High diversity of vacA and cagA Helicobacter pylori genotypes in patients with and without gastric cancer.

Directory of Open Access Journals (Sweden)

Yolanda López-Vidal

Full Text Available BACKGROUND: Helicobacter pylori is associated with chronic gastritis, peptic ulcers, and gastric cancer. The aim of this study was to assess the topographical distribution of H. pylori in the stomach as well as the vacA and cagA genotypes in patients with and without gastric cancer. METHODOLOGY/PRINCIPAL FINDINGS: Three gastric biopsies, from predetermined regions, were evaluated in 16 patients with gastric cancer and 14 patients with dyspeptic symptoms. From cancer patients, additional biopsy specimens were obtained from tumor centers and margins; among these samples, the presence of H. pylori vacA and cagA genotypes was evaluated. Positive H. pylori was 38% and 26% in biopsies obtained from the gastric cancer and non-cancer groups, respectively (p = 0.008, and 36% in tumor sites. In cancer patients, we found a preferential distribution of H. pylori in the fundus and corpus, whereas, in the non-cancer group, the distribution was uniform (p = 0.003. A majority of the biopsies were simultaneously cagA gene-positive and -negative. The fundus and corpus demonstrated a higher positivity rate for the cagA gene in the non-cancer group (p = 0.036. A mixture of cagA gene sizes was also significantly more frequent in this group (p = 0.003. Ninety-two percent of all the subjects showed more than one vacA gene genotype; s1b and m1 vacA genotypes were predominantly found in the gastric cancer group. The highest vacA-genotype signal-sequence diversity was found in the corpus and 5 cm from tumor margins. CONCLUSION/SIGNIFICANCE: High H. pylori colonization diversity, along with the cagA gene, was found predominantly in the fundus and corpus of patients with gastric cancer. The genotype diversity observed across systematic whole-organ and tumor sampling was remarkable. We find that there is insufficient evidence to support the association of one isolate with a specific disease, due to the multistrain nature of H. pylori infection shown in this work.

Infecção por Helicobacter pylori e câncer gástrico: freqüência de cepas patogênicas cagA e vacA em pacientes com câncer gástrico Helicobacter pylori and gastric cancer: distribution of cagA and vacA genotypes in patients with gastric carcinoma

Directory of Open Access Journals (Sweden)

Cristiane Melissa Thomazini

2006-02-01

the human stomach by pathogenic Helicobacter pylori strains. OBJECTIVE: To investigate the distribution of cagA and vacA genotypes of Helicobacter pylori in paraffin-embedded gastric samples from patients with gastric cancer. MATERIAL AND METHODS: Paraffin-embedded samples from 42 patients with gastric cancer were histologically examined and evaluated by PCR for H. pylori cagA and vacA (s and m regions genotypes. RESULTS: Histological analysis allowed direct visualization of H. pylori in 85.7% of cases and PCR for urease C gene detected H. pylori in 95% of cases. The presence of cagA gene was detected in 23 (54.7% patients with gastric cancer. The s1 allele from vacA gene was found in samples from 24 (57.1% patients and the m1 allele in 26 (61.9 %. The s1m1 genotype was detected in 24 (57.1% patients with gastric cancer. The s2 allele was found in samples from four patients (9.5% and the m2 allele in three (7.1% patients. The distribution of H. pylori genotypes was similar in both intestinal and diffuse types of gastric carcinoma. CONCLUSION: Our results confirm the relevance of the pathogenic cagA and vacA H. pylori genotypes for significant organic lesions, such as gastric cancer, suggesting a possible role for H. pylori in the pathogenesis of gastric carcinoma.

Different distribution of Helicobacter pylori EPIYA- cagA motifs and dupA genes in the upper gastrointestinal diseases and correlation with clinical outcomes in iranian patients.

Science.gov (United States)

Haddadi, Mohammad Hossein; Bazargani, Abdollah; Khashei, Reza; Fattahi, Mohammad Reza; Bagheri Lankarani, Kamran; Moini, Maryam; Rokni Hosseini, Seyed Mohammad Hossein

2015-01-01

Our aim was to determine the EPIYA-cagA Phosphorylation sites and dupA gene in H. pylori isolates among patients with upper gastrointestinal diseases. Pathogenicity of the cagA-positive Helicobacter pylori is associated with EPIYA motifs and higher number of EPIYA-C segments is a risk factor of gastric cancer, while duodenal ulcer-promoting gene (dupA) is determined as a protective factor against gastric cancer. A total of 280 non-repeated gastric biopsies obtained from patients undergoing endoscopy from January 2013 till July 2013. Samples were cultured on selective horse blood agar and incubated in microaerophilic atmosphere. The isolated organisms were identified as H. pylori by Gram staining and positive oxidase, catalase, and urease tests. Various motif types of cagA and the prevalence of dupA were determined by PCR method. Out of 280 specimens, 128 (54.7%) isolated organisms were identified as H. pylori. Of 120 H. pylori isolates, 35.9% were dupA positive and 56.26% were cagA positive, while cagA with ABC and ABCC motifs were 55.5% and 44.5%, respectively. Fifty six percent of the isolates with the ABCC motif have had dupA genes. We also found a significant association between strains with genotypes of dupA-ABC and duodenal ulcer disease (p = 0.007). The results of this study showed that the prevalence of cagA-positive H. pylori in Shiraz was as high as in western countries and higher numbers of EPIYA-C segments were seen in gastric cancer patients. We may also use dupA as a prognostic and pathogenic marker for duodenal ulcer disease and cagA with the segment C for gastric cancer and gastric ulcer disease in this region.

Distribution of Helicobacter pylori cagA, cagE and vacA in different ethnic groups in Kuala Lumpur, Malaysia.

Science.gov (United States)

Tan, Huck Joo; Rizal, Abdul Manaf; Rosmadi, Mohamed-Yusoff; Goh, Khean-Lee

2005-04-01

There is a geographic variation in Helicobacter pylori (HP) genotypes and virulence factors. Cytotoxin associated genes A (cagA) and E (cagE), and certain vacuolating cytotoxin (vacA) genotypes are associated with peptic ulcer disease (PUD). There is also a different prevalence of PUD among different ethnic groups in Malaysia. The present study compared the distribution of vacA alleles and cagA and cagE status in three ethnic groups residing in Kuala Lumpur, Malaysia, and their association with clinical outcome. All patients with cultured positive HP were recruited prospectively. DNA was extracted and polymerase chain reaction was carried out to determine the cagA and cagE status and vacA alleles. The results of 127 patients (72 men and 55 women) were included. The mean age was 55.53 +/- 12.52 years. The ethnic distribution was 59 Chinese, 38 Indian and 30 Malay patients. The predominant genotype was s1a among the Malay (76.6%) and Indian patients (71.0%), and s1c among the Chinese patients (66.1%). The vacA middle region sequence m1 was detected in 66.7% of Malay, 54.2% of Chinese and 76.3% of Indian patients. Of the Malay, Chinese and Indian patients, 76.6%, 86.4% and 86.8%, respectively, were cagA positive, and 70.0%, 39.0% and 81.6%, respectively, were cagE positve. HP cagA, cagE and vacA were not associated with PUD. There is a distinctive difference in the HP strains among the three ethnic groups in Malaysia. There was no association between cagA, cagE or vacA genotypes and clinical outcome in the patients. None of these markers are helpful in predicting the clinical presentation of a HP infection.

Relationship between New Allelic Types of Helicobacter pylori vacA Gene and cagA Status and Risk of GU or DU in Iran

Directory of Open Access Journals (Sweden)

S Bakhti

2015-09-01

Full Text Available Background & objectives: Several studies have described VacA and CagA as the two important virulence determinants of Helicobacter pylori, which are associated with gastric ulcer (GU and duodenal ulcer (DU. The aim of present study was to determine the associations of the i and d regions genotypes of H. pylori vacA gene and cagA status with GU and DU risk. Methods: A total of 177 isolates were cultured from the biopsies of Iranian patients with different geographic origins and genotyped. Data were collected and analyzed. Results: Frequency of the vacA i1, i2, i1i2, d1, and d2 alleles and cagA in all patients was 42.9%, 55.4%, 1.7%, 41.8%, 58.2% and 68.4%, respectively. There was a significant difference between the frequencies of vacA i1 in isolates from GU than those from non-atrophic gastritis (p<0.05. When the GU was considered as a dependant factor by the multiple logistic regression analysis, the vacA i1 genotype was significantly associated with the age- and sex-adjusted risk for GU (p=0.006, odds ratio [OR]=3.56 95% confidence interval [CI]=1.45–8.75. Statistical analysis showed no significant association between vacA d genotype and digestive diseases. After controlling for age and sex variables, the cagA genotype remained in the final model when the DU was considered as a dependant factor by the the multiple logistic regression analysis (p=0.021, OR=3.77 95% CI=1.22-11.60. Conclusion: We have proposed that the H. pylori vacA i1 and cagA genotypes could be considered as benefit biomarkers for prediction of risk of GU and DU in Iran, respectively.

CagA, a major virulence factor of Helicobacter pylori, promotes the production and underglycosylation of IgA1 in DAKIKI cells

Energy Technology Data Exchange (ETDEWEB)

Yang, Man [Department of Nephrology, The First Affiliated Hospital of Chengdu Medical College, Chengdu City 610500 (China); Li, Fu-gang [Department of Nephrology, Affiliated Hospital of Luzhou Medical College, Luzhou City 646000 (China); Xie, Xi-sheng [Department of Nephrology, Second Clinical Medical Institution of North Sichuan Medical College (Nanchong Central Hospital), Nanchong City 637400 (China); Wang, Shao-qing [Department of Nephrology, The First Affiliated Hospital of Chengdu Medical College, Chengdu City 610500 (China); Fan, Jun-ming, E-mail: junmingfan@163.com [Department of Nephrology, The First Affiliated Hospital of Chengdu Medical College, Chengdu City 610500 (China); Department of Nephrology, Affiliated Hospital of Luzhou Medical College, Luzhou City 646000 (China)

2014-02-07

Highlights: • CagA stimulated cell proliferation and the production of IgA1 in DAKIKI cells. • CagA promoted the underglycosylation of IgA1 in DAKIKI cells. • CagA decreased the expression of C1GALT1 and its chaperone Cosmc in DAKIKI cells. • Helicobacter pylori infection may participate in the pathogenesis of IgAN via CagA. - Abstract: While Helicobacter pylori (Hp) infection is closely associated with IgA nephropathy (IgAN), the underlying molecular mechanisms remain to be elucidated. This study was to investigate the effect of cytotoxin associated gene A protein (CagA), a major virulence factor of Hp, on the production and underglycosylation of IgA1 in the B cell line DAKIKI cells. Cells were cultured and treated with recombinant CagA protein. We found that CagA stimulated cell proliferation and the production of IgA1 in a dose-dependent and time-dependent manner. Moreover, CagA promoted the underglycosylation of IgA1, which at least partly attributed to the downregulation of β1,3-galactosyltransferase (C1GALT1) and its chaperone Cosmc. In conclusion, we demonstrated that Hp infection, at least via CagA, may participate in the pathogenesis of IgAN by influencing the production and glycosylation of IgA1 in B cells.

CagA, a major virulence factor of Helicobacter pylori, promotes the production and underglycosylation of IgA1 in DAKIKI cells

International Nuclear Information System (INIS)

Yang, Man; Li, Fu-gang; Xie, Xi-sheng; Wang, Shao-qing; Fan, Jun-ming

2014-01-01

Highlights: • CagA stimulated cell proliferation and the production of IgA1 in DAKIKI cells. • CagA promoted the underglycosylation of IgA1 in DAKIKI cells. • CagA decreased the expression of C1GALT1 and its chaperone Cosmc in DAKIKI cells. • Helicobacter pylori infection may participate in the pathogenesis of IgAN via CagA. - Abstract: While Helicobacter pylori (Hp) infection is closely associated with IgA nephropathy (IgAN), the underlying molecular mechanisms remain to be elucidated. This study was to investigate the effect of cytotoxin associated gene A protein (CagA), a major virulence factor of Hp, on the production and underglycosylation of IgA1 in the B cell line DAKIKI cells. Cells were cultured and treated with recombinant CagA protein. We found that CagA stimulated cell proliferation and the production of IgA1 in a dose-dependent and time-dependent manner. Moreover, CagA promoted the underglycosylation of IgA1, which at least partly attributed to the downregulation of β1,3-galactosyltransferase (C1GALT1) and its chaperone Cosmc. In conclusion, we demonstrated that Hp infection, at least via CagA, may participate in the pathogenesis of IgAN by influencing the production and glycosylation of IgA1 in B cells

Conformational analysis of isolated domains of Helicobacter pylori CagA.

Directory of Open Access Journals (Sweden)

Amanda P Woon

Full Text Available The CagA protein of Helicobacter pylori is associated with increased virulence and gastric cancer risk. CagA is translocated into the host cell by a H. pylori type IV secretion system via mechanisms that are poorly understood. Translocated CagA interacts with numerous host factors, altering a variety of host signalling pathways. The recently determined crystal structure of C-terminally-truncated CagA indicated the presence of two domains: the smaller, flexible N-terminal domain and the larger, middle domain. In this study, we have investigated the conformation, oligomeric state and stability of the N-terminal, middle and glutamate-proline-isoleucine-tyrosine-alanine (EPIYA-repeats domains. All three domains are monomeric, suggesting that the multimerisation of CagA observed in infected cells is likely to be mediated not by CagA itself but by its interacting partners. The middle and the C-terminal domains, but not the N-terminal domain, are capable of refolding spontaneously upon heat denaturation, lending support to the hypothesis that unfolded CagA is threaded C-terminus first through the type IV secretion channel with its N-terminal domain, which likely requires interactions with other domains to refold, being threaded last. Our findings also revealed that the C-terminal EPIYA-repeats domain of CagA exists in an intrinsically disordered premolten globule state with regions in PPII conformation--a feature that is shared by many scaffold proteins that bind multiple protein components of signalling pathways. Taken together, these results provide a deeper understanding of the physicochemical properties of CagA that underpin its complex cellular and oncogenic functions.

Distinct repeat motifs at the C-terminal region of CagA of Helicobacter pylori strains isolated from diseased patients and asymptomatic individuals in West Bengal, India

Directory of Open Access Journals (Sweden)

Chattopadhyay Santanu

2012-05-01

Full Text Available Abstract Background Infection with Helicobacter pylori strains that express CagA is associated with gastritis, peptic ulcer disease, and gastric adenocarcinoma. The biological function of CagA depends on tyrosine phosphorylation by a cellular kinase. The phosphate acceptor tyrosine moiety is present within the EPIYA motif at the C-terminal region of the protein. This region is highly polymorphic due to variations in the number of EPIYA motifs and the polymorphism found in spacer regions among EPIYA motifs. The aim of this study was to analyze the polymorphism at the C-terminal end of CagA and to evaluate its association with the clinical status of the host in West Bengal, India. Results Seventy-seven H. pylori strains isolated from patients with various clinical statuses were used to characterize the C-ternimal polymorphic region of CagA. Our analysis showed that there is no correlation between the previously described CagA types and various disease outcomes in Indian context. Further analyses of different CagA structures revealed that the repeat units in the spacer sequences within the EPIYA motifs are actually more discrete than the previously proposed models of CagA variants. Conclusion Our analyses suggest that EPIYA motifs as well as the spacer sequence units are present as distinct insertions and deletions, which possibly have arisen from extensive recombination events. Moreover, we have identified several new CagA types, which could not be typed by the existing systems and therefore, we have proposed a new typing system. We hypothesize that a cagA gene encoding higher number EPIYA motifs may perhaps have arisen from cagA genes that encode lesser EPIYA motifs by acquisition of DNA segments through recombination events.

Systematic analysis of phosphotyrosine antibodies recognizing single phosphorylated EPIYA-motifs in CagA of Western-type Helicobacter pylori strains.

Directory of Open Access Journals (Sweden)

Judith Lind

Full Text Available The clinical outcome of Helicobacter pylori infections is determined by multiple host-pathogen interactions that may develop to chronic gastritis, and sometimes peptic ulcers or gastric cancer. Highly virulent strains encode a type IV secretion system (T4SS that delivers the effector protein CagA into gastric epithelial cells. Translocated CagA undergoes tyrosine phosphorylation at EPIYA-sequence motifs, called A, B and C in Western-type strains, by members of the oncogenic Src and Abl host kinases. Phosphorylated EPIYA-motifs mediate interactions of CagA with host signaling factors--in particular various SH2-domain containing human proteins--thereby hijacking multiple downstream signaling cascades. Observations of tyrosine-phosphorylated CagA are mainly based on the use of commercial phosphotyrosine antibodies, which originally were selected to detect phosphotyrosines in mammalian proteins. Systematic studies of phosphorylated EPIYA-motif detection by the different antibodies would be very useful, but are not yet available. To address this issue, we synthesized phospho- and non-phosphopeptides representing each predominant Western CagA EPIYA-motif, and determined the recognition patterns of seven different phosphotyrosine antibodies in Western blots, and also performed infection studies with diverse representative Western H. pylori strains. Our results show that a total of 9-11 amino acids containing the phosphorylated EPIYA-motifs are necessary and sufficient for specific detection by these antibodies, but revealed great variability in sequence recognition. Three of the antibodies recognized phosphorylated EPIYA-motifs A, B and C similarly well; whereas preferential binding to phosphorylated motif A and motifs A and C was found with two and one antibodies, respectively, and the seventh anti-phosphotyrosine antibody did not recognize any phosphorylated EPIYA-motif. Controls showed that none of the antibodies recognized the corresponding non

Prevalence of cagA and vacA among Helicobacter pylori-infected patients in Iran: a systematic review and meta-analysis.

Science.gov (United States)

Sayehmiri, Fatemeh; Kiani, Faezeh; Sayehmiri, Kourosh; Soroush, Setareh; Asadollahi, Khairollah; Alikhani, Mohammad Yousef; Delpisheh, Ali; Emaneini, Mohammad; Bogdanović, Lidija; Varzi, Ali Mohammad; Zarrilli, Raffaele; Taherikalani, Morovat

2015-07-30

The varieties of infections caused by Helicobacter pylori may be due to differences in bacterial genotypes and virulence factors as well as environmental and host-related factors. This study aimed to investigate the prevalence of cagA and vacA genes among H. pylori-infected patients in Iran and analyze their relevance to the disease status between two clinical groups via a meta-analysis method. Different databases including PubMed, ISI, Scopus, SID, Magiran, Science Direct, and Medlib were investigated, and 23 relevant articles from the period between 2001 and 2012 were finally analyzed. The relevant data obtained from these papers were analyzed by a random-effects model. Data were analyzed using R software and STATA. The prevalence of cagA and vacA genes among H. pylori-infected patients was 70% (95% CI, 64-75) and 41% (95% CI, 24.3-57.7), respectively. The prevalence of duodenal ulcers, peptic ulcers, and gastritis among cagA+ individuals was 53% (95% CI, 20-86), 65% (95% CI, 34-97), and 71% (95% CI, 59-84), respectively. Odds ratio (OR) between cagA-positive compared with cagA-negative patients showed a 1.89 (95% CI, 1.38-2.57) risk of ulcers. In conclusion, the frequency of cagA gene among H. pylori strains is elevated in Iran and it seems to be more frequently associated with gastritis. Therefore, any information about cagA and vacA prevalence among different H. pylori-infected clinical groups in the country can help public health authorities to plan preventive policies to reduce the prevalence of diseases associated with H. pylori infection.

Anti-CagA IgG Antibody is Independent from Helicobacter pylori vacA and cagA Genotypes

Directory of Open Access Journals (Sweden)

Hashem Fakhre Yaseri

2015-12-01

Full Text Available Background: Helicobacter pylori strains have two classical virulence genes, the cytotoxinassociated A (cagA gene and the vacuolating cytotoxin A (vacA gene, which are located in thecag pathogenicity island (cagPAI. Serum immunoglobulin G (IgG antibodies to H. pylori,especially, the CagA antigen may be a reliable marker for selection of dyspeptic patients for upperendoscopy.Methods: Serum sample of 129 dyspeptic patients with positive H. pylori, were tested for serumIgG Anti-CagA antibody by ELISA. The presence of the cagA and vacA genotypes weredetermined using polymerase chain reaction (PCR on biopsy samples taken via endoscopy.Results: Positive serum IgG anti-CagA antibodies in patients with cagA+/vacA+ and cagA+/vacA- genotypes were 22/23 (95.6% and 18/19 (94.7%, respectively. In addition, serum IgG anti-CagAantibodies in patients with cagA-/vacA+ and cagA-/vacA- genotypes were 22/47 (46.8% and 33/40(82.5%, respectively.Conclusions: It can be concluded that the serum IgG anti-CagA antibody alone could selectpatients with dyspepsia following upper endoscopy. The assessment of vacuolating cytotoxinactivity of H. Pylori is, therefore, not required, even when vacA gene is positive. This hypothesisneeds to be studied in a large number of patients with dyspepsia.

Prevalence of Helicobacter pylori cagA, babA2, and dupA genotypes andcorrelation with clinical outcome in Malaysian patients with dyspepsia

OpenAIRE

OSMAN, HUSSEIN ALI; HASAN, HABSAH; SUPPIAN, RAPEAH; HASSAN, SYED; ANDEE, DZULKARNAEN ZAKARIA; MAJID, NOORIZAN ABDUL; ZILFALIL, BIN ALWI

2015-01-01

Background/aim: The severity of disease outcome in dyspepsia has been attributed to Helicobacter pylori virulence genes. The aim of this study was to determine the distribution of H. pylori virulence genes (cagA, babA2, and dupA) and to determine whether or not there arises a significant correlation with clinical dyspepsia outcomes. Materials and methods: H. pylori genotypes cagA, babA2, and dupA were identified by polymerase chain reactions from gastric biopsy samples in 105 H. pylori-posit...

Dynamic Expansion and Contraction of cagA Copy Number in Helicobacter pylori Impact Development of Gastric Disease

Directory of Open Access Journals (Sweden)

Sungil Jang

2017-02-01

Full Text Available Infection with Helicobacter pylori is a major risk factor for development of gastric disease, including gastric cancer. Patients infected with H. pylori strains that express CagA are at even greater risk of gastric carcinoma. Given the importance of CagA, this report describes a new molecular mechanism by which the cagA copy number dynamically expands and contracts in H. pylori. Analysis of strain PMSS1 revealed a heterogeneous population in terms of numbers of cagA copies; strains carried from zero to four copies of cagA that were arranged as direct repeats within the chromosome. Each of the multiple copies of cagA was expressed and encoded functional CagA; strains with more cagA repeats exhibited higher levels of CagA expression and increased levels of delivery and phosphorylation of CagA within host cells. This concomitantly resulted in more virulent phenotypes as measured by cell elongation and interleukin-8 (IL-8 induction. Sequence analysis of the repeat region revealed three cagA homologous areas (CHAs within the cagA repeats. Of these, CHA-ud flanked each of the cagA copies and is likely important for the dynamic variation of cagA copy numbers. Analysis of a large panel of clinical isolates showed that 7.5% of H. pylori strains isolated in the United States harbored multiple cagA repeats, while none of the tested Korean isolates carried more than one copy of cagA. Finally, H. pylori strains carrying multiple cagA copies were differentially associated with gastric disease. Thus, the dynamic expansion and contraction of cagA copy numbers may serve as a novel mechanism by which H. pylori modulates gastric disease development.

The Middle Fragment of Helicobacter pylori CagA Induces Actin Rearrangement and Triggers Its Own Uptake into Gastric Epithelial Cells

Directory of Open Access Journals (Sweden)

Abolghasem Tohidpour

2017-07-01

Full Text Available Cytotoxin-associated gene product A (CagA is a major virulence factor secreted by Helicobacter pylori. CagA activity in the gastric epithelium is associated with higher risk of gastric cancer development. Bacterial type IV secretion system (T4SS-mediated translocation of CagA into the cytosol of human epithelial cells occurs via a poorly understood mechanism that requires CagA interaction with the host membrane lipid phosphatidylserine (PS and host cell receptor integrin α5β1. Here we have characterized the isolated recombinant middle fragment of CagA (CagA-M that contains the positively-charged PS-binding region (aa 613–636 and a putative β1 integrin binding site, but lacks the EPIYA region, secretion signal peptide and the CagA multimerization motif. We show that CagA-M, when immobilized on latex beads, is capable of binding to, and triggering its own uptake into, gastric epithelial cells in the absence of infection with cagA-positive H. pylori. Using site-directed mutagenesis, fluorescent and electron microscopy, and highly-specific inhibitors, we demonstrate that the cell-binding and endocytosis-like internalization of CagA-M are dependent on (1 binding to PS; (2 β1 integrin activity; and (3 actin dynamics. Interaction of CagA-M with the host cells is accompanied by the development of long filopodia-like protrusions (macrospikes. This novel morphology is different from the hummingbird phenotype induced by the translocation of full-length CagA. The determinants within CagA-M and within the host that are important for endocytosis-like internalization into host cells are very similar to those observed for T4SS-mediated internalization of full-length CagA, suggesting that the latter may involve an endocytic pathway.

Helicobacter pylori CagA Inhibits PAR1-MARK Family Kinases by Mimicking Host Substrates

Energy Technology Data Exchange (ETDEWEB)

Nesic, D.; Miller, M; Quinkert, Z; Stein, M; Chait, B; Stebbins, C

2010-01-01

The CagA protein of Helicobacter pylori interacts with numerous cellular factors and is associated with increased virulence and risk of gastric carcinoma. We present here the cocrystal structure of a subdomain of CagA with the human kinase PAR1b/MARK2, revealing that a CagA peptide mimics substrates of this kinase family, resembling eukaryotic protein kinase inhibitors. Mutagenesis of conserved residues central to this interaction renders CagA inactive as an inhibitor of MARK2.

An inverse relationship between CagA+ strains of Helicobacter pylori infection and risk of erosive GERD

International Nuclear Information System (INIS)

Somi, Mohammad H.; Fattahi, E.; Fouladi, Rohollah F.; Karimi, M.; Bonyadi, R.; Baballou, Z.

2008-01-01

The aim of this study is investigating the association of Helicobacter pylori (H. pylori) infection and its cytogenetic-associated gene A (cag A) strain with reflux esophagitis. In a case-control setting (May 2005-2006), patients with reflux esophagitis (case group) were compared with age and gender matched people suffering from symptoms of gastroesophageal reflux disease with normal upper gastrointestinal endoscopic findings (control group) in Imam Khomeini Hospital, Tabriz, Iran. The rates of H. pylori and its cagA positive infections were separately compared between the 2 groups and the subgroups with different severity of reflux esophagitis. Ninety-two and 93 patients were enrolled in the case and control groups. The rate of H.pylori infection was significantly lower in case group (81.5%versus 87.10%, p=0.29, odd ratio 0.654, 95% confidence interval [CI] 0.293 to 1.495). The CagA positive infections were found significantly more frequent in the control group (59.1% versus 40.2%, p=0.01, odd ratio 0.465, 95% CI 0.258 to 0.836). There was no significant difference between the severity subgroups of the disease for H. pylori (p=0.30) or cagA positive infection rates (p=0.40). The cagA positive strains might have a protective effect against reflux esophagitis. (author)

Prevalence and Correlation with Clinical Diseases of Helicobacter pylori cagA and vacA Genotype among Gastric Patients from Northeast China

Directory of Open Access Journals (Sweden)

Faisal Aziz

2014-01-01

Full Text Available Helicobacter pylori vacA and cagA genes have significant genetic heterogenicity, resulting in different clinical outcomes. Northeast part of China has reported high prevalence of H. pylori infections and gastric cancer. Hence, we investigated the H. pylori cagA and vacA genotypes with clinical outcomes in Northeast China. Gastric tissue samples (n=169, chronic gastritis (GIs, gastric ulcer (GU, and gastric cancer (GC were analysed for 16S rRNA ureA, cagA, and cagA genotypes by PCR. A total of 141 (84% cases were found positive for H. pylori by 16S rRNA and ureA. GC showed high H. pylori infection (93% compared with GIs (72% and GU (84%. The vacAs1am1 was highly found in GC (40% and GU (36%, vacAs1am2 in GIs (33%, vacAs1bm1 (14% and vacAs1bm2 (8% in GU cases, and s2m1 in normal cases (33%, while vacAs1cm1 showed low frequency in GIs (2% and GU (3% and GC showed negative result. The East-Asian cagA strain was highly observed in GC (43%, as compared to GIs (41% and GU (20%. The East-Asian cagA/vacAs1am1 was significantly higher in GC (23% than in GU (22% and GIs (145 patients. The East-Asian type cagA with vacAs1a and vacAm1 is the most predominant genotype in H. pylori strains of Northeast China.

Molecular mechanisms of gastric epithelial cell adhesion and injection of CagA by Helicobacter pylori

Directory of Open Access Journals (Sweden)

Backert Steffen

2011-11-01

Full Text Available Abstract Helicobacter pylori is a highly successful pathogen uniquely adapted to colonize humans. Gastric infections with this bacterium can induce pathology ranging from chronic gastritis and peptic ulcers to gastric cancer. More virulent H. pylori isolates harbour numerous well-known adhesins (BabA/B, SabA, AlpA/B, OipA and HopZ and the cag (cytotoxin-associated genes pathogenicity island encoding a type IV secretion system (T4SS. The adhesins establish tight bacterial contact with host target cells and the T4SS represents a needle-like pilus device for the delivery of effector proteins into host target cells such as CagA. BabA and SabA bind to blood group antigen and sialylated proteins respectively, and a series of T4SS components including CagI, CagL, CagY and CagA have been shown to target the integrin β1 receptor followed by injection of CagA across the host cell membrane. The interaction of CagA with membrane-anchored phosphatidylserine may also play a role in the delivery process. While substantial progress has been made in our current understanding of many of the above factors, the host cell receptors for OipA, HopZ and AlpA/B during infection are still unknown. Here we review the recent progress in characterizing the interactions of the various adhesins and structural T4SS proteins with host cell factors. The contribution of these interactions to H. pylori colonization and pathogenesis is discussed.

Molecular mechanisms of gastric epithelial cell adhesion and injection of CagA by Helicobacter pylori

LENUS (Irish Health Repository)

Backert, Steffen

2011-11-01

Abstract Helicobacter pylori is a highly successful pathogen uniquely adapted to colonize humans. Gastric infections with this bacterium can induce pathology ranging from chronic gastritis and peptic ulcers to gastric cancer. More virulent H. pylori isolates harbour numerous well-known adhesins (BabA\\/B, SabA, AlpA\\/B, OipA and HopZ) and the cag (cytotoxin-associated genes) pathogenicity island encoding a type IV secretion system (T4SS). The adhesins establish tight bacterial contact with host target cells and the T4SS represents a needle-like pilus device for the delivery of effector proteins into host target cells such as CagA. BabA and SabA bind to blood group antigen and sialylated proteins respectively, and a series of T4SS components including CagI, CagL, CagY and CagA have been shown to target the integrin β1 receptor followed by injection of CagA across the host cell membrane. The interaction of CagA with membrane-anchored phosphatidylserine may also play a role in the delivery process. While substantial progress has been made in our current understanding of many of the above factors, the host cell receptors for OipA, HopZ and AlpA\\/B during infection are still unknown. Here we review the recent progress in characterizing the interactions of the various adhesins and structural T4SS proteins with host cell factors. The contribution of these interactions to H. pylori colonization and pathogenesis is discussed.

In vitro effect of amoxicillin and clarithromycin on the 3’ region of cagA gene in Helicobacter pylori isolates

Science.gov (United States)

Bustamante-Rengifo, Javier Andrés; Matta, Andrés Januer; Pazos, Alvaro; Bravo, Luis Eduardo

2013-01-01

AIM: To evaluate the in vitro effect of amoxicillin and clarithromycin on the cag pathogenicity island (cag PAI). METHODS: One hundred and forty-nine clinical isolates of Helicobacter pylori (H. pylori) cultured from gastric biopsies from 206 Colombian patients with dyspeptic symptoms from a high-risk area for gastric cancer were included as study material. Antimicrobial susceptibility was determined by the agar dilution method. Resistant isolates at baseline and in amoxicillin and clarithromycin serial dilutions were subjected to genotyping (cagA, vacA alleles s and m), Glu-Pro-Ile-Tyr-Ala (EPIYA) polymerase chain reaction and random amplified polymorphic DNA (RAPD). Images of the RAPD amplicons were analyzed by Gel-Pro Analyzer 4.5 program. Cluster analyses was done using SPSS 15.0 statistical package, where each of the fingerprint bands were denoted as variables. Dendrograms were designed by following Ward’s clustering method and the estimation of distances between each pair of H. pylori isolates was calculated with the squared Euclidean distance. RESULTS: Resistance rates were 4% for amoxicillin and 2.7% for clarithromycin with 2% double resistances. Genotyping evidenced a high prevalence of the genotype cagA-positive/vacA s1m1. The 3’ region of cagA gene was successfully amplified in 92.3% (12/13) of the baseline resistant isolates and in 60% (36/60) of the resistant isolates growing in antibiotic dilutions. Upon observing the distribution of the number of EPIYA repetitions in each dilution with respect to baseline isolates, it was found that in 61.5% (8/13) of the baseline isolates, a change in the number of EPIYA repetitions lowered antibiotic pressure. The gain and loss of EPIYA motifs resulted in a diversity of H. pylori subclones after bacterial adjustment to changing conditions product of antibiotic pressure. RAPD PCR evidenced the close clonal relationship between baseline isolates and isolates growing in antibiotic dilutions. CONCLUSION: Antibiotic

Polymorphism in the Helicobacter pylori CagA and VacA toxins and disease

Science.gov (United States)

Bridge, Dacie R.; Merrell, D. Scott

2013-01-01

Half of the world’s population is infected with Helicobacter pylori and approximately 20% of infected individuals develop overt clinical disease such as ulcers and stomach cancer. Paradoxically, despite its classification as a class I carcinogen, H. pylori has been shown to be protective against development of asthma, allergy, and esophageal disease. Given these conflicting roles for H. pylori, researchers are attempting to define the environmental, host, and pathogen interactions that ultimately result in severe disease in some individuals. From the bacterial perspective, the toxins, CagA and VacA, have each been shown to be polymorphic and to contribute to disease in an allele-dependent manner. Based on the notable advances that have recently been made in the CagA field, herein we review recent studies that have begun to shed light on the role of CagA polymorphism in H. pylori disease. Moreover, we discuss the potential interaction of CagA and VacA as a mediator of gastric disease. PMID:23380646

VacA and cagA genotypes status and antimicrobial resistance properties of Helicobacter pylori strains isolated from meat products in Isfahan province, Iran.

Science.gov (United States)

Gilani, A; Razavilar, V; Rokni, N; Rahimi, E

2017-01-01

Although Helicobacter pylori has a significant impact on the occurrence of severe clinical syndromes, its exact ways of transmission and origin have not been identified. According to the results of some previously published articles, foods with animal origins play a substantial role in the transmission of H. pylori to humans. The present investigation was carried out to study the vacuolating cytotoxin A ( vacA ) and cytotoxin associated gene A ( cagA ) genotypes status and antibiotic resistance properties of H. pylori strains recovered from minced-meat and hamburger samples. A total of 150 meat product samples were collected from supermarkets. All samples were cultured and the susceptive colonies were then subjected to nested-PCR, PCR-based genotyping and disk diffusion methods. 11 out of 150 samples (7.33%) were positive for H. pylori . All the isolates were further identified using the nested-PCR assay. Prevalence of H. pylori in hamburger and minced-meat samples was 1.42% and 12.5%, respectively. S1a , m1a and cagA were the most commonly detected genotypes. The most commonly detected combined genotypes in the H. pylori strains of minced-meat were s1am1a (10%), s1am1b (10%) and s2m1a (10%). Helicobacter pylori strains of meat products harbored the highest levels of resistance against ampicillin (90.90%), erythromycin (72.72%), amoxicillin (72.72%), trimethoprim (63.63%), tetracycline (63.63%), and clarithromycin (63.63%). Hamburger and minced-meat samples may be the sources of virulent and resistant strains of H. pylori . Meat products are possible sources of resistant and virulent strains of H. pylori similar to those vacA and cagA genotypes. Using healthy raw materials and observation of personal hygiene can reduce the risk of H. pylori in meat products.

Role of the Helicobacter pylori virulence factors vacuolating cytotoxin, CagA, and urease in a mouse model of disease.

Science.gov (United States)

Ghiara, P; Marchetti, M; Blaser, M J; Tummuru, M K; Cover, T L; Segal, E D; Tompkins, L S; Rappuoli, R

1995-10-01

The pathogenic role of Helicobacter pylori virulence factors has been studied with a mouse model of gastric disease. BALB/c mice were treated orally with different amounts of sonic extracts of cytotoxic H. pylori strains (NCTC 11637, 60190, 84-183, and 87A300 [CagA+/Tox+]). The pathological effects on histological sections of gastric mucosae were assessed and were compared with the effects of treatments with extracts from noncytotoxic strains (G21 and G50 [CagA-/Tox-]) and from strains that express either CagA alone (D931 [CagA+/Tox-]) or the cytotoxin alone (G104 [CagA-/Tox+]). The treatment with extracts from cytotoxic strains induced various epithelial lesions (vacuolation, erosions, and ulcerations), recruitment of inflammatory cells in the lamina propria, and a marked reduction of the mucin layer. Extracts of noncytotoxic strains induced mucin depletion but no other significant pathology. Crude extracts of strain D931, expressing CagA alone, caused only mild infiltration of inflammatory cells, whereas extracts of strain G104, expressing cytotoxin alone, induced extensive epithelial damage but little inflammatory reaction. Loss of the mucin layer was not associated with a cytotoxic phenotype, since this loss was observed in mice treated with crude extracts of all strains. The pathogenic roles of CagA, cytotoxin, and urease were further assessed by using extracts of mutant strains of H. pylori defective in the expression of each of these virulence factors. The results obtained suggest that (i) urease activity does not play a significant role in inducing the observed gastric damage, (ii) cytotoxin has an important role in the induction of gastric epithelial cell lesions but not in eliciting inflammation, and (iii) other components present in strains which carry the cagA gene, but distinct from CagA itself, are involved in eliciting the inflammatory response.

The EPIYA-ABCC motif pattern in CagA of Helicobacter pylori is associated with peptic ulcer and gastric cancer in Mexican population.

Science.gov (United States)

Beltrán-Anaya, Fredy Omar; Poblete, Tomás Manuel; Román-Román, Adolfo; Reyes, Salomón; de Sampedro, José; Peralta-Zaragoza, Oscar; Rodríguez, Miguel Ángel; del Moral-Hernández, Oscar; Illades-Aguiar, Berenice; Fernández-Tilapa, Gloria

2014-12-24

Helicobacter pylori chronic infection is associated with chronic gastritis, peptic ulcer, and gastric cancer. Cytotoxin-associated gene A (cagA)-positive H. pylori strains increase the risk of gastric pathology. The carcinogenic potential of CagA is linked to its polymorphic EPIYA motif variants. The goals of this study were to investigate the frequency of cagA-positive Helicobacter pylori in Mexican patients with gastric pathologies and to assess the association of cagA EPIYA motif patterns with peptic ulcer and gastric cancer. A total of 499 patients were studied; of these, 402 had chronic gastritis, 77 had peptic ulcer, and 20 had gastric cancer. H. pylori DNA, cagA, and the EPIYA motifs were detected in total DNA from gastric biopsies by PCR. The type and number of EPIYA segments were determined by the electrophoretic patterns. To confirm the PCR results, 20 amplicons of the cagA 3' variable region were sequenced, and analyzed in silico, and the amino acid sequence was predicted with MEGA software, version 5. The odds ratio (OR) was calculated to determine the associations between the EPIYA motif type and gastric pathology and between the number of EPIYA-C segments and peptic ulcers and gastric cancer. H. pylori DNA was found in 287 (57.5%) of the 499 patients, and 214 (74%) of these patients were cagA-positive. The frequency of cagA-positive H. pylori was 74.6% (164/220) in chronic gastritis patients, 73.6% (39/53) in peptic ulcer patients, and 78.6% (11/14) in gastric cancer patients. The EPIYA-ABC pattern was more frequently observed in chronic gastritis patients (79.3%, 130/164), while the EPIYA-ABCC sequence was more frequently observed in peptic ulcer (64.1%, 25/39) and gastric cancer patients (54.5%, 6/11). However, the risks of peptic ulcer (OR = 7.0, 95% CI = 3.3-15.1; p peptic ulcers and gastric cancer.

Differential Mechanisms for SHP2 Binding and Activation Are Exploited by Geographically Distinct Helicobacter pylori CagA Oncoproteins

Directory of Open Access Journals (Sweden)

Takeru Hayashi

2017-09-01

Full Text Available Helicobacter pylori East Asian CagA is more closely associated with gastric cancer than Western CagA. Here we show that, upon tyrosine phosphorylation, the East Asian CagA-specific EPIYA-D segment binds to the N-SH2 domain of pro-oncogenic SHP2 phosphatase two orders of magnitude greater than Western CagA-specific EPIYA-C. This high-affinity binding is achieved via cryptic interaction between Phe at the +5 position from phosphotyrosine in EPIYA-D and a hollow on the N-SH2 phosphopeptide-binding floor. Also, duplication of EPIYA-C in Western CagA, which increases gastric cancer risk, enables divalent high-affinity binding with SHP2 via N-SH2 and C-SH2. These strong CagA bindings enforce enzymatic activation of SHP2, which endows cells with neoplastic traits. Mechanistically, N-SH2 in SHP2 is in an equilibrium between stimulatory “relaxed” and inhibitory “squeezed” states, which is fixed upon high-affinity CagA binding to the “relaxed” state that stimulates SHP2. Accordingly, East Asian CagA and Western CagA exploit distinct mechanisms for SHP2 deregulation.

Inhibitory Effects of Anthocyanins on Secretion of Helicobacter pylori CagA and VacA Toxins

Science.gov (United States)

Kim, Sa-Hyun; Park, Min; Woo, Hyunjun; Tharmalingam, Nagendran; Lee, Gyusang; Rhee, Ki-Jong; Eom, Yong Bin; Han, Sang Ik; Seo, Woo Duck; Kim, Jong Bae

2012-01-01

Anthocyanins have been studied as potential antimicrobial agents against Helicobacter pylori. We investigated whether the biosynthesis and secretion of cytotoxin-associated protein A (CagA) and vacuolating cytotoxin A (VacA) could be suppressed by anthocyanin treatment in vitro. H. pylori reference strain 60190 (CagA+/VacA+) was used in this study to investigate the inhibitory effects of anthocyanins; cyanidin 3-O-glucoside (C3G), peonidin 3-O-glucoside (Peo3G), pelargonidin 3-O-glucoside (Pel3G), and malvidin 3-O-glucoside (M3G) on expression and secretion of H. pylori toxins. Anthocyanins were added to bacterial cultures and Western blotting was used to determine secretion of CagA and VacA. Among them, we found that C3G inhibited secretion of CagA and VacA resulting in intracellular accumulation of CagA and VacA. C3G had no effect on cagA and vacA expression but suppressed secA transcription. As SecA is involved in translocation of bacterial proteins, the down-regulation of secA expression by C3G offers a mechanistic explanation for the inhibition of toxin secretion. To our knowledge, this is the first report suggesting that C3G inhibits secretion of the H. pylori toxins CagA and VacA via suppression of secA transcription. PMID:23155357

A specific A/T polymorphism in Western tyrosine phosphorylation B-motifs regulates Helicobacter pylori CagA epithelial cell interactions.

Directory of Open Access Journals (Sweden)

Xue-Song Zhang

2015-02-01

Full Text Available Helicobacter pylori persistently colonizes the human stomach, with mixed roles in human health. The CagA protein, a key host-interaction factor, is translocated by a type IV secretion system into host epithelial cells, where its EPIYA tyrosine phosphorylation motifs (TPMs are recognized by host cell kinases, leading to multiple host cell signaling cascades. The CagA TPMs have been described as type A, B, C or D, each with a specific conserved amino acid sequence surrounding EPIYA. Database searching revealed strong non-random distribution of the B-motifs (including EPIYA and EPIYT in Western H. pylori isolates. In silico analysis of Western H. pylori CagA sequences provided evidence that the EPIYT B-TPMs are significantly less associated with gastric cancer than the EPIYA B-TPMs. By generating and using a phosphorylated CagA B-TPM-specific antibody, we demonstrated the phosphorylated state of the CagA B-TPM EPIYT during H. pylori co-culture with host cells. We also showed that within host cells, CagA interaction with phosphoinositol 3-kinase (PI3-kinase was B-TPM tyrosine-phosphorylation-dependent, and the recombinant CagA with EPIYT B-TPM had higher affinity to PI3-kinase and enhanced induction of AKT than the isogenic CagA with EPIYA B-TPM. Structural modeling of the CagA B-TPM motif bound to PI3-kinase indicated that the threonine residue at the pY+1 position forms a side-chain hydrogen bond to N-417 of PI3-kinase, which cannot be formed by alanine. During co-culture with AGS cells, an H. pylori strain with a CagA EPIYT B-TPM had significantly attenuated induction of interleukin-8 and hummingbird phenotype, compared to the isogenic strain with B-TPM EPIYA. These results suggest that the A/T polymorphisms could regulate CagA activity through interfering with host signaling pathways related to carcinogenesis, thus influencing cancer risk.

Analysis of cagA in Helicobacter pylori strains from Colombian populations with contrasting gastric cancer risk reveals a biomarker for disease severity

Science.gov (United States)

Loh, John T.; Shaffer, Carrie L.; Piazuelo, M. Blanca; Bravo, Luis E.; McClain, Mark S.; Correa, Pelayo; Cover, Timothy L.

2011-01-01

BACKGROUND Helicobacter pylori infection is a risk factor for the development of gastric cancer, and the bacterial oncoprotein CagA contributes to gastric carcinogenesis. METHODS We analyzed H. pylori isolates from persons in Colombia and observed that there was marked variation among strains in levels of CagA expression. To elucidate the basis for this variation, we analyzed sequences upstream from the CagA translational initiation site in each strain. RESULTS A DNA motif (AATAAGATA) upstream of the translational initiation site of CagA was associated with high levels of CagA expression. Experimental studies showed that this motif was necessary but not sufficient for high-level CagA expression. H. pylori strains from a region of Colombia with high gastric cancer rates expressed higher levels of CagA than did strains from a region with lower gastric cancer rates, and Colombian strains of European phylogeographic origin expressed higher levels of CagA than did strains of African origin. Histopathological analysis of gastric biopsy specimens revealed that strains expressing high levels of CagA or containing the AATAAGATA motif were associated with more advanced precancerous lesions than those found in persons infected with strains expressing low levels of CagA or lacking the AATAAGATA motif. CONCLUSIONS CagA expression varies greatly among H. pylori strains. The DNA motif identified in this study is associated with high levels of CagA expression, and may be a useful biomarker to predict gastric cancer risk. IMPACT These findings help to explain why some persons infected with cagA-positive H. pylori develop gastric cancer and others do not. PMID:21859954

Genotyping of Helicobacter pylori Strains Isolated from Patients with Gastric Ulcer and Non Ulcer Disease using RFLP-PCR of ureAB, vacA , cagA Genes

Directory of Open Access Journals (Sweden)

Sh. Farshad

2008-10-01

Full Text Available Introduction & Objective: Different studies show that the reasons for clinically diverse outcomes of infections caused by H. pylori may include host and environmental factors as well as differences in the prevalence or expression of bacterial virulence factors. The aim of this study was to study the distribution of different genotypes of major virulence factors cagA, vacA and ureAB among H. pylori strains isolated from patients with gastric ulcer (ulcerative disease and patients with gastritis (non ulcerative disease.Materials & Methods: In this cross sectional study 65 H. pylori strains, 30 from patients with gastric ulcer and 35 from patients with non ulcerative gastritis disease were investigated by RFLP-PCR.Results: The prevalence of vacA-positive strains in ulcerative patients was significantly more than that in non ulcerative patients (P0.05.Conclusion: It seems that in the patients under our study the presence of cagA gene may not necessarily be a risk factor for ulcer disease, while a homologous genotype of vacA appears to be associated with an increase risk of ulcer development. Lastly, despite the existence of a high degree of genomic variability within ureAB, conserved DNA banding profiles are distributed in our areas.

Higher frequency of cagA EPIYA-C Phosphorylation Sites in H. pylori strains from first-degree relatives of gastric cancer patients

Directory of Open Access Journals (Sweden)

Queiroz Dulciene MM

2012-08-01

Full Text Available Abstract Background To evaluate the prevalence of more virulent H. pylori genotypes in relatives of gastric cancer patients and in patients without family histories of gastric cancer. Methods We evaluated prospectively the prevalence of the infection by more virulent H. pylori strains in 60 relatives of gastric cancer patients comparing the results with those obtained from 49 patients without family histories of gastric cancer. H. pylori status was determined by the urease test, histology and presence of H. pylori ureA. The cytotoxin associated gene (cagA, the cagA-EPIYA and vacuolating cytotoxin gene (vacA were typed by PCR and the cagA EPIYA typing was confirmed by sequencing. Results The gastric cancer relatives were significant and independently more frequently colonized by H. pylori strains with higher numbers of CagA-EPIYA-C segments (OR = 4.23, 95%CI = 1.53–11.69 and with the most virulent s1m1 vacA genotype (OR = 2.80, 95%CI = 1.04–7.51. Higher numbers of EPIYA-C segments were associated with increased gastric corpus inflammation, foveolar hyperplasia and atrophy. Infection by s1m1 vacA genotype was associated with increased antral and corpus gastritis. Conclusions We demonstrated that relatives of gastric cancer patients are more frequently colonized by the most virulent H. pylori cagA and vacA genotypes, which may contribute to increase the risk of gastric cancer.

Helicobacter pylori counteracts the apoptotic action of its VacA toxin by injecting the CagA protein into gastric epithelial cells.

Directory of Open Access Journals (Sweden)

Amanda Oldani

2009-10-01

Full Text Available Infection with Helicobacter pylori is responsible for gastritis and gastroduodenal ulcers but is also a high risk factor for the development of gastric adenocarcinoma and lymphoma. The most pathogenic H. pylori strains (i.e., the so-called type I strains associate the CagA virulence protein with an active VacA cytotoxin but the rationale for this association is unknown. CagA, directly injected by the bacterium into colonized epithelium via a type IV secretion system, leads to cellular morphological, anti-apoptotic and proinflammatory effects responsible in the long-term (years or decades for ulcer and cancer. VacA, via pinocytosis and intracellular trafficking, induces epithelial cell apoptosis and vacuolation. Using human gastric epithelial cells in culture transfected with cDNA encoding for either the wild-type 38 kDa C-terminal signaling domain of CagA or its non-tyrosine-phosphorylatable mutant form, we found that, depending on tyrosine-phosphorylation by host kinases, CagA inhibited VacA-induced apoptosis by two complementary mechanisms. Tyrosine-phosphorylated CagA prevented pinocytosed VacA to reach its target intracellular compartments. Unphosphorylated CagA triggered an anti-apoptotic activity blocking VacA-induced apoptosis at the mitochondrial level without affecting the intracellular trafficking of the toxin. Assaying the level of apoptosis of gastric epithelial cells infected with wild-type CagA(+/VacA(+H. pylori or isogenic mutants lacking of either CagA or VacA, we confirmed the results obtained in cells transfected with the CagA C-ter constructions showing that CagA antagonizes VacA-induced apoptosis. VacA toxin plays a role during H. pylori stomach colonization. However, once bacteria have colonized the gastric niche, the apoptotic action of VacA might be detrimental for the survival of H. pylori adherent to the mucosa. CagA association with VacA is thus a novel, highly ingenious microbial strategy to locally protect its

Distribution of Helicobacter pylori cagA, cagE, oipA and vacA in different major ethnic groups in Tehran, Iran.

Science.gov (United States)

Dabiri, Hossein; Maleknejad, Parviz; Yamaoka, Yoshio; Feizabadi, Mohammad M; Jafari, Fereshteh; Rezadehbashi, Maryam; Nakhjavani, Farrokh A; Mirsalehian, Akbar; Zali, Mohammad R

2009-08-01

There are geographical variations in Helicobacter pylori virulence genes; cagA, cagE, vacA and oipA. The present study compared the distribution of these genotypes in major ethnic groups residing in Tehran, Iran and their association with clinical outcomes. A total of 124 H. pylori-positive patients living in Tehran were enrolled in this study. The ethnic distribution was 74 Persians, 33 Turks and 17 other ethnics including Kurds, Lurs, Afghanis and Arabs. The presence of the cagA, cagE and oipA genes and vacA alleles (signal [s] and middle [m] region) were determined by polymerase chain reaction (PCR) from H. pylori DNA. The cagA-positive status was predominant in all three ethnic groups (e.g. 65% in Persians and 73% in Turks). In contrast, the cagE-positive status was less than half in Persians (47%) and Turks (30%), whereas it was 77% in other ethnicities (P = 0.008). The predominant vacA genotypes were s1 and m1 in all three ethnic groups (e.g. 68% in Persians and 70% in Turks were s1). There was no significant association between cagA and cagE status or vacA genotypes and clinical outcomes. The oipA-positive strains were more common in non-ulcer dyspepsia (NUD) (63%) than in peptic ulcer patients (15%) (P = 0.001) in Persians, but the association was not observed in other ethnic groups. There are some differences in the H. pylori genotypes among the ethnic groups in Iran. However, none of these markers seemed to be clinically helpful in predicting the clinical presentation of a H. pylori infection in Iran.

Role of Helicobacter pylori cagA EPIYA motif and vacA genotypes for the development of gastrointestinal diseases in Southeast Asian countries: a meta-analysis

Directory of Open Access Journals (Sweden)

Sahara Shu

2012-09-01

Full Text Available Abstract Background Infection with cagA-positive, cagA EPIYA motif ABD type, and vacA s1, m1, and i1 genotype strains of Helicobacter pylori is associated with an exacerbated inflammatory response and increased risk of gastroduodenal diseases. However, it is unclear whether the prevalence and virulence factor genotypes found in Southeast Asia are similar to those in Western countries. Here, we examined the cagA status and prevalence of cagA EPIYA motifs and vacA genotypes among H. pylori strains found in Southeast Asia and examined their association with gastroduodenal disease. Methods To determine the cagA status, cagA EPIYA motifs, and vacA genotypes of H. pylori, we conducted meta-analyses of 13 previous reports for 1,281 H. pylori strains detected from several Southeast Asian countries. Results The respective frequencies of cagA-positive and vacA s1, m1, and i1 genotypes among examined subjects were 93% (1,056/1,133, 98% (1,010/1,033, 58% (581/1,009, and 96% (248/259, respectively. Stratification showed significant variation in the frequencies of cagA status and vacA genotypes among countries and the individual races residing within each respective country. The frequency of the vacA m-region genotype in patients infected with East Asian-type strains differed significantly between the northern and southern areas of Vietnam (p vacA m1 type or cagA-positive strains was associated with an increased risk of peptic ulcer disease (odds ratio: 1.46, 95%CI: 1.01-2.12, p = 0.046 and 2.83, 1.50-5.34, p = 0.001, respectively in the examined Southeast Asian populations. Conclusions Both Western- and East Asian-type strains of H. pylori are found in Southeast Asia and are predominantly cagA-positive and vacA s1 type. In Southeast Asia, patients infected with vacA m1 type or cagA-positive strains have an increased risk of peptic ulcer disease. Thus, testing for this genotype and the presence of cagA may have clinical usefulness.

Helicobacter pylori cagA and iceA genotypes status and risk of peptic ulcer in Saudi patients

International Nuclear Information System (INIS)

Momenah, Aiman M.; Tayeb, Mohammad T.

2007-01-01

Objective was to determine the prevalence of cagA+ and iceA genotypes among Helicobacter pylori (H. pylori) isolates from a group of Saudi patients with gastric complaints, and to find out any significant correlation between these strains and severe gastric clinical outcomes such as peptic ulcer and gastric cancer in Saudi population. A total of 1104 gastric biopsies from 368 patients who presented with symptoms suggestive of chronic gastritis, peptic ulcer disease, or gastric carcinoma were taken from the main hospitals in the Western region of Saudi Arabia from July 2004 to July 2005. We cultured the samples for H. pylori and a polymerase chain reaction was carried out to check for the presence or absence of cagA gene and the status of iceA genotypes. Among the 368 suspected patients to be infected with H. pylori by means of clinical features and endoscopic findings; 103 (28%) were positive using culture technique. The relation of the presence of cagA and the development of cases to gastritis and ulcer was statistically significant (p=0.0001). Furthermore, this study revealed that 100% of ulcer cases were infected with iceA1 with a statistically significant correlation (p=0.0001), while 94.6% of gastritis and 90.9% of normal were infected with iceA2 (p=0.0001). Moreover cagA+/iceA1 combined genotypes was statistically correlated with peptic ulcer (100%) but not cagA-/iceA1 (0%; p=0.0001).Certain H. pylori genotypes were more virulent than others. Multiple clinical implications based on these finding might be studied further.(author)

VacA and cagA genotypes of Helicobacter pylori isolated from raw meat in Isfahan province, Iran.

Science.gov (United States)

Gilani, Ali; Razavilar, Vadood; Rokni, Nordahr; Rahimi, Ebrahim

2017-01-01

Foods with animal origins play a substantial role in the transmission of Helicobacter pylori . The present investigation was carried out to study the vacA and cagA genotypes status of H. pylori isolated from various types of meat samples. Two hundred and twenty meat samples were collected and cultured. H. pylori -positive strains were analyzed for the presence of vacA and cagA genotypes. Eleven out of 220 (5.00%) samples were positive for H. pylori . Findings were confirmed by nested PCR. Prevalence of H. pylori in the meat samples of slaughterhouses and butcheries were 72.20% and 27.70%, respectively. The most commonly detected genotypes in the meat samples of slaughterhouses and butcheries were vacA m1a (66.66%) and vacA s1a (37.50%), respectively. The S1am1a was the most commonly detected genotype. Meat sampled from butcheries had the higher prevalence of H. pylori and its genotypes than those of slaughterhouses ( p meat samples could be the potential sources of virulent strains of H. pylori . Application of sanitary measures in the storage, transportation and sale of meat is essential for reducing the levels of H. pylori cross contamination.

VacA and CagA Status as Biomarker of Two Opposite End Outcomes of Helicobacter pylori Infection (Gastric Cancer and Duodenal Ulcer) in a Moroccan Population

OpenAIRE

El Khadir, Mounia; Alaoui Boukhris, Samia; Benajah, Dafr-Allah; El Rhazi, Karima; Ibrahimi, Sidi Adil; El Abkari, Mohamed; Harmouch, Taoufiq; Nejjari, Chakib; Mahmoud, Mustapha; Benlemlih, Mohamed; Bennani, Bahia

2017-01-01

Helicobacter pylori (H. pylori) infection induces inflammation of the gastric mucosa, which may progress to precancerous lesions leading to gastric cancer. Pathological determinism is associated to some virulence genes of the bacterium, notably the vacA and cagA genes. The present study aimed to determine the H. pylori genotypes distribution and their association with sex, age and gastric diseases in a Moroccan population. Gastric biopsy was taken from 1079 consenting patients. The specimens ...

Helicobacter pylori vacA and cagA genotypes in patients from northeastern Brazil with upper gastrointestinal diseases

Directory of Open Access Journals (Sweden)

Meyssa Quezado de Figueiredo Cavalcante

2012-06-01

Full Text Available Helicobacter pylori causes chronic gastric inflammation and significantly increases the risk of duodenal and gastric ulcer disease and distal gastric carcinoma. In this study, we evaluated the Helicobacter pylori vacA and cagA genotypes in patients from a Brazilian region where there is a high prevalence of gastric cancer. Polymerase chain reaction (PCR was used to investigate vacA mosaicism and cagA status in the gastric mucosa of 134 H. pylori-positive patients, including 76 with gastritis: 28 with peptic ulcer disease and 30 with gastric cancer. The s1m1 variant was the predominant vacA genotype observed, whereas the s1 allele was more frequently observed in patients with more severe diseases associated with H. pylori infection [p = 0.03, odds ratio (OR = 5.72, 95% confidence interval (CI = 1.15-38.60]. Furthermore, all of the s1 alleles were s1b. Mixed vacA m1/m2 strains were found more frequently in patients with gastric cancer and a cagA-positive status was significantly associated with gastric cancer (p = 0.016, OR = 10.36, 95% CI = 1.35-217.31. Patients with gastric cancer (21/21, 100%, p = 0.006 or peptic ulcers (20/21, 95%, p = 0.02 were more frequently colonised by more virulent H. pylori strains compared to gastritis patients (41/61, 67.2%. In conclusion, in the northeastern of Brazil, which is one of the regions with the highest prevalence of gastric cancer in the country, infection with the most virulent H. pylori strains, carrying the cagA gene and s1m1 vacA alleles, predominates and is correlated with more severe H. pylori-associated diseases.

Virulence genes of Helicobacter pylori in gastritis, peptic ulcer and gastric cancer in Laos.

Science.gov (United States)

Vannarath, Sengdao; Vilaichone, Ratha-korn; Rasachak, Bouachanh; Mairiang, Pisaln; Yamaoka, Yoshio; Shiota, Seiji; Binh, Tran Thanh; Mahachai, Varocha

2014-01-01

Helicobacter pylori (H. pylori) infection is an established cause of peptic ulcers and gastric cancer. The aim of this study was to identify H. pylori genotypes and to examine their associations with geographical regions and gastritis, peptic ulcers and gastric cancer in Laos. A total of 329 Lao dyspeptic patients who underwent gastroscopy at Mahosot Hospital, Vientiane, Laos during December 2010--March 2012 were enrolled. Two biopsy specimens (one each from the antrum and corpus) were obtained for CLO testing and only CLO test-positive gastric tissue were used to extract DNA. PCR and sequencing were identified for variants of the cagA and vacA genotypes. Some 119 Laos patients (36.2%) were found to be infected with H. pylori including 83 with gastritis, 13 with gastric ulcers (GU), 20 with duodenal ulcers (DU) and 3 with gastric cancer. cagA was detected in 99.2%. East-Asian-type cagA (62%) and vacA s1c (64.7%) were predominant genotypes in Laos. vacA s1c-m1b was significantly higher in GU than gastritis (53.8% vs. 24.1%; P-value=0.04) whereas vacA s1a-m2 was significantly higher in DU than gastritis (40.0% vs. 16.9%; P-value=0.03). East-Asian-type cagA and vacA s1c were significantly higher in highland than lowland Lao (100% vs. 55.8%; P-value=0.001 and 88.2% vs. 61.5%, P-value=0.03 respectively). H. pylori is a common infection in Laos, as in other countries in Southeast Asia. The cagA gene was demonstrated in nearly all Laos patients, cagA and vacA genotypes being possible important factors in explaining H. pylori infection and disease outcomes in Laos.

Differential effects of multiplicity of infection on Helicobacter pylori-induced signaling pathways and interleukin-8 gene transcription.

Science.gov (United States)

Ritter, Birgit; Kilian, Petra; Reboll, Marc Rene; Resch, Klaus; DiStefano, Johanna Kay; Frank, Ronald; Beil, Winfried; Nourbakhsh, Mahtab

2011-02-01

Interleukin-8 (IL-8) plays a central role in the pathogenesis of Helicobacter pylori infection. We used four different H. pylori strains isolated from patients with gastritis or duodenal ulcer disease to examine their differential effects on signaling pathways and IL-8 gene response in gastric epithelial cells. IL-8 mRNA level is elevated in response to high (100) multiplicity of infection (MOI) independent of cagA, vacA, and dupA gene characteristics. By lower MOIs (1 or 10), only cagA ( + ) strains significantly induce IL-8 gene expression. This is based on differential regulation of IL-8 promoter activity. Analysis of intracellular signaling pathways indicates that H. pylori clinical isolates induce IL-8 gene transcription through NF-κB p65, but by a MOI-dependent differential activation of MAPK pathways. Thus, the major virulence factors of H. pylori CagA, VacA, and DupA might play a minor role in the level of IL-8 gene response to a high bacterial load.

