Application of RNAi to confirm theobromine as the major intermediate for caffeine biosynthesis in coffee plants with potential for construction of decaffeinated varieties.

Science.gov (United States)

Ogita, Shinjiro; Uefuji, Hirotaka; Morimoto, Masayuki; Sano, Hiroshi

2004-04-01

The caffeine biosynthetic pathway in coffee plants has been proposed to involve three distinct N -methyltransferases, xanthosine methyltransferase (XMT), 7- N -methylxanthine methyltransferase (MXMT; theobromine synthase), and 3,7-dimethylxanthine methyltransferase (DXMT; caffeine synthase). We previously isolated all corresponding cDNAs designated as CaXMT1 , CaMXMT1 , CaMXMT2 and CaDXMT1 , respectively, and showed that caffeine was indeed synthesized in vitro by the combination of their gene products. In order to regulate caffeine biosynthesis in planta , we suppressed expression of CaMXMT1 by the double stranded RNA interference (RNAi) method. For this purpose, we first established a protocol for efficient somatic embryogenesis of Coffea arabica and C. canephora , and then Agrobacterium -mediated transformation techniques. The RNAi transgenic lines of embryogenic tissues derived from C. arabica and transgenic plantlets of C. canephora demonstrated a clear reduction in transcripts for CaMXMT1 in comparison with the control plants. Transcripts for CaXMT1 and CaDXMT1 were also reduced in the most cases. Both embryonic tissues and plantlets exhibited a concomitant reduction of theobromine and caffeine contents to a range between 30% and 50% of that of the control. These results suggest that the CaMXMT1 -RNAi sequence affected expression of not only CaMXMT1 itself, but also CaXMT1 and CaDXMT1 , and that, since the reduction in theobromine content was proportional to that for caffeine, it is involved in the major synthetic pathway in coffee plants. The results also indicate that the method can be practically applied to produce decaffeinated coffee plants.

Caffeine administration alters the behaviour and development of Galleria mellonella larvae.

Science.gov (United States)

Maguire, Ronan; Kunc, Martin; Hyrsl, Pavel; Kavanagh, Kevin

2017-11-01

The effect of feeding caffeine on the behaviour and neural proteome of Galleria mellonella larvae was assessed. Caffeine was administered to larvae by force feeding and the metabolites theobromine and theophylline were subsequently detected by RP-HPLC analysis. Administration of caffeine to larvae resulted in reduced movement and a reduction in the formation of pupae. The production of the muscle relaxant theophylline may contribute to the reduction in larval movement. Analysis of the changes in proteome of the brain and surrounding tissues of caffeine fed larvae revealed an increase in the abundance of immune related proteins such as immune-related Hdd1 (6.28 fold increase) and hemolin (1.68 fold increase), ATPase associated proteins such as H+ transporting ATP synthase O subunit isoform 1 (1.87 fold increase) and H+ transporting ATP synthase delta subunit (1.53 fold increase) and proteins indicative of brain trauma such as troponin T transcript variant B, partial (1.55 fold increase). Proteins involved in development and protein degradation such as SUMO-activating enzyme subunit 1 (3.08 fold decrease) and chitin deacetylase, partial (3.67 fold decrease) were decreased in abundance. The results presented here indicate that caffeine is metabolised in a similar way in G. mellonella larvae to that in mammals and results in a variety of behavioural and developmental alterations. Utilisation of insects for studying the effects of caffeine and other neuroactive compounds may offer new insights into their mode of action and reduce the need to use mammals for this type of analysis. Copyright © 2017 Elsevier Inc. All rights reserved.

Modified cellulose synthase gene from Arabidopsis thaliana confers herbicide resistance to plants

Science.gov (United States)

Somerville, Chris R [Portola Valley, CA; Scheible, Wolf [Golm, DE

2007-07-10

Cellulose synthase ("CS"), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl)phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

Directory of Open Access Journals (Sweden)

Bechard Matthew E.

2003-01-01

Full Text Available Tetrahydromethanopterin (H4MPT is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase. Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H4MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli.

Science.gov (United States)

Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

2003-01-01

Tetrahydromethanopterin (H(4)MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H(4)MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H(4)MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H(4)MPT biosynthesis, the identification of putative RFAP synthase genes and measurement of RFAP synthase activity would provide an indication of the presence of H(4)MPT in untested microorganisms. Investigation of putative archaeal RFAP synthase genes has been hampered by the tendency of the resulting proteins to form inactive inclusion bodies in Escherichia coli. The current work describes a colorimetric assay for measuring RFAP synthase activity, and two modified procedures for expressing recombinant RFAP synthase genes to produce soluble, active enzyme. By lowering the incubation temperature during expression, RFAP synthase from Archaeoglobus fulgidus was produced in E. coli and purified to homogeneity. The production of active RFAP synthase from Methanothermobacter thermautotrophicus was achieved by coexpression of the gene MTH0830 with a molecular chaperone. This is the first direct biochemical identification of a methanogen gene that codes for an active RFAP synthase.

Conversion of nicotinic acid to trigonelline is catalyzed by N-methyltransferase belonged to motif B′ methyltransferase family in Coffea arabica

International Nuclear Information System (INIS)

Mizuno, Kouichi; Matsuzaki, Masahiro; Kanazawa, Shiho; Tokiwano, Tetsuo; Yoshizawa, Yuko; Kato, Misako

2014-01-01

Graphical abstract: Trigonelline synthase catalyzes the conversion of nicotinic acid to trigonelline. We isolated and characterized trigonelline synthase gene(s) from Coffea arabica. - Highlights: • Trigonelline is a major compound in coffee been same as caffeine is. • We isolated and characterized trigonelline synthase gene. • Coffee trigonelline synthases are highly homologous with coffee caffeine synthases. • This study contributes the fully understanding of pyridine alkaloid metabolism. - Abstract: Trigonelline (N-methylnicotinate), a member of the pyridine alkaloids, accumulates in coffee beans along with caffeine. The biosynthetic pathway of trigonelline is not fully elucidated. While it is quite likely that the production of trigonelline from nicotinate is catalyzed by N-methyltransferase, as is caffeine synthase (CS), the enzyme(s) and gene(s) involved in N-methylation have not yet been characterized. It should be noted that, similar to caffeine, trigonelline accumulation is initiated during the development of coffee fruits. Interestingly, the expression profiles for two genes homologous to caffeine synthases were similar to the accumulation profile of trigonelline. We presumed that these two CS-homologous genes encoded trigonelline synthases. These genes were then expressed in Escherichiacoli, and the resulting recombinant enzymes that were obtained were characterized. Consequently, using the N-methyltransferase assay with S-adenosyl[methyl- 14 C]methionine, it was confirmed that these recombinant enzymes catalyzed the conversion of nicotinate to trigonelline, coffee trigonelline synthases (termed CTgS1 and CTgS2) were highly identical (over 95% identity) to each other. The sequence homology between the CTgSs and coffee CCS1 was 82%. The pH-dependent activity curve of CTgS1 and CTgS2 revealed optimum activity at pH 7.5. Nicotinate was the specific methyl acceptor for CTgSs, and no activity was detected with any other nicotinate derivatives, or with

Conversion of nicotinic acid to trigonelline is catalyzed by N-methyltransferase belonged to motif B′ methyltransferase family in Coffea arabica

Energy Technology Data Exchange (ETDEWEB)

Mizuno, Kouichi, E-mail: koumno@akita-pu.ac.jp [Faculty of Bioresource Sciences, Akita Prefectural University, Akita City, Akita 010-0195 (Japan); Matsuzaki, Masahiro [Faculty of Bioresource Sciences, Akita Prefectural University, Akita City, Akita 010-0195 (Japan); Kanazawa, Shiho [Graduate School of Humanities and Sciences, Ochanomizu University, Otsuka, Bunkyo-ku, Tokyo 112-8610 (Japan); Tokiwano, Tetsuo; Yoshizawa, Yuko [Faculty of Bioresource Sciences, Akita Prefectural University, Akita City, Akita 010-0195 (Japan); Kato, Misako [Graduate School of Humanities and Sciences, Ochanomizu University, Otsuka, Bunkyo-ku, Tokyo 112-8610 (Japan)

2014-10-03

Graphical abstract: Trigonelline synthase catalyzes the conversion of nicotinic acid to trigonelline. We isolated and characterized trigonelline synthase gene(s) from Coffea arabica. - Highlights: • Trigonelline is a major compound in coffee been same as caffeine is. • We isolated and characterized trigonelline synthase gene. • Coffee trigonelline synthases are highly homologous with coffee caffeine synthases. • This study contributes the fully understanding of pyridine alkaloid metabolism. - Abstract: Trigonelline (N-methylnicotinate), a member of the pyridine alkaloids, accumulates in coffee beans along with caffeine. The biosynthetic pathway of trigonelline is not fully elucidated. While it is quite likely that the production of trigonelline from nicotinate is catalyzed by N-methyltransferase, as is caffeine synthase (CS), the enzyme(s) and gene(s) involved in N-methylation have not yet been characterized. It should be noted that, similar to caffeine, trigonelline accumulation is initiated during the development of coffee fruits. Interestingly, the expression profiles for two genes homologous to caffeine synthases were similar to the accumulation profile of trigonelline. We presumed that these two CS-homologous genes encoded trigonelline synthases. These genes were then expressed in Escherichiacoli, and the resulting recombinant enzymes that were obtained were characterized. Consequently, using the N-methyltransferase assay with S-adenosyl[methyl-{sup 14}C]methionine, it was confirmed that these recombinant enzymes catalyzed the conversion of nicotinate to trigonelline, coffee trigonelline synthases (termed CTgS1 and CTgS2) were highly identical (over 95% identity) to each other. The sequence homology between the CTgSs and coffee CCS1 was 82%. The pH-dependent activity curve of CTgS1 and CTgS2 revealed optimum activity at pH 7.5. Nicotinate was the specific methyl acceptor for CTgSs, and no activity was detected with any other nicotinate derivatives, or

Modeling caffeine concentrations with the Stanford Caffeine Questionnaire: preliminary evidence for an interaction of chronotype with the effects of caffeine on sleep.

Science.gov (United States)

Nova, Philip; Hernandez, Beatriz; Ptolemy, Adam S; Zeitzer, Jamie M

2012-04-01

To examine the validity of a novel caffeine intake questionnaire and to examine the effects of caffeine on sleep in college students. One-week, ad libitum behavior of 50 university students (28 female, 22 male; aged 20.9 ± 1.78 years) was examined with sleep logs, wrist actigraphy, and a novel daily questionnaire assessing caffeine intake at different times of day. Saliva samples were collected for caffeine assessment (questionnaire validation) and DNA extraction, and for analysis of a single nucleotide polymorphism in the adenosine receptor 2A (ADORA2A) gene. The caffeine questionnaire was able to accurately predict salivary concentrations of caffeine (R(2) = 0.41, Psleep were correlated with wake after sleep onset (WASO) most strongly in morning-type individuals (R(2) = 0.49; Psleep and genotype and chronotype. Published by Elsevier B.V.

Differentiation of Cannabis subspecies by THCA synthase gene analysis using RFLP.

Science.gov (United States)

Cirovic, Natasa; Kecmanovic, Miljana; Keckarevic, Dusan; Keckarevic Markovic, Milica

2017-10-01

Cannabis sativa subspecies, known as industrial hemp (C. sativa sativa) and marijuana (C. sativa indica) show no evident morphological distinctions, but they contain different levels of psychoactive Δ-9-tetrahidrocanabinol (THC), with considerably higher concentration in marijuana than in hemp. C. sativa subspecies differ in sequence of tetrahydrocannabinolic acid (THCA) synthase gene, responsible for THC production, and only one active copy of the gene, distinctive for marijuana, is capable of producing THC in concentration more then 0,3% in dried plants, usually punishable by the law. Twenty different samples of marijuana that contain THC in concentration more then 0,3% and three varieties of industrial hemp were analyzed for presence of an active copy of THCA synthase gene using in-house developed restriction fragment length polymorphism (RFLP) method All twenty samples of marijuana were positive for the active copy of THCA synthase gene, 16 of them heterozygous. All three varieties of industrial hemp were homozygous for inactive copy. An algorithm for the fast and accurate forensic analysis of samples suspected to be marijuana was constructed, answering the question if an analyzed sample is capable of producing THC in concentrations higher than 0.3%. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

Cloning and heterologous expression of a novel subgroup of class IV polyhydroxyalkanoate synthase genes from the genus Bacillus.

Science.gov (United States)

Mizuno, Kouhei; Kihara, Takahiro; Tsuge, Takeharu; Lundgren, Benjamin R; Sarwar, Zaara; Pinto, Atahualpa; Nomura, Christopher T

2017-01-01

Many microorganisms harbor genes necessary to synthesize biodegradable plastics known as polyhydroxyalkanoates (PHAs). We surveyed a genomic database and discovered a new cluster of class IV PHA synthase genes (phaRC). These genes are different in sequence and operon structure from any previously reported PHA synthase. The newly discovered PhaRC synthase was demonstrated to produce PHAs in recombinant Escherichia coli.

Strengthening Triterpene Saponins Biosynthesis by Over-Expression of Farnesyl Pyrophosphate Synthase Gene and RNA Interference of Cycloartenol Synthase Gene in Panax notoginseng Cells

Directory of Open Access Journals (Sweden)

Yan Yang

2017-04-01

Full Text Available To conform to the multiple regulations of triterpene biosynthesis, the gene encoding farnesyl pyrophosphate synthase (FPS was transformed into Panax notoginseng (P. notoginseng cells in which RNA interference (RNAi of the cycloartenol synthase (CAS gene had been accomplished. Transgenic cell lines showed both higher expression levels of FPS and lower expression levels of CAS compared to the wild-type (WT cells. In the triterpene and phytosterol analysis, transgenic cell lines provided a higher accumulation of total triterpene saponins, and a lower amount of phytosterols in comparison with the WT cells. Compared with the cells in which RNAi of the CAS gene was achieved, the cells with simultaneously over-expressed FPS and silenced CAS showed higher triterpene contents. These results demonstrate that over-expression of FPS can break the rate-limiting reaction catalyzed by FPS in the triterpene saponins biosynthetic pathway; and inhibition of CAS expression can decrease the synthesis metabolic flux of the phytosterol branch. Thus, more precursors flow in the direction of triterpene synthesis, and ultimately promote the accumulation of P. notoginseng saponins. Meanwhile, silencing and over-expressing key enzyme genes simultaneously is more effective than just manipulating one gene in the regulation of saponin biosynthesis.

Lineage-Specific Expansion of the Chalcone Synthase Gene Family in Rosids.

Directory of Open Access Journals (Sweden)

Kattina Zavala

Full Text Available Rosids are a monophyletic group that includes approximately 70,000 species in 140 families, and they are found in a variety of habitats and life forms. Many important crops such as fruit trees and legumes are rosids. The evolutionary success of this group may have been influenced by their ability to produce flavonoids, secondary metabolites that are synthetized through a branch of the phenylpropanoid pathway where chalcone synthase is a key enzyme. In this work, we studied the evolution of the chalcone synthase gene family in 12 species belonging to the rosid clade. Our results show that the last common ancestor of the rosid clade possessed six chalcone synthase gene lineages that were differentially retained during the evolutionary history of the group. In fact, of the six gene lineages that were present in the last common ancestor, 7 species retained 2 of them, whereas the other 5 only retained one gene lineage. We also show that one of the gene lineages was disproportionately expanded in species that belonged to the order Fabales (soybean, barrel medic and Lotus japonicas. Based on the available literature, we suggest that this gene lineage possesses stress-related biological functions (e.g., response to UV light, pathogen defense. We propose that the observed expansion of this clade was a result of a selective pressure to increase the amount of enzymes involved in the production of phenylpropanoid pathway-derived secondary metabolites, which is consistent with the hypothesis that suggested that lineage-specific expansions fuel plant adaptation.

Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model

Science.gov (United States)

Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

2018-03-01

Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.

Modified cellulose synthase gene from 'Arabidopsis thaliana' confers herbicide resistance to plants

Energy Technology Data Exchange (ETDEWEB)

Somerville, Chris R.; Scieble, Wolf

2000-10-11

Cellulose synthase ('CS'), a key enzyme in the biosynthesis of cellulose in plants is inhibited by herbicides comprising thiazolidinones such as 5-tert-butyl-carbamoyloxy-3-(3-trifluromethyl) phenyl-4-thiazolidinone (TZ), isoxaben and 2,6-dichlorobenzonitrile (DCB). Two mutant genes encoding isoxaben and TZ-resistant cellulose synthase have been isolated from isoxaben and TZ-resistant Arabidopsis thaliana mutants. When compared with the gene coding for isoxaben or TZ-sensitive cellulose synthase, one of the resistant CS genes contains a point mutation, wherein glycine residue 998 is replaced by an aspartic acid. The other resistant mutation is due to a threonine to isoleucine change at amino acid residue 942. The mutant CS gene can be used to impart herbicide resistance to a plant; thereby permitting the utilization of the herbicide as a single application at a concentration which ensures the complete or substantially complete killing of weeds, while leaving the transgenic crop plant essentially undamaged.

The polyketide components of waxes and the Cer-cqu gene cluster encoding a novel polyketide synthase, the β-diketone synthase, DKS

DEFF Research Database (Denmark)

von Wettstein, Penny

2017-01-01

The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...

Nitric oxide synthase gene G298 allele

International Nuclear Information System (INIS)

Nagib El-Kilany, Galal E.; Nayel, Ehab; Hazzaa, Sahar

2004-01-01

Background: Nitric oxide (NO) has an important effect on blood pressure, arterial wall, and the basal release of endothelial NO in hypertension (HPN) may be reduced. Until now, there is no solid data revealing the potential role of the polymorphism of the nitric oxide synthase gene (NOS) in patients with HPN and microvascular angina. Aim: The aim of the present study is to investigate the gene of endothelial nitric oxide synthase (eNOS), as the polymorphism of this gene may be a putative candidate for HPN and initiate the process of atherosclerosis. Methods: Sixty participants were recruited for this study; 50 were hypertensive patients complaining of chest pain [30 of them have electrocardiogram (EKG) changes of ischemia], 20 had isolated HPN, and 10 healthy volunteers served as control. All patients underwent stress myocardial perfusion imaging (MPI) and coronary angiography. Genotyping of eNOS for all patients and controls was performed. The linkages between HPN, microvascular angina and eNOS gene polymorphism were investigated. Results: MPI and coronary angiography revealed that 15 patients had chest pain with true ischemia and reversible myocardial perfusion defects (multiple and mild) but normal epicardial coronary arteries (microvascular angina), while 15 patients had significant coronary artery disease (CAD), and 20 hypertensive patients showed normal perfusion scan and coronary angiography. The prevalence of the NOS G 298 allele was higher in the hypertensive group with microvascular angina (documented by MPI) than it was among the control participants (P<.005). The eNOS allele was significantly higher in the hypertensive group than in the control participants, but there was no significant difference in homozygote mutants among hypertensive participants, x-syndrome and patients with CAD. Conclusion: eNOS gene polymorphism is proved to be an important etiology in microvascular angina (x-syndrome) among hypertensive patients. In addition, the eNOS mutant

Metabolic effects of physiological levels of caffeine in myotubes.

Science.gov (United States)

Schnuck, Jamie K; Gould, Lacey M; Parry, Hailey A; Johnson, Michele A; Gannon, Nicholas P; Sunderland, Kyle L; Vaughan, Roger A

2018-02-01

Caffeine has been shown to stimulate multiple major regulators of cell energetics including AMP-activated protein kinase (AMPK) and Ca 2+ /calmodulin-dependent protein kinase II (CaMKII). Additionally, caffeine induces peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α) and mitochondrial biogenesis. While caffeine enhances oxidative metabolism, experimental concentrations often exceed physiologically attainable concentrations through diet. This work measured the effects of low-level caffeine on cellular metabolism and gene expression in myotubes, as well as the dependence of caffeine's effects on the nuclear receptor peroxisome proliferator-activated receptor beta/delta (PPARβ/δ). C2C12 myotubes were treated with various doses of caffeine for up to 24 h. Gene and protein expression were measured via qRT-PCR and Western blot, respectively. Cellular metabolism was determined via oxygen consumption and extracellular acidification rate. Caffeine significantly induced regulators of mitochondrial biogenesis and oxidative metabolism. Mitochondrial staining was suppressed in PPARβ/δ-inhibited cells which was rescued by concurrent caffeine treatment. Caffeine-treated cells also displayed elevated peak oxidative metabolism which was partially abolished following PPARβ/δ inhibition. Similar to past observations, glucose uptake and GLUT4 content were elevated in caffeine-treated cells, however, glycolytic metabolism was unaltered following caffeine treatment. Physiological levels of caffeine appear to enhance cell metabolism through mechanisms partially dependent on PPARβ/δ.

Chromosomal localization of the human and mouse hyaluronan synthase genes

Energy Technology Data Exchange (ETDEWEB)

Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

1997-05-01

We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

The Eucalyptus terpene synthase gene family.

Science.gov (United States)

Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

2015-06-11

Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

The Polyketide Components of Waxes and the Cer-cqu Gene Cluster Encoding a Novel Polyketide Synthase, the β-Diketone Synthase, DKS.

Science.gov (United States)

von Wettstein-Knowles, Penny

2017-07-10

The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c , -q and -u genes forming the 101 kb Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms long, thin crystalline tubes. A pathway branch leads to the formation of esterified alkan-2-ols.

Isolation and expression of the Pneumocystis carinii thymidylate synthase gene

DEFF Research Database (Denmark)

Edman, U; Edman, J C; Lundgren, B

1989-01-01

The thymidylate synthase (TS) gene from Pneumocystis carinii has been isolated from complementary and genomic DNA libraries and expressed in Escherichia coli. The coding sequence of TS is 891 nucleotides, encoding a 297-amino acid protein of Mr 34,269. The deduced amino acid sequence is similar...

Coffee, caffeine-related genes, and Parkinson's disease: a case-control study.

Science.gov (United States)

Facheris, Maurizio F; Schneider, Nicole K; Lesnick, Timothy G; de Andrade, Mariza; Cunningham, Julie M; Rocca, Walter A; Maraganore, Demetrius M

2008-10-30

An inverse association between coffee and Parkinson's disease (PD) has been reported. However, it remains uncertain why some but not all coffee drinkers are less susceptible to PD. We considered the possibility of a pharmacogenetic effect. In our study, we included 1,208 subjects (446 case-unaffected sibling pairs and 158 case-unrelated control pairs) recruited from an ongoing study of the molecular epidemiology of PD in the Upper Midwest (USA). We collected information on lifetime coffee drinking and we studied two genes: ADORA2A, which encodes the major receptor activity of caffeine in the brain (variants rs5751876 and rs3032740), and CYP1A2, which encodes the major rate-limiting step of caffeine metabolism (variants rs35694136 and rs762551). We did not observe significant associations of coffee drinking or of the genetic variants with PD susceptibility, either independently or jointly, in the sample overall and in most strata. Our study neither supports the hypothesis that coffee protects against PD nor provides evidence for a pharmacogenetic effect. (c) 2008 Movement Disorder Society.

Coffee, Caffeine-Related Genes, and Parkinson's Disease: A Case–Control Study

Science.gov (United States)

Facheris, Maurizio F.; Schneider, Nicole K.; Lesnick, Timothy G.; de Andrade, Mariza; Cunningham, Julie M.; Rocca, Walter A.; Maraganore, Demetrius M.

2015-01-01

An inverse association between coffee and Parkinson's disease (PD) has been reported. However, it remains uncertain why some but not all coffee drinkers are less susceptible to PD. We considered the possibility of a pharmaco-genetic effect. In our study, we included 1,208 subjects (446 case-unaffected sibling pairs and 158 case-unrelated control pairs) recruited from an ongoing study of the molecular epidemiology of PD in the Upper Midwest (USA). We collected information on lifetime coffee drinking and we studied two genes: ADORA2A, which encodes the major receptor activity of caffeine in the brain (variants rs5751876 and rs3032740), and CYP1A2, which encodes the major rate-limiting step of caffeine metabolism (variants rs35694136 and rs762551). We did not observe significant associations of coffee drinking or of the genetic variants with PD susceptibility, either independently or jointly, in the sample overall and in most strata. Our study neither supports the hypothesis that coffee protects against PD nor provides evidence for a pharmacogenetic effect. PMID:18759349

Excess caffeine exposure impairs eye development during chick embryogenesis

Science.gov (United States)

Ma, Zheng-lai; Wang, Guang; Cheng, Xin; Chuai, Manli; Kurihara, Hiroshi; Lee, Kenneth Ka Ho; Yang, Xuesong

2014-01-01

Caffeine has been an integral component of our diet and medicines for centuries. It is now known that over consumption of caffeine has detrimental effects on our health, and also disrupts normal foetal development in pregnant mothers. In this study, we investigated the potential teratogenic effect of caffeine over-exposure on eye development in the early chick embryo. Firstly, we demonstrated that caffeine exposure caused chick embryos to develop asymmetrical microphthalmia and induced the orbital bone to develop abnormally. Secondly, caffeine exposure perturbed Pax6 expression in the retina of the developing eye. In addition, it perturbed the migration of HNK-1+ cranial neural crest cells. Pax6 is an important gene that regulates eye development, so altering the expression of this gene might be the cause for the abnormal eye development. Thirdly, we found that reactive oxygen species (ROS) production was significantly increased in eye tissues following caffeine treatment, and that the addition of anti-oxidant vitamin C could rescue the eyes from developing abnormally in the presence of caffeine. This suggests that excess ROS induced by caffeine is one of the mechanisms involved in the teratogenic alterations observed in the eye during embryogenesis. In sum, our experiments in the chick embryo demonstrated that caffeine is a potential teratogen. It causes asymmetrical microphthalmia to develop by increasing ROS production and perturbs Pax6 expression. PMID:24636305

UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

Energy Technology Data Exchange (ETDEWEB)

Miyata, Maiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Sugiura, Kazumitsu [Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Koichi, E-mail: koichi@med.nagoya-u.ac.jp [Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan); Furukawa, Keiko [Department of Life and Medical Sciences, Chubu University Faculty of Life and Health Sciences, Matsumoto, Kasugai 487-8501 (Japan); Department of Biochemistry II, Nagoya University Graduate School of Medicine, 65 Tsurumai, Showa-ku, Nagoya 466-0065 (Japan)

2014-03-07

Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes.

