. Mold sensitization is a risk factor for development and deterioration of upper airway allergy, especially chronic rhinosinusitis. We addressed the incidence of mold allergy measured as specific IgE to molds and skin prick tests in chronic sinusitis patients. We assessed ...

  19. Geological and physicochemical controls of the spatial distribution of partition coefficients for radionuclides (Sr-90, Cs-137, Co-60, Pu-239,240 and Am-241) at a site of nuclear reactors and radioactive waste disposal (St. Petersburg region, Russian Federation). (United States)

    Rumynin, Vyacheslav G; Nikulenkov, Anton M


    The paper presents a study of the sorption properties of sediments of different geological ages and lithological types, governing radionuclide retention in the subsurface (up to 160 m beneath the surface) within the area of potential influence of the Northwestern Center of Atomic Energy (NWCAE), St. Petersburg region, RF. The focus of this work is mostly on the sedimentary rocks of two types, i.e., weakly cemented sandstone and lithified clay formations of Cambrian and Vendian series. The first lithological unit is associated with a groundwater reservoir (Lomonosov aquifer), and the second one, with both a relative aquitard in the upper part of the Vendian formation (Kotlin clay) and a regional aquifer (Gdov aquifer) in the lower part of the formation. The main mechanisms responsible for the variability of the sorption distribution coefficient (Kd, defined as the ratio of the concentration of solute on solid phase to its concentration in solution at equilibrium) was identified for radionuclides such as Sr-90, Cs-137, Co-60, Pu-239,240, and Am-241. It was shown that the main factors contributing to the chemical heterogeneity of the Cambrian sandstone were related to the presence of secondary minerals (iron and magnesium oxides and hydroxides produced by the weathering process) in trace amounts, forming correlated layer structures. The statistical analysis of nonlinear isotherms confirmed this conclusion. For the Vendian formation, a determinate trend was established in the Kd change over depth as a result of temporal trends in the sedimentation process and pore-water chemistry. The geostatistical characteristics and the spatial correlation models for describing linear sorption of different radionuclides are not identical, and the exhibition of chemical heterogeneity of sedimentary rock of a particular lithological type depends on radionuclide chemistry. Moreover, variogram analysis for some Kd data sets (both in Cambrian and Vendian formations) demonstrates the


    Directory of Open Access Journals (Sweden)

    L Steyn


    Full Text Available The interface between the National Credit Act 34 of 2005 and the Insolvency Act 24 of 1936 has been the object of our courts' attention in a number of recent cases including Ex parte Ford and Two Similar Cases 2009 3 SA 376 (WCC, Investec Bank Ltd v Mutemeri 2010 1 SA 265 (GSJ, Naidoo v ABSA Bank Ltd 2010 4 SA 597 (SCA and, more recently, Nedbank v Andrews (240/2011 2011 ZAECPEHC 29 (10 May 2011, FirstRand Bank Ltd v Evans 2011 4 597 (KZD and FirstRand Bank Ltd v Janse van Rensburg 2012 2 All SA 186 (ECP. The question raised in all of the three most recent cases was whether or not a debtor's application for debt review in terms of the National Credit Act constitutes an "act of insolvency" in terms of section 8 of the Insolvency Act, upon which a creditor may rely in an application for the compulsory sequestration of the debtor's estate. If it does, it would mean that by resorting to the debt relief measures provided by the National Credit Act a debtor commits the very act on which a creditor may base an application for a sequestration order which, if granted, will render the debtor's estate insolvent and bring about the liquidation of his assets. From the debtor's perspective, this is probably precisely the situation that he seeks to avert by applying for debt review. Further, sequestration would frustrate the stated purpose of the National Credit Act, which is that debtors should take responsibility for their debts by satisfying them in full. Concurrent creditors might also ultimately receive a dividend which falls far short of what is due to them. The question of whether a debtor's resorting to debt review may or should be the very act that triggers his estate's sequestration and its attendant consequences is an important issue, the treatment of which impacts significantly on the efficacy of the South African consumer debt relief system. This article analyses the most recent judgments and considers whether or not statutory regulation of the

  1. ZPR-6 assembly 7 high {sup 240} PU core : a cylindrical assemby with mixed (PU, U)-oxide fuel and a central high {sup 240} PU zone.

    Energy Technology Data Exchange (ETDEWEB)

    Lell, R. M.; Schaefer, R. W.; McKnight, R. D.; Tsiboulia, A.; Rozhikhin, Y.; Nuclear Engineering Division; Inst. of Physics and Power Engineering


    Over a period of 30 years more than a hundred Zero Power Reactor (ZPR) critical assemblies were constructed at Argonne National Laboratory. The ZPR facilities, ZPR-3, ZPR-6, ZPR-9 and ZPPR, were all fast critical assembly facilities. The ZPR critical assemblies were constructed to support fast reactor development, but data from some of these assemblies are also well suited to form the basis for criticality safety benchmarks. Of the three classes of ZPR assemblies, engineering mockups, engineering benchmarks and physics benchmarks, the last group tends to be most useful for criticality safety. Because physics benchmarks were designed to test fast reactor physics data and methods, they were as simple as possible in geometry and composition. The principal fissile species was {sup 235}U or {sup 239}Pu. Fuel enrichments ranged from 9% to 95%. Often there were only one or two main core diluent materials, such as aluminum, graphite, iron, sodium or stainless steel. The cores were reflected (and insulated from room return effects) by one or two layers of materials such as depleted uranium, lead or stainless steel. Despite their more complex nature, a small number of assemblies from the other two classes would make useful criticality safety benchmarks because they have features related to criticality safety issues, such as reflection by soil-like material. The term 'benchmark' in a ZPR program connotes a particularly simple loading aimed at gaining basic reactor physics insight, as opposed to studying a reactor design. In fact, the ZPR-6/7 Benchmark Assembly (Reference 1) had a very simple core unit cell assembled from plates of depleted uranium, sodium, iron oxide, U3O8, and plutonium. The ZPR-6/7 core cell-average composition is typical of the interior region of liquid-metal fast breeder reactors (LMFBRs) of the era. It was one part of the Demonstration Reactor Benchmark Program,a which provided integral experiments characterizing the important features of demonstration-size LMFBRs. As a benchmark, ZPR-6/7 was devoid of many 'real' reactor features, such as simulated control rods and multiple enrichment zones, in its reference form. Those kinds of features were investigated experimentally in variants of the reference ZPR-6/7 or in other critical assemblies in the Demonstration Reactor Benchmark Program.