Características da gastrite crônica associada a Helicobacter pylori: aspectos topográficos, doenças associadas e correlação com o status cagA Helicobacter pylori associated gastritis: topographical pattern, associated diseases and correlation with cagA status

Directory of Open Access Journals (Sweden)

Mônica Maria Demas Álvares

2006-02-01

ástricos (CaG.AIMS: We aimed to investigate the topographical pattern of H. pylori gastritis in relation to cagA status and association with duodenal ulcer (DU and early gastric carcinoma (EGCa. MATERIALS AND METHOD: We studied chronic gastritis (CG in 160 patients submitted to upper endoscopy and in 40 patients with EGCa submitted to gastrectomy. Samples were taken from the antrum and corpus in the lesser and greater curvatures, incisura and from the tumour and were processed routinely for histology and histochemistry for intestinal metaplasia (IM characterisation. H. pylori was evaluated by histology, immunohistochemistry, culture, and PCR; cagA status was evaluated by polymerase chain reaction (PCR. CG was analyzed according to the updated Sydney System. In 130 patients a topographic study was conducted by the comparative analysis of the gastritis parameters among the areas and according to cagA status. RESULTS: CG was observed in 121 patients, 24 had UD and 14 were normal. cagA-positive strains were detected in 59 patients with GC, 17 DU and 24 EGCa. All gastritis parameters were significantly more intense in the cagA-positive group than in cagA-negative one. Infection by cagA-positive strains was associated with atrophy and IM. IM was significantly more intense in the middle portion of the lesser curvature in the antral mucosa. In CG or EGCa patients infected with cagA-positive strains, inflammation and activity compromised equally the antrum and distal corpus, whereas atrophy and IM were more frequently found in the antral mucosa. In DU, CG was antral-predominant irrespectively of cagA status. CONCLUSIONS: According to our data the topographical pattern of H. pylori-associated gastritis seems to be associated with cagA status. Precancerous lesions were significantly more intense in the antral lesser curvature, where most gastric carcinomas arise.

Helicobacter pylori VacA, acting through receptor protein tyrosine phosphatase ?, is crucial for CagA phosphorylation in human duodenum carcinoma cell line AZ-521

OpenAIRE

Nakano, Masayuki; Yahiro, Kinnosuke; Yamasaki, Eiki; Kurazono, Hisao; Akada, Junko; Yamaoka, Yoshio; Niidome, Takuro; Hatakeyama, Masanori; Suzuki, Hidekazu; Yamamoto, Taro; Moss, Joel; Isomoto, Hajime; Hirayama, Toshiya

2016-01-01

ABSTRACT Helicobacter pylori, a major cause of gastroduodenal diseases, produces vacuolating cytotoxin (VacA) and cytotoxin-associated gene A (CagA), which seem to be involved in virulence. VacA exhibits pleiotropic actions in gastroduodenal disorders via its specific receptors. Recently, we found that VacA induced the phosphorylation of cellular Src kinase (Src) at Tyr418 in AZ-521 cells. Silencing of receptor protein tyrosine phosphatase (RPTP)?, a VacA receptor, reduced VacA-induced Src ph...

Soroprevalência de anticorpos contra o antígeno CagA do Helicobacter pylori em pacientes com úlcera gástrica na região Norte do Brasil Seroprevalence of antibodies against the CagA antigen the Helicobacter pylori in patients with gastric ulcer in the North region of Brazil

Directory of Open Access Journals (Sweden)

Luisa Caricio Martins

2002-08-01

Full Text Available O Helicobacter pylori é um agente patogênico largamente distribuído no mundo, estando envolvido no desenvolvimento de várias doenças gastrointestinais. Atualmente a infecção pela cepa virulenta (CagA+ do H. pylori é considerado um dos principais fatores etiológicos para o desenvolvimento de ulcerações gástricas. Baseado nessa informação, investigamos a soroprevalência das cepas virulentas entre os pacientes com úlcera gástrica da nossa região, utilizando testes sorológicos para detecção de anticorpos contra o H. pylori e a proteína CagA. Sendo observado que 82% (45/55 dos pacientes estavam infectados pela cepa virulenta, entre esses 89% (40/45 apresentaram grau de inflamação aumentado na mucosa gástrica, com denso infiltrado de leucócitos no tecido, o que provavelmente favoreceu a formação das ulcerações gástricas.Helicobacter pylori is a pathogenic agent with a worldwide distribution and is involved in the development of many gastrointestinal diseases. Nowadays infection with the virulent strain CagA+ of H. pylori is considered one of the main etiological factors in the development of gastric ulcer. Based on this information, we investigated the seroprevalence of virulent strains among patients with gastric ulcer from one region, using serologic tests to detect antibodies against H. pylori and CagA protein. Infection by the virulent strain was found in 82% (40/55 of the patients, and among these, 89% (40/45 presented an increased degree of inflammation in the gastric mucosa, with a dense infiltration of leukocytes in the tissue, which probably favored the formation of gastric ulcer. We concluded that the presence of the virulent strain is related to the development of an increased inflammation in the gastric mucosa.

cagA Status and Eradication Treatment Outcome of Anti-Helicobacter pylori Triple Therapies in Patients with Nonulcer Dyspepsia

Science.gov (United States)

Broutet, Nathalie; Marais, Armelle; Lamouliatte, Hervé; de Mascarel, Antoine; Samoyeau, Roland; Salamon, Roger; Mégraud, Francis

2001-01-01

The differences in eradication rates reported in clinical trials aiming to cure Helicobacter pylori infection cannot be entirely explained by the type of regimen, bacterial resistance, or lack of compliance. Using data from a clinical trial, a logistic regression model was constructed to determine whether cagA status, assessed by PCR, affects the outcome of eradication. Resistance to clarithromycin (10% of the strains) predicted failure perfectly. In the model (n = 156), a cagA-lacking strain (odds ratio [OR] = 2.2; 95% confidence interval [CI], (1.1 to 4.7), tobacco smoking OR = 3.1; 95% CI, 1.3 to 7.0), and a double dose of proton pump inhibitor in the treatment regimen (OR = 0.3; 95% CI, 0.2 to 0.7) were associated with the treatment outcome. The exact role of cagA in the outcome of H. pylori eradication therapy has not been explored. However, the type of histological lesions which it causes in the gastric mucosa may be implicated. Regardless of the mechanism involved, cagA status is a good predictive marker of eradication outcome. PMID:11283049

Relationship between caga-positive Helicobacter pylori infection and risk of gastric cancer: a case control study in Porto Alegre, RS, Brazil

Directory of Open Access Journals (Sweden)

Gilmara Coelho Meine

2011-03-01

Full Text Available CONTEXT: Gastric cancer is the second most common cause of cancer related death worldwide. Although Helicobacter pylori has been classified as a class I carcinogen, the presence of infection is not a factor that alone is able to lead to gastric cancer, and one of the possible explanations for this is the existence of different strains of H. pylori with different degrees of virulence. OBJECTIVES: To investigate the association between cagA-positive H. pylori and gastric cancer, using polymerase chain reaction (PCR for the detection of this bacterial strain. METHODS: Twenty-nine patients with gastric cancer were matched by sex and age (± 5 years with 58 patients without gastric cancer, submitted to upper gastrointestinal endoscopy. All patients were evaluated for the status of infection by H. pylori (through urease test, histological analysis and PCR for the genes ureA and 16SrRNA and by cagA-positive strain (through PCR for cagA gene. RESULTS: Evaluating the presence of infection by cagA-positive H. pylori, it was verified that the rate of infection was significantly higher in the group with gastric cancer when compared with the matched controls, occurring in 62.1% and 29.3%, respectively (OR = 3.95; CI 95% 1.543-10.096. CONCLUSIONS: There is an association between cagA-positive H. pylori strain and risk of gastric cancer.

Positive selection on a bacterial oncoprotein associated with gastric cancer

Directory of Open Access Journals (Sweden)

Delgado-Rosado Gisela

2011-11-01

Full Text Available Background Helicobacter pylori is a vertically inherited gut commensal that is carcinogenic if it possesses the cag pathogenicity island (cag PaI; infection with H.pylori is the major risk factor for gastric cancer, the second leading cause of death from cancer worldwide (WHO. The cag PaI locus encodes the cagA gene, whose protein product is injected into stomach epithelial cells via a Type IV secretion system, also encoded by the cag PaI. Once there, the cagA protein binds to various cellular proteins, resulting in dysregulation of cell division and carcinogenesis. For this reason, cagA may be described as an oncoprotein. A clear understanding of the mechanism of action of cagA and its benefit to the bacteria is lacking. Results Here, we reveal that the cagA gene displays strong signatures of positive selection in bacteria isolated from amerindian populations, using the Ka/Ks ratio. Weaker signatures are also detected in the gene from bacteria isolated from asian populations, using the Ka/Ks ratio and the more sensitive branches-sites model of the PAML package. When the cagA gene isolated from amerindian populations was examined in more detail it was found that the region under positive selection contains the EPIYA domains, which are known to modulate the carcinogenicity of the gene. This means that the carcinogenicity modulating region of the gene is undergoing adaptation. The results are discussed in relation to the high incidences of stomach cancer in some latin american and asian populations. Conclusion Positive selection on cagA indicates antagonistic coevolution between host and bacteria, which appears paradoxical given that cagA is detrimental to the human host upon which the bacteria depends. This suggests several non-exclusive possibilities; that gastric cancer has not been a major selective pressure on human populations, that cagA has an undetermined benefit to the human host, or that horizontal transmission of H.pylori between hosts

Phylogenetic analysis, based on EPIYA repeats in the cagA gene of Indian Helicobacter pylori, and the implications of sequence variation in tyrosine phosphorylation motifs on determining the clinical outcome

Directory of Open Access Journals (Sweden)

Santosh K. Tiwari

2011-01-01

Full Text Available The population of India harbors one of the world's most highly diverse gene pools, owing to the influx of successive waves of immigrants over regular periods in time. Several phylogenetic studies involving mitochondrial DNA and Y chromosomal variation have demonstrated Europeans to have been the first settlers in India. Nevertheless, certain controversy exists, due to the support given to the thesis that colonization was by the Austro-Asiatic group, prior to the Europeans. Thus, the aim was to investigate pre-historic colonization of India by anatomically modern humans, using conserved stretches of five amino acid (EPIYA sequences in the cagA gene of Helicobacter pylori. Simultaneously, the existence of a pathogenic relationship of tyrosine phosphorylation motifs (TPMs, in 32 H. pylori strains isolated from subjects with several forms of gastric diseases, was also explored. High resolution sequence analysis of the above described genes was performed. The nucleotide sequences obtained were translated into amino acids using MEGA (version 4.0 software for EPIYA. An MJ-Network was constructed for obtaining TPM haplotypes by using NETWORK (version 4.5 software. The findings of the study suggest that Indian H. pylori strains share a common ancestry with Europeans. No specific association of haplotypes with the outcome of disease was revealed through additional network analysis of TPMs.

VacA, CagA, IceA and OipA Genotype Status of Helicobacter pylori ...

African Journals Online (AJOL)

Purpose: To investigate the state of vacA, cagA, oipA and iceA genotypes of H. pylori isolated from gastric biopsy samples of dogs. Methods: A total of 240 gastric biopsy samples were taken from 240 dogs using gastric endoscope. All the samples were cultured and H. pylori-positive samples were analyzed for the presence ...

Relationship of interleukin-1B gene promoter region polymorphism with Helicobacter pylori infection and gastritis.

Science.gov (United States)

Ramis, Ivy Bastos; Vianna, Júlia Silveira; Halicki, Priscila Cristina Bartolomeu; Lara, Caroline; Tadiotto, Thássia Fernanda; da Silva Maciel, João Batista; Gonçalves, Carla Vitola; von Groll, Andrea; Dellagostin, Odir Antônio; da Silva, Pedro Eduardo Almeida

2015-09-29

Helicobacter pylori infection is associated with gastritis, peptic ulcer disease and gastric carcinoma. The severity of damage is determined by the interplay between environmental/behavioral factors, bacterial pathogenicity genes and host genetic polymorphisms that can influence the secretion levels of inflammatory cytokines. Accordingly, this study aimed to identify polymorphisms in the IL-1B and IL-1RN genes and their associations with H. pylori infection, cagA gene of H. pylori, and gastroduodenal diseases. Gastric biopsy samples from 151 patients infected with H. pylori and 76 uninfected individuals were analyzed. H. pylori infection was diagnosed by histology and PCR. Polymorphisms at positions -511, -31 and +3954 of the IL-1B gene were detected by PCR-RFLP, and an analysis of the VNTR polymorphism of the IL-1RN gene was performed by PCR. It was observed that the presence of the T/T genotype at position -511 and the C/C genotype at position -31 were associated with H. pylori infection and with an increased risk of gastritis in H. pylori-positive patients. Additionally, strains from patients H. pylori-positive carrying the cagA gene was significantly related with the T/T genotype at position -511 of IL-1B.  No association of polymorphisms at position +3954 of IL-1B and in the IL-1RN with H. pylori infection and with risk of severe gastric diseases was found. We demonstrated that polymorphisms in the promoter region of the IL-1B gene (at positions -511 and -31) are associated with an enhanced risk of H. pylori infection as well as gastritis in H. pylori-positive patients.

Importance of Helicobacter pylori cagA and vacA status for the efficacy of antibiotic treatment

NARCIS (Netherlands)

L.-J. van Doorn (Leen-Jan); P.M. Schneeberger (Peter); N. Nouhan (N.); A.P. Plaisier (Anton); W.G.V. Quint (Wim); W.A. de Boer (Wink)

2000-01-01

textabstractBackground - Virulence factors of Helicobacter pylori are associated with peptic ulcer disease and may be also associated with the efficacy of treatment. Aims - To determine the relation between the vacA and the cagA status of H pylori, clinical disease, and treatment outcome. Patients -

Clonación y expresión de un fragmento recombinante del gen cagA de Helicobacter pylori y su evaluación preliminar en el serodiagnóstico

Directory of Open Access Journals (Sweden)

Lidice González

2013-12-01

100 % y 92,7 %, respectivamente. Conclusiones. El fragmento de la proteína CagA del estudio puede constituir una herramienta útil para el diagnóstico serológico de la infección por cepas de H. pylori positivas para CagA. doi: http://dx.doi.org/10.7705/biomedica.v33i4.1678

The Helicobacter pylori duodenal ulcer promoting gene, dupA in China

Directory of Open Access Journals (Sweden)

Liu Wenzhong

2008-10-01

Full Text Available Abstract Background The prevalence of H. pylori is as high as 60–70% in Chinese population. Although duodenal ulcer and gastric cancer are both caused by H. pylori, they are at opposite ends of the spectrum and as such are considered mutually exclusive. Duodenal ulcer promoting (dupA gene was reported to be associated with duodenal ulcer development. The aim of this study was to determine the prevalence of dupA gene of Helicobacter pylori in patients with various gastroduodenal diseases and to explore the association between the gene and other virulence factors. Methods H. pylori were isolated from gastric biopsies of patients with chronic gastritis, duodenal ulcer (DU, gastric ulcer (GU, or non-cardia gastric carcinoma. The dupA, cagA, vacA, iceA and babA2 genotypes were determined by polymerase chain reaction. Histological features of gastric mucosal biopsy specimens were graded based on the scoring system proposed by the updated Sydney system. IL-1β polymorphism was investigated using restriction fragment length polymorphism. Results Isolates from 360 patients including 133 with chronic gastritis, 101 with DU, 47 with GU, and 79 with non-cardia gastric carcinoma were examined. The dupA gene was detected in 35.3% (127/360 and the prevalence DU patients was significantly greater than that in gastric cancer or GU patients (45.5% vs. 24.1% and 23.4%, P dupA-positive strains had higher scores for chronic inflammation compared to those with dupA-negative strains (2.36 vs. 2.24, p = 0.058. The presence of dupA was not associated with the cagA, vacA, iceA and babA 2 genotypes or with IL-1β polymorphisms. Conclusion In China the prevalence of dupA gene was highest in DU and inversely related to GU and gastric cancer.

The Helicobacter pylori duodenal ulcer promoting gene, dupA in China.

Science.gov (United States)

Zhang, Zhiyu; Zheng, Qing; Chen, Xiaoyu; Xiao, Shudong; Liu, Wenzhong; Lu, Hong

2008-10-25

The prevalence of H. pylori is as high as 60-70% in Chinese population. Although duodenal ulcer and gastric cancer are both caused by H. pylori, they are at opposite ends of the spectrum and as such are considered mutually exclusive. Duodenal ulcer promoting (dupA) gene was reported to be associated with duodenal ulcer development. The aim of this study was to determine the prevalence of dupA gene of Helicobacter pylori in patients with various gastroduodenal diseases and to explore the association between the gene and other virulence factors. H. pylori were isolated from gastric biopsies of patients with chronic gastritis, duodenal ulcer (DU), gastric ulcer (GU), or non-cardia gastric carcinoma. The dupA, cagA, vacA, iceA and babA2 genotypes were determined by polymerase chain reaction. Histological features of gastric mucosal biopsy specimens were graded based on the scoring system proposed by the updated Sydney system. IL-1beta polymorphism was investigated using restriction fragment length polymorphism. Isolates from 360 patients including 133 with chronic gastritis, 101 with DU, 47 with GU, and 79 with non-cardia gastric carcinoma were examined. The dupA gene was detected in 35.3% (127/360) and the prevalence DU patients was significantly greater than that in gastric cancer or GU patients (45.5% vs. 24.1% and 23.4%, P dupA-positive strains had higher scores for chronic inflammation compared to those with dupA-negative strains (2.36 vs. 2.24, p = 0.058). The presence of dupA was not associated with the cagA, vacA, iceA and babA 2 genotypes or with IL-1beta polymorphisms. In China the prevalence of dupA gene was highest in DU and inversely related to GU and gastric cancer.

Distribution of Helicobacter pylori virulence markers in patients with gastroduodenal diseases in a region at high risk of gastric cancer.

Science.gov (United States)

Wang, Ming-yi; Chen, Cheng; Gao, Xiao-zhong; Li, Jie; Yue, Jing; Ling, Feng; Wang, Xiao-chun; Shao, Shi-he

2013-01-01

Helicobacter pylori (H. pylori) is a major human pathogen that is responsible for various gastroduodenal diseases. We investigated the prevalence of H. pylori virulence markers in a region at high risk of gastric cancer. One hundred and sixteen H. pylori strains were isolated from patients with gastroduodenal diseases. cagA, the cagA 3' variable region, cagPAI genes, vacA, and dupA genotypes were determined by PCR, and some amplicons of the cagA 3' variable region, cagPAI genes and dupA were sequenced. cagA was detected in all strains. The cagA 3' variable region of 85 strains (73.3%) was amplified, and the sequences of 24 strains were obtained including 22 strains possessing the East Asian-type. The partial cagPAI presented at a higher frequency in chronic gastritis (44.4%) than that of the severe clinical outcomes (9.7%, p dupA and sequencing of dupA revealed an ORF of 2449-bp. The prevalence of dupA was significantly higher in strains from patients with the severe clinical outcomes (40.3%) than that from chronic gastritis (20.4%, p = 0.02). The high rate of East Asian-type cagA, intact cagPAI, virulent vacA genotypes, and the intact long-type dupA may underlie the high risk of gastric cancer in the region. Copyright © 2013 Elsevier Ltd. All rights reserved.

adolescents with gastroduodenal disease

Directory of Open Access Journals (Sweden)

Monika Maria Biernat

2014-08-01

Full Text Available Introduction: Infection with Helicobacter pylori is a major cause of chronic gastritis and peptic ulcer disease in children and its consequences in adulthood can lead to serious complications, including in particular the development of gastric cancer. Our aim was to analyze the relationship between the occurrence of selected genes such as cagA, vacA, iceA, and babA2 determining pathogenicity of H. pylori strains and clinical outcome in children.Material and methods: The study was performed on H. pylori strains isolated from biopsies taken from 130 children and adolescents with non-ulcer dyspepsia (NUD, gastric and duodenal ulcers (PUD and gastroesophageal reflux disease (GERD. Genes such as cagA, vacA (allelic variants: s1/ s2, m1/m2, iceA (allelic variants: iceA1, iceA2 and babA2 were determined by polymerase chain reaction (PCR.Results: The cagA gene was detected in 79/130 (60.8% H. pylori isolates. The presence of the cagA gene was significantly associated with duodenal ulcer (p<0.05. The vacAs1/m1 genotype as more frequent in children with ulcers than in other groups, whereas the vacAs2/m2 genotype was more frequent in patients with gastritis and GERD. The iceA1, iceA2 and babA2 genes were present in 59/130 (45.4%, 27/130 (21% and 30/130 (23.1% of the strains, respectively. The vacAs1/cagA+ genotype was most frequently observed in strains isolated from children with PUD. The predominant genotype in children with NUD and GERD was vacAs2/cagA-/iceA1+/babA2-.Conclusion: The study showed a high incidence of strains with increased virulence, possessing cagA, vacAs1 and iceA1 genes in symptomatic children with H. pylori infection.

Structural biology studies of CagA from Helicobacter pylori and histone chaperone CIA/ASF1

International Nuclear Information System (INIS)

Senda, Toshiya

2015-01-01

Crystal structures of proteins and their complexes have become critical information for molecular-based life science. Biochemical and biological analysis based on tertiary structural information is a powerful tool to unveil complex molecular processes in the cell. Here, we present two examples of the structure-based life science study, structural biology studies of CagA, an effector protein from Helicobacter pylori, and histone chaperone CIA/ASF1, which is involved in transcription initiation. (author)

Inhibitory Effects of Anthocyanins on Secretion of Helicobacter pylori CagA and VacA Toxins

OpenAIRE

Sa-Hyun Kim, Min Park, Hyunjun Woo, Nagendran Tharmalingam, Gyusang Lee, Ki-Jong Rhee, Yong Bin Eom, Sang Ik Han, Woo Duck Seo, Jong Bae Kim

2012-01-01

Anthocyanins have been studied as potential antimicrobial agents against Helicobacter pylori. We investigated whether the biosynthesis and secretion of cytotoxin-associated protein A (CagA) and vacuolating cytotoxin A (VacA) could be suppressed by anthocyanin treatment in vitro. H. pylori reference strain 60190 (CagA+/VacA+) was used in this study to investigate the inhibitory effects of anthocyanins; cyanidin 3-O-glucoside (C3G), peonidin 3-O-glucoside (Peo3G), pelargonidin 3-O-glucoside (Pe...

Research progress in machine learning methods for gene-gene interaction detection.

Science.gov (United States)

Peng, Zhe-Ye; Tang, Zi-Jun; Xie, Min-Zhu

2018-03-20

Complex diseases are results of gene-gene and gene-environment interactions. However, the detection of high-dimensional gene-gene interactions is computationally challenging. In the last two decades, machine-learning approaches have been developed to detect gene-gene interactions with some successes. In this review, we summarize the progress in research on machine learning methods, as applied to gene-gene interaction detection. It systematically examines the principles and limitations of the current machine learning methods used in genome wide association studies (GWAS) to detect gene-gene interactions, such as neural networks (NN), random forest (RF), support vector machines (SVM) and multifactor dimensionality reduction (MDR), and provides some insights on the future research directions in the field.

Disease association with two Helicobacter pylori duplicate outer membrane protein genes, homB and homA.

Science.gov (United States)

Oleastro, Monica; Cordeiro, Rita; Yamaoka, Yoshio; Queiroz, Dulciene; Mégraud, Francis; Monteiro, Lurdes; Ménard, Armelle

2009-06-22

homB encodes a Helicobacter pylori outer membrane protein. This gene was previously associated with peptic ulcer disease (PUD) and was shown to induce activation of interleukin-8 secretion in vitro, as well as contributing to bacterial adherence. Its 90%-similar gene, homA, was previously correlated with gastritis. The present study aimed to evaluate the gastric disease association with homB and homA, as well as with the H. pylori virulence factors cagA, babA and vacA, in 415 H. pylori strains isolated from patients from East Asian and Western countries. The correlation among these genotypes was also evaluated. Both homB and homA genes were heterogeneously distributed worldwide, with a marked difference between East Asian and Western strains. In Western strains (n = 234, 124 PUD and 110 non-ulcer dyspepsia (NUD), homB, cagA and vacA s1 were all significantly associated with PUD (p = 0.025, p = 0.014, p = 0.039, respectively), and homA was closely correlated with NUD (p = 0.072). In East Asian strains (n = 138, 73 PUD and 65 NUD), homB was found more frequently than homA, and none of these genes was associated with the clinical outcome. Overall, homB was associated with the presence of cagA (p = 0.043) and vacA s1 (p homA was found more frequently in cagA-negative (p = 0.062) and vacA s2 (p homA copy number were observed, with a clear geographical specificity, suggesting an involvement of these genes in host adaptation. A correlation between the homB two-copy genotype and PUD was also observed, emphasizing the role of homB in the virulence of the strain. The global results suggest that homB and homA contribute to the determination of clinical outcome.

Variation in the number of EPIYA-C repeats in CagA protein from Colombian Helicobacter pylori strains and its ability to induce hummingbird phenotype in gastric epithelial cells Variación en el número de repeticiones EPIYA-C en la proteína CagA de aislamientos colombianos de Helicobacter pylori y su capacidad para inducir fenotipo colibrí en células epiteliales gástricas

Directory of Open Access Journals (Sweden)

María Mercedes Bravo

2010-08-01

Full Text Available Introduction. Studies using Western Helicobacter pylori strains have shown that a risk factor for gastric cancer is the number of EPIYA-C motifs in the cytotoxin-associated A protein. CagA is delivered into epithelial cells, where it becomes tyrosine phosphorylated in their EPIYA repeats and induces cytoskeleton rearrangements.
Objectives. The objective of this study was to evaluate H. pylori cagA positive strains isolated from Colombian patients with gastroduodenal diseases for the number of EPIYA-C repeats in cagA and their ability to induce cytoskeleton rearrangements in epithelial cells.
Materials and methods. We analyzed the 3' EPIYA repeats region of cagA by PCR in 93 H. pylori cagA positive strains from 49 patients with gastritis, 17 with gastric cancer, and 24 with duodenal ulcer. AGS cells exposed to the various H. pylori isolates were evaluated for rearrangements in their cytoskeleton.
Results. Strains with one EPIYA-C were the most frequent in gastritis and duodenal ulcer patients. Strains with three EPIYA-C were mainly found in gastric cancer. We found a significantly higher risk of gastric cancer for individuals infected with strains harboring three EPIYA-C motifs (OR=12.4, CI95%: 2.32-66.3. Strains from gastric cancer showed significantly higher percentages of induction of cytoskeleton rearrangements in comparison with those from gastritis (p Mann-Whitney<0.005.
Conclusions. H. pylori strains with three EPIYA-C repeats can confer an increased risk of cancer to infected individuals.Introducción. En los aislamientos de Helicobacter pylori del hemisferio occidental, se ha observado que el número de repeticiones EPIYA-C en la proteína CagA es un factor de riesgo para cáncer gástrico. La proteína CagA es introducida en la célula epitelial y, posteriormente, es fosforilada en las tirosinas presentes en los motivos EPIYA e induce rearreglos en el citoesqueleto.
Objetivos. Nuestro propósito fue evaluar el n

[Advances and strategies in gene doping detection].

Science.gov (United States)

He, Jiangang; Liu, Zhen; Liu, Jing; Dou, Peng; Chen, Hong-Yuan

2008-07-01

This review surveys the recent status of gene doping detection and the strategies for anti-gene doping. The main gene doping candidates for athletes are summarized, and the advances in the detection of the proteins expressed by these genes such as erythropoietin (EPO) and human growth hormone (hGH) are reviewed. The potential detection strategies for further gene doping analysis are also discussed.

Gene doping detection: evaluation of approach for direct detection of gene transfer using erythropoietin as a model system.

Science.gov (United States)

Baoutina, A; Coldham, T; Bains, G S; Emslie, K R

2010-08-01

As clinical gene therapy has progressed toward realizing its potential, concern over misuse of the technology to enhance performance in athletes is growing. Although 'gene doping' is banned by the World Anti-Doping Agency, its detection remains a major challenge. In this study, we developed a methodology for direct detection of the transferred genetic material and evaluated its feasibility for gene doping detection in blood samples from athletes. Using erythropoietin (EPO) as a model gene and a simple in vitro system, we developed real-time PCR assays that target sequences within the transgene complementary DNA corresponding to exon/exon junctions. As these junctions are absent in the endogenous gene due to their interruption by introns, the approach allows detection of trace amounts of a transgene in a large background of the endogenous gene. Two developed assays and one commercial gene expression assay for EPO were validated. On the basis of ability of these assays to selectively amplify transgenic DNA and analysis of literature on testing of gene transfer in preclinical and clinical gene therapy, it is concluded that the developed approach would potentially be suitable to detect gene doping through gene transfer by analysis of small volumes of blood using regular out-of-competition testing.

Frequency of virulence factors in Helicobacter pylori-infected patients with gastritis.

Science.gov (United States)

Salimzadeh, Loghman; Bagheri, Nader; Zamanzad, Behnam; Azadegan-Dehkordi, Fatemeh; Rahimian, Ghorbanali; Hashemzadeh-Chaleshtori, Morteza; Rafieian-Kopaei, Mahmoud; Sanei, Mohammad Hossein; Shirzad, Hedayatollah

2015-03-01

The outcome of Helicobacter pylori infection has been related to specific virulence-associated bacterial genotypes. The vacuolating cytotoxin (vacA), cagA gene, oipA and babA2 gene are important virulence factor involving gastric diseases. The objective of this study was to assess the relationship between virulence factors of H. pylori and histopathological findings. Gastroduodenoscopy was performed in 436 dyspeptic patients. Antrum biopsy was obtained for detection of H. pylori, virulence factors and for histopathological assessment. The polymerase chain reaction was used to detect virulence factors of H. pylori using specific primers. vacA genotypes in patients infected with H. pylori were associated with cagA, iceA1 and iceA2. In the patients with H. pylori infection there was a significant relationship between cagA positivity and neutrophil activity (P = 0.004) and chronic inflammation (P = 0.013) and with H. pylori density (P = 0.034). Neutrophil infiltration was found to be more severe in the s1 group than in the s2 group (P = 0.042). Also was a significant relationship between oipA positivity and neutrophil activity (P = 0.004) and with H. pylori density (P = 0.018). No significant relationships were observed between other vacA genotypes and histopathological parameters. H. pylori strains showing cagA, vacA s1 and oipA positivity are associated with more severe gastritis in some histological features but virulence factors of H. pylori do not appear to determine the overall pattern of gastritis. Copyright © 2015 Elsevier Ltd. All rights reserved.

Developing strategies for detection of gene doping.

Science.gov (United States)

Baoutina, Anna; Alexander, Ian E; Rasko, John E J; Emslie, Kerry R

2008-01-01

It is feared that the use of gene transfer technology to enhance athletic performance, the practice that has received the term 'gene doping', may soon become a real threat to the world of sport. As recognised by the anti-doping community, gene doping, like doping in any form, undermines principles of fair play in sport and most importantly, involves major health risks to athletes who partake in gene doping. One attraction of gene doping for such athletes and their entourage lies in the apparent difficulty of detecting its use. Since the realisation of the threat of gene doping to sport in 2001, the anti-doping community and scientists from different disciplines concerned with potential misuse of gene therapy technologies for performance enhancement have focused extensive efforts on developing robust methods for gene doping detection which could be used by the World Anti-Doping Agency to monitor athletes and would meet the requirements of a legally defensible test. Here we review the approaches and technologies which are being evaluated for the detection of gene doping, as well as for monitoring the efficacy of legitimate gene therapy, in relation to the detection target, the type of sample required for analysis and detection methods. We examine the accumulated knowledge on responses of the body, at both cellular and systemic levels, to gene transfer and evaluate strategies for gene doping detection based on current knowledge of gene technology, immunology, transcriptomics, proteomics, biochemistry and physiology. (c) 2008 John Wiley & Sons, Ltd.

Helicobacter pylori vacA and cagA genotype diversity and interferon gamma expression in patients with chronic gastritis and patients with gastric cancer.

Science.gov (United States)

Martínez-Carrillo, D N; Atrisco-Morales, J; Hernández-Pando, R; Reyes-Navarrete, S; Betancourt-Linares, R; Cruz-del Carmen, I; Illades Aguiar, B; Román-Román, A; Fernández-Tilapa, G

2014-01-01

Helicobacter pylori (H. pylori) is the main risk factor for the development of chronic gastritis, gastric ulcer, and gastric cancer. In H. pylori-infected individuals, the clinical result is dependent on various factors, among which are bacterial components, the immune response, and environmental influence. To compare IFN-γ expression with the H. pylori vacA and cagA genotypes in patients with chronic gastritis and patients with gastric cancer. Ninety-five patients diagnosed with chronic gastritis and 20 with gastric cancer were included in the study. Three gastric biopsies were taken; one was used for the molecular detection and genotyping of H. pylori; another was fixed in absolute alcohol and histologic sections were made for determining IFN-γ expression through immunohistochemistry. No differences were found in the cells that expressed IFN-γ between the patients with chronic gastritis (median percentage of positive cells: 82.6% in patients without H. pylori and 82% in infected persons) and those with gastric cancer (70.5% in H. pylori-negative patients and 78.5% in infected persons). IFN-γ expression was 69% in chronic gastritis patients infected with H. pylori vacAs2m2/cagA⁻ it was 86.5% in patients infected with H. pylori vacAs1m2/cagA⁻, 86.5% in vacAs1m1/cagA⁻, and 82% in vacAs1m1/cagA⁺. Similar data were found in the patients with gastric cancer. IFN-γ expression varied depending on the H. pylori vacA and cagA genotype, but not in accordance with the presence of chronic gastritis or gastric cancer.

Helicobacter pylori iceA, clinical outcomes, and correlation with cagA: a meta-analysis.

Science.gov (United States)

Shiota, Seiji; Watada, Masahide; Matsunari, Osamu; Iwatani, Shun; Suzuki, Rumiko; Yamaoka, Yoshio

2012-01-01

Although the iceA (induced by contact with epithelium) allelic types of Helicobacter pylori have been reported to be associated with peptic ulcer, the importance of iceA on clinical outcomes based on subsequent studies is controversial. The aim of this study was to estimate the magnitude of the risk for clinical outcomes associated with iceA. A literature search was performed using the PubMed and EMBASE databases for articles published through April 2011. Published case-control studies examining the relationship between iceA and clinical outcomes (gastritis, peptic ulcer, including gastric ulcer and duodenal ulcer, and gastric cancer) were included. Fifty studies with a total of 5,357 patients were identified in the search. Infection with iceA1-positive H. pylori increased the overall risk for peptic ulcer by 1.26-fold (95% confidence interval [CI], 1.09-1.45). However, the test for heterogeneity was significant among these studies. Sensitivity analysis showed that the presence of iceA1 was significantly associated with peptic ulcer (odds ratio [OR] = 1.25, 95% CI = 1.08-1.44). The presence of iceA2 was inversely associated with peptic ulcer (OR = 0.76, 95% CI = 0.65-0.89). The presence of iceA was not associated with gastric cancer. Most studies examined the cagA status; however, only 15 studies examined the correlation and only 2 showed a positive correlation between the presence of cagA and iceA1. Our meta-analysis confirmed the importance of the presence of iceA for peptic ulcer, although the significance was marginal.

Detection of EPO gene doping in blood.

Science.gov (United States)

Neuberger, Elmo W I; Jurkiewicz, Magdalena; Moser, Dirk A; Simon, Perikles

2012-11-01

Gene doping--or the abuse of gene therapy--will continue to threaten the sports world. History has shown that progress in medical research is likely to be abused in order to enhance human performance. In this review, we critically discuss the progress and the risks associated with the field of erythropoietin (EPO) gene therapy and its applicability to EPO gene doping. We present typical vector systems that are employed in ex vivo and in vivo gene therapy trials. Due to associated risks, gene doping is not a feasible alternative to conventional EPO or blood doping at this time. Nevertheless, it is well described that about half of the elite athlete population is in principle willing to risk its health to gain a competitive advantage. This includes the use of technologies that lack safety approval. Sophisticated detection approaches are a prerequisite for prevention of unapproved and uncontrolled use of gene therapy technology. In this review, we present current detection approaches for EPO gene doping, with a focus on blood-based direct and indirect approaches. Gene doping is detectable in principle, and recent DNA-based detection strategies enable long-term detection of transgenic DNA (tDNA) following in vivo gene transfer. Copyright © 2012 John Wiley & Sons, Ltd.

Detection of Helicobacter pylori virulence factors and interleukin-1 polymorphisms in patients with abdominal complaint

International Nuclear Information System (INIS)

Anarkhuu, B.; Munguntsetseg, B.; Khosbayar, T.; Enkh-Amar, A.; Bayasgalan, P.; Yadamjav, Ch.; Oyuntsetseg, K.; Bira, N.; Choi, P.W.

2007-01-01

Full text: Gastric Cancer is the second leading cause of cancer related death in Mongolia (National Cancer Center, report-2006). Chronic infection with Helicobacter pylori affects approximately half the world and results in malignancy in a small subset of this population. There was sufficient evidence that the Working Group of the International Agency for Research on Cancer (IARC-1994) classified it as a class I carcinogen, the only bacterial agent on this list. The aim of the study is to detect and define the role of H.pylori virulence factors and host IL-1 polymorphisms to prevent further gastric cancer. In the future, this combined bacterial/host genotyping may provide an important opportunity to identify patients who are at high risk for the development of gastric carcinoma long before malignancy occurs. Patients and biopsy specimens. Two biopsy specimens and 5ml of blood samples were collected from each of 59 patients who had abdominal complaint, after informed consent was obtained. All patients lived in Ulaanbaatar, Mongolia, 100% were of Mongolian nationality. Their mean age was 40.33 years (range, 1575 years). One biopsy specimen was used to test urease, and another was stored for molecular testing. DNA isolation from blood and tissue sample was performed with ''Promega'' kit, according to the manufacturer's instruction. Tissue samples were homogenized treated with proteinase K prior to DNA extraction. H. pylori detection and genotyping. For H.pylori, detection was by UreC primer. For virulence gene typing of H.pylori cagA and vacA, gene specific primer were used. Genotyping of IL-1 polymorphisms. IL-1B polymorphisms were distinguished by 2 methods, 5-nuclease PCR assay and restriction fragment length polymorphism analysis (RFLP). Result. Strain characteristics of H. pylori were investigated in all 59 patients. 66,7% (40/59) and 76,3% (29/36) of the patients were infected with H. pylori by UreC PCR and by urea test, respectively. The vacAs1 genotype was

Infección por Helicobacter pylori en la Ciudad de La Habana, Cuba.Prevalencia de las cepas cagA positivas

Directory of Open Access Journals (Sweden)

Beatriz Gutiérrez

2005-12-01

Full Text Available Existe una gran falta de información acerca de la infección por Helicobacter pylori en los países de la región del Caribe. Nuestros objetivos en este estudio fueron determinar la prevalencia, la resistencia a los antibióticos y los factores de virulencia de la bacteria. La medida de la prevalencia de la infección por H. pylori se determinó en un grupo de pacientes a los que se les practicó una endoscopia en tres centros hospitalarios de La Ciudad de La Habana, lo que nos permitió evaluar la resistencia a la claritromicina y la presencia de cagA + en las cepas obtenidas. De las endoscopias realizadas se obtuvieron 117 biopsias gástricas, procedentes de tres centros hospitalarios de La Ciudad de La Habana, Cuba: Instituto de Oncología, Instituto de Gastroenterología y el Hospital Calixto García. Las biopsias fueron mantenidas a –70 ºC para posterior cultivo en tres medios diferentes (dos selectivos y uno no selectivo y su posterior incubación por 7 días a 37 ºC en una atmósfera de microaerofilia. La presencia de H. pylori fue identificada por la presencia de diferentes enzimas (oxidasa, catalasa, ureasa. Se realizó la extracción del DNA y la PCR, donde se utilizó el primer H2761676 y se amplificó con 397 fragmentos del gen cagA. La susceptibilidad a la claritromicina fue medida por el método de difusión en gel. Diagnóstico endoscópico: (1 cáncer gástrico; (19 úlcera duodenal; (8 úlcera gástrica; (89 dispepsias no ulcerosas, incluyendo (62 gastritis; (9 hernia hiatal; (2 reflujo biliar; (1 pólipo gástrico; (15 panendoscopias normales. Del total de 117 biopsias realizadas, 83 fueron positivas a la infección por H.pylori (70,9% . De las 35 cepas a las que se les realizó presencia de cagA+ resultaron positivas 31 (88,5%. Solo el 3% de las cepas fueron resistentes a la claritromicina. La prevalencia de la infección por H. pylori en la población sintomática de La Ciudad de La Habana es la misma que la reportada en

Human Gastric Mucosal Hydrophobicity Does dot Decrease with Helicobacter Pylori Infection or Chronological Age

Directory of Open Access Journals (Sweden)

Mohammed S Al-Marhoon

2005-01-01

Full Text Available BACKGROUND AND AIMS: Infection with cytotoxin-associated gene A (cagA Helicobacter pylori is associated with severe gastric diseases. Previous studies in humans have reported a decreased gastric hydrophobicity with H pylori infection. The aim of the present study was to differentiate between the effect of cagA+ and cagA- strains on gastric mucus hydrophobicity.

A novel basolateral type IV secretion model for the CagA oncoprotein of Helicobacter pylori

Directory of Open Access Journals (Sweden)

Silja Wessler

2017-12-01

Full Text Available Intercellular junctions are crucial structural elements for the formation and maintenance of epithelial barrier functions to control homeostasis or protect against intruding pathogens in humans. Alterations in these complexes represent key events in the development and progression of numerous cancers as well as multiple infectious diseases. Many bacterial pathogens harbor type IV secretion systems (T4SSs, which translocate virulence factors into host cells to hijack cellular processes. The pathology of the gastric pathogen and type-I carcinogen Helicobacter pylori strongly depends on a T4SS encoded by the cag pathogenicity island (cagPAI. This T4SS forms a needle-like pilus and its activity is accomplished by the pilus-associated factors CagL, CagI and CagY which target the host integrin-β1 receptor followed by injection of the CagA oncoprotein into non-polarized AGS gastric epithelial cells. The finding of a T4SS receptor, however, suggested the presence of a sophisticated control mechanism for the injection of CagA. In fact, integrins constitute a group of basolateral receptors, which are normally absent at apical surfaces of the polarized epithelium in vivo. Our new results demonstrate that T4SS-pilus formation during H. pylori infection of polarized epithelial cells occurs preferentially at basolateral sites, and not at apical membranes (Tegtmeyer et al., 2017. We propose a stepwise process how H. pylori interacts with components of intercellular tight junctions (TJs and adherens junctions (AJs, followed by contacting integrin-based focal adhesions to disrupt and transform the epithelial cell layer in the human stomach. The possible impact of this novel signaling cascade on pathogenesis during infection is reviewed.

Frequency of virulence genes in mixed infections with Helicobacter pylori strains from a Mexican population

Directory of Open Access Journals (Sweden)

R. González-Vázquez

2016-01-01

Conclusions: The Fisher's exact test did not support a significant association between clinical outcome and genotype. The main circulating genotypes in the Mexican population studied were: cagA+, vacAs1, and vacAm1. Multiplex PCR can be used as a screening test for H. pylori strains. Furthermore, the cagE gene is a good marker for identifying cag-PAI positive strains.

[Current status and prospects of gene doping detection].

Science.gov (United States)

Wang, Wenjun; Zhang, Sichun; Xu, Jingjuan; Xia, Xinghua; Tian, Yaping; Zhang, Xinrong; Chen, Hong-Yuan

2008-07-01

The fast development of biotechnology promotes the development of doping. From recombinant protein to gene doping, there is a great challenge to their detection. The improvement of gene therapy and potential to enhance athletic performance open the door for gene doping. After a brief introduction of the concept of gene doping, the current status and prospects of gene doping detection are reviewed.

PCR-based detection of gene transfer vectors: application to gene doping surveillance.

Science.gov (United States)

Perez, Irene C; Le Guiner, Caroline; Ni, Weiyi; Lyles, Jennifer; Moullier, Philippe; Snyder, Richard O

2013-12-01

Athletes who illicitly use drugs to enhance their athletic performance are at risk of being banned from sports competitions. Consequently, some athletes may seek new doping methods that they expect to be capable of circumventing detection. With advances in gene transfer vector design and therapeutic gene transfer, and demonstrations of safety and therapeutic benefit in humans, there is an increased probability of the pursuit of gene doping by athletes. In anticipation of the potential for gene doping, assays have been established to directly detect complementary DNA of genes that are top candidates for use in doping, as well as vector control elements. The development of molecular assays that are capable of exposing gene doping in sports can serve as a deterrent and may also identify athletes who have illicitly used gene transfer for performance enhancement. PCR-based methods to detect foreign DNA with high reliability, sensitivity, and specificity include TaqMan real-time PCR, nested PCR, and internal threshold control PCR.

Thin film electroluminescent cells on the basis of Ce-doped CaGa2S4 and SrGa2S4 prepared by flash evaporation method

International Nuclear Information System (INIS)

Gambarov, E.; Bayramov, A.; Kato, A.; Iida, S.

2006-01-01

Ce-doped CaGa 2 S 4 and SrGa 2 S 4 thin film electroluminescent (TFEL) devices were prepared for the first time on the basis of films deposited by flash evaporation method. Significant crystallization, stoichiometry improvement of the films and increase of photoluminescence intensity were found after annealing in H 2 S and O 2 gas stream. EL spectra of the cells exhibited the characteristic double-band emission similar to that seen for Ce 3+ activated CaGa 2 S 4 and SrGa 2 S 4 films under photon excitation. Applied voltage and frequency dependences of the electroluminescence were studied. Low voltage operation as low as 20 V was observed for these cells. Luminance of about 4 cd/m 2 at 100 V operating voltage with 2.5 kHz frequency was achieved for the TFEL cell with films annealed in O 2 gas stream. (copyright 2006 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

LOS GENES COMO MARCADORES DE RIESGO EN CÁNCER GÁSTRICO: REVISIÓN DE ESTUDIOS EN POBLACIÓN COLOMBIANA

Directory of Open Access Journals (Sweden)

Claudia Marcela Yáñez-Gutiérrez

2013-07-01

Full Text Available The objective of this review was to identify the role of genes as risk markers in gastric cancer (GC in Colombian population studies. The study reviewed research publications in the last ten years, using the MEDLINE and LILACS, as well as various literature research of relevant articles. Searching studies found GC association with several human gene polymorphisms involved in the immune response, detoxification and suppressor p53. In Colombia, as in other countries, the evidence of the association of genetic polymorphisms with GC are still controversial because of the variation in results that studies in different populations. The genome of Helicobacter pylori strains that infect Colombian population has also been investigated in search of polymorphisms of virulence. cagA/ vacAs1m1 genotype identified as cytotoxic in this bacterium, demonstrated most of the research associated with GC. Evidence of association of GC with Colombian population genetic factors was inconclusive. It is yet to be determined the exact identification of genetic markers that can predict the risk of developing GC. However, some human gene polymorphisms as IL-1 or some detoxifying enzymes and the vacA and cagA of H. pylori could be candidates for future risk markers in these tumors.

A study of RUNX3, E-cadherin and β-catenin in CagA-positive Helicobacter pylori associated chronic gastritis in Saudi patients.

Science.gov (United States)

Wagih, H M; El-Ageery, S M; Alghaithy, A A

2015-04-01

H. pylori is the most important risk factor for gastric carcinoma. CagA-positive H. pylori is associated with an increased risk for gastric cancer compared with negative strains. RUNX3 is a tumor suppressor gene, which is related to the genesis of gastric cancer. β-catenin is integrated with E-cadherin in the cell membrane, and aberrant expression of the complex was reported in gastric carcinoma. Aim of this paper is to determine of the relation between RUNX3, E-cadherin and β-catenin in chronic gastritis associated with cagA-positive H. pylori infection. Retrospective study was done on formalin fixed paraffin embedded gastric biopsies blocks of 90 patients diagnosed as H. pylori associated chronic gastritis. H. pylori was detected using modified Giemsa stain. Nested PCR was used for detection of cagA, reverse transcription-PCR for detection of RUNX3 and immunohistochemistry for detection of E-cadherin and β-catenin. Fifty percent of cases were found to be cagA positive. CagA was significantly associated with the intensity of mononuclear inflammation, the intensity of neutrophilic inflammation, the degree of mucosal atrophy and loss of RUNX3 but not with the density of H. pylori, intestinal metaplasia, E-cadherin or β-catenin. There was significant relation between loss of RUNX3 and increasing density of H. pylori, intensity of neutrophilic inflammation, mucosal atrophy and intestinal metaplasia. RUNX3 was found to be significantly correlated with E-cadherin but not with β-catenin. E-cadherin showed decreased expression in 36.7% of biopsies while, β-catenin was decreased in 33% of biopsies. Loss of RUNX3, E-cadherin and β-catenin was considered early events in the cascade of gastric carcinoma development. Loss of RUNX3 but neither E-cadherin nor β-catenin was related to cagA positive H. pylori strains.

Detecting Horizontal Gene Transfer between Closely Related Taxa.

Directory of Open Access Journals (Sweden)

Orit Adato

2015-10-01

Full Text Available Horizontal gene transfer (HGT, the transfer of genetic material between organisms, is crucial for genetic innovation and the evolution of genome architecture. Existing HGT detection algorithms rely on a strong phylogenetic signal distinguishing the transferred sequence from ancestral (vertically derived genes in its recipient genome. Detecting HGT between closely related species or strains is challenging, as the phylogenetic signal is usually weak and the nucleotide composition is normally nearly identical. Nevertheless, there is a great importance in detecting HGT between congeneric species or strains, especially in clinical microbiology, where understanding the emergence of new virulent and drug-resistant strains is crucial, and often time-sensitive. We developed a novel, self-contained technique named Near HGT, based on the synteny index, to measure the divergence of a gene from its native genomic environment and used it to identify candidate HGT events between closely related strains. The method confirms candidate transferred genes based on the constant relative mutability (CRM. Using CRM, the algorithm assigns a confidence score based on "unusual" sequence divergence. A gene exhibiting exceptional deviations according to both synteny and mutability criteria, is considered a validated HGT product. We first employed the technique to a set of three E. coli strains and detected several highly probable horizontally acquired genes. We then compared the method to existing HGT detection tools using a larger strain data set. When combined with additional approaches our new algorithm provides richer picture and brings us closer to the goal of detecting all newly acquired genes in a particular strain.

Variations in Helicobacter pylori cytotoxin-associated genes and their influence in progression to gastric cancer: implications for prevention.

Directory of Open Access Journals (Sweden)

Cosmeri Rizzato

Full Text Available Helicobacter pylori (HP is a bacterium that colonizes the human stomach and can establish a long-term infection of the gastric mucosa. Persistent Hp infection often induces gastritis and is associated with the development of peptic ulcer disease, atrophic gastritis, and gastric adenocarcinoma. Virulent HP isolates harbor the cag (cytotoxin-associated genes pathogenicity island (cagPAI, a 40 kb stretch of DNA that encodes components of a type IV secretion system (T4SS. This T4SS forms a pilus for the injection of virulence factors into host target cells, such as the CagA oncoprotein. We analyzed the genetic variability in cagA and other selected genes of the HP cagPAI (cagC, cagE, cagL, cagT, cagV and cag Gamma using DNA extracted from frozen gastric biopsies or from clinical isolates. Study subjects were 95 cagA+ patients that were histologically diagnosed with chronic gastritis or gastric cancer in Venezuela and Mexico, areas with high prevalence of Hp infection. Sequencing reactions were carried out by both Sanger and next-generation pyrosequencing (454 Roche methods. We found a total of 381 variants with unambiguous calls observed in at least 10% of the originally tested samples and reference strains. We compared the frequencies of these genetic variants between gastric cancer and chronic gastritis cases. Twenty-six SNPs (11 non-synonymous and 14 synonymous showed statistically significant differences (P<0.05, and two SNPs, in position 1039 and 1041 of cagE, showed a highly significant association with cancer (p-value = 2.07×10⁻⁶, and the variant codon was located in the VirB3 homology domain of Agrobacterium. The results of this study may provide preliminary information to target antibiotic treatment to high-risk individuals, if effects of these variants are confirmed in further investigations.

Patrón de los motivos EPIYA de cepas cubanas de Helicobacter pylori positivas para CagA

Directory of Open Access Journals (Sweden)

Lino E. Torres

2012-03-01

Conclusión. La mayoría de los aislamientos cubanos presentaron las combinaciones de motivos EPIYA menos virulentas (ABC. Los resultados del empleo de los nuevos cebadores y el análisis de la secuenciación, confirmaron que todas las cepas estudiadas portaban el gen cagA de tipo occidental. Ninguno de los patrones específicos de EPIYA se asoció con úlcera péptica. Este es el primer reporte que muestra la distribución de los motivos EPIYA en los aislamientos de H. pylori de la región del Caribe.   DOI: http://dx.doi.org/10.7705/biomedica.v32i1.453

VacA, cagA, iceA and oipA genotypes status and antimicrobial resistance properties of Helicobacter pylori isolated from various types of ready to eat foods.

Science.gov (United States)

Hemmatinezhad, Behsan; Momtaz, Hassan; Rahimi, Ebrahim

2016-01-20

Despite the high clinical standing of Helicobacter pylori, its exact routes of transmission and origin have not been determined. Based on the contentious hypothesis, foods play an important roles in the transmission of H. pylori to humans. The present study was carried out to investigate the vacA, cagA, oipA and iceA genotypes status of H. pylori isolated from the various types of ready to eat foods. A total of 550 ready to eat food samples were cultured and tested. H. pylori-positive strains were analyzed for the presence of various genotypes and antimicrobial resistance pattern. Seventy four out of 550 (13.45 %) samples were positive for H. pylori. Olvie salad (36 %), restaurant salad (30 %), fruit salad (28 %) and soup (22 %) were the most commonly contaminated. H. pylori strains harbored the highest levels of resistance against amoxicillin (94.59 %), ampicillin (93.24 %), metronidazole (89.18 %) and tetracycline (72.97 %). The most commonly detected genotypes were vacA s1a (78.37 %), vacA m2 (75.67 %), vacA m1a (51.35 %) and cagA (41.89 %). The prevalence of iceA1, iceA2 and oipA genotypes were 13.51, 4.05 and 18.91 %, respectively. S1am2 (70.27 %), s1am1a (39.18 %) and m1am2 (31.08 %) were the most commonly detected combined genotypes. Of 40 different genotypic combinations, s1a/cagA+/iceA1/oipA- (12.16 %), s1a/cagA+/iceA1/oipA+ (10.81 %) and s1a/cagA-/iceA1/oipA+ (10.81 %) were the most prevalent. The present investigation showed that some types of ready to eat food samples maybe the sources of resistant and virulent strains of H. pylori. Warily use of antibiotics with respect to the results of disk diffusion method and careful health monitoring on food and staffs of food producing companies maybe reduce the risk of H. pylori in foods.

Analysis of clinical isolates of Helicobacter pylori in Pakistan reveals high degrees of pathogenicity and high frequencies of antibiotic resistance.

Science.gov (United States)

Rasheed, Faisal; Campbell, Barry James; Alfizah, Hanafiah; Varro, Andrea; Zahra, Rabaab; Yamaoka, Yoshio; Pritchard, David Mark

2014-10-01

Antibiotic resistance in Helicobacter pylori contributes to failure in eradicating the infection and is most often due to point and missense mutations in a few key genes. The antibiotic susceptibility profiles of H. pylori isolates from 46 Pakistani patients were determined by Etest. Resistance and pathogenicity genes were amplified, and sequences were analyzed to determine the presence of mutations. A high percentage of isolates (73.9%) were resistant to metronidazole (MTZ), with considerable resistance to clarithromycin (CLR; 47.8%) and amoxicillin (AML; 54.3%) also observed. Relatively few isolates were resistant to tetracycline (TET; 4.3%) or to ciprofloxacin (CIP; 13%). However, most isolates (n = 43) exhibited resistance to one or more antibiotics. MTZ-resistant isolates contained missense mutations in oxygen-independent NADPH nitroreductase (RdxA; 8 mutations found) and NADH flavin oxidoreductase (FrxA; 4 mutations found). In the 23S rRNA gene, responsible for CLR resistance, a new point mutation (A2181G) and 4 previously reported mutations were identified. Pathogenicity genes cagA, dupA, and vacA s1a/m1 were detected frequently in isolates which were also found to be resistant to MTZ, CLR, and AML. A high percentage of CagA and VacA seropositivity was also observed in these patients. Phylogenetic analysis of partial sequences showed uniform distribution of the 3' region of cagA throughout the tree. We have identified H. pylori isolates in Pakistan which harbor pathogenicity genes and worrying antibiotic resistance profiles as a result of having acquired multiple point and missense mutations. H. pylori eradication regimens should therefore be reevaluated in this setting. © 2014 John Wiley & Sons Ltd.

Analysis of antimicrobial susceptibility and virulence factors in Helicobacter pylori clinical isolates

Directory of Open Access Journals (Sweden)

Mendonça Sergio

2003-08-01

Full Text Available Abstract Background In this study, we evaluated the prevalence of primary resistance of Brazilian H. pylori isolates to metronidazole, clarithromycin, amoxicillin, tetracycline, and furazolidone. In addition, the vacA, iceA, cagA and cagE genotypes of strains isolated from Brazilian patients were determined and associated with clinical data in an effort to correlate these four virulence markers and antibiotic resistance. Methods H. pylori was cultured in 155 H. pylori-positive patients and MICs for metronidazole, clarithromycin, amoxicillin, tetracycline, and furazolidone were determined by the agar dilution method. Genomic DNA was extracted, and allelic variants of vacA, iceA, cagA and cagE were identified by the polymerase chain reaction. Results There was a strong association between the vacA s1/cagA -positive genotype and peptic ulcer disease (OR = 5.42, 95% CI 2.6–11.3, p = 0.0006. Additionally, infection by more virulent strains may protect against GERD, since logistic regression showed a negative association between the more virulent strain, vacA s1/cagA-positive genotype and GERD (OR = 0.26, 95% CI 0.08–0.8, p = 0.03. Resistance to metronidazole was detected in 75 patients (55%, to amoxicillin in 54 individuals (38%, to clarithromycin in 23 patients (16%, to tetracycline in 13 patients (9%, and to furazolidone in 19 individuals (13%. No significant correlation between pathogenicity and resistance or susceptibility was detected when MIC values for each antibiotic were compared with different vacA, iceA, cagA and cagE genotypes. Conclusion The analysis of virulence genes revealed a specific association between H. pylori strains and clinical outcome, furthermore, no significant association was detected among pathogenicity and resistance or susceptibility.

A powerful score-based test statistic for detecting gene-gene co-association.

Science.gov (United States)

Xu, Jing; Yuan, Zhongshang; Ji, Jiadong; Zhang, Xiaoshuai; Li, Hongkai; Wu, Xuesen; Xue, Fuzhong; Liu, Yanxun

2016-01-29

The genetic variants identified by Genome-wide association study (GWAS) can only account for a small proportion of the total heritability for complex disease. The existence of gene-gene joint effects which contains the main effects and their co-association is one of the possible explanations for the "missing heritability" problems. Gene-gene co-association refers to the extent to which the joint effects of two genes differ from the main effects, not only due to the traditional interaction under nearly independent condition but the correlation between genes. Generally, genes tend to work collaboratively within specific pathway or network contributing to the disease and the specific disease-associated locus will often be highly correlated (e.g. single nucleotide polymorphisms (SNPs) in linkage disequilibrium). Therefore, we proposed a novel score-based statistic (SBS) as a gene-based method for detecting gene-gene co-association. Various simulations illustrate that, under different sample sizes, marginal effects of causal SNPs and co-association levels, the proposed SBS has the better performance than other existed methods including single SNP-based and principle component analysis (PCA)-based logistic regression model, the statistics based on canonical correlations (CCU), kernel canonical correlation analysis (KCCU), partial least squares path modeling (PLSPM) and delta-square (δ (2)) statistic. The real data analysis of rheumatoid arthritis (RA) further confirmed its advantages in practice. SBS is a powerful and efficient gene-based method for detecting gene-gene co-association.

A review for detecting gene-gene interactions using machine learning methods in genetic epidemiology.

Science.gov (United States)

Koo, Ching Lee; Liew, Mei Jing; Mohamad, Mohd Saberi; Salleh, Abdul Hakim Mohamed

2013-01-01

Recently, the greatest statistical computational challenge in genetic epidemiology is to identify and characterize the genes that interact with other genes and environment factors that bring the effect on complex multifactorial disease. These gene-gene interactions are also denoted as epitasis in which this phenomenon cannot be solved by traditional statistical method due to the high dimensionality of the data and the occurrence of multiple polymorphism. Hence, there are several machine learning methods to solve such problems by identifying such susceptibility gene which are neural networks (NNs), support vector machine (SVM), and random forests (RFs) in such common and multifactorial disease. This paper gives an overview on machine learning methods, describing the methodology of each machine learning methods and its application in detecting gene-gene and gene-environment interactions. Lastly, this paper discussed each machine learning method and presents the strengths and weaknesses of each machine learning method in detecting gene-gene interactions in complex human disease.

A Review for Detecting Gene-Gene Interactions Using Machine Learning Methods in Genetic Epidemiology

Directory of Open Access Journals (Sweden)

Ching Lee Koo

2013-01-01

Full Text Available Recently, the greatest statistical computational challenge in genetic epidemiology is to identify and characterize the genes that interact with other genes and environment factors that bring the effect on complex multifactorial disease. These gene-gene interactions are also denoted as epitasis in which this phenomenon cannot be solved by traditional statistical method due to the high dimensionality of the data and the occurrence of multiple polymorphism. Hence, there are several machine learning methods to solve such problems by identifying such susceptibility gene which are neural networks (NNs, support vector machine (SVM, and random forests (RFs in such common and multifactorial disease. This paper gives an overview on machine learning methods, describing the methodology of each machine learning methods and its application in detecting gene-gene and gene-environment interactions. Lastly, this paper discussed each machine learning method and presents the strengths and weaknesses of each machine learning method in detecting gene-gene interactions in complex human disease.

Detection of Gene Interactions Based on Syntactic Relations

Directory of Open Access Journals (Sweden)

Mi-Young Kim

2008-01-01

Full Text Available Interactions between proteins and genes are considered essential in the description of biomolecular phenomena, and networks of interactions are applied in a system's biology approach. Recently, many studies have sought to extract information from biomolecular text using natural language processing technology. Previous studies have asserted that linguistic information is useful for improving the detection of gene interactions. In particular, syntactic relations among linguistic information are good for detecting gene interactions. However, previous systems give a reasonably good precision but poor recall. To improve recall without sacrificing precision, this paper proposes a three-phase method for detecting gene interactions based on syntactic relations. In the first phase, we retrieve syntactic encapsulation categories for each candidate agent and target. In the second phase, we construct a verb list that indicates the nature of the interaction between pairs of genes. In the last phase, we determine direction rules to detect which of two genes is the agent or target. Even without biomolecular knowledge, our method performs reasonably well using a small training dataset. While the first phase contributes to improve recall, the second and third phases contribute to improve precision. In the experimental results using ICML 05 Workshop on Learning Language in Logic (LLL05 data, our proposed method gave an F-measure of 67.2% for the test data, significantly outperforming previous methods. We also describe the contribution of each phase to the performance.

Effect of Helicobacter pylori infection on IL-8, IL-1beta and COX-2 expression in patients with chronic gastritis and gastric cancer.

Science.gov (United States)

Bartchewsky, Waldemar; Martini, Mariana Rocha; Masiero, Mariana; Squassoni, Aline Candido; Alvarez, Marisa Claudia; Ladeira, Marcelo Sady; Salvatore, Daisy; Trevisan, Miriam; Pedrazzoli, José; Ribeiro, Marcelo Lima

2009-01-01

Helicobacter pylori infection is related to gastric cancer development, and chronic inflammation is presumed to be the main cause. The aim of the present study was to evaluate the influence of H. pylori cagA, vacA, iceA, and babA genotypes on COX-2, IL-1beta, and IL-8 expression. Of the 217 patients included in the study, 26 were uninfected, 127 had chronic gastritis and were H. pylori-positive, and 64 had gastric cancer. Bacterial genotypes were evaluated by polymerase chain reaction (PCR), and the expression values were determined by quantitative real-time PCR and immunohistochemistry. An association was found between the infection with cagA, vacA s1m1 strains and gastric cancer development. Regarding the 3' region of the cagA gene, we also found an association between the infection with cagA EPIYA-ABCCC strains and clinical outcome. Higher levels of IL-8, IL-1beta, and COX-2 were detected in gastric mucosa from infected patients with chronic gastritis, and they were also associated with the infection by cagA, vacA s1m1 strains. The IL-8 and IL-1beta levels decrease significantly from chronic gastritis to gastric cancer, while the relative expression remained unaltered when COX-2 expression was analyzed among patients with gastritis and cancer. Since inflammatory response to H. pylori infection plays an important role in cellular proliferation and gastric mucosal damage, the up-regulation of IL-1beta, IL-8, and COX-2 in patients with chronic gastritis has an important clinical implication in gastric carcinogenesis.

