
Sample records for californium 239

  1. 239 (United States)

    Lal, R; Fifield, L K; Tims, S G; Wasson, R J


    At present there is a need for the development of new radioisotopes for soil erosion and sediment tracing especially as fallout 137 Cs levels become depleted. Recent studies have shown that 239 Pu can be a useful new soil erosion and sediment radioisotope tracer. 239 Pu was released in the major atmospheric nuclear weapons tests of 1950's and 1960's. However 239 Pu has a half-life of 24110 years and more than 99% of this isotope is still present in the environment today. In contrast 137 Cs with a half-life of 30.07 year has decayed to Australia was carried out from comparison of measured 239 Pu inventories with expected 239 Pu inventories from fallout models. 239 Pu inventories were also compared with rainfall and measured 240 Pu/ 239 Pu ratios across Australia. 239 Pu fallout inventories ranged from 430 to 1461 μB/cm 2 . Central Australia, with fallout 107% in excess of expected values, seems to be strongly impacted by local fallout deposition. In comparison other sites typically show 5-40% variation between expected and measured fallout values. The fallout inventories were found to weakly correlate (using power functions, y = ax b ) with rainfall with r 2  = 0.50 across the southern catchments (25-40°S latitude band). Across the northern catchments (10-25°S latitude band) fallout showed greater variability with rainfall with r 2  = 0.24. Central Australia and Alice Springs which seem to be strongly impacted by local fallout are excluded from the rainfall correlation data (with these sites included r 2  = 0.08 and r 2  Australia (0.069) likely represent fallout from the Australian tests which also have low 240 Pu/ 239 Pu atom ratios i.e., Maralinga (0.113) and Montebello (0.045). The average ratios in the 20-30°S and 30-40° bands are closer to the global average (0.139 and 0.177 respectively when not including the close-in fallout data from the nuclear test sites) if the Australian test sites and Central Australian sites are neglected as they

  2. Historical review of californium-252 discovery and development (United States)

    Stoddard, D. H.

    This paper discusses the discovery and history of californium 252. This isotope may be synthesized by irradiating plutonium 239, plutonium 242, americium 243, or curium 244 with neutrons in a nuclear reactor. Various experiments and inventions involving (252)Cf conducted at the Savannah River Plant are discussed. The evolution of radiotherapy using californium 252 is reviewed.

  3. Californium-252 progress, report No. 7, April 1971

    Energy Technology Data Exchange (ETDEWEB)


    This report contains discusses of the following topics on Californium-252: First sales of californium-252; encapsulation services discussed; three new participants in market evaluation program; summer training programs to use californium; Californium-252 shipping casks available; Californium-252 questions and answers, radiotherapy; neutron radiography; natural resources exploration; nuclear safeguards; process control; dosimetry; neutron radiography; neutron shielding; and nuclear safeguards.

  4. Californium-252: a remarkable versatile radioisotope

    Energy Technology Data Exchange (ETDEWEB)

    Osborne-Lee, I.W.; Alexander, C.W.


    A product of the nuclear age, Californium-252 ({sup 252}Cf) has found many applications in medicine, scientific research, industry, and nuclear science education. Californium-252 is unique as a neutron source in that it provides a highly concentrated flux and extremely reliable neutron spectrum from a very small assembly. During the past 40 years, {sup 252}Cf has been applied with great success to cancer therapy, neutron radiography of objects ranging from flowers to entire aircraft, startup sources for nuclear reactors, fission activation for quality analysis of all commercial nuclear fuel, and many other beneficial uses, some of which are now ready for further growth. Californium-252 is produced in the High Flux Isotope Reactor (HFIR) and processed in the Radiochemical Engineering Development Center (REDC), both of which are located at the Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee. The REDC/HFIR facility is virtually the sole supplier of {sup 252}Cf in the western world and is the major supplier worldwide. Extensive exploitation of this product was made possible through the {sup 252}Cf Market Evaluation Program, sponsored by the United States Department of Energy (DOE) [then the Atomic Energy Commission (AEC) and later the Energy Research and Development Administration (ERDA)]. This program included training series, demonstration centers, seminars, and a liberal loan policy for fabricated sources. The Market Evaluation Program was instituted, in part, to determine if large-quantity production capability was required at the Savannah River Laboratory (SRL). Because of the nature of the product and the means by which it is produced, {sup 252}Cf can be produced only in government-owned facilities. It is evident at this time that the Oak Ridge research facility can meet present and projected near-term requirements. The production, shipment, and sales history of {sup 252}Cf from ORNL is summarized herein.

  5. Production, Distribution, and Applications of Californium-252 Neutron Sources

    Energy Technology Data Exchange (ETDEWEB)

    Balo, P.A.; Knauer, J.B.; Martin, R.C.


    The radioisotope {sup 252}Cf is routinely encapsulated into compact, portable, intense neutron sources with a 2.6-year half-life. A source the size of a person's little finger can emit up to 10{sup 11} neutrons/s. Californium-252 is used commercially as a reliable, cost-effective neutron source for prompt gamma neutron activation analysis (PGNAA) of coal, cement, and minerals, as well as for detection and identification of explosives, laud mines, and unexploded military ordnance. Other uses are neutron radiography, nuclear waste assays, reactor start-up sources, calibration standards, and cancer therapy. The inherent safety of source encapsulations is demonstrated by 30 years of experience and by U.S. Bureau of Mines tests of source survivability during explosions. The production and distribution center for the U. S Department of Energy (DOE) Californium Program is the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL). DOE sells The radioisotope {sup 252}Cf is routinely encapsulated into compact, portable, intense neutron sources with a 2.6- year half-life. A source the size of a person's little finger can emit up to 10 neutrons/s. Californium-252 is used commercially as a reliable, cost-effective neutron source for prompt gamma neutron activation analysis (PGNAA) of coal, cement, and minerals, as well as for detection and identification of explosives, laud mines, and unexploded military ordnance. Other uses are neutron radiography, nuclear waste assays, reactor start-up sources, calibration standards, and cancer therapy. The inherent safety of source encapsulations is demonstrated by 30 years of experience and by U.S. Bureau of Mines tests of source survivability during explosions. The production and distribution center for the U. S Department of Energy (DOE) Californium Program is the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory(ORNL). DOE sells {sup 252}Cf to commercial

  6. Unusual structure, bonding and properties in a californium borate

    Energy Technology Data Exchange (ETDEWEB)

    Polinski, Matthew J.; Garner, Edward B.; Maurice, Rémi; Planas, Nora; Stritzinger, Jared T.; Parker, T. Gannon; Cross, Justin N.; Green, Thomas D.; Alekseev, Evgeny V.; Van Cleve, Shelley M.; Depmeier, Wulf; Gagliardi, Laura; Shatruk, Michael; Knappenberger, Kenneth L.; Liu, Guokui; Skanthakumar, S.; Soderholm, Lynda; Dixon, David A.; Albrecht-Schmitt, Thomas E.


    The participation of the valence orbitals of actinides in bonding has been debated for decades. Recent experimental and computational investigations demonstrated the involvement of 6p, 6d and/or 5f orbitals in bonding. However, structural and spectroscopic data, as well as theory, indicate a decrease in covalency across the actinide series, and the evidence points to highly ionic, lanthanide-like bonding for late actinides. Here we show that chemical differentiation between californium and lanthanides can be achieved by using ligands that are both highly polarizable and substantially rearrange on complexation. A ligand that suits both of these desired properties is polyborate. We demonstrate that the 5f, 6d and 7p orbitals are all involved in bonding in a Cf(III) borate, and that large crystal-field effects are present. Synthetic, structural and spectroscopic data are complemented by quantum mechanical calculations to support these observations.

  7. Biomedical neutron research at the Californium User Facility for neutron science

    Energy Technology Data Exchange (ETDEWEB)

    Martin, R.C. [Oak Ridge National Lab., TN (United States); Byrne, T.E. [Roane State Community College, Harriman, TN (United States); Miller, L.F. [Univ. of Tennessee, Knoxville, TN (United States)


    The Californium User Facility for Neutron Science has been established at Oak Ridge National Laboratory (ORNL). The Californium User Facility (CUF) is a part of the larger Californium Facility, which fabricates and stores compact {sup 252}Cf neutron sources for worldwide distribution. The CUF can provide a cost-effective option for research with {sup 252}Cf sources. Three projects at the CUF that demonstrate the versatility of {sup 252}Cf for biological and biomedical neutron-based research are described: future establishment of a {sup 252}Cf-based neutron activation analysis system, ongoing work to produce miniature high-intensity, remotely afterloaded {sup 252}Cf sources for tumor therapy, and a recent experiment that irradiated living human lung cancer cells impregnated with experimental boron compounds to test their effectiveness for boron neutron capture therapy.

  8. Apparatus for the measurement of total body nitrogen using prompt neutron activation analysis with californium-252. (United States)

    Mackie, A; Hannan, W J; Smith, M A; Tothill, P


    Details of clinical apparatus designed for the measurement of total body nitrogen (as an indicator of body protein), suitable for the critically ill, intensive-care patient are presented. Californium-252 radio-isotopic neutron sources are used, enabling a nitrogen measurement by prompt neutron activation analysis to be made in 40 min with a precision of +/- 3.2% for a whole body dose equivalent of 0.145 mSv. The advantages of Californium-252 over alternative neutron sources are discussed. A comparison between two irradiation/detection geometries is made, leading to an explanation of the geometry adopted for the apparatus. The choice of construction and shielding materials to reduce the count rate at the detectors and consequently to reduce the pile-up contribution to the nitrogen background is discussed. Salient features of the gamma ray spectroscopy system to reduce spectral distortion from pulse pile-up are presented.

  9. 43 CFR 23.9 - Performance bond. (United States)


    ... cash or negotiable bonds of the U.S. Government. The cash deposit or the market value of such... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Performance bond. 23.9 Section 23.9 Public... LANDS § 23.9 Performance bond. (a)(1) Upon approval of an exploration plan or mining plan, the operator...

  10. 40 CFR 745.239 - Effective dates. (United States)


    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Effective dates. 745.239 Section 745.239 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) TOXIC SUBSTANCES CONTROL ACT... § 745.239 Effective dates. This subpart L shall apply in any State or Indian Country that does not have...

  11. 32 CFR 239.10 - Management Controls. (United States)


    ... 32 National Defense 2 2010-07-01 2010-07-01 false Management Controls. 239.10 Section 239.10...) MISCELLANEOUS HOMEOWNERS ASSISTANCE PROGRAM-APPLICATION PROCESSING § 239.10 Management Controls. (a). Management Systems. Headquarters, USACE has an existing information management system that manages all information...

  12. 37 CFR 2.39 - [Reserved (United States)


    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false 2.39 Section 2.39 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE RULES OF PRACTICE IN TRADEMARK CASES The Written Application § 2.39 ...

  13. 14 CFR 23.239 - Spray characteristics. (United States)


    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Spray characteristics. 23.239 Section 23.239 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION AIRCRAFT... Handling Characteristics § 23.239 Spray characteristics. Spray may not dangerously obscure the vision of...

  14. 32 CFR 239.7 - Responsibilities. (United States)


    ... 32 National Defense 2 2010-07-01 2010-07-01 false Responsibilities. 239.7 Section 239.7 National... HOMEOWNERS ASSISTANCE PROGRAM-APPLICATION PROCESSING § 239.7 Responsibilities. (a) The DUSD(I&E), under the... Chief of Engineers, has been delegated authority and responsibility for the execution of HAP. CEMP-CR...

  15. Safety Analysis Report for Packaging (SARP) of the Oak Ridge National Laboratory TRU Californium Shipping Container

    Energy Technology Data Exchange (ETDEWEB)

    Box, W.D.; Shappert, L.B.; Seagren, R.D.; Klima, B.B.; Jurgensen, M.C.; Hammond, C.R.; Watson, C.D.


    An analytical evaluation of the Oak Ridge National Laboratory TRU Californium Shipping Container was made in order to demonstrate its compliance with the regulations governing off-site shipment of packages that contain radioactive material. The evaluation encompassed five primary categories: structural integrity, thermal resistance, radiation shielding, nuclear criticality safety, and quality assurance. The results of this evaluation demonstrate that the container complies with the applicable regulations.

  16. Automated absolute activation analysis with californium-252 sources

    Energy Technology Data Exchange (ETDEWEB)

    MacMurdo, K.W.; Bowman, W.W.


    A 100-mg /sup 252/Cf neutron activation analysis facility is used routinely at the Savannah River Laboratory for multielement analysis of many solid and liquid samples. An absolute analysis technique converts counting data directly to elemental concentration without the use of classical comparative standards and flux monitors. With the totally automated pneumatic sample transfer system, cyclic irradiation-decay-count regimes can be pre-selected for up to 40 samples, and samples can be analyzed with the facility unattended. An automatic data control system starts and stops a high-resolution gamma-ray spectrometer and/or a delayed-neutron detector; the system also stores data and controls output modes. Gamma ray data are reduced by three main programs in the IBM 360/195 computer: the 4096-channel spectrum and pertinent experimental timing, counting, and sample data are stored on magnetic tape; the spectrum is then reduced to a list of significant photopeak energies, integrated areas, and their associated statistical errors; and the third program assigns gamma ray photopeaks to the appropriate neutron activation product(s) by comparing photopeak energies to tabulated gamma ray energies. Photopeak areas are then converted to elemental concentration by using experimental timing and sample data, calculated elemental neutron capture rates, absolute detector efficiencies, and absolute spectroscopic decay data. Calculational procedures have been developed so that fissile material can be analyzed by cyclic neutron activation and delayed-neutron counting procedures. These calculations are based on a 6 half-life group model of delayed neutron emission; calculations include corrections for delayed neutron interference from /sup 17/O. Detection sensitivities of < or = 400 ppB for natural uranium and 8 ppB (< or = 0.5 (nCi/g)) for /sup 239/Pu were demonstrated with 15-g samples at a throughput of up to 140 per day. Over 40 elements can be detected at the sub-ppM level.

  17. 32 CFR 239.3 - Policy. (United States)


    ... 32 National Defense 2 2010-07-01 2010-07-01 false Policy. 239.3 Section 239.3 National Defense... ASSISTANCE PROGRAM-APPLICATION PROCESSING § 239.3 Policy. (a) It is DoD policy, in implementing section 3374... determination of available benefits, can also be found in the circular (EC 405-1-18a) published by the HQUSACE...

  18. Dicty_cDB: SLC239 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLC239 (Link to dictyBase) - - - - SLC239Z (Link to Original site) - - SLC...239Z 598 - - - - Show SLC239 Library SL (Link to library) Clone ID SLC239 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID SLC239Z (Link to Original site) R...epresentative DNA sequence >SLC239 (SLC239Q) /CSM/SL/SLC2-B/SLC239Q.Seq.d/ XXXXXXXXXXACAACGTCTCATTTTCGCTGGTA

  19. Dicty_cDB: SLB239 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLB239 (Link to dictyBase) - - - - SLB239Z (Link to Original site) - - SLB...239Z 770 - - - - Show SLB239 Library SL (Link to library) Clone ID SLB239 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL Representative seq. ID SLB239Z (Link to Original site) R...epresentative DNA sequence >SLB239 (SLB239Q) /CSM/SL/SLB2-B/SLB239Q.Seq.d/ XXXXXXXXXXTGCCATTCAAGCCGTCTTATCCT

  20. 33 CFR 239.9 - Effective date. (United States)


    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Effective date. 239.9 Section 239....9 Effective date. These regulations are applicable to all projects not approved by OCE prior to the date of this regulation. ...

  1. 25 CFR 700.239 - Records available. (United States)


    ... or foreign policy and in fact properly classified pursuant to such Executive Order; (2) Related... 25 Indians 2 2010-04-01 2010-04-01 false Records available. 700.239 Section 700.239 Indians THE OFFICE OF NAVAJO AND HOPI INDIAN RELOCATION COMMISSION OPERATIONS AND RELOCATION PROCEDURES Inspection of...

  2. 14 CFR 29.239 - Spray characteristics. (United States)


    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Spray characteristics. 29.239 Section 29... AIRWORTHINESS STANDARDS: TRANSPORT CATEGORY ROTORCRAFT Flight Ground and Water Handling Characteristics § 29.239 Spray characteristics. If certification for water operation is requested, no spray characteristics...

  3. 14 CFR 27.239 - Spray characteristics. (United States)


    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Spray characteristics. 27.239 Section 27... AIRWORTHINESS STANDARDS: NORMAL CATEGORY ROTORCRAFT Flight Ground and Water Handling Characteristics § 27.239 Spray characteristics. If certification for water operation is requested, no spray characteristics...

  4. 49 CFR 239.7 - Definitions. (United States)


    ... rail modes of transportation means other railroads, trolleys, light rail, heavy transit, and other... emergency preparedness. Railroad means: (1) Any form of non-highway ground transportation that runs on rails... 49 Transportation 4 2010-10-01 2010-10-01 false Definitions. 239.7 Section 239.7 Transportation...

  5. 48 CFR 239.7409 - Special assembly. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Special assembly. 239.7409... Services 239.7409 Special assembly. (a) Special assembly is the designing, manufacturing, arranging... general use equipment. (b) Special assembly rates and charges shall be based on estimated costs. The...

  6. Dicty_cDB: VFB239 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VF (Link to library) VFB239 (Link to dictyBase) - - - Contig-U16243-1 VFB239P (Link to Original site) VFB...239F 540 VFB239Z 644 VFB239P 1184 - - Show VFB239 Library VF (Link to library) Clone ID VFB...e URL Representative seq. ID VFB...239P (Link to Original site) Representative DNA sequence >VFB239 (VFB239Q) /CSM/VF/VFB2-B/VFB...CSM-cDNA Score E Sequences producing significant alignments: (bits) Value VFB239 (VFB239Q) /CSM/VF/VFB2-B/VFB

  7. Dicty_cDB: CHF239 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHF239 (Link to dictyBase) - - - Contig-U14187-1 CHF239E (Link to Original site) CHF...239F 653 CHF239Z 795 CHF239P 1428 CHF239E 1084 Show CHF239 Library CH (Link to library) Clone ID CHF...ginal site URL Representative seq. ID CHF...239E (Link to Original site) Representative DNA sequence >CHF239 (CHF239Q) /CSM/CH/CHF2-B/CHF...KMFGNLGKK*k*y*****kk Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value CHF239 (CHF

  8. Dicty_cDB: SLJ239 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLJ239 (Link to dictyBase) - - - Contig-U16455-1 SLJ239Z (Link... to Original site) - - SLJ239Z 221 - - - - Show SLJ239 Library SL (Link to library) Clone ID SLJ239 (Link Representative seq. ID SLJ23...9Z (Link to Original site) Representative DNA sequence >SLJ239 (SLJ239Q) /CSM/SL/SLJ2-B/SLJ239Q.Seq.d/ XXXXX...plasmic 4.0 %: mitochondrial 4.0 %: peroxisomal >> prediction for SLJ239 is nuc 5' end seq. ID - 5' end seq.

  9. Neutron Capture Cross Section of 239Pu (United States)

    Mosby, S.; Arnold, C.; Bredeweg, T. A.; Couture, A.; Jandel, M.; O'Donnell, J. M.; Rusev, G.; Ullmann, J. L.; Chyzh, A.; Henderson, R.; Kwan, E.; Wu, C. Y.


    The 239Pu(n,γ) cross section has been measured over the energy range 10 eV - 10 keV using the Detector for Advanced Neutron Capture Experiments (DANCE) as part of a campaign to produce precision (n,γ) measurements on 239Pu in the keV region. Fission coincidences were measured with a PPAC and used to characterize the prompt fission γ-ray spectrum in this region. The resulting spectra will be used to better characterize the fission component of another experiment with a thicker target to extend the (n,γ) cross section measurement well into the keV region.

  10. Neutron Resonance Parameters for Pu-239 (Plutonium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Volume 24 `Neutron Resonance Parameters' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms'. It provides the neutron resonance parameters for the isotope Pu-239 (Plutonium).

  11. 48 CFR 239.7001 - Policy. (United States)


    ... Government-owned information technology. ... DEFENSE SPECIAL CATEGORIES OF CONTRACTING ACQUISITION OF INFORMATION TECHNOLOGY Exchange or Sale of Information Technology 239.7001 Policy. Agencies shall follow the procedures in DoD 4140.1-R, DoD Supply Chain...

  12. 48 CFR 239.7102-1 - General. (United States)


    ..., DEPARTMENT OF DEFENSE SPECIAL CATEGORIES OF CONTRACTING ACQUISITION OF INFORMATION TECHNOLOGY Security and Privacy for Computer Systems 239.7102-1 General. (a) Agencies shall ensure that information assurance is... Telecommunications and Information Systems Security Policy No. 11; (4) Federal Information Processing Standards; (5...

  13. 48 CFR 239.7101 - Definition. (United States)


    ... OF DEFENSE SPECIAL CATEGORIES OF CONTRACTING ACQUISITION OF INFORMATION TECHNOLOGY Security and Privacy for Computer Systems 239.7101 Definition. Information assurance, as used in this subpart, means measures that protect and defend information, that is entered, processed, transmitted, stored, retrieved...

  14. Reference: 239 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 239 Bundock Paul et al. 2005 Jul. Natur...functions. An Arabidopsis hAT-like transposase is essential for plant development. 7048 282-4 16015335 2005 Jul Nature Bundock Paul|Hooykaas Paul

  15. 46 CFR 153.239 - Use of cast iron. (United States)


    ... 46 Shipping 5 2010-10-01 2010-10-01 false Use of cast iron. 153.239 Section 153.239 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CERTAIN BULK DANGEROUS CARGOES SHIPS CARRYING BULK... Systems § 153.239 Use of cast iron. (a) Cast iron used in a cargo containment system must meet the...

  16. 48 CFR 1352.239-71 - Electronic and information technology. (United States)


    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Electronic and information technology. 1352.239-71 Section 1352.239-71 Federal Acquisition Regulations System DEPARTMENT OF COMMERCE CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions and Clauses 1352.239-71 Electronic and information technolog...

  17. 48 CFR 239.7405 - Delegated authority for telecommunications resources. (United States)


    ... telecommunications resources. 239.7405 Section 239.7405 Federal Acquisition Regulations System DEFENSE ACQUISITION... TECHNOLOGY Telecommunications Services 239.7405 Delegated authority for telecommunications resources. The contracting officer may enter into a telecommunications service contract on a month-to-month basis or for any...

  18. Application of TSH bioindicator for studying the biological efficiency of neutrons from californium-252 source

    Energy Technology Data Exchange (ETDEWEB)

    Cebulska-Wasilewska, A.; Rekas, K. [Institute of Nuclear Physics, Cracow (Poland); Kim, J.K. [Korea Atomic Energy Research Inst., Taejon (Korea, Republic of)


    The effectiveness of neutrons from a Californium-252 source in the induction of various abnormalities in the Tradescantia clone 4430 stamen hair cells (TSH-assay) was studied. The special attention was paid to check whether any enhancement in effects caused by process of boron neutron capture is visible in the cells enriched with boron ions. Two chemicals (borax and BSH) were applied to introduce boron-10 ions into cells. Inflorescence, normal or pretreated with chemicals containing boron, were irradiated in the air with neutrons from a Cf-252 source at KAERI, Taejon, Korea. To estimate the relative biological effectiveness (RBE) in the induction of gene mutations of the neutron beam under the study, Tradescantia inflorescences, without any chemical pretreatment, were irradiated with various doses of X-rays. The ranges of radiation doses used were 0-0.1 Gy in neutrons and 0-0.5 Gy in X-rays. After the time needed to complete the postirradiation repair Tradescantia cuttings were transferred to Cracow, where screening of gene and lethal; mutations, cell cycle alterations in somatic cells have been done, and dose response relationships were figured. The maximal RBE values were estimated in the range of 4.6-6.8. Alterations of RBE value were observed; from 6.8 to 7.8 in the case of plants pretreated with 240 ppm of B-10 from borax, and 4.6 to 6.1 in the case of 400 ppm of B-10 from BSH. Results showed a slight, although statistically insignificant increase in biological efficacy of radiation from the Cf-252 source in samples pretreated with boron containing chemicals. (author)

  19. Study of the shielding for spontaneous fission sources of Californium-252; Estudio de blindaje para fuentes de fision espontanea de Californio-252

    Energy Technology Data Exchange (ETDEWEB)

    Davila R, I


    A shielding study is made to attenuate, until maximum permissible levels, the neutrons radiation and photons emitted by spontaneous fission coming from a source of Californium-252. The compound package by a database (Library DLC-23) and the ANISNW code is used, in it version for personal computer. (Author)

  20. Photonuclear data evaluation of {sup 239}Pu

    Energy Technology Data Exchange (ETDEWEB)

    Raskinyte, I.; Dupont, E.; Ridikas, D


    This document presents cross-section calculations up to 130 MeV for Pu{sup 239} using the Talys-0.64 code. The photoabsorption process is described by the giant dipole resonance and quasi-deuteron mechanisms. Preequilibrium particle emission is treated with the classical exciton model. At equilibrium, the compound nucleus decay channels are handled within the Hauser-Feshbach statistical model. Neutron transmission coefficients are calculated with a double humped parabolic model. A few sensitive nuclear parameters were fine-tuned to better reproduce the experimental data available for ({gamma},n), ({gamma},2n) and ({gamma},f) partial cross-sections. In addition, the nuclear models provide predictions of the emitted neutron energy and angular distributions. (A.C.)

  1. Simulation and design of an electron beam ion source charge breeder for the californium rare isotope breeder upgrade

    Directory of Open Access Journals (Sweden)

    Clayton Dickerson


    Full Text Available An electron beam ion source (EBIS will be constructed and used to charge breed ions from the californium rare isotope breeder upgrade (CARIBU for postacceleration into the Argonne tandem linear accelerator system (ATLAS. Simulations of the EBIS charge breeder performance and the related ion transport systems are reported. Propagation of the electron beam through the EBIS was verified, and the anticipated incident power density within the electron collector was identified. The full normalized acceptance of the charge breeder with a 2 A electron beam, 0.024π  mm mrad for nominal operating parameters, was determined by simulating ion injection into the EBIS. The optics of the ion transport lines were carefully optimized to achieve well-matched ion injection, to minimize emittance growth of the injected and extracted ion beams, and to enable adequate testing of the charge bred ions prior to installation in ATLAS.

  2. Extraction of Trivalent Actinides and Lanthanides from Californium Campaign Rework Solution Using TODGA-based Solvent Extraction System

    Energy Technology Data Exchange (ETDEWEB)

    Benker, Dennis [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Delmau, Laetitia Helene [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Dryman, Joshua Cory [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)


    This report presents the studies carried out to demonstrate the possibility of quantitatively extracting trivalent actinides and lanthanides from highly acidic solutions using a neutral ligand-based solvent extraction system. These studies stemmed from the perceived advantage of such systems over cationexchange- based solvent extraction systems that require an extensive feed adjustment to make a low-acid feed. The targeted feed solutions are highly acidic aqueous phases obtained after the dissolution of curium targets during a californium (Cf) campaign. Results obtained with actual Cf campaign solutions, but highly diluted to be manageable in a glove box, are presented, followed by results of tests run in the hot cells with Cf campaign rework solutions. It was demonstrated that a solvent extraction system based on the tetraoctyl diglycolamide molecule is capable of quantitatively extracting trivalent actinides from highly acidic solutions. This system was validated using actual feeds from a Cf campaign.

  3. 46 CFR 67.239 - Requirements for assumptions of mortgages. (United States)


    ... 46 Shipping 2 2010-10-01 2010-10-01 false Requirements for assumptions of mortgages. 67.239... MEASUREMENT OF VESSELS DOCUMENTATION OF VESSELS Filing and Recording of Instruments-Mortgages, Preferred Mortgages, and Related Instruments § 67.239 Requirements for assumptions of mortgages. An assumption of...

  4. 7 CFR 205.239 - Livestock living conditions. (United States)


    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Livestock living conditions. 205.239 Section 205.239 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) ORGANIC FOODS PRODUCTION ACT PROVISIONS NATIONAL ORGANIC PROGRAM...

  5. 48 CFR 2452.239-71 - Information Technology Virus Security. (United States)


    ... computer viruses. The contractor shall be responsible for examining all such products prior to their... resulting from computer virus damage or malicious destruction of computer information arising from the... Virus Security. 2452.239-71 Section 2452.239-71 Federal Acquisition Regulations System DEPARTMENT OF...

  6. 48 CFR 252.239-7008 - Reuse arrangements. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Reuse arrangements. 252... Provisions And Clauses 252.239-7008 Reuse arrangements. As prescribed in 239.7411(a), use the following clause: Reuse Arrangements (DEC 1991) (a) When feasible, the Contractor shall reuse canceled or...

  7. 49 CFR 239.105 - Debriefing and critique. (United States)


    ... 49 Transportation 4 2010-10-01 2010-10-01 false Debriefing and critique. 239.105 Section 239.105... Debriefing and critique. (a) General. Except as provided in paragraph (b) of this section, each railroad operating passenger train service shall conduct a debriefing and critique session after each passenger train...

  8. 40 CFR 86.238-94-86.239-94 - [Reserved (United States)


    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false 86.238-94-86.239-94 Section 86.238-94-86.239-94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS... 1994 and Later Model Year Gasoline-Fueled New Light-Duty Vehicles, New Light-Duty Trucks and New Medium...

  9. 48 CFR 352.239-71 - Standard for encryption language. (United States)


    ... language. 352.239-71 Section 352.239-71 Federal Acquisition Regulations System HEALTH AND HUMAN SERVICES... Standard for encryption language. As prescribed in 339.101(d)(2), the Contracting Officer shall insert the following clause: Standard for Encryption Language (January 2010) (a) The Contractor shall use Federal...

  10. Beyond Californium-A Neutron Generator Alternative for Dosimetry and Instrument Calibration in the U.S. (United States)

    Piper, Roman K; Mozhayev, Andrey V; Murphy, Mark K; Thompson, Alan K


    Evaluations of neutron survey instruments, area monitors, and personal dosimeters rely on reference neutron radiations, which have evolved from the heavy reliance on (α,n) sources to a shared reliance on (α,n) and the spontaneous fission neutrons of californium-252 (Cf). Capable of producing high dose equivalent rates from an almost point source geometry, the characteristics of Cf are generally more favorable when compared to the use of (α,n) and (γ,n) sources or reactor-produced reference neutron radiations. Californium-252 is typically used in two standardized configurations: unmoderated, to yield a fission energy spectrum; or with the capsule placed within a heavy-water moderating sphere to produce a softened spectrum that is generally considered more appropriate for evaluating devices used in nuclear power plant work environments. The U.S. Department of Energy Cf Loan/Lease Program, a longtime origin of affordable Cf sources for research, testing and calibration, was terminated in 2009. Since then, high-activity sources have become increasingly cost-prohibitive for laboratories that formerly benefited from that program. Neutron generators, based on the D-T and D-D fusion reactions, have become economically competitive with Cf and are recognized internationally as important calibration and test standards. Researchers from the National Institute of Standards and Technology and the Pacific Northwest National Laboratory are jointly considering the practicality and technical challenges of implementing neutron generators as calibration standards in the U.S. This article reviews the characteristics of isotope-based neutron sources, possible isotope alternatives to Cf, and the rationale behind the increasing favor of electronically generated neutron options. The evaluation of a D-T system at PNNL has revealed characteristics that must be considered in adapting generators to the task of calibration and testing where accurate determination of a dosimetric quantity is

  11. Californium-252 Brachytherapy Combined With External-Beam Radiotherapy for Cervical Cancer: Long-Term Treatment Results

    Energy Technology Data Exchange (ETDEWEB)

    Lei Xin; Qian Chengyuan; Qing Yi; Zhao Kewei; Yang Zhengzhou; Dai Nan; Zhong Zhaoyang; Tang Cheng; Li Zheng; Gu Xianqing; Zhou Qian; Feng Yan; Xiong Yanli; Shan Jinlu [Cancer Center, Research Institute of Surgery and Daping Hospital, Third Military Medical University, Chongqing (China); Wang Dong, E-mail: [Cancer Center, Research Institute of Surgery and Daping Hospital, Third Military Medical University, Chongqing (China)


    Purpose: To observe, by retrospective analysis, the curative effects and complications due to californium-252 ({sup 252}Cf) neutron intracavitary brachytherapy (ICBT) combined with external-beam radiotherapy (EBRT) in the treatment of cervical cancer. Methods and Materials: From February 1999 to December 2007, 696 patients with cervical cancer (Stages IB to IIIB) were treated with {sup 252}Cf-ICBT in combination of EBRT. Of all, 31 patients were at Stage IB, 104 at IIA, 363 at IIB, 64 at IIIA, and 134 at IIIB. Californium-252 ICBT was delivered at 7-12 Gy per insertion per week, with a total dose of 29-45 Gy to reference point A in three to five insertions. The whole pelvic cavity was treated with 8-MV X-ray external irradiation at 2 Gy per fraction, four times per week. After 16-38 Gy of external irradiation, the center of the whole pelvic field was blocked with a 4-cm-wide lead shield, with a total external irradiation dose of 44-56 Gy. The total treatment course was 5 to 6 weeks. Results: Overall survival rate at 3 and 5 years for all patients was 76.0% and 64.9%, respectively. Disease-free 3- and 5-year survival rates of patients were 71.2% and 58.4%, respectively. Late complications included vaginal contracture and adhesion, radiation proctitis, radiation cystitis, and inflammatory bowel, which accounted for 5.8%, 7.1%, 6.2%, and 4.9%, respectively. Univariate analysis results showed significant correlation of stage, age, histopathologic grade, and lymph node status with overall survival. Cox multiple regression analysis showed that the independent variables were stage, histopathologic grade, tumor size, and lymphatic metastasis in all patients. Conclusion: Results of this series suggest that the combined use of {sup 252}Cf-ICBT with EBRT is an effective method for treatment of cervical cancer.

  12. Radiography Facility - Building 239 Independent Validation Review

    Energy Technology Data Exchange (ETDEWEB)

    Altenbach, T J; Beaulieu, R A; Watson, J F; Wong, H J


    The purpose of this task was to perform an Independent Validation Review to evaluate the successful implementation and effectiveness of Safety Basis controls, including new and revised controls, to support the implementation of a new DSA/TSR for B239. This task addresses Milestone 2 of FY10 PEP 7.6.6. As the first IVR ever conducted on a LLNL nuclear facility, it was designated a pilot project. The review follows the outline developed for Milestone 1 of the PEP, which is based on the DOE Draft Guide for Performance of Independent Verification Review of Safety Basis Controls. A formal Safety Basis procedure will be developed later, based on the lessons learned with this pilot project. Note, this review is termed a ''Validation'' in order to be consistent with the PEP definition and address issues historically raised about verification mechanisms at LLNL. Validation is intended to confirm that implementing mechanisms realistically establish the ability of TSR LCO, administrative control or safety management program to accomplish its intended safety function and that the controls are being implemented. This effort should not, however, be confused with a compliance assessment against all relevant DOE requirements and national standards. Nor is it used as a vehicle to question the derivation of controls already approved by LSO unless a given TSR statement simply cannot be implemented as stated.

  13. National Low-Level Waste Management Program Radionuclide Report Series, Volume 17: Plutonium-239

    Energy Technology Data Exchange (ETDEWEB)

    J. P. Adams; M. L. Carboneau


    This report, Volume 17 of the National Low-Level Waste Management Program Radionuclide Report Series, discusses the radiological and chemical characteristics of plutonium-239 (Pu-239). This report also discusses waste types and forms in which Pu-239 can be found, waste and disposal information on Pu-239, and Pu-239 behavior in the environment and in the human body.

  14. 48 CFR 239.7100 - Scope of subpart. (United States)


    ... OF DEFENSE SPECIAL CATEGORIES OF CONTRACTING ACQUISITION OF INFORMATION TECHNOLOGY Security and Privacy for Computer Systems 239.7100 Scope of subpart. This subpart includes information assurance and Privacy Act considerations. Information assurance requirements are in addition to provisions concerning...

  15. Long-term effects of an intracavitary treatment with californium-252 on normal tissue. [Swine, /sup 226/Ra

    Energy Technology Data Exchange (ETDEWEB)

    Sullivan, M.F.; Beamer, J.L.; Mahony, T.D.; Cross, F.T.; Lund, J.E.; Endres, G.W.R.


    About one hundred fifty swine were exposed to either radium-226 or californium-252 sources in the uterine cervix to determine an RBE for both acute and long-term effects. That value for early changes in the tissues at risk in the treatment of cervical cancer was between 6.2 and 6.8. The incidence of complications increased with time after exposure, especially among animals treated with /sup 252/Cf. Analysis of rectal injury showed that ulceration occurred frequently within a year postexposure at doses between 1600 and 2400 rad calculated at 2 cm lateral to the source midline. Fat necrosis and smooth muscle atrophy, resulting in a local rectal stricture, were delayed changes observed in some animals. The lower ureter was the site for a greater frequency of complications than the GI tract. Ureteral stricture often occurred at doses of 1200 rad from /sup 252/Cf and 7000 rad from /sup 226/Ra. Observation of delayed effects in the uterine-cervix in animals held up to 4 years postexposure indicate that the RBE for /sup 252/Cf may be increased to a value as high as 18, while repair may have even decreased it to about 5.6 in the rectum. Fifty swine are still being observed for long-term effects after doses above 800 rad from /sup 252/Cf and 5000 rad from /sup 226/Ra.

  16. Improved neutron capture cross section of Pu239 (United States)

    Mosby, S.; Bredeweg, T. A.; Chyzh, A.; Couture, A.; Henderson, R.; Jandel, M.; Kwan, E.; O'Donnell, J. M.; Ullmann, J.; Wu, C. Y.


    The 239Pu(n ,γ) cross section has been measured over the energy range 10 eV to 1 keV using the Detector for Advanced Neutron Capture Experiments (DANCE) at the Los Alamos Neutron Science Center as part of a campaign to produce precision (n ,γ) measurements on 239Pu. Fission coincidences were measured with a parallel-plate avalanche counter and used to measure the prompt fission γ-ray spectrum in this region to accurately characterize background. The resulting (n ,γ) cross section is generally in agreement with current evaluations. The experimental method utilizes much more detailed information than past measurements on 239Pu and can be used to extend the measurement to higher incident neutron energies.

  17. Determination of 242Pu by correlation with 239Pu only (United States)

    Swinhoe, M. T.; Iwamoto, T.; Tamura, T.


    Correlations are used to determine the 242Pu content of material using high resolution gamma measurements on the other plutonium isotopes because 242Pu itself has no practically detectable gamma emission lines. This paper presents an improved correlation that is particularly useful because, unlike some previous correlations, no prior knowledge of the reactor type or initial enrichment is required. This correlation has been shown to perform well over a range of plutonium from commercial BWR and PWR reactors. The agreement of the calculated 242Pu values with IDMS values is within 1% for 239Pu content of less than 70% and within 4% for 239Pu content of less than 80%. This simple form of the correlation is somewhat surprising given the complex behavior of 239/240 and 242/240 ratios.

  18. Pu-239 and Pu-240 inventories and Pu-240/ Pu-239 atom ratios in the water column off Sanriku, Japan. (United States)

    Yamada, Masatoshi; Zheng, Jian; Aono, Tatsuo


    A magnitude 9.0 earthquake and subsequent tsunami occurred in the Pacific Ocean off northern Honshu, Japan, on 11 March 2011 which caused severe damage to the Fukushima Dai-ichi Nuclear Power Plant. This accident has resulted in a substantial release of radioactive materials to the atmosphere and ocean, and has caused extensive contamination of the environment. However, no information is available on the amounts of radionuclides such as Pu isotopes released into the ocean at this time. Investigating the background baseline concentration and atom ratio of Pu isotopes in seawater is important for assessment of the possible contamination in the marine environment. Pu-239 (half-life: 24,100 years), Pu-240 (half-life: 6,560 years) and Pu-241 (half-life: 14.325 years) mainly have been released into the environment as the result of atmospheric nuclear weapons testing. The atom ratio of Pu-240/Pu-239 is a powerful fingerprint to identify the sources of Pu in the ocean. The Pu-239 and Pu-240 inventories and Pu-240/Pu-239 atom ratios in seawater samples collected in the western North Pacific off Sanriku before the accident at Fukushima Dai-ichi Nuclear Power Plant will provide useful background baseline data for understanding the process controlling Pu transport and for distinguishing additional Pu sources. Seawater samples were collected with acoustically triggered quadruple PVC sampling bottles during the KH-98-3 cruise of the R/V Hakuho-Maru. The Pu-240/Pu-239 atom ratios were measured with a double-focusing SF-ICP-MS, which was equipped with a guard electrode to eliminate secondary discharge in the plasma and to enhance overall sensitivity. The Pu-239 and Pu-240 concentrations were 2.07 and 1.67 mBq/m3 in the surface water, respectively, and increased with depth; a subsurface maximum was identified at 750 m depth, and the concentrations decreased with depth, then increased at the bottom layer. The total Pu-239+240 inventory in the entire water column (depth interval 0

  19. Atomic Mass and Nuclear Binding Energy for Pu-239 (Plutonium) (United States)

    Sukhoruchkin, S. I.; Soroko, Z. N.

    This document is part of the Supplement containing the complete sets of data of Subvolume B `Nuclei with Z = 55 - 100' of Volume 22 `Nuclear Binding Energies and Atomic Masses' of Landolt-Börnstein - Group I `Elementary Particles, Nuclei and Atoms', and additionally including data for nuclei with Z = 101 - 130. It provides atomic mass, mass excess, nuclear binding energy, nucleon separation energies, Q-values, and nucleon residual interaction parameters for atomic nuclei of the isotope Pu-239 (Plutonium, atomic number Z = 94, mass number A = 239).

  20. 40 CFR 239.9 - Intervention in civil enforcement proceedings. (United States)


    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Intervention in civil enforcement... Programs § 239.9 Intervention in civil enforcement proceedings. Any state seeking approval must provide for intervention in the state civil enforcement process by providing either: (a) Authority that allows intervention...

  1. Ab initio full-potential study of mechanical properties and magnetic phase stability of californium monopnictides (CfN and CfP)

    Energy Technology Data Exchange (ETDEWEB)

    Amari, S., E-mail: [Faculté des Sciences de la Nature et de la Vie, Université Hassiba Benbouali, Chlef, 02000 (Algeria); Bouhafs, B. [Laboratoire de Modélisation et Simulation en Sciences des Matériaux, Université Djillali Liabès de Sidi Bel-Abbés, Sidi Bel-Abbés, 22000 (Algeria)


    Based on the first-principles methods, the structural, elastic, electronic, properties and magnetic ordering of californium monopnictides CfX (X = P) have been studied using the full-potential augmented plane wave plus local orbitals (FP-L/APW + lo) method within the framework of density functional theory (DFT). The electronic exchange correlation energy is described by generalized gradient approximation GGA and GGA+U (U is the Hubbard correction). The GGA+U method is applied to the rare-earth 5f states. We have calculated the lattice parameters, bulk modulii and the first pressure derivatives of the bulk modulii. The elastic properties of the studied compounds are only investigated in the most stable calculated phase. In order to gain further information, we have calculated Young’s modulus, shear modulus, anisotropy factor and Kleinman parameter by the aid of the calculated elastic constants. The results mainly show that californium monopnictides CfX (X = P) have an antiferromagnetic spin ordering. Density of states (DOS) and charge densities for both compounds are also computed in the NaCl (B1) structure.

  2. Yeast Interacting Proteins Database: YDL239C, YDR148C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YDL239C ADY3 Protein required for spore wall formation, thought to mediate assembly...239C Bait gene name ADY3 Bait description Protein required for spore wall formation, thought to mediate asse

  3. Yeast Interacting Proteins Database: YDL239C, YAL028W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YDL239C ADY3 Protein required for spore wall formation, thought to mediate assembly...39C Bait ORF YDL239C Bait gene name ADY3 Bait description Protein required for spore wall formation, thought

  4. Yeast Interacting Proteins Database: YDL239C, YPL255W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YDL239C ADY3 Protein required for spore wall formation, thought to mediate assembly...ait ORF YDL239C Bait gene name ADY3 Bait description Protein required for spore wall formation, thought to m

  5. Yeast Interacting Proteins Database: YDL239C, YHR184W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YDL239C ADY3 Protein required for spore wall formation, thought to mediate assembly...C Bait ORF YDL239C Bait gene name ADY3 Bait description Protein required for spore wall formation, thought

  6. Yeast Interacting Proteins Database: YDL239C, YLR072W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YDL239C ADY3 Protein required for spore wall formation, thought to mediate assembly... Bait ORF YDL239C Bait gene name ADY3 Bait description Protein required for spore wall formation, thought

  7. Low-Dose-Rate Californium-252 Neutron Intracavitary Afterloading Radiotherapy Combined With Conformal Radiotherapy for Treatment of Cervical Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Zhang Min [Department of Oncology, Armed Police Hospital of Hangzhou, Hangzhou, Zhejiang Province (China); Xu Hongde [Cancer Center, Armed Police Hospital of Hangzhou, Hangzhou, Zhejiang Province (China); Pan Songdan; Lin Shan; Yue Jianhua [Department of Oncology, Armed Police Hospital of Hangzhou, Hangzhou, Zhejiang Province (China); Liu Jianren, E-mail: [Second Affiliated Hospital, School of Medicine, Zhejiang University, Hangzhou, Zhejiang Province (China)


    Purpose: To study the efficacy of low-dose-rate californium-252 ({sup 252}Cf) neutron intracavitary afterloading radiotherapy (RT) combined with external pelvic RT for treatment of cervical cancer. Methods and Materials: The records of 96 patients treated for cervical cancer from 2006 to 2010 were retrospectively reviewed. For patients with tumors {<=}4 cm in diameter, external beam radiation was performed (1.8 Gy/day, five times/week) until the dose reached 20 Gy, and then {sup 252}Cf neutron intracavitary afterloading RT (once/week) was begun, and the frequency of external beam radiation was changed to four times/week. For patients with tumors >4 cm, {sup 252}Cf RT was performed one to two times before whole-pelvis external beam radiation. The tumor-eliminating dose was determined by using the depth limit of 5 mm below the mucosa as the reference point. In all patients, the total dose of the external beam radiation ranged from 46.8 to 50 Gy. For {sup 252}Cf RT, the dose delivered to point A was 6 Gy/fraction, once per week, for a total of seven times, and the total dose was 42 Gy. Results: The mean {+-} SD patient age was 54.7 {+-} 13.7 years. Six patients had disease assessed at stage IB, 13 patients had stage IIA, 49 patients had stage IIB, 3 patients had stage IIIA, 24 patients had stage IIIB, and 1 patient had stage IVA. All patients obtained complete tumor regression (CR). The mean {+-} SD time to CR was 23.5 {+-} 3.4 days. Vaginal bleeding was fully controlled in 80 patients within 1 to 8 days. The mean {+-} SD follow-up period was 27.6 {+-} 12.7 months (range, 6-48 months). Five patients died due to recurrence or metastasis. The 3-year survival and disease-free recurrence rates were 89.6% and 87.5 %, respectively. Nine patients experienced mild radiation proctitis, and 4 patients developed radiocystitis. Conclusions: Low-dose-rate {sup 252}Cf neutron RT combined with external pelvic RT is effective for treating cervical cancer, with a low incidence of

  8. 46 CFR 10.239 - Quick reference table for MMC requirements. (United States)


    ... 46 Shipping 1 2010-10-01 2010-10-01 false Quick reference table for MMC requirements. 10.239 Section 10.239 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY MERCHANT MARINE OFFICERS AND SEAMEN... reference table for MMC requirements. Table 10.239 provides a guide to the requirements for officer...

  9. Yeast Interacting Proteins Database: YDL239C, YBR072W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YDL239C ADY3 Protein required for spore wall formation, thought to mediate assembly...L239C Bait ORF YDL239C Bait gene name ADY3 Bait description Protein required for spore wall formation, thought

  10. 48 CFR 352.239-72 - Security requirements for Federal information technology resources. (United States)


    ... Federal information technology resources. 352.239-72 Section 352.239-72 Federal Acquisition Regulations... Provisions and Clauses 352.239-72 Security requirements for Federal information technology resources. As... Federal Information Technology Resources (January 2010) (a) Applicability. This clause applies whether the...

  11. Disposition of plutonium-239 via production of fission molybdenum-99. (United States)

    Mushtaq, A


    A heritage of physical consequences of the U.S.-Soviet arms race has accumulated, the weapons-grade plutonium (WPu), which will become excess as a result of the dismantlement of the nuclear weapons under the arms reduction agreements. Disposition of Pu has been proposed by mixing WPu with high-level radioactive waste with subsequent vitrification into large, highly radioactive glass logs or fabrication into mixed oxide fuel with subsequent irradiation in existing light water reactors. A potential option may be the production of medical isotope molybdenum-99 by using Pu-239 targets. Copyright © 2011 Elsevier Ltd. All rights reserved.

  12. Neutron Resonance Parameters and Covariance Matrix of 239Pu

    Energy Technology Data Exchange (ETDEWEB)

    Derrien, Herve [ORNL; Leal, Luiz C [ORNL; Larson, Nancy M [ORNL


    In order to obtain the resonance parameters in a single energy range and the corresponding covariance matrix, a reevaluation of 239Pu was performed with the code SAMMY. The most recent experimental data were analyzed or reanalyzed in the energy range thermal to 2.5 keV. The normalization of the fission cross section data was reconsidered by taking into account the most recent measurements of Weston et al. and Wagemans et al. A full resonance parameter covariance matrix was generated. The method used to obtain realistic uncertainties on the average cross section calculated by SAMMY or other processing codes was examined.

  13. Disposition of plutonium-239 via production of fission molybdenum-99

    Energy Technology Data Exchange (ETDEWEB)

    Mushtaq, A., E-mail: [Isotope Production Division, Pakistan Institute of Nuclear Science and Technology, P.O. Nilore, Islamabad (Pakistan)


    A heritage of physical consequences of the U.S.-Soviet arms race has accumulated, the weapons-grade plutonium (WPu), which will become excess as a result of the dismantlement of the nuclear weapons under the arms reduction agreements. Disposition of Pu has been proposed by mixing WPu with high-level radioactive waste with subsequent vitrification into large, highly radioactive glass logs or fabrication into mixed oxide fuel with subsequent irradiation in existing light water reactors. A potential option may be the production of medical isotope molybdenum-99 by using Pu-239 targets.

  14. Absolute measurement of rates of capture of neutrons in 238U and fission in 239Pu (United States)

    Dulin, V. A.


    The absolute rate of capture of neutrons in U-238 was measured in terms of the Np-239 activity found (gamma radiation), using a calibrated Am-243 source to determine the efficiency of gamma recording in the detector. The absolute rate of fission of Pu-239 was determined by means of a fission chamber with a known number of Pu-239 nuclei, and the efficiency of fission fragment recording in the chamber was calculated.

  15. 48 CFR 239.7102-2 - Compromising emanations-TEMPEST or other standard. (United States)


    ... INFORMATION TECHNOLOGY Security and Privacy for Computer Systems 239.7102-2 Compromising emanations—TEMPEST or other standard. For acquisitions requiring information assurance against compromising emanations, the...

  16. Global opportunities on 239 general surgery residency Web sites. (United States)

    Wackerbarth, Joel J; Campbell, Timothy D; Wren, Sherry; Price, Raymond R; Maier, Ronald V; Numann, Patricia; Kushner, Adam L


    Many general surgical residency programs lack a formal international component. We hypothesized that most surgery programs do not have international training or do not provide the information to prospective applicants regarding electives or programs in an easily accessible manner via Web-based resources. Individual general surgery program Web sites and the American College of Surgeons residency tool were used to identify 239 residencies. The homepages were examined for specific mention of international or global health programs. Ease of access was also considered. Global surgery specific pages or centers were noted. Programs were assessed for length of rotation, presence of research component, and mention of benefits to residents and respective institution. Of 239 programs, 24 (10%) mentioned international experiences on their home page and 42 (18%) contained information about global surgery. Of those with information available, 69% were easily accessible. Academic programs were more likely than independent programs to have information about international opportunities on their home page (13.7% versus 4.0%, P = 0.006) and more likely to have a dedicated program or pathway Web site (18.8% versus 2.0%, P Web sites. Benefits to high-income country residents were discussed more than benefits to low- and middle-income country residents (57% versus 17%). General surgery residency programs do not effectively communicate international opportunities for prospective residents through Web-based resources and should seriously consider integrating international options into their curriculum and better present them on department Web sites. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. 48 CFR 252.239-7012 - Title to telecommunication facilities and equipment. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Title to telecommunication... CLAUSES Text of Provisions And Clauses 252.239-7012 Title to telecommunication facilities and equipment. As prescribed in 239.7411(b), use the following clause: Title to Telecommunication Facilities and...

  18. 16 CFR 23.9 - Additional guidance for the use of quality marks. (United States)


    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Additional guidance for the use of quality marks. 23.9 Section 23.9 Commercial Practices FEDERAL TRADE COMMISSION GUIDES AND TRADE PRACTICE RULES... on an industry product, or is printed on a tag or label attached to the product, the quality mark...

  19. Yeast Interacting Proteins Database: YDL239C, YPL124W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YDL239C ADY3 Protein required for spore wall formation, thought to mediate assembly...39C Bait ORF YDL239C Bait gene name ADY3 Bait description Protein required for spore wall formation, to mediate assembly of a Don1p-containing structure at the leading edge of the p

  20. 40 CFR 239.4 - Narrative description of state permit program. (United States)


    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Narrative description of state permit program. 239.4 Section 239.4 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) SOLID... Narrative description of state permit program. The description of a state's program must include: (a) An...

  1. 16 CFR 239.2 - Disclosures in warranty or guarantee advertising. (United States)


    ... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Disclosures in warranty or guarantee advertising. 239.2 Section 239.2 Commercial Practices FEDERAL TRADE COMMISSION GUIDES AND TRADE PRACTICE RULES...: (address).” B. “ABC power tools are guaranteed. Read about our limited 90 day warranty in this catalogue...

  2. Radiotoxicity of inhaled (239)PuO(2) in dogs. (United States)

    Muggenburg, Bruce A; Guilmette, Raymond A; Hahn, Fletcher F; Diel, Joseph H; Mauderly, Joe L; Seilkop, Steven K; Boecker, Bruce B


    Beagle dogs inhaled graded exposure levels of insoluble plutonium dioxide ((239)PuO(2)) aerosols in one of three monodisperse particle sizes at the Lovelace Respiratory Research Institute (LRRI) to study the life-span health effects of different degrees of alpha-particle dose non-uniformity in the lung. The primary noncarcinogenic effects seen were lymphopenia, atrophy and fibrosis of the thoracic lymph nodes, and radiation pneumonitis and pulmonary fibrosis. Radiation pneumonitis/ pulmonary fibrosis occurred from 105 days to more than 11 years after exposure, with the lowest associated alpha-particle dose being 5.9 Gy. The primary carcinogenic effects also occurred almost exclusively in the lung because of the short range of the alpha-particle emissions. The earliest lung cancer was observed at 1086 days after the inhalation exposure. The most common type seen was papillary adenocarcinoma followed by bronchioloalveolar carcinoma. These lung cancer results indicate that a more uniform distribution of alpha-particle dose within the lung has an equal or possibly greater risk of neoplasia than less uniform distributions of alpha-particle dose. The results are consistent with a linear relationship between dose and response, but these data do not directly address the response expected at low dose levels. No primary tumors were found in the tracheobronchial and mediastinal lymph nodes despite the high alpha-particle radiation doses to these lymph nodes, and no cases of leukemia were observed.

  3. Study of the number of neutrons produced by fission of {sup 239}Pu; Etude du nombre de neutrons produits par la fission de {sup 239}Pu

    Energy Technology Data Exchange (ETDEWEB)

    Jacob, M. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires


    Study of the number of neutrons produced by fission of {sup 239}Pu. The counting by coincidence of fissions and neutrons produced by these fissions allows the study of the variation of the mean number of neutrons emitted by {nu} fission. In the first chapter, it studied the variation of the mean number of neutrons emitted by {sup 239}Pu fission with the energy of the incident neutron. A description of the experiment is given: a spectrometer with a crystal of sodium chloride or beryllium (mounted on a goniometer) is used, a fission chamber containing 10 mg of {sup 239}Pu and the neutron detection system constituted of BF{sub 3} counters which are enriched in {sup 10}B. In the second part, the counting by coincidence of fissions and neutrons produced by the same fission and received by two different groups of counters allow the determination of a relationship between the root mean square and the average of neutron number produced by fission. The variation of the mean number of neutrons emitted by fission of {sup 239}Pu is studied when we change from a thermal spectra of neutrons to a fission spectra of incident neutrons. Finally, when separating in two different part the fission chamber, it is possible to measure the mean number of neutrons emitted from fission of two different sources. It compared the mean number of neutrons emitted by fission of {sup 239}Pu and {sup 233}U. (M.P.)

  4. [State of immune reactivity of persons having occupational contact with Pu-239]. (United States)

    Oradovskaia, I V; Radzivil, T T; Antipin, V T; Levenko, Iu N


    Clinical and immunological investigation with immune status evaluation of the group of people who had professionally contacts with Pu-239 in the quantity of 328 persons. The clinical characters of immune deficiency (ID) were defected in 75.3% of examined persons. There are showed that leading clinical syndromes of ID is appeared the infection syndromes (62.5%). The distribution of ID clinical infection characters are increased with increasing of radiation from internal 239Pu contains and seniority of professional contact with them. The particularity of immune status and dependence of the change its indices from the internal radiation dose, seniority of professional contact with Pu-239 and chronic diseases were revealed.

  5. 48 CFR 239.7406 - Cost or pricing data and information other than cost or pricing data. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Cost or pricing data and information other than cost or pricing data. 239.7406 Section 239.7406 Federal Acquisition Regulations System... ACQUISITION OF INFORMATION TECHNOLOGY Telecommunications Services 239.7406 Cost or pricing data and...

  6. Californium-252 neutron intracavity brachytherapy alone for T1N0 low-lying rectal adenocarcinoma: A definitive anal sphincter-preserving radiotherapy (United States)

    Xiong, Yanli; Shan, Jinlu; Liu, Jia; Zhao, Kewei; Chen, Shu; Xu, Wenjing; Zhou, Qian; Yang, Mei; Lei, Xin


    This study evaluated the 4-year results of 32 patients with T1N0 low-lying rectal adenocarcinoma treated solely with californium-252 (Cf-252) neutron intracavity brachytherapy (ICBT). Patients were solicited into the study from January 2008 to June 2011. All the patients had refused surgery or surgery was contraindicated. The patients were treated with Cf-252 neutron ICBT using a novel 3.5-cm diameter off-axis 4-channel intrarectal applicator designed by the authors. The dose reference point was defined on the mucosa surface, with a total dose of 55–62 Gy-eq/4 f (13–16 Gy-eq/f/wk). All the patients completed the radiotherapy in accordance with our protocol. The rectal lesions regressed completely, and the acute rectal toxicity was mild (≤G2). The 4-year local control, overall survival, disease-free survival, and late complication (≥G2) rates were 96.9%, 90.6%, 87.5% and 15.6%, respectively. No severe late complication (≥G3) occurred. The mean follow-up was 56.1 ± 16.0 months. At the end of last follow-up, 29 patients remained alive. The mean survival time was 82.1 ± 2.7 months. Cf-252 neutron ICBT administered as the sole treatment (without surgery) for patients with T1N0 low-lying rectal adenocarcinoma is effective with acceptable late complications. Our study and method offers a definitive anal sphincter-preserving radiotherapy for T1N0 low-lying rectal adenocarcinoma patients. PMID:28094790

  7. Yeast Interacting Proteins Database: YDL239C, YLR423C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YDL239C ADY3 Protein required for spore wall formation, thought to mediate assembly...cription Protein required for spore wall formation, thought to mediate assembly of a Don1p-containing struct

  8. Yeast Interacting Proteins Database: YDL239C, YML042W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YDL239C ADY3 Protein required for spore wall formation, thought to mediate assembly...iption Protein required for spore wall formation, thought to mediate assembly of a Don1p-containing structur

  9. Yeast Interacting Proteins Database: YDL239C, YDR273W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YDL239C ADY3 Protein required for spore wall formation, thought to mediate assembly...ption Protein required for spore wall formation, thought to mediate assembly of a Don1p-containing structure

  10. Yeast Interacting Proteins Database: YDL239C, YOR324C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YDL239C ADY3 Protein required for spore wall formation, thought to mediate gene name ADY3 Bait description Protein required for spore wall formation, thought to mediate assembly of

  11. Feasibility of in vivo measurement of {sup 239}Pu distribution in lungs using an imaging plate

    Energy Technology Data Exchange (ETDEWEB)

    Hirota, Masahiro, E-mail: [Department of Nuclear Engineering and Management, University of Tokyo, Bunkyo, Tokyo 113-8656 (Japan); Takada, Chie; Takasaki, Koji; Momose, Takumaro; Kurihara, Osamu [Japan Atomic Energy Agency, Nuclear Fuel Cycle Engineering Laboratories, Tokai, Ibaraki 319-1194 (Japan); Saze, Takuya [Radioisotope Research Center, Tokushima University, Tokushima, Tokushima 770-8503 (Japan); Ito, Shigeki [Faculty of Life Sciences, Kumamoto University, Kumamoto, Kumamoto 862-0976 (Japan); Nishizawa, Kunihide [Radioisotope Research Center, Nagoya University, Chikusa, Nagoya, Aichi 464-8602 (Japan)


    An in vivo measurement system using an imaging plate (IP) system was developed, which displayed images reflecting {sup 239}Pu distribution in the lung of a phantom. The detection limits of the IP system for 1-12 h exposures were between 1670 and 245 Bq at a 1.6 cm chest wall thickness. The detection limit of the IP system for a 2.5 h exposure was equal to that of a germanium detector for a 0.5 h measurement. The IP system could be used as a new device for in vivo measurement of {sup 239}Pu in the lung.