UVB-irradiated keratinocytes induce melanoma-associated ganglioside GD3 synthase gene in melanocytes via secretion of tumor necrosis factor α and interleukin 6

International Nuclear Information System (INIS)

Miyata, Maiko; Ichihara, Masatoshi; Tajima, Orie; Sobue, Sayaka; Kambe, Mariko; Sugiura, Kazumitsu; Furukawa, Koichi; Furukawa, Keiko

2014-01-01

Highlights: • Melanocytes showed low ST8SIA1 and high B3GALT4 levels in contrast with melanomas. • Direct UVB irradiation of melanocytes did not induce ganglioside synthase genes. • Culture supernatants of UVB-irradiated keratinocytes induced ST8SIA1 in melanocytes. • TNFα and IL-6 secreted from keratinocytes enhanced ST8SIA1 expression in melanocytes. • Inflammatory cytokines induced melanoma-related ST8SIA1 in melanocytes. - Abstract: Although expression of gangliosides and their synthetic enzyme genes in malignant melanomas has been well studied, that in normal melanocytes has been scarcely analyzed. In particular, changes in expression levels of glycosyltransferase genes responsible for ganglioside synthesis during evolution of melanomas from melanocytes are very important to understand roles of gangliosides in melanomas. Here, expression of glycosyltransferase genes related to the ganglioside synthesis was analyzed using RNAs from cultured melanocytes and melanoma cell lines. Quantitative RT-PCR revealed that melanomas expressed high levels of mRNA of GD3 synthase and GM2/GD2 synthase genes and low levels of GM1/GD1b synthase genes compared with melanocytes. As a representative exogenous stimulation, effects of ultraviolet B (UVB) on the expression levels of 3 major ganglioside synthase genes in melanocytes were analyzed. Although direct UVB irradiation of melanocytes caused no marked changes, culture supernatants of UVB-irradiated keratinocytes (HaCaT cells) induced definite up-regulation of GD3 synthase and GM2/GD2 synthase genes. Detailed examination of the supernatants revealed that inflammatory cytokines such as TNFα and IL-6 enhanced GD3 synthase gene expression. These results suggest that inflammatory cytokines secreted from UVB-irradiated keratinocytes induced melanoma-associated ganglioside synthase genes, proposing roles of skin microenvironment in the promotion of melanoma-like ganglioside profiles in melanocytes

Cloning and characterization of indole synthase (INS) and a putative tryptophan synthase α-subunit (TSA) genes from Polygonum tinctorium.

Science.gov (United States)

Jin, Zhehao; Kim, Jin-Hee; Park, Sang Un; Kim, Soo-Un

2016-12-01

Two cDNAs for indole-3-glycerol phosphate lyase homolog were cloned from Polygonum tinctorium. One encoded cytosolic indole synthase possibly in indigoid synthesis, whereas the other encoded a putative tryptophan synthase α-subunit. Indigo is an old natural blue dye produced by plants such as Polygonum tinctorium. Key step in plant indigoid biosynthesis is production of indole by indole-3-glycerol phosphate lyase (IGL). Two tryptophan synthase α-subunit (TSA) homologs, PtIGL-short and -long, were isolated by RACE PCR from P. tinctorium. The genome of the plant contained two genes coding for IGL. The short and the long forms, respectively, encoded 273 and 316 amino acid residue-long proteins. The short form complemented E. coli ΔtnaA ΔtrpA mutant on tryptophan-depleted agar plate signifying production of free indole, and thus was named indole synthase gene (PtINS). The long form, either intact or without the transit peptide sequence, did not complement the mutant and was tentatively named PtTSA. PtTSA was delivered into chloroplast as predicted by 42-residue-long targeting sequence, whereas PtINS was localized in cytosol. Genomic structure analysis suggested that a TSA duplicate acquired splicing sites during the course of evolution toward PtINS so that the targeting sequence-containing pre-mRNA segment was deleted as an intron. PtINS had about two to fivefolds higher transcript level than that of PtTSA, and treatment of 2,1,3-benzothiadiazole caused the relative transcript level of PtINS over PtTSA was significantly enhanced in the plant. The results indicate participation of PtINS in indigoid production.

Caffeine inhibits STAT1 signaling and downregulates inflammatory pathways involved in autoimmunity.

Science.gov (United States)

Iris, Merve; Tsou, Pei-Suen; Sawalha, Amr H

2018-04-18

Caffeine is a widely consumed pharmacologically active product. We focused on characterizing immunomodulatory effects of caffeine on peripheral blood mononuclear cells. Caffeine at high doses showed a robust downregulatory effect on cytokine activity and genes related to several autoimmune diseases including lupus and rheumatoid arthritis. Dose-dependent validation experiments showed downregulation at the mRNA levels of key inflammation-related genes including STAT1, TNF, IFNG, and PPARG. TNF and PPARG were suppressed even with the lowest caffeine dose tested, which corresponds to the serum concentration of caffeine after administration of one cup of coffee. Cytokine levels of IL-8, MIP-1β, IL-6, IFN-γ, GM-CSF, TNF, IL-2, IL-4, MCP-1, and IL-10 were decreased significantly with caffeine treatment. Upstream regulator analysis suggests that caffeine inhibits STAT1 signaling, which was confirmed by showing reduced phosphorylated STAT1 after caffeine treatment. Further studies exploring disease-modulating potential of caffeine in autoimmune diseases and further exploring the mechanisms involved are warranted. Copyright © 2018 Elsevier Inc. All rights reserved.

Pu-erh Tea Reduces Nitric Oxide Levels in Rats by Inhibiting Inducible Nitric Oxide Synthase Expression through Toll-Like Receptor 4

Science.gov (United States)

Xu, Yang; Wang, Guan; Li, Chunjie; Zhang, Min; Zhao, Hang; Sheng, Jun; Shi, Wei

2012-01-01

Pu-erh tea undergoes a unique fermentation process and contains theabrownins, polysaccharides and caffeine; although it is unclear about which component is associated with the down regulation of nitric oxide levels or how this process is mediated. To address this question we examined the effects of pu-erh tea on nitric oxide synthase (NOS) genes. Cohorts of rats were separately given four-week treatments of water as control, pu-erh tea, or the tea components: theabrownins, caffeine or polysaccharides. Five experimental groups were injected with lipopolysaccharides (LPS) to induce nitric oxide (NO) production, while the corresponding five control groups were injected with saline as a negative control. The serum and liver NO concentrations were examined and the NOS expression of both mRNA and protein was measured in liver. The results showed that the rats which were fed pu-erh tea or polysaccharides had lower levels of NO which corresponded with the down-regulation of inducible nitric oxide synthase (iNOS) expression. We further demonstrate that this effect is mediated through reduction of Toll-like receptor 4 (TLR4) signaling. Thus we find that the polysaccharide components in pu-erh tea reduce NO levels in an animal model by inhibiting the iNOS expression via signaling through TLR4. PMID:22837686

Cytochrome P450-Dependent Metabolism of Caffeine in Drosophila melanogaster

Science.gov (United States)

Coelho, Alexandra; Fraichard, Stephane; Le Goff, Gaëlle; Faure, Philippe; Artur, Yves; Ferveur, Jean-François; Heydel, Jean-Marie

2015-01-01

Caffeine (1, 3, 7-trimethylxanthine), an alkaloid produced by plants, has antioxidant and insecticide properties that can affect metabolism and cognition. In vertebrates, the metabolites derived from caffeine have been identified, and their functions have been characterized. However, the metabolites of caffeine in insects remain unknown. Thus, using radiolabelled caffeine, we have identified some of the primary caffeine metabolites produced in the body of Drosophila melanogaster males, including theobromine, paraxanthine and theophylline. In contrast to mammals, theobromine was the predominant metabolite (paraxanthine in humans; theophylline in monkeys; 1, 3, 7-trimethyluric acid in rodents). A transcriptomic screen of Drosophila flies exposed to caffeine revealed the coordinated variation of a large set of genes that encode xenobiotic-metabolizing proteins, including several cytochromes P450s (CYPs) that were highly overexpressed. Flies treated with metyrapone—an inhibitor of CYP enzymes—showed dramatically decreased caffeine metabolism, indicating that CYPs are involved in this process. Using interference RNA genetic silencing, we measured the metabolic and transcriptomic effect of three candidate CYPs. Silencing of CYP6d5 completely abolished theobromine synthesis, whereas CYP6a8 and CYP12d1 silencing induced different consequences on metabolism and gene expression. Therefore, we characterized several metabolic products and some enzymes potentially involved in the degradation of caffeine. In conclusion, this pioneer approach to caffeine metabolism in insects opens novel perspectives for the investigation of the physiological effects of caffeine metabolites. It also indicates that caffeine could be used as a biomarker to evaluate CYP phenotypes in Drosophila and other insects. PMID:25671424

Cytochrome P450-dependent metabolism of caffeine in Drosophila melanogaster.

Directory of Open Access Journals (Sweden)

Alexandra Coelho

Full Text Available Caffeine (1, 3, 7-trimethylxanthine, an alkaloid produced by plants, has antioxidant and insecticide properties that can affect metabolism and cognition. In vertebrates, the metabolites derived from caffeine have been identified, and their functions have been characterized. However, the metabolites of caffeine in insects remain unknown. Thus, using radiolabelled caffeine, we have identified some of the primary caffeine metabolites produced in the body of Drosophila melanogaster males, including theobromine, paraxanthine and theophylline. In contrast to mammals, theobromine was the predominant metabolite (paraxanthine in humans; theophylline in monkeys; 1, 3, 7-trimethyluric acid in rodents. A transcriptomic screen of Drosophila flies exposed to caffeine revealed the coordinated variation of a large set of genes that encode xenobiotic-metabolizing proteins, including several cytochromes P450s (CYPs that were highly overexpressed. Flies treated with metyrapone--an inhibitor of CYP enzymes--showed dramatically decreased caffeine metabolism, indicating that CYPs are involved in this process. Using interference RNA genetic silencing, we measured the metabolic and transcriptomic effect of three candidate CYPs. Silencing of CYP6d5 completely abolished theobromine synthesis, whereas CYP6a8 and CYP12d1 silencing induced different consequences on metabolism and gene expression. Therefore, we characterized several metabolic products and some enzymes potentially involved in the degradation of caffeine. In conclusion, this pioneer approach to caffeine metabolism in insects opens novel perspectives for the investigation of the physiological effects of caffeine metabolites. It also indicates that caffeine could be used as a biomarker to evaluate CYP phenotypes in Drosophila and other insects.

Identifying the catalytic components of cellulose synthase and the maize mixed-linkage beta-glucan synthase

Energy Technology Data Exchange (ETDEWEB)

Nicholas C Carpita

2009-04-20

Five specific objectives of this project are to develop strategies to identify the genes that encode the catalytic components of "mixed-linkage" (1→3),(1→4)-beta-D-glucans in grasses, to determine the protein components of the synthase complex, and determine the biochemical mechanism of synthesis. We have used proteomic approaches to define intrinsic and extrinsic polypeptides of Golgi membranes that are associated with polysaccharide synthesis and trafficking. We were successful in producing recombinant catalytic domains of cellulose synthase genes and discovered that they dimerize upon concentration, indicating that two CesA proteins form the catalytic unit. We characterized a brittle stalk2 mutant as a defect in a COBRA-like protein that results in compromised lignin-cellulose interactions that decrease tissue flexibility. We used virus-induced gene silencing of barley cell wall polysaccharide synthesis by BSMV in an attempt to silence specific members of the cellulose synthase-like gene family. However, we unexpectedly found that regardless of the specificity of the target gene, whole gene interaction networks were silenced. We discovered the cause to be an antisense transcript of the cellulose synthase gene initiated small interfering RNAs that spread silencing to related genes.

Virus-induced gene silencing of Withania somnifera squalene synthase negatively regulates sterol and defence-related genes resulting in reduced withanolides and biotic stress tolerance.

Science.gov (United States)

Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A

2015-12-01

Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides

Caffeine withdrawal symptoms and self-administration following caffeine deprivation.

Science.gov (United States)

Mitchell, S H; de Wit, H; Zacny, J P

1995-08-01

This study examined the effects of complete or partial caffeine deprivation on withdrawal symptomatology and self-administration of coffee in caffeine-dependent coffee drinkers. Nine habitual coffee drinkers abstained from dietary sources of caffeine for 33.5 h. Caffeine deprivation was manipulated by administering capsules containing 0%, 50%, or 100% of each subject's daily caffeine intake (complete, partial, and no deprivation conditions). Caffeine withdrawal symptomatology was measured using self-report questionnaires. Caffeine self-administration was measured using: i) the amount of coffee subjects earned on a series of concurrent random-ratio schedules that yielded coffee and money reinforcers; ii) the amount of earned coffee they consumed. Saliva samples revealed that subjects complied with the caffeine abstinence instructions. Caffeine withdrawal symptoms occurred reliably following complete caffeine deprivation, though not in the partial deprivation condition. Caffeine self-administration was not related to deprivation condition. We conclude that caffeine withdrawal symptomatology is not necessarily associated with increased caffeine consumption.

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Caffeine as a model drug of dependence: recent developments in understanding caffeine withdrawal, the caffeine dependence syndrome, and caffeine negative reinforcement.

Science.gov (United States)

Griffiths, R R; Chausmer, A L

2000-11-01

Caffeine is an excellent model compound for understanding drugs of abuse/dependence. The results of self-administration and choice studies in humans clearly demonstrate the reinforcing effects of low and moderate doses of caffeine. Caffeine reinforcement has been demonstrated in about 45% of normal subjects with histories of moderate and heavy caffeine use. Recent studies provide compelling evidence that caffeine physical dependence potentiates the reinforcing effects of caffeine through the mechanism of withdrawal symptom avoidance. Tolerance to the subjective and sleep-disrupting effects of caffeine in humans has been demonstrated. Physical dependence as reflected in a withdrawal syndrome in humans has been repeatedly demonstrated in adults and recently demonstrated in children. Withdrawal severity is an increasing function of caffeine maintenance dose, with withdrawal occurring at doses as low as 100 mg per day. Increased cerebral blood flow may be the physiological mechanism for caffeine withdrawal headache. Case studies in adults and adolescents clearly demonstrate that some individuals meet DSM-IV diagnostic criteria for a substance dependence syndrome on caffeine, including feeling compelled to continue caffeine use despite desires and recommendations to the contrary. Survey data suggest that 9% to 30% percent of caffeine consumers may be caffeine dependent according to DSM-IV criteria.

Cloning and characterization of ATP synthase CF1 α gene from ...

African Journals Online (AJOL)

ATP synthase CF1 α subunit protein is a key enzyme for energy metabolism in plant kingdom, and plays an important role in multiple cell processes. In this study, the complete atpA gene (accession no. JN247444) was cloned from sweet potato (Ipomoea batatas L. Lam) by reverse transcriptasepolymerase chain reaction ...

Application of a Colorimetric Assay to Identify Putative Ribofuranosylaminobenzene 5'-Phosphate Synthase Genes Expressed with Activity in Escherichia coli

OpenAIRE

Bechard, Matthew E.; Chhatwal, Sonya; Garcia, Rosemarie E.; Rasche, Madeline E.

2003-01-01

Tetrahydromethanopterin (H4MPT) is a tetrahydrofolate analog originally discovered in methanogenic archaea, but later found in other archaea and bacteria. The extent to which H4MPT occurs among living organisms is unknown. The key enzyme which distinguishes the biosynthetic pathways of H4MPT and tetrahydrofolate is ribofuranosylaminobenzene 5'-phosphate synthase (RFAP synthase). Given the importance of RFAP synthase in H4MPT biosynthesis, the identification of putative RFAP synthase genes and...

Caffeine intake and abstract reasoning among 1374 unselected men and women from general population. Role of the -163C>A polymorphism of CYP1A2 gene.

Science.gov (United States)

Casiglia, Edoardo; Tikhonoff, Valérie; Albertini, Federica; Favaro, Jacopo; Montagnana, Martina; Danese, Elisa; Finatti, Francesco; Benati, Marco; Mazza, Alberto; Dal Maso, Lucia; Spinella, Paolo; Palatini, Paolo

2017-08-01

The possible effect of caffeine as an enhancer of cognitive performance, particularly that on abstract reasoning, has never been studied in an epidemiological setting, especially in relation to -163C>A polymorphism of CYP1A2 gene, largely controlling caffeine metabolism. Aim of this study was to ascertain whether in general population free chronic caffeine intake modifies abstract reasoning, and if this effect is influenced by the above mentioned genotype, by age, schooling, ethanol intake and smoking habits. We studied 1374 unselected men and women aged 51 ± 15 years (range 18-89) from a general population. Daily caffeine intake deriving from coffee, tea, chocolate or cola was calculated from an anamnestic questionnaire and from a 7-day dietary diary. Abstract reasoning was measured in the frame of a neuropsychological assessment as the ability to find a concept linking two words indicating objects or actions and explaining how they were connected. In age-schooling-adjusted linear regression, the higher the caffeine intake, the better the abstraction score. Abstract reasoning depended on caffeine in the -163C>A CC homozygous only (so-called slow metabolizers), where it was higher in the 3rd tertile of caffeine intake. Age and ethanol reduced while smoking and schooling enhanced this association. The interaction term between caffeine and the -163C>A polymorphism was accepted in linear regressions. Caffeine consumption resulted innocuous for the A-carriers (so-called fast metabolizers). In general population, a positive association between caffeine intake and abstract reasoning exists in the CC homozygous of the -163C>A polymorphism of CYP1A2 gene. Copyright © 2017 European Society for Clinical Nutrition and Metabolism. Published by Elsevier Ltd. All rights reserved.

Functional mitochondrial ATP synthase proteolipid gene produced by recombination of parental genes in a petunia somatic hybrid

International Nuclear Information System (INIS)

Rothenberg, M.; Hanson, M.R.

1988-01-01

A novel ATP synthase subunit 9 gene (atp9) was identified in the mitochondrial genome of a Petunia somatic hybrid line (13-133) which was produced from a fusion between Petunia lines 3688 and 3704. The novel gene was generated by intergenomic recombination between atp9 genes from the two parental plant lines. The entire atp9 coding region is represented on the recombinant gene. Comparison of gene sequences using electrophoresis and autoradiography, indicate that the 5' transcribed region is contributed by an atp9 gene from 3704 and the 3' transcribed region is contributed by an atp9 gene from 3688. The recombinant atp9 gene is transcriptionally active. The location of the 5' and 3' transcript termini are conserved with respect to the parental genes, resulting in the production of hybrid transcripts

A real-time PCR assay for the relative quantification of the tetrahydrocannabinolic acid (THCA) synthase gene in herbal Cannabis samples.

Science.gov (United States)

Cascini, Fidelia; Passerotti, Stella; Martello, Simona

2012-04-10

In this study, we wanted to investigate whether or not the tetrahydrocannabinolic acid (THCA) synthase gene, which codes for the enzyme involved in the biosynthesis of THCA, influences the production and storage of tetrahydrocannabinol (THC) in a dose-dependent manner. THCA is actually decarboxylated to produce THC, the main psychoactive component in the Cannabis plant. Assuming as the research hypothesis a correlation between the gene copy number and the production of THC, gene quantification could be useful in forensics in order to complement or replace chemical analysis for the identification and classification of seized Cannabis samples, thus distinguishing the drug-type from the fibre-type varieties. A real-time PCR assay for the relative quantification of the THCA synthase gene was then validated on Cannabis samples; some were seized from the illegal drug market and others were derived from experimental cultivation. In order to determine the gene copy number to compare high vs. low potency plants, we chose the ΔΔCt method for TaqMan reactions. The assay enabled single plants with zero, one, and two copies of the gene to be distinguished. As a result of this first part of the research on the THCA synthase gene (the second part will cover a study of gene expression), we found no correlation between THCA synthase gene copy number and the content of THC in the herbal Cannabis samples tested. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Caffeine Induces the Stress Response and Up-Regulates Heat Shock Proteins in Caenorhabditis elegans.

Science.gov (United States)

Al-Amin, Mohammad; Kawasaki, Ichiro; Gong, Joomi; Shim, Yhong-Hee

2016-02-01

Caffeine has both positive and negative effects on physiological functions in a dose-dependent manner. C. elegans has been used as an animal model to investigate the effects of caffeine on development. Caffeine treatment at a high dose (30 mM) showed detrimental effects and caused early larval arrest. We performed a comparative proteomic analysis to investigate the mode of action of high-dose caffeine treatment in C. elegans and found that the stress response proteins, heat shock protein (HSP)-4 (endoplasmic reticulum [ER] chaperone), HSP-6 (mitochondrial chaperone), and HSP-16 (cytosolic chaperone), were induced and their expression was regulated at the transcriptional level. These findings suggest that high-dose caffeine intake causes a strong stress response and activates all three stress-response pathways in the worms, including the ER-, mitochondrial-, and cytosolic pathways. RNA interference of each hsp gene or in triple combination retarded growth. In addition, caffeine treatment stimulated a food-avoidance behavior (aversion phenotype), which was enhanced by RNAi depletion of the hsp-4 gene. Therefore, up-regulation of hsp genes after caffeine treatment appeared to be the major responses to alleviate stress and protect against developmental arrest.

Mutation of Cellulose Synthase Gene Improves the Nutritive Value of Rice Straw

Directory of Open Access Journals (Sweden)

Yanjing Su

2012-06-01

Full Text Available Rice straw is an important roughage resource for ruminants in many rice-producing countries. In this study, a rice brittle mutant (BM, mutation in OsCesA4, encoding cellulose synthase and its wild type (WT were employed to investigate the effects of a cellulose synthase gene mutation on rice straw morphological fractions, chemical composition, stem histological structure and in situ digestibility. The morphological fractions investigation showed that BM had a higher leaf sheath proportion (43.70% vs 38.21%, p0.05 was detected in neutral detergent fiber (NDFom and ADL contents for both strains. Histological structure observation indicated that BM stems had fewer sclerenchyma cells and a thinner sclerenchyma cell wall than WT. The results of in situ digestion showed that BM had higher DM, NDFom, cellulose and hemicellulose disappearance at 24 or 48 h of incubation (p<0.05. The effective digestibility of BM rice straw DM and NDFom was greater than that of WT (31.4% vs 26.7% for DM, 29.1% vs 24.3% for NDFom, p<0.05, but the rate of digestion of the slowly digested fraction of BM rice straw DM and NDF was decreased. These results indicated that the mutation in the cellulose synthase gene could improve the nutritive value of rice straw for ruminants.

Caffeine inhibits cell proliferation by G0/G1 phase arrest in JB6 cells.

Science.gov (United States)

Hashimoto, Takashi; He, Zhiwei; Ma, Wei-Ya; Schmid, Patricia C; Bode, Ann M; Yang, Chung S; Dong, Zigang

2004-05-01

Caffeine is a major biologically active constituent in coffee and tea. Because caffeine has been reported to inhibit carcinogenesis in UVB-exposed mice, the cancer-preventing effect of caffeine has attracted considerable attention. In the present study, the effect of caffeine in quiescent (G0 phase) cells was investigated. Pretreatment with caffeine suppressed cell proliferation in a dose-dependent manner 36 h after addition of fetal bovine serum as a cell growth stimulator. Analysis by flow cytometry showed that caffeine suppressed cell cycle progression at the G0/G1 phase, i.e., 18 h after addition of fetal bovine serum, the percentages of cells in G0/G1 phase in 1 mM caffeine-treated cells and in caffeine-untreated cells were 61.7 and 29.0, respectively. The percentage of cells in G0/G1 phase at 0 h was 75.5. Caffeine inhibited phosphorylation of retinoblastoma protein at Ser780 and Ser807/Ser811, the sites where retinoblastoma protein has been reported to be phosphorylated by cyclin-dependent kinase 4 (cdk4). Furthermore, caffeine inhibited the activation of the cyclin D1-cdk4 complex in a dose-dependent manner. However this compound did not directly inhibit the activity of this complex. In addition, caffeine did not affect p16INK4 or p27Kip1 protein levels, but inhibited the phosphorylation of protein kinase B (Akt) and glycogen synthase kinase 3beta. Our results showed that caffeine suppressed the progression of quiescent cells into the cell cycle. The inhibitory mechanism may be due to the inhibition of cell growth signal-induced activation of cdk4, which may be involved in the inhibition of carcinogenesis in vivo.

Differential responsiveness to caffeine and perceived effects of caffeine in moderate and high regular caffeine consumers.