Association between Helicobacter pylori Virulence Factors and Gastroduodenal Diseases in Okinawa, Japan

Science.gov (United States)

Matsunari, Osamu; Shiota, Seiji; Suzuki, Rumiko; Watada, Masahide; Kinjo, Nagisa; Murakami, Kazunari; Fujioka, Toshio; Kinjo, Fukunori

2012-01-01

The incidence of gastric cancer in Okinawa is lowest in Japan. Some previous reports using small number of strains suggested that the high prevalence of Helicobacter pylori with Western-type cagA in Okinawa compared to other areas in Japan might contribute to the low incidence of gastric cancer. It has still not been confirmed why the prevalence of Western-type cagA strains is high in Okinawa. We examined the association between the virulence factors of H. pylori and gastroduodenal diseases in Okinawa. The genotypes of cagA and vacA of 337 H. pylori strains were determined by PCR and gene sequencing. The genealogy of these Western-type cagA strains in Okinawa was analyzed by multilocus sequence typing (MLST). Overall, 86.4% of the strains possessed cagA: 70.3% were East-Asian type and 16.0% were Western type. After adjustment by age and sex, the presence of East-Asian-type cagA/vacA s1m1 genotypes was significantly associated with gastric cancer compared to gastritis (odds ratio = 6.68, 95% confidence interval = 1.73 to 25.8). The structure of Western-type CagA in Okinawa was different from that of typical Western-type CagA found in Western countries. Intriguingly, MLST analysis revealed that the majority of Western-type cagA strains formed individual clusters but not hpEurope. Overall, low prevalence of gastric cancer in Okinawa may result from the high prevalence of non-East-Asian-type cagA strains. The origin of Western-type cagA strains in Okinawa may be different from those of Western countries. PMID:22189111

Plasticity Region Genes jhp0940, jhp0945, jhp0947, and jhp0949 of Helicobacter pylori in Isolates from Mexican Children.

Science.gov (United States)

Romo-González, Carolina; Consuelo-Sánchez, Alejandra; Camorlinga-Ponce, Margarita; Velázquez-Guadarrama, Norma; García-Zúñiga, Magdalena; Burgueño-Ferreira, Juan; Coria-Jiménez, Rafael

2015-06-01

The genes jhp0940, jhp0945, jhp0947, and jhp0949 belong to the plasticity region of the Helicobacter pylori genome. Due to their prevalence in isolates from patients with gastritis, duodenal ulcer, and gastric cancer, they have been proposed as markers of gastroduodenal diseases. These genes are associated with pro-inflammatory cytokine induction through the NF-κB activation pathway. Nevertheless, the status of these genes is unknown in H. pylori isolates from children. The aim of the present work was to determine the frequency of the jhp0940-jhp0945-jhp0947-jhp0949 genes in H. pylori isolates from children. We identified the jhp0940, jhp0945, jhp0947, and jhp0949 genes and the relationship of each with the virulence factors cagA, cagPAI, and dupA by PCR in 49 isolates of H. pylori from children. The results were corroborated using dot blots. In addition, we compared the prevalence of these genes with the prevalence in adults. The prevalence of jhp0940 (53.1%), jhp0945 (44.9%), jhp0947 (77.6%), and jhp0949 (83.7%) was determined in the isolates from children, as was the prevalence of the virulence genes cagA (63.3%), cagPAI (71.4%), and dupA (37.5%). No association was found between the four genes of the plasticity region and the virulence genes. The presence of the intact locus integrated by jhp0940-jhp0945-jhp0947-jhp0949 was very common among the isolates from children. The genes jhp0940, jhp0947, and jhp0949 were present in more than 50% of the H. pylori isolates, and the joint presence of jhp0940-jhp0945-jhp0947-jhp0949 was very frequent. The frequency of these genes in isolates from children could contribute to the virulence of H. pylori and the evolution of the infection. © 2015 John Wiley & Sons Ltd.

Efficient strategy for detecting gene × gene joint action and its application in schizophrenia.

Science.gov (United States)

Won, Sungho; Kwon, Min-Seok; Mattheisen, Manuel; Park, Suyeon; Park, Changsoon; Kihara, Daisuke; Cichon, Sven; Ophoff, Roel; Nöthen, Markus M; Rietschel, Marcella; Baur, Max; Uitterlinden, Andre G; Hofmann, A; Lange, Christoph

2014-01-01

We propose a new approach to detect gene × gene joint action in genome-wide association studies (GWASs) for case-control designs. This approach offers an exhaustive search for all two-way joint action (including, as a special case, single gene action) that is computationally feasible at the genome-wide level and has reasonable statistical power under most genetic models. We found that the presence of any gene × gene joint action may imply differences in three types of genetic components: the minor allele frequencies and the amounts of Hardy-Weinberg disequilibrium may differ between cases and controls, and between the two genetic loci the degree of linkage disequilibrium may differ between cases and controls. Using Fisher's method, it is possible to combine the different sources of genetic information in an overall test for detecting gene × gene joint action. The proposed statistical analysis is efficient and its simplicity makes it applicable to GWASs. In the current study, we applied the proposed approach to a GWAS on schizophrenia and found several potential gene × gene interactions. Our application illustrates the practical advantage of the proposed method. © 2013 WILEY PERIODICALS, INC.

Efficient strategy for detecting gene × gene joint action and its application in schizophrenia

NARCIS (Netherlands)

Won, Sungho; Kwon, Min-Seok; Mattheisen, Manuel; Park, Suyeon; Park, Changsoon; Kihara, Daisuke; Cichon, Sven; Ophoff, Roel; Nöthen, Markus M.; Rietschel, Marcella; Baur, Max; Uitterlinden, Andre G.; Hofmann, A.; Lange, Christoph; Kahn, René S.; Linszen, Don H.; van Os, Jim; Wiersma, Durk; Bruggeman, Richard; Cahn, Wiepke; de Haan, Lieuwe; Krabbendam, Lydia; Myin-Germeys, Inez

2014-01-01

We propose a new approach to detect gene × gene joint action in genome-wide association studies (GWASs) for case-control designs. This approach offers an exhaustive search for all two-way joint action (including, as a special case, single gene action) that is computationally feasible at the

Detection of virulence-associated genes in Brucella melitensis ...

African Journals Online (AJOL)

The current study involved detection of three virulence genes (bvfA, virB, ure) by PCR in 52 isolates of Brucella melitensis biovar 3, recovered from different animal species (28 sheep, 10 goats, 9 cattle and 5 buffaloes). Of the 52 B. melitensis strains; 48 (92.3%) isolates carried bvfA genes, 51 (98.1%) isolates had virB genes ...

Detection of Lsr2 gene of Mycobacterium leprae in nasal mucus

Directory of Open Access Journals (Sweden)

Luiz Antonio Custodio

2012-06-01

Full Text Available In the present study, nasal mucus from patients with leprosy were analyzed by PCR using specific primers for Lsr2 gene of Mycobacterium leprae. The presence of Lsr2 gene in the nasal mucus was detected in 25.80% of patients with paucibacillari leprosy, and 23.07% of contacts. Despite the absence of clinical features in the contact individuals, it was possible to detect the presence of Lsr2 gene in the nasal mucus of these individuals. Therefore, PCR detection of M. leprae targeting Lsr2 gene using nasal mucus samples could contribute to early diagnosis of leprosy.

21 CFR 866.5900 - Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation detection system.

Science.gov (United States)

2010-04-01

... regulator (CFTR) gene mutation detection system. 866.5900 Section 866.5900 Food and Drugs FOOD AND DRUG...) gene mutation detection system. (a) Identification. The CFTR gene mutation detection system is a device... Guidance Document: CFTR Gene Mutation Detection System.” See § 866.1(e) for the availability of this...

Detection of horizontal transfer of individual genes by anomalous oligomer frequencies

Directory of Open Access Journals (Sweden)

Elhai Jeff

2012-06-01

Full Text Available Abstract Background Understanding the history of life requires that we understand the transfer of genetic material across phylogenetic boundaries. Detecting genes that were acquired by means other than vertical descent is a basic step in that process. Detection by discordant phylogenies is computationally expensive and not always definitive. Many have used easily computed compositional features as an alternative procedure. However, different compositional methods produce different predictions, and the effectiveness of any method is not well established. Results The ability of octamer frequency comparisons to detect genes artificially seeded in cyanobacterial genomes was markedly increased by using as a training set those genes that are highly conserved over all bacteria. Using a subset of octamer frequencies in such tests also increased effectiveness, but this depended on the specific target genome and the source of the contaminating genes. The presence of high frequency octamers and the GC content of the contaminating genes were important considerations. A method comprising best practices from these tests was devised, the Core Gene Similarity (CGS method, and it performed better than simple octamer frequency analysis, codon bias, or GC contrasts in detecting seeded genes or naturally occurring transposons. From a comparison of predictions with phylogenetic trees, it appears that the effectiveness of the method is confined to horizontal transfer events that have occurred recently in evolutionary time. Conclusions The CGS method may be an improvement over existing surrogate methods to detect genes of foreign origin.

Detection of Helicobacter pylori vacA, cagA and iceA1 virulence ...

African Journals Online (AJOL)

Ahmed El-Shenawy

related genes in different age group patients with ... vacA and iceA1 genotypes of H. pylori strains recovered from patients with dyspepsia. Subjects and methods: ..... many decades in the absence of antimicrobial treatment. Longitu- dinal studies ...

On the importance of developing a new generation of breath tests for Helicobacter pylori detection.

Science.gov (United States)

Kushch, Ievgeniia; Korenev, Nikolai; Kamarchuk, Lyudmila; Pospelov, Alexander; Kravchenko, Andrey; Bajenov, Leonid; Kabulov, Mels; Amann, Anton; Kamarchuk, Gennadii

2015-12-15

State-of-the-art methods for non-invasive detection of the Helicobacter pylori (H. pylori) infection have been considered. A reported global tendency towards a non-decreasing prevalence of H. pylori worldwide could be co-influenced by the functional limitations of urea breath tests (UBTs), currently preferred for the non-invasive recognition of H. pylori in a clinical setting. Namely, the UBTs can demonstrate false-positive or false-negative results. Within this context, limitations of conventional clinically exploited H. pylori tests have been discussed to justify the existing need for the development of a new generation of breath tests for the detection of H. pylori and the differentiation of pathogenic and non-pathogenic strains of the bacterium. This paper presents the results of a pilot clinical study aimed at evaluating the development and diagnostic potential of a new method based on the detection of the non-urease products of H. pylori vital activity in exhaled gas. The characteristics of breath of adolescents with H. pylori-positive and H. pylori-negative functional dyspepsia, together with a consideration of the cytotoxin-associated gene A (CagA) status of H. pylori-positive subjects, have been determined for the first time using innovative point-contact nanosensor devices based on salts of the organic conductor tetracyanoquinodimethane (TCNQ). The clinical and diagnostic relevance of the response curves of the point-contact sensors was assessed. It was found that the recovery time of the point-contact sensors has a diagnostic value for differentiation of the H. pylori-associated peptic ulcer disease. The diagnostically significant elongation of the recovery time was even more pronounced in patients infected with CagA-positive H. pylori strains compared to the CagA-negative patients. Taking into account the operation of the point-contact sensors in the real-time mode, the obtained results are essential prerequisites for the development of a fast and

Correlation between virulence markers of Helicobacter pylori in the oral cavity and gastric biopsies

Directory of Open Access Journals (Sweden)

Myriam Lucrecia MEDINA

2017-07-01

Full Text Available ABSTRACT BACKGROUND: The clinical outcome of Helicobacter pylori infection has been associated with virulence factors. The presence of these factors is useful as molecular markers in the identification of the high risk for developing severe gastric pathologies. OBJECTIVE: To correlate the presence of virulence markers cagA and bab2A of H. pylori in oral and gastric biopsy samples. METHODS: An observational, prospective, descriptive, and cross-sectional study was carried out between September 2011 and September 2012. Patients suffering dyspepsia with indication for upper gastrointestinal video endoscopy who attended the Gastroenterology Service of the Hospital Dr. Julio C. Perrando were included. Epidemiological investigation was completed. To detect the bacteria and their virulence genes, samples of saliva, dental plaque and gastric biopsy were taken and processed by PCR. RESULTS: Sixty-one patients were selected for this study (30 women and 31 men. H. pylori was detected in 31 gastric biopsies and 31 oral samples. Significant difference between oral and gastric samples was found in cagA genotype. Agreement between oral and gastric genotypes was found in 38.7% of samples from the same patient. CONCLUSION: This study is the first in provide information about the genotypes of the Argentinean Northeast H. pylori strains. Despite the high prevalence of H. pylori infection, the most of patients had less virulent genotypes in oral cavity and gastric tissue. The cagA / babA2 combination was not frequent in the samples studied. There was not a statistical correlation between the virulence genes and gastroduodenal or oral diseases. Although in some patients the same genotype was found both in oral and gastric samples, it cannot be ensure that they corresponding to the same strain because a DNA sequencing was not performed.

Detection of Helicobacter pylori vacA, cagA and iceA1 virulence ...

African Journals Online (AJOL)

Background: Helicobactor pylori (H. pylori) virulence markers would be useful to predict peptic ulcer disease (PUD) or gastric cancer. Aim: In Egypt, since inadequate data are present regarding H. pylori virulence–related genes in different age group patients with gastro-duodenal diseases, it becomes crucial to study the ...

A polymerase chain reaction-based methodology to detect gene doping.

Science.gov (United States)

Carter, Adam; Flueck, Martin

2012-04-01

The non-therapeutic use of genes to enhance athletic performance (gene doping) is a novel threat to the world of sports. Skeletal muscle is a prime target of gene therapy and we asked whether we can develop a test system to produce and detect gene doping. Towards this end, we introduced a plasmid (pCMV-FAK, 3.8 kb, 50 μg) for constitutive expression of the chicken homologue for the regulator of muscle growth, focal adhesion kinase (FAK), via gene electro transfer in the anti-gravitational muscle, m. soleus, or gastrocnemius medialis of rats. Activation of hypertrophy signalling was monitored by assessing the ribosomal kinase p70S6K and muscle fibre cross section. Detectability of the introduced plasmid was monitored with polymerase chain reaction in deoxyribonucleic acids (DNA) from transfected muscle and serum. Muscle transfection with pCMV-FAK elevated FAK expression 7- and 73-fold, respectively, and increased mean cross section by 52 and 16% in targeted muscle fibres of soleus and gastrocnemius muscle 7 days after gene electro transfer. Concomitantly p70S6K content was increased in transfected soleus muscle (+110%). Detection of the exogenous plasmid sequence was possible in DNA and cDNA of muscle until 7 days after transfection, but not in serum except close to the site of plasmid deposition, 1 h after injection and surgery. The findings suggest that the reliable detection of gene doping in the immoral athlete is not possible unless a change in the current practice of tissue sampling is applied involving the collection of muscle biopsy close to the site of gene injection.

Gene-wide analysis detects two new susceptibility genes for Alzheimer's disease.

Science.gov (United States)

Escott-Price, Valentina; Bellenguez, Céline; Wang, Li-San; Choi, Seung-Hoan; Harold, Denise; Jones, Lesley; Holmans, Peter; Gerrish, Amy; Vedernikov, Alexey; Richards, Alexander; DeStefano, Anita L; Lambert, Jean-Charles; Ibrahim-Verbaas, Carla A; Naj, Adam C; Sims, Rebecca; Jun, Gyungah; Bis, Joshua C; Beecham, Gary W; Grenier-Boley, Benjamin; Russo, Giancarlo; Thornton-Wells, Tricia A; Denning, Nicola; Smith, Albert V; Chouraki, Vincent; Thomas, Charlene; Ikram, M Arfan; Zelenika, Diana; Vardarajan, Badri N; Kamatani, Yoichiro; Lin, Chiao-Feng; Schmidt, Helena; Kunkle, Brian; Dunstan, Melanie L; Vronskaya, Maria; Johnson, Andrew D; Ruiz, Agustin; Bihoreau, Marie-Thérèse; Reitz, Christiane; Pasquier, Florence; Hollingworth, Paul; Hanon, Olivier; Fitzpatrick, Annette L; Buxbaum, Joseph D; Campion, Dominique; Crane, Paul K; Baldwin, Clinton; Becker, Tim; Gudnason, Vilmundur; Cruchaga, Carlos; Craig, David; Amin, Najaf; Berr, Claudine; Lopez, Oscar L; De Jager, Philip L; Deramecourt, Vincent; Johnston, Janet A; Evans, Denis; Lovestone, Simon; Letenneur, Luc; Hernández, Isabel; Rubinsztein, David C; Eiriksdottir, Gudny; Sleegers, Kristel; Goate, Alison M; Fiévet, Nathalie; Huentelman, Matthew J; Gill, Michael; Brown, Kristelle; Kamboh, M Ilyas; Keller, Lina; Barberger-Gateau, Pascale; McGuinness, Bernadette; Larson, Eric B; Myers, Amanda J; Dufouil, Carole; Todd, Stephen; Wallon, David; Love, Seth; Rogaeva, Ekaterina; Gallacher, John; George-Hyslop, Peter St; Clarimon, Jordi; Lleo, Alberto; Bayer, Anthony; Tsuang, Debby W; Yu, Lei; Tsolaki, Magda; Bossù, Paola; Spalletta, Gianfranco; Proitsi, Petra; Collinge, John; Sorbi, Sandro; Garcia, Florentino Sanchez; Fox, Nick C; Hardy, John; Naranjo, Maria Candida Deniz; Bosco, Paolo; Clarke, Robert; Brayne, Carol; Galimberti, Daniela; Scarpini, Elio; Bonuccelli, Ubaldo; Mancuso, Michelangelo; Siciliano, Gabriele; Moebus, Susanne; Mecocci, Patrizia; Zompo, Maria Del; Maier, Wolfgang; Hampel, Harald; Pilotto, Alberto; Frank-García, Ana; Panza, Francesco; Solfrizzi, Vincenzo; Caffarra, Paolo; Nacmias, Benedetta; Perry, William; Mayhaus, Manuel; Lannfelt, Lars; Hakonarson, Hakon; Pichler, Sabrina; Carrasquillo, Minerva M; Ingelsson, Martin; Beekly, Duane; Alvarez, Victoria; Zou, Fanggeng; Valladares, Otto; Younkin, Steven G; Coto, Eliecer; Hamilton-Nelson, Kara L; Gu, Wei; Razquin, Cristina; Pastor, Pau; Mateo, Ignacio; Owen, Michael J; Faber, Kelley M; Jonsson, Palmi V; Combarros, Onofre; O'Donovan, Michael C; Cantwell, Laura B; Soininen, Hilkka; Blacker, Deborah; Mead, Simon; Mosley, Thomas H; Bennett, David A; Harris, Tamara B; Fratiglioni, Laura; Holmes, Clive; de Bruijn, Renee F A G; Passmore, Peter; Montine, Thomas J; Bettens, Karolien; Rotter, Jerome I; Brice, Alexis; Morgan, Kevin; Foroud, Tatiana M; Kukull, Walter A; Hannequin, Didier; Powell, John F; Nalls, Michael A; Ritchie, Karen; Lunetta, Kathryn L; Kauwe, John S K; Boerwinkle, Eric; Riemenschneider, Matthias; Boada, Mercè; Hiltunen, Mikko; Martin, Eden R; Schmidt, Reinhold; Rujescu, Dan; Dartigues, Jean-François; Mayeux, Richard; Tzourio, Christophe; Hofman, Albert; Nöthen, Markus M; Graff, Caroline; Psaty, Bruce M; Haines, Jonathan L; Lathrop, Mark; Pericak-Vance, Margaret A; Launer, Lenore J; Van Broeckhoven, Christine; Farrer, Lindsay A; van Duijn, Cornelia M; Ramirez, Alfredo; Seshadri, Sudha; Schellenberg, Gerard D; Amouyel, Philippe; Williams, Julie

2014-01-01

Alzheimer's disease is a common debilitating dementia with known heritability, for which 20 late onset susceptibility loci have been identified, but more remain to be discovered. This study sought to identify new susceptibility genes, using an alternative gene-wide analytical approach which tests for patterns of association within genes, in the powerful genome-wide association dataset of the International Genomics of Alzheimer's Project Consortium, comprising over 7 m genotypes from 25,580 Alzheimer's cases and 48,466 controls. In addition to earlier reported genes, we detected genome-wide significant loci on chromosomes 8 (TP53INP1, p = 1.4×10-6) and 14 (IGHV1-67 p = 7.9×10-8) which indexed novel susceptibility loci. The additional genes identified in this study, have an array of functions previously implicated in Alzheimer's disease, including aspects of energy metabolism, protein degradation and the immune system and add further weight to these pathways as potential therapeutic targets in Alzheimer's disease.

Gene-wide analysis detects two new susceptibility genes for Alzheimer's disease.

Directory of Open Access Journals (Sweden)

Valentina Escott-Price

Full Text Available Alzheimer's disease is a common debilitating dementia with known heritability, for which 20 late onset susceptibility loci have been identified, but more remain to be discovered. This study sought to identify new susceptibility genes, using an alternative gene-wide analytical approach which tests for patterns of association within genes, in the powerful genome-wide association dataset of the International Genomics of Alzheimer's Project Consortium, comprising over 7 m genotypes from 25,580 Alzheimer's cases and 48,466 controls.In addition to earlier reported genes, we detected genome-wide significant loci on chromosomes 8 (TP53INP1, p = 1.4×10-6 and 14 (IGHV1-67 p = 7.9×10-8 which indexed novel susceptibility loci.The additional genes identified in this study, have an array of functions previously implicated in Alzheimer's disease, including aspects of energy metabolism, protein degradation and the immune system and add further weight to these pathways as potential therapeutic targets in Alzheimer's disease.

Detection and sequence analysis of accessory gene regulator genes of Staphylococcus pseudintermedius isolates

Directory of Open Access Journals (Sweden)

M. Ananda Chitra

2015-07-01

Full Text Available Background: Staphylococcus pseudintermedius (SP is the major pathogenic species of dogs involved in a wide variety of skin and soft tissue infections. The accessory gene regulator (agr locus of Staphylococcus aureus has been extensively studied, and it influences the expression of many virulence genes. It encodes a two-component signal transduction system that leads to down-regulation of surface proteins and up-regulation of secreted proteins during in vitro growth of S. aureus. The objective of this study was to detect and sequence analyzing the AgrA, B, and D of SP isolated from canine skin infections. Materials and Methods: In this study, we have isolated and identified SP from canine pyoderma and otitis cases by polymerase chain reaction (PCR and confirmed by PCR-restriction fragment length polymorphism. Primers for SP agrA and agrBD genes were designed using online primer designing software and BLAST searched for its specificity. Amplification of the agr genes was carried out for 53 isolates of SP by PCR and sequencing of agrA, B, and D were carried out for five isolates and analyzed using DNAstar and Mega5.2 software. Results: A total of 53 (59% SP isolates were obtained from 90 samples. 15 isolates (28% were confirmed to be methicillinresistant SP (MRSP with the detection of the mecA gene. Accessory gene regulator A, B, and D genes were detected in all the SP isolates. Complete nucleotide sequences of the above three genes for five isolates were submitted to GenBank, and their accession numbers are from KJ133557 to KJ133571. AgrA amino acid sequence analysis showed that it is mainly made of alpha-helices and is hydrophilic in nature. AgrB is a transmembrane protein, and AgrD encodes the precursor of the autoinducing peptide (AIP. Sequencing of the agrD gene revealed that the 5 canine SP strains tested could be divided into three Agr specificity groups (RIPTSTGFF, KIPTSTGFF, and RIPISTGFF based on the putative AIP produced by each strain

Direct and long-term detection of gene doping in conventional blood samples.

Science.gov (United States)

Beiter, T; Zimmermann, M; Fragasso, A; Hudemann, J; Niess, A M; Bitzer, M; Lauer, U M; Simon, P

2011-03-01

The misuse of somatic gene therapy for the purpose of enhancing athletic performance is perceived as a coming threat to the world of sports and categorized as 'gene doping'. This article describes a direct detection approach for gene doping that gives a clear yes-or-no answer based on the presence or absence of transgenic DNA in peripheral blood samples. By exploiting a priming strategy to specifically amplify intronless DNA sequences, we developed PCR protocols allowing the detection of very small amounts of transgenic DNA in genomic DNA samples to screen for six prime candidate genes. Our detection strategy was verified in a mouse model, giving positive signals from minute amounts (20 μl) of blood samples for up to 56 days following intramuscular adeno-associated virus-mediated gene transfer, one of the most likely candidate vector systems to be misused for gene doping. To make our detection strategy amenable for routine testing, we implemented a robust sample preparation and processing protocol that allows cost-efficient analysis of small human blood volumes (200 μl) with high specificity and reproducibility. The practicability and reliability of our detection strategy was validated by a screening approach including 327 blood samples taken from professional and recreational athletes under field conditions.

Application of nanomaterials in the bioanalytical detection of disease-related genes.

Science.gov (United States)

Zhu, Xiaoqian; Li, Jiao; He, Hanping; Huang, Min; Zhang, Xiuhua; Wang, Shengfu

2015-12-15

In the diagnosis of genetic diseases and disorders, nanomaterials-based gene detection systems have significant advantages over conventional diagnostic systems in terms of simplicity, sensitivity, specificity, and portability. In this review, we describe the application of nanomaterials for disease-related genes detection in different methods excluding PCR-related method, such as colorimetry, fluorescence-based methods, electrochemistry, microarray methods, surface-enhanced Raman spectroscopy (SERS), quartz crystal microbalance (QCM) methods, and dynamic light scattering (DLS). The most commonly used nanomaterials are gold, silver, carbon and semiconducting nanoparticles. Various nanomaterials-based gene detection methods are introduced, their respective advantages are discussed, and selected examples are provided to illustrate the properties of these nanomaterials and their emerging applications for the detection of specific nucleic acid sequences. Copyright © 2015. Published by Elsevier B.V.

Application of DNA Machineries for the Barcode Patterned Detection of Genes or Proteins.

Science.gov (United States)

Zhou, Zhixin; Luo, Guofeng; Wulf, Verena; Willner, Itamar

2018-06-05

The study introduces an analytical platform for the detection of genes or aptamer-ligand complexes by nucleic acid barcode patterns generated by DNA machineries. The DNA machineries consist of nucleic acid scaffolds that include specific recognition sites for the different genes or aptamer-ligand analytes. The binding of the analytes to the scaffolds initiate, in the presence of the nucleotide mixture, a cyclic polymerization/nicking machinery that yields displaced strands of variable lengths. The electrophoretic separation of the resulting strands provides barcode patterns for the specific detection of the different analytes. Mixtures of DNA machineries that yield, upon sensing of different genes (or aptamer ligands), one-, two-, or three-band barcode patterns are described. The combination of nucleic acid scaffolds acting, in the presence of polymerase/nicking enzyme and nucleotide mixture, as DNA machineries, that generate multiband barcode patterns provide an analytical platform for the detection of an individual gene out of many possible genes. The diversity of genes (or other analytes) that can be analyzed by the DNA machineries and the barcode patterned imaging is given by the Pascal's triangle. As a proof-of-concept, the detection of one of six genes, that is, TP53, Werner syndrome, Tay-Sachs normal gene, BRCA1, Tay-Sachs mutant gene, and cystic fibrosis disorder gene by six two-band barcode patterns is demonstrated. The advantages and limitations of the detection of analytes by polymerase/nicking DNA machineries that yield barcode patterns as imaging readout signals are discussed.

Impairments of mecA gene detection in bovine Staphylococcus spp.

Directory of Open Access Journals (Sweden)

Dayanne Araújo de Melo

2014-09-01

Full Text Available Staphylococcus aureus antimicrobial resistance, especially to beta-lactams, favors treatment failures and its persistence in herd environment. This work aimed to develop a more specific primer for mecA gene detection based on the comparison of the conserved regions from distinct host origins and also investigated the presence of homologue mecA LGA251 in bovine strains. A total of 43 Staphylococcus spp. were included in this study, comprising 38 bovine S. aureus, two human and three equine coagulase-negative staphylococci (CNS. Phenotypical methicillin-resistance detection was performed through oxacillin agar-screening and cefoxitin disk-diffusion test. None isolate tested positive for mecA LGA251 gene. For mecA gene PCR, new primers were designed based on the sequences of human S. aureus (HE681097 and bovine S. sciuri (AY820253 mecA. The new primers based on the S. aureus mecA sequence amplified fragments of human and equine CNS and the ones based on S. sciuri mecA sequence only yielded fragments for S. aureus bovine strains. Multiples alignments of mecA gene sequences from bovine, human and equine revealed punctual but significant differences in bovine strains that can lead to the mecA gene detection impairment. The observed divergences of mecA gene sequences are not a matter of animal or human origin, it is a specificity of bovine samples.

Validation of a Novel Immunoline Assay for Patient Stratification according to Virulence of the Infecting Helicobacter pylori Strain and Eradication Status

Directory of Open Access Journals (Sweden)

Luca Formichella

2017-01-01

Full Text Available Helicobacter pylori infection shows a worldwide prevalence of around 50%. However, only a minority of infected individuals develop clinical symptoms or diseases. The presence of H. pylori virulence factors, such as CagA and VacA, has been associated with disease development, but assessment of virulence factor presence requires gastric biopsies. Here, we evaluate the H. pylori recomLine test for risk stratification of infected patients by comparing the test score and immune recognition of type I or type II strains defined by the virulence factors CagA, VacA, GroEL, UreA, HcpC, and gGT with patient’s disease status according to histology. Moreover, the immune responses of eradicated individuals from two different populations were analysed. Their immune response frequencies and intensities against all antigens except CagA declined below the detection limit. CagA was particularly long lasting in both independent populations. An isolated CagA band often represents past eradication with a likelihood of 88.7%. In addition, a high recomLine score was significantly associated with high-grade gastritis, atrophy, intestinal metaplasia, and gastric cancer. Thus, the recomLine is a sensitive and specific noninvasive test for detecting serum responses against H. pylori in actively infected and eradicated individuals. Moreover, it allows stratifying patients according to their disease state.

Molecular detection of TasA gene in endophytic Bacillus species ...

African Journals Online (AJOL)

Molecular detection of TasA gene in endophytic Bacillus species and characterization of the gene in Bacillus amyloliquefaciens. ... African Journal of Biotechnology ... in Bacillus amyloliquefaciens PEBA20 and 7 strains of Bacillus subtilis, ...

A functional gene array for detection of bacterial virulence elements

Energy Technology Data Exchange (ETDEWEB)

Jaing, C

2007-11-01

We report our development of the first of a series of microarrays designed to detect pathogens with known mechanisms of virulence and antibiotic resistance. By targeting virulence gene families as well as genes unique to specific biothreat agents, these arrays will provide important data about the pathogenic potential and drug resistance profiles of unknown organisms in environmental samples. To validate our approach, we developed a first generation array targeting genes from Escherichia coli strains K12 and CFT073, Enterococcus faecalis and Staphylococcus aureus. We determined optimal probe design parameters for microorganism detection and discrimination, measured the required target concentration, and assessed tolerance for mismatches between probe and target sequences. Mismatch tolerance is a priority for this application, due to DNA sequence variability among members of gene families. Arrays were created using the NimbleGen Maskless Array Synthesizer at Lawrence Livermore National Laboratory. Purified genomic DNA from combinations of one or more of the four target organisms, pure cultures of four related organisms, and environmental aerosol samples with spiked-in genomic DNA were hybridized to the arrays. Based on the success of this prototype, we plan to design further arrays in this series, with the goal of detecting all known virulence and antibiotic resistance gene families in a greatly expanded set of organisms.

Molecular detection of disease resistance genes to powdery mildew ...

African Journals Online (AJOL)

A study was conducted to detect the presence of disease resistance genes to infection of wheat powdery mildew (Blumeria graminis f. sp. tritici) in selected wheat cultivars from China using molecular markers. Genomic DNA of sixty cultivars was extracted and tested for the presence of selected prominent resistance genes to ...

Fast and sensitive detection of indels induced by precise gene targeting

DEFF Research Database (Denmark)

Yang, Zhang; Steentoft, Catharina; Hauge, Camilla

2015-01-01

The nuclease-based gene editing tools are rapidly transforming capabilities for altering the genome of cells and organisms with great precision and in high throughput studies. A major limitation in application of precise gene editing lies in lack of sensitive and fast methods to detect...... and characterize the induced DNA changes. Precise gene editing induces double-stranded DNA breaks that are repaired by error-prone non-homologous end joining leading to introduction of insertions and deletions (indels) at the target site. These indels are often small and difficult and laborious to detect...

A hybrid network-based method for the detection of disease-related genes

Science.gov (United States)

Cui, Ying; Cai, Meng; Dai, Yang; Stanley, H. Eugene

2018-02-01

Detecting disease-related genes is crucial in disease diagnosis and drug design. The accepted view is that neighbors of a disease-causing gene in a molecular network tend to cause the same or similar diseases, and network-based methods have been recently developed to identify novel hereditary disease-genes in available biomedical networks. Despite the steady increase in the discovery of disease-associated genes, there is still a large fraction of disease genes that remains under the tip of the iceberg. In this paper we exploit the topological properties of the protein-protein interaction (PPI) network to detect disease-related genes. We compute, analyze, and compare the topological properties of disease genes with non-disease genes in PPI networks. We also design an improved random forest classifier based on these network topological features, and a cross-validation test confirms that our method performs better than previous similar studies.

Detection of drought tolerant genes within seedling apple rootstocks in Syria

Science.gov (United States)

This investigation was conducted to detect the drought tolerant genes (four genes) within seedling apple rootstocks derived from five apple genotypes, including Syrian apple cultivars. The results showed that the gene MdPepPro (a cyclophilin) was found in all studied genotypes and their progenies e...

Real-time PCR detection of Fe-type nitrile hydratase genes from environmental isolates suggests horizontal gene transfer between multiple genera.

Science.gov (United States)

Coffey, Lee; Owens, Erica; Tambling, Karen; O'Neill, David; O'Connor, Laura; O'Reilly, Catherine

2010-11-01

Nitriles are widespread in the environment as a result of biological and industrial activity. Nitrile hydratases catalyse the hydration of nitriles to the corresponding amide and are often associated with amidases, which catalyze the conversion of amides to the corresponding acids. Nitrile hydratases have potential as biocatalysts in bioremediation and biotransformation applications, and several successful examples demonstrate the advantages. In this work a real-time PCR assay was designed for the detection of Fe-type nitrile hydratase genes from environmental isolates purified from nitrile-enriched soils and seaweeds. Specific PCR primers were also designed for amplification and sequencing of the genes. Identical or highly homologous nitrile hydratase genes were detected from isolates of numerous genera from geographically diverse sites, as were numerous novel genes. The genes were also detected from isolates of genera not previously reported to harbour nitrile hydratases. The results provide further evidence that many bacteria have acquired the genes via horizontal gene transfer. The real-time PCR assay should prove useful in searching for nitrile hydratases that could have novel substrate specificities and therefore potential in industrial applications.

Association testing to detect gene-gene interactions on sex chromosomes in trio data

Directory of Open Access Journals (Sweden)

Yeonok eLee

2013-11-01

Full Text Available Autism Spectrum Disorder (ASD occurs more often among males than females in a 4:1 ratio. Among theories used to explain the causes of ASD, the X chromosome and the Y chromosome theories attribute ASD to X-linked mutation and the male-limited gene expressions on the Y chromosome, respectively. Despite the rationale of the theory, studies have failed to attribute the sex-biased ratio to the significant linkage or association on the regions of interest on X chromosome. We further study the gender biased ratio by examining the possible interaction effects between two genes in the sex chromosomes. We propose a logistic regression model with mixed effects to detect gene-gene interactions on sex chromosomes. We investigated the power and type I error rates of the approach for a range of minor allele frequencies and varying linkage disequilibrium between markers and QTLs. We also evaluated the robustness of the model to population stratification. We applied the model to a trio-family data set with an ASD affected male child to study gene-gene interactions on sex chromosomes.

Can subtle changes in gene expression be consistently detected with different microarray platforms?

Directory of Open Access Journals (Sweden)

Kuiper Rowan

2008-03-01

Full Text Available Abstract Background The comparability of gene expression data generated with different microarray platforms is still a matter of concern. Here we address the performance and the overlap in the detection of differentially expressed genes for five different microarray platforms in a challenging biological context where differences in gene expression are few and subtle. Results Gene expression profiles in the hippocampus of five wild-type and five transgenic δC-doublecortin-like kinase mice were evaluated with five microarray platforms: Applied Biosystems, Affymetrix, Agilent, Illumina, LGTC home-spotted arrays. Using a fixed false discovery rate of 10% we detected surprising differences between the number of differentially expressed genes per platform. Four genes were selected by ABI, 130 by Affymetrix, 3,051 by Agilent, 54 by Illumina, and 13 by LGTC. Two genes were found significantly differentially expressed by all platforms and the four genes identified by the ABI platform were found by at least three other platforms. Quantitative RT-PCR analysis confirmed 20 out of 28 of the genes detected by two or more platforms and 8 out of 15 of the genes detected by Agilent only. We observed improved correlations between platforms when ranking the genes based on the significance level than with a fixed statistical cut-off. We demonstrate significant overlap in the affected gene sets identified by the different platforms, although biological processes were represented by only partially overlapping sets of genes. Aberrances in GABA-ergic signalling in the transgenic mice were consistently found by all platforms. Conclusion The different microarray platforms give partially complementary views on biological processes affected. Our data indicate that when analyzing samples with only subtle differences in gene expression the use of two different platforms might be more attractive than increasing the number of replicates. Commercial two-color platforms seem to

RUBIC identifies driver genes by detecting recurrent DNA copy number breaks

NARCIS (Netherlands)

van Dyk, H.O.; Hoogstraat, M; ten Hoeve, J; Reinders, M.J.T.; Wessels, L.F.A.

2016-01-01

The frequent recurrence of copy number aberrations across tumour samples is a reliable hallmark of certain cancer driver genes. However, state-of-the-art algorithms for detecting recurrent aberrations fail to detect several known drivers. In this study, we propose RUBIC, an approach that detects

PCR-based detection of resistance genes in anaerobic bacteria isolated from intra-abdominal infections.

Science.gov (United States)

Tran, Chau Minh; Tanaka, Kaori; Watanabe, Kunitomo

2013-04-01

Little information is available on the distribution of antimicrobial resistance genes in anaerobes in Japan. To understand the background of antimicrobial resistance in anaerobes involved in intra-abdominal infections, we investigated the distribution of eight antimicrobial resistance genes (cepA, cfiA, cfxA, ermF, ermB, mefA, tetQ, and nim) and a mutation in the gyrA gene in a total of 152 organisms (Bacteroides spp., Prevotella spp., Fusobacterium spp., Porphyromonas spp., Bilophila wadsworthia, Desulfovibrio desulfuricans, Veillonella spp., gram-positive cocci, and non-spore-forming gram-positive bacilli) isolated between 2003 and 2004 in Japan. The cepA gene was distributed primarily in Bacteroides fragilis. Gene cfxA was detected in about 9 % of the Bacteroides isolates and 75 % of the Prevotella spp. isolates and did not appear to contribute to cephamycin resistance. Two strains of B. fragilis contained the metallo-β-lactamase gene cfiA, but they did not produce the protein product. Gene tetQ was detected in about 81, 44, and 63 % of B. fragilis isolates, other Bacteroides spp., and Prevotella spp. isolates, respectively. The ermF gene was detected in 25, 13, 56, 64, and 16 % of Bacteroides spp., Prevotella spp., Fusobacterium spp., B. wadsworthia, and anaerobic cocci, respectively. Gene mefA was found in only 10 % of the B. fragilis strains and 3 % of the non-B. fragilis strains. Genes nim and ermB were not detected in any isolate. Substitution at position 82 (Ser to Phe) in gyrA was detected in B. fragilis isolates that were less susceptible or resistant to moxifloxacin. This study is the first report on the distribution of resistance genes in anaerobes isolated from intra-abdominal infections in Japan. We expect that the results might help in understanding the resistance mechanisms of specific anaerobes.

Detection of Shiga toxins genes by Multiplex PCR in clinical samples

Directory of Open Access Journals (Sweden)

2013-09-01

Full Text Available Background: Different methods have been used for detection of shiga toxins; such as,  cell culture, ELISA, and RFPLA. However, all of these methods suffer from high cost, time-consumption and relatively low sensitivity. In this study we used Multiplex PCR method for detection of genes encoding shiga toxins. Material and Methods: In this study, 63 clinical samples were obtained from positive cultures of Shigella and E. coli O157, from Bahman 1391 until Ordibehesht 1392 in Mazandaran province. Initial confirmation of shiga toxins producing bacteria was performed by biochemical and serological methods. After DNA extraction, detection of stx1 and stx2 genes was accomplished by multiplex PCR.  For confirmation of the PCR amplicon, DNA sequencing was used. Antibiotic sensitivity tests were performed by disk diffusion method. Results:  Among the positive strains, 13 strains contained stx2 genes, 4 strains contained Stx/Stx1 genes and 4 strains harbored both Stx/Stx1 and Stx2. The DNA extracted from other Gram-negative bacteria was not protected by the relevant parts of these toxins. Sequencing of the amplified fragments indicated the correct toxin sequences.  The sensitivity for identification of Stx/Stx1 gene was 1.56 pg/ µl and for Stx2 was 1.08 pg/µl. The toxin positive strains were all sensitive to Cefixime, Gentamicin, Amikacin, Ceftriaxone, and Nitrofurantoin. Conclusion: This method is fast and accurate for detection of bacteria producing shiga toxin and can be used to identify different types of shiga toxin.

Real-time PCR detection of aldoxime dehydratase genes in nitrile-degrading microorganisms.

Science.gov (United States)

Dooley-Cullinane, Tríona Marie; O'Reilly, Catherine; Coffey, Lee

2017-02-01

Aldoxime dehydratase catalyses the conversion of aldoximes to their corresponding nitriles. Utilization of the aldoxime-nitrile metabolising enzyme pathway can facilitate the move towards a greener chemistry. In this work, a real-time PCR assay was developed for the detection of aldoxime dehydratase genes in aldoxime/nitrile metabolising microorganisms which have been purified from environmental sources. A conventional PCR assay was also designed allowing gene confirmation via sequencing. Aldoxime dehydratase genes were identified in 30 microorganisms across 11 genera including some not previously shown to harbour the gene. The assay displayed a limit of detection of 1 pg/μL DNA or 7 CFU/reaction. This real-time PCR assay should prove valuable in the high-throughput screening of micro-organisms for novel aldoxime dehydratase genes towards pharmaceutical and industrial applications.

Detection of growth hormone doping by gene expression profiling of peripheral blood.

Science.gov (United States)

Mitchell, Christopher J; Nelson, Anne E; Cowley, Mark J; Kaplan, Warren; Stone, Glenn; Sutton, Selina K; Lau, Amie; Lee, Carol M Y; Ho, Ken K Y

2009-12-01

GH abuse is a significant problem in many sports, and there is currently no robust test that allows detection of doping beyond a short window after administration. Our objective was to evaluate gene expression profiling in peripheral blood leukocytes in-vivo as a test for GH doping in humans. Seven men and thirteen women were administered GH, 2 mg/d sc for 8 wk. Blood was collected at baseline and at 8 wk. RNA was extracted from the white cell fraction. Microarray analysis was undertaken using Agilent 44K G4112F arrays using a two-color design. Quantitative RT-PCR using TaqMan gene expression assays was performed for validation of selected differentially expressed genes. GH induced an approximately 2-fold increase in circulating IGF-I that was maintained throughout the 8 wk of the study. GH induced significant changes in gene expression with 353 in women and 41 in men detected with a false discovery rate of less than 5%. None of the differentially expressed genes were common between men and women. The maximal changes were a doubling for up-regulated or halving for down-regulated genes, similar in magnitude to the variation between individuals. Quantitative RT-PCR for seven target genes showed good concordance between microarray and quantitative PCR data in women but not in men. Gene expression analysis of peripheral blood leukocytes is unlikely to be a viable approach for the detection of GH doping.

The Prevalence of Helicobacter pylori in Estonian Bariatric Surgery Patients

Directory of Open Access Journals (Sweden)

Natalja Šebunova

2018-01-01

Full Text Available Helicobacter pylori (Hp is one of the most important human pathogens that can cause duodenal and gastric ulcers, gastritis and stomach cancer. Hp infection is considered to be a cause of limiting access to bariatric surgery. The aim of this study was to determine the prevalence of Hp in patients with obesity going into bariatric surgery and to reveal the relationship between Hp and clinical data. The study group was formed of 68 preoperative bariatric surgery patients (body mass index (BMI 44.7 ± 4.8. Gastric biopsies (antrum and corpus were used for histological and molecular (caqA and glmM genes examinations. The PCR method revealed Hp infection in 64.7% of obese patients that is higher in comparison with histological analysis (55.9%. The prevalence of cagA and glmM genes in antrum mucosa was 45.6% and 47.0% while in the corpus it was 41.2% and 38.3%, respectively. The coincidence of both cagA and glmM virulence genes in the antrum and corpus mucosa was 33.8% and 22.1%, respectively. Either of the genes was found in 58.8% of antrum and 57.3% of corpus mucosa. Presence of caqA and glmM genes was in association with active and atrophic chronic gastritis. In conclusion, our study demonstrated that two thirds of morbidly obese patients undergoing bariatric surgery are infected with Hp and have a high prevalence of cagA and glmM virulence genes that points out the necessity for diagnostics and treatment of this infection before surgery.

Rapid, highly sensitive and highly specific gene detection by combining enzymatic amplification and DNA chip detection simultaneously

Directory of Open Access Journals (Sweden)

Koji Hashimoto

2016-05-01

Full Text Available We have developed a novel gene detection method based on the loop-mediated isothermal amplification (LAMP reaction and the DNA dissociation reaction on the same DNA chip surface to achieve a lower detection limit, broader dynamic range and faster detection time than are attainable with a conventional DNA chip. Both FAM- and thiol-labeled DNA probe bound to the complementary sequence accompanying Dabcyl was immobilized on the gold surface via Au/thiol bond. The LAMP reaction was carried out on the DNA probe fixed gold surface. At first, Dabcyl molecules quenched the FAM fluorescence. According to the LAMP reaction, the complementary sequence with Dabcyl was competitively reacted with the amplified targeted sequence. As a result, the FAM fluorescence increased owing to dissociation of the complementary sequence from the DNA probe. The simultaneous reaction of LAMP and DNA chip detection was achieved, and 103 copies of the targeted gene were detected within an hour by measuring fluorescence intensity of the DNA probe. Keywords: Biosensor, DNA chip, Loop-mediated isothermal amplification (LAMP, Fluorescence detection, Gold substrate, Au/thiol bond

Molecular detection of carbapenemase-producing genes in referral ...

African Journals Online (AJOL)

Molecular confirmation of carbapenemase-producing Enterobacteriaceae (CPE) was introduced in South Africa (SA) at the end of 2011. We report on the detection of these resistance genes based on referral isolates. Enterobacteriaceae with non-susceptibility to any of the carbapenems according to defined criteria for ...

Inhibition of Helicobacter pylori CagA-Induced Pathogenesis by Methylantcinate B from Antrodia camphorata

Directory of Open Access Journals (Sweden)

Chun-Jung Lin

2013-01-01

Full Text Available The bacterial pathogen Helicobacter pylori (Hp is the leading risk factor for the development of gastric cancer. Hp virulence factor, cytotoxin-associated gene A (CagA interacted with cholesterol-enriched microdomains and leads to induction of inflammation in gastric epithelial cells (AGS. In this study, we identified a triterpenoid methylantcinate B (MAB from the medicinal mushroom Antrodia camphoratawhich inhibited the translocation and phosphorylation of CagA and caused a reduction in hummingbird phenotype in HP-infected AGS cells. Additionally, MAB suppressed the Hp-induced inflammatory response by attenuation of NF-κB activation, translocation of p65 NF-κB, and phosphorylation of IκB-α, indicating that MAB modulates CagA-mediated signaling pathway. Additionally, MAB also suppressed the IL-8 luciferase activity and its secretion in HP-infected AGS cells. On the other hand, molecular structure simulations revealed that MAB interacts with CagA similarly to that of cholesterol. Moreover, binding of cholesterol to the immobilized CagA was inhibited by increased levels of MAB. Our results demonstrate that MAB is the first natural triterpenoid which competes with cholesterol bound to CagA leading to attenuation of Hp-induced pathogenesis of epithelial cells. Thus, this study indicates that MAB may have a scope to develop as a therapeutic candidate against Hp CagA-induced inflammation.

Detection of exogenous gene doping of IGF-I by a real-time quantitative PCR assay.

Science.gov (United States)

Zhang, Jin-Ju; Xu, Jing-Feng; Shen, Yong-Wei; Ma, Shi-Jiao; Zhang, Ting-Ting; Meng, Qing-Lin; Lan, Wen-Jun; Zhang, Chun; Liu, Xiao-Mei

2017-07-01

Gene doping can be easily concealed since its product is similar to endogenous protein, making its effective detection very challenging. In this study, we selected insulin-like growth factor I (IGF-I) exogenous gene for gene doping detection. First, the synthetic IGF-I gene was subcloned to recombinant adeno-associated virus (rAAV) plasmid to produce recombinant rAAV2/IGF-I-GFP vectors. Second, in an animal model, rAAV2/IGF-I-GFP vectors were injected into the thigh muscle tissue of mice, and then muscle and blood specimens were sampled at different time points for total DNA isolation. Finally, real-time quantitative PCR was employed to detect the exogenous gene doping of IGF-I. In view of the characteristics of endogenous IGF-I gene sequences, a TaqMan probe was designed at the junction of exons 2 and 3 of IGF-I gene to distinguish it from the exogenous IGF-I gene. In addition, an internal reference control plasmid and its probe were used in PCR to rule out false-positive results through comparison of their threshold cycle (Ct) values. Thus, an accurate exogenous IGF-I gene detection approach was developed in this study. © 2016 International Union of Biochemistry and Molecular Biology, Inc.

Helicobacter pylori HopE and HopV porins present scarce expression among clinical isolates

Science.gov (United States)

Lienlaf, Maritza; Morales, Juan Pablo; Díaz, María Inés; Díaz, Rodrigo; Bruce, Elsa; Siegel, Freddy; León, Gloria; Harris, Paul R; Venegas, Alejandro

2010-01-01

AIM: To evaluate how widely Helicobacter pylori (H. pylori) HopE and HopV porins are expressed among Chilean isolates and how seroprevalent they are among infected patients in Chile. METHODS: H. pylori hopE and hopV genes derived from strain CHCTX-1 were cloned by polymerase chain reaction (PCR), sequenced and expressed in Escherichia coli AD494 (DE3). Gel-purified porins were used to prepare polyclonal antibodies. The presence of both genes was tested by PCR in a collection of H. pylori clinical isolates and their expression was detected in lysates by immunoblotting. Immune responses against HopE, HopV and other H. pylori antigens in sera from infected and non-infected patients were tested by Western blotting using these sera as first antibody on recombinant H. pylori antigens. RESULTS: PCR and Western blotting assays revealed that 60 and 82 out of 130 Chilean isolates carried hopE and hopV genes, respectively, but only 16 and 9, respectively, expressed these porins. IgG serum immunoreactivity evaluation of 69 H. pylori-infected patients revealed that HopE and HopV were infrequently recognized (8.7% and 10.1% respectively) compared to H. pylori VacA (68.1%) and CagA (59.5%) antigens. Similar values were detected for IgA serum immunoreactivity against HopE (11.6%) and HopV (10.5%) although lower values for VacA (42%) and CagA (17.4%) were obtained when compared to the IgG response. CONCLUSION: A scarce expression of HopE and HopV among Chilean isolates was found, in agreement with the infrequent seroconversion against these antigens when tested in infected Chilean patients. PMID:20082477

High-throughput Microarray Detection of Vomeronasal Receptor Gene Expression in Rodents

Directory of Open Access Journals (Sweden)

Xiaohong Zhang

2010-11-01

Full Text Available We performed comprehensive data mining to explore the vomeronasal receptor (V1R & V2R repertoires in mouse and rat using the mm5 and rn3 genome, respectively. This bioinformatic analysis was followed by investigation of gene expression using a custom designed high-density oligonucleotide array containing all of these receptors and other selected genes of interest. This array enabled us to detect the specific expression of V1R and V2Rs which were previously identified solely based on computational prediction from gene sequence data, thereby establishing that these genes are indeed part of the vomeronasal system, especially the V2Rs. 168 V1Rs and 98 V2Rs were detected to be highly enriched in mouse vomeronasal organ (VNO, and 108 V1Rs and 87 V2Rs in rat VNO. We monitored the expression profile of mouse VR genes in other non-VNO tissues with the result that some VR genes were re-designated as VR-like genes based on their non-olfactory expression pattern. Temporal expression profiles for mouse VR genes were characterized and their patterns were classified, revealing the developmental dynamics of these so-called pheromone receptors. We found numerous patterns of temporal expression which indicate possible behavior-related functions. The uneven composition of VR genes in certain patterns suggests a functional differentiation between the two types of VR genes. We found the coherence between VR genes and transcription factors in terms of their temporal expression patterns. In situ hybridization experiments were performed to evaluate the cell number change over time for selected receptor genes.

The cag PAI is intact and functional but HP0521 varies significantly in Helicobacter pylori isolates from Malaysia and Singapore.

Science.gov (United States)

Schmidt, H-M A; Andres, S; Nilsson, C; Kovach, Z; Kaakoush, N O; Engstrand, L; Goh, K-L; Fock, K M; Forman, D; Mitchell, H

2010-04-01

Helicobacter pylori-related disease is at least partially attributable to the genotype of the infecting strain, particularly the presence of specific virulence factors. We investigated the prevalence of a novel combination of H. pylori virulence factors, including the cag pathogenicity island (PAI), and their association with severe disease in isolates from the three major ethnicities in Malaysia and Singapore, and evaluated whether the cag PAI was intact and functional in vitro. Polymerase chain reaction (PCR) was used to detect dupA, cagA, cagE, cagT, cagL and babA, and to type vacA, the EPIYA motifs, HP0521 alleles and oipA ON status in 159 H. pylori clinical isolates. Twenty-two strains were investigated for IL-8 induction and CagA translocation in vitro. The prevalence of cagA, cagE, cagL, cagT, babA, oipA ON and vacA s1 and i1 was >85%, irrespective of the disease state or ethnicity. The prevalence of dupA and the predominant HP0521 allele and EPIYA motif varied significantly with ethnicity (p < 0.05). A high prevalence of an intact cag PAI was found in all ethnic groups; however, no association was observed between any virulence factor and disease state. The novel association between the HP0521 alleles, EPIYA motifs and host ethnicity indicates that further studies to determine the function of this gene are important.

Detection of Promyelocytic Leukemia/Retinoic Acid Receptor α (PML/RARα Fusion Gene with Functionalized Graphene Oxide

Directory of Open Access Journals (Sweden)

Hongwei Wang

2013-06-01

Full Text Available An attempt was made to use functionalized graphene oxide (GO to detect the Promyelocytic leukemia/Retinoic acid receptor α fusion gene (PML/RARα fusion gene, a marker gene of acute promyelocytic leukemia. The functionalized GO was prepared by chemical exfoliation method, followed by a polyethylene glycol grafting. It is found that the functionalized GO can selectively adsorb the fluorescein isothiocyanate (FITC-labeled single-stranded DNA probe and quench its fluorescence. The probe can be displaced by the PML/RARα fusion gene to restore the fluorescence, which can be detected by laser confocal microscopy and flow cytometry. These can be used to detect the presence of the PML/RARα fusion gene. This detection method is verified to be fast, simple and reliable.

Multiplex-PCR-Based Screening and Computational Modeling of Virulence Factors and T-Cell Mediated Immunity in Helicobacter pylori Infections for Accurate Clinical Diagnosis.

Science.gov (United States)

Oktem-Okullu, Sinem; Tiftikci, Arzu; Saruc, Murat; Cicek, Bahattin; Vardareli, Eser; Tozun, Nurdan; Kocagoz, Tanil; Sezerman, Ugur; Yavuz, Ahmet Sinan; Sayi-Yazgan, Ayca

2015-01-01

The outcome of H. pylori infection is closely related with bacteria's virulence factors and host immune response. The association between T cells and H. pylori infection has been identified, but the effects of the nine major H. pylori specific virulence factors; cagA, vacA, oipA, babA, hpaA, napA, dupA, ureA, ureB on T cell response in H. pylori infected patients have not been fully elucidated. We developed a multiplex- PCR assay to detect nine H. pylori virulence genes with in a three PCR reactions. Also, the expression levels of Th1, Th17 and Treg cell specific cytokines and transcription factors were detected by using qRT-PCR assays. Furthermore, a novel expert derived model is developed to identify set of factors and rules that can distinguish the ulcer patients from gastritis patients. Within all virulence factors that we tested, we identified a correlation between the presence of napA virulence gene and ulcer disease as a first data. Additionally, a positive correlation between the H. pylori dupA virulence factor and IFN-γ, and H. pylori babA virulence factor and IL-17 was detected in gastritis and ulcer patients respectively. By using computer-based models, clinical outcomes of a patients infected with H. pylori can be predicted by screening the patient's H. pylori vacA m1/m2, ureA and cagA status and IFN-γ (Th1), IL-17 (Th17), and FOXP3 (Treg) expression levels. Herein, we report, for the first time, the relationship between H. pylori virulence factors and host immune responses for diagnostic prediction of gastric diseases using computer-based models.

Detection of Horizontal Gene Transfers from Phylogenetic Comparisons

Science.gov (United States)

Pylro, Victor Satler; Vespoli, Luciano de Souza; Duarte, Gabriela Frois; Yotoko, Karla Suemy Clemente

2012-01-01

Bacterial phylogenies have become one of the most important challenges for microbial ecology. This field started in the mid-1970s with the aim of using the sequence of the small subunit ribosomal RNA (16S) tool to infer bacterial phylogenies. Phylogenetic hypotheses based on other sequences usually give conflicting topologies that reveal different evolutionary histories, which in some cases may be the result of horizontal gene transfer events. Currently, one of the major goals of molecular biology is to understand the role that horizontal gene transfer plays in species adaptation and evolution. In this work, we compared the phylogenetic tree based on 16S with the tree based on dszC, a gene involved in the cleavage of carbon-sulfur bonds. Bacteria of several genera perform this survival task when living in environments lacking free mineral sulfur. The biochemical pathway of the desulphurization process was extensively studied due to its economic importance, since this step is expensive and indispensable in fuel production. Our results clearly show that horizontal gene transfer events could be detected using common phylogenetic methods with gene sequences obtained from public sequence databases. PMID:22675653

An endogenous reference gene of common and durum wheat for detection of genetically modified wheat.

Science.gov (United States)

Imai, Shinjiro; Tanaka, Keiko; Nishitsuji, Yasuyuki; Kikuchi, Yosuke; Matsuoka, Yasuyuki; Arami, Shin-Ichiro; Sato, Megumi; Haraguchi, Hiroyuki; Kurimoto, Youichi; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

2012-01-01

To develop a method for detecting GM wheat that may be marketed in the near future, we evaluated the proline-rich protein (PRP) gene as an endogenous reference gene of common wheat (Triticum aestivum L.) and durum wheat (Triticum durum L.). Real-time PCR analysis showed that only DNA of wheat was amplified and no amplification product was observed for phylogenetically related cereals, indicating that the PRP detection system is specific to wheat. The intensities of the amplification products and Ct values among all wheat samples used in this study were very similar, with no nonspecific or additional amplification, indicating that the PRP detection system has high sequence stability. The limit of detection was estimated at 5 haploid genome copies. The PRP region was demonstrated to be present as a single or double copy in the common wheat haploid genome. Furthermore, the PRP detection system showed a highly linear relationship between Ct values and the amount of plasmid DNA, indicating that an appropriate calibration curve could be constructed for quantitative detection of GM wheat. All these results indicate that the PRP gene is a suitable endogenous reference gene for PCR-based detection of GM wheat.

Development of a rapid method for direct detection of tet(M) genes in soil from Danish farmland

DEFF Research Database (Denmark)

Agersø, Yvonne; Sengeløv, Gitte; Jensen, Lars Bogø

2004-01-01

. The tet(M) gene was directly detected in 10-80% of the samples from the various farmland soils and could be detected in all samples tested after selective enrichment. To validate the obtained results, the method was applied to garden soil samples where lower prevalence of resistance was found. Result......A method for direct detection of antibiotic resistance genes in soil samples has been developed. The tetracycline resistance gene, tet(M), was used as a model. The method was validated on Danish farmland soil that had repeatedly been treated with pig manure slurry containing resistant bacteria......: A detection limit of 10(2)-10(3) copies of the tet(M) gene per gram of soil (in a Bacillus cereus group bacterium) was achieved. tet(M) gene was detected in soil samples with the highest prevalence on farmland treated with pig manure slurry....

Frecuencia de los genotipos babA2, oipA y cagE de Helicobacter pylori en pacientes colombianos con enfermedades gastroduodenales.

Directory of Open Access Journals (Sweden)

Andrés Javier Quiroga

2005-09-01

Full Text Available Introducción. La infección con Helicobacter pylori está asociada con el desarrollo de diferentes enfermedades gastroduodenales. Varios genes de virulencia de H. pylori se han relacionado con mayor riesgo de enfermedad gástrica. Objetivos. El propósito de este trabajo fue determinar las posibles asociaciones entre la presencia de los genes vacA, cagA, cagE, babA2 y oipA en aislamientos de H. pylori de pacientes colombianos y las diferentes consecuencias clínicas de la infección. Materiales y métodos. Mediante PCR se evaluaron los genotipos cagA, vacA, cagE, oipA y babA2 en 166 aislamientos de H. pylori provenientes de 50 pacientes con úlcera péptica, 39 con gastritis crónica no atrófica, 26 con gastritis crónica atrófica, 26 con metaplasia intestinal y 25 con adenocarcinoma gástrico. Resultados. La frecuencia de los genotipos cagA, cagE, babA2 y oipA fue de 73%, 75%, 48% y 74%, respectivamente. El 64% (100/157 de los aislamientos presentó el genotipo citotóxico vacAs1m1/cagA positivo/cagE positivo. Se observó una mayor frecuencia de cepas citotóxicas en pacientes con cáncer (84%, metaplasia (91% y úlcera (81% en comparación con pacientes con gastritis no atrófica (50% (p=0,002, 0,008 y 0,007, respectivamente. La frecuencia de oipA y babA2 fue mayor en cepas citotóxicas que en cepas no citotóxicas (oipA: 81% vs. 52%, p=0,003; babA2: 58% vs. 12%, p=0,000. No se observaron diferencias significativas en la frecuencia de los genes oipA o babA2 solos o en asociación con vacA y cagA/cagE y las diferentes enfermedades gastroduodenales. Conclusiones. No se encontraron evidencias que sugieran que los genes babA2 u oipA puedan servir como marcadores de ulcerogénesis o carcinogénesis en esta población, solos o en asociación con cagA, cagE o vacA.

Detection of single-copy functional genes in prokaryotic cells by two-pass TSA-FISH with polynucleotide probes.

Science.gov (United States)

Kawakami, Shuji; Hasegawa, Takuya; Imachi, Hiroyuki; Yamaguchi, Takashi; Harada, Hideki; Ohashi, Akiyoshi; Kubota, Kengo

2012-02-01

In situ detection of functional genes with single-cell resolution is currently of interest to microbiologists. Here, we developed a two-pass tyramide signal amplification (TSA)-fluorescence in situ hybridization (FISH) protocol with PCR-derived polynucleotide probes for the detection of single-copy genes in prokaryotic cells. The mcrA gene and the apsA gene in methanogens and sulfate-reducing bacteria, respectively, were targeted. The protocol showed bright fluorescence with a good signal-to-noise ratio and achieved a high efficiency of detection (>98%). The discrimination threshold was approximately 82-89% sequence identity. Microorganisms possessing the mcrA or apsA gene in anaerobic sludge samples were successfully detected by two-pass TSA-FISH with polynucleotide probes. The developed protocol is useful for identifying single microbial cells based on functional gene sequences. Copyright © 2011 Elsevier B.V. All rights reserved.

ROLE OF HELICOBACTER PYLORI INFECTION AND LIFESTYLE HABITS IN THE DEVELOPMENT OF GASTRODUODENAL DISEASES IN A POPULATION FROM THE BRAZILIAN AMAZON

Directory of Open Access Journals (Sweden)

Ruth Maria Dias Ferreira VINAGRE

2013-09-01

Full Text Available Context Although more than half of the world's population is colonized with Helicobacter pylori, it remains unknown why this organism is able to produce severe disease in some hosts and be innocuous in others. The clinical outcome of infection is determined by several factors, including differences in the host response to bacterial stimulation, specific virulence factors of the organism and environmental influences, or a combination of these factors. Objectives This study compared the prevalence of H. pylori infection and risk factors (infection with CagA+ strains, excessive alcohol consumption, smoking, and inadequate eating habits between patients with different gastrointestinal disorders and associated these risk factors with the histopathological findings. Methods In a prospective study, samples were collected from 442 patients and a standardized questionnaire regarding lifestyle habits (excessive alcohol consumption, smoking, and eating habits was applied. The presence of H. pylori and of the cagA gene was investigated by polymerase chain reaction (PCR. Gastric biopsies were obtained for histological assessment. Results The frequency of alcohol consumption, smoking, inadequate diet and infection with CagA+ H. pylori was higher among patients with peptic ulcer and adenocarcinoma when compared to those with gastritis. Gastric inflammation was more pronounced in patients infected with CagA+ strains. Conclusion We conclude that infection with CagA+ H. pylori strains, excessive alcohol consumption, smoking and inadequate eating habits increase the risk of developing peptic ulcer and gastric carcinoma.