  12. Initial synthesis of area 13 /sup 239/Pu data and other statistical analyses

    Energy Technology Data Exchange (ETDEWEB)

    Gilbert, R.O.; Eberhardt, L.L.


    An initial effort is made here to synthesize the /sup 239 -240/Pu data currently available from Area 13 (Project 57). Plutonium concentrations for soil, vegetation, small vertebrates, and various tissues in beef cattle (grazed on the Pu contaminated vegetation) are plotted on a single graph for visual comparison. Hypothetical /sup 239 -240/Pu concentrations for lungs, skeletal bone, and kidney of a Standard Man assumed to live in and obtain most of his food from the area are also plotted. These hypothetical values were obtained using results from the plutonium transport and dose estimation model of Martin and Bloom (1975).

  13. Solid Phase Extraction Disk Procedure to Determine 239Pu in Soils

    Directory of Open Access Journals (Sweden)

    ZHANG Ji-qiao;ZHAO Ya-ping;DING You-qian;ZHANG Sheng-dong;YANG Jin-ling


    Full Text Available 239Pu in many soil samples should be analyzed to survey radioactive pollution level in nuclear facilities and its affinity environment efficiently. In order to input the opt conditions for column experiment, the experiments of the static adsorption coefficient of 239Pu to solid phase extraction disk with different contact time, concentration of HNO3 and different temperature were carried out. The chemical procedure for the rapid separation and determination of 239Pu in soils had been formulated, which using solid phase extraction disk (EmporeTM Anion Exchange-SR as extraction material and liquid scintillation spectrometry counting as measurement. In the procedure, soil sample usage was 10 g, and were leached by 8 mol/L HNO3, the chemical recovery of the procedure was about 78.9%, and the minimum detectable concentration was 3.7 Bq/kg. It took less than 3 hours once and the presence of 137Cs, 90Sr-90Y and natural uranium, 241Am, 99Tc did not interfere with the procedure, owning high DF of them. The procedure can be used extensively in determination of 239Pu in soils.

  14. 48 CFR 252.239-7016 - Telecommunications security equipment, devices, techniques, and services. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Telecommunications... SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions And Clauses 252.239-7016 Telecommunications... clause: Telecommunications Security Equipment, Devices, Techniques, and Services (DEC 1991) (a...

  15. Pu-239+240 and Cs-137 in Montenegro soil: their correlation and origin. (United States)

    Antovic, Nevenka M; Vukotic, Perko; Svrkota, Nikola; Andrukhovich, Sergey K


    The (239+240)Pu activity concentrations in soil from Montenegro (six samples from three localities) have been measured for the first time. The alpha and gamma-spectrometric measurements are used to determine the (239+240)Pu/(137)Cs activity ratio, and it was found to be with an average of 0.02 and standard deviation of 0.007. This average activity ratio was applied to estimate (239+240)Pu in soil samples from the other 21 localities at which (137)Cs activity concentrations were measured. In this research obtained (either experimentally or estimated) (239+240)Pu activity concentrations (0.036-8.265 Bq kg(-1)) are comparable with those measured in some other European countries. On the basis of the results obtained in the present study and a survey of relevant literature, it is possible to conclude that Chernobyl contribution to (137)Cs contamination of Montenegro soils is dominant, whilst Pu contamination comes from the global fallout of nuclear weapon tests. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. Presence of plutonium isotopes, {sup 239}Pu and {sup 240}Pu, in soils from Chile

    Energy Technology Data Exchange (ETDEWEB)

    Chamizo, E., E-mail: [Centro Nacional de Aceleradores, Avda. Thomas Alba Edison, 7, 41092 Sevilla (Spain); Garcia-Leon, M., E-mail: [Departamento de Fisica Atomica, Molecular y Nuclear, Universidad de Sevilla, Avda. Reina Mercedes sn, 41012 Seville (Spain); Peruchena, J.I., E-mail: [Centro Nacional de Aceleradores, Avda. Thomas Alba Edison, 7, 41092 Sevilla (Spain); Cereceda, F., E-mail: [Laboratorio de Quimica Ambiental, Centro de Tecnologias Ambientales (CETAM), Universidad Tecnica Federico Santa Maria, Casilla 110-V, Valparaiso (Chile); Vidal, V., E-mail: [Laboratorio de Quimica Ambiental, Centro de Tecnologias Ambientales (CETAM), Universidad Tecnica Federico Santa Maria, Casilla 110-V, Valparaiso (Chile); Pinilla, E., E-mail: [Departamento de Quimica Analitica, Facultad de Ciencias, Universidad de Extremadura, Avda. de Elvas sn, 06071 Badajoz (Spain); Miro, C., E-mail: [Departamento de Fisica Aplicada, Universidad de Extremadura, Avda. de la Universidad sn, 10071 Caceres (Spain)


    Plutonium is present in every environmental compartment, due to a variety of nuclear activities. The Southern Hemisphere has received about 20% of the global {sup 239}Pu and {sup 240}Pu environmental inventory, with an important contribution of the so-called tropospheric fallout from both the atmospheric nuclear tests performed in the French Polynesia and in Australia by France and United Kingdom, respectively. In this work we provide new data on the impact of these tests to South America through the study of {sup 239}Pu and {sup 240}Pu in soils from different areas of Northern, Central and Southern Chile. The obtained results point out to the presence of debris from the French tests in the 20-40 Degree-Sign Southern latitude range, with {sup 240}Pu/{sup 239}Pu atomic ratios quite heterogeneous and ranging from 0.02 to 0.23. They are significantly different from the expected one for the global fallout in the Southern Hemisphere for the 30-53 Degree-Sign S latitude range (0.185 {+-} 0.047), but they follow the same trend as the reported values by the Department of Energy of United States for other points with similar latitudes. The {sup 239+240}Pu activity inventories show as well a wider variability range in that latitude range, in agreement with the expected heterogeneity of the contamination.

  17. Improved MOX fuel calculations using new Pu-239, Am-241 and Pu-240 evaluations


    Schillebeeckx P.; Leal L.; De Saint Jean C.; Vidal J.F.; Peneliau Y.; Blaise P.; Leconte P.; Bernard D.; Bouland O.; Noguere G.; Kopecky S.; Lampoudis C.


    Several studies based on the JEFF-3.1.1 nuclear data library show a systematic overestimation of the critical keff for core configurations of MOX fuel assemblies. The present work investigates possible improvements of the C/E results by using new evaluations for Am-241, Pu-239 and Pu-240.

  18. Improved MOX fuel calculations using new Pu-239, Am-241 and Pu-240 evaluations (United States)

    Noguere, G.; Bouland, O.; Bernard, D.; Leconte, P.; Blaise, P.; Peneliau, Y.; Vidal, J. F.; De Saint Jean, C.; Leal, L.; Schillebeeckx, P.; Kopecky, S.; Lampoudis, C.


    Several studies based on the JEFF-3.1.1 nuclear data library show a systematic overestimation of the critical keff for core configurations of MOX fuel assemblies. The present work investigates possible improvements of the C/E results by using new evaluations for Am-241, Pu-239 and Pu-240.

  19. Improved MOX fuel calculations using new Pu-239, Am-241 and Pu-240 evaluations

    Directory of Open Access Journals (Sweden)

    Schillebeeckx P.


    Full Text Available Several studies based on the JEFF-3.1.1 nuclear data library show a systematic overestimation of the critical keff for core configurations of MOX fuel assemblies. The present work investigates possible improvements of the C/E results by using new evaluations for Am-241, Pu-239 and Pu-240.

  20. Phenylalanine and tyrosine metabolism in the facultative methylotroph Nocardia sp. 239

    NARCIS (Netherlands)

    Boer, L. de; Harder, W.; Dijkhuizen, L.

    Nocardia sp. 239 is able to use L-tyrosine and both D- and L-phenylalanine as carbon-, energy- and nitrogen sources for growth. The catabolism of these compounds is by way of (4-hydroxy)phenylpyruvate and (4-hydroxy)phenylacetate as intermediates and the pathways merge at the level of homogentisate.

  1. Regulation of aromatic amino acid biosynthesis in the ribulose monophosphate cycle methylotroph Nocardia sp. 239

    NARCIS (Netherlands)

    Boer, L. de; Vrijbloed, J.W.; Grobben, G.; Dijkhuizen, L.

    The regulation of aromatic amino acid biosynthesis in Nocardia sp. 239 was studied. In cell-free extracts 3-deoxy-D-arabinoheptulosonate 7-phosphate (DAHP) synthase activity was inhibited in a cumulative manner by tryptophan, phenylalanine and tyrosine. Chorismate mutase was inhibited by both

  2. 48 CFR 239.7102-3 - Information assurance contractor training and certification. (United States)


    ... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Information assurance... ACQUISITION OF INFORMATION TECHNOLOGY Security and Privacy for Computer Systems 239.7102-3 Information assurance contractor training and certification. (a) For acquisitions that include information assurance...

  3. 48 CFR 652.239-71 - Security Requirements for Unclassified Information Technology Resources. (United States)


    ... FAH 11, Information Assurance Handbook. (c) Submittal of IT Security Plan. Within 30 days after... Provisions and Clauses 652.239-71 Security Requirements for Unclassified Information Technology Resources. As prescribed in 639.107-70(b), insert the following clause: Security Requirements for Unclassified Information...

  4. 48 CFR 652.239-70 - Information Technology Security Plan and Accreditation. (United States)


    ... 48 Federal Acquisition Regulations System 4 2010-10-01 2010-10-01 false Information Technology... Clauses 652.239-70 Information Technology Security Plan and Accreditation. As prescribed in 639.107-70(a), insert the following provision: Information Technology Security Plan and Accreditation (SEP 2007) All...

  5. 48 CFR 1252.239-71 - Information technology security plan and accreditation. (United States)


    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Information technology... Provisions and Clauses 1252.239-71 Information technology security plan and accreditation. As prescribed in (TAR) 48 CFR 1239.70, insert the following provision: Information Technology Security Plan and...

  6. 48 CFR 1552.239-103 - Acquisition of Energy Star Compliant Microcomputers, Including Personal Computers, Monitors and... (United States)


    ... Compliant Microcomputers, Including Personal Computers, Monitors and Printers. 1552.239-103 Section 1552.239... Star Compliant Microcomputers, Including Personal Computers, Monitors and Printers. As prescribed in... Personal Computers, Monitors, and Printers (APR 1996) (a) The Contractor shall provide computer products...

  7. 17 CFR 239.34 - Form F-4, for registration of securities of foreign private issuers issued in certain business... (United States)


    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Form F-4, for registration of securities of foreign private issuers issued in certain business combination transactions. 239.34 Section 239.34 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION FORMS PRESCRIBED UNDER THE...

  8. Large particle flux of 239+240Pu on the continental margin of the East China Sea

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Masatoshi; Aono, Tatsuo [Nakaminato Laboratory for Marine Radioecology, Environmental Radiation Protection Research Group, Research Center for Radiation Safety, National Institute of Radiological Sciences, Isozaki 3609, Hitachinaka, 311-1202 Ibaraki (Japan)


    Settling particles were collected from three locations in the East China Sea continental margin and analyzed for 239+240Pu. Two types of sediment traps were used, cylindrical traps and conical time-series traps. Surface sediment samples collected from five locations were also analyzed for 239+240Pu. Data from cylindrical traps showed there was a clear tendency for total mass fluxes to increase with depth at all three stations, and there was an especially large increase near the bottom. 239+240Pu concentrations in settling particles increased with depth from 1.76 mBq/g at 97-m depth to 3.00 mBq/g at 120-m depth and ranged from approximately 3 to 4 mBq/g at depths greater than 120 m. 239+240Pu concentrations collected in the near-bottom traps were approximately two times higher than those in the underlying surface sediments. Like total mass fluxes there was a clear tendency for 239+240Pu fluxes to increase with depth at every station, and the highest 239+240Pu fluxes were observed near the bottom. 239+240Pu concentrations in the time-series traps had little variation throughout the sampling period, though the total mass fluxes showed a large variation. A high variability of 239+240Pu fluxes occurred in very short period of time (1/2 day). The large fluxes of 239+240Pu might be attributed to episodic lateral transport of particles that flow down the continental slope with the nepheloid layer which was considered to be significant for 239+240Pu transport on the continental slope in the East China Sea.

  9. Californium-252 Program Equipment Evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Chattin, Fred Rhea [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Wilson, Kenton [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Ezold, Julie G. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)


    To successfully continue the 252Cf production and meet the needs of the customers, a comprehensive evaluation of the Building 7920 processing equipment was requested to identify equipment critical to the operational continuity of the program.

  10. Characterization of a neutron source of {sup 239}PuBe; Caracterizacion de una fuente de neutrones de {sup 239}PuBe

    Energy Technology Data Exchange (ETDEWEB)

    Hernandez V, R.; Chacon R, A.; Hernandez D, V. M.; Mercado, G. A.; Vega C, H. R. [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Calle Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas (Mexico); Ramirez G, J. [Instituto Nacional de Estadistica Geografia e Informatica, Direccion General de Innovacion y Tecnologia de Informacion, Av. Heroes de Nacozari Sur 2301, Fracc. Jardines del Parque, 20276 Aguascalientes (Mexico)], e-mail:


    The spectrum equivalent dose and environmental equivalent dose f a {sup 239}PuBe source have been determined. The appropriate handling of a neutron source depends on the knowledge of its characteristics, such as its energy distribution, total rate of flowing and dosimetric magnitudes. In many facilities have not spectrometer that allows to determine the spectrum and then area monitors are used that give a dosimetric magnitude starting from measuring the flowing rate and the use of conversion factors, however this procedure has many limitations and it is preferable to measure the spectra and starting from this information the interest dosimetric magnitudes are calculated. In this work a Bonner sphere spectrometer has been used with a {sup 6}LiI(Eu) scintillator obtaining the count rates that produce, to a distance of 100 cm, a {sup 239}PuBe source of 1.85E(11) Bq. The spectrum was reconstructed starting from the count rates using BUNKIUT code and response matrix UTA4. With the spectrum information was calculated the source intensity, total flow, energy average, equivalent dose rate, environmental equivalent dose rate, equivalent dose coefficient and environmental equivalent dose coefficient. By means of two area monitors for neutrons, Eberline ASP-1 and LB 6411 of Berthold the equivalent dose and environmental equivalent dose were measured. The determinate values were compared with those reported in literature and it found that are coincident inside 17%. (Author)

  11. Preclinical Profile and Clinical Efficacy of a Novel Hepatitis C Virus NS5A Inhibitor, EDP-239. (United States)

    Owens, Christopher M; Brasher, Bradley B; Polemeropoulos, Alex; Rhodin, Michael H J; McAllister, Nicole; Peng, Xiaowen; Wang, Ce; Ying, Lu; Cao, Hui; Lawitz, Eric; Poordad, Fred; Rondon, Juan; Box, Terry D; Zeuzem, Stefan; Buggisch, Peter; Lin, Kai; Qiu, Yao-Ling; Jiang, Lijuan; Colvin, Richard; Or, Yat Sun


    EDP-239, a novel hepatitis C virus (HCV) inhibitor targeting nonstructural protein 5A (NS5A), has been investigated in vitro and in vivo EDP-239 is a potent, selective inhibitor with potency at picomolar to nanomolar concentrations against HCV genotypes 1 through 6. In the presence of human serum, the potency of EDP-239 was reduced by less than 4-fold. EDP-239 is additive to synergistic with other direct-acting antivirals (DAAs) or host-targeted antivirals (HTAs) in blocking HCV replication and suppresses the selection of resistance in vitro Furthermore, EDP-239 retains potency against known DAA- or HTA-resistant variants, with half-maximal effective concentrations (EC50s) equivalent to those for the wild type. In a phase I, single-ascending-dose, placebo-controlled clinical trial, EDP-239 demonstrated excellent pharmacokinetic properties that supported once daily dosing. A single 100-mg dose of EDP-239 resulted in reductions in HCV genotype 1a viral RNA of >3 log10 IU/ml within the first 48 h after dosing and reductions in genotype 1b viral RNA of >4-log10 IU/ml within 96 h. (This study has been registered at under identifier NCT01856426.). Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  12. Combining Differential and Integral Experiments on 239PU for Reducing Uncertainties in Nuclear Data Applications (United States)

    Kawano, T.; Hanson, K. M.; Frankle, S. C.; Talou, P.; Chadwick, M. B.; Little, R. C.


    We present an approach to uncertainty quantification for nuclear applications, which combines the covariance evaluation of differential cross-sections data and the error propagation from matching a criticality experiment using a neutron transport calculation. We have studied the effect on Pu-239 fission cross sections of using a one-dimensional neutron transport calculation with the PARTISN code. The evaluation of Pu-239 differential cross-section data is combined with a criticality measurement (Jezebel) using a Bayesian method. To perform the uncertainty quantification for such calculations, we generate a set of random samples of cross sections, which is representative of the covariance matrix, and estimate the distribution of calculated quantities, such as criticality. We show that inclusion of the Jezebel data reduces uncertainties in estimating neutron multiplicity.

  13. [Resorption coefficients and prevention of Pu-239 oxide entry through microtrauma of the skin]. (United States)

    Bazhin, A G


    The resorption coefficients of 239Pu were from (3.0 +/- 0.3) x 10(-4) to (6.3 +/- 1.4) x 10(-4) after contamination of skin microwounds of rats with plutonium oxides. Effective periods of the radionuclide accumulation in the organism were from 0.18 to 0.48 days. Disactivation of microinjuries with 3% hydrogen peroxide solution followed by electrocoagulation of the involved skin sites helped reduce the level of 239Pu in the tested skin site by 12.5 times, and by 4.5 to 7.5 times in the skeleton and liver. These measures, in combination with a 64-day course of pentacin and zincacin injections, helped reduce the level of the radionuclide in the organism 12-fold.

  14. [Effects of pentacin on subcellular distribution of Pu-239 nitrate in the lungs of rats]. (United States)

    Kabirova, N R; Sokhranich, A L


    The method of differential centrifugation has shown that 26% of 239Pu-nitrate injected intratracheally, is detected in cells in 3 h (24.4% of Pu is bound with subcellular organellae). In 24 h the nuclear fraction acquires a paramount importance in Pu binding. In the hyaloplasm 239Pu is distributed equally between low molecular (32.9-42.9%) and high molecular (54.1-55.2%) proteins. Pentacine decreases the level of Pu in the lungs, in the sum of subcellular fractions and in the sum of organellae, but produces no noticeable action on the level of the radionuclide in hyaloplasmic proteins though promotes certain redistribution of the radionuclide between low- and high molecular proteins.

  15. [Comparative study of hazards of energy plutonium and standard Pu-239 using non stochastic effects]. (United States)

    Kalmykova, Z I; Liubchanskiĭ, E R; Chudin, V A; Sokhranich, A L; Muksinova, K N; Kirillova, E N; Karpova, V N; Kaminskaia, T V; Spirina, S S


    In experiment with rats it was found that the "energy" Pu is more toxic than standard 239Pu when entered endotracheally. The comparison was made by the non-stochastic effects. The toxicity in respiratory system and blood system was 1.8 and 1.6 times higher when calculated per 1sGy of absorbed dose and 1.6 and 1.1 times higher when calculated per 1kBg/kg of the amount taken, respectively.

  16. Impaired RNA incorporation and dimerization in live attenuated leader-variants of SIVmac239

    Directory of Open Access Journals (Sweden)

    Whitney James B


    Full Text Available Abstract Background The 5' untranslated region (UTR or leader sequence of simian immunodeficiency virus (SIVmac239 is multifunctional and harbors the regulatory elements for viral replication, persistence, gene translation, expression, and the packaging and dimerization of viral genomic RNA (vRNA. We have constructed a series of deletions in the SIVmac239 leader sequence in order to determine the involvement of this region in both the packaging and dimerization of viral genomic RNA. We also assessed the impact of these deletions upon viral infectiousness, replication kinetics and gene expression in cell lines and monkey peripheral blood mononuclear cells (PBMC. Results Regions on both sides of the major splice donor (SD were found to be necessary for the efficiency and specificity of viral genome packaging. However, stem-loop1 is critical for both RNA encapsidation and dimerization. Downstream elements between the splice donor and the initiation site of SIV-Gag have additive effects on RNA packaging and contribute to a lesser degree to RNA dimerization. The targeted disruption of structures on both sides of the SD also severely impacts viral infectiousness, gene expression and replication in both CEMx174 cells and rhesus PBMC. Conclusion In the leader region of SIVmac239, stem-loop1 functions as the primary determinant for both RNA encapsidation and dimerization. Downstream elements between the splice donor and the translational initiation site of SIV-Gag are classified as secondary determinants and play a role in dimerization. Collectively, these data signify a linkage between the primary encapsidation determinant of SIVmac239 and RNA dimerization.

  17. Dynamics of Simian Immunodeficiency Virus SIVmac239 Infection in Pigtail Macaques (United States)

    Klatt, Nichole R.; Canary, Lauren A.; Vanderford, Thomas H.; Vinton, Carol L.; Engram, Jessica C.; Dunham, Richard M.; Cronise, Heather E.; Swerczek, Joanna M.; Lafont, Bernard A. P.; Picker, Louis J.; Silvestri, Guido


    Pigtail macaques (PTM) are an excellent model for HIV research; however, the dynamics of simian immunodeficiency virus (SIV) SIVmac239 infection in PTM have not been fully evaluated. We studied nine PTM prior to infection, during acute and chronic SIVmac239 infections, until progression to AIDS. We found PTM manifest clinical AIDS more rapidly than rhesus macaques (RM), as AIDS-defining events occurred at an average of 42.17 weeks after infection in PTM compared to 69.56 weeks in RM (P = 0.0018). However, increased SIV progression was not associated with increased viremia, as both peak and set-point plasma viremias were similar between PTM and RM (P = 0.7953 and P = 0.1006, respectively). Moreover, this increased disease progression was not associated with rapid CD4+ T cell depletion, as CD4+ T cell decline resembled other SIV/human immunodeficiency virus (HIV) models. Since immune activation is the best predictor of disease progression during HIV infection, we analyzed immune activation by turnover of T cells by BrdU decay and Ki67 expression. We found increased levels of turnover prior to SIV infection of PTM compared to that observed with RM, which may contribute to their increased disease progression rate. These data evaluate the kinetics of SIVmac239-induced disease progression and highlight PTM as a model for HIV infection and the importance of immune activation in SIV disease progression. PMID:22090099

  18. Photonuclear cross sections of Pu-239 using neutron capture gamma rays, near threshold (United States)

    Antonio, Marco; de Moraes, P. V.; Cesar, Marilia F.


    The photofission and photoneutron cross sections of Pu-239 have been measured by using monochromatic and discrete photons produced by thermal neutron capture gamma rays in several targets placed at the core of the IEA-R1 reactor in the energy interval from 5.43 MeV to 9.72 MeV. Analysing the photofission and photoneutron data we have observed similarities between the cross sections obtained for Pu-239 in comparison with the data obtained by other authors. From the photofission cross sections obtained and according to the liquid drop model, the height of the simple fission barrier was determined: F.B. = (5.7 ± 0.2) MeV. The relative fissionability to U-238 was also determined and shown to be energy independent: F.R. = (3.32 ± 0.41). For the competition between the photoneutron and the photofission emission (Γn/Γf) a constant value was found: (0.44 ± 0.05). By using this result the following nuclear temperature for Pu-239 was determined on basis of Nuclear Constant Temperature model of level density: T = (0.49 ± 0.05) MeV. The total photoabsorption cross sections were calculated as well as the photofission branching ratio (Γf/ΓA), or fission probability Pf. A constant value was also found: Pf = (0.70 ± 0.06).

  19. Dosimetry of inhaled plutonium-239 dioxide in rodent lung: a morphometric study

    Energy Technology Data Exchange (ETDEWEB)

    Rhoads, K.


    Morphometric analysis of rat and hamster lung did not demonstrate any extensive changes in lung composition or structure following inhalation exposure to /sup 239/Pu0/sub 2/ at levels near that for maximum tumor yield in rats. The problem of dosimetry for this compound thus appears to be relatively uncomplicated by any major radiation-induced pathological alterations in the lung. Rat and hamster lung were found to be similar in structure and composition, with few significant differences which could be directly related to the different tumor responses. The distribution of /sup 239/Pu0/sub 2/ particles was not uniform in all regions of the lung; thus estimation of the dose to specific tissues or regions within the lung requires a correction for this effect. Species differences were found for particle distribution in the subpleural region and major airways, and in the spatial association of particles, both of which may affect the tumor development process. These regions contain the principal target cells for tumor production and serve as foci for the origin of tumors. Different dose distributions within these regions may therefore explain, at least in part, the difference in tumor response to inhaled /sup 239/Pu0/sub 2/ for rats and hamsters.


    Directory of Open Access Journals (Sweden)

    E. B. Ershov


    Full Text Available The article considers, on the basis of experimental data, the issue of assessing dose burdens to the skin basal layer in conditions of its permanent contamination with solutions of plutonium-239 and americium-241 and subsequent decontamination.

  1. Modifying effects of preexisting pulmonary fibrosis on biological responses of rats to inhaled 239PuO2

    Energy Technology Data Exchange (ETDEWEB)

    Lundgren, D.L.; Mauderly, J.L.; Rebar, A.H.; Gillett, N.A.; Hahn, F.F. (Lovelace Biomedical and Environmental Research Institute, Albuquerque, NM (USA))


    We investigated the modifying effects of preexisting, bleomycin-induced pulmonary fibrosis on the deposition, retention, and biological effects of inhaled 239PuO2 in the rat. Among rats exposed to similar airborne concentrations of 239PuO2, initial lung burdens of 239Pu per kilogram body mass were similar whether or not pulmonary fibrosis was present. However, clearance of 239Pu from the lungs was significantly decreased in the rats with preexisting pulmonary fibrosis. The incidence of lung lesions (epithelial hyperplasia, diffuse macrophage increases and aggregation, and loose and dense connective tissue) was significantly greater among rats with preexisting pulmonary fibrosis than among the exposed controls. Rats with preexisting fibrosis had shorter life spans than 239PuO2-exposed control rats. When groups of rats with similar alpha doses to the lungs were compared, the incidences of neoplastic lesions in the lung, the times to death of rats with lung neoplasms, and the risk of lung tumors per unit of alpha dose to the lungs in rats with or without pulmonary fibrosis were similar. The results of this study suggest that humans with uncomplicated pulmonary fibrosis may not be more sensitive to the carcinogenic effects of inhaled 239PuO2 than are individuals with normal lungs, assuming that the total alpha doses to the lungs are similar.

  2. MTS-6 detectors calibration by using 239Pu-Be neutron source

    Directory of Open Access Journals (Sweden)

    Małgorzata Wrzesień


    Full Text Available Background: Thermoluminescent detectors, type MTS-6, containing isotope 6Li (lithium are sensitive in the range of thermal neutron energy; the 239Pu-Be (plutonium-and-beryllium source emits neutrons in the energy range from 1 to 11 MeV. These seemingly contradictory elements may be combined by using the paraffin moderator, a determined density of thermal neutrons in the paraffin block and a conversion coefficient neutron flux to kerma, not forgetting the simultaneous registration of the photon radiation inseparable from the companion neutron radiation. The main aim of this work is to present the idea of calibration of thermoluminescent detectors that consist of a 6Li isotope, by using 239Pu-Be neutron radiation source. Material and Methods: In this work, MTS-6 and MTS-7 thermoluminescent detectors and a plutonium-and-beryllium (239Pu-Be neutron source were used. Paraffin wax fills the block, acting as a moderator. The calibration idea was based on the determination of dose equivalent rate based on the average kerma rate calculated taking into account the empirically determined function describing the density of thermal neutron flux in the paraffin block and a conversion coefficient neutron flux to kerma. Results: The calculated value of the thermal neutron flux density was 1817.5 neutrons/cm2/s and the average value of kerma rate determined on this basis amounted to 244 μGy/h, and the dose equivalent rate 610 μSv/h. The calculated value allowed for the assessment of the length of time of exposure of the detectors directly in the paraffin block. Conclusions: The calibration coefficient for the used batch of detectors is (6.80±0.42×10–7 Sv/impulse. Med Pr 2017;68(6:705–710

  3. Beta decay heat following U-235, U-238 and Pu-239 neutron fission (United States)

    Li, Shengjie


    This is an experimental study of beta-particle decay heat from 235U, 239Pu and 238U aggregate fission products over delay times 0.4-40,000 seconds. The experimental results below 2s for 235U and 239Pu, and below 20s for 238U, are the first such results reported. The experiments were conducted at the UMASS Lowell 5.5-MV Van de Graaff accelerator and 1-MW swimming-pool research reactor. Thermalized neutrons from the 7Li(p,n)7Be reaction induced fission in 238U and 239Pu, and fast neutrons produced in the reactor initiated fission in 238U. A helium-jet/tape-transport system rapidly transferred fission fragments from a fission chamber to a low background counting area. Delay times after fission were selected by varying the tape speed or the position of the spray point relative to the beta spectrometer that employed a thin-scintillator-disk gating technique to separate beta-particles from accompanying gamma-rays. Beta and gamma sources were both used in energy calibration. Based on low-energy(<1 MeV) internal-conversion electron studies, a set of trial responses for the spectrometer was established and spanned electron energies 0-10 MeV. Measured beta spectra were unfolded for their energy distributions by the program FERD, and then compared to other measurements and summation calculations based on ENDF/B-VI fission-product data performed on the LANL Cray computer. Measurements of the beta activity as a function of decay time furnished a relative normalization. Results for the beta decay heat are presented and compared with other experimental data and the summation calculations.

  4. MTS-6 detectors calibration by using 239Pu-Be neutron source. (United States)

    Wrzesień, Małgorzata; Albiniak, Łukasz; Al-Hameed, Hiba


    Thermoluminescent detectors, type MTS-6, containing isotope 6Li (lithium) are sensitive in the range of thermal neutron energy; the 239Pu-Be (plutonium-and-beryllium) source emits neutrons in the energy range from 1 to 11 MeV. These seemingly contradictory elements may be combined by using the paraffin moderator, a determined density of thermal neutrons in the paraffin block and a conversion coefficient neutron flux to kerma, not forgetting the simultaneous registration of the photon radiation inseparable from the companion neutron radiation. The main aim of this work is to present the idea of calibration of thermoluminescent detectors that consist of a 6Li isotope, by using 239Pu-Be neutron radiation source. In this work, MTS-6 and MTS-7 thermoluminescent detectors and a plutonium-and-beryllium (239Pu-Be) neutron source were used. Paraffin wax fills the block, acting as a moderator. The calibration idea was based on the determination of dose equivalent rate based on the average kerma rate calculated taking into account the empirically determined function describing the density of thermal neutron flux in the paraffin block and a conversion coefficient neutron flux to kerma. The calculated value of the thermal neutron flux density was 1817.5 neutrons/cm2/s and the average value of kerma rate determined on this basis amounted to 244 μGy/h, and the dose equivalent rate 610 μSv/h. The calculated value allowed for the assessment of the length of time of exposure of the detectors directly in the paraffin block. The calibration coefficient for the used batch of detectors is (6.80±0.42)×10-7 Sv/impulse. Med Pr 2017;68(6):705-710.

  5. Manganese determination om minerals by activation analysis, using the californium-252 as a neutron source; Determinacao de manganes em minerios, por analise por ativacao, usando californio-252 como fonte de neutrons

    Energy Technology Data Exchange (ETDEWEB)

    Cardoso, Antonio


    Neutron Activation Analysis, using a Californium-252 neutron source, has been applied for the determination of manganese in ores such as pyrolusite, rodonite (manganese silicate)' and blending used in dry-batteries The favorable nuclear properties of manganese, such as high thermal neutron cross-section for the reaction {sup 55}Mn (n.gamma){sup 56} Mn, high concentration of manganese in the matrix and short half - life of {sup 56}Mn, are an ideal combination for non-destructive analysis of manganese in ores. Samples and standards of manganese dioxide were irradiated for about 20 minutes, followed by a 4 to 15 minutes decay and counted in a single channel pulse-height discrimination using a NaI(Tl) scintillation detector. Counting time was equal to 10 minutes. The interference of nuclear reactions {sup 56}Fe(n,p){sup 56}Mn and {sup 59} Co (n, {alpha}){sup 56} were studied, as well as problems in connection with neutron shadowing during irradiation, gamma-rays attenuation during counting and influence of granulometry of samples. One sample,was also analysed by wet-chemical method (sodium bismuthate) in order to compare results. As a whole, i t was shown that the analytical method of neutron activation for manganese in ores and blending, is a method simple, rapid and with good precision and accuracy. (author)

  6. Design of a homogeneous subcritical nuclear reactor based on thorium with a source of californium 252; Diseno de un reactor nuclear subcritico homogeneo a base de Torio con una fuente de Californio 252

    Energy Technology Data Exchange (ETDEWEB)

    Delgado H, C. E.; Vega C, H. R. [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas, Zac. (Mexico); Sajo B, L., E-mail: [Universidad Simon Bolivar, Laboratorio de Fisica Nuclear, Apdo. 89000, 1080A Caracas (Venezuela, Bolivarian Republic of)


    Full text: One of the energy alternatives to fossil fuels which do not produce greenhouse gases is the nuclear energy. One of the drawbacks of this alternative is the generation of radioactive wastes of long half-life and its relation to the generation of nuclear materials to produce weapons of mass destruction. An option to these drawbacks of nuclear energy is to use Thorium as part of the nuclear fuel which it becomes in U{sup 233} when capturing neutrons, that is a fissile material. In this paper Monte Carlo methods were used to design a homogeneous subcritical reactor based on thorium. As neutron reflector graphite was used. The reactor core is homogeneous and is formed of 70% light water as moderator, 12% of enriched uranium UO{sub 2}(NO{sub 3}){sub 4} and 18% of thorium Th(NO{sub 3}){sub 4} as fuel. To start the nuclear fission chain reaction an isotopic source of californium 252 was used with an intensity of 4.6 x 10{sup 7} s{sup -1}. In the design the value of the effective multiplication factor, whose value turned out k{sub eff} <1 was calculated. Also, the neutron spectra at different distances from the source and the total fluence were calculated, as well as the values of the ambient dose equivalent in the periphery of the reactor. (Author)

  7. {sup 240}Pu/239Pu isotopic ratios and 239+240Pu total measurements in surface and deep waters around Mururoa and Fangataufa atolls compared with Rangiroa atoll (French Polynesia)

    Energy Technology Data Exchange (ETDEWEB)

    Chiappini, R.; Pointurier, F.; Millies-Lacroix, J.C.; Lepetit, G.; Hemet, P. [Commissariat a l' Energie Atomique, Direction DAM-Ile de-France, Departement Analyse et Surveillance de l' Environnement. BP 12, 91680 Bruyeres-le-Chatel (France)


    The average values of 240Pu/239Pu mass isotopic ratios of plutonium deposited in Mururoa and Fangataufa atoll sediments by French atmospheric nuclear tests range from 3.5 to 5%. In order to assess the near field and far field influence of those deposits in the open ocean, two water profiles were measured for 239+240Pu and 240Pu/239Pu using, for the first time, an Inductively Coupled Plasma Mass Spectrometer which was developed to achieve femtogram detection limits. One site was located at the limit of the French territorial waters, which is 22 km distant from Mururoa. The second site was located close to Rangiroa atoll, at a distance of approximately 1200-km from French nuclear test sites. The sample volumes were approximately 500 litres and plutonium was purified prior to mass spectrometry and alpha spectrometry measurements. In Rangiroa, the 239+240Pu profile is comparable with those already determined in world open oceans but the maximum detected activity, 9 mBq/m{sup 3} at 500-600 m is a lot lower than those measured in the northern hemisphere. 240Pu/239Pu ratios were measured between 500 and 1000 m and were not statistically different from the typical 0.18{+-}0.01 ratio which characterises the global fallout. Consequently, any influence of plutonium from the tests in Mururoa and Fangataufa is not apparent at Rangiroa. The vertical distribution of 239+240Pu near Mururoa shows similar changes with depth but with a slight increase in concentration. 240Pu/239Pu mass ratios vary with depth, from 7 to 10% in the upper 500 m and in the deep waters (below 1000 m) to 15-16% between 600 and 1000 m. A contribution from plutonium deposited in the sediments at Mururoa and Fangataufa is observed at the limit of territorial waters, especially in surface and deep waters.

  8. Functional state of the bronchopulmonary system in Mayak nuclear workers inhaled plutonium-239 aerosols

    Energy Technology Data Exchange (ETDEWEB)

    Belyaeva, Z.; Grigoryeva, E.; Khokhryakov, V. [Southern Urals Biophysics Institute, Ozyorsk (Russian Federation)


    Full text of publication follows: The current system of the individual and collective protection facilities for nuclear personnel permits decreasing the radiation dose from internal emitters at the most. At the same time, specific production conditions do not exclude possible inhalation of plutonium-239 aerosols. As the lung is the critical organ for this isotope, the study of respiratory function is aimed at detecting of pre-clinical lung pathology. Early detection of internal exposure effects on functional state of respiratory apparatus is difficult due to a number of confounding actors of non-radiation nature, one of which is smoking. Functional state of bronchopulmonary system was studied in 386 males, workers of the first Russian nuclear facility. 1198 examinations were carried out during medical inspection as well as hospitalization for routine preventive inspection. Most of males (39.4%) started working at the age of 21-26 years and 27.2% at the age of 20 years. The main factors of occupational exposure were exposure to plutonium-239 aerosols and the external gamma -rays. The absorbed dose to lungs from incorporated plutonium-239 was 0-435.8 c Gy. Whole-body external gamma dose varied from 0 to 382 c Gy at the examination. Individual dosimetry data were provided by the Mayak Radiation Safety Department and Internal Dosimetry Laboratory of the Southern Urals Biophysics Institute. While studying respiratory function, the most informative indices characterizing the state of lung tissue and tracheobronchial system such as vital capacity inspiration, forced expiratory volume, forced inspiratory volume, test Tiffno, diffusion capacity, characteristics of the flow vs. volume of the forced vital capacity inspiration curve, and resistance were used. Analysis was done separately for smokers and nonsmokers. Smoking index, i.e. product of number of smoked cigarettes per day and number of years of smoking was considered an integral value. The study did not reveal the

  9. Deconvolution of 238,239,240Pu conversion electron spectra measured with a silicon drift detector. (United States)

    Pommé, S; Marouli, M; Paepen, J; Marković, N; Pöllänen, R


    Internal conversion electron (ICE) spectra of thin 238,239,240Pu sources, measured with a windowless Peltier-cooled silicon drift detector (SDD), were deconvoluted and relative ICE intensities were derived from the fitted peak areas. Corrections were made for energy dependence of the full-energy-peak counting efficiency, based on Monte Carlo simulations. A good agreement was found with the theoretically expected internal conversion coefficient (ICC) values calculated from the BrIcc database. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  10. R-matrix Analysis of the 239Pu Neutron Cross Sections (United States)

    de Saussure, G.; Perez, R. B.; Macklin, R. L.

    Pu-239 neutron cross-section data in the resolved resonance region were analyzed with the R-Matrix Bayesian Program SAMMY. Below 30 eV the cross sections computed with the multilevel parameters are consistent with recent fission and transmission measurements as well as with older capture and alpha measurements. Above 30 eV no suitable transmission data were available and only fission cross-section measurements were analyzed. However, since the analysis conserves the complete covariance matrix, the analysis can be updated by the Bayes method as transmission measurements become available. To date, the analysis of the fission measurements was completed up to 300 eV.

  11. Possible Fine Structure in the Delayed Neutron Yields in the Resonance Region for Pu-239 (United States)

    Ohsawa, Takaaki; Hambsch, Franz-Josef; Torii, Takayuki


    A method of analysis of fluctuation in the delayed neutron yield on the basis of the multimodal fission model was applied to the low-energy resolved resonances for Pu-239. The present calculation using recent data of the fluctuation of the mode branching ratios for the resolved resonances showed both positive and negative resonance structure in the delayed neutron yield relative to the thermal neutron value. This is in contrast to the U-235 case, for which mainly negative dips of about -3.5% were predicted.

  12. Prompt-fission γ-ray spectral characteristics from Pu-239(nth,f)




    In this paper we present new results for prompt fission γ-ray spectral characteristics from the thermal neutron induced fission of 239Pu. The measured spectra were unfolded using the detectors’ response functions simulated with Geant4. We obtained in average per fission a γ-ray multiplicity M ̄γ = (7.13 ± 0.12), a mean photon energy ε ̄γ = (0.85 ± 0.02) MeV, and an average total energy released in fission Eγ,tot = (6.10 ± 0.11) MeV. Our results are in good agreement with historical data measu...

  13. mec-associated dru typing in the epidemiological analysis of ST239 MRSA in Malaysia. (United States)

    Ghaznavi-Rad, E; Goering, R V; Nor Shamsudin, M; Weng, P L; Sekawi, Z; Tavakol, M; van Belkum, A; Neela, V


    The usefulness of mec-associated dru typing in the epidemiological analysis of methicillin-resistant Staphylococcus aureus (MRSA) isolated in Malaysia was investigated and compared with pulsed-field gel electrophoresis (PFGE), multilocus sequence typing (MLST), and spa and SCCmec typing. The isolates studied included all MRSA types in Malaysia. Multilocus sequence type ST188 and ST1 isolates were highly clonal by all typing methods. However, the dru typing of ST239 isolates produced the clearest discrimination between SCCmec IIIa and III isolates, yielding more subtypes than any other method. Evaluation of the discriminatory power for each method identified dru typing and PFGE as the most discriminatory, with Simpson's index of diversity (SID) values over 89%, including an isolate which was non-typeable by spa, but dru-typed as dt13j. The discriminatory ability of dru typing, especially with closely related MRSA ST239 strains (e.g., Brazilian and Hungarian), underscores its utility as a tool for the epidemiological investigation of MRSA.

  14. 237 Np analytical method using 239 Np tracers and application to a contaminated nuclear disposal facility

    Energy Technology Data Exchange (ETDEWEB)

    Snow, Mathew S.; Morrison, Samuel S.; Clark, Sue B.; Olson, John E.; Watrous, Matthew G.


    Environmental 237Np analyses are challenged by low 237Np concentrations and lack of an available yield tracer; we report a rapid, inexpensive 237Np analytical approach employing the short lived 239Np (t1/2 = 2.3 days) as a chemical yield tracer followed by 237Np quantification using inductively coupled plasma-mass spectrometry. 239Np tracer is obtained via separation from a 243Am stock solution and standardized using gamma spectrometry immediately prior to sample processing. Rapid digestions using a commercial, 900 watt “Walmart” microwave and Parr microwave vessels result in 99.8 ± 0.1% digestion yields, while chromatographic separations enable Np/U separation factors on the order of 106 and total Np yields of 95 ± 4% (2σ). Application of this method to legacy soil samples surrounding a radioactive disposal facility (the Subsurface Disposal Area at Idaho National Laboratory) reveal the presence of low level 237Np contamination within 600 meters of this site, with maximum 237Np concentrations on the order of 103 times greater than nuclear weapons testing fallout levels.

  15. Baseline Caesium-137 and Plutonium-239+240 inventory assessment for Central Europe (United States)

    Meusburger, Katrin; Borelli, Pasquale; Evrard, Olivier; Ketterer, Michael; Mabit, Lionel; van Oost, Kristof; Alewell, Christine; Panagos, Panos


    Artificial fallout radionuclides (FRNs) such as Caesium-137 and Plutonium-239+240 released as products of the thermonuclear weapons testing that took place from the mid-1950s to the early 1980s and from nuclear power plant accidents (e.g. Chernobyl) are useful tools to quantify soil redistribution. In combination with geostatistics, FRNs may have the potential to bridge the gap between small scale process oriented studies and modelling that simplifies processes and effects over large spatial scales. An essential requirement for the application of FRNs as soil erosion tracers is the establishment of the baseline fallout at undisturbed sites before its comparison to those inventories found at sites undergoing erosion/accumulation. For this purpose, undisturbed topsoil (0-20cm) samples collected in 2009 within the framework of the Land Use/Cover Area frame Survey (LUCAS) have been measured by gamma-spectrometry and ICP-MS to determine 137Cs (n=145) and 239+240Pu (n=108) activities. To restrict the analysis to undisturbed reference sites a geospatial database query selecting only sites having a slope angle Chernobyl fallout. The establishment of such baseline inventory map will provide a unique opportunity to assess soil redistribution for a comparable time-frame (1953-2009) following a harmonised methodological protocol across national boundaries.

  16. A Study of the 384 KeV Complex Gamma Emission from Plutonium-239

    Energy Technology Data Exchange (ETDEWEB)

    Forsyth, R.S.; Ronqvist, N.


    Plutonium-239 has been reported to emit a gamma of energy 384 KeV. Subsequent workers, using radiation of this energy as a nondestructive measure of the plutonium content of various materials, found that the peak obtained by sodium iodide scintillation spectrometry showed a pronounced shoulder at about 330 KeV. This shoulder has been attributed to protactinium-233 and to uranium-237. From the width of the peak, however, it is obvious that at least three contributors are present. The present paper describes gamma spectrometric studies of plutonium samples of several isotopic compositions using a sodium iodide detector and a lithium-drifted germanium detector. The 384 KeV peak has been shown to be a complex peak containing 12 gamma components due to plutonium-239 between 300 - 450 KeV, and their relative intensities have been estimated. Anion exchange and solvent extraction experiments have also demonstrated that two further contributions due to uranium-237 are present in plutonium containing significant amounts of plutonium-241.

  17. A multi-radionuclide approach to evaluate the suitability of {sup 239+240}Pu as soil erosion tracer

    Energy Technology Data Exchange (ETDEWEB)

    Meusburger, Katrin, E-mail: [Environmental Geosciences, University of Basel, Bernoullistrasse 30, CH-4056 Basel (Switzerland); Mabit, Lionel, E-mail: [Soil and Water Management and Crop Nutrition Laboratory, FAO/IAEA Agriculture & Biotechnology Laboratory, IAEA Laboratories, Seibersdorf (Austria); Ketterer, Michael, E-mail: [Chemistry Department, Metropolitan State University of Denver, CO (United States); Park, Ji-Hyung, E-mail: [Department of Environmental Science & Engineering, Ewha Womans University, Seoul 120-750 (Korea, Republic of); Sandor, Tarjan [Radioanalytical Reference Laboratory, Central Agricultural Office Food and Feed Safety Directorate (Hungary); Porto, Paolo, E-mail: [Dipartimento di AGRARIA, Università degli Studi “Mediterranea” di Reggio Calabria (Italy); Alewell, Christine, E-mail: [Environmental Geosciences, University of Basel, Bernoullistrasse 30, CH-4056 Basel (Switzerland)


    Fallout radionuclides have been used successfully worldwide as tracers for soil erosion, but relatively few studies exploit the full potential of plutonium (Pu) isotopes. Hence, this study aims to explore the suitability of the plutonium isotopes {sup 239}Pu and {sup 240}Pu as a method to assess soil erosion magnitude by comparison to more established fallout radionuclides such as {sup 137}Cs and {sup 210}Pb{sub ex}. As test area an erosion affected headwater catchment of the Lake Soyang (South Korea) was selected. All three fallout radionuclides confirmed high erosion rates for agricultural sites (> 25 t ha{sup −1} yr{sup −1}). Pu isotopes further allowed determining the origin of the fallout. Both {sup 240}Pu/{sup 239}Pu atomic ratios and {sup 239+240}Pu/{sup 137}Cs activity ratios were close to the global fallout ratio. However, the depth profile of the {sup 239+240}Pu/{sup 137}Cs activity ratios in undisturbed sites showed lower ratios in the top soil increments, which might be due to higher migration rates of {sup 239+240}Pu. The activity ratios further indicated preferential transport of {sup 137}Cs from eroded sites (higher ratio compared to the global fallout) to the depositional sites (smaller ratio). As such the {sup 239+240}Pu/{sup 137}Cs activity ratio offered a new approach to parameterize a particle size correction factor that can be applied when both {sup 137}Cs and {sup 239+240}Pu have the same fallout source. Implementing this particle size correction factor in the conversion of {sup 137}Cs inventories resulted in comparable estimates of soil loss for {sup 137}Cs and {sup 239+240}Pu. The comparison among the different fallout radionuclides highlights the suitability of {sup 239+240}Pu through less preferential transport compared to {sup 137}Cs and the possibility to gain information regarding the origin of the fallout. In conclusion, {sup 239+240}Pu is a promising soil erosion tracer, however, since the behaviour i.e. vertical migration in the

  18. Nuclear weapons produced 236U, 239Pu and 240Pu archived in a Porites Lutea coral from Enewetak Atoll. (United States)

    Froehlich, M B; Tims, S G; Fallon, S J; Wallner, A; Fifield, L K


    A slice from a Porites Lutea coral core collected inside the Enewetak Atoll lagoon, within 15 km of all major nuclear tests conducted at the atoll, was analysed for 236U, 239Pu and 240Pu over the time interval 1952-1964 using a higher time resolution than previously reported for a parallel slice from the same core. In addition two sediment samples from the Koa and Oak craters were analysed. The strong peaks in the concentrations of 236U and 239Pu in the testing years are confirmed to be considerably wider than the flushing time of the lagoon. This is likely due to the growth mechanism of the coral. Following the last test in 1958 atom concentrations of both 236U and 239Pu decreased from their peak values by more than 95% and showed a seasonal signal thereafter. Between 1959 and 1964 the weighted average of the 240Pu/239Pu atom ratio is 0.124 ± 0.008 which is similar to that in the lagoon sediments (0.129 ± 0.006) but quite distinct from the global fallout value of ∼0.18. This, and the high 239,240Pu and 236U concentrations in the sediments, provides clear evidence that the post-testing signal in the coral is dominated by remobilisation of the isotopes from the lagoon sediments rather than from global fallout. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. An examination of the potential fission-bomb weaponizability of nuclides other than 235U and 239Pu (United States)

    Reed, B. Cameron


    Long-lived fissionable isotopes other than uranium-235 and plutonium-239 are examined for possible use in fission weapons. A few other isotopes are potentially weaponizable and in some cases have been tried or their criticality experimentally demonstrated. In most cases, however, promising isotopes are either extremely rare, difficult to produce in quantity, or hazardous to handle. Some isotopes can serve to boost the yield of fission weapons, but 235U and 239Pu are likely to remain the only practical primary fuels for nuclear weapons. In view of this, and the fact that this analysis gives no engineering details on the design of nuclear weapons, this paper will be of no assistance to putative bomb-makers; rather, my purpose is to clarify the physics similarities between 235U and 239Pu that make them suitable candidates for fission weapons.

  20. Spatial statistical analysis of contamination level of 241Am and 239Pu, Thule, North-West Greenland

    Energy Technology Data Exchange (ETDEWEB)

    Strodl Andersen, J. (JSA EnviroStat (Denmark))


    A spatial analysis of data on radioactive pollution on land at Thule, North-West Greenland is presented. The data comprises levels of 241Am and 239,240Pu on land. Maximum observed level of 241Am is 2.8x105 Bq m-2. Highest levels were observed near Narsaarsuk. This area was also sampled most intensively. In Groennedal the maximum observed level of 241Am is 1.9-104 Bq m-2. Prediction of the overall amount of 241Am and 239,240Pu is based on grid points within the range from the nearest measurement location. The overall amount is therefore highly dependent on the model. Under the optimal spatial model for Narsaarsuk, within the area of prediction, the predicted total amount of 241Am is 45 GBq and the predicted total amount of 239,240Pu is 270 GBq. (Author)

  1. Historical changes in 239Pu and 240Pu sources in sedimentary records in the East China Sea: Implications for provenance and transportation

    DEFF Research Database (Denmark)

    Wang, Jinlong; Baskaran, Mark; Hou, Xiaolin


    the East China Sea (ECS) collected in the summer of 2013 (August 6–28). The 239+240Pu activity concentrations in surface sediment samples were found to range between 0.048 and 0.492 Bqkg−1and the 240Pu/239Pu atom ratios showed a similar trend as that of the 239,240Pu activities; the Pu atom ratios ranged...

  2. 239Pu(n,2n) 238Pu cross section inferred from IDA calculations and GEANIE measurements

    Energy Technology Data Exchange (ETDEWEB)

    Chen, H; Ormand, W E; Dietrich, F S


    This report presents the latest {sup 239}Pu(n,2n){sup 238}Pu cross sections inferred from calculations performed with the nuclear reaction-modeling code system, IDA, coupled with experimental measurements of partial {gamma}-ray cross sections for incident neutron energies ranging from 5.68 to 17.18 MeV. It is found that the inferred {sup 239}Pu(n,2n){sup 238}Pu cross section peaks at E{sub inc} {approx} 11.4 MeV with a peak value of approximately 326 mb. At E{sub inc} {approx} 14 MeV, the inferred {sup 239}Pu(n,2n){sup 238}Pu cross section is found to be in good agreement with previous radio-chemical measurements by Lockheed. However, the shape of the inferred {sup 239}Pu(n,2n){sup 238}Pu cross section differs significantly from previous evaluations of ENDL, ENDF/B-V and ENDF/B-VI. In our calculations, direct, preequilibrium, and compound reactions are included. Also considered in the modeling are fission and {gamma}-cascade processes in addition to particle emission. The main components of physics adopted and the parameters used in our calculations are discussed. Good agreement of the inferred {sup 239}Pu(n,2n){sup 238}Pu cross sections derived separately from IDA and GNASH calculations is shown. The two inferences provide an estimate of variations in the deduced {sup 239}Pu(n,2n){sup 238}Pu cross section originating from modeling.

  3. Indolizidine 239Q and Quinolizidine 275I. Major alkaloids in two Argentinian bufonid toads (Melanophryniscus) (United States)

    Daly, John W.; Garraffo, H. Martin; Spande, Thomas F.; Yeh, Herman J. C.; Peltzer, Paola M.; Cacivio, Pedro; Baldo, J. Diego; Faivovich, Julián


    Alkaloid profiles in skin of poison frogs/toads (Dendrobatidae, Mantellidae, Bufonidae, and Myobatrachidae) are highly dependent on diet and hence on the nature of habitat. Extracts of the two species of toads (Melanophryniscus klappenbachi and M. cupreuscapularis) from similar habitats in the Corrientes/Chaco Provinces of Argentina have similar profiles of alkaloids, which differ considerably from profiles from other Melanophryniscus species from Brazil, Uruguay and Argentina. Structures of two major alkaloids 239Q (1) and 275I (2) were determined by mass, FTIR, and NMR spectral analysis as 5Z,9Z-3-(1-hydroxybutyl)-5-propylindolizidine and 6Z,10E-4,6-di(pent-4-enyl) quinolizidine, respectively. A third alkaloid, 249F (3), is postulated to be a homopumiliotoxin with an unprecedented conjugated exocyclic diene moiety. PMID:18848574

  4. Environmental aspects of the transuranics: a selected, annotated bibliography. [Pu-238, Pu-239

    Energy Technology Data Exchange (ETDEWEB)

    Ensminger, J.T.; Martin, F.M.; Fore, C.S. (comps.)


    This eighth published bibliography of 427 references is compiled from the Nevada Applied Ecology Information Center's Data Base on the Environmental Aspects of the Transuranics. The data base was built to provide information support to the Nevada Applied Ecology Group (NAEG) of ERDA's Nevada Operations Office. The general scope covers environmental aspects of uranium and the transuranic elements, with emphasis on plutonium. This bibliography highlights literature on plutonium 238 and 239 and americium in the critical organs of man and animals. Supporting information on ecology of the Nevada Test Site and reviews and summarizing literature on other radionuclides have been included at the request of the NAEG. The references are arranged by subject category with leading authors appearing alphabetically in each category. Indexes are provided for author(s), geographic location, keyword(s), taxon, title, and publication description.

  5. Calculation of 239Pu fission observables in an event-by-event simulation

    Energy Technology Data Exchange (ETDEWEB)

    Vogt, R; Randrup, J; Pruet, J; Younes, W


    The increased interest in more exclusive fission observables has demanded more detailed models. We describe a new computational model, FREYA, that aims to meet this need by producing large samples of complete fission events from which any observable of interest can then be extracted consistently, including any interesting correlations. The various model assumptions are described and the potential utility of the model is illustrated. As a concrete example, we use formal statistical methods, experimental data on neutron production in neutron-induced fission of {sup 239}Pu, along with FREYA, to develop quantitative insights into the relation between reaction observables and detailed microscopic aspects of fission. Current measurements of the mean number of prompt neutrons emitted in fission taken together with less accurate current measurements for the prompt post-fission neutron energy spectrum, up to the threshold for multi-chance fission, place remarkably fine constraints on microscopic theories.

  6. Performance Assessment of 239 Series Sub-cooling Heat Exchangers for the Large Hadron Collider

    CERN Document Server

    Riddone, G; Roussel, P; Moracchioli, R; Tavian, L


    Helium sub-cooling heat exchangers of the counter-flow type are used to minimize the vapor fraction produced in the final expansion of the 1.9 K distributed cooling loops used for cooling the superconducting magnets of the Large Hadron Collider (LHC). These components are of compact design, featuring low-pressure drop and handling very low pressure vapor at low temperature. Following a qualification phase of prototypes, a contract has been placed in European industry for the supply of 239 heat exchanger units. Different levels of extracted heat load require three different variants of heat exchangers. This paper will describe the manufacturing phase with emphasis on the main difficulties encountered to keep the production quality after a brief recall of the prototype phase. Finally, the acceptance tests performed at room temperature and at the nominal cryogenic condition at the factory and at CEA-Grenoble will be presented.

  7. Combined exposure of F344 rats to beryllium metal and plutonium-239 dioxide

    Energy Technology Data Exchange (ETDEWEB)

    Finch, G.L.; Carlton, W.W.; Rebar, A.H. [Purdue Univ., Lafayette, IN (United States)] [and others


    Nuclear weapons industry workers have the potential for inhalation exposures to plutonium (Pu) and other agents, such as beryllium (Be) metal. The purpose of this ongoing study is to investigate potential interactions between Pu and Be in the production of lung tumors in rats exposed by inhalation to particles of {sup 239}PuO{sub 2}, Be metal, or these agents in combination. Inhaled Pu deposited in the lung delivers high-linear-energy transfer, alpha-particle radiation and is known to induce pulmonary cancer in laboratory animals. Although the epidemiological evidence implicating Be in the induction of human lung cancer is weak and controversial, various studies in laboratory animals have demonstrated the pulmonary carcinogenicity of Be. As a result, Be is classified as a suspect human carcinogen in the United STates and as a demonstrated human carcinogen by the International Agency for Research on Cancer. This study is in progress.

  8. Comparison of rats and dogs exposed to /sup 239/PuO/sub 2/

    Energy Technology Data Exchange (ETDEWEB)

    Mahaffey, J.A.; Sanders, C.L.; Park, J.F.; Dagle, G.E.


    Rats and dogs inhaled aerosols of /sup 239/PuO/sub 2/ at comparable ages relative to their lifespan. Both received a single exposure. The estimated lung doses at death in dogs were between 1100 and 11,000 rad. From two inhalation experiments, rats receiving doses in this range were chosen from the high-level exposed animals for comparison. Based on this data base, several comparisons were investigated. Metabolism of the material was compared for all animals and for animals which developed lung tumors. The differences in histopathology and tumor incidence in the lung were also reviewed. Although there were several differences between species, there were also many similarities. On-going research in dogs should produce data which will allow clarification of these relationships.

  9. Characterization of a {sup 239}PuBe isotopic neutron source

    Energy Technology Data Exchange (ETDEWEB)

    Vega C, H. R.; Hernandez D, V. M. [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas (Mexico); Rivera M, T. [IPN, Centro de Investigacion en Ciencia Aplicada y Tecnologia Avanzada, Calz. Legaria No. 694, Col. Irrigacion, 11500 Mexico D. F. (Mexico); Sanchez, A., E-mail: [IPN, Escuela Superior de Fisica y Matematicas, 07738 Mexico D. F. (Mexico)


    A Bonner sphere spectrometer was used to determine the features of a {sup 239}PuBe neutron source used to operate the ESFM-Ipn Subcritical Reactor. The spectrometer is a {sup 6}Lil(Eu) scintillator and 2, 3, 5, 8, 10 and 12 inches-diameter polyethylene spheres, that was located 100 cm from the neutron source. The count rates obtained with the spectrometer were unfolded using the NSDUAZ code and neutron spectrum, total fluence, and ambient dose equivalent were determined. A Monte Carlo calculation, using the MCNP5 code, was carried out to estimate the spectrum and integral features being less that values obtained experimentally due to the presence of {sup 241}Pu in the Pu used to fabricate the source. Using the experimental information the actual neutron yield and the mass fraction of {sup 241}Pu was estimated. (Author)

  10. Investigation of zircon/zirconia ceramics doped with {sup 239}Pu and {sup 238}Pu

    Energy Technology Data Exchange (ETDEWEB)

    Burakov, B.E.; Anderson, E.B.; Zamoryanskaya, M.V.; Nikolaeva, E.V.; Strykanova, E.E.; Yagovkina, M.A. [V.G. Khlopin Radium Institute, Saint Petersburg (Russian Federation)


    Several samples of crystalline double-phase ceramics based on zircon, (Zr,Pu)SiO{sub 4} and zirconia, (Zr,Pu)O{sub 2}, were synthesized by sintering in air, precursors containing approximately 5-6 and 10 wt% {sup 239}Pu, respectively. One sample doped with 5-6 wt% {sup 238-39-40}Pu was also obtained under the same conditions. All ceramic samples were studied by X-ray powder diffraction (XRD), scanning electron microscopy (SEM), electron probe microanalysis (EPMA) and MCC-1 leach test in deionized water at 90 C. Results indicate that even radiation damaged zircon/zirconia ceramics retain high chemical resistance and mechanical durability. (author)

  11. Dependence of dose coefficients for {sup 239}Pu on transfer rates and absorption parameters

    Energy Technology Data Exchange (ETDEWEB)

    Suzuki, K.; Sekimoto, H. [Research Laboratory for Nuclear Reactors, Tokyo Institute of Technology, Tokyo (Japan); Ishigure, N. [Division of Radiotoxicology and Protection, National Institute of Radiological Sciences, Chiba (Japan)


    As it is reported of the biokinetic models and parameter values of the International Commission on Radiological Protection (ICRP) for dose estimation have uncertainties owing to insufficiency of human data. For most radionuclides, the data underlying such models and parameters of ICRP usually depend on animal experiments. Moreover, these values or model parameter are also greatly different between mammalian species. Recently, various radiation protection organizations are considering the biokinetic uncertainties from standpoints of data's sources, quality and completeness. In practice, a sensitivity analysis of doses to parameters is significant for the purpose of risk assessment. In general, movement or material in the body is depicted as a system of first-order processes, and parameter values are expressed as transfer rates between compartments. In this study, we made a code to reproduce the ICRP's dose coefficients for {sup 239}Pu, which is one of the most important elements for occupational exposure and its effective dose is much concerned with its own distribution in the body for dominance of alpha-decay. By using this code, we modified each transfer rate in a factor of 2, 3 and 4 in order to evaluate the effects, and calculated the sensitivities of effective doses due to these changes. Additionally, we examined the effects of modification of absorption parameters f{sub r}, S{sub r} and S{sub s}, which represent the absorption of particles from respiratory tract into blood. Consequently, the transfer rates that give a large sensitivity were specified, and it was shown that changes of transfer rates and absorption parameters are not so influential on effective doses for {sup 239}Pu in many cases. (author)

  12. Radioecologycal study of 239/240Pu in Bangka Island and Muria Peninsula: Determination of 239/240Pu in marine sediment and seawater as part of baseline data collecting for sitting of candidates of first Indonesia NPP (United States)

    Suseno, Heny; Wisnubroto, Djarot S.