  2. 17 CFR 240.15c3-1a - Options (Appendix A to 17 CFR 240.15c3-1). (United States)


    ... determined that a percentage of offsetting profits may be applied to losses at the same valuation point. (b... option's class, at 10 equidistant intervals (valuation points) ranging from an assumed movement (both up... options pricing model that satisfies the criteria set forth in paragraph (a)(1)(i)(B) of this section. (B...

  3. 17 CFR 240.13d-101 - Schedule 13D-Information to be included in statements filed pursuant to § 240.13d-1(a) and... (United States)


    ... plan, pension fund or endowment fund is not required. (e) If applicable, state the date on which the... appropriate box if a member of a group (a) (see instructions) (b) (3) SEC use only (4) Source of funds (see...)). (3) The 3rd row is for SEC internal use; please leave blank. (4) Classify the source of funds or...

  4. 17 CFR 240.15g-100 - Schedule 15G-Information to be included in the document distributed pursuant to 17 CFR 240.15g-2. (United States)


    ... obtaining your signature, the SEC requires your broker to wait at least two business days after sending you... investment. While penny stocks generally trade over-the-counter, they may also trade on U.S. securities... you buy penny stock, Federal law requires your salesperson to tell you the “offer” and the “bid” on...

  5. 17 CFR 240.15c3-1g - Conditions for ultimate holding companies of certain brokers or dealers (Appendix G to 17 CFR 240... (United States)


    ... provide quarterly updates of the organizational chart if a material change in the information provided to...) Certain regular risk reports provided to the persons responsible for managing group-wide risk as the..., the ultimate holding company must notify the Commission of any changes in the procedures; (iv) An...

  6. 17 CFR 240.14a-101 - Schedule 14A. Information required in proxy statement. (United States)


    ... not apply to registered investment companies. E. In Item 13 of this Schedule, the reference to “meets... of this schedule which concerns non-convertible debt or preferred securities which are “investment... will be taken in regard to these matters. 2. Open-end investment companies registered under the...

  7. 17 CFR 240.14c-7 - Providing copies of material for certain beneficial owners. (United States)


    ... authorizations or consents if no meeting is held, are held of record by a broker, dealer, voting trustee, or bank... is supplied with Notices of Internet Availability of Proxy Materials, information statements and/or...

  8. 17 CFR 240.14c-101 - Schedule 14C. Information required in information statement. (United States)


    .... Registrants and acquirees that meet the definition of “smaller reporting company” under Rule 12b-2 of the... holders, information statement, or Notice of Internet Availability of Proxy Materials is being delivered... statement, or Notice of Internet Availability of Proxy Materials, as applicable, is being delivered to...

  9. 31 CFR 240.6 - Provisional credit; first examination; declination; final payment. (United States)


    ... Finance (Continued) FISCAL SERVICE, DEPARTMENT OF THE TREASURY FINANCIAL MANAGEMENT SERVICE INDORSEMENT... substitute check, Treasury has a warranty or indemnity claim arising under 12 CFR 229.52 or 229.53. (d...

  10. Determination of 238Pu, 239+240Pu and 241Am in air filters


    Rzemek, Katarzyna; Czerwi?ski, Andrzej; O?ko, Jakub; Tymi?ska, Katarzyna; Dymecka, Ma?gorzata; Pliszczy?ski, Tomasz


    The aim of this work is to present the method for sequential plutonium and americium activity determination in air filters using chromatographic radionuclide separation and alpha spectrometry measurement. The developed method may be employed for the purposes of workplace monitoring and as an indicator of the need of introducing the individual monitoring as well as a useful complementation of individual monitoring. Basic parameters describing the developed method such as values of chemical rec...

  11. Degarelix 240/80 mg: a new treatment option for patients with advanced prostate cancer

    DEFF Research Database (Denmark)

    Boccon-Gibod, L.; Iversen, P.; Persson, B.E.


    levels that can lead to clinical flare in patients with advanced disease. Degarelix (Firmagon is a new GnRH blocker that has recently been approved by the EMEA and US FDA for the treatment of men with hormone-sensitive advanced prostate cancer. In this article, we briefly review the Phase III trial data...

  12. 29 CFR 1952.240 - Description of the plan as initially approved. (United States)


    ... maritime workers in the area of exclusive Federal jurisdiction; employees of the United States; employees protected by State agencies under the Atomic Energy Act of 1954, (42 U.S.C. 2021); and employees whose... this chapter in areas such as procedures for granting or denying permanent and temporary variances to...

  13. Users Manual for the Program LCP2 (Version 2.40)

    DEFF Research Database (Denmark)

    Gaunholt, Hans


    or to compensate designs for the application of nonideal circuit components such as transmission lines with losses and nonideal operational amplifiers. The information needed by the program is some target responses such as the poles and zeros or tabulated responses of e.g. the magnitude and the group-delay. Output......LCP2 (Linear Circuit Program) is developed as an analysis and optimization tool to be used in the design of passive, active and digital filters with arbitrary structures. By the aid of an optimization loop the program may be used to solve nonlinear design equations for active filter structures...

  14. 17 CFR 240.15a-6 - Exemption of certain foreign brokers or dealers. (United States)


    ... International Monetary Fund, the United Nations, and their agencies, affiliates, and pension funds; (iii) A....15c3-1) with respect to the transactions; and (6) Receiving, delivering, and safeguarding funds and...

  15. 7 CFR 1493.240 - Initial application and letter of preliminary commitment. (United States)


    ... including, where applicable, brand name, model number, Standard Industrial Classification (SIC) or the North... whether the projected use of U.S. agricultural commodities or products depends on the availability of U.S...

  16. 33 CFR 222.5 - Water control management (ER 1110-2-240). (United States)


    ... facilities, i.e., Fish and Wildlife Coordination Act (Pub. L. 85-624), Federal Water Project Recreation Act... are established by the division commanders concerned. Master Water Control Manuals for river basins..., depending on hydrologic parameters, such as snow cover. (5) Water control plans should be developed to...

  17. Fabrication and Tests of M240 Machine Gun Barrels Lined with Stellite 25 (United States)


    medical implant industry . The CCM in the name stands for Co, Cr, and Mo. The alloy will hereafter be referred to as Biodur. Table A-1 Biodur CCM...potential for use as gun barrel liners, as demonstrated in recent work.1 The supposition was that since Biodur was a cobalt- chromium alloy , it would also...liner; reducing the carbon content would make the new alloy more machineable. The plan was to cold-spray the special powder into tubes to be used in

  18. 40 CFR 1042.240 - Demonstrating compliance with exhaust emission standards. (United States)


    ... emissions at the low-hour test point. For example, if you use aftertreatment technology that controls... (CONTINUED) AIR POLLUTION CONTROLS CONTROL OF EMISSIONS FROM NEW AND IN-USE MARINE COMPRESSION-IGNITION... deterioration factors as follows: (1) Additive deterioration factor for exhaust emissions. Except as specified...