Science.gov (United States)

Attwood, A S; Higgs, S; Terry, P

2007-03-01

Individual differences in responsiveness to caffeine occur even within a caffeine-consuming population, but the factors that mediate differential responsiveness remain unclear. To compare caffeine's effects on performance and mood in a group of high vs moderate consumers of caffeine and to examine the potential role of subjective awareness of the effects of caffeine in mediating any differential responsiveness. Two groups of regular caffeine consumers (200 mg/day) attended two sessions at which mood and cognitive functions were measured before and 30 min after consumption of 400-mg caffeine or placebo in a capsule. Cognitive tests included visual information processing, match-to-sample visual search (MTS) and simple and choice reaction times. Post-session questionnaires asked participants to describe any perceived effect of capsule consumption. High consumers, but not moderate consumers, demonstrated significantly faster simple and choice reaction times after caffeine relative to placebo. These effects were not attributable to obvious group differences in withdrawal or tolerance because there were no group differences in baseline mood or in reports of negative affect after caffeine. Instead, the high consumers were more likely to report experiencing positive effects of caffeine, whereas the moderate consumers were more likely to report no effect. The sensitivity of caffeine consumers to the mood- and performance-enhancing effects of caffeine is related to their levels of habitual intake. High caffeine consumers are more likely than moderate consumers to perceive broadly positive effects of caffeine, and this may contribute to their levels of use.

Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.).

Science.gov (United States)

Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq

2017-08-01

Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.

Caffeine

Science.gov (United States)

What is caffeine? Caffeine is a bitter substance that occurs naturally in more than 60 plants including Coffee beans Tea leaves Kola nuts, ... chocolate products There is also synthetic (man-made) caffeine, which is added to some medicines, foods, and ...

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

OpenAIRE

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-01-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was succe...

Sesquiterpene Synthase-3-Hydroxy-3-Methylglutaryl Coenzyme A Synthase Fusion Protein Responsible for Hirsutene Biosynthesis in Stereum hirsutum.

Science.gov (United States)

Flynn, Christopher M; Schmidt-Dannert, Claudia

2018-06-01

The wood-rotting mushroom Stereum hirsutum is a known producer of a large number of namesake hirsutenoids, many with important bioactivities. Hirsutenoids form a structurally diverse and distinct class of sesquiterpenoids. No genes involved in hirsutenoid biosynthesis have yet been identified or their enzymes characterized. Here, we describe the cloning and functional characterization of a hirsutene synthase as an unexpected fusion protein of a sesquiterpene synthase (STS) with a C-terminal 3-hydroxy-3-methylglutaryl-coenzyme A (3-hydroxy-3-methylglutaryl-CoA) synthase (HMGS) domain. Both the full-length fusion protein and truncated STS domain are highly product-specific 1,11-cyclizing STS enzymes with kinetic properties typical of STSs. Complementation studies in Saccharomyces cerevisiae confirmed that the HMGS domain is also functional in vivo Phylogenetic analysis shows that the hirsutene synthase domain does not form a clade with other previously characterized sesquiterpene synthases from Basidiomycota. Comparative gene structure analysis of this hirsutene synthase with characterized fungal enzymes reveals a significantly higher intron density, suggesting that this enzyme may be acquired by horizontal gene transfer. In contrast, the HMGS domain is clearly related to other fungal homologs. This STS-HMGS fusion protein is part of a biosynthetic gene cluster that includes P450s and oxidases that are expressed and could be cloned from cDNA. Finally, this unusual fusion of a terpene synthase to an HMGS domain, which is not generally recognized as a key regulatory enzyme of the mevalonate isoprenoid precursor pathway, led to the identification of additional HMGS duplications in many fungal genomes, including the localization of HMGSs in other predicted sesquiterpenoid biosynthetic gene clusters. IMPORTANCE Hirsutenoids represent a structurally diverse class of bioactive sesquiterpenoids isolated from fungi. Identification of their biosynthetic pathways will provide

Unchanged gene expression of glycogen synthase in muscle from patients with NIDDM following sulphonylurea-induced improvement of glycaemic control

DEFF Research Database (Denmark)

Vestergaard, H; Lund, S; Bjørbaek, C

1995-01-01

We have previously shown that the mRNA expression of muscle glycogen synthase is decreased in non-insulin-dependent diabetic (NIDDM) patients; the objective of the present protocol was to examine whether the gene expression of muscle glycogen synthase in NIDDM is affected by chronic sulphonylurea...... as enhanced beta-cell responses to an oral glucose load. During euglycaemic, hyperinsulinaemic clamp (2 mU x kg-1 x min-1) in combination with indirect calorimetry, a 35% (p=0.005) increase in whole-body insulin-stimulated glucose disposal rate, predominantly due to an increased non-oxidative glucose....... In conclusion, improved blood glucose control in gliclazide-treated obese NIDDM patients has no impact on the gene expression of muscle glycogen synthase....

Caffeine and cognitive performance: persistent methodological challenges in caffeine research.

Science.gov (United States)

James, Jack E

2014-09-01

Human cognitive performance is widely perceived to be enhanced by caffeine at usual dietary doses. However, the evidence for and against this belief continues to be vigorously contested. Controversy has centred on caffeine withdrawal and withdrawal reversal as potential sources of experimental confounding. In response, some researchers have enlisted "caffeine-naïve" experimental participants (persons alleged to consume little or no caffeine) assuming that they are not subject to withdrawal. This mini-review examines relevant research to illustrate general methodological challenges that have been the cause of enduring confusion in caffeine research. At issue are the processes of caffeine withdrawal and withdrawal reversal, the definition of caffeine-naïve, the population representativeness of participants deemed to be caffeine-naïve, and confounding due to caffeine tolerance. Attention to these processes is necessary if premature conclusions are to be avoided, and if caffeine's complex effects and the mechanisms responsible for those effects are to be illuminated. Strategies are described for future caffeine research aimed at minimising confounding from withdrawal and withdrawal reversal. Copyright © 2014 Elsevier Inc. All rights reserved.

Association of the Anxiogenic and Alerting Effects of Caffeine with ADORA2A and ADORA1 Polymorphisms and Habitual Level of Caffeine Consumption

Science.gov (United States)

Rogers, Peter J; Hohoff, Christa; Heatherley, Susan V; Mullings, Emma L; Maxfield, Peter J; Evershed, Richard P; Deckert, Jürgen; Nutt, David J

2010-01-01

Caffeine, a widely consumed adenosine A1 and A2A receptor antagonist, is valued as a psychostimulant, but it is also anxiogenic. An association between a variant within the ADORA2A gene (rs5751876) and caffeine-induced anxiety has been reported for individuals who habitually consume little caffeine. This study investigated whether this single nucleotide polymorphism (SNP) might also affect habitual caffeine intake, and whether habitual intake might moderate the anxiogenic effect of caffeine. Participants were 162 non-/low (NL) and 217 medium/high (MH) caffeine consumers. In a randomized, double-blind, parallel groups design they rated anxiety, alertness, and headache before and after 100 mg caffeine and again after another 150 mg caffeine given 90 min later, or after placebo on both occasions. Caffeine intake was prohibited for 16 h before the first dose of caffeine/placebo. Results showed greater susceptibility to caffeine-induced anxiety, but not lower habitual caffeine intake (indeed coffee intake was higher), in the rs5751876 TT genotype group, and a reduced anxiety response in MH vs NL participants irrespective of genotype. Apart from the almost completely linked ADORA2A SNP rs3761422, no other of eight ADORA2A and seven ADORA1 SNPs studied were found to be clearly associated with effects of caffeine on anxiety, alertness, or headache. Placebo administration in MH participants decreased alertness and increased headache. Caffeine did not increase alertness in NL participants. With frequent consumption, substantial tolerance develops to the anxiogenic effect of caffeine, even in genetically susceptible individuals, but no net benefit for alertness is gained, as caffeine abstinence reduces alertness and consumption merely returns it to baseline. PMID:20520601

Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

Directory of Open Access Journals (Sweden)

Catalina Sanz

Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

Caffein

DEFF Research Database (Denmark)

Nørager, Charlotte Buchard; Jensen, Martin Bach; Madsen, Mogens Rørbæk

2005-01-01

/kg) can increase the endurance of athletes engaged in running, bicycling, swimming and other endurance sports. Caffeine is used both in training and in competitions, and the International Olympic Commitée (IOC) has included caffeine as a drug used for doping. There are several theories about caffeine...

Effects of caffeine co-treatment with radiation on breast cancer susceptibility gene BRCA1

International Nuclear Information System (INIS)

Li Ning; Zhou Xin; Zhang Hong; Wang Yanling; Hao Jifang

2011-01-01

The sensitizing effect of caffeine to carbon ion radiation was investigated and the change of BRCA1 expression was observed. The MCF-7 breast carcinoma cells were exposed to carbon ion beams with or without caffeine. The cell survival was automatically monitored by RT-CES system. Cell cycle distribution was assessed by flow cytometry. The levels of BRCA1 mRNA were analyzed by real-time RT-PCR.The expression of BRCA1 protein and its phosphorylation were examined by Western blot. The results show that caffeine increases the sensitivity of MCF-7 cells to carbon ion radiation, and abrogates the radiation-induced G2 arrest. Caffeine inhibits radiation-induced BRCA1 expression both at mRNA and protein level. At the same time, caffeine specifically abolishes BRCA1 phosphorylation of Ser-1524. The data implicate that caffeine inhibits the expression of BRCA1 protein and its phosphorylation. (authors)

Caffeine inheritance in interspecific hybrids of Coffea arabica x Coffea canephora (Gentianales, Rubiaceae

Directory of Open Access Journals (Sweden)

Regina H.G. Priolli

2008-01-01

Full Text Available Caffeine inheritance was investigated in F2 and BC1F1 generations between Coffea arabica var. Bourbon Vermelho (BV and Coffea canephora var. Robusta 4x (R4x. The caffeine content of seeds and leaves was determined during 2004 and 2005. Microsatellite loci-markers were used to deduce the meiotic pattern of chromosome pairing of tetraploid interspecific hybrids. Genetic analysis indicated that caffeine content in seeds was quantitatively inherited and controlled by genes with additive effects. The estimates of broad-sense heritability of caffeine content in seeds were high for both generations. In coffee leaves, the caffeine content (BSH from the same populations showed transgressive segregants with enhanced levels and high BSH. Segregation of loci-markers in BC1F1 populations showed that the ratios of the gametes genotype did not differ significantly from those expected assuming random associations and tetrasomic inheritance. The results confirm the existence of distinct mechanisms controlling the caffeine content in seeds and leaves, the gene exchange between the C. arabica BV and C. canephora R4x genomes and favorable conditions for improving caffeine content in this coffee population.

[Caffeine dependence].

Science.gov (United States)

Ogawa, Naoshi; Ueki, Hirofumi

2010-08-01

Caffeine is the most widely consumed psychoactive substance in the world and is a legal stimulant that is readily available to children. The potential for dependence on caffeine has been debated. Presently, due to a paucity of clinical evidence on caffeine dependence, no such diagnosis is included in the Diagnostic and Statistical Manual of Mental Disorders Fourth Edition, Text Revision (DSM-IV-TR). Although in recent studies, a subset of the general population was found to demonstrate caffeine dependence. It is valuable for psychiatrists and primary care physicians to recognize caffeine dependence as a clinical syndrome, since some people are distressed by their caffeine use and feel they can not control or stop their problematic use.

Analysis of Human Bradykinin Receptor Gene and Endothelial Nitric Oxide Synthase Gene Polymorphisms in End-Stage Renal Disease Among Malaysians

Directory of Open Access Journals (Sweden)

R. Vasudevan

2014-06-01

Full Text Available The aim of this study was to determine the association of the c.894G>T; p.Glu298Asp polymorphism and the variable number tandem repeat (VNTR polymorphism of the endothelial nitric oxide synthase (eNOS gene and c.181C>T polymorphism of the bradykinin type 2 receptor gene (B2R in Malaysian end-stage renal disease (ESRD subjects.

Make Caffeine Visible: a Fluorescent Caffeine “Traffic Light” Detector

Science.gov (United States)

Xu, Wang; Kim, Tae-Hyeong; Zhai, Duanting; Er, Jun Cheng; Zhang, Liyun; Kale, Anup Atul; Agrawalla, Bikram Keshari; Cho, Yoon-Kyoung; Chang, Young-Tae

2013-07-01

Caffeine has attracted abundant attention due to its extensive existence in beverages and medicines. However, to detect it sensitively and conveniently remains a challenge, especially in resource-limited regions. Here we report a novel aqueous phase fluorescent caffeine sensor named Caffeine Orange which exhibits 250-fold fluorescence enhancement upon caffeine activation and high selectivity. Nuclear magnetic resonance spectroscopy and Fourier transform infrared spectroscopy indicate that π-stacking and hydrogen-bonding contribute to their interactions while dynamic light scattering and transmission electron microscopy experiments demonstrate the change of Caffeine Orange ambient environment induces its fluorescence emission. To utilize this probe in real life, we developed a non-toxic caffeine detection kit and tested it for caffeine quantification in various beverages. Naked-eye sensing of various caffeine concentrations was possible based on color changes upon irradiation with a laser pointer. Lastly, we performed the whole system on a microfluidic device to make caffeine detection quick, sensitive and automated.

Expression of an (E-β-farnesene synthase gene from Asian peppermint in tobacco affected aphid infestation

Directory of Open Access Journals (Sweden)

Xiudao Yu

2013-10-01

Full Text Available Aphids are major agricultural pests that cause significant yield losses in crop plants each year. (E-β-farnesene (EβF is the main or only component of an alarm pheromone involved in chemical communication within aphid species and particularly in the avoidance of predation. EβF also occurs in the essential oil of some plant species, and is catalyzed by EβF synthase. By using oligonucleotide primers designed from the known sequence of an EβF synthase gene from black peppermint (Mentha × piperita, two cDNA sequences, MaβFS1 and MaβFS2, were isolated from Asian peppermint (Mentha asiatica. Expression pattern analysis showed that the MaβFS1 gene exhibited higher expression in flowers than in roots, stems and leaves at the transcriptional level. Overexpression of MaβFS1 in tobacco plants resulted in emission of pure EβF ranging from 2.62 to 4.85 ng d− 1 g− 1 of fresh tissue. Tritrophic interactions involving peach aphids (Myzus persicae, and predatory lacewing (Chrysopa septempunctata larvae demonstrated that transgenic tobacco expressing MaβFS1 had lower aphid infestation. This result suggested that the EβF synthase gene from Asian peppermint could be a good candidate for genetic engineering of agriculturally important crop plants.

Disruption of Bcchs4, Bcchs6 or Bcchs7 chitin synthase genes in Botrytis cinerea and the essential role of class VI chitin synthase (Bcchs6).

Science.gov (United States)

Morcx, Serena; Kunz, Caroline; Choquer, Mathias; Assie, Sébastien; Blondet, Eddy; Simond-Côte, Elisabeth; Gajek, Karina; Chapeland-Leclerc, Florence; Expert, Dominique; Soulie, Marie-Christine

2013-03-01

Chitin synthases play critical roles in hyphal development and fungal pathogenicity. Previous studies on Botrytis cinerea, a model organism for necrotrophic pathogens, have shown that disruption of Bcchs1 and more particularly Bcchs3a genes have a drastic impact on virulence (Soulié et al., 2003, 2006). In this work, we investigate the role of other CHS including BcCHS4, BcCHS6 and BcCHS7 during the life cycle of B. cinerea. Single deletions of corresponding genes were carried out. Phenotypic analysis indicates that: (i) BcCHS4 enzyme is not essential for development and pathogenicity of the fungus; (ii) BcCHS7 is required for pathogenicity in a host dependant manner. For Bcchs6 gene disruption, we obtained only heterokaryotic strains. Indeed, sexual or asexual purification assays were unsuccessful. We concluded that class VI chitin synthase could be essential for B. cinerea and therefore BcCHS6 represents a valuable antifungal target. Copyright © 2012 Elsevier Inc. All rights reserved.

[Interspecific polymorphism of the glucosyltransferase domain of the sucrose synthase gene in the genus Malus and related species of Rosaceae].

Science.gov (United States)

Boris, K V; Kochieva, E Z; Kudryavtsev, A M

2014-12-01

The sequences that encode the main functional glucosyltransferase domain of sucrose synthase genes have been identified for the first time in 14 species of the genus Malus and related species of the family Rosaceae, and their polymorphism was investigated. Single nucleotide substitutions leading to amino acid substitutions in the protein sequence, including the conservative transmembrane motif sequence common to all sucrose synthase genes of higher plants, were detected in the studied sequences.

IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT

Directory of Open Access Journals (Sweden)

Mariateresa eVolpicella

2016-03-01

Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.

[Cellulose synthase genes that control the fiber formation of flax (Linum usitatissimum L.)].

Science.gov (United States)

Galinovskiĭ, D V; Anisimova, N V; Raĭskiĭ, A P; Leont'ev, V N; Titok, V V; Hotyleva, L V

2014-01-01

Four cellulose synthase genes were identified by analysis of their class-specific regions (CSRII) in plants of fiber flax during the "rapid growth" stage. These genes were designated as LusCesA1, LusCesA4, LusCesA7 and LusCesA9. LusCesA4, LusCesA7, and LusCesA9 genes were expressed in the stem; LusCesA1 and LusCesA4 genes were expressed in the apex part of plants, and the LusCesA4 gene was expressed in the leaves of fiber flax. The expression of the LusCesA7 and LusCesA9 genes was specific to the stems of fiber flax. These genes may influence the quality of the flax fiber.

Heterooligomeric phosphoribosyl diphosphate synthase of Saccharomyces cerevisiae

DEFF Research Database (Denmark)

Hove-Jensen, Bjarne

2004-01-01

The yeast Saccharomyces cerevisiae contains five phosphoribosyl diphosphate (PRPP) synthase-homologous genes (PRS1-5), which specify PRPP synthase subunits 1-5. Expression of the five S. cerevisiae PRS genes individually in an Escherichia coli PRPP-less strain (Deltaprs) showed that a single PRS...

Reduced methylation of the thromboxane synthase gene is correlated with its increased vascular expression in preeclampsia.

Science.gov (United States)

Mousa, Ahmad A; Strauss, Jerome F; Walsh, Scott W

2012-06-01

Preeclampsia is characterized by increased thromboxane and decreased prostacyclin levels, which predate symptoms, and can explain some of the clinical manifestations of preeclampsia, including hypertension and thrombosis. In this study, we examined DNA methylation of the promoter region of the thromboxane synthase gene (TBXAS1) and the expression of thromboxane synthase in systemic blood vessels of normal pregnant and preeclamptic women. Thromboxane synthase is responsible for the synthesis of thromboxane A(2), a potent vasoconstrictor and activator of platelets. We also examined the effect of experimentally induced DNA hypomethylation on the expression of thromboxane synthase in a neutrophil-like cell line (HL-60 cells) and in cultured vascular smooth muscle and endothelial cells. We found that DNA methylation of the TBXAS1 promoter was decreased and thromboxane synthase expression was increased in omental arteries of preeclamptic women as compared with normal pregnant women. Increased thromboxane synthase expression was observed in vascular smooth muscles cells, endothelial cells, and infiltrating neutrophils. Experimentally induced DNA hypomethylation only increased expression of thromboxane synthase in the neutrophil-like cell line, whereas tumor necrosis factor-α, a neutrophil product, increased its expression in cultured vascular smooth muscle cells. Our study suggests that epigenetic mechanisms and release of tumor necrosis factor-α by infiltrating neutrophils could contribute to the increased expression of thromboxane synthase in maternal systemic blood vessels, contributing to the hypertension and coagulation abnormalities associated with preeclampsia.

Interindividual Differences in Caffeine Metabolism and Factors Driving Caffeine Consumption.

Science.gov (United States)

Nehlig, Astrid

2018-04-01

Most individuals adjust their caffeine intake according to the objective and subjective effects induced by the methylxanthine. However, to reach the desired effects, the quantity of caffeine consumed varies largely among individuals. It has been known for decades that the metabolism, clearance, and pharmacokinetics of caffeine is affected by many factors such as age, sex and hormones, liver disease, obesity, smoking, and diet. Caffeine also interacts with many medications. All these factors will be reviewed in the present document and discussed in light of the most recent data concerning the genetic variability affecting caffeine levels and effects at the pharmacokinetic and pharmacodynamic levels that both critically drive the level of caffeine consumption. The pharmacokinetics of caffeine are highly variable among individuals due to a polymorphism at the level of the CYP1A2 isoform of cytochrome P450, which metabolizes 95% of the caffeine ingested. Moreover there is a polymorphism at the level of another critical enzyme, N -acetyltransferase 2. At the pharmacodynamic level, there are several polymorphisms at the main brain target of caffeine, the adenosine A2A receptor or ADORA2. Genetic studies, including genome-wide association studies, identified several loci critically involved in caffeine consumption and its consequences on sleep, anxiety, and potentially in neurodegenerative and psychiatric diseases. We start reaching a better picture on how a multiplicity of biologic mechanisms seems to drive the levels of caffeine consumption, although much more knowledge is still required to understand caffeine consumption and effects on body functions. Copyright © 2018 by The American Society for Pharmacology and Experimental Therapeutics.

Cocaine and Caffeine Effects on the Conditioned Place Preference Test: Concomitant Changes on Early Genes within the Mouse Prefrontal Cortex and Nucleus Accumbens

Directory of Open Access Journals (Sweden)

Javier A. Muñiz

2017-10-01

Full Text Available Caffeine is the world's most popular psychostimulant and is frequently used as an active adulterant in many illicit drugs including cocaine. Previous studies have shown that caffeine can potentiate the stimulant effects of cocaine and cocaine-induced drug seeking behavior. However, little is known about the effects of this drug combination on reward-related learning, a key process in the maintenance of addiction and vulnerability to relapse. The goal of the present study was thus to determine caffeine and cocaine combined effects on the Conditioned Place Preference (CPP test and to determine potential differential mRNA expression in the Nucleus Accumbens (NAc and medial prefrontal cortex (mPFC of immediate-early genes (IEGs as well as dopamine and adenosine receptor subunits. Mice were treated with caffeine (5 mg/kg, CAF, cocaine (10 mg/kg, COC, or their combination (caffeine 5 mg/kg + cocaine 10 mg/kg, CAF-COC and trained in the CPP test or treated with repeated injections inside the home cage. NAc and mPFC tissues were dissected immediately after the CPP test, after a single conditioning session or following psychostimulant injection in the home cage for mRNA expression analysis. CAF-COC induced a marked change of preference to the drug conditioned side of the CPP and a significant increase in locomotion compared to COC. Gene expression analysis after CPP test revealed specific up-regulation in the CAF-COC group of Drd1a, cFos, and FosB in the NAc, and cFos, Egr1, and Npas4 in the mPFC. Importantly, none of these changes were observed when animals received same treatments in their home cage. With a single conditioning session, we found similar effects in both CAF and CAF-COC groups: increased Drd1a and decreased cFos in the NAc, and increased expression of Drd1a and Drd2, in the mPFC. Interestingly, we found that cFos and Npas4 gene expression were increased only in the mPFC of the CAF-COC. Our study provides evidence that caffeine acting as

Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

Directory of Open Access Journals (Sweden)

Piotr Szymczyk

2016-09-01

Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

Caffeine, creatine, GRIN2A and Parkinson's disease progression.

Science.gov (United States)

Simon, David K; Wu, Cai; Tilley, Barbara C; Lohmann, Katja; Klein, Christine; Payami, Haydeh; Wills, Anne-Marie; Aminoff, Michael J; Bainbridge, Jacquelyn; Dewey, Richard; Hauser, Robert A; Schaake, Susen; Schneider, Jay S; Sharma, Saloni; Singer, Carlos; Tanner, Caroline M; Truong, Daniel; Wei, Peng; Wong, Pei Shieen; Yang, Tianzhong

2017-04-15

Caffeine is neuroprotective in animal models of Parkinson's disease (PD) and caffeine intake is inversely associated with the risk of PD. This association may be influenced by the genotype of GRIN2A, which encodes an NMDA-glutamate-receptor subunit. In two placebo-controlled studies, we detected no association of caffeine intake with the rate of clinical progression of PD, except among subjects taking creatine, for whom higher caffeine intake was associated with more rapid progression. We now have analyzed data from 420 subjects for whom DNA samples and caffeine intake data were available from a placebo-controlled study of creatine in PD. The GRIN2A genotype was not associated with the rate of clinical progression of PD in the placebo group. However, there was a 4-way interaction between GRIN2A genotype, caffeine, creatine and the time since baseline. Among subjects in the creatine group with high levels of caffeine intake, but not among those with low caffeine intake, the GRIN2A T allele was associated with more rapid progression (p=0.03). These data indicate that the deleterious interaction between caffeine and creatine with respect to rate of progression of PD is influenced by GRIN2A genotype. This example of a genetic factor interacting with environmental factors illustrates the complexity of gene-environment interactions in the progression of PD. Copyright © 2017 Elsevier B.V. All rights reserved.

Functional analysis of the cellulose synthase-like genes CSLD1, CSLD2 and CSLD4 in tip-growing arabidopsis cells

DEFF Research Database (Denmark)

Bernal Giraldo, Adriana Jimena; Yoo, Cheol-Min; Mutwil, Marek

2008-01-01

A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from that pre......A reverse genetic approach was used to investigate the functions of three members of the cellulose synthase superfamily in Arabidopsis (Arabidopsis thaliana), CELLULOSE SYNTHASE-LIKE D1 (CSLD1), CSLD2, and CSLD4. CSLD2 is required for normal root hair growth but has a different role from...... for insertions in these genes were partially rescued by reduced temperature growth. However, this was not the case for a double mutant homozygous for insertions in both CSLD2 and CSLD3, suggesting that there may be partial redundancy in the functions of these genes. Mutants in CSLD1 and CSLD4 had a defect...