    Radioisotope Pu-239/240 are alpha emitting nuclides important indicators of radioactive contamination of the marine environment. Global fallout is the main source of plutonium in the marine environment. There are very limited study on 239/240Pu in Indonesia coastal environments. The data of this radioisotopes is needed for baseline data of nuclear power plant (NPP) site candidates both in Bangka Island and Muria Peninsula. Bottom sediments play an important role in radioecological studies of the marine environment because a large proportion of radioactive substances entering the sea is adsorbed over time onto suspended particulate matter and deposited in sediments. Plutonium is particle reactive and deposited in marine sediment. Radioisotope 239/240Pu was determinated by alpha spectrometry after radiochemical procedure that was performed in both water and marine sediment from Bangka Island and Muria Peninsula. The sediment baseline of concentration 239/240Pu in Bangka Island and Muria Peninsula were range from 0.013 to 0.021 and 0.018 to 0.024 respectively. The water baseline concentration this isotope were range from 2.73 to 4.05 mBq.m-3 and 2.98 to 4.50 mBq.m-3.

  13. 78 FR 71983 - Delegation of Functions Under Sections 1261(b) and 1262(a) of Public Law 112-239 (United States)


    ... From the Federal Register Online via the Government Publishing Office ] Vol. 78 Friday,--- No. 230 November 29, 2013 Part VII The President Memorandum of October 28, 2013--Delegation of Functions Under Sections 1261(b) and 1262(a) of Public Law 112-239 #0; #0; #0; Presidential Documents #0; #0; #0;#0;Federal Register / Vol. 78 , No. 230 / Friday, November 29,...

  14. [Modifying effect of tributylphosphate (TBP) and hexachlorbutadien (HCLB) on non-stochastic effects of inhaled Pu-239]. (United States)

    Spirina, S S; Kirillova, E N; Kaminskaia, T V; Kalmykova, Z I; Liubchanskiĭ, E R; Chudin, V A


    It has been established in experiments on rats that under combined inhalation exposure to 239Pu along with TBP and HCLB in amounts which may cause the changes in blood and immune systems the enhancing of different non-stochastic effects on the average by two times on a basis of a unit absorbed dose in comparison with isolated nuclide inhalation.

  15. [State of cellular immunity effectors of the lung in inhalation exposure to low-transportable Pu-239]. (United States)

    Sokol'nikov, M E; Kirillova, E N; Muksinova, K N; Smirnov, D G; Sokhranich, A L


    The reduction of populations of lung cell immunity effectors as well as changes in their cytotoxic and phagocytic activity was observed in rats after inhalation exposure to polymeric 239Pu. Dose-response curves described as a function of absorbed dose of alpha-irradiation in lung.

  16. Deconvolution of 238,239,240Pu conversion electron spectra measured with a silicon drift detector

    DEFF Research Database (Denmark)

    Pommé, S.; Marouli, M.; Paepen, J.


    Internal conversion electron (ICE) spectra of thin 238,239,240Pu sources, measured with a windowless Peltier-cooled silicon drift detector (SDD), were deconvoluted and relative ICE intensities were derived from the fitted peak areas. Corrections were made for energy dependence of the full-energy-...

  17. Biosynthesis of aromatic amino acids in Nocardia sp. 239 : effects of amino acid analogues on growth and regulatory enzymes

    NARCIS (Netherlands)

    Boer, L. de; Grobben, G.; Vrijbloed, J.W.; Dijkhuizen, L.


    Further steps required for overproduction of aromatic amino acids by a mutant strain of Nocardia sp. 239 (Noc 87-13), unable to grow on L-phenylalanine as a sole carbon and energy source, were investigated. A number of analogues of the aromatic amino acids displayed severe inhibitory effects on the

  18. Purification, characterization and regulation of a monomeric L-phenylalanine dehydrogenase from the facultative methylotroph Nocardia sp. 239

    NARCIS (Netherlands)

    Boer, L. de; Rijssel, M. van; Euverink, G.J.; Dijkhuizen, L.


    In Nocardia sp. 239 D-phenylalanine is converted into L-phenylalanine by an inducible amino acid racemase. The further catabolism of this amino acid involves an NAD-dependent L-phenylalanine dehydrogenase. This enzyme was detected only in cells grown on L- or D-phenylalanine and in batch cultures

  19. 17 CFR 239.18 - Form S-11, for registration under the Securities Act of 1933 of securities of certain real estate... (United States)


    ... under the Securities Act of 1933 of securities of certain real estate companies. 239.18 Section 239.18... Securities Act of 1933 of securities of certain real estate companies. This form shall be used for registration under the Securities Act of 1933 of (a) securities issued by real estate investment trusts, as...

  20. Effects of the histamine H₃ receptor antagonist ABT-239 on cognition and nicotine-induced memory enhancement in mice. (United States)

    Kruk, Marta; Miszkiel, Joanna; McCreary, Andrew C; Przegaliński, Edmund; Filip, Małgorzata; Biała, Grażyna


    The strong correlation between central histaminergic and cholinergic pathways on cognitive processes has been reported extensively. However, the role of histamine H(3) receptor mechanisms interacting with nicotinic mechanisms has not previously been extensively investigated. The current study was conducted to determine the interactions of nicotinic and histamine H(3) receptor systems with regard to learning and memory function using a modified elevated plus-maze test in mice. In this test, the latency for mice to move from the open arm to the enclosed arm (i.e., transfer latency) was used as an index of memory. We tested whether ABT-239 (4-(2-{2-[(2R)-2-methylpyrrolidinyl]ethyl}-benzofuran-5-yl), an H(3) receptor antagonist/inverse agonist, had influence on two different stages of memory, i.e., memory acquisition and consolidation (administered prior to or immediately after the first trial, respectively) and whether ABT-239 influenced nicotine-induced memory enhancement. Our results revealed that the acute administration of nicotine (0.035 and 0.175 mg/kg), but not of ABT-239 (0.1-3 mg/kg) reduced transfer latency in the acquisition and consolidation phases. In combination studies, concomitant administration of either ABT-239 (1 and 3 mg/kg) and nicotine (0.035 mg/kg), or ABT-239 (0.1 mg/kg) and nicotine (0.0175 mg/kg) further increased nicotine-induced improvement in both memory acquisition and consolidation. The present data confirm an important role for H(3) receptors in regulating nicotine-induced mnemonic effects since inhibition of H(3) receptors augmented nicotine-induced memory enhancement in mice.

  1. Suitability of 239+240Pu and 137Cs as tracers for soil erosion assessment in mountain grasslands. (United States)

    Alewell, Christine; Meusburger, Katrin; Juretzko, Gregor; Mabit, Lionel; Ketterer, Michael E


    Anthropogenic radionuclides have been distributed globally due to nuclear weapons testing, nuclear accidents, nuclear weapons fabrication, and nuclear fuel reprocessing. While the negative consequences of this radioactive contamination are self-evident, the ubiquitous fallout radionuclides (FRNs) distribution form the basis for the use as tracers in ecological studies, namely for soil erosion assessment. Soil erosion is a major threat to mountain ecosystems worldwide. We compare the suitability of the anthropogenic FRNs, 137Cs and 239+240Pu as soil erosion tracers in two alpine valleys of Switzerland (Urseren Valley, Canton Uri, Central Swiss Alps and Val Piora, Ticino, Southern Alps). We sampled reference and potentially erosive sites in transects along both valleys. 137Cs measurements of soil samples were performed with a Li-drifted Germanium detector and 239+240Pu with ICP-MS. Our data indicates a heterogeneous deposition of the 137Cs, since most of the fallout origins from the Chernobyl April/May 1986 accident, when large parts of the European Alps were still snow-covered. In contrast, 239+240Pu fallout originated mainly from 1950s to 1960s atmospheric nuclear weapons tests, resulting in a more homogenous distribution and thus seems to be a more suitable tracer in mountainous grasslands. Soil erosion assessment using 239+240Pu as a tracer pointed to a huge dynamic and high heterogeneity of erosive processes (between sedimentation of 1.9 and 7 t ha(-1) yr(-1) and erosion of 0.2-16.4 t ha(-1) yr(-1) in the Urseren Valley and sedimentation of 0.4-20.3 t ha(-1) yr(-1) and erosion of 0.1-16.4 t ha(-1) yr(-1) at Val Piora). Our study represents a novel and successful application of 239+240Pu as a tracer of soil erosion in a mountain environment. Copyright © 2013 The Authors. Published by Elsevier Ltd.. All rights reserved.

  2. Pu-239 organ specific dosimetric model applied to non-human biota (United States)

    Kaspar, Matthew Jason

    There are few locations throughout the world, like the Maralinga nuclear test site located in south western Australia, where sufficient plutonium contaminate concentration levels exist that they can be utilized for studies of the long-term radionuclide accumulation in non-human biota. The information obtained will be useful for the potential human users of the site while also keeping with international efforts to better understand doses to non-human biota. In particular, this study focuses primarily on a rabbit sample set collected from the population located within the site. Our approach is intended to employ the same dose and dose rate methods selected by the International Commission on Radiological Protection and adapted by the scientific community for similar research questions. These models rely on a series of simplifying assumptions on biota and their geometry; in particular; organisms are treated as spherical and ellipsoidal representations displaying the animal mass and volume. These simplifications assume homogeneity of all animal tissues. In collaborative efforts between Colorado State University and the Australian Nuclear Science and Technology Organisation (ANSTO), we are expanding current knowledge on radionuclide accumulation in specific organs causing organ-specific dose rates, such as Pu-239 accumulating in bone, liver, and lungs. Organ-specific dose models have been developed for humans; however, little has been developed for the dose assessment to biota, in particular rabbits. This study will determine if it is scientifically valid to use standard software, in particular ERICA Tool, as a means to determine organ-specific dosimetry due to Pu-239 accumulation in organs. ERICA Tool is normally applied to whole organisms as a means to determine radiological risk to whole ecosystems. We will focus on the aquatic model within ERICA Tool, as animal organs, like aquatic organisms, can be assumed to lie within an infinite uniform medium. This model would

  3. Historical changes in 239Pu and 240Pu sources in sedimentary records in the East China Sea: Implications for provenance and transportation (United States)

    Wang, Jinlong; Baskaran, Mark; Hou, Xiaolin; Du, Jinzhou; Zhang, Jing


    Concentrations and isotopic compositions of plutonium (Pu) are widely used for its source identification and to determine transport processes of Pu-associated particulate matter and water. We investigated the concentrations of 239Pu and 240Pu and their ratios in a number of sediment samples from the East China Sea (ECS) collected in the summer of 2013 (August 6-28). The 239+240Pu activity concentrations in surface sediment samples were found to range between 0.048 and 0.492 Bq kg-1 and the 240Pu/239Pu atom ratios showed a similar trend as that of the 239, 240Pu activities; the Pu atom ratios ranged from 0.158 to 0.297 and were mostly higher than the mean global fallout value of 0.18. The 239, 240Pu inventories in the ECS varied widely, from 2 to 807 Bq m-2, with the highest values commonly found in the coastal areas. In the Yangtze Estuary, the mean 239+240Pu activity concentration is close to the estimated value of the suspended material from the Yangtze River catchment (0.18 Bq kg-1), and the 240Pu/239Pu atom ratio was found to be ∼0.18, which indicates that the Yangtze River input is the dominant source of Pu for this area. The total annual Yangtze River input of 239+240Pu was estimated to be 2.4 ×1010 Bq, which is small compared to the total amount of 239+240Pu buried, 3.1 ×1013 Bq in the whole ECS. The Pacific Proving Ground input appears to be the dominant source of Pu to the ECS, accounting for 45%-52% of the total inventory. The fractional amount of 239+240Pu scavenged from the total 239+240Pu transported by the Kuroshio Current (KC) and Taiwan Warm Current (TWC) into ECS sediments is estimated to be ∼10%. Our study shows that the 240Pu/239Pu atom ratio is useful not only to obtain a better insight of the biogeochemistry influenced by the KC, but also to trace the long-range transport of other particle-reactive species. Besides, the sedimentation rates obtained based on the penetration depths of 239+240Pu and vertical profiles of excess 210Pb agree

  4. Pu239 Cross-Section Variations Based on Experimental Uncertainties and Covariances

    Energy Technology Data Exchange (ETDEWEB)

    Sigeti, David Edward [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Williams, Brian J. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Parsons, D. Kent [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)


    Algorithms and software have been developed for producing variations in plutonium-239 neutron cross sections based on experimental uncertainties and covariances. The varied cross-section sets may be produced as random samples from the multi-variate normal distribution defined by an experimental mean vector and covariance matrix, or they may be produced as Latin-Hypercube/Orthogonal-Array samples (based on the same means and covariances) for use in parametrized studies. The variations obey two classes of constraints that are obligatory for cross-section sets and which put related constraints on the mean vector and covariance matrix that detemine the sampling. Because the experimental means and covariances do not obey some of these constraints to sufficient precision, imposing the constraints requires modifying the experimental mean vector and covariance matrix. Modification is done with an algorithm based on linear algebra that minimizes changes to the means and covariances while insuring that the operations that impose the different constraints do not conflict with each other.

  5. Dominant lethal and ovarian effects of plutonium-239 in female mice

    Energy Technology Data Exchange (ETDEWEB)

    Searle, A.G.; Beechey, C.V.; Green, D.; Howells, G.R. (Medical Research Council, Harwell (UK). Radiobiological Research Unit)


    (C3H x 101)F/sub 1/ female mice were injected intravenously with /sup 239/Pu in trisodium citrate, then mated in pairs to strain CBA males, to test for dominant lethality. In the first experiment kg/sup -1/ and in the second kg/sup -1/ body mass was injected. Matings were after 6 days in the first experiment (estimated ovarian absorbed dose of 0.1 Gy) and after 3,6 or 12 weeks in the second (estimated ovarian doses of 1.11, 2.45 and 5.91 Gy respectively). No evidence of dominant lethal induction was found in the first experiment, but in the second there was a significant increase over controls in pre-implantation loss in all three series. Post-implantation lethality increased significantly (by 12%) only after 12 weeks' exposure. With the 6- and 12-week exposures (especially the latter) luteal counts fell, fewer females becoming pregnant than in controls. This is attributed to oocyte killing by the ..cap alpha..-particles. Histological and autoradiographic investigations showed a marked reduction in ovarian size and follicular numbers with fission-tracks clustered mainly over the medullary stroma. The preimplantation loss may stem from lowered fertilization of oocytes because of their damage, so that the best measure of dominant lethality is that based on post-implantation death.

  6. Measurement of the fission cross-section of {sup 235}U and {sup 239}Pu for thermal neutrons; Mesures des sections de fission de {sup 235}U et de {sup 239}Pu en neutrons thermiques

    Energy Technology Data Exchange (ETDEWEB)

    Fraysse, G.; Prosdocimi, A.; Netter, F.; Samour, C. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires


    Improved techniques of fast detection have been applied for determining the fission cross-sections of {sup 235}U and {sup 239}Pu with reference to the absorption cross-section of Boron. Monochromatic neutron beams of 0.0322 eV, 0.0626 eV and 0.275 eV have been employed. Use has been made of a Xe-filled gaseous scintillator and of a low-geometry solid state ion chamber. Both measured alpha and fission rates. The results at the reference energy of 0.0253 eV are: ({sigma}{sub F}){sub 0} {sup 235}U = 588 {+-} 10 barns ({sigma}{sub F}){sub 0} {sup 239}Pu = 738 {+-} 7 barns. (authors) [French] Des techniques avancees de comptage rapide ont ete mise en oeuvre pour determiner la section efficace de fission de {sup 235}U et de {sup 239}Pu par rapport a celle d'absorption du bore. Des faisceaux de neutrons monochromatiques de 0,0322 eV, 0,0626 eV et 0,275 eV ont ete employes. Les detecteurs utilises sont un scintillateur gazeux rempli de xenon et une chambre d'ionisation a etat solide a basse geometrie. Les deux ont mesure les taux des desintegrations alpha et des fissions. Les resultats a l'energie de reference de 0,0253 eV sont: ({sigma}{sub F}){sub 0} {sup 235}U = 588 {+-} 10 barns ({sigma}{sub F}){sub 0} {sup 239}Pu = 738 {+-} 7 barns. (auteurs)

  7. Revisiting the U-238 thermal capture cross section and gamma-raymission probabilities from Np-239 decay

    Energy Technology Data Exchange (ETDEWEB)

    Trkov, A.; Molnar, G.L.; Revay, Zs.; Mughabghab, S.F.; Firestone,R.B.; Pronyaev, V.G.; Nichols, A.L.; Moxon, M.C.


    The precise value of the thermal capture cross section of238U is uncertain, and evaluated cross sections from various sourcesdiffer by more than their assigned uncertainties. A number of theoriginal publications have been reviewed to assess the discrepant data,corrections were made for more recent standard cross sections andotherconstants, and one new measurement was analyzed. Due to the strongcorrelations in activation measurements, the gamma-ray emissionprobabilities from the beta decay of 239Np were also analyzed. As aresult of the analysis, a value of 2.683 +- 0.012 barns was derived forthe thermal capture cross section of 238U. A new evaluation of thegamma-ray emission probabilities from 239Np decay was alsoundertaken.

  8. Spa therapy for elderly: a retrospective study of 239 older patients with osteoarthritis (United States)

    Karagülle, Mine; Kardeş, Sinan; Dişçi, Rian; Gürdal, Hatice; Karagülle, Müfit Zeki


    Very few studies tested the effectiveness of spa therapy in older patients with osteoarthritis. Therefore, we aimed to evaluate the short-term effects of spa therapy in patients aged 65 years and older with generalized, knee, hip, and cervical and lumbar spine osteoarthritis. In an observational retrospective study design at the Medical Ecology and Hydroclimatology Department of Istanbul Medical Faculty, we analyzed the records of 239 patients aged over 65 years with the diagnosis of all types of osteoarthritis who were prescribed a spa therapy course in some spa resorts in Turkey between 7 March 2002 and 31 December 2012. They travelled to a spa resort where they stayed at a thermal spa hotel and followed the usual therapy packages for 2 weeks. Patients were assessed by an experienced physician within a week before the spa journey and within a week after the completion of the spa therapy. Compared with baseline in whole sample, statistically significant improvements were observed in pain (visual analog scale, VAS), patient and physician global assessments (VAS), Health Assessment Questionnaire disability index (HAQ-DI), Lequesne algofunctional index (LAFI) for knee, Western Ontario and McMaster Universities index (WOMAC), Waddell disability index (WDI), and Neck Pain and Disability Scale (NPAD). According to Outcome Measures in Rheumatology—Osteoarthritis Research Society International (OMERACT-OARSI) Set of Responder Criteria, responder rate were 63.8 % (51/80) in generalized, 52 % (13/25) in knee, 50 % (2/4) in hip, 66.7 % (8/12) in lumbar, and 100 % (6/6) in cervical osteoarthritis subgroups. Spa therapy improved pain and physical functional status in older patients with osteoarthritis, especially generalized osteoarthritis and multiple joint osteoarthritis with involvement of knee. This improvement was clinically important in majority of the patients. To confirm the results of this preliminary study, there is a need of a randomized controlled clinical study

  9. Surgical site infections in spine surgery: identification of microbiologic and surgical characteristics in 239 cases. (United States)

    Abdul-Jabbar, Amir; Berven, Sigurd H; Hu, Serena S; Chou, Dean; Mummaneni, Praveen V; Takemoto, Steven; Ames, Christopher; Deviren, Vedat; Tay, Bobby; Weinstein, Phil; Burch, Shane; Liu, Catherine


    Retrospective analysis. The objective of this study was to describe the microbiology of surgical site infection (SSI) in spine surgery and relationship with surgical management characteristics. SSI is an important complication of spine surgery that results in significant morbidity. A comprehensive and contemporary understanding of the microbiology of postoperative spine infections is valuable to direct empiric antimicrobial treatment and prophylaxis and other infection prevention strategies. All cases of spinal surgery associated with SSI between July 2005 and November 2010 were identified by the hospital infection control surveillance program using Centers for Disease Control National Health Safety Network criteria. Surgical characteristics and microbiologic data for each case were gathered by direct medical record review. Of 7529 operative spine cases performed between July 2005 and November 2010, 239 cases of SSI were identified. The most commonly isolated pathogen was Staphylococcus aureus (45.2%), followed by Staphylococcus epidermidis (31.4%). Methicillin-resistant organisms accounted for 34.3% of all SSIs and were more common in revision than in primary surgical procedures (47.4% vs. 28.0%, P = 0.003). Gram-negative organisms were identified in 30.5% of the cases. Spine surgical procedures involving the sacrum were significantly associated with gram-negative organisms (P spine. Cefazolin-resistant gram-negative organisms accounted for 61.6% of all gram-negative infections and 18.8% of all SSIs. Although gram-positive organisms predominated, gram-negative organisms accounted for a sizeable portion of SSI, particularly among lower lumbar and sacral spine surgical procedures. Nearly half of infections in revision surgery were due to a methicillin-resistant organism. These findings may help guide choice of empiric antibiotics while awaiting culture data and antimicrobial prophylaxis strategies in specific spine surgical procedures. 3.

  10. Effects of combined exposure of F344 rats to inhaled Plutonium-239 dioxide and a chemical carcinogen (NNK)

    Energy Technology Data Exchange (ETDEWEB)

    Lundgren, D.L.; Carlton, W.W. [Purdue Univ., Lafayette, IN (United States); Griffith, W.C. [and others


    Workers in nuclear weapons facilities have a significant potential for exposure to chemical carcinogens and to radiation from external sources or from internally deposited radionuclides such as {sup 239}Pu. Although the carcinogenic effects of inhaled {sup 239}Pu and many chemicals have been studied individually, very little information is available on their combined effects. One chemical carcinogen that workers could be exposed to via tobacco smoke is the tobacco-specific nitrosamine 4-(N-methyl-n-nitrosamino)-1-(3-pyridyl)-1(3-pyridyl)-1-butanone (NNK), a product of tobacco curing and the pyrolysis of nicotine in tobacco. NNK causes lung tumors in rats, regardless of the route of administration and to a lesser extent liver, nasal, and pancreatic tumors. From the results presented, it can be concluded that exposure to a chemical carcinogen (NNK) in combination with {alpha}-particle radiation from inhaled {sup 239}PuO{sub 2} acts in, at best, an additive manner in inducing lung cancer in rats.

  11. Pertubation in the 240Pu/239Pu global fallout ratio in local sediments following the nuclear accidents at Thule (Greenland) and Palomares (Spain)

    DEFF Research Database (Denmark)

    Mitchell, P.I.; León Vintró, L.; Dahlgaard, H.


    in samples of sediment (and soil) collected at Thule (Greenland) and Palomares (Spain), where accidents involving the release and dispersion of plutonium from fractured nuclear weapons occurred in 1968 and 1966, respectively. The Pu-240/Pu-239 ratio was measured by high-resolution alpha spectrometry...... with those reported for weapons-grade plutonium. It is noteworthy that the mean Pu-238/Pu-239 activity ratio in the Thule samples, at 0.0150 +/- 0.0017 (n = 4), was also lower than that measured in the Palomares samples, namely, 0.0275 +/- 0.0012 (n = 4). The Pu-241/Pu-239 ratios were similarly different...

  12. Comparison of neutron induced fission and capture in Np-237 and Pu-239 irradiated in QUINTA assembly with 660 MeV proton beam (United States)

    Kilim, Stanislaw; Strugalska-Gola, Elzbieta; Szuta, Marcin; Bielewicz, Marcin; Tyutyunnikov, Sergey; Stegailov, Vladimir


    Two Np-237 samples and one Pu-239 were irradiated in spallation neutrons produced in ADS setup QUINTA. The accelerated beam consisted of protons of energy 660 MeV. The method was based on gamma-ray spectrometry measurement. During analysis of the spectra several fission products and one actinide were identified. Fission product activities gave the number of fissions. The actinide (Np-238), a result of neutron capture by Np-237 gave the number of captures. In a similar manner the number of fissions in Pu-239 was determined. The Pu-240, a product of neutron capture by Pu-239, activity was impossible to measure.

  13. Comparison of neutron induced fission and capture in Np-237 and Pu-239 irradiated in QUINTA assembly with 660 MeV proton beam

    Directory of Open Access Journals (Sweden)

    Kilim Stanislaw


    Full Text Available Two Np-237 samples and one Pu-239 were irradiated in spallation neutrons produced in ADS setup QUINTA. The accelerated beam consisted of protons of energy 660 MeV. The method was based on gamma-ray spectrometry measurement. During analysis of the spectra several fission products and one actinide were identified. Fission product activities gave the number of fissions. The actinide (Np-238, a result of neutron capture by Np-237 gave the number of captures. In a similar manner the number of fissions in Pu-239 was determined. The Pu-240, a product of neutron capture by Pu-239, activity was impossible to measure.

  14. Comparative genomics and drug resistance of a geographic variant of ST239 methicillin-resistant Staphylococcus aureus emerged in Russia.

    Directory of Open Access Journals (Sweden)

    Tatsuo Yamamoto

    Full Text Available Two distinct classes of methicillin-resistant Staphylococcus aureus (MRSA are spreading in hospitals (as hospital-acquired MRSA, HA-MRSA and in the community (as community-acquired MRSA, CA-MRSA. Multilocus sequence type (ST 239 MRSA, one of the most worldwide-disseminated lineages, has been noted as a representative HA-MRSA. Here, we isolated ST239 MRSA (spa type 3 [t037] and staphylococcal cassette chromosome mec [SCCmec] type III.1.1.1 and its novel variant with ST239/spa351 (t030/SCCmecIII.1.1.4 (SCCmecIII(R not only from hospitals but also from patients with urethritis in the community in Russia. The Russian variant (strain 16K possessed a hybrid genome consisting of CC8 and CC30, similar to the ST239/spa3/SCCmecIII.1.1.1 HA-MRSA (TW20 genome, but with marked diversity. The 16K' CC30 section had SCCmecIII(R carrying the dcs-carrying unit (which corresponded to the SCCmecIVc J3 joining region of ST30 CA-MRSA, lacked SCCmercury, and possessed a novel mobile element structure (MES16K carrying the ccrC-carrying unit (with the recombinase gene ccrC1 allele 3 and drug resistance tranposons. The Russian variant included strains with a high ability to transfer its multiple drug resistance by conjugation; e.g., for strain 16K, the transfer frequency of a chloramphenicol resistance plasmid (p16K-1 with 2.9 kb in size reached 1.4×10(-2, followed by Tn554 conjugative transfer at 3.6×l0(-4. The Russian variant, which has been increasing recently, included divergent strains with different plasmid patterns and pulsed field gel electrophoresis profiles. The data demonstrate the alternative nature of ST239 MRSA as CA-MRSA and also as a drug resistance disseminator, and its micro but dynamic evolution in Russia.

  15. Excess Lead-210 and Plutonium-239+240: Two suitable radiogenic soil erosion tracers for mountain grassland sites. (United States)

    Meusburger, K; Porto, P; Mabit, L; La Spada, C; Arata, L; Alewell, C


    The expected growing population and challenges associated with globalisation will increase local food and feed demands and enhance the pressure on local and regional upland soil resources. In light of these potential future developments it is necessary to define sustainable land use and tolerable soil loss rates with methods applicable and adapted to mountainous areas. Fallout-radionuclides (FRNs) are proven techniques to increase our knowledge about the status and resilience of agro-ecosystems. However, the use of the Caesium-137 ( 137 Cs) method is complicated in the European Alps due to its heterogeneous input and the timing of the Chernobyl fallout, which occurred during a few single rain events on partly snow covered ground. Other radioisotopic techniques have been proposed to overcome these limitations. The objective of this study is to evaluate the suitability of excess Lead-210 ( 210 Pb ex ) and Plutonium-239+240 ( 239+240 Pu) as soil erosion tracers for three different grassland management types at the steep slopes (slope angles between 35 and 38°) located in the Central Swiss Alps. All three FRNs identified pastures as having the highest mean (± standard deviation) net soil loss of -6.7 ± 1.1, -9.8 ± 6.8 and -7.0 ± 5.2 Mg ha -1 yr -1 for 137 Cs, 210 Pb ex and 239+240 Pu, respectively. A mean soil loss of -5.7 ± 1.5, -5.2 ± 1.5 and-5.6 ± 2.1 was assessed for hayfields and the lowest rates were established for pastures with dwarf-shrubs (-5.2 ± 2.5, -4.5 ± 2.5 and -3.3 ± 2.4 Mg ha -1 yr -1 for 137 Cs, 210 Pb ex and 239+240 Pu, respectively). These rates, evaluated at sites with an elevated soil erosion risk exceed the respective soil production rates. Among the three FRN methods used, 239+240 Pu appears as the most promising tracer in terms of measurement uncertainty and reduced small scale variability (CV of 13%). Despite a higher level of uncertainty, 210 Pb ex produced comparable results, with a wide range of erosion rates sensitive to changes

  16. Preclinical and Clinical Resistance Profile of EDP-239, a Novel Hepatitis C Virus NS5A Inhibitor. (United States)

    Owens, Christopher M; Brasher, Bradley B; Polemeropoulos, Alex; Rhodin, Michael H J; McAllister, Nicole; Wong, Kelly A; Jones, Christopher T; Jiang, Lijuan; Lin, Kai; Or, Yat Sun


    EDP-239, a potent and selective hepatitis C virus (HCV) nonstructural protein 5A (NS5A) inhibitor developed for the treatment of HCV infection, has been investigated in vitro and in vivo This study sought to characterize genotypic changes in the HCV NS5A sequence of genotype 1 (GT1) replicons and to compare those changes to GT1 viral RNA mutations isolated from clinical trial patients. Resistance selection experiments in vitro using a subgenomic replicon identified resistance-associated mutations (RAMs) at GT1a NS5A amino acid positions 24, 28, 30, 31, and 93 that confer various degrees of resistance to EDP-239. Key RAMs were similarly identified in GT1b NS5A at amino acid positions 31 and 93. Mutations F36L in GT1a and A92V in GT1b do not confer resistance to EDP-239 individually but were found to enhance the resistance of GT1a K24R and GT1b Y93H. RAMs were identified in GT1 patients at baseline or after dosing with EDP-239 that were similar to those detected in vitro Baseline RAMs identified at NS5A position 93 in GT1, or positions 28 or 30 in GT1a only, correlated with a reduced treatment response. RAMs at additional positions were also detected and may have contributed to reduced EDP-239 efficacy. The most common GT1a and GT1b RAMs found to persist up to weeks 12, 24, or 48 were those at NS5A positions 28, 30, 31, 58 (GT1a only), and 93. Those RAMs persisting at the highest frequencies up to weeks 24 or 48 were L31M and Q30H/R for GT1a and L31M and Y93H for GT1b. (This study has been registered at under identifier NCT01856426.). Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  17. Carcinogenesis From Inhaled (PuO2)-Pu-239 in Beagles: Evidence for Radiation Homeostasis at Low Doses?

    Energy Technology Data Exchange (ETDEWEB)

    Fisher, Darrell R.; Weller, Richard E.


    From the early 1970s to the late 1980s, Pacific Northwest National Laboratory conducted life-span studies in beagle dogs on the biological effects of inhaled plutonium (239PuO2, 238PuO2, and 239Pu[NO3]4) to help predict risks associated with accidental intakes in workers. Years later, the purpose of the present follow-up study is to reassess the dose-response relationship for lung cancer induction in the 239PuO2 dogs compared to controls, with particular focus on the dose-response at low lung doses. A 239PuO2 aerosol (2.3 μm AMAD, 1.9 μm GSD) was administered to six groups of 20 young (18-month old) beagle dogs (10 males and 10 females) by inhalation at six different activity levels, as previously described in Laboratory reports. Control dogs were sham-exposed. In dose level 1, initial pulmonary lung depositions were 130 ± 48 Bq (3.5 ± 1.3 nCi), corresponding to 1 Bq g-1 lung tissue (0.029 ± 0.001 nCi g-1. Groups 2 through 6 received initial lung depositions (mean values) of 760, 2724, 10345, 37900, and 200000 Bq (22, 79, 300, 1100, and 5800 nCi) 239PuO2, respectively. For each dog, the absorbed dose to lungs was calculated from the initial lung burden and the final lung burden at time of death and lung mass, assuming a single, long-term retention function. Insoluble plutonium oxide exhibited long retention times in the lungs. Increased dose-dependent mortality due to lung cancer (bronchiolar-alveolar carcinoma, adenocarcinoma, epidermoid carcinoma) and radiation pneumonitis (highest exposures group) was observed in dogs exposed to 239PuO2. Calculated lung doses ranged from a few cGy in early-sacrificed dogs to 7764 cGy in dogs that experienced early deaths from radiation pneumonitis. Data were regrouped by lifetime lung dose and plotted as a function of lung tumor incidence. Lung tumor incidence in controls and zero-dose exposed dogs was 18% (5/28). However, no lung tumors were observed in 16 dogs with the lowest lung doses (8 to 22 cGy, mean 14.4 ± 7.6 c

  18. EPA Method: Rapid Radiochemical Method for Americium-241, Radium-226, Plutonium-238/-239, Radiostronium, and Isotopic Uranium in Water for Environmental Restoration Following Homeland Security Events (United States)

    SAM lists this method for the qualitative determination of Americium-241, Radium-226, Plutonium-238, Plutonium-239 and isotopic uranium in drinking water samples using alpha spectrometry and radiostrontium using beta counting.

  19. Spa therapy for elderly: a retrospective study of 239 older patients with osteoarthritis. (United States)

    Karagülle, Mine; Kardeş, Sinan; Dişçi, Rian; Gürdal, Hatice; Karagülle, Müfit Zeki


    Very few studies tested the effectiveness of spa therapy in older patients with osteoarthritis. Therefore, we aimed to evaluate the short-term effects of spa therapy in patients aged 65 years and older with generalized, knee, hip, and cervical and lumbar spine osteoarthritis. In an observational retrospective study design at the Medical Ecology and Hydroclimatology Department of Istanbul Medical Faculty, we analyzed the records of 239 patients aged over 65 years with the diagnosis of all types of osteoarthritis who were prescribed a spa therapy course in some spa resorts in Turkey between 7 March 2002 and 31 December 2012. They travelled to a spa resort where they stayed at a thermal spa hotel and followed the usual therapy packages for 2 weeks. Patients were assessed by an experienced physician within a week before the spa journey and within a week after the completion of the spa therapy. Compared with baseline in whole sample, statistically significant improvements were observed in pain (visual analog scale, VAS), patient and physician global assessments (VAS), Health Assessment Questionnaire disability index (HAQ-DI), Lequesne algofunctional index (LAFI) for knee, Western Ontario and McMaster Universities index (WOMAC), Waddell disability index (WDI), and Neck Pain and Disability Scale (NPAD). According to Outcome Measures in Rheumatology-Osteoarthritis Research Society International (OMERACT-OARSI) Set of Responder Criteria, responder rate were 63.8 % (51/80) in generalized, 52 % (13/25) in knee, 50 % (2/4) in hip, 66.7 % (8/12) in lumbar, and 100 % (6/6) in cervical osteoarthritis subgroups. Spa therapy improved pain and physical functional status in older patients with osteoarthritis, especially generalized osteoarthritis and multiple joint osteoarthritis with involvement of knee. This improvement was clinically important in majority of the patients. To confirm the results of this preliminary study, there is a need of a randomized controlled clinical

  20. 29 CFR 779.239 - Meaning of “engaged in commerce or in the production of goods for commerce.” (United States)


    ... 29 Labor 3 2010-07-01 2010-07-01 false Meaning of âengaged in commerce or in the production of goods for commerce.â 779.239 Section 779.239 Labor Regulations Relating to Labor (Continued) WAGE AND... commerce or in the production of goods for commerce.” The term “engaged in commerce or in the production of...

  1. Determination of Plutonium Activity Concentrations and 240Pu/239Pu Atom Ratios in Brown Algae (Fucus distichus) Collected from Amchitka Island, Alaska.

    Energy Technology Data Exchange (ETDEWEB)

    Hamilton, T F; Brown, T A; Marchetti, A A; Martinelli, R E; Kehl, S R


    Plutonium-239 ({sup 239}Pu) and plutonium-240 ({sup 240}Pu) activity concentrations and {sup 240}Pu/{sup 239}Pu atom ratios are reported for Brown Algae (Fucus distichus) collected from the littoral zone of Amchitka Island (Alaska) and at a control site on the Alaskan peninsula. Plutonium isotope measurements were performed in replicate using Accelerator Mass Spectrometry (AMS). The average {sup 240}Pu/{sup 239}Pu atom ratio observed in dried Fucus d. collected from Amchitka Island was 0.227 {+-} 0.007 (n=5) and compares with the expected {sup 240}Pu/{sup 239}Pu atom ratio in integrated worldwide fallout deposition in the Northern Hemisphere of 0.1805 {+-} 0.0057 (Cooper et al., 2000). In general, the characteristically high {sup 240}Pu/{sup 239}Pu content of Fucus d. analyzed in this study appear to indicate the presence of a discernible basin-wide secondary source of plutonium entering the marine environment. Of interest to the study of plutonium source terms within the Pacific basin are reports of elevated {sup 240}Pu/{sup 239}Pu atom ratios in fallout debris from high-yield atmospheric nuclear tests conducted in the Marshall Islands during the 1950s (Diamond et al., 1960), the wide range of {sup 240}Pu/{sup 239}Pu atom ratio values (0.19 to 0.34) observed in sea water, sediments, coral and other environmental media from the North Pacific Ocean (Hirose et al., 1992; Buesseler, 1997) and updated estimates of the relative contributions of close-in and intermediate fallout deposition on oceanic inventories of radionuclidies, especially in the Northern Pacific Ocean (Hamilton, 2004).

  2. Plutonium Isotopes (239-241Pu) Dissolved in Pacific Ocean Waters Detected by Accelerator Mass Spectrometry: No Effects of the Fukushima Accident Observed. (United States)

    Hain, Karin; Faestermann, Thomas; Fimiani, Leticia; Golser, Robin; Gómez-Guzmán, José Manuel; Korschinek, Gunther; Kortmann, Florian; Lierse von Gostomski, Christoph; Ludwig, Peter; Steier, Peter; Tazoe, Hirofumi; Yamada, Masatoshi


    The concentration of plutonium (Pu) and the isotopic ratios of 240Pu to 239Pu and 241Pu to 239Pu were determined by accelerator mass spectrometry (AMS) in Pacific Ocean water samples (20 L each) collected in late 2012. The isotopic Pu ratios are important indicators of different contamination sources and were used to identify a possible release of Pu into the ocean by the Fukushima Daiichi Nuclear Power Plant (FDNPP) accident. In particular, 241Pu is a well-suited indicator for a recent entry of Pu because 241Pu from fallout of nuclear weapon testings has already significantly decayed. A total of 10 ocean water samples were prepared at the Radiochemie München of the TUM and analyzed at the Vienna Environmental Research Laboratory (VERA). Several samples showed a slightly elevated 240Pu/239Pu ratio of up to 0.22 ± 0.02 compared to global fallout (240Pu/239Pu = 0.180 ± 0.007), whereas all measured 241Pu-to-239Pu ratios were consistent with nuclear weapon fallout (241Pu/239Pu < 2.4 × 10-3), which means that no impact from the Fukushima accident was detected. From the average 241Pu-to-239Pu ratio of 8-2+3 ×10-4 at a sampling station located at a distance of 39.6 km to FDNPP, the 1-σ upper limit for the FDNPP contribution to the 239Pu inventory in the water column was estimated to be 0.2%. Pu, with the signature of weapon-grade Pu was found in a single sample collected around 770 km off the west coast of the United States.

  3. Detection of fuel release in a nuclear accident: a method for preconcentration and isolation of reactor-borne (239)Np using ion-specific extraction chromatography. (United States)

    Rosenberg, Brett L; Shozugawa, Katsumi; Steinhauser, Georg


    Although actinides are the most informative elements with respect to the nature of a nuclear accident, plutonium analysis is complicated by the background created by fallout from atmospheric nuclear explosions. Therefore, we propose (239)Np, a short-lived actinide that emits several γ rays, as a preferred proxy. The aim of this study was to screen ion specific extraction chromatography resins (RE-, TEVA-, UTEVA-, TRU-, and Actinide-Resin) for the highest possible recovery and separation of trace amounts of (239)Np from samples with large activities of fission products such as radiocesium, radioiodine, and, most importantly, radiotellurium, the latter of which causes spectral interference in gamma spectrometry through overlapping peaks with (239)Np. The investigated environmental media for these separations were aqueous solutions simulating rainwater and soil. Spiked samples containing (239)Np and the aforementioned volatile radionuclides were separated through extraction chromatographic columns to ascertain the most effective means of separating (239)Np from other fission products for detection by gamma spectroscopy. We propose a method for nuclear accident preparedness based on the use of Eichrom's RE-Resin. The proposed method was found most effective for isolating (239)Np from interfering radionuclides in both aqueous solution and soil using 8 M HNO3 as the loading solution and H2O as the eluent. The RE-Resin outperforms the more commonly used TEVA-Resin because the TEVA-Resin showed a higher affinity for interfering radiotellurium and radioiodine.

  4. Transient Expression of Lumbrokinase (PI239 in Tobacco (Nicotiana tabacum Using a Geminivirus-Based Single Replicon System Dissolves Fibrin and Blood Clots

    Directory of Open Access Journals (Sweden)

    Alexia Dickey


    Full Text Available Lumbrokinases, a group of fibrinolytic enzymes extracted from earthworm, have been widely used to prevent and treat various cardiovascular diseases. They specifically target fibrin to effectively degrade thrombi without major side effects. Plant expression systems are becoming potential alternative expression platforms for producing pharmaceutical proteins. In this work, a lumbrokinase (PI239 was produced from a plant system. Both wild-type (WT and plant codon-optimized (OP PI239 gene sequences were synthesized and cloned into a geminivirus-based single-vector DNA replicon system. Both vectors were independently expressed in tobacco (Nicotiana tabacum leaves transiently by agroinfiltration. Overexpressed PI239 resulted in sudden tissue necrosis 3 days after infiltration. Remaining proteins were purified through His-tag affinity chromatography and analyzed with SDS-PAGE and Western blot methods. Purified PI239 successfully degraded artificial fibrin with relative activity of 13,400 U/mg when compared with commercial lumbrokinase product. In vitro tests demonstrated that plant-derived PI239 dissolved human blood clots and that the plant expression system is capable of producing functional PI239.

  5. Comparative migration behaviour of {sup 90}Sr, {sup 239+240}Pu and {sup 241}Am in mineral and organic soils of France

    Energy Technology Data Exchange (ETDEWEB)

    Solovitch-Vella, N. [IRSN Cadarache, BP3 13115, Saint-Paul-lez Durance cedex (France); Pourcelot, L. [IRSN Cadarache, BP3 13115, Saint-Paul-lez Durance cedex (France)], E-mail:; Chen, V.T. [IRSN Cadarache, BP3 13115, Saint-Paul-lez Durance cedex (France); Froidevaux, P. [Institut de Radiophysique Appliquee, Grand Pre 1, 1007 Lausanne (Switzerland); Gauthier-Lafaye, F.; Stille, P. [Centre de Geochimie de la Surface-CNRS, 1, rue Blessig 67083, Strasbourg cedex (France); Aubert, D. [CEFREM, Universite de Perpignan 52, Avenue Paul Alduy, 66860 Perpignan (France)


    The vertical migration of {sup 90}Sr, {sup 239+240}Pu and {sup 241}Am has been studied in two types of soils in France (acid forest soil in the Vosges Mountains and organic-rich alkaline wetland in the Mercantour area). In order to interpret the different migration behaviour of radionuclides, the combination of two approaches are proposed - a statistical study of the evolution of radionuclide ratios ({sup 241}Am/{sup 239+240}Pu, {sup 90}Sr/{sup 239+240}Pu) with depth and a calculation of the radionuclide migration rates. Migration behaviour of {sup 90}Sr, {sup 239+240}Pu and {sup 241}Am is significantly different in the Vosges and Mercantour soils. In the Mercantour soil {sup 241}Am was found to be less mobile than {sup 239+240}Pu. In both profiles {sup 90}Sr is more mobile than {sup 239+240}Pu. The high sand content (55-60%) and weathering processes of cations in the Vosges soil are thought to be responsible for the larger migration rates of radionuclides in depth, while the high organic matter content (>70%) of Mercantour soil is thought to be responsible for the stronger retention of {sup 241}Am in the first 10 cm of the soil.

  6. Commentary on inhaled {sup 239}PuO{sub 2} in dogs - a prophylaxis against lung cancer?

    Energy Technology Data Exchange (ETDEWEB)

    Cuttler, J.M., E-mail: [Cuttler and Associates, Vaughan, ON (Canada); Feinendegen, L. [Brookhaven National Laboratories, Upton, NY (United States)


    Several studies on the effect of inhaled plutonium-dioxide particulates and the incidence of lung tumors in dogs reveal beneficial effects when the cumulative alpha-radiation dose is low. There is a threshold at an exposure level of about 100 cGy for excess tumor incidence and reduced lifespan. The observations conform to the expectations of the radiation hormesis dose-response model and contradict the predictions of the Linear No-Threshold (LNT) hypothesis. These studies suggest investigating the possibility of employing low-dose alpha-radiation, such as from {sup 239}PuO{sub 2} inhalation, as a prophylaxis against lung cancer. (author)

  7. Commentary on inhaled {sup 239}PuO{sub 2} in dogs - a prophylaxis against lung cancer?

    Energy Technology Data Exchange (ETDEWEB)

    Cuttler, J.M. [Cuttler and Assoc., Vaughan, Ontario (Canada); Feinendegen, L. [Brookhaven National Laboratories, Upton, New York (United States)


    Several studies on the effect of inhaled plutonium-dioxide particulates and the incidence of lung tumors in dogs reveal beneficial effects when the cumulative alpha-radiation dose is low. There is a threshold at an exposure level of about 100 cGy for excess tumor incidence and reduced lifespan. The observations conform to the expectations of the radiation hormesis dose-response model and contradict the predictions of the Linear No-Threshold (LNT) hypothesis. These studies suggest investigating the possibility of employing low-dose alpha-radiation, such as from {sup 239}PuO {sub 2} inhalation, as a prophylaxis against lung cancer. (author)

  8. Sorption of {sup 239}Np and {sup 235}U fission products by zeolite Y, Mexican natural erionite, and bentonite

    Energy Technology Data Exchange (ETDEWEB)

    Olguin, M.T.; Solache, M.; Iturbe, J.L. [Instituto Nacional de Investigaciones Nucleares, C.P. (Mexico)]|[Universidad Autonoma Metropolitana, C.P. (Mexico)] [and others


    Zeolite Y, erionite, and bentonite have been used in this work to remove {sup 239}Np and {sup 235}U fission products from aqueous solutions at various pH values. It was found that the sorption of fission products by aluminosilicates takes place by different mechanisms, mainly ion exchange, precipitation, and electrostatic surface interaction. The radionuclides content was determined by {gamma}-spectrometry, and X-ray diffraction was used to learn whether the solids maintained their crystallinity at different pH values.

  9. Surrogate 239Pu(n, fxn) and 241Pu(n, fxn) average fission-neutron-multiplicity measurements

    Energy Technology Data Exchange (ETDEWEB)

    Burke, J. T. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Alan, B. S. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Akindele, O. A. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Casperson, R. J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Hughes, R. O. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Fisher, S. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)


    We have constructed a new neutron-charged-particle detector array called NeutronSTARS. It has been described extensively in LLNL-TR-703909 [1] and Akindele et al [2]. We have used this new neutron-charged-particle array to measure the 241Pu and 239Pu fissionneutron multiplicity as a function of equivalent incident-neutron energy from 100 keV to 20 MeV. The experimental approach, detector array, data analysis, and results are summarized in the following sections.

  10. Distribution and migration of 239+240Pu in abiotic components of the Black Sea ecosystems during the post-Chernobyl period. (United States)

    Tereshchenko, N N; Gulin, S B; Proskurnin, V Yu


    Distribution of 239,240Pu in abiotic components (water and bottom sediment) of the Black Sea ecosystems was studied during the post-Chernobyl period at different offshore and near-shore locations. The trends of these radionuclides accumulation by sediments were analyzed. The spatial-temporal changes in the 239,240Pu distribution as well as effective half-life for these radionuclides in the Black Sea surface water in deep-sea area are presented. The estimations of the average annual removal fluxes of the 239,240Pu into the bottom sediments were obtained. The Black Sea sediments were characterized by a higher 239,240Pu concentration factor (Cf ≈ n·104-n·106) and radiocapacity factor (F(239,240Pu) was about 99.9% on the shelf, 94.5-99.1% on deep-sea basin for silty and 94.6-98.9% on the shelf for sandy bottom sediments) as compared with Cf and F for 137Cs and 90Sr. Silty bottom sediments play the role of 239,240Pu main depot in the Black Sea ecosystem. The studied radioecological characteristics of Pu allowed us to define the type of plutonium biogeochemical behavior in the Black Sea as a pedotropic one. The results of this complex radioecological monitoring of 239+240Pu contamination in the Black Sea and their analysis makes it possible to understand the plutonium redistribution pathways which will enable to carry out the tracing of its migration within the ecosystems. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Pu-239/Pu-240 isotope ratios determined using high resolution emission spectroscopy in a laser-induced plasma (United States)

    Smith, Coleman A.; Martinez, Max A.; Veirs, D. Kirk; Cremers, David A.


    Laser-induced breakdown spectroscopy (LIBS) has been applied for the determination of plutonium isotope ratios through direct observation of atomic emission from laser-induced plasmas at high resolution. The Pu-239/Pu-240 isotope shift of -0.355 cm -1 from the plutonium atomic line at 594.52202 nm (Blaise et al., The Atomic Spectrum of Plutonium, Argonne National Laboratory Report ANL-83-95, 1984) is clearly resolved in our plasma conditions. Atomic emission is dispersed through a 2-m spectrometer in double pass mode and collected on an electronically gated, intensified charge-coupled device (ICCD) camera. The integrated peak areas obtained from curve-fitting closely match the Pu-239/Pu-240 isotopic ratios obtained from standard methods of thermal ionization mass spectrometry and gamma spectrometry. The observed plutonium linewidths were 0.19 cm -1 (0.0067 nm). These linewidths are within the experimental error of the ideal instrument-limited linewidth, which is calculated to be 0.15 cm -1 (0.0052 nm) based upon the known modulation transfer function for the ICCD system. This linewidth should allow LIBS to be applicable for isotopic ratio measurements for all of the light actinides.

  12. Activity ratios of {sup 137}Cs, {sup 90}Sr and {sup 239+240}Pu in environmental samples

    Energy Technology Data Exchange (ETDEWEB)

    Bossew, P. [European Commission - DG Joint Research Centre, Institute for Environment and Sustainability (IES), I-21020 Ispra (Vatican City State, Holy See,) (Italy)], E-mail:; Lettner, H. [Institute of Physics and Biophysics, University of Salzburg, Hellbrunner Strasse 34, A-5020 Salzburg (Austria)], E-mail:; Hubmer, A.; Erlinger, C.; Gastberger, M. [Institute of Physics and Biophysics, University of Salzburg, Hellbrunner Strasse 34, A-5020 Salzburg (Austria)


    Both global and Chernobyl fallout have resulted in environmental contamination with radionuclides such as {sup 137}Cs, {sup 90}Sr and {sup 239+240}Pu. In environmental samples, {sup 137}Cs and {sup 239+240}Pu can be divided into the contributions of either source, if also the isotopes {sup 134}Cs and {sup 238}Pu are measurable, based on the known isotopic ratios in global and Chernobyl fallout. No analogous method is available for {sup 90}Sr. The activity ratios of Sr to Cs and Pu, respectively, are known for the actual fallout mainly from air filter measurements; but due to the high mobility of Sr in the environment, compared to Cs and Pu, these ratios generally do not hold for the inventory many years after deposition. In this paper we suggest a method to identify the mean contributions of global and Chernobyl fallout to total Sr in soil, sediment and cryoconite samples from Alpine and pre-Alpine regions of Austria, based on a statistical evaluation of Sr/Cs/Pu radionuclide activity ratios. Results are given for Sr:Cs, Sr:Pu and Cs:Pu ratios. Comparison with fallout data shows a strong depletion of Sr against Cs and Pu.

  13. First measurements of (236)U concentrations and (236)U/(239)Pu isotopic ratios in a Southern Hemisphere soil far from nuclear test or reactor sites. (United States)

    Srncik, M; Tims, S G; De Cesare, M; Fifield, L K


    The variation of the (236)U and (239)Pu concentrations as a function of depth has been studied in a soil profile at a site in the Southern Hemisphere well removed from nuclear weapon test sites. Total inventories of (236)U and (239)Pu as well as the (236)U/(239)Pu isotopic ratio were derived. For this investigation a soil core from an undisturbed forest area in the Herbert River catchment (17°30' - 19°S) which is located in north-eastern Queensland (Australia) was chosen. The chemical separation of U and Pu was carried out with a double column which has the advantage of the extraction of both elements from a relatively large soil sample (∼20 g) within a day. The samples were measured by Accelerator Mass Spectrometry using the 14UD pelletron accelerator at the Australian National University. The highest atom concentrations of both (236)U and (239)Pu were found at a depth of 2-3 cm. The (236)U/(239)Pu isotopic ratio in fallout at this site, as deduced from the ratio of the (236)U and (239)Pu inventories, is 0.085 ± 0.003 which is clearly lower than the Northern Hemisphere value of ∼0.2. The (236)U inventory of (8.4 ± 0.3) × 10(11) at/m(2) was more than an order of magnitude lower than values reported for the Northern Hemisphere. The (239)Pu activity concentrations are in excellent agreement with a previous study and the (239+240)Pu inventory was (13.85 ± 0.29) Bq/m(2). The weighted mean (240)Pu/(239)Pu isotopic ratio of 0.142 ± 0.005 is slightly lower than the value for global fallout, but our results are consistent with the average ratio of 0.173 ± 0.027 for the southern equatorial region (0-30°S). Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Immunization with single-cycle SIV significantly reduces viral loads after an intravenous challenge with SIV(mac239.

    Directory of Open Access Journals (Sweden)

    Bin Jia


    Full Text Available Strains of simian immunodeficiency virus (SIV that are limited to a single cycle of infection were evaluated for the ability to elicit protective immunity against wild-type SIV(mac239 infection of rhesus macaques by two different vaccine regimens. Six animals were inoculated at 8-week intervals with 6 identical doses consisting of a mixture of three different envelope variants of single-cycle SIV (scSIV. Six additional animals were primed with a mixture of cytoplasmic domain-truncated envelope variants of scSIV and boosted with two doses of vesicular stomatitis virus glycoprotein (VSV G trans-complemented scSIV. While both regimens elicited detectable virus-specific T cell responses, SIV-specific T cell frequencies were more than 10-fold higher after boosting with VSV G trans-complemented scSIV (VSV G scSIV. Broad T cell recognition of multiple viral antigens and Gag-specific CD4(+ T cell responses were also observed after boosting with VSV G scSIV. With the exception of a single animal in the repeated immunization group, all of the animals became infected following an intravenous challenge with SIV(mac239. However, significantly lower viral loads and higher memory CD4(+ T cell counts were observed in both immunized groups relative to an unvaccinated control group. Indeed, both scSIV immunization regimens resulted in containment of SIV(mac239 replication after challenge that was as good as, if not better than, what has been achieved by other non-persisting vaccine vectors that have been evaluated in this challenge model. Nevertheless, the extent of protection afforded by scSIV was not as good as typically conferred by persistent infection with live, attenuated SIV. These observations have potentially important implications to the design of an effective AIDS vaccine, since they suggest that ongoing stimulation of virus-specific immune responses may be essential to achieving the degree of protection afforded by live, attenuated SIV.

  15. Determination of plutonium-239, thorium-232, and natural uranium isotopic concentrations in biological samples using photofission track analysis (United States)

    Parry, James Roswell

    Fission track analysis (FTA) has many uses in the scientific community including but not limited to geological dating, neutron flux mapping, and dose reconstruction. The common method of fission for FTA is through neutrons from a nuclear reactor. This dissertation investigates the use of bremsstrahlung radiation produced from an electron linear accelerator to induce fission in FTA samples. This provides a means of simultaneously measuring the amount of Pu-239, U-nat, and Th-232 in a single sample. The benefit of measuring the three isotopes simultaneously is the possible elimination of costly and time consuming chemical processing for dose reconstruction samples. Samples containing the three isotopes were irradiated in two different bremsstrahlung spectra and a neutron spectrum to determine the amount of Pu-239, U-nat, and Th-232 in the samples. The reaction rate from the calibration samples and the counted fission tracks on the samples were used in determining the concentration of each isotope in the samples. The results were accurate to within a factor of two or three, showing that the method can work to predict the concentrations of multiple isotopes in a sample. The limitations of current accelerators and detectors limits the application of this specific procedure to higher concentrations of isotopes. The method detection limits for Pu-239, U-nat, and Th-232 are 20 pCi, 1 fCi, and 0.4 flCI respectively. Analysis of extremely low concentrations of isotopes would require the use of different detectors such as quartz due to the embrittlement encountered in the Lexan at high exposures. Cracking of the Texan detectors started to appear at a fluence of about 2 x 1018 electrons from the accelerator. This may be partly due to the beam stop not being an adequate thickness. The procedure is likely limited to specialty applications for the near term. However, with the world concerns of exposure to depleted uranium, this procedure may find applications in this area since

  16. Distribution and source of 129I, 239,240Pu, 137Cs in the environment of Lithuania

    DEFF Research Database (Denmark)

    Ezerinskis, Z.; Hou, Xiaolin; Druteikiene, R.


    Fifty five soil samples collected in the Lithuania teritory in 2011 and 2012 were analyzed for 129I, 137Cs and Pu isotopes in order to investigate the level and distribution of artificial radioactivity in Lithuania. The activity and atomic ratio of 238Pu/239,240Pu, 129I/127I and 131I/137Cs were...... used to identify the origin of these radionuclides. The 238Pu/239þ240Pu and 240Pu/239Pu ratios in the soil samples analyzed varied in the range of 0.02e0.18 and 0.18e0.24, respectively, suggesting the global fallout as the major source of Pu in Lithuania. The values of 109 to 106 for 129I/127I atomic...

  17. Atmospheric input of ¹³⁷Cs and 239,240Pu isotopes in Korea after the Fukushima nuclear power plant accident. (United States)

    Oh, Jung-Suk; Lee, Sang-Han; Choi, Jong-Ki; Lee, Jong-Man; Lee, Kyung-Bum; Park, Tae-Soon


    Caesium isotopes ((134)Cs and (137)Cs) and (239,240)Pu in rainwater and dry deposition have been analyzed by Korea Research Institute of Standards and Science (KRISS) since the Fukushima nuclear power plant (NPP) accident in March 2011. The concentrations of (239,240)Pu and (137)Cs in the rainwater are 2.6±1.0 to 15±3 µBq/kg and 0.01 to 0.36 mBq/kg, respectively. The concentrations are concordant to those observed before the Fukushima NPP accident, on the other hand, the monthly depositional flux of (239,240)Pu and (137)Cs are much lower than the amounts observed after Fukushima NPP accident and in Monaco in 1998-2001. This confirms that the Fukushima NPP accident caused no significant impact in Korea. © 2013 The Authors. Published by Elsevier Ltd All rights reserved.

  18. Time-resolved record of 236U and 239,240Pu isotopes from a coral growing during the nuclear testing program at Enewetak Atoll (Marshall Islands). (United States)

    Froehlich, M B; Chan, W Y; Tims, S G; Fallon, S J; Fifield, L K


    A comprehensive series of nuclear tests were carried out by the United States at Enewetak Atoll in the Marshall Islands, especially between 1952 and 1958. A Porites Lutea coral that was growing in the Enewetak lagoon within a few km of all of the high-yield tests contains a continuous record of isotopes, which are of interest (e.g. 14C, 236U, 239,240Pu) through the testing period. Prior to the present work, 14C measurements at ∼2-month resolution had shown pronounced peaks in the Δ14C data that coincided with the times at which tests were conducted. Here we report measurements of 236U and 239,240Pu on the same coral using accelerator mass spectrometry, and again find prominent peaks in the concentrations of these isotopes that closely follow those in 14C. Consistent with the 14C data, the magnitudes of these peaks do not, however, correlate well with the explosive yields of the corresponding tests, indicating that smaller tests probably contributed disproportionately to the debris that fell in the lagoon. Additional information about the different tests can also be obtained from the 236U/239Pu and 240Pu/239Pu ratios, which are found to vary dramatically over the testing period. In particular, the first thermonuclear test, Ivy-Mike, has characteristic 236U/239Pu and 240Pu/239Pu signatures which are diagnostic of the first arrival of nuclear test material in various archives. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. [Functional state of the thyroid gland in sheep at a remote period after single administration of Sr-90, Pu-239 and their mixture]. (United States)

    Bogatov, L V; Surina, A G; Antonenko, G I; Pershina, L I


    Five years after single intravenous injection of a mixture of 239Pu and 90Sr to semifine-wool sheep (7.4 kBq/kg + 185 kBq/kg) the iodine-fixing and hormone secreting functions of the thyroid gland were inhibited; where 90Sr alone was injected in the above dose inhibited was the hormone-secreting function only. Since 239Pu alone did not cause such alterations, the observed remote effect was attributed to the effect of the incorporated 90Sr.