Molecular interactions between MUC1 epithelial mucin, β-catenin, and CagA proteins

Directory of Open Access Journals (Sweden)

Wei eGuang

2012-05-01

Full Text Available Interleukin (IL-8-driven neutrophil infiltration of the gastric mucosa is pathognomonic of persistent Helicobacter pylori infection. Our prior study showed that ectopic over-expression of MUC1 in human AGS gastric epithelial cells reduced H. pylori-stimulated IL-8 production compared with cells expressing MUC1 endogenously. Conversely, Muc1 knockout (Muc1-/- mice displayed an increased level of transcripts encoding the keratinocyte chemoattractant (KC, the murine equivalent of human IL-8, in gastric mucosa compared with Muc1(+/+ mice during experimental H. pylori infection. The current study tested the hypothesis that a decreased IL-8 level observed following MUC1 over-expression is mediated through the ability of MUC1 to associate with β-catenin, thereby inhibiting H. pylori-induced β-catenin nuclear translocation. Increased neutrophil infiltration of the gastric mucosa of H. pylori-infected Muc1(-/- mice was observed compared with Muc1(+/+ wild type littermates, thus defining the functional consequences of increased KC expression in the Muc1-null animals. Protein co-immunoprecipitation (coIP studies using lysates of untreated or H. pylori-treated AGS cells demonstrated that (a MUC1 formed a coIP complex with β-catenin and CagA, (b MUC1 over-expression reduced CagA/β-catenin coIP, and (c in the absence of MUC1 over-expression, H. pylori infection increased the nuclear level of β-catenin, (d whereas MUC1 over-expression decreased bacteria-driven β-catenin nuclear localization. These results suggest that manipulation of MUC1 expression in gastric epithelia may be an effective therapeutic strategy to inhibit H. pylori-dependent IL-8 production, neutrophil infiltration, and stomach inflammation.

A Global Overview of the Genetic and Functional Diversity in the Helicobacter pylori cag Pathogenicity Island

Science.gov (United States)

Moodley, Yoshan; Uhr, Markus; Stamer, Christiana; Vauterin, Marc; Suerbaum, Sebastian; Achtman, Mark

2010-01-01

The Helicobacter pylori cag pathogenicity island (cagPAI) encodes a type IV secretion system. Humans infected with cagPAI–carrying H. pylori are at increased risk for sequelae such as gastric cancer. Housekeeping genes in H. pylori show considerable genetic diversity; but the diversity of virulence factors such as the cagPAI, which transports the bacterial oncogene CagA into host cells, has not been systematically investigated. Here we compared the complete cagPAI sequences for 38 representative isolates from all known H. pylori biogeographic populations. Their gene content and gene order were highly conserved. The phylogeny of most cagPAI genes was similar to that of housekeeping genes, indicating that the cagPAI was probably acquired only once by H. pylori, and its genetic diversity reflects the isolation by distance that has shaped this bacterial species since modern humans migrated out of Africa. Most isolates induced IL-8 release in gastric epithelial cells, indicating that the function of the Cag secretion system has been conserved despite some genetic rearrangements. More than one third of cagPAI genes, in particular those encoding cell-surface exposed proteins, showed signatures of diversifying (Darwinian) selection at more than 5% of codons. Several unknown gene products predicted to be under Darwinian selection are also likely to be secreted proteins (e.g. HP0522, HP0535). One of these, HP0535, is predicted to code for either a new secreted candidate effector protein or a protein which interacts with CagA because it contains two genetic lineages, similar to cagA. Our study provides a resource that can guide future research on the biological roles and host interactions of cagPAI proteins, including several whose function is still unknown. PMID:20808891

Canine olfactory receptor gene polymorphism and its relation to odor detection performance by sniffer dogs.

Science.gov (United States)

Lesniak, Anna; Walczak, Marta; Jezierski, Tadeusz; Sacharczuk, Mariusz; Gawkowski, Maciej; Jaszczak, Kazimierz

2008-01-01

The outstanding sensitivity of the canine olfactory system has been acknowledged by using sniffer dogs in military and civilian service for detection of a variety of odors. It is hypothesized that the canine olfactory ability is determined by polymorphisms in olfactory receptor (OR) genes. We investigated 5 OR genes for polymorphic sites which might affect the olfactory ability of service dogs in different fields of specific substance detection. All investigated OR DNA sequences proved to have allelic variants, the majority of which lead to protein sequence alteration. Homozygous individuals at 2 gene loci significantly differed in their detection skills from other genotypes. This suggests a role of specific alleles in odor detection and a linkage between single-nucleotide polymorphism and odor recognition efficiency.

Erythropoietin abuse and erythropoietin gene doping: detection strategies in the genomic era.

Science.gov (United States)

Diamanti-Kandarakis, Evanthia; Konstantinopoulos, Panagiotis A; Papailiou, Joanna; Kandarakis, Stylianos A; Andreopoulos, Anastasios; Sykiotis, Gerasimos P

2005-01-01

The administration of recombinant human erythropoietin (rhEPO) increases the maximum oxygen consumption capacity, and is therefore abused as a doping method in endurance sports. The detection of erythropoietin (EPO) abuse is based on direct pharmacological and indirect haematological approaches, both of which have several limitations. In addition, current detection methods cannot cope with the emerging doping strategies of EPO mimicry, analogues and gene doping, and thus novel detection strategies are urgently needed. Direct detection methods for EPO misuse can be either pharmacological approaches that identify exogenous substances based on their physicochemical properties, or molecular methods that recognise EPO transgenes or gene transfer vectors. Since direct detection with molecular methods requires invasive procedures, it is not appropriate for routine screening of large numbers of athletes. In contrast, novel indirect methods based on haematological and/or molecular profiling could be better suited as screening tools, and athletes who are suspect of doping would then be submitted to direct pharmacological and molecular tests. This article reviews the current state of the EPO doping field, discusses available detection methods and their shortcomings, outlines emerging pharmaceutical and genetic technologies in EPO misuse, and proposes potential directions for the development of novel detection strategies.

Shared Gene Expression Alterations in Nasal and Bronchial Epithelium for Lung Cancer Detection.

Science.gov (United States)

2017-07-01

We previously derived and validated a bronchial epithelial gene expression biomarker to detect lung cancer in current and former smokers. Given that bronchial and nasal epithelial gene expression are similarly altered by cigarette smoke exposure, we sought to determine if cancer-associated gene expression might also be detectable in the more readily accessible nasal epithelium. Nasal epithelial brushings were prospectively collected from current and former smokers undergoing diagnostic evaluation for pulmonary lesions suspicious for lung cancer in the AEGIS-1 (n = 375) and AEGIS-2 (n = 130) clinical trials and gene expression profiled using microarrays. All statistical tests were two-sided. We identified 535 genes that were differentially expressed in the nasal epithelium of AEGIS-1 patients diagnosed with lung cancer vs those with benign disease after one year of follow-up ( P  cancer-associated gene expression alterations between the two airway sites ( P  lung cancer classifier derived in the AEGIS-1 cohort that combined clinical factors (age, smoking status, time since quit, mass size) and nasal gene expression (30 genes) had statistically significantly higher area under the curve (0.81; 95% confidence interval [CI] = 0.74 to 0.89, P  = .01) and sensitivity (0.91; 95% CI = 0.81 to 0.97, P  = .03) than a clinical-factor only model in independent samples from the AEGIS-2 cohort. These results support that the airway epithelial field of lung cancer-associated injury in ever smokers extends to the nose and demonstrates the potential of using nasal gene expression as a noninvasive biomarker for lung cancer detection. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Development of a universal RNA beacon for exogenous gene detection.

Science.gov (United States)

Guo, Yuanjian; Lu, Zhongju; Cohen, Ira Stephen; Scarlata, Suzanne

2015-05-01

Stem cell therapy requires a nontoxic and high-throughput method to achieve a pure cell population to prevent teratomas that can occur if even one cell in the implant has not been transformed. A promising method to detect and separate cells expressing a particular gene is RNA beacon technology. However, developing a successful, specific beacon to a particular transfected gene can take months to develop and in some cases is impossible. Here, we report on an off-the-shelf universal beacon that decreases the time and cost of applying beacon technology to select any living cell population transfected with an exogenous gene. ©AlphaMed Press.

GeneBreak: detection of recurrent DNA copy number aberration-associated chromosomal breakpoints within genes [version 2; referees: 2 approved

Directory of Open Access Journals (Sweden)

Evert van den Broek

2017-07-01

Full Text Available Development of cancer is driven by somatic alterations, including numerical and structural chromosomal aberrations. Currently, several computational methods are available and are widely applied to detect numerical copy number aberrations (CNAs of chromosomal segments in tumor genomes. However, there is lack of computational methods that systematically detect structural chromosomal aberrations by virtue of the genomic location of CNA-associated chromosomal breaks and identify genes that appear non-randomly affected by chromosomal breakpoints across (large series of tumor samples. ‘GeneBreak’ is developed to systematically identify genes recurrently affected by the genomic location of chromosomal CNA-associated breaks by a genome-wide approach, which can be applied to DNA copy number data obtained by array-Comparative Genomic Hybridization (CGH or by (low-pass whole genome sequencing (WGS. First, ‘GeneBreak’ collects the genomic locations of chromosomal CNA-associated breaks that were previously pinpointed by the segmentation algorithm that was applied to obtain CNA profiles. Next, a tailored annotation approach for breakpoint-to-gene mapping is implemented. Finally, dedicated cohort-based statistics is incorporated with correction for covariates that influence the probability to be a breakpoint gene. In addition, multiple testing correction is integrated to reveal recurrent breakpoint events. This easy-to-use algorithm, ‘GeneBreak’, is implemented in R (www.cran.r-project.org and is available from Bioconductor (www.bioconductor.org/packages/release/bioc/html/GeneBreak.html.

Epidemiology of Helicobacter pylori and CagA-Positive Infections and Global Variations in Gastric Cancer

Science.gov (United States)

Forman, David; Crabtree, Jean E.

2018-01-01

Gastric cancer is a major health burden and is the fifth most common malignancy and the third most common cause of death from cancer worldwide. Development of gastric cancer involves several aspects, including host genetics, environmental factors, and Helicobacter pylori infection. There is increasing evidence from epidemiological studies of the association of H. pylori infection and specific virulence factors with gastric cancer. Studies in animal models indicate H. pylori is a primary factor in the development of gastric cancer. One major virulence factor in H. pylori is the cytotoxin-associated gene A (cagA), which encodes the CagA protein in the cag pathogenicity island (cag PAI). Meta-analysis of studies investigating CagA seropositivity irrespective of H. pylori status identified that CagA seropositivity increases the risk of gastric cancer (OR = 2.87, 95% CI: 1.95–4.22) relative to the risk of H. pylori infection alone (OR = 2.31, 95% CI: 1.58–3.39). Eradicating H. pylori is a strategy for reducing gastric cancer incidence. A meta-analysis of six randomised controlled trials (RCTs) suggests that searching for and eradicating H. pylori infection reduces the subsequent incidence of gastric cancer with a pooled relative risk of 0.66 (95% CI: 0.46–0.95). The introduction in regions of high gastric cancer incidence of population-based H. pylori screening and treatment programmes, with a scientifically valid assessment of programme processes, feasibility, effectiveness and possible adverse consequences, would impact the incidence of H. pylori-induced gastric cancer. Given the recent molecular understanding of the oncogenic role of CagA, targeting H. pylori screening and treatment programmes in populations with a high prevalence of H. pylori CagA-positive strains, particularly the more oncogenic East Asian H. pylori CagA strains, may be worth further investigation to optimise the benefits of such strategies. PMID:29671784

Epidemiology of Helicobacter pylori and CagA-Positive Infections and Global Variations in Gastric Cancer

Directory of Open Access Journals (Sweden)

Jin Young Park

2018-04-01

Full Text Available Gastric cancer is a major health burden and is the fifth most common malignancy and the third most common cause of death from cancer worldwide. Development of gastric cancer involves several aspects, including host genetics, environmental factors, and Helicobacter pylori infection. There is increasing evidence from epidemiological studies of the association of H. pylori infection and specific virulence factors with gastric cancer. Studies in animal models indicate H. pylori is a primary factor in the development of gastric cancer. One major virulence factor in H. pylori is the cytotoxin-associated gene A (cagA, which encodes the CagA protein in the cag pathogenicity island (cag PAI. Meta-analysis of studies investigating CagA seropositivity irrespective of H. pylori status identified that CagA seropositivity increases the risk of gastric cancer (OR = 2.87, 95% CI: 1.95–4.22 relative to the risk of H. pylori infection alone (OR = 2.31, 95% CI: 1.58–3.39. Eradicating H. pylori is a strategy for reducing gastric cancer incidence. A meta-analysis of six randomised controlled trials (RCTs suggests that searching for and eradicating H. pylori infection reduces the subsequent incidence of gastric cancer with a pooled relative risk of 0.66 (95% CI: 0.46–0.95. The introduction in regions of high gastric cancer incidence of population-based H. pylori screening and treatment programmes, with a scientifically valid assessment of programme processes, feasibility, effectiveness and possible adverse consequences, would impact the incidence of H. pylori-induced gastric cancer. Given the recent molecular understanding of the oncogenic role of CagA, targeting H. pylori screening and treatment programmes in populations with a high prevalence of H. pylori CagA-positive strains, particularly the more oncogenic East Asian H. pylori CagA strains, may be worth further investigation to optimise the benefits of such strategies.

Detection of Genes for Superantigen Toxins in Methicillin-Resistant Staphylococcus aureus Clinical Isolates in Karachi

International Nuclear Information System (INIS)

Taj, Y.; Fatima, I.; Ali, S. W.; Kazmi, S. U.

2014-01-01

Objective: To detect genes for enterotoxins, exfoliative and toxic shock syndrome toxins in Staphylococcus aureus (S. aureus) strains isolated from clinical specimens. Study Design: Cross-sectional observational study. Place and Duration of Study: Department of Molecular Genetics, Dr. Ziauddin Hospital, Karachi, from January to December 2010. Methodology: Two hundred and ninety eight S. aureus clinical isolates were obtained from various clinical samples received at Dr. Ziauddin Hospital, Karachi. Out of these, 115 were detected as methicillin resistant (MRSA) by cefoxitin disk diffusion test showing a prevalence rate of 38.6%. Detection of individual toxin genes was performed by Polymerase Chain Reaction (PCR) by using only one primer pair for each tube. Uniplex primers were preferred as multiplex primers are longer in base pairs and have the potential for cross reaction due to non-specific binding and increase in optimization time. Results: The possession of a single gene or more than a single gene in MRSA isolates was found in 61.73% of clinical samples; the highest number was found in pus swab, followed by sputum, blood, urethral swab, and urine. The prevalence of toxin genes was higher in MRSA as compared to methicillin sensitive (MSSA) isolates (19.12%). Conclusion: PCR detects strains possessing toxin genes independent of their expression. The possession of genes for super-antigens seems to be a frequent and habitual trait of S. aureus more so in MRSA. (author)

Multiplex-PCR-Based Screening and Computational Modeling of Virulence Factors and T-Cell Mediated Immunity in Helicobacter pylori Infections for Accurate Clinical Diagnosis.

Directory of Open Access Journals (Sweden)

Sinem Oktem-Okullu

Full Text Available The outcome of H. pylori infection is closely related with bacteria's virulence factors and host immune response. The association between T cells and H. pylori infection has been identified, but the effects of the nine major H. pylori specific virulence factors; cagA, vacA, oipA, babA, hpaA, napA, dupA, ureA, ureB on T cell response in H. pylori infected patients have not been fully elucidated. We developed a multiplex- PCR assay to detect nine H. pylori virulence genes with in a three PCR reactions. Also, the expression levels of Th1, Th17 and Treg cell specific cytokines and transcription factors were detected by using qRT-PCR assays. Furthermore, a novel expert derived model is developed to identify set of factors and rules that can distinguish the ulcer patients from gastritis patients. Within all virulence factors that we tested, we identified a correlation between the presence of napA virulence gene and ulcer disease as a first data. Additionally, a positive correlation between the H. pylori dupA virulence factor and IFN-γ, and H. pylori babA virulence factor and IL-17 was detected in gastritis and ulcer patients respectively. By using computer-based models, clinical outcomes of a patients infected with H. pylori can be predicted by screening the patient's H. pylori vacA m1/m2, ureA and cagA status and IFN-γ (Th1, IL-17 (Th17, and FOXP3 (Treg expression levels. Herein, we report, for the first time, the relationship between H. pylori virulence factors and host immune responses for diagnostic prediction of gastric diseases using computer-based models.

Association of helicobacter pylori infection and chronic atrophic gastritis with risk of colonic, pancreatic and gastric cancer: A ten-year follow-up of the ESTHER cohort study.

Science.gov (United States)

Chen, Xin-Zu; Schöttker, Ben; Castro, Felipe Andres; Chen, Hongda; Zhang, Yan; Holleczek, Bernd; Brenner, Hermann

2016-03-29

To assess the association of H. pylori and chronic atrophic gastritis (AG) with colonic, pancreatic and gastric cancer in a population-based prospective cohort. Serum antibodies against H. pylori in general and specific to cytotoxin-associated gene A (CagA), as well as serum pepsinogen I and II were analyzed in 9,506 men and women, aged 50-75 years in a cohort study from Saarland, Germany. Incident cases of colonic, pancreatic and gastric cancer were ascertained by record linkage with data from the Saarland Cancer Registry. During an average follow-up of 10.6 years, 108 colonic, 46 pancreatic and 27 gastric incident cancers were recorded. There was no association between H. pylori infection and colonic cancer (HR = 1.07; 95% CI 0.73-1.56) or pancreatic cancer (HR = 1.32; 0.73-2.39), regardless of either CagA seropositivity or AG status. In contrast, CagA+ infection was associated with a strongly increased risk of gastric cancer, especially non-cardia gastric cancer, and this association was particularly pronounced in the presence of AG. Compared to people without AG and without CagA+ infection, people with both risk factors had a significantly increased risk of non-cardia gastric cancer (HR = 32.4; 7.6-137.6). This large cohort study did not observe an association of H. pylori infection or AG with colonic or pancreatic cancer, but underlines that the vast majority of non-cardia gastric cancers arise from AG and infection with CagA+ H. pylori strains.

Rapid detection of pathological mutations and deletions of the haemoglobin beta gene (HBB) by High Resolution Melting (HRM) analysis and Gene Ratio Analysis Copy Enumeration PCR (GRACE-PCR).

Science.gov (United States)

Turner, Andrew; Sasse, Jurgen; Varadi, Aniko

2016-10-19

Inherited disorders of haemoglobin are the world's most common genetic diseases, resulting in significant morbidity and mortality. The large number of mutations associated with the haemoglobin beta gene (HBB) makes gene scanning by High Resolution Melting (HRM) PCR an attractive diagnostic approach. However, existing HRM-PCR assays are not able to detect all common point mutations and have only a very limited ability to detect larger gene rearrangements. The aim of the current study was to develop a HBB assay, which can be used as a screening test in highly heterogeneous populations, for detection of both point mutations and larger gene rearrangements. The assay is based on a combination of conventional HRM-PCR and a novel Gene Ratio Analysis Copy Enumeration (GRACE) PCR method. HRM-PCR was extensively optimised, which included the use of an unlabelled probe and incorporation of universal bases into primers to prevent interference from common non-pathological polymorphisms. GRACE-PCR was employed to determine HBB gene copy numbers relative to a reference gene using melt curve analysis to detect rearrangements in the HBB gene. The performance of the assay was evaluated by analysing 410 samples. A total of 44 distinct pathological genotypes were detected. In comparison with reference methods, the assay has a sensitivity of 100 % and a specificity of 98 %. We have developed an assay that detects both point mutations and larger rearrangements of the HBB gene. This assay is quick, sensitive, specific and cost effective making it suitable as an initial screening test that can be used for highly heterogeneous cohorts.

Comparison of different phenotypic methods of detection of methicillin resistance in staphylococcus aureus with the molecular detection of mec-a gene

International Nuclear Information System (INIS)

Zeeshan, M.; Jabeen, K.; Irfan, S.; Parween, Z.; Zafar, A.

2007-01-01

To evaluate accuracy, cost-effectiveness and ease to perform different phenotypic methods i.e. Cefoxitin 30 micro g disc, Oxacillin 1micro g disc and Oxacillin agar screening plate (6 micro g/ml) for early and accurate identification of MRSA by comparing with the detection of mec-A gene in our clinical isolates. Out of 200 clinical samples, conventional Polymerase Chain Reaction (PCR) was done on 62 pure biochemically identified S. aureus isolates for mec-A gene detection. Phenotypic methods for detecting methicillin sensitivity (Cefoxitin 30 microg disc, Oxacillin 1 micro g disc and Oxacillin agar screening plate) were also used according to the recommended incubation time, duration and temperature on the same isolates. Out of 62 isolates of S. aureus, mec-A gene were detected (MRSA) in 32, whereas 30 were mec-A gene negative (MSSA). Cefoxitin disc and agar screening plate correctly identify all MRSA isolates with the sensitivity and specificity of 100%. Single isolate was false, positively detected as sensitive with Oxacillin 1g disc, due to which, the sensitivity and negative predictive value of this method were reduced to 96.9% and 96.8% respectively, while positive predictive value and specificity remained 100%. Comparing different phenotypic methods for MRSA screening in routine microbiology laboratory, Cefoxitin disc and Oxacillin agar screening has better sensitivity and specificity comparative to Oxacillin disc. However, Cefoxitin disc can be preferred especially for small laboratories because it is easy to perform, do not require special technique and media preparation is consequently more cost-effective. (author)

From gene engineering to gene modulation and manipulation: can we prevent or detect gene doping in sports?

Science.gov (United States)

Fischetto, Giuseppe; Bermon, Stéphane

2013-10-01

-carboxamide 1-β-D-ribofuranoside (AICAR), GW1516], might concomitantly improve endurance exercise capacity in ischaemic conditions but also in normal conditions. Undoubtedly, some athletes will attempt to take advantage of these new molecules to increase strength or endurance. Antidoping laboratories are improving detection methods. These are based both on direct identification of new substances or their metabolites and on indirect evaluation of changes in gene, protein or metabolite patterns (genomics, proteomics or metabolomics).

Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.

Science.gov (United States)

Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping

2017-07-25

Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an

Advance in plasma SEPT9 gene methylation assay for colorectal cancer early detection.

Science.gov (United States)

Wang, Yu; Chen, Pei-Min; Liu, Rong-Bin

2018-01-15

This review article summarizes the research advances of the plasma-based SEPT9 gene methylation assay for the clinical detection of colorectal cancer and its limitations. Colorectal cancer is a common malignancy with a poor prognosis and a high mortality, for which early detection and diagnosis are particularly crucial for the high-risk groups. Increasing evidence supported that SEPT9 gene methylation is associated with the pathogenesis of colorectal cancer and that detecting the level of methylation of SEPT9 in the peripheral blood can be used for screening of colorectal cancer in susceptible populations. In recent years, the data obtained in clinical studies demonstrated that the SEPT9 gene methylation assay has a good diagnostic performance with regard to both sensitivity and specificity with the advantage of better acceptability, convenience and compliance with serological testing compared with fecal occult blood tests and carcinoembryonic antigen for colorectal cancer (CRC). Furthermore, the combination of multiple methods or markers has become a growing trend for CRC detection and screening. Nevertheless, the clinical availability of the methylated SEPT9 assay is still limited because of the large degree of sample heterogeneity caused by demographic characteristics, pathological features, comorbidities and/or technique selection. Another factor is the cost-effectiveness of colorectal cancer screening strategies that hinders its large-scale application. In addition, improvements in its accuracy in detecting adenomas and premalignant polyps are required.

Affinity-based biosensors as promising tools for gene doping detection.

Science.gov (United States)

Minunni, Maria; Scarano, Simona; Mascini, Marco

2008-05-01

Innovative bioanalytical approaches can be foreseen as interesting means for solving relevant emerging problems in anti-doping control. Sport authorities fear that the newer form of doping, so-called gene doping, based on a misuse of gene therapy, will be undetectable and thus much less preventable. The World Anti-Doping Agency has already asked scientists to assist in finding ways to prevent and detect this newest kind of doping. In this Opinion article we discuss the main aspects of gene doping, from the putative target analytes to suitable sampling strategies. Moreover, we discuss the potential application of affinity sensing in this field, which so far has been successfully applied to a variety of analytical problems, from clinical diagnostics to food and environmental analysis.

A PLSPM-Based Test Statistic for Detecting Gene-Gene Co-Association in Genome-Wide Association Study with Case-Control Design

Science.gov (United States)

Zhang, Xiaoshuai; Yang, Xiaowei; Yuan, Zhongshang; Liu, Yanxun; Li, Fangyu; Peng, Bin; Zhu, Dianwen; Zhao, Jinghua; Xue, Fuzhong

2013-01-01

For genome-wide association data analysis, two genes in any pathway, two SNPs in the two linked gene regions respectively or in the two linked exons respectively within one gene are often correlated with each other. We therefore proposed the concept of gene-gene co-association, which refers to the effects not only due to the traditional interaction under nearly independent condition but the correlation between two genes. Furthermore, we constructed a novel statistic for detecting gene-gene co-association based on Partial Least Squares Path Modeling (PLSPM). Through simulation, the relationship between traditional interaction and co-association was highlighted under three different types of co-association. Both simulation and real data analysis demonstrated that the proposed PLSPM-based statistic has better performance than single SNP-based logistic model, PCA-based logistic model, and other gene-based methods. PMID:23620809

Detection of virulence genes in Uropathogenic E. coli (UPEC strains by Multiplex-PCR method

Directory of Open Access Journals (Sweden)

Javad Mohammadi

2017-06-01

Full Text Available Background & Objectives: Urinary tract infection caused by E. coli is one of the most common illnesses in all age groups worldwide. Presence of virulence genes is a key factor in bacterial pathogens in uroepithelial cells. The present study was performed to detect iha, iroN, ompT genes in the Uropathogenic E.coli isolates from clinical samples using multiplex-PCR method in Kerman. Materials & Methods: In this descriptive cross-sectional study, 200 samples of patients with urinary tract infections in Kerman hospitals were collected. After biochemical and microbiological tests, all strains were tested with regard to the presence of iha, iroN, and ompT genes using multiplex-PCR method. Results: The results of Multiplex-PCR showed that all specimens had one, two, or three virulence genes simultaneously. The highest and lowest frequency distribution of genes was related to iha (56.7% and iroN (20% respectively. Conclusion: According to the prevalence of urinary tract infection in the community and distribution of resistance and virulence factors, the fast and accurate detection of the strains and virulence genes is necessary

A new efficient statistical test for detecting variability in the gene expression data.

Science.gov (United States)

Mathur, Sunil; Dolo, Samuel

2008-08-01

DNA microarray technology allows researchers to monitor the expressions of thousands of genes under different conditions. The detection of differential gene expression under two different conditions is very important in microarray studies. Microarray experiments are multi-step procedures and each step is a potential source of variance. This makes the measurement of variability difficult because approach based on gene-by-gene estimation of variance will have few degrees of freedom. It is highly possible that the assumption of equal variance for all the expression levels may not hold. Also, the assumption of normality of gene expressions may not hold. Thus it is essential to have a statistical procedure which is not based on the normality assumption and also it can detect genes with differential variance efficiently. The detection of differential gene expression variance will allow us to identify experimental variables that affect different biological processes and accuracy of DNA microarray measurements.In this article, a new nonparametric test for scale is developed based on the arctangent of the ratio of two expression levels. Most of the tests available in literature require the assumption of normal distribution, which makes them inapplicable in many situations, and it is also hard to verify the suitability of the normal distribution assumption for the given data set. The proposed test does not require the assumption of the distribution for the underlying population and hence makes it more practical and widely applicable. The asymptotic relative efficiency is calculated under different distributions, which show that the proposed test is very powerful when the assumption of normality breaks down. Monte Carlo simulation studies are performed to compare the power of the proposed test with some of the existing procedures. It is found that the proposed test is more powerful than commonly used tests under almost all the distributions considered in the study. A

Genetic affinities of Helicobacter pylori isolates from ethnic Arabs in Kuwait

Directory of Open Access Journals (Sweden)

Albert M John

2010-07-01

Full Text Available Abstract Helicobacter pylori is one of the most genetically diverse of bacterial species, and since the 5'-end of cagA gene and the middle allele of vacA gene of H. pylori from different populations exhibit considerable polymorphisms, these sequence diversities were used to gain insights into the genetic affinities of this gastric pathogen from different populations. Because the genetic affinity of Arab strains from the Arabian Gulf is not known, we carried out genetic analysis based on sequence diversities of the cagA and the vacA genes of H. pylori from 9 ethnic Arabs in Kuwait. The analysis showed that the Kuwaiti isolates are closely related to the Indo-European group of strains, although some strains have a tendency to form a separate cluster close to the Indo- European group, but clearly distinct from East Asian strains. However, these results need to be confirmed by analyses of neutral markers (house-keeping genes in a multi-locus sequence typing [MLST] platform. The profiling of virulence-associated genes may have resulted from ecologically distinct populations due to human migration and geographical separation over long periods of time.

Detection of anabolic androgenic steroid abuse in doping control using mammalian reporter gene bioassays.

Science.gov (United States)

Houtman, Corine J; Sterk, Saskia S; van de Heijning, Monique P M; Brouwer, Abraham; Stephany, Rainer W; van der Burg, Bart; Sonneveld, Edwin

2009-04-01

Anabolic androgenic steroids (AAS) are a class of steroid hormones related to the male hormone testosterone. They are frequently detected as drugs in sport doping control. Being similar to or derived from natural male hormones, AAS share the activation of the androgen receptor (AR) as common mechanism of action. The mammalian androgen responsive reporter gene assay (AR CALUX bioassay), measuring compounds interacting with the AR can be used for the analysis of AAS without the necessity of knowing their chemical structure beforehand, whereas current chemical-analytical approaches may have difficulty in detecting compounds with unknown structures, such as designer steroids. This study demonstrated that AAS prohibited in sports and potential designer AAS can be detected with this AR reporter gene assay, but that also additional steroid activities of AAS could be found using additional mammalian bioassays for other types of steroid hormones. Mixtures of AAS were found to behave additively in the AR reporter gene assay showing that it is possible to use this method for complex mixtures as are found in doping control samples, including mixtures that are a result of multi drug use. To test if mammalian reporter gene assays could be used for the detection of AAS in urine samples, background steroidal activities were measured. AAS-spiked urine samples, mimicking doping positive samples, showed significantly higher androgenic activities than unspiked samples. GC-MS analysis of endogenous androgens and AR reporter gene assay analysis of urine samples showed how a combined chemical-analytical and bioassay approach can be used to identify samples containing AAS. The results indicate that the AR reporter gene assay, in addition to chemical-analytical methods, can be a valuable tool for the analysis of AAS for doping control purposes.

[Using exon combined target region capture sequencing chip to detect the disease-causing genes of retinitis pigmentosa].

Science.gov (United States)

Rong, Weining; Chen, Xuejuan; Li, Huiping; Liu, Yani; Sheng, Xunlun

2014-06-01

To detect the disease-causing genes of 10 retinitis pigmentosa pedigrees by using exon combined target region capture sequencing chip. Pedigree investigation study. From October 2010 to December 2013, 10 RP pedigrees were recruited for this study in Ningxia Eye Hospital. All the patients and family members received complete ophthalmic examinations. DNA was abstracted from patients, family members and controls. Using exon combined target region capture sequencing chip to screen the candidate disease-causing mutations. Polymerase chain reaction (PCR) and direct sequencing were used to confirm the disease-causing mutations. Seventy patients and 23 normal family members were recruited from 10 pedigrees. Among 10 RP pedigrees, 1 was autosomal dominant pedigrees and 9 were autosomal recessive pedigrees. 7 mutations related to 5 genes of 5 pedigrees were detected. A frameshift mutation on BBS7 gene was detected in No.2 pedigree, the patients of this pedigree combined with central obesity, polydactyly and mental handicap. No.2 pedigree was diagnosed as Bardet-Biedl syndrome finally. A missense mutation was detected in No.7 and No.10 pedigrees respectively. Because the patients suffered deafness meanwhile, the final diagnosis was Usher syndrome. A missense mutation on C3 gene related to age-related macular degeneration was also detected in No. 7 pedigrees. A nonsense mutation and a missense mutation on CRB1 gene were detected in No. 1 pedigree and a splicesite mutation on PROM1 gene was detected in No. 5 pedigree. Retinitis pigmentosa is a kind of genetic eye disease with diversity clinical phenotypes. Rapid and effective genetic diagnosis technology combined with clinical characteristics analysis is helpful to improve the level of clinical diagnosis of RP.

Fundamental study of detection of muscle hypertrophy-oriented gene doping by myostatin knock down using RNA interference.

Science.gov (United States)

Takemasa, Tohru; Yakushiji, Naohisa; Kikuchi, Dale Manjiro; Deocaris, Custer; Widodo; Machida, Masanao; Kiyosawa, Hidenori

2012-01-01

To investigate the feasibility of developing a method for detection of gene doping in power-athletes, we devised an experimental model system. Myostatin is a potent negative regulator of skeletal muscle development and growth, and myostatin-knockout mice exhibit a double-muscle phenotype. To achieve knockdown, we constructed plasmids expressing short hairpin interfering RNAs (shRNAs) against myostatin. These shRNAs were transfected into C2C12 cultured cells or injected into the tibialis anterior (TA) muscle of adult mice. By performing in vitro and in vivo experiments, we found that some shRNAs effectively reduced the expression of myostatin, and that the TA muscle showed hypertrophy of up to 27.9%. Then, using real-time PCR, we tried to detect the shRNA plasmid in the serum or muscles of mice into which it had been injected. Although we were unable to detect the plasmid in serum samples, it was detectable in the treated muscle at least four weeks after induction. We were also able to detect the plasmid in muscle in the vicinity of the TA. This gene doping model system will be useful for further studies aimed at doping control. Key pointsUsing a myostatin knockdown plasmid, we have succeeded in creating a model system for gene doping using mice that resulted in muscle hypertrophy greater than that reported previously.We confirmed that there was a limit of gene doping detection using real-time PCR, either from serum or muscle smple.This model experimental system can be utilized for examining indirect methods of gene doping detection such as immune responses to gene transfer or a profiling approach using DNA microarray.

PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas

International Nuclear Information System (INIS)

Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

1994-01-01

From 1971--1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF 1 mice irradiated with 60 Co γ-rays or JANUS fission-spectrum neutrons. Polymerase chain reaction (PCR) technique was used to detect deletions in the mouse retinoblastoma (mRb) gene. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. Absence of any of these fragments on a Southern blot indicated a deletion of that portion of the mRb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice were analyzed for mRb deletions. In all normal mouse tissues studies all six mRb exon fragments were present on Southern blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, 1 of 6 tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice showed a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene

CagI is an essential component of the Helicobacter pylori Cag type IV secretion system and forms a complex with CagL.

Directory of Open Access Journals (Sweden)

Kieu Thuy Pham

Full Text Available Helicobacter pylori, the causative agent of type B gastritis, peptic ulcers, gastric adenocarcinoma and MALT lymphoma, uses the Cag type IV secretion system to induce a strong proinflammatory response in the gastric mucosa and to inject its effector protein CagA into gastric cells. CagA translocation results in altered host cell gene expression profiles and cytoskeletal rearrangements, and it is considered as a major bacterial virulence trait. Recently, it has been shown that binding of the type IV secretion apparatus to integrin receptors on target cells is a crucial step in the translocation process. Several bacterial proteins, including the Cag-specific components CagL and CagI, have been involved in this interaction. Here, we have examined the localization and interactions of CagI in the bacterial cell. Since the cagI gene overlaps and is co-transcribed with the cagL gene, the role of CagI for type IV secretion system function has been difficult to assess, and conflicting results have been reported regarding its involvement in the proinflammatory response. Using a marker-free gene deletion approach and genetic complementation, we show now that CagI is an essential component of the Cag type IV secretion apparatus for both CagA translocation and interleukin-8 induction. CagI is distributed over soluble and membrane-associated pools and seems to be partly surface-exposed. Deletion of several genes encoding essential Cag components has an impact on protein levels of CagI and CagL, suggesting that both proteins require partial assembly of the secretion apparatus. Finally, we show by co-immunoprecipitation that CagI and CagL interact with each other. Taken together, our results indicate that CagI and CagL form a functional complex which is formed at a late stage of secretion apparatus assembly.

PCR detection of oxytetracycline resistance genes from diverse habitats in total community DNA and in streptomycete isolates.

NARCIS (Netherlands)

Nikolakopoulou, T.L.; Egan, S.; Overbeek, van L.S.; Guillaume, G.; Heuer, H.; Wellington, E.M.H.; Elsas, van J.D.; Collard, J.M.; Smalla, K.; Karagouni, A.D.

2005-01-01

A range of European habitats was screened by PCR for detection of the oxytetracycline resistance genes otr(A) and otr(B), found in the oxytetracycline-producing strain Streptomyces rimosus. Primers were developed to detect these otr genes in tetracycline-resistant (TcR) streptomycete isolates from

Simultaneous detection of transgenic DNA by surface plasmon resonance imaging with potential application to gene doping detection.

Science.gov (United States)

Scarano, Simona; Ermini, Maria Laura; Spiriti, Maria Michela; Mascini, Marco; Bogani, Patrizia; Minunni, Maria

2011-08-15

Surface plasmon resonance imaging (SPRi) was used as the transduction principle for the development of optical-based sensing for transgenes detection in human cell lines. The objective was to develop a multianalyte, label-free, and real-time approach for DNA sequences that are identified as markers of transgenosis events. The strategy exploits SPRi sensing to detect the transgenic event by targeting selected marker sequences, which are present on shuttle vector backbone used to carry out the transfection of human embryonic kidney (HEK) cell lines. Here, we identified DNA sequences belonging to the Cytomegalovirus promoter and the Enhanced Green Fluorescent Protein gene. System development is discussed in terms of probe efficiency and influence of secondary structures on biorecognition reaction on sensor; moreover, optimization of PCR samples pretreatment was carried out to allow hybridization on biosensor, together with an approach to increase SPRi signals by in situ mass enhancement. Real-time PCR was also employed as reference technique for marker sequences detection on human HEK cells. We can foresee that the developed system may have potential applications in the field of antidoping research focused on the so-called gene doping.

Presymptomatic breast cancer in Egypt: role of BRCA1 and BRCA2 tumor suppressor genes mutations detection

Directory of Open Access Journals (Sweden)

Hashishe Mervat M

2010-06-01

Full Text Available Abstract Background Breast cancer is one of the most common diseases affecting women. Inherited susceptibility genes, BRCA1 and BRCA2, are considered in breast, ovarian and other common cancers etiology. BRCA1 and BRCA2 genes have been identified that confer a high degree of breast cancer risk. Objective Our study was performed to identify germline mutations in some exons of BRCA1 and BRCA2 genes for the early detection of presymptomatic breast cancer in females. Methods This study was applied on Egyptian healthy females who first degree relatives to those, with or without a family history, infected with breast cancer. Sixty breast cancer patients, derived from 60 families, were selected for molecular genetic testing of BRCA1 and BRCA2 genes. The study also included 120 healthy first degree female relatives of the patients, either sisters and/or daughters, for early detection of presymptomatic breast cancer mutation carriers. Genomic DNA was extracted from peripheral blood lymphocytes of all the studied subjects. Universal primers were used to amplify four regions of the BRCA1 gene (exons 2,8,13 and 22 and one region (exon 9 of BRCA2 gene using specific PCR. The polymerase chain reaction was carried out. Single strand conformation polymorphism assay and heteroduplex analysis were used to screen for mutations in the studied exons. In addition, DNA sequencing of the normal and mutated exons were performed. Results Mutations in both BRCA1 and BRCA2 genes were detected in 86.7% of the families. Current study indicates that 60% of these families were attributable to BRCA1 mutations, while 26.7% of them were attributable to BRCA2 mutations. Results showed that four mutations were detected in the BRCA1 gene, while one mutation was detected in the BRCA2 gene. Asymptomatic relatives, 80(67% out of total 120, were mutation carriers. Conclusions BRCA1 and BRCA2 genes mutations are responsible for a significant proportion of breast cancer. BRCA mutations

Detection of Fusarium verticillioides by PCR-ELISA based on FUM21 gene.

Science.gov (United States)

Omori, Aline Myuki; Ono, Elisabete Yurie Sataque; Bordini, Jaqueline Gozzi; Hirozawa, Melissa Tiemi; Fungaro, Maria Helena Pelegrinelli; Ono, Mario Augusto

2018-08-01

Fusarium verticillioides is a primary corn pathogen and fumonisin producer which is associated with toxic effects in humans and animals. The traditional methods for detection of fungal contamination based on morphological characteristics are time-consuming and show low sensitivity and specificity. Therefore, the objective of this study was to develop a PCR-ELISA based on the FUM21 gene for F. verticillioides detection. The DNA of the F. verticillioides, Fusarium sp., Aspergillus sp. and Penicillium sp. isolates was analyzed by conventional PCR and PCR-ELISA to determine the specificity. The PCR-ELISA was specific to F. verticillioides isolates, showed a 2.5 pg detection limit and was 100-fold more sensitive than conventional PCR. In corn samples inoculated with F. verticillioides conidia, the detection limit of the PCR-ELISA was 1 × 10 4 conidia/g and was also 100-fold more sensitive than conventional PCR. Naturally contaminated corn samples were analyzed by PCR-ELISA based on the FUM21 gene and PCR-ELISA absorbance values correlated positively (p PCR-ELISA developed in this study can be useful for F. verticillioides detection in corn samples. Copyright © 2018 Elsevier Ltd. All rights reserved.

Molecular detection of TasA gene in endophytic Bacillus species ...

African Journals Online (AJOL)

hope&shola

2012-03-20

Mar 20, 2012 ... formation in Bacillus species was detected in the endophytic bacteria by polymerase chain reaction. (PCR) amplification. In ten endophytic ... confer a competitive advantage to the spore from the onset of sporulation and later, ... possessing TasA gene (Chen et al., 2007; Gioia et al.,. 2007; Kunst et al., 1997; ...

Human synthetic lethal inference as potential anti-cancer target gene detection

Directory of Open Access Journals (Sweden)

Solé Ricard V

2009-12-01

Full Text Available Abstract Background Two genes are called synthetic lethal (SL if mutation of either alone is not lethal, but mutation of both leads to death or a significant decrease in organism's fitness. The detection of SL gene pairs constitutes a promising alternative for anti-cancer therapy. As cancer cells exhibit a large number of mutations, the identification of these mutated genes' SL partners may provide specific anti-cancer drug candidates, with minor perturbations to the healthy cells. Since existent SL data is mainly restricted to yeast screenings, the road towards human SL candidates is limited to inference methods. Results In the present work, we use phylogenetic analysis and database manipulation (BioGRID for interactions, Ensembl and NCBI for homology, Gene Ontology for GO attributes in order to reconstruct the phylogenetically-inferred SL gene network for human. In addition, available data on cancer mutated genes (COSMIC and Cancer Gene Census databases as well as on existent approved drugs (DrugBank database supports our selection of cancer-therapy candidates. Conclusions Our work provides a complementary alternative to the current methods for drug discovering and gene target identification in anti-cancer research. Novel SL screening analysis and the use of highly curated databases would contribute to improve the results of this methodology.

Detecting negative selection on recurrent mutations using gene genealogy

Science.gov (United States)

2013-01-01

Background Whether or not a mutant allele in a population is under selection is an important issue in population genetics, and various neutrality tests have been invented so far to detect selection. However, detection of negative selection has been notoriously difficult, partly because negatively selected alleles are usually rare in the population and have little impact on either population dynamics or the shape of the gene genealogy. Recently, through studies of genetic disorders and genome-wide analyses, many structural variations were shown to occur recurrently in the population. Such “recurrent mutations” might be revealed as deleterious by exploiting the signal of negative selection in the gene genealogy enhanced by their recurrence. Results Motivated by the above idea, we devised two new test statistics. One is the total number of mutants at a recurrently mutating locus among sampled sequences, which is tested conditionally on the number of forward mutations mapped on the sequence genealogy. The other is the size of the most common class of identical-by-descent mutants in the sample, again tested conditionally on the number of forward mutations mapped on the sequence genealogy. To examine the performance of these two tests, we simulated recurrently mutated loci each flanked by sites with neutral single nucleotide polymorphisms (SNPs), with no recombination. Using neutral recurrent mutations as null models, we attempted to detect deleterious recurrent mutations. Our analyses demonstrated high powers of our new tests under constant population size, as well as their moderate power to detect selection in expanding populations. We also devised a new maximum parsimony algorithm that, given the states of the sampled sequences at a recurrently mutating locus and an incompletely resolved genealogy, enumerates mutation histories with a minimum number of mutations while partially resolving genealogical relationships when necessary. Conclusions With their

A Microchip for Integrated Single-Cell Gene Expression Profiling and Genotoxicity Detection

Directory of Open Access Journals (Sweden)

Hui Dong

2016-09-01

Full Text Available Microfluidics-based single-cell study is an emerging approach in personalized treatment or precision medicine studies. Single-cell gene expression holds a potential to provide treatment selections with maximized efficacy to help cancer patients based on a genetic understanding of their disease. This work presents a multi-layer microchip for single-cell multiplexed gene expression profiling and genotoxicity detection. Treated by three drug reagents (i.e., methyl methanesulfonate, docetaxel and colchicine with varied concentrations and time lengths, individual human cancer cells (MDA-MB-231 are lysed on-chip, and the released mRNA templates are captured and reversely transcribed into single strand DNA. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH, cyclin-dependent kinase inhibitor 1A (CDKN1A, and aurora kinase A (AURKA genes from single cells are amplified and real-time quantified through multiplex polymerase chain reaction. The microchip is capable of integrating all steps of single-cell multiplexed gene expression profiling, and providing precision detection of drug induced genotoxic stress. Throughput has been set to be 18, and can be further increased following the same approach. Numerical simulation of on-chip single cell trapping and heat transfer has been employed to evaluate the chip design and operation.

PanCoreGen - Profiling, detecting, annotating protein-coding genes in microbial genomes.

Science.gov (United States)

Paul, Sandip; Bhardwaj, Archana; Bag, Sumit K; Sokurenko, Evgeni V; Chattopadhyay, Sujay

2015-12-01

A large amount of genomic data, especially from multiple isolates of a single species, has opened new vistas for microbial genomics analysis. Analyzing the pan-genome (i.e. the sum of genetic repertoire) of microbial species is crucial in understanding the dynamics of molecular evolution, where virulence evolution is of major interest. Here we present PanCoreGen - a standalone application for pan- and core-genomic profiling of microbial protein-coding genes. PanCoreGen overcomes key limitations of the existing pan-genomic analysis tools, and develops an integrated annotation-structure for a species-specific pan-genomic profile. It provides important new features for annotating draft genomes/contigs and detecting unidentified genes in annotated genomes. It also generates user-defined group-specific datasets within the pan-genome. Interestingly, analyzing an example-set of Salmonella genomes, we detect potential footprints of adaptive convergence of horizontally transferred genes in two human-restricted pathogenic serovars - Typhi and Paratyphi A. Overall, PanCoreGen represents a state-of-the-art tool for microbial phylogenomics and pathogenomics study. Copyright © 2015 Elsevier Inc. All rights reserved.

Detection of Toxoplasma gondii in Diabetic Patients Using the Nested PCR Assay via RE and B1 Genes.

Science.gov (United States)

Mousavi, Mohammad; Saravani, Ramin; Jafari Modrek, Mohammad; Shahrakipour, Mahnaz; Sekandarpour, Sina

2016-02-01

Toxoplasma gondii is an obligate intracellular protozoan parasite that exists worldwide. Various techniques have been developed for T. gondii detection. The aim of this study was the detection of T. gondii in diabetic patients with RE and B1 genes and the comparison of these two genes for diagnosis using the nested-PCR assay method. DNA samples from 205 diabetic patients who had been referred to the diabetes center of Ali Asghar hospital in Zahedan, Iran, were collected and analyzed using the nested-PCR assay method. Toxoplasma antibody data gathered using the enzyme-linked immunosorbent assay (ELISA) method from a previous study was used to group patients. The data were analyzed using SPSS 18. The chi-square test was used for comparison. Of the diabetic patients selected, the following results were obtained: 53 (IgG+, IgM+); 20 (IgG-, IgM+); 72 (IgG+, IgM-); and 60 (IgG-, IgM-). The nested-PCR detected the following: in the acute group, 21/53 (39.63%), 30/53 (56.60%) (IgM+, IgG+); in the chronic group, 40/72 (55.56%), 51/72 (70.83%), (IgG+, IgM-); in the false positive group, 18/20 (90%), 17/20 (85%) (IgM+, IgG-); and sero-negative samples of 38/60 (63.33%) and 60/ 41 (77.35%) for RE and B1 genes, respectively. The prevalence of toxoplasmosis showed positive in patients with diabetes in the B1 gene 139 (67.8%) and RE gene 117 (57.1%). Our study demonstrated that the B1 gene, more so than the RE gene, showed positive samples and can be used to detect toxoplasmosis, although the B1 gene, in comparison to the RE gene, did not show any superiority of molecular diagnosing capability. Results also showed that toxoplasma molecular detection methods can be used instead of routine serological detection methods in a clinical laboratory testing.

Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.

Science.gov (United States)

Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P

1999-08-02

Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.

Detection of biosurfactants in Bacillus species: genes and products identification.

Science.gov (United States)

Płaza, G; Chojniak, J; Rudnicka, K; Paraszkiewicz, K; Bernat, P

2015-10-01

To screen environmental Bacillus strains for detection of genes encoding the enzymes involved in biosurfactant synthesis and to evaluate their products e.g. surfactin, iturin and fengycin. The taxonomic identification of isolated from the environment Bacillus strains was performed by Microgene ID Bacillus panel and GEN III Biolog system. The polymerase chain reaction (PCR) strategy for screening of genes in Bacillus strains was set up. Liquid chromatography-mass spectrometry (LC-MS/MS) method was used for the identification of lipopeptides (LPs). All studied strains exhibited the presence of srfAA gene and produced surfactin mostly as four homologues (C13 to C16). Moreover, in 2 strains (KP7, T'-1) simultaneous co-production of 3 biosurfactants: surfactin, iturin and fengycin was observed. Additionally, it was found out that isolate identified as Bacillus subtilis ssp. subtilis (KP7), beside LPs co-production, synthesizes surfactin with the efficiency much higher than other studied strains (40·2 mg l(-1) ) and with the yield ranging from 0·8 to 8·3 mg l(-1) . We showed that the combined methodology based on PCR and LC-MS/MS technique is an optimal tool for the detection of genes encoding enzymes involved in biosurfactant synthesis as well as their products, e.g. surfactin, iturin and fengycin. This approach improves the screening and the identification of environmental Bacillus co-producing biosurfactants-stimulating and facilitating the development of this area of science. The findings of this work will help to improve screening of biosurfactant producers. Discovery of novel biosurfactants and biosurfactants co-production ability has shed light on their new application fields and for the understanding of their interactions and properties. © 2015 The Society for Applied Microbiology.

Detection of Chloramphenicol Resistance Genes (cat in Clinical Isolates of Pseudomonas aeruginosa with Polymerase Chain Reaction Method

Directory of Open Access Journals (Sweden)

Tiana Milanda

2014-12-01

Full Text Available Pseudomonas aeruginosa is an opportunistic Gram negative bacteria, which may cause infection in eyes, ears, skin, bones, central nervous system, gastrointestinal tract, circulatory system, heart, respiratory system, and urinary tract. Recently, chloramphenicol is no longer used as the main option of the therapy due of its resistance case. The aim of this research was to detect the presence of gene which is responsible to chloramphenicol resistance in clinical isolates of P.aeruginosa. These bacteria isolated from pus of external otitis patients in Hasan Sadikin Hospital in Bandung City. Polymerase Chain Reaction (PCR method (colony-PCR and DNA-PCR were performed to detect this resistance gene. Electropherogram from PCR products showed that the chloramphenicol resistance in clinical isolates of P. aeruginosa was caused by cat gene (317 bp. Based on this research, cat gene may be used to detect the chloramphenicol resistance in patients with external ostitis.

[Gene doping: gene transfer and possible molecular detection].

Science.gov (United States)

Argüelles, Carlos Francisco; Hernández-Zamora, Edgar

2007-01-01

The use of illegal substances in sports to enhance athletic performance during competition has caused international sports organizations such as the COI and WADA to take anti doping measures. A new doping method know as gene doping is defined as "the non-therapeutic use of genes, genetic elements and/or cells that have the capacity to enhance athletic performance". However, gene doping in sports is not easily identified and can cause serious consequences. Molecular biology techniques are needed in order to distinguish the difference between a "normal" and an "altered" genome. Further, we need to develop new analytic methods and biological molecular techniques in anti-doping laboratories, and design programs that avoid the non therapeutic use of genes.

Detection of virulence genes and the phylogenetic groups of Escherichia coli isolated from dogs in Brazil

Directory of Open Access Journals (Sweden)

Fernanda Morcatti Coura

2018-02-01

Full Text Available ABSTRACT: This study identified the virulence genes, pathovars, and phylogenetic groups of Escherichia coli strains obtained from the feces of dogs with and without diarrhea. Virulence genes and phylogenetic group identification were studied using polymerase chain reaction. Thirty-seven E. coli isolates were positive for at least one virulence factor gene. Twenty-one (57.8% of the positive isolates were isolated from diarrheal feces and sixteen (43.2% were from the feces of non-diarrheic dogs. Enteropathogenic E. coli (EPEC were the most frequently (62.2% detected pathovar in dog feces and were mainly from phylogroup B1 and E. Necrotoxigenic E. coli were detected in 16.2% of the virulence-positive isolates and these contained the cytotoxic necrotizing factor 1 (cnf1 gene and were classified into phylogroups B2 and D. All E. coli strains were negative for the presence of enterotoxigenic E. coli (ETEC enterotoxin genes, but four strains were positive for ETEC-related fimbriae 987P and F18. Two isolates were Shiga toxin-producing E. coli strains and contained the toxin genesStx2 or Stx2e, both from phylogroup B1. Our data showed that EPEC was the most frequent pathovar and B1 and E were the most common phylogroups detected in E. coli isolated from the feces of diarrheic and non-diarrheic dogs.

TESTING HIGH-DIMENSIONAL COVARIANCE MATRICES, WITH APPLICATION TO DETECTING SCHIZOPHRENIA RISK GENES.

Science.gov (United States)

Zhu, Lingxue; Lei, Jing; Devlin, Bernie; Roeder, Kathryn

2017-09-01

Scientists routinely compare gene expression levels in cases versus controls in part to determine genes associated with a disease. Similarly, detecting case-control differences in co-expression among genes can be critical to understanding complex human diseases; however statistical methods have been limited by the high dimensional nature of this problem. In this paper, we construct a sparse-Leading-Eigenvalue-Driven (sLED) test for comparing two high-dimensional covariance matrices. By focusing on the spectrum of the differential matrix, sLED provides a novel perspective that accommodates what we assume to be common, namely sparse and weak signals in gene expression data, and it is closely related with Sparse Principal Component Analysis. We prove that sLED achieves full power asymptotically under mild assumptions, and simulation studies verify that it outperforms other existing procedures under many biologically plausible scenarios. Applying sLED to the largest gene-expression dataset obtained from post-mortem brain tissue from Schizophrenia patients and controls, we provide a novel list of genes implicated in Schizophrenia and reveal intriguing patterns in gene co-expression change for Schizophrenia subjects. We also illustrate that sLED can be generalized to compare other gene-gene "relationship" matrices that are of practical interest, such as the weighted adjacency matrices.

Loop-mediated isothermal amplification (LAMP) as an alternative to PCR: A rapid on-site detection of gene doping.

Science.gov (United States)

Salamin, Olivier; Kuuranne, Tiia; Saugy, Martial; Leuenberger, Nicolas

2017-11-01

Innovation in medical research has been diverted at multiple occasions to enhance human performance. The predicted great progress in gene therapy has raised some concerns regarding its misuse in the world of sports (gene doping) for several years now. Even though there is no evidence that gene doping has ever been used in sports, the continuous improvement of gene therapy techniques increases the likelihood of abuse. Therefore, since 2004, efforts have been invested by the anti-doping community and WADA for the development of detection methods. Several nested PCR and qPCR-based strategies exploiting the absence of introns in the transgenic DNA have been proposed for the long-term detection of transgene in blood. Despite their great sensitivity, those protocols are hampered by limitations of the techniques that can be cumbersome and costly. The purpose of this perspective is to describe a new approach based on loop-mediated isothermal amplification (LAMP) for the detection of gene doping. This protocol enables a rapid and simple method to amplify nucleic acids with a high sensitivity and specificity and with a simple visual detection of the results. LAMP is already being used in clinical application for the detection of viruses or mutations. Therefore, this technique has the potential to be further developed for the detection of foreign genetic material in elite athletes. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

Detection of methicillin resistant Staphylococcus aureus (MRSA) from recreational beach using the mecA gene

Science.gov (United States)

Zulkifli, Aisya; Ahmad, Asmat

2015-09-01

Water samples were collected in triplicates from three different locations choosen from the recreational beach of Teluk Kemang, Port Dickson as sampling station including main area of recreation activity for the public. Bacteria were isolated from the water and cultured. Out of 286 presumptive Staphylococcus aureus enumerated by using culture method, only 4 (1.4 %) confirmed as Meticillin Resistant S. aureus (MRSA) based on PCR detection of mecA gene. Interestingly, all of MRSA detections were found at the main area of recreational activity. Our results suggested that public beaches may be reservoir for transmission of MRSA to beach visitors and PCR using the mecA gene is the fastest way to detect this pathogenic bacteria.

Selection of Suitable Endogenous Reference Genes for Relative Copy Number Detection in Sugarcane

Directory of Open Access Journals (Sweden)

Bantong Xue

2014-05-01

Full Text Available Transgene copy number has a great impact on the expression level and stability of exogenous gene in transgenic plants. Proper selection of endogenous reference genes is necessary for detection of genetic components in genetically modification (GM crops by quantitative real-time PCR (qPCR or by qualitative PCR approach, especially in sugarcane with polyploid and aneuploid genomic structure. qPCR technique has been widely accepted as an accurate, time-saving method on determination of copy numbers in transgenic plants and on detection of genetically modified plants to meet the regulatory and legislative requirement. In this study, to find a suitable endogenous reference gene and its real-time PCR assay for sugarcane (Saccharum spp. hybrids DNA content quantification, we evaluated a set of potential “single copy” genes including P4H, APRT, ENOL, CYC, TST and PRR, through qualitative PCR and absolute quantitative PCR. Based on copy number comparisons among different sugarcane genotypes, including five S. officinarum, one S. spontaneum and two S. spp. hybrids, these endogenous genes fell into three groups: ENOL-3—high copy number group, TST-1 and PRR-1—medium copy number group, P4H-1, APRT-2 and CYC-2—low copy number group. Among these tested genes, P4H, APRT and CYC were the most stable, while ENOL and TST were the least stable across different sugarcane genotypes. Therefore, three primer pairs of P4H-3, APRT-2 and CYC-2 were then selected as the suitable reference gene primer pairs for sugarcane. The test of multi-target reference genes revealed that the APRT gene was a specific amplicon, suggesting this gene is the most suitable to be used as an endogenous reference target for sugarcane DNA content quantification. These results should be helpful for establishing accurate and reliable qualitative and quantitative PCR analysis of GM sugarcane.

Detecting coordinated regulation of multi-protein complexes using logic analysis of gene expression

Directory of Open Access Journals (Sweden)

Yeates Todd O

2009-12-01

Full Text Available Abstract Background Many of the functional units in cells are multi-protein complexes such as RNA polymerase, the ribosome, and the proteasome. For such units to work together, one might expect a high level of regulation to enable co-appearance or repression of sets of complexes at the required time. However, this type of coordinated regulation between whole complexes is difficult to detect by existing methods for analyzing mRNA co-expression. We propose a new methodology that is able to detect such higher order relationships. Results We detect coordinated regulation of multiple protein complexes using logic analysis of gene expression data. Specifically, we identify gene triplets composed of genes whose expression profiles are found to be related by various types of logic functions. In order to focus on complexes, we associate the members of a gene triplet with the distinct protein complexes to which they belong. In this way, we identify complexes related by specific kinds of regulatory relationships. For example, we may find that the transcription of complex C is increased only if the transcription of both complex A AND complex B is repressed. We identify hundreds of examples of coordinated regulation among complexes under various stress conditions. Many of these examples involve the ribosome. Some of our examples have been previously identified in the literature, while others are novel. One notable example is the relationship between the transcription of the ribosome, RNA polymerase and mannosyltransferase II, which is involved in N-linked glycan processing in the Golgi. Conclusions The analysis proposed here focuses on relationships among triplets of genes that are not evident when genes are examined in a pairwise fashion as in typical clustering methods. By grouping gene triplets, we are able to decipher coordinated regulation among sets of three complexes. Moreover, using all triplets that involve coordinated regulation with the ribosome

Polymerase chain reaction detection of retinoblastoma gene deletions in paraffin-embedded mouse lung adenocarcinomas

International Nuclear Information System (INIS)

Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

1991-01-01

A Polymerase chain reaction (PCR) technique was used to detect deletions in the mouse retinoblastoma (mRb) gene using microtomed sections from paraffin-embedded radiation-induced and spontaneous tumors as the DNA source. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. Absence of any of these fragments relative to control PCR products on a Southern blot indicated a deletion of that portion of the mRb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death. Spontaneous tumors as well as those from irradiated mice (569 cGy of 60 Co γ rays or 60 cGy of JANUS neutrons) were analyzed. Tumors in six neutron-irradiated mice also had no mRb deletions. However, one of six tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice showed a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene

Sensitive detection of novel Indian isolate of BTV 21 using ns1 gene based real-time PCR assay

Directory of Open Access Journals (Sweden)

Gaya Prasad

2013-06-01

Full Text Available Aim: The study was conducted to develop ns1 gene based sensitive real-time RT-PCR assay for diagnosis of India isolates of bluetongue virus (BTV. Materials and Methods: The BTV serotype 21 isolate (KMNO7 was isolated from Andhra Pradesh and propagated in BHK-21 cell line in our laboratory. The Nucleic acid (dsRNA of virus was extracted using Trizol method and cDNA was prepared using a standard protocol. The cDNA was allowed to ns1 gene based group specific PCR to confirm the isolate as BTV. The viral RNA was diluted 10 folds and the detection limit of ns1 gene based RT-PCR was determined. Finally the tenfold diluted viral RNA was subjected to real-time RT-PCR using ns1 gene primer and Taq man probe to standardized the reaction and determine the detection limit. Results: The ns1 gene based group specific PCR showed a single 366bp amplicon in agarose gel electrophoresis confirmed the sample as BTV. The ns1 gene RT-PCR using tenfold diluted viral RNA showed the detection limit of 70.0 fg in 1%agarose gel electrophoresis. The ns1 gene based real time RT-PCR was successfully standardized and the detection limit was found to be 7.0 fg. Conclusion: The ns1 gene based real-time RT-PCR was successfully standardized and it was found to be 10 times more sensitive than conventional RT-PCR. Key words: bluetongue, BTV21, RT-PCR, Real time RT-PCR, ns1 gene [Vet World 2013; 6(8.000: 554-557

Detection of the HTLV-I gene on cytologic smear slides.

Science.gov (United States)

Kashima, Kenji; Nagahama, Junji; Sato, Keiji; Tanamachi, Hiroyuki; Gamachi, Ayako; Daa, Tsutomu; Nakayama, Iwao; Yokoyama, Shigeo

2002-01-01

To apply the polymerase chain reaction (PCR) for detection of the HTLV-I gene from cytologic smear slides. Samples were from seven cases of serum anti-ATL antibody (ATLA)-positive T-cell lymphoma and three from ATLA-negative T-cell lymphoma. Six of the seven ATLA-positive cases were confirmed to be ATLL by Southern blotting. From the seventh case a fresh sample for blotting could not obtained. DNA was extracted from the cytologic smear slides of all 10 cases; they had been stained with Papanicolaou or May-Giemsa stain, digested with proteinase K and precipitated with phenol and ethanol. The target sequence in the pX region of the HTLV-I gene was amplified by PCR. All seven ATLA-positive cases, including one that had not yet been confirmed by Southern blotting, showed a single band, as predicted, while the three ATLA-negative cases showed no band. If cytologic smear slides are available but a fresh sample is not, the PCR method should provide evidence that the virus is present since in our study sufficient DNA templates were successfully extracted from the stained cytologic smear slides for detection of the virus.