The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes

DEFF Research Database (Denmark)

Schneider, Lizette Marais; Adamski, Nikolai M.; Christensen, Caspar Elo

2016-01-01

identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified...... alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed...... five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase...

Identification and molecular characterization of nitric oxide synthase (NOS) gene in the intertidal copepod Tigriopus japonicus.

Science.gov (United States)

Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong

2016-02-10

In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity. Copyright © 2015 Elsevier B.V. All rights reserved.

Effects of caffeine on performance and mood depend on the level of caffeine abstinence.

Science.gov (United States)

Yeomans, Martin R; Ripley, Tamzin; Davies, Laura H; Rusted, Jennifer M; Rogers, Peter J

2002-11-01

Most studies of the effects of caffeine on performance have used regular caffeine consumers who are deprived at test. Thus the reported effects of caffeine could be explained through reversal of caffeine withdrawal. To test how preloading deprived caffeine consumers with 0, 1 or 2 mg/kg caffeine altered the subsequent ability of caffeine to modify mood and performance. Thirty moderate caffeine consumers were given a drink containing 0, 1 or 2 mg/kg caffeine at breakfast followed 60 min later by a second drink containing either 0 or 1 mg/kg caffeine. Performance on a measure of sustained attention and mood were measured before and after each drink. Administration of both 1 and 2 mg/kg caffeine at breakfast decreased reaction time and 1 mg/kg caffeine also increased performance accuracy on the sustained attention (RVIP) task relative to placebo. Both breakfast doses of caffeine also improved rated mental alertness. Similarly, 1 mg/kg caffeine administered 60 min after breakfast decreased reaction time and increased rated mental alertness in the group who had not been given caffeine at breakfast. However, this second dose of caffeine had no effect on subsequent performance or mood in the two groups who had received caffeine at breakfast. Caffeine reliably improved performance on a sustained attention task, and increased rated mental alertness, in moderate caffeine consumers who were tested when caffeine-deprived. However, caffeine had no such effects when consumers were no longer caffeine deprived. These data are consistent with the view that reversal of caffeine withdrawal is a major component of the effects of caffeine on mood and performance.

Interaction of caffeine with the SOS response pathway in Escherichia coli.

Science.gov (United States)

Whitney, Alyssa K; Weir, Tiffany L

2015-01-01

Previous studies have highlighted the antimicrobial activity of caffeine, both individually and in combination with other compounds. A proposed mechanism for caffeine's antimicrobial effects is inhibition of bacterial DNA repair pathways. The current study examines the influence of sub-lethal caffeine levels on the growth and morphology of SOS response pathway mutants of Escherichia coli. Growth inhibition after treatment with caffeine and methyl methane sulfonate (MMS), a mutagenic agent, was determined for E. coli mutants lacking key genes in the SOS response pathway. The persistence of caffeine's effects was explored by examining growth and morphology of caffeine and MMS-treated bacterial isolates in the absence of selective pressure. Caffeine significantly reduced growth of E. coli recA- and uvrA-mutants treated with MMS. However, there was no significant difference in growth between umuC-isolates treated with MMS alone and MMS in combination with caffeine after 48 h of incubation. When recA-isolates from each treatment group were grown in untreated medium, bacterial isolates that had been exposed to MMS or MMS with caffeine showed increased growth relative to controls and caffeine-treated isolates. Morphologically, recA-isolates that had been treated with caffeine and both caffeine and MMS together had begun to display filamentous growth. Caffeine treatment further reduced growth of recA- and uvrA-mutants treated with MMS, despite a non-functional SOS response pathway. However, addition of caffeine had very little effect on MMS inhibition of umuC-mutants. Thus, growth inhibition of E. coli with caffeine treatment may be driven by caffeine interaction with UmuC, but also appears to induce damage by additional mechanisms as evidenced by the additive effects of caffeine in recA- and uvrA-mutants.

High polyhydroxybutyrate production in Pseudomonas extremaustralis is associated with differential expression of horizontally acquired and core genome polyhydroxyalkanoate synthase genes.

Directory of Open Access Journals (Sweden)

Mariela V Catone

Full Text Available Pseudomonas extremaustralis produces mainly polyhydroxybutyrate (PHB, a short chain length polyhydroxyalkanoate (sclPHA infrequently found in Pseudomonas species. Previous studies with this strain demonstrated that PHB genes are located in a genomic island. In this work, the analysis of the genome of P. extremaustralis revealed the presence of another PHB cluster phbFPX, with high similarity to genes belonging to Burkholderiales, and also a cluster, phaC1ZC2D, coding for medium chain length PHA production (mclPHA. All mclPHA genes showed high similarity to genes from Pseudomonas species and interestingly, this cluster also showed a natural insertion of seven ORFs not related to mclPHA metabolism. Besides PHB, P. extremaustralis is able to produce mclPHA although in minor amounts. Complementation analysis demonstrated that both mclPHA synthases, PhaC1 and PhaC2, were functional. RT-qPCR analysis showed different levels of expression for the PHB synthase, phbC, and the mclPHA synthases. The expression level of phbC, was significantly higher than the obtained for phaC1 and phaC2, in late exponential phase cultures. The analysis of the proteins bound to the PHA granules showed the presence of PhbC and PhaC1, whilst PhaC2 could not be detected. In addition, two phasin like proteins (PhbP and PhaI associated with the production of scl and mcl PHAs, respectively, were detected. The results of this work show the high efficiency of a foreign gene (phbC in comparison with the mclPHA core genome genes (phaC1 and phaC2 indicating that the ability of P. extremaustralis to produce high amounts of PHB could be explained by the different expression levels of the genes encoding the scl and mcl PHA synthases.

A comparison of the effects of caffeine following abstinence and normal caffeine use.

Science.gov (United States)

Addicott, Merideth A; Laurienti, Paul J

2009-12-01

Caffeine typically produces positive effects on mood and performance. However, tolerance may develop following habitual use, and abrupt cessation can result in withdrawal symptoms, such as fatigue. This study investigated whether caffeine has a greater stimulant effect in a withdrawn state compared to a normal caffeinated state, among moderate daily caffeine consumers. Using a within-subjects design, 17 caffeine consumers (mean +/- sd = 375 +/- 101 mg/day) ingested placebo or caffeine (250 mg) following 30-h of caffeine abstention or normal dietary caffeine use on four separate days. Self-reported mood and performance on choice reaction time, selective attention, and memory tasks were measured. Caffeine had a greater effect on mood and choice reaction time in the abstained state than in the normal caffeinated state, but caffeine improved selective attention and memory in both states. Although improvements in mood and reaction time may best explained as relief from withdrawal symptoms, other performance measures showed no evidence of withdrawal and were equally sensitive to an acute dose of caffeine in the normal caffeinated state.

Biodegradation of Caffeine by Trichosporon asahii Isolated from Caffeine Contaminated Soil

OpenAIRE

LAKSHMI V.; NILANJANA DAS

2011-01-01

Studies were carried out on caffeine degradation using Trichosporon asahii, a yeast species isolated from caffeine contaminated soil. There was 100 % degradation of caffeine at 54 h by the yeast cells acclimated to the medium containing caffeine and sucrose both. Experiments with T. asahii growing on caffeine in the presenceof 1 mM 1-aminobenzotriazole (ABT), an inhibitor of the cytochrome P-450 enzyme system, resulted inhibition of biomass production relative to positive control implicating ...

Development of intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase for discriminating Curcuma species.

Science.gov (United States)

Kita, Tomoko; Komatsu, Katsuko; Zhu, Shu; Iida, Osamu; Sugimura, Koji; Kawahara, Nobuo; Taguchi, Hiromu; Masamura, Noriya; Cai, Shao-Qing

2016-03-01

Various Curcuma rhizomes have been used as medicines or spices in Asia since ancient times. It is very difficult to distinguish them morphologically, especially when they are boiled and dried, which causes misidentification leading to a loss of efficacy. We developed a method for discriminating Curcuma species by intron length polymorphism markers in genes encoding diketide-CoA synthase and curcumin synthase. This method could apply to identification of not only fresh plants but also samples of crude drugs or edible spices. By applying this method to Curcuma specimens and samples, and constructing a dendrogram based on these markers, seven Curcuma species were clearly distinguishable. Moreover, Curcuma longa specimens were geographically distinguishable. On the other hand, Curcuma kwangsiensis (gl type) specimens also showed intraspecies polymorphism, which may have occurred as a result of hybridization with other Curcuma species. The molecular method we developed is a potential tool for global classification of the genus Curcuma. Copyright © 2015 Elsevier Ltd. All rights reserved.

Molecular cloning and expression levels of the monoterpene synthase gene (ZMM1 in Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr.

Directory of Open Access Journals (Sweden)

Bua-In Saowaluck

2014-01-01

Full Text Available Cassumunar ginger (Zingiber montanum (Koenig Link ex Dietr. is a native Thai herb with a high content and large variety of terpenoids in its essential oil. Improving the essential oil content and quality of cassumunar ginger is difficult for a breeder due to its clonally propagated nature. In this research, we describe the isolation and expression level of the monoterpene synthase gene that controls the key step of essential oil synthesis in this plant and evaluate the mechanical wounding that may influence the transcription level of the monoterpene synthase gene. To isolate the gene, the selected clones from DNA derived from young leaves were sequenced and analyzed and the monoterpene synthase gene from cassumunar ginger (ZMM1 was identified. The ZMM1 CDS containing 1 773 bp (KF500399 is predicted to encode a protein of 590 amino acids. The deduced amino acid sequence is 40-74% identical with known sequences of other angiosperm monoterpene synthases belonging to the isoprenoid biosynthesis C1 superfamily. A transcript of ZMM1 was detected almost exclusively in the leaves and was related to leaf wounding. The results of this research offer insight into the control of monoterpene synthesis in this plant. This finding can be applied to breeding programs or crop management of cassumunar ginger for better yield and quality of essential oil.

Caffeine dependence in teenagers.

Science.gov (United States)

Bernstein, Gail A; Carroll, Marilyn E; Thuras, Paul D; Cosgrove, Kelly P; Roth, Megan E

2002-03-01

This study identifies and characterizes symptoms of caffeine dependence in adolescents. Thirty-six adolescents who consumed caffeine daily and had some features of caffeine dependence on telephone screen were scheduled for outpatient evaluation. Evaluation included the Diagnostic Interview Schedule for Children-IV-Youth Version (DISC-IV) and modified DISC-IV questions that assessed caffeine dependence based on DSM-IV substance dependence criteria. Of 36 subjects, 41.7% (n=15) reported tolerance to caffeine, 77.8% (n=28) described withdrawal symptoms after cessation or reduction of caffeine intake, 38.9% (n=14) reported desire or unsuccessful attempts to control use, and 16.7% (n=6) endorsed use despite knowledge of physical or psychological problems associated with caffeine. There was no significant difference in the amount of caffeine consumed daily by caffeine dependent versus non-dependent teenagers. These findings are important due to the vast number of adolescents who drink caffeinated beverages.

Caffeine taste signaling in Drosophila larvae

Directory of Open Access Journals (Sweden)

Anthi A Apostolopoulou

2016-08-01

Full Text Available The Drosophila larva has a simple peripheral nervous system with a comparably small number of sensory neurons located externally at the head or internally along the pharynx to assess its chemical environment. It is assumed that larval taste coding occurs mainly via external organs (the dorsal, terminal and ventral organ. However, the contribution of the internal pharyngeal sensory organs has not been explored. Here we find that larvae require a single pharyngeal gustatory receptor neuron pair called D1, which is located in the dorsal pharyngeal sensilla, in order to avoid caffeine and to associate an odor with caffeine punishment. In contrast, caffeine-driven reduction in feeding in non-choice situations does not require D1. Hence, this work provides data on taste coding via different receptor neurons, depending on the behavioral context. Furthermore, we show that the larval pharyngeal system is involved in bitter tasting. Using ectopic expressions, we show that the caffeine receptor in neuron D1 requires the function of at least four receptor genes: the putative coreceptors Gr33a, Gr66a, the putative caffeine-specific receptor Gr93a, and yet unknown additional molecular component(s. This suggests that larval taste perception is more complex than previously assumed already at the sensory level. Taste information from different sensory organs located outside at the head or inside along the pharynx of the larva is assembled to trigger taste guided behaviours.

Caffeine controversies.

Science.gov (United States)

Gentle, Samuel J; Travers, Colm P; Carlo, Waldemar A

2018-04-01

Caffeine use in preterm infants has endured several paradigms: from standard of care to possible neurotoxin to one of the few medications for which there is evidence of bronchopulmonary dysplasia (BPD) risk reduction. The purpose of the review is to analyze this dynamic trajectory and discuss controversies that still remain after decades of caffeine use. Following concerns for caffeine safety in preterm infants, a large randomized controlled trial demonstrated a reduction in BPD and treatment for patent ductus arteriosus. The lower rate of death or neurodevelopmental impairment noted at 18-21 months was not statistically different at later timepoints; however, infants in the caffeine group had lower rates of motor impairment at 11-year follow-up. The time of caffeine therapy initiation is now substantially earlier, and doses used are sometimes higher that previously used, but there are limited data to support these practices. Caffeine therapy for apnea of prematurity (AOP) remains one of the pillars of neonatal care, although more evidence to support dosing and timing of initiation and discontinuation are needed.

Caffeine and exercise.

Science.gov (United States)

Paluska, Scott A

2003-08-01

Caffeine is the most commonly consumed drug in the world, and athletes frequently use it as an ergogenic aid. It improves performance and endurance during prolonged, exhaustive exercise. To a lesser degree it also enhances short-term, high-intensity athletic performance. Caffeine improves concentration, reduces fatigue, and enhances alertness. Habitual intake does not diminish caffeine's ergogenic properties. Several mechanisms have been proposed to explain the physiologic effects of caffeine, but adenosine receptor antagonism most likely accounts for the primary mode of action. It is relatively safe and has no known negative performance effects, nor does it cause significant dehydration or electrolyte imbalance during exercise. Routine caffeine consumption may cause tolerance or dependence, and abrupt discontinuation produces irritability, mood shifts, headache, drowsiness, or fatigue. Major sport governing bodies ban excessive use of caffeine, but current monitoring techniques are inadequate, and ethical dilemmas persist regarding caffeine intake by athletes.

Germacrene A Synthase in Yarrow (Achillea millefolium Is an Enzyme with Mixed Substrate Specificity: Gene Cloning, Functional Characterization and Expression Analysis

Directory of Open Access Journals (Sweden)

Leila ePazouki

2015-03-01

Full Text Available Terpenoid synthases constitute a highly diverse gene family producing a wide range of cyclic and acyclic molecules consisting of isoprene (C5 residues. Often a single terpene synthase produces a spectrum of molecules of given chain length, but some terpene synthases can use multiple substrates, producing products of different chain length. Only a few such enzymes has been characterized, but the capacity for multiple-substrate use can be more widespread than previously thought. Here we focused on germacrene A synthase (GAS that is a key cytosolic enzyme in the sesquiterpene lactone biosynthesis pathway in the important medicinal plant Achillea millefolium (AmGAS. The full length encoding gene was heterologously expressed in Escherichia coli BL21 (DE3, functionally characterized, and its in vivo expression was analyzed. The recombinant protein catalyzed formation of germacrene A with the C15 substrate farnesyl diphosphate (FDP, while acyclic monoterpenes were formed with the C10 substrate geranyl diphosphate (GDP and cyclic monoterpenes with the C10 substrate neryl diphosphate (NDP. Although monoterpene synthesis has been assumed to be confined exclusively to plastids, AmGAS can potentially synthesize monoterpenes in cytosol when GDP or NDP become available. AmGAS enzyme had high homology with GAS sequences from other Asteraceae species, suggesting that multi-substrate use can be more widespread among germacrene A synthases than previously thought. Expression studies indicated that AmGAS was expressed in both autotrophic and heterotrophic plant compartments with the highest expression levels in leaves and flowers. To our knowledge, this is the first report on the cloning and characterization of germacrene A synthase coding gene in A. millefolium, and multi-substrate use of GAS enzymes.

Expression analysis of cellulose synthase and main cytoskeletal protein genes in flax (Linum usitatissimum L.).

Science.gov (United States)

Galinousky, Dmitry; Padvitski, Tsimafei; Bayer, Galina; Pirko, Yaroslav; Pydiura, Nikolay; Anisimova, Natallia; Nikitinskaya, Tatyana; Khotyleva, Liubov; Yemets, Alla; Kilchevsky, Aleksandr; Blume, Yaroslav

2017-08-09

Fiber flax is an important source of natural fiber and a comprehensive model for the plant fiber biogenesis studies. Cellulose-synthase (CesA) and cytoskeletal genes are known to be important for the cell wall biogenesis in general and for the biogenesis of flax fibers in particular. Currently, knowledge about activity of these genes during the plant growth is limited. In this study, we have investigated flax fiber biogenesis by measuring expression of CesA and cytoskeletal genes at two stages of the flax development (seedlings and stems at the rapid growth stage) in several flax subspecies (elongatum, mediterraneum, crepitans). RT-qPCR has been used to quantify the expression of LusСesA1, LusСesA4, LusСesA7, LusСesA6, Actin, and α-Tubulin genes in plant samples. We report that CesA genes responsible for the secondary cell wall synthesis (LusCesA4, LusCesA7) have different expression pattern compared with CesA genes responsible for the primary cell wall synthesis (LusCesA1, LusCesA6): an average expression of LusCesA4 and LusCesA7 genes is relatively high in seedlings and further increases in stems at the rapid growth stage, whereas an average expression of LusCesA1 and LusCesA6 genes decreases. Interestingly, LusCesA1 is the only studied gene with different expression dynamics between the flax subspecies: its expression decreases by 5.2-10.7 folds in elongatum and mediterraneum but does not change in crepitans subspecies when the rapid growth stage and seedlings are compared. The expression of cytoskeleton genes (coding actin and α-tubulin) is relatively stable and significantly higher than the expression of cellulose-synthase genes in all the studied samples. © 2017 International Federation for Cell Biology.

Caffeine Citrate Dosing Adjustments to Assure Stable Caffeine Concentrations in Preterm Neonates.

Science.gov (United States)

Koch, Gilbert; Datta, Alexandre N; Jost, Kerstin; Schulzke, Sven M; van den Anker, John; Pfister, Marc

2017-12-01

To identify dosing strategies that will assure stable caffeine concentrations in preterm neonates despite changing caffeine clearance during the first 8 weeks of life. A 3-step simulation approach was used to compute caffeine doses that would achieve stable caffeine concentrations in the first 8 weeks after birth: (1) a mathematical weight change model was developed based on published weight distribution data; (2) a pharmacokinetic model was developed based on published models that accounts for individual body weight, postnatal, and gestational age on caffeine clearance and volume of distribution; and (3) caffeine concentrations were simulated for different dosing regimens. A standard dosing regimen of caffeine citrate (using a 20 mg/kg loading dose and 5 mg/kg/day maintenance dose) is associated with a maximal trough caffeine concentration of 15 mg/L after 1 week of treatment. However, trough concentrations subsequently exhibit a clinically relevant decrease because of increasing clearance. Model-based simulations indicate that an adjusted maintenance dose of 6 mg/kg/day in the second week, 7 mg/kg/day in the third to fourth week and 8 mg/kg/day in the fifth to eighth week assures stable caffeine concentrations with a target trough concentration of 15 mg/L. To assure stable caffeine concentrations during the first 8 weeks of life, the caffeine citrate maintenance dose needs to be increased by 1 mg/kg every 1-2 weeks. These simple adjustments are expected to maintain exposure to stable caffeine concentrations throughout this important developmental period and might enhance both the short- and long-term beneficial effects of caffeine treatment. Copyright © 2017 Elsevier Inc. All rights reserved.

Manipulation of saponin biosynthesis by RNA interference-mediated silencing of β-amyrin synthase gene expression in soybean.

Science.gov (United States)

Takagi, Kyoko; Nishizawa, Keito; Hirose, Aya; Kita, Akiko; Ishimoto, Masao

2011-10-01

Soybean seeds contain substantial amount of diverse triterpenoid saponins that influence the seed quality, although little is known about the physiologic functions of saponins in plants. We now describe the modification of saponin biosynthesis by RNA interference (RNAi)-mediated gene silencing targeted to β-amyrin synthase, a key enzyme in the synthesis of a common aglycon of soybean saponins. We identified two putative β-amyrin synthase genes in soybean that manifested distinct expression patterns with regard to developmental stage and tissue specificity. Given that one of these genes, GmBAS1, was expressed at a much higher level than the other (GmBAS2) in various tissues including the developing seeds, we constructed two RNAi vectors that encode self-complementary hairpin RNAs corresponding to the distinct regions of GmBAS1 under the control of a seed-specific promoter derived from the soybean gene for the α' subunit of the seed storage protein β-conglycinin. These vectors were introduced independently into soybean. Six independent transgenic lines exhibited a stable reduction in seed saponin content, with the extent of saponin deficiency correlating with the β-amyrin synthase mRNA depletion. Although some transgenic lines produced seeds almost devoid of saponins, no abnormality in their growth was apparent and the antioxidant activity of their seeds was similar to that of control seeds. These results suggest that saponins are not required for seed development and survival, and that soybean seeds may therefore be amenable to the modification of triterpenoid saponin content and composition through molecular biologic approaches.

Anaphylaxis due to caffeine

OpenAIRE

Sugiyama, Kumiya; Cho, Tatsurai; Tatewaki, Masamitsu; Onishi, Shogo; Yokoyama, Tatsuya; Yoshida, Naruo; Fujimatsu, Takayoshi; Hirata, Hirokuni; Fukuda, Takeshi; Fukushima, Yasutsugu

2015-01-01

We report a rare case of anaphylaxis due to caffeine intake. A 27-year-old woman suffered her first episode of anaphylaxis and a positive skin prick test suggested that the anaphylaxis was due to an IgE-mediated hypersensitivity reaction to caffeine. She was diagnosed with caffeine allergy and has not had an allergic reaction after avoiding foods and drinks containing caffeine. Although caffeine is known to have antiallergic effects, this case shows that caffeine can be an allergen and cause ...

Attentional bias for caffeine-related stimuli in high but not moderate or non-caffeine consumers.

Science.gov (United States)

Yeomans, Martin R; Javaherian, Shabnam; Tovey, Heather M; Stafford, Lorenzo D

2005-09-01

Attentional bias for drug-related cues has been reported with a wide range of drugs, but to date the extent to which caffeine consumers show similar biases for caffeine-related stimuli has not been tested. The present study therefore examined this issue in terms of differences in attentional bias for caffeine-related words in High, Moderate and Non-caffeine consumers using a dot-probe word task following overnight caffeine abstinence. This study was conducted to test whether caffeine consumers show an attentional bias for caffeine-related words, and whether such biases relate to habitual levels of caffeine use. Sixteen High, Moderate and Non-consumers of caffeine were asked to complete a modified dot-probe task in order to measure attentional bias for caffeine-related relative to neutral control word groups. The task was completed following overnight caffeine abstinence, and participants also completed mood and caffeine-craving measures. The High consumer group showed a significant attentional bias for the caffeine-related words, but no such bias was seen in Moderate or Non-consumer groups. As expected, craving for caffeine was strongest in the High consumers and weakest in the Non-consumers. Attentional bias in the High group correlated with self-reported caffeine consumption and with craving for caffeine, but neither effect was significant in the Moderate group. These data confirm that High caffeine consumers show attentional bias for caffeine-related stimuli, consistent with current theories of drug addiction.

Caffeine in the diet

Science.gov (United States)

Diet - caffeine ... Caffeine is absorbed and passes quickly into the brain. It does not collect in the bloodstream or ... been consumed. There is no nutritional need for caffeine. It can be avoided in the diet. Caffeine ...

Functional genomic analysis supports conservation of function among cellulose synthase-like a gene family members and suggests diverse roles of mannans in plants

DEFF Research Database (Denmark)

Liepman, Aaron H; Nairn, C Joseph; Willats, William G T

2007-01-01

from Arabidopsis (Arabidopsis thaliana), guar (Cyamopsis tetragonolobus), and Populus trichocarpa catalyze beta-1,4-mannan and glucomannan synthase reactions in vitro. Mannan polysaccharides and homologs of CslA genes appear to be present in all lineages of land plants analyzed to date. In many plants......, the CslA genes are members of extended multigene families; however, it is not known whether all CslA proteins are glucomannan synthases. CslA proteins from diverse land plant species, including representatives of the mono- and dicotyledonous angiosperms, gymnosperms, and bryophytes, were produced...... they are prevalent at cell junctions and in buds. Taken together, these results demonstrate that members of the CslA gene family from diverse plant species encode glucomannan synthases and support the hypothesis that mannans function in metabolic networks devoted to other cellular processes in addition to cell wall...

Acute effects of theanine, caffeine and theanine-caffeine combination on attention.