  20. Total kinetic energy release in 239Pu(n ,f ) post-neutron emission from 0.5 to 50 MeV incident neutron energy (United States)

    Meierbachtol, K.; Tovesson, F.; Duke, D. L.; Geppert-Kleinrath, V.; Manning, B.; Meharchand, R.; Mosby, S.; Shields, D.


    The average total kinetic energy (T K E ¯) in 239Pu(n ,f ) has been measured for incident neutron energies between 0.5 and 50 MeV. The experiment was performed at the Los Alamos Neutron Science Center (LANSCE) using the neutron time-of-flight technique, and the kinetic energy of fission fragments post-neutron emission was measured in a double Frisch-gridded ionization chamber. This represents the first experimental study of the energy dependence of T K E ¯ in 239Pu above neutron energies of 6 MeV.

  1. Subchronic inhalation of carbon tetrachloride alters the tissue retention of acutely inhaled plutonium-239 nitrate in F344 rats and syrian golden hamsters

    Energy Technology Data Exchange (ETDEWEB)

    Benson, J.M.; Barr, E.B.; Lundgren, D.L. [and others


    Carbon tetrachloride (CCl{sub 4}) has been used extensively in the nuclear weapons industry, so it is likely that nuclear plant workers have been exposed to both CCl{sub 4} and plutonium compounds. Future exposures may occur during {open_quotes}cleanup{close_quotes} operations at weapons productions sites such as the Hanford, Washington, and Rocky Flats, Colorado, facilities. Inhalation of 20 and 100 ppm CCl{sub 4} by hamsters reduces uptake of {sup 239}Pu solubilized from lung, shunting the {sup 239}Pu to the skeleton.

  2. References to Studies of 137Cs, 90Sr and 239+240Pu in the Pacific Ocean a Bibliography

    Energy Technology Data Exchange (ETDEWEB)

    Noshkin, V.E.


    This report contains a listing of publications known to this author on reported concentrations, reviews and discussions of {sup 137}Cs, {sup 90}Sr and {sup 239+240}Pu in seawater, sediment and the biota from parts of the North and South Pacific Ocean. Each reference has been assigned an accession number consisting of the first three letters of the first author's last name followed by the first letter of the first name, the year of the publication and an assigned number. Studies in both the coastal areas and the open ocean are included as well as those providing data within lagoons of coral atolls. Some references to the radionuclides in the Indian Ocean are also provided.

  3. Applicability of {sup 239}Pu as a tracer for soil erosion in the wet-dry tropics of northern Australia

    Energy Technology Data Exchange (ETDEWEB)

    Lal, R., E-mail: [Department of Nuclear Physics, Research School of Physics and Engineering, Australian National University, Canberra, ACT 0200 (Australia); Tims, S.G.; Fifield, L.K. [Department of Nuclear Physics, Research School of Physics and Engineering, Australian National University, Canberra, ACT 0200 (Australia); Wasson, R.J.; Howe, D. [Charles Darwin University, Darwin, NT 0810 (Australia)


    The technique of accelerator mass spectroscopy (AMS) has been employed to determine modern soil loss rates through the analysis of {sup 239}Pu profiles in soil cores from the Daly basin in Northern Territory, Australia. In areas in which soil conservation banks were not present or were only added recently (<25a) and which had a history of grazing and cultivation the measured soil loss rates over the past {approx}50 years were 7.5-19.5 t ha{sup -1} a{sup -1}. The measured rates are up to 5 times higher compared to agricultural and uncultivated areas within soil conservation banks in other parts of the catchment. High intensity seasonal rainfall combined with reduction in land cover due to grazing and episodic bush fires are primary factors influencing erosion although other impacts on the landscape such as tillage generated runoff and land clearing seem to be responsible for accelerated sediment production.

  4. Alpha and conversion electron spectroscopy of 238,239Pu and 241Am and alpha-conversion electron coincidence measurements

    Energy Technology Data Exchange (ETDEWEB)

    Dion, Michael P.; Miller, Brian W.; Warren, Glen A.


    A technique to determine the isotopics of a mixed actinide sample has been proposed by measuring the coincidence of the alpha particle during radioactive decay with the conversion electron (or Auger) emitted during the relaxation of the daughter isotope. This presents a unique signature to allow the deconvolution of isotopes that possess overlapping alpha particle energy. The work presented here are results of conversion electron spectroscopy of 241Am, 238Pu and 239Pu using a dual-stage peltier-cooled 25 mm2 silicon drift detector. A passivated ion implanted planar silicon detector provided measurements of alpha spectroscopy. The conversion electron spectra were evaluated from 20–55 keV based on fits to the dominant conversion electron emissions, which allowed the relative conversion electron emission intensities to be determined. These measurements provide crucial singles spectral information to aid in the coincident measurement approach.

  5. Evaluating the 239Pu Prompt Fission Neutron Spectrum Induced by Thermal to 30 MeV Neutrons

    Directory of Open Access Journals (Sweden)

    Neudecker D.


    Full Text Available We present a new evaluation of the 239Pu prompt fission neutron spectrum (PFNS induced by thermal to 30 MeV neutrons. Compared to the ENDF/B-VII.1 evaluation, this one includes recently published experimental data as well as an improved and extended model description to predict PFNS. For instance, the pre-equilibrium neutron emission component to the PFNS is considered and the incident energy dependence of model parameters is parametrized more realistically. Experimental and model parameter uncertainties and covariances are estimated in detail. Also, evaluated covariances are provided between all PFNS at different incident neutron energies. Selected evaluation results and first benchmark calculations using this evaluation are briefly discussed.

  6. Lifespan studies in rats exposed to [sup 239]PuO[sub 2] aerosol: Part 3; Survival and lung tumours

    Energy Technology Data Exchange (ETDEWEB)

    Sanders, C.L. (Washington State Univ./Tri-Cities, Richland, WA (United States). Health Research and Education Center Pacific Northwest Lab., Richland, WA (United States)); Lauhala, K.E.; McDonald, K.E. (Pacific Northwest Lab., Richland, WA (United States))


    Female, young adult, Wistar rats were given a single inhalation exposure to a submicron sized aerosol of high-fired [sup 239]PuO[sub 2] and observed during their lifespan for primary lung tumours. Rats were distributed among sham-control (n = 1052) and exposed (n = 2105) groups. Survival was significantly reduced only in rat with lung doses > 30 Gy. A total of 99 primary lung tumours were found, of which 92% were malignant and 80% were carcinomas. Of malignant lung tumours, 49 were squamous cell carcinoma, 23 adenocarcinoma, nine hemangiosarcoma, seven adenosquamous carcinoma, and three fibrosarcoma. One adenocarcinoma was found in controls and only four adenomas were seen in the exposed rat at lung doses < 1.5 Gy. (author).

  7. 239Pu(n, 2n) and 241Pu(n, 2n) surrogate cross section measurements using NeutronSTARS

    Energy Technology Data Exchange (ETDEWEB)

    Burke, J. T. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Alan, B. S. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Akindele, O. A. [Univ. of California, Berkeley, CA (United States); Casperson, R. J. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Hughes, R. O. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Koglin, J. D. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Tamashiro, A. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Oregon State Univ., Corvallis, OR (United States); Kolos, K. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Norman, E. B. [Univ. of California, Berkeley, CA (United States); Saastamoinen, A. [Univ. of California, Los Angeles, CA (United States); Padilla, A. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Univ. of California, Los Angeles, CA (United States); Fisher, S. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)


    The goal of this project was to develop a new approach to measuring (n,2n) reactions for isotopes of interest. We set out to measure the 239Pu(n,2n) and 241Pu(n,2n) cross sections by directly detecting the 2n neutrons that are emitted. With the goal of improving the 239Pu(n,2n) cross section and to measure the 241Pu(n,2n) cross section for the first time. To that end, we have constructed a new neutron-charged-particle detector array called NeutronSTARS. It has been described extensively in Casperson et al. [1] and in Akindele et al. [2]. We have used this new neutron-charged-particle array to measure the 241Pu and 239Pu fission neutron multiplicity as a function of equivalent incident-neutron energy from 100 keV to 20 MeV. We have made a preliminary determination of the 239Pu(n,2n) and 241Pu(n,2n) cross sections from the surrogate 240Pu(α,α’2n) and 242Pu(α,α’2n) reactions respectively. The experimental approach, detector array, data analysis, and results to date are summarized in the following sections.

  8. Dissolution rates of /sup 238/PuO/sub 2/ and /sup 239/PuO/sub 2/ in 1M perchloric acid

    Energy Technology Data Exchange (ETDEWEB)

    Matlack, G.M.; Patterson, J.H.; Nelson, G.B.; Waterbury, G.R.


    The dissolution rate of /sup 238/PuO/sub 2/ and /sup 239/PuO/sub 2/ in 1M HClO/sub 4/ was measured over a period of 200 days. When equal ( masses of the oxides were compared, /sup 238/Pu was found to be released approximately five times faster than /sup 239/Pu. At the activity level, /sup 238/Pu was released 100 times faster than /sup 239/Pu. The difference in dissolution rates is attributed to the difference in alpha particle specific activity of the two materials which causes significantly greater radiation damage in /sup 238/PuO/sub 2/ than in /sup 239/PuO/sub 2/. The rate difference also may be affected by particle size and total oxide mass in the dissolution system. The results of these studies agree with data from earlier investigations in distilled water and simulated body fluid solvents.

  9. Vertical distribution of {sup 238}Pu, {sup 239(40)}Pu, {sup 241}Am, {sup 90}Sr and {sup 137}Cs in Austrian soil profiles

    Energy Technology Data Exchange (ETDEWEB)

    Srncik, M.; Wallner, G. [Inst. fuer Anorganische Chemie, Univ. Wien (Austria); Hrnecek, E. [ARC Seibersdorf Research GmbH, Seibersdorf (Austria); European Commission, Joint Research Centre, Inst. for Transuranium Elements, Karlsruhe (Germany); Steier, P.; Wallner, A. [Fakultaet fuer Physik, Isotopenforschung, Univ. Wien (Austria); Bossew, P. [Inst. fuer Physik und Biophysik, Univ. Salzburg (Austria)


    The occurrence of {sup 238}Pu, {sup 239(40)}Pu, {sup 241}Am, {sup 90}Sr and {sup 137}Cs in the region of Nassfeld (Salzburg, Austria) is discussed at four different locations by evaluating a depth profile for each radionuclide. Furthermore, the plutonium separated from the soil samples was measured by Accelerator Mass Spectrometry (AMS) to get information on the isotope ratio {sup 240}Pu/{sup 239}Pu. The radiochemical procedure consisted of a Pu separation step from Am and Sr by anion exchange in 8 M HNO{sub 3} after oxidation state adjustment to Pu(IV). Am and Sr were coprecipitated with calcium oxalate. Am was separated from Sr by extraction chromatography using TRU-resin. The Sr separation was performed also by extraction chromatography using Sr-resin; after coprecipitation as oxalate, {sup 90}Sr was measured in a gas proportional counter. For the determination of {sup 239(40)}Pu and {sup 241}Am by {alpha}-spectrometry thin sources were prepared by microprecipitation with NdF{sub 3}. With the respective Pu isotope ratios, it was possible to identify the global fallout as source of the contamination. This was confirmed by the ratio {sup 241}Am/{sup 239(40)}Pu. From the activity ratio {sup 90}Sr/{sup 137}Cs, it could be shown that most of these radionuclides stem from the reactor accident in Chernobyl. (orig.)

  10. 239+240Pu and 137Cs concentrations for zooplankton and nekton in the Northwest Pacific and Antarctic Oceans (1993-1996). (United States)

    Hong, G H; Kim, Y I; Lee, S H; Cooper, L W; Choe, S M; Tkalin, A V; Lee, A; Kim, S H; Chung, C S; Hirose, K


    The concentrations of 239+240Pu and 137Cs in zooplankton and nekton in the Northwest Pacific and Southern Oceans were measured during the period 1993-1996. The object of the sampling was to assess the potential impacts of existing submerged anthropogenic-radioactive materials in the western North Pacific as well as the East China Sea. Samples from the Bransfield Strait of the Antarctic Ocean provided a control source impacted by only atmospheric bomb fallout. No particularly elevated levels of 239+240Pu were found in zooplankton samples from the Northwest Pacific, although significantly lower levels of 239+240Pu were found in three mixed zooplankton samples from the Bransfield Strait. The body burden of 239+240Pu in zooplankton appears to reflect concentrations in ambient seawater with some variation. Some additional measurements of 137Cs in fish are also reported here to complement existing databases and for future reference in the regional marine environmental radioactivity monitoring effort.

  11. Comparison of cytotoxic and genotoxic effects of plutonium-239 alpha particles and mobile phone GSM 900 radiation in the Allium cepa test. (United States)

    Pesnya, Dmitry S; Romanovsky, Anton V


    The goal of this study was to compare the cytotoxic and genotoxic effects of plutonium-239 alpha particles and GSM 900 modulated mobile phone (model Sony Ericsson K550i) radiation in the Allium cepa test. Three groups of bulbs were exposed to mobile phone radiation during 0 (sham), 3 and 9h. A positive control group was treated during 20min with plutonium-239 alpha-radiation. Mitotic abnormalities, chromosome aberrations, micronuclei and mitotic index were analyzed. Exposure to alpha-radiation from plutonium-239 and exposure to modulated radiation from mobile phone during 3 and 9h significantly increased the mitotic index. GSM 900 mobile phone radiation as well as alpha-radiation from plutonium-239 induced both clastogenic and aneugenic effects. However, the aneugenic activity of mobile phone radiation was more pronounced. After 9h of exposure to mobile phone radiation, polyploid cells, three-groups metaphases, amitoses and some unspecified abnormalities were detected, which were not registered in the other experimental groups. Importantly, GSM 900 mobile phone radiation increased the mitotic index, the frequency of mitotic and chromosome abnormalities, and the micronucleus frequency in a time-dependent manner. Due to its sensitivity, the A. cepa test can be recommended as a useful cytogenetic assay to assess cytotoxic and genotoxic effects of radiofrequency electromagnetic fields. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Regulation of methanol metabolism in the facultative methylotroph Nocardia sp. 239 during growth on mixed substrates in batch- and continuous cultures

    NARCIS (Netherlands)

    Boer, L. de; Euverink, G.J.; Vlag, J. van der; Dijkhuizen, L.

    The regulation of methanol metabolism in Nocardia sp. 239 was investigated. Growth on mixtures of glucose or acetate plus methanol in batch cultures resulted in simultaneous utilization of the substrates. The presence of glucose, but not of acetate, repressed synthesis of the ribulose monophosphate

  13. Energy measurement of prompt fission neutrons in 239Pu(n,f) for incident neutron energies from 1 to 200 MeV

    CERN Document Server

    Chatillon, A; Granier, Th; Laurent, B; Taïeb, J; Noda, S; Haight, R C; Devlin, M; Nelson, R O; O’Donnell, J M


    Prompt fission neutron spectra in the neutron-induced fission of 239Pu have been measured for incident neutron energies from 1 to 200 MeV at the Los Alamos Neutron Science Center. Preliminary results are discussed and compared to theoretical model calculation.

  14. First report on methicillin-resistant Staphylococcus aureus of Spa type T037, Sequence type 239, SCCmec type III/IIIA in Malaysia

    NARCIS (Netherlands)

    V. Neela (Vasanthakumari); H. Ghasemzadeh Moghaddam (Hamed); A.F. van Belkum (Alex); D. Horst-Kreft (Deborah); N.S. Mariana (Nor Shamsudin); E. Ghaznavi Rad (Ehsanollah)


    textabstractMethicillin-resistant Staphylococcus aureus (MRSA) from Malaysia were shown to possess staphylococcal cassette chromosome mec (SCCmec)-III and IIIA. Spa sequencing and multi-locus sequence typing (MLST) documented t037 and ST 239 (CC8) for 83.3% of the isolates. This confirms

  15. {sup 239+240}Pu and 137Cs concentrations in fish, cephalopods, crustaceans, shellfish, and algae collected around the Japanese coast in the early 1990s

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, M.; Aono, T.; Hirano, S. [Geochemical Research Section, Research Center for Radioecology, National Institute of Radiological Sciences, Isozaki 3609, Hitachinaka, Ibaraki (Japan)


    Marine organisms, i.e. fish, cephalopods, crustaceans, shellfish, and algae, were collected in the early 1990s along the Sea of Japan coast and the Japanese Pacific coast and analyzed for their 239+240Pu and 137Cs concentrations. The 239+240Pu concentrations in muscle of fish were below 0.4 mBq/kg wet wt. and the lowest among the analyzed marine organisms. Most 137Cs concentrationsin muscle of fish ranged from 100 to 300 mBq/kg wet wt. Higher concentrations of 239+240Pu, ranging from 1.6 to 5.7 mBq/kg wet wt., were observed in viscera of cephalopods than in their muscle. The 239+240Pu concentrations in whole soft tissues of bivalves varied approximately one order of magnitude from 0.8 to 6.1 mBq/kg wet wt., while 137Cs concentrations had little variation, being approximately 60 mBq/kg wet wt. The 239+240Pu concentrations in algae had a wide variation, ranging from 1.7 to 42.3 mBq/kg wet wt., and were higher than those of the other marine organisms. No statistically significant difference in mean concentrations of 239+240Pu was detected among the whole soft tissues of bivalves, viscera of cephalopods and crustaceans, and whole bodies of cephalopods and crustaceans within the 95% confidence limit. The mean concentrations of 137Cs became higher in the order, cephalopods and crustaceans and bivalves, algae, viscera of fish, muscles of fish. The mean concentrations of 239+240Pu were comparable for algae collected along the Japan Sea coast and the Pacific coast. Furthermore, the difference in mean concentrations of 137Cs in algae between the Japan Sea coast and the Pacific coast was not statistically significant within the 95% confidence limit. These results can be considered to indicate no definite influence from radioactive dumping into the Japan Sea by the former USSR and Russia with respect to radioactive pollution of marine organisms collected along the Japanese coast.

  16. CD8+ lymphocytes control viral replication in SIVmac239-infected rhesus macaques without decreasing the lifespan of productively infected cells.

    Directory of Open Access Journals (Sweden)

    Nichole R Klatt


    Full Text Available While CD8+ T cells are clearly important in controlling virus replication during HIV and SIV infections, the mechanisms underlying this antiviral effect remain poorly understood. In this study, we assessed the in vivo effect of CD8+ lymphocyte depletion on the lifespan of productively infected cells during chronic SIVmac239 infection of rhesus macaques. We treated two groups of animals that were either CD8+ lymphocyte-depleted or controls with antiretroviral therapy, and used mathematical modeling to assess the lifespan of infected cells either in the presence or absence of CD8+ lymphocytes. We found that, in both early (day 57 post-SIV and late (day 177 post-SIV chronic SIV infection, depletion of CD8+ lymphocytes did not result in a measurable increase in the lifespan of either short- or long-lived productively infected cells in vivo. This result indicates that the presence of CD8+ lymphocytes does not result in a noticeably shorter lifespan of productively SIV-infected cells, and thus that direct cell killing is unlikely to be the main mechanism underlying the antiviral effect of CD8+ T cells in SIV-infected macaques with high virus replication.

  17. Gene Therapy Corrects Mitochondrial Dysfunction in Hematopoietic Progenitor Cells and Fibroblasts from Coq9R239X Mice. (United States)

    Barriocanal-Casado, Eliana; Cueto-Ureña, Cristina; Benabdellah, Karim; Gutiérrez-Guerrero, Alejandra; Cobo, Marién; Hidalgo-Gutiérrez, Agustín; Rodríguez-Sevilla, Juan José; Martín, Francisco; López, Luis C


    Recent clinical trials have shown that in vivo and ex vivo gene therapy strategies can be an option for the treatment of several neurological disorders. Both strategies require efficient and safe vectors to 1) deliver the therapeutic gene directly into the CNS or 2) to genetically modify stem cells that will be used as Trojan horses for the systemic delivery of the therapeutic protein. A group of target diseases for these therapeutic strategies are mitochondrial encephalopathies due to mutations in nuclear DNA genes. In this study, we have developed a lentiviral vector (CCoq9WP) able to overexpress Coq9 mRNA and COQ9 protein in mouse embryonic fibroblasts (MEFs) and hematopoietic progenitor cells (HPCs) from Coq9R239X mice, an animal model of mitochondrial encephalopathy due to primary Coenzyme Q (CoQ) deficiency. Ectopic over-expression of Coq9 in both cell types restored the CoQ biosynthetic pathway and mitochondrial function, improving the fitness of the transduced cells. These results show the potential of the CCoq9WP lentiviral vector as a tool for gene therapy to treat mitochondrial encephalopathies.

  18. Migration of Sr-20, Cs-137, and Pu-239/240 in Canyon below Los Alamos outfall

    Energy Technology Data Exchange (ETDEWEB)

    Murphy, J.M.; Mason, C.F.V.; Boak, J.M.; Longmire, P.A.


    Technical Area-21 (TA-21) of Los Alamos National Laboratory (LANL) is on a mesa bordered by two canyons DP Canyon and Los Alamos (LA) Canyon. DP Canyon is a small semiarid watershed with a well defined channel system where the stream flow is ephemeral. TA-21 has had a complex history of waste disposal as research to determine the chemical and metallurgical properties of nuclear materials occurred here from 1945-1978. Due to these operations, the TA-21 mesa top and bordering canyons have been monitored and characterized by the LANL Environmental Restoration Program. Results identify radionuclide values at outfall. 21-011 (k) which exceed Screening Action Levels, and points along DP Canyon which exceed regional background levels. The radiocontaminants considered in this study are strontium-90, cesium-137, and plutonium-239. This research examines sediment transport and speciation of radionuclide contaminant migration from a source term named SWMU 21-011 (k) down DP Canyon. Three dimensional surface plots of data from 1977-1994 are used to portray the transport and redistribution of radioactive contaminants in an alluvial stream channel. An overall decrease in contamination concentration since 1983 has been observed which could be due to more stringent laboratory controls and also to the removal of main plutonium processing laboratories to another site.

  19. Alpha and conversion electron spectroscopy of 238,239Pu and 241Am and alpha-conversion electron coincidence measurements (United States)

    Dion, Michael P.; Miller, Brian W.; Warren, Glen A.


    A technique to determine the isotopic constituents of a mixed actinide sample has been proposed by a coincident alpha-conversion electron measurement. This presents a unique signature to allow the unfolding of isotopes that possess overlapping alpha particle energy and reduce backgrounds of an unseparated sample. The work presented here are results of conversion electron spectroscopy of 241Am, 238Pu and 239Pu using a dual-stage peltier-cooled 25 mm2 silicon drift detector and alpha spectroscopy with a passivated ion implanted planar silicon detector. The conversion electron spectra were evaluated from 20-55 keV based on fits to the dominant conversion electron emissions, which allowed the relative conversion electron emission intensities to be determined. These measurements provide crucial singles spectral information and calibration to aid in the coincident measurement approach. Furthermore, an alpha-conversion electron spectrometer was assembled using the silicon based detectors described and results of a coincident spectrum analysis is reported for 241Am.

  20. Transcriptional Profiling of Experimental CD8+ Lymphocyte Depletion in Rhesus Macaques Infected with Simian Immunodeficiency Virus SIVmac239 (United States)

    Bosinger, Steven E.; Jochems, Simon P.; Folkner, Kathryn A.; Hayes, Timothy L.; Klatt, Nichole R.


    CD8+ T cells inhibit virus replication in SIV-infected rhesus macaques. However, it is unclear to what extent the viral suppression mediated by CD8+ T cells reflects direct killing of infected cells as opposed to indirect, noncytolytic mechanisms. In this study, we used functional genomics to investigate noncytolytic mechanisms of in vivo viral suppression mediated by CD8+ lymphocytes. Eight chronically SIVmac239-infected rhesus macaques underwent CD8+ lymphocyte depletion, and RNA from whole blood was obtained prior to depletion, during the nadir of CD8+ cell depletion, and after CD8+ lymphocyte numbers had rebounded. We observed significant downregulation of the expression of genes encoding factors that can suppress SIV replication, including the CCR5-binding chemokine CCL5/RANTES and CCL4 and several members of the tripartite motif-containing (TRIM) family. Surprisingly, we also noted a strong, widespread downregulation of α- and θ-defensins with anti-HIV activity, which are not expressed by CD8+ T cells. After cessation of depleting antibody treatment, we observed induction of a transcriptional signature indicative of B lymphocyte activation. Validation experiments demonstrated that animals during this period had elevated levels of B cells coupled with higher expression of the proliferative marker Ki67, indicating that CD8+ depletion triggered a potent expansion of B cell numbers. Collectively, these data identify antiviral pathways perturbed by in vivo CD8+ T cell depletion that may contribute to noncytolytic control of SIV replication. PMID:23097439

  1. (236)U and (239,)(240)Pu ratios from soils around an Australian nuclear weapons test site. (United States)

    Tims, S G; Froehlich, M B; Fifield, L K; Wallner, A; De Cesare, M


    The isotopes (236)U, (239)Pu and (240)Pu are present in surface soils as a result of global fallout from nuclear weapons tests carried out in the 1950's and 1960's. These isotopes potentially constitute artificial tracers of recent soil erosion and sediment movement. Only Accelerator Mass Spectrometry has the requisite sensitivity to measure all three isotopes at these environmental levels. Coupled with its relatively high throughput capabilities, this makes it feasible to conduct studies of erosion across the geographical extent of the Australian continent. In the Australian context, however, global fallout is not the only source of these isotopes. As part of its weapons development program the United Kingdom carried out a series of atmospheric and surface nuclear weapons tests at Maralinga, South Australia in 1956 and 1957. The tests have made a significant contribution to the Pu isotopic abundances present in the region around Maralinga and out to distances ∼1000 km, and impact on the assessment techniques used in the soil and sediment tracer studies. Quantification of the relative fallout contribution derived from detonations at Maralinga is complicated owing to significant contamination around the test site from numerous nuclear weapons safety trials that were also carried out around the site. We show that (236)U can provide new information on the component of the fallout that is derived from the local nuclear weapons tests, and highlight the potential of (236)U as a new fallout tracer. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.

  2. Genetic diversity of methicillin resistant Staphylococcus aureus strains isolated from burn patients in Iran: ST239-SCCmec III/t037 emerges as the major clone. (United States)

    Goudarzi, Mehdi; Bahramian, Mahnaz; Satarzadeh Tabrizi, Mahboobeh; Udo, Edet E; Figueiredo, Agnes Marie Sá; Fazeli, Maryam; Goudarzi, Hossein


    Methicillin-resistant Staphylococcus aureus (MRSA) as a major cause of infection in health care, hospital and community settings is a global health concern. The purpose of this study was to determine the antibiotic susceptibility pattern and distribution of circulating molecular types of MRSA in a burn hospital in Tehran, the capital of Iran. During a 10-month study period, 106 Staphylococcus aureus isolates were assessed. Isolates were subjected to susceptibility testing using the disk diffusion method and Polymerase Chain Reaction (PCR) for detection of mecA, fem and nuc genes. The presence of PVL and tst encoding genes were determined by PCR method. All the MRSA isolates were genotyped by multilocus sequence typing (MLST), spa typing, SCCmec typing and agr typing. The presence of mecA gene was confirmed in all the Staphylococcus aureus isolates. Antimicrobial susceptibility testing revealed a high resistance rate (90.6%) to ampicillin, tetracycline, and erythromycin. The rates of resistance to remaining antibiotics tested varied between 18.9% and 84.9%. The high- level of resistance to mupirocin was confirmed in 19.8% of MRSA strains isolated from burn patients. Multi-drug resistance was observed in 90.6% of isolates. Sixteen of the 106 MRSA isolates (15.1%) harbored PVL-encoding genes. The majority of our MRSA strains carried SCCmec III (71.7%). ST239-SCCmec III/t037 (34%) was the most common genotype followed by ST239-SCCmec III/t030 (24.5%), ST15-SCCmec IV/t084 (15.1%), ST22-SCCmec IV/t790 (13.2%), and ST239-SCCmec III/t631 (13.2%). Mupirocin resistant MRSA isolates belonged to ST15-SCCmec IV/t084 (40%), ST22-SCCmec IV/t790 (23.3%), ST239-SCCmec III/t631 (20%), and ST239-SCCmec III/t030 (16.7%) clones. The results showed that genetically diverse strains of MRSA are circulating in our burn hospitals with relatively high prevalence of ST239-SCCmec III/t037 clone. The findings support the need for regular surveillance of MRSA to determine the distribution of

  3. Assinatura da deposição atmosférica de testes nucleares em sedimentos da costa brasileira (240+239Pu e 137Cs

    Directory of Open Access Journals (Sweden)

    Christian J. Sanders


    Full Text Available The aim of this review is to take a look at Cold War era nuclear tests signatures found in Brazilian coastal sediments. Both137Cs and 240+239Pu signatures have been documented in mangrove, coastal mudflats and continental shelf sediments, associated with above ground nuclear tests beginning in the 1950's. The dates associated to the anthropogenic radionuclide signatures 137Cs and 240+239Pu along sediment columns are confirmed by 210Pb geochronology in many of the studies highlighted in this review. The results outlined in this review characterize the extent to which nuclear fallout products reach the Brazilian coast in quantities sufficient for detection, allowing the use of these radioisotopes as geochronometers.

  4. Distal leucines are key functional determinants of Alix-binding simian immunodeficiency virus SIV(smE543) and SIV(mac239) type 3 L domains. (United States)

    Bello, Nana F; Wu, Fan; Sette, Paola; Dussupt, Vincent; Hirsch, Vanessa M; Bouamr, Fadila


    In addition to PTAP L domains, primate lentiviruses carry Alix-binding motifs that include the recently described type 3 SREKPYKEVTEDLLHLNSLF sequence. We examined the requirements for the type 3 sequence motif in simian immunodeficiency virus SIV(smE543) and identified the (499)LNSLF(503) sequence as a key functional determinant. Mutation of distal leucines (499)L and (502)L (LL mutant) caused an inhibitory effect on Alix-dependent SIV(smE543) release that was quantitatively similar to that observed following disruption of the type 3 L domain or RNA interference (RNAi) depletion of Alix. Similar results were obtained with the SIV(mac239) LL mutant. Thus, distal leucines are key determinants of SIV(smE543) and SIV(mac239) type 3 L domains.

  5. Comparison of the effects of inhaled {sup 239}PuO{sub 2} and {beta}- emitting radionuclides on the incidence of lung carcinomas in laboratory animals

    Energy Technology Data Exchange (ETDEWEB)

    Hahn, F.F.; Griffith, W.C.; Boecker, B.B.; Muggenburg, B.A.; Lundgren, D.L.


    The health effects of inhaling radioactive particles when the lung is the primary organ irradiated were studied in rats and Beagle dogs. The animals were exposed to aerosols of {sup 239}PuO{sub 2} or fission-product radionuclides in insoluble forms and observed for their life span. Lung carcinomas were the primary late-occuring effect. The incidence rate for lung carcinomas was modeled using a proportional hazard rate model. Linear functions predominated below 5 Gy to the lung. The life-time risk for lung carcinomas per 10{sup 4} Gy for beta emitters was 60 for rats and 65 for dogs, and for {sup 239}PuO{sub 2} it was 1500 for rats and 2300 for dogs.

  6. Fate and transport of plutonium-239 + 240 and Americium-241 in the soil of Rocky Flats, Colorado

    Energy Technology Data Exchange (ETDEWEB)

    Litaor, M.I.; Barth, G.R.; Zika, E.M. [Univ. of Colorado, Boulder, CO (United States)


    Actinides contamination of soils around Rocky Flats, CO, resulted from leaking drums of Pu-contaminated oil stored at an outdoor site. The transport of these actinides through the soil to groundwater was studied using an advanced monitoring system (MS). The fully automated, remotely controlled MS gathered real-time data on soil water content, groundwater level, and timing of gravitationally flowing water. Controlled rain simulations coupled with measurements of volume flux and actinide activities provided essential information about the fate and transport of Pu-239 + 240 and Am-241. Volume fluxes at most sampling locations were similar, regardless of the antecedent moisture or the duration, frequency, and intensity of the simulated rain. Actinide activities were not correlated with the measured volume flux, or the duration, frequency, and intensity of the simulated rain. Flow was facilitated primarily via macropore channeling. The relatively short residence time precluded a continuous interaction between the soil and the flowing water, which minimized the movement of actinides in the soil. Actinide activities in the interstitial water collected from the upper 20 cm of the soil were significantly higher (P>0.001) than water collected at deeper sampling depths (20-70 cm). Actinide activity in water samples from the deepest sampling depth (40-70 cm) did not exceed 0.4 Bq/L. These results suggest that, under the experimental conditions, the movement of actinides was restricted to the top 20 cm. A transport mechanism involving discrete Pu oxide particles, coupled with macropore channeling is proposed to explain the observed actinide activities in the soil. 31 refs., 6 figs., 7 tabs.

  7. Delayed Fission Gamma-ray Characteristics of Th-232 U-233 U-235 U-238 and Pu-239

    Energy Technology Data Exchange (ETDEWEB)

    Lane, Taylor [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States); Parma, Edward J. [Sandia National Laboratories (SNL-NM), Albuquerque, NM (United States)


    Delayed fission gamma-rays play an important role in determining the time dependent ioniz- ing dose for experiments in the central irradiation cavity of the Annular Core Research Reactor (ACRR). Delayed gamma-rays are produced from both fission product decay and from acti- vation of materials in the core, such as cladding and support structures. Knowing both the delayed gamma-ray emission rate and the time-dependent gamma-ray energy spectrum is nec- essary in order to properly determine the dose contributions from delayed fission gamma-rays. This information is especially important when attempting to deconvolute the time-dependent neutron, prompt gamma-ray, and delayed gamma-ray contribution to the response of a diamond photo-conducting diode (PCD) or fission chamber in time frames of milliseconds to seconds following a reactor pulse. This work focused on investigating delayed gamma-ray character- istics produced from fission products from thermal, fast, and high energy fission of Th-232, U-233, U-235, U-238, and Pu-239. This work uses a modified version of CINDER2008, a transmutation code developed at Los Alamos National Laboratory, to model time and energy dependent photon characteristics due to fission. This modified code adds the capability to track photon-induced transmutations, photo-fission, and the subsequent radiation caused by fission products due to photo-fission. The data is compared against previous work done with SNL- modified CINDER2008 [ 1 ] and experimental data [ 2 , 3 ] and other published literature, includ- ing ENDF/B-VII.1 [ 4 ]. The ability to produce a high-fidelity (7,428 group) energy-dependent photon fluence at various times post-fission can improve the delayed photon characterization for radiation effects tests at research reactors, as well as other applications.

  8. CD8+ and CD4+ cytotoxic T cell escape mutations precede breakthrough SIVmac239 viremia in an elite controller

    Directory of Open Access Journals (Sweden)

    Burwitz Benjamin J


    Full Text Available Abstract Background Virus-specific T cells are critical components in the containment of immunodeficiency virus infections. While the protective role of CD8+ T cells is well established by studies of CD8+ T cell-mediated viral escape, it remains unknown if CD4+ T cells can also impose sufficient selective pressure on replicating virus to drive the emergence of high-frequency escape variants. Identifying a high frequency CD4+ T cell driven escape mutation would provide compelling evidence of direct immunological pressure mediated by these cells. Results Here, we studied a SIVmac239-infected elite controller rhesus macaque with a 1,000-fold spontaneous increase in plasma viral load that preceded disease progression and death from AIDS-related complications. We sequenced the viral genome pre- and post-breakthrough and demonstrate that CD8+ T cells drove the majority of the amino acid substitutions outside of Env. However, within a region of Gag p27CA targeted only by CD4+ T cells, we identified a unique post-breakthrough mutation, Gag D205E, which abrogated CD4+ T cell recognition. Further, we demonstrate that the Gag p27CA-specific CD4+ T cells exhibited cytolytic activity and that SIV bearing the Gag D205E mutation escapes this CD4+ T cell effector function ex vivo. Conclusions Cumulatively, these results confirm the importance of virus specific CD8+ T cells and demonstrate that CD4+ T cells can also exert significant selective pressure on immunodeficiency viruses in vivo during low-level viral replication. These results also suggest that further studies of CD4+ T cell escape should focus on cases of elite control with spontaneous viral breakthrough.

  9. A new salicylate synthase AmS is identified for siderophores biosynthesis in Amycolatopsis methanolica 239(T). (United States)

    Xie, Feng; Dai, Shengwang; Shen, Jinzhao; Ren, Biao; Huang, Pei; Wang, Qiushui; Liu, Xueting; Zhang, Buchang; Dai, Huanqin; Zhang, Lixin


    Siderophores are important for the growth of bacteria or the applications in treatment of iron overload-associated diseases due to the iron-chelating property. Salicylate synthase played a key role in the biosynthesis of some NRPS-derived siderophores by the providing of an iron coordination moiety as the initial building block. A new salicylate synthase, namely AmS, was identified in the biosynthesis pathway of siderophore amychelin in Amycolatopsis methanolica 239(T), since it shunt chorismate, an integrant precursor, from primary to secondary metabolite flow. The amino acid sequence alignment and phylogenetic analysis showed that AmS grouped into a new cluster. In vitro assays of AmS revealed its wide temperature tolerance ranged from 0 to 40 °C and narrow pH tolerant ranged from 7.0 to 9.0. AmS was resistant to organic solvents and non-ionic detergents. Moreover, AmS converted chorismate to salicylate with K m of 129.05 μM, k cat of 2.20 min(-1) at optimal conditions, indicating its low substrate specificity and comparable velocity to reported counterparts (Irp9 and MbtI). These properties of AmS may improve the iron-seizing ability of A. methanolica to compete with its neighbors growing in natural environments. Most importantly, serine and cysteine residues were found to be important for the catalytic activity of AmS. This study presented AmS as a new cluster of salicylate synthase and the reaction mechanism and potential applications of salicylate synthase were highlighted as well.

  10. Energy measurement of prompt fission neutrons in 239Pu(n,f) for incident neutron energies from 1 to 200 MeV

    Energy Technology Data Exchange (ETDEWEB)

    Haight, Robert C [Los Alamos National Laboratory; Devlin, Matthew J [Los Alamos National Laboratory; Nelson, Ronald O [Los Alamos National Laboratory; O' Donnell, John M [Los Alamos National Laboratory; Chatillon, Audrey [CEA, FRANCE; Granier, Thierry [CEA, FRANCE; Taieb, Julien [CEA, FRANCE; Belier, Gilbert [CEA, FRANCE; Laurent, Benoit [CEA, FRANCE; Noda, Shusaku [KYUSHU UNIV, JAPAN


    An experimental campaign was started in 2002 in the framework of a collaboration belween CEA-DAM and the Los Alamos National Laboratory to measure the prompt fission neutron spectra (PFNS) for incident neutron energies from 1 to 200 MeV with consistent error uncertainties over the whole energy range. The prompt neutron spectra in {sup 235,238}U(n,f) and {sup 237}Np(n,f) have been already studied successfully. A first attempt to characterize the prompt neutrons emitted during the fission of the {sup 239}Pu was done in 2007. This contribution will focus on the results obtained during the final experiment to measure the PFNS in {sup 239}Pu(n,f) performed in 2008. Prompt fission neutron spectra in the neutron-induced fission of {sup 239}Pu have been measured for incident neutron energies from 1 to 200 MeV at the Los Alamos Neutron Science Center. Mean energies obtained from the spectra are discussed and compared to theoretical model calculation.

  11. Adjustment of a direct method for the determination of man body burden in Pu-239 on by X-ray detection of U-235; Mise au point d'une methode directe de determination de la charge corporelle en plutonium 239 chez l'homme par detection X de l'uranium 235

    Energy Technology Data Exchange (ETDEWEB)

    Boulay, P. [Commissariat a l' Energie Atomique, Bruyeres-le-Chatel (France). Centre d' Etudes


    The use of Pu-239 on a larger scale sets a problem about the contamination measurement by aerosol at lung level. A method of direct measurement of Pu-239 lung burden is possible, thanks to the use of a large area window proportional counter. A counter of such pattern, has been especially carried out for this purpose. The adjustment of the apparatus allows an adequate sensibility to detect a contamination at the maximum permissible body burden level. Besides, a method for individual 'internal calibration', with a plutonium mock: the protactinium-233, is reported. (author) [French] L'utilisation a une echelle de plus en plus large du plutonium-239 pose un probleme de la mesure de la contamination par aerosol au niveau du poumon. Une methode de mesure directe de la charge pulmonaire en plutonium-239 est possible grace a l'utilisation d'un compteur proportionnel a fenetre de grande surface. Un compteur de ce type a specialement ete realise dans ce but. La mise au point de l'appareillage permet une sensibilite suffisante pour deceler une contamination au niveau de la Q.M.A (quantite maximale admissible). D'autre part, une methode 'd'etalonnage interne' de l'individu a l'aide d'un simulateur de plutonium, le protactinium-233, est decrite. (auteur)

  12. Fate of 137Cs, 90Sr and 239+240Pu in soil profiles at a water recharge site in Basel, Switzerland. (United States)

    Abraham, Johannes; Meusburger, Katrin; Waldis, Judith Kobler; Ketterer, Michael E; Zehringer, Markus


    An important process in the production of drinking water is the recharge of the withdrawn ground water with river water at protected recharge fields. While it is well known that undisturbed soils are efficiently filtering and adsorbing radionuclides, the goal of this study was to investigate their behaviour in an artificial recharge site that may receive rapid and additional input of radionuclides by river water (particularly when draining a catchment including nuclear power plants (NPP)). Soil profiles of recharge sites were drilled and analysed for radionuclides, specifically radiocesium (137Cs), radiostrontium (90Sr) and plutonium (239+240Pu). The distribution of the analysed radionuclides were compared with an uncultivated reference soil outside the recharge site. The main activity of 137Cs was located in the top soil (4.5-7.5 cm) and reached down to a depth of 84 cm and 48 cm for the recharge and the reference site, respectively. The found activities of 239+240Pu originate from the global fallout after 1950. 239+240Pu appeared to be strongly adsorbed onto soil particles. The shape of the depth profile was similar to 137Cs, but also similar between the recharge and the reference site. In contrast, 90Sr showed a uniform distribution over the entire depth of the recharge and reference profiles indicating that 90Sr already entered the gravel zone and the ground water. Elevated inventories of the radionuclides were observed for the recharge site. The soil of the recharge field exhibited a threefold higher activity of 137Cs compared to the reference soil. Also for 239+240Pu higher inventories where observed for the recharge sites (40%). 90Sr behaved differently, showing similar inventories between reference and recharge site. We estimate that 75-89% of the total inventory of 137Cs in the soil at the recharge site (7.000 Bq/m2) originated from the fallout of the Chernobyl accident and from emissions of Swiss NPPs. This estimate is based on the actual activity

  13. Spatial and temporal variations of plutonium isotopes ({sup 238}Pu and {sup 239,240}Pu) in sediments off the Rhone River mouth (NW Mediterranean)

    Energy Technology Data Exchange (ETDEWEB)

    Lansard, B. [Laboratoire d' Oceanographie et de Biogeochimie, UMR 6535, CNRS/Universite de la Mediterranee, Station Marine d' Endoume, rue de la Batterie des Lions, 13007, Marseille (France)]. E-mail:; Charmasson, S. [Institut de Radioprotection et de Surete Nucleaire, IRSN, Laboratoire d' Etudes Radioecologiques en milieu Continental et Marin, centre IFREMER de Mediterranee, BP 330, zone portuaire de Bregaillon, 83507, La Seyne-sur-Mer Cedex (France); Gasco, C. [Centro de Investigaciones Energeticas, Medioambientales y Tecnologicas, CIEMAT, Departamento de Medio Ambiante, Avenida de la Complutense 22, 28040, Madrid (Spain); Anton, M.P. [Centro de Investigaciones Energeticas, Medioambientales y Tecnologicas, CIEMAT, Departamento de Medio Ambiante, Avenida de la Complutense 22, 28040, Madrid (Spain); Grenz, C. [Laboratoire d' Oceanographie et de Biogeochimie, UMR 6535, CNRS/Universite de la Mediterranee, Station Marine d' Endoume, rue de la Batterie des Lions, 13007, Marseille (France); Arnaud, M. [Institut de Radioprotection et de Surete Nucleaire, IRSN, Laboratoire d' Etudes Radioecologiques en milieu Continental et Marin, centre IFREMER de Mediterranee, BP 330, zone portuaire de Bregaillon, 83507, La Seyne-sur-Mer Cedex (France)


    The dispersion and fate of the Rhone River inputs to the Gulf of Lions (Northwestern Mediterranean Sea) have been studied through the spatial and temporal distributions of plutonium isotopes in continental shelf sediments. Plutonium isotopes ({sup 238}Pu and {sup 239,240}Pu) are appropriate tracers to follow the dispersion of particulate matter due both to their high affinity for particles and their long half-lives. In the Rhone River valley, plutonium isotopes originate from both the weathering of the catchment basin contaminated by global atmospheric fallout, and the liquid effluents released from the Marcoule reprocessing plant since 1961. This work presents a first detailed study on {sup 238}Pu and {sup 239,240}Pu distributions in sediments from the Rhone prodelta to the adjacent continental shelf, since the decommissioning of Marcoule in 1997. The vertical distribution of Pu isotopes has been analysed in a 4.75 m long core sampled in 2001 at the Rhone mouth. Despite this length, plutonium is found at the last 10 cm, manifesting the high sedimentation rate of the prodeltaic area and its ability for trapping fine-grained sediments and associated contaminants. The highest {sup 238}Pu and {sup 239,240}Pu concentrations reached 1.26 and 5.97 Bq kg{sup -1} respectively and were found within the layer 280-290 cm. The {sup 238}Pu/{sup 239,240}Pu activity ratios (AR) demonstrated an efficient and huge trapping of the Pu isotopes derived from Marcoule. The fresh sediments, located on the top of the core, show lower plutonium activity concentrations and lower {sup 238}Pu/{sup 239,240}Pu ratios. This decrease is in close relation with the shut down of the Marcoule reprocessing plant in 1997. In 2001, plutonium isotopes were also analysed in 21 surface sediments located offshore and concentrations ranged from 0.03 to 0.17 Bq kg{sup -1} for {sup 238}Pu and from 0.33 to 1.72 Bq kg{sup -1} for {sup 239,240}Pu. The {sup 238}Pu/{sup 239,240}Pu AR ranged from 0.24 close to the

  14. Physical and underway data collected aboard the THOMAS G. THOMPSON during cruise TN239 in the Coastal Waters of SE Alaska and North Pacific Ocean from 2009-08-22 to 2009-09-20 (NODC Accession 0104355) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC accession 0104355 includes physical and underway data collected aboard the THOMAS G. THOMPSON during cruise TN239 in the Coastal Waters of SE Alaska and North...

  15. Feasibility study of {sup 235}U and {sup 239}Pu characterization in radioactive waste drums using neutron-induced fission delayed gamma rays

    Energy Technology Data Exchange (ETDEWEB)

    Nicol, T. [CEA, DEN, Cadarache, Nuclear Measurement Laboratory, F-13108 Saint-Paul-lez-Durance (France); FZJ, Institute of Energy and Climate Research – Nuclear Waste Management and Reactor Safety, Wilhelm-Johnen-Straße, d-52425 Jülich (Germany); Pérot, B., E-mail: [CEA, DEN, Cadarache, Nuclear Measurement Laboratory, F-13108 Saint-Paul-lez-Durance (France); Carasco, C. [CEA, DEN, Cadarache, Nuclear Measurement Laboratory, F-13108 Saint-Paul-lez-Durance (France); Brackx, E. [CEA, DEN, Marcoule, Metallography and Chemical Analysis Laboratory, F-30207 Bagnols-sur-Cèze (France); Mariani, A.; Passard, C. [CEA, DEN, Cadarache, Nuclear Measurement Laboratory, F-13108 Saint-Paul-lez-Durance (France); Mauerhofer, E. [FZJ, Institute of Energy and Climate Research – Nuclear Waste Management and Reactor Safety, Wilhelm-Johnen-Straße, d-52425 Jülich (Germany); Collot, J. [Laboratoire de Physique Subatomique et de Cosmologie, Université Grenoble Alpes, CNRS/IN2P3 Grenoble (France)


    This paper reports a feasibility study of {sup 235}U and {sup 239}Pu characterization in 225 L bituminized waste drums or 200 L concrete waste drums, by detecting delayed fission gamma rays between the pulses of a deuterium-tritium neutron generator. The delayed gamma yields were first measured with bare samples of {sup 235}U and {sup 239}Pu in REGAIN, a facility dedicated to the assay of 118 L waste drums by Prompt Gamma Neutron Activation Analysis (PGNAA) at CEA Cadarache, France. Detectability in the waste drums is then assessed using the MCNPX model of MEDINA (Multi Element Detection based on Instrumental Neutron Activation), another PGNAA cell dedicated to 200 L drums at FZJ, Germany. For the bituminized waste drum, performances are severely hampered by the high gamma background due to {sup 137}Cs, which requires the use of collimator and shield to avoid electronics saturation, these elements being very penalizing for the detection of the weak delayed gamma signal. However, for lower activity concrete drums, detection limits range from 10 to 290 g of {sup 235}U or {sup 239}Pu, depending on the delayed gamma rays of interest. These detection limits have been determined by using MCNPX to calculate the delayed gamma useful signal, and by measuring the experimental gamma background in MEDINA with a 200 L concrete drum mock-up. The performances could be significantly improved by using a higher interrogating neutron emission and an optimized experimental setup, which would allow characterizing nuclear materials in a wide range of low and medium activity waste packages.

  16. Comparison of the ENDF/B-V and SOKRATOR evaluations of /sup 235/U, /sup 239/Pu, /sup 240/Pu and /sup 241/Pu at low neutron energies

    Energy Technology Data Exchange (ETDEWEB)

    de Saussure, G.; Wright, R.Q.


    The US and USSR's most recent evaluationsof /sup 235/U, /sup 239/Pu, /sup 240/Pu and /sup 241/Pu are compared over the thermal region and over the first few resonances. The two evaluations rest on essentially the same experimental data base and the differences reflect different approaches to the representation of the cross sections or different weightings of the experimental results. It is found that over the thermal and resolved ranges the two evaluations are very similar. Some differences in approaches are briefly discussed.

  17. {sup 238}Pu, {sup 239+240}Pu and {sup 241}Am levels in the terrestrial and aquatic environment of the Loire and Garonne rivers basins (France)

    Energy Technology Data Exchange (ETDEWEB)

    Rousseau, G.; Mokili, M.B.; Le Roy, C.; Pagano, V. [SUBATECH/IN2P3 (France); Gontier, G.; Boyer, C. [EDF-DPI-DIN-CIDEN (France); Chardon, P. [CNRS/IN2P3 (France); Hemidy, P.Y. [EDF-DPN-UNIE-GPRE-IEV (France)


    Plutonium and americium long-lived alpha emitter isotopes can be found in the environment because of atmospheric global fallout due to thermonuclear tests performed between 1945 and 1980, to the American SNAP 9A satellite explosion in 1964, to the Chernobyl nuclear power plant accident,... In France, the nuclear safety authority does not allow the release of artificial alpha emitters from nuclear power plants. Thus, monitoring is performed to verify the absence of these alpha emitters in liquid discharges to respect the limits set by the regulations. These thresholds ensure a very low dosimetric impact to the population compared to other radionuclides. With the objective of environmental monitoring around nuclear facilities, activity measurements of long-lived alpha emitters are carried out to detect the traces of these radionuclides. Analysis of low activity by alpha spectrometry after chemical steps were performed and used to determine the {sup 238}Pu, {sup 239+240}Pu and {sup 241}Am activities on a large set of environmental solid samples likely to be encountered in environmental monitoring as soils, sediments, terrestrial and aquatic bio-indicators. The samples collected in the terrestrial and aquatic environment of the Loire and Garonne rivers basins (France) was investigated for the 2009-2014 period. It was found that the mean activity concentration of the most frequently detected was for the radionuclide {sup 238}Pu: from <0.00031 to 0.0061 Bq/kg dry in terrestrial samples and from <0.00086 to 0.011 Bq/kg dry in aquatic samples; for the radionuclide {sup 239+240}Pu: from 0.00041 to 0.150 Bq/kg dry in terrestrial samples and from 0.0023 to 0.240 Bq/kg dry in aquatic samples and for the radionuclide {sup 241}Am: from <0.00086 to 0.087 Bq/kg dry in terrestrial samples and from 0.0022 to 0.120 Bq/kg dry in aquatic samples. {sup 238}Pu/{sup 239+240}Pu and {sup 241}Am/{sup 239+240}Pu ratios determined are in accordance with an environmental contamination due to

  18. Plants as bio-monitors for Cs-137, Pu-238, Pu-239,240 and K-40 at the Savannah River Site. (United States)

    Caldwell, Eric Frank; Duff, Martine C; Ferguson, Caitlin E; Coughlin, Daniel P


    The Savannah River Site was constructed in South Carolina to produce plutonium (Pu) in the 1950s. Discharges associated with these now-ceased operations have contaminated large areas within the site, particularly streams associated with reactor cooling basins. Evaluating the exposure risk of contamination to an ecosystem requires methodologies that can assess the bioavailability of contaminants. Plants, as primary producers, represent an important mode of transfer of contaminants from soils and sediments into the food chain. The objective of this study was to identify local area plants for their ability to act as bio-monitors of radionuclides. The concentrations of cesium-137 ((137)Cs), potassium-40 ((40)K), (238)Pu and (239,240)Pu in plants and their associated soils were determined using γ and α spectrometry. The ratio of contamination concentration found in the plant relative to the soil was calculated to assess a concentration ratio (CR). The highest CR for (137)Cs was found in Pinus palustris needles (CR of 2.18). The correlation of soil and plant (137)Cs concentration was strong (0.76) and the R(2) (0.58) from the regression was significant (p = 0.006). This suggests the ability to predict the degree of (137)Cs contamination of a soil through analysis of the pine needles. The (238)Pu and (239,240)Pu concentrations were most elevated within the plant roots. Extremely high CR values were found in Sparganium americanum (bur-reed) roots with a value of 5.86 for (238)Pu and 5.66 for (239,240)Pu. The concentration of (40)K was measured as a known congener of (137)C. Comparing (40)K and (137)C concentrations in each plant revealed an inverse relationship for these radioisotopes. Correlating (40)K and (137)Cs was most effective in identifying plants that have a high affinity for (137)Cs uptake. The P. palustris and S. americanum proved to be particularly strong accumulators of all K congeners from the soil. Some species that were measured, warrant further

  19. [State of the lymphoid tissue of tracheobronchial lymph nodes in rats after incorporation in respiratory organs of low-transportable Pu-239]. (United States)

    Sokol'nikov, M E


    After single inhalation exposure of rats to low transportable 239Pu the alpha-irradiation doses in tracheo-bronchial lymph nodes (TBLN) were one order of magnitude lower than those in lung. The reduction of cell population in TBLN was observed in late (12-18 month after) post-inhalation period. Dose-response curve for the reduction (as a whole for 12 month) were presented as a line function. Functional abilities of these cells were less damaged and observed in different periods after inhalation. As one of the probable mechanisms of different radiation damage to cells in TBLN population, a variety in their spatial distribution is discussed.

  20. Investigation of the integral beta-spectra of235U(nth, f)- and239Pu(nth, f)-fission products (United States)

    Keyser, U.


    The integral β--spectra of235U and239Pu fission products have been measured with a plastic scintillator telescope at an external neutron guide tube at the high flux reactor of the ILL in Grenoble. The highly enriched targets (150 800 γg/cm2) were placed in a fission chamber at a distance of approximately 110 m from the reactor core. From the measured beta-spectra absolute counting rates per MeV and fission have been calculated, which are compared with the results of earlier experiments of other authors and with recent theoretical calculations.

  1. Criticality Evaluation of Plutonium-239 Moderated by High-Density Polyethylene in Stainless Steel and Aluminum Containers Suitable for Non-Exclusive Use Transport

    Energy Technology Data Exchange (ETDEWEB)

    Watson, T T


    Research is conducted at the Joint Actinide Shock Physics Experimental Facility (JASPER) on the effects of high pressure and temperature environments on plutonium-239, in support of the stockpile stewardship program. Once an experiment has been completed, it is necessary to transport the end products for interim storage or final disposition. Federal shipping regulations for nonexclusive use transportation require that no more than 180 grams of fissile material are present in at least 360 kilograms of contiguous non-fissile material. To evaluate the conservatism of these regulatory requirements, a worst-case scenario of 180g {sup 239}Pu and a more realistic scenario of 100g {sup 239}Pu were modeled using one of Lawrence Livermore National Laboratory's Monte Carlo transport codes known as COG 10. The geometry consisted of {sup 239}Pu spheres homogeneously mixed with high-density polyethylene surrounded by a cube of either stainless steel 304 or aluminum. An optimized geometry for both cube materials and hydrogen-to-fissile isotope (H/X) ratio were determined for a single unit. Infinite and finite 3D arrays of these optimized units were then simulated to determine if the systems would exceed criticality. Completion of these simulations showed that the optimal H/X ratio for the most reactive units ranged from 800 to 1600. A single unit of either cube type for either scenario would not reach criticality. An infinite array was determined to reach criticality only for the 180g case. The offsetting of spheres in their respective cubes was also considered and showed a considerable decrease in the number of close-packed units needed to reach criticality. These results call into question the current regulations for fissile material transport, which under certain circumstances may not be sufficient in preventing the development of a critical system. However, a conservative, theoretical approach was taken in all assumptions and such idealized configurations may not be

  2. Carcinogenesis from inhaled (239)PuO(2) in beagles: Evidence for radiation homeostasis at low doses? (United States)

    Fisher, Darrell R; Weller, Richard E


    From the early 1970's to the late 1980's, Pacific Northwest National Laboratory conducted life-span studies in beagle dogs on the biological effects of inhaled plutonium ((238)PuO(2), (239)PuO(2), and Pu[NO(3)](4)) to help predict risks associated with accidental intakes in workers. Years later, the purpose of the present follow-up study was to reassess the dose-response relationship for lung cancer in the PuO(2) dogs compared to controls-with particular focus on the dose-response at relatively low lung doses. A PuO(2) aerosol (2.3 mum activity-median aerodynamic diameter, 1.9 mum geometric standard deviation) was administered to six groups of 20 young (18-mo-old) beagle dogs (10 males and 10 females) by inhalation at six different activity levels, as previously described in Laboratory reports. Control dogs were sham-exposed. In dose level 1, initial pulmonary lung depositions were 130 + or - 48 Bq (3.5 + or - 1.3 nCi), corresponding to 1 Bq g lung tissue (0.029 + or - 0.001 nCi g(-1)). Groups 2 through 6 received initial lung depositions (mean values) of 760, 2,724, 10,345, 37,900, and 200,000 Bq (22, 79, 300, 1,100, and 5,800 nCi) PuO(2), respectively. For each dog, the absorbed dose to lungs was calculated from the initial lung burden and the final lung burden at time of death and lung mass, assuming a single, long-term retention function. Insoluble plutonium oxide exhibited long retention times in the lungs. Increased dose-dependent mortality due to lung cancer (bronchiolar-alveolar carcinoma, adenocarcinoma, and epidermoid carcinoma) and radiation pneumonitis (in the highest exposure group) were observed in dogs exposed to PuO(2). Calculated lung doses ranged from a few cGy (lowest exposure level) to 7,764 cGy in dogs that experienced early deaths from radiation pneumonitis. Data were regrouped by lifetime lung dose and plotted as a function of lung tumor incidence. The lung tumor incidence in controls and zero-dose exposed dogs was 18% (5/28). However, no

  3. Measurement/Evaluation Techniques and Nuclear Data Associated with Fission of 239Pu by Fission Spectrum Neutrons

    Energy Technology Data Exchange (ETDEWEB)

    Baisden, P; Bauge, E; Ferguson, J; Gilliam, D; Granier, T; Jeanloz, R; McMillan, C; Robertson, D; Thompson, P; Verdon, C; Wilkerson, C; Young, P


    This Panel was chartered to review and assess new evaluations of work on fission product data, as well as the evaluation process used by the two U.S. nuclear weapons physics laboratories. The work focuses on fission product yields resulting from fission spectrum neutrons incident on plutonium, and includes data from measurements that had not been previously published as well as new or revised fission product cumulative yield data, and related quantities such as Q values and R values. This report documents the Panel's assessment of the work presented by Los Alamos National Laboratory (LANL) and Lawrence Livermore National Laboratory (LLNL). Based on the work presented we have seven key observations: (1) Experiments conducted in the 1970s at LANL, some of which were performed in association with a larger, NIST-led, program, have recently been documented. A preliminary assessment of this work, which will be referred to in this document as ILRR-LANL, shows it to be technically sound. (2) LLNL has done a thorough, unbiased review and evaluation of the available literature and is in the process of incorporating the previously unavailable LANL data into its evaluation of key fission product yields. The results of the LLNL effort, which includes a preliminary evaluation of the ILRR-LANL data, have been documented. (3) LANL has also conducted an evaluation of fission product yields for fission spectrum neutrons on plutonium including a meta-analysis of benchmark data as part of a planned upgrade to the ENDF/B compilation. We found that the approach of using meta-analysis provides valuable additional insight for evaluating the sparse data sets involved in this assessment. (4) Both laboratories have provided convincing evidence for energy dependence in the fission product yield of {sup 147}Nd produced from the bombardment of {sup 239}Pu with fission spectrum neutrons over an incident neutron energy range of 0.2 to 1.9 MeV. (5) Consistent, complete, and explicit treatment

  4. Relative radiosensitivity of bone tumor induction among beagles as a function of age at injection of {sup 239}Pu or {sup 226}Ra

    Energy Technology Data Exchange (ETDEWEB)

    Lloyd, R.D.; Taylor, G.N.; Jee, W.S.S.; Miller, S.C. [Univ. of Utah, Salt Lake City, UT (United States). Radiobiology Lab.