Statistics on gene-based laser speckles with a small number of scatterers: implications for the detection of polymorphism in the Chlamydia trachomatis omp1 gene

Science.gov (United States)

Ulyanov, Sergey S.; Ulianova, Onega V.; Zaytsev, Sergey S.; Saltykov, Yury V.; Feodorova, Valentina A.

2018-04-01

The transformation mechanism for a nucleotide sequence of the Chlamydia trachomatis gene into a speckle pattern has been considered. The first and second-order statistics of gene-based speckles have been analyzed. It has been demonstrated that gene-based speckles do not obey Gaussian statistics and belong to the class of speckles with a small number of scatterers. It has been shown that gene polymorphism can be easily detected through analysis of the statistical characteristics of gene-based speckles.

Causality analysis detects the regulatory role of maternal effect genes in the early Drosophila embryo

Directory of Open Access Journals (Sweden)

Zara Ghodsi

2017-03-01

Full Text Available In developmental studies, inferring regulatory interactions of segmentation genetic network play a vital role in unveiling the mechanism of pattern formation. As such, there exists an opportune demand for theoretical developments and new mathematical models which can result in a more accurate illustration of this genetic network. Accordingly, this paper seeks to extract the meaningful regulatory role of the maternal effect genes using a variety of causality detection techniques and to explore whether these methods can suggest a new analytical view to the gene regulatory networks. We evaluate the use of three different powerful and widely-used models representing time and frequency domain Granger causality and convergent cross mapping technique with the results being thoroughly evaluated for statistical significance. Our findings show that the regulatory role of maternal effect genes is detectable in different time classes and thereby the method is applicable to infer the possible regulatory interactions present among the other genes of this network.

Immune Responses to "Helicobacter pylori" Infection in Children with Intellectual Disabilities

Science.gov (United States)

Douraghi, Masoumeh; Goudarzi, Hossein; Rostami, Mahmoud Nateghi; Nikmanesh, Bahram

2012-01-01

Infection with "Helicobacter pylori" was assessed through serum "H. pylori" IgG antibody in children with intellectual disabilities (ID). The sero-status of cytotoxin-associated gene A (CagA) was determined as a risk determinant for severe "H. pylori"-associated diseases. In total, 210 children with ID were included…

Detection of toxin genes and RAPD analysis of bacillus cereus isolates from different soil types

Directory of Open Access Journals (Sweden)

Savic Dejana

2015-01-01

Full Text Available The aim of this study was to detect genes for enterotoxins (hbla, entFM and bceT and for emetic toxin (cer, to determine antibiotic resistance, and to estimate intraspecies diversity in B. cereus isolates by RAPD analysis. B. cereus was identified in 12 out of 117 indigenous Bacillus spp. using the classical microbiological methods and PCR. All isolates were resistant to penicillin and ampicillin, two to tetracyclin and four to trimethoprim-sulphamethoxazole. Also, all isolates produced inducible penicillinases and β-lactamase. Toxin genes were detected with PCR. EntFM and cer genes were present in all isolates, hbla in all, but two, and bceT in none. RAPD analysis was performed with four different primers, two of them designed for this study. The intraspecies diversity revealed 10 different patterns at the 90% similarity level. Two separate clusters were formed regardless of a soil type or utilization. The detection of genes encoding toxins in all B. cereus isolates indicated these bacteria as potentially pathogenic and seriously for human health. Regardless of a soil type or utilization, the RAPD analysis showed high intraspecies heterogeneity in B. cereus isolates. To the best of our knowledge, this is the first study to analyse the presence of entero- and emetic toxin genes and genetic heterogeneity in B. cereus isolates from different soil types and different soil utilization in Serbia. [Projekat Ministarstva nauke Republike Srbije, br. TR37006

Bioaerosol emissions and detection of airborne antibiotic resistance genes from a wastewater treatment plant

Science.gov (United States)

Li, Jing; Zhou, Liantong; Zhang, Xiangyu; Xu, Caijia; Dong, Liming; Yao, Maosheng

2016-01-01

Air samples from twelve sampling sites (including seven intra-plant sites, one upwind site and four downwind sites) from a wastewater treatment plant (WWTP) in Beijing were collected using a Reuter Centrifugal Sampler High Flow (RCS); and their microbial fractions were studied using culturing and high throughput gene sequence. In addition, the viable (fluorescent) bioaerosol concentrations for 7 intra-plant sites were also monitored for 30 min each using an ultraviolet aerodynamic particle sizer (UV-APS). Both air and water samples collected from the plant were investigated for possible bacterial antibiotic resistance genes and integrons using polymerase chain reaction (PCR) coupled with gel electrophoresis. The results showed that the air near sludge thickening basin was detected to have the highest level of culturable bacterial aerosols (up to 1697 CFU/m3) and fungal aerosols (up to 930 CFU/m3). For most sampling sites, fluorescent peaks were observed at around 3-4 μm, except the office building with a peak at 1.5 μm, with a number concentration level up to 1233-6533 Particles/m3. About 300 unique bacterial species, including human opportunistic pathogens, such as Comamonas Testosteroni and Moraxella Osloensis, were detected from the air samples collected over the biological reaction basin. In addition, we have detected the sul2 gene resistant to cotrimoxazole (also known as septra, bactrim and TMP-SMX) and class 1 integrase gene from the air samples collected from the screen room and the biological reaction basin. Overall, the screen room, sludge thickening basin and biological reaction basin imposed significant microbial exposure risks, including those from airborne antibiotic resistance genes.

The Spike-and-Slab Lasso Generalized Linear Models for Prediction and Associated Genes Detection.

Science.gov (United States)

Tang, Zaixiang; Shen, Yueping; Zhang, Xinyan; Yi, Nengjun

2017-01-01

Large-scale "omics" data have been increasingly used as an important resource for prognostic prediction of diseases and detection of associated genes. However, there are considerable challenges in analyzing high-dimensional molecular data, including the large number of potential molecular predictors, limited number of samples, and small effect of each predictor. We propose new Bayesian hierarchical generalized linear models, called spike-and-slab lasso GLMs, for prognostic prediction and detection of associated genes using large-scale molecular data. The proposed model employs a spike-and-slab mixture double-exponential prior for coefficients that can induce weak shrinkage on large coefficients, and strong shrinkage on irrelevant coefficients. We have developed a fast and stable algorithm to fit large-scale hierarchal GLMs by incorporating expectation-maximization (EM) steps into the fast cyclic coordinate descent algorithm. The proposed approach integrates nice features of two popular methods, i.e., penalized lasso and Bayesian spike-and-slab variable selection. The performance of the proposed method is assessed via extensive simulation studies. The results show that the proposed approach can provide not only more accurate estimates of the parameters, but also better prediction. We demonstrate the proposed procedure on two cancer data sets: a well-known breast cancer data set consisting of 295 tumors, and expression data of 4919 genes; and the ovarian cancer data set from TCGA with 362 tumors, and expression data of 5336 genes. Our analyses show that the proposed procedure can generate powerful models for predicting outcomes and detecting associated genes. The methods have been implemented in a freely available R package BhGLM (http://www.ssg.uab.edu/bhglm/). Copyright © 2017 by the Genetics Society of America.

PCR detection of oxytetracycline resistance genes otr(A) and otr(B) in tetracycline-resistant streptomycete isolates from diverse habitats

NARCIS (Netherlands)

Nikolakopoulou, T; Egan, S; van Overbeek, L; Guillaume, G; Heuer, H; Wellington, EMH; van Elsas, JD; Collard, JM; Smalla, K; Karagouni, A

2005-01-01

A range of European habitats was screened by PCR for detection of the oxytetracycline resistance genes otr(A) and otr(B), found in the oxytetracycline-producing strain Streptomyces rimosus. Primers were developed to detect these otr genes in tetracycline-resistant (Tc-R) streptomycete isolates from

Rapid detection of single nucleotide mutation in p53 gene based on ...

Indian Academy of Sciences (India)

mutation.27 Nevertheless, more than 50% of all human tumors contain p53 mutation; ... gene mutation detection in various fields of biology and medicine persuaded us to find ..... Yola M L, Eren T and Atar N 2014 Electrochim. Acta. 125 38. 26.

MimiLook: A Phylogenetic Workflow for Detection of Gene Acquisition in Major Orthologous Groups of Megavirales.

Science.gov (United States)

Jain, Sourabh; Panda, Arup; Colson, Philippe; Raoult, Didier; Pontarotti, Pierre

2017-04-07

With the inclusion of new members, understanding about evolutionary mechanisms and processes by which members of the proposed order, Megavirales, have evolved has become a key area of interest. The central role of gene acquisition has been shown in previous studies. However, the major drawback in gene acquisition studies is the focus on few MV families or putative families with large variation in their genetic structure. Thus, here we have tried to develop a methodology by which we can detect horizontal gene transfers (HGTs), taking into consideration orthologous groups of distantly related Megavirale families. Here, we report an automated workflow MimiLook, prepared as a Perl command line program, that deduces orthologous groups (OGs) from ORFomes of Megavirales and constructs phylogenetic trees by performing alignment generation, alignment editing and protein-protein BLAST (BLASTP) searching across the National Center for Biotechnology Information (NCBI) non-redundant (nr) protein sequence database. Finally, this tool detects statistically validated events of gene acquisitions with the help of the T-REX algorithm by comparing individual gene tree with NCBI species tree. In between the steps, the workflow decides about handling paralogs, filtering outputs, identifying Megavirale specific OGs, detection of HGTs, along with retrieval of information about those OGs that are monophyletic with organisms from cellular domains of life. By implementing MimiLook, we noticed that nine percent of Megavirale gene families (i.e., OGs) have been acquired by HGT, 80% OGs were Megaviralespecific and eight percent were found to be sharing common ancestry with members of cellular domains (Eukaryote, Bacteria, Archaea, Phages or other viruses) and three percent were ambivalent. The results are briefly discussed to emphasize methodology. Also, MimiLook is relevant for detecting evolutionary scenarios in other targeted phyla with user defined modifications. It can be accessed at

PanCoreGen – profiling, detecting, annotating protein-coding genes in microbial genomes

Science.gov (United States)

Bhardwaj, Archana; Bag, Sumit K; Sokurenko, Evgeni V.

2015-01-01

A large amount of genomic data, especially from multiple isolates of a single species, has opened new vistas for microbial genomics analysis. Analyzing pan-genome (i.e. the sum of genetic repertoire) of microbial species is crucial in understanding the dynamics of molecular evolution, where virulence evolution is of major interest. Here we present PanCoreGen – a standalone application for pan- and core-genomic profiling of microbial protein-coding genes. PanCoreGen overcomes key limitations of the existing pan-genomic analysis tools, and develops an integrated annotation-structure for species-specific pan-genomic profile. It provides important new features for annotating draft genomes/contigs and detecting unidentified genes in annotated genomes. It also generates user-defined group-specific datasets within the pan-genome. Interestingly, analyzing an example-set of Salmonella genomes, we detect potential footprints of adaptive convergence of horizontally transferred genes in two human-restricted pathogenic serovars – Typhi and Paratyphi A. Overall, PanCoreGen represents a state-of-the-art tool for microbial phylogenomics and pathogenomics study. PMID:26456591

Detection of the intercellular adhesion gene cluster (ica in clinical Staphylococcus aureus isolates

Directory of Open Access Journals (Sweden)

Namvar, Amirmorteza Ebrahimzadeh

2013-04-01

Full Text Available [english] is a major hospital and community pathogen having the aptitude to cause a wide variety of infections in men. The ability of microorganisms to produce biofilm facilitates them to withstand the host immune response and is recognized as one factor contributing to chronic or persistent infections. It was demonstrated that the -encoded genes lead to the biosynthesis of polysaccharide intercellular adhesion (PIA molecules, and may be involved in the accumulation phase of biofilm formation. Different studies have shown the decisive role of the gene as virulence factors in staphylococcal infections. This study was carried out to demonstrate the relationship between gene and production of slime layer in strains. Sixty strains were isolated from patients. The isolates were identified morphologically and biochemically following standard laboratory methods. After identification, the staphylococcal isolates were maintained in trypticase soy broth (TSB, to which 15% glycerol was added, and stored at –20°C. Slime formation and biofilm assay was monitored. A PCR assay was developed to identify the presence of (intercellular adhesion gene gene in all isolates. Thirty-nine slime producing colonies with CRA plates (65% formed black colors, the remaining 21 isolates were pink (35%. In the quantitative biofilm assay 35 (58% produced biofilm while 25 (42% isolates did not exhibit this property. All isolates were positive for detection of gene by PCR method. The interaction of and in the investigated isolates may be important in slime layer formation and biofilm phenomena.We propose PCR detection of the gene locus as a rapid and effective method to be used for discrimination between potentially virulent and nonvirulent isolates, with implications for therapeutic and preventive measures pertainin to the management of colonized indwelling catheters.

Association between infection with Helicobacter pylori and atopy in young Ethiopian children: A longitudinal study.

Science.gov (United States)

Taye, B; Enquselassie, F; Tsegaye, A; Amberbir, A; Medhin, G; Fogarty, A; Robinson, K; Davey, G

2017-10-01

Epidemiological evidence from developed countries indicates that Helicobacter pylori infection correlates with a reduced risk of atopy and allergic disorders; however, limited data are available from low-income countries. We examined associations between H. pylori infection in early childhood and atopy and reported allergic disorders at the age of 6.5 years in an Ethiopian birth cohort. A total of 856 children (85.1% of the 1006 original singletons in a population-based birth cohort) were followed up at age six and half years. An interviewer-led questionnaire administered to mothers provided information on demographic and lifestyle variables. Questions on allergic disease symptoms were based on the International Study of Asthma and Allergies in Children (ISAAC) core allergy and environmental questionnaire. Serum samples were analysed for total IgE levels and anti-H. pylori cytotoxin-associated gene A (CagA) IgG antibody using commercially available ELISA kits. Stool samples were analysed for H. pylori antigen using a rapid immunochromatographic test. The independent effects of H. pylori infection (measured at age of 3, 5 and 6.5 years) on prevalence and incidence of atopy and reported allergic disorders (measured at age of 6.5 years) were determined using multiple logistic regression. In cross-sectional analysis, current H. pylori infection at age 6.5 years was inversely, though not significantly, related to prevalence of atopy and "any allergic condition" at age 6.5 years. However, detection of H. pylori infection at any point up to age 6.5 years was associated with a significantly reduced odds of both atopy and "any allergic condition" (adjusted OR AOR, 95% CI, 0.54; 0.32-0.92, P = .02, and .31; 0.10-0.94, P = .04, respectively). In longitudinal analyses, H. pylori infection at age 3 was inversely associated with incidence of atopy (AOR, 95% CI, 0.49; 0.27-0.89, P = .02). Furthermore, among H. pylori-infected children, those with a CagA

Rapid detection of SNP (c.309T>G in the MDM2 gene by the Duplex SmartAmp method.

Directory of Open Access Journals (Sweden)

Yasuaki Enokida

Full Text Available BACKGROUND: Genetic polymorphisms in the human MDM2 gene are suggested to be a tumor susceptibility marker and a prognostic factor for cancer. It has been reported that a single nucleotide polymorphism (SNP c.309T>G in the MDM2 gene attenuates the tumor suppressor activity of p53 and accelerates tumor formation in humans. METHODOLOGY: In this study, to detect the SNP c.309T>G in the MDM2 gene, we have developed a new SNP detection method, named "Duplex SmartAmp," which enabled us to simultaneously detect both 309T and 309G alleles in one tube. To develop this new method, we introduced new primers i.e., nBP and oBPs, as well as two different fluorescent dyes that separately detect those genetic polymorphisms. RESULTS AND CONCLUSIONS: By the Duplex SmartAmp method, the genetic polymorphisms of the MDM2 gene were detected directly from a small amount of genomic DNA or blood samples. We used 96 genomic DNA and 24 blood samples to validate the Duplex SmartAmp by comparison with results of the conventional PCR-RFLP method; consequently, the Duplex SmartAmp results agreed totally with those of the PCR-RFLP method. Thus, the new SNP detection method is considered useful for detecting the SNP c.309T>G in the MDM2 gene so as to judge cancer susceptibility against some cellular stress in the clinical setting, and also to handle a large number of samples and enable rapid clinical diagnosis.

Comparison of in-house and commercial real time-PCR based carbapenemase gene detection methods in Enterobacteriaceae and non-fermenting gram-negative bacterial isolates.

Science.gov (United States)

Smiljanic, M; Kaase, M; Ahmad-Nejad, P; Ghebremedhin, B

2017-07-10

Carbapenemase-producing gram-negative bacteria are increasing globally and have been associated with outbreaks in hospital settings. Thus, the accurate detection of these bacteria in infections is mandatory for administering the adequate therapy and infection control measures. This study aimed to establish and evaluate a multiplex real-time PCR assay for the simultaneous detection of carbapenemase gene variants in gram-negative rods and to compare the performance with a commercial RT-PCR assay (Check-Direct CPE). 116 carbapenem-resistant Enterobacteriaceae, Pseudomonas aeruginosa and Acinetobacter baumannii isolates were genotyped for carbapenemase genes by PCR and sequencing. The defined isolates were used for the validation of the in-house RT-PCR by use of designed primer pairs and probes. Among the carbapenem-resistant isolates the genes bla KPC , bla VIM , bla NDM or bla OXA were detected. Both RT-PCR assays detected all bla KPC , bla VIM and bla NDM in the isolates. The in-house RT-PCR detected 53 of 67 (79.0%) whereas the commercial assay detected only 29 (43.3%) of the OXA genes. The in-house sufficiently distinguished the most prevalent OXA types (23-like and 48-like) in the melting curve analysis and direct detection of the genes from positive blood culture vials. The Check-Direct CPE and the in-house RT-PCR assay detected the carbapenem resistance from solid culture isolates. Moreover, the in-house assay enabled the identification of carbapenemase genes directly from positive blood-culture vials. However, we observed insufficient detection of various OXA genes in both assays. Nevertheless, the in-house RT-PCR detected the majority of the OXA type genes in Enterobacteriaceae and A. baumannii.

[Rapid detection of hot spot mutations of FGFR3 gene with PCR-high resolution melting assay].

Science.gov (United States)

Li, Shan; Wang, Han; Su, Hua; Gao, Jinsong; Zhao, Xiuli

2017-08-10

To identify the causative mutations in five individuals affected with dyschondroplasia and develop an efficient procedure for detecting hot spot mutations of the FGFR3 gene. Genomic DNA was extracted from peripheral blood samples with a standard phenol/chloroform method. PCR-Sanger sequencing was used to analyze the causative mutations in the five probands. PCR-high resolution melting (HRM) was developed to detect the identified mutations. A c.1138G>A mutation in exon 8 was found in 4 probands, while a c.1620C>G mutation was found in exon 11 of proband 5 whom had a mild phenotype. All patients were successfully distinguished from healthy controls with the PCR-HRM method. The results of HRM analysis were highly consistent with that of Sanger sequencing. The Gly380Arg and Asn540Lys are hot spot mutations of the FGFR3 gene among patients with ACH/HCH. PCR-HRM analysis is more efficient for detecting hot spot mutations of the FGFR3 gene.

Detection of p53 gene mutations in bronchial biopsy samples of patients with lung cancer

International Nuclear Information System (INIS)

Irshad, S.; Nawaz, T.

2008-01-01

Lung cancer is the malignant transformation and expansion of lung tissue. It is the most lethal of all cancers worldwide, responsible for 1.2 million deaths annually. The goal of this study was to detect the p53 gene mutations in lung cancer, in local population of Lahore, Pakistan. These mutations were screened in the bronchial biopsy lung cancer tissue samples. For this purpose microtomed tissue sections were collected. Following DNA extraction from tissue sections, the p53 mutations were detected by amplifying Exon 7 (145 bp) and Exon 8 (152 bp) of the p53 gene. PCR then followed by single-strand conformation polymorphism analysis for screening the p53 gene mutations. This results of SSCP were visualized of silver staining. The results showed different banding pattern indicating the presence of mutation. Majority of the mutations were found in Exon 7. Exon 7 of p53 gene may be the mutation hotspot in lung cancer. In lung cancer, the most prevalent mutations of p53 gene are G -> T transversions; other types of insertions and deletions are also expected, however, the exact nature of mutations in presented work could be confirmed by direct sequencing. (author)

Similarity-based gene detection: using COGs to find evolutionarily-conserved ORFs.

Science.gov (United States)

Powell, Bradford C; Hutchison, Clyde A

2006-01-19

Experimental verification of gene products has not kept pace with the rapid growth of microbial sequence information. However, existing annotations of gene locations contain sufficient information to screen for probable errors. Furthermore, comparisons among genomes become more informative as more genomes are examined. We studied all open reading frames (ORFs) of at least 30 codons from the genomes of 27 sequenced bacterial strains. We grouped the potential peptide sequences encoded from the ORFs by forming Clusters of Orthologous Groups (COGs). We used this grouping in order to find homologous relationships that would not be distinguishable from noise when using simple BLAST searches. Although COG analysis was initially developed to group annotated genes, we applied it to the task of grouping anonymous DNA sequences that may encode proteins. "Mixed COGs" of ORFs (clusters in which some sequences correspond to annotated genes and some do not) are attractive targets when seeking errors of gene prediction. Examination of mixed COGs reveals some situations in which genes appear to have been missed in current annotations and a smaller number of regions that appear to have been annotated as gene loci erroneously. This technique can also be used to detect potential pseudogenes or sequencing errors. Our method uses an adjustable parameter for degree of conservation among the studied genomes (stringency). We detail results for one level of stringency at which we found 83 potential genes which had not previously been identified, 60 potential pseudogenes, and 7 sequences with existing gene annotations that are probably incorrect. Systematic study of sequence conservation offers a way to improve existing annotations by identifying potentially homologous regions where the annotation of the presence or absence of a gene is inconsistent among genomes.

Similarity-based gene detection: using COGs to find evolutionarily-conserved ORFs

Directory of Open Access Journals (Sweden)

Hutchison Clyde A

2006-01-01

Full Text Available Abstract Background Experimental verification of gene products has not kept pace with the rapid growth of microbial sequence information. However, existing annotations of gene locations contain sufficient information to screen for probable errors. Furthermore, comparisons among genomes become more informative as more genomes are examined. We studied all open reading frames (ORFs of at least 30 codons from the genomes of 27 sequenced bacterial strains. We grouped the potential peptide sequences encoded from the ORFs by forming Clusters of Orthologous Groups (COGs. We used this grouping in order to find homologous relationships that would not be distinguishable from noise when using simple BLAST searches. Although COG analysis was initially developed to group annotated genes, we applied it to the task of grouping anonymous DNA sequences that may encode proteins. Results "Mixed COGs" of ORFs (clusters in which some sequences correspond to annotated genes and some do not are attractive targets when seeking errors of gene predicion. Examination of mixed COGs reveals some situations in which genes appear to have been missed in current annotations and a smaller number of regions that appear to have been annotated as gene loci erroneously. This technique can also be used to detect potential pseudogenes or sequencing errors. Our method uses an adjustable parameter for degree of conservation among the studied genomes (stringency. We detail results for one level of stringency at which we found 83 potential genes which had not previously been identified, 60 potential pseudogenes, and 7 sequences with existing gene annotations that are probably incorrect. Conclusion Systematic study of sequence conservation offers a way to improve existing annotations by identifying potentially homologous regions where the annotation of the presence or absence of a gene is inconsistent among genomes.

A powerful nonparametric method for detecting differentially co-expressed genes: distance correlation screening and edge-count test.

Science.gov (United States)

Zhang, Qingyang

2018-05-16

Differential co-expression analysis, as a complement of differential expression analysis, offers significant insights into the changes in molecular mechanism of different phenotypes. A prevailing approach to detecting differentially co-expressed genes is to compare Pearson's correlation coefficients in two phenotypes. However, due to the limitations of Pearson's correlation measure, this approach lacks the power to detect nonlinear changes in gene co-expression which is common in gene regulatory networks. In this work, a new nonparametric procedure is proposed to search differentially co-expressed gene pairs in different phenotypes from large-scale data. Our computational pipeline consisted of two main steps, a screening step and a testing step. The screening step is to reduce the search space by filtering out all the independent gene pairs using distance correlation measure. In the testing step, we compare the gene co-expression patterns in different phenotypes by a recently developed edge-count test. Both steps are distribution-free and targeting nonlinear relations. We illustrate the promise of the new approach by analyzing the Cancer Genome Atlas data and the METABRIC data for breast cancer subtypes. Compared with some existing methods, the new method is more powerful in detecting nonlinear type of differential co-expressions. The distance correlation screening can greatly improve computational efficiency, facilitating its application to large data sets.

Detection of coding genes for enterotoxins in Bacillus cereus by PCR and their products by BCET-RPLA and ELISA Assay

Directory of Open Access Journals (Sweden)

Marcela Vyletělová

2010-01-01

Full Text Available Determination of enterotoxin production, diarrhoeal and emetic gene identification was studied in 41 Bacillus cereus strains isolated from raw cows’ and raw goats’ milk, pasteurized milk, dairy products during technological processing and from dairy plant equipment. Presence of enterotoxins was detected by BCET-RPLA (HBL and ELISA immunoassay (NHE. Gene identification (nheA, nheB, nheC, hblA, hblC, hblD, bceT, cytK-1, cytK-2, entFM and ces was achieved by means of PCR. Enterotoxin HBL was detected in 32 strains, enterotoxin NHE in all 41 strains. Presence of all three genes nheA, nheB and nheC was confirmed in 40 strains and genes hblA, hblC and hblD in 29 strains. Comparison of used methods was as follow: 1 BCET-RPLA (which detects L2 component and PCR (positive or negative all three hblA, hblC and hblD gene detection were identical in 30 (73%; 2 ELISA (NheA and PCR (all three nheC, nheB and nheA gene expression were identical in 40 (98% cases isolated strains.

Detection and analysis of hemolysin genes in Aeromonas hydrophila isolated from Gouramy (Osphronemus gouramy) by polymerase chain reaction (PCR)

Science.gov (United States)

Rozi; Rahayu, K.; Daruti, D. N.

2018-04-01

The goal of this study was to detect of Aeromonas hydrophila carrying the hlyA gene in guramy by PCR assay. A total of 5 A. hydrophila strains were isolated from gouramy with different location and furthermore genotypic of all A. hydrophila strains havedetected by PCR assay for 16S rRNA gene. The primers used in the PCR targeted a 592-bp fragment of the hlyA gene coding for the hemolysin gene. Particularly hlyA genes are responsible for haemolysin toxins production in this genus. After gel electrophoresis, the amplicons from representative strains of the A. hydrophila were purified using extraction kit and were subjected to the DNA sequencing analysis. The results showed that: (i) the 592bp amplicon of the hlyA gene was detected in 5/6 of the A. hydrophila; (ii) the nucleotide blast results of hemolysin gene sequences of the strains of A. hydrophila revealed a high homology of 90-97 % with published sequences, and;(iii) the protein blast showed 95-98 % homology when compared to the published sequences. The PCR clearly identified the haemolysin-producing strains of A. hydrophila by detection in hlyA genes and may have application as a rapid species-specific virulence test.

In situ detection of the Clostridium botulinum type C1 toxin gene in wetland sediments with a nested PCR assay

Science.gov (United States)

Williamson, Judy L.; Rocke, Tonie E.; Aiken, Judd M.

1999-01-01

A nested PCR was developed for detection of the Clostridium botulinum type C1 toxin gene in sediments collected from wetlands where avian botulism outbreaks had or had not occurred. The C1 toxin gene was detected in 16 of 18 sites, demonstrating both the ubiquitous distribution of C. botulinum type C in wetland sediments and the sensitivity of the detection assay.

Search Engine for Antimicrobial Resistance: A Cloud Compatible Pipeline and Web Interface for Rapidly Detecting Antimicrobial Resistance Genes Directly from Sequence Data.

Science.gov (United States)

Rowe, Will; Baker, Kate S; Verner-Jeffreys, David; Baker-Austin, Craig; Ryan, Jim J; Maskell, Duncan; Pearce, Gareth

2015-01-01

Antimicrobial resistance remains a growing and significant concern in human and veterinary medicine. Current laboratory methods for the detection and surveillance of antimicrobial resistant bacteria are limited in their effectiveness and scope. With the rapidly developing field of whole genome sequencing beginning to be utilised in clinical practice, the ability to interrogate sequencing data quickly and easily for the presence of antimicrobial resistance genes will become increasingly important and useful for informing clinical decisions. Additionally, use of such tools will provide insight into the dynamics of antimicrobial resistance genes in metagenomic samples such as those used in environmental monitoring. Here we present the Search Engine for Antimicrobial Resistance (SEAR), a pipeline and web interface for detection of horizontally acquired antimicrobial resistance genes in raw sequencing data. The pipeline provides gene information, abundance estimation and the reconstructed sequence of antimicrobial resistance genes; it also provides web links to additional information on each gene. The pipeline utilises clustering and read mapping to annotate full-length genes relative to a user-defined database. It also uses local alignment of annotated genes to a range of online databases to provide additional information. We demonstrate SEAR's application in the detection and abundance estimation of antimicrobial resistance genes in two novel environmental metagenomes, 32 human faecal microbiome datasets and 126 clinical isolates of Shigella sonnei. We have developed a pipeline that contributes to the improved capacity for antimicrobial resistance detection afforded by next generation sequencing technologies, allowing for rapid detection of antimicrobial resistance genes directly from sequencing data. SEAR uses raw sequencing data via an intuitive interface so can be run rapidly without requiring advanced bioinformatic skills or resources. Finally, we show that SEAR

Multiplex real-time PCR assay for the detection of extended-spectrum β-lactamase and carbapenemase genes using melting curve analysis.

Science.gov (United States)

Singh, Prashant; Pfeifer, Yvonne; Mustapha, Azlin

2016-05-01

Real-time PCR melt curve assays for the detection of β-lactamase, extended-spectrum β-lactamase and carbapenemase genes in Gram-negative bacteria were developed. Two multiplex real-time PCR melt curve assays were developed for the detection of ten common β-lactamase genes: blaKPC-like, blaOXA-48-like, blaNDM-like, blaVIM-like, blaIMP-like, blaCTX-M-1+2-group, blaCMY-like, blaACC-like, blaSHV-like and blaTEM-like. The assays were evaluated using 25 bacterial strains and 31 DNA samples (total n=56) comprising different Enterobacteriaceae genera and Pseudomonas spp. These strains were previously characterized at five research institutes. Each resistance gene targeted in this study generated a non-overlapping and distinct melt curve peak. The assay worked effectively and detected the presence of additional resistance genes in 23 samples. The assays developed in this study offer a simple, low cost method for the detection of prevalent β-lactamase, ESBL and carbapenemase genes among Gram-negative pathogens. Copyright © 2016 Elsevier B.V. All rights reserved.

Detection of antibiotic resistance and tetracycline resistance genes in Enterobacteriaceae isolated from the Pearl rivers in South China

International Nuclear Information System (INIS)

Tao Ran; Ying Guangguo; Su Haochang; Zhou Hongwei; Sidhu, Jatinder P.S.

2010-01-01

This study investigated antibiotic resistance profiles and tetracycline resistance genes in Enterobacteriaceae family isolates from the Pearl rivers. The Enterobacteriaceae isolates were tested for susceptibility to seven antibiotics ampicillin, chloramphenicol, ciprofloxacin, levofloxacin, sulphamethoxazole/trimethoprim, tetracycline and trimethoprim. In Liuxi reservoir, with an exception to ampicillin resistant strains (11%) no other antibiotic resistance bacterial strains were detected. However, multiple drug resistance in bacterial isolates from the other sites of Pearl rivers was observed which is possibly due to sewage discharge and input from other anthropogenic sources along the rivers. Four tetracycline resistance genes tet A, tet B, tet C and tet D were detected in the isolates from the rivers. The genes tet A and tet B were widely detected with the detection frequencies of 43% and 40% respectively. Ciprofloxacin and levofloxacin resistant enteric bacteria were also isolated from the pig and duck manures which suggest a wider distribution of human specific drugs in the environment. This investigation provided a baseline data on antibiotic resistance profiles and tetracycline resistance genes in the Pearl rivers delta. - High rates of antibiotic resistance in Enterobacteriaceae from river water are attributed to wastewater contamination.

Detection of antibiotic resistance and tetracycline resistance genes in Enterobacteriaceae isolated from the Pearl rivers in South China

Energy Technology Data Exchange (ETDEWEB)

Tao Ran [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Ying Guangguo, E-mail: guangguo.ying@gmail.co [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Su Haochang [State Key Laboratory of Organic Geochemistry, Guangzhou Institute of Geochemistry, Chinese Academy of Sciences, 511 Kehua Street, Tianhe District, Guangzhou 510640 (China); Zhou Hongwei [Department of Environmental Health, School of Public Health and Tropical Medicine, Southern Medical University, 1838 North Guangzhou Street, Baiyun District, Guangzhou 510515 (China); Sidhu, Jatinder P.S. [CSIRO Land and Water, Queensland Bioscience Precinct, 306 Carmody Road, St Lucia QLD 4067 (Australia)

2010-06-15

This study investigated antibiotic resistance profiles and tetracycline resistance genes in Enterobacteriaceae family isolates from the Pearl rivers. The Enterobacteriaceae isolates were tested for susceptibility to seven antibiotics ampicillin, chloramphenicol, ciprofloxacin, levofloxacin, sulphamethoxazole/trimethoprim, tetracycline and trimethoprim. In Liuxi reservoir, with an exception to ampicillin resistant strains (11%) no other antibiotic resistance bacterial strains were detected. However, multiple drug resistance in bacterial isolates from the other sites of Pearl rivers was observed which is possibly due to sewage discharge and input from other anthropogenic sources along the rivers. Four tetracycline resistance genes tet A, tet B, tet C and tet D were detected in the isolates from the rivers. The genes tet A and tet B were widely detected with the detection frequencies of 43% and 40% respectively. Ciprofloxacin and levofloxacin resistant enteric bacteria were also isolated from the pig and duck manures which suggest a wider distribution of human specific drugs in the environment. This investigation provided a baseline data on antibiotic resistance profiles and tetracycline resistance genes in the Pearl rivers delta. - High rates of antibiotic resistance in Enterobacteriaceae from river water are attributed to wastewater contamination.

PCR detection of retinoblastoma gene deletions in radiation-induced mouse lung adenocarcinomas

International Nuclear Information System (INIS)

Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

1993-01-01

From 1971 to 1986, Argonne National Laboratory conducted a series of large-scale studies of tumor incidence in 40,000 BCF 1 mice irradiated with 60 Co γ rays or JANUS fission-spectrum neutrons; normal and tumor tissues from mice in these studies were preserved in paraffin blocks. A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma (mRb) gene in the paraffin-embedded tissues. Microtomed sections were used as the DNA source in PCR reaction mixtures. Six mRb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments (relative to control PCR products) on a Southern blot indicated a deletion of that portion of the mRb gene. The tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death in post-mortem analyses. Spontaneous tumors as well as those from irradiated mice (569 cGy of 60 Co γ rays or 60 cGy of JANUS neutrons, doses that have been found to have approximately equal biological effectiveness in the BCF, mouse) were analyzed for mRb deletions. In all normal mouse tissues studies, all six mRb exon fragments were present on Southem blots. Tumors in six neutron-irradiated mice also had no mRb deletions. However, I of 6 tumors from γ-irradiated mice and 6 of 18 spontaneous tumors from unirradiated mice had a deletion in one or both mRb alleles. All deletions detected were in the 5' region of the mRb gene

Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils.

Science.gov (United States)

Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V

2003-01-01

Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).

Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

Directory of Open Access Journals (Sweden)

Abbas Ali Imani Fooladi

2014-02-01

Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

Analysis of human reticulocyte genes reveals altered erythropoiesis: potential use to detect recombinant human erythropoietin doping.

Science.gov (United States)

Varlet-Marie, Emmanuelle; Audran, Michel; Lejeune, Mireille; Bonafoux, Béatrice; Sicart, Marie-Therese; Marti, Jacques; Piquemal, David; Commes, Thérèse

2004-08-01

Enhancement of oxygen delivery to tissues is associated with improved sporting performance. One way of enhancing oxygen delivery is to take recombinant human erythropoietin (rHuEpo), which is an unethical and potentially dangerous practice. However, detection of the use of rHuEpo remains difficult in situations such as: i) several days after the end of treatment ii) when a treatment with low doses is conducted iii) if the rHuEpo effect is increased by other substances. In an attempt to detect rHuEpo abuse, we selected erythroid gene markers from a SAGE library and analyzed the effects of rHuEpo administration on expression of the HBB, FTL and OAZ genes. Ten athletes were assigned to the rHuEpo or placebo group. The rHuEpo group received subcutaneous injections of rHuEpo (50 UI/kg three times a week, 4 weeks; 20 UI/kg three times a week, 2 weeks). HBB, FTL and OAZ gene profiles were monitored by real time-polymerase chain reaction (PCR) quantification during and for 3 weeks after drug administration. The global analysis of these targeted genes detected in whole blood samples showed a characteristic profile of subjects misusing rHuEpo with a increase above the threshold levels. The individual analysis of OAZ mRNA seemed indicative of rHuEpo treatment. The performance-enhancing effect of rHuEpo treatment is greater than the duration of hematologic changes associated with rHuEpo misuse. Although direct electrophoretic methods to detect rHuEpo have been developed, recombinant isoforms of rHuEpo are not detectable some days after the last subcutaneous injection. To overcome these limitations indirect OFF models have been developed. Our data suggest that, in the near future, it will be possible to consolidate results achievable with the OFF models by analyzing selected erythroid gene markers as a supplement to indirect methods.

Anti-CagA positivity in duodenal ulcer and functional dyspepsia patients infected with Helicobacter pylori and its effect on the outcome of eradication treatment

Directory of Open Access Journals (Sweden)

Yaşar Nazlıgül

2011-03-01

Full Text Available Objectives: CagA positive H. pylori strains are considered to be more virulent than other strains. In this study, we aimed to investigate the rate of CagA positivity in duodenal ulcer (DU and functional dyspepsia (FD, and its effect on H. pylori eradication response.Materials and methods: The study was performed on H. pylori positive 60 patients with DU and 50 patients with FD, who underwent upper gastrointestinal endoscopy. H. pylori infection was identified by histology. All patients received a quadriple therapy consisted of esomeprazole 20 mg b.i.d., colloidal bismuth subcitrate 600 mg b.i.d., tetracycline 500 mg q.i.d. and metronidazole 500 mg t.i.d. for 7 days. H.pylori status was rechecked using C14-urea breath test 6 weeks after the end of treatment to confirm cure. Specific IgG antibodies for CagA status were determined by enzyme linked immunosorbent assay.Results: CagA positivities in the patients with DU and FD were calculated respectivily 70% and 68% (P>0.05. H. pylori was eradicated in 85.5% of the patients infected with CagA (+ strains, in 50% of those infected with CagA (- strains (P=0.001. The eradication rates were 95.2% and 55.6% in CagA positive and negative DU subgroups (P=0.001, and 73.5% and 43.8% in CagA positive and negative FD subgroups (P=0.04.Conclusion: CagA positivities were not different in duodenal ulcer and functional dyspepsia. CagA (+ strains was susceptible to the eradication treatment. The titres of serum anti-CagA antibodies may be used in the prediction of eradication outcome, and the modification of eradication therapy.

Spectrophotometric, colorimetric and visually detection of Pseudomonas aeruginosa ETA gene based gold nanoparticles DNA probe and endonuclease enzyme

Science.gov (United States)

Amini, Bahram; Kamali, Mehdi; Salouti, Mojtaba; Yaghmaei, Parichehreh

2018-06-01

Colorimetric DNA detection is preferred over other methods for clinical molecular diagnosis because it does not require expensive equipment. In the present study, the colorimetric method based on gold nanoparticles (GNPs) and endonuclease enzyme was used for the detection of P. aeruginosa ETA gene. Firstly, the primers and probe for P. aeruginosa exotoxin A (ETA) gene were designed and checked for specificity by the PCR method. Then, GNPs were synthesized using the citrate reduction method and conjugated with the prepared probe to develop the new nano-biosensor. Next, the extracted target DNA of the bacteria was added to GNP-probe complex to check its efficacy for P. aeruginosa ETA gene diagnosis. A decrease in absorbance was seen when GNP-probe-target DNA cleaved into the small fragments of BamHI endonuclease due to the weakened electrostatic interaction between GNPs and the shortened DNA. The right shift of the absorbance peak from 530 to 562 nm occurred after adding the endonuclease. It was measured using a UV-VIS absorption spectroscopy that indicates the existence of the P. aeruginosa ETA gene. Sensitivity was determined in the presence of different concentrations of target DNA of P. aeruginosa. The results obtained from the optimized conditions showed that the absorbance value has linear correlation with concentration of target DNA (R: 0.9850) in the range of 10-50 ng mL-1 with the limit detection of 9.899 ng mL-1. Thus, the specificity of the new method for detection of P. aeruginosa was established in comparison with other bacteria. Additionally, the designed assay was quantitatively applied to detect the P. aeruginosa ETA gene from 103 to 108 CFU mL-1 in real samples with a detection limit of 320 CFU mL-1.

Detecting Role Errors in the Gene Hierarchy of the NCI Thesaurus

Directory of Open Access Journals (Sweden)

Yehoshua Perl

2008-01-01

Full Text Available Gene terminologies are playing an increasingly important role in the ever-growing field of genomic research. While errors in large, complex terminologies are inevitable, gene terminologies are even more susceptible to them due to the rapid growth of genomic knowledge and the nature of its discovery. It is therefore very important to establish quality- assurance protocols for such genomic-knowledge repositories. Different kinds of terminologies oftentimes require auditing methodologies adapted to their particular structures. In light of this, an auditing methodology tailored to the characteristics of the NCI Thesaurus’s (NCIT’s Gene hierarchy is presented. The Gene hierarchy is of particular interest to the NCIT’s designers due to the primary role of genomics in current cancer research. This multiphase methodology focuses on detecting role-errors, such as missing roles or roles with incorrect or incomplete target structures, occurring within that hierarchy. The methodology is based on two kinds of abstraction networks, called taxonomies, that highlight the role distribution among concepts within the IS-A (subsumption hierarchy. These abstract views tend to highlight portions of the hierarchy having a higher concentration of errors. The errors found during an application of the methodology

Simultaneous amplification of two bacterial genes: more reliable method of Helicobacter pylori detection in microbial rich dental plaque samples.

Science.gov (United States)

Chaudhry, Saima; Idrees, Muhammad; Izhar, Mateen; Butt, Arshad Kamal; Khan, Ayyaz Ali

2011-01-01

Polymerase Chain reaction (PCR) assay is considered superior to other methods for detection of Helicobacter pylori (H. pylori) in oral cavity; however, it also has limitations when sample under study is microbial rich dental plaque. The type of gene targeted and number of primers used for bacterial detection in dental plaque samples can have a significant effect on the results obtained as there are a number of closely related bacterial species residing in plaque biofilm. Also due to high recombination rate of H. pylori some of the genes might be down regulated or absent. The present study was conducted to determine the frequency of H. pylori colonization of dental plaque by simultaneously amplifying two genes of the bacterium. One hundred dental plaque specimens were collected from dyspeptic patients before their upper gastrointestinal endoscopy and presence of H. pylori was determined through PCR assay using primers targeting two different genes of the bacterium. Eighty-nine of the 100 samples were included in final analysis. With simultaneous amplification of two bacterial genes 51.6% of the dental plaque samples were positive for H. pylori while this prevalence increased to 73% when only one gene amplification was used for bacterial identification. Detection of H. pylori in dental plaque samples is more reliable when two genes of the bacterium are simultaneously amplified as compared to one gene amplification only.

A designated centre for people with disabilities operated by Nua Healthcare Services, Clare

LENUS (Irish Health Repository)

Backert, Steffen

2011-11-01

Abstract Helicobacter pylori is a highly successful pathogen uniquely adapted to colonize humans. Gastric infections with this bacterium can induce pathology ranging from chronic gastritis and peptic ulcers to gastric cancer. More virulent H. pylori isolates harbour numerous well-known adhesins (BabA\\/B, SabA, AlpA\\/B, OipA and HopZ) and the cag (cytotoxin-associated genes) pathogenicity island encoding a type IV secretion system (T4SS). The adhesins establish tight bacterial contact with host target cells and the T4SS represents a needle-like pilus device for the delivery of effector proteins into host target cells such as CagA. BabA and SabA bind to blood group antigen and sialylated proteins respectively, and a series of T4SS components including CagI, CagL, CagY and CagA have been shown to target the integrin β1 receptor followed by injection of CagA across the host cell membrane. The interaction of CagA with membrane-anchored phosphatidylserine may also play a role in the delivery process. While substantial progress has been made in our current understanding of many of the above factors, the host cell receptors for OipA, HopZ and AlpA\\/B during infection are still unknown. Here we review the recent progress in characterizing the interactions of the various adhesins and structural T4SS proteins with host cell factors. The contribution of these interactions to H. pylori colonization and pathogenesis is discussed.

Gene Expression Profiling of Peripheral Blood From Kidney Transplant Recipients for the Early Detection of Digestive System Cancer.

Science.gov (United States)

Kusaka, M; Okamoto, M; Takenaka, M; Sasaki, H; Fukami, N; Kataoka, K; Ito, T; Kenmochi, T; Hoshinaga, K; Shiroki, R

2017-06-01

Kidney transplant recipients are at increased risk of developing cancer in comparison with the general population. To effectively manage post-transplantation malignancies, it is essential to proactively monitor patients. A long-term intensive screening program was associated with a reduced incidence of cancer after transplantation. This study evaluated the usefulness of the gene expression profiling of peripheral blood samples obtained from kidney transplant patients and adopted a screening test for detecting cancer of the digestive system (gastric, colon, pancreas, and biliary tract). Nineteen patients were included in this study and a total of 53 gene expression screening tests were performed. The gene expression profiles of blood-delivered total RNA and whole genome human gene expression profiles were obtained. We investigated the expression levels of 2665 genes associated with digestive cancers and counted the number of genes in which expression was altered. A hierarchical clustering analysis was also performed. The final prediction of the cancer possibility was determined according to an algorithm. The number of genes in which expression was altered was significantly increased in the kidney transplant recipients in comparison with the general population (1091 ± 63 vs 823 ± 94; P = .0024). The number of genes with altered expression decreased after the induction of mechanistic target of rapamycin (mTOR) inhibitor (1484 ± 227 vs 883 ± 154; P = .0439). No cases of possible digestive cancer were detected in this study period. The gene expression profiling of peripheral blood samples may be a useful and noninvasive diagnostic tool that allows for the early detection of cancer of the digestive system. Copyright © 2017 Elsevier Inc. All rights reserved.

Carbon nanoparticles as detection labels in antibody microarrays. Detection of genes encoding virulence factors in Shiga toxin-producing Escherichia coli.

NARCIS (Netherlands)

Noguera, P.S.; Posthuma-Trumpie, G.A.; Tuil, Van M.; Wal, van der F.J.; Boer, De A.; Moers, A.P.H.A.; Amerongen, Van A.

2011-01-01

The present study demonstrates that carbon nanoparticles (CNPs) can be used as labels in microarrays. CNPs were used in nucleic acid microarray immunoassays (NAMIAs) for the detection of different Shiga toxin-producing Escherichia coli (STEC) virulence factors: four genes specific for STEC (vt1,

Hearing-loss-associated gene detection in neonatal intensive care unit.

Science.gov (United States)

Yang, S M; Liu, Ying; Liu, C; Yin, A H; Wu, Y F; Zheng, X E; Yang, H M; Yang, J

2018-02-01

To investigate the frequency and mutation spectrum of hearing loss-associated gene mutation in Neonatal Intensive Care Unit (NICU). Neonates (n=2305) admitted to NICU were enrolled in this study. Nine prominent hearing loss-associated genes, GJB2 (35 del G, 176 del 16,235 del C, 299 del AT), GJB3 (538 C > T), SLC26A4 (IVS7-2A > G, 2168 A > G) and mtDNA 12S rRNA(1555 A > G, 1494 C > T), were detected. There were 73 cases hearing-loss-associated gene mutation among 2305 cases, the mutation frequency was 3.1%, with 40 cases GJB2 (235del C) mutation (54.8%), 6 cases GJB2 (299 del AT) mutation (8.2%), 21 cases SLC26A4 (IVS 7-2 A > G) mutation (28.7%), 4 cases SLC26A4 (2168 A > G) mutation (5.5%), 2 cases of GJB2 (235del C) combined SLC26A4 (IVS 7-2 A > G, 2168 A > G) mutation (2.8%). Among 73 gene mutation cases, preterm neonates presented in 18 cases, accounting for 24.7% (18/73); hyperbilirubinemia in 13 cases, accounting for 17.8% (13/73); Torch Syndrome in 15 cases, with 12 cases CMV, 2 cases rubella, 1 case toxoplasm, respectively, totally accounting for 20.54% (15/73); neonatal pneumonia in 12 cases, accounting for 16.4% (12/73); birth asphyxia in 5 cases, accounting for 6.9% (5/73); sepsis in 5 cases, accounting for 6.9% (5/73); others in 5 cases, accounting for 6.8% (5/73) . The frequency of hearing loss-associated gene mutation was higher in NICU.There were hearing loss-associated gene mutations in the NICU, suggesting this mutation may complicate with perinatal high-risk factors.

Identification of pyrG Used as an Endogenous Reference Gene in Qualitative and Real-Time Quantitative PCR Detection of Pleurotus ostreatus.

Science.gov (United States)

Zheng, Shi; Shan, Luying; Zhuang, Yongliang; Shang, Ying

2018-03-01

As a well-known edible fungus rich in nutrients, Pleurotus ostreatus has been used as an alternative to expensive wild edible fungi. Specifically, the fact that using P. ostreatus instead of other expensive wild edible fungi has damaged the rights and interests of consumers. Among the existing methods for detection of food adulteration, the amplification of endogenous reference gene is the most accurate method. However, an ideal endogenous reference gene for P. ostreatus has yet to be developed. In this study, a DNA extraction method for P. ostreatus was optimized, and pyrG was selected as a species-specific gene through sequence alignment. This gene was subsequently subjected to qualitative and quantitative Polymerase Chain Reaction (PCR) assays with 3 different P. ostreatus varieties and 7 other species. A low detection limit of 5 pg/μL was obtained by TaqMan quantitative PCR, and no pyrG amplification product was observed in the 7 other species. No allelic variation was detected in P. ostreatus varieties. These experiments confirmed that pyrG was an ideal endogenous reference gene for the qualitative and real-time quantitative PCR detection of P. ostreatus. This method was also suitable for the examination of processed P. ostreatus samples and determination of adulteration in wild mushrooms. The pyrG gene was chosen as an ideal endogenous reference gene for the qualitative and real-time quantitative PCR detection of P. ostreatus, and the detection limit was 5 pg/μL for the quantification. This method is used not only for raw materials but also for processed P. ostreatus products and other processed mushroom foods. © 2018 Institute of Food Technologists®.

Methodological issues in detecting gene-gene interactions in breast cancer susceptibility: a population-based study in Ontario

Directory of Open Access Journals (Sweden)

Onay Venus

2007-08-01

Full Text Available Abstract Background There is growing evidence that gene-gene interactions are ubiquitous in determining the susceptibility to common human diseases. The investigation of such gene-gene interactions presents new statistical challenges for studies with relatively small sample sizes as the number of potential interactions in the genome can be large. Breast cancer provides a useful paradigm to study genetically complex diseases because commonly occurring single nucleotide polymorphisms (SNPs may additively or synergistically disturb the system-wide communication of the cellular processes leading to cancer development. Methods In this study, we systematically studied SNP-SNP interactions among 19 SNPs from 18 key genes involved in major cancer pathways in a sample of 398 breast cancer cases and 372 controls from Ontario. We discuss the methodological issues associated with the detection of SNP-SNP interactions in this dataset by applying and comparing three commonly used methods: the logistic regression model, classification and regression trees (CART, and the multifactor dimensionality reduction (MDR method. Results Our analyses show evidence for several simple (two-way and complex (multi-way SNP-SNP interactions associated with breast cancer. For example, all three methods identified XPD-[Lys751Gln]*IL10-[G(-1082A] as the most significant two-way interaction. CART and MDR identified the same critical SNPs participating in complex interactions. Our results suggest that the use of multiple statistical approaches (or an integrated approach rather than a single methodology could be the best strategy to elucidate complex gene interactions that have generally very different patterns. Conclusion The strategy used here has the potential to identify complex biological relationships among breast cancer genes and processes. This will lead to the discovery of novel biological information, which will improve breast cancer risk management.

Twin target self-amplification-based DNA machine for highly sensitive detection of cancer-related gene.

Science.gov (United States)

Xu, Huo; Jiang, Yifan; Liu, Dengyou; Liu, Kai; Zhang, Yafeng; Yu, Suhong; Shen, Zhifa; Wu, Zai-Sheng

2018-06-29

The sensitive detection of cancer-related genes is of great significance for early diagnosis and treatment of human cancers, and previous isothermal amplification sensing systems were often based on the reuse of target DNA, the amplification of enzymatic products and the accumulation of reporting probes. However, no reporting probes are able to be transformed into target species and in turn initiate the signal of other probes. Herein we reported a simple, isothermal and highly sensitive homogeneous assay system for tumor suppressor p53 gene detection based on a new autonomous DNA machine, where the signaling probe, molecular beacon (MB), was able to execute the function similar to target DNA besides providing the common signal. In the presence of target p53 gene, the operation of DNA machine can be initiated, and cyclical nucleic acid strand-displacement polymerization (CNDP) and nicking/polymerization cyclical amplification (NPCA) occur, during which the MB was opened by target species and cleaved by restriction endonuclease. In turn, the cleaved fragments could activate the next signaling process as target DNA did. According to the functional similarity, the cleaved fragment was called twin target, and the corresponding fashion to amplify the signal was named twin target self-amplification. Utilizing this newly-proposed DNA machine, the target DNA could be detected down to 0.1 pM with a wide dynamic range (6 orders of magnitude) and single-base mismatched targets were discriminated, indicating a very high assay sensitivity and good specificity. In addition, the DNA machine was not only used to screen the p53 gene in complex biological matrix but also was capable of practically detecting genomic DNA p53 extracted from A549 cell line. This indicates that the proposed DNA machine holds the potential application in biomedical research and early clinical diagnosis. Copyright © 2018 Elsevier B.V. All rights reserved.

Local Immune Homeostasis of Gastric Mucosa in Chronic CagA-positive Hр-associated Gastritis in Children

Directory of Open Access Journals (Sweden)

O.Ye. Abaturov

2012-04-01

Full Text Available The article deal with study of lymphocyte-macrophage link of the gastric mucosa local immunity in Hр-associated chronic gastritis, taking into account the presence of the cytotoxin-associated gene A (CagA Hр through a standard morphological examination according to the Modified Sydney System and immunohistochemical studies of biopsy specimens.

Detection of Genes that Determine Maize Grain Quality Characteristics and Resistance to Stress Factors

Directory of Open Access Journals (Sweden)

Markovskyi, O.V.

2014-01-01

Full Text Available 200 experimental maize samples (Maize Company were examined for the presence of genes that determine the quality characteristics of grain (wx and fl-2 genes, herbicide (bar (pat, epsps genes and insect (cry-genes resistance. The total DNA was extracted from maize living plant tissue. Primers to detect wx, fl-2, bar (pat, mepsps, CP4 epsps, cry1A(b, cry1F, cry1A.105, mcry3A, cry2Ab2, cry3Bb1, cry34Ab1, cry35Ab1 genes were designed and selected. Multiplex and Touchdown PCR were worked out. PCR amplification of certain sequences was carried out. No transgenes (bar (pat, mepsps, CP4 epsps, cry1A(b, cry1F, cry1A.105, mcry3A, cry2Ab2, cry3Bb1, cry34Ab1, cry35Ab1 were found among 200 analyzed experimental maize samples. At the same time, fl-2 gene was found in 41 samples, wx gene was found in 192 analyzed samples.

40 CFR 798.5300 - Detection of gene mutations in somatic cells in culture.

Science.gov (United States)

2010-07-01

... cells in culture. 798.5300 Section 798.5300 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY....5300 Detection of gene mutations in somatic cells in culture. (a) Purpose. Mammalian cell culture... selected by resistance to ouabain. (2) Description. Cells in suspension or monolayer culture are exposed to...

The significance of virulence factors in Helicobacter pylori.

Science.gov (United States)

Shiota, Seiji; Suzuki, Rumiko; Yamaoka, Yoshio

2013-07-01

Helicobacter pylori (H. pylori) infection is linked to various gastroduodenal diseases; however, only a small fraction of these patients develop associated diseases. Despite the high prevalence of H. pylori infection in Africa and South Asia, the incidence of gastric cancer in these areas is much lower than those in other countries. The incidence of gastric cancer tends to decrease from north to south in East Asia. Such geographical differences in the pathology can be explained, at least in part, by the presence of different types of H. pylori virulence factors in addition to host and environmental factors. Virulence factors of H. pylori, such as CagA, VacA, DupA, IceA, OipA and BabA, have been demonstrated to be the predictors of severe clinical outcomes. Interestingly, a meta-analysis showed that CagA seropositivity was associated with gastric cancer compared with gastritis, even in East Asian countries where almost the strains possess cagA. Another meta-analysis also confirmed the significance of vacA, dupA and iceA. However, it is possible that additional important pathogenic genes may exist because H. pylori consists of approximately 1600 genes. Despite the advances in our understanding of the development of H. pylori infection-related diseases, further work is required to clarify the roles of H. pylori virulence factors. © 2013 The Authors. Journal of Digestive Diseases © 2013 Wiley Publishing Asia Pty Ltd and Chinese Medical Association Shanghai Branch, Chinese Society of Gastroenterology, Renji Hospital Affiliated to Shanghai Jiaotong University School of Medicine.

Phenotypic and molecular detection of BLACTX-M gene extended-spectrum beta-lactamases in escherichia coli and klebsiella pneumoniae of north sumatera isolates

Science.gov (United States)

Hasibuan, Mirzan; Suryanto, Dwi; Lia Kusumawati, R.

2018-03-01

The application of antibiotics expanded-spectrum third-generation cephalosporin for the treatment of infectious diseases in hospitals is known contribute to increasing resistance due to the presence of the blaCTX-M gene in the bacteria producing ESBLs. This study was aimed to detect ESBLs, isolate phenotype and blaCTX-M genes on Escherichia coli and Klebsiella pneumoniae collected from H. Adam Malik Central Hospital. Phenotypes of the bacterial were detection using Vitek two compact, while the blaCTX-M genes were detection using polymerase chain reaction technique. The results showed that 85 (100%) isolates were ESBLs consisted of 41(48%) of Escherichia coli, and 44 (52%) of Klebsiella pneumoniae, respectively. blaCTX-M genes were detection in 62 (72.94%) of the isolates which 31 (36.47%) were Escherichia coli, and 31 (36.47%) of the isolates were Klebsiella pneumoniae, respectively. This study indicates the high prevalence of blaCTX-M genes in Escherichia coli and Klebsiella pneumoniea causing bacterial antibiotic resistance.

First detection of the staphylococcal trimethoprim resistance gene dfrK and the dfrK-carrying transposon Tn559 in enterococci.

Science.gov (United States)

López, María; Kadlec, Kristina; Schwarz, Stefan; Torres, Carmen

2012-02-01

The trimethoprim resistance gene dfrK has been recently described in Staphylococcus aureus, but so far has not been found in other bacteria. A total of 166 enterococci of different species (E. faecium, E. faecalis, E. hirae, E. durans, E. gallinarum, and E. casseliflavus) and origins (food, clinical diseases in humans, healthy humans or animals, and sewage) were studied for their susceptibility to trimethoprim as determined by agar dilution (European Committee on Antimicrobial Susceptibility Testing) and the presence of (a) the dfrK gene and its genetic environment and (b) other dfr genes. The dfrK gene was detected in 49% of the enterococci (64% and 42% of isolates with minimum inhibitory concentrations of ≥2 mg/L or ≤1 mg/L, respectively). The tet(L)-dfrK linkage was detected in 21% of dfrK-positive enterococci. The chromosomal location of the dfrK gene was identified in one E. faecium isolate in which the dfrK was not linked to tet(L) gene but was part of a Tn559 element, which was integrated in the chromosomal radC gene. This Tn559 element was also found in 14 additional isolates. All combinations of dfr genes were detected among the isolates tested (dfrK, dfrG, dfrF, dfrK+dfrG, dfrK+dfrF, dfrF+dfrG, and dfrF+dfrG+dfrK). The gene dfrK gene was found together with other dfr genes in 58% of the tested enterococci. This study suggested an exchange of the trimethoprim resistance gene dfrK between enterococci and staphylococci, as previously observed for the trimethoprim resistance gene dfrG.

Random regression models for detection of gene by environment interaction

Directory of Open Access Journals (Sweden)

Meuwissen Theo HE

2007-02-01

Full Text Available Abstract Two random regression models, where the effect of a putative QTL was regressed on an environmental gradient, are described. The first model estimates the correlation between intercept and slope of the random regression, while the other model restricts this correlation to 1 or -1, which is expected under a bi-allelic QTL model. The random regression models were compared to a model assuming no gene by environment interactions. The comparison was done with regards to the models ability to detect QTL, to position them accurately and to detect possible QTL by environment interactions. A simulation study based on a granddaughter design was conducted, and QTL were assumed, either by assigning an effect independent of the environment or as a linear function of a simulated environmental gradient. It was concluded that the random regression models were suitable for detection of QTL effects, in the presence and absence of interactions with environmental gradients. Fixing the correlation between intercept and slope of the random regression had a positive effect on power when the QTL effects re-ranked between environments.

Detection of biomarkers for Hepatocellular Carcinoma using a hybrid univariate gene selection methods

Directory of Open Access Journals (Sweden)

Abdel Samee Nagwan M

2012-08-01

Full Text Available Abstract Background Discovering new biomarkers has a great role in improving early diagnosis of Hepatocellular carcinoma (HCC. The experimental determination of biomarkers needs a lot of time and money. This motivates this work to use in-silico prediction of biomarkers to reduce the number of experiments required for detecting new ones. This is achieved by extracting the most representative genes in microarrays of HCC. Results In this work, we provide a method for extracting the differential expressed genes, up regulated ones, that can be considered candidate biomarkers in high throughput microarrays of HCC. We examine the power of several gene selection methods (such as Pearson’s correlation coefficient, Cosine coefficient, Euclidean distance, Mutual information and Entropy with different estimators in selecting informative genes. A biological interpretation of the highly ranked genes is done using KEGG (Kyoto Encyclopedia of Genes and Genomes pathways, ENTREZ and DAVID (Database for Annotation, Visualization, and Integrated Discovery databases. The top ten genes selected using Pearson’s correlation coefficient and Cosine coefficient contained six genes that have been implicated in cancer (often multiple cancers genesis in previous studies. A fewer number of genes were obtained by the other methods (4 genes using Mutual information, 3genes using Euclidean distance and only one gene using Entropy. A better result was obtained by the utilization of a hybrid approach based on intersecting the highly ranked genes in the output of all investigated methods. This hybrid combination yielded seven genes (2 genes for HCC and 5 genes in different types of cancer in the top ten genes of the list of intersected genes. Conclusions To strengthen the effectiveness of the univariate selection methods, we propose a hybrid approach by intersecting several of these methods in a cascaded manner. This approach surpasses all of univariate selection methods when

Detection of antibiotic resistance genes in samples from acute and chronic endodontic infections and after treatment.

Science.gov (United States)

Rôças, Isabela N; Siqueira, José F

2013-09-01

The purpose of this study was twofold: survey samples from acute and chronic endodontic infections for the presence of genes encoding resistance to beta-lactams, tetracycline and erythromycin, and evaluate the ability of treatment to eliminate these genes from root canals. DNA extracts from samples of abscess aspirates (n=25) and root canals of teeth with asymptomatic apical periodontitis (n=24) were used as template for direct detection of the genes blaTEM, cfxA, tetM, tetQ, tetW, and ermC using real-time polymerase chain reaction (PCR). Bacterial presence was determined using PCR with universal bacterial primers. Root canals of the asymptomatic cases were also sampled and evaluated after chemomechanical procedures using NiTi instruments with 2.5% NaOCl irrigation. All abscess and initial root canal samples were positive for bacteria. At least one of the target resistance genes was found in 36% of the abscess samples and 67% of the asymptomatic cases. The most prevalent genes in abscesses were blaTEM (24%) and ermC (24%), while tetM (42%) and tetW (29%) prevailed in asymptomatic cases. The blaTEM gene was significantly associated with acute cases (p=0.02). Conversely, tetM was significantly more prevalent in asymptomatic cases (p=0.008). Treatment eliminated resistance genes from most cases. Acute and chronic endodontic infections harboured resistance genes for 3 classes of widely used antibiotics. In most cases, treatment was effective in eliminating these genes, but there were a few cases in which they persisted. The implications of persistence are unknown. Direct detection of resistance genes in abscesses may be a potential method for rapid diagnosis and establishment of proactive antimicrobial therapy. Copyright © 2013 Elsevier Ltd. All rights reserved.