  19. Sébastien Lechevalier (editor), The Great Transformation of Japanese Capitalism. London: Routledge, 2014. 240 pp

    DEFF Research Database (Denmark)

    Kravtsova, Victoria


    Book review of: Sébastien Lechevalier (editor), The Great Transformation of Japanese Capitalism. London: Routledge, 2014.......Book review of: Sébastien Lechevalier (editor), The Great Transformation of Japanese Capitalism. London: Routledge, 2014....

  20. Comparison of Dow Corning 544 antifoam to IIT747 antifoam in the 1/240 SRAT

    Energy Technology Data Exchange (ETDEWEB)

    Koopman, D.C.


    The Defense Waste Processing Facility requested that the Immobilization Technology Section compare the relative foaming tendencies of sludge simulant during simulated Chemical Processing Cell operations (HLW-DWPF-TTR-99-0012). Dow Corning 544 antifoam, currently used in DWPF, was compared to a new antifoam formulation developed at the Illinois Institute of Technology. A task plan was written and approved. The task plan deliverables included a recommendation on the choice of antifoam, an evaluation of the influence of solids concentration on foaming, an evaluation on the effect of boil-up rate on foaming, an estimate of the mass of steam stripped to remove 90 percent of the mercury, and a determination of the fate of mercury. Additional parameters to be investigated during experimentation included the maximum foam height observed, hydrogen generation rates, and nitrite destruction rates.

  1. 17 CFR 240.14d-10 - Equal treatment of security holders. (United States)


    ... independence that it uses for determining that the members of the compensation committee are independent in... by independent directors as follows: (i) The compensation committee or a committee of the board of... that performs functions similar to a compensation committee is independent, a special committee of the...

  2. Degarelix 240/80 mg: a new treatment option for patients with advanced prostate cancer

    DEFF Research Database (Denmark)

    Boccon-Gibod, Laurent; Iversen, Peter; Persson, Bo-Eric


    Gonadotrophin-releasing hormone (GnRH) receptor blockers (antagonists) are the latest addition to the hormonal therapy armamentarium for patients with prostate cancer. In contrast to the GnRH agonists, GnRH blockers have an immediate onset of action and do not cause an initial surge in testosterone...... levels that can lead to clinical flare in patients with advanced disease. Degarelix (Firmagon is a new GnRH blocker that has recently been approved by the EMEA and US FDA for the treatment of men with hormone-sensitive advanced prostate cancer. In this article, we briefly review the Phase III trial data...

  3. 320 x 240 uncooled IRFPA with pixel wise thin film vacuum packaging (United States)

    Yon, J.-J.; Dumont, G.; Rabaud, W.; Becker, S.; Carle, L.; Goudon, V.; Vialle, C.; Hamelin, A.; Arnaud, A.


    Silicon based vacuum packaging is a key enabling technology for achieving affordable uncooled Infrared Focal Plane Arrays (IRFPA) as required by the promising mass market for very low cost IR applications, such as automotive driving assistance, energy loss monitoring in buildings, motion sensors… Among the various approaches studied worldwide, the CEA, LETI is developing a unique technology where each bolometer pixel is sealed under vacuum at the wafer level, using an IR transparent thin film deposition. This technology referred to as PLP (Pixel Level Packaging), leads to an array of hermetic micro-caps each containing a single microbolometer. Since the successful demonstration that the PLP technology, when applied on a single microbolometer pixel, can provide the required vacuum distributions, the paper also puts emphasis on additional key features such as thermal time constant, image quality, and ageing properties.

  4. 17 CFR 240.17f-2 - Fingerprinting of securities industry personnel. (United States)


    ... the sale of shares of registered open-end management investment companies, variable contracts, or... Act of 1934; (C) Has insurance or bonding indemnifying it for losses to customers caused by the... less than three years after termination of that person's employment or relationship with the...

  5. Eesti rikkaima mehe tütre hind 240 miljonit krooni / Lauri Birkan

    Index Scriptorium Estoniae

    Birkan, Lauri


    Politsei tabas kaks meest, kes üritasid röövida ärimees Armin Karu tütart Inest ning nõuda tema eest 15 miljonit eurot lunaraha. Küsimustele vastab Armin Karu. Vt. samas: Pankurid hindavad Armin Karu rikkuseks 5,4 miljardit; 1997. aastal plaanis äripartner Armin Karu tappa

  6. Soomes teeb 240 000 naist vabatahtlikku riigikaitsetööd / Rita Loel

    Index Scriptorium Estoniae

    Loel, Rita, 1966-2012


    Soome naiste tegevusest vabatahtlikes riigikaitseorganisatsioonides ja mais 2004 Tuusulas toimunud maakaitsekoolitusorganisatsiooni (Maanpuolustuskoulutus) õppusest Kiuru 2004, millel osales 350 naist ühenduse Naisten Valmiusliitto organisatsioonidest

  7. 49 CFR 240.117 - Criteria for consideration of operating rules compliance data. (United States)


    ... operating rules, or a railroad's program under § 217.9 of this chapter, will not be considered a legitimate... 49 Transportation 4 2010-10-01 2010-10-01 false Criteria for consideration of operating rules... operating rules compliance data. (a) Each railroad's program shall include criteria and procedures for...

  8. 17 CFR 240.13e-3 - Going private transactions by certain issuers or their affiliates. (United States)


    ... effects referred to in paragraph (a)(3) of this section are: (A) Causing any class of equity securities of... or the context otherwise requires, all terms used in this section and in Schedule 13E-3 shall have... the commencement of such person's tender offer for a class of equity securities of such issuer will...

  9. 17 CFR 240.15g-9 - Sales practice requirements for certain low-priced securities. (United States)


    ... account of a customer less than two business days after the broker or dealer sends such agreement. (b) In...) Obtain from the person information concerning the person's financial situation, investment experience... transactions) has sufficient knowledge and experience in financial matters that the person (or the person's...

  10. 17 CFR 240.17a-5 - Reports to be made by certain brokers and dealers. (United States)


    ... from: (A) Computer software incorrectly reading the date “01/01/00” as being the year 1900 or another... each stage of preparation for potential problems caused by Year 2000 Problems. These stages are: (1...