    A comparison was made of the response to induction of skeletal malignancy from exposure of beagles to monomeric {sup 239}Pu or to {sup 226}Ra as juveniles (3 mo of age), young adults (1.5 y of age), or mature adults (5 y of age). This indicated that of these age groups, animals injected as young adults are most sensitive per Gy of average skeletal dose evaluated at 1 y before death. Dogs exposed either as juveniles or as mature adults appeared to be less sensitive. Relative radiosensitivities (RRS) of juvenile and mature beagles ranged between about 0.3 and 0.7 that of dogs injected as young adults. Mean values of RRS for both radionuclides were about 0.5, but RRS values derived from dogs given monomeric {sup 239}Pu appeared to be most reliable and were 0.27 {+-} 0.09 for dogs injected as juveniles and 0.41 {+-} 0.13 for animals exposed as mature adults.

  5. The Association of Inbreeding With Lung Fibrosis Incidence in Beagle Dogs That Inhaled 238PuO2 or 239PuO2.

    Energy Technology Data Exchange (ETDEWEB)

    Wilson, Dulaney A.; Brigantic, Andrea M.; Morgan, William F.


    Studies of health effects in animals after exposure to internally deposited radionuclides were intended to supplement observational studies in humans. Both nuclear workers and Beagle dogs have exhibited plutonium associated lung fibrosis; however, the dogs smaller gene pool may limit the applicability of findings to humans. Data on Beagles that inhaled either plutonium-238 dioxide (238PuO2) or plutonium-239 dioxide (239PuO2) were analyzed. Wright's Coefficient of Inbreeding was used to measure genetic or familial susceptibility and was assessed as an explanatory variable when modeling the association between lung fibrosis incidence and plutonium exposure. Lung fibrosis was diagnosed in approximately 80% of the exposed dogs compared with 23.7% of the control dogs. The maximum degree of inbreeding was 9.4%. Regardless of isotope, the addition of inbreeding significantly improved the model in female dogs but not in males. In female dogs an increased inbreeding coefficient predicted decreased hazard of a lung fibrosis diagnosis. Lung fibrosis was common in these dogs with inbreeding affecting models of lung fibrosis incidence in females but not in males. The apparent protective effect in females predicted by these models of lung fibrosis incidence is likely to be minimal given the small degree of inbreeding in these groups.

  6. A modelling study on 137Cs and 239,240Pu behaviour in the Alborán Sea, western Mediterranean. (United States)

    Periáñez, R


    A model for simulating the dispersion processes of 137Cs and 239,240Pu in the Alborán Sea is described. The model consists of two hydrodynamic models: a 2D depth-averaged model and a two-layer model which provide tidal and geostrophic currents, respectively; a sediment transport model which provides suspended particle concentrations and sedimentation rates over the domain; and the radionuclide dispersion model including interactions of dissolved radionuclides with suspended particles and bed sediments. These processes are formulated using kinetic transfer coefficients. The hydrodynamic and sediment models are run and validated in advance, and their results are then used to simulate the dispersion of 137Cs and 239,240Pu, which are introduced from atmospheric fallout. Radionuclide concentrations in the water column and distributions in bed sediments have been compared with measurements in the sea. Both set of data are, in general, in agreement. The model has also been applied to calculate radionuclide fluxes through the Strait of Gibraltar. These computed fluxes have been compared with previous estimations as well.

  7. Ternary particles from the reactions 229Th(nth,f) 233U(nth,f) and 239Pu(nth,f) (United States)

    Wöstheinrich, M.; Pfister, R.; Gönnenwein, F.; Denschlag, H. O.; Faust, H.; Oberstedt, S.


    Energy distributions and yields of ternary particles (TP's) emitted in the thermal neutron induced fission of 229Th, 233U and 239Pu have been determined. Special emphasis was put on the study of heavy ternary particles. The measurements were performed at the high flux reactor of the Institut Laue-Langevin (ILL). For identification of particles the mass separator Lohengrin and a ΔE-E ionisation chamber were used. In the case of 233U(nth,f) it was possible to detect 25 different TP's, with 19 of them having never been detected before in this reaction. For 229Th(nth,f) all 17 TP's that were observed were new. From the reaction 239Pu(nth,f) 21 out of 34 detected TP's were new. The energy distributions and yields of the TP's are given. The yields of TP's as a function of mass number depend on the mass of the decaying compound nucleus. Heavy TP's are increasingly favored in the decay of heavy mother nuclei.

  8. Development of self-interrogation neutron resonance densitometry (SINRD) to measure U-235 and Pu-239 content in a PWR spent fuel assembly

    Energy Technology Data Exchange (ETDEWEB)

    Lafleur, Adrienne M [Los Alamos National Laboratory; Charlton, William S [Los Alamos National Laboratory; Menlove, Howard O [Los Alamos National Laboratory; Swinhoe, Martyn T [Los Alamos National Laboratory


    The use of Self-Interrogation Neutron Resonance Densitometry (SINRD) to measure the {sup 235}U and {sup 239}Pu content in a PWR spent fuel assembly was investigated via Monte Carlo N-Particle eXtended transport code (MCNPX) simulations. The sensitivity of SINRD is based on using the same fissile materials in the fission chambers as are present in the fuel because the effect of resonance absorption lines in the transmitted flux is amplified by the corresponding (n, f) reaction peaks in fission chamber. These simulations utilize the {sup 244}Cm spontaneous fission neutrons to self-interrogate the fuel pins. The amount of resonance absorption of these neutrons in the fuel can be measured using {sup 235}U and {sup 239}Pu fission chambers placed adjacent to the assembly. We used ratios of different fission chambers to reduce the sensitivity of the measurements to extraneous material present in fuel. The development of SINRD to measure the fissile content in spent fuel is of great importance to the improvement of nuclear safeguards and material accountability. Future work includes the use of this technique to measure the fissile content in FBR spent fuel and heavy metal product from reprocessing methods.

  9. New prompt fission gamma-ray spectral data from 239Pu(nth, f) in response to a high priority request from OECD Nuclear Energy Agency (United States)

    Gatera, Angélique; Belgya, Tamás; Geerts, Wouter; Göök, Alf; Hambsch, Franz-Josef; Lebois, Matthieu; Maróti, Boglárka; Oberstedt, Stephan; Oberstedt, Andreas; Postelt, Frederik; Qi, Liqiang; Szentmiklósi, Laszló; Vidali, Marzio; Zeiser, Fabio


    Benchmark reactor calculations have revealed an underestimation of γ-heat following fission of up to 28%. To improve the modelling of new nuclear reactors, the OECD/NEA initiated a nuclear data High Priority Request List (HPRL) entry for the major isotopes (235U, 239Pu). In response to that HPRL entry, we executed a dedicated measurement program on prompt fission γ-rays employing state-of-the-art lanthanum bromide (LaBr3) detectors with superior timing and good energy resolution. Our new results from 252Cf(sf), 235U(nth,f) and 241Pu(nth,f) provide prompt fission γ-ray spectra characteristics : average number of photons per fission, average total energy per fission and mean photon energy; all within 2% of uncertainty. We present preliminary results on 239Pu(nth,f), recently measured at the Budapest Neutron Centre and supported by the CHANDA Trans-national Access Activity, as well as discussing our different published results in comparison to the historical data and what it says about the discrepancy observed in the benchmark calculations.

  10. Determination of 239Pu and 240Pu isotope ratio for a nuclear bomb particle using X-ray spectrometry in conjunction with γ-ray spectrometry and non-destructive α-particle spectrometry (United States)

    Pöllänen, R.; Ruotsalainen, K.; Toivonen, H.


    A nuclear bomb particle from Thule containing Pu and U was analyzed using X-ray spectrometry in combination with γ-ray spectrometry and non-destructive α-spectrometry. The main objective was to investigate the possibility to determine the 239Pu and 240Pu isotope ratios. Previously, X-ray spectrometry together with the above-mentioned methods has been successfully applied for radiochemically processed samples, but not for individual particles. In the present paper we demonstrate the power of non-destructive analysis. The 239Pu/( 239Pu+ 240Pu) atom ratio for the Thule particle was determined, using two different approaches, to be 0.93±0.07 and 0.91±0.05. These results are consistent with weapons-grade material and the results obtained by other investigators.

  11. Estimating Reaction Cross Sections from Measured (Gamma)-Ray Yields: The 238U(n,2n) and 239Pu(n,2n) Cross Sections

    Energy Technology Data Exchange (ETDEWEB)

    Younes, W


    A procedure is presented to deduce the reaction-channel cross section from measured partial {gamma}-ray cross sections. In its simplest form, the procedure consists in adding complementary measured and calculated contributions to produce the channel cross section. A matrix formalism is introduced to provide a rigorous framework for this approach. The formalism is illustrated using a fictitious product nucleus with a simple level scheme, and a general algorithm is presented to process any level scheme. In order to circumvent the cumbersome algebra that can arise in the matrix formalism, a more intuitive graphical procedure is introduced to obtain the same reaction cross-section estimate. The features and limitations of the method are discussed, and the technique is applied to extract the {sup 235}U (n,2n) and {sup 239}Pu(n,2n) cross sections from experimental partial {gamma}-ray cross sections, coupled with (enhanced) Hauser-Feshbach calculations.

  12. Determination of plutonium isotopes (238Pu, 239Pu, 240Pu, 241Pu) in environmental samples using radiochemical separation combined with radiometric and mass spectrometric measurements

    DEFF Research Database (Denmark)

    Xu, Yihong; Qiao, Jixin; Hou, Xiaolin


    This paper reports an analytical method for the determination of plutonium isotopes (238Pu, 239Pu, 240Pu, 241Pu) in environmental samples using anion exchange chromatography in combination with extraction chromatography for chemical separation of Pu. Both radiometric methods (liquid scintillation...... counting and alpha spectrometry) and inductively coupled plasma mass spectrometry (ICP-MS) were applied for the measurement of plutonium isotopes. The decontamination factors for uranium were significantly improved up to 7.5×105 for 20 g soil compared to the level reported in the literature......, this is critical for the measurement of plutonium isotopes using mass spectrometric technique. Although the chemical yield of Pu in the entire procedure is about 55%, the analytical results of IAEA soil 6 and IAEA-367 in this work are in a good agreement with the values reported in the literature or reference...

  13. Quantification of Uncertainties due to 235,238U, 239,240,241Pu and Fission Products Nuclear Data Uncertainties for a PWR Fuel Assembly (United States)

    da Cruz, D. F.; Rochman, D.; Koning, A. J.


    Uncertainty analysis on reactivity and discharged inventory for a typical PWR fuel element as a result of uncertainties in 235,238U, 239,240,241Pu, and fission products nuclear data was performed. The Total Monte-Carlo (TMC) method was applied using the deterministic transport code DRAGON. The nuclear data used in this study is from the JEFF-3.1 evaluations, with the exception of the nuclear data files for U, Pu and fission products isotopes, which are taken from the nuclear data library TENDL-2012. Results show that the calculated total uncertainty in keff (as result of uncertainties in nuclear data of the considered isotopes) is virtually independent on fuel burnp and amounts to 700 pcm. The uncertainties in inventory of the discharged fuel is dependent on the element considered and lies in the range 1-15% for most fission products, and is below 5% for the most important actinides.

  14. Evaluating and adjusting {sup 239}Pu, {sup 56}Fe, {sup 28}Si and {sup 95}Mo nuclear data with a Monte Carlo technique

    Energy Technology Data Exchange (ETDEWEB)

    Rochman, D.; Koning, A. J. [Nuclear Research and Consultancy Group, Petten (Netherlands)


    In this paper, Monte Carlo optimization and nuclear data evaluation are combined to produce optimal adjusted nuclear data files. The methodology is based on the so-called 'Total Monte Carlo' and the TALYS system. Not only a single nuclear data file is produced for a given isotope, but virtually an infinite number, defining probability distributions for each nuclear quantity. Then each of these random nuclear data libraries is used in a series of benchmark calculations. With a goodness-of-fit estimator, best {sup 239}Pu, {sup 56}Fe, {sup 28}Si and {sup 95}Mo evaluations for that benchmark set can be selected. A few thousands of random files are used and each of them is tested with a large number of fast, thermal and intermediate energy criticality benchmarks. From this, the best performing random file is chosen and proposed as the optimum choice among the studied random set. (authors)

  15. Identification and structural characterization of the ALIX-binding late domains of simian immunodeficiency virus SIVmac239 and SIVagmTan-1. (United States)

    Zhai, Qianting; Landesman, Michael B; Robinson, Howard; Sundquist, Wesley I; Hill, Christopher P


    Retroviral Gag proteins contain short late-domain motifs that recruit cellular ESCRT pathway proteins to facilitate virus budding. ALIX-binding late domains often contain the core consensus sequence YPX(n)L (where X(n) can vary in sequence and length). However, some simian immunodeficiency virus (SIV) Gag proteins lack this consensus sequence, yet still bind ALIX. We mapped divergent, ALIX-binding late domains within the p6(Gag) proteins of SIV(mac239) ((40)SREKPYKEVTEDLLHLNSLF(59)) and SIV(agmTan-1) ((24)AAGAYDPARKLLEQYAKK(41)). Crystal structures revealed that anchoring tyrosines (in lightface) and nearby hydrophobic residues (underlined) contact the ALIX V domain, revealing how lentiviruses employ a diverse family of late-domain sequences to bind ALIX and promote virus budding.

  16. Standardization of (166m)Ho and 243Am/239Np by live-timed anti-coincidence counting with extending dead time. (United States)

    da Silva, C J; Loureiro, J S; Delgado, J U; Poledna, R; Moreira, D S; Iwahara, A; Tauhata, L; da Silva, R L; Lopes, R T


    The National Laboratory for Metrology of Ionizing Radiation (LNMRI)/Brazil acquired (166m)Ho and (243)Am/(239)Np solutions from commercial suppliers in order to realize primary standardization and therefore reducing the associated uncertainties. The method used in the standardization was the live-timed 4πβ(LS)-γ(ΝaI(Tl)) anticoincidence counting. The live-timed anticoincidence system is operated since 2006 in LNMRI and is composed of two MTR2 modules donated by Laboratoire National Henri Becquerel (LNE-LNHB)/France. The data acquisition system uses a homemade LabView program and an Excel file for calculus. These systems have been used for primary standardization at LNMRI for many radionuclides and recently took part in the (124)Sb and (177)Lu International Key Comparisons with good performance. Copyright © 2012 Elsevier Ltd. All rights reserved.

  17. p53, erbB-2 and K-ras gene alterations are rare in spontaneous and plutonium-239-induced canine lung neoplasia

    Energy Technology Data Exchange (ETDEWEB)

    Tierney, L.A.; Hahn, F.F.; Lechner, J.F. [Inhalation Toxicology Research Inst., Albuquerque, NM (United States)


    Inhalation of high-linear energy transfer radiation in the form of radon progeny is a suspected cause of human lung cancer. To gain insight into the types of genetic derangements caused by this type of radiation, lung tumors from beagle dogs exposed to {sup 239}PuO{sub 2} and those arising in animals with no known carcinogen exposure were examined for evidence of aberrations in genes known to be altered in lung tumors. Altered expression of the p53 tumor suppressor gene and proto-oncogene erbB-2 proteins (p185{sup erbB2}) was evaluated by immunohistochemical analysis of 117 tumors representing different histological types in exposed (n = 80) and unexposed (n = 37) animals. Twenty-eight tumors were analyzed for K-ras proto-oncogene mutations by polymerase chain reaction amplification and direct sequencing. Fourteen percent (16/116) of all lung neoplasms showed elevated nuclear accumulation of p53 protein. Regardless of exposure history, adenosquamous and squamous cell cancers comprised 94% of all tumors with p53 abnormalities. Eighteen percent (21/117) of all tumors had evidence of erbB-2 protein overexpression. K-ras mutations were not detected in codons 12, 13 or 61 of tumors from unexposed (n = 9) or plutonium-exposed dogs (n = 19). These data indicate that p53 and K-ras gene abnormalities as a result of missense mutation are infrequent events in spontaneous and {sup 239}PuO{sub 2}-induced lung neoplasia in this colony of beagle dogs. Alternative mechanisms of gene alteration may be involved in canine pulmonary carcinogenesis. 45 refs., 3 figs., 2 tabs.

  18. Effect of plasma viremia on apoptosis and immunophenotype of dendritic cells subsets in acute SIVmac239 infection of Chinese rhesus macaques.

    Directory of Open Access Journals (Sweden)

    Hou-Jun Xia

    Full Text Available Non-human primates such as Chinese rhesus macaques (Ch Rhs provide good animal models for research on human infectious diseases. Similar to humans, there are two principal subsets of dendritic cells (DCs in the peripheral blood of Ch Rhs: myeloid DCs (mDCs and plasmacytoid DCs (pDCs. In this study, two-color fluorescence-activated cell sorting (FACS analyses were used to identify the main DC subsets, namely CD1c(+ mDCs and pDCs from Ch Rhs. Then, the apoptosis and immunophenotype changes of DCs subsets were first described during the acute phase of SIVmac239 infection. Both the DCs subsets showed decreased CD4 expression and enhanced CCR5 expression; in particular, those of pDCs significantly changed at most time points. Interestingly, the plasma viral loads were negatively correlated with CD4 expression, but were positively correlated with CCR5 expression of pDCs. During this period, both CD1c(+ mDCs and pDCs were activated by enhancing expressions of co-stimulatory molecules, accompanied with increase in CCR7. Either CD80 or CD86 expressed on CD1c(+ mDCs and pDCs was positively correlated with the plasma viral loads. Our analysis demonstrates that the pDCs were more prone to apoptosis after infection during the acute phase of SIVmac239 infection, which may be due to their high expressions of CD4 and CCR5. Both DCs subsets activated through elevating the expression of co-stimulatory molecules, which was beneficial in controlling the replication of SIV. However, a mere broad immune activation initiated by activated DCs may lead to tragic AIDS progression.

  19. Radionuclide concentrations in soils and vegetation at Low-Level Radioactive Waste Disposal Area G during the 1998 growing season (with a cumulative summary of {sup 3}H and {sup 239}Pu over time)

    Energy Technology Data Exchange (ETDEWEB)

    P. R. Fresquez; M. H. Ebinger; R. J. Wechsler; L. Naranjo, Jr.


    Soils and unwashed overstory and understory vegetation were collected at eight locations within and around Area G, a disposal facility for low-level, radioactive solid waste at Los Alamos National Laboratory. The samples were analyzed for {sup 3}H, {sup 238}Pu, {sup 239}Pu, {sup 90}Sr, {sup 241}Am, {sup 137}Cs, {sup tot}U. Most of the radionuclide concentrations in soils and vegetation were within the upper 95% level of background concentrations except for {sup 3}H and {sup 239}Pu. Tritium concentrations in vegetation from most sites were greater than background concentrations of about 2 pCi mL{sup {minus}1}. The concentrations of {sup 239}Pu in soils and understory vegetation were largest in samples collected several meters north of the transuranic waste pad area and were consistent with previous results. Based on {sup 3}H and {sup 239}Pu data through 1998, it was shown that concentrations were (1) significantly greater than background concentrations (p < 0.05) in soils and vegetation collected from most locations at Area G, and (2) there was no systematic increase or decrease in concentrations with time apparent in the data.

  20. Metastable charge-transfer state of californium(iii) compounds. (United States)

    Liu, Guokui; Cary, Samantha K; Albrecht-Schmitt, Thomas E


    Among a series of anomalous physical and chemical properties of Cf(iii) compounds revealed by recent investigations, the present work addresses the characteristics of the optical spectra of An(HDPA)3·H2O (An = Am, Cm, and Cf), especially the broadband photoluminescence from Cf(HDPA)3·H2O induced by ligand-to-metal charge transfer (CT). As a result of strong ion-ligand interactions and the relative ease of reducing Cf(iii) to Cf(ii), a CT transition occurs at low energy (transfer state undergoes radiative and non-radiative relaxations. Broadening of the CT transition arises from strong vibronic coupling and hole-charge interactions in the valence band. The non-radiative relaxation of the metastable CT state results from a competition between phonon-relaxation and thermal tunneling that populates the excited states of Cf(iii).

  1. Mean fission neutron spectrum energies for /sup 252/Cf and fissile nuclides, /sup 233/U, /sup 235/U, /sup 239/Pu and /sup 241/Pu

    Energy Technology Data Exchange (ETDEWEB)

    Holden, N.E.


    The international standard for a neutron spectrum is that produced from the spontaneous fission of /sup 252/Cf, while the thermal neutron induced fission neutron spectra for the four fissile nuclides, /sup 233/U, /sup 235/U, /sup 239/Pu and /sup 241/Pu, are of interest from the standpoint of nuclear reactors. There have been many data sets produced in recent years which deal with the shape of these spectra, particularly at both the low energy and the high energy portions of the curve. However, our interest here is in the average neutron energies of these spectra. We have tabulated all measurements for the five nuclides of interest. The individual measurements are recorded with the neutron energy range measured, the method of detection as well as the average neutron energy for each author. Fortunately, the measurements have been performed with a number of techniques, which allows one to estimate the systematic error from the spread in the results for the different techniques. An attempt has been made to renormalize results when the neutron spectrum used for normalization purposes has been given. In addition to the tables of mean energy measurements, we have also tabulated the measurements of the ratio of mean energies for pairs of fission neutron spectra. The following items were considered, where possible, in the analysis of the mean energies of the neutron spectra: the energy scale of the measurement, the determination of the detector efficiency, the sample size and the sample thickness and the scattering corrections made. The recommended mean energies for the spectra considered are shown. The uncertainty listed attempts to estimate the systematic error as well as merely the precision in each of the experiments. The recommended values for /sup 233,235/U, /sup 239,241/Pu, and /sup 252/Cf are 2.02 +- 0.03 MeV, 1.98 +- 0.03 MeV, 2.06 +- 0.04 MeV, 2.05 +- 0.05 MeV, and 2.14 +- 0.03 MeV, respectively. 73 refs.

  2. Radionuclides {sup 137}Cs, {sup 90}Sr, {sup 241}Am and {sup 239+240}Pu in vegetation cover of the former Semipalatinsk test site

    Energy Technology Data Exchange (ETDEWEB)

    Larionova, N. [Institute of Radiation Safety and Ecology (Kazakhstan); Lukashenko, S. [Institute of Radiation Safety and Ecology of the Republican State Enterprise (Kazakhstan)


    The Semipalatinsk Test Site (STS) is one of the largest testing grounds for nuclear weapons. Diverse nuclear explosions were carried out on its territory: 340 underground tests (sites 'Degelen', 'Balapan' and 'Sary-Uzen'), 30 surface and 86 nuclear air explosions (site for radioactive warfare agent (RWA) and 'Experimental Field'). Since the STS was shutdown a large amount of information about current radiological situation in its territory has been collected. In recent years, one of the main problems is gradual transfer of its lands for national economy. Under these conditions, an essential element for prediction of radioactive contamination levels of food products is radionuclides redistribution parameters in soil-plant system used in calculation of doses to the population living within STS territory. Until recently, matter of radionuclides migration from soil to plants has been poorly studied. Individual researches, more or less devoted to this issue occurred in the past, but have virtually no information about accumulation of transuranic radionuclides in plants. More regular studies in this direction have been initiated recently. Between 2007 and 2013 features of artificial radionuclides accumulation in certain plant species under radioactive tunnel watercourses at 'Degelen' site were studied. We've obtained statistically reliable data characterizing accumulation of radionuclides, including {sup 239+240}Pu and {sup 241}Am, in steppe plants at 'Experimental field' site. The content of radionuclides in plants was researched at the RWA site. Comprehensive ecological survey in order to release the lands to the national economic turnover investigated parameters of radionuclides accumulation in steppe grasses at conditionally 'background' areas of STS and some parts of radioactive trace plume caused by the explosion in 1953. To date, all the findings have been generalized. We present an

  3. Transcriptional activation of OsDERF1 in OsERF3 and OsAP2-39 negatively modulates ethylene synthesis and drought tolerance in rice.

    Directory of Open Access Journals (Sweden)

    Liyun Wan

    Full Text Available The phytohormone ethylene is a key signaling molecule that regulates a variety of developmental processes and stress responses in plants. Transcriptional modulation is a pivotal process controlling ethylene synthesis, which further triggers the expression of stress-related genes and plant adaptation to stresses; however, it is unclear how this process is transcriptionally modulated in rice. In the present research, we report the transcriptional regulation of a novel rice ethylene response factor (ERF in ethylene synthesis and drought tolerance. Through analysis of transcriptional data, one of the drought-responsive ERF genes, OsDERF1, was identified for its activation in response to drought, ethylene and abscisic acid. Transgenic plants overexpressing OsDERF1 (OE led to reduced tolerance to drought stress in rice at seedling stage, while knockdown of OsDERF1 (RI expression conferred enhanced tolerance at seedling and tillering stages. This regulation was supported by negative modulation in osmotic adjustment response. To elucidate the molecular basis of drought tolerance, we identified the target genes of OsDERF1 using the Affymetrix GeneChip, including the activation of cluster stress-related negative regulators such as ERF repressors. Biochemical and molecular approaches showed that OsDERF1 at least directly interacted with the GCC box in the promoters of ERF repressors OsERF3 and OsAP2-39. Further investigations showed that OE seedlings had reduced expression (while RI lines showed enhanced expression of ethylene synthesis genes, thereby resulting in changes in ethylene production. Moreover, overexpression of OsERF3/OsAP2-39 suppressed ethylene synthesis. In addition, application of ACC recovered the drought-sensitive phenotype in the lines overexpressing OsERF3, showing that ethylene production contributed to drought response in rice. Thus our data reveal that a novel ERF transcriptional cascade modulates drought response through controlling

  4. Determination of {sup 238}Pu, {sup 239+240}Pu, {sup 241}Pu and {sup 241}Am in radioactive waste from IPEN reactor

    Energy Technology Data Exchange (ETDEWEB)

    Geraldo, Bianca; Taddei, Maria Helena T.; Cheberle, Sandra M.; Ferreira, Marcelo T., E-mail:, E-mail:, E-mail:, E-mail: [Brazilian Nuclear Energy Commission (LAPOC/CNEN-MG), Pocos de Caldas, MG (Brazil). Lab. of Pocos de Caldas; Marumo, Julio T., E-mail: jtmarumo@ipen.b [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)


    Ion exchange resin is a common type of radioactive waste arising from treatment of coolant water of the main circuit of research and nuclear power reactors. This waste contains high concentrations of fission and activation products. The management of this waste includes its characterization in order to determine and quantify specific radionuclides including those known as difficult-to-measure radionuclides (RDM). The analysis of RDMs generally involves expensive and time-consuming complex radiochemical analysis for purification and separation of the radionuclides. The objective of this work is to show an easy methodology for quantifying plutonium and americium isotopes in spent ion exchange resin, used for purification of the cooling water of the IEA-R1 reactor located at the Nuclear and Energy Research Institute, IPEN-CNEN/SP. The resins were destroyed by acid digestion, followed by purification and separation of the Pu and Am isotopes with anionic and chromatographic resins. {sup 238}Pu, {sup 239}+{sup 24}'0Pu, and {sup 24}'1Am isotopes were analyzed in an alpha spectrometer equipped with surface barrier detectors. {sup 241}Pu isotope was analyzed by liquid scintillation counting. Chemical recovery yield ranged from 73 to 98% for Pu and 77 to 98% for Am, demonstrating that the methodology is suitable for identification and quantification of the isotopes studied in spent resins. (author)

  5. A canine orthologue of the human GFAP c.716G>A (p.Arg239His) variant causes Alexander disease in a Labrador retriever. (United States)

    Van Poucke, Mario; Martlé, Valentine; Van Brantegem, Leen; Ducatelle, Richard; Van Ham, Luc; Bhatti, Sofie; Peelman, Luc J


    Alexander disease (AxD) is a fatal neurodegenerative disorder of astrocyte dysfunction in man, for which already a number of causal variants are described, mostly de novo dominant missense variants in the glial fibrillary acidic protein (GFAP). A similar disorder was already phenotypically described in animals but without the identification of causal variants. We diagnosed a Labrador retriever with a juvenile form of AxD based on clinical (tetraparesis with spastic front limbs mimicking 'swimming puppy syndrome') and pathological (the detection of GFAP containing Rosenthal fibers in astrocytes) features. In order to identify a causal variant, the coding sequences of the four detected GFAP transcript variants (orthologues from human transcript variants α, γ, δ/ɛ and κ) were sequenced. From the five detected variants, a heterozygous c.719G>A nucleotide substitution resulting in a p.Arg240His substitution was considered to be causal, because it is orthologous to the heterozygous de novo dominant c.716G>A (p.Arg239His) hotspot variant in man, proven to cause a severe phenotype. In addition, the variant was not found in 50 unrelated healthy Labrador retrievers. Because the condition in dogs is morphologically similar to man, it could be a promising animal model for further elucidating the genotype/phenotype correlation in order to treat or prevent this disease.

  6. Microdistribution and Long-Term Retention of 239Pu (NO3)4 in the Respiratory Tracts of an Acutely Exposed Plutonium Worker and Experimental Beagle Dogs

    Energy Technology Data Exchange (ETDEWEB)

    Nielsen, Christopher E.; Wilson, Dulaney A.; Brooks, Antone L.; McCord, Stacey; Dagle, Gerald E.; James, Anthony C.; Tolmachev, Sergei Y.; Thrall, Brian D.; Morgan, William F.


    The long-term retention of inhaled soluble forms of plutonium raises concerns as to the potential health effects in persons working in nuclear energy or the nuclear weapons program. The distributions of long-term retained inhaled plutonium-nitrate [239Pu (NO3)4] deposited in the lungs of an accidentally exposed nuclear worker (Human Case 0269) and in the lungs of experimentally exposed beagle dogs with varying initial lung depositions were determined via autoradiographs of selected histological lung, lymph node, trachea, and nasal turbinate tissue sections. These studies showed that both the human and dogs had a non-uniform distribution of plutonium throughout the lung tissue. Fibrotic scar tissue effectively encapsulated a portion of the plutonium and prevented its clearance from the body or translocation to other tissues and diminished dose to organ parenchyma. Alpha radiation activity from deposited plutonium in Human Case 0269 was observed primarily along the sub-pleural regions while no alpha activity was seen in the tracheobronchial lymph nodes of this individual. However, relatively high activity levels in the tracheobronchial lymph nodes of the beagles indicated the lymphatic system was effective in clearing deposited plutonium from the lung tissues. In both the human case and beagle dogs, the appearance of retained plutonium within the respiratory tract was inconsistent with current biokinetic models of clearance for soluble forms of plutonium. Bound plutonium can have a marked effect on the dose to the lungs and subsequent radiation exposure has the potential increase in cancer risk.

  7. Depletion of CD8+ cells does not affect the lifespan of productively infected cells during pathogenic sivmac239 infection of rhesus macaques

    Energy Technology Data Exchange (ETDEWEB)

    Shudo, Emi [Los Alamos National Laboratory; Ribeiro, Ruy M [Los Alamos National Laboratory; Perelson, Alan S [Los Alamos National Laboratory


    While CD8+ T cell responses are clearly important in anti-viral immunity during HIV/SIV infection, the mechanisms by which CD8+ T cells induce this effect remain poorly understood, as emphasized by the failure of the Merck adenovirus-based, cytotoxic T lymphocyte (CTL)-inducing AIDS vaccine in a large phase IIb clinical trial. In this study, we measured the in vivo effect of CD8+ lymphocytes on the lifespan of productively infected cells during chronic SIVmac239 infection of rhesus macaques by treating two groups of animals (i.e., CD8+ lymphocyte-depleted or controls) with antiretroviral therapy (PMPA and FTC). The lifespan of productively infected cells was calculated based on the slope of the decline of SIV plasma viremia using a well-accepted mathematical model. We found that, in both early (i.e., day 57 post-inoculation) and late (i.e., day 177 post-inoculation) chronic SIV infection, depletion of CD8+ lymphocytes did not result in an increased lifespan of productively infected cells in vivo. This result indicates that direct killing of cells producing virus is unlikely to be a major mechanism underlying the anti-viral effect of CD8+ T cells during SIV infection. These results have profound implications for the development of AIDS vaccines.

  8. Identification and Structural Characterization of the ALIX-Binding Late Domains of Simian Immunodeficiency Virus SIVmac239 and SIVagmTan-1

    Energy Technology Data Exchange (ETDEWEB)

    Zhai, Q.; Robinson, H.; Landesman, M. B.; Sundquist, W. I.; Hill, C. P.


    Retroviral Gag proteins contain short late-domain motifs that recruit cellular ESCRT pathway proteins to facilitate virus budding. ALIX-binding late domains often contain the core consensus sequence YPX{sub n}L (where X{sub n} can vary in sequence and length). However, some simian immunodeficiency virus (SIV) Gag proteins lack this consensus sequence, yet still bind ALIX. We mapped divergent, ALIX-binding late domains within the p6{sup Gag} proteins of SIV{sub mac239} ({sub 40}SREK{und P}YKE{und VT}ED{und L}LHLNSLF{sub 59}) and SIV{sub agmTan-1} ({sub 24}AAG{und A}YDP{und AR}KL{und L}EQYAKK{sub 41}). Crystal structures revealed that anchoring tyrosines (in lightface) and nearby hydrophobic residues (underlined) contact the ALIX V domain, revealing how lentiviruses employ a diverse family of late-domain sequences to bind ALIX and promote virus budding.

  9. Identification and Structural Characterization of the ALIX-Binding Late Domains of Simian Immunodeficiency Virus SIV mac239 and SIV agmTan-1

    Energy Technology Data Exchange (ETDEWEB)

    Q Zhai; M Landesman; H Robinson; W Sundquist; C Hill


    Retroviral Gag proteins contain short late-domain motifs that recruit cellular ESCRT pathway proteins to facilitate virus budding. ALIX-binding late domains often contain the core consensus sequence YPX{sub n}L (where X{sub n} can vary in sequence and length). However, some simian immunodeficiency virus (SIV) Gag proteins lack this consensus sequence, yet still bind ALIX. We mapped divergent, ALIX-binding late domains within the p6{sup Gag} proteins of SIV{sub MAC239} ({sub 40}SREK{und P}YKE{und VT}ED{und L}LHLNSLF{sub 59}) and SIV{sub agmTan-1} ({sub 24}AAG{und A}YDP{und AR}KL{und L}EQYAKK{sub 41}). Crystal structures revealed that anchoring tyrosines (in lightface) and nearby hydrophobic residues (underlined) contact the ALIX V domain, revealing how lentiviruses employ a diverse family of late-domain sequences to bind ALIX and promote virus budding.

  10. Experiments with Rotating Collimators Cutting out Pencil of Alpha-Particles at Radioactive Decay of 239-Pu Evidence Sharp Anisotropy of Space

    Directory of Open Access Journals (Sweden)

    Shnoll S. E.


    Full Text Available As shown in our previous experiments fine structure of histograms of α-activity measurements serve as a sensitive tool for investigation of cosmo-physical influences. Particularly, the histograms structure is changed with the period equal to sidereal (1436 min and solar (1440 day. It is similar with the high probability in different geographic points at the same local (longitude time. More recently investigations were carried out with collimators, cutting out separate flows of total α-particles flying out at radioactive decay of 239 Pu. These experiments revealed sharp dependence the histogram structure on the direction of α-particles flow. In the presented work measurements were made with collimators rotating in the plane of sky equator. It was shown that during rotation the shape of histograms changes with periods determined by number of revolution. These results correspond to the assumption that the histogram shapes are determined by a picture of the celestial sphere, and also by interposition of the Earth, the Sun and the Moon.

  11. Alpha and conversion electron spectroscopy of {sup 238,239}Pu and {sup 241}Am and alpha-conversion electron coincidence measurements

    Energy Technology Data Exchange (ETDEWEB)

    Dion, Michael P., E-mail:; Miller, Brian W.; Warren, Glen A.


    A technique to determine the isotopic constituents of a mixed actinide sample has been proposed by a coincident alpha-conversion electron measurement. This presents a unique signature to allow the unfolding of isotopes that possess overlapping alpha particle energy and reduce backgrounds of an unseparated sample. The work presented here are results of conversion electron spectroscopy of {sup 241}Am, {sup 238}Pu and {sup 239}Pu using a dual-stage peltier-cooled 25 mm{sup 2} silicon drift detector and alpha spectroscopy with a passivated ion implanted planar silicon detector. The conversion electron spectra were evaluated from 20–55 keV based on fits to the dominant conversion electron emissions, which allowed the relative conversion electron emission intensities to be determined. These measurements provide crucial singles spectral information and calibration to aid in the coincident measurement approach. Furthermore, an alpha-conversion electron spectrometer was assembled using the silicon based detectors described and results of a coincident spectrum analysis is reported for {sup 241}Am.

  12. Capture and Fission rate of 232-Th, 238-U, 237-Np and 239-Pu from spallation neutrons in a huge block of lead.

    CERN Document Server

    Vlachoudis, Vasilis


    The study is centered on the research of the incineration possibility of nuclear waste, by the association of a particle accelerator with a multiplying medium of neutrons, in the project "Energy Amplifier" of C. Rubbia. It consists of the experimental determination of the rates of capture and fission of certain elements (232-Th, 238-U, 237-Np and 239-Pu) subjected to a fluence of fast spallation neutrons. These neutrons are produced by the interaction of high kinetic energy protons (several GeV) provided by the CERN-PS accelerator, on a large lead solid volume. The measurement techniques used in this work, are based on the activation of elements in the lead volume and the subsequent gamma spectroscopy of the activated elements, and also by the detection of fission fragment traces. The development, of a Monte Carlo code makes it possible, on one hand, to better understand the relevant processes, and on the other hand, to validate the code, by comparison with measurements, for the design and the construction of...

  13. Radioactive foodchains in the subarctic environment. Progress report, August 15, 1975--August 14, 1976. [/sup 137/Cs and /sup 239/Pu, /sup 240/Pu distribution

    Energy Technology Data Exchange (ETDEWEB)

    Miettinen, J K


    Cesium-137 is accumulated in the foodchain lichen-reindeer-man causing high body burdens in Lapps who have reindeer meat as staple food. A group of Finnish Lapps has been whole body counted for /sup 137/Cs annually since 1961. Results of the measurements made in April 1976 show 18 percent decrease in /sup 137/Cs body burdens from the previous year. A dietary study confirmed that there was no mentionable change in the total amount of reindeer meat consumed although winter consumption has slightly decreased and summer consumption increased in recent years. Plutonium analyses of stockpiled lichen and reindeer samples from 1960 to 1973 were begun in 1973; since then the sampling has continued. Lichen had 200 pCi per kg dry weight in 1963 to 1964, 100 pCi/kg in 1966 to 1970, 20 pCi/kg in 1973 to 1975. Biological half-time of plutonium in lichen is 2 years. Reindeer liver contained about 20 pCi per kg fresh weight in 1963, 2 pCi in 1973. The ratio of plutonium in liver to its lifelong total intake gave a lower limit to absorption in reindeer. Of bones, plutonium concentration is highest in teeth, medium high in sternum, vertebra and humerus, and lowest in solid long bones. Human autopsy samples gave for lungs 0.19 liver 0.02 and bone 0.09 pCi /sup 239/ /sup 240/Pu per kg of wet weight.

  14. Inhaled /sup 239/PuO/sub 2/ and/or total-body gamma radiation: Early mortality and morbidity in rats and dogs

    Energy Technology Data Exchange (ETDEWEB)

    Filipy, R.E.; Decker, J.R.; Lai, Y.L.; Lauhala, K.E.; Buschbom, R.L.; Hiastala, M.P.; McGee, D.R.; Park, J.F.; Kuffel, E.G.; Ragan, H.A.; Cannon, W.C.; Yaniv, S.S.; Scott, B.R.


    Rats and beagle dogs were given doses of /sup 60/Co gamma radiation and/or body burdens of /sup 239/PuO/sub 2/ within lethal ranges in an experiment to determine and compare morbidity and mortality responses of both species within 1 year after exposure. Radiation-induced morbidity was assessed by measuring changes in body weights, hematologic parameters, and pulmonary-function parameters. Gamma radiation caused transient morbidity, reflected by immediately depressed blood cell concentrations and by long-term loss of body weight and diminished pulmonary function in animals of both species that survived the acute gamma radiation syndrome. Inhaled plutonium caused a loss of body weight and diminished pulmonary function in both species, but its only effect on blood cell concentrations was lymphocytopenia in dogs. Combined gamma irradiation and plutonium lung burdens were synergistic, in that animals receiving both radiation insults had higher morbidity and mortality rates than would be predicted based on the effect of either kind of radiation alone. Plutonium lung burdens enhanced the effect of gamma radiation in rats within the first 30 days of exposure, and gamma radiation enhanced the long-term effect of plutonium lung burdens in both species. Rats were less sensitive to both kinds of radiation, whether administered alone or in combination. 71 refs., 105 figs., 48 tabs.

  15. Transmutation of $^{239}$Pu and Other Nuclides Using Spallation Neutrons Produced by Relativistic Protons Reacting with Massive U- and Pb-Targets

    CERN Document Server

    Adam, J; Bamblevski, V P; Barabanov, M Yu; Bradnova, V; Chaloun, P; Hella, K M; Kalinnikov, V G; Krivopustov, M I; Kulakov, B A; Perelygin, V P; Pronskikh, V S; Pavliouk, A V; Solnyshkin, A A; Sosnin, A N; Stegailov, V I; Tsoupko-Sitnikov, V M; Zaverioukha, O S; Adloff, J C; Debeauvais, M; Brandt, R; Langrock, E J; Vater, P; Van, J S; Westmeier, W; Dwivedi, K K; Guo Shi Lun; Li Li Qiang; Hashemi-Nezhad, S R; Kievets, M K; Lomonosova, E M; Zhuk, I V; Modolo, G; Odoj, R; Zamani-Valassiadou, M


    Experimental studies on the transmutation of some long-lived radioactive waste nuclei, such as ^{129}I, ^{237}Np, and ^{239}Pu, as well as on natural uranium and lanthanum (all of them used as sensors) were carried out at the Synchrophasotron of the Laboratory for High Energies (JINR, Dubna). Spallation neutrons were produced by relativistic protons with energies in the range of 0.5 GeV\\le E(p)\\le 1.5 GeV interacting with 20 cm long uranium or lead target stacks. The targets were surrounded by 6 cm paraffin moderators. The radioactive sensors mentioned above were positioned on the outside surface of the moderator and contained typically approximately 0.5 up to 1 gram of long-lived isotopes. The highly radioactive targets were produced perfectly well-sealed in aluminum containers by the Institute of Physics and Power Engineering, Obninsk, Russia. From the experimentally observed transmutation rates one can easily extrapolate, that in a subcritical nuclear power assembly (or "energy amplifier") using a 10 mA pr...

  16. The influence of ozone on ligand-assisted extraction of {sup 239}Pu and {sup 241}Am from rocky flats soil

    Energy Technology Data Exchange (ETDEWEB)

    Plaue, J.W.; Czerwinski, K.R. [Actinide Research Group, Massachusetts Inst. of Tech., Cambridge, MA (United States)


    Chemical extraction of {sup 239}Pu and {sup 241}Am from a Rocky Flats soil matrix was studied at 50 C using four ligands; citric acid and ascorbic acid at pH 2, EDTA and carbonate at pH 10. The soil was treated for a 12-hour reaction period with ozone gas prior to the addition of ligands. With the carbonate ligand, the ozone treatment continued during the entire extraction. High Pu removal was found at pH 2 with ascorbic acid and pH 10 with carbonate. Both maintained redox conditions during the extraction. For the carbonate system, a trend of increased extraction with increasing E{sub h} and carbonate concentration was observed. Ozone treatment of soil prior to addition of EDTA at pH 10 and citric acid at pH 2 was shown to dramatically increase extraction of Am. Since no oxidation of Am occurred, the increased removal from ozone is mainly due to the oxidation of the soil phase containing the Am. (orig.)

  17. Measurement of electro-sprayed 238 and 239+240 plutonium isotopes using 4{pi}-alpha spectrometry. Application to environmental samples; Spectrometrie alpha 4{pi} de sources d'actinides realisees par electronebulisation. Developpement et optimisation d'un protocole applique au mesurage des isotopes 238 et 239+240 du plutonium dans l'environnement

    Energy Technology Data Exchange (ETDEWEB)

    Charmoille-Roblot, M. [CEA/Fontenay-aux-Roses, Dept. de Protection de l' Environnement (DPRE), 92 (France)]|[Paris-11 Univ., 91 - Orsay (France)


    A new protocol for plutonium deposition using the electro-spray technique coupled with 4{pi}-{alpha} spectrometry is proposed to improve the detection limit, shorten the counting time. In order to increase the detection efficiency, it was proposed to measure 238 and 239+240 plutonium isotopes electro-sprayed deposit simultaneously on both sides of the source support, that must be as transparent as possible to alpha-emissions, in a two-alpha detectors chamber. A radiochemical protocol was adapted to electro-spray constraints and a very thin carbon foil was selected for 4{pi} -alpha spectrometry. The method was applied to a batch of sediment samples and gave the same results as an electrodeposited source measured using conventional alpha spectrometry with a 25 % gain on counting time and 10 % on plutonium 238 detection limit. Validation and application of the technique have been made on reference samples. (author)

  18. Retention and translocation of foliar applied {sup 239,240}Pu and {sup 241}Am, as compared to {sup 137}Cs and {sup 85}Sr, into bean plants (Phaseolus vulgaris)

    Energy Technology Data Exchange (ETDEWEB)

    Henner, P. [Institute for Radioprotection and Nuclear Safety, Environment and Emergency Operations Division, Department for the Study of Radionuclides Behaviour in Ecosystems, Laboratory of Radioecology and Ecotoxicology, IRSN/DPRE/SECRE/LRE, Cadarache Centre, Building 186, BP 3, 13115 Saint-Paul-lez-Durance (France)]. E-mail:; Colle, C. [Institute for Radioprotection and Nuclear Safety, Environment and Emergency Operations Division, Department for the Study of Radionuclides Behaviour in Ecosystems, Laboratory of Radioecology and Ecotoxicology, IRSN/DPRE/SECRE/LRE, Cadarache Centre, Building 186, BP 3, 13115 Saint-Paul-lez-Durance (France); Morello, M. [Institute for Radioprotection and Nuclear Safety, Environment and Emergency Operations Division, Department for the Study of Radionuclides Behaviour in Ecosystems, Laboratory of Radioecology and Ecotoxicology, IRSN/DPRE/SECRE/LRE, Cadarache Centre, Building 186, BP 3, 13115 Saint-Paul-lez-Durance (France)


    Foliar transfer of {sup 241}Am, {sup 239,240}Pu, {sup 137}Cs and {sup 85}Sr was evaluated after contamination of bean plants (Phaseolus vulgaris) at the flowering development stage, by soaking their first two trifoliate leaves into contaminated solutions. Initial retentions of {sup 241}Am (27%) and {sup 239,240}Pu (37%) were higher than those of {sup 137}Cs and {sup 85}Sr (10-15%). Mean fraction of retained activity redistributed among bean organs was higher for {sup 137}Cs (20.3%) than for {sup 239,240}Pu (2.2%), {sup 241}Am (1%) or {sup 85}Sr (0.1%). Mean leaf-to-pod translocation factors (Bq kg{sup -1}dry weight pod/Bq kg{sup -1}dry weight contaminated leaves) were 5.0 x 10{sup -4} for {sup 241}Am, 2.7 x 10{sup -6} for {sup 239,240}Pu, 5.4 x 10{sup -2} for {sup 137}Cs and 3.6 x 10{sup -4} for {sup 85}Sr. Caesium was mainly recovered in pods (12.8%). Americium and strontium were uniformly redistributed among leaves, stems and pods. Plutonium showed preferential redistribution in oldest bean organs, leaves and stems, and very little redistribution in forming pods. Results for americium and plutonium were compared to those of strontium and caesium to evaluate the consistency of the attribution of behaviour of strontium to transuranium elements towards foliar transfer, based on translocation factors, as stated in two radioecological models, ECOSYS-87 and ASTRAL.

  19. Dependence of Changes of Histogram Shapes from Time and Space Direction is the Same when Fluctuation Intensities of Both Light-Diode Light Flow and 239-Pu Alpha-Activity are Measured

    Directory of Open Access Journals (Sweden)

    Rubinshtein I. A.


    Full Text Available The paper tells that spectra of fluctuation amplitudes, that is, shapes of corresponding histograms, resulting measurements of intensity of light fluxes issued by a light-diode and measurements of intensity of 239 Pu alpha-particles issues change synchronously. Experiments with light beams show the same diurnal periodicity and space direction dependencies as experiments with radioactivity. Thus new possibilities for investigation of “macroscopic fluctuations” come.

  20. Donepezil, an acetylcholine esterase inhibitor, and ABT-239, a histamine H3 receptor antagonist/inverse agonist, require the integrity of brain histamine system to exert biochemical and procognitive effects in the mouse. (United States)

    Provensi, Gustavo; Costa, Alessia; Passani, M Beatrice; Blandina, Patrizio


    Histaminergic H3 receptors (H3R) antagonists enhance cognition in preclinical models and modulate neurotransmission, in particular acetylcholine (ACh) release in the cortex and hippocampus, two brain areas involved in memory processing. The cognitive deficits seen in aging and Alzheimer's disease have been associated with brain cholinergic deficits. Donepezil is one of the acetylcholinesterase (AChE) inhibitor approved for use across the full spectrum of these cognitive disorders. We addressed the question if H3R antagonists and donepezil require an intact histamine neuronal system to exert their procognitive effects. The effect of the H3R antagonist ABT-239 and donepezil were evaluated in the object recognition test (ORT), and on the level of glycogen synthase kinase 3 beta (GSK-3β) phosphorylation in normal and histamine-depleted mice. Systemic administration of ABT-239 or donepezil ameliorated the cognitive performance in the ORT. However, these compounds were ineffective in either genetically (histidine decarboxylase knock-out, HDC-KO) or pharmacologically, by means of intracerebroventricular (i.c.v.) injections of the HDC irreversible inhibitor a-fluoromethylhistidine (a-FMHis), histamine-deficient mice. Western blot analysis revealed that ABT-239 or donepezil systemic treatments increased GSK-3β phosphorylation in cortical and hippocampal homogenates of normal, but not of histamine-depleted mice. Furthermore, administration of the PI3K inhibitor LY294002 that blocks GSK-3β phosphorylation, prevented the procognitive effects of both drugs in normal mice. Our results indicate that both donepezil and ABT-239 require the integrity of the brain histaminergic system to exert their procognitive effects and strongly suggest that impairments of PI3K/AKT/GSK-3β intracellular pathway activation is responsible for the inefficacy of both drugs in histamine-deficient animals. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Analysis of {sup 236}U and plutonium isotopes, {sup 239,240}Pu, on the 1 MV AMS system at the Centro Nacional de Aceleradores, as a potential tool in oceanography

    Energy Technology Data Exchange (ETDEWEB)

    Chamizo, Elena; López-Lora, Mercedes [Centro Nacional de Aceleradores (Universidad de Sevilla, Consejo Superior de Investigaciones Científicas, Junta de Andalucía), Thomas Alva Edison 7, 41092 Seville (Spain); Villa, María [Departamento de Física Aplicada II, Universidad de Sevilla, Av. Reina Mercedes 4A, 41012 Seville (Spain); Servicio de Radioisótopos, Centro de Investigación, Tecnología e Innovación, Universidad de Sevilla, Av. Reina Mercedes 4B, 41012 Seville (Spain); Casacuberta, Núria [Laboratory of Ion Beam Physics, ETH Zürich, Otto-Stern-Weg 5, CH-8093 Zürich (Switzerland); López-Gutiérrez, José María [Centro Nacional de Aceleradores (Universidad de Sevilla, Consejo Superior de Investigaciones Científicas, Junta de Andalucía), Thomas Alva Edison 7, 41092 Seville (Spain); Departamento de Física Aplicada I, Escuela Universitaria Politécnica, Universidad de Sevilla, Virgen de África 7, 41011 Seville (Spain); Pham, Mai Khanh [IAEA-Environment Laboratories, Monte Carlo 98000 (Monaco)


    The performance of the 1 MV AMS system at the CNA (Centro Nacional de Aceleradores, Seville, Spain) for {sup 236}U and {sup 239,240}Pu measurements has been extensively investigated. A very promising {sup 236}U/{sup 238}U abundance sensitivity of about 3 × 10{sup −11} has been recently achieved, and background figures for {sup 239}Pu of about 10{sup 6} atoms were reported in the past. These promising results lead to the use of conventional low energy AMS systems for the analysis of {sup 236}U and {sup 239}Pu and its further application in environmental studies. First {sup 236}U results obtained on our AMS system for marine samples (sediments and water) are presented here. Results of two new IAEA reference materials (IAEA-410 and IAEA-412, marine sediments from Pacific Ocean) are reported. The obtained {sup 236}U/{sup 239}Pu atom ratios, of 0.12 and 0.022, respectively, show a dependency with the contamination source (i.e. local fallout from the US tests performed at the Bikini Atoll and general fallout). The results obtained for a third IAEA reference material (IAEA-381, seawater from the Irish Sea), are also presented. In the following, the uranium and plutonium isotopic compositions obtained on a set of 5 intercomparison seawater samples from the Arctic Ocean provided by the ETH Zürich are discussed. By comparing them with the obtained results on the 600 kV AMS facility Tandy at the ETH Zürich, we demonstrate the solidity of the CNA technique for {sup 236}U/{sup 238}U determinations at, at least, 7 × 10{sup −10} level. Finally, these results are discussed in their environmental context.

  2. Procedures for the use of Lexan and Makrofol SSNTDs in the detection of environmental concentrations of 235U and 239Pu

    Energy Technology Data Exchange (ETDEWEB)

    Henderson, Cynthia L. [Univ. of Utah, Salt Lake City, UT (United States)


    Solid State Nuclear Track Detectors are used to study a variety of atomic particles. Polycarbonate SSNTD is used to study environmental concentrations of 235U and 239Pu in human urine and feces through fission track analysis. The samples of interest are deposited upon a Lexan slide, covered with a piece of Makrofol and exposed to a neutron fluence of 1.1 X 1017. The fissile isotopes in the sample fission and the resulting fission fragments pass through either the surface of the Lexan or the surface of the Makrofol. The positive Coulombic attraction of the ionized fission fragments causes the electrons of the polycarbonate lattice to move towards the path of these particles, resulting in the breakage of chemical bonds in the lattice. The detector is then chemically etched in 6.5 N KOH that preferentially dissolves the damaged polycarbonate left in the path of the fission fragment. The chemically etched fission tracks are permanent records of the path of the fission fragment. The etched fission tracks in Lexan are optically counted using a microscope and the fission tracks in Makrofol are counted using a Spark Chamber. The amount of fissile material in the original sample can be calculated from the number of fission tracks. This paper presents further details of procedures for etching fission tracks in Lexan and Makrofol and for operating a Spark Chamber to count etched fission tracks in Makrofol. The physics of fission track formation in dielectric detectors is also discussed, as well as the physics of the Spark Chamber.

  3. New fit of thermal neutron constants (TNC for 233,235U, 239,241Pu and 252Cf(sf: Microscopic vs. maxwellian data

    Directory of Open Access Journals (Sweden)

    Pronyaev Vladimir G.


    Full Text Available An IAEA project to update the Neutron Standards is near completion. Traditionally, the Thermal Neutron Constants (TNC evaluated data by Axton for thermal-neutron scattering, capture and fission on four fissile nuclei and the total nu-bar of 252Cf(sf are used as input in the combined least-square fit with neutron cross section standards. The evaluation by Axton (1986 was based on a least-square fit of both thermal-spectrum averaged cross sections (Maxwellian data and microscopic cross sections at 2200 m/s. There is a second Axton evaluation based exclusively on measured microscopic cross sections at 2200 m/s (excluding Maxwellian data. Both evaluations disagree within quoted uncertainties for fission and capture cross sections and total multiplicities of uranium isotopes. There are two factors, which may lead to such difference: Westcott g-factors with estimated 0.2% uncertainties used in the Axton's fit, and deviation of the thermal spectra from Maxwellian shape. To exclude or mitigate the impact of these factors, a new combined GMA fit of standards was undertaken with Axton's TNC evaluation based on 2200 m/s data used as a prior. New microscopic data at the thermal point, available since 1986, were added to the combined fit. Additionally, an independent evaluation of TNC was undertaken using CONRAD code. Both GMA and CONRAD results are consistent within quoted uncertainties. New evaluation shows a small increase of fission and capture thermal cross sections, and a corresponding decrease in evaluated thermal nubar for uranium isotopes and 239Pu.

  4. Amchitka Radiobiological Program. Progress report, January 1977--December 1977. [/sup 3/H, /sup 90/Sr, /sup 239/Pu, /sup 240/Pu, /sup 40/K, /sup 7/Be

    Energy Technology Data Exchange (ETDEWEB)

    Seymour, A.H.; Johnson, A.F.


    The Amchitka Radiobiological Program began in 1970 and is a continuing program to collect biological and environmental samples for radiometric analyses. An account of the program from July 1970, to December 1976, has been given in seven previous progress reports from the Laboratory of Radiation Ecology to the Nevada Operations Office of the U.S. Department of Energy. This report is an account of the program for calendar year 1977. Results of analyses for samples collected in September 1977 have been added to the tables in Nelson and Seymour (1977) that summarize the results of analyses of samples collected from 1970 to 1977, and include analyses for: gamma-emitting radionuclides in air filters, freshwater, birds, lichens, marine algae, marine invertebrates, fish, aufwuchs, and freshwater moss and plants; strontium-90 (/sup 90/Sr) in rats, birds, and soil; /sup 239/ /sup 240/Pu in sand, soil, marine algae, and fish; and tritium (/sup 3/H) in seawater, freshwater, and biological organisms. Monitoring of background radiation with survey instruments was added to the Laboratory's program in 1974, and the results of the four annual surveys since that date are included in this report. Conclusions from the results of the recent analyses are a reiteration of the results stated in Nelson and Seymour (1975a); namely, no new radionuclides are present; the most abundant radionuclides are naturally occurring beryllium-7 (/sup 7/Be) and potassium-40 (/sup 40/K); the trace quantities of fission products and induced radionuclides are from world fallout; and a trace of /sup 3/H contamination remains in some Long Shot ponds, as previously reported.'' It is concluded from the results of analyses of samples collected between September 1969, and September 1977, as reported in this and the seven previous progress reports, that there were no radionuclides of Milrow or Cannikin origin in the water, plants, or animals of Amchitka Island.

  5. High workload and job stress are associated with lower practice performance in general practice: an observational study in 239 general practices in the Netherlands

    Directory of Open Access Journals (Sweden)

    Grol Richard


    Full Text Available Abstract Background The impact of high physician workload and job stress on quality and outcomes of healthcare delivery is not clear. Our study explored whether high workload and job stress were associated with lower performance in general practices in the Netherlands. Methods Secondary analysis of data from 239 general practices, collected in practice visits between 2003 to 2006 in the Netherlands using a comprehensive set of measures of practice management. Data were collected by a practice visitor, a trained non-physician observer using patients questionnaires, doctors and staff. For this study we selected five measures of practice performance as outcomes and six measures of GP workload and job stress as predictors. A total of 79 indicators were used out of the 303 available indicators. Random coefficient regression models were applied to examine associations. Results and discussion Workload and job stress are associated with practice performance. Workload: Working more hours as a GP was associated with more positive patient experiences of accessibility and availability (b = 0.16. After list size adjustment, practices with more GP-time per patient scored higher on GP care (b = 0.45. When GPs provided more than 20 hours per week per 1000 patients, patients scored over 80% on the Europep questionnaire for quality of GP care. Job stress: High GP job stress was associated with lower accessibility and availability (b = 0.21 and insufficient practice management (b = 0.25. Higher GP commitment and more satisfaction with the job was associated with more prevention and disease management (b = 0.35. Conclusion Providing more time in the practice, and more time per patient and experiencing less job stress are all associated with perceptions by patients of better care and better practice performance. Workload and job stress should be assessed by using list size adjusted data in order to realise better quality of care. Organisational development using

  6. High workload and job stress are associated with lower practice performance in general practice: an observational study in 239 general practices in the Netherlands. (United States)

    van den Hombergh, Pieter; Künzi, Beat; Elwyn, Glyn; van Doremalen, Jan; Akkermans, Reinier; Grol, Richard; Wensing, Michel


    The impact of high physician workload and job stress on quality and outcomes of healthcare delivery is not clear. Our study explored whether high workload and job stress were associated with lower performance in general practices in the Netherlands. Secondary analysis of data from 239 general practices, collected in practice visits between 2003 to 2006 in the Netherlands using a comprehensive set of measures of practice management. Data were collected by a practice visitor, a trained non-physician observer using patients questionnaires, doctors and staff. For this study we selected five measures of practice performance as outcomes and six measures of GP workload and job stress as predictors. A total of 79 indicators were used out of the 303 available indicators. Random coefficient regression models were applied to examine associations. Workload and job stress are associated with practice performance.Workload: Working more hours as a GP was associated with more positive patient experiences of accessibility and availability (b = 0.16). After list size adjustment, practices with more GP-time per patient scored higher on GP care (b = 0.45). When GPs provided more than 20 hours per week per 1000 patients, patients scored over 80% on the Europep questionnaire for quality of GP care.Job stress: High GP job stress was associated with lower accessibility and availability (b = 0.21) and insufficient practice management (b = 0.25). Higher GP commitment and more satisfaction with the job was associated with more prevention and disease management (b = 0.35). Providing more time in the practice, and more time per patient and experiencing less job stress are all associated with perceptions by patients of better care and better practice performance. Workload and job stress should be assessed by using list size adjusted data in order to realise better quality of care. Organisational development using this kind of data feedback could benefit both patients and GP.