Assessment of a six gene panel for the molecular detection of circulating tumor cells in the blood of female cancer patients

International Nuclear Information System (INIS)

Obermayr, Eva; Heinze, Georg; Tong, Dan; Zeillinger, Robert; Sanchez-Cabo, Fatima; Tea, Muy-Kheng M; Singer, Christian F; Krainer, Michael; Fischer, Michael B; Sehouli, Jalid; Reinthaller, Alexander; Horvat, Reinhard

2010-01-01

The presence of circulating tumor cells (CTC) in the peripheral blood of cancer patients has been described for various solid tumors and their clinical relevance has been shown. CTC detection based on the analysis of epithelial antigens might be hampered by the genetic heterogeneity of the primary tumor and loss of epithelial antigens. Therefore, we aimed to identify new gene markers for the PCR-based detection of CTC in female cancer patients. Gene expression of 38 cancer cell lines (breast, ovarian, cervical and endometrial) and of 10 peripheral blood mononuclear cell (PBMC) samples from healthy female donors was measured using microarray technology (Applied Biosystems). Differentially expressed genes were identified using the maxT test and the 50% one-sided trimmed maxT-test. Confirmatory RT-qPCR was performed for 380 gene targets using the AB TaqMan ® Low Density Arrays. Then, 93 gene targets were analyzed using the same RT-qPCR platform in tumor tissues of 126 patients with primary breast, ovarian or endometrial cancer. Finally, blood samples from 26 healthy women and from 125 patients (primary breast, ovarian, cervical, or endometrial cancer, and advanced breast cancer) were analyzed following OncoQuick enrichment and RNA pre-amplification. Likewise, hMAM and EpCAM gene expression was analyzed in the blood of breast and ovarian cancer patients. For each gene, a cut-off threshold value was set at three standard deviations from the mean expression level of the healthy controls to identify potential markers for CTC detection. Six genes were over-expressed in blood samples from 81% of patients with advanced and 29% of patients with primary breast cancer. EpCAM gene expression was detected in 19% and 5% of patients, respectively, whereas hMAM gene expression was observed in the advanced group (39%) only. Multimarker analysis using the new six gene panel positively identified 44% of the cervical, 64% of the endometrial and 19% of the ovarian cancer patients. The

Detection of canine distemper virus nucleocapsid protein gene in canine peripheral blood mononuclear cells by RT-PCR.

Science.gov (United States)

Shin, Y; Mori, T; Okita, M; Gemma, T; Kai, C; Mikami, T

1995-06-01

For a rapid diagnosis of canine distemper virus (CDV) infection, the reverse transcription-PCR (RT-PCR) was carried out to detect CDV nucleoprotein (NP) gene from canine peripheral blood mononuclear cells (PBMCs). Two sets of primers were targeted to two regions of NP gene of CDV Onderstepoort strain. The NP gene fragments were well amplified by the RT-PCR in each of the RNA extracts from Vero cells infected with 6 laboratory strains of CDV including Onderstepoort strain, and from PBMCs of a dog experimentally infected with CDV. The amplified NP gene was detected in 17 of 32 samples from dogs which were clinically suspected for CDV infection at veterinary hospitals. No RT-PCR product was found in 52 samples from healthy dogs including 40 specific pathogen free beagles vaccinated with an attenuated live virus-vaccine for CDV and 12 stray dogs. The RT-PCR provides a fast, sensitive, and supplementary method for the diagnosis of CDV infection in dogs.

Detection of GSTM1, GSTT1 and the Ile105Val GSTP1 gene variants

DEFF Research Database (Denmark)

Buchard, Anders; Sanchez, Juan J.; Dalhoff, Kim

2008-01-01

We have developed a PCR multiplex method that in a fast, inexpensive and reliable manner can detect if a person has two, one or no GSTM1 and GSTT1 genes and which at the same time can detect the allelic status of the GSTP1 Ile105Val genetic variant. A total of 200 Danes, 100 Somalis and 100...

Staphylococcus aureus Isolates from Bovine Mastitis in Eight Countries: Genotypes, Detection of Genes Encoding Different Toxins and Other Virulence Genes

Directory of Open Access Journals (Sweden)

Valentina Monistero

2018-06-01

Full Text Available Staphylococcus aureus is recognized worldwide as one of the major agents of dairy cow intra-mammary infections. This microorganism can express a wide spectrum of pathogenic factors used to attach, colonize, invade and infect the host. The present study evaluated 120 isolates from eight different countries that were genotyped by RS-PCR and investigated for 26 different virulence factors to increase the knowledge on the circulating genetic lineages among the cow population with mastitis. New genotypes were observed for South African strains while for all the other countries new variants of existing genotypes were detected. For each country, a specific genotypic pattern was found. Among the virulence factors, fmtB, cna, clfA and leucocidins genes were the most frequent. The sea and sei genes were present in seven out of eight countries; seh showed high frequency in South American countries (Brazil, Colombia, Argentina, while sel was harboured especially in one Mediterranean country (Tunisia. The etb, seb and see genes were not detected in any of the isolates, while only two isolates were MRSA (Germany and Italy confirming the low diffusion of methicillin resistance microorganism among bovine mastitis isolates. This work demonstrated the wide variety of S. aureus genotypes found in dairy cattle worldwide. This condition suggests that considering the region of interest might help to formulate strategies for reducing the infection spreading.

Geographically weighted regression as a generalized Wombling to detect barriers to gene flow.

Science.gov (United States)

Diniz-Filho, José Alexandre Felizola; Soares, Thannya Nascimento; de Campos Telles, Mariana Pires

2016-08-01

Barriers to gene flow play an important role in structuring populations, especially in human-modified landscapes, and several methods have been proposed to detect such barriers. However, most applications of these methods require a relative large number of individuals or populations distributed in space, connected by vertices from Delaunay or Gabriel networks. Here we show, using both simulated and empirical data, a new application of geographically weighted regression (GWR) to detect such barriers, modeling the genetic variation as a "local" linear function of geographic coordinates (latitude and longitude). In the GWR, standard regression statistics, such as R(2) and slopes, are estimated for each sampling unit and thus are mapped. Peaks in these local statistics are then expected close to the barriers if genetic discontinuities exist, capturing a higher rate of population differentiation among neighboring populations. Isolation-by-Distance simulations on a longitudinally warped lattice revealed that higher local slopes from GWR coincide with the barrier detected with Monmonier algorithm. Even with a relatively small effect of the barrier, the power of local GWR in detecting the east-west barriers was higher than 95 %. We also analyzed empirical data of genetic differentiation among tree populations of Dipteryx alata and Eugenia dysenterica Brazilian Cerrado. GWR was applied to the principal coordinate of the pairwise FST matrix based on microsatellite loci. In both simulated and empirical data, the GWR results were consistent with discontinuities detected by Monmonier algorithm, as well as with previous explanations for the spatial patterns of genetic differentiation for the two species. Our analyses reveal how this new application of GWR can viewed as a generalized Wombling in a continuous space and be a useful approach to detect barriers and discontinuities to gene flow.

[The prevalence of dupA (duodenal ulcer-promoting gene) of Helicobacter pylori in children and adolescents--own observation].

Science.gov (United States)

Parzecka, Monika; Szaflarska-Popławska, Anna; Gasiorowska, Joanna; Gorzkiewicz, Marta; Grzybowski, Tomasz

2013-05-01

The strains of Helicobacter pylori are described by many common features which determine their virulence. The genes which are connected with much higher virulence of some strains are vacA, cagA, oipA, dupA. Duodenal Ulcer Promoting Gene--dupA is the new virulence factor coexisting with a duodenum ulcer. There is a rationale that shows a protective character of dupA with reference to a stomach cancer. The dupA gene probably causes increasingly higher releasing of pro-infectious IL-8 via stomach cells and it influences the production of IL-12 and other cytokines. The aim of the study was to determine the frequency of dupA gene's appearance in the Polish children's group and in the Polish teenagers' group infected with H. pylori. The research was also aimed to determine the coexistence of dupA gene and duodenum ulcer disease or erosion infection of duodenum's mucous membrane. The endoscopic examination of the upper part of digestive duct was performed in 119 qualified patients with dyspeptic symptoms and with suspicion of stomach and duodenum's mucous membrane infection. The segments were taken for histopathological identification of H. pylori and for genetic indicating via PCR method. To confirm the presence of H. pylori in the extract the amplification of DNA fragment sized 860 pz was used. The presence of dupA gene was detected by PCR reaction with using the starters which include the fragment of jhp0917-jhp0918 sequence in the plastic H. pylori's genome area. To confirm the infection the urea breathing test was taken. 88 patients confirm the infection of H. pylori. The presence of dupA gene was found in 20 patients--a group A (22.7%), whereas in 68 patients dupA gene was not found--a group B (77.2%). Pathological changes in duodenum was found in 20 patients infected with H. pylori (22.7%), included 4 patients in the group A (20%) and 16 in the group B (23.5%). There was an infection (swelling, redness, congestion) in duodenum was found in the group A in all cases

Development of Ecogenomic Sensors for Remote Detection of Marine Microbes, Their Genes and Gene Products

Science.gov (United States)

Scholin, C.; Preston, C.; Harris, A.; Birch, J.; Marin, R.; Jensen, S.; Roman, B.; Everlove, C.; Makarewicz, A.; Riot, V.; Hadley, D.; Benett, W.; Dzenitis, J.

2008-12-01

An internet search using the phrase "ecogenomic sensor" will return numerous references that speak broadly to the idea of detecting molecular markers indicative of specific organisms, genes or other biomarkers within an environmental context. However, a strict and unified definition of "ecogenomic sensor" is lacking and the phrase may be used for laboratory-based tools and techniques as well as semi or fully autonomous systems that can be deployed outside of laboratory. We are exploring development of an ecogenomic sensor from the perspective of a field-portable device applied towards oceanographic research and water quality monitoring. The device is known as the Environmental Sample Processor, or ESP. The ESP employs wet chemistry molecular analytical techniques to autonomously assess the presence and abundance of specific organisms, their genes and/or metabolites in near real-time. Current detection chemistries rely on low- density DNA probe and protein arrays. This presentation will emphasize results from 2007-8 field trials when the ESP was moored in Monterey Bay, CA, as well as current engineering activities for improving analytical capacity of the instrument. Changes in microbial community structure at the rRNA level were observed remotely in accordance with changing chemical and physical oceanographic conditions. Current developments include incorporation of a reusable solid phase extraction column for purifying nucleic acids and a 4-channel real-time PCR module. Users can configure this system to support a variety of PCR master mixes, primer/probe combinations and control templates. An update on progress towards fielding a PCR- enabled ESP will be given along with an outline of plans for its use in coastal and oligotrophic oceanic regimes.

Detection and phylogenetic analysis of a new adenoviral polymerase gene in reptiles in Korea.

Science.gov (United States)

Bak, Eun-Jung; Jho, Yeonsook; Woo, Gye-Hyeong

2018-06-01

Over a period of 7 years (2004-2011), samples from 34 diseased reptiles provided by local governments, zoos, and pet shops were tested for viral infection. Animals were diagnosed based on clinical signs, including loss of appetite, diarrhea, rhinorrhea, and unexpected sudden death. Most of the exotic animals had gastrointestinal problems, such as mucosal redness and ulcers, while the native animals had no clinical symptoms. Viral sequences were found in seven animals. Retroviral genes were amplified from samples from five Burmese pythons (Python molurus bivittatus), an adenovirus was detected in a panther chameleon (Furcifer pardalis), and an adenovirus and a paramyxovirus were detected in a tropical girdled lizard (Cordylus tropidosternum). Phylogenetic analysis of retroviruses and paramyxoviruses showed the highest sequence identity to both a Python molurus endogenous retrovirus and a Python curtus endogenous retrovirus and to a lizard isolate, respectively. Partial sequencing of an adenoviral DNA polymerase gene from the lizard isolate suggested that the corresponding virus was a novel isolate different from the reference strain (accession no. AY576677.1). The virus was not isolated but was detected, using molecular genetic techniques, in a lizard raised in a pet shop. This animal was also coinfected with a paramyxovirus.

A molecular beacon based on DNA-templated silver nanoclusters for the highly sensitive and selective multiplexed detection of virulence genes.

Science.gov (United States)

Han, Dan; Wei, Chunying

2018-05-01

In this work, we develop a fluorescent molecular beacon based on the DNA-templated silver nanoclusters (DNA-Ag NCs). The skillfully designed molecular beacon can be conveniently used for detection of diverse virulence genes as long as the corresponding recognition sequences are embedded. Importantly, the constructed detection system allows simultaneous detection of multiple nucleic acids, which is attributed to non-overlapping emission spectra of the as-synthesized silver nanoclusters. Based on the target-induced fluorescence enhancement, three infectious disease-related genes HIV, H1N1, and H5N1 are detected, and the corresponding detection limits are 3.53, 0.12 and 3.95nM, respectively. This design allows specific, versatile and simultaneous detection of diverse targets with easy operation and low cost. Copyright © 2017 Elsevier B.V. All rights reserved.

Loop-mediated isothermal amplification: Rapid and sensitive detection of the antibiotic resistance gene ISAba1-blaOXA-51-like in Acinetobacter baumannii.

Science.gov (United States)

Mu, Xiaoqin; Nakano, Ryuichi; Nakano, Akiyo; Ubagai, Tsuneyuki; Kikuchi-Ueda, Takane; Tansho-Nagakawa, Shigeru; Kikuchi, Hirotoshi; Kamoshida, Go; Endo, Shiro; Yano, Hisakazu; Ono, Yasuo

2016-02-01

Carbapenem-resistant Acinetobacter baumannii, which are mainly induced by the production of OXA-type β-lactamases, are among the leading causes of nosocomial infections worldwide. Among the β-lactamase genes, the presence of the OXA-51-like gene carrying the upstream insertion sequence, ISAba1, was found to be one of the most prevalent carbapenem resistance mechanisms utilized by these bacteria. Consequently, it is necessary to develop a rapid detection method for ISAba1-blaOXA-51-like sequence for the timely and appropriate antibiotic treatment of A. baumannii infection. In this study, a loop-mediated isothermal amplification (LAMP) assay was optimized for ISAba1-blaOXA-51-like detection. The LAMP primer set was designed to recognize distinct sequences in the ISAba1-blaOXA-51-like gene and could amplify the gene within 25 min at an isothermal temperature of 60°C. This LAMP assay was able to detect the ISAba1-blaOXA-51-like gene with high specificity; in addition, no cross-reactivity was observed for other types of β-lactamase producers (OXA-23-like, OXA-40-like, OXA-58-like, and IMP-1), as indicated by the absence of false positive or false negative results. The detection limit for this assay was found to be 10(0)CFU per tube which was 100-fold more sensitive than a polymerase chain reaction assay for ISAba1-blaOXA-51-like detection. Furthermore, the LAMP assay provided swift detection of the ISAba1-blaOXA-51-like gene, even directly from clinical specimens. In summary, we have described a new, rapid assay for the detection of the ISAba1-blaOXA-51-like gene from A. baumannii that could be useful in a clinical setting. This method might facilitate epidemiological studies and allow monitoring of the emergence of drug resistant strains. Copyright © 2015 Elsevier B.V. All rights reserved.

Detection and linkage to mobile genetic elements of tetracycline resistance gene tet(M) in Escherichia coli isolates from pigs

DEFF Research Database (Denmark)

Jurado-Rabadan, Sonia; de la Fuente, Ricardo; Ruiz-Santa-Quiteria, Jose A.

2014-01-01

Background: In Escherichia coli the genes involved in the acquisition of tetracycline resistance are mainly tet(A) and tet(B). In addition, tet(M) is the most common tetracycline resistance determinant in enterococci and it is associated with conjugative transposons and plasmids. Although tet......(M) has been identified in E. coli, to our knowledge, there are no previous reports studying the linkage of the tet(M) gene in E. coli to different mobile genetic elements. The aim of this study was to determine the occurrence of tet(A), tet(B), and tet(M) genes in doxycycline-resistant E. coli isolates...... from pigs, as well as the detection of mobile genetic elements linked to tet(M) in E. coli and its possible transfer from enterococci. Results: tet(A) was the most frequently detected gene (87.9%) in doxycycline-resistant isolates. tet(M) was found in 13.1% E. coli isolates. The tet(M) gene...

A combination test for detection of gene-environment interaction in cohort studies.

Science.gov (United States)

Coombes, Brandon; Basu, Saonli; McGue, Matt

2017-07-01

Identifying gene-environment (G-E) interactions can contribute to a better understanding of disease etiology, which may help researchers develop disease prevention strategies and interventions. One big criticism of studying G-E interaction is the lack of power due to sample size. Studies often restrict the interaction search to the top few hundred hits from a genome-wide association study or focus on potential candidate genes. In this paper, we test interactions between a candidate gene and an environmental factor to improve power by analyzing multiple variants within a gene. We extend recently developed score statistic based genetic association testing approaches to the G-E interaction testing problem. We also propose tests for interaction using gene-based summary measures that pool variants together. Although it has recently been shown that these summary measures can be biased and may lead to inflated type I error, we show that under several realistic scenarios, we can still provide valid tests of interaction. These tests use significantly less degrees of freedom and thus can have much higher power to detect interaction. Additionally, we demonstrate that the iSeq-aSum-min test, which combines a gene-based summary measure test, iSeq-aSum-G, and an interaction-based summary measure test, iSeq-aSum-I, provides a powerful alternative to test G-E interaction. We demonstrate the performance of these approaches using simulation studies and illustrate their performance to study interaction between the SNPs in several candidate genes and family climate environment on alcohol consumption using the Minnesota Center for Twin and Family Research dataset. © 2017 WILEY PERIODICALS, INC.

The combination of heteroduplex analysis and protein truncation test for exact detection of the APC gene mutations

International Nuclear Information System (INIS)

Tomka, M.; Kirchhoff, T.; Stefurkova, V.; Zajac, V.; Kulcsar, L.

1998-01-01

Familial adenomatous polyposis (FAP) is usually associated with mutation in the adenomatous polyposis coli (APC) gene. To examine the occurrence of these mutations in the number of FAP suspected families from the whole Slovakia effectively, we have applied heteroduplex analysis (HDA) and protein truncation test (PTT) for the analyses of 2-5 base pair deletions and point mutations of the APC gene. In the analyzed exon 15 of the APC gene determined by the primers 15Efor-15Grev for HDA and 15ET7-15J3 for PTT more than 70% of mutations should be deletions [3, 12], which are detectable by HDA. In our collection of 5 FAP families mutations in the APC gene were found in families 10, 27 and 41 using HDA. By PTT test the formation of truncated APC protein in FAP families 2, 10, 16 and 27 were revealed. The necessity of combination of at least HDA and PTT techniques for exact detection of APC mutations in analyzed APC region is discussed. (authors)

Evaluation of molecular detection of extrapulmonary tuberculosis and resistance to rifampicin with GeneXpert® MTB/RIF.

Science.gov (United States)

Marouane, C; Smaoui, S; Kammoun, S; Slim, L; Messadi-Akrout, F

2016-02-01

We aimed to evaluate the GeneXpert® MTB/RIF test for the diagnosis of extrapulmonary tuberculosis. The test simultaneously detects Mycobacterium tuberculosis complex and resistance to rifampicin. We analyzed 153 clinical samples collected in a tertiary hospital in Sfax, Tunisia, between 2013 and 2014. We performed the GeneXpert® test, a Ziehl-Neelsen and auramine-rhodamine staining, conventional culture on MGIT 960 and LJ media, and we tested the resistance to anti-tuberculosis drugs on MGIT 960 and LJ media for each sample. Diagnosis was based on clinical, radiological, microbiological, pathological, and therapeutic data. We considered that 59 patients out of 153 presented with tuberculosis. PCR was positive in 50 samples and all of these samples were susceptible to rifampicin. Sensitivity, specificity, positive predictive value, and negative predictive value of the GeneXpert® test were 84.7%, 96.8%, 94.3%, and 91%, respectively, compared with diagnosis. We observed a statistically significant difference between the direct test and the GeneXpert® test, and between culture and the GeneXpert® test. No statistically significant difference was observed between pathological results and the GeneXpert® test. Sensitivity of the GeneXpert® test was 87.5% in biopsies, 80% in pus and abscesses, and 66.7% in biological fluids. All strains were susceptible to rifampicin with culture and GeneXpert® test. The GeneXpert® test helped detect a higher proportion of M. tuberculosis complex. It does not replace conventional diagnostic methods but it is a useful addition to achieve better sensitivity and obtain rapid results. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Metabolic primers for detection of (Per)chlorate-reducing bacteria in the environment and phylogenetic analysis of cld gene sequences.

Science.gov (United States)

Bender, Kelly S; Rice, Melissa R; Fugate, William H; Coates, John D; Achenbach, Laurie A

2004-09-01

Natural attenuation of the environmental contaminant perchlorate is a cost-effective alternative to current removal methods. The success of natural perchlorate remediation is dependent on the presence and activity of dissimilatory (per)chlorate-reducing bacteria (DPRB) within a target site. To detect DPRB in the environment, two degenerate primer sets targeting the chlorite dismutase (cld) gene were developed and optimized. A nested PCR approach was used in conjunction with these primer sets to increase the sensitivity of the molecular detection method. Screening of environmental samples indicated that all products amplified by this method were cld gene sequences. These sequences were obtained from pristine sites as well as contaminated sites from which DPRB were isolated. More than one cld phylotype was also identified from some samples, indicating the presence of more than one DPRB strain at those sites. The use of these primer sets represents a direct and sensitive molecular method for the qualitative detection of (per)chlorate-reducing bacteria in the environment, thus offering another tool for monitoring natural attenuation. Sequences of cld genes isolated in the course of this project were also generated from various DPRB and provided the first opportunity for a phylogenetic treatment of this metabolic gene. Comparisons of the cld and 16S ribosomal DNA (rDNA) gene trees indicated that the cld gene does not track 16S rDNA phylogeny, further implicating the possible role of horizontal transfer in the evolution of (per)chlorate respiration.

Heat-transfer-based detection of SNPs in the PAH gene of PKU patients

Directory of Open Access Journals (Sweden)

Vanden Bon N

2014-03-01

Full Text Available Natalie Vanden Bon,1 Bart van Grinsven,2 Mohammed Sharif Murib,2 Weng Siang Yeap,2 Ken Haenen,2,3 Ward De Ceuninck,2,3 Patrick Wagner,2,3 Marcel Ameloot,1 Veronique Vermeeren,1 Luc Michiels11Biomedical Research Institute, Hasselt University, Diepenbeek, Belgium; 2Institute for Materials Research, Hasselt University, Diepenbeek, Belgium; 3IMOMEC, Diepenbeek, BelgiumAbstract: Conventional neonatal diagnosis of phenylketonuria is based on the presence of abnormal levels of phenylalanine in the blood. However, for carrier detection and prenatal diagnosis, direct detection of disease-correlated mutations is needed. To speed up and simplify mutation screening in genes, new technologies are developed. In this study, a heat-transfer method is evaluated as a mutation-detection technology in entire exons of the phenylalanine hydroxylase (PAH gene. This method is based on the change in heat-transfer resistance (Rth upon thermal denaturation of dsDNA (double-stranded DNA on nanocrystalline diamond. First, ssDNA (single-stranded DNA fragments that span the size range of the PAH exons were successfully immobilized on nanocrystalline diamond. Next, it was studied whether an Rth change could be observed during the thermal denaturation of these DNA fragments after hybridization to their complementary counterpart. A clear Rth shift during the denaturation of exon 5, exon 9, and exon 12 dsDNA was observed, corresponding to lengths of up to 123 bp. Finally, Rth was shown to detect prevalent single-nucleotide polymorphisms, c.473G>A (R158Q, c.932T>C (p.L311P, and c.1222C>T (R408W, correlated with phenylketonuria, displaying an effect related to the different melting temperatures of homoduplexes and heteroduplexes.Keywords: mutation detection, heat-transfer resistance, melting temperature, nanocrystalline diamond, persistence length

The detection and differentiation of methicillin-resistant and methicillin-susceptible Staphylococcus aureus endocarditis by using the BD GeneOhm StaphSR Assay.

Science.gov (United States)

Frey, Amy B; Wilson, Deborah A; LaSalvia, Margaret M; Tan, Carmela D; Rodriguez, E Rene; Shrestha, Nabin K; Hall, Gerri S; Procop, Gary W

2011-11-01

We use the BD GeneOhm StaphSR Assay (BD Diagnostics, Oakville, Canada) to screen for Staphylococcus aureus nasal colonization and sought to evaluate this assay for the assessment of valve specimens from patients with endocarditis. We examined 23 paired fresh and formalin-fixed, paraffin-embedded cardiac valve tissue samples, 12 of which had S aureus endocarditis, using the BD GeneOhm StaphSR Assay for the detection and differentiation of methicillin-susceptible and methicillin-resistant S aureus. This assay appropriately characterized all specimens with respect to the presence or absence of S aureus. There was an 87.5% correlation between the presence or absence of the mecA gene and the oxacillin susceptibility results for the S aureus isolates studied. The GeneOhm StaphSR assay accurately detected S aureus in cardiac valve tissue samples. Rare discordances were observed between oxacillin susceptibility status and mecA gene detection by this assay.

Cry-Bt identifier: a biological database for PCR detection of Cry genes present in transgenic plants.

Science.gov (United States)

Singh, Vinay Kumar; Ambwani, Sonu; Marla, Soma; Kumar, Anil

2009-10-23

We describe the development of a user friendly tool that would assist in the retrieval of information relating to Cry genes in transgenic crops. The tool also helps in detection of transformed Cry genes from Bacillus thuringiensis present in transgenic plants by providing suitable designed primers for PCR identification of these genes. The tool designed based on relational database model enables easy retrieval of information from the database with simple user queries. The tool also enables users to access related information about Cry genes present in various databases by interacting with different sources (nucleotide sequences, protein sequence, sequence comparison tools, published literature, conserved domains, evolutionary and structural data). http://insilicogenomics.in/Cry-btIdentifier/welcome.html.

Direct detection of hemophilia B F9 gene mutation using multiplex PCR and conformation sensitive gel electrophoresis

Directory of Open Access Journals (Sweden)

Ki Young Yoo

2010-03-01

Full Text Available Purpose : The F9 gene is known to be the causative gene for hemophilia B, but unfortunately the detection rate for restriction fragment length polymorphism-based linkage analysis is only 55.6%. Direct DNA sequencing can detect 98% of mutations, but this alternative procedure is very costly. Here, we conducted multiplex polymerase chain reactions (PCRs and conformation sensitive gel electrophoresis (CSGE to perform a screened DNA sequencing for the F9 gene, and we compared the results with direct sequencing in terms of accuracy, cost, simplicity, and time consumption. Methods : A total of 27 unrelated hemophilia B patients were enrolled. Direct DNA sequencing was performed for 27 patients by a separate institute, and multiplex PCR-CSGE screened sequencing was done in our laboratory. Results of the direct DNA sequencing were used as a reference, to which the results of the multiplex PCR-CSGE screened sequencing were compared. For the patients whose mutation was not detected by the 2 methods, multiplex ligation-dependent probe amplification (MLPA was conducted. Results : With direct sequencing, the mutations could be identified from 26 patients (96.3%, whereas for multiplex PCR- CSGE screened sequencing, the mutations could be detected in 23 (85.2%. One patient’s mutation was identified by MLPA. A total of 21 different mutations were found among the 27 patients. Conclusion : Multiplex PCR-CSGE screened DNA sequencing detected 88.9% of mutations and reduced costs by 55.7% compared with direct DNA sequencing. However, it was more labor-intensive and time-consuming.

Detection of stx1 and stx2 Genes in Pennsylvanian White-Tailed Deer

Directory of Open Access Journals (Sweden)

Steven A. Mauro

2011-06-01

Full Text Available Shiga toxin-producing E. coli carrying the stx1 and/or stx2 genes can cause multi-symptomatic illness in humans. A variety of terrestrial and aquatic environmental reservoirs of stx have been described. Culture based detection of microbes in deer species have found a low percentage of samples that have tested positive for Stx-producing microbes, suggesting that while deer may contain these microbes, their overall abundance in deer is low. In this study, quantitative PCR (qPCR was utilized to test for the presence of stx genes in white-tailed deer fecal matter in western Pennsylvania. In this culture independent screening, nearly half of the samples tested positive for the stx2 gene, with a bias towards samples that were concentrated with stx2. This study, while limited in scope, suggests that deer may be a greater reservoir for stx than was previously thought.

Normal uniform mixture differential gene expression detection for cDNA microarrays

Directory of Open Access Journals (Sweden)

Raftery Adrian E

2005-07-01

Full Text Available Abstract Background One of the primary tasks in analysing gene expression data is finding genes that are differentially expressed in different samples. Multiple testing issues due to the thousands of tests run make some of the more popular methods for doing this problematic. Results We propose a simple method, Normal Uniform Differential Gene Expression (NUDGE detection for finding differentially expressed genes in cDNA microarrays. The method uses a simple univariate normal-uniform mixture model, in combination with new normalization methods for spread as well as mean that extend the lowess normalization of Dudoit, Yang, Callow and Speed (2002 1. It takes account of multiple testing, and gives probabilities of differential expression as part of its output. It can be applied to either single-slide or replicated experiments, and it is very fast. Three datasets are analyzed using NUDGE, and the results are compared to those given by other popular methods: unadjusted and Bonferroni-adjusted t tests, Significance Analysis of Microarrays (SAM, and Empirical Bayes for microarrays (EBarrays with both Gamma-Gamma and Lognormal-Normal models. Conclusion The method gives a high probability of differential expression to genes known/suspected a priori to be differentially expressed and a low probability to the others. In terms of known false positives and false negatives, the method outperforms all multiple-replicate methods except for the Gamma-Gamma EBarrays method to which it offers comparable results with the added advantages of greater simplicity, speed, fewer assumptions and applicability to the single replicate case. An R package called nudge to implement the methods in this paper will be made available soon at http://www.bioconductor.org.

Shrinkage covariance matrix approach based on robust trimmed mean in gene sets detection

Science.gov (United States)

Karjanto, Suryaefiza; Ramli, Norazan Mohamed; Ghani, Nor Azura Md; Aripin, Rasimah; Yusop, Noorezatty Mohd

2015-02-01

Microarray involves of placing an orderly arrangement of thousands of gene sequences in a grid on a suitable surface. The technology has made a novelty discovery since its development and obtained an increasing attention among researchers. The widespread of microarray technology is largely due to its ability to perform simultaneous analysis of thousands of genes in a massively parallel manner in one experiment. Hence, it provides valuable knowledge on gene interaction and function. The microarray data set typically consists of tens of thousands of genes (variables) from just dozens of samples due to various constraints. Therefore, the sample covariance matrix in Hotelling's T2 statistic is not positive definite and become singular, thus it cannot be inverted. In this research, the Hotelling's T2 statistic is combined with a shrinkage approach as an alternative estimation to estimate the covariance matrix to detect significant gene sets. The use of shrinkage covariance matrix overcomes the singularity problem by converting an unbiased to an improved biased estimator of covariance matrix. Robust trimmed mean is integrated into the shrinkage matrix to reduce the influence of outliers and consequently increases its efficiency. The performance of the proposed method is measured using several simulation designs. The results are expected to outperform existing techniques in many tested conditions.

Rapid detection of most frequent Slovenian germ-line mutations in BRCA1 gene using real-time PCR and melting curve analysis

International Nuclear Information System (INIS)

Novakovic, S.; Stegel, V.

2005-01-01

Background. Detection of inherited mutations in cancer susceptibility genes is of great importance in some types of cancers including the colorectal cancer (mutations of APC gene in familial adenomatous polyposis - FAP, mutations in mismatch repair genes in hereditary nonpolyposis colorectal cancer - HNPCC), malignant melanoma (mutations in CDKN2A and CDK4 genes) and breast cancer (mutations in BRCA1 and BRCA2 genes). Methods. This article presents the technical data for the detection of five mutations in BRCA1 gene in breast cancer patients and their relatives. The mutations - 1806C>T, 300T>G, 300T>A, 310G>A, 5382insC - were determined by the real-time PCR and the melting curve analysis. Results and conclusion. In comparison to direct sequencing, this method proved to be sensitive and rapid enough for the routine daily determination of mutations in DNA isolated from the peripheral blood. (author)

FUNDAMENTAL STUDY OF DETECTION OF MUSCLE HYPERTROPHY-ORIENTED GENE DOPING BY MYOSTATIN KNOCK DOWN USING RNA INTERFERENCE

Directory of Open Access Journals (Sweden)

Tohru Takemasa

2012-06-01

Full Text Available To investigate the feasibility of developing a method for detection of gene doping in power-athletes, we devised an experimental model system. Myostatin is a potent negative regulator of skeletal muscle development and growth, and myostatin-knockout mice exhibit a double-muscle phenotype. To achieve knockdown, we constructed plasmids expressing short hairpin interfering RNAs (shRNAs against myostatin. These shRNAs were transfected into C2C12 cultured cells or injected into the tibialis anterior (TA muscle of adult mice. By performing in vitro and in vivo experiments, we found that some shRNAs effectively reduced the expression of myostatin, and that the TA muscle showed hypertrophy of up to 27.9%. Then, using real-time PCR, we tried to detect the shRNA plasmid in the serum or muscles of mice into which it had been injected. Although we were unable to detect the plasmid in serum samples, it was detectable in the treated muscle at least four weeks after induction. We were also able to detect the plasmid in muscle in the vicinity of the TA. This gene doping model system will be useful for further studies aimed at doping control

Gene doping: gene delivery for olympic victory.

Science.gov (United States)

Gould, David

2013-08-01

With one recently recommended gene therapy in Europe and a number of other gene therapy treatments now proving effective in clinical trials it is feasible that the same technologies will soon be adopted in the world of sport by unscrupulous athletes and their trainers in so called 'gene doping'. In this article an overview of the successful gene therapy clinical trials is provided and the potential targets for gene doping are highlighted. Depending on whether a doping gene product is secreted from the engineered cells or is retained locally to, or inside engineered cells will, to some extent, determine the likelihood of detection. It is clear that effective gene delivery technologies now exist and it is important that detection and prevention plans are in place. © 2012 The Author. British Journal of Clinical Pharmacology © 2012 The British Pharmacological Society.

Detection of the enzymatically-active polyhydroxyalkanoate synthase subunit gene, phaC, in cyanobacteria via colony PCR.

Science.gov (United States)

Lane, Courtney E; Benton, Michael G

2015-12-01

A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously. Copyright © 2015 Elsevier Ltd. All rights reserved.

Establishment of a universal and rational gene detection strategy through three-way junction-based remote transduction.

Science.gov (United States)

Tang, Yidan; Lu, Baiyang; Zhu, Zhentong; Li, Bingling

2018-01-21

The polymerase chain reaction and many isothermal amplifications are able to achieve super gene amplification. Unfortunately, most commonly-used transduction methods, such as dye staining and Taqman-like probing, still suffer from shortcomings including false signals or difficult probe design, or are incompatible with multi-analysis. Here a universal and rational gene detection strategy has been established by translating isothermal amplicons to enzyme-free strand displacement circuits via three-way junction-based remote transduction. An assistant transduction probe was imported to form a partial hybrid with the target single-stranded nucleic acid. After systematic optimization the hybrid could serve as an associative trigger to activate a downstream circuit detector via a strand displacement reaction across the three-way junction. By doing so, the detection selectivity can be double-guaranteed through both amplicon-transducer recognition and the amplicon-circuit reaction. A well-optimized circuit can be immediately applied to a new target detection through simply displacing only 10-12 nt on only one component, according to the target. More importantly, this property for the first time enables multi-analysis and logic-analysis in a single reaction, sharing a single fluorescence reporter. In an applicable model, trace amounts of Cronobacter and Enterobacteria genes have been clearly distinguished from samples with no bacteria or one bacterium, with ultra-high sensitivity and selectivity.

Molecular detection of β-lactamase and integron genes in clinical strains of Klebsiella pneumoniae by multiplex polymerase chain reaction

Directory of Open Access Journals (Sweden)

Mansour Sedighi

Full Text Available Abstract INTRODUCTION: Infections caused by β-lactamase-producing gram-negative bacteria, such as Klebsiella pneumoniae, are increasing globally with high morbidity and mortality. The aim of the current study was to determine antimicrobial susceptibility patterns and the prevalence of antibiotic resistance genes (β-lactamase and integron genes using multiplex PCR. METHODS One-hundred K. pneumoniae isolates were collected from different clinical samples. Antibiotic susceptibility testing was performed with thirteen different antibiotics. Multiplex-PCR was used to detect β-lactamase (bla TEM, bla CTX-M, bla SHV , bla VEB, bla PER, bla GES, bla VIM, bla IMP, bla OXA, and bla KPC and integron genes (int I, int II, and int III. RESULTS: The highest and lowest rate of resistance was exhibited against amikacin (93% and imipenem (8%, respectively. The frequency of β-lactamase-positive K. pneumoniae was 37%, and the prevalence of the bla TEM, bla CTX-M, bla SHV , bla VEB, bla PER, bla GES, bla VIM, bla IMP, bla OXA, and bla KPC genes was 38%, 24%, 19%, 12%, 6%, 11%, 33%, 0%, 28%, and 23%, respectively. Of the 100 isolates, eight (8% were positive for class I integrons; however, class II and III integrons were not detected in any of the strains. CONCLUSIONS: These results indicate co-carriage of a number of β-lactamase genes and antibiotic resistance integrons on the same plasmids harboring multi-drug resistance genes. It seems that these properties help to decrease treatment complications due to resistant bacterial infections by rapid detection, infection-control programs and prevention of transmission of drug resistance.

Wheat-specific gene, ribosomal protein l21, used as the endogenous reference gene for qualitative and real-time quantitative polymerase chain reaction detection of transgenes.

Science.gov (United States)

Liu, Yi-Ke; Li, He-Ping; Huang, Tao; Cheng, Wei; Gao, Chun-Sheng; Zuo, Dong-Yun; Zhao, Zheng-Xi; Liao, Yu-Cai

2014-10-29

Wheat-specific ribosomal protein L21 (RPL21) is an endogenous reference gene suitable for genetically modified (GM) wheat identification. This taxon-specific RPL21 sequence displayed high homogeneity in different wheat varieties. Southern blots revealed 1 or 3 copies, and sequence analyses showed one amplicon in common wheat. Combined analyses with sequences from common wheat (AABBDD) and three diploid ancestral species, Triticum urartu (AA), Aegilops speltoides (BB), and Aegilops tauschii (DD), demonstrated the presence of this amplicon in the AA genome. Using conventional qualitative polymerase chain reaction (PCR), the limit of detection was 2 copies of wheat haploid genome per reaction. In the quantitative real-time PCR assay, limits of detection and quantification were about 2 and 8 haploid genome copies, respectively, the latter of which is 2.5-4-fold lower than other reported wheat endogenous reference genes. Construct-specific PCR assays were developed using RPL21 as an endogenous reference gene, and as little as 0.5% of GM wheat contents containing Arabidopsis NPR1 were properly quantified.

Coupled Transcriptome and Proteome Analysis of Human Lymphotropic Tumor Viruses: Insights on the Detection and Discovery of Viral Genes

Energy Technology Data Exchange (ETDEWEB)

Dresang, Lindsay R.; Teuton, Jeremy R.; Feng, Huichen; Jacobs, Jon M.; Camp, David G.; Purvine, Samuel O.; Gritsenko, Marina A.; Li, Zhihua; Smith, Richard D.; Sugden, Bill; Moore, Patrick S.; Chang, Yuan

2011-12-20

Kaposi's sarcoma-associated herpesvirus (KSHV) and Epstein-Barr virus (EBV) are related human tumor viruses that cause primary effusion lymphomas (PEL) and Burkitt's lymphomas (BL), respectively. Viral genes expressed in naturally-infected cancer cells contribute to disease pathogenesis; knowing which viral genes are expressed is critical in understanding how these viruses cause cancer. To evaluate the expression of viral genes, we used high-resolution separation and mass spectrometry coupled with custom tiling arrays to align the viral proteomes and transcriptomes of three PEL and two BL cell lines under latent and lytic culture conditions. Results The majority of viral genes were efficiently detected at the transcript and/or protein level on manipulating the viral life cycle. Overall the correlation of expressed viral proteins and transcripts was highly complementary in both validating and providing orthogonal data with latent/lytic viral gene expression. Our approach also identified novel viral genes in both KSHV and EBV, and extends viral genome annotation. Several previously uncharacterized genes were validated at both transcript and protein levels. Conclusions This systems biology approach coupling proteome and transcriptome measurements provides a comprehensive view of viral gene expression that could not have been attained using each methodology independently. Detection of viral proteins in combination with viral transcripts is a potentially powerful method for establishing virus-disease relationships.

Detection of retinoblastoma gene deletions in spontaneous and radiation-induced mouse lung adenocarcinomas by polymerase chain reaction

International Nuclear Information System (INIS)

Churchill, M.E.; Gemmell, M.A.; Woloschak, G.E.

1994-01-01

A polymerase chain reaction (PCR) technique has been developed to detect deletions in the mouse retinoblastoma gene using histological sections from radiation-induced and spontaneous tumors as the DNA source. Six mouse Rb gene exon fragments were amplified in a 40-cycle, 3-temperature PCR protocol. The absence of any of these fragments relative to control PCR products on a Southern blot indicated a deletion of that portion of the mouse Rb gene. Tumors chosen for analysis were lung adenocarcinomas that were judged to be the cause of death. Spontaneous tumors as well as those from irradiated mice (5.69 Gy 60 Co γ rays or 0.6 Gy JANUS neutrons, which have been found to have approximately equal radiobiological effectiveness) were analyzed for mouse Rb deletions. Tumors in 6 neutron-irradiated mice had no mouse Rb deletions. However, 1 of 6 tumors from γ-irradiated mice (17%) and 6 of 18 spontaneous tumors from unirradiated mice (33%) showed a deletion in one or both mouse Rb alleles. All deletions detected were in the 5' region of the mouse Rb gene. 36 refs., 2 figs., 2 tabs

Gene-wide analysis detects two new susceptibility genes for Alzheimer's Disease

OpenAIRE

Escott-Price, Valentina; Bellenguez, Céline; Wang, Li-San; Choi, Seung-Hoan; Harold, Denise; Jones, Lesley; Holmans, Peter Alan; Gerrish, Amy; Vedernikov, Alexey; Richards, Alexander; DeStefano, Anita L.; Lambert, Jean-Charles; Ibrahim-Verbaas, Carla A.; Naj, Adam C.; Sims, Rebecca

2014-01-01

PUBLISHED BACKGROUND: Alzheimer's disease is a common debilitating dementia with known heritability, for which 20 late onset susceptibility loci have been identified, but more remain to be discovered. This study sought to identify new susceptibility genes, using an alternative gene-wide analytical approach which tests for patterns of association within genes, in the powerful genome-wide association dataset of the International Genomics of Alzheimer's Project Consortium, comprising over...

Gastric epithelial expression of IL-12 cytokine family in Helicobacter pylori infection in human: is it head or tail of the coin?

Directory of Open Access Journals (Sweden)

Fadi Al-Sammak

Full Text Available Recently, there has been a growing interest in an expanding group of cytokines known as "IL-12 family". The so far gained knowledge about these cytokines, as crucial playmakers in mucosal immunity, has not yet been sufficiently investigated in the context of Helicobacter pylori infection. All genes encoding the monomeric components of these cytokines and their corresponding receptors were examined in gastric epithelial cell lines (AGS and MKN-28 after being infected with 4 H. pylori strains: BCM-300, P1 wild-type, and P1-derived isogenic mutants lacking cytotoxin-associated gene A (cagA or virulence gene virB7 (multiplicity of infection=50. Both infected and uninfected samples were analyzed after 24h and 48h using real-time quantitative polymerase chain reaction (RT-qPCR. Gene expression analysis demonstrated a strong upregulation of IL23A (encodes p19 by infection, whereas IL23R, Epstein-Barr virus-induced gene 3 (EBI3, IL6ST, IL12A, and IL27RA were found to be expressed, but not regulated, or to a lesser extent. Transcripts of IL12RB2, IL12B, IL12RB1, and IL27A were not detected. Interestingly, P1 resulted in stronger alterations of expression than CagA mutant and BCM-300, particularly for IL23A (59.7-fold versus 32.4- and 6.7-fold, respectively in AGS after 48h, P<.05, whereas no changes were seen with VirB7 mutant. In a proof-of-principle experiment, we demonstrated epithelial-derived expression of IL-12, p19, and Ebi3 in gastric mucosa of gastritis patients using immunohistochemistry (IHC. Unlike IL-12 and Ebi3, increased immunostaining of p19 was observed in H. pylori gastritis. Herein, we highlight the potential role of gastric epithelial cells in mucosal immunity, not only because they are predominant cell type in mucosa and initial site of host-bacterial interaction, but also as a major contributor to molecules that are thought to be primarily expressed by immune cells so far. Of these molecules, p19 was the most relevant one to H

Non-invasive detection of urothelial cancer through the analysis of driver gene mutations and aneuploidy

Science.gov (United States)

Li, Lu; Douville, Christopher; Wang, Yuxuan; Cohen, Joshua David; Taheri, Diana; Silliman, Natalie; Schaefer, Joy; Ptak, Janine; Dobbyn, Lisa; Papoli, Maria; Kinde, Isaac; Afsari, Bahman; Tregnago, Aline C; Bezerra, Stephania M; VandenBussche, Christopher; Fujita, Kazutoshi; Ertoy, Dilek; Cunha, Isabela W; Yu, Lijia; Bivalacqua, Trinity J; Grollman, Arthur P; Diaz, Luis A; Karchin, Rachel; Danilova, Ludmila; Huang, Chao-Yuan; Shun, Chia-Tung; Turesky, Robert J; Yun, Byeong Hwa; Rosenquist, Thomas A; Pu, Yeong-Shiau; Hruban, Ralph H; Tomasetti, Cristian; Papadopoulos, Nickolas; Kinzler, Ken W

2018-01-01

Current non-invasive approaches for detection of urothelial cancers are suboptimal. We developed a test to detect urothelial neoplasms using DNA recovered from cells shed into urine. UroSEEK incorporates massive parallel sequencing assays for mutations in 11 genes and copy number changes on 39 chromosome arms. In 570 patients at risk for bladder cancer (BC), UroSEEK was positive in 83% of those who developed BC. Combined with cytology, UroSEEK detected 95% of patients who developed BC. Of 56 patients with upper tract urothelial cancer, 75% tested positive by UroSEEK, including 79% of those with non-invasive tumors. UroSEEK detected genetic abnormalities in 68% of urines obtained from BC patients under surveillance who demonstrated clinical evidence of recurrence. The advantages of UroSEEK over cytology were evident in low-grade BCs; UroSEEK detected 67% of cases whereas cytology detected none. These results establish the foundation for a new non-invasive approach for detection of urothelial cancer. PMID:29557778

Group spike-and-slab lasso generalized linear models for disease prediction and associated genes detection by incorporating pathway information.

Science.gov (United States)

Tang, Zaixiang; Shen, Yueping; Li, Yan; Zhang, Xinyan; Wen, Jia; Qian, Chen'ao; Zhuang, Wenzhuo; Shi, Xinghua; Yi, Nengjun

2018-03-15

Large-scale molecular data have been increasingly used as an important resource for prognostic prediction of diseases and detection of associated genes. However, standard approaches for omics data analysis ignore the group structure among genes encoded in functional relationships or pathway information. We propose new Bayesian hierarchical generalized linear models, called group spike-and-slab lasso GLMs, for predicting disease outcomes and detecting associated genes by incorporating large-scale molecular data and group structures. The proposed model employs a mixture double-exponential prior for coefficients that induces self-adaptive shrinkage amount on different coefficients. The group information is incorporated into the model by setting group-specific parameters. We have developed a fast and stable deterministic algorithm to fit the proposed hierarchal GLMs, which can perform variable selection within groups. We assess the performance of the proposed method on several simulated scenarios, by varying the overlap among groups, group size, number of non-null groups, and the correlation within group. Compared with existing methods, the proposed method provides not only more accurate estimates of the parameters but also better prediction. We further demonstrate the application of the proposed procedure on three cancer datasets by utilizing pathway structures of genes. Our results show that the proposed method generates powerful models for predicting disease outcomes and detecting associated genes. The methods have been implemented in a freely available R package BhGLM (http://www.ssg.uab.edu/bhglm/). nyi@uab.edu. Supplementary data are available at Bioinformatics online.

Selection of appropriate reference genes for the detection of rhythmic gene expression via quantitative real-time PCR in Tibetan hulless barley.

Directory of Open Access Journals (Sweden)

Jing Cai

Full Text Available Hulless barley (Hordeum vulgare L. var. nudum. hook. f. has been cultivated as a major crop in the Qinghai-Tibet plateau of China for thousands of years. Compared to other cereal crops, the Tibetan hulless barley has developed stronger endogenous resistances to survive in the severe environment of its habitat. To understand the unique resistant mechanisms of this plant, detailed genetic studies need to be performed. The quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR is the most commonly used method in detecting gene expression. However, the selection of stable reference genes under limited experimental conditions was considered to be an essential step for obtaining accurate results in qRT-PCR. In this study, 10 candidate reference genes-ACT (Actin, E2 (Ubiquitin conjugating enzyme 2, TUBα (Alpha-tubulin, TUBβ6 (Beta-tubulin 6, GAPDH (Glyceraldehyde 3-phosphate dehydrogenase, EF-1α (Elongation factor 1-alpha, SAMDC (S-adenosylmethionine decarboxylase, PKABA1 (Gene for protein kinase HvPKABA1, PGK (Phosphoglycerate kinase, and HSP90 (Heat shock protein 90-were selected from the NCBI gene database of barley. Following qRT-PCR amplifications of all candidate reference genes in Tibetan hulless barley seedlings under various stressed conditions, the stabilities of these candidates were analyzed by three individual software packages including geNorm, NormFinder, and BestKeeper. The results demonstrated that TUBβ6, E2, TUBα, and HSP90 were generally the most suitable sets under all tested conditions; similarly, TUBα and HSP90 showed peak stability under salt stress, TUBα and EF-1α were the most suitable reference genes under cold stress, and ACT and E2 were the most stable under drought stress. Finally, a known circadian gene CCA1 was used to verify the service ability of chosen reference genes. The results confirmed that all recommended reference genes by the three software were suitable for gene expression

Selection of appropriate reference genes for the detection of rhythmic gene expression via quantitative real-time PCR in Tibetan hulless barley.

Science.gov (United States)

Cai, Jing; Li, Pengfei; Luo, Xiao; Chang, Tianliang; Li, Jiaxing; Zhao, Yuwei; Xu, Yao

2018-01-01

Hulless barley (Hordeum vulgare L. var. nudum. hook. f.) has been cultivated as a major crop in the Qinghai-Tibet plateau of China for thousands of years. Compared to other cereal crops, the Tibetan hulless barley has developed stronger endogenous resistances to survive in the severe environment of its habitat. To understand the unique resistant mechanisms of this plant, detailed genetic studies need to be performed. The quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) is the most commonly used method in detecting gene expression. However, the selection of stable reference genes under limited experimental conditions was considered to be an essential step for obtaining accurate results in qRT-PCR. In this study, 10 candidate reference genes-ACT (Actin), E2 (Ubiquitin conjugating enzyme 2), TUBα (Alpha-tubulin), TUBβ6 (Beta-tubulin 6), GAPDH (Glyceraldehyde 3-phosphate dehydrogenase), EF-1α (Elongation factor 1-alpha), SAMDC (S-adenosylmethionine decarboxylase), PKABA1 (Gene for protein kinase HvPKABA1), PGK (Phosphoglycerate kinase), and HSP90 (Heat shock protein 90)-were selected from the NCBI gene database of barley. Following qRT-PCR amplifications of all candidate reference genes in Tibetan hulless barley seedlings under various stressed conditions, the stabilities of these candidates were analyzed by three individual software packages including geNorm, NormFinder, and BestKeeper. The results demonstrated that TUBβ6, E2, TUBα, and HSP90 were generally the most suitable sets under all tested conditions; similarly, TUBα and HSP90 showed peak stability under salt stress, TUBα and EF-1α were the most suitable reference genes under cold stress, and ACT and E2 were the most stable under drought stress. Finally, a known circadian gene CCA1 was used to verify the service ability of chosen reference genes. The results confirmed that all recommended reference genes by the three software were suitable for gene expression analysis

Detection of virulence-associated genes in pathogenic and commensal avian Escherichia coli isolates.

Science.gov (United States)

Paixão, A C; Ferreira, A C; Fontes, M; Themudo, P; Albuquerque, T; Soares, M C; Fevereiro, M; Martins, L; Corrêa de Sá, M I

2016-07-01

Poultry colibacillosis due to Avian Pathogenic Escherichia coli (APEC) is responsible for several extra-intestinal pathological conditions, leading to serious economic damage in poultry production. The most commonly associated pathologies are airsacculitis, colisepticemia, and cellulitis in broiler chickens, and salpingitis and peritonitis in broiler breeders. In this work a total of 66 strains isolated from dead broiler breeders affected with colibacillosis and 61 strains from healthy broilers were studied. Strains from broiler breeders were typified with serogroups O2, O18, and O78, which are mainly associated with disease. The serogroup O78 was the most prevalent (58%). All the strains were checked for the presence of 11 virulence genes: 1) arginine succinyltransferase A (astA); ii) E.coli hemeutilization protein A (chuA); iii) colicin V A/B (cvaA/B); iv) fimbriae mannose-binding type 1 (fimC); v) ferric yersiniabactin uptake A (fyuA); vi) iron-repressible high-molecular-weight proteins 2 (irp2); vii) increased serum survival (iss); viii) iron-uptake systems of E.coli D (iucD); ix) pielonefritis associated to pili C (papC); x) temperature sensitive haemaglutinin (tsh), and xi) vacuolating autotransporter toxin (vat), by Multiplex-PCR. The results showed that all genes are present in both commensal and pathogenic E. coli strains. The iron uptake-related genes and the serum survival gene were more prevalent among APEC. The adhesin genes, except tsh, and the toxin genes, except astA, were also more prevalent among APEC isolates. Except for astA and tsh, APEC strains harbored the majority of the virulence-associated genes studied and fimC was the most prevalent gene, detected in 96.97 and 88.52% of APEC and AFEC strains, respectively. Possession of more than one iron transport system seems to play an important role on APEC survival. © 2016 Poultry Science Association Inc.

Identification of active methanotrophs in a landfill cover soil through detection of expression of 16S rRNA and functional genes.

Science.gov (United States)

Chen, Yin; Dumont, Marc G; Cébron, Aurélie; Murrell, J Colin

2007-11-01

Active methanotrophs in a landfill soil were revealed by detecting the 16S rRNA of methanotrophs and the mRNA transcripts of key genes involved in methane oxidation. New 16S rRNA primers targeting type I and type II methanotrophs were designed and optimized for analysis by denaturing gradient gel electrophoresis. Direct extraction of RNA from soil enabled the analysis of the expression of the functional genes: mmoX, pmoA and mxaF, which encode subunits of soluble methane monooxygenase, particulate methane monooxygenase and methanol dehydrogenase respectively. The 16S rRNA polymerase chain reaction (PCR) primers for type I methanotrophs detected Methylomonas, Methylosarcina and Methylobacter sequences from both soil DNA and cDNA which was generated from RNA extracted directly from the landfill cover soil. The 16S rRNA primers for type II methanotrophs detected primarily Methylocella and some Methylocystis 16S rRNA genes. Phylogenetic analysis of mRNA recovered from the soil indicated that Methylobacter, Methylosarcina, Methylomonas, Methylocystis and Methylocella were actively expressing genes involved in methane and methanol oxidation. Transcripts of pmoA but not mmoX were readily detected by reverse transcription polymerase chain reaction (RT-PCR), indicating that particulate methane monooxygenase may be largely responsible for methane oxidation in situ.

Application of heteroduplex analysis for detecting variation within the growth hormone 2 gene in Salmo trutta L. (brown trout).

Science.gov (United States)

Gross, R; Nilsson, J

1995-03-01

A new method to detect variation at a single copy nuclear gene in brown trout, Salmo trutta L., is provided. The technique entails (i) selective gene amplification by the polymerase chain reaction (PCR), (ii) digestion of amplification products by restriction endonucleases to obtain fragments of suitable size, (iii) hybridization with heterologous DNA followed by denaturation and reannealing to obtain heteroduplex molecules, and (iv) screening for variation in polyacrylamide gels. Variation was studied within a growth hormone 2 gene 1489 bp segment and polymorphism was detected in two HinfI-digested fragments. Formation of different heteroduplex patterns in experimental mixtures of digested amplification products from brown trout and Atlantic salmon, Salmo salar L., allowed us to determine the genotype of the brown trout. Polymorphism was observed in four out of six studied populations.

Serotonin transporter gene-linked polymorphism affects detection of facial expressions.

Directory of Open Access Journals (Sweden)

Ai Koizumi

Full Text Available Previous studies have demonstrated that the serotonin transporter gene-linked polymorphic region (5-HTTLPR affects the recognition of facial expressions and attention to them. However, the relationship between 5-HTTLPR and the perceptual detection of others' facial expressions, the process which takes place prior to emotional labeling (i.e., recognition, is not clear. To examine whether the perceptual detection of emotional facial expressions is influenced by the allelic variation (short/long of 5-HTTLPR, happy and sad facial expressions were presented at weak and mid intensities (25% and 50%. Ninety-eight participants, genotyped for 5-HTTLPR, judged whether emotion in images of faces was present. Participants with short alleles showed higher sensitivity (d' to happy than to sad expressions, while participants with long allele(s showed no such positivity advantage. This effect of 5-HTTLPR was found at different facial expression intensities among males and females. The results suggest that at the perceptual stage, a short allele enhances the processing of positive facial expressions rather than that of negative facial expressions.

Identification of novel candidate target genes in amplicons of Glioblastoma multiforme tumors detected by expression and CGH microarray profiling

Directory of Open Access Journals (Sweden)

Hernández-Moneo Jose-Luis

2006-09-01

Full Text Available Abstract Background Conventional cytogenetic and comparative genomic hybridization (CGH studies in brain malignancies have shown that glioblastoma multiforme (GBM is characterized by complex structural and numerical alterations. However, the limited resolution of these techniques has precluded the precise identification of detailed specific gene copy number alterations. Results We performed a genome-wide survey of gene copy number changes in 20 primary GBMs by CGH on cDNA microarrays. A novel amplicon at 4p15, and previously uncharacterized amplicons at 13q32-34 and 1q32 were detected and are analyzed here. These amplicons contained amplified genes not previously reported. Other amplified regions containg well-known oncogenes in GBMs were also detected at 7p12 (EGFR, 7q21 (CDK6, 4q12 (PDGFRA, and 12q13-15 (MDM2 and CDK4. In order to identify the putative target genes of the amplifications, and to determine the changes in gene expression levels associated with copy number change events, we carried out parallel gene expression profiling analyses using the same cDNA microarrays. We detected overexpression of the novel amplified genes SLA/LP and STIM2 (4p15, and TNFSF13B and COL4A2 (13q32-34. Some of the candidate target genes of amplification (EGFR, CDK6, MDM2, CDK4, and TNFSF13B were tested in an independent set of 111 primary GBMs by using FISH and immunohistological assays. The novel candidate 13q-amplification target TNFSF13B was amplified in 8% of the tumors, and showed protein expression in 20% of the GBMs. Conclusion This high-resolution analysis allowed us to propose novel candidate target genes such as STIM2 at 4p15, and TNFSF13B or COL4A2 at 13q32-34 that could potentially contribute to the pathogenesis of these tumors and which would require futher investigations. We showed that overexpression of the amplified genes could be attributable to gene dosage and speculate that deregulation of those genes could be important in the development

Detection of denitrification genes by in situ rolling circle amplification - fluorescence in situ hybridization (in situ RCA-FISH) to link metabolic potential with identity inside bacterial cells

DEFF Research Database (Denmark)

Hoshino, Tatsuhiko; Schramm, Andreas

2010-01-01

target site. Finally, the RCA product inside the cells was detected by standard fluorescence in situ hybridization (FISH). The optimized protocol showed high specificity and signal-to-noise ratio but low detection frequency (up to 15% for single-copy genes and up to 43% for the multi-copy 16S rRNA gene...... as Candidatus Accumulibacter phosphatis by combining in situ RCA-FISH with 16S rRNA-targeted FISH. While not suitable for quantification because of its low detection frequency, in situ RCA-FISH will allow to link metabolic potential with 16S rRNA (gene)-based identification of single microbial cells.......). Nevertheless, multiple genes (nirS and nosZ; nirS and the 16S rRNA gene) could be detected simultaneously in P. stutzeri. Environmental application of in situ RCA-FISH was demonstrated on activated sludge by the differential detection of two types of nirS-defined denitrifiers; one of them was identified...

Spectroscopic detection of fluorescent protein marker gene activity in genetically modified plants

Science.gov (United States)

Liew, O. W.; Chong, Jenny P. C.; Asundi, Anand K.

2005-04-01

This work focuses on developing a portable fibre optic fluorescence analyser for rapid identification of genetically modified plants tagged with a fluorescent marker gene. Independent transgenic tobacco plant lines expressing the enhanced green fluorescence protein (EGFP) gene were regenerated following Agrobacterium-mediated gene transfer. Molecular characterisation of these plant lines was carried out at the DNA level by PCR screening to confirm their transgenic status. Conventional transgene expression analysis was then carried out at the RNA level by RT-PCR and at the protein level by Western blotting using anti-GFP rabbit antiserum. The amount of plant-expressed EGFP on a Western blot was quantified against known amounts of purified EGFP by scanning densitometry. The expression level of EGFP in transformed plants was found to range from 0.1 - 0.6% of total extractable protein. A comparison between conventional western analysis of transformants and direct spectroscopic quantification using the fibre optic fluorescence analyser was made. The results showed that spectroscopic measurements of fluorescence emission from strong EGFP expressors correlated positively with Western blot data. However, the fluorescence analyser was also able to identify weakly expressing plant transformants below the detection limit of colorimetric Western blotting.

Multi-gene detection and identification of mosquito-borne RNA viruses using an oligonucleotide microarray.

Directory of Open Access Journals (Sweden)

Nathan D Grubaugh

Full Text Available BACKGROUND: Arthropod-borne viruses are important emerging pathogens world-wide. Viruses transmitted by mosquitoes, such as dengue, yellow fever, and Japanese encephalitis viruses, infect hundreds of millions of people and animals each year. Global surveillance of these viruses in mosquito vectors using molecular based assays is critical for prevention and control of the associated diseases. Here, we report an oligonucleotide DNA microarray design, termed ArboChip5.1, for multi-gene detection and identification of mosquito-borne RNA viruses from the genera Flavivirus (family Flaviviridae, Alphavirus (Togaviridae, Orthobunyavirus (Bunyaviridae, and Phlebovirus (Bunyaviridae. METHODOLOGY/PRINCIPAL FINDINGS: The assay utilizes targeted PCR amplification of three genes from each virus genus for electrochemical detection on a portable, field-tested microarray platform. Fifty-two viruses propagated in cell-culture were used to evaluate the specificity of the PCR primer sets and the ArboChip5.1 microarray capture probes. The microarray detected all of the tested viruses and differentiated between many closely related viruses such as members of the dengue, Japanese encephalitis, and Semliki Forest virus clades. Laboratory infected mosquitoes were used to simulate field samples and to determine the limits of detection. Additionally, we identified dengue virus type 3, Japanese encephalitis virus, Tembusu virus, Culex flavivirus, and a Quang Binh-like virus from mosquitoes collected in Thailand in 2011 and 2012. CONCLUSIONS/SIGNIFICANCE: We demonstrated that the described assay can be utilized in a comprehensive field surveillance program by the broad-range amplification and specific identification of arboviruses from infected mosquitoes. Furthermore, the microarray platform can be deployed in the field and viral RNA extraction to data analysis can occur in as little as 12 h. The information derived from the ArboChip5.1 microarray can help to establish

Development of a dot blot assay using gene probes for the detection of enteroviruses in water

International Nuclear Information System (INIS)

Margolin, A.B.