  11. 33 CFR Appendix B to Part 240 - Formulas for Determining Amount of Allowable Credit (United States)


    ... integral work credited in first step of calculations plus 20.0 external work credited, to the extent... disposal areas as included in that estimate. 3. Calculations for several hypothetical examples are provided... authorized is $100.0 million. All of the elements of cost are given in millions of dollars. 4. Integral Work...

  12. 17 CFR 240.15c3-1 - Net capital requirements for brokers or dealers. (United States)


    ... other factors, the special nature of its business, its financial position, its internal risk management... same issue and quantity. In no event may a brokers' broker exclude any overnight bank loan attributable... paragraph shall be subject to the prior claims of the exchange and its clearing corporation and those...

  13. SU-F-T-240: EPID-Based Quality Assurance for Dosimetric Credentialing

    Energy Technology Data Exchange (ETDEWEB)

    Miri, N [University of Newcastle, Newcastle, NSW (Australia); Lehmann, J [Calvary Mater Newcastle, Newcastle, NSW (Australia); Vial, P [Liverpool Hospital, Sydney, NSW (Australia); Greer, P [Calvary Mater Newcastle, Newcastle, NSW (Australia); University of Newcastle, Newcastle, NSW (Australia)


    Purpose: We propose a novel dosimetric audit method for clinical trials using EPID measurements at each center and a standardized EPID to dose conversion algorithm. The aim of this work is to investigate the applicability of the EPID method to different linear accelerator, EPID and treatment planning system (TPS) combinations. Methods: Combination of delivery and planning systems were three Varian linacs including one Pinnacle and two Eclipse TPS and, two ELEKTA linacs including one Pinnacle and one Monaco TPS. All Varian linacs had the same EPID structure and similarly for the ELEKTA linacs. Initially, dose response of the EPIDs was investigated by acquiring integrated pixel value (IPV) of the central area of 10 cm2 images versus MUs, 5-400 MU. Then, the EPID to dose conversion was investigated for different system combinations. Square field size images, 2, 3, 4, 6, 10, 15, 20, 25 cm2 acquired by all systems were converted to dose at isocenter of a virtual flat phantom then the dose was compared to the corresponding TPS dose. Results: All EPIDs showed a relatively linear behavior versus MU except at low MUs which showed irregularities probably due to initial inaccuracies of irradiation. Furthermore, for all the EPID models, the model predicted TPS dose with a mean dose difference percentage of 1.3. However the model showed a few inaccuracies for ELEKTA EPID images at field sizes larger than 20 cm2. Conclusion: The EPIDs demonstrated similar behavior versus MU and the model was relatively accurate for all the systems. Therefore, the model could be employed as a global dosimetric method to audit clinical trials. Funding has been provided from Department of Radiation Oncology, TROG Cancer Research and the University of Newcastle. Narges Miri is a recipient of a University of Newcastle postgraduate scholarship.

  14. Segue: A Spectroscopic Survey of 240,000 Stars With g = 14-20 (United States)


    spectra. 3.3. Cool White Dwarfs Cool WD stars, the fossil remains of an ancient stellar population, offer a window into the early stages of the Galaxy the kinematic distribution of G dwarfs in a much larger volume of the Galaxy than has been previously attempted (Wyse & Gilmore 1995; Wyse 1986...SEGUE M dwarf , note the strong MgH, Na i, and TiO molecular bands. plates that observed primarily galaxies . The target-selection categories were briefly

  15. Introduction & Overview to Symposium 240: Binary Stars as Critical Tools and Tests in Contemporary Astrophysics

    National Research Council Canada - National Science Library

    Guinan, Edward F; Harmanec, Petr; Hartkopf, William


    .... It is crucial to study binary and multiple stars because the vast majority of stars (>60%) in our Galaxy and in other galaxies consist, not of single stars, but of double and multiple star systems...

  16. 33 CFR 110.240 - San Juan Harbor, P.R. (United States)


    ...) Temporary Anchorage E (general). Beginning at a point which bears 262° T, 878 yards from Isla Grande Aero Beacon; thence along a line 75°47′, 498 yards; thence along a line 134°49′, 440 yards; thence along a line 224°49′ to the northerly channel limit of Graving Dock Channel, and thence to the point of...

  17. School Discipline Data Indicators: A Guide for Districts and Schools. REL 2017-240 (United States)

    Nishioka, Vicki


    This guide is designed to supply educators with a means to identify whether racial/ethnic disproportionality in discipline practice exists in their schools or districts. It also aims to help educators use data to reduce racial/ethnic disproportionality in suspensions and expulsions. The guide is organized into two sections. The first section…

  18. 20 CFR 662.240 - What are a program's applicable core services? (United States)


    ... training services described in WIA section 122; (ii) Eligible providers of youth activities described in... claims for unemployment compensation; (10) Assistance in establishing eligibility for programs of...

  19. 17 CFR 240.17Ad-17 - Transfer agents' obligation to search for lost securityholders. (United States)


    ..., each recordkeeping transfer agent shall conduct two data base searches using at least one information data base service. The transfer agent shall search by taxpayer identification number or by name if a.... Such data base searches must be conducted without charge to a lost securityholder and with the...

  20. Турбины нового поколения мощностью 540…600 МВт для блоков тепловых электрических станций поставляемые ОАО "Турбоатом" взамен отработавших свой ресурс турбин К-500-240-2


    Швецов, В. Л.; Кожешкурт, И. И.; Дроздов, Р. А.


    Внедрение паровых турбин нового поколения К-540-23,5 и К-600-23,5, проекты которых выполнены с использованием конструктивных решений и накопленного опыта эксплуатации турбин для замены отработавших свой ресурс турбин К-500-240 на тепловых станциях. Implementation of new-generation steam turbines К-540-23.5 and К-600-23.5 which projects are executed using design solutions and accumulated experience of turbine operation for replacement of turbines K-500-240 which have worked off their servic...

  1. Activity Ratios of ^<241>Pu/^<239+240>Pu and ^<238>Pu/^<239+240>Pu in Fall-out Samples Collected in the Period of 1961-1968


    松並, 忠男; 真室, 哲雄; T., MATSUNAMI; T., MAMURO; 大阪府立放射線中央研究所; Department of Health Physics and Instrumentation, Radiation Center of Osaka Prefecture


    Beta-ray emitting nuclide 241Pu, which transforms into alpha-ray emitting nuclide 241Am( α-ray energy:5.49 MeV (85%), 5.44 MeV (13%); half-life:458 y), is released in nuclear explosions together with three alpha-ray emitting plutonium isotopes, namely, 23

  2. Managing Customer Credit and Collections. PACE Revised. Level 2. Unit 17. Research & Development Series No. 240BB17. (United States)

    Ashmore, M. Catherine; Pritz, Sandra G.