Science.gov (United States)

Kahathuduwa, Chanaka N; Dassanayake, Tharaka L; Amarakoon, A M Tissa; Weerasinghe, Vajira S

2017-07-01

l-theanine is a constituent of tea which is claimed to enhance cognitive functions. We aimed to determine whether theanine and theanine-caffeine combination have acute positive effects on cognitive and neurophysiological measures of attention, compared to caffeine (a positive control) and a placebo in healthy individuals. In a placebo-controlled, five-way crossover trial in 20 healthy male volunteers, we compared the effects of l-theanine (200 mg), caffeine (160 mg), their combination, black tea (one cup) and a placebo (distilled water) on cognitive (simple [SVRT] and recognition visual reaction time [RVRT]) and neurophysiological (event-related potentials [ERPs]) measures of attention. We also recorded visual (VEPs) and motor evoked potentials (MEPs) to examine any effects of treatments on peripheral visual and motor conduction, respectively. Mean RVRT was significantly improved by theanine (P = 0.019), caffeine (P = 0.043), and theanine-caffeine combination (P = 0.001), but not by tea (P = 0.429) or placebo (P = 0.822). VEP or MEP latencies or SVRT did not show significant inter-treatment differences. Theanine (P = 0.001) and caffeine (P = 0.001) elicited significantly larger mean peak-to-peak N2-P300 ERP amplitudes than the placebo, whereas theanine-caffeine combination elicited a significantly larger mean N2-P300 amplitude than placebo (P caffeine (P = 0.005). No significant theanine × caffeine interaction was observed for RVRT or N2-P300 amplitude. A dose of theanine equivalent of eight cups of back tea improves cognitive and neurophysiological measures of selective attention, to a degree that is comparable with that of caffeine. Theanine and caffeine seem to have additive effects on attention in high doses.

Aldosterone synthase gene is not a major susceptibility gene for progression of chronic kidney disease in patients with autosomal dominant polycystic kidney disease

Directory of Open Access Journals (Sweden)

Gnanasambandan Ramanathan

2017-01-01

Full Text Available Autosomal dominant polycystic kidney disease (ADPKD is the most common heritable kidney disease and is characterized by bilateral renal cysts. Hypertension is a frequent cause of chronic kidney disease (CKD and mortality in patients with ADPKD. The aldosterone synthase gene polymorphisms of the renin-angiotensin-aldosterone system have been extensively studied as hypertension candidate genes. The present study is aimed to investigate the potential modifier effect of CYP11B2 gene on the progression of CKD in ADPKD. One hundred and two ADPKD patients and 106 healthy controls were recruited based on Ravine inclusion and exclusion criteria. The three tag-SNPs within CYP11B2 gene (rs3802230, rs4543, and rs4544 were genotyped using FRET-based KASPar method. Cochran-Armitage trend test was used to assess the potential associations between these polymorphisms and CKD stages. Mantel- Haenszel stratified analysis was used to explore confounding and interaction effects of these polymorphisms. Of the three tag-SNPs genotyped, rs4544 polymorphism was monomorphic and rs3802230 deviated Hardy-Weinberg equilibrium. The CYP11B2 tag-SNPs did not show significant association with ADPKD or CKD. Further, these polymorphisms did not exhibit confounding effect on the relationship between CKD progression and hypertension. Our results suggest that aldosterone synthase gene is not a major susceptibility gene for progression of CKD in South Indian ADPKD patients.

Estimation of caffeine intake from analysis of caffeine metabolites in wastewater

DEFF Research Database (Denmark)

Gracia-Lor, Emma; Rousis, Nikolaos I.; Zuccato, Ettore

2017-01-01

with the human urinary excretion profile. A good match was found for 1,7-dimethyluric acid, an exclusive caffeine metabolite, suggesting that might be a suitable biomarker in wastewater for assessing population-level caffeine consumption. A correction factor was developed considering the percentage of excretion......Caffeine metabolites in wastewater were investigated as potential biomarkers for assessing caffeine intake in a population. The main human urinary metabolites of caffeine were measured in the urban wastewater of ten European cities and the metabolic profiles in wastewater were compared...... of this metabolite in humans, according to published pharmacokinetic studies. Daily caffeine intake estimated from wastewater analysis was compared with the average daily intake calculated from the average amount of coffee consumed by country per capita. Good agreement was found in some cities but further...

Association of Endothelial Nitric Oxide Synthase Gene Polymorphisms With Acute Rejection in Liver Transplant Recipients.

Science.gov (United States)

Azarpira, Negar; Namazi, Soha; Malahi, Sayan; Kazemi, Kourosh

2016-06-01

Polymorphisms of the endothelial nitric oxide synthase gene have been associated with altered endothelial nitric oxide synthase activity. The purpose of this study was to investigate the relation between endothelial nitric oxide synthase -786T/C and 894G/T polymorphism and their haplotypes on the occurrence of acute rejection episodes in liver transplant recipients. We conducted a case control study in which 100 liver transplant recipients and 100 healthy controls were recruited from Shiraz Transplant Center. The patients used triple therapy including tacrolimus, mycophenolate mofetil, and prednisolone for immunosuppression maintenance. DNA was extracted from peripheral blood and endothelial nitric oxide synthase polymorphisms were determined by polymerase chain reaction and restriction fragment length polymorphism. Patients included 60 men and 40 women (mean age, 32.35 ± 10.2 y). There was a significant association of endothelial nitric oxide synthase 894G/T and acute rejection episode. The GT* gen-otype and acute rejection episodes had a significant association (odds ratio, 2.42; 95% confidence interval, 0.97-6.15; P = .03). The GG and GT* genotype and T* allele frequency were significantly different between patients and control subjects (P = .001). Haplotype TT* was higher in recipients than control subjects (odds ratio, 2.17; 95% confidence interval, 1.12-4.25; P = .01). Haplotype TG was higher in the control group (odds ratio, 0.62; 95% confidence interval, 0.40-0.96; P = .02). Our results suggest a relation between different endothelial nitric oxide synthase geno-types and risk of acute rejection episodes. However, further study is necessary to determine genetic susceptibility for transplant patients.

Caffeine and Your Child

Science.gov (United States)

... Staying Safe Videos for Educators Search English Español Caffeine KidsHealth / For Parents / Caffeine What's in this article? ... español La cafeína y su hijo What Is Caffeine? Caffeine is a natural stimulant found in coffee, ...

Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

NARCIS (Netherlands)

van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

1991-01-01

Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

Caffeine promotes global spatial processing in habitual and non-habitual caffeine consumers

Directory of Open Access Journals (Sweden)

Grace E. Giles

2013-10-01

Full Text Available Information processing is generally biased toward global cues, often at the expense of local information. Equivocal extant data suggests that arousal states may accentuate either a local or global processing bias, at least partially dependent on the nature of the manipulation, task and stimuli. To further differentiate the conditions responsible for such equivocal results we varied caffeine doses to alter physiological arousal states and measured their effect on tasks requiring the retrieval of local versus global spatial knowledge. In a double-blind, repeated-measures design, non-habitual (Exp. 1; N=36, M=42.5±29 mg/day caffeine and habitual (Exp. 2; N=34, M=579.5±311.5 mg/day caffeine caffeine consumers completed four test sessions corresponding to each of four caffeine doses (0 mg, 100 mg, 200 mg, 400 mg. During each test session, participants consumed a capsule containing one of the three doses of caffeine or placebo, waited sixty minutes, and then completed two spatial tasks, one involving memorizing maps and one spatial descriptions. A spatial statement verification task tested local versus global spatial knowledge by differentially probing memory for proximal versus distal landmark relationships. On the map learning task, results indicated that caffeine enhanced memory for distal (i.e. global compared to proximal (i.e. local comparisons at 100 (marginal, 200, and 400 mg caffeine in non-habitual consumers, and marginally beginning at 200 mg caffeine in habitual consumers. On the spatial descriptions task, caffeine enhanced memory for distal compared to proximal comparisons beginning at 100 mg in non-habitual but not habitual consumers. We thus provide evidence that caffeine-induced physiological arousal amplifies global spatial processing biases, and these effects are at least partially driven by habitual caffeine consumption.

Characterization and evolutionary analysis of ent-kaurene synthase like genes from the wild rice species Oryza rufipogon.

Science.gov (United States)

Toyomasu, Tomonobu; Miyamoto, Koji; Shenton, Matthew R; Sakai, Arisa; Sugawara, Chizu; Horie, Kiyotaka; Kawaide, Hiroshi; Hasegawa, Morifumi; Chuba, Masaru; Mitsuhashi, Wataru; Yamane, Hisakazu; Kurata, Nori; Okada, Kazunori

2016-11-18

Cultivated rice (Oryza sativa) possesses various labdane-related diterpene synthase genes, homologs of ent-copalyl diphosphate synthase (CPS) and ent-kaurene synthase (KS) that are responsible for the biosynthesis of phytohormone gibberellins. The CPS homologs and KS like (KSL) homologs successively converted geranylgeranyl diphosphate to cyclic diterpene hydrocarbons via ent-copalyl diphosphate or syn-copalyl diphosphate in O. sativa. Consequently, a variety of labdane-related diterpenoids, including phytoalexin phytocassanes, momilactones and oryzalexins, have been identified from cultivated rice. Our previous report indicated that the biosynthesis of phytocassanes and momilactones is conserved in Oryza rufipogon, the progenitor of Asian cultivated rice. Moreover, their biosynthetic gene clusters, containing OsCPS2 and OsKSL7 for phytocassane biosynthesis and OsCPS4 and OsKSL4 for momilactone biosynthesis, are also present in the O. rufipogon genome. We herein characterized O. rufipogon homologs of OsKSL5, OsKSL6, OsKSL8 responsible for oryzalexin S biosynthesis, and OsKSL10 responsible for oryzalexins A-F biosynthesis, to obtain more evolutionary insight into diterpenoid biosynthesis in O. sativa. Our phytoalexin analyses showed that no accumulation of oryzalexins was detected in extracts from O. rufipogon leaf blades. In vitro functional analyses indicated that unlike OsKSL10, O. rufipogon KSL10 functions as an ent-miltiradiene synthase, which explains the lack of accumulation of oryzalexins A-F in O. rufipogon. The different functions of KSL5 and KSL8 in O. sativa japonica to those in indica are conserved in each type of O. rufipogon, while KSL6 functions (ent-isokaurene synthases) are well conserved. Our study suggests that O. sativa japonica has evolved distinct specialized diterpenoid metabolism, including the biosynthesis of oryzalexins. Copyright © 2016 Elsevier Inc. All rights reserved.

Caffeine alters emotion and emotional responses in low habitual caffeine consumers.

Science.gov (United States)

Giles, Grace E; Spring, Alexander M; Urry, Heather L; Moran, Joseph M; Mahoney, Caroline R; Kanarek, Robin B

2018-02-01

Caffeine reliably increases emotional arousal, but it is unclear whether and how it influences other dimensions of emotion such as emotional valence. These experiments documented whether caffeine influences emotion and emotion regulation choice and success. Low to abstinent caffeine consumers (maximum 100 mg/day) completed measures of state anxiety, positive and negative emotion, and salivary cortisol before, 45 min after, and 75 min after consuming 400 mg caffeine or placebo. Participants also completed an emotion regulation choice task, in which they chose to employ cognitive reappraisal or distraction in response to high and low intensity negative pictures (Experiment 1), or a cognitive reappraisal task, in which they employed cognitive reappraisal or no emotion regulation strategy in response to negative and neutral pictures (Experiment 2). State anxiety, negative emotion, and salivary cortisol were heightened both 45 and 75 min after caffeine intake relative to placebo. In Experiment 1, caffeine did not influence the frequency with which participants chose reappraisal or distraction, but reduced negativity of the picture ratings. In Experiment 2, caffeine did not influence cognitive reappraisal success. Thus, caffeine mitigated emotional responses to negative situations, but not how participants chose to regulate such responses or the success with which they did so.

Caffeine Reinforces Flavor Preference and Behavior in Moderate Users but Not in Low Caffeine Users

Science.gov (United States)

Dack, Charlotte; Reed, Phil

2009-01-01

The study examined the role of caffeine consumption in caffeine reinforcement. Previous findings have shown that caffeine reinforced flavor preference in moderate caffeine consumers who are caffeine deprived. However, most of these studies have employed rating procedures only, and have not shown the effectiveness of caffeine to reinforce behaviors…

Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

Science.gov (United States)

Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

2015-09-01

In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

Caffeine mediates sustained inactivation of breast cancer-associated myofibroblasts via up-regulation of tumor suppressor genes.

Directory of Open Access Journals (Sweden)

Mysoon M Al-Ansari

Full Text Available BACKGROUND: Active cancer-associated fibroblasts (CAFs or myofibroblasts play important roles not only in the development and progression of breast carcinomas, but also in their prognosis and treatment. Therefore, targeting these cells through suppressing their supportive procarcinogenic paracrine effects is mandatory for improving the current therapies that are mainly targeting tumor cells. To this end, we investigated the effect of the natural and pharmacologically safe molecule, caffeine, on CAF cells and their various procarcinogenic effects. METHODOLOGY/PRINCIPAL FINDINGS: We have shown here that caffeine up-regulates the tumor suppressor proteins p16, p21, p53 and Cav-1, and reduces the expression/secretion of various cytokines (IL-6, TGF-β, SDF-1 and MMP-2, and down-regulates α-SMA. Furthermore, caffeine suppressed the migratory/invasiveness abilities of CAF cells through PTEN-dependent Akt/Erk1/2 inactivation. Moreover, caffeine reduced the paracrine pro-invasion/-migration effects of CAF cells on breast cancer cells. These results indicate that caffeine can inactivate breast stromal myofibroblasts. This has been confirmed by showing that caffeine also suppresses the paracrine pro-angiogenic effect of CAF cells through down-regulating HIF-1αand its downstream effector VEGF-A. Interestingly, these effects were sustained in absence of caffeine. CONCLUSION/SIGNIFICANCE: The present findings provide a proof of principle that breast cancer myofibroblasts can be inactivated, and thereby caffeine may provide a safe and effective prevention against breast tumor growth/recurrence through inhibition of the procarcinogenic effects of active stromal fibroblasts.

Cloning and Functional Characterization of a Gene for Capsanthin-Capsorubin Synthase from Tiger Lily (Lilium lancifolium Thunb. ‘Splendens’)

OpenAIRE

Jeknić, Zoran; Morré, Jeffrey T.; Jeknić, Stevan; Jevremović, Slađana; Subotić, Angelina; Chen, Tony H.H.

2012-01-01

The orange color of tiger lily (Lolium lancifolium ‘Splendens’) flowers is due, primarily, to the accumulation of two κ-xanthophylls, capsanthin and capsorubin. An enzyme, known as capsanthin-capsorubin synthase (CCS), catalyzes the conversion of antheraxanthin and violaxanthin into capsanthin and capsorubin, respectively. We cloned the gene for capsanthin-capsorubin synthase (Llccs) from flower tepals of L. lancifolium by the rapid amplification of cDNA ends (RACE) with a heterologous non-de...

Faster but not smarter:effects of caffeine and caffeine withdrawal on alertness and performance

OpenAIRE

Rogers, Peter J; Heatherley, Susan V; Mullings, Emma L; Smith, Jessica E

2013-01-01

Despite 100 years of psychopharmacological research, the extent to which caffeine consumption benefits human functioning remains unclear.To measure the effects of overnight caffeine abstinence and caffeine administration as a function of level of habitual caffeine consumption.Medium-high (n = 212) and non-low (n = 157) caffeine consumers completed self-report measures and computer-based tasks before (starting at 10:30 AM) and after double-blind treatment with either caffeine (100 mg, then 150...

Estimation of caffeine intake from analysis of caffeine metabolites in wastewater

NARCIS (Netherlands)

Gracia-Lor, E.; Rousis, N.I.; Zuccato, E.; Bade, R.; Baz-Lomba, J.A.; Castrignanò, E.; Causanilles Llanes, A.; Hernández, F.; Kasprzyk-Hordern, B.; Kinyua, J.; McCall, A.-K.; van Nuijs, A.L.N.; Plósz, B.G.; Ramin, P.; Ryu, Y.; Santos, M.M.; Thomas, K.; de Voogt, P.; Yang, Z.; Castiglioni, S.

2017-01-01

Caffeine metabolites in wastewater were investigated as potential biomarkers for assessing caffeine intake in a population. The main human urinary metabolites of caffeine were measured in the urban wastewater of ten European cities and the metabolic profiles in wastewater were compared with the

Mutations in the dihydropteroate synthase gene of Pneumocystis jiroveci isolates from Portuguese patients with Pneumocystis pneumonia

DEFF Research Database (Denmark)

Costa, M C; Helweg-Larsen, J; Lundgren, Bettina

2003-01-01

The aim of this study was to evaluate the frequency of mutations of the P. jiroveci dihydropteroate synthase (DHPS) gene in an immunocompromised Portuguese population and to investigate the possible association between DHPS mutations and sulpha exposure. In the studied population, DHPS gene...... mutations were not significantly more frequent in patients exposed to sulpha drugs compared with patients not exposed (P=0.390). The results of this study suggest that DHPS gene mutations are frequent in the Portuguese immunocompromised population but do not seem associated with previous sulpha exposure...

Cloning and Comparative Studies of Seaweed Trehalose-6-Phosphate Synthase Genes

Directory of Open Access Journals (Sweden)

Bin Wang

2010-07-01

Full Text Available The full-length cDNA sequence (3219 base pairs of the trehalose-6-phosphate synthase gene of Porphyra yezoensis (PyTPS was isolated byRACE-PCR and deposited in GenBank (NCBI with the accession number AY729671. PyTPS encodes a protein of 908 amino acids before a stop codon, and has a calculated molecular mass of 101,591 Daltons. The PyTPS protein consists of a TPS domain in the N-terminus and a putative TPP domain at the C-terminus. Homology alignment for PyTPS and the TPS proteins from bacteria, yeast and higher plants indicated that the most closely related sequences to PyTPS were those from higher plants (OsTPS and AtTPS5, whereas the most distant sequence to PyTPS was from bacteria (EcOtsAB. Based on the identified sequence of the PyTPS gene, PCR primers were designed and used to amplify the TPS genes from nine other seaweed species. Sequences of the nine obtained TPS genes were deposited in GenBank (NCBI. All 10 TPS genes encoded peptides of 908 amino acids and the sequences were highly conserved both in nucleotide composition (>94% and in amino acid composition (>96%. Unlike the TPS genes from some other plants, there was no intron in any of the 10 isolated seaweed TPS genes.

Quantitative HPLC Analysis of an Analgesic/Caffeine Formulation: Determination of Caffeine

Science.gov (United States)

Ferguson, Glenda K.

1998-04-01

A modern high performance liquid chromatography (HPLC) laboratory experiment which entails the separation of acetaminophen, aspirin, and caffeine and the quantitative assay of caffeine in commercial mixtures of these compounds has been developed. Our HPLC protocol resolves these compounds in only three minutes with a straightforward chromatographic apparatus which consists of a C-18 column, an isocratic mobile phase, UV detection at 254 nm, and an integrator; an expensive, sophisticated system is not required. The separation is both repeatable and rapid. Moreover, the experiment can be completed in a single three-hour period. The experiment is appropriate for any chemistry student who has completed a minimum of one year of general chemistry and is ideal for an analytical or instrumental analysis course. The experiment detailed herein involves the determination of caffeine in Goody's Extra Strength Headache Powders, a commercially available medication which contains acetaminophen, aspirin, and caffeine as active ingredients. However, the separation scheme is not limited to this brand of medication nor is it limited to caffeine as the analyte. With only minor procedural modifications, students can simultaneously quantitate all of these compounds in a commercial mixture. In our procedure, students prepare a series of four caffeine standard solutions as well as a solution from a pharmaceutical analgesic/caffeine mixture, chromatographically analyze each solution in quadruplicate, and plot relative average caffeine standard peak area versus concentration. From the mathematical relationship that results, the concentration of caffeine in the commercial formulation is obtained. Finally, the absolute standard deviation of the mean concentration is calculated.

Caffeine content of decaffeinated coffee.

Science.gov (United States)

McCusker, Rachel R; Fuehrlein, Brian; Goldberger, Bruce A; Gold, Mark S; Cone, Edward J

2006-10-01

Caffeine is the most widely consumed drug in the world with coffee representing a major source of intake. Despite widespread availability, various medical conditions necessitate caffeine-restricted diets. Patients on certain prescription medications are advised to discontinue caffeine intake. Such admonition has implications for certain psychiatric patients because of pharmacokinetic interactions between caffeine and certain anti-anxiety drugs. In an effort to abstain from caffeine, patients may substitute decaffeinated for caffeinated coffee. However, decaffeinated beverages are known to contain caffeine in varying amounts. The present study determined the caffeine content in a variety of decaffeinated coffee drinks. In phase 1 of the study, 10 decaffeinated samples were collected from different coffee establishments. In phase 2 of the study, Starbucks espresso decaffeinated (N=6) and Starbucks brewed decaffeinated coffee (N=6) samples were collected from the same outlet to evaluate variability of caffeine content of the same drink. The 10 decaffeinated coffee samples from different outlets contained caffeine in the range of 0-13.9 mg/16-oz serving. The caffeine content for the Starbucks espresso and the Starbucks brewed samples collected from the same outlet were 3.0-15.8 mg/shot and 12.0-13.4 mg/16-oz serving, respectively. Patients vulnerable to caffeine effects should be advised that caffeine may be present in coffees purported to be decaffeinated. Further research is warranted on the potential deleterious effects of consumption of "decaffeinated" coffee that contains caffeine on caffeine-restricted patients. Additionally, further exploration is merited for the possible physical dependence potential of low doses of caffeine such as those concentrations found in decaffeinated coffee.

Use of a draft genome of coffee (Coffea arabica) to identify SNPs associated with caffeine content.

Science.gov (United States)

Tran, Hue T M; Ramaraj, Thiruvarangan; Furtado, Agnelo; Lee, Leonard Slade; Henry, Robert J

2018-03-07

Arabica coffee (Coffea arabica) has a small gene pool limiting genetic improvement. Selection for caffeine content within this gene pool would be assisted by identification of the genes controlling this important trait. Sequencing of DNA bulks from 18 genotypes with extreme high- or low-caffeine content from a population of 232 genotypes was used to identify linked polymorphisms. To obtain a reference genome, a whole genome assembly of arabica coffee (variety K7) was achieved by sequencing using short read (Illumina) and long-read (PacBio) technology. Assembly was performed using a range of assembly tools resulting in 76 409 scaffolds with a scaffold N50 of 54 544 bp and a total scaffold length of 1448 Mb. Validation of the genome assembly using different tools showed high completeness of the genome. More than 99% of transcriptome sequences mapped to the C. arabica draft genome, and 89% of BUSCOs were present. The assembled genome annotated using AUGUSTUS yielded 99 829 gene models. Using the draft arabica genome as reference in mapping and variant calling allowed the detection of 1444 nonsynonymous single nucleotide polymorphisms (SNPs) associated with caffeine content. Based on Kyoto Encyclopaedia of Genes and Genomes pathway-based analysis, 65 caffeine-associated SNPs were discovered, among which 11 SNPs were associated with genes encoding enzymes involved in the conversion of substrates, which participate in the caffeine biosynthesis pathways. This analysis demonstrated the complex genetic control of this key trait in coffee. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Effects of caffeine and caffeine withdrawal on mood and cognitive performance degraded by sleep restriction.

Science.gov (United States)

Rogers, Peter J; Heatherley, Susan V; Hayward, Robert C; Seers, Helen E; Hill, Joanne; Kane, Marian

2005-06-01

It has been suggested that caffeine is most likely to benefit mood and performance when alertness is low. To measure the effects of caffeine on psychomotor and cognitive performance, mood, blood pressure and heart rate in sleep-restricted participants. To do this in a group of participants who had also been previously deprived of caffeine for 3 weeks, thereby potentially removing the confounding effects of acute caffeine withdrawal. Participants were moderate to moderate-high caffeine consumers who were provided with either decaffeinated tea and/or coffee for 3 weeks (LTW) or regular tea and/or coffee for 3 weeks (overnight caffeine-withdrawn participants, ONW). Then, following overnight caffeine abstinence, they were tested on a battery of tasks assessing mood, cognitive performance, etc. before and after receiving caffeine (1.2 mg/kg) or on another day after receiving placebo. Final analyses were based on 17 long-term caffeine-withdrawn participants (LTW) and 17 ONW participants whose salivary caffeine levels on each test day confirmed probable compliance with the instructions concerning restrictions on consumption of caffeine-containing drinks. Acute caffeine withdrawal (ONW) had a number of negative effects, including impairment of cognitive performance, increased headache, and reduced alertness and clear-headedness. Caffeine (versus placebo) did not significantly improve cognitive performance in LTW participants, although it prevented further deterioration of performance in ONW participants. Caffeine increased tapping speed (but tended to impair hand steadiness), increased blood pressure, and had some effects on mood in both groups. The findings provide strong support for the withdrawal reversal hypothesis. In particular, cognitive performance was found to be affected adversely by acute caffeine withdrawal and, even in the context of alertness lowered by sleep restriction, cognitive performance was not improved by caffeine in the absence of these withdrawal

Caffeine overdose

Science.gov (United States)

... this page: //medlineplus.gov/ency/article/002579.htm Caffeine overdose To use the sharing features on this page, please enable JavaScript. Caffeine is a substance that exists naturally in certain ...

Subjective, behavioral, and physiological effects of acute caffeine in light, nondependent caffeine users.