  7. Energy dependence of fission product yields from 235U, 238U, and 239Pu with monoenergetic neutrons between thermal and 14.8 MeV (United States)

    Gooden, Matthew; Arnold, Charles; Bhike, Megha; Bredeweg, Todd; Fowler, Malcolm; Krishichayan; Tonchev, Anton; Tornow, Werner; Stoyer, Mark; Vieira, David; Wilhelmy, Jerry


    Under a joint collaboration between TUNL-LANL-LLNL, a set of absolute fission product yield measurements has been performed. The energy dependence of a number of cumulative fission product yields (FPY) have been measured using quasi-monoenergetic neutron beams for three actinide targets, 235U, 238U and 239Pu, between 0.5 and 14.8 MeV. The FPYs were measured by a combination of fission counting using specially designed dual-fission chambers and γ-ray counting. Each dual-fission chamber is a back-to-back ionization chamber encasing an activation target in the center with thin deposits of the same target isotope in each chamber. This method allows for the direct measurement of the total number of fissions in the activation target with no reference to the fission cross-section, thus reducing uncertainties. γ-ray counting of the activation target was performed on well-shielded HPGe detectors over a period of two months post irradiation to properly identify fission products. Reported are absolute cumulative fission product yields for incident neutron energies of 0.5, 1.37, 2.4, 3.6, 4.6, 5.5, 7.5, 8.9 and 14.8 MeV. Preliminary results from thermal irradiations at the MIT research reactor will also be presented and compared to present data and evaluations. This work was performed under the auspices of the U.S. Department of Energy by Los Alamos National Security, LLC under contract DE-AC52-06NA25396, Lawrence Livermore National Laboratory under contract DE-AC52-07NA27344 and by Duke University and Triangle Universities Nuclear Laboratory through NNSA Stewardship Science Academic Alliance grant No. DE-FG52-09NA29465, DE-FG52-09NA29448 and Office of Nuclear Physics Grant No. DE-FG02-97ER41033.

  8. Survival and prognostic factors for survival, cancer specific survival and disease free interval in 239 patients with Hurthle cell carcinoma: a single center experience. (United States)

    Oluic, Branisav; Paunovic, Ivan; Loncar, Zlatibor; Djukic, Vladimir; Diklic, Aleksandar; Jovanovic, Milan; Garabinovic, Zeljko; Slijepcevic, Nikola; Rovcanin, Branislav; Micic, Dusan; Filipovic, Aleksandar; Zivaljevic, Vladan


    Hurthle cell carcinoma makes up 3 to 5% of all thyroid cancers and is considered to be a true rarity. The aim of our study was to analyze clinical characteristics and survival rates of patients with Hurthle cell carcinoma. Clinical data regarding basic demographic characteristics, tumor grade, type of surgical treatment and vital status were collected. Methods of descriptive statistics and Kaplan-Meier survival curves were used for statistical analysis. Cox proportional hazards regression was used to identify independent predictors. During the period from 1995 to 2014, 239 patients with Hurthle cell carcinoma were treated at our Institution. The average age of the patients was 54.3, with female to male ratio of 3.6:1 and average tumor size was 41.8 mm. The overall recurrence rate was 12.1%, with average time for relapse of 90.74 months and average time without any signs of the disease of 222.4 months. Overall 5-year, 10-year and 20-year survival rates were 89.4%, 77.2%, 61.9% respectively. The 5-year, 10-year and 20-year cancer specific survival rates were 94.6%, 92.5%, 87.4%, respectively. When disease free interval was observed, 5-year, 10-year and 20-year rates were 91.1%, 86.2%, 68.5%, respectively. The affection of both thyroid lobes and the need for reoperation due to local relapse were unfavorable independent prognostic factors, while total thyroidectomy as primary procedure was favorable predictive factor for cancer specific survival. Hurthle cell carcinoma is a rare tumor with an encouraging prognosis and after adequate surgical treatment recurrences are rare.

  9. GLAST 239 Days till Launch

    CERN Multimedia

    CERN. Geneva


    The GLAST mission will open a new era in High Energy Astrophysics. GLAST will increase the available data over its predecessor, EGRET, by 2 orders of magnitude along with greatly improved image reconstruction, dead-time, and energy resolution. Vast improvements to known science and the large discovery potential are eagerly anticipated by the Astrophysics community. The current status of the mission will be detailed as well as the preparation by the GLAST Collaboration for the first observations. A few science topics as relates to fundamental physics questions will also be discussed.

  10. Modelling Deposition and Erosion rates with RadioNuclides (MODERN) - Part 2: A comparison of different models to convert239+240Pu inventories into soil redistribution rates at unploughed sites. (United States)

    Arata, Laura; Alewell, Christine; Frenkel, Elena; A'Campo-Neuen, Annette; Iurian, Andra-Rada; Ketterer, Michael E; Mabit, Lionel; Meusburger, Katrin


    Sheet erosion is one of the major threats to alpine soils. To quantify its role and impact in the degradation processes of alpine grasslands, the application of Fallout Radionuclides (FRN) showed very promising results. The specific characteristics of plutonium 239 + 240 ( 239+240 Pu), such as the homogeneous fallout distribution, the long half-life and the cost and time effective measurements make this tracer application for investigating soil degradation in Alpine grasslands more suitable than any other FRN (e.g. 137 Cs). However, the conversion of 239+240 Pu inventories into soil erosion rates remains a challenge. Currently available conversion models have been developed mainly for 137 Cs with later adaptation to other FRN (e.g. Excess 210 Pb, and 7 Be), each model being defined for specific land use (ploughed and/or unploughed) and processes (erosion or deposition). As such, they may fail in describing correctly the distribution of Pu isotopes in the soil. A new conversion model, MODERN, with an adaptable algorithm to estimate erosion and deposition rates from any FRN inventory changes was recently proposed (Arata et al., 2016). In this complementary contribution, the authors compare the application of MODERN to other available conversion models. The results show a good agreement between soil redistribution rates obtained from MODERN and from the models currently used by the FRN scientific community (i.e. the Inventory Method). Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  11. Immunogenicity of seven new recombinant yellow fever viruses 17D expressing fragments of SIVmac239 Gag, Nef, and Vif in Indian rhesus macaques.

    Directory of Open Access Journals (Sweden)

    Mauricio A Martins

    Full Text Available An effective vaccine remains the best solution to stop the spread of human immunodeficiency virus (HIV. Cellular immune responses have been repeatedly associated with control of viral replication and thus may be an important element of the immune response that must be evoked by an efficacious vaccine. Recombinant viral vectors can induce potent T-cell responses. Although several viral vectors have been developed to deliver HIV genes, only a few have been advanced for clinical trials. The live-attenuated yellow fever vaccine virus 17D (YF17D has many properties that make it an attractive vector for AIDS vaccine regimens. YF17D is well tolerated in humans and vaccination induces robust T-cell responses that persist for years. Additionally, methods to manipulate the YF17D genome have been established, enabling the generation of recombinant (rYF17D vectors carrying genes from unrelated pathogens. Here, we report the generation of seven new rYF17D viruses expressing fragments of simian immunodeficiency virus (SIVmac239 Gag, Nef, and Vif. Studies in Indian rhesus macaques demonstrated that these live-attenuated vectors replicated in vivo, but only elicited low levels of SIV-specific cellular responses. Boosting with recombinant Adenovirus type-5 (rAd5 vectors resulted in robust expansion of SIV-specific CD8(+ T-cell responses, particularly those targeting Vif. Priming with rYF17D also increased the frequency of CD4(+ cellular responses in rYF17D/rAd5-immunized macaques compared to animals that received rAd5 only. The effect of the rYF17D prime on the breadth of SIV-specific T-cell responses was limited and we also found evidence that some rYF17D vectors were more effective than others at priming SIV-specific T-cell responses. Together, our data suggest that YF17D - a clinically relevant vaccine vector - can be used to prime AIDS virus-specific T-cell responses in heterologous prime boost regimens. However, it will be important to optimize rYF17D

  12. Intercomparison of Pb-210, Cs-137, Pu-239,240 and C-14-Based Chronologies of Recent Sediments - Problems and Challenges (United States)

    Baskaran, M. M.


    Short-lived naturally-occurring Pb-210 and anthropogenically-delivered Cs-137 are the two most extensively utilized chronometers over the time scale of less than a decade to 60 (Cs-137) to 120 yrs (Pb-210) in a variety of environment including terrestrial and aqueous systems and glaciers. Despite all the advances in the field, still major issues, we confront several issues on the robustness of their applications in these environments. Those include: i) how does the temporal and spatial variations of Pb-210 input to an aqueous environment affect the Pb-210 chronology? ii) how well we are able to quantify the multiple source inputs (atmospheric fallout, watershed erosional input, production of Pb-210 from the decay of SGD-derived Rn-222 and Ra-226, etc); iii) How well are we able to sort out a number of processes that affect the vertical profiles of both Cs-137 and Pb-210 which include sediment mixing (biological and/or physical), sediment focusing/erosion due to bottom currents and transport of sediments in subsurface environment and post-depositional mobility of Cs-137 and Pb-210. In this presentation, the following case studies will be discussed: 1) where there is excellent as well non-agreement between Pb-210 and Cs-137-based chronologies; 2) agreement between Cs-137-based chronology with historical time-marker from Hg mining, while no chronology obtainable from Pb-210; 3) agreement between five different methods of dating in a reservoir; 4) evidence of Cs-137 diffusion in some of the sediment cores, but not in all cores in a small reservoir; and 5) evidence of long-term remineralization based on a comparison of C-14-based ages with those of Pb-210, Cs-137 and Pu-239,240-based methods. We also show evidence Cs-137 diffusion based on a set of laboratory-based diffusion experiments under different pore water chemical conditions. A brief discussion on time resolution and error estimation on ages will be discussed. The challenges in the field of `Anthropocene

  13. Involved-field radiotherapy (IFRT) versus elective nodal irradiation (ENI) in combination with concurrent chemotherapy for 239 esophageal cancers: a single institutional retrospective study. (United States)

    Yamashita, Hideomi; Takenaka, Ryousuke; Omori, Mami; Imae, Toshikazu; Okuma, Kae; Ohtomo, Kuni; Nakagawa, Keiichi


    This retrospective study on early and locally advanced esophageal cancer was conducted to evaluate locoregional failure and its impact on survival by comparing involved field radiotherapy (IFRT) with elective nodal irradiation (ENI) in combination with concurrent chemotherapy. We assessed all patients with esophageal cancer of stages I-IV treated with definitive radiotherapy from June 2000 to March 2014. Between 2000 and 2011, ENI was used for all cases excluding high age cases. After Feb 2011, a prospective study about IFRT was started, and therefore IFRT was used since then for all cases. Concurrent chemotherapy regimen was nedaplatin (80 mg/m(2) at D1 and D29) and 5-fluorouracil (800 mg/m(2) at D1-4 and D29-32). Of the 239 consecutive patients assessed (120 ENI vs. 119 IFRT), 59 patients (24.7%) had stage IV disease and all patients received at least one cycle of chemotherapy. The median follow-up time for survivors was 34.0 months. There were differences in 3-year local control (44.8% vs. 55.5%, p = 0.039), distant control (53.8% vs. 69.9%, p = 0.021) and overall survival (34.8% vs. 51.6%, p = 0.087) rates between ENI vs. IFRT, respectively. Patients treated with IFRT (8 %) demonstrated a significantly lower risk (p = 0.047) of high grade late toxicities than with ENI (16%). IFRT did not increase the risk of initially uninvolved or isolated nodal failures (27.5% in ENI and 13.4% in IFRT). Nodal failure rates in clinically uninvolved nodal stations were not increased with IFRT when compared to ENI. IFRT also resulted in significantly decreased esophageal toxicity, suggesting that IFRT may allow for integration of concurrent systemic chemotherapy in a greater proportion of patients. Both tendencies of improved loco-regional progression-free survival and a significant increased overall survival rate favored the IFRT arm over the ENI arm in this study.

  14. Alcohol Consumption and Survival after a Breast Cancer Diagnosis: A Literature-Based Meta-analysis and Collaborative Analysis of Data for 29,239 Cases (United States)

    Ali, Alaa M.G.; Schmidt, Marjanka K.; Bolla, Manjeet K.; Wang, Qin; Gago-Dominguez, M.; Castelao, J. Esteban; Carracedo, Angel; Garzón, Victor Muñoz; Bojesen, Stig E.; Nordestgaard, Børge G.; Flyger, Henrik; Chang-Claude, Jenny; Vrieling, Alina; Rudolph, Anja; Seibold, Petra; Nevanlinna, Heli; Muranen, Taru A.; Aaltonen, Kirsimari; Blomqvist, Carl; Matsuo, Keitaro; Ito, Hidemi; Iwata, Hiroji; Horio, Akiyo; John, Esther M.; Sherman, Mark; Lissowska, Jolanta; Figueroa, Jonine; Garcia-Closas, Montserrat; Anton-Culver, Hoda; Shah, Mitul; Hopper, John L.; Trichopoulou, Antonia; Bueno-de-Mesquita, Bas; Krogh, Vittorio; Weiderpass, Elisabete; Andersson, Anne; Clavel-Chapelon, Françoise; Dossus, Laure; Fagherazzi, Guy; Peeters, Petra H.; Olsen, Anja; Wishart, Gordon C.; Easton, Douglas F.; Borgquist, Signe; Overvad, Kim; Barricarte, Aurelio; González, Carlos A.; Sánchez, María-José; Amiano, Pilar; Riboli, Elio; Key, Tim; Pharoah, Paul D.


    Background Evidence for an association of alcohol consumption with prognosis after a diagnosis of breast cancer has been inconsistent. We have reviewed and summarized the published evidence and evaluated the association using individual patient data from multiple case cohorts. Methods A MEDLINE search to identify studies published up to January 2013 was performed. We combined published estimates of survival time for “moderate drinkers” versus nondrinkers. An analysis of individual participant data using Cox regression was carried out using data from 11 case cohorts. Results We identified 11 published studies suitable for inclusion in the meta-analysis. Moderate post-diagnosis alcohol consumption was not associated with overall survival [HR, 0.95; 95% confidence interval (CI), 0.85–1.05], but there was some evidence of better survival associated with prediagnosis consumption (HR, 0.80; 95% CI, 0.73–0.88). Individual data on alcohol consumption for 29,239 cases with 4,839 deaths were available from the 11 case cohorts, all of which had data on estrogen receptor (ER) status. For women with ER-positive disease, there was little evidence that pre- or postdiagnosis alcohol consumption is associated with breast cancer–specific mortality, with some evidence of a negative association with all-cause mortality. On the basis of a single study, moderate postdiagnosis alcohol intake was associated with a small reduction in breast cancer–specific mortality for women with ER-negative disease. There was no association with prediagnosis intake for women with ER-negative disease. Conclusion There was little evidence that pre- or post-diagnosis alcohol consumption is associated with breast cancer–specific mortality for women with ER-positive disease. There was weak evidence that moderate post-diagnosis alcohol intake is associated with a small reduction in breast cancer–specific mortality in ER-negative disease. Impact Considering the totality of the evidence, moderate

  15. Transfer and translocation of {sup 241}Am, {sup 239}Pu, {sup 137}Cs and {sup 85}Sr after partial foliar contamination of bean plants

    Energy Technology Data Exchange (ETDEWEB)

    Henner, P.; Colle, C.; Morello, M. [CEA Cadarache (DEI/SECRE/LRE), Laboratory of Radioecology and Ecotoxicology, Institute for Radioprotection and Nuclear Safety, 13 - Saint-Paul-lez-Durance (France)


    Bean plants at the flowering development stage were contaminated by soaking their two first leaves for 3 hours in a solution containing one of the actinides {sup 241}Am or {sup 239}Pu, or both {sup 137}Cs and {sup 85}Sr. The aim of the study was to assess the adequacy of using the values of Cs/Sr for the foliar transfer parameters of transuranic actinides, as used for example in the ASTRAL code to calculate the contamination of agricultural products after a nuclear accident. Secondly, these experiments were launched to tentatively determine specific values for the foliar transfer parameters for Am and Pu, despite technical limitations due to high radiotoxicity of these isotopes which prevented the contamination of the whole foliage of bean plants. Cs and Sr were used to compare the results with those obtained with other modes of contamination, by dry deposition of aerosols for example. Results showed that the soaking protocol was adequate to compare the foliar transfer of various radionuclides, although it should be difficult to provide specific values because of partial contamination of the foliage. Foliar transfer factors, expressed as{sup -1}{sub dw} {sub pods}/Bq.L{sup -1}{sub solution} (2.5x10{sup -2}) and translocation factors, dimensionless, (2.3x10{sup -3}) for Am and for Pu (1.5x10{sup -3} and 7.5x10{sup -5} respectively), compared to those for Sr (respectively 3.6x10{sup -3} and 5.9x10{sup -4}) and for Cs (respectively 2.9x10{sup -1} and 1.3x10{sup -1}), were studied using this procedure. Transfer and translocation factors for Am were significantly higher than those for Sr, but were smaller than those for Cs. Therefore, Am can be classified as a medium mobile radionuclide in plant. Transfer and translocation of Pu were significantly lower than these for Sr and for Am. Besides, the transfer and translocation factors of Am and Pu only differed from one order of magnitude or less from the one of Sr, which could be in the usual range of variation

  16. Radiotoxicological analyses of {sup 239+240}Pu and {sup 241}Am in biological samples by anion-exchange and extraction chromatography: a preliminary study for internal contamination evaluations

    Energy Technology Data Exchange (ETDEWEB)

    Ridone, S.; Arginelli, D.; Bortoluzzi, S.; Canuto, G.; Montalto, M.; Nocente, M.; Vegro, M. [Italian National Agency for New Technologies, Energy and the Environment (ENEA), Research Centre of Saluggia, Radiation Protection Institute, Saluggia, VC (Italy)


    Many biological samples (urines and faeces) have been analysed by means of chromatographic extraction columns, utilising two different resins (AG 1-X2 resin chloride and T.R.U.), in order to detect the possible internal contamination of {sup 239{sup +}}{sup 240}Pu and {sup 241}Am, for some workers of a reprocessing nuclear plant in the decommissioning phase. The results obtained show on one hand the great suitability of the first resin for the determination of plutonium, and on the other the great selectivity of the second one for the determination of americium.


    Directory of Open Access Journals (Sweden)

    Vitalie STATI


    Full Text Available Prezentul articol este consacrat analizei de drept penal a infracţiunilor prevăzute la art.238 şi 239 CP RM. Analiza este efectuată prin prisma Legii pentru modificarea şi completarea unor acte legislative din 25.07.2014. În acord cu aceasta, aria de aplicare a art.238 CP RM a fost extinsă asupra ipotezelor presupunând prezentarea cu bună ştiinţă a unor infor-maţii false în scopul obţinerii unui împrumut sau a unei despăgubiri/indemnizaţii de asigurare, ori al majorării sumei acestora, ori al obţinerii unui împrumut în condiţii avantajoase, dacă prin aceasta instituţiei financiare, organizaţiei financiare nebancare, asociaţiei de economii şi împrumut sau asigurătorului i-au fost cauzate daune. De asemenea, art.238 CP RM a fost completat cu alineatul (2: „Aceleaşi acţiuni care au cauzat daune în proporţii deosebit de mari”. Nu în ultimul rând, aria de aplicare a art.239 CP RM a fost extinsă asupra ipotezelor presupunând acordarea unui împru-mut sau a unei despăgubiri/indemnizaţii de asigurare cu încălcarea intenţionată a legii, a politicilor de acordare a împru-muturilor sau normelor de prudenţă financiară, dacă prin aceasta instituţiei financiare, organizaţiei financiare nebancare, asociaţiei de economii şi împrumut sau asigurătorului i-au fost cauzate daune.THE OFFENCES REFFERED TO AT ART.238 AND 239 PC RM IN THE LIGHT OF THE AMENDMENTS OPERATED TO THE PENAL CODE AT 07.25.2014This article is dedicated to the penal law analysis of the offences referred to at art.238 and 239 PC RM. The analysis is carried through the Law on amending and supplementing certain legislative acts from 25.07.2014. In line with these procedures, the application scope of art.238 PC RM was extended over the hypothesis assuming knowingly presenting false information in order to obtain a loan or reparation/insurance claim, or to increase their amount, or to obtain a loan on favorable terms, if all these were caused

  18. Os quilombos perante o STF: a emergência de uma jurisprudência dos direitos étnicos (ADIN 3.239-9 The quilombos before Supreme Court: the emergence of an ethnic rights jurisprudency (ADIN 3.239-9

    Directory of Open Access Journals (Sweden)

    João Carlos Bemerguy Camerini


    Full Text Available O STF apreciará este ano a ADIN nº 3.239-9, na qual se discute a interpretação do direito das comunidades remanescentes de quilombos à titulação de suas terras (art. 68 do ADCT. Para além de prenunciar impactos sociais sobremodo relevantes, notadamente no mercado de terras, essa ação recoloca a Corte Suprema brasileira face aos dilemas da jurisdição constitucional, tais como a sua legitimidade democrática, o seu compromisso com a concretização dos direitos fundamentais, além da necessidade de forçá-la a perscrutar as consequências materiais de suas decisões. A partir da demonstração da tese da fundamentabilidade do direito às terras quilombolas e da crítica às teorias liberal-positivistas da jurisdição e da interpretação, este artigo visa demarcar as questões principais desse processo judicial, cujo enfrentamento se impõe, segundo métodos hermenêuticos adequados, se o tribunal quiser chegar a um provimento final efetivo, isto é, ser capaz de promover a pacificação social e promover a eficácia dos direitos fundamentais, que consubstanciam a razão última da função jurisdicional no contexto do Estado Constitucional.This year, the Brazilian Supreme Court will judge the Direct Action of Unconstitutionality 3239-9, which discusses the correct interpretation of the right of quilombo communities to their territories (article 68 of the Transitory Constitutional Provisions ACT. The decision of this process will bring social impacts, especially in the land market, and will compel the Court to face the dilemmas of constitutional jurisdiction, such as its democratic legitimacy, its commitment to the realization of fundamental rights and the problem of material consequences of hard cases decisions. Based on the thesis that the quilombo territories are fundamental rights, this text seeks to demarcate the key issues of this lawsuit, whose analysis is imposed, according to appropriate hermeneutical methods, if the Court

  19. Long-term variation (1986-1998) of post-Chernobyl 90Sr, 137Cs, 238Pu and (239,240)Pu concentrations in air, depositions to ground, resuspension factors and resuspension rates in south Germany. (United States)

    Rosner, G; Winkler, R


    Annual mean concentrations in air and annual total (wet plus dry) depositions to ground of 90Sr, 137Cs, 238Pu and (239,240)Pu decreased at Neuherberg, south Germany, in the period from July 1986 (i.e. after the end of the initial deposition phase from Chernobyl) to 1998 as follows: 90Sr from 0.77 to 0.05 microBq m(-3), and from 0.82 (1988) to 0.28 Bq m(-2) year(-1); 137Cs from 133 to 2.8 microBq m(-3), and from 116 to 3.8 Bq m(-2) year(-1); 238Pu from 0.95 to 0.063 nBq m(-3), and from 1.0 to 0.23 mBq m(-2) year(-1); (239,240)Pu from 8.1 to 0.53 nBq m(-3), and from 6.4 to 2.1 mBq m(-2) year(-1). The values for the non-caesium radionuclides are compared to the few available data from other stations. After an initial phase which is characterised for a given radionuclide by the varying ratio of the Chernobyl-derived inventory to the earlier, weapons fallout-derived inventory, the time courses of concentrations of 137Cs, 90Sr, 238Pu and (239,240)Pu in air become more or less parallel (from about 1990), despite the considerable differences in the physico-chemical properties of these elements. By contrast, the time series of radionuclide deposition rates show until about 1994 less similarity among each other and with the respective concentration series in air. From 1994, concentrations in air and depositions to ground become nearly constant, or decrease very slowly. At the end of the observation period, resuspension factors between 1.4 x 10(-10) m(-1) and 1.0 x 10(-11) m(-1) are observed for the various nuclides. The time courses of specific activities (Bq g(-1)) as well as the time courses of radionuclide ratios show characteristic differences between air and deposition. The data will be useful in predicting the post-accident behaviour of radionuclides a long time after a large-scale contamination event.

  20. Synchronous Changes of the Shape of Histograms Constructed from the Results of Measurements of 90-Sr Beta-Decay and 239-Pu Alpha-Decay Observed in More than 3000 km Distant Laboratories

    Directory of Open Access Journals (Sweden)

    Filin E. Y.


    Full Text Available It was discovered many years ago that histograms constructed from the results of mea- surements of various natural processes are not random. The histogram shape was demonstrated to be determined by the diurnal rotation and circumsolar movement of the Earth and to be independent of the nature of the process considered [1-17]. The results of those works change our basic views about stochasticity of natural processes. When the time series of physical measurements, which are traditionally considered stochastic, are transformed into the series of histograms constructed for an optimally small num- ber of the results (i.e., optimally short segment of the time series, one can see regular changes in the histogram shape. The paper illustrates the main manifestations of this phenomenon by comparing the results of 90 Sr -radioactivity and 239 Pu -decay mea- surements, with the distance between the laboratories in which the data were collected being about 3000 km.

  1. A systematic study of the whole genome sequence of Amycolatopsis methanolica strain 239T provides an insight into its physiological and taxonomic properties which correlate with its position in the genus

    Directory of Open Access Journals (Sweden)

    Biao Tang


    Full Text Available The complete genome of methanol-utilizing Amycolatopsis methanolica strain 239T was generated, revealing a single 7,237,391 nucleotide circular chromosome with 7074 annotated protein-coding sequences (CDSs. Comparative analyses against the complete genome sequences of Amycolatopsis japonica strain MG417-CF17T, Amycolatopsis mediterranei strain U32 and Amycolatopsis orientalis strain HCCB10007 revealed a broad spectrum of genomic structures, including various genome sizes, core/quasi-core/non-core configurations and different kinds of episomes. Although polyketide synthase gene clusters were absent from the A. methanolica genome, 12 gene clusters related to the biosynthesis of other specialized (secondary metabolites were identified. Complete pathways attributable to the facultative methylotrophic physiology of A. methanolica strain 239T, including both the mdo/mscR encoded methanol oxidation and the hps/hpi encoded formaldehyde assimilation via the ribulose monophosphate cycle, were identified together with evidence that the latter might be the result of horizontal gene transfer. Phylogenetic analyses based on 16S rDNA or orthologues of AMETH_3452, a novel actinobacterial class-specific conserved gene against 62 or 18 Amycolatopsis type strains, respectively, revealed three major phyletic lineages, namely the mesophilic or moderately thermophilic A. orientalis subclade (AOS, the mesophilic Amycolatopsis taiwanensis subclade (ATS and the thermophilic A. methanolica subclade (AMS. The distinct growth temperatures of members of the subclades correlated with corresponding genetic variations in their encoded compatible solutes. This study shows the value of integrating conventional taxonomic with whole genome sequence data.

  2. Synchronous Measurements of Alpha-Decay of 239-Pu Carried out at North Pole, Antarctic, and in Puschino Confirm that the Shapes of the Respective Histograms Depend on the Diurnal Rotation of the Earth and on the Direction of the Alpha-Particle Beam

    Directory of Open Access Journals (Sweden)

    Shnoll S. E.


    Full Text Available Dependence of histogram shapes from Earth diurnal rotation, and from direction of alpha-particles issue at 239 Pu radioactive decay is confirmed by simultaneous measure- ments of fluctuation amplitude spectra — shapes of corresponding histograms. The measurements were made with various methods and in different places: at the North Pole, in Antarctic (Novolazarevskaya station, and in Puschino.

  3. Sequential determination of natural ({sup 232}Th, {sup 238}U) and anthropogenic ({sup 137}Cs, {sup 90}Sr, {sup 241}Am, {sup 239+240}Pu) radionuclides in environmental matrix

    Energy Technology Data Exchange (ETDEWEB)

    Michel, H.; Levent, D.; Barci, V.; Barci-Funel, G.; Hurel, C. [Laboratoire de Radiochimie, Sciences Analytiques et Environnement (LRSAE), Universite de Nice Sophia-Antipolis 06108 Nice Cedex (France)


    A new sequential method for the determination of both natural (U, Th) and anthropogenic (Sr, Cs, Pu, Am) radionuclides has been developed for application to soil and sediment samples. The procedure was optimised using a reference sediment (IAEA-368) and reference soils (IAEA-375 and IAEA-326). Reference materials were first digested using acids (leaching), 'total' acids on hot plate, and acids in microwave in order to compare the different digestion technique. Then, the separation and purification were made by anion exchange resin and selective extraction chromatography: Transuranic (TRU) and Strontium (SR) resins. Natural and anthropogenic alpha radionuclides were separated by Uranium and Tetravalent Actinide (UTEVA) resin, considering different acid elution medium. Finally, alpha and gamma semiconductor spectrometer and liquid scintillation spectrometer were used to measure radionuclide activities. The results obtained for strontium-90, cesium-137, thorium-232, uranium- 238, plutonium-239+240 and americium-241 isotopes by the proposed method for the reference materials provided excellent agreement with the recommended values and good chemical recoveries. (authors)

  4. Distribution and inventories of fallout radionuclides ({sup 239+24}Pu, {sup 137}Cs) and {sup 21}Pb to study the filling velocity of salt marshes in Donana National Park (Spain)

    Energy Technology Data Exchange (ETDEWEB)

    Gasco, C. [Centro de Investigaciones Energeticas, Medioambientales y Tecnologicas, CIEMAT, Departamento de Medio Ambiente, Avda. Complutense 22, Madrid 28040 (Spain); Anton, M.P. [Centro de Investigaciones Energeticas, Medioambientales y Tecnologicas, CIEMAT, Departamento de Medio Ambiente, Avda. Complutense 22, Madrid 28040 (Spain)]. E-mail:; Pozuelo, M. [Centro de Investigaciones Energeticas, Medioambientales y Tecnologicas, CIEMAT, Departamento de Medio Ambiente, Avda. Complutense 22, Madrid 28040 (Spain); Clemente, L. [Consejo Superior de Investigaciones Cientificas, Instituto de Recursos Naturales y Agrobiologia, CSIC-IRNA, Departamento de Geoecologia, Avda. Reina Mercedes s/n, Sevilla 41012 (Spain); Rodriguez, A. [Universidad de Huelva, Departamento de Geodinamica y Paleontologia, Avda. de las Fuerzas Armadas s/n, Huelva 21071 (Spain); Yanez, C. [Consejo Superior de Investigaciones Cientificas, Instituto de Recursos Naturales y Agrobiologia, CSIC-IRNA, Departamento de Geoecologia, Avda. Reina Mercedes s/n, Sevilla 41012 (Spain); Gonzalez, A. [Centro de Investigaciones Energeticas, Medioambientales y Tecnologicas, CIEMAT, Departamento de Medio Ambiente, Avda. Complutense 22, Madrid 28040 (Spain); Meral, J. [Centro de Investigaciones Energeticas, Medioambientales y Tecnologicas, CIEMAT, Departamento de Medio Ambiente, Avda. Complutense 22, Madrid 28040 (Spain)


    Within an extensive multinational and multidisciplinary project carried out in Donana National Park (Spain) to investigate its preservation and regeneration, the filling velocity of the salt marshes has been evaluated through the calculation of their average sediment accumulation rates. {sup 239+24}Pu and {sup 137}Cs from weapons testing fallout and total {sup 21}Pb distribution profiles and inventories have been determined in some of the most characteristic zones of the park, namely, the ponds (or 'lucios') and the waterjets (or 'canos'). Plutonium inventories range from 16 to 101 Bq m{sup -2}, {sup 137}Cs values fluctuate between 514 and 3758 Bq m{sup -2} and unsupported {sup 21}Pb values comprise between 124 and 9398 Bq m{sup -2}. Average sedimentation rates range from 3 to 5 mm y{sup -1} (1952-2002). These data are higher than those obtained by carbon dating for the period 6500 AD-present, estimated as 1.5-2 mm y{sup -1}, suggesting an increase in the accumulation of sediments and the alteration of the park's hydrodynamics caused by the re-channeling of the major rivers feeding the salt marshes.

  5. Estimation of multi-group cross section covariances for {sup 235,238}U, {sup 239}Pu, {sup 241}Am, {sup 56}Fe, {sup 23}Na and {sup 27}Al

    Energy Technology Data Exchange (ETDEWEB)

    De Saint Jean, C.; Archier, P.; Noguere, G.; Litaize, O.; Vaglio-Gaudard, C.; Bernard, D.; Leray, O. [CEA, DEN, DER, Cadarache, F-13108 Saint-Paul-lez-Durance (France)


    This paper presents the methodology used to estimate multi-group covariances for some major isotopes used in reactor physics. The starting point of this evaluation is the modelling of the neutron induced reactions based on nuclear reaction models with parameters. These latest are the vectors of uncertainties as they are absorbing uncertainties and correlation arising from the confrontation of nuclear reaction model to microscopic experiment. These uncertainties are then propagated towards multi-group cross sections. As major breakthroughs were then asked by nuclear reactor physicists to assess proper uncertainties to be used in applications, a solution is proposed by the use of integral experiment information at two different stages in the covariance estimation. In this paper, we will explain briefly the treatment of all type of uncertainties, including experimental ones (statistical and systematic) as well as those coming from validation of nuclear data on dedicated integral experiment (nuclear data oriented). We will illustrate the use of this methodology with various isotopes such as {sup 235,238}U, {sup 239}Pu, {sup 241}Am, {sup 56}Fe, {sup 23}Na and {sup 27}Al. (authors)

  6. Estimation of covariances of {sup 16}O, {sup 23}Na, Fe, {sup 235}U, {sup 238}U and {sup 239}Pu neutron nuclear data in JENDL-3.2

    Energy Technology Data Exchange (ETDEWEB)

    Shibata, Keiichi [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Nakajima, Yutaka; Kawano, Toshihiko; Oh, Soo-Youl; Matsunobu, Hiroyuki; Murata, Toru


    Covariances of nuclear data have been estimated for 6 nuclides contained in JENDL-3.2. The nuclides considered are {sup 16}O, {sup 23}Na, Fe, {sup 235}U, {sup 238}U, and {sup 239}Pu, which are regarded as important for the nuclear design study of fast reactors. The physical quantities for which covariances are deduced are cross sections, resolved and unresolved resonance parameters, and the first order Legendre-polynomial coefficient for the angular distribution of elastically scattered neutrons. As for {sup 235}U, covariances were obtained also for the average number of neutrons emitted in fission. The covariances were estimated by using the same methodology that had been used in the JENDL-3.2 evaluation in order to keep a consistency between mean values and their covariances. The least-squares fitting code GMA was used in estimating covariances for reactions of which JENDL-3.2 cross sections had been evaluated by taking account of measurements. In nuclear model calculations, the covariances were calculated by the KALMAN system. The covariance data obtained were compiled in the ENDF-6 format, and will be put into the JENDL-3.2 Covariance File which is one of JENDL special purpose files. (author). 193 refs.

  7. Distribution and inventories of fallout radionuclides (239+240Pu, 137Cs) and 210Pb to study the filling velocity of salt marshes in Doñana National Park (Spain). (United States)

    Gascó, C; Antón, M P; Pozuelo, M; Clemente, L; Rodríguez, A; Yañez, C; González, A; Meral, J


    Within an extensive multinational and multidisciplinary project carried out in Doñana National Park (Spain) to investigate its preservation and regeneration, the filling velocity of the salt marshes has been evaluated through the calculation of their average sediment accumulation rates. (239+240)Pu and (137)Cs from weapons testing fallout and total (210)Pb distribution profiles and inventories have been determined in some of the most characteristic zones of the park, namely, the ponds (or "lucios") and the waterjets (or "caños"). Plutonium inventories range from 16 to 101 Bq m(-2), (137)Cs values fluctuate between 514 and 3,758 Bq m(-2) and unsupported (210)Pb values comprise between 124 and 9398 Bq m(-2). Average sedimentation rates range from 3 to 5 mm y(-1) (1952-2002). These data are higher than those obtained by carbon dating for the period 6,500 AD-present, estimated as 1.5-2 mm y(-1), suggesting an increase in the accumulation of sediments and the alteration of the park's hydrodynamics caused by the re-channeling of the major rivers feeding the salt marshes.

  8. Pregnancy outcomes decline with increasing body mass index: analysis of 239,127 fresh autologous in vitro fertilization cycles from the 2008-2010 Society for Assisted Reproductive Technology registry. (United States)

    Provost, Meredith P; Acharya, Kelly S; Acharya, Chaitanya R; Yeh, Jason S; Steward, Ryan G; Eaton, Jennifer L; Goldfarb, James M; Muasher, Suheil J


    To examine the effect of body mass index (BMI) on IVF outcomes in fresh autologous cycles. Retrospective cohort study. Not applicable. A total of 239,127 fresh IVF cycles from the 2008-2010 Society for Assisted Reproductive Technology registry were stratified into cohorts based on World Health Organization BMI guidelines. Cycles reporting normal BMI (18.5-24.9 kg/m(2)) were used as the reference group (REF). Subanalyses were performed on cycles reporting purely polycystic ovary syndrome (PCOS)-related infertility and those with purely male-factor infertility (34,137 and 89,354 cycles, respectively). None. Implantation rate, clinical pregnancy rate, pregnancy loss rate, and live birth rate. Success rates and adjusted odds ratios (ORs) with 95% confidence intervals (CIs) for all pregnancy outcomes were most favorable in cohorts with low and normal BMIs and progressively worsened as BMI increased. Obesity also had a negative impact on IVF outcomes in cycles performed for PCOS and male-factor infertility, although it did not always reach statistical significance. Success rates in fresh autologous cycles, including those done for specifically PCOS or male-factor infertility, are highest in those with low and normal BMIs. Furthermore, there is a progressive and statistically significant worsening of outcomes in groups with higher BMIs. More research is needed to determine the causes and extent of the influence of BMI on IVF success rates in other patient populations. Copyright © 2016 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  9. 7 CFR 58.239 - Drying. (United States)



  10. Publications | Page 239 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Establishing a recovery orientation in first line mental health teams in Québec : perspectives from social workers and managers (restricted access). Certain aspects of work organization, such as flexibility, autonomy, reflexivity, training, and interdisciplinarity can foster a practice that is recovery-oriented. Results of the study ...

  11. Plutonium 238/239 Decorporation Model (United States)


    for acute effects and Pu is immobilized in bone RBM exposure to radionuclides may cause acute affects, such as the hematopoietic radiation syndrome ...the external dose contribution would be targeted toward acute radiation syndrome rather than decorporation. As stated previously, this particular...from the portion of the Pu absorbed, particularly from Pu immobilized in the bone compartment. Therefore, the biokinetic model is required for

  12. 49 CFR 239.3 - Application. (United States)


    ...) Rapid transit operations in an urban area that are not connected with the general railroad system of transportation; (2) Operation of private cars, including business/office cars and circus trains; or (3) Tourist...

  13. 32 CFR 239.6 - Eligibility. (United States)


    ... Schedule for Ratings Disabilities) for wounds, injuries, or illness incurred in the line of duty while... residence for sale due to the wound, injury or illness. (For example, the need to be closer to a hospital or..., but including employees of non-appropriated fund instrumentalities): (A) Who suffer a wound, injury...

  14. 32 CFR 239.1 - Purpose. (United States)


    ... Permanent Change of Station (PCS) moves during the mortgage crisis. This authority is referred to as “Expanded HAP.” (b) Establishes policy, authority, and responsibilities for managing Expanded HAP and...

  15. 32 CFR 239.4 - Definitions. (United States)


    ... full outstanding mortgage balance. (c) Deployment. Performing service in a training exercise or... off-duty time in the housing in which the member resides when on garrison or installation duty at the...-family dwelling from which employees or members regularly commute (or commuted) to their primary place of...

  16. 48 CFR 239.7402 - Policy. (United States)


    ... DEFENSE SPECIAL CATEGORIES OF CONTRACTING ACQUISITION OF INFORMATION TECHNOLOGY Telecommunications... decisions of the Federal Communications Commission (FCC) and other governmental regulatory bodies on rates... not expressed itself; (B) The governmental regulatory body has declined jurisdiction; or (C) There is...

  17. TMFunction data: 239 [TMFunction[Archive

    Lifescience Database Archive (English)

    Full Text Available HC. J Biol Chem. 2000 Jul 14;275(28):21017-24 mutagenesis ... affinity chromatography 1AJJ ... LDLR_HUMAN (P01130) Helix ... ligand binding site; surface exposed; acidic residue; conserved

  18. 48 CFR 239.7103 - Contract clauses. (United States)


    ... OF DEFENSE SPECIAL CATEGORIES OF CONTRACTING ACQUISITION OF INFORMATION TECHNOLOGY Security and... performance of information assurance functions as described in DoD 8570.01-M. ... Against Compromising Emanations, in solicitations and contracts involving information technology that...

  19. Publications | Page 239 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    No longer. Enter Severe Acute Respiratory Syndrome (SARS), which has affected both... IDRC's fight against malaria. 2004-04-22. BACKGROUNDER. In Africa, malaria kills an African child every 30 seconds. Together with HIV/AIDS and TB, malaria is one of the major public health challenges undermining development.

  20. 7 CFR 23.9 - General. (United States)


    ... “Title V” authorizes funds to finance work authorized under title V which serve two or more States; in... Assistant Secretary for Conservation, Research and Education will implement title V plans and activities in...

  1. Sequential metabolism of AMG 487, a novel CXCR3 antagonist, results in formation of quinone reactive metabolites that covalently modify CYP3A4 Cys239 and cause time-dependent inhibition of the enzyme. (United States)

    Henne, Kirk R; Tran, Thuy B; VandenBrink, Brooke M; Rock, Dan A; Aidasani, Divesh K; Subramanian, Raju; Mason, Andrew K; Stresser, David M; Teffera, Yohannes; Wong, Simon G; Johnson, Michael G; Chen, Xiaoqi; Tonn, George R; Wong, Bradley K


    CYP3A4-mediated biotransformation of (R)-N-(1-(3-(4-ethoxyphenyl)-4-oxo-3,4-dihydropyrido[2,3-d]pyrimidin-2-yl)ethyl)-N-(pyridin-3-ylmethyl)-2-(4-(trifluoromethoxy)phenyl)acetamide (AMG 487) was previously shown to generate an inhibitory metabolite linked to dose- and time-dependent pharmacokinetics in humans. Although in vitro activity loss assays failed to demonstrate CYP3A4 time-dependent inhibition (TDI) with AMG 487, its M2 phenol metabolite readily produced TDI when remaining activity was assessed using either midazolam or testosterone (K(I) = 0.73-0.74 μM, k(inact) = 0.088-0.099 min(-1)). TDI investigations using an IC(50) shift method successfully produced inhibition attributable to AMG 487, but only when preincubations were extended from 30 to 90 min. The shift magnitude was ∼3× for midazolam activity, but no shift was observed for testosterone activity. Subsequent partition ratio determinations conducted for M2 using recombinant CYP3A4 showed that inactivation was a relatively inefficient process (r = 36). CYP3A4-mediated biotransformation of [(3)H]M2 in the presence of GSH led to identification of two new metabolites, M4 and M5, which shifted focus away from M2 being directly responsible for TDI. M4 (hydroxylated M2) was further metabolized to form reactive intermediates that, upon reaction with GSH, produced isomeric adducts, collectively designated M5. Incubations conducted in the presence of [(18)O]H(2)O confirmed incorporation of oxygen from O(2) for the majority of M4 and M5 formed (>75%). Further evidence of a primary role for M4 in CYP3A4 TDI was generated by protein labeling and proteolysis experiments, in which M4 was found to be covalently bound to Cys239 of CYP3A4. These investigations confirmed a primarily role for M4 in CYP3A4 inactivation, suggesting that a more complex metabolic pathway was responsible for generation of inhibitory metabolites affecting AMG 487 human pharmacokinetics.

  2. Antifungal Activities of Posaconazole, Ravuconazole, and Voriconazole Compared to Those of Itraconazole and Amphotericin B against 239 Clinical Isolates of Aspergillus spp. and Other Filamentous Fungi: Report from SENTRY Antimicrobial Surveillance Program, 2000 (United States)

    Pfaller, M. A.; Messer, S. A.; Hollis, R. J.; Jones, R. N.


    Posaconazole, ravuconazole, and voriconazole are new triazole derivatives that possess potent, broad-spectrum antifungal activity. We evaluated the in vitro activity of these investigational triazoles compared with that of itraconazole and amphotericin B against 239 clinical isolates of filamentous fungi from the SENTRY Program, including Aspergillus spp. (198 isolates), Fusarium spp. (7 isolates), Penicillium spp. (19 isolates), Rhizopus spp. (4 isolates), Mucor spp. (2 isolates), and miscellaneous species (9 isolates). The isolates were obtained from 16 different medical centers in the United States and Canada between January and December 2000. In vitro susceptibility testing was performed using the microdilution broth method outlined in the National Committee for Clinical Laboratory Standards M38-P document. Overall, posaconazole was the most active compound, inhibiting 94% of isolates at a MIC of ≤1 μg/ml, followed by voriconazole (91%), amphotericin B (89%), ravuconazole (88%), and itraconazole (70%). All three new triazoles demonstrated excellent activity (MIC, ≤1 μg/ml) against Aspergillus spp. (114 Aspergillus fumigatus, 22 Aspergillus niger, 13 Aspergillus flavus, 9 Aspergillus versicolor, 8 Aspergillus terreus, and 32 Aspergillus spp.): posaconazole (98%), voriconazole (98%), ravuconazole (92%), amphotericin B (89%), and itraconazole (72%). None of the triazoles were active against Fusarium spp. (MIC at which 50% of the isolates tested were inhibited [MIC50], >8 μg/ml) or Mucor spp. (MIC50, >8 μg/ml). Posaconazole and ravuconazole were more active than voriconazole against Rhizopus spp. (MIC50, 1 to 2 μg/ml versus >8 μg/ml, respectively). Based on these results, all three new triazoles exhibited promising activity against Aspergillus spp. and other less commonly encountered isolates of filamentous fungi. The clinical value of these in vitro data remains to be seen, and in vitro-in vivo correlation is needed for both new and established

  3. Neutron Protection Factor Determination and Validation for a Vehicle Surrogate Using a Californium Fission Source (United States)


    a 4 mm x 4 mm (0.157" x 0.157") LiI(Eu) crystal with 96% enrichment of lithium -6. The crystal is connected to a photomultiplier tube (PMT) which...32 Figure 17. Lithium -6 Iodide, Europium Doped Scintillation Detector. Source: [27...Alamos National Laboratory LiI(Eu) Lithium Iodide Europium Doped LLD Low Level Discriminator LLNL Lawrence Livermore National Laboratory MASH Monte

  4. Simultaneous measurement of {sup 239}Pu, {sup 240}Pu, {sup 241}Pu, and {sup 242}Pu by high resolution inductively coupled plasma mass spectrometer (HR ICP-MS) in marine sediments; Mesure des isotopes du plutonium des sediments marins par spectrometrie de masse a plasma couple inductivement haute resolution (HR ICP-MS)

    Energy Technology Data Exchange (ETDEWEB)

    Bruneau, F


    Transuranics elements are of particular interest in radioecological studies because of their radiotoxicity and their potential use to decipher source fingerprints and transport processes. The simultaneous measurement of {sup 239}Pu, {sup 240}Pu, {sup 241}Pu, and {sup 242}Pu in environmental samples requires a specific chemical procedure. This work deals with an analytical procedure which yields a very high grade of purification of Pu suitable for ultra low level detection by HR ICP-MS, from marine sediments. After the elimination of major elements (Fe, Al, Mg...) by a first chromatographic separation, a new device of purification by solvent extraction and concentration by a second chromatographic separation is used to obtain a concentrated and high purified solution of plutonium. The chemical procedure have been validated on IAEA certified sediment samples and on sediment samples collected in the roads of Cherbourg which had been previously analysed by other techniques (a spectrometry and thermo-ionisation mass spectrometer). (author)

  5. Modification of a loop sequence between α-helices 6 and 7 of virus capsid (CA protein in a human immunodeficiency virus type 1 (HIV-1 derivative that has simian immunodeficiency virus (SIVmac239 vif and CA α-helices 4 and 5 loop improves replication in cynomolgus monkey cells

    Directory of Open Access Journals (Sweden)

    Adachi Akio


    Full Text Available Abstract Background Human immunodeficiency virus type 1 (HIV-1 productively infects only humans and chimpanzees but not cynomolgus or rhesus monkeys while simian immunodeficiency virus isolated from macaque (SIVmac readily establishes infection in those monkeys. Several HIV-1 and SIVmac chimeric viruses have been constructed in order to develop an animal model for HIV-1 infection. Construction of an HIV-1 derivative which contains sequences of a SIVmac239 loop between α-helices 4 and 5 (L4/5 of capsid protein (CA and the entire SIVmac239 vif gene was previously reported. Although this chimeric virus could grow in cynomolgus monkey cells, it did so much more slowly than did SIVmac. It was also reported that intrinsic TRIM5α restricts the post-entry step of HIV-1 replication in rhesus and cynomolgus monkey cells, and we previously demonstrated that a single amino acid in a loop between α-helices 6 and 7 (L6/7 of HIV type 2 (HIV-2 CA determines the susceptibility of HIV-2 to cynomolgus monkey TRIM5α. Results In the study presented here, we replaced L6/7 of HIV-1 CA in addition to L4/5 and vif with the corresponding segments of SIVmac. The resultant HIV-1 derivatives showed enhanced replication capability in established T cell lines as well as in CD8+ cell-depleted primary peripheral blood mononuclear cells from cynomolgus monkey. Compared with the wild type HIV-1 particles, the viral particles produced from a chimeric HIV-1 genome with those two SIVmac loops were less able to saturate the intrinsic restriction in rhesus monkey cells. Conclusion We have succeeded in making the replication of simian-tropic HIV-1 in cynomolgus monkey cells more efficient by introducing into HIV-1 the L6/7 CA loop from SIVmac. It would be of interest to determine whether HIV-1 derivatives with SIVmac CA L4/5 and L6/7 can establish infection of cynomolgus monkeys in vivo.

  6. Dicty_cDB: CHL239 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available sq27g07.y1 Gm-c1046 Glycine max cDNA clone GENOME SYSTEMS CLONE ID: Gm-c1046-2101 5' similar to WP:D1005...sad75f02.y1 Gm-c1051 Glycine max cDNA clone GENOME SYSTEMS CLONE ID: Gm-c1051-6028 5' similar to TR:Q9XFY7...sc93f08.y1 Gm-c1019 Glycine max cDNA clone GENOME SYSTEMS CLONE ID: Gm-c1019-928 5' similar to WP:D1005.1

  7. Dicty_cDB: VSE239 [Dicty_cDB

    Lifescience Database Archive (English)


  8. 239 Needed Reforms and Innovations in Motherhood/Gender ...

    African Journals Online (AJOL)



    Jan 18, 2011 ... called mothers who raise children full-time an “endangered species” ... meeting traditional family responsibilities while also taking on the demands of a job to help ..... (Unpublished monograph, Delta State University, Abraka).

  9. 239 Inter-Agency Cooperation in Combating Terrorism in Nigeria ...

    African Journals Online (AJOL)


    Abstract. In recent times, terrorism has become one of the most dangerous threats to peace and order nationally and globally. It is so pervasive that no country on earth can claim immunity from its violent acts of bombing, shooting, armed robbery, kidnapping, hostage-taking and bank robbery. This paper examines this global ...

  10. Dicty_cDB: CHD239 [Dicty_cDB

    Lifescience Database Archive (English)


  11. Dicty_cDB: VFD239 [Dicty_cDB

    Lifescience Database Archive (English)


  12. Dicty_cDB: SHD239 [Dicty_cDB

    Lifescience Database Archive (English)


  13. Dicty_cDB: CHI239 [Dicty_cDB

    Lifescience Database Archive (English)


  14. 239 Needed Reforms and Innovations in Motherhood/Gender ...

    African Journals Online (AJOL)



    Jan 18, 2011 ... reforms/innovations in motherhood/gender education in enhancing attainment of the Millennium Development ..... Bangladesh, Pakistan, Brazil, and Mexico) with the largest population of the world's illiterates. Nigeria, for example .... Haynes, B.R. & Jackson, J.P. (1997). A History of Business Education in.

  15. 49 CFR 239.101 - Emergency preparedness plan. (United States)


    ... training at least once every two calendar years thereafter, on appropriate courses of action for each... emergency preparedness plan. The types of testing selected by the railroad shall be: (A) Designed to... being tested to open reference books or other materials, except to the degree the person is being tested...

  16. Dicty_cDB: CHS239 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available neering clone MHPN192d01. 42 9.9 1 AZ781723 |AZ781723.1 2M0021H18F Mouse 10kb plasm...end partial sequence. 42 9.9 1 CR029411 |CR029411.1 Forward strand read from insert in 5'HPRT insertion targeting and chromosome engi

  17. 48 CFR 1552.239-70 - Rehabilitation act notice. (United States)


    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Rehabilitation act notice... Rehabilitation act notice. As prescribed in 1523.7003(a), insert the following clause. Rehabilitation Act Notice (OCT 2000) (a) EPA has a legal obligation under the Rehabilitation Act of 1973, 29 U.S.C. 791, to...

  18. Dicty_cDB: AFI239 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ' end,single read. 599 e-167 1 CN206669 |CN206669.1 Tor7097 Gametophyte rehydration Library Tortula ruralis ...7908 O17908 H06O01.1 PROTEIN. [1] ;, mRNA sequence. 70 4e-08 1 CN206834 |CN206834.1 Tor7258 Game

  19. 239 Inter-Agency Cooperation in Combating Terrorism in Nigeria ...

    African Journals Online (AJOL)


    according to International Terrorism and Security Research (ITRS 2010). The first perspective is that of the ... binding, criminal law definition currently exists, terrorism can therefore be defined as those violent acts which .... should be organized into a single directorate headed by a director- general who will be responsible ...

  20. Dicty_cDB: SSL239 [Dicty_cDB

    Lifescience Database Archive (English)


  1. 48 CFR 1352.239-70 - Software license addendum. (United States)


    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Software license addendum... Software license addendum. As prescribed in 48 CFR 1339.107, insert the following clause: Software License...-125, Prompt Payment. (g) Patent and Copyright Infringement: Patent or copyright infringement suits...

  2. MD 239 on Collide and Squeeze (part 2)

    CERN Document Server

    Gorzawski, Arkadiusz; Salvachua Ferrando, Belen Maria; Wenninger, Jorg; CERN. Geneva. ATS Department


    Colliding the beams during the squeeze to profit from Landau damping due to head--on beam-beam and beta--star leveling are two operational modes that may have to be used in a not so distant future at the LHC. This MD aimed at improving the orbit control during the squeeze with much improved handling of orbit feedback references and at evaluating instruments and techniques to maintain the beam in collisions with active feedback on luminosity or beam position. This MD also integrated for the first time synchronized collimator measurements. Comparison of the settings with the previous MD allowed a validation of the long term stability of collide and squeeze.

  3. Dicty_cDB: VSG239 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available OWAsporoLib2 Cryptosporidium parvum cDNA 5' similar to 40S ribosomal protein S17A, mRNA sequence. 44 0.003 2 CD477300 |CD47...7300.1 eca01-12ms1-h08 Eca01 Eschscholzia californica cDNA clone eca01-12ms1-h08 5', mRNA sequence. 42 0.011 2 CD47...6897 |CD476897.1 eca01-7ms1-c05 Eca01 Eschscholzia californ...haliana cDNA clone 180B22T7, mRNA sequence. 36 0.013 3 CD477145 |CD477145.1 eca01-14ms1-h01 Eca01 Eschscholz

  4. Dicty_cDB: CFH239 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available GWDILASF--- ---AQQGXQAWKXGVNXIGDXIAXXAHXVGDGXXXTAR*vgxgixipakegyxlxkxgax xtwvxky*rlsxixixkaxqxmaxqxxxxrfmqxxsxxxrlqxnxx...XIAXXAHXVGDGXXXTAR*vgxgixipakegyxlxkxgax xtwvxky*rlsxixixkaxqxmaxqxxxxrfmqxxsxxxrlqxnxxxxxpixt Frame B: lnny

  5. 239-IJBCS-Article-Dr O. I. Oyewole

    African Journals Online (AJOL)

    Dr Gatsing

    antisickling agents. O. I. OYEWOLE 1 *, S. O. MALOMO 2 and R. O. ARISE 2. 1 Department of Biochemistry, Bowen University I W O, Nigeria. 2 Department of Biochemistry, ... negative effects of the drugs on blood parameters which is useful in considering their suitability for the ... from the Animal House, Department of.

  6. 48 CFR 352.239-70 - Standard for security configurations. (United States)


    ... configure its computers that contain HHS data with the applicable Federal Desktop Core Configuration (FDCC) (see and ensure that its computers have and maintain the latest operating system patch level and anti-virus software level. Note: FDCC is applicable to all computing...

  7. All projects related to | Page 239 | IDRC - International Development ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Topic: INFORMATION TECHNOLOGY, GENDER EQUALITY, WOMEN'S RIGHTS, BRAZIL, SOUTH AFRICA, INDIA, Democracy. Region: Brazil, South America, India, South Africa, North of Sahara, South of Sahara, North and Central America, Central Asia, Far East Asia, South Asia. Program: Governance and Justice.

  8. Dicty_cDB: CHO239 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available 3e-26 AF016833_1( AF016833 |pid:none) Homo sapiens maltase-glucoamylase ... 117 8e-25 AB057452_1( AB057452...Mus musculus sucrase-isomaltase mR... 115 3e-24 ( O43451 ) RecName: Full=Maltase-glucoamylase, intestinal;

  9. Lessons learned in the accident of contamination with Pu-239; Lecciones aprendidas en el accidente de contaminacion con Pu-239

    Energy Technology Data Exchange (ETDEWEB)

    Molina, G.; Ruiz C, M.; Angeles C, A.; Benitez S, J.A. [ININ, 52045 Estado de Mexico (Mexico)]. e-mail:


    This work describes the lessons learned during the accident by transuranic contamination in the National Institute of Nuclear Research happened between 1998 and 2003. The origin of the same one is the not authorized transfer of 0.51 g of plutonium metallic used as pattern source in the Department of Metrology to a laboratory which lacked of physical infrastructure, training and team to manipulate this source. (Author)

  10. Geological and physicochemical controls of the spatial distribution of partition coefficients for radionuclides (Sr-90, Cs-137, Co-60, Pu-239,240 and Am-241) at a site of nuclear reactors and radioactive waste disposal (St. Petersburg region, Russian Federation). (United States)

    Rumynin, Vyacheslav G; Nikulenkov, Anton M


    The paper presents a study of the sorption properties of sediments of different geological ages and lithological types, governing radionuclide retention in the subsurface (up to 160 m beneath the surface) within the area of potential influence of the Northwestern Center of Atomic Energy (NWCAE), St. Petersburg region, RF. The focus of this work is mostly on the sedimentary rocks of two types, i.e., weakly cemented sandstone and lithified clay formations of Cambrian and Vendian series. The first lithological unit is associated with a groundwater reservoir (Lomonosov aquifer), and the second one, with both a relative aquitard in the upper part of the Vendian formation (Kotlin clay) and a regional aquifer (Gdov aquifer) in the lower part of the formation. The main mechanisms responsible for the variability of the sorption distribution coefficient (Kd, defined as the ratio of the concentration of solute on solid phase to its concentration in solution at equilibrium) was identified for radionuclides such as Sr-90, Cs-137, Co-60, Pu-239,240, and Am-241. It was shown that the main factors contributing to the chemical heterogeneity of the Cambrian sandstone were related to the presence of secondary minerals (iron and magnesium oxides and hydroxides produced by the weathering process) in trace amounts, forming correlated layer structures. The statistical analysis of nonlinear isotherms confirmed this conclusion. For the Vendian formation, a determinate trend was established in the Kd change over depth as a result of temporal trends in the sedimentation process and pore-water chemistry. The geostatistical characteristics and the spatial correlation models for describing linear sorption of different radionuclides are not identical, and the exhibition of chemical heterogeneity of sedimentary rock of a particular lithological type depends on radionuclide chemistry. Moreover, variogram analysis for some Kd data sets (both in Cambrian and Vendian formations) demonstrates the

  11. A retrospective study of californium-252 neutron brachytherapy combined with EBRT versus 3D-CRT in the treatment of esophageal squamous cell cancer. (United States)

    Wang, Qifeng; Li, Tao; Lang, Jinyi; Wang, Jie; Wang, Jian; Liu, Huiming; Jia, Xitang; Liu, Bo; Wang, C-K Chris


    We conducted a retrospective analysis on 884 patients who were diagnosed with esophageal squamous cell carcinoma (ESCC) and treated with either the neutron brachytherapy in combination with external beam radiotherapy (NBT + EBRT) or 3-dimensional conformal radiation therapy (3D-CRT) to determine the differences in efficacy and morbidity between the two treatment groups. The 884 ESCC patients treated with either NBT + EBRT or 3D-CRT between 2002 and 2012 were retrospectively reviewed and analyzed. Multivariable Cox regression was used to compare oncologic outcomes of the two groups of patients in the context of other clinically relevant variables. The acute and chronic toxicities associated with the two groups were compared using Fisher exact and log-rank tests, respectively. Among the 884 patients, 545 received NBT + EBRT and 339 received 3D-CRT (i.e. EBRT-only). The age range is 39-95 years (median 66). The follow-up time range is 3-145 months (median 32). The analysis shows that the NBT + EBRT group has higher overall survival rate and local control rate than that of the 3D-CRT group. The acute toxicity effects were acceptable for both groups of patients with the NBT + EBRT group showing higher rates of leukopenia and thrombocytopenia and the 3D-CRT group showing higher rates on fistula and massive bleeding. The patients treated with NBT + EBRT showed better oncologic outcomes than those treated with 3D-CRT. The toxicity effects were acceptable for both groups with the NBT + EBRT group showing higher rates on the acute effects and the 3D-CRT group showing higher rates on the late effects.