    This unit on managing customer credit and collections in a small business, the 17th in a series of 18 modules, is on the second level of the revised PACE (Program for Acquiring Competence in Entrepreneurship) comprehensive curriculum. Geared to advanced secondary and beginning postsecondary or adult students, the modules provide an opportunity to…

  3. 17 CFR 240.14b-2 - Obligation of banks, associations and other entities that exercise fiduciary powers in connection... (United States)


    ... Notice of Internet Availability of Proxy Materials or request for voting instructions the following..., pursuant to an instrument, agreement, or otherwise, the power to vote, or to direct the voting of a security. Note 1: If more than one person shares voting power, the provisions of the instrument creating...

  4. Putative Alginate Assimilation Process of the Marine Bacterium Saccharophagus degradans 2-40 Based on Quantitative Proteomic Analysis. (United States)

    Takagi, Toshiyuki; Morisaka, Hironobu; Aburaya, Shunsuke; Tatsukami, Yohei; Kuroda, Kouichi; Ueda, Mitsuyoshi


    Quantitative proteomic analysis was conducted to assess the assimilation processes of Saccharophagus degradans cultured with glucose, pectin, and alginate as carbon sources. A liquid chromatography-tandem mass spectrometry approach was used, employing our unique, long monolithic silica capillary column. In an attempt to select candidate proteins that correlated to alginate assimilation, the production of 23 alginate-specific proteins was identified by statistical analyses of the quantitative proteomic data. Based on the analysis, we propose that S. degradans has an alginate-specific gene cluster for efficient alginate utilization. The alginate-specific proteins of S. degradans were comprised of alginate lyases, enzymes related to carbohydrate metabolism, membrane transporters, and transcription factors. Among them, the short-chain dehydrogenase/reductase Sde_3281 annotated in the alginate-specific cluster showed 4-deoxy-L-erythro-5-hexoseulose uronic acid reductase (DehR) activity. Furthermore, we found two different genes (Sde_3280 and Sde_0939) encoding 2-keto-3-deoxy-D-gluconic acid (KDG) kinases (KdgK) that metabolize the KDG derived from alginate and pectin in S. degradans. S. degradans used Sde_3280 to phosphorylate the KDG derived from alginate and Sde_0939 to phosphorylate the KDG derived from pectin. The distinct selection of KdgKs provides an important clue toward the elucidation of how S. degradans recognizes and processes polysaccharides.

  5. 17 CFR 240.17i-7 - Calculations of allowable capital and risk allowances or alternative capital assessment. (United States)


    ... debt is not protected by any Federal agency or the Securities Investor Protection Corporation; the... the following: (1) Value at risk. The Value at Risk measures obtained by applying one or more approved Value at Risk models to each position and multiplying the result by the appropriate multiplication...

  6. A 240-year history of avalanche risk in the Vosges Mountains based on non-conventional (resources

    Directory of Open Access Journals (Sweden)

    F. Giacona


    Full Text Available Despite the strong societal impact of mountain risks, their systematic documentation remains poor. Therefore, snow avalanche chronologies exceeding several decades are exceptional, especially in medium-high mountain ranges. This article implements a combination of historical and geographical methods leading to the reconstruction, at the scale of the entire Vosges Mountains (north-east of France, of more than 700 avalanches that have occurred since the late eighteenth century on 128 paths. The clearly episodic nature of the derived geo-chronology can be explained by three interrelated factors that have changed together over time: the body and reliability of sources, social practices conditioning the vulnerability and the natural hazard itself. Finally, the geo-chronology reflects the changes in the meaning of the hazard in social space. Specifically, the event which could be retrieved from the historical sources is an aspect of the interaction between society and its environment. These results confirm the role of the historian in contextualising and evaluating such data. It transforms these data into information that is relevant for mitigating risk and understanding its change over time. The work also demonstrates the usefulness of constructing an original database from a diverse suite of historical data and field investigations. This approach could be applied to other risk phenomena in the frequent situation in which archival data are sparse.

  7. Raman-assisted transmission of 16×10 Gbit/s over 240 km using post-compensation only

    DEFF Research Database (Denmark)

    Kjær, Rasmus; Galili, Michael; Oxenløwe, Leif Katsuo


    We demonstrate transmission of 16 WDM channels at 10 Gbit/s with 50 GHz channel spacing over 3 times 80 km NZDSF, with small OSNR penalty, using only a single Raman-pumped dispersion compensating module positioned before the receiver.......We demonstrate transmission of 16 WDM channels at 10 Gbit/s with 50 GHz channel spacing over 3 times 80 km NZDSF, with small OSNR penalty, using only a single Raman-pumped dispersion compensating module positioned before the receiver....

  8. 240 Caractérisation des Personnages en Théatre Sartrien Vis-À-Vis ...

    African Journals Online (AJOL)

    Ike Odimegwu

    15 janv. 2004 ... Quand on parle de la caractérisation, il s'agit d'un procédé de la création et du développement des personnages. Ceci consiste aussi à faire une construction détaillée des personnages. Il s'agit aussi d'une définition précise de l'identité du personnage, particulièrement en ce qui concerne sa psychologie.

  9. Occupational accidents in dental school: a 10-year retrospective - doi:10.5020/18061230.2009.p240

    Directory of Open Access Journals (Sweden)

    Ítalo Sarto Carvalho Rodrigues


    Full Text Available Objective: To investigate occupational accidents that occurred during the first 10 years of Fortaleza University (UNIFOR Dental School. Methods: A documental study based on secondary data from the Notification Center of Occupational Accidents of UNIFOR Dental School, reported in the last 10 years. The variables included characteristics of the accidents and of the injured, besides the type of instrument and the resulting injury. Results: Were recorded 160 occupational accidents divided by location, function of the injured and type of accident. It was observed that 63.1% of cases occurred in the Multidisciplinary Clinic, 23.1% in the Integrated Clinic, 8.8% in the laboratories, 1.9% at home, 1.25% in the Surgical Center, 1.25% in the Material Sterilization Central and 0.6% during the training outside university. Concerning the injured, 90.6% of the victims were undergraduates, 5.0% staff, 3.8% teachers and 0.6% patients. Regarding the injury, 40.6% were penetrating bloody injuries, 11.9% cutting bloody injuries, 2.5% cutting non-bloody injuries, 5% burns, 5% penetrating bloody injuries/cutting bloody injuries, 2.5% were injuries with maceration, 1.9% injuries causing ocular trauma and 0.6% of an incident of dog bite. Conclusion: It was concluded that penetrating injuries were prevalent and these occurred mostly in the multidisciplinary clinic, where students of earlier periods of dental course work, indicating that the experience in dental practice generates more care with safety.