Science.gov (United States)

Childs, Emma; de Wit, Harriet

2006-05-01

Caffeine produces mild psychostimulant effects that are thought to underlie its widespread use. However, the direct effects of caffeine are difficult to evaluate in regular users of caffeine because of tolerance and withdrawal. Indeed, some researchers hypothesize that the psychostimulant effects of caffeine are due largely to the reversal of withdrawal and question whether there are direct effects of caffeine consumption upon mood, alertness, or mental performance in nondependent individuals. This study investigated the physiological, subjective, and behavioral effects of 0, 50, 150, and 450 mg caffeine in 102 light, nondependent caffeine users. Using a within-subjects design, subjects participated in four experimental sessions, in which they received each of the four drug conditions in random order under double blind conditions. Participants completed subjective effects questionnaires and vital signs were measured before and at repeated time points after drug administration. Forty minutes after the capsules were ingested, subjects completed behavioral tasks that included tests of sustained attention, short-term memory, psychomotor performance, and behavioral inhibition. Caffeine significantly increased blood pressure, and produced feelings of arousal, positive mood, and high. Caffeine increased the number of hits and decreased reaction times in a vigilance task, but impaired performance on a memory task. We confirm that acute doses of caffeine, at levels typically found in a cup of coffee, produce stimulant-like subjective effects and enhance performance in light, nondependent caffeine users. These findings support the idea that the drug has psychoactive effects even in the absence of withdrawal.

Associations of ambulatory blood pressure with urinary caffeine and caffeine metabolite excretions.

Science.gov (United States)

Guessous, Idris; Pruijm, Menno; Ponte, Belén; Ackermann, Daniel; Ehret, Georg; Ansermot, Nicolas; Vuistiner, Philippe; Staessen, Jan; Gu, Yumei; Paccaud, Fred; Mohaupt, Markus; Vogt, Bruno; Pechère-Bertschi, Antoinette; Pechère-Berstchi, Antoinette; Martin, Pierre-Yves; Burnier, Michel; Eap, Chin B; Bochud, Murielle

2015-03-01

Intake of caffeinated beverages might be associated with reduced cardiovascular mortality possibly via the lowering of blood pressure. We estimated the association of ambulatory blood pressure with urinary caffeine and caffeine metabolites in a population-based sample. Families were randomly selected from the general population of Swiss cities. Ambulatory blood pressure monitoring was conducted using validated devices. Urinary caffeine, paraxanthine, theophylline, and theobromine excretions were measured in 24 hours urine using ultrahigh performance liquid chromatography tandem mass spectrometry. We used mixed models to explore the associations of urinary excretions with blood pressure although adjusting for major confounders. The 836 participants (48.9% men) included in this analysis had mean age of 47.8 and mean 24-hour systolic and diastolic blood pressure of 120.1 and 78.0 mm Hg. For each doubling of caffeine excretion, 24-hour and night-time systolic blood pressure decreased by 0.642 and 1.107 mm Hg (both P values theobromine excretion was not associated with blood pressure. Anti-hypertensive therapy, diabetes mellitus, and alcohol consumption modify the association of caffeine urinary excretion with systolic blood pressure. Ambulatory systolic blood pressure was inversely associated with urinary excretions of caffeine and other caffeine metabolites. Our results are compatible with a potential protective effect of caffeine on blood pressure. © 2014 American Heart Association, Inc.

Caffeine's implications for women's health and survey of obstetrician-gynecologists' caffeine knowledge and assessment practices.

Science.gov (United States)

Anderson, Britta L; Juliano, Laura M; Schulkin, Jay

2009-09-01

Caffeine has relevance for women's health and pregnancy, including significant associations with spontaneous abortion and low birth weight. According to scientific data, pregnant women and women of reproductive age should be advised to limit their caffeine consumption. This article reviews the implications of caffeine for women's psychological and physical health, and presents data on obstetrician-gynecologists' (ob-gyns) knowledge and practices pertaining to caffeine. Ob-gyns (N = 386) who are members of the American College of Obstetricians and Gynecologists' Collaborative Ambulatory Research Network responded to a 21-item survey about caffeine. Although most knew that caffeine is passed through breast milk, only 24.8% were aware that caffeine metabolism significantly slows as pregnancy progresses. Many respondents were not aware of the caffeine content of commonly used products, such as espresso and Diet Coke, with 14.3% and 57.8% indicating amounts within an accurate range, respectively. Furthermore, ob-gyns did not take into account large differences in caffeine content across different caffeinated beverages with most recommending one to two servings of coffee or tea or soft drinks per day. There was substantial inconsistency in what was considered to be "high levels" of maternal caffeine consumption, with only 31.6% providing a response. When asked to indicate the risk that high levels of caffeine have on various pregnancy outcomes, responses were not consistent with scientific data. For example, respondents overestimated the relative risk of stillbirths and underestimated the relative risk of spontaneous abortion. There was great variability in assessment and advice practices pertaining to caffeine. More than half advise their pregnant patients to consume caffeine under certain circumstances, most commonly to alleviate headache and caffeine withdrawal. The data suggest that ob-gyns could benefit from information about caffeine and its relevance to their

The biosynthetic origin of irregular monoterpenes in Lavandula: isolation and biochemical characterization of a novel cis-prenyl diphosphate synthase gene, lavandulyl diphosphate synthase.

Science.gov (United States)

Demissie, Zerihun A; Erland, Lauren A E; Rheault, Mark R; Mahmoud, Soheil S

2013-03-01

Lavender essential oils are constituted predominantly of regular monoterpenes, for example linalool, 1,8-cineole, and camphor. However, they also contain irregular monoterpenes including lavandulol and lavandulyl acetate. Although the majority of genes responsible for the production of regular monoterpenes in lavenders are now known, enzymes (including lavandulyl diphosphate synthase (LPPS)) catalyzing the biosynthesis of irregular monoterpenes in these plants have not been described. Here, we report the isolation and functional characterization of a novel cis-prenyl diphosphate synthase cDNA, termed Lavandula x intermedia lavandulyl diphosphate synthase (LiLPPS), through a homology-based cloning strategy. The LiLPPS ORF, encoding for a 305-amino acid long protein, was expressed in Escherichia coli, and the recombinant protein was purified by nickel-nitrilotriacetic acid affinity chromatography. The approximately 34.5-kDa bacterially produced protein specifically catalyzed the head-to-middle condensation of two dimethylallyl diphosphate units to LPP in vitro with apparent Km and kcat values of 208 ± 12 μm and 0.1 s(-1), respectively. LiLPPS is a homodimeric enzyme with a sigmoidal saturation curve and Hill coefficient of 2.7, suggesting a positive co-operative interaction among its catalytic sites. LiLPPS could be used to modulate the production of lavandulol and its derivatives in plants through metabolic engineering.

Bioinformatics analysis of the phytoene synthase gene in cabbage (Brassica oleracea var. capitata)

Science.gov (United States)

Sun, Bo; Jiang, Min; Xue, Shengling; Zheng, Aihong; Zhang, Fen; Tang, Haoru

2018-04-01

Phytoene Synthase (PSY) is an important enzyme in carotenoid biosynthesis. Here, the Brassica oleracea var. capitata PSY (BocPSY) gene sequences were obtained from Brassica database (BRAD), and preformed for bioinformatics analysis. The BocPSY1, BocPSY2 and BocPSY3 genes mapped to chromosomes 2,3 and 9, and contains an open reading frame of 1,248 bp, 1,266 bp and 1,275 bp that encodes a 415, 421, 424 amino acid protein, respectively. Subcellular localization predicted all BocPSY genes were in the chloroplast. The conserved domain of the BocPSY protein is PLN02632. Homology analysis indicates that the levels of identity among BocPSYs were all more than 85%, and the PSY protein is apparently conserved during plant evolution. The findings of the present study provide a molecular basis for the elucidation of PSY gene function in cabbage.

Caffeine, fatigue, and cognition.

Science.gov (United States)

Lorist, Monicque M; Tops, Mattie

2003-10-01

Effects of caffeine and fatigue are discussed with special attention to adenosine-dopamine interactions. Effects of caffeine on human cognition are diverse. Behavioural measurements indicate a general improvement in the efficiency of information processing after caffeine, while the EEG data support the general belief that caffeine acts as a stimulant. Studies using ERP measures indicate that caffeine has an effect on attention, which is independent of specific stimulus characteristics. Behavioural effects on response related processes turned out to be mainly related to more peripheral motor processes. Recent insights in adenosine and dopamine physiology and functionality and their relationships with fatigue point to a possible modulation by caffeine of mechanisms involved in the regulation of behavioural energy expenditure.

Caffeine suppresses homologous recombination through interference with RAD51-mediated joint molecule formation

Science.gov (United States)

Zelensky, Alex N.; Sanchez, Humberto; Ristic, Dejan; Vidic, Iztok; van Rossum-Fikkert, Sari E.; Essers, Jeroen; Wyman, Claire; Kanaar, Roland

2013-01-01

Caffeine is a widely used inhibitor of the protein kinases that play a central role in the DNA damage response. We used chemical inhibitors and genetically deficient mouse embryonic stem cell lines to study the role of DNA damage response in stable integration of the transfected DNA and found that caffeine rapidly, efficiently and reversibly inhibited homologous integration of the transfected DNA as measured by several homologous recombination-mediated gene-targeting assays. Biochemical and structural biology experiments revealed that caffeine interfered with a pivotal step in homologous recombination, homologous joint molecule formation, through increasing interactions of the RAD51 nucleoprotein filament with non-homologous DNA. Our results suggest that recombination pathways dependent on extensive homology search are caffeine-sensitive and stress the importance of considering direct checkpoint-independent mechanisms in the interpretation of the effects of caffeine on DNA repair. PMID:23666627

Nicotianamine synthase overexpression positively modulates iron homeostasis-related genes in high iron rice

Directory of Open Access Journals (Sweden)

Meng eWang

2013-05-01

Full Text Available Nearly one-third of the world population, mostly women and children, suffer from iron malnutrition and its consequences, such as anemia or impaired mental development. Biofortification of rice, which is a staple crop for nearly half of the world’s population, can significantly contribute in alleviating iron deficiency. NFP rice (transgenic rice expressing nicotianamine synthase, ferritin and phytase genes has a more than six-fold increase in iron content in polished rice grains, resulting from the synergistic action of nicotianamine synthase (NAS and ferritin transgenes. We investigated iron homeostasis in NFP plants by analyzing the expression of 28 endogenous rice genes known to be involved in the homeostasis of iron and other metals, in iron-deficient and iron-sufficient conditions. RNA was collected from different tissues (roots, flag leaves, grains and at three developmental stages during grain filling. NFP plants showed increased sensitivity to iron-deficiency conditions and changes in the expression of endogenous genes involved in nicotianamine (NA metabolism, in comparison to their non-transgenic siblings. Elevated transcript levels were detected in NFP plants for several iron transporters. In contrast, expression of OsYSL2, which encodes a member of Yellow Stripe-like protein family, and a transporter of the NA-Fe(II complex was reduced in NFP plants under low iron conditions, indicating that expression of OsYSL2 is regulated by the endogenous iron status. Expression of the transgenes did not significantly affect overall iron homeostasis in NFP plants, which establishes the engineered push-pull mechanism as a suitable strategy to increase rice endosperm iron content.

Functional analyses of cellulose synthase genes in flax (Linum usitatissimum) by virus-induced gene silencing.

Science.gov (United States)

Chantreau, Maxime; Chabbert, Brigitte; Billiard, Sylvain; Hawkins, Simon; Neutelings, Godfrey

2015-12-01

Flax (Linum usitatissimum) bast fibres are located in the stem cortex where they play an important role in mechanical support. They contain high amounts of cellulose and so are used for linen textiles and in the composite industry. In this study, we screened the annotated flax genome and identified 14 distinct cellulose synthase (CESA) genes using orthologous sequences previously identified. Transcriptomics of 'primary cell wall' and 'secondary cell wall' flax CESA genes showed that some were preferentially expressed in different organs and stem tissues providing clues as to their biological role(s) in planta. The development for the first time in flax of a virus-induced gene silencing (VIGS) approach was used to functionally evaluate the biological role of different CESA genes in stem tissues. Quantification of transcript accumulation showed that in many cases, silencing not only affected targeted CESA clades, but also had an impact on other CESA genes. Whatever the targeted clade, inactivation by VIGS affected plant growth. In contrast, only clade 1- and clade 6-targeted plants showed modifications in outer-stem tissue organization and secondary cell wall formation. In these plants, bast fibre number and structure were severely impacted, suggesting that the targeted genes may play an important role in the establishment of the fibre cell wall. Our results provide new fundamental information about cellulose biosynthesis in flax that should facilitate future plant improvement/engineering. © 2015 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Prenatal caffeine exposure induced a lower level of fetal blood leptin mainly via placental mechanism

International Nuclear Information System (INIS)

Wu, Yi-meng; Luo, Han-wen; Kou, Hao; Wen, Yin-xian; Shen, Lang; Pei, Ling-guo; Zhou, Jin; Zhang, Yuan-zhen; Wang, Hui

2015-01-01

It's known that blood leptin level is reduced in intrauterine growth retardation (IUGR) fetus, and placental leptin is the major source of fetal blood leptin. This study aimed to investigate the decreased fetal blood leptin level by prenatal caffeine exposure (PCE) and its underlying placental mechanisms. Pregnant Wistar rats were intragastrically administered caffeine (30–120 mg/kg day) from gestational day 9 to 20. The level of fetal serum leptin and the expression of placental leptin-related genes were analyzed. Furthermore, we investigated the molecular mechanism of the reduced placental leptin's expression by treatment with caffeine (0.8–20 μM) in the BeWo cells. In vivo, PCE significantly decreased fetal serum leptin level in caffeine dose-dependent manner. Meanwhile, placental mRNA expression of adenosine A2a receptor (Adora2a), cAMP-response element binding protein (CREB), a short-type leptin receptor (Ob-Ra) and leptin was reduced in the PCE groups. In vitro, caffeine significantly decreased the mRNA expression of leptin, CREB and ADORA2A in concentration and time-dependent manners. The addition of ADORA2A agonist or adenylyl cyclase (AC) agonist reversed the inhibition of leptin expression induced by caffeine. PCE induced a lower level of fetal blood leptin, which the primary mechanism is that caffeine inhibited antagonized Adora2a and AC activities to decreased cAMP synthesis, thus inhibited the expression of the transcription factor CREB and target gene leptin in the placenta. Meantime, the reduced transportation of maternal leptin by placental Ob-Ra also contributed to the reduced fetal blood leptin. Together, PCE decreased fetal blood leptin mainly via reducing the expression and transportation of leptin in the placenta. - Highlights: • Caffeine reduced fetal blood leptin level. • Caffeine inhibited placental leptin production and transport. • Caffeine down-regulated placental leptin expression via antagonizing ADORA2. �

Prenatal caffeine exposure induced a lower level of fetal blood leptin mainly via placental mechanism

Energy Technology Data Exchange (ETDEWEB)

Wu, Yi-meng [Department of Pharmacology, Basic Medical School of Wuhan University, Wuhan 430071 (China); Luo, Han-wen [Department of Orthopedic Surgery, Zhongnan Hospital of Wuhan University, Wuhan 430071 (China); Kou, Hao [Department of Pharmacology, Basic Medical School of Wuhan University, Wuhan 430071 (China); Wen, Yin-xian [Department of Orthopedic Surgery, Zhongnan Hospital of Wuhan University, Wuhan 430071 (China); Shen, Lang; Pei, Ling-guo; Zhou, Jin [Department of Pharmacology, Basic Medical School of Wuhan University, Wuhan 430071 (China); Zhang, Yuan-zhen [Department of Obstetrics and Gynecology, Zhongnan Hospital of Wuhan University, Wuhan 430071 (China); Hubei Provincial Key Laboratory of Developmentally Originated Disease, Wuhan 430071 (China); Wang, Hui, E-mail: wanghui19@whu.edu.cn [Department of Pharmacology, Basic Medical School of Wuhan University, Wuhan 430071 (China); Hubei Provincial Key Laboratory of Developmentally Originated Disease, Wuhan 430071 (China)

2015-11-15

It's known that blood leptin level is reduced in intrauterine growth retardation (IUGR) fetus, and placental leptin is the major source of fetal blood leptin. This study aimed to investigate the decreased fetal blood leptin level by prenatal caffeine exposure (PCE) and its underlying placental mechanisms. Pregnant Wistar rats were intragastrically administered caffeine (30–120 mg/kg day) from gestational day 9 to 20. The level of fetal serum leptin and the expression of placental leptin-related genes were analyzed. Furthermore, we investigated the molecular mechanism of the reduced placental leptin's expression by treatment with caffeine (0.8–20 μM) in the BeWo cells. In vivo, PCE significantly decreased fetal serum leptin level in caffeine dose-dependent manner. Meanwhile, placental mRNA expression of adenosine A2a receptor (Adora2a), cAMP-response element binding protein (CREB), a short-type leptin receptor (Ob-Ra) and leptin was reduced in the PCE groups. In vitro, caffeine significantly decreased the mRNA expression of leptin, CREB and ADORA2A in concentration and time-dependent manners. The addition of ADORA2A agonist or adenylyl cyclase (AC) agonist reversed the inhibition of leptin expression induced by caffeine. PCE induced a lower level of fetal blood leptin, which the primary mechanism is that caffeine inhibited antagonized Adora2a and AC activities to decreased cAMP synthesis, thus inhibited the expression of the transcription factor CREB and target gene leptin in the placenta. Meantime, the reduced transportation of maternal leptin by placental Ob-Ra also contributed to the reduced fetal blood leptin. Together, PCE decreased fetal blood leptin mainly via reducing the expression and transportation of leptin in the placenta. - Highlights: • Caffeine reduced fetal blood leptin level. • Caffeine inhibited placental leptin production and transport. • Caffeine down-regulated placental leptin expression via antagonizing ADORA2. �

Is caffeine a cognitive enhancer?

Science.gov (United States)

Nehlig, Astrid

2010-01-01

The effects of caffeine on cognition were reviewed based on the large body of literature available on the topic. Caffeine does not usually affect performance in learning and memory tasks, although caffeine may occasionally have facilitatory or inhibitory effects on memory and learning. Caffeine facilitates learning in tasks in which information is presented passively; in tasks in which material is learned intentionally, caffeine has no effect. Caffeine facilitates performance in tasks involving working memory to a limited extent, but hinders performance in tasks that heavily depend on working memory, and caffeine appears to rather improve memory performance under suboptimal alertness conditions. Most studies, however, found improvements in reaction time. The ingestion of caffeine does not seem to affect long-term memory. At low doses, caffeine improves hedonic tone and reduces anxiety, while at high doses, there is an increase in tense arousal, including anxiety, nervousness, jitteriness. The larger improvement of performance in fatigued subjects confirms that caffeine is a mild stimulant. Caffeine has also been reported to prevent cognitive decline in healthy subjects but the results of the studies are heterogeneous, some finding no age-related effect while others reported effects only in one sex and mainly in the oldest population. In conclusion, it appears that caffeine cannot be considered a ;pure' cognitive enhancer. Its indirect action on arousal, mood and concentration contributes in large part to its cognitive enhancing properties.

Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

Science.gov (United States)

Noar, Roslyn D; Daub, Margaret E

2016-01-01

Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity) for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity) to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that they may encode

Bioinformatics Prediction of Polyketide Synthase Gene Clusters from Mycosphaerella fijiensis.

Directory of Open Access Journals (Sweden)

Roslyn D Noar

Full Text Available Mycosphaerella fijiensis, causal agent of black Sigatoka disease of banana, is a Dothideomycete fungus closely related to fungi that produce polyketides important for plant pathogenicity. We utilized the M. fijiensis genome sequence to predict PKS genes and their gene clusters and make bioinformatics predictions about the types of compounds produced by these clusters. Eight PKS gene clusters were identified in the M. fijiensis genome, placing M. fijiensis into the 23rd percentile for the number of PKS genes compared to other Dothideomycetes. Analysis of the PKS domains identified three of the PKS enzymes as non-reducing and two as highly reducing. Gene clusters contained types of genes frequently found in PKS clusters including genes encoding transporters, oxidoreductases, methyltransferases, and non-ribosomal peptide synthases. Phylogenetic analysis identified a putative PKS cluster encoding melanin biosynthesis. None of the other clusters were closely aligned with genes encoding known polyketides, however three of the PKS genes fell into clades with clusters encoding alternapyrone, fumonisin, and solanapyrone produced by Alternaria and Fusarium species. A search for homologs among available genomic sequences from 103 Dothideomycetes identified close homologs (>80% similarity for six of the PKS sequences. One of the PKS sequences was not similar (< 60% similarity to sequences in any of the 103 genomes, suggesting that it encodes a unique compound. Comparison of the M. fijiensis PKS sequences with those of two other banana pathogens, M. musicola and M. eumusae, showed that these two species have close homologs to five of the M. fijiensis PKS sequences, but three others were not found in either species. RT-PCR and RNA-Seq analysis showed that the melanin PKS cluster was down-regulated in infected banana as compared to growth in culture. Three other clusters, however were strongly upregulated during disease development in banana, suggesting that

Caffeine: Friend or Foe?

Science.gov (United States)

Doepker, Candace; Lieberman, Harris R; Smith, Andrew Paul; Peck, Jennifer D; El-Sohemy, Ahmed; Welsh, Brian T

2016-01-01

The debate on the safety of and regulatory approaches for caffeine continues among various stakeholders and regulatory authorities. This decision-making process comes with significant challenges, particularly when considering the complexities of the available scientific data, making the formulation of clear science-based regulatory guidance more difficult. To allow for discussions of a number of key issues, the North American Branch of the International Life Sciences Institute (ILSI) convened a panel of subject matter experts for a caffeine-focused session entitled "Caffeine: Friend or Foe?," which was held during the 2015 ILSI Annual Meeting. The panelists' expertise covered topics ranging from the natural occurrence of caffeine in plants and interindividual metabolism of caffeine in humans to specific behavioral, reproductive, and cardiovascular effects related to caffeine consumption. Each presentation highlighted the potential risks, benefits, and challenges that inform whether caffeine exposure warrants concern. This paper aims to summarize the key topics discussed during the session.

The rice terpene synthase gene OsTPS19 functions as an (S)-limonene synthase in planta, and its overexpression leads to enhanced resistance to the blast fungus Magnaporthe oryzae.

Science.gov (United States)

Chen, Xujun; Chen, Hao; Yuan, Joshua S; Köllner, Tobias G; Chen, Yuying; Guo, Yufen; Zhuang, Xiaofeng; Chen, Xinlu; Zhang, Yong-Jun; Fu, Jianyu; Nebenführ, Andreas; Guo, Zejian; Chen, Feng

2018-03-06

Rice blast disease, caused by the fungus Magnaporthe oryzae, is the most devastating disease of rice. In our ongoing characterization of the defence mechanisms of rice plants against M. oryzae, a terpene synthase gene OsTPS19 was identified as a candidate defence gene. Here, we report the functional characterization of OsTPS19, which is up-regulated by M. oryzae infection. Overexpression of OsTPS19 in rice plants enhanced resistance against M. oryzae, while OsTPS19 RNAi lines were more susceptible to the pathogen. Metabolic analysis revealed that the production of a monoterpene (S)-limonene was increased and decreased in OsTPS19 overexpression and RNAi lines, respectively, suggesting that OsTPS19 functions as a limonene synthase in planta. This notion was further supported by in vitro enzyme assays with recombinant OsTPS19, in which OsTPS19 had both sesquiterpene activity and monoterpene synthase activity, with limonene as a major product. Furthermore, in a subcellular localization experiment, OsTPS19 was localized in plastids. OsTPS19 has a highly homologous paralog, OsTPS20, which likely resulted from a recent gene duplication event. We found that the variation in OsTPS19 and OsTPS20 enzyme activities was determined by a single amino acid in the active site cavity. The expression of OsTPS20 was not affected by M. oryzae infection. This indicates functional divergence of OsTPS19 and OsTPS20. Lastly, (S)-limonene inhibited the germination of M. oryzae spores in vitro. OsTPS19 was determined to function as an (S)-limonene synthase in rice and plays a role in defence against M. oryzae, at least partly, by inhibiting spore germination. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

The Effects of Caffeine Use on Driving Safety Among Truck Drivers Who Are Habitual Caffeine Users.

Science.gov (United States)

Heaton, Karen; Griffin, Russell

2015-08-01

The purpose of this study was to describe caffeine use among a group of habitual caffeine users, truck drivers, and to explore the associations between caffeine use and critical safety events by age in the naturalistic work setting. A secondary analysis of existing data from the Naturalistic Truck Driving Study was conducted. Analyses focused on the association between sleep and caffeine consumption by duty status, comparisons of sleep and caffeine use by age, and the associations between caffeine use and safety-critical events (SCEs). Findings indicated differences in caffeine use by duty status. However, no difference in sleep time by duty status, or between sleep time and caffeine use was found regardless of when the caffeine was consumed during the 5 hours prior to sleep. Sleep time did not vary significantly by age, although increasing age was associated with decreased caffeine use. Overall, a 6% reduction in the rate of SCEs per eight ounces of caffeinated beverage consumed was found. This study makes a unique scientific contribution because it uses real-time observations of truckers in the naturalistic work setting. It also does not involve caffeine withdrawal but rather an investigation of the effects of the naturalistic consumption of caffeine on sleep and driving performance. Findings suggest that caffeine use among habitual users offers a protective effect for safety-critical driving events. Occupational health nurses may use this information to counsel workers in the use of caffeine to enhance driving safety. © 2015 The Author(s).

Identification of a Fungal 1,8-Cineole Synthase from Hypoxylon sp. with Specificity Determinants in Common with the Plant Synthases*

Science.gov (United States)

Shaw, Jeffrey J.; Berbasova, Tetyana; Sasaki, Tomoaki; Jefferson-George, Kyra; Spakowicz, Daniel J.; Dunican, Brian F.; Portero, Carolina E.; Narváez-Trujillo, Alexandra; Strobel, Scott A.