  12. Accurate determination of Curium and Californium isotopic ratios by inductively coupled plasma quadrupole mass spectrometry (ICP-QMS) in 248Cm samples for transmutation studies

    Energy Technology Data Exchange (ETDEWEB)

    Gourgiotis, A.; Isnard, H.; Aubert, M.; Dupont, E.; AlMahamid, I.; Cassette, P.; Panebianco, S.; Letourneau, A.; Chartier, F.; Tian, G.; Rao, L.; Lukens, W.


    The French Atomic Energy Commission has carried out several experiments including the mini-INCA (INcineration of Actinides) project for the study of minor-actinide transmutation processes in high intensity thermal neutron fluxes, in view of proposing solutions to reduce the radiotoxicity of long-lived nuclear wastes. In this context, a Cm sample enriched in {sup 248}Cm ({approx}97 %) was irradiated in thermal neutron flux at the High Flux Reactor (HFR) of the Laue-Langevin Institute (ILL). This work describes a quadrupole ICP-MS (ICP-QMS) analytical procedure for precise and accurate isotopic composition determination of Cm before sample irradiation and of Cm and Cf after sample irradiation. The factors that affect the accuracy and reproducibility of isotopic ratio measurements by ICP-QMS, such as peak centre correction, detector dead time, mass bias, abundance sensitivity and hydrides formation, instrumental background, and memory blank were carefully evaluated and corrected. Uncertainties of the isotopic ratios, taking into account internal precision of isotope ratio measurements, peak tailing, and hydrides formations ranged from 0.3% to 1.3%. This uncertainties range is quite acceptable for the nuclear data to be used in transmutation studies.

  13. Radiological Characterization Technical Report on Californium-252 Sealed Source Transuranic Debris Waste for the Off-Site Source Recovery Project at Los Alamos National Laboratory

    Energy Technology Data Exchange (ETDEWEB)

    Feldman, Alexander [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)


    This document describes the development and approach for the radiological characterization of Cf-252 sealed sources for shipment to the Waste Isolation Pilot Plant. The report combines information on the nuclear material content of each individual source (mass or activity and date of manufacture) with information and data on the radionuclide distributions within the originating nuclear material. This approach allows for complete and accurate characterization of the waste container without the need to take additional measurements. The radionuclide uncertainties, developed from acceptable knowledge (AK) information regarding the source material, are applied to the summed activities in the drum. The AK information used in the characterization of Cf-252 sealed sources has been qualified by the peer review process, which has been reviewed and accepted by the Environmental Protection Agency.

  14. 48 CFR 252.239-7007 - Cancellation or termination of orders. (United States)


    ... Cancellation or Termination Liability established by the CSA or other contractual document is based on... payments if in the opinion of the Contracting Officer the total of the payments is within the amount the...) Failure to agree shall be a dispute concerning a question of fact within the meaning of the Disputes...

  15. Transmutation of 129 I, 237 Np, 238 Pu, 239 Pu, and 241 Am using ...

    Indian Academy of Sciences (India)

    Target-blanket facility `Energy + Transmutation' was irradiated by proton beam extracted from the Nuclotron Accelerator in Laboratory of High Energies of Joint Institute for Nuclear Research in Dubna, Russia. Neutrons generated by the spallation reactions of 0.7, 1.0, 1.5 and 2 GeV protons and lead target interact with ...

  16. Prakash et al., Afr J Tradit Complement Altern Med. (2014) 11(3):239 ...

    African Journals Online (AJOL)


    Chinese medicine, the leaves of pigeonpea have been widely used to arrest blood pressure, relieve pain and kill worms (Tang et al., 1990). It .... Flowers. Crushed flowers applied to snake bites. 10. Pang gong. Tree. Flame of the forest. Butea monosperma. Leguminasae. Bark, leaves. Leaves are tonic, bark used in snake ...

  17. Yeast Interacting Proteins Database: YBR239C, YPL133C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available cytoplasm and nucleus; null mutation affects periodicity of transcriptional and metabolic oscillation; play...ion; GFP-fusion protein localizes to the cytoplasm and nucleus; null mutation affects

  18. SOGC Clinical Practice Guidelines: Obesity in pregnancy. No. 239, February 2010. (United States)

    Davies, Gregory A L; Maxwell, Cynthia; McLeod, Lynne; Gagnon, Robert; Basso, Melanie; Bos, Hayley; Delisle, Marie-France; Farine, Dan; Hudon, Lynda; Menticoglou, Savas; Mundle, William; Murphy-Kaulbeck, Lynn; Ouellet, Annie; Pressey, Tracy; Roggensack, Anne; Leduc, Dean; Ballerman, Charlotte; Biringer, Anne; Duperron, Louise; Jones, Donna; Lee, Lily Shek-Yun; Shepherd, Debra; Wilson, Kathleen


    To review the evidence and provide recommendations for the counselling and management of obese parturients. OUTCOMES evaluated include the impact of maternal obesity on the provision of antenatal and intrapartum care, maternal morbidity and mortality, and perinatal morbidity and mortality. Literature was retrieved through searches of Statistics Canada, Medline, and The Cochrane Library on the impact of obesity in pregnancy on antepartum and intrapartum care, maternal morbidity and mortality, obstetrical anaesthesia, and perinatal morbidity and mortality. Results were restricted to systematic reviews, randomized controlled trials/controlled clinical trials, and observational studies. There were no date or language restrictions. Searches were updated on a regular basis and incorporated in the guideline to April 2009. Grey (unpublished) literature was identified through searching the websites of health technology assessment and health technology assessment-related agencies, clinical practice guideline collections, clinical trial registries, and national and international medical specialty societies. The evidence obtained was reviewed and evaluated by the Maternal Fetal Medicine and Clinical Practice Obstetric Committees of the SOGC under the leadership of the principal authors, and recommendations were made according to guidelines developed by the Canadian Task Force on Preventive Health Care. Implementation of the recommendations in this guideline should increase recognition of the issues clinicians need to be aware of when managing obese women in pregnancy, improve communication and consultation amongst the obstetrical care team, and encourage federal and provincial agencies to educate Canadians about the values of entering pregnancy with as healthy a weight as possible.

  19. Determination of 238Pu, 239+240Pu and 241Am in air filters


    Rzemek, Katarzyna; Czerwi?ski, Andrzej; O?ko, Jakub; Tymi?ska, Katarzyna; Dymecka, Ma?gorzata; Pliszczy?ski, Tomasz


    The aim of this work is to present the method for sequential plutonium and americium activity determination in air filters using chromatographic radionuclide separation and alpha spectrometry measurement. The developed method may be employed for the purposes of workplace monitoring and as an indicator of the need of introducing the individual monitoring as well as a useful complementation of individual monitoring. Basic parameters describing the developed method such as values of chemical rec...

  20. Yeast Interacting Proteins Database: YDL239C, YGR268C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available ith sequence similarity to that of Type I J-proteins; computational analysis of large-scale protein-protein ...equence similarity to that of Type I J-proteins; computational analysis of large-scale protein-protein inter

  1. Transmutation of 129I, 237Np, 238Pu, 239Pu, and 241Am using ...

    Indian Academy of Sciences (India)

    1Joint Institute for Nuclear Research, Dubna near Moscow, 141 980 Russian Federation. 2Czech Academy of ... tween each two sections are slits into which experimental instruments and detectors are inserted. The side from where ... Simplified design of the 'Energy + Transmutation' assembly inside its shielding as used in ...

  2. Event-by-event study of prompt neutrons from 239Pu(n,f)

    Energy Technology Data Exchange (ETDEWEB)

    Vogt, R; Randrup, J; Pruet, J; Younes, W


    Employing a recently developed Monte-Carlo model, we study the fission of {sup 240}Pu induced by neutrons with energies from thermal to just below the threshold for second chance fission. Current measurements of the mean number of prompt neutrons emitted in fission, together with less accurate measurements of the neutron energy spectra, place remarkably fine constraints on predictions of microscopic calculations. In particular, the total excitation energy of the nascent fragments must be specified to within 1MeV to avoid disagreement with measurements of the mean neutron multiplicity. The combination of the Monte-Carlo fission model with a statistical likelihood analysis also presents a powerful tool for the evaluation of fission neutron data. Of particular importance is the fission spectrum, which plays a key role in determining reactor criticality. We show that our approach can be used to develop an estimate of the fission spectrum with uncertainties several times smaller than current experimental uncertainties for outgoing neutron energies of less than 2 MeV.

  3. Event-by-Event Study of Prompt Neutrons from 239Pu

    Energy Technology Data Exchange (ETDEWEB)

    Vogt, R; Randrup, J; Pruet, J; Younes, W


    Employing a recently developed Monte Carlo model, we study the fission of {sup 240}Pu induced by neutrons with energies from thermal to just below the threshold for second chance fission. Current measurements of the mean number of prompt neutrons emitted in fission, together with less accurate measurements of the neutron energy spectra, place remarkably fine constraints on predictions of microscopic calculations. In particular, the total excitation energy of the nascent fragments must be specified to within 1 MeV to avoid disagreement with measurements of the mean neutron multiplicity. The combination of the Monte Carlo fission model with a statistical likelihood analysis also presents a powerful tool for the evaluation of fission neutron data. Of particular importance is the fission spectrum, which plays a key role in determining reactor criticality. We show that our approach can be used to develop an estimate of the fission spectrum with uncertainties several times smaller than current experimental uncertainties for outgoing neutron energies of less than 2 MeV.

  4. 48 CFR 1252.239-70 - Security requirements for unclassified information technology resources. (United States)


    ..., storage, manipulation, management, movement, control, display, switching, interchange, transmission, or... law enforcement and authorized Department officials. Use of this system constitutes consent to such...

  5. : tous les projets | Page 239 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    analyse et de dialogue menées par des organismes de la société civile du Canada en vue d'accroître leur efficacité. Date de début : 1 janvier 2012. End Date: 1 janvier 2014. Sujet: SUSTAINABLE DEVELOPMENT, Poverty alleviation, Capacity ...

  6. Yeast Interacting Proteins Database: YDL239C, YPL070W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available it as prey (1) YPL070W MUK1 Cytoplasmic protein of unknown function containing a Vps9 domain; computationa...ey description Cytoplasmic protein of unknown function containing a Vps9 domain; computational analysis of l

  7. 16 CFR 239.4 - “Lifetime” and similar representations. (United States)


    ... A: (In an advertisement mentioning a lifetime guarantee on an automobile muffler where the duration... on the Whisper Muffler protects you for as long as your car runs—even if you sell it, trade it, or...

  8. Yeast Interacting Proteins Database: YGR239C, YDR142C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available PEX21 Peroxin required for targeting of peroxisomal matrix proteins containing PTS2; interacts with Pex7p;...N-terminal nonapeptide signal (PTS2) of peroxisomal matrix proteins; WD repeat protein; defects in human homolog...description Peroxin required for targeting of peroxisomal matrix proteins containing PTS2; interacts with Pex7p;...N-terminal nonapeptide signal (PTS2) of peroxisomal matrix proteins; WD repeat protein; defects in human homolog

  9. Page 1 Aaman Effect in Relation to Crystal Structure 239 The ...

    Indian Academy of Sciences (India)

    handed one, m, m, and ma are respectively the masses of the calcium, carbon and oxygen atoms. Corresponding to the 10 atoms (30 degrees of freedom) in the tunit cell we get 9 single modes, 9 doubly degenerate modes and 1 single translation and one doubly degenerate translation. Of these, 4 single and. 4 degenerate ...

  10. Matrix effects corrections in DDT assay of {sup 239}Pu with the CTEN instrument

    Energy Technology Data Exchange (ETDEWEB)

    Hollas, C.L.; Arnone, G.; Brunson, G.; Coop, K. [Los Alamos National Lab., NM (United States)


    The accuracy of transuranic (TRU) waste assay using the differential die-away technique depends upon significant corrections to compensate for the effects of the matrix material in which the TRU waste is located. We have used a new instrument, the combined thermal/epithermal neutron (CTEN) instrument for the assay of TRU waste, to develop methods to improve the accuracy of these corrections. Neutrons from a pulsed 14-MeV neutron generator are moderated in the walls of the CTEN cavity and induce fission in the TRU material. The prompt neutrons from these fission events are detected in cadmium-wrapped {sup 3}He neutron detectors. We have developed methods of data acquisition and analysis to extract correlation in the neutron signals resulting from fission during active interrogation. This correlation information, in conjunction with the total number of neutrons detected, is used to determine the fraction of fission neutrons transmitted through the matrix material into the {sup 3}He detectors. This determination allows us to cleanly separate the matrix effects into two processes: matrix modification upon the neutron interrogating flux and matrix modification upon the fraction of fission neutrons transmitted to the neutron detectors. Recent results indicate that for some matrix systems, corrections for position dependent effects within the matrix are possible. 7 refs., 7 figs., 1 tab.

  11. Yeast Interacting Proteins Database: YDL239C, YKL103C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available that belongs to the peptidase family M18; often used as a marker protein in studies of autophagy and cytosol...ily M18; often used as a marker protein in studies of autophagy and cytosol to vacuole targeting (CVT) pathw

  12. 48 CFR 2452.239-70 - Background investigations for sensitive automated systems/applications. (United States)


    ... resource. All contractor employees working on this contract in positions which HUD has determined to have... shall notify the contractor of those contractor employee positions requiring background investigations. For each contractor employee in such a position, the contractor shall submit the following completed...

  13. Yeast Interacting Proteins Database: YDR176W, YDL239C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available 9C ADY3 Protein required for spore wall formation, thought to mediate assembly of...DY3 Prey description Protein required for spore wall formation, thought to mediate assembly of a Don1p-conta

  14. Page 1 Gravimetric Determination of Thorium 239 done in the pH ...

    Indian Academy of Sciences (India)

    The thorium content of the solution was determined by the 8-hydroxy-quinoline method. (b) 1-hydroxy-3-methoxy Xanthone.--It was prepared by the condensa- tion of phloroglucinol-dimethyl ether' with salicylic acid in presence of fused zinc chloride. A 2% (almost Saturated) solution of the xanthone in alcohol was used.

  15. Page 1 Bull, Mater. Sci, Vol. 11, Nos 2 & 3, November 1988, pp. 239 ...

    Indian Academy of Sciences (India)

    When two different fields like laser physics and biology begin to interact, extremely valuable and exciting new directions in research are created. McKenzie and Carruth. (1984) and Telle (1986) have given extensive accounts of lasers in medicine. The biophysical modalities used in laser treatment are separated into thermal ...

  16. Large scale production of cyclohexanone monooxygenase from Escherichia coli TOP10 pQR239. (United States)

    Doig, S D.; O'Sullivan, L M.; Patel, S; Ward, J M.; Woodley, J M.


    The cyclohexanone monooxygenase (CHMO) from Acinetobacter calcoaceticus NCIMB 9871 has been cloned into Escherichia coli in an L-arabinose inducible vector. The recombinant E. coli containing the L-arabinose inducible CHMO was grown at 1.5 litres under controlled conditions to determine the parameters for growth and induction. It was found that induction with 0.1% (w/v) L-arabinose at late logarithmic phase of growth and growth for a further 2.5 to 3 h gave the optimal CHMO titre ( approximately 3500 U.l(-1,) 630 U. g dry cell weight(-1)). High dissolved oxygen concentrations were shown to be deleterious to the CHMO titre. This influenced the strategy for growth and induction, and was optimal when the oxygen uptake rate was maximized but the dissolved oxygen concentration was zero. Finally, a 300 litre scale fermentation was carried out giving a total CHMO titre of >8 x 10(5) U.

  17. 48 CFR 1352.239-72 - Security requirements for information technology resources. (United States)


    ... information (data). Information technology services include, but are not limited to, the management, operation... comply with the requirements contained in the DOC Information Technology Management Handbook (see DOC..., including project management information (at a minimum the tasks, resources, and milestones) for the...

  18. Activity Ratios of ^<241>Pu/^<239+240>Pu and ^<238>Pu/^<239+240>Pu in Fall-out Samples Collected in the Period of 1961-1968


    松並, 忠男; 真室, 哲雄; T., MATSUNAMI; T., MAMURO; 大阪府立放射線中央研究所; Department of Health Physics and Instrumentation, Radiation Center of Osaka Prefecture


    Beta-ray emitting nuclide 241Pu, which transforms into alpha-ray emitting nuclide 241Am( α-ray energy:5.49 MeV (85%), 5.44 MeV (13%); half-life:458 y), is released in nuclear explosions together with three alpha-ray emitting plutonium isotopes, namely, 23

  19. Influence of high volumes of ultra-fine additions on self-compacting concrete[ACI SP-239

    Energy Technology Data Exchange (ETDEWEB)

    Cioffi, R. [Naples Univ., Naples (Italy). Faculty of Engineering; Colangelo, F. [Naples Univ., Naples (Italy). Dept. of Technologies; Caputo, D.; Liguori, B. [Naples Univ., Naples (Italy). Dept. of Materials and Production Engineering


    The addition of fine minerals can reduce water demand and increase the slump characteristics of concrete. This paper examined the influence of high volumes of ultra-fine fly ash, raw fly ash, silica fume and natural zeolites on the properties of self-compacting concrete (SCC). Three samples of SCC were prepared using various mineral additions to determine normal slump and J-ring slump flows of fresh concrete as well as the compressive strength and elastic modulus properties of hardened concrete. Cement and crushed limestone natural aggregates were used. The fly ash, silica fume and natural zeolites were subjected to wet high energy milling. The rotating speed, milling time, water-to-solid ratio, and size of milling media were optimized to obtain powders with varying qualities. Results of the study showed that values for the normal slump flow ranged between 604 and 785 mm, while the differences with the J-ring slump flow were less than 30 mm. The samples were then tested to evaluate the mechanical properties of the hardened concrete after 7 and 28 curing days. The modulus of elasticity and compressive strength showed improvements in the concretes containing the ultra-fine fly ash. No segregation phenomena were observed in the case of the cylindrical column specimens. It was concluded that all the specimens provided environmentally sustainable, high workability concretes which can be successfully prepared with the addition of high volumes of minerals. 17 refs., 5 tabs., 6 figs.

  20. Protein profiling in pathology: analysis and evaluation of 239 frozen tissue biopsies for diagnosis of B-cell lymphomas.

    NARCIS (Netherlands)

    Jansen, C.; Feuth, T.; Raemaekers, J.M.M.; Rijntjes, J.; Meijer, J.W.; Westenend, P.J.; Baarlen, J. van; Krieken, J.H.J.M. van; Hebeda, K.M.; Groenen, P.J.T.A.


    PURPOSE: We determined the potential value of protein profiling of tissue samples by assessing how precise this approach enables discrimination of B-cell lymphoma from reactive lymph nodes, and how well the profiles can be used for lymphoma classification. EXPERIMENTAL DESIGN: Protein lysates from

  1. SU-E-J-239: IMRT Planning of Prostate Cancer for a MRI-Linac Based On MRI Only

    Energy Technology Data Exchange (ETDEWEB)

    Chen, X; Prior, P; Paulson, E; Lawton, C; Li, X [Medical College of Wisconsin, Milwaukee, WI (United States)


    Purpose: : To investigate dosimetric differences between MRI- and CT-based IMRT planning for prostate cancer, the impact of a magnetic field in a MRI-Linac, and to explore the feasibility of IMRT planning based on MRI alone. Methods: IMRT plans were generated based on CT and MRI images acquired on two representative prostate-cancer patients using clinical dose volume constraints. A research planning system (Monaco, Elekta), which employs a Monte Carlo dose engine and includes a perpendicular magnetic field of 1.5T from an MRI-Linac, was used. Bulk electron density assignments based on organ-specific values from ICRU 46 were used to convert MRI (T2) to pseudo CT. With the same beam configuration as in the original CT plan, 5 additional plans were generated based on CT or MRI, with or without optimization (i.e., just recalculation) and with or without the magnetic field. The plan quality in terms of commonly used dose volume (DV) parameters for all plans was compared. The statistical uncertainty on dose was < 1%. Results: For plans with the same contour set but without re-optimization, the DV parameters were different from those for the original CT plan, mostly less than 5% with a few exceptions. These differences were reduced to mostly less than 3% when the plans were re-optimized. For plans with contours from MRI, the differences in the DV parameters varied depending on the difference in the contours as compared to CT. For the optimized plans with contours from MR, the differences for PTV were less than 3%. Conclusion: The prostate IMRT plans based on MRI-only for a MR-Linac were practically similar as compared to the CT plan under the same beam and optimization configuration if the difference on the structure delineation is excluded, indicating the feasibility of using MRI-only for prostate IMRT.

  2. Cell-shaped silicon-on-insulator microdosimeters: characterization and response to 239PuBe irradiations. (United States)

    Mazza, Anthony; Newhauser, Wayne; Pittman, Stephen; Halloran, Andrew; Maggi, Paul; Tran, Linh; Gila, Brent; Rosenfeld, Anatoly; Ziegler, James


    This work tested the feasibility of a silicon-on-insulator microdosimeter, which mimics the size and shape of specific cells within the human body, to determine dose equivalent from neutron irradiation. The microdosimeters were analyzed in terms of their basic diode characteristics, i.e., leakage current as a function of bias voltage. Lineal energy spectra were acquired using two different converter layers placed atop the microdosimeter: a tissue-substitute converter made from high-density polyethylene, and a boron converter consisting of epoxy coated with boron powder. The spectra were then converted into absorbed dose and dose equivalent. Experimental results were compared to Monte Carlo simulations of the neutron irradiations, revealing good agreement. Uncertainty in the dose equivalent determinations was 7.5% when using the cell-shaped microdosimeter with the tissue-substitute converter and 13.1% when using the boron converter. This work confirmed that the SOI approach to cell-mimicking microdosimetry is feasible.

  3. Radiolytic oxidation of UO{sub 2} pellets doped with alpha-emitters ({sup 238/239}Pu)

    Energy Technology Data Exchange (ETDEWEB)

    Muzeau, B. [Commissariat a l' Energie Atomique, Rhone Valley Research Center DTCD/SECM/LMPA, BP 17 171, 30207 Bagnols-sur-Ceze Cedex (France); Jegou, C. [Commissariat a l' Energie Atomique, Rhone Valley Research Center DTCD/SECM/LMPA, BP 17 171, 30207 Bagnols-sur-Ceze Cedex (France)], E-mail:; Delaunay, F. [Commissariat a l' Energie Atomique, Valduc Research Center, 21120 Is-sur-Tille (France); Broudic, V. [Commissariat a l' Energie Atomique, Rhone Valley Research Center DTCD/SECM/LMPA, BP 17 171, 30207 Bagnols-sur-Ceze Cedex (France); Brevet, A. [Commissariat a l' Energie Atomique, Valduc Research Center, 21120 Is-sur-Tille (France); Catalette, H. [Electricite de France, Les Renardieres Research Center, Route de Sens Ecuelles, 77250 Moret-sur-Loing (France); Simoni, E. [Institut de Physique Nucleaire, Bat. 100, 91406 Orsay Cedex (France); Corbel, C. [Laboratoire des Solides Irradies, UMR 7642-CNRS-CEA-Ecole Polytechnique, Ecole Polytechnique, 91128 Palaiseau Cedex (France)


    To assess the impact of alpha radiolysis of water on the oxidative dissolution of UO{sub 2} under anoxic conditions, two series of plutonium-doped samples (specific alpha activity 385 and 18 MBqg{sub UO{sub 2}}{sup -1}) were fabricated, characterized and leached in water of varying complexity (pure water, carbonated water, dissolved hydrogen). Given the very high reactivity of these samples in the presence of air and in order to minimize any prior surface oxidation, a strict experimental protocol was developed based on high-temperature annealing in Ar + 4% H{sub 2} with preleaching cycles. Failure to follow this protocol prevents absolute quantification of oxidation of the UO{sub 2} surface by water radiolysis in solutions. Preoxidation of the pellet surface can lead to uranium release in solution that is dependent on the alpha particle flux, revealing initial oxidation by radiolysis in air including potential traces of water. This makes difficult the accurate quantification of the radiolytic oxidation in water solutions. Controlling the initial surface condition of the samples finally allowed us to demonstrate that radiolytic oxidation in water-saturated media is governed by several threshold effects for which the main parameters are the sample alpha activity and the hydrogen concentration.

  4. Simulated PUREX Solvent Extraction Experiments Using {sup 238}U, {sup 239}Np and {sup 85}Sr Solution

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ju hyeong; Park, Kwangheon; Kim, Tae hoon; Park, Hyoung gyu; Kim, Jisu [Kyunghee University, Yongin (Korea, Republic of); Song, Hyuk jin [Dongguk University, Gyeongju (Korea, Republic of); Lee, Chan ki; Kang, Do kyu; Jeong, Hyeon jun [UNIST, Ulsan (Korea, Republic of)


    PUREX (plutonium uranium redox extraction) is an aqueous reprocessing method that separates U from spent nuclear fuel using a solvent extraction process. In solvent extraction process, predicting the behavior of U, MA (minor actinides) and TRU (transuranic elements) is important, because efficiency of U recovery is determined by their combined behavior. In this study, PUREX-simulated aqueous solution was prepared by varying [HNO{sub 3}] as 0.1 M, 1 M, and 5 M, to measure U extraction behavior. It is hard to determine the optimum nitric acid concentration for extraction of only uranium because the mechanism is very complicated. It can’t be calculated by mathematics, but, in this experiment, only 3 points of nitric acid concentration exist. Anyway, the optimum point is at 0.5 M of nitric acid. Therefore, estimation of the optimum point is not correct. If more accurate estimation should be needed, more experiments are needed. How to increase the separation efficiency of uranium and plutonium is very important for PUREX process. However, in real spent nuclear fuel, there are many nuclides, about 50 elements of FPs and MAs. The mechanism of solvent extraction is more complicated, as elements participated in reaction are increased. Therefore, understanding the behaviors of FPs and MAs during the solvent extraction is very important. The highest separation efficiency can be obtained and designed, when we make the appropriate modeling of the solvent extraction process in the view of engineering.

  5. Insights into the dual activity of SIVmac239 Vif against human and African green monkey APOBEC3G.

    Directory of Open Access Journals (Sweden)

    Ritu Gaur

    Full Text Available Human immunodeficiency virus type 1 (HIV-1 Vif is essential for viral evasion of the host antiviral protein APOBEC3G (APO3G. The Vif protein from a distantly related African green monkey (Agm simian immunodeficiency virus (SIVagm is unable to suppress the antiviral activity of human APO3G but is active against Agm APO3G. SIVmac Vif on the other hand, possesses antiviral activity against both human and Agm APO3G. In this study, we were interested in mapping domains in SIVmac Vif that are responsible for its dual activity against human and Agm APO3G. We constructed a series of Vif chimeras by swapping domains in SIVmac Vif with equivalent regions from SIVagm Vif and determined their activity against human and Agm APO3G. We found that replacing any region in SIVmac Vif by corresponding fragments from SIVagm Vif only moderately reduced the activity of the chimeras against Agm APO3G but in all cases resulted in a severe loss of activity against human APO3G. These results suggest that the domains in SIVmac Vif required for targeting human and Agm APO3G are distinct and cannot be defined as linear amino acid motifs but rather appear to depend on the overall structure of full-length SIVmac Vif.

  6. Comparative Plutonium-239 Dose Assessment for Three Desert Sites: Maralinga, Australia; Palomares, Spain; and the Nevada Test Site, USA - Before and After Remedial Action

    Energy Technology Data Exchange (ETDEWEB)

    Church, B W; Shinn, J; Williams, G A; Martin, L J; O' Brien, R S; Adams, S R


    As a result of nuclear weapons testing and accidents, plutonium has been distributed into the environment. The areas close to the sites of these tests and accidental dispersions contain plutonium deposition of such a magnitude that health authorities and responsible officials have mandated that the contaminated areas be protected, generally through isolation or removal of the contaminated areas. In recent years remedial actions have taken place at all these sites. For reasons not entirely clear, the public perceives radiation exposure risk to be much greater than the evidence would suggest [1]. This perception seems to be particularly true for plutonium, which has often been ''demonized'' in various publications as the ''most hazardous substance known to man'' [2]. As the position statement adapted by the Health Physics Society explains, ''Plutonium's demonization is an example of how the public has been misled about radiation's environmental and health threats generally, and in cases like plutonium, how it has developed a warped ''risk perception'' that does not reflect reality'' [3]. As a result of this risk perception and ongoing debate surrounding environmental plutonium contamination, remedial action criteria are difficult to establish. By examining the data available before and after remedial actions taken at the three sites discussed in our report, we hope to present data that will illustrate that plutonium measured as aged deposition (older than several months) does not present as high a dose or risk as many had expected. The authors show that even though dose to the lung from inhalation (the primary pathway for the high-fired plutonium oxide particles present at these sites) is reduced, such a reduction is achieved at significant cost. The cost comes from damage to the environment, large expenditures per hectare rehabilitated, and the risk to occupational workers. This paper specifically examines sites that are similar in many ways. These sites were chosen for their similarities to make comparisons. The sites are all desert in nature i.e., have low rainfall (all receive about 20 cm per year), have minimal vegetative ground cover, and have high summer temperatures. These sites are Palomares, Spain; the Nevada Test Site (NTS); and the Maralinga site in Australia. One significant difference, however, is that the Palomares site has been used continuously for residential and agriculture purposes since the plutonium remediation was completed. Maralinga is being remediated with the objective of returning the land to its former owners, but it will have some use restrictions for the remaining contaminated areas. Any decision to return the land being remediated by the United States Department of Energy (USDOE) at its Nevada sites, for public use, is in the distant future.

  7. 17 CFR 239.500 - Form D, notice of sales of securities under Regulation D and section 4(6) of the Securities Act... (United States)


    ...) An issuer's revenues or aggregate net asset value; (C) The minimum investment amount, if the change... number of non-accredited investors who have invested in the offering, as long as the change does not increase the number to more than 35; (H) The total number of investors who have invested in the offering...

  8. Erratum to: Inter-laboratory exercise with an aim to compare methods for 90Sr and 239,240Pu determination in environmental soil samples

    DEFF Research Database (Denmark)

    Qiao, Jixin; Salminen-Paatero, Susanna; Rondahl, Stina Holmgren


    In the original article, the LOD assigned to method Sr-B in Table 1 was published incorrectly as 24 Bq/kg, the correct LOD for that method should be 10.4 Bq/kg. As a consequence the range of LODs, as presented in the first sentence of the section Limit of detection should be stated as "It can...

  9. 17 CFR 239.37 - Form F-7, for registration under the Securities Act of 1933 of securities of certain Canadian... (United States)


    ... Exchange, The Toronto Stock Exchange or the Senior Board of the Vancouver Stock Exchange for the 12... United States. (e) This Form shall not be used if the registrant is an investment company registered or... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Form F-7, for registration...

  10. 17 CFR 239.41 - Form F-80, for registration under the Securities Act of 1933 of securities of certain Canadian... (United States)


    ... securities as being located in the United States. 2. With respect to any tender offer, including any exchange... United States and on NASDAQ exceeded its aggregate trading volume on securities exchanges in Canada and... securities listed on The Montreal Exchange, The Toronto Stock Exchange or the Senior Board of the Vancouver...

  11. 17 CFR 239.38 - Form F-8, for registration under the Securities Act of 1933 of securities of certain Canadian... (United States)


    ... securities as being located in the United States. 2. With respect to any tender offer, including any exchange... United States and on NASDAQ exceeded its aggregate trading volume on securities exchanges in Canada and... securities listed on The Montreal Exchange, The Toronto Stock Exchange or the Senior Board of the Vancouver...

  12. A VLT/FLAMES survey for massive binaries in Westerlund 1. III. The WC9d binary W239 and implications for massive stellar evolution

    NARCIS (Netherlands)

    Clark, J.S.; Ritchie, B. W.; Negueruela, I.; Crowther, P.A.; Damineli, A.; Jablonski, F.J.; Langer, N.|info:eu-repo/dai/nl/304829498


    Context. There is growing evidence that a treatment of binarity amongst OB stars is essential for a full theory of stellar evolution. However the binary properties of massive stars – frequency, mass ratio & orbital separation – are still poorly constrained. Aims. In order to address this shortcoming

  13. Studies of the Vertical Distribution of Cs-134, Cs-137, Pu-238, Pu-239,240, Pu-241, Am-241 and Pb-210 in ombrogenous mires in Ireland (United States)

    McGarry, A. T.; Mitchell, P. I.

    The technique of using Pb-210, a member of the naturally occurring U-238 chain, as a dating tool, has been widely used since the 1960's and has been shown to be reliable when applied to ombrotrophic peat bogs. Its application rests on two fundamental assumptions (a) that the flux of Pb-210 is constant when averaged over periods of at least a few years and (b) that Pb-210 is essentially immobile in peat over the range of natural conditions usually encountered…

  14. Changes in the Shape of Histograms Constructed from the Results of 239-Pu Alpha-Activity Measurements Correlate with the Deviations of the Moon from the Keplerian Orbit

    Directory of Open Access Journals (Sweden)

    Shapovalov S. N.


    Full Text Available We have found that the shape of the histograms, constructed on the basis of the results of radioactivity measurements, changes in correlation with the distortions of the lunar Keplerian orbit (due to the gravitational influence of the Sun. Taking into account that the phenomenon of “macroscopic fluctuations” (regular changes in the fine structure of histograms constructed from the results of measurements of natural processes does not depend on the nature of the process under study, one can consider the correlation of the histogram shape with the Moon’s deviations from the Keplerian orbit to be independent from the nature of the process the histograms were obtained on.

  15. Changes in the Shape of Histograms Constructed from the Results of 239-Pu Alpha-Activity Measurements Correlate with the Deviations of the Moon from the Keplerian Orbit

    Directory of Open Access Journals (Sweden)

    Shapovalov S. N.


    Full Text Available We have found that the shape of the histograms, constructed on the basis of the results of radioactivity measurements, changes in correlation with the distortions of the lunar Keplerian orbit (due to the gravitational influence of the Sun. Taking into account that the phenomenon of "macroscopic fluctuations" (regular changes in the fine structure of histograms constructed from the results of measurements of natural processes does not depend on the nature of the process under study, one can consider the correlation of the histogram shape with the Moon's deviations from the Keplerian orbit to be independent from the nature of the process the histograms were obtained on.

  16. Innovative AE and NDT techniques for on-site measurement of concrete and masonry structures state-of-the-art report of the RILEM technical committee 239-MCM

    CERN Document Server


    This volume, in which on-site measurements of concrete and masonry structures by NDT techniques are comprehensively summarized, focuses on the visualization procedure of the results measured. The research and its outcomes presented in this book treat applications of NDT techniques to on-site measurements. These on-site measurements have been marginally successful as each technique requires a particular analysis. In this regard, visualization and imaging of results are in great demand for practitioners and engineers for inspection. The book will therefore be of great value to the field. .

  17. Anthropometric and physical fitness characteristics of young male soccer players DOI: 10.5007/1980-0037.2010v12n4p239

    Directory of Open Access Journals (Sweden)

    Ive da Luz Canhadas


    Full Text Available The objective of this study was to determine anthropometric and physical fitness characteristics of Brazilian male children and adolescents at the beginning of soccer training. In this study, 282 male soccer players ranging in age from 10 to 13 years were evaluated. The athletes participated in a formal soccer training program 3 times per week, with each training lasting 3 hours. Anthropometric and physical fitness parameters were obtained. The boys were divided into age classes and prevalence data were analyzed using Pearson’s chi-square test. Parametric data were compared by one-way ANOVA or the Kruskal-Wallis test, when necessary. The results are expressed as the mean ± standard deviation and a p value <0.05 was considered to be significant. Growth, development, body adiposity and physical fitness characteristics were adequate and proportional to age among the boys studied (p<0.05. It was concluded that anthropometric and physical fitness characteristics of young male elite soccer players improve with and are proportional to age. Children and adolescents greatly benefit from regular physical activity. The present results show that young male soccer players present adequate anthropometric conditions and physical fitness prior to the initiation of formal training at soccer clubs.

  18. Distribution and source of 129I, 239,240Pu, 137Cs in the environment of Lithuania

    DEFF Research Database (Denmark)

    Ezerinskis, Z.; Hou, Xiaolin; Druteikiene, R.


    . No correlation of the 137Cs and Pu isotopes with 129I was observed, indicating their different sources terms. Results demonstrate uneven distribution of these radionuclides in the Lithuanian territory and several sources of contamination i.e. Chernobyl accident, reprocessing releases and global fallout....... ratio revealed that the source of 129I in Lithuania is global fallout in most cases though several sampling sites shows a possible impact of reprocessing releases. Estimated 129I/131I ratio in soil samples from the southern part of Lithuania shows negligible input of the Chernobyl fallout...

  19. Distribution of sup 137 Cs, sup 90 Sr, sup 238 Pu, sup 239 Pu, sup 241 Am and sup 244 Cm in Pond B, Savannah River Site

    Energy Technology Data Exchange (ETDEWEB)

    Whicker, F.W. (Colorado State Univ., Fort Collins, CO (USA)); Pinder, J.E. III; Bowling, J.W. (Savannah River Ecology Lab., Aiken, SC (USA)); Alberts, J.J. (Georgia Univ., Sapelo Island, GA (USA). Marine Inst.); Brisbin, I.L. Jr. (Savannah River Ecology Lab., Aiken, SC (USA))


    The gradual senescence of present-day operating nuclear facilities, and resultant contamination of aquatic and terrestrial ecosystems, emphasize the importance of understanding the behavior of radionuclides in the environment. Observations and deductions concerning mechanisms of radionuclide transport can contribute significantly to knowledge of fundamental ecological processes. This study emphasized the ecosystem-level distribution of several long-lived radionuclides in an abandoned reactor cooling impoundment after a twenty year period of chemical and biological equilibration. 90 refs., 14 figs., 5 tabs.

  20. Experimental and modelling study of artificial radionuclides (239Pu, 241Am and 99Tc) uptake by suspended matter in environmental waters located in the south of Spain


    El Mrabet, Rachid; Abril Hernández, José María; Manjón Collado, Guillermo


    The interest on transfer coefficients studies have increased recently, since they are important parameters required understanding and reliably modelling the dispersion of conservative and non-conservative radionuclides in aquatic environments. The approaches, based in the implementation of the uptake kinetics of dissolved radionuclides by solid particles, are more appropriate than those based in the use of the distribution coefficients, k^. In this work, we present a series of tracing experim...

  1. High workload and job stress are associated with lower practice performance in general practice: an observational study in 239 general practices in the Netherlands.

    NARCIS (Netherlands)

    Hombergh, P. van den; Kunzi, B.; Elwyn, G.; Doremalen, J.H.M. van; Akkermans, R.P.; Grol, R.P.T.M.; Wensing, M.J.P.


    BACKGROUND: The impact of high physician workload and job stress on quality and outcomes of healthcare delivery is not clear. Our study explored whether high workload and job stress were associated with lower performance in general practices in the Netherlands. METHODS: Secondary analysis of data

  2. Middlesex Sampling Plant environmental report for calendar year 1992, 239 Mountain Avenue, Middlesex, New Jersey. Formerly Utilized Sites Remedial Action Program (FUSRAP)

    Energy Technology Data Exchange (ETDEWEB)


    This report describes the environmental surveillance program at the Middlesex Sampling Plant (MSP) and provides the results for 1992. The site, in the Borough of Middlesex, New Jersey, is a fenced area and includes four buildings and two storage piles that contain 50,800 m{sup 3} of radioactive and mixed hazardous waste. More than 70 percent of the MSP site is paved with asphalt. The MSP facility was established in 1943 by the Manhattan Engineer District (MED) to sample, store, and/or ship uranium, thorium, and beryllium ores. In 1955 the Atomic Energy Commission (AEC), successor to MED, terminated the operation and later used the site for storage and limited sampling of thorium residues. In 1967 AEC activities ceased, onsite structures were decontaminated, and the site was certified for unrestricted use under criteria applicable at that time. In 1980 the US Department of Energy (DOE) initiated a multiphase remedial action project to clean up several vicinity properties onto which contamination from the plant had migrated. Material from these properties was consolidated into the storage piles onsite. Environmental surveillance of MSP began in 1980 when Congress added the site to DOE`s Formerly Utilized Sites Remedial Action Program. The environmental surveillance program at MSP includes sampling networks for radon and thoron in air; external gamma radiation exposure; and radium-226, radium-228, thorium-230, thorium-232, and total uranium in surface water, sediment, and groundwater. Additionally, chemical analyses are performed to detect metals and organic compounds in surface water and groundwater and metals in sediments. This program assists in fulfilling th DOE policy of measuring and monitoring effluents from DOE activities and calculating hypothetical doses.

  3. 17 CFR 239.13 - Form S-3, for registration under the Securities Act of 1933 of securities of certain issuers... (United States)


    ... arrangements, a copy of its latest annual report to security holders, if in the English language. Such annual... or scheme to evade the requirements of the Securities Act or the Exchange Act. See the definition of... as a whole. (6) A foreign issuer, other than a foreign government, which satisfies all of the above...

  4. CD8+ T Cell Escape Mutations in Simian Immunodeficiency Virus SIVmac239 Cause Fitness Defects In Vivo, and Many Revert after Transmission▿†


    Mudd, Philip A.; Ericsen, Adam J.; Walsh, Andrew D.; León, Enrique J.; Wilson, Nancy A.; Maness, Nicholas J.; Friedrich, Thomas C.; Watkins, David I.


    Virus-specific CD8+ T lymphocytes select for escape mutations in human immunodeficiency virus (HIV) and simian immunodeficiency virus (SIV). To assess the effects of these mutations on viral fitness, we introduced escape mutations into 30 epitopes (bound by five major histocompatibility complex class I [MHC-I] molecules) in three different viruses. Two of these MHC-I alleles are associated with elite control. Two of the three viruses demonstrated reduced fitness in vivo, and 27% of the introd...


    Energy Technology Data Exchange (ETDEWEB)

    Caldwell, E.; Duff, M.; Ferguson, C.


    The nuclear fuel cycle generates a considerable amount of radioactive waste, which often includes nuclear fission products, such as strontium-90 ({sup 90}Sr) and cesium-137 ({sup 137}Cs), and actinides such as uranium (U) and plutonium (Pu). When released into the environment, large quantities of these radionuclides can present considerable problems to man and biota due to their radioactive nature and, in some cases as with the actinides, their chemical toxicity. Radionuclides are expected to decay at a known rate. Yet, research has shown the rate of elimination from an ecosystem to differ from the decay rate due to physical, chemical and biological processes that remove the contaminant or reduce its biological availability. Knowledge regarding the rate by which a contaminant is eliminated from an ecosystem (ecological half-life) is important for evaluating the duration and potential severity of risk. To better understand a contaminants impact on an environment, consideration should be given to plants. As primary producers, they represent an important mode of contamination transfer from sediments and soils into the food chain. Contaminants that are chemically and/or physically sequestered in a media are less likely to be bio-available to plants and therefore an ecosystem.

  6. Activity measurements of a suite of radionuclides ({sup 40}K, {sup 137}Cs, {sup 210}Pb, {sup 210}Po, {sup 228}Ra, {sup 232}Th, {sup 234}U, {sup 235}U, {sup 238}U, {sup 238}Pu, {sup 239}Pu, {sup 239+240}Pu, {sup 241}Am) in vegetal reference material (seaweed)

    Energy Technology Data Exchange (ETDEWEB)

    Outola, I. [Maryland Univ., MD (United States); Inn, K.G.W.; Karam, L.R. [National Institute of Standards and Technology (NIST), Gaithersburg, MD (United States)


    In 2005, the CCRI decided that a comparison undertaken from 2002 to 2005 by the NIST (SIM) in the development of a new seaweed standard reference material (SRM) was sufficiently well constructed that it could be converted into a supplementary comparison under CCRI(II), with comparison identifier CCRI(II)-S1, so as to support calibration and measurement capability (CMC) claims for radionuclide measurements in reference material (specifically, plant material). Previous comparisons of radionuclides have been of single or multiple nuclides in non-complex matrices and results of such could not be extended to support capabilities to measure the same nuclides in reference materials. The results of this comparison have been reported to the participants, and were also used to determine the certified reference values of the SRM. The key comparison working group (KCWG) of the CCRI(II) has approved this approach as a mechanism to link all the results to the certified 'reference values' in lieu of the key comparison reference value (KCRV) of these specified radionuclides in this type of matrix (vegetative) so as to support CMCs of similar materials. (authors)

  7. Inter-laboratory exercise with an aim to compare methods for 90Sr and 239,240Pu determination in environmental soil samples

    DEFF Research Database (Denmark)

    Qiao, Jixin; Salminen-Paatero, Susanna; Rondahl, Stina Holmgren


    In order to deliver reliable results for a multitude of different scenarios, e.g. emergency preparedness, environmental monitoring, nuclear decommissioning and waste management, there is a constant process of method development in the field of radioanalytical chemistry. This work presents...

  8. National Dam Inspection Program. Broomalls Dam (NDS I.D. Number PA 00349, DER I.D. Number 23-9), Delaware River Basin, Tributary to Ridley Creek, Delaware County, Pennsylvania. Phase I Inspection Report, (United States)


    to be ten feet. The surface area of the pond is about 1.5 acres. A ten inch PVC pipe and an 18 inch CMP are laid through the embankment. Additional...12 Hours 123% 24 Hours 132% 48 Hours 143% SNYDER HYDROGRAPH PARAMETERS: (4) Zone 10 Cp, Ct 0.60, 1.25 L(5 ) 0.99 Lca (6) 0.52 tp=Ct (L- Lca )0 ŗ

  9. Histograms Constructed from the Data of 239-Pu Alpha-Activity Manifest a Tendency for Change in the Similar Way as at the Moments when the Sun, the Moon, Venus, Mars and Mercury Intersect the Celestial Equator

    Directory of Open Access Journals (Sweden)

    Shnoll S. E.


    Full Text Available Earlier, the shape of histograms of the results of measurements obtained in processes of different physical nature had been shown to be determined by cosmophysical factors [1]. Appearance of histograms of a similar shape is repeated periodically: these are the near- a-day, near-27-days and annual periods of increased probability of the similar shapes. There are two distinctly distinguished near-a-day periods: the sidereal-day (1,436 min- utes and solar-day (1,440 minutes ones. The annual periods are represented by three sub-periods: the “calendar” (365 average solar days, “tropical” (365 days 5 hours and 48 minutes and “sidereal” (365 days 6 hours and 9 minutes ones. The tropical year period indicates that fact that histogram shape depends on the time elapsed since the spring equinox [2]. The latter dependence is studied in more details in this work. We demonstrate that the appearance of similar histograms is highly probable at the same time count o from the moments of equinoxes, independent from the geographic lo- cation where the measurements had been performed: in Pushchino, Moscow Region (54 NL, 37 EL, and in Novolazarevskaya, Antarctic (70 SL, 11 EL. The sequence of the changed histogram shapes observed at the spring equinoxes was found to be op- posite to that observed at the autumnal equinoxes. As the moments of equinoxes are defined by the cross of the celestial equator by Sun, we also studied that weather is not the same as observed at the moments when the celestial equator was crossed by other celestial bodies — the Moon, Venus, Mars and Mercury. Let us, for simplicity, refer to these moments as a similar term “planetary equinoxes”. The regularities observed at these “planetary equinoxes” had been found to be the same as in the case of true solar equinoxes. In this article, we confine ourselves to considering the phenomenological observations only; their theoretical interpretation is supposed to be subject of further studies.

  10. Histograms Constructed from the Data of 239-Pu Alpha-Activity Manifest a Tendency for Change in the Similar Way as at the Moments when the Sun, the Moon, Venus, Mars and Mercury Intersect the Celestial Equator

    Directory of Open Access Journals (Sweden)

    Kharakoz D. P.


    Full Text Available Earlier, the shape of histograms of the results of measurements obtained in processes of different physical nature had been shown to be determined by cosmophysical factors. Appearance of histograms of a similar shape is repeated periodically: these are the near-a-day, near-27-days and annual periods of increased probability of the similar shapes. There are two distinctly distinguished near-a-day periods: the sidereal-day (1,436 minutes and solar-day (1,440 minutes ones. The annual periods are represented by three sub-periods: the "calendar" (365 average solar days, "tropical" (365 days 5 hours and 48 minutes and "sidereal" (365 days 6 hours and 9 minutes ones. The tropical year period indicates that fact that histogram shape depends on the time elapsed since the spring equinox.The latter dependence is studied in more details in this work. We demonstrate that the appearance of similar histograms is highly probable at the same time count off from the moments of equinoxes, independent from the geographic location where the measurements had been performed: in Pushchino, Moscow Region (54 deg NL, 37 deg EL, and in Novolazarevskaya, Antarctic (70 deg SL, 11 deg EL. The sequence of the changed histogram shapes observed at the spring equinoxes was found to be opposite to that observed at the autumnal equinoxes. As the moments of equinoxes are defined by the cross of the celestial equator by Sun, we also studied that weather is not the same as observed at the moments when the celestial equator was crossed by other celestial bodies - the Moon, Venus, Mars and Mercury. Let us, for simplicity, refer to these moments as a similar term "planetary equinoxes". The regularities observed at these "planetary equinoxes" had been found to be the same as in the case of true solar equinoxes. In this article, we confine ourselves to considering the phenomenological observations only; their theoretical interpretation is supposed to be subject of further studies.

  11. Thermosalinograph data of the Hawaii Ocean Time-series (HOT) program in the North Pacific 100 miles north of Oahu, Hawaii for cruises HOT239-248 during 2012 (NODC Accession 0120323) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The HOT program makes repeated observations of the physics, biology and chemistry at a site approximately 100 km north of Oahu, Hawaii. Two stations are visited...

  12. Mechanical behavior of {sup 238}UO{sub 2}, {sup 238}PuO{sub 2}, and {sup 239}PuO{sub 2} as a function of strain rate and temperature

    Energy Technology Data Exchange (ETDEWEB)

    Stout, M.G.; Ellis, R.W.; Pereyra, R.A.


    The mechanical response of {sup 238}UO{sub 2} was measured as a function of strain rate and temperature. We evaluated material produced by two processing schedules: hot pressing followed by a grain stabilization; and cold pressing plus a sintering treatment. The response of these two materials was identical, within the scatter of our data. We complemented our data with that published in the literature, after having made the appropriate corrections for grain size, porosity, and stoichiometry. The entire collection of data was used to evaluate the Follansbee-Kocks mechanical threshold stress (MTS) model for the prediction of yield stress as a function of strain rate and temperature. We used this model to predict the yield stress of {sup 238}UO{sub 2} for strain rates between {dot {var_epsilon}} = 10{sup {minus}5} and 10{sup 3} s{sup {minus}1} and temperatures from 800 to 1600C. These predictions provided the basis for constructing a deformation/fracture map for both urania and plutonia. Examination of the maps indicates that for compressive loading and impact strain rates, the {sup 238}UO{sub 2} will be an excellent mock material for {sup 238}PuO{sub 2}. Under these conditions both the strength and deformation and the fracture modes are consistent between these two materials.

  13. Organización de Estados Iberoamericanos (Boletín de Novedades 239. Tecnologías entrañables. ¿Es posible un modelo alternativo de desarrollo tecnológico?

    Directory of Open Access Journals (Sweden)

    Miguel Ángel Quintanilla


    Full Text Available Frente al modelo predominante de desarrollo tecnológico alienante, aquí se propone un modelo alternativo, el de tecnologías entrañables. En vez de tecnologías propietarias y cerradas, se trata de optar por diseñar y consumir tecnologías abiertas. En vez de aceptar la obsolescencia programada, se trata de potenciar los mercados de segunda mano, desterrar el principio de usar y tirar y aceptar el principio del mantenimiento y reparación continua de nuestros artefactos. Se trata de priorizar el mantenimiento del control sobre nuestras máquinas en vez de empeñarnos en desarrollar máquinas de las que terminaremos siendo esclavos. En definitiva, se trata de preferir las soluciones tecnológicas compatibles con el desarrollo sostenible, con los ideales de la solidaridad y no solo del éxito, o con la participación cooperativa y no solo la competitiva. En palabras de José A. López Cerezo, “este libro constituye un espacio de reflexión sobre la naturaleza de la tecnología y el cambio tecnológico, sobre los rasgos que contribuyen a hacer de la tecnología algo deseable o indeseable. [...] Es una mirada a los matices de las relaciones entre la tecnología y los agentes humanos, al extrañamiento que generan ciertos modos de expresión de la tecnología, basada en un análisis filosófico de calidad y una comprensión cabal del mundo que nos rodea”.

  14. CTD data of the Hawaii Ocean Time-series (HOT) program in the North Pacific 100 miles north of Oahu, Hawaii for cruises HOT239-248 during 2012 (NODC Accession 0119895) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The HOT program makes repeated observations of the physics, biology and chemistry at a site approximately 100 km north of Oahu, Hawaii. Two stations are visited...

  15. Niskin bottle data of the Hawaii Ocean Time-series (HOT) program in the North Pacific 100 miles north of Oahu, Hawaii for cruises HOT239-248 during 2012 (NCEI Accession 0119430) (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The HOT program makes repeated observations of the physics, biology and chemistry at a site approximately 100 km north of Oahu, Hawaii. Two stations are visited...

  16. Discovery of isotopes of the transuranium elements with 93≤Z≤98

    Energy Technology Data Exchange (ETDEWEB)

    Fry, C.; Thoennessen, M., E-mail:


    One hundred and five isotopes of the transuranium elements neptunium, plutonium, americium, curium, berkelium, and californium have been observed so far; the discovery of these isotopes is described. For each isotope a brief summary of the first refereed publication, including the production and identification method, is presented.

  17. Separation of Transplutonium Elements from Neutron Irradiated Americium-241

    National Research Council Canada - National Science Library

    UENO, Kaoru; WATANABE, Kenju; SAGAWA, Chiaki; ISHIMORI, Tomitaro


    .... The ratios of the amounts present of these isotopes were determined by mass spectrometry. It was not possible to identify 249Bk in the berkelium fraction owing to the interference from other β-ray emitting nuclides. In the californium fraction, both spontaneous fission and a-activities due to 250, 252 were observed.

  18. Neutron-Activated Gamma-Emission: Technology Review (United States)


    flux sources developed for boron neutron capture therapy ( BNCT ), found to be an experimental success in cancer treatment (26). 30 Improved flux on...achievable Am americium API associated particle imaging B boron Be beryllium BNCT boron neutron capture therapy C carbon Cf californium Cl

  19. Associação da palma forrageira com diferentes tipos de volumosos em dietas para vacas em lactação: comportamento ingestivo e parâmetros fisiológicos - DOI: 10.4025/actascianimsci.v29i2.239 Association of the forage cactus with different types of forage in diets for lactating cows: ingestive behaviour and physiologic parameters - DOI: 10.4025/actascianimsci.v29i2.239

    Directory of Open Access Journals (Sweden)

    Marcilio de Azevedo


    Full Text Available O experimento foi realizado de janeiro a abril de 2005, objetivando avaliar o comportamento ingestivo e os parâmetros fisiológicos de vacas da raça Holandesa em lactação, alimentadas com concentrado e palma forrageira associada a diferentes volumosos (bagaço de cana-de-açúcar em in natura, feno de capim-tifton, feno de capim-elefante, silagem de sorgo e bagaço de cana mais silagem de sorgo. Foram utilizadas cinco vacas, distribuídas em quadrado latino 5 x 5, após período pré-experimental de quatorze dias. Cada período experimental teve duração de 14 dias. O registro das variáveis comportamentais foi de forma visual, em intervalos de cinco minutos, em 24 horas. O ambiente foi monitorado de hora em hora, das 6h às 18h, por meio dos termômetros de bulbo seco e úmido. A temperatura retal e freqüência respiratória foram registradas às 9h e 18h. O consumo de água foi mensurado às 5h30min e 17h30min. Não houve diferença (p > 0,05 entre os volumosos, quanto às variáveis fisiológicas e comportamentais, ao número de defecação e micção e a procura por água. Houve diferença (p The experiment was carried out from January to April 2005, evaluating the ingestive behaviour and physiologic parameters of lactating Holstein cows fed with cactus forage associated with different forage (sugarcane bagasse in natura, tifton grass hay, elephant grass hay, sorghum silage and sorghum silage plus sugarcane bagasse. Five cows were assigned to a 5 x 5 latin square design, after pre-experimental period of 14 days. Each experimental period lasted 14 days. The registration of the behavior variables was in a visual way, at five-minute intervals, in 24 hours. The ambient temperature was monitored every hour, from 6 am to 6 pm, through bulb dry and humid thermometer. Rectal temperature and respiratory frequency were registered at 9 am and at 6 pm. The water intake was measured at 5.30 am and at 5.30 pm. There was no difference (p > 0.05 among the forage, as for physiologic variables, behavior, defecation, urination and seek for water. Yet, there was difference (p < 0.05 among the treatments for the afternoon and total water intake. Under these conditions, the association of cactus forage with sugarcane bagasse, tifton grass hay, elephant grass hay, sorghum silage and sorghum silage plus sugarcane bagasse, did not influence behavior, physiologic variables, while it influenced water ingestion.

  20. ORF Alignment: NC_006361 [GENIUS II[Archive

    Lifescience Database Archive (English)


  1. Dicty_cDB: [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VF (Link to library) VFC239 (Link to dictyBase) - - - Contig-U16455-1 VFC239P (Link... to Original site) VFC239F 347 VFC239Z 463 VFC239P 810 - - Show VFC239 Library VF (Link to library) Clone ID VFC239 (Link to dict...yBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig Contig-U16455-1 Original site URL http://dict....0 3 AF016242 |AF016242.1 Dictyostelium discoideum protein synthesis elongation factor 1-alpha (tef2) gene, ...ondrial 4.0 %: peroxisomal >> prediction for VFC239 is nuc 5' end seq. ID VFC239F 5' end seq. >VFC239F.Seq A

  2. Solid-State Neutron Multiplicity Counting System Using Commercial Off-the-Shelf Semiconductor Detectors

    Energy Technology Data Exchange (ETDEWEB)

    Rozhdestvenskyy, S. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)


    This work iterates on the first demonstration of a solid-state neutron multiplicity counting system developed at Lawrence Livermore National Laboratory by using commercial off-the-shelf detectors. The system was demonstrated to determine the mass of a californium-252 neutron source within 20% error requiring only one-hour measurement time with 20 cm2 of active detector area.

  3. Cold valleys in the radioactive decay of 248−254Cf isotopes

    Indian Academy of Sciences (India)

    Geiger–Nuttal plots of log10(T1/2) vs. Q−1/2 for 48−52Ca emitting from various californium isotopes. Acknowledgement. One of the authors (KPS) would like to thank University Grants Commis- sion, Govt. of India for the financial support under project No. MRP(S)-. 352/2005(X Plan)/KLKA 002/UGC-SWRO. References.

  4. Directed evolution of the periodic table: probing the electronic structure of late actinides. (United States)

    Marsh, M L; Albrecht-Schmitt, T E


    Recent investigations of the coordination chemistry and physical properties of berkelium (Z = 97) and californium (Z = 98) have revealed fundamental differences between post-curium elements and lighter members of the actinide series. This review highlights these developments and chronicles key findings and concepts from the last half-century that have helped usher in a new understanding of the evolution of electronic structure in the periodic table.

  5. Open Source: Potential in Latin America for Radiological Weapons (United States)


    terrorist group would need to acquire a radioactive isotope with a relatively short half-life. 36,37 As an aside, the IAEA verified that (accessed March 3, 2010), Useful RDD isotopes include cobalt-60, strontium-90, yttrium-90, iridium-192, cesium-137...plutonium-238, radium -226, americium-241, and californium-252. 37 Hansell and Salama, “Does intent equal capability?,” 640-641. 38 Internation Atomic

  6. Radionuclide Basics: Plutonium (United States)

    Plutonium (chemical symbol Pu) is a radioactive metal. Plutonium is considered a man-made element. Plutonium-239 is used to make nuclear weapons. Pu-239 and Pu-240 are byproducts of nuclear reactor operations and nuclear bomb explosions.

  7. Drug: D07591 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available D07591 Drug Bupropion (INN) C13H18ClNO 239.1077 239.7411 D07591.gif Antidepressant ...atment Agents Smoking Cessation Agents Bupropion D07591 Bupropion (INN) Antidepressants Antidepressants, Oth

  8. Choosing the Right Book: Factors that Affect Children’s Reading. A Review of: Maynard, S., Mackay, S., & Smyth, F. (2008. A survey of young people’s reading in England: Borrowing and choosing books. Journal of Librarianship and Information Science, 40(4, 239-253.