  10. The molecular background of the differential UV absorbance of the human lens in the 240-400 nm range. (United States)

    Pajer, Viktor; Tiboldi, Akos; Bae, Narkhyun; Li, Kongzhao; Kang, Sung Ung; Hopp, Béla; Kolozsvári, Lajos; Lubec, Gert; Nógrádi, Antal


    The ultraviolet (UV) absorption of various sections of the human lens was studied and compared with protein expression paralleling differential UV absorbance in anterior and posterior lenticular tissue. The UV absorbance of serial lens cryostat sections (60 μm) and that of lens capsules was determined using a Shimadzu scanning spectrophotometer, and the absorption coefficients were calculated. Two-dimensional gel electrophoresis was performed using two pooled lenticular protein extracts (anterior and posterior sections). Protein spots were quantified and significantly different spots were identified by mass spectrometry following in-gel digestion with trypsin and chymotrypsin. The UV-C and UV-B absorption of the human lens increased toward the posterior parts of the lens. The anterior and posterior lens capsules also effectively absorbed UV radiation. Levels of molecular chaperone proteins Beta-crystallin B2 (UniProtKB ID:P43320), A3 (UniProtKB ID:P05813) and of glyceraldehyde 3-phosphate dehydrogenase (UniProtKB ID:P04406) were significantly higher in the anterior part of the lens, whereas lens proteins Beta-crystallin B1 (UniProtKB ID:P53674) and Alpha-crystallin A chain (UniProtKB ID:P02489) were higher in the posterior sections. These results provide evidence that differential UV absorption in the anterior and posterior lens is accompanied by differential protein expression. © 2013 Wiley Periodicals, Inc. Photochemistry and Photobiology © 2013 The American Society of Photobiology.

  11. Migration of Sr-20, Cs-137, and Pu-239/240 in Canyon below Los Alamos outfall

    Energy Technology Data Exchange (ETDEWEB)

    Murphy, J.M.; Mason, C.F.V.; Boak, J.M.; Longmire, P.A.


    Technical Area-21 (TA-21) of Los Alamos National Laboratory (LANL) is on a mesa bordered by two canyons DP Canyon and Los Alamos (LA) Canyon. DP Canyon is a small semiarid watershed with a well defined channel system where the stream flow is ephemeral. TA-21 has had a complex history of waste disposal as research to determine the chemical and metallurgical properties of nuclear materials occurred here from 1945-1978. Due to these operations, the TA-21 mesa top and bordering canyons have been monitored and characterized by the LANL Environmental Restoration Program. Results identify radionuclide values at outfall. 21-011 (k) which exceed Screening Action Levels, and points along DP Canyon which exceed regional background levels. The radiocontaminants considered in this study are strontium-90, cesium-137, and plutonium-239. This research examines sediment transport and speciation of radionuclide contaminant migration from a source term named SWMU 21-011 (k) down DP Canyon. Three dimensional surface plots of data from 1977-1994 are used to portray the transport and redistribution of radioactive contaminants in an alluvial stream channel. An overall decrease in contamination concentration since 1983 has been observed which could be due to more stringent laboratory controls and also to the removal of main plutonium processing laboratories to another site.

  12. 17 CFR 240.19b-4 - Filings with respect to proposed rule changes by self-regulatory organizations. (United States)


    ... policy, practice, or interpretation means: (1) Any material aspect of the operation of the facilities of...) Constituting a stated policy, practice, or interpretation with respect to the meaning, administration, or... associations, persons associated with specified persons; or (ii) The meaning, administration, or enforcement of...

  13. 41 CFR 102-73.240 - What policy must Federal agencies follow to acquire official parking spaces? (United States)


    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false What policy must Federal... Property Management Federal Property Management Regulations System (Continued) FEDERAL MANAGEMENT REGULATION REAL PROPERTY 73-REAL ESTATE ACQUISITION Acquisition by Lease Limitations on the Use of Delegated...

  14. Drying southern pine at 240°F. -- effects of air velocity and humidity, board thickness and density (United States)

    Peter Koch


    Kiln time to each 10 percent moisture content was shortened by circulating air at high velocity, but was little affected by board specific gravity. A wet-bulb depression of 80oF. provided faster drying than depressions of 40 or 115oF. At 80 depression and with air circulated at 930 f.p.m., kiln time was directly...

  15. 17 CFR 240.10b-18 - Purchases of certain equity securities by the issuer and others. (United States)


    ... securities association in response to a market-wide decline during a single trading session; or (ii) Declared... on behalf of the issuer by a broker-dealer that is not an electronic communication network (ECN) or...

  16. 40 CFR 1045.240 - How do I demonstrate that my engine family complies with exhaust emission standards? (United States)


    ... ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR POLLUTION CONTROLS CONTROL OF EMISSIONS FROM SPARK-IGNITION... engine families certified under this part. Apply deterioration factors as follows: (1) Additive deterioration factor for exhaust emissions. For engines that do not use aftertreatment technology, use an...

  17. 40 CFR 1048.240 - How do I demonstrate that my engine family complies with exhaust emission standards? (United States)


    ... technology. Also, you may use an additive deterioration factor for exhaust emissions for a particular... ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR POLLUTION CONTROLS CONTROL OF EMISSIONS FROM NEW, LARGE NONROAD... the deterioration factor. If the factor is less than one, use one. (2) Additive deterioration factor...

  18. 40 CFR 1039.240 - How do I demonstrate that my engine family complies with exhaust emission standards? (United States)


    ...-hour test point. For example, if you use aftertreatment technology that controls emissions of a... ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR POLLUTION CONTROLS CONTROL OF EMISSIONS FROM NEW AND IN-USE... deterioration factors as follows: (1) Additive deterioration factor for exhaust emissions. Except as specified...

  19. 17 CFR 240.17f-1 - Requirements for reporting and inquiry with respect to missing, lost, counterfeit or stolen... (United States)


    ... Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED) GENERAL RULES AND... agency, participant therein, member of the Federal Reserve System and bank whose deposits are insured by... not represented by an instrument and the transfer of which is registered upon books maintained for...