2015-01-01

Terpenes are an important and diverse class of secondary metabolites widely produced by fungi. Volatile compound screening of a fungal endophyte collection revealed a number of isolates in the family Xylariaceae, producing a series of terpene molecules, including 1,8-cineole. This compound is a commercially important component of eucalyptus oil used in pharmaceutical applications and has been explored as a potential biofuel additive. The genes that produce terpene molecules, such as 1,8-cineole, have been little explored in fungi, providing an opportunity to explore the biosynthetic origin of these compounds. Through genome sequencing of cineole-producing isolate E7406B, we were able to identify 11 new terpene synthase genes. Expressing a subset of these genes in Escherichia coli allowed identification of the hyp3 gene, responsible for 1,8-cineole biosynthesis, the first monoterpene synthase discovered in fungi. In a striking example of convergent evolution, mutational analysis of this terpene synthase revealed an active site asparagine critical for water capture and specificity during cineole synthesis, the same mechanism used in an unrelated plant homologue. These studies have provided insight into the evolutionary relationship of fungal terpene synthases to those in plants and bacteria and further established fungi as a relatively untapped source of this important and diverse class of compounds. PMID:25648891

Increased DNA methylation of scavenger receptor class B type I contributes to inhibitory effects of prenatal caffeine ingestion on cholesterol uptake and steroidogenesis in fetal adrenals

Energy Technology Data Exchange (ETDEWEB)

Wu, Dong-Mei; He, Zheng; Ma, Liang-Peng; Wang, Lin-Long [Department of Pharmacology, Wuhan University School of Basic Medical Sciences, Wuhan 430071 (China); Ping, Jie, E-mail: pingjie@whu.edu.cn [Department of Pharmacology, Wuhan University School of Basic Medical Sciences, Wuhan 430071 (China); Hubei Provincial Key Laboratory of Developmentally Originated Diseases, Wuhan 430071 (China); Research Center of Food and Drug Evaluation, Wuhan University, Wuhan 430071 (China); Wang, Hui [Department of Pharmacology, Wuhan University School of Basic Medical Sciences, Wuhan 430071 (China); Hubei Provincial Key Laboratory of Developmentally Originated Diseases, Wuhan 430071 (China); Research Center of Food and Drug Evaluation, Wuhan University, Wuhan 430071 (China)

2015-06-01

Steroid hormones synthesized from cholesterol in the fetal adrenal are crucial for fetal development. We have observed the inhibited fetal adrenal corticosterone synthesis and increased intrauterine growth retardation (IUGR) rate in rats under prenatal caffeine ingestion. The aim of this study is to evaluate the effects of prenatal caffeine ingestion on cholesterol supply in fetal adrenal steroidogenesis in rats and explore the underlying epigenetic mechanisms. Pregnant Wistar rats were treated with 60 mg/kg·d caffeine from gestational day (GD) 7 to GD17. Histological changes of fetal adrenals and increased IUGR rates were observed in the caffeine group. There were significantly decreased steroid hormone contents and cholesterol supply in caffeine-treated fetal adrenals. Data from the gene expression array suggested that prenatal caffeine ingestion caused increased expression of genes related to DNA methylation and decreased expression of genes related to cholesterol uptake. The following conjoint analysis of DNA methylation array with these differentially expressed genes suggested that scavenger receptor class B type I (SR-BI) may play an important role in caffeine-induced cholesterol supply deficiency. Moreover, real-time RT-PCR and immunohistochemical detection certified the inhibitory effects of caffeine on both mRNA expression and protein expression of SR-BI in the fetal adrenal. And the increased DNA methylation frequency in the proximal promoter of SR-BI was confirmed by bisulfite-sequencing PCR. In conclusion, prenatal caffeine ingestion can induce DNA hypermethylation of the SR-BI promoter in the rat fetal adrenal. These effects may lead to decreased SR-BI expression and cholesterol uptake, which inhibits steroidogenesis in the fetal adrenal. - Highlights: • Prenatal caffeine ingestion inhibits steroid hormone production in the fetal adrenal. • Prenatal caffeine ingestion inhibits cholesterol uptake in the fetal adrenal. • Prenatal caffeine

Increased DNA methylation of scavenger receptor class B type I contributes to inhibitory effects of prenatal caffeine ingestion on cholesterol uptake and steroidogenesis in fetal adrenals

International Nuclear Information System (INIS)

Wu, Dong-Mei; He, Zheng; Ma, Liang-Peng; Wang, Lin-Long; Ping, Jie; Wang, Hui

2015-01-01

Steroid hormones synthesized from cholesterol in the fetal adrenal are crucial for fetal development. We have observed the inhibited fetal adrenal corticosterone synthesis and increased intrauterine growth retardation (IUGR) rate in rats under prenatal caffeine ingestion. The aim of this study is to evaluate the effects of prenatal caffeine ingestion on cholesterol supply in fetal adrenal steroidogenesis in rats and explore the underlying epigenetic mechanisms. Pregnant Wistar rats were treated with 60 mg/kg·d caffeine from gestational day (GD) 7 to GD17. Histological changes of fetal adrenals and increased IUGR rates were observed in the caffeine group. There were significantly decreased steroid hormone contents and cholesterol supply in caffeine-treated fetal adrenals. Data from the gene expression array suggested that prenatal caffeine ingestion caused increased expression of genes related to DNA methylation and decreased expression of genes related to cholesterol uptake. The following conjoint analysis of DNA methylation array with these differentially expressed genes suggested that scavenger receptor class B type I (SR-BI) may play an important role in caffeine-induced cholesterol supply deficiency. Moreover, real-time RT-PCR and immunohistochemical detection certified the inhibitory effects of caffeine on both mRNA expression and protein expression of SR-BI in the fetal adrenal. And the increased DNA methylation frequency in the proximal promoter of SR-BI was confirmed by bisulfite-sequencing PCR. In conclusion, prenatal caffeine ingestion can induce DNA hypermethylation of the SR-BI promoter in the rat fetal adrenal. These effects may lead to decreased SR-BI expression and cholesterol uptake, which inhibits steroidogenesis in the fetal adrenal. - Highlights: • Prenatal caffeine ingestion inhibits steroid hormone production in the fetal adrenal. • Prenatal caffeine ingestion inhibits cholesterol uptake in the fetal adrenal. • Prenatal caffeine

Analysis of MaACS2, a stress-inducible ACC Synthase Gene in Musa acuminata AAA Group Cultivar Pisang Ambon

Directory of Open Access Journals (Sweden)

Resnanti Utami Handayani

2014-07-01

Full Text Available Ethylene has an important function in plant growth and development. Ethylene production generally increases in response to pathogen attacks and other environmental stress conditions. The synthesis of this phytohormone is regulated by two enzymes, ACC synthase (ACS and ACC oxidase (ACO. ACC synthase is encoded by a multigene that regulates the production of ACC, after which this precursor is converted into ethylene by ACO. Pisang Ambon (Musa sp. AAA group, a banana cultivar originating from Indonesia, has nine ACS genes (MaACS 1-9 and one ACO gene (MaACO. One of the banana ACS genes, MaACS2, is stress-inducible. In this research, we have investigated the expression profile of MaACS2 in the roots and leaf tissues of infected tissue culture plants. Quantification of gene expression was analyzed using Real-Time PCR (qPCR using Ma18srRNA and MaGAPDH as reference genes. The results showed nine-to ten fold higher MaACS2 expression levels in the infected roots tissues compared to the uninfected roots tissues. However, MaACS2 expression in the leaves was only detected in infected tissue.

Parallel evolution of the glycogen synthase 1 (muscle) gene Gys1 between Old World and New World fruit bats (Order: Chiroptera).

Science.gov (United States)

Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi

2014-10-01

Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.

Performance effects and metabolic consequences of caffeine and caffeinated energy drink consumption on glucose disposal.

Science.gov (United States)

Shearer, Jane; Graham, Terry E

2014-10-01

This review documents two opposing effects of caffeine and caffeine-containing energy drinks, i.e., their positive effects on athletic performance and their negative impacts on glucose tolerance in the sedentary state. Analysis of studies examining caffeine administration prior to performance-based exercise showed caffeine improved completion time by 3.6%. Similar analyses following consumption of caffeine-containing energy drinks yielded positive, but more varied, benefits, which were likely due to the diverse nature of the studies performed, the highly variable composition of the beverages consumed, and the range of caffeine doses administered. Conversely, analyses of studies administering caffeine prior to either an oral glucose tolerance test or insulin clamp showed a decline in whole-body glucose disposal of ~30%. The consequences of this resistance are unknown, but there may be implications for the development of a number of chronic diseases. Both caffeine-induced performance enhancement and insulin resistance converge with the primary actions of caffeine on skeletal muscle. © 2014 International Life Sciences Institute.

Faster but not smarter: effects of caffeine and caffeine withdrawal on alertness and performance.

Science.gov (United States)

Rogers, Peter J; Heatherley, Susan V; Mullings, Emma L; Smith, Jessica E

2013-03-01

Despite 100 years of psychopharmacological research, the extent to which caffeine consumption benefits human functioning remains unclear. To measure the effects of overnight caffeine abstinence and caffeine administration as a function of level of habitual caffeine consumption. Medium-high (n = 212) and non-low (n = 157) caffeine consumers completed self-report measures and computer-based tasks before (starting at 10:30 AM) and after double-blind treatment with either caffeine (100 mg, then 150 mg) or placebo. The first treatment was given at 11:15 AM and the second at 12:45 PM, with post-treatment measures repeated twice between 1:45 PM and 3:30 PM. Caffeine withdrawal was associated with some detrimental effects at 10:30 AM, and more severe effects, including greater sleepiness, lower mental alertness, and poorer performance on simple reaction time, choice reaction time and recognition memory tasks, later in the afternoon. Caffeine improved these measures in medium-high consumers but, apart from decreasing sleepiness, had little effect on them in non-low consumers. The failure of caffeine to increase mental alertness and improve mental performance in non-low consumers was related to a substantial caffeine-induced increase in anxiety/jitteriness that offset the benefit of decreased sleepiness. Caffeine enhanced physical performance (faster tapping speed and faster simple and choice reaction times) in both medium-high and non-low consumers. While caffeine benefits motor performance and tolerance develops to its tendency to increase anxiety/jitteriness, tolerance to its effects on sleepiness means that frequent consumption fails to enhance mental alertness and mental performance.

Dispelling the myth that habitual caffeine consumption influences the performance response to acute caffeine supplementation.

Science.gov (United States)

Gonçalves, Lívia de Souza; Painelli, Vitor de Salles; Yamaguchi, Guilherme; Oliveira, Luana Farias de; Saunders, Bryan; da Silva, Rafael Pires; Maciel, Erika; Artioli, Guilherme Giannini; Roschel, Hamilton; Gualano, Bruno

2017-07-01

This study investigates the influence of habitual caffeine intake on aerobic exercise-performance responses to acute caffeine supplementation. A double-blind, crossover, counterbalanced study was performed. Forty male endurance-trained cyclists were allocated into tertiles, according to their daily caffeine intake: low (58 ± 29 mg/d), moderate (143 ± 25 mg/d), and high (351 ± 139 mg/d) consumers. Participants completed three trials in which they performed simulated cycling time trials (TTs) in the fastest time possible following ingestion of the following: caffeine (CAF: 6 mg/kg body mass), placebo (PLA), and no supplement (CON). A mixed-model analysis revealed that TT performance was significantly improved in CAF compared with PLA and CON (29.92 ± 2.18 vs. 30.81 ± 2.67 and 31.14 ± 2.71 min, respectively; P = 0.0002). Analysis of covariance revealed no influence of habitual caffeine intake as a covariate on exercise performance ( P = 0.47). TT performance was not significantly different among tertiles ( P = 0.75). No correlation was observed between habitual caffeine intake and absolute changes (CAF - CON) in TT performance with caffeine ( P = 0.524). Individual analysis showed that eight, seven, and five individuals improved above the variation of the test in CAF in the low, moderate, and high tertiles, respectively. A Fisher's exact test did not show any significant differences in the number of individuals who improved in CAF among the tertiles ( P > 0.05). Blood lactate and ratings of perceived exertion were not different between trials and tertiles ( P > 0.05). Performance effects of acute caffeine supplementation during an ~30-min cycling TT performance were not influenced by the level of habitual caffeine consumption. NEW & NOTEWORTHY There has been a long-standing paradigm that habitual caffeine intake may influence the ergogenicity of caffeine supplementation. Low, moderate, and high caffeine consumers showed similar absolute and

Differential accumulation of β-carotene and tissue specific expression of phytoene synthase (MaPsy) gene in banana (Musa sp) cultivars.

Science.gov (United States)

Dhandapani, R; Singh, V P; Arora, A; Bhattacharya, R C; Rajendran, Ambika

2017-12-01

An experiment was conducted with twelve major Indian banana cultivars to investigate the molecular relationship between the differential accumulation of β-carotene in peel and pulp of the banana fruit and carotenoid biosynthetic pathway genes. The high performance liquid chromatography showed that all banana cultivars accumulated two-three fold more β-carotene in non-edible portion of the banana fruit. However, Nendran , a famous orange fleshed cultivar of South India, had high β-carotene content (1362 µg/100 g) in edible pulp. The gene encoding Musa accuminata phytoene synthase ( MaPsy ) was successfully amplified using a pair of degenerate primers designed from Oncidium orchid. The deduced amino acid sequences shared a high level of identity to phytoene synthase gene from other plants. Gene expression analysis confirmed the presence of two isoforms ( MaPsy1 and MaPsy2 ) of MaPsy gene in banana fruits. Presence of two isoforms of MaPsy gene in peel and one in pulp confirmed the differential accumulation of β-carotene in banana fruits. However, Nendran accumulated more β-carotene in edible pulp due to presence of both the isoforms of MaPsy gene. Thus, carotenoid accumulation is a tissue specific process strongly dependent on differential expression pattern of two isoforms of MaPsy gene in banana.

Caffeine, extraversion and working memory.

Science.gov (United States)

Smith, Andrew P

2013-01-01

Research has shown that extraverts performing a working memory task benefit more from caffeine than do introverts. The present study aimed to replicate this and extend our knowledge by using a lower dose of caffeine (65 mg) and a range of tasks related to different components of working memory. In addition, tasks assessing psychomotor speed and the encoding of new information were included to determine whether caffeine-extraversion interactions were restricted to working memory tasks. A double-blind design was used, with 128 participants being randomly assigned to caffeinated or de-caffeinated coffee conditions. The results showed that caffeine interacted with extraversion in the predicted direction for serial recall and running memory tasks. Caffeine improved simple reaction time and the speed of encoding of new information, effects which were not modified by extraversion. These results suggest possible biological mechanisms underlying effects of caffeine on cognitive performance.

Caffeine, fatigue, and cognition

NARCIS (Netherlands)

Lorist, M.M.; Tops, M.

2003-01-01

Effects of caffeine and fatigue are discussed with special attention to adenosine-dopamine interactions. Effects of caffeine on human cognition are diverse. Behavioural measurements indicate a general improvement in the efficiency of information processing after caffeine, while the EEG data support

A Randomized, Two-Way Crossover Study to Evaluate the Pharmacokinetics of Caffeine Delivered Using Caffeinated Chewing Gum Versus a Marketed Caffeinated Beverage in Healthy Adult Volunteers.

Science.gov (United States)

Sadek, Paul; Pan, Xiao; Shepherd, Phil; Malandain, Elise; Carney, John; Coleman, Hugh

2017-12-01

Background: This study was conducted to compare the pharmacokinetics of caffeine delivered using caffeinated chewing gum to that delivered using a marketed caffeinated beverage (instant coffee) in 16 healthy adult volunteers. Materials and Methods: This was a controlled open-label, randomized, two-period crossover study. Caffeinated chewing gum and a serving of instant coffee, each containing ∼50 mg caffeine, were administered with blood samples collected before and up to 24 hours after administration starts. Plasma caffeine levels were analyzed using validated liquid chromatography coupled with tandem mass spectrometry methodology. Results: There were no statistical differences between the two caffeine products in t max ( p  = 0.3308) and k a ( p  = 0.3894). Although formulated at ∼50 mg caffeine each, mean dose released from chewing gum was ∼18% less than beverage. Dose-normalized area under the concentration-time curve (AUC) 0-t , AUC 0-∞ , and C max was similar between products. Although the criteria were not set a priori and the study was not powered for concluding bioequivalence, the 90% confidence intervals fell within the bioequivalence limit of 80% to 125%. Conclusions: Existing scientific literature on caffeine, based mostly on data from caffeinated beverages, can be leveraged to support the safety of caffeine delivered by chewing gum and current maximum safe caffeine dose advice should be applicable irrespective of delivery method.

Genetic polymorphism of the adenosine A2A receptor is associated with habitual caffeine consumption.

Science.gov (United States)

Cornelis, Marilyn C; El-Sohemy, Ahmed; Campos, Hannia

2007-07-01

Caffeine is the most widely consumed stimulant in the world, and individual differences in response to its stimulating effects may explain some of the variability in caffeine consumption within a population. We examined whether genetic variability in caffeine metabolism [cytochrome P450 1A2 (CYP1A2) -163A-->C] or the main target of caffeine action in the nervous system [adenosine A(2A) receptor (ADORA2A) 1083C-->T] is associated with habitual caffeine consumption. Subjects (n=2735) were participants from a study of gene-diet interactions and risk of myocardial infarction who did not have a history of hypertension. Genotype frequencies were examined among persons who were categorized according to their self-reported daily caffeine intake, as assessed with a validated food-frequency questionnaire. The ADORA2A, but not the CYP1A2, genotype was associated with different amounts of caffeine intake. Compared with persons consuming caffeine/d, the odds ratios for having the ADORA2A TT genotype were 0.74 (95% CI: 0.53, 1.03), 0.63 (95% CI: 0.48, 0.83), and 0.57 (95% CI: 0.42, 0.77) for those consuming 100-200, >200-400, and >400 mg caffeine/d, respectively. The association was more pronounced among current smokers than among nonsmokers (P for interaction = 0.07). Persons with the ADORA2A TT genotype also were significantly more likely to consume less caffeine (ie, caffeine consumption increases. This observation provides a biologic basis for caffeine consumption behavior and suggests that persons with this genotype may be less vulnerable to caffeine dependence.

Novel, Highly Specific N-Demethylases Enable Bacteria To Live on Caffeine and Related Purine Alkaloids

Science.gov (United States)

Summers, Ryan M.; Louie, Tai Man; Yu, Chi-Li; Gakhar, Lokesh; Louie, Kailin C.

2012-01-01

The molecular basis for the ability of bacteria to live on caffeine as a sole carbon and nitrogen source is unknown. Pseudomonas putida CBB5, which grows on several purine alkaloids, metabolizes caffeine and related methylxanthines via sequential N-demethylation to xanthine. Metabolism of caffeine by CBB5 was previously attributed to one broad-specificity methylxanthine N-demethylase composed of two subunits, NdmA and NdmB. Here, we report that NdmA and NdmB are actually two independent Rieske nonheme iron monooxygenases with N1- and N3-specific N-demethylation activity, respectively. Activity for both enzymes is dependent on electron transfer from NADH via a redox-center-dense Rieske reductase, NdmD. NdmD itself is a novel protein with one Rieske [2Fe-2S] cluster, one plant-type [2Fe-2S] cluster, and one flavin mononucleotide (FMN) per enzyme. All ndm genes are located in a 13.2-kb genomic DNA fragment which also contained a formaldehyde dehydrogenase. ndmA, ndmB, and ndmD were cloned as His6 fusion genes, expressed in Escherichia coli, and purified using a Ni-NTA column. NdmA-His6 plus His6-NdmD catalyzed N1-demethylation of caffeine, theophylline, paraxanthine, and 1-methylxanthine to theobromine, 3-methylxanthine, 7-methylxanthine, and xanthine, respectively. NdmB-His6 plus His6-NdmD catalyzed N3-demethylation of theobromine, 3-methylxanthine, caffeine, and theophylline to 7-methylxanthine, xanthine, paraxanthine, and 1-methylxanthine, respectively. One formaldehyde was produced from each methyl group removed. Activity of an N7-specific N-demethylase, NdmC, has been confirmed biochemically. This is the first report of bacterial N-demethylase genes that enable bacteria to live on caffeine. These genes represent a new class of Rieske oxygenases and have the potential to produce biofuels, animal feed, and pharmaceuticals from coffee and tea waste. PMID:22328667

Cognitive and psychomotor performance, mood, and pressor effects of caffeine after 4, 6 and 8 h caffeine abstinence.

Science.gov (United States)

Heatherley, Susan V; Hayward, Robert C; Seers, Helen E; Rogers, Peter J

2005-04-01

Many studies have found that caffeine consumed after overnight caffeine abstinence improves cognitive performance and mood. Much less is known, however, about the effects of caffeine after shorter periods of caffeine abstinence. The aim of this study was to measure the effects on psychomotor and cognitive performance, mood, hand steadiness, blood pressure and heart rate of caffeine administration after periods of 4, 6, and 8 h of caffeine abstinence. Participants (n = 49, 27 female) were moderate to moderate-high caffeine consumers (mean daily intake 370 mg/day). Following overnight caffeine abstinence, a 'pre-dose' of caffeine (1.2 mg/kg) was administered at 9 A.M, 11 A.M or 1 P.M. The participants started a baseline battery of measurements at 4 P.M.: before receiving caffeine (1.2 mg/kg) or placebo at 5 P.M.: They then performed the battery of tests again, starting at 5:30 P.M. This was a double-blind, placebo-controlled, randomised study. Performance and mood measurements confirmed a psychostimulant action of caffeine (versus placebo), but only after 8 h of caffeine abstinence. Caffeine also increased blood pressure after 8-h abstinence, whereas hand steadiness was decreased and perception of task demand was increased by caffeine after 4 h, but not after 6- and 8-h abstinence. A second cup-of-coffee equivalent dose of caffeine only reliably affected cognitive performance and mood after an 8-h interval between doses, but not after shorter intervals (when caffeine had some adverse effects). These results show that, apart from caffeine consumption soon after waking, the daily pattern of caffeine intake of many typical caffeine consumers is not well explained by the short-term psychostimulant effects of caffeine.

Effects of low doses of caffeine on cognitive performance, mood and thirst in low and higher caffeine consumers.

Science.gov (United States)

Smit, H J; Rogers, P J

2000-10-01

Caffeine is present in many widely consumed drinks and some foods. In the fairly extensive literature on the psychostimulant effects of caffeine, there are few dose-response studies and even fewer studies of the effects of doses of caffeine lower than 50 mg (the range of the amounts of caffeine contained in, for example, a typical serving of tea or cola). This study measured the effects of 0, 12.5, 25, 50 and 100 mg caffeine on cognitive performance, mood and thirst in adults with low and moderate to high habitual caffeine intakes. This was a double-blind, within-subjects study. Following overnight caffeine abstinence, participants (n=23) completed a test battery once before and three times after placebo or caffeine administration. The test battery consisted of two performance tests, a long duration simple reaction time task and a rapid visual information processing task, and a mood questionnaire (including also an item on thirst). Effects on performance and mood confirmed a psychostimulant action of caffeine. All doses of caffeine significantly affected cognitive performance, and the dose-response relationships for these effects were rather flat. The effects on performance were more marked in individuals with a higher level of habitual caffeine intake, whereas caffeine increased thirst only in low caffeine consumers. After overnight caffeine abstinence, caffeine can significantly affect cognitive performance, mood and thirst at doses within and even lower than the range of amounts of caffeine contained in a single serving of popular caffeine-containing drinks. Regular caffeine consumers appear to show substantial tolerance to the thirst-increasing but not to the performance and mood effects of caffeine.

Caffeine Confusion

Science.gov (United States)

... 20 mg* Milk chocolate 1 ounce 6 mg* Cocoa beverage 5 ounces 4 mg* Chocolate milk beverage 8 ounces 5 mg* Cold relief medication 1 tablet 30 mg* *This is an average amount of caffeine. That means some of these products may contain a little more caffeine; some may ...

Caffeine in the milk prevents respiratory disorders caused by in utero caffeine exposure in rats.

Science.gov (United States)

Bodineau, Laurence; Saadani-Makki, Fadoua; Jullien, Hugues; Frugière, Alain

2006-01-25

Consequences of postnatal caffeine exposure by the milk on ponto-medullary respiratory disturbances observed following an in utero caffeine exposure were analysed. Ponto-medullary-spinal cord preparations from newborn rats exposed to caffeine during gestation but not after the birth display an increase in respiratory frequency and an exaggeration of the hypoxic respiratory depression compared to not treated preparations. These data suggest that tachypneic and apneic episodes encountered in human newborns whose mother consumed caffeine during pregnancy are due in large part to central effect of caffeine at the ponto-medullary level. Both baseline respiratory frequency increase and emphasis of hypoxic respiratory depression are not encountered if rat dams consumed caffeine during nursing. Our hypothesis is that newborn rats exposed to caffeine during gestation but not after the birth would be in withdrawal situation whereas, when caffeine is present in drinking fluid of lactating dams, it goes down the milk and is able to prevent ponto-medullary respiratory disturbances.

Degradation of exogenous caffeine by Populus alba and its effects on endogenous caffeine metabolism.