    Directory of Open Access Journals (Sweden)

    Gayle Bogel


    Full Text Available Objective – To analyze factors affecting book choice: reading recommendations, reasons for choosing series books, book reviews, and school libraries.Design – This secondary analysis of data is based on a selection of findings from a larger 2005 survey that monitored trends in youth reading habits. The large scale 2005 study was designed as a follow up to a 1996 survey. The 2005 survey used online questionnaires and formal statistical analysis to compare gender and age groups. The data on factors affecting book choice were derived from the original questions, responses, and analyses.Setting – Questionnaires were administered in22 primary and 24 secondary schools in the UK with access to computers and internet.Subjects – Almost 4,200 students from 4 to 16 years of age.Methods – Study authors invited approximately 150 schools to participate in the survey. Forty-six schools (31% responded. A total of 22 primary and 24 secondary schools participated in the original study between April and June 2005.This study used comparative analysis to examine factors affecting book choice between gender and age groups. Statistical significance was defined as one percent. Other demographic information was collected, such as ethnicity, language spoken at home, and religion, but was deemed insufficient for any meaningful analysis.There were 4,182 responses to the survey, separated into three age groups: ages 4 to 7 (KS1, ages 7 to 11 (KS2, and ages 11 to 16 (KS3&4.Students were asked to describe themselves as readers by responding to multiple choice questions, and then to provide specific information on the places or people most frequently used as book borrowing sources. Participants were considered “enthusiastic” readers if they “read a lot with pleasure” and “average” readers if they “read an ordinary amount”. Participants responded to additional multiple choice questions on specific factors related to borrowing books and book choices, the process of choosing series, fiction, and nonfiction books.Main Results – Readers: The number of children who described themselves as “enthusiastic” readers decreased with age, and approximately half of the children between 7 and 16 years of age described themselves as “average” readers, average rating increasing slightly through this age group. Investigators found a marked difference in gender within the 4 to 7 year olds: 49.7% percent of girls in this age group considered themselves “enthusiastic,” compared to 37.3% of boys. Only 18.5% of girls considered themselves “reluctant” readers, compared to 28.1% of boys.The longitudinal comparison to the earlier 1996 study found that although the percentage of boys from ages 7 to 16 who described themselves as reluctant readers stayed about the same, the percentage of girls who described themselves as reluctant increased. There was also a dramatic drop in the number of girls who described themselves as enthusiastic; from 51% in 1996 to 17% in 2005.Borrowing Books: Libraries of all types (school, classroom and public were the prime sources for borrowing books. Girls borrowed more books from schools than boys, and girls also borrowed more books from non-library sources (family members and friends than boys. Both boys and girls increasingly reported borrowing more books from friends than from libraries as they grew older.Over half of each age group rated the school library or classroom book corner as having “enough” books. The perception of “too many books” decreased with age. The perception of quality of the classroom or school library also decreased with age. The number of students in the younger age groups who rated the quality of books in the classroom or school library as “very good” was significantly higher than students in the older age groups. The number of student who rated the quality as “okay” doubled from the lower to the higher age group.Choosing Books: Children were asked six questions related to whether the physical book itself provided motivation to read, and six questions related to other factors for book recommendation. Younger readers were more likely to choose a book for its visual appeal, although this factor (interesting cover or illustrations inside was more consistent for boys of all age groups than girls. The author’s name and book blurb were stronger factors for girls in the 7 to 16 age group than for boys.The study authors sought to explore the idea of “shared reading” and asked children in the 7 to 11 and 11 to 16 age groups how often they chose a book based on a recommendation from a friend or family member, a public or school librarian, or other adults. Friends were the strongest recommendation source (43.2% for 7 to 11 year olds and 38.4% for 11to 16 year olds. Recommendations from school or public librarians rated only three to six percent for both age groups.All age groups were asked about choosing series books, and the questions were simplified for the younger age group. All students reported that appealing factors were the consistency of characters, familiar storylines, and familiar writing styles. Some students also noted that the availability of series books positively affected their choices.Print or online book reviews were used “hardly ever or never” by over 40% of the 7 to16 year old age groups, while television or magazine reviews or recommendations were highly rated by over 50% of respondents in the same age groups. Participants chose informational or non-fiction books because of personal interests, hobbies, or recommendations from friends, while they selected fiction or poetry for the blurb, title, or appearance and design of the cover. Celebrity recommendations and books about celebrities were popular reasons for choosing books.When asked who helped them choose books, 53.2% in the 7 to11 age group and 66.1% in the 11to 16 age group stated that no one ever helps them. Of the students who had help choosing books, “family members” was the most common response. Local librarians were not used as a source for recommendations.

  9. Ibarra García, M. V. e I. Escamilla Herrera (Coords. 2016, Geografías feministas de diversas latitudes. Orígenes, desarrollo y temáticas contemporáneas. México, Instituto de Geografía, Facultad de Filosofía y Letras, UNAM. 239 pp., ISBN 978-607-02-8506-6

    Directory of Open Access Journals (Sweden)

    Álvaro López López


    Full Text Available Uno de los propósitos de los estudios de género dentro de las ciencias sociales es buscar relaciones equitativas entre hombres y mujeres; sin embargo, aún muchas personas se resisten a las relaciones de equidad entre ellos y ellas, pues asumen que su diferencia tradicional es un “hecho natural”, “esencial”, al que no hay nada que cuestionar. Por lo que vistas así, las categorías “hombre” y “mujer” serían ontológicamente positivistas, donde la realidad es manejada por leyes naturales inamovibles. Esto podría parecer algo irrefutable, pero nada más alejado de la realidad, pues las categorías “hombre” y “mujer” son constructos sociales y, por lo tanto, están sujetos al escrutinio humano, en el afán de búsqueda de la equidad.

  10. DOI: 10.4025/actascibiolsci.v33i3.8011 Acta Scientiarum. Biological Sciences Maringá, v. 33, n. 3, p. 239-246, 2011 Acute inflammatory response in Nile tilapia fed probiotic Lactobacillus plantarum in the diet = Resposta inflamatória aguda em tilápia do Nilo alimentada com probiótico, Lactobacillus plantarum na dieta

    Directory of Open Access Journals (Sweden)

    Geovana Dotta


    Full Text Available The present study evaluated the acute inflammatory response induced bycarrageenin (500 £gg injected in the swim bladder of Nile tilapia, after fed or not probiotic supplemented diet. Fifty four fish were distributed in six treatments and three replicates: Group A: Fish fed unsupplemented diet: 0.5 mL saline-injected fish; fish injected with 500 £gg carrageenin diluted in 0.5 mL saline; Non-injected. Group B: Fish fed probiotic supplemented diet: saline-injected fish; carrageenin-injected fish; Non-injected. Fifteen days after feeding the fish were injected with carrageenin or saline. After six hours, inflammatory exudate was collected, as well as the blood for hematocrit, red blood cell (RBC and white blood cell (WBC counts, differential count of leucocytes and phagocytic activity in the blood. Supplementation with probiotic did not influence the RBC, hematocrit and the numbers of lymphocytes and basophils in the blood. The number of neutrophils was significantly higher in supplemented fish injected with carrageenin. Glucose concentration in supplemented and non-injected fish was higher than that observed in the saline injected ones. Probiotic potentialized the migration of cells to the inflammatory focus in the animals injected with the carrageenin irritant. In fish injected with saline and carrageenin occurred the greatest phagocytic activity in the blood in relation to those treatments.Este trabalho avaliou a resposta inflamatoria aguda induzida por injecao de carragenina (500 ƒÝg na bexiga natatoria de tilapia do Nilo suplementada ou nao com probiotico na racao. Cinquenta e quatro animais foram distribuidos em seis tratamentos com tres repeticoes: Grupo A: peixes alimentados com racao naosuplementada: Controle (injecao de 0,5 mL de solucao salina esteril; Carragenina (injecao de500 £gg de carragenina; Nao-injetada. Grupo B: peixes alimentados com racao suplementada com probiotico: Controle; Carragenina; Nao-injetada. Apos 15 dias de alimentacao foi injetado carragenina ou salina. Apos 6h, realizou-se a coleta de exsudato e sangue para determinacao do hematocrito, contagens totais de eritrocitos, leucocitos, contagem diferencial de leucocitos e atividade fagocitaria no sangue. A suplementacao com probiotico na racao nao influenciou o numero total de eritrocitos, o hematocrito e os numeros de linfocitos e basofilos no sangue dos animais. O numero de neutrofilos foi maior nos peixes suplementados com probiotico einjetados com carragenina. A glicose nos peixes suplementados com probiotico nao-injetados foi maior do que nos injetados com salina. A suplementacao com probiotico potencializou a migracao de celulas para o foco inflamatorio nos injetados com o flogogeno carragenina. Empeixes injetados com salina e carragenina, ocorreu maior atividade fagocitaria no sangue em relacao aos demais tratamentos.

  11. Reference material for radionuclides in sediment IAEA-384 (Fangataufa Lagoon sediment)

    DEFF Research Database (Denmark)

    Povinec, P.P.; Pham, M.K.; Sanchez-Cabeza, J.A.


    -238, Pu239+240 and Am-241). Information values are given for 12 radionuclides (Sr-90, Cs-137, Pb-210 (Po-210), Ra-226, Ra-228, Th-232, U-234, U-235, Pu-239, Pu-240 and Pu-241). Less reported radionuclides include Th-228, U-236, Np-239 and Pu-242. The reference material may be used for quality...

  12. Second Annual Clinical Diabetes Technology Meeting (United States)


    an ABG "* Check BUN/Cr. Check U/A to look for proteinuria "* Best test for proteinuria is urine microalbumin "* Clinical estimation of left ventricular... 150 -179 1.5 150 -179 2 150 -179 4 150 -179 7 180-209 2 180-209 3 180-209 5 180-209 9 210-239 2 210-239 4 210-239 6 210-239 12 240-269 3 240-269 5 240-269 8...120-149 1.5 120-149 3 120-149 5 150 -179 1.9 150 -179 2 150 -179 4 150 -179 7 180-209 2 180-209 3 180-209 5 180-209 9 210-239 2 210-239 4 210-239 6 210


    Energy Technology Data Exchange (ETDEWEB)

    Seaborg, Glenn T.; Street Jr., Kenneth; Thompson, Stanley G.; Ghiorso, Albert


    This volume includes the talks given on January 20, 1975, at a symposium in Berkeley on the occasion of the celebration of the 25th anniversary of the discovery of berkelium and californium. Talks were given at this symposium by the four people involved in the discovery of these elements and by a number of people who have made significant contributions in the intervening years to the investigation of their nuclear and chemical properties. The papers are being published here, without editing, in the form in which they were submitted by the authors in the months following the anniversary symposium, and they reflect rather faithfully the remarks made on that occasion.

  14. Composition containing transuranic elements for use in the homeopathic treatment of aids

    Energy Technology Data Exchange (ETDEWEB)

    Lustig, D.


    A homeopathic remedy consisting of a composition containing one or more transuranic elements, particularly plutonium, for preventing and treating acquired immunodeficiency syndrome (AIDS) in humans, as well as seropositivity for human immunodeficiency virus (HIV). Said composition is characterized in that it uses any chemical or isotopic form of one or more transuranic elements (neptunium, plutonium, americium, curium, berkelium, californium or einsteinium), particularly plutonium, said form being diluted and dynamized according to conventional homeopathic methods, particularly the so-called Hahnemann and Korsakov methods, and provided preferably but not exclusively in the form of lactose and/or saccharose globules or granules impregnated with the active principle of said composition. (author).

  15. Advanced development of the spectrum sciences Model 5005-TF, single-event test fixture

    Energy Technology Data Exchange (ETDEWEB)

    Ackermann, M.R.; Browning, J.S. (Sandia National Labs., Albuquerque, NM (USA)); Hughlock, B.W. (Boeing Aerospace and Electronics Co., Seattle, WA (USA)); Lum, G.K. (Lockheed Missiles and Space Co., Sunnyvale, CA (USA)); Tsacoyeanes, W.C. (Draper (Charles Stark) Lab., Inc., Cambridge, MA (USA)); Weeks, M.D. (Spectrum Sciences, Inc., Santa Clara, CA (USA))


    This report summarizes the advanced development of the Spectrum Sciences Model 5005-TF, Single-Event Test Fixture. The Model 5005-TF uses a Californium-252 (Cf-252) fission-fragment source to test integrated circuits and other devices for the effects of single-event phenomena. Particle identification methods commonly used in high-energy physics research and nuclear engineering have been incorporated into the Model 5005-TF for estimating the particle charge, mass, and energy parameters. All single-event phenomena observed in a device under test (DUT) are correlated with an identified fission fragment, and its linear energy transfer (LET) and range in the semiconductor material of the DUT.


    Energy Technology Data Exchange (ETDEWEB)

    Albrecht-Schmitt, Thomas


    This grant supported the exploratory synthesis of new actinide materials with all of the actinides from thorium to californium with the exceptions of protactinium and berkelium. We developed detailed structure-property relationships that allowed for the identification of novel materials with selective ion-exchange, selective oxidation, and long-range magnetic ordering. We found novel bonding motifs and identified periodic trends across the actinide series. We identified structural building units that would lead to desired structural features and novel topologies. We also characterized many different spectroscopic trends across the actinide series. The grant support the preparation of approximately 1200 new compounds all of which were structurally characterized.

  17. Detection of rare earth elements in Powder River Basin sub-bituminous coal ash using laser-induced breakdown spectroscopy (LIBS)

    Energy Technology Data Exchange (ETDEWEB)

    Tran, Phuoc [National Energy Technology Lab. (NETL), Pittsburgh, PA, (United State; Mcintyre, Dustin [National Energy Technology Lab. (NETL), Pittsburgh, PA, (United State


    We reported our preliminary results on the use of laser-induced breakdown spectroscopy to analyze the rare earth elements contained in ash samples from Powder River Basin sub-bituminous coal (PRB-coal). We have identified many elements in the lanthanide series (cerium, europium, holmium, lanthanum, lutetium, praseodymium, promethium, samarium, terbium, ytterbium) and some elements in the actinide series (actinium, thorium, uranium, plutonium, berkelium, californium) in the ash samples. In addition, various metals were also seen to present in the ash samples

  18. Dicty_cDB: CHH190 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available stercoralis cDNA 5' similar to WP:C41C4.8 CE05402 TRANSITIONAL ENDOPLASMIC RETICULUM ATPASE HOMOLOG 2 ;, mRNA...mansoni cDNA clone SMNCG50 5' end similar to transitional endoplasmic reticulum ATPase, mRNA sequence...embryo spinal... 239 9e-62 S25197( S25197 ;S30329) transitional endoplasmic reticulum ATPase ... 239 9e-62...DKFZp434K0... 239 9e-62 ( P03974 ) RecName: Full=Transitional endoplasmic reticulum ATPase... 239 9e-62 AK169140_1(...kidney... 239 9e-62 ( P55072 ) RecName: Full=Transitional endoplasmic reticulum ATPase... 239 9e-62 protein

  19. 10 CFR Appendix P to Part 110 - Category 1 and 2 Radioactive Material (United States)


    .... 2 The limits for Pu-238 and Pu-239/Be in this table apply for imports to the U.S. The limits for exports of Pu-238 and Pu-239/Be can be found in § 110.21. a Discrete sources of radium-226. Calculation of... Gadolinium-153 1,000 27,000 10.0 270 Iridium-192 80 2,200 0.8 22 Plutonium-2382 60 1,600 0.6 16 Plutonium-239...

  20. Microbial co-occurrence relationships in the human microbiome

    National Research Council Canada - National Science Library

    Faust, Karoline; Sathirapongsasuti, J Fah; Izard, Jacques; Segata, Nicola; Gevers, Dirk; Raes, Jeroen; Huttenhower, Curtis


    .... The initial Human Microbiome Project (HMP) cohort, comprising 239 individuals and 18 different microbial habitats, provides an unprecedented resource to detect, catalog, and analyze such relationships...

  1. 48 CFR 1339.270 - Solicitation provisions and contract clauses. (United States)


    ... COMMERCE SPECIAL CATEGORIES OF CONTRACTING ACQUISITION OF INFORMATION TECHNOLOGY Electronic and Information... to 1352.239-71, Electronic and Information Technology, in solicitations for Electronic and...

  2. Compendium of Environmental Sustainability Indicator Collections: Complete Collection, Version 1.1 (United States)

    National Aeronautics and Space Administration — The Compendium of Environmental Sustainability Indicator Collections, Version 1.1 contains 426 indicators for 239 countries from five major environmental...

  3. Resolving global versus local/regional Pu sources in the environment using sector ICP-MS (United States)

    Ketterer, M.E.; Hafer, K.M.; Link, C.L.; Kolwaite, D.; Wilson, Jim; Mietelski, J.W.


    Sector inductively coupled plasma mass spectrometry is a versatile method for the determination of plutonium activities and isotopic compositions in samples containing this element at fallout levels. Typical detection limits for 239+240Pu are 0.1, 0.02 and 0.002 Bq kg -1Pu for samples sizes of 0.5 g, 3 g, and 50 g of soil, respectively. The application of sector ICP-MS-based Pu determinations is demonstrated in studies in sediment chronology, soil Pu inventory and depth distribution, and the provenance of global fallout versus local or regional Pu sources. A sediment core collected from Sloans Lake (Denver, Colorado, USA) exhibits very similar 137Cs and 239+240Pu activity profiles; 240Pu/239Pu atom ratios indicate possible small influences from the Nevada Test Site and/or the Rocky Flats Environmental Technology Site. An undisturbed soil profile from Lockett Meadow (Flagstaff, Arizona, USA) exhibits an exponential decrease in 239+240Pu activity versus depth; 240Pu/239Pu in the top 3 cm is slightly lower than the global fallout range of 0.180 ?? 0.014 due to possible regional influence of Nevada Test Site fallout. The 239??240Pu inventory at Lockett Meadow is 56 ?? 4 Bq m-2, consistent with Northern Hemisphere mid-latitude fallout. Archived NdF3 sources, prepared from Polish soils, demonstrate that substantial 239+240Pu from the 1986 Chernobyl disaster has been deposited in north eastern regions of Poland; compared to global fallout, Chernobyl Pu exhibits higher abundances of 240Pu and 241Pu. The ratios 240Pu/239pu and 241Pu/239Pu co-vary and range from 0.186-0.348 and 0.0029-0.0412, respectively, in forest soils (241Pu/239Pu = 0.2407??[240Pu/239Pu] - 0.0413; r2 = 0.9924). ?? The Royal Society of Chemistry 2004.

  4. 17 CFR 260.10a-5 - Eligibility of Canadian Trustees. (United States)


    ... Eligibility of Canadian Trustees. (a) Subject to paragraph (b) of this section, any trust company, acting as... (§§ 239.37 through 239.41 of this chapter) that is incorporated and regulated as a trust company under the... pursuant to the Trust Companies Act (Canada), R.S.C. 1985, or the Canada Deposit Insurance Corporation Act...

  5. Draft Genome Sequences of Four Nosocomial Methicillin-Resistant Staphylococcus aureus (MRSA) Strains (PPUKM-261-2009, PPUKM-332-2009, PPUKM-377-2009, and PPUKM-775-2009) Representative of Dominant MRSA Pulsotypes Circulating in a Malaysian University Teaching Hospital (United States)

    Mohamed-Hussein, Zeti-Azura; Tan, Xin-Ee; B Raja Abd Rahman, Raja Mohd Fadhil; Hussin, Salasawati; Mohamad Zin, Noraziah; Jamal, Rahman


    Here, we report the draft genome sequences of four nosocomial methicillin-resistant Staphylococcus aureus strains (PPUKM-261-2009, PPUKM-332-2009, PPUKM-377-2009, and PPUKM-775-2009) isolated from a university teaching hospital in Malaysia. Three of the strains belong to sequence type 239 (ST239), which has been associated with sustained hospital epidemics worldwide. PMID:23405328

  6. An Analysis of Writing Coach Programs on American Daily Newspapers. (United States)

    Laakaniemi, Ray

    A survey of 239 newspapers was conducted to explore the use of writing coach programs at these papers. The coaches' backgrounds, newsroom factors, specific writing problems, budgetary considerations, and implications for journalism education were all explored, as were the perceptions of editors supervising the writing coaches. Of the 239 papers…

  7. Depth-Resolved Cathodoluminescence of Thorium Dioxide (United States)


    1 238Pu……………... Plutonium -238... plutonium -239 (239Pu)-based nuclear weapons. Thorium also results in less highly radioactive waste in comparison to the uranium fuels. Thorium is four...spectra. Direct determination of fractional parts per million amounts of rare earths in thorium.” Analytical Chemistry , 42, no. 3 (1970): 325-329. B

  8. Bulletin of Materials Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science; Volume 23; Issue 4. Issue front cover thumbnail. Volume 23, Issue 4. August 2000, pages 239-340. pp 239-241 Phase Transitions. Phase transitions in Na2TeO4 ceramics · N K Singh R N P Choudhary · More Details Abstract Fulltext PDF. Polycrystalline samples of NaTeO4 ...

  9. Robot-assisted radical prostatectomy is a safe procedure

    DEFF Research Database (Denmark)

    Thomsen, Frederik Birkebæk; Berg, Kasper Drimer; Hvarness, Helle


    We present our departmental experience with robot-assisted radical prostatectomy and describe complications and early results for the first 239 consecutive patients.......We present our departmental experience with robot-assisted radical prostatectomy and describe complications and early results for the first 239 consecutive patients....

  10. Aetiological considerations in 96 consecutive cases of ascites ...

    African Journals Online (AJOL)

    Results: The three most common causes of ascites in this series were liver diseases-36.5% (chronic liver disease 27.1%, hepatocellular carcinoma 9.4%), renal diseases 30.2% (chronic renal failure 23.9%, nephrotic syndrome 6.3%), and cardiac diseases 23.9% (congestive cardiac failure 22.9%, Endomyocardial fibrosis ...

  11. 01 Anker 03.pmd

    African Journals Online (AJOL)


    23 Jul 2008 ... wind wat die brief wegwaai (217), die stemme uit die natuur (225), dat hy vlieg in sy verbeelding (228), die nagmaaltoneel (239), die optel van die ster (239–40) en die ver- skyning van die veer met sy vertrek saam met Arend (246). Alhoewel die meeste van hierdie magiese gebeure saamval met die eerste ...

  12. NCBI nr-aa BLAST: CBRC-OGAR-01-1331 [SEVENS

    Lifescience Database Archive (English)

    Full Text Available CBRC-OGAR-01-1331 ref|NP_477761.1| wsv239 [Shrimp white spot syndrome virus] gb|AAL...33243.1| wsv239 [shrimp white spot syndrome virus] gb|AAL89163.1| WSSV295 [shrimp white spot syndrome virus] NP_477761.1 7e-05 36% ...

  13. Using a Time Projection Chamber to Measure High Precision Neutron-Induced Fission Cross Sections

    Energy Technology Data Exchange (ETDEWEB)

    Manning, Brett [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)


    2014 LANSCE run cycle data will provide a preliminary 239Pu(n,f) cross section and will quantify uncertainties: PID and Target/beam non-uniformities. Continued running during the 2015 LANSCE run cycle: Thin targets to see both fission fragments and 239Pu(n,f) cross section and fully quantified uncertainties

  14. Pacific Northwest Laboratory annual report for 1976 to the ERDA Assistant Administrator for Environment and Safety. Part 1. Biomedical Sciences

    Energy Technology Data Exchange (ETDEWEB)

    Thompson, R.C.


    Separate abstracts were prepared for individual sections of this publication. In addition to research reports the publication also contains organization charts, author index, and appendixes showing data on selected parameters relative to life-span dose-effect studies with inhaled /sup 239/PuO/sub 2/, /sup 238/PuO/sub 2/, and /sup 239/Pu in beagles. (HLW)

  15. Plutonium in Southern Hemisphere ocean Waters

    DEFF Research Database (Denmark)

    Hirose, K.; Aoyama, M.; Gastaud, J.


    Plutonium in seawater collected by the BEAGLE2003 cruise was determined using ICP- SF-MS and alpha spectrometry after Fe co-precipitation and radiochemical purification. Levels and distributions of dissolved plutonium activity concentrations in Southern Hemisphere ocean waters are summarized here......, including historical data. Pu-239 concentrations in surface water----of the central South Pacific (32.5 °S) in 2003 were around 1 mBq/m3. The 239Pu concentrations in the Indian Ocean surface waters (20°S) were similar to that in the South Pacific, whereas the 239Pu concentrations in the South Atlantic...... surface waters (30°S) were markedly lower than those in the South Pacific and Indian Oceans. The 239Pu vertical profile pattern was similar to that in the North Pacific subtropical gyre, although 239Pu concentrations in the deep South Pacific were significantly lower than those in the North Pacific. One...

  16. Measurements of the neutron capture cross sections and incineration potentials of minor-actinides in high thermal neutron fluxes: Impact on the transmutation of nuclear wastes; Mesures des sections efficaces de capture et potentiels d'incineration des actinides mineurs dans les hauts flux de neutrons: Impact sur la transmutation des dechets

    Energy Technology Data Exchange (ETDEWEB)

    Bringer, O


    This thesis comes within the framework of minor-actinide nuclear transmutation studies. First of all, we have evaluated the impact of minor actinide nuclear data uncertainties within the cases of {sup 241}Am and {sup 237}Np incineration in three different reactor spectra: EFR (fast), GT-MHR (epithermal) and HI-HWR (thermal). The nuclear parameters which give the highest uncertainties were thus highlighted. As a result of fact, we have tried to reduce data uncertainties, in the thermal energy region, for one part of them through experimental campaigns in the moderated high intensity neutron fluxes of ILL reactor (Grenoble). These measurements were focused onto the incineration and transmutation of the americium-241, the curium-244 and the californium-249 isotopes. Finally, the values of 12 different cross sections and the {sup 241}Am isomeric branching ratio were precisely measured at thermal energy point. (author)

  17. A gas secondary electron detector

    CERN Document Server

    Drouart, A; Alamanos, N; Auger, F; Besson, P; Bougamont, E; Bourgeois, P; Lobo, G; Pollacco, E C; Riallot, M


    A new Secondary Electron gas Detector (SED) is under development to be used in conjunction with an emissive foil to detect low energy heavy ions as an alternative to micro-channel plates. It could measure position and time of flight. Secondary electrons are accelerated to 10 keV so that they can cross through the 0.9 mu m Mylar entrance window. The electrons then are multiplied in the isobutane gas of the detector at 4-10 Torr. A time resolution of 150 ps and a spatial resolution of 3 mm have been obtained by using californium fission fragments on a prototype detector of 7x7 cm sup 2. The advantage of the SED against MCP is that its size is not limited. Our final goal is to build a large size detector (15x40 cm sup 2) that will operate at the focal plane of the VAMOS magnetic spectrometer at GANIL.

  18. Environmental assessment of the thermal neutron activation explosive detection system for concourse use at US airports

    Energy Technology Data Exchange (ETDEWEB)

    Jones, C.G.


    This document is an environmental assessment of a system designed to detect the presence of explosives in checked airline baggage or cargo. The system is meant to be installed at the concourse or lobby ticketing areas of US commercial airports and uses a sealed radioactive source of californium-252 to irradiate baggage items. The major impact of the use of this system arises from direct exposure of the public to scattered or leakage radiation from the source and to induced radioactivity in baggage items. Under normal operation and the most likely accident scenarios, the environmental impacts that would be created by the proposed licensing action would not be significant. 44 refs., 19 figs., 18 tabs.

  19. Chelation and stabilization of berkelium in oxidation state +IV (United States)

    Deblonde, Gauthier J.-P.; Sturzbecher-Hoehne, Manuel; Rupert, Peter B.; An, Dahlia D.; Illy, Marie-Claire; Ralston, Corie Y.; Brabec, Jiri; de Jong, Wibe A.; Strong, Roland K.; Abergel, Rebecca J.


    Berkelium (Bk) has been predicted to be the only transplutonium element able to exhibit both +III and +IV oxidation states in solution, but evidence of a stable oxidized Bk chelate has so far remained elusive. Here we describe the stabilization of the heaviest 4+ ion of the periodic table, under mild aqueous conditions, using a siderophore derivative. The resulting Bk(IV) complex exhibits luminescence via sensitization through an intramolecular antenna effect. This neutral Bk(IV) coordination compound is not sequestered by the protein siderocalin—a mammalian metal transporter—in contrast to the negatively charged species obtained with neighbouring trivalent actinides americium, curium and californium (Cf). The corresponding Cf(III)-ligand-protein ternary adduct was characterized by X-ray diffraction analysis. Combined with theoretical predictions, these data add significant insight to the field of transplutonium chemistry, and may lead to innovative Bk separation and purification processes.

  20. The CARIBU EBIS control and synchronization system (United States)

    Dickerson, Clayton; Peters, Christopher


    The Californium Rare Isotope Breeder Upgrade (CARIBU) Electron Beam Ion Source (EBIS) charge breeder has been built and tested. The bases of the CARIBU EBIS electrical system are four voltage platforms on which both DC and pulsed high voltage outputs are controlled. The high voltage output pulses are created with either a combination of a function generator and a high voltage amplifier, or two high voltage DC power supplies and a high voltage solid state switch. Proper synchronization of the pulsed voltages, fundamental to optimizing the charge breeding performance, is achieved with triggering from a digital delay pulse generator. The control system is based on National Instruments realtime controllers and LabVIEW software implementing Functional Global Variables (FGV) to store and access instrument parameters. Fiber optic converters enable network communication and triggering across the platforms.

  1. Off-line commissioning of EBIS and plans for its integration into ATLAS and CARIBU

    Energy Technology Data Exchange (ETDEWEB)

    Ostroumov, P. N., E-mail:; Barcikowski, A.; Dickerson, C. A.; Mustapha, B.; Perry, A.; Sharamentov, S. I.; Vondrasek, R. C.; Zinkann, G. [Argonne National Laboratory, Argonne, Illinois 60439 (United States)


    An Electron Beam Ion Source Charge Breeder (EBIS-CB) has been developed at Argonne to breed radioactive beams from the CAlifornium Rare Isotope Breeder Upgrade (CARIBU) facility at Argonne Tandem Linac Accelerator System (ATLAS). The EBIS-CB will replace the existing ECR charge breeder to increase the intensity and significantly improve the purity of reaccelerated radioactive ion beams. The CARIBU EBIS-CB has been successfully commissioned offline with an external singly charged cesium ion source. The performance of the EBIS fully meets the specifications to breed rare isotope beams delivered from CARIBU. The EBIS is being relocated and integrated into ATLAS and CARIBU. A long electrostatic beam transport system including two 180° bends in the vertical plane has been designed. The commissioning of the EBIS and the beam transport system in their permanent location will start at the end of this year.

  2. Populations of selected microbial and fungal species growing on the surface of rape seeds following treatment with desiccants or plant growth regulators. (United States)

    Frac, Magdalena; Jezierska-Tys, Stefania; Tys, Jerzy


    The aim of this study was to determine the effects of desiccants and plant growth regulators on selected microbial species affecting rape seeds, with special emphasis on the growth of fungi and identification of the genus and species composition. The experimental material in the study was seeds of winter rape cv. Californium that were collected from the field during combine harvest. The chemical agents applied, both desiccants and growth regulators, generally decreased the populations of bacteria occurring on the surface of rape seeds. The responses of fungi depended upon the type of agent applied and were manifested as either stimulation or inhibition of the growth of the fungal species. The fungi isolated from the surface of rape seeds were characteristic of those found in the field environment (Cladosporium and Penicillium) and typical for those present on the surface of rape seeds (Alternaria).

  3. Reliability of semiconductor and gas-filled diodes for over-voltage protection exposed to ionizing radiation

    Directory of Open Access Journals (Sweden)

    Stanković Koviljka


    Full Text Available The wide-spread use of semiconductor and gas-filled diodes for non-linear over-voltage protection results in a variety of possible working conditions. It is therefore essential to have a thorough insight into their reliability in exploitation environments which imply exposure to ionizing radiation. The aim of this paper is to investigate the influence of irradiation on over-voltage diode characteristics by exposing the diodes to californium-252 combined neutron/gamma radiation field. The irradiation of semiconductor over-voltage diodes causes severe degradation of their protection characteristics. On the other hand, gas-filled over-voltage diodes exhibit a temporal improvement of performance. The results are presented with the accompanying theoretical interpretations of the observed changes in over-voltage diode behaviour, based on the interaction of radiation with materials constituting the diodes.

  4. Triton and alpha-particle contribution from LiF converter for neutron dosimeter

    CERN Document Server

    Camacho, M E; Balcazar, M


    A personnel neutron dosimeter prototype based on chemical and electrochemical etched CR-39 detector, combined with LiF converter, has been calibrated using an ICRP-like phantom, under a heavy-water moderated Californium source neutron spectra; A conversion factor of 1.052+-126 spots cm sup - sup 2 mSv sup - sup 1 was obtained. The sealing properties of the detector holder showed a ten-fold reduction in radon background when it was tested in a high radon atmosphere. A convenient mechanical shock resistance was achieved in LiF converters by sintering to 11 tons pressure LiF powder at 650 deg. C, during one hour.

  5. Study of reproducibility of measurements with the spectrometer of Bonner multispheres

    Energy Technology Data Exchange (ETDEWEB)

    Azevedo, G.A.; Pereira, W.W.; Patrao, K.C.S.; Fonseca, E.S., E-mail:, E-mail:, E-mail:, E-mail: [Instituto de Radionprotecao e Dosimetria (IRD/CNEN-RJ), Rio de Janeiro, RJ (Brazil)


    This work aims to study the metrological behavior of the Bonner Multisphere Spectrometer (BMS) of the LN / LNMRI / IRD - Laboratorio Metrologia de Neutrons / Laboratorio Nacional de Metrologia e Radiacao Ionizante / Instituto de Radioprotecao e Dosimetria, for measurements in repeatability and reproducibility conditions. Initially, a simulation was done by applying the Monte Carlo method, using the MCNP code and respecting the ISO 8529-1 (2001), using the sources of Californium ({sup 252} Cf), Americium-Beryllium ({sup 241} AmBe) and californium in heavy water (Cf + D{sub 2}O), all located at a distance of 100 cm from the neutron detector ({sup 6}Li (Eu) - crystal scintillator). In this program, the counting of neutrons that are captured by the detector was made. The source is located in the center of a sphere of radius 300 cm. Analyzes the impact of these neutrons in a point of the sphere wall, which in this case acted as a neutron detector and from there, it is estimated the number of neutrons that collide in the whole sphere. The purpose is to obtain the neutron count for different energy bands in a solid field of neutrons, since they have a spectrum ranging from a low to a high energy that can also vary within a particular environment. Wishes to obtain new fields with different sources and moderators materials to be used as new reference fields. Measurements are being conducted for these fields, with the aim of analyzing the variability conditions of the measurement (repeatability and reproducibility) in LEN - Laboratorio de Espectrometria de Neutrons of the LN/LMNRI/IRD. Thus, the spectrometer will be used to improve both the knowledge of the spectrum as the standard of neutrons of the lab, proving that a spectrometry is essential for correct measurement.

  6. Plutonium, 137Cs and uranium isotopes in Mongolian surface soils. (United States)

    Hirose, K; Kikawada, Y; Igarashi, Y; Fujiwara, H; Jugder, D; Matsumoto, Y; Oi, T; Nomura, M


    Plutonium (238Pu and 239,240Pu), 137Cs and plutonium activity ratios (238Pu/239,240Pu) as did uranium isotope ratio (235U/238U) were measured in surface soil samples collected in southeast Mongolia. The 239,240Pu and 137Cs concentrations in Mongolian surface soils (<53 μm of particle size) ranged from 0.42 ± 0.03 to 3.53 ± 0.09 mBq g-1 and from 11.6 ± 0.7 to 102 ± 1 mBq g-1, respectively. The 238Pu/239,240Pu activity ratios in the surface soils (0.013-0.06) coincided with that of global fallout. The 235U/238U atom ratios in the surface soil show the natural one. There was a good correlation between the 239,240Pu and 137Cs concentrations in the surface soils. We introduce the migration depth to have better understanding of migration behaviors of anthropogenic radionuclides in surface soil. We found a difference of the migration behavior between 239,240Pu and 137Cs from 137Cs/239,240Pu - 137Cs plots for the Mongolian and Tsukuba surface soils; plutonium in surface soil is migrated easier than 137Cs. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Experiments at the GELINA facility for the validation of the self-indication neutron resonance densitometry technique

    Directory of Open Access Journals (Sweden)

    Rossa Riccardo


    Full Text Available Self-Indication Neutron Resonance Densitometry (SINRD is a passive non-destructive method that is being investigated to quantify the 239Pu content in a spent fuel assembly. The technique relies on the energy dependence of total cross sections for neutron induced reaction. The cross sections show resonance structures that can be used to quantify the presence of materials in objects, e.g. the total cross-section of 239Pu shows a strong resonance close to 0.3 eV. This resonance will cause a reduction of the number of neutrons emitted from spent fuel when 239Pu is present. Hence such a reduction can be used to quantify the amount of 239Pu present in the fuel. A neutron detector with a high sensitivity to neutrons in this energy region is used to enhance the sensitivity to 239Pu. This principle is similar to self-indication cross section measurements. An appropriate detector can be realized by surrounding a 239Pu-loaded fission chamber with appropriate neutron absorbing material. In this contribution experiments performed at the GELINA time-of-flight facility of the JRC at Geel (Belgium to validate the simulations are discussed. The results confirm that the strongest sensitivity to the target material was achieved with the self-indication technique, highlighting the importance of using a 239Pu fission chamber for the SINRD measurements.

  8. Healthcare- and Community-Associated Methicillin-Resistant Staphylococcus aureus (MRSA) and Fatal Pneumonia with Pediatric Deaths in Krasnoyarsk, Siberian Russia: Unique MRSA's Multiple Virulence Factors, Genome, and Stepwise Evolution. (United States)

    Khokhlova, Olga E; Hung, Wei-Chun; Wan, Tsai-Wen; Iwao, Yasuhisa; Takano, Tomomi; Higuchi, Wataru; Yachenko, Svetlana V; Teplyakova, Olga V; Kamshilova, Vera V; Kotlovsky, Yuri V; Nishiyama, Akihito; Reva, Ivan V; Sidorenko, Sergey V; Peryanova, Olga V; Reva, Galina V; Teng, Lee-Jene; Salmina, Alla B; Yamamoto, Tatsuo


    Methicillin-resistant Staphylococcus aureus (MRSA) is a common multidrug-resistant (MDR) pathogen. We herein discussed MRSA and its infections in Krasnoyarsk, Siberian Russia between 2007 and 2011. The incidence of MRSA in 3,662 subjects was 22.0% and 2.9% for healthcare- and community-associated MRSA (HA- and CA-MRSA), respectively. The 15-day mortality rates for MRSA hospital- and community-acquired pneumonia (HAP and CAP) were 6.5% and 50%, respectively. MRSA CAP cases included pediatric deaths; of the MRSA pneumonia episodes available, ≥27.3% were associated with bacteremia. Most cases of HA-MRSA examined exhibited ST239/spa3(t037)/SCCmecIII.1.1.2 (designated as ST239Kras), while all CA-MRSA cases examined were ST8/spa1(t008)/SCCmecIV.3.1.1(IVc) (designated as ST8Kras). ST239Kras and ST8Kras strongly expressed cytolytic peptide (phenol-soluble modulin α, PSMα; and δ-hemolysin, Hld) genes, similar to CA-MRSA. ST239Kras pneumonia may have been attributed to a unique set of multiple virulence factors (MVFs): toxic shock syndrome toxin-1 (TSST-1), elevated PSMα/Hld expression, α-hemolysin, the staphylococcal enterotoxin SEK/SEQ, the immune evasion factor SCIN/SAK, and collagen adhesin. Regarding ST8Kras, SEA was included in MVFs, some of which were common to ST239Kras. The ST239Kras (strain OC3) genome contained: a completely unique phage, φSa7-like (W), with no att repetition; S. aureus pathogenicity island SaPI2R, the first TSST-1 gene-positive (tst+) SaPI in the ST239 lineage; and a super copy of IS256 (≥22 copies/genome). ST239Kras carried the Brazilian SCCmecIII.1.1.2 and United Kingdom-type tst. ST239Kras and ST8Kras were MDR, with the same levofloxacin resistance mutations; small, but transmissible chloramphenicol resistance plasmids spread widely enough to not be ignored. These results suggest that novel MDR and MVF+ HA- and CA-MRSA (ST239Kras and ST8Kras) emerged in Siberian Russia (Krasnoyarsk) associated with fatal pneumonia, and also with ST

  9. Seaborg's Plutonium?


    Norman, Eric B.; Thomas, Keenan J.; Telhami, Kristina E.


    Passive x-ray and gamma-ray analysis was performed on UC Berkeley's EH&S Sample S338. The object was found to contain Pu-239 and no other radioactive isotopes. The mass of Pu-239 contained in this object was determined to be 2.0 +- 0.3 micrograms. These observations are consistent with the identification of this object being the 2.77-microgram plutonium oxide sample described by Glenn Seaborg and his collaborators as the first sample of Pu-239 that was large enough to be weighed.

  10. Seaborg's Plutonium ?

    CERN Document Server

    Norman, Eric B; Telhami, Kristina E


    Passive x-ray and gamma-ray analysis was performed on UC Berkeley's EH&S Sample S338. The object was found to contain Pu-239 and no other radioactive isotopes. The mass of Pu-239 contained in this object was determined to be 2.0 +- 0.3 micrograms. These observations are consistent with the identification of this object being the 2.77-microgram plutonium oxide sample described by Glenn Seaborg and his collaborators as the first sample of Pu-239 that was large enough to be weighed.

  11. Brewing properties of clotrimazole-resistant mutants isolated from sake yeast.


    広畑, 修二; 渡辺, 睦; 西村, 顕; 近藤, 恭一; SHUJI, HIROHATA; MUTSUMI, WATANABE; AKIRA, NISHIMURA; KYOICHI, KONDO; 白鶴酒造(株)研究室; 白鶴酒造(株)研究室; 白鶴酒造(株)研究室; 白鶴酒造(株)研究室; Research Laboratory, Hakutsuru Sake Brewing Co., Ltd.,; Research Laboratory, Hakutsuru Sake Brewing Co., Ltd.,; Research Laboratory, Hakutsuru Sake Brewing Co., Ltd.,


    High fermentative activity mutants were selected from among sake yeast mutants resistant to clotrimazole(CTZ)by means of small-scale sake brewing tests. CTZ239 had the highest fermentative activity among these mutants, and the sake brewed with it was of good quality. Industrial-scale brewing tests were conducted with CTZ239 and the parent strain K1001. With CTZ239 the decrease in specific gravity and production of alcohol were so rapid that the fermentation of the sake mash was accomplished i...

  12. Healthcare- and Community-Associated Methicillin-Resistant Staphylococcus aureus (MRSA) and Fatal Pneumonia with Pediatric Deaths in Krasnoyarsk, Siberian Russia: Unique MRSA's Multiple Virulence Factors, Genome, and Stepwise Evolution (United States)

    Khokhlova, Olga E.; Hung, Wei-Chun; Wan, Tsai-Wen; Iwao, Yasuhisa; Takano, Tomomi; Higuchi, Wataru; Yachenko, Svetlana V.; Teplyakova, Olga V.; Kamshilova, Vera V.; Kotlovsky, Yuri V.; Nishiyama, Akihito; Reva, Ivan V.; Sidorenko, Sergey V.; Peryanova, Olga V.; Reva, Galina V.; Teng, Lee-Jene; Salmina, Alla B.; Yamamoto, Tatsuo


    Methicillin-resistant Staphylococcus aureus (MRSA) is a common multidrug-resistant (MDR) pathogen. We herein discussed MRSA and its infections in Krasnoyarsk, Siberian Russia between 2007 and 2011. The incidence of MRSA in 3,662 subjects was 22.0% and 2.9% for healthcare- and community-associated MRSA (HA- and CA-MRSA), respectively. The 15-day mortality rates for MRSA hospital- and community-acquired pneumonia (HAP and CAP) were 6.5% and 50%, respectively. MRSA CAP cases included pediatric deaths; of the MRSA pneumonia episodes available, ≥27.3% were associated with bacteremia. Most cases of HA-MRSA examined exhibited ST239/spa3(t037)/SCCmecIII.1.1.2 (designated as ST239Kras), while all CA-MRSA cases examined were ST8/spa1(t008)/SCCmecIV.3.1.1(IVc) (designated as ST8Kras). ST239Kras and ST8Kras strongly expressed cytolytic peptide (phenol-soluble modulin α, PSMα; and δ-hemolysin, Hld) genes, similar to CA-MRSA. ST239Kras pneumonia may have been attributed to a unique set of multiple virulence factors (MVFs): toxic shock syndrome toxin-1 (TSST-1), elevated PSMα/Hld expression, α-hemolysin, the staphylococcal enterotoxin SEK/SEQ, the immune evasion factor SCIN/SAK, and collagen adhesin. Regarding ST8Kras, SEA was included in MVFs, some of which were common to ST239Kras. The ST239Kras (strain OC3) genome contained: a completely unique phage, φSa7-like (W), with no att repetition; S. aureus pathogenicity island SaPI2R, the first TSST-1 gene-positive (tst+) SaPI in the ST239 lineage; and a super copy of IS256 (≥22 copies/genome). ST239Kras carried the Brazilian SCCmecIII.1.1.2 and United Kingdom-type tst. ST239Kras and ST8Kras were MDR, with the same levofloxacin resistance mutations; small, but transmissible chloramphenicol resistance plasmids spread widely enough to not be ignored. These results suggest that novel MDR and MVF+ HA- and CA-MRSA (ST239Kras and ST8Kras) emerged in Siberian Russia (Krasnoyarsk) associated with fatal pneumonia, and also with ST

  13. Healthcare- and Community-Associated Methicillin-Resistant Staphylococcus aureus (MRSA and Fatal Pneumonia with Pediatric Deaths in Krasnoyarsk, Siberian Russia: Unique MRSA's Multiple Virulence Factors, Genome, and Stepwise Evolution.

    Directory of Open Access Journals (Sweden)

    Olga E Khokhlova

    Full Text Available Methicillin-resistant Staphylococcus aureus (MRSA is a common multidrug-resistant (MDR pathogen. We herein discussed MRSA and its infections in Krasnoyarsk, Siberian Russia between 2007 and 2011. The incidence of MRSA in 3,662 subjects was 22.0% and 2.9% for healthcare- and community-associated MRSA (HA- and CA-MRSA, respectively. The 15-day mortality rates for MRSA hospital- and community-acquired pneumonia (HAP and CAP were 6.5% and 50%, respectively. MRSA CAP cases included pediatric deaths; of the MRSA pneumonia episodes available, ≥27.3% were associated with bacteremia. Most cases of HA-MRSA examined exhibited ST239/spa3(t037/SCCmecIII.1.1.2 (designated as ST239Kras, while all CA-MRSA cases examined were ST8/spa1(t008/SCCmecIV.3.1.1(IVc (designated as ST8Kras. ST239Kras and ST8Kras strongly expressed cytolytic peptide (phenol-soluble modulin α, PSMα; and δ-hemolysin, Hld genes, similar to CA-MRSA. ST239Kras pneumonia may have been attributed to a unique set of multiple virulence factors (MVFs: toxic shock syndrome toxin-1 (TSST-1, elevated PSMα/Hld expression, α-hemolysin, the staphylococcal enterotoxin SEK/SEQ, the immune evasion factor SCIN/SAK, and collagen adhesin. Regarding ST8Kras, SEA was included in MVFs, some of which were common to ST239Kras. The ST239Kras (strain OC3 genome contained: a completely unique phage, φSa7-like (W, with no att repetition; S. aureus pathogenicity island SaPI2R, the first TSST-1 gene-positive (tst+ SaPI in the ST239 lineage; and a super copy of IS256 (≥22 copies/genome. ST239Kras carried the Brazilian SCCmecIII.1.1.2 and United Kingdom-type tst. ST239Kras and ST8Kras were MDR, with the same levofloxacin resistance mutations; small, but transmissible chloramphenicol resistance plasmids spread widely enough to not be ignored. These results suggest that novel MDR and MVF+ HA- and CA-MRSA (ST239Kras and ST8Kras emerged in Siberian Russia (Krasnoyarsk associated with fatal pneumonia, and also with ST

  14. Book Review: Qualitative-Quantitative Analyses of Dutch and ...

    African Journals Online (AJOL)

    Abstract. Book Title: Qualitative-Quantitative Analyses of Dutch and Afrikaans Grammar and Lexicon. Book Author: Robert S. Kirsner. 2014. John Benjamins Publishing Company ISBN 9789027215772, price ZAR481.00. 239 pages ...

  15. Assessment of Paleozoic shale gas resources in the Sichuan Basin of China, 2015 (United States)

    Potter, Christopher J.; Schenk, Christopher J.; Charpentier, Ronald R.; Gaswirth, Stephanie B.; Klett, Timothy R.; Leathers, Heidi M.; Brownfield, Michael E.; Mercier, Tracey J.; Tennyson, Marilyn E.; Pitman, Janet K.


    Using a geology-based assessment methodology, the U.S. Geological Survey estimated a mean of 23.9 trillion cubic feet of technically recoverable shale gas resources in Paleozoic formations in the Sichuan Basin of China.

  16. Acute subdural hematoma, Head injury, Functional reco

    African Journals Online (AJOL)


    TRAUMATIQUES AU KENYA: .... died during admission as compared to 8% mortality in patients with no history of loss of consciousness ... who remained conscious as compared to 40.6% and 23.9% of those who lost consciousness following.

  17. K některým otázkám etnochoreologického studia: tanec, gender a politika

    Czech Academy of Sciences Publication Activity Database

    Stavělová, Daniela


    Roč. 20, č. 4 (2010), s. 239-243 ISSN 0862-8351 Institutional research plan: CEZ:AV0Z90580513 Keywords : dance * gender * politics * national movement * identity Subject RIV: AC - Archeology, Anthropology, Ethnology

  18. Renger E. de Bruin, Bedreigd door Napoleon. De Ridderlijke Duitsche Orde, Balije van Utrecht 1753-1838

    Directory of Open Access Journals (Sweden)

    Egbert Wolleswinkel


    Full Text Available Koenraad Brosens, Leen Kelchtermans, Katlijne Van der Stighelen (eds., Family Ties: Art Production and Kinship Patterns in the Early Modern Low Countries (Turnhout: Brepols, 2012, 239 pp., ISBN 978 2 503 54227 0.

  19. Estimating the Critical Mass of a Fissionable Isotope (United States)

    Reed, B. Cameron


    A method utilizing only basic nuclear physics and one-dimensional integration is developed for estimating the critical mass of a fissionable isotope. Application to U-235 and Pu-239 gives results in excellent agreement with published values.

  20. Why Are Drugs So Hard to Quit?

    Medline Plus

    Full Text Available ... now. Please try again later. Published on Feb 7, 2012 Quitting drugs is hard because addiction is ... is wrong | Johann Hari - Duration: 14:43. TED 3,569,239 views 14:43 Addiction - Duration: 5: ...

  1. Results from the 2013 National Survey on Drug Use and Health: Mental Health Findings (United States)

    ... Not Hispanic or Latino Whites) West South Central Mountain Pacific Table B.2 – Summary of 2013 NSDUH ... and positive youth development: Competitive or cooperative frameworks? Journal of Adolescent Health , 31 (6 Suppl.), 230-239. ...

  2. High resolution gamma-ray spectrometry of culverts containing transuranic waste at the Savannah River Site

    Energy Technology Data Exchange (ETDEWEB)

    Hofstetter, K.J.; Sigg, R.


    A number of concrete culverts used to retrievably store drummed, dry, radioactive waste at the Savannah River Site (SRS), were suspected of containing ambiguous quantities of transuranic (TRU) nuclides. These culverts were assayed in place for Pu-239 content using thermal and fast neutron counting techniques. High resolution gamma-ray spectroscopy on 17 culverts, having neutron emission rates several times higher than expected, showed characteristic gamma-ray signatures of neutron emitters other than Pu-239 (e.g., Pu-238, Pu/Be, or Am/Be neutron sources). This study confirmed the Pu-239 content of the culverts with anomalous neutron rates and established limits on the Pu-239 mass in each of the 17 suspect culverts by in-field, non-intrusive gamma-ray measurements.

  3. the clinical anatomy of the insertion of the rotator cuff tendons

    African Journals Online (AJOL)


    Sep 7, 2016 ... Correspondence to Dr. Martie Vosloo, Department of Anatomy, Faculty of Health Sciences, University .... Sciences. Student. Ethics. Committee. (239/2015). The cadaveric shoulders were obtained ..... Gray's Anatomy. 37th Ed.

  4. 48 CFR 204.7000 - Scope. (United States)


    ..., contracts, and related instruments; and (b) Does not apply to solicitations or orders for communication service authorizations issued by the Defense Information Technology Contracting Organization of the Defense Information Systems Agency in accordance with 239.7407-2. ...

  5. FastStats: Viral Hepatitis (United States)

    ... Submit What's this? Submit Button NCHS Home Viral Hepatitis Recommend on Facebook Tweet Share Compartir Data are for the U.S. Morbidity Number of new hepatitis A cases: 1,239 (2014) Number of new ...

  6. Relationship between craniofacial morphology and occlusal plane in adult males

    National Research Council Canada - National Science Library

    Hashimoto, Noboru; Matsumoto, Naoyuki; Iida, Takuji; Kawamoto, Tatsuo; Nakajima, Masahiro


    .... We measured the maxillofacial complex and occlusal plane on standardized lateral cephalograms of 239 male students and analyzed the potential relation-ship of these measurements with the mandibular plane angle...

  7. 76 FR 51424 - Satinder Dang, M.D.; Revocation of Registration (United States)


    ... also found that Respondent is ``still engaged in an ongoing working relationship with ,'' id. at 32....K.'s. Id. at 239-40. \\10\\ The transcript notes the coworker's initials as C.G.; however, other...

  8. African Zoology - Vol 29, No 4 (1994)

    African Journals Online (AJOL)

    Descriptions of two new earthworm species, Iridodrilus abujaensis and Iridodrilus furcothecata (Eudrilidae: Oligochaeta: Annelida) from Nigeria · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. S.O. Owa, 235-239 ...

  9. Book Review: The mission of preaching: equipping the community ...

    African Journals Online (AJOL)

    Abstract. Book Title: The mission of preaching: equipping the community for faithful witness. Book Author: P.W.T. Johnson. Downers Grove: IVP Academic, 2015). 239 pp. Price: R369 ISBN: 978-0-8308-4070-0 ...

  10. Electrical Safety for Non-Electricians (United States)

    HAZARD ALERT ELSEACFTERTICYAL For Non-electricians Electrical current is unforgiving. Electrocutions happen in less than a second. In 2010, 239 construction workers were killed by electricity.* More than 2/ ...

  11. Gclust Server: 77978 [Gclust Server

    Lifescience Database Archive (English)

    Full Text Available Sequences Related Sequences(239) 359 NP_036338.1 hepatitis A virus cellular receptor 1 ; no annotation 1...length 359 Representative annotation NP_036338.1 hepatitis A virus cellular receptor 1 ; no annotation Number

  12. Influence of radiation and non-radiation factors on pancreatic cancer incidence among Mayak PA workers

    Energy Technology Data Exchange (ETDEWEB)

    Zhuntova, G.V.; Tokarskaya, Z.B.; Belyaeva, Z.D. [Southern Ural Biophysics Institute (SUBI), Ozyorsk (Russian Federation); Syrchikov, V.A.; Grigoryeva, E.S. [Mayak Production Association (Mayak PA), Ozyorsk (Russian Federation)


    The finding of this nested case-control study suggests that high levels of 239 Pu incorporation (239 Pu body burden > 3.7), alcohol abuse and smoking were associated with increasing the risk of pancreatic cancer among Mayak PA workers chronically exposed to ionizing radiation. The contribution of non radiation factors (alcohol abuse and smoking) to pancreatic tumor incidence is greater (AR=51%) than 239 Pu incorporation kBq; AR = 7%). No significant effect of external gamma rays ({<=} 6.8 Gy), prior exposure to chemical agents, or chronic digestive diseases was found on the incidence of pancreatic tumor. Evaluation of the absorbed alpha-radiation pancreatic dose will permit to make more exact the 239 Pu risk estimation in the further extended study.

  13. Heterogeneity in development of adolescent anxiety disorder symptoms in an 8-year longitudinal community study

    NARCIS (Netherlands)

    Nelemans, Stefanie A.; Hale, William W.; Branje, Susan J. T.; Raaijmakers, Quinten A. W.; Frijns, Tom; van Lier, Pol A. C.; Meeus, Wim H. J.


    In this study, we prospectively examined developmental trajectories of five anxiety disorder symptom dimensions (generalized anxiety disorder, panic disorder, school anxiety, separation anxiety disorder, and social anxiety disorder) from early to late adolescence in a community sample of 239

  14. 78 FR 4469 - Biweekly Notice; Applications and Amendments to Facility Operating Licenses and Combined Licenses... (United States)


    ..., Pilgrim Nuclear Power Station (Pilgrim), Plymouth County, Massachusetts Entergy Nuclear Vermont Yankee...--193; IP2--271; IP3--248; Palisades-- ] 249; Pilgrim--239; RBS--178; VY--253; and Waterford--240...

  15. Sensitization of Secondary School Students towards Sustainable ...

    African Journals Online (AJOL)



    Jul 26, 2012 ... Sensitization of Secondary School Students towards. Sustainable Electoral Process in Nigeria: Nigeria. Independent Electoral Commission as a Focus. (Pp. 239-251). Uhunmwuangho, Sunday Okungbowa - Lecturer, Institute of Public. Administration & Extension Services, University of Benin, Benin City,.

  16. Cryptosporidium meleagridis infection: the first report in Poland of its occurrence in an HIV-positive woman

    Czech Academy of Sciences Publication Activity Database

    Wesołowska, M.; Szostakowska, B.; Kicia, M.; Sak, Bohumil; Kváč, Martin; Knysz, B.


    Roč. 62, č. 3 (2016), s. 239-241 ISSN 2299-0631 Institutional support: RVO:60077344 Keywords : Cryptosporidium meleagridis * HIV * AIDS * opportunistic parasites * immunocompromised patients Subject RIV: FN - Epidemiology, Contagious Diseases ; Clinical Immunology

  17. Dicty_cDB: SFH683 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ratti cDNA 5' similar to SW:TER2_CAEEL P54812 TRANSITIONAL ENDOPLASMIC RETICULUM ATPASE HOMOLOG 2 ;, mRNA...cDNA c... 249 e-108 ( P54812 ) RecName: Full=Transitional endoplasmic reticulum ATPase... 235 e-108 FB906005_1(...cDNA, RIK... 239 e-108 S25197( S25197 ;S30329) transitional endoplasmic reticulum ATPase ... 239 e-108

  18. A Study of Factors Affecting the Retention of Civilian Registered Nurses in the Army Medical Department (United States)


    significant changes occur in satisfaction or expected utilities. Hellriegel and White demonstrated that, in 60 percent of the turnovers in their study...Between Job Satisfaction and Employee Turnover," Journal of Applied Psychology 62 (February 1977): 237-239. 5D. Hellriegel and G. E. White, "Turnover of... Hellriegel , D., and White, G. E. "Turnover of Professionals in Public Accounting: A Comparative Analysis," Personnel Psychology 26 (1973): 239-249

  19. Mortality and kidney histopathology of Chinook salmon Oncorhynchus tshawytscha exposed to virulent and attenuated Renibacterium salmoninarum strains (United States)

    O'Farrell, Caroline L.; Elliott, Diane G.; Landolt, Marsha L.


    An isolate of Renibacterium salmoninarum (strain MT 239) exhibiting reduced virulence in rainbow trout Oncorhynchus mykiss was tested for its ability to cause bacterial kidney disease (BKD) in chinook salmon Oncorhynchus tshawytscha, a salmonid species more susceptible to BKD. Juvenile chinook salmon were exposed to either 33209, the American Type Culture Collection type strain of R. salmoninarum, or to MT 239, by an intraperitoneal injection of 1 x 10(3) or 1 x 10(6) bacteria fish(-1), or by a 24 h immersion in 1 x 10(5) or 1 x 10(7) bacteria ml(-1). For 22 wk fish were held in 12 degrees C water and monitored for mortality. Fish were sampled periodically for histological examination of kidney tissues. In contrast to fish exposed to the high dose of strain 33209 by either injection or immersion, none of the fish exposed to strain MT 239 by either route exhibited gross clinical signs or histopathological changes indicative of BKD. However, the MT 239 strain was detected by the direct fluorescent antibody technique in 4 fish that died up to 11 wk after the injection challenge and in 5 fish that died up to 20 wk after the immersion challenge. Viable MT 239 was isolated in culture from 3 fish that died up to 13 wk after the immersion challenge. Total mortality in groups injected with the high dose of strain MT 239 (12%) was also significantly lower (p < 0.05) than mortality in groups injected with strain 33209 (73 %). These data indicate that the attenuated virulence observed with MT 239 in rainbow trout also occurs in a salmonid species highly susceptible to BKD. The reasons for the attenuated virulence of MT 239 were not determined but may be related to the reduced levels of the putative virulence protein p57 associated with this strain.

  20. Isotope dilution gamma spectrometry for Pu using low energy photons

    Energy Technology Data Exchange (ETDEWEB)

    Paul, S.; Sarkar, A.; Alamelu, D.; Shah, R.V.; Aggarwal, S.K. [Bhabha Atomic Reseach Centre, Mumbai (India). Fuel Chemistry Div.


    Isotope dilution gamma spectrometry (IDGS) for determination of the Pu concentration, using high resolution gamma-ray spectrometry (HRGS) in the 40-150 keV energy range, is developed and described. The methodology involves purification of Pu by an anion exchange procedure, followed by the determination of Pu isotopic composition using HRGS. For isotope dilution, a pre-calibrated power reactor grade Pu ({proportional_to} 70 at. % {sup 239}Pu) solution from an Indian PHWR was used as a spike for research reactor grade Pu ({proportional_to} 95 at. % {sup 239}Pu) samples and vice versa. Changes in {sup 240}Pu/{sup 239}Pu (45.24 keV/51.62 keV) and {sup 241}Pu/{sup 239}Pu (148.57 keV/129.29 keV) activity ratios in the spiked samples were determined by gamma spectrometry. Using the atom ratios calculated from the measured activity ratios, the concentration of Pu in the sample was calculated using two different efficiency calibration methods. The isotopic composition and concentration of Pu samples both from power reactor and research reactor grade agreed well with the values obtained by isotope dilution-thermal ionization mass spectrometry. The present method also shows the superiority of using the {sup 240}Pu/{sup 239}Pu atom ratio against the {sup 241}Pu/{sup 239}Pu atom ratio in IDGS with respect to the accuracy and precision. (orig.)