  20. 17 CFR 240.17a-3 - Records to be made by certain exchange members, brokers and dealers. (United States)


    ... provided further, That such bank files with the Commission a written undertaking in form acceptable to the Commission and signed by a duly authorized person, that such books and records are available for examination... demand made by or on behalf of said Commission for copies of books and records, true, correct, complete...

  1. SU-E-T-240: Design and Implement of An Electronic Records Function for Treatment Plan Checked Meeting

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Q [Beijing Hospital, Beijing (China)


    Purpose: To replace the paper records, we designed an electronic records function for plan checked meeting in our in-house developed radiotherapy information management system(RTIMS). Methods: Since 2007, the RTIMS has been developed on a database and web service of Apache+PHP+MySQL, and almost all computers and smartphones could access the RTIMS through IE browser, to input, search, count, and print the data. In 2012, we also established an radiation therapy case conference multi-media system(RTCCMMS) based on Windows Remote Desktop feature. Since 2013, we have carried out the treatment plan checked meeting of the physics division in every afternoon for about half an hour. In 2014, we designed an electronic records function, which includes a meeting information record and a checked plan record. And the meeting record includes the following items: meeting date, name, place, length, status, attendee, content, etc. The plan record includes the followings: meeting date, meeting name, patient ID, gender, age, patient name, course, plan, purpose, position, technique, CTsim type, plan type, primary doctor, other doctor, primary physicist, other physicist, difficulty, quality, score, opinion, status, note, etc. Results: In the past year, the electronic meeting records function has been successfully developed and implemented in the division, and it could be accessed from an smartphone. Almost all items have the corresponding pull-down menu selection, and each option would try to intelligently inherit default value from the former record or other form. According to the items, we could do big data mining to the input data. It also has both Chinese and English two versions. Conclusion: It was demonstrated to be user-friendly and was proven to significantly improve the clinical efficiency and quality of treatment plan. Since the RTIMS is an in-house developed system, more functions can be added or modified to further enhance its potentials in research and clinical practice. Project supported by the National Natural Science Foundation of China (Grant No.81101694)

  2. 40 CFR 1051.240 - How do I demonstrate that my engine family complies with exhaust emission standards? (United States)


    ... catalytic converters, use a multiplicative deterioration factor for exhaust emissions. A multiplicative... considered in compliance with the applicable numerical exhaust emission standards in subpart B of this part... durability demonstration. (Note: if you participate in the ABT program in subpart H of this part, your FELs...

  3. The Mineral Dust Cycle in EMAC 2.40: sensitivity to the spectral resolution and the dust emission scheme

    Directory of Open Access Journals (Sweden)

    G. Gläser


    Full Text Available This first detailed analysis of the mineral dust cycle in the ECHAM5/MESSy Atmospheric Chemistry (EMAC model system investigates the performance of two dust emission schemes, following the approach of Balkanski et al. (2004 and Tegen et al. (2002, respectively, and the influence of the horizontal model resolution. Here the spectral resolutions T42, T63, T85, and T106 are investigated. A basic sulphur chemistry, enabling the coating of insoluble dust particles to make them soluble, is employed in order to realistically describe the ageing and wet deposition of mineral dust. Independent of the dust emission scheme the five-year simulations with the horizontal resolutions T42 and T63 produce unrealistically high emissions at some grid points in the Tarim Basin in Central Asia, leading to very high dust loads in polar regions. With these coarse resolutions, dust source grid points in the basin and elevated grid points of the Himalayas with high wind speeds cannot be distinguished, causing this overestimation. In T85 and T106 these regions are well separated and considerably less dust is emitted there. With the chosen model setup, the dust emission scheme by Balkanski et al. (2004 places the global maximum of emissions in the Thar Desert in India. This is unrealistic as the Sahara Desert is known to be the largest dust source in the world. This is the main deficiency of this scheme compared to the one by Tegen et al. (2002, which, based on a qualitative comparison to AEROCOM data, produces a very reasonable distribution of emissions and dust loads in simulations with resolutions T85 and T106. For future climate simulations with EMAC focusing on mineral dust, we recommend to use the dust emission scheme by Tegen et al. (2002 and a model resolution of at least T85. Simulations of two selected episodes and comparison to observational data sets show that in this model configuration EMAC is able to realistically simulate also intense, episodic events of dust emission and long-range transport.

  4. Education practices developed by nurses in adolescent health promotion - doi:10.5020/18061230.2006.p240

    Directory of Open Access Journals (Sweden)

    Valdicleibe Lira de Amorim


    Full Text Available Adolescence is expressed by biopsychosocial development, delimited by the age group of 10 to 19 years old that, in general, initiates with corporal changes of puberty and finishes with social, professional and economic insertion. The adolescents possess health necessities that are produced in the scope of the society, defining and changing themselves from the interaction with its several economic, institutional, political, ethical, cultural and physical ambient components. This study had as its objective to analyze the education practices aimed at adolescent heath promotion, by means of documental research in nursing publications, in the period of 1999 to 2005, emphasizing empirical studies and experience reports involving group formation; and to identify the main theoretical and methodological procedures in education actions adopted in these studies. The results disclosed that only six articles, in which the nurses had affirmed to base their education practice with adolescents on theoretic referential, had valued the active participation of the adolescents, the critical reflection, the creativity and formal and not formal knowledge aiming at reaching transformation in their relations. Thus, we infer that there is a restrict number of publications on the subject, considering the high vulnerability and dependence of this age group regarding its sexuality and exposure to conflict situations.

  5. 17 CFR 240.12g3-2 - Exemptions for American depositary receipts and certain foreign securities. (United States)


    ... securities on one or more exchanges in a foreign jurisdiction that, either singly or together with the... principal stock exchange in its primary trading market on which its securities are traded and which has been... basis took place in, on or through the facilities of a securities market or markets in a single foreign...

  6. 17 CFR 240.17g-2 - Records to be made and retained by nationally recognized statistical rating organizations. (United States)


    ... publicly available on its corporate Internet Web site in an XBRL (eXtensible Business Reporting Language... its corporate Internet Web site, the nationally recognized statistical rating organization shall use the List of XBRL Tags for NRSROs as specified on the Commission's Internet Web site. (3)(i)(A) A...

  7. LHC Beam Splash seen by the ATLAS detector - 5 Apr 2015 - Run 260272 - LB 240 - event 5879

    CERN Multimedia



    Event display of first collimator "splash" event seen by the ATLAS experiment in LHC Run-2 , on Sunday April the 5th : event 5879, run 260272. The collimator position is 140m in front of the ATLAS interaction point. The spray of particles enters ATLAS from the right hand side of the picture.