1986-01-01

Enteric viruses are viruses which replicate in the intestinal tract of man and animals. One mode of transmission for enteric viruses is the fecal-oral route. Drinking water which has been contaminated with sewage or sewage effluent has been implicated as a means for the spread of enteric viruses. Current methods for the detection of enteric viruses in water requires the use of animal cell culture. This technique has several drawbacks. More rapid techniques, such as fluorescent antibody or radioimmunoassay do not have the needed sensitivity to detect the low levels of virus found in contaminated water. An alternative technique for the detection of viruses in water was sought. Recent advances in recombinant DNA technology now makes it possible to detect viruses without the use of cell culture or antibodies. Gene probes that hybridize to the RNA of poliovirus and hepatitis A virus were tested for their ability to detect different enteric viruses. The probes were labeled with 32 P dCTP and 32 P dATP to a specific activity greater then 1.0 x 10 9 cpm/ug DNA. One infectious unit of poliovirus and hepatitis A virus was detected using labeled cDNA probes. Upon comparison, the dot blot assay was as sensitive as tissue culture for the detection of poliovirus in beef extract, secondary effluent, and tap water. Environmental samples, such as secondary effluent, reclaimed wastewater and unchlorinated drinking water were also assayed for poliovirus and hepatitis A virus with the use of gene probes. The results presented here offer an alternative method for screening water samples for the presence of enteric viruses

Direct Detection and Differentiation of Pathogenic Leptospira Species Using a Multi-Gene Targeted Real Time PCR Approach

Science.gov (United States)

Ferreira, Ana Sofia; Costa, Pedro; Rocha, Teresa; Amaro, Ana; Vieira, Maria Luísa; Ahmed, Ahmed; Thompson, Gertrude; Hartskeerl, Rudy A.; Inácio, João

2014-01-01

Leptospirosis is a growing public and veterinary health concern caused by pathogenic species of Leptospira. Rapid and reliable laboratory tests for the direct detection of leptospiral infections in animals are in high demand not only to improve diagnosis but also for understanding the epidemiology of the disease. In this work we describe a novel and simple TaqMan-based multi-gene targeted real-time PCR approach able to detect and differentiate Leptospira interrogans, L. kirschneri, L. borgpeteresenii and L. noguchii, which constitute the veterinary most relevant pathogenic species of Leptospira. The method uses sets of species-specific probes, and respective flanking primers, designed from ompL1 and secY gene sequences. To monitor the presence of inhibitors, a duplex amplification assay targeting both the mammal β-actin and the leptospiral lipL32 genes was implemented. The analytical sensitivity of all primer and probe sets was estimated to be <10 genome equivalents (GE) in the reaction mixture. Application of the amplification reactions on genomic DNA from a variety of pathogenic and non-pathogenic Leptospira strains and other non-related bacteria revealed a 100% analytical specificity. Additionally, pathogenic leptospires were successfully detected in five out of 29 tissue samples from animals (Mus spp., Rattus spp., Dolichotis patagonum and Sus domesticus). Two samples were infected with L. borgpetersenii, two with L. interrogans and one with L. kirschneri. The possibility to detect and identify these pathogenic agents to the species level in domestic and wildlife animals reinforces the diagnostic information and will enhance our understanding of the epidemiology of leptopirosis. PMID:25398140

Detection and characterization of recombinant DNA expressing vip3A-type insecticidal gene in GMOs--standard single, multiplex and construct-specific PCR assays.

Science.gov (United States)

Singh, Chandra K; Ojha, Abhishek; Bhatanagar, Raj K; Kachru, Devendra N

2008-01-01

Vegetative insecticidal protein (Vip), a unique class of insecticidal protein, is now part of transgenic plants for conferring resistance against lepidopteron pests. In order to address the imminent regulatory need for detection and labeling of vip3A carrying genetically modified (GM) products, we have developed a standard single PCR and a multiplex PCR assay. As far as we are aware, this is the first report on PCR-based detection of a vip3A-type gene (vip-s) in transgenic cotton and tobacco. Our assay involves amplification of a 284-bp region of the vip-s gene. This assay can possibly detect as many as 20 natural wild-type isolates bearing a vip3A-like gene and two synthetic genes of vip3A in transgenic plants. The limit of detection as established by our assay for GM trait (vip-s) is 0.1%. Spiking with nontarget DNA originating from diverse plant sources had no inhibitory effect on vip-s detection. Since autoclaving of vip-s bearing GM leaf samples showed no deterioration/interference in detection efficacy, the assay seems to be suitable for processed food products as well. The vip-s amplicon identity was reconfirmed by restriction endonuclease assay. The primer set for vip-s was equally effective in a multiplex PCR assay format (duplex, triplex and quadruplex), used in conjunction with the primer sets for the npt-II selectable marker gene, Cauliflower mosaic virus 35S promoter and nopaline synthetase terminator, enabling concurrent detection of the transgene, regulatory sequences and marker gene. Further, the entire transgene construct was amplified using the forward primer of the promoter and the reverse primer of the terminator. The resultant amplicon served as a template for nested PCR to confirm the construct integrity. The method is suitable for screening any vip3A-carrying GM plant and food. The availability of a reliable PCR assay method prior to commercial release of vip3A-based transgenic crops and food would facilitate rapid and efficient regulatory

Constitutional von Hippel-Lindau (VHL) gene deletions detected in VHL families by fluorescence in situ hybridization.

Science.gov (United States)

Pack, S D; Zbar, B; Pak, E; Ault, D O; Humphrey, J S; Pham, T; Hurley, K; Weil, R J; Park, W S; Kuzmin, I; Stolle, C; Glenn, G; Liotta, L A; Lerman, M I; Klausner, R D; Linehan, W M; Zhuang, Z

1999-11-01

von Hippel-Lindau (VHL) disease is an autosomal dominantly inherited cancer syndrome predisposing to a variety of tumor types that include retinal hemangioblastomas, hemangioblastomas of the central nervous system, renal cell carcinomas, pancreatic cysts and tumors, pheochromocytomas, endolymphatic sac tumors, and epididymal cystadenomas [W. M. Linehan et al., J. Am. Med. Assoc., 273: 564-570, 1995; E. A. Maher and W. G. Kaelin, Jr., Medicine (Baltimore), 76: 381-391, 1997; W. M. Linehan and R. D. Klausner, In: B. Vogelstein and K. Kinzler (eds.), The Genetic Basis of Human Cancer, pp. 455-473, McGraw-Hill, 1998]. The VHL gene was localized to chromosome 3p25-26 and cloned [F. Latif et al., Science (Washington DC), 260: 1317-1320, 1993]. Germline mutations in the VHL gene have been detected in the majority of VHL kindreds. The reported frequency of detection of VHL germline mutations has varied from 39 to 80% (J. M. Whaley et al., Am. J. Hum. Genet., 55: 1092-1102, 1994; Clinical Research Group for Japan, Hum. Mol. Genet., 4: 2233-2237, 1995; F. Chen et al., Hum. Mutat., 5: 66-75, 1995; E. R. Maher et al., J. Med. Genet., 33: 328-332, 1996; B. Zbar, Cancer Surv., 25: 219-232, 1995). Recently a quantitative Southern blotting procedure was found to improve this frequency (C. Stolle et al., Hum. Mutat., 12: 417-423, 1998). In the present study, we report the use of fluorescence in situ hybridization (FISH) as a method to detect and characterize VHL germline deletions. We reexamined a group of VHL patients shown previously by single-strand conformation and sequencing analysis not to harbor point mutations in the VHL locus. We found constitutional deletions in 29 of 30 VHL patients in this group using cosmid and P1 probes that cover the VHL locus. We then tested six phenotypically normal offspring from four of these VHL families: two were found to carry the deletion and the other four were deletion-free. In addition, germline mosaicism of the VHL gene was identified in

Novel RNA hybridization method for the in situ detection of ETV1, ETV4, and ETV5 gene fusions in prostate cancer.

Science.gov (United States)

Kunju, Lakshmi P; Carskadon, Shannon; Siddiqui, Javed; Tomlins, Scott A; Chinnaiyan, Arul M; Palanisamy, Nallasivam

2014-09-01

The genetic basis of 50% to 60% of prostate cancer (PCa) is attributable to rearrangements in E26 transformation-specific (ETS) (ERG, ETV1, ETV4, and ETV5), BRAF, and RAF1 genes and overexpression of SPINK1. The development and validation of reliable detection methods are warranted to classify various molecular subtypes of PCa for diagnostic and prognostic purposes. ETS gene rearrangements are typically detected by fluorescence in situ hybridization and reverse-transcription polymerase chain reaction methods. Recently, monoclonal antibodies against ERG have been developed that detect the truncated ERG protein in immunohistochemical assays where staining levels are strongly correlated with ERG rearrangement status by fluorescence in situ hybridization. However, specific antibodies for ETV1, ETV4, and ETV5 are unavailable, challenging their clinical use. We developed a novel RNA in situ hybridization-based assay for the in situ detection of ETV1, ETV4, and ETV5 in formalin-fixed paraffin-embedded tissues from prostate needle biopsies, prostatectomy, and metastatic PCa specimens using RNA probes. Further, with combined RNA in situ hybridization and immunohistochemistry we identified a rare subset of PCa with dual ETS gene rearrangements in collisions of independent tumor foci. The high specificity and sensitivity of RNA in situ hybridization provides an alternate method enabling bright-field in situ detection of ETS gene aberrations in routine clinically available PCa specimens.

AffyMiner: mining differentially expressed genes and biological knowledge in GeneChip microarray data

Directory of Open Access Journals (Sweden)

Xia Yuannan

2006-12-01

Full Text Available Abstract Background DNA microarrays are a powerful tool for monitoring the expression of tens of thousands of genes simultaneously. With the advance of microarray technology, the challenge issue becomes how to analyze a large amount of microarray data and make biological sense of them. Affymetrix GeneChips are widely used microarrays, where a variety of statistical algorithms have been explored and used for detecting significant genes in the experiment. These methods rely solely on the quantitative data, i.e., signal intensity; however, qualitative data are also important parameters in detecting differentially expressed genes. Results AffyMiner is a tool developed for detecting differentially expressed genes in Affymetrix GeneChip microarray data and for associating gene annotation and gene ontology information with the genes detected. AffyMiner consists of the functional modules, GeneFinder for detecting significant genes in a treatment versus control experiment and GOTree for mapping genes of interest onto the Gene Ontology (GO space; and interfaces to run Cluster, a program for clustering analysis, and GenMAPP, a program for pathway analysis. AffyMiner has been used for analyzing the GeneChip data and the results were presented in several publications. Conclusion AffyMiner fills an important gap in finding differentially expressed genes in Affymetrix GeneChip microarray data. AffyMiner effectively deals with multiple replicates in the experiment and takes into account both quantitative and qualitative data in identifying significant genes. AffyMiner reduces the time and effort needed to compare data from multiple arrays and to interpret the possible biological implications associated with significant changes in a gene's expression.

A kernel regression approach to gene-gene interaction detection for case-control studies.

Science.gov (United States)

Larson, Nicholas B; Schaid, Daniel J

2013-11-01

Gene-gene interactions are increasingly being addressed as a potentially important contributor to the variability of complex traits. Consequently, attentions have moved beyond single locus analysis of association to more complex genetic models. Although several single-marker approaches toward interaction analysis have been developed, such methods suffer from very high testing dimensionality and do not take advantage of existing information, notably the definition of genes as functional units. Here, we propose a comprehensive family of gene-level score tests for identifying genetic elements of disease risk, in particular pairwise gene-gene interactions. Using kernel machine methods, we devise score-based variance component tests under a generalized linear mixed model framework. We conducted simulations based upon coalescent genetic models to evaluate the performance of our approach under a variety of disease models. These simulations indicate that our methods are generally higher powered than alternative gene-level approaches and at worst competitive with exhaustive SNP-level (where SNP is single-nucleotide polymorphism) analyses. Furthermore, we observe that simulated epistatic effects resulted in significant marginal testing results for the involved genes regardless of whether or not true main effects were present. We detail the benefits of our methods and discuss potential genome-wide analysis strategies for gene-gene interaction analysis in a case-control study design. © 2013 WILEY PERIODICALS, INC.

Detection of Amp C genes encoding for beta-lactamases in Escherichia coli and Klebsiella pneumoniae

Directory of Open Access Journals (Sweden)

M Shanthi

2012-01-01

Full Text Available Purpose : Amp C beta-lactamase are Ambler class C enzymes that confer resistance to extended spectrum cephalosporins and are not inhibited by beta-lactamase inhibitors. Their detection is crucial, since the phenotypic tests are not standardised leading to ambiguity in interpretation of results. This study was done to detect the types of Amp C prevalent in Escherichia coli and Klebsiella pneumoniae by multiplex polymerase chain reaction (PCR. Materials and Methods : Seventy-seven consecutive cefoxitin resistant clinical isolates of E. coli (n = 25 and K. pneumoniae (n = 52 were included in the study. Antibiotic susceptibility testing to various classes of antibiotics was performed by disc diffusion using Clinical Laboratory Standards Institute (CLSI guidelines. Minimum inhibitory concentration (MIC to cefoxitin, imipenem and meropenem were determined by broth microdilution method. Isolates were screened for production of Extended Spectrum Beta-Lactamase (ESBL. Multiplex PCR was performed for the detection of Amp C genes after phenotypic testing (Hodge test and inhibitor based test. Results : Cefoxitin Hodge test was positive in 40 isolates which included 20 E. coli and 20 K. pneumoniae. There was zone enhancement with boronic acid in 55 isolates, of which 36 were K. pneumoniae and 19 were E. coli. Multiplex PCR detected Amp C in 11/25 E. coli and 12/52 K. pneumoniae isolates. The Amp C genes detected were CIT (Amp C origin - Citrobacter freundii, DHA (Dhahran Hospital, Saudi Arabia, ACC (Ambler class C, EBC (Amp C origin - Enterobacter cloacae groups. ESBL was co-produced in 54 isolates. Conclusions : Amp C was detected in 29.87% of the study isolates. Majority of them co-produced ESBL. The most common Amp C was the CIT family. Screen tests for cefoxitin resistance may be falsely positive due to production of carbapenamases.

The application of reporter gene assays for the detection of endocrine disruptors in sport supplements

International Nuclear Information System (INIS)

Plotan, Monika; Elliott, Christopher T.; Scippo, Marie Louise; Muller, Marc; Antignac, Jean-Philippe; Malone, Edward; Bovee, Toine F.H.; Mitchell, Samuel; Connolly, Lisa

2011-01-01

The increasing availability and use of sports supplements is of concern as highlighted by a number of studies reporting endocrine disruptor contamination in such products. The health food supplement market, including sport supplements, is growing across the Developed World. Therefore, the need to ensure the quality and safety of sport supplements for the consumer is essential. The development and validation of two reporter gene assays coupled with solid phase sample preparation enabling the detection of estrogenic and androgenic constituents in sport supplements is reported. Both assays were shown to be of high sensitivity with the estrogen and androgen reporter gene assays having an EC 50 of 0.01 ng mL -1 and 0.16 ng mL -1 respectively. The developed assays were applied in a survey of 63 sport supplements samples obtained across the Island of Ireland with an additional seven reference samples previously investigated using LC-MS/MS. Androgen and estrogen bio-activity was found in 71% of the investigated samples. Bio-activity profiling was further broken down into agonists, partial agonists and antagonists. Supplements (13) with the strongest estrogenic bio-activity were chosen for further investigation. LC-MS/MS analysis of these samples determined the presence of phytoestrogens in seven of them. Supplements (38) with androgen bio-activity were also selected for further investigation. Androgen agonist bio-activity was detected in 12 supplements, antagonistic bio-activity was detected in 16 and partial antagonistic bio-activity was detected in 10. A further group of supplements (7) did not present androgenic bio-activity when tested alone but enhanced the androgenic agonist bio-activity of dihydrotestosterone when combined. The developed assays offer advantages in detection of known, unknown and low-level mixtures of endocrine disruptors over existing analytical screening techniques. For the detection and identification of constituent hormonally active compounds the

Rapid Molecular detection of citrus brown spot disease using ACT gene in Alternaria alternata

Directory of Open Access Journals (Sweden)

Hamid Moghimi

2017-06-01

Full Text Available Introduction:Using rapid detection methods is important for detection of plant pathogens and also prevention through spreading pests in agriculture. Citrus brown spot disease caused by pathogenic isolates of Alternaria alternata is a common disease in Iran. Materials and methods: In this study, for the first time a PCR based molecular method was used for rapid diagnosis of brown spot disease. Nine isolates of A. Alternata were isolated in PDA medium from different citrus gardens. The plant pathogenic activity was examined in tangerine leaves for isolates. Results showed that these isolates are the agents of brown spot disease. PCR amplification of specific ACT-toxin gene was performed for DNA extracted from A. alternata isolates, with 11 different fungal isolates as negative controls and 5 DNA samples extracted from soil. Results: Results showed that A. alternata, the causal agent of brown spot disease, can be carefully distinguished from other pathogenic agents by performing PCR amplification with specific primers for ACT toxin gene. Also, the results from Nested-PCR method confirmed the primary reaction and the specificity of A. alternata for brown spot disease. PCR results to control samples of the other standard fungal isolates, showed no amplification band. In addition, PCR with the DNA extracted from contaminated soils confirmed the presence of ACT toxin gene. Discussion and conclusion: Molecular procedure presented here can be used in rapid identification and prevention of brown spot infection in citrus gardens all over the country.

Study on drug resistance of mycobacterium tuberculosis in patients with pulmonary tuberculosis by drug resistance gene detecting

International Nuclear Information System (INIS)

Wang Wei; Li Hongmin; Wu Xueqiong; Wang Ansheng; Ye Yixiu; Wang Zhongyuan; Liu Jinwei; Chen Hongbing; Lin Minggui; Wang Jinhe; Li Sumei; Jiang Ping; Feng Bai; Chen Dongjing

2004-01-01

To investigate drug resistance of mycobacterium tuberculosis in different age group, compare detecting effect of two methods and evaluate their the clinical application value, all of the strains of mycobacterium tuberculosis were tested for resistance to RFP, INH SM PZA and EMB by the absolute concentration method on Lowenstein-Jensen medium and the mutation of the rpoB, katG, rpsL, pncA and embB resistance genes in M. tuberculosis was tested by PCR-SSCP. In youth, middle and old age group, the rate of acquired drug resistance was 89.2%, 85.3% and 67.6% respectively, the gene mutation rate was 76.2%, 81.3% and 63.2% respectively. The rate of acquired drug resistance and multiple drug resistance in youth group was much higher than those in other groups. The gene mutation was correlated with drug resistance level of mycobacterium tuberculosis. The gene mutation rate was higher in strains isolated from high concentration resistance than those in strains isolated from low concentration resistance. The more irregular treatment was longer, the rate of drug resistance was higher. Acquired drug resistance varies in different age group. It suggested that surveillance of drug resistence in different age group should be taken seriously, especially in youth group. PCR - SSCP is a sensitive and specific method for rapid detecting rpoB, katG, rpsL, pncA and embB genes mutations of MTB. (authors)

Molecular detection and analysis of a novel metalloprotease gene of entomopathogenic Serratia marcescens strains in infected Galleria mellonella.

Science.gov (United States)

Tambong, J T; Xu, R; Sadiku, A; Chen, Q; Badiss, A; Yu, Q

2014-04-01

Serratia marcescens strains isolated from entomopathogenic nematodes (Rhabditis sp.) were examined for their pathogenicity and establishment in wax moth (Galleria mellonella) larvae. All the Serratia strains were potently pathogenic to G. mellonella larvae, leading to death within 48 h. The strains were shown to possess a metalloprotease gene encoding for a novel serralysin-like protein. Rapid establishment of the bacteria in infected larvae was confirmed by specific polymerase chain reaction (PCR) detection of a DNA fragment encoding for this protein. Detection of the viable Serratia strains in infected larvae was validated using the SYBR Green reverse transcriptase real-time PCR assay targeting the metalloprotease gene. Nucleotide sequences of the metalloprotease gene obtained in our study showed 72 single nucleotide polymorphisms (SNP) and 3 insertions compared with the metalloprotease gene of S. marcescens E-15. The metalloprotease gene had 60 synonymous and 8 nonsynonymous substitutions relative to the closest GenBank entry, S. marcescens E-15. A comparison of the amino acid composition of the new serralysin-like protein with that of the serralysin protein of S. marcescens E-15 revealed differences at 11 positions and a new aspartic acid residue. Analysis of the effect of protein variation suggests that a new aspartic acid residue resulting from nonsynonymous nucleotide mutations in the protein structure could have the most significant effect on its biological function. The new metalloprotease gene and (or) its product could have applications in plant agricultural biotechnology.

Virulence Gene Pool Detected in Bovine Group C Streptococcus dysgalactiae subsp. dysgalactiae Isolates by Use of a Group A S. pyogenes Virulence Microarray ▿

Science.gov (United States)

Rato, Márcia G.; Nerlich, Andreas; Bergmann, René; Bexiga, Ricardo; Nunes, Sandro F.; Vilela, Cristina L.; Santos-Sanches, Ilda; Chhatwal, Gursharan S.

2011-01-01

A custom-designed microarray containing 220 virulence genes of Streptococcus pyogenes (group A Streptococcus [GAS]) was used to test group C Streptococcus dysgalactiae subsp. dysgalactiae (GCS) field strains causing bovine mastitis and group C or group G Streptococcus dysgalactiae subsp. equisimilis (GCS/GGS) isolates from human infections, with the latter being used for comparative purposes, for the presence of virulence genes. All bovine and all human isolates carried a fraction of the 220 genes (23% and 39%, respectively). The virulence genes encoding streptolysin S, glyceraldehyde-3-phosphate dehydrogenase, the plasminogen-binding M-like protein PAM, and the collagen-like protein SclB were detected in the majority of both bovine and human isolates (94 to 100%). Virulence factors, usually carried by human beta-hemolytic streptococcal pathogens, such as streptokinase, laminin-binding protein, and the C5a peptidase precursor, were detected in all human isolates but not in bovine isolates. Additionally, GAS bacteriophage-associated virulence genes encoding superantigens, DNase, and/or streptodornase were detected in bovine isolates (72%) but not in the human isolates. Determinants located in non-bacteriophage-related mobile elements, such as the gene encoding R28, were detected in all bovine and human isolates. Several virulence genes, including genes of bacteriophage origin, were shown to be expressed by reverse transcriptase PCR (RT-PCR). Phylogenetic analysis of superantigen gene sequences revealed a high level (>98%) of identity among genes of bovine GCS, of the horse pathogen Streptococcus equi subsp. equi, and of the human pathogen GAS. Our findings indicate that alpha-hemolytic bovine GCS, an important mastitis pathogen and considered to be a nonhuman pathogen, carries important virulence factors responsible for virulence and pathogenesis in humans. PMID:21525223

Detection of Cyanobacteria in Eutrophic Water Using a Portable Electrocoagulator and NanoGene Assay.

Science.gov (United States)

Lee, Eun-Hee; Chua, Beelee; Son, Ahjeong

2018-02-06

We have demonstrated the detection of cyanobacteria in eutrophic water samples using a portable electrocoagulator and NanoGene assay. The electrocoagulator is designed to preconcentrate cyanobacteria from water samples prior to analysis via NanoGene assay. Using Microcystis aeruginosa laboratory culture and environmental samples (cell densities ranging from 1.7 × 10 5 to 4.1 × 10 6 and 6.5 × 10 3 to 6.6 × 10 7 cells·mL -1 , respectively), the electrocoagulator was evaluated and compared with a conventional centrifuge. Varying the operation duration from 0 to 300 s with different cell densities was first investigated. Preconcentration efficiencies (obtained via absorbance measurement) and dry cell weight of preconcentrated cyanobacteria were then obtained and compared. For laboratory samples at cell densities from 3.2 × 10 5 to 4.1 × 10 6 cells·mL -1 , the preconcentration efficiencies of electrocoagulator appeared to be stable at ∼60%. At lower cell densities (1.7 and 2.2 × 10 5 cells·mL -1 ), the preconcentration efficiencies decreased to 33.9 ± 0.2 and 40.4 ± 5.4%, respectively. For environmental samples at cell densities of 2.7 × 10 5 and 6.6 × 10 7 cells·mL -1 , the electrocoagulator maintained its preconcentration efficiency at ∼60%. On the other hand, the centrifuge's preconcentration efficiencies decreased to nondetectable and below 40%, respectively. This shows that the electrocoagulator outperformed the centrifuge when using eutrophic water samples. Finally, the compatibility of the electrocoagulator with the NanoGene assay was verified via the successful detection of the microcystin synthetase D (mcyD) gene in environmental samples. The viability of the electrocoagulator as an in situ compatible alternative to the centrifuge is also discussed.

Partial antiviral activities detection of chicken Mx jointing with neuraminidase gene (NA against Newcastle disease virus.

Directory of Open Access Journals (Sweden)

Yani Zhang

Full Text Available As an attempt to increase the resistance to Newcastle Disease Virus (NDV and so further reduction of its risk on the poultry industry. This work aimed to build the eukaryotic gene co-expression plasmid of neuraminidase (NA gene and myxo-virus resistance (Mx and detect the gene expression in transfected mouse fibroblasts (NIH-3T3 cells, it is most important to investigate the influence of the recombinant plasmid on the chicken embryonic fibroblasts (CEF cells. cDNA fragment of NA and mutant Mx gene were derived from pcDNA3.0-NA and pcDNA3.0-Mx plasmid via PCR, respectively, then NA and Mx cDNA fragment were inserted into the multiple cloning sites of pVITRO2 to generate the eukaryotic co-expression plasmid pVITRO2-Mx-NA. The recombinant plasmid was confirmed by restriction endonuclease treatment and sequencing, and it was transfected into the mouse fibroblasts (NIH-3T3 cells. The expression of genes in pVITRO2-Mx-NA were measured by RT-PCR and indirect immunofluorescence assay (IFA. The recombinant plasmid was transfected into CEF cells then RT-PCR and the micro-cell inhibition tests were used to test the antiviral activity for NDV. Our results showed that co-expression vector pVITRO2-Mx-NA was constructed successfully; the expression of Mx and NA could be detected in both NIH-3T3 and CEF cells. The recombinant proteins of Mx and NA protect CEF cells from NDV infection until after 72 h of incubation but the individually mutagenic Mx protein or NA protein protects CEF cells from NDV infection till 48 h post-infection, and co-transfection group decreased significantly NDV infection compared with single-gene transfection group (P<0. 05, indicating that Mx-NA jointing contributed to delaying the infection of NDV in single-cell level and the co-transfection of the jointed genes was more powerful than single one due to their synergistic effects.

Helicobacter pylori virulence genes in the five largest islands of Indonesia.

Science.gov (United States)

Miftahussurur, Muhammad; Syam, Ari Fahrial; Makmun, Dadang; Nusi, Iswan Abbas; Zein, Lukman Hakim; Zulkhairi; Akil, Fardah; Uswan, Willi Brodus; Simanjuntak, David; Uchida, Tomohisa; Adi, Pangestu; Utari, Amanda Pitarini; Rezkitha, Yudith Annisa Ayu; Subsomwong, Phawinee; Nasronudin; Yamaoka, Yoshio

2015-01-01

It remains unclear whether the low incidence of gastric cancer in Indonesia is due to low infection rates only or is also related to low Helicobacter pylori pathogenicity. We collected H. pylori strains from the five largest islands in Indonesia and evaluated genetic virulence factors. The genotypes of H. pylori virulence factors were determined by polymerase chain reaction (PCR)-based sequencing. Histological severity of the gastric mucosa was classified into 4 grades, according to the updated Sydney system. A total of 44 strains were analyzed. Forty-three (97.7 %) were cagA-positive: 26 (60.5 %) were East-Asian-type-cagA, 9 (20.9 %) were Western-type-cagA, and 8 (18.6 %) were novel ABB-type, most of which were obtained from Papuan. EPIYT sequences were more prevalent than EPIYA sequences (P = 0.01) in the EPIYA-B motif of all types of cagA. The majority of cagA-positive strains (48.8 %, 21/43) had a 6-bp deletion in the first pre-EPIYA region. Subjects infected with East-Asian-type-cagA strains with a 6-bp deletion had significantly lower inflammation and atrophy scores in the corpus than those infected with Western-type-cagA strains (both P = 0.02). In total, 70.4 % of strains possessed the vacA s1m1 genotype and 29.5 % were m2. All strains from peptic ulcer patients were of the iceA1 genotype, which occurred at a significantly higher proportion in peptic ulcer patients than that in gastritis patients (55.3 %, P = 0.04). The double positive genotype of jhp0562/β-(1,3)galT was predominant (28/44, 63.6 %), and subjects infected with this type had significantly higher inflammation scores in the corpus than those with the jhp0562 negative/β-(1,3)galT positive genotype (mean [median]; 1.43 [1] vs. 0.83 [1], P = 0.04). There were significant differences in cagA and pre-EPIYA cagA type, oipA status, and jhp0562/β-(1,3)galT type among different ethnic groups (P dupA negative or short type dupA, and the jhp0562/β-(1,3)galT double positive genotype.

Detection of chicken contamination in beef meatball using duplex-PCR Cyt b gene

Science.gov (United States)

Sari, E. P.; Kartikasari, L. R.; Cahyadi, M.

2017-04-01

Beef is one of expensive animal protein sources compared to other meats, on the other hand, chicken is cheap animal protein source. Mixing of chicken into beef meatball is possibly performed to decrease production cost. The aim of this study was to detect chicken contamination in beef meatball using Cytochrome b (Cyt b) gene by duplex-PCR. Sample was designed and prepared as follows, 100% of chicken meatball, 100% of beef meatball and serial level of chicken contaminations in beef meatball (1, 5, 10 and 25%, respectively). Isolation of DNA genome from meatball was according to the guideline of gSYNCTM DNA Extraction Kit for animal tissue. The PCR reaction was carried out using KAPA2G Fast Multiplex Mix. This study found that the DNA genome was succesfully extracted. Moreover, chicken contamination in beef meatball was indicated by the presence of 227 bp DNA band on 2% of agarose gels. Current study revealed that duplex-PCR using Cyt b gene as a genetic marker was able to detect chicken contamination in beef meatball until 1% of chicken meat in the sample. It can be effectively used to identify contamination and also authenticate species origin in animal products to protect consumer from undesirable contents in the food.

Rapid detection of Van genes in rectal swabs by real time PCR in Southern Brazil

Directory of Open Access Journals (Sweden)

Vlademir Cantarelli

2011-10-01

Full Text Available INTRODUCTION: Laboratory-based surveillance is an important component in the control of vancomycin resistant enterococci (VRE. METHODS: The study aimed to evaluate real-time polymerase chain reaction (RT-PCR (genes vanA-vanB for VRE detection on 115 swabs from patients included in a surveillance program. RESULTS: Sensitivity of RT-PCR was similar to primary culture (75% and 79.5%, respectively when compared to broth enriched culture, whereas specificity was 83.1%. CONCLUSIONS: RT-PCR provides same day results, however it showed low sensitivity for VRE detection.

Sensitive detection of enteropathogenic E. coli using a bfpA gene-based electrochemical sensor

International Nuclear Information System (INIS)

Zhang, Wei; Luo, Caihui; Zhong, Liang; Zhao, Dan; Ding, Shijia; Nie, Shichang; Cheng, Wei

2013-01-01

We have developed a sensitive assay for enteropathogenic E. coli (EPEC) by integrating DNA extraction, specific polymerase chain reaction (PCR) and DNA detection using an electrode modified with the bundle-forming pilus (bfpA) structural gene. The PCR amplified products are captured on the electrode and hybridized with biotinylated detection probes to form a sandwich hybrid containing two biotinylated detection probes. The sandwich hybridization structure significantly combined the numerous streptavidin alkaline phosphatase on the electrode by biotin-streptavidin connectors. Electrochemical readout is based on dual signal amplification by both the sandwich hybridization structure and the enzyme. The electrode can satisfactorily discriminate complementary and mismatched oligonucleotides. Under optimal conditions, synthetic target DNA can be detected in the 1 pM to 10 nM concentration range, with a detection limit of 0.3 pM. EPEC can be quantified in the 10 to 10 7 CFU mL −1 levels within 3.5 h. The method also is believed to present a powerful platform for the screening of pathogenic microorganisms in clinical diagnostics, food safety and environmental monitoring. (author)

A method to detect transfected chloramphenicol acetyltransferase gene expression in intact animals

International Nuclear Information System (INIS)

Narayanan, R.; Jastreboff, M.M.; Chiu, Chang Fang; Ito, Etsuro; Bertino, J.R.

1988-01-01

A rapid procedure is described for assaying chloramphenicol acetyltransferase enzyme activity in intact animals following transfection of the RSV CAT plasmid into mouse bone marrow cells by electroporation. The reconstituted mice were injected with [ 14 C]chloramphenicol and ethyl acetate extracts of 24-h urine samples were analyzed by TLC autoradiography for the excretion of 14 C-labeled metabolites. CAT expression in vivo can be detected by the presence of acetylated 14 C-labeled metabolites in the urine within 1 week after bone marrow transplantation and, under the conditions described, these metabolites can be detected for at least 3 months. CAT expression in intact mice as monitored by the urine assay correlates with the CAT expression in the hematopoietic tissues assayed in vitro. This method offers a quick mode of screening for introduced CAT gene expression in vivo without sacrificing the mice

Clinical significance of fluorescence in situ hybridization for detection of hTERC gene amplification in cervical cancer and precancerous tissues cases

Directory of Open Access Journals (Sweden)

Shuang LIU

2012-06-01

Full Text Available Objective 　To detect the human telomerase RNA gene (hTERC amplification in cervical lesions, and explore its clinical significance. Methods 　The tissues of the cervical lesions were collected from 195 patients, including 33 of chronic cervicitis, 34 of CINⅠ, 37 of CIN Ⅱ-Ⅲ, 30 of cervical squamous cell carcinoma, and 61 of cervica1 adenocarcinoma, and abnormal hTERC was detected with amplification of fluorescence in situhybridization (FISH. The relationship between hTERC gene amplification and clinicopathological parameters was analyzed. Results 　Among the 195 patients, the positive rate of hTERC gene amplification was 3.03% (1/33, 29.41% (10/34, 72.97% (27/37, 100% (30/30, 91.8% (56/61 in chronic cervicitis, CINⅠ, CIN Ⅱ-Ⅲ, cervical squamous cell carcinoma and cervica1 adenocarcinoma respectively, and the results showed that hTERC amplification rate was significantly higher in group CIN Ⅱ-Ⅲthan in group CINⅠ(P 0.05. Conclusion 　Detection of gene amplification by FISH technology can be used as a means for accurate diagnosis and prediction of the histologically difficult-to-diagnose lesion and for risk assessment after treatment of cervical precancerous lesions.

A Multiplex SYBR Green Real-Time PCR Assay for the Detection of Three Colistin Resistance Genes from Cultured Bacteria, Feces, and Environment Samples

Directory of Open Access Journals (Sweden)

Jiyun Li

2017-10-01

Full Text Available The aim of the study was to develop a multiplex assay for rapid detection of mcr-1, mcr-2, and mcr-3, a group of genes of conferring resistance to colistin mediated by plasmid in Enterobacteriaceae. A SYBR Green based real-time PCR assay has been designed to detect the mcr genes, and applied to cultured bacteria, feces and soil samples. All three mcr genes could be detected with a lower limit of 102 cultured bacteria. This test was highly specific and sensitive, and generated no false-positive results. The assay was also conclusive when applied to feces and soil samples containing mcr-1-positive Escherichia coli, which could facilitate the screening of mcr genes not only in the bacteria, but also directly from the environment. This simple, rapid, sensitive, and specific multiplex assay will be useful for rapid screening of the colistin resistance in both clinical medicine and animal husbandry.

Genome-Wide Detection and Analysis of Multifunctional Genes

Science.gov (United States)

Pritykin, Yuri; Ghersi, Dario; Singh, Mona

2015-01-01

Many genes can play a role in multiple biological processes or molecular functions. Identifying multifunctional genes at the genome-wide level and studying their properties can shed light upon the complexity of molecular events that underpin cellular functioning, thereby leading to a better understanding of the functional landscape of the cell. However, to date, genome-wide analysis of multifunctional genes (and the proteins they encode) has been limited. Here we introduce a computational approach that uses known functional annotations to extract genes playing a role in at least two distinct biological processes. We leverage functional genomics data sets for three organisms—H. sapiens, D. melanogaster, and S. cerevisiae—and show that, as compared to other annotated genes, genes involved in multiple biological processes possess distinct physicochemical properties, are more broadly expressed, tend to be more central in protein interaction networks, tend to be more evolutionarily conserved, and are more likely to be essential. We also find that multifunctional genes are significantly more likely to be involved in human disorders. These same features also hold when multifunctionality is defined with respect to molecular functions instead of biological processes. Our analysis uncovers key features about multifunctional genes, and is a step towards a better genome-wide understanding of gene multifunctionality. PMID:26436655

Robust multi-tissue gene panel for cancer detection

Directory of Open Access Journals (Sweden)

Talantov Dmitri

2010-06-01

Full Text Available Abstract Background We have identified a set of genes whose relative mRNA expression levels in various solid tumors can be used to robustly distinguish cancer from matching normal tissue. Our current feature set consists of 113 gene probes for 104 unique genes, originally identified as differentially expressed in solid primary tumors in microarray data on Affymetrix HG-U133A platform in five tissue types: breast, colon, lung, prostate and ovary. For each dataset, we first identified a set of genes significantly differentially expressed in tumor vs. normal tissue at p-value = 0.05 using an experimentally derived error model. Our common cancer gene panel is the intersection of these sets of significantly dysregulated genes and can distinguish tumors from normal tissue on all these five tissue types. Methods Frozen tumor specimens were obtained from two commercial vendors Clinomics (Pittsfield, MA and Asterand (Detroit, MI. Biotinylated targets were prepared using published methods (Affymetrix, CA and hybridized to Affymetrix U133A GeneChips (Affymetrix, CA. Expression values for each gene were calculated using Affymetrix GeneChip analysis software MAS 5.0. We then used a software package called Genes@Work for differential expression discovery, and SVM light linear kernel for building classification models. Results We validate the predictability of this gene list on several publicly available data sets generated on the same platform. Of note, when analysing the lung cancer data set of Spira et al, using an SVM linear kernel classifier, our gene panel had 94.7% leave-one-out accuracy compared to 87.8% using the gene panel in the original paper. In addition, we performed high-throughput validation on the Dana Farber Cancer Institute GCOD database and several GEO datasets. Conclusions Our result showed the potential for this panel as a robust classification tool for multiple tumor types on the Affymetrix platform, as well as other whole genome arrays

Detection of the Helicobacter pylori dupA gene is strongly affected by the PCR design

NARCIS (Netherlands)

Abadi, Amin Talebi Bezmin; Loffeld, Ruud J L F; Constancia, Ashandra C; Wagenaar, Jaap A; Kusters, Johannes G

2014-01-01

The Helicobacter pylori virulence gene dupA is usually detected by PCR, but the primer binding sites used are highly variable. Our newly designed qPCR against a conserved region of dupA was positive in 64.2% of 394 clinical isolates while the positivity rate of the commonly used PCRs ranged from

Heteroduplex analysis of the dystrophin gene: Application to point mutation and carrier detection

Energy Technology Data Exchange (ETDEWEB)

Prior, T.W.; Papp, A.C.; Snyder, P.J.; Sedra, M.S.; Western, L.M.; Bartolo, C.; Mendell, J.R. [Ohio State Univ., Columbus, OH (United States); Moxley, R.T. [Univ. of Rochester Medical Center, NY (United States)

1994-03-01

Approximately one-third of Duchenne muscular dystrophy patients have undefined mutations in the dystrophin gene. For carrier and prenatal studies in families without detectable mutations, the indirect restriction fragment length polymorphism linkage approach is used. Using a multiplex amplification and heteroduplex analysis of dystrophin exons, the authors identified nonsense mutations in two DMD patients. Although the nonsense mutations are predicted to severely truncate the dystrophin protein, both patients presented with mild clinical courses of the disease. As a result of identifying the mutation in the affected boys, direct carrier studies by heteroduplex analysis were extended to other relatives. The authors conclude that the technique is not only ideal for mutation detection but is also useful for diagnostic testing. 29 refs., 4 figs.

Multiplex Real-Time PCR for Detection of Staphylococcus aureus, mecA and Panton-Valentine Leukocidin (PVL) Genes from Selective Enrichments from Animals and Retail Meat

Science.gov (United States)

Velasco, Valeria; Sherwood, Julie S.; Rojas-García, Pedro P.; Logue, Catherine M.

2014-01-01

The aim of this study was to compare a real-time PCR assay, with a conventional culture/PCR method, to detect S. aureus, mecA and Panton-Valentine Leukocidin (PVL) genes in animals and retail meat, using a two-step selective enrichment protocol. A total of 234 samples were examined (77 animal nasal swabs, 112 retail raw meat, and 45 deli meat). The multiplex real-time PCR targeted the genes: nuc (identification of S. aureus), mecA (associated with methicillin resistance) and PVL (virulence factor), and the primary and secondary enrichment samples were assessed. The conventional culture/PCR method included the two-step selective enrichment, selective plating, biochemical testing, and multiplex PCR for confirmation. The conventional culture/PCR method recovered 95/234 positive S. aureus samples. Application of real-time PCR on samples following primary and secondary enrichment detected S. aureus in 111/234 and 120/234 samples respectively. For detection of S. aureus, the kappa statistic was 0.68–0.88 (from substantial to almost perfect agreement) and 0.29–0.77 (from fair to substantial agreement) for primary and secondary enrichments, using real-time PCR. For detection of mecA gene, the kappa statistic was 0–0.49 (from no agreement beyond that expected by chance to moderate agreement) for primary and secondary enrichment samples. Two pork samples were mecA gene positive by all methods. The real-time PCR assay detected the mecA gene in samples that were negative for S. aureus, but positive for Staphylococcus spp. The PVL gene was not detected in any sample by the conventional culture/PCR method or the real-time PCR assay. Among S. aureus isolated by conventional culture/PCR method, the sequence type ST398, and multi-drug resistant strains were found in animals and raw meat samples. The real-time PCR assay may be recommended as a rapid method for detection of S. aureus and the mecA gene, with further confirmation of methicillin-resistant S. aureus (MRSA) using

Multiplex real-time PCR for detection of Staphylococcus aureus, mecA and Panton-Valentine Leukocidin (PVL genes from selective enrichments from animals and retail meat.

Directory of Open Access Journals (Sweden)

Valeria Velasco

Full Text Available The aim of this study was to compare a real-time PCR assay, with a conventional culture/PCR method, to detect S. aureus, mecA and Panton-Valentine Leukocidin (PVL genes in animals and retail meat, using a two-step selective enrichment protocol. A total of 234 samples were examined (77 animal nasal swabs, 112 retail raw meat, and 45 deli meat. The multiplex real-time PCR targeted the genes: nuc (identification of S. aureus, mecA (associated with methicillin resistance and PVL (virulence factor, and the primary and secondary enrichment samples were assessed. The conventional culture/PCR method included the two-step selective enrichment, selective plating, biochemical testing, and multiplex PCR for confirmation. The conventional culture/PCR method recovered 95/234 positive S. aureus samples. Application of real-time PCR on samples following primary and secondary enrichment detected S. aureus in 111/234 and 120/234 samples respectively. For detection of S. aureus, the kappa statistic was 0.68-0.88 (from substantial to almost perfect agreement and 0.29-0.77 (from fair to substantial agreement for primary and secondary enrichments, using real-time PCR. For detection of mecA gene, the kappa statistic was 0-0.49 (from no agreement beyond that expected by chance to moderate agreement for primary and secondary enrichment samples. Two pork samples were mecA gene positive by all methods. The real-time PCR assay detected the mecA gene in samples that were negative for S. aureus, but positive for Staphylococcus spp. The PVL gene was not detected in any sample by the conventional culture/PCR method or the real-time PCR assay. Among S. aureus isolated by conventional culture/PCR method, the sequence type ST398, and multi-drug resistant strains were found in animals and raw meat samples. The real-time PCR assay may be recommended as a rapid method for detection of S. aureus and the mecA gene, with further confirmation of methicillin-resistant S. aureus (MRSA

Detection of Balamuthia mandrillaris DNA by real-time PCR targeting the RNase P gene

Directory of Open Access Journals (Sweden)

Lewin Astrid

2008-12-01

Full Text Available Abstract Background The free-living amoeba Balamuthia mandrillaris may cause fatal encephalitis both in immunocompromised and in – apparently – immunocompetent humans and other mammalian species. Rapid, specific, sensitive, and reliable detection requiring little pathogen-specific expertise is an absolute prerequisite for a successful therapy and a welcome tool for both experimental and epidemiological research. Results A real-time polymerase chain reaction assay using TaqMan® probes (real-time PCR was established specifically targeting the RNase P gene of B. mandrillaris amoebae. The assay detected at least 2 (down to 0.5 genomes of B. mandrillaris grown in axenic culture. It did not react with DNA from closely related Acanthamoeba (3 species, nor with DNA from Toxoplasma gondii, Leishmania major, Pneumocystis murina, Mycobacterium bovis (BCG, human brain, various mouse organs, or from human and murine cell lines. The assay efficiently detected B. mandrillaris DNA in spiked cell cultures, spiked murine organ homogenates, B. mandrillaris-infected mice, and CNS tissue-DNA preparations from 2 patients with proven cerebral balamuthiasis. This novel primer set was successfully combined with a published set that targets the B. mandrillaris 18S rRNA gene in a duplex real-time PCR assay to ensure maximum specificity and as a precaution against false negative results. Conclusion A real-time PCR assay for B. mandrillaris amoebae is presented, that is highly specific, sensitive, and reliable and thus suited both for diagnosis and for research.

Sex determination in femurs of modern Egyptians: A comparative study between metric measurements and SRY gene detection

Directory of Open Access Journals (Sweden)

Iman F. Gaballah

2014-12-01

Conclusion: The SRY gene detection method for sex determination is quick and simple, requiring only one PCR reaction. It corroborates the results obtained from anatomical measurements and further confirms the sex of the femur bone in question.

Detection of OXA-Type Carbapenemase Genes in Acinetobacter baumannii Isolates from Nosocomial Infections in Isfahan Hospitals, Iran

Directory of Open Access Journals (Sweden)

Vajihe Karbasizade

2016-02-01

Full Text Available "> Background: Acinetobacter baumannii as one of the causes of nosocomial infections has becomeresistant to almost all antimicrobial agents. The emergence of resistance to carbapenems, one ofthe last drugs on the shelf, is the major concern about A. baumannii antimicrobial resistance.Resistance to carbapenems is mediated by production of class B and D carbapenemases. The aimof this study was to detect the resistance genes including blaOXA-23, 24, 51, and 58 in A. baumanniiisolates from nosocomial infections in Isfahan hospitals.Methods: A total number of 456 clinical specimens were collected from nosocomial infections andevaluated in order to isolate A. baumannii strains. After identification of the isolates, the antibioticsensitivity to carbapenems was assessed using disk diffusion method. The resistance genes of blaOXA-23, 24, 51, and 58 were detected by multiplex PCR method.Results: Fifty A. baumannii isolates were isolated from clinical specimens. Fifty two percent ofthe isolates showed phenotypic resistance to the carbapenems (imipenem and meropenem.According to PCR results, 88% of resistant isolates had ≥1 blaOXA gene. The frequency of resistantisolates bearing blaOXA-23, blaOXA-24 and blaOXA-58 were 77%, 38% and 15% respectively.Conclusions: This study showed the high frequency of carbapenem resistance genes among A.baumannii isolates. Therefore, adopting an appropriate strategy to confine the spreading of thesestrains and also implementing new treatment regimens are necessary.

Spectral Analysis on Time-Course Expression Data: Detecting Periodic Genes Using a Real-Valued Iterative Adaptive Approach

Directory of Open Access Journals (Sweden)

Kwadwo S. Agyepong

2013-01-01

Full Text Available Time-course expression profiles and methods for spectrum analysis have been applied for detecting transcriptional periodicities, which are valuable patterns to unravel genes associated with cell cycle and circadian rhythm regulation. However, most of the proposed methods suffer from restrictions and large false positives to a certain extent. Additionally, in some experiments, arbitrarily irregular sampling times as well as the presence of high noise and small sample sizes make accurate detection a challenging task. A novel scheme for detecting periodicities in time-course expression data is proposed, in which a real-valued iterative adaptive approach (RIAA, originally proposed for signal processing, is applied for periodogram estimation. The inferred spectrum is then analyzed using Fisher’s hypothesis test. With a proper -value threshold, periodic genes can be detected. A periodic signal, two nonperiodic signals, and four sampling strategies were considered in the simulations, including both bursts and drops. In addition, two yeast real datasets were applied for validation. The simulations and real data analysis reveal that RIAA can perform competitively with the existing algorithms. The advantage of RIAA is manifested when the expression data are highly irregularly sampled, and when the number of cycles covered by the sampling time points is very reduced.

Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

Science.gov (United States)

Furlan, João Pedro Rueda; Stehling, Eliana Guedes

2018-01-10

β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

ICGE: an R package for detecting relevant clusters and atypical units in gene expression

Directory of Open Access Journals (Sweden)

Irigoien Itziar

2012-02-01

Full Text Available Abstract Background Gene expression technologies have opened up new ways to diagnose and treat cancer and other diseases. Clustering algorithms are a useful approach with which to analyze genome expression data. They attempt to partition the genes into groups exhibiting similar patterns of variation in expression level. An important problem associated with gene classification is to discern whether the clustering process can find a relevant partition as well as the identification of new genes classes. There are two key aspects to classification: the estimation of the number of clusters, and the decision as to whether a new unit (gene, tumor sample... belongs to one of these previously identified clusters or to a new group. Results ICGE is a user-friendly R package which provides many functions related to this problem: identify the number of clusters using mixed variables, usually found by applied biomedical researchers; detect whether the data have a cluster structure; identify whether a new unit belongs to one of the pre-identified clusters or to a novel group, and classify new units into the corresponding cluster. The functions in the ICGE package are accompanied by help files and easy examples to facilitate its use. Conclusions We demonstrate the utility of ICGE by analyzing simulated and real data sets. The results show that ICGE could be very useful to a broad research community.

Efficacy of Exome-Targeted Capture Sequencing to Detect Mutations in Known Cerebellar Ataxia Genes.

Science.gov (United States)

Coutelier, Marie; Hammer, Monia B; Stevanin, Giovanni; Monin, Marie-Lorraine; Davoine, Claire-Sophie; Mochel, Fanny; Labauge, Pierre; Ewenczyk, Claire; Ding, Jinhui; Gibbs, J Raphael; Hannequin, Didier; Melki, Judith; Toutain, Annick; Laugel, Vincent; Forlani, Sylvie; Charles, Perrine; Broussolle, Emmanuel; Thobois, Stéphane; Afenjar, Alexandra; Anheim, Mathieu; Calvas, Patrick; Castelnovo, Giovanni; de Broucker, Thomas; Vidailhet, Marie; Moulignier, Antoine; Ghnassia, Robert T; Tallaksen, Chantal; Mignot, Cyril; Goizet, Cyril; Le Ber, Isabelle; Ollagnon-Roman, Elisabeth; Pouget, Jean; Brice, Alexis; Singleton, Andrew; Durr, Alexandra

2018-05-01

Molecular diagnosis is difficult to achieve in disease groups with a highly heterogeneous genetic background, such as cerebellar ataxia (CA). In many patients, candidate gene sequencing or focused resequencing arrays do not allow investigators to reach a genetic conclusion. To assess the efficacy of exome-targeted capture sequencing to detect mutations in genes broadly linked to CA in a large cohort of undiagnosed patients and to investigate their prevalence. Three hundred nineteen index patients with CA and without a history of dominant transmission were included in the this cohort study by the Spastic Paraplegia and Ataxia Network. Centralized storage was in the DNA and cell bank of the Brain and Spine Institute, Salpetriere Hospital, Paris, France. Patients were classified into 6 clinical groups, with the largest being those with spastic ataxia (ie, CA with pyramidal signs [n = 100]). Sequencing was performed from January 1, 2014, through December 31, 2016. Detected variants were classified as very probably or definitely causative, possibly causative, or of unknown significance based on genetic evidence and genotype-phenotype considerations. Identification of variants in genes broadly linked to CA, classified in pathogenicity groups. The 319 included patients had equal sex distribution (160 female [50.2%] and 159 male patients [49.8%]; mean [SD] age at onset, 27.9 [18.6] years). The age at onset was younger than 25 years for 131 of 298 patients (44.0%) with complete clinical information. Consanguinity was present in 101 of 298 (33.9%). Very probable or definite diagnoses were achieved for 72 patients (22.6%), with an additional 19 (6.0%) harboring possibly pathogenic variants. The most frequently mutated genes were SPG7 (n = 14), SACS (n = 8), SETX (n = 7), SYNE1 (n = 6), and CACNA1A (n = 6). The highest diagnostic rate was obtained for patients with an autosomal recessive CA with oculomotor apraxia-like phenotype (6 of 17 [35.3%]) or

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

Science.gov (United States)

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Detection of copy number variants reveals association of cilia genes with neural tube defects.

Directory of Open Access Journals (Sweden)

Xiaoli Chen

Full Text Available BACKGROUND: Neural tube defects (NTDs are one of the most common birth defects caused by a combination of genetic and environmental factors. Currently, little is known about the genetic basis of NTDs although up to 70% of human NTDs were reported to be attributed to genetic factors. Here we performed genome-wide copy number variants (CNVs detection in a cohort of Chinese NTD patients in order to exam the potential role of CNVs in the pathogenesis of NTDs. METHODS: The genomic DNA from eighty-five NTD cases and seventy-five matched normal controls were subjected for whole genome CNVs analysis. Non-DGV (the Database of Genomic Variants CNVs from each group were further analyzed for their associations with NTDs. Gene content in non-DGV CNVs as well as participating pathways were examined. RESULTS: Fifty-five and twenty-six non-DGV CNVs were detected in cases and controls respectively. Among them, forty and nineteen CNVs involve genes (genic CNV. Significantly more non-DGV CNVs and non-DGV genic CNVs were detected in NTD patients than in control (41.2% vs. 25.3%, p<0.05 and 37.6% vs. 20%, p<0.05. Non-DGV genic CNVs are associated with a 2.65-fold increased risk for NTDs (95% CI: 1.24-5.87. Interestingly, there are 41 cilia genes involved in non-DGV CNVs from NTD patients which is significantly enriched in cases compared with that in controls (24.7% vs. 9.3%, p<0.05, corresponding with a 3.19-fold increased risk for NTDs (95% CI: 1.27-8.01. Pathway analyses further suggested that two ciliogenesis pathways, tight junction and protein kinase A signaling, are top canonical pathways implicated in NTD-specific CNVs, and these two novel pathways interact with known NTD pathways. CONCLUSIONS: Evidence from the genome-wide CNV study suggests that genic CNVs, particularly ciliogenic CNVs are associated with NTDs and two ciliogenesis pathways, tight junction and protein kinase A signaling, are potential pathways involved in NTD pathogenesis.

Evaluation of an expanded microarray for detecting antibiotic resistance genes in a broad range of gram-negative bacterial pathogens.

Science.gov (United States)

Card, Roderick; Zhang, Jiancheng; Das, Priya; Cook, Charlotte; Woodford, Neil; Anjum, Muna F

2013-01-01

A microarray capable of detecting genes for resistance to 75 clinically relevant antibiotics encompassing 19 different antimicrobial classes was tested on 132 Gram-negative bacteria. Microarray-positive results correlated >91% with antimicrobial resistance phenotypes, assessed using British Society for Antimicrobial Chemotherapy clinical breakpoints; the overall test specificity was >83%. Microarray-positive results without a corresponding resistance phenotype matched 94% with PCR results, indicating accurate detection of genes present in the respective bacteria by microarray when expression was low or absent and, hence, undetectable by susceptibility testing. The low sensitivity and negative predictive values of the microarray results for identifying resistance to some antimicrobial resistance classes are likely due to the limited number of resistance genes present on the current microarray for those antimicrobial agents or to mutation-based resistance mechanisms. With regular updates, this microarray can be used for clinical diagnostics to help accurate therapeutic options to be taken following infection with multiple-antibiotic-resistant Gram-negative bacteria and prevent treatment failure.

Establishing a novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure for the direct detection of gene doping.

Science.gov (United States)

Beiter, Thomas; Zimmermann, Martina; Fragasso, Annunziata; Armeanu, Sorin; Lauer, Ulrich M; Bitzer, Michael; Su, Hua; Young, William L; Niess, Andreas M; Simon, Perikles

2008-01-01

So far, the abuse of gene transfer technology in sport, so-called gene doping, is undetectable. However, recent studies in somatic gene therapy indicate that long-term presence of transgenic DNA (tDNA) following various gene transfer protocols can be found in DNA isolated from whole blood using conventional PCR protocols. Application of these protocols for the direct detection of gene doping would require almost complete knowledge about the sequence of the genetic information that has been transferred. Here, we develop and describe the novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure that overcomes this difficulty. Apart from the interesting perspectives that this spiPCR procedure offers in the fight against gene doping, this technology could also be of interest in biodistribution and biosafety studies for gene therapeutic applications.

Detecting microRNA activity from gene expression data

LENUS (Irish Health Repository)

Madden, Stephen F

2010-05-18

Abstract Background MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression by binding to the messenger RNA (mRNA) of protein coding genes. They control gene expression by either inhibiting translation or inducing mRNA degradation. A number of computational techniques have been developed to identify the targets of miRNAs. In this study we used predicted miRNA-gene interactions to analyse mRNA gene expression microarray data to predict miRNAs associated with particular diseases or conditions. Results Here we combine correspondence analysis, between group analysis and co-inertia analysis (CIA) to determine which miRNAs are associated with differences in gene expression levels in microarray data sets. Using a database of miRNA target predictions from TargetScan, TargetScanS, PicTar4way PicTar5way, and miRanda and combining these data with gene expression levels from sets of microarrays, this method produces a ranked list of miRNAs associated with a specified split in samples. We applied this to three different microarray datasets, a papillary thyroid carcinoma dataset, an in-house dataset of lipopolysaccharide treated mouse macrophages, and a multi-tissue dataset. In each case we were able to identified miRNAs of biological importance. Conclusions We describe a technique to integrate gene expression data and miRNA target predictions from multiple sources.

Detecting microRNA activity from gene expression data.

LENUS (Irish Health Repository)

Madden, Stephen F

2010-01-01

BACKGROUND: MicroRNAs (miRNAs) are non-coding RNAs that regulate gene expression by binding to the messenger RNA (mRNA) of protein coding genes. They control gene expression by either inhibiting translation or inducing mRNA degradation. A number of computational techniques have been developed to identify the targets of miRNAs. In this study we used predicted miRNA-gene interactions to analyse mRNA gene expression microarray data to predict miRNAs associated with particular diseases or conditions. RESULTS: Here we combine correspondence analysis, between group analysis and co-inertia analysis (CIA) to determine which miRNAs are associated with differences in gene expression levels in microarray data sets. Using a database of miRNA target predictions from TargetScan, TargetScanS, PicTar4way PicTar5way, and miRanda and combining these data with gene expression levels from sets of microarrays, this method produces a ranked list of miRNAs associated with a specified split in samples. We applied this to three different microarray datasets, a papillary thyroid carcinoma dataset, an in-house dataset of lipopolysaccharide treated mouse macrophages, and a multi-tissue dataset. In each case we were able to identified miRNAs of biological importance. CONCLUSIONS: We describe a technique to integrate gene expression data and miRNA target predictions from multiple sources.

Palindromic Molecule Beacon-Based Cascade Amplification for Colorimetric Detection of Cancer Genes.

Science.gov (United States)

Shen, Zhi-Fa; Li, Feng; Jiang, Yi-Fan; Chen, Chang; Xu, Huo; Li, Cong-Cong; Yang, Zhe; Wu, Zai-Sheng

2018-03-06

A highly sensitive and selective colorimetric assay based on a multifunctional molecular beacon with palindromic tail (PMB) was proposed for the detection of target p53 gene. The PMB probe can serve as recognition element, primer, and polymerization template and contains a nicking site and a C-rich region complementary to a DNAzyme. In the presence of target DNA, the hairpin of PMB is opened, and the released palindromic tails intermolecularly hybridize with each other, triggering the autonomous polymerization/nicking/displacement cycles. Although only one type of probe is involved, the system can execute triple and continuous polymerization strand displacement amplifications, generating large amounts of G-quadruplex fragments. These G-rich fragments can bind to hemin and form the DNAzymes that possess the catalytic activity similar to horseradish peroxidase, catalyzing the oxidation of ABTS by H 2 O 2 and producing the colorimetric signal. Utilizing the newly proposed sensing system, target DNA can be detected down to 10 pM with a linear response range from 10 pM to 200 nM, and mutant target DNAs are able to be distinguished even by the naked eye. The desirable detection sensitivity, high specificity, and operation convenience without any separation step and chemical modification demonstrate that the palindromic molecular beacon holds the potential for detecting and monitoring a variety of nucleic acid-related biomarkers.

The application of reporter gene assays for the detection of endocrine disruptors in sport supplements

Energy Technology Data Exchange (ETDEWEB)

Plotan, Monika; Elliott, Christopher T. [Institute of Agri-Food and Land Use, School of Biological Sciences, Queen' s University Belfast, Belfast BT95AG, Northern Ireland (United Kingdom); Scippo, Marie Louise [Department of Food Sciences, University of Liege, 4000 Liege (Belgium); Muller, Marc [Molecular Biology and Genetic Engineering GIGA-R, University of Liege, 4000 Liege (Belgium); Antignac, Jean-Philippe [LABERCA, ENVN, USC INRA 2013, BP 50707, 44 307, Nantes (France); Malone, Edward [The State Laboratory, Young' s Cross, Celbridge, Co. Kildare (Ireland); Bovee, Toine F.H. [RIKILT Institute of Food Safety, P.O. Box 230, AE Wageningen 6700 (Netherlands); Mitchell, Samuel [Agri-Food and Biosciences Institute, Belfast BT9 5PX (United Kingdom); Connolly, Lisa, E-mail: l.connolly@qub.ac.uk [Institute of Agri-Food and Land Use, School of Biological Sciences, Queen' s University Belfast, Belfast BT95AG, Northern Ireland (United Kingdom)

2011-08-26

The increasing availability and use of sports supplements is of concern as highlighted by a number of studies reporting endocrine disruptor contamination in such products. The health food supplement market, including sport supplements, is growing across the Developed World. Therefore, the need to ensure the quality and safety of sport supplements for the consumer is essential. The development and validation of two reporter gene assays coupled with solid phase sample preparation enabling the detection of estrogenic and androgenic constituents in sport supplements is reported. Both assays were shown to be of high sensitivity with the estrogen and androgen reporter gene assays having an EC{sub 50} of 0.01 ng mL{sup -1} and 0.16 ng mL{sup -1} respectively. The developed assays were applied in a survey of 63 sport supplements samples obtained across the Island of Ireland with an additional seven reference samples previously investigated using LC-MS/MS. Androgen and estrogen bio-activity was found in 71% of the investigated samples. Bio-activity profiling was further broken down into agonists, partial agonists and antagonists. Supplements (13) with the strongest estrogenic bio-activity were chosen for further investigation. LC-MS/MS analysis of these samples determined the presence of phytoestrogens in seven of them. Supplements (38) with androgen bio-activity were also selected for further investigation. Androgen agonist bio-activity was detected in 12 supplements, antagonistic bio-activity was detected in 16 and partial antagonistic bio-activity was detected in 10. A further group of supplements (7) did not present androgenic bio-activity when tested alone but enhanced the androgenic agonist bio-activity of dihydrotestosterone when combined. The developed assays offer advantages in detection of known, unknown and low-level mixtures of endocrine disruptors over existing analytical screening techniques. For the detection and identification of constituent hormonally

Sensitivity and Frequencies of Dystrophin Gene Mutations in Thai DMD/BMD Patients As Detected by Multiplex PCR

Directory of Open Access Journals (Sweden)

Thanyachai Sura

2008-01-01

Full Text Available Background: Duchenne muscular dystrophy (DMD, a lethal X-linked disease affecting 1 in 3500 male births, and its more benign variant, Becker muscular dystrophy (BMD, are caused by mutations in the dystrophin gene. Because of its large size, analysing the whole gene is impractical. Methods have been developed to detect the commonest mutations i.e. the deletions of the exons. Although these tests are highly specific, their sensitivity is inherently limited by the prevalence of deletions, which differs among different populations.

[Prokaryotic expression of vp3 gene of Muscovy duck parvovirus, and its antiserum preparation for detection of virus multiplication].

Science.gov (United States)

Huang, Yu; Zhu, Yumin; Dong, Shijuan; Yu, Ruisong; Zhang, Yuanshu; Li, Zhen

2015-01-01

New epidemic broke out in recent year which was suspected to be caused by variant Muscovy duck parvovirus (MDPV). For this reason, new MDPV detection methods are needed for the new virus strains. In this study, a pair of primers were designed according to the full-length genome of MDPV strain SAAS-SHNH, which were identified in 2012, and were used to amplify the vp3 gene of MDPV by polymerase chain reaction. After being sequenced, the vp3 gene was subcloned into the prokaryotic expression vector PET28a. The recombinant plasmid was transformed into E. coli BL21 and induced with IPTG. SDS-PAGE and Western blotting analysis showed the MDPV vp3 gene was successfully expressed. After being purified by Ni2+ affinity chromatography system, the recombinant protein was used as antigen to immunize rabbits to obtain antiserum. Western blotting analysis showed that the acquired antiserum could react specifically with VP3 protein of J3D6 strain and MDPV vaccine strain. The antiserum could also be used for detection of cultured MDPV from primary duck embryo fibroblasts by immune fluorescence assay (IFA). It could be concluded that the VP3 protein and its antibody prepared in the research could be used for detection of VP3 antiserum and antigen respectively.