  8. 17 CFR 240.17h-1T - Risk assessment recordkeeping requirements for associated persons of brokers and dealers. (United States)


    ... translated into the English language. For the purposes of this section, the term Foreign Financial Regulatory... specific description of any extensions of credit to a single borrower exceeding the Materiality Threshold... not less than three years in an easily accessible place. (4) For the purposes of this section and...

  9. 49 CFR Appendix C to Part 240 - Procedures for Obtaining and Evaluating Motor Vehicle Driving Record Data (United States)


    ... to address the problem that occurs when chronic traffic law violators, after losing their license in... that person. It may be supplemented by data concerning the person's height, weight, color of eyes, and... Administration, 1200 New Jersey Avenue, SE., Washington, DC 20590. 2. The request must contain: (a) The full...

  10. Neuroendocrine carcinoma of the breast - a pilot study of a Danish population of 240 breast cancer patients

    DEFF Research Database (Denmark)

    Brask, Julie Benedicte; Talman, Maj-Lis Møller; Wielenga, Vera Timmermans


    and gastrointestinal tract combined with positive neuroendocrine immunohistochemical markers. While much information has been gathered during the last decade, most studies suffer from poor statistics due to a low incidence, and there are still fundamental open questions regarding etiology and prognosis. Furthermore......, apparent limitations of the WHO definition appear to influence diagnosis. Here, we present our own results obtained from 13 cases and furthermore review previous reports with particular reference to incidence, clinical, histological, and prognostic features....

  11. Failure rates of tube systems used in delivery-water heaters of T-250/300-240 turbine units (United States)

    Vasilenko, G. V.; Nikitin, V. I.; Meshcheryakov, I. M.; Murzin, M. A.


    Field experience data on the stress corrosion cracking of a tube system made of Grade 12Kh18N10T austenitic stainless steel are given. The pattern of damages and the factors causing them to appear in certain locations are analyzed. Design and operational solutions aimed at making the heaters more reliable are proposed.

  12. 40 CFR 1060.240 - How do I demonstrate that my emission family complies with evaporative emission standards? (United States)


    ... § 1060.810), except that hardness is defined as the ratio of mean particle diameter before and after the test and the procedure must involve twenty 1/2-inch steel balls and ten 3/4-inch steel balls. Use good...

  13. 17 CFR 240.14d-1 - Scope of and definitions applicable to Regulations 14D and 14E. (United States)


    ...) the offeror has actual knowledge that the level of U.S. ownership equals or exceeds 40 percent of such... Regulation 14E under the Act if the following conditions are satisfied: (1) U.S. ownership limitation. Except..., the bidder must furnish that informational document, including any amendments thereto, in English, to...

  14. 17 CFR 240.12h-3 - Suspension of duty to file reports under section 15(d). (United States)


    ... annual report on Form 10-K for its preceding fiscal year, not later than 120 days after the end of such... $10 million on the last day of each of the issuer's three most recent fiscal years; and (2) Any class... non-reporting issuer into a one subsidiary holding company in which equity security holders receive...

  15. 240 Caractérisation des Personnages en Théatre Sartrien Vis-À-Vis ...

    African Journals Online (AJOL)

    Ike Odimegwu

    15 janv. 2004 ... siècle et même jusqu'à nos jours. On note que la plupart d'ouvrages critiques sur Sartre sont surtout sur ses œuvres théoriques et romanesques; ses œuvres théâtrales n'ont pas été assez abordées. Dans cette communication, il nous convient de concentrer sur son œuvre théâtrale. D'ailleurs, le théâtre.

  16. 17 CFR 240.19c-4 - Governing certain listing or authorization determinations by national securities exchanges and... (United States)


    ... bona fide merger or acquisition, with voting rights not greater than the per share voting rights of any... effect of nullifying, restricting or disparately reducing the per share voting rights of holders of an..., or disparately reducing the per share voting rights of holders of an outstanding class or classes of...

  17. Planning the Marketing Strategy. PACE Revised. Level 3. Unit 6. Research & Development Series No. 240CB6. (United States)

    Ashmore, M. Catherine; Pritz, Sandra G.

    This individualized, competency-based unit on planning marketing strategy, the sixth of 18 modules, is on the third level of the revised Program for Acquiring Competence in Entrepreneurship (PACE). Intended for the advanced secondary and postsecondary levels and for adults wanting training or retraining, this unit, together with the other…

  18. Planning the Marketing Strategy. PACE Revised. Level 1. Unit 6. Research & Development Series No. 240AB6. (United States)

    Ashmore, M. Catherine; Pritz, Sandra G.

    This lesson on planning a marketing strategy, the sixth in a series of 18 units, is part of the first level of a comprehensive entrepreneurship curriculum entitled: A Program for Acquiring Competence in Entrepreneurship (PACE). (Designed for use with secondary students, the first level of PACE introduces students to the concepts involved in…

  19. A 240-year history of avalanche risk in the Vosges Mountains based on non-conventional (re)sources (United States)

    Giacona, Florie; Eckert, Nicolas; Martin, Brice


    Despite the strong societal impact of mountain risks, their systematic documentation remains poor. Therefore, snow avalanche chronologies exceeding several decades are exceptional, especially in medium-high mountain ranges. This article implements a combination of historical and geographical methods leading to the reconstruction, at the scale of the entire Vosges Mountains (north-east of France), of more than 700 avalanches that have occurred since the late eighteenth century on 128 paths. The clearly episodic nature of the derived geo-chronology can be explained by three interrelated factors that have changed together over time: the body and reliability of sources, social practices conditioning the vulnerability and the natural hazard itself. Finally, the geo-chronology reflects the changes in the meaning of the hazard in social space. Specifically, the event which could be retrieved from the historical sources is an aspect of the interaction between society and its environment. These results confirm the role of the historian in contextualising and evaluating such data. It transforms these data into information that is relevant for mitigating risk and understanding its change over time. The work also demonstrates the usefulness of constructing an original database from a diverse suite of historical data and field investigations. This approach could be applied to other risk phenomena in the frequent situation in which archival data are sparse.

  20. 17 CFR 240.17g-3 - Annual financial reports to be furnished by nationally recognized statistical rating organizations. (United States)


    ... financial statements of the nationally recognized statistical rating organization or audited consolidated financial statements of its parent if the nationally recognized statistical rating organization is a...) of this section are consolidated financial statements of the parent of the nationally recognized...