Comparative evaluation of PCR amplification of RLEP, 16S rRNA, rpoT and Sod A gene targets for detection of M. leprae DNA from clinical and environmental samples.

Science.gov (United States)

Turankar, Ravindra P; Pandey, Shradha; Lavania, Mallika; Singh, Itu; Nigam, Astha; Darlong, Joydeepa; Darlong, Fam; Sengupta, Utpal

2015-03-01

PCR assay is a highly sensitive, specific and reliable diagnostic tool for the identification of pathogens in many infectious diseases. Genome sequencing Mycobacterium leprae revealed several gene targets that could be used for the detection of DNA from clinical and environmental samples. The PCR sensitivity of particular gene targets for specific clinical and environmental isolates has not yet been established. The present study was conducted to compare the sensitivity of RLEP, rpoT, Sod A and 16S rRNA gene targets in the detection of M. leprae in slit skin smear (SSS), blood, soil samples of leprosy patients and their surroundings. Leprosy patients were classified into Paucibacillary (PB) and Multibacillary (MB) types. Ziehl-Neelsen (ZN) staining method for all the SSS samples and Bacteriological Index (BI) was calculated for all patients. Standard laboratory protocol was used for DNA extraction from SSS, blood and soil samples. PCR technique was performed for the detection of M. leprae DNA from all the above-mentioned samples. RLEP gene target was able to detect the presence of M. leprae in 83% of SSS, 100% of blood samples and in 36% of soil samples and was noted to be the best out of all other gene targets (rpoT, Sod A and 16S rRNA). It was noted that the RLEP gene target was able to detect the highest number (53%) of BI-negative leprosy patients amongst all the gene targets used in this study. Amongst all the gene targets used in this study, PCR positivity using RLEP gene target was the highest in all the clinical and environmental samples. Further, the RLEP gene target was able to detect 53% of blood samples as positive in BI-negative leprosy cases indicating its future standardization and use for diagnostic purposes. Copyright © 2015 Asian African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.

Construction of a gene bank and use of the chromosome walking technique for the detection of new putative agrocin genes in Agrobacterium tumefaciens strain D286

International Nuclear Information System (INIS)

Herrera, G.

1987-02-01

A gene bank of Agrobacterium tumefaciens D286 wt has been constructed by cloning D286 wt DNA partially digested with EcoRI in the cosmid vector pLAFRI. The library; composed of 1750 members with a 27.7 kb average insert size was probed with pCDTn5-3, a cosmid vector carrying a D286:: Tn5 insert from the strain D286:: Tn5 Ag-. One recombinant cosmid of the library, pCDO932, was detected. The insert DNA of pCDO932 has sequences homologous to the D286:: Tn5 insert of pCDTn5-3, therefore it carries putative wt agrocin D286 genes. The insert DNA of pCDO932 was isolated and used to probe the D286 wt gene library. Chromosome walking resulted in the detection of pCD2375. EcoRI restriction digestions and DNA homology studies of pCDO932 and pCD2375 showed that their D286 wt inserts are both composed of 4 EcoRI DNA sub-fragments totalling 21.8 and 24.8 kb respectively, with an overlapping sequence extending 3.5 kb. In order to overcome the failure to detect A. tumefaciens cells transformed with pCDO932. Vectors pSUP204-1 was constructed. Such vector has been derived from pSUP204 which were slightly altered by cloning into it a 700 bp λ DNA SalI fragmet. This resulted in insertion inactivation of the Tc r gene, allows the use of pSUP204-1 as a subcloning vector in conjugations and transformations involving pCDO932 or pCD2375 and strains D286:: Tn5 Ag- and C58 C1G. Two recombinant cosmids bearing D286 wt DNA inserts, at least one of which (pCDO932) contains DNA sequences putatively affecting agrocin D286 production, are now available for further genetic manipulations. pSUP204-1 should prove useful as a subcloning vector for transformations and conjugations involving recombinant cosmids from the D286 wt gene bank and Agrobacterium strains. Future work on the molecular biology of agrocin D286 production is discussed. The DNA probe used in this study was labelled with phosphorus 32

Fully automated pipeline for detection of sex linked genes using RNA-Seq data.

Science.gov (United States)

Michalovova, Monika; Kubat, Zdenek; Hobza, Roman; Vyskot, Boris; Kejnovsky, Eduard

2015-03-11

Sex chromosomes present a genomic region which to some extent, differs between the genders of a single species. Reliable high-throughput methods for detection of sex chromosomes specific markers are needed, especially in species where genome information is limited. Next generation sequencing (NGS) opens the door for identification of unique sequences or searching for nucleotide polymorphisms between datasets. A combination of classical genetic segregation analysis along with RNA-Seq data can present an ideal tool to map and identify sex chromosome-specific expressed markers. To address this challenge, we established genetic cross of dioecious plant Rumex acetosa and generated RNA-Seq data from both parental generation and male and female offspring. We present a pipeline for detection of sex linked genes based on nucleotide polymorphism analysis. In our approach, tracking of nucleotide polymorphisms is carried out using a cross of preferably distant populations. For this reason, only 4 datasets are needed - reads from high-throughput sequencing platforms for parent generation (mother and father) and F1 generation (male and female progeny). Our pipeline uses custom scripts together with external assembly, mapping and variant calling software. Given the resource-intensive nature of the computation, servers with high capacity are a requirement. Therefore, in order to keep this pipeline easily accessible and reproducible, we implemented it in Galaxy - an open, web-based platform for data-intensive biomedical research. Our tools are present in the Galaxy Tool Shed, from which they can be installed to any local Galaxy instance. As an output of the pipeline, user gets a FASTA file with candidate transcriptionally active sex-linked genes, sorted by their relevance. At the same time, a BAM file with identified genes and alignment of reads is also provided. Thus, polymorphisms following segregation pattern can be easily visualized, which significantly enhances primer design

Bayesian logistic regression in detection of gene-steroid interaction for cancer at PDLIM5 locus.

Science.gov (United States)

Wang, Ke-Sheng; Owusu, Daniel; Pan, Yue; Xie, Changchun

2016-06-01

The PDZ and LIM domain 5 (PDLIM5) gene may play a role in cancer, bipolar disorder, major depression, alcohol dependence and schizophrenia; however, little is known about the interaction effect of steroid and PDLIM5 gene on cancer. This study examined 47 single-nucleotide polymorphisms (SNPs) within the PDLIM5 gene in the Marshfield sample with 716 cancer patients (any diagnosed cancer, excluding minor skin cancer) and 2848 noncancer controls. Multiple logistic regression model in PLINK software was used to examine the association of each SNP with cancer. Bayesian logistic regression in PROC GENMOD in SAS statistical software, ver. 9.4 was used to detect gene- steroid interactions influencing cancer. Single marker analysis using PLINK identified 12 SNPs associated with cancer (Plogistic regression in PROC GENMOD showed that both rs6532496 and rs951613 revealed strong gene-steroid interaction effects (OR=2.18, 95% CI=1.31-3.63 with P = 2.9 × 10⁻³ for rs6532496 and OR=2.07, 95% CI=1.24-3.45 with P = 5.43 × 10⁻³ for rs951613, respectively). Results from Bayesian logistic regression showed stronger interaction effects (OR=2.26, 95% CI=1.2-3.38 for rs6532496 and OR=2.14, 95% CI=1.14-3.2 for rs951613, respectively). All the 12 SNPs associated with cancer revealed significant gene-steroid interaction effects (P logistic regression and OR=2.59, 95% CI=1.4-3.97 from Bayesian logistic regression; respectively). This study provides evidence of common genetic variants within the PDLIM5 gene and interactions between PLDIM5 gene polymorphisms and steroid use influencing cancer.

Gastric adenocarcinoma in common variable immunodeficiency: features of cancer and associated gastritis may be characteristic of the condition.

Science.gov (United States)

De Petris, Giovanni; Dhungel, Bal M; Chen, Longwen; Chang, Yu-Hui H

2014-10-01

Common variable immunodeficiency (CVID) is associated with an increased risk of gastric cancer. The aim of the study was to determine the morphological features of CVID-associated gastric adenocarcinoma (CAGA) and of the background gastritis. The population of gastric cancer patients with CVID of Mayo Clinic in the period 2000-2010 was studied; 6 cases of CVID (2 males, 4 females, average age 47 years, age range 26-71 years) were found in 5793 patients with gastric cancer in the study period. Each patient underwent gastric resection for which histology slides were reviewed. Chronic gastritis variables, CVID-related findings, and features of the adenocarcinoma were recorded. CAGA was of intestinal type, with high number of intratumoral lymphocytes (ITLs). Cancer was diagnosed in younger patients than in the overall population of gastric cancer. Severe atrophic metaplastic pangastritis with extensive dysplasia was present in the background in 4 cases, with features of lymphocytic gastritis in 2 cases. Features of CVID (plasma cells paucity in 4 of 6 cases, lymphoid nodules prominent in four cases) could be detected. In summary, gastric adenocarcinoma at young age with ITLs, accompanied by atrophic metaplastic pangastritis, should alert the pathologist of the possibility of CAGA. It follows that, in presence of those characteristics, the search of CVID-associated abnormalities should be undertaken in the nonneoplastic tissues. © The Author(s) 2014.

Automated Detection of Cancer Associated Genes Using a Combined Fuzzy-Rough-Set-Based F-Information and Water Swirl Algorithm of Human Gene Expression Data.

Directory of Open Access Journals (Sweden)

Pugalendhi Ganesh Kumar

Full Text Available This study describes a novel approach to reducing the challenges of highly nonlinear multiclass gene expression values for cancer diagnosis. To build a fruitful system for cancer diagnosis, in this study, we introduced two levels of gene selection such as filtering and embedding for selection of potential genes and the most relevant genes associated with cancer, respectively. The filter procedure was implemented by developing a fuzzy rough set (FR-based method for redefining the criterion function of f-information (FI to identify the potential genes without discretizing the continuous gene expression values. The embedded procedure is implemented by means of a water swirl algorithm (WSA, which attempts to optimize the rule set and membership function required to classify samples using a fuzzy-rule-based multiclassification system (FRBMS. Two novel update equations are proposed in WSA, which have better exploration and exploitation abilities while designing a self-learning FRBMS. The efficiency of our new approach was evaluated on 13 multicategory and 9 binary datasets of cancer gene expression. Additionally, the performance of the proposed FRFI-WSA method in designing an FRBMS was compared with existing methods for gene selection and optimization such as genetic algorithm (GA, particle swarm optimization (PSO, and artificial bee colony algorithm (ABC on all the datasets. In the global cancer map with repeated measurements (GCM_RM dataset, the FRFI-WSA showed the smallest number of 16 most relevant genes associated with cancer using a minimal number of 26 compact rules with the highest classification accuracy (96.45%. In addition, the statistical validation used in this study revealed that the biological relevance of the most relevant genes associated with cancer and their linguistics detected by the proposed FRFI-WSA approach are better than those in the other methods. The simple interpretable rules with most relevant genes and effectively

A resampling-based meta-analysis for detection of differential gene expression in breast cancer

International Nuclear Information System (INIS)

Gur-Dedeoglu, Bala; Konu, Ozlen; Kir, Serkan; Ozturk, Ahmet Rasit; Bozkurt, Betul; Ergul, Gulusan; Yulug, Isik G

2008-01-01

proposed meta-analysis approach has the ability to detect a set of differentially expressed genes with the least amount of within-group variability, thus providing highly stable gene lists for class prediction. Increased statistical power and stringent filtering criteria used in the present study also make identification of novel candidate genes possible and may provide further insight to improve our understanding of breast cancer development

A resampling-based meta-analysis for detection of differential gene expression in breast cancer

Directory of Open Access Journals (Sweden)

Ergul Gulusan

2008-12-01

-time qRT-PCR supported the meta-analysis results. Conclusion The proposed meta-analysis approach has the ability to detect a set of differentially expressed genes with the least amount of within-group variability, thus providing highly stable gene lists for class prediction. Increased statistical power and stringent filtering criteria used in the present study also make identification of novel candidate genes possible and may provide further insight to improve our understanding of breast cancer development.

Background Adjusted Alignment-Free Dissimilarity Measures Improve the Detection of Horizontal Gene Transfer

Directory of Open Access Journals (Sweden)

Kujin Tang

2018-04-01

Full Text Available Horizontal gene transfer (HGT plays an important role in the evolution of microbial organisms including bacteria. Alignment-free methods based on single genome compositional information have been used to detect HGT. Currently, Manhattan and Euclidean distances based on tetranucleotide frequencies are the most commonly used alignment-free dissimilarity measures to detect HGT. By testing on simulated bacterial sequences and real data sets with known horizontal transferred genomic regions, we found that more advanced alignment-free dissimilarity measures such as CVTree and d2* that take into account the background Markov sequences can solve HGT detection problems with significantly improved performance. We also studied the influence of different factors such as evolutionary distance between host and donor sequences, size of sliding window, and host genome composition on the performances of alignment-free methods to detect HGT. Our study showed that alignment-free methods can predict HGT accurately when host and donor genomes are in different order levels. Among all methods, CVTree with word length of 3, d2* with word length 3, Markov order 1 and d2* with word length 4, Markov order 1 outperform others in terms of their highest F1-score and their robustness under the influence of different factors.

High Resolution Melting Analysis for Detecting p53 Gene Mutations in Patients with Non-small Cell Lung Cancer

Directory of Open Access Journals (Sweden)

Zhihong CHEN

2011-10-01

Full Text Available Background and objective It has been proven that p53 gene was related to many human cancers. The mutations in p53 gene play an important role in carcinogensis and mostly happened in exon 5-8. The aim of this study is to establish a high resolution melting (HRM assay to detect p53 mutations from patients with non-small cell lung cancer (NSCLC, to investigate the characteristics of p53 gene mutations, and to analyze the relationship between p53 mutations and evolution regularity of pathogenesis. Methods p53 mutations in exon 5-8 were detected by HRM assay on DNA insolated from 264 NSCLC samples derived from tumor tissues and 54 control samples from pericancerous pulmonary tissues. The mutation samples by the HRM assay were confirmed by sequencing technique. Samples which were positive by HRM but wild type by sequencing were further confirmed by sub-clone and sequencing. Results No mutation was found in 54 pericancerous pulmonary samples by HRM assay. 104 of the 264 tumor tissues demonstrated mutation curves by HRM assay, 102 samples were confirmed by sequencing, including 95 point mutations and 7 frame shift mutations by insertion or deletion. The mutation rate of p53 gene was 39.4%. The mutation rate from exon 5-8 were 11.7%, 8%, 12.5% and 10.6%, respectively and there was no statistically significant difference between them (P=0.35. p53 mutations were significantly more frequent in males than that in females, but not related to the other clinicopathologic characteristics. Conclusion The results indicate that HRM is a sensitive in-tube methodology to detect for mutations in clinical samples. The results suggest that the arising p53 mutations in NSCLC may be due to spontaneous error in DNA synthesis and repair.

Extending the scope of diagnostic chromosome analysis: detection of single gene defects using high-resolution SNP microarrays.

Science.gov (United States)

Bruno, Damien L; Stark, Zornitza; Amor, David J; Burgess, Trent; Butler, Kathy; Corrie, Sylvea; Francis, David; Ganesamoorthy, Devika; Hills, Louise; James, Paul A; O'Rielly, Darren; Oertel, Ralph; Savarirayan, Ravi; Prabhakara, Krishnamurthy; Salce, Nicholas; Slater, Howard R

2011-12-01

Microarray analysis has provided significant advances in the diagnosis of conditions resulting from submicroscopic chromosome abnormalities. It has been recommended that array testing should be a "first tier" test in the evaluation of individuals with intellectual disability, developmental delay, congenital anomalies, and autism. The availability of arrays with increasingly high probe coverage and resolution has increased the detection of decreasingly small copy number changes (CNCs) down to the intragenic or even exon level. Importantly, arrays that genotype SNPs also detect extended regions of homozygosity. We describe 14 examples of single gene disorders caused by intragenic changes from a consecutive set of 6,500 tests using high-resolution SNP microarrays. These cases illustrate the increased scope of cytogenetic testing beyond dominant chromosome rearrangements that typically contain many genes. Nine of the cases confirmed the clinical diagnosis, that is, followed a "phenotype to genotype" approach. Five were diagnosed by the laboratory analysis in the absence of a specific clinical diagnosis, that is, followed a "genotype to phenotype" approach. Two were clinically significant, incidental findings. The importance of astute clinical assessment and laboratory-clinician consultation is emphasized to optimize the value of microarrays in the diagnosis of disorders caused by single gene copy number and sequence mutations. © 2011 Wiley-Liss, Inc.

Integrative analysis of gene expression and DNA methylation using unsupervised feature extraction for detecting candidate cancer biomarkers.

Science.gov (United States)

Moon, Myungjin; Nakai, Kenta

2018-04-01

Currently, cancer biomarker discovery is one of the important research topics worldwide. In particular, detecting significant genes related to cancer is an important task for early diagnosis and treatment of cancer. Conventional studies mostly focus on genes that are differentially expressed in different states of cancer; however, noise in gene expression datasets and insufficient information in limited datasets impede precise analysis of novel candidate biomarkers. In this study, we propose an integrative analysis of gene expression and DNA methylation using normalization and unsupervised feature extractions to identify candidate biomarkers of cancer using renal cell carcinoma RNA-seq datasets. Gene expression and DNA methylation datasets are normalized by Box-Cox transformation and integrated into a one-dimensional dataset that retains the major characteristics of the original datasets by unsupervised feature extraction methods, and differentially expressed genes are selected from the integrated dataset. Use of the integrated dataset demonstrated improved performance as compared with conventional approaches that utilize gene expression or DNA methylation datasets alone. Validation based on the literature showed that a considerable number of top-ranked genes from the integrated dataset have known relationships with cancer, implying that novel candidate biomarkers can also be acquired from the proposed analysis method. Furthermore, we expect that the proposed method can be expanded for applications involving various types of multi-omics datasets.

PCR-RFLP to Detect Codon 248 Mutation in Exon 7 of "p53" Tumor Suppressor Gene

Science.gov (United States)

Ouyang, Liming; Ge, Chongtao; Wu, Haizhen; Li, Suxia; Zhang, Huizhan

2009-01-01

Individual genome DNA was extracted fast from oral swab and followed up with PCR specific for codon 248 of "p53" tumor suppressor gene. "Msp"I restriction mapping showed the G-C mutation in codon 248, which closely relates to cancer susceptibility. Students learn the concepts, detection techniques, and research significance of point mutations or…

Detection of the Helicobacter pylori dupA gene is strongly affected by the PCR design.

Science.gov (United States)

Abadi, Amin Talebi Bezmin; Loffeld, Ruud J L F; Constancia, Ashandra C; Wagenaar, Jaap A; Kusters, Johannes G

2014-11-01

The Helicobacter pylori virulence gene dupA is usually detected by PCR, but the primer binding sites used are highly variable. Our newly designed qPCR against a conserved region of dupA was positive in 64.2% of 394 clinical isolates while the positivity rate of the commonly used PCRs ranged from 29.9% to 37.8%. Copyright © 2014. Published by Elsevier B.V.

Detection of meca gene from methicillin resistant staphylococcus aureus isolates of north sumatera

Science.gov (United States)

Septiani Nasution, Gabriella; Suryanto, Dwi; Lia Kusumawati, R.

2018-03-01

Methicillin Resistant Staphylococcus aureus (MRSA) is a major pathogen associated with hospital-acquired infections (nosocomial infections). MRSA is a type of S. aureus resistant to the sub-group of beta-lactam antibiotics such as penicillin, cephalosporin, monobactam, and carbapenem. MRSA is resistant because of genetic changes caused by exposure to irrational antibiotic therapy. This study aimed to detect mecA gene in North Sumatra isolates of MRSA and to determine the pattern of antibiotic resistance in S.aureus isolates classified as MRSA by Vitek 2 Compact in the Central Public Hospital Haji Adam Malik, Medan. Samples were 40 isolates of S. aureus classified as MRSA obtained from clinical microbiology specimens. DNA isolation of the isolates was conducted by a method of freeze-thaw cycling. Amplification of mecA gene was done by PCR technique using specific primer for the gene. PCR products were visualized using mini-gel electrophoresis. The results showed that all MRSA isolates showed to have 533 bp band of mecA. Antibiotics test of Vitek 2 Compact showed that despite all isolates were resistant to beta-lactam antibiotics groups; the isolates showed multidrug resistant to other common antibiotics, such as aminoglycosides, macrolides, and fluoroquinolones. However, they were still sensitive to vancomycin (82.5% isolates), linezolid (97.5% isolates), and tigecycline (100% isolates).

CD44 plays a functional role in Helicobacter pylori-induced epithelial cell proliferation.

Directory of Open Access Journals (Sweden)

Nina Bertaux-Skeirik

2015-02-01

Full Text Available The cytotoxin-associated gene (Cag pathogenicity island is a strain-specific constituent of Helicobacter pylori (H. pylori that augments cancer risk. CagA translocates into the cytoplasm where it stimulates cell signaling through the interaction with tyrosine kinase c-Met receptor, leading cellular proliferation. Identified as a potential gastric stem cell marker, cluster-of-differentiation (CD CD44 also acts as a co-receptor for c-Met, but whether it plays a functional role in H. pylori-induced epithelial proliferation is unknown. We tested the hypothesis that CD44 plays a functional role in H. pylori-induced epithelial cell proliferation. To assay changes in gastric epithelial cell proliferation in relation to the direct interaction with H. pylori, human- and mouse-derived gastric organoids were infected with the G27 H. pylori strain or a mutant G27 strain bearing cagA deletion (∆CagA::cat. Epithelial proliferation was quantified by EdU immunostaining. Phosphorylation of c-Met was analyzed by immunoprecipitation followed by Western blot analysis for expression of CD44 and CagA. H. pylori infection of both mouse- and human-derived gastric organoids induced epithelial proliferation that correlated with c-Met phosphorylation. CagA and CD44 co-immunoprecipitated with phosphorylated c-Met. The formation of this complex did not occur in organoids infected with ∆CagA::cat. Epithelial proliferation in response to H. pylori infection was lost in infected organoids derived from CD44-deficient mouse stomachs. Human-derived fundic gastric organoids exhibited an induction in proliferation when infected with H. pylori that was not seen in organoids pre-treated with a peptide inhibitor specific to CD44. In the well-established Mongolian gerbil model of gastric cancer, animals treated with CD44 peptide inhibitor Pep1, resulted in the inhibition of H. pylori-induced proliferation and associated atrophic gastritis. The current study reports a unique

Usual normalization strategies for gene expression studies impair the detection and analysis of circadian patterns.

Science.gov (United States)

Figueredo, Diego de Siqueira; Barbosa, Mayara Rodrigues; Coimbra, Daniel Gomes; Dos Santos, José Luiz Araújo; Costa, Ellyda Fernanda Lopes; Koike, Bruna Del Vechio; Alexandre Moreira, Magna Suzana; de Andrade, Tiago Gomes

2018-03-01

Recent studies have shown that transcriptomes from different tissues present circadian oscillations. Therefore, the endogenous variation of total RNA should be considered as a potential bias in circadian studies of gene expression. However, normalization strategies generally include the equalization of total RNA concentration between samples prior to cDNA synthesis. Moreover, endogenous housekeeping genes (HKGs) frequently used for data normalization may exhibit circadian variation and distort experimental results if not detected or considered. In this study, we controlled experimental conditions from the amount of initial brain tissue samples through extraction steps, cDNA synthesis, and quantitative real time PCR (qPCR) to demonstrate a circadian oscillation of total RNA concentration. We also identified that the normalization of the RNA's yield affected the rhythmic profiles of different genes, including Per1-2 and Bmal1. Five widely used HKGs (Actb, Eif2a, Gapdh, Hprt1, and B2m) also presented rhythmic variations not detected by geNorm algorithm. In addition, the analysis of exogenous microRNAs (Cel-miR-54 and Cel-miR-39) spiked during RNA extraction suggests that the yield was affected by total RNA concentration, which may impact circadian studies of small RNAs. The results indicate that the approach of tissue normalization without total RNA equalization prior to cDNA synthesis can avoid bias from endogenous broad variations in transcript levels. Also, the circadian analysis of 2 -Cycle threshold (Ct) data, without HKGs, may be an alternative for chronobiological studies under controlled experimental conditions.

Evaluation of four endogenous reference genes and their real-time PCR assays for common wheat quantification in GMOs detection.

Science.gov (United States)

Huang, Huali; Cheng, Fang; Wang, Ruoan; Zhang, Dabing; Yang, Litao

2013-01-01

Proper selection of endogenous reference genes and their real-time PCR assays is quite important in genetically modified organisms (GMOs) detection. To find a suitable endogenous reference gene and its real-time PCR assay for common wheat (Triticum aestivum L.) DNA content or copy number quantification, four previously reported wheat endogenous reference genes and their real-time PCR assays were comprehensively evaluated for the target gene sequence variation and their real-time PCR performance among 37 common wheat lines. Three SNPs were observed in the PKABA1 and ALMT1 genes, and these SNPs significantly decreased the efficiency of real-time PCR amplification. GeNorm analysis of the real-time PCR performance of each gene among common wheat lines showed that the Waxy-D1 assay had the lowest M values with the best stability among all tested lines. All results indicated that the Waxy-D1 gene and its real-time PCR assay were most suitable to be used as an endogenous reference gene for common wheat DNA content quantification. The validated Waxy-D1 gene assay will be useful in establishing accurate and creditable qualitative and quantitative PCR analysis of GM wheat.

Evaluation of four endogenous reference genes and their real-time PCR assays for common wheat quantification in GMOs detection.

Directory of Open Access Journals (Sweden)

Huali Huang

Full Text Available Proper selection of endogenous reference genes and their real-time PCR assays is quite important in genetically modified organisms (GMOs detection. To find a suitable endogenous reference gene and its real-time PCR assay for common wheat (Triticum aestivum L. DNA content or copy number quantification, four previously reported wheat endogenous reference genes and their real-time PCR assays were comprehensively evaluated for the target gene sequence variation and their real-time PCR performance among 37 common wheat lines. Three SNPs were observed in the PKABA1 and ALMT1 genes, and these SNPs significantly decreased the efficiency of real-time PCR amplification. GeNorm analysis of the real-time PCR performance of each gene among common wheat lines showed that the Waxy-D1 assay had the lowest M values with the best stability among all tested lines. All results indicated that the Waxy-D1 gene and its real-time PCR assay were most suitable to be used as an endogenous reference gene for common wheat DNA content quantification. The validated Waxy-D1 gene assay will be useful in establishing accurate and creditable qualitative and quantitative PCR analysis of GM wheat.

Evaluation of Four Endogenous Reference Genes and Their Real-Time PCR Assays for Common Wheat Quantification in GMOs Detection

Science.gov (United States)

Huang, Huali; Cheng, Fang; Wang, Ruoan; Zhang, Dabing; Yang, Litao

2013-01-01

Proper selection of endogenous reference genes and their real-time PCR assays is quite important in genetically modified organisms (GMOs) detection. To find a suitable endogenous reference gene and its real-time PCR assay for common wheat (Triticum aestivum L.) DNA content or copy number quantification, four previously reported wheat endogenous reference genes and their real-time PCR assays were comprehensively evaluated for the target gene sequence variation and their real-time PCR performance among 37 common wheat lines. Three SNPs were observed in the PKABA1 and ALMT1 genes, and these SNPs significantly decreased the efficiency of real-time PCR amplification. GeNorm analysis of the real-time PCR performance of each gene among common wheat lines showed that the Waxy-D1 assay had the lowest M values with the best stability among all tested lines. All results indicated that the Waxy-D1 gene and its real-time PCR assay were most suitable to be used as an endogenous reference gene for common wheat DNA content quantification. The validated Waxy-D1 gene assay will be useful in establishing accurate and creditable qualitative and quantitative PCR analysis of GM wheat. PMID:24098735

Plasmid fingerprinting and virulence gene detection among indigenous strains of salmonella enterica serovar enteritidis

International Nuclear Information System (INIS)

Sajid, S.U.; Schwarz, S.

2009-01-01

Salmonella enterica serovar Enteritidis is an important frequently reported zoonotic pathogen and a common cause of human gastroenteritis worldwide. The highly conserved Serospecific plasmids (SSPs) and Salmonella plasmid virulence (Spv) genes have been shown to mediate extra-intestinal colonization and systemic infection. The objective of current study was to document the presence of SSPs and SpvB/SpvC genes prevailing in the indigenous population of serovar Enteritidis. A total of 48 epidemiologically unrelated strains of Salmonella enteritidis were included in the study. Preparation of plasmids DNA suitable for endonuclease digestion and separation of respective fragments by agarose gel electrophoresis followed previously described protocols. The plasmids of Escherichia coli V517, 1-kbp ladder, and lambda DNA HindIII fragments served as DNA size standards. Transfer of DNA fragments from agarose gels to nitrocellulose membranes was achieved by capillary blot procedure. An ECL labeled 3.6 kbp HindIII fragment of plasmid PRQ 51 was used as probe for SpvB/SpvC gene detection. Plasmid DNA fingerprinting revealed the presence of two different profiles of approximately 55 kbp and 90 kbp and were identified as virulence plasmids by DNA hybridization. The SpvB/SpvC genes were located on HindIII fragments of 3.6 kbp in each of the two types of virulence plasmids. The study confirms the presence of SSPs and SpvB/SpvC genes in indigenous strains of S. enteritidis isolated from Northern Punjab area of Pakistan and substantiate the previous data on such findings from other parts of the world. (author)

[Identification and detection of trag: a new infection-related gene expressed in vivo from isolates of Streptococcus suis].

Science.gov (United States)

Zhu, Haodan; Gu, Hongwei; Lu, Chengping

2008-12-01

The trag (transfer gene G) was one of the novel infection-related factors identified by in vivo-induced antigen technology (IVIAT) from Streptococcus suis type 2 expression libraries with swine convalesecent sera in our former research. We detected the distribution of trag in different Streptococcus suis isolates and identify the differential expression of the new infection-related factor between in vivo and in vitro condition. According to the sequence of trag of North American strain 89/1591, a pair of primers were designed to detect the distribution of trag in total 43 SS isolates. Another pair of primers were designed to amplify the ORF of trag of 5 SS representive strains (ZY05719, HA9801, 98012, SH040805, SH040917). Partial gene of trag was cloned and inserted into expression vector pET28a(+), and induced by IPTG to express recombinant TRAG. The recombinant protein was probed with swine convalescent sera and immune sera respectively. The trag was detected in the most of SS2 isolates (30/32), in SS9 isolates (4/6), and 1 isolate of SS7, while it was not found in SS2 European strain ATCC43765, avirulent strain SS2 T15, 1 isolates of SS1, 1 isolates of SS1/2 and 2 isolates of group C streptococcal strains from pigs. Comparisons between the sequences of TRAG of 5 isolates with that of SS isolates, showed a high homology (>97%) with North American strain 89/1589 and China strains 98HAH33, 05ZYH33. The immunoreactivity was only presented with convalescent sera. The trag was detected from virulent SS isolates but not from avirulent strain, which suggested that this gene may be related to the pathogenicity of SS. The special reactivity was only present with convalescent sera, and it indicated that TRAG might play a role during SS2 invasive course.

Detection of Helicobacter pylori CagA and VacA genotypes from ...

African Journals Online (AJOL)

Background: Helicobacter pylori(H. Pylori) is one of the most common pathogens affecting human kind, infecting more than 50% of the world's population. Invasive and non- invasive methods have been used to diagnose H. pylori infection. The polymerase chain reaction (PCR) has been broadly and successfully used to ...

Single-cell multiple gene expression analysis based on single-molecule-detection microarray assay for multi-DNA determination

Energy Technology Data Exchange (ETDEWEB)

Li, Lu [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Xianwei [School of Life Sciences, Shandong University, Jinan 250100 (China); Zhang, Xiaoli [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China); Wang, Jinxing [School of Life Sciences, Shandong University, Jinan 250100 (China); Jin, Wenrui, E-mail: jwr@sdu.edu.cn [School of Chemistry and Chemical Engineering, Shandong University, Jinan 250100 (China)

2015-01-07

Highlights: • A single-molecule-detection (SMD) microarray for 10 samples is fabricated. • The based-SMD microarray assay (SMA) can determine 8 DNAs for each sample. • The limit of detection of SMA is as low as 1.3 × 10{sup −16} mol L{sup −1}. • The SMA can be applied in single-cell multiple gene expression analysis. - Abstract: We report a novel ultra-sensitive and high-selective single-molecule-detection microarray assay (SMA) for multiple DNA determination. In the SMA, a capture DNA (DNAc) microarray consisting of 10 subarrays with 9 spots for each subarray is fabricated on a silanized glass coverslip as the substrate. On the subarrays, the spot-to-spot spacing is 500 μm and each spot has a diameter of ∼300 μm. The sequence of the DNAcs on the 9 spots of a subarray is different, to determine 8 types of target DNAs (DNAts). Thus, 8 types of DNAts are captured to their complementary DNAcs at 8 spots of a subarray, respectively, and then labeled with quantum dots (QDs) attached to 8 types of detection DNAs (DNAds) with different sequences. The ninth spot is used to detect the blank value. In order to determine the same 8 types of DNAts in 10 samples, the 10 DNAc-modified subarrays on the microarray are identical. Fluorescence single-molecule images of the QD-labeled DNAts on each spot of the subarray are acquired using a home-made single-molecule microarray reader. The amounts of the DNAts are quantified by counting the bright dots from the QDs. For a microarray, 8 types of DNAts in 10 samples can be quantified in parallel. The limit of detection of the SMA for DNA determination is as low as 1.3 × 10{sup −16} mol L{sup −1}. The SMA for multi-DNA determination can also be applied in single-cell multiple gene expression analysis through quantification of complementary DNAs (cDNAs) corresponding to multiple messenger RNAs (mRNAs) in single cells. To do so, total RNA in single cells is extracted and reversely transcribed into their cDNAs. Three

Detection of high frequency of mutations in a breast and/or ovarian cancer cohort: implications of embracing a multi-gene panel in molecular diagnosis in India.

Science.gov (United States)

Mannan, Ashraf U; Singh, Jaya; Lakshmikeshava, Ravikiran; Thota, Nishita; Singh, Suhasini; Sowmya, T S; Mishra, Avshesh; Sinha, Aditi; Deshwal, Shivani; Soni, Megha R; Chandrasekar, Anbukayalvizhi; Ramesh, Bhargavi; Ramamurthy, Bharat; Padhi, Shila; Manek, Payal; Ramalingam, Ravi; Kapoor, Suman; Ghosh, Mithua; Sankaran, Satish; Ghosh, Arunabha; Veeramachaneni, Vamsi; Ramamoorthy, Preveen; Hariharan, Ramesh; Subramanian, Kalyanasundaram

2016-06-01

Breast and/or ovarian cancer (BOC) are among the most frequently diagnosed forms of hereditary cancers and leading cause of death in India. This emphasizes on the need for a cost-effective method for early detection of these cancers. We sequenced 141 unrelated patients and families with BOC using the TruSight Cancer panel, which includes 13 genes strongly associated with risk of inherited BOC. Multi-gene sequencing was done on the Illumina MiSeq platform. Genetic variations were identified using the Strand NGS software and interpreted using the StrandOmics platform. We were able to detect pathogenic mutations in 51 (36.2%) cases, out of which 19 were novel mutations. When we considered familial breast cancer cases only, the detection rate increased to 52%. When cases were stratified based on age of diagnosis into three categories, ⩽40 years, 40-50 years and >50 years, the detection rates were higher in the first two categories (44.4% and 53.4%, respectively) as compared with the third category, in which it was 26.9%. Our study suggests that next-generation sequencing-based multi-gene panels increase the sensitivity of mutation detection and help in identifying patients with a high risk of developing cancer as compared with sequential tests of individual genes.

Insect-gene-activity detection system for chemical and biological warfare agents and toxic industrial chemicals

Science.gov (United States)

Mackie, Ryan S.; Schilling, Amanda S.; Lopez, Arturo M.; Rayms-Keller, Alfredo

2002-02-01

Detection of multiple chemical and biological weapons (CBW) agents and/or complex mixtures of toxic industrial chemicals (TIC) is imperative for both the commercial and military sectors. In a military scenario, a multi-CBW attack would create confusion, thereby delaying decontamination and therapeutic efforts. In the commercial sector, polluted sites invariably contain a mixture of TIC. Novel detection systems capable of detecting CBW and TIC are sorely needed. While it may be impossible to build a detector capable of discriminating all the possible combinations of CBW, a detection system capable of statistically predicting the most likely composition of a given mixture is within the reach of current emerging technologies. Aquatic insect-gene activity may prove to be a sensitive, discriminating, and elegant paradigm for the detection of CBW and TIC. We propose to systematically establish the expression patterns of selected protein markers in insects exposed to specific mixtures of chemical and biological warfare agents to generate a library of biosignatures of exposure. The predicting capabilities of an operational library of biosignatures of exposures will allow the detection of emerging novel or genetically engineered agents, as well as complex mixtures of chemical and biological weapons agents. CBW and TIC are discussed in the context of war, terrorism, and pollution.

Original Article

African Journals Online (AJOL)

Conclusion: H. pylori infection with cagA positive strains was similarly common in dyspeptic diabetic patients and controls. It was associated with poorer glycemic control and higher rates of microalbuminuria in diabetic subjects. Key words: cagA positive strains; Diabetes mellitus;. Helicobatcer pylori; Microalbuminuria.

Application of oligonucleotide array CGH to the simultaneous detection of a deletion in the nuclear TK2 gene and mtDNA depletion.

Science.gov (United States)

Zhang, Shulin; Li, Fang-Yuan; Bass, Harold N; Pursley, Amber; Schmitt, Eric S; Brown, Blaire L; Brundage, Ellen K; Mardach, Rebecca; Wong, Lee-Jun

2010-01-01

Thymidine kinase 2 (TK2), encoded by the TK2 gene on chromosome 16q22, is one of the deoxyribonucleoside kinases responsible for the maintenance of mitochondrial deoxyribonucleotide pools. Defects in TK2 mainly cause a myopathic form of the mitochondrial DNA depletion syndrome (MDDS). Currently, only point mutations and small insertions and deletions have been reported in TK2 gene; gross rearrangements of TK2 gene and possible hepatic involvement in patients with TK2 mutations have not been described. We report a non-consanguineous Jordanian family with three deceased siblings due to mtDNA depletion. Sequence analysis of the father detected a heterozygous c.761T>A (p.I254N) mutation in his TK2 gene; however, point mutations in the mother were not detected. Subsequent gene dosage analysis using oligonucleotide array CGH identified an intragenic approximately 5.8-kb deletion encompassing the 5'UTR to intron 2 of her TK2 gene. Sequence analysis confirmed that the deletion spans c.1-495 to c.283-2899 of the TK2 gene (nucleotide 65,136,256-65,142,086 of chromosome 16). Analysis of liver and muscle specimens from one of the deceased infants in this family revealed compound heterozygosity for the paternal point mutation and maternal intragenic deletion. In addition, a significant reduction of the mtDNA content in liver and muscle was detected (10% and 20% of age- and tissue-matched controls, respectively). Prenatal diagnosis was performed in the third pregnancy. The fetus was found to carry both the point mutation and the deletion. This child died 6months after birth due to myopathy. A serum specimen demonstrated elevated liver transaminases in two of the infants from whom results were available. This report expands the mutation spectrum associated with TK2 deficiency. While the myopathic form of MDDS appears to be the main phenotype of TK2 mutations, liver dysfunction may also be a part of the mitochondrial depletion syndrome caused by TK2 gene defects.

Digenic mutations involving both the BSND and GJB2 genes detected in Bartter syndrome type IV.

Science.gov (United States)

Wang, Hong-Han; Feng, Yong; Li, Hai-Bo; Wu, Hong; Mei, Ling-Yun; Wang, Xing-Wei; Jiang, Lu; He, Chu-Feng

2017-01-01

Bartter syndrome type IV, characterized by salt-losing nephropathies and sensorineural deafness, is caused by mutations of BSND or simultaneous mutations of both CLCNKA and CLCNKB. GJB2 is the primary causative gene for non-syndromic sensorineural deafness and associated with several syndromic sensorineural deafness. Owing to the rarity of Bartter syndrome, only a few mutations have been reported in the abovementioned causative genes. To investigate the underlying mutations in a Chinese patient with Bartter syndrome type IV, genetic analysis of BSND, CLCNKA, CLCNKB and GJB2 were performed by polymerase chain reaction and direct sequencing. Finally, double homozygous mutations c.22C > T (p.Arg8Trp) and c.127G > A (Val43Ile) were detected in exon 1 of BSND. Intriguingly, compound heterozygous mutations c.235delC (p.Leu79CysfsX3) and c.109G > A (p.Val37Ile) were also revealed in exon 2 of GJB2 in the same patient. No pathogenic mutations were found in CLCNKA and CLCNKB. Our results indicated that the homozygous mutation c.22C > T was the key genetic reason for the proband, and a digenic effect of BSND and GJB2 might contributed to sensorineural deafness. To our knowledge, it was the first report showing that the GJB2 gene mutations were detected in Bartter syndrome. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Human gastric mucins differently regulate Helicobacter pylori proliferation, gene expression and interactions with host cells.

Directory of Open Access Journals (Sweden)

Emma C Skoog

Full Text Available Helicobacter pylori colonizes the mucus niche of the gastric mucosa and is a risk factor for gastritis, ulcers and cancer. The main components of the mucus layer are heavily glycosylated mucins, to which H. pylori can adhere. Mucin glycosylation differs between individuals and changes during disease. Here we have examined the H. pylori response to purified mucins from a range of tumor and normal human gastric tissue samples. Our results demonstrate that mucins from different individuals differ in how they modulate both proliferation and gene expression of H. pylori. The mucin effect on proliferation varied significantly between samples, and ranged from stimulatory to inhibitory, depending on the type of mucins and the ability of the mucins to bind to H. pylori. Tumor-derived mucins and mucins from the surface mucosa had potential to stimulate proliferation, while gland-derived mucins tended to inhibit proliferation and mucins from healthy uninfected individuals showed little effect. Artificial glycoconjugates containing H. pylori ligands also modulated H. pylori proliferation, albeit to a lesser degree than human mucins. Expression of genes important for the pathogenicity of H. pylori (babA, sabA, cagA, flaA and ureA appeared co-regulated in response to mucins. The addition of mucins to co-cultures of H. pylori and gastric epithelial cells protected the viability of the cells and modulated the cytokine production in a manner that differed between individuals, was partially dependent of adhesion of H. pylori to the gastric cells, but also revealed that other mucin factors in addition to adhesion are important for H. pylori-induced host signaling. The combined data reveal host-specific effects on proliferation, gene expression and virulence of H. pylori due to the gastric mucin environment, demonstrating a dynamic interplay between the bacterium and its host.

Detection of selected antibiotic resistance genes using multiplex PCR assay in mastitis pathogens in the Czech Republic

Directory of Open Access Journals (Sweden)

Vladimir Pyatov

2017-01-01

Full Text Available The aim of this research was to develop multiplex polymerase chain reaction assays for the detection of aminoglycoside (strA, strB, sulphonamide (sulI, sulII, tetracycline (tetA, tetB, tetK, tetM, tetO, macrolide and lincosamide (msrA, ermA, ermB, ermC, mefA/E genes of resistance in mastitis pathogens (Escherichia coli, Staphylococcus aureus, Streptococcus uberis, Streptococcus agalactiae and Streptococcus dysgalactiae. Applying the established assays, we investigated the distribution of antibiotic resistance genes in the above mentioned species isolated from milk samples in the Czech Republic. Each assay consisted of seven pairs of primers. Six of them amplified fragments of antibiotic resistance genes and one pair a fragment of a species specific gene. Polymerase chain reaction conditions were optimized to amplify seven gene fragments simultaneously in one reaction. In total, 249 isolates were used, among which 111 were positive for E. coli, 52 for S. aureus and 86 for Streptococcus spp. The majority (60.2% of bacteria carried at least one antibiotic resistance gene and 44.6% were multidrug-resistant. The designed multiplex polymerase chain reaction assays may be applied as diagnostic method to replace or complement standard techniques of antibiotic susceptibility testing in the mentioned pathogens.

A 91 kb microdeletion at Xq26.2 involving the GPC3 gene in a female fetus with Simpson-Golabi-Behmel syndrome detected by prenatal arrayCGH

DEFF Research Database (Denmark)

Becher, Naja; Gjørup, Vibike; Christensen, Rikke

2012-01-01

A 91 kb microdeletion at Xq26.2 involving the GPC3 gene in a female fetus with Simpson-Golabi-Behmel syndrome detected by prenatal arrayCGH......A 91 kb microdeletion at Xq26.2 involving the GPC3 gene in a female fetus with Simpson-Golabi-Behmel syndrome detected by prenatal arrayCGH...

Frecuencia de genes de virulencia en infecciones mixtas con cepas de Helicobacter pylori de una población mexicana

Directory of Open Access Journals (Sweden)

R. González-Vázquez

2016-01-01

Conclusiones: La prueba de Fisher no mostró una asociación significativa entre el resultado clínico y el genotipo en la población estudiada. Los genotipos circulantes en la población mexicana fueron cagA+, vacAs1, vacAm1. La PCR multiplex puede usarse para genotipificar rápidamente las cepas de H. pylori. cagE es un buen marcador para identificar cepas cag-PAI+.

MLPA based detection of mutations in the dystrophin gene of 180 Polish families with Duchenne/Becker muscular dystrophy.

Science.gov (United States)

Zimowski, Janusz G; Massalska, Diana; Holding, Mariola; Jadczak, Sylwia; Fidziańska, Elżbieta; Lusakowska, Anna; Kostera-Pruszczyk, Anna; Kamińska, Anna; Zaremba, Jacek

2014-01-01

Duchenne/Becker muscular dystrophy (DMD/BMD) is a recessive, X-linked disorder caused by a mutation in the dystrophin gene. Deletions account for approximately 60-65% of mutations, duplications for 5-10%. The remaining cases are mainly point mutations. According to Monaco theory clinical form of the disease depends on maintaining or disrupting the reading frame. The purpose of the study was to determine frequency and location of deletions and duplications in the dystrophin gene, to determine the compliance between maintaining/disrupting the reading frame and clinical form of the disease and to check the effectiveness of MLPA (multiplex ligation-dependent probe amplification) in the detection of these mutations in hemizygous patients and heterozygous female carriers. The material is composed of combined results of molecular diagnosis carried out in years 2009-2012 in 180 unrelated patients referred with the diagnosis of DMD/BMD tested by use of MLPA. We identified 110 deletions, 22 duplication (in one patient two different duplications were detected) and 2 point mutations. Deletions involved mainly exons 45-54 and 3-21, whereas most duplications involved exons 3-18. The compliance with Monaco theory was 95% for deletions and 76% for duplications. Most of mutations in the dystrophin gene were localized in the hot spots - different for deletions and duplications. MLPA enabled their quick identification, exact localization and determination whether or not they maintained or disrupted the reading frame. MLPA was also effective in detection of deletions and duplications in female carriers. Copyright © 2014 Polish Neurological Society. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

Detection of toxic shock toxin (tst gene in Staphylococcus aureus isolated from bovine milk samples

Directory of Open Access Journals (Sweden)

S. Baniardalan

2017-09-01

Full Text Available Staphylococcus aureus is a major causative pathogen of clinical and subclinical mastitis in dairy cattle all over the world. This agent produces a variety of extracellular toxins and virulence factors in-cluding toxic shock syndrome toxin-1 (TSST-1 which is the major cause of toxic shock syndrome (TSS. In the present study, 76 S. aureus isolates have been obtained from milk samples collected from 7 dairy herds in Hamedan province of Iran. The isolates were identified based on the biochemical and molecular methods using PCR amplification of the femA gene. The staphylococcal isolates were also examined for the presence of TSST-1 (tst encoding gene. This gene was detected in only one S. aureus isolate (1.3%. The results revealed that S. aureus strains causing bovine mastitis may potentially produce staphylococcal toxic shock syndrome toxin-1, indicating that it is very important to follow the presence of TSST-1 producing S. aureus isolates in foodstuffs to protect consumers against the risk of toxic shock syndrome

Characterization of Antimicrobial Resistance Patterns and Detection of Virulence Genes in Campylobacter Isolates in Italy

Science.gov (United States)

Di Giannatale, Elisabetta; Di Serafino, Gabriella; Zilli, Katiuscia; Alessiani, Alessandra; Sacchini, Lorena; Garofolo, Giuliano; Aprea, Giuseppe; Marotta, Francesca

2014-01-01

Campylobacter has developed resistance to several antimicrobial agents over the years, including macrolides, quinolones and fluoroquinolones, becoming a significant public health hazard. A total of 145 strains derived from raw milk, chicken faeces, chicken carcasses, cattle faeces and human faeces collected from various Italian regions, were screened for antimicrobial susceptibility, molecular characterization (SmaI pulsed-field gel electrophoresis) and detection of virulence genes (sequencing and DNA microarray analysis). The prevalence of C. jejuni and C. coli was 62.75% and 37.24% respectively. Antimicrobial susceptibility revealed a high level of resistance for ciprofloxacin (62.76%), tetracycline (55.86%) and nalidixic acid (55.17%). Genotyping of Campylobacter isolates using PFGE revealed a total of 86 unique SmaI patterns. Virulence gene profiles were determined using a new microbial diagnostic microarray composed of 70-mer oligonucleotide probes targeting genes implicated in Campylobacter pathogenicity. Correspondence between PFGE and microarray clusters was observed. Comparisons of PFGE and virulence profiles reflected the high genetic diversity of the strains examined, leading us to speculate different degrees of pathogenicity inside Campylobacter populations. PMID:24556669

Detection of the mosquitocidal toxin genes encoding Cry11 proteins from Bacillus thuringiensis using a novel PCR-RFLP method Detección de genes que codifican proteínas mosquitocidas Cry11 de Bacillus thuringiensis mediante un método de PCR-RFLP novedoso

Directory of Open Access Journals (Sweden)

D. H. Sauka

2010-02-01

Full Text Available A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP method for detection of cry11 genes from Bacillus thuringiensis was established. Based on the analysis of conserved regions of the cry11 genes, 2 oligonucleotide primers were designed to amplify a 1459-bp fragment of the cry11Aa gene, and a 1471-bp of the cry11Ba and cry11Bb genes. The amplification products were digested with restriction endonuclease HinfI. Exotic B. thuringiensis strains and native isolates collected from soils, leaves and stored product dust of Argentina were analyzed to study the distribution of cry11 genes. The PCR-RFLP patterns revealed the detection of cry11 genes in 3 of 64 exotic strains and in 10 of 107 native B. thuringiensis isolates tested. Just the cry11Aa gene subclass was detected among these bacteria. Since the methodology was also developed to detect cry11Ba and cry11Bb genes, an experimental future confirmation will be required. Based on the results obtained, the PCR-RFLP method presented may be a valuable tool for specific detection of the mosquitocidal toxin genes encoding Cry11 proteins from B. thuringiensis.En el presente estudio se estableció una estrategia basada en la amplificación génica (PCR y el posterior análisis de restricción (RFLP para detectar todos los genes cry11 de Bacillus thuringiensis informados hasta ahora. De acuerdo con el análisis de las regiones conservadas en los genes cry11, se diseñaron dos cebadores para amplificar un fragmento de 1459 pb de los genes cry11Aa y un fragmento de 1471 pb de los genes cry11Ba y cry11Bb. Los productos de la amplificación fueron digeridos con la enzima de restricción HinfI. Se analizaron cepas exóticas de B. thuringiensis y aislamientos nativos de Argentina obtenidos a partir de muestras de suelos, hojas y polvillo de silos, para estudiar la distribución de los genes cry11. Los patrones de PCR-RFLP revelaron la presencia de genes cry11 en 3 de las 64 cepas ex

Detection and Characterizations of Genes Resistant to Tetracycline and Sulfa among the Bacteria in Mariculture Water

Science.gov (United States)

Qu, L.; Li, Y.; Zhu, P.

2013-12-01

One hundred and thirty-five bacteria from maricultural environments were tested for sensitivity to tetracycline and sulfa. Result show that 72% of the bacteria were sulfa-resistant, 36% of the bacteria were tetracycline-resistant, and 16.5% of bacteria showed resistance to both tetracyclines and sulfa ,indicating that the proportion of sulfa and tetracycline resistance bacteria isvery large in the maricultural environments. PCR methods were used to detect if these resistant bacteria carry tetracycline and sulfa resistance genes. Out of the 33 tetracycline-resistant bacteria screened, 3 were positive for tetA, 6 were positive for tetB and no isolate wasboth positive for tetA and tetB. Of the 97 sulfa-resistant bacteria screened, 9 were positive for sul2, 6 were positive for sul1, 1 isolate was positive for bothsul1 and sul2. The minimum inhibitory concentration (MIC) of tetracycline for tetA-carrying isolates were higher than those tetB-carrying isolates.while The MIC of sulfa for sul2-carrying isolates were higher than those sul1-carrying isolates. Indicating that tetA and sul2 gene may play ubknown roles in resisting tetracycline and sulfa than tetB and sul1 genes. The results showed the 4 kinds of genes (tetA,tetB,sul1,sul2) has no host specificity. All these 16S sequence are from the isolates which are positive for the above genes, it indicated the above antibiotic resistance genes are widespread in the environment regardless of the host. While the DNA sequence of these four genes showed tetA, sul1, sul2 genes are conservative in different bacteria , etB gene conserved poorly. The research aim is to get a preliminary understanding of resistance mechanism related to the resistant bacteria and the resistance genes in marine aquaculture environment through the analysis of resistant genes, providing research base for the prevention and treatment of drug-resistant bacteria so as to reduce the threat to the ecological environment, aquaculture and human health.

Application of microarray and functional-based screening methods for the detection of antimicrobial resistance genes in the microbiomes of healthy humans.

Directory of Open Access Journals (Sweden)

Roderick M Card

Full Text Available The aim of this study was to screen for the presence of antimicrobial resistance genes within the saliva and faecal microbiomes of healthy adult human volunteers from five European countries. Two non-culture based approaches were employed to obviate potential bias associated with difficult to culture members of the microbiota. In a gene target-based approach, a microarray was employed to screen for the presence of over 70 clinically important resistance genes in the saliva and faecal microbiomes. A total of 14 different resistance genes were detected encoding resistances to six antibiotic classes (aminoglycosides, β-lactams, macrolides, sulphonamides, tetracyclines and trimethoprim. The most commonly detected genes were erm(B, blaTEM, and sul2. In a functional-based approach, DNA prepared from pooled saliva samples was cloned into Escherichia coli and screened for expression of resistance to ampicillin or sulphonamide, two of the most common resistances found by array. The functional ampicillin resistance screen recovered genes encoding components of a predicted AcrRAB efflux pump. In the functional sulphonamide resistance screen, folP genes were recovered encoding mutant dihydropteroate synthase, the target of sulphonamide action. The genes recovered from the functional screens were from the chromosomes of commensal species that are opportunistically pathogenic and capable of exchanging DNA with related pathogenic species. Genes identified by microarray were not recovered in the activity-based screen, indicating that these two methods can be complementary in facilitating the identification of a range of resistance mechanisms present within the human microbiome. It also provides further evidence of the diverse reservoir of resistance mechanisms present in bacterial populations in the human gut and saliva. In future the methods described in this study can be used to monitor changes in the resistome in response to antibiotic therapy.

[Helicobacter pylori population characteristic in patients with diseases of gastrointestinal tract].

Science.gov (United States)

Zhebrun, A B; Svarval', A V; Balabash, O A; Ferman, R S

2013-01-01

Study H. pylori strains circulating in St. Petersburg among patients with various gastrointestinal tract pathology as well as study of frequency of infection by H. pylori based on serological markers data among this group of patients. By using serological method 162 individuals with various chronic diseases of stomach and duodenum were examined. The presence in blood serum of IgG against H. pylori bacterial antigen and IgG against its toxin--CagA was studied. 129 patients were examined bacteriologically, biopsy samples of stomach mucous membrane were studied. PCR in real time format was used for study of H. pylori strains (49) and biopsy samples (36) of stomach mucous membrane. The analysis performed showed that on the territory of St. Petersburg H. pylori strains containing cagA gene predominate (81.63% of the isolated strains). Genotyping of strains by vacA showed that s1m1 genotype was more frequent (in 57.14% of cases). The fraction of CagA positive strains in patients in St. Petersburg is maximum for stomach cancer (90.8%), whereas for peptic ulcer disease and gastritis it is 64.7% and 72.2%, respectively. In patients with stomach and duodenum pathology the parameters of seropositivity for H. pylori were significantly higher than in individuals without clinical manifestations of H. pylori infection (86.72% against 65.09%; p < 0.05). The data obtained on increase of fraction of CagA positive strains among H. pylori circulating in St. Petersburg determine the importance of conducting eradication H. pylori.

Systematic identification and validation of candidate genes for detection of circulating tumor cells in peripheral blood specimens of colorectal cancer patients.

Science.gov (United States)

Findeisen, Peter; Röckel, Matthias; Nees, Matthias; Röder, Christian; Kienle, Peter; Von Knebel Doeberitz, Magnus; Kalthoff, Holger; Neumaier, Michael

2008-11-01

The presence of tumor cells in peripheral blood is being regarded increasingly as a clinically relevant prognostic factor for colorectal cancer patients. Current molecular methods are very sensitive but due to low specificity their diagnostic value is limited. This study was undertaken in order to systematically identify and validate new colorectal cancer (CRC) marker genes for improved detection of minimal residual disease in peripheral blood mononuclear cells of colorectal cancer patients. Marker genes with upregulated gene expression in colorectal cancer tissue and cell lines were identified using microarray experiments and publicly available gene expression data. A systematic iterative approach was used to reduce a set of 346 candidate genes, reportedly associated with CRC to a selection of candidate genes that were then further validated by relative quantitative real-time RT-PCR. Analytical sensitivity of RT-PCR assays was determined by spiking experiments with CRC cells. Diagnostic sensitivity as well as specificity was tested on a control group consisting of 18 CRC patients compared to 12 individuals without malignant disease. From a total of 346-screened genes only serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 5 (SERPINB5) showed significantly elevated transcript levels in peripheral venous blood specimens of tumor patients when compared to the nonmalignant control group. These results were confirmed by analysis of an enlarged collective consisting of 63 CRC patients and 36 control individuals without malignant disease. In conclusion SERPINB5 seems to be a promising marker for detection of circulating tumor cells in peripheral blood of colorectal cancer patients.

The detection of HBV DNA with gold-coated iron oxide nanoparticle gene probes

International Nuclear Information System (INIS)

Xi Dong; Luo Xiaoping; Lu Qianghua; Yao Kailun; Liu Zuli; Ning Qin

2008-01-01

Gold-coated iron oxide nanoparticle Hepatitis B virus (HBV) DNA probes were prepared, and their application for HBV DNA measurement was studied. Gold-coated iron oxide nanoparticles were prepared by the citrate reduction of tetra-chloroauric acid in the presence of iron oxide nanoparticles which were added as seeds. With a fluorescence-based method, the maximal surface coverage of hexaethiol 30-mer oligonucleotides and the maximal percentage of hybridization strands on gold-coated iron oxide nanoparticles were (120 ± 8) oligonucleotides per nanoparticle, and (14 ± 2%), respectively, which were comparable with those of (132 ± 10) and (22 ± 3%) in Au nanoparticle groups. Large network aggregates were formed when gold-coated iron oxide nanoparticle HBV DNA gene probe was applied to detect HBV DNA molecules as evidenced by transmission electron microscopy and the high specificity was verified by blot hybridization. Our results further suggested that detecting DNA with iron oxide nanoparticles and magnetic separator was feasible and might be an alternative effective method

Diversity of virulence genes in Brucella melitensis and Brucella abortus detected from patients with rheumatoid arthritis.

Science.gov (United States)

Rahdar, Hossein Ali; Golmohammadi, Reza; Mirnejad, Reza; Ataee, Ramezan Ali; Alishiri, Gholam Hossein; Kazemian, Hossein

2018-03-22

The presence of Brucella melitensis and Brucella abortus genomes were investigated in the synovial fluid (SF) samples from 90 patients with rheumatoid arthritis (RA). DNA extraction and PCR assay were performed for simultaneous identification and discrimination of B. melitensis and B. abortus from the SF using three specific primers. After gel electrophoresis, the PCR products were confirmed by DNA sequencing. The cbg, omp31, manA, virB, and znuA virulence genes typing were performed by multiplex-PCR. Of the 90 samples, 14 were positive for B. melitensis (n = 9; 10%) and B. abortus (n = 5; 5.5%). The virulotyping of positive samples revealed the presence of all five virulence genes in B. melitensis. The virB, cbg, and om31 were detected in all five samples of B. abortus. In addition, zhuA and manA were detected in three (60%) and four (80%) samples, respectively, of the B. abortus-positive samples. Moreover, a total of 94.2% and 89.2% of the 14 positive samples were also found positive for manA and znuA, respectively. Our findings revealed that the Brucella spp. genomes can be detected in the SF of RA patients by the PCR-based method. We thus suggest that physicians should consider the Brucella spp. as indicators of potential RA for the timely diagnosis and treatment of RA. Copyright © 2018. Published by Elsevier Ltd.

Variations among Japanese of the factor IX gene (F9) detected by PCR-denaturing gradient gel electrophoresis

Energy Technology Data Exchange (ETDEWEB)

Satoh, Chiyoko; Takahashi, Norio; Asakawa, Junichi; Hiyama, Keiko; Kodaira, Meiko (Radiation Effects Research Foundation, Hiroshima (Japan))

1993-01-01

In the course of feasibility studies to examine the efficiencies and practicalities of various techniques for screening for genetic variations, the human coagulation factor IX (F9) genes of 63 Japanese families were examined by PCR-denaturing gradient gel electrophoresis (PCR-DGGE). Four target sequences with lengths of 983-2,891 bp from the F9 genes of 126 unrelated individuals from Hiroshima and their 100 children were amplified by PCR, digested with restriction enzymes to approximately 500-bp fragments, and examined by DGGE - a total of 6,724 bp being examined per individual. GC-rich sequences (GC-clamps) of 40 bp were attached to both ends of the target sequences, as far as was feasible. Eleven types of new nucleotide substitutions were detected in the population, none of which produced RFLPs or caused hemophilia B. By examining two target sequences in a single lane, approximately 8,000 bp in a diploid individual could be examined. This approach is very effective for the detection of variations in DNA and is applicable to large-scale population studies. 46 refs., 3 figs., 1 tab.

DETECTING PRESENCE OF C/T POLYMORPHISM AT POSITION 34 SECOND INTRON OF THE MYOSTATIN GENE IN RABBITS

Directory of Open Access Journals (Sweden)

Agnieszka MARKOWSKA

2011-01-01

Full Text Available Myostatin gene is a negative regulator of skeletal muscles growth. It is responsible for normal development of skeletal muscles. The objective of the research was to detect variation of C/T at position 34 of the second intron of the MNST gene in rabbits. The research included 114 rabbits: 54 of them Polish Rabbits, and 60 of them White Flemish Giants, examined by means of the PCR-RFLP method using AluI restriction enzyme. We found allele C with a frequency of 0.6184 of the examined rabbit population, and allele T with a frequency of 0.3816 of the examined rabbits.

Detection of clonal immunoglobulin heavy chain gene rearrangements by the polymerase chain reaction and capillary gel electrophoresis.

Science.gov (United States)

Fan, Hongxin; Robetorye, Ryan S

2013-01-01

Although well-established diagnostic criteria exist for mature B-cell neoplasms, a definitive diagnosis of a B-cell lymphoproliferative disorder cannot always be obtained using more conventional techniques such as flow cytometric immunophenotyping, conventional cytogenetics, fluorescence in situ hybridization, or immunohistochemistry. However, because B-cell malignancies contain identically rearranged immunoglobulin heavy chain genes, the polymerase chain reaction (PCR) can be a fast, convenient, and dependable option to identify clonal B-cell processes. This chapter describes the use of PCR and capillary electrophoresis to identify clonal immunoglobulin heavy chain (IGH) variable and joining region (VH-JH) gene rearrangements (IGH VH-JH PCR) using a commercially available method employing multiple multiplex PCR tubes that was originally developed as the result of a large European BIOMED-2 collaborative study (Invivoscribe Technologies). The core protocol involves the use of three separate master mix tubes that target the conserved framework (FR1, FR2, and FR3) and joining (J) regions of the IGH gene. Analysis of these three framework regions can detect approximately 88% of clonal IGH gene rearrangements.

Cryptic intragenic deletion of the SHOX gene in a family with Léri-Weill dyschondrosteosis detected by Multiplex Ligation-Dependent Probe Amplification (MLPA).