Science.gov (United States)

Pierattini, Erika C; Francini, Alessandra; Raffaelli, Andrea; Sebastiani, Luca

2016-04-01

This is the first study reporting the presence of endogenous caffeine, theobromine, and theophylline in all organs of poplar plants. Liquid chromatography coupled with tandem mass spectrometry (LC-MS/MS) was used in order to evaluate the uptake, translocation, and metabolism of caffeine-(trimethyl-(13)C) in Populus alba L. Villafranca clone grown in hydroponic conditions. We investigated the remediation of caffeine since it is one of the most widely consumed drugs and it is frequently detected in wastewater treatment plant effluents, surface water, and groundwater worldwide. Our results demonstrated that poplar can absorb and degrade exogenous caffeine without negative effects on plant health. Data showed that concentrations of all endogenous compounds varied depending on caffeine-(trimethyl-(13)C) treatments. In particular, in control conditions, endogenous caffeine, theobromine, and theophylline were mainly distributed in roots. On the other hand, once caffeine-(trimethyl-(13)C) was provided, this compound and its dimethy-(13)C metabolites are mainly localized at leaf level. In conclusion, our results support the possible use of Villafranca clone in association with other water treatment systems in order to complete the process of caffeine remediation.

Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.

Directory of Open Access Journals (Sweden)

Dullat Harpreet K

2011-03-01

Full Text Available Abstract Background In conifers, terpene synthases (TPSs of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs and full-length cDNAs in several spruce (Picea species allowed us to estimate that a conifer genome contains at least 69 unique and transcriptionally active TPS genes. This number is comparable to the number of TPSs found in any of the sequenced and well-annotated angiosperm genomes. We functionally characterized a total of 21 spruce TPSs: 12 from Sitka spruce (P. sitchensis, 5 from white spruce (P. glauca, and 4 from hybrid white spruce (P. glauca × P. engelmannii, which included 15 monoterpene synthases, 4 sesquiterpene synthases, and 2 diterpene synthases. Conclusions The functional diversity of these characterized TPSs parallels the diversity of terpenoids found in the oleoresin and volatile emissions of Sitka spruce and provides a context for understanding this chemical diversity at the molecular and mechanistic levels. The comparative characterization of Sitka spruce and Norway spruce diterpene synthases revealed the natural occurrence of TPS sequence variants between closely related spruce species, confirming a previous prediction from site-directed mutagenesis and modelling.

Evaluating Dependence Criteria for Caffeine.

Science.gov (United States)

Striley, Catherine L W; Griffiths, Roland R; Cottler, Linda B

2011-12-01

Background: Although caffeine is the most widely used mood-altering drug in the world, few studies have operationalized and characterized Diagnostic and Statistical Manual IV (DSM-IV) substance dependence criteria applied to caffeine. Methods: As a part of a nosological study of substance use disorders funded by the National Institute on Drug Abuse, we assessed caffeine use and dependence symptoms among high school and college students, drug treatment patients, and pain clinic patients who reported caffeine use in the last 7 days and also reported use of alcohol, nicotine, or illicit drugs within the past year ( n =167). Results: Thirty-five percent met the criteria for dependence when all seven of the adopted DSM dependence criteria were used. Rates of endorsement of several of the most applicable diagnostic criteria were as follows: 26% withdrawal, 23% desire to cut down or control use, and 44% continued use despite harm. In addition, 34% endorsed craving, 26% said they needed caffeine to function, and 10% indicated that they talked to a physician or counselor about problems experienced with caffeine. There was a trend towards increased caffeine dependence among those dependent on nicotine or alcohol. Within a subgroup that had used caffeine, alcohol, and nicotine in the past year, 28% fulfilled criteria for caffeine dependence compared to 50% for alcohol and 80% for nicotine. Conclusion: The present study adds to a growing literature suggesting the reliability, validity, and clinical utility of the caffeine dependence diagnosis. Recognition of caffeine dependence in the DSM-V may be clinically useful.

Administration of Caffeine in Alternate Forms.

Science.gov (United States)

Wickham, Kate A; Spriet, Lawrence L

2018-03-01

There has been recent interest in the ergogenic effects of caffeine delivered in low doses (~ 200 mg or ~ 3 mg/kg body mass) and administered in forms other than capsules, coffee and sports drinks, including chewing gum, bars, gels, mouth rinses, energy drinks and aerosols. Caffeinated chewing gum is absorbed quicker through the buccal mucosa compared with capsule delivery and absorption in the gut, although total caffeine absorption over time is not different. Rapid absorption may be important in many sporting situations. Caffeinated chewing gum improved endurance cycling performance, and there is limited evidence that repeated sprint cycling and power production may also be improved. Mouth rinsing with caffeine may stimulate nerves with direct links to the brain, in addition to caffeine absorption in the mouth. However, caffeine mouth rinsing has not been shown to have significant effects on cognitive performance. Delivering caffeine with mouth rinsing improved short-duration, high-intensity, repeated sprinting in normal and depleted glycogen states, while the majority of the literature indicates no ergogenic effect on aerobic exercise performance, and resistance exercise has not been adequately studied. Studies with caffeinated energy drinks have generally not examined the individual effects of caffeine on performance, making conclusions about this form of caffeine delivery impossible. Caffeinated aerosol mouth and nasal sprays may stimulate nerves with direct brain connections and enter the blood via mucosal and pulmonary absorption, although little support exists for caffeine delivered in this manner. Overall, more research is needed examining alternate forms of caffeine delivery including direct measures of brain activation and entry of caffeine into the blood, as well as more studies examining trained athletes and female subjects.

Spectrophotometric Analysis of Caffeine

Directory of Open Access Journals (Sweden)

Showkat Ahmad Bhawani

2015-01-01

Full Text Available The nature of caffeine reveals that it is a bitter white crystalline alkaloid. It is a common ingredient in a variety of drinks (soft and energy drinks and is also used in combination with various medicines. In order to maintain the optimum level of caffeine, various spectrophotometric methods have been developed. The monitoring of caffeine is very important aspect because of its consumption in higher doses that can lead to various physiological disorders. This paper incorporates various spectrophotometric methods used in the analysis of caffeine in various environmental samples such as pharmaceuticals, soft and energy drinks, tea, and coffee. A range of spectrophotometric methodologies including chemometric techniques and derivatization of spectra have been used to analyse the caffeine.

Cloning and characterization of novel methylsalicylic acid synthase gene involved in the biosynthesis of isoasperlactone and asperlactone in Aspergillus westerdijkiae

International Nuclear Information System (INIS)

Bacha, N.; Dao, H.P.; Mathieu, F.; Liboz, T.; Lebrihi, A.; Atoui, A.; O'Callaghan, J.; Dobson, A.D.W.; Puel, O.

2008-01-01

Aspergillus westerdijkiae is the main producer of several biologically active polyketide metabolites including isoasperlactone and asperlactone. A 5298 bp polyketide synthase gene ''aomsas'' has been cloned in Aspergillus westerdijkiae by using gene walking approach and RACE-PCR. The predicted amino acid sequence of aomsas shows an identity of 40-56% with different methylsalicylic acid synthase genes found in Byssochlamys nivea, P. patulum, A. terreus and Streptomyces viridochromogenes. Based on the reverse transcription PCR and kinetic secondary metabolites production studies, aomsas expression was found to be associated with the biosynthesis of isoasperlactone and asperlactone. Moreover an aomsas knockout mutant ''aomsas'' of A. westerdijkiae, not only lost the capacity to produce isoasperlactone and asperlactone, but also 6-methylsalicylic acid. The genetically complemented mutant aomsas restored the biosynthesis of all the missing metabolites. Chemical complementation through the addition of 6-methylsalicylic acid, aspyrone and diepoxide to growing culture of aomsas mutant revealed that these compounds play intermediate roles in the biosynthesis of asperlactone and isoasperlactone. (author)

Cloning and characterization of the Yarrowia lipolytica squalene synthase (SQS1) gene and functional complementation of the Saccharomyces cerevisiae erg9 mutation

NARCIS (Netherlands)

Merkulov, S.; Assema, van F.; Springer, J.; Carmen, del A.F.; Mooibroek, H.

2000-01-01

The squalene synthase (SQS) gene encodes a key regulatory enzyme, farnesyl-diphosphate farnesyltransferase (EC 2.5.1.21), in sterol biosynthesis. The SQS1 gene was isolated from a subgenomic library of the industrially important yeast Yarrowia lipolytica, using PCR-generated probes. Probes were

Longitudinal bone growth is impaired by direct involvement of caffeine with chondrocyte differentiation in the growth plate.

Science.gov (United States)

Choi, Hyeonhae; Choi, Yuri; Kim, Jisook; Bae, Jaeman; Roh, Jaesook

2017-01-01

We showed previously that caffeine adversely affects longitudinal bone growth and disrupts the histomorphometry of the growth plate during the pubertal growth spurt. However, little attention has been paid to the direct effects of caffeine on chondrocytes. Here, we investigated the direct effects of caffeine on chondrocytes of the growth plate in vivo and in vitro using a rapidly growing young rat model, and determined whether they were related to the adenosine receptor signaling pathway. A total of 15 male rats (21 days old) were divided randomly into three groups: a control group and two groups fed caffeine via gavage with 120 and 180 mg kg -1  day -1 for 4 weeks. After sacrifice, the tibia processed for the analysis of the long bone growth and proliferation of chondrocytes using tetracycline and BrdU incorporation, respectively. Caffeine-fed animals showed decreases in matrix mineralization and proliferation rate of growth plate chondrocytes compared with the control. To evaluate whether caffeine directly affects chondrocyte proliferation and chondrogenic differentiation, primary rat chondrocytes were isolated from the growth plates and cultured in either the presence or absence of caffeine at concentrations of 0.1-1 mm, followed by determination of the cellular proliferation or expression profiles of cellular differentiation markers. Caffeine caused significant decreases in extracellular matrix production, mineralization, and alkaline phosphatase activity, accompanied with decreases in gene expression of the cartilage-specific matrix proteins such as aggrecan, type II collagen and type X. Our results clearly demonstrate that caffeine is capable of interfering with cartilage induction by directly inhibiting the synthetic activity and orderly expression of marker genes relevant to chondrocyte maturation. In addition, we found that the adenosine type 1 receptor signaling pathway may be partly involved in the detrimental effects of caffeine on chondrogenic

Salinivibrio costicola GL6, a Novel Isolated Strain for Biotransformation of Caffeine to Theobromine Under Hypersaline Conditions.

Science.gov (United States)

Ashengroph, Morahem

2017-01-01

The present study has been conducted towards isolation of moderately halophilic bacteria capable of transforming caffeine into theobromine. A total of 45 caffeine-degrading moderate halophiles were enriched from hypersaline lakes and examined for the biotransformation of caffeine to theobromine by thin-layer chromatography (TLC) and high-performance liquid chromatography analyses. Strain GL6, giving the highest yield of theobromine, was isolated from the Hoz Soltan Lake, 20 % w/v salinity, central Iran, and identified as Salinivibrio costicola based on morphological and biochemical features as well as its 16S rRNA gene sequence analysis (GeneBank Accession No. KT378066) and DNA-DNA relatedness. The biotransformation of caffeine with strain GL6 leads to the formation of two metabolites, identified as theobromine and paraxanthine, but the yield of paraxanthine was much lower. Further study on the production of theobromine from caffeine under resting cell experiment was carried out subsequently. The optimal yield of theobromine (56 %) was obtained after a 32-h incubation using 5 mM of caffeine and 15 g l -1 (wet weight) of biomass in 0.1 M saline phosphate buffer (pH 7.0 and 10 % w/v NaCl) under agitation 180 rpm at 30 °C. The biotransformed theobromine was purified by preparative TLC and subjected to FTIR and mass spectroscopy for chemical identification. This is the first evidence for biotransformation of caffeine into theobromine by strains of the genus Salinivibrio.

Radiation genetic studies in garden pea. Part 2. Caffeine potentiation and chromosome damage

International Nuclear Information System (INIS)

Kaul, M.L.H.

1979-01-01

The effect of 1.5x10 -2 M caffeine post-treatments over the chromosome damage induced by 4kR X-ray 1.5x10 -2 M Maleic hydrazide (MH) and N-Nitroso-N-urethane (NMU) treatments in the root top cells of a normal and trigenic leaf mutant of Pisum sativum was studied. While MH and NMU produced S-dependent effects, X-rays induced non-delayed S-independent effects. These effects got potentiated by caffeine treatments. With MH, the potentiation occurred when the cells got exposed to caffeine during S-phase and with X-rays, it occurred when the irradiated cells are treated in G 2 or prophase stage. The caffeine potentiation of chromosome damage produced by MH was similar in the roots exposed to caffeine at 16 and 31degC but with NMU, the potentiation was lower at 31 than at 16degC. If the inhibitory effect of caffeine on gap filling process of the damaged DNA is the molecular mechanism responsible for caffeine potentiation of reproductive death it may be the mechanism responsible for the observed chromosome damage in MH treated cells exposed to caffeine during G 1 and S phase. But the X-irradiated cells are insensitive to caffeine at such phases. In these cells caffeine probably acts as an inhibitor of the photoreactivating enzymes for binding sites or with the substrate in the irradiated cells post-treated during G 2 and prophase. However, temperature independence of caffeine potentiation is not compatible with eithr of the above two views. Compared to the normal genotype, the trigenic mutant exhibited an increased chromosomal damage, but not the potentiation. Probably mutant genes reduce the resistance of a genome against mutagenic action, consequently enhance the suseptibility to chromosome damage. (author)

Caffeine for asthma

OpenAIRE

Welsh, EJ; Bara, A; Barley, E; Cates, CJ

2010-01-01

Background\\ud \\ud Caffeine has a variety of pharmacological effects; it is a weak bronchodilator and it also reduces respiratory muscle fatigue. It is chemically related to the drug theophylline which is used to treat asthma. It has been suggested that caffeine may reduce asthma symptoms and interest has been expressed in its potential role as an asthma treatment. A number of studies have explored the effects of caffeine in asthma, this is the first review to systematically examine and summar...

Caffeine in Pregnancy

Science.gov (United States)

... Global Map Premature Birth Report Cards Careers Archives Pregnancy Before or between pregnancies Nutrition, weight & fitness Prenatal ... Nutrition, weight & fitness > Caffeine in pregnancy Caffeine in pregnancy E-mail to a friend Please fill in ...

Caffeine Use and Extroversion.

Science.gov (United States)

Landrum, R. Eric; Meliska, Charles J.

Some research on the stimulant effect of caffeine suggests that the amount of behavioral enhancement produced by caffeine may depend on subjects' prior experience with the task and the drug. A study was undertaken to test whether prior experience with a task while under the influence of caffeine would facilitate performance of that task. Male…

Detection of the enzymatically-active polyhydroxyalkanoate synthase subunit gene, phaC, in cyanobacteria via colony PCR.

Science.gov (United States)

Lane, Courtney E; Benton, Michael G

2015-12-01

A colony PCR-based assay was developed to rapidly determine if a cyanobacterium of interest contains the requisite genetic material, the PHA synthase PhaC subunit, to produce polyhydroxyalkanoates (PHAs). The test is both high throughput and robust, owing to an extensive sequence analysis of cyanobacteria PHA synthases. The assay uses a single detection primer set and a single reaction condition across multiple cyanobacteria strains to produce an easily detectable positive result - amplification via PCR as evidenced by a band in electrophoresis. In order to demonstrate the potential of the presence of phaC as an indicator of a cyanobacteria's PHA accumulation capabilities, the ability to produce PHA was assessed for five cyanobacteria with a traditional in vivo PHA granule staining using an oxazine dye. The confirmed in vivo staining results were then compared to the PCR-based assay results and found to be in agreement. The colony PCR assay was capable of successfully detecting the phaC gene in all six of the diverse cyanobacteria tested which possessed the gene, while exhibiting no undesired product formation across the nine total cyanobacteria strains tested. The colony PCR quick prep provides sufficient usable DNA template such that this assay could be readily expanded to assess multiple genes of interest simultaneously. Copyright © 2015 Elsevier Ltd. All rights reserved.

Homospermidine synthase, the first pathway-specific enzyme of pyrrolizidine alkaloid biosynthesis, evolved from deoxyhypusine synthase

Science.gov (United States)

Ober, Dietrich; Hartmann, Thomas

1999-01-01

Pyrrolizidine alkaloids are preformed plant defense compounds with sporadic phylogenetic distribution. They are thought to have evolved in response to the selective pressure of herbivory. The first pathway-specific intermediate of these alkaloids is the rare polyamine homospermidine, which is synthesized by homospermidine synthase (HSS). The HSS gene from Senecio vernalis was cloned and shown to be derived from the deoxyhypusine synthase (DHS) gene, which is highly conserved among all eukaryotes and archaebacteria. DHS catalyzes the first step in the activation of translation initiation factor 5A (eIF5A), which is essential for eukaryotic cell proliferation and which acts as a cofactor of the HIV-1 Rev regulatory protein. Sequence comparison provides direct evidence for the evolutionary recruitment of an essential gene of primary metabolism (DHS) for the origin of the committing step (HSS) in the biosynthesis of pyrrolizidine alkaloids. PMID:10611289

Caffeine: sleep and daytime sleepiness.

Science.gov (United States)

Roehrs, Timothy; Roth, Thomas

2008-04-01

Caffeine is one of the most widely consumed psychoactive substances and it has profound effects on sleep and wake function. Laboratory studies have documented its sleep-disruptive effects. It clearly enhances alertness and performance in studies with explicit sleep deprivation, restriction, or circadian sleep schedule reversals. But, under conditions of habitual sleep the evidence indicates that caffeine, rather then enhancing performance, is merely restoring performance degraded by sleepiness. The sleepiness and degraded function may be due to basal sleep insufficiency, circadian sleep schedule reversals, rebound sleepiness, and/or a withdrawal syndrome after the acute, over-night, caffeine discontinuation typical of most studies. Studies have shown that caffeine dependence develops at relatively low daily doses and after short periods of regular daily use. Large sample and population-based studies indicate that regular daily dietary caffeine intake is associated with disturbed sleep and associated daytime sleepiness. Further, children and adolescents, while reporting lower daily, weight-corrected caffeine intake, similarly experience sleep disturbance and daytime sleepiness associated with their caffeine use. The risks to sleep and alertness of regular caffeine use are greatly underestimated by both the general population and physicians.

The Janus face of caffeine.

Science.gov (United States)

Porciúncula, Lisiane O; Sallaberry, Cássia; Mioranzza, Sabrina; Botton, Paulo Henrique S; Rosemberg, Denis B

2013-11-01

Caffeine is certainly the psychostimulant substance most consumed worldwide. Over the past years, chronic consumption of caffeine has been associated with prevention of cognitive decline associated to aging and mnemonic deficits of brain disorders. While its preventive effects have been reported extensively, the cognitive enhancer properties of caffeine are relatively under debate. Surprisingly, there are scarce detailed ontogenetic studies focusing on neurochemical parameters related to the effects of caffeine during prenatal and earlier postnatal periods. Furthermore, despite the large number of epidemiological studies, it remains unclear how safe is caffeine consumption during pregnancy and brain development. Thus, the purpose of this article is to review what is currently known about the actions of caffeine intake on neurobehavioral and adenosinergic system during brain development. We also reviewed other neurochemical systems affected by caffeine, but not only during brain development. Besides, some recent epidemiological studies were also outlined with the control of "pregnancy signal" as confounding variable. The idea is to tease out how studies on the impact of caffeine consumption during brain development deserve more attention and further investigation. Copyright © 2013 Elsevier Ltd. All rights reserved.

Caffeine levels in beverages from Argentina's market: application to caffeine dietary intake assessment.

Science.gov (United States)

Olmos, V; Bardoni, N; Ridolfi, A S; Villaamil Lepori, E C

2009-03-01

The caffeine content of different beverages from Argentina's market was measured. Several brands of coffees, teas, mates, chocolate milks, soft and energy drinks were analysed by high-performance liquid chromatography (HPLC) with ultraviolet detection. The highest concentration level was found in short coffee (1.38 mg ml(-1)) and the highest amount per serving was found in instant coffee (95 mg per serving). A consumption study was also carried out among 471 people from 2 to 93 years of age to evaluate caffeine total dietary intake by age and to identify the sources of caffeine intake. The mean caffeine intake among adults was 288 mg day(-1) and mate was the main contributor to that intake. The mean caffeine intake among children of 10 years of age and under was 35 mg day(-1) and soft drinks were the major contributors to that intake. Children between 11 and 15 years old and teenagers (between 16 and 20 years) had caffeine mean intakes of 120 and 240 mg day(-1), respectively, and mate was the major contributor to those intakes. Drinking mate is a deep-rooted habit among Argentine people and it might be the reason for their elevated caffeine mean daily intake.

Clinical importance of caffeine dependence and abuse.

Science.gov (United States)

Ogawa, Naoshi; Ueki, Hirofumi

2007-06-01

Caffeine is the most widely consumed psychoactive substance and is a legal stimulant that is readily available to children. Caffeine has occasionally been considered a drug of abuse and the potential for dependence on caffeine has been debated. Presently, due to a paucity of clinical evidence on caffeine dependence or abuse, no such diagnosis is included in the Diagnostic and Statistical Manual of Mental Disorder-fourth edition. The authors present two cases of abuse or dependence on the caffeine contained in 'eutrophic' (energy/nutritional) beverages or caffeine preparations, followed by a review of clinical studies demonstrating evidence that some people can manifest a clinical syndrome of caffeine dependence or abuse. The cases suggest that caffeine can produce a clinical dependence syndrome similar to those produced by other psychoactive substances and has a potential for abuse. In a recent study using a structured interview and the Diagnostic and Statistical Manual of Mental Disorder-fourth edition criteria for substance dependence and abuse, a subset of the general population was found to demonstrate caffeine dependence or caffeine abuse. Therefore, the authors propose that companies or businesses manufacturing or marketing caffeine or products containing caffeine must meet the following guidelines: (i) clearly indicate the caffeine content of products containing comparatively higher quantities of caffeine; (ii) warn that such products should be avoided by infants and children wherever possible, and inform adult consumers about the precise quantity of caffeine that is considered safe for consumption; and (iii) clearly state that consuming large quantities of caffeine and the long-term use of caffeine carry health risks.

A Polyketide Synthase Encoded by the Gene An15g07920 Is Involved in the Biosynthesis of Ochratoxin A in Aspergillus niger.

Science.gov (United States)

Zhang, Jian; Zhu, Liuyang; Chen, Haoyu; Li, Min; Zhu, Xiaojuan; Gao, Qiang; Wang, Depei; Zhang, Ying

2016-12-28

The polyketide synthase gene An15g07920 was known in Aspergillus niger CBS 513.88 as putatively involved in the production of ochratoxin A (OTA). Genome resequencing analysis revealed that the gene An15g07920 is also present in the ochratoxin-producing A. niger strain 1062. Disruption of An15g07920 in A. niger 1062 removed its capacity to biosynthesize ochratoxin β (OTβ), ochratoxin α (OTα), and OTA. These results indicate that the polyketide synthase encoded by An15g07920 is a crucial player in the biosynthesis of OTA, in the pathway prior to the phenylalanine ligation step. The gene An15g07920 reached its maximum transcription level before OTA accumulation reached its highest level, confirming that gene transcription precedes OTA production. These findings will not only help explain the mechanism of OTA production in A. niger but also provide necessary information for the development of effective diagnostic, preventive, and control strategies to reduce the risk of OTA contamination in foods.

Amplification and diversity analysis of keto synthase domains of putative polyketide synthase genes in Aspergillus ochraceus and Aspergillus carbonarius producers of ochratoxin A

International Nuclear Information System (INIS)

Atoui, A.; Phong Dao, H.; Mathieu, F.; Lebrihi, A.

2006-01-01

The diversity of polyketide synthase (PKS) genes in Aspergillus ochraceus NRRL 3174 and Aspergil- lus carbonarius 2Mu134 has been investigated using different primer pairs previously developed for the ketosynthase (KS) domain of fungal PKSs. Nine different KS domain sequences in A. ochraceus NRRL 3174 as well as five different KS domain sequences in A. carbonarius 2Mu134 have been identified. The identified KS fragments were distributed in five different clusters on the phylogenetic tree, indicating that they most probably represent PKSs responsible for different functions. (author)

Compound list: caffeine [Open TG-GATEs

Lifescience Database Archive (English)

Full Text Available caffeine CAF 00097 ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Human/in_vitro/caffeine....Human.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vitro/caffeine....Rat.in_vitro.Liver.zip ftp://ftp.biosciencedbc.jp/archive/open-tggates/LATEST/Rat/in_vivo/Liver/Single/caffeine...-tggates/LATEST/Rat/in_vivo/Liver/Repeat/caffeine.Rat.in_vivo.Liver.Repeat.zip ftp://ftp.biosciencedbc.jp/ar...chive/open-tggates/LATEST/Rat/in_vivo/Kidney/Single/caffeine.Rat.in_vivo.Kidney.Single.zip ftp://ftp.bioscie

Identification and molecular characterization of the nicotianamine synthase gene family in bread wheat.

Science.gov (United States)

Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T

2016-12-01

Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

Deletion of a Chitin Synthase Gene in a Citric Acid Producing Strain of Aspergillus niger

Energy Technology Data Exchange (ETDEWEB)

Rinker, Torri E.; Baker, Scott E.

2007-01-29

Citric acid production by the filamentous fungus Aspergillus niger is carried out in a process that causes the organism to drastically alter its morphology. This altered morphology includes hyphal swelling and highly limited polar growth resulting in clumps of swollen cells that eventually aggregate into pellets of approximately 100 microns in diameter. In this pelleted form, A. niger has increased citric acid production as compared to growth in filamentous form. Chitin is a crucial component of the cell wall of filamentous fungi. Alterations in the deposition or production of chitin may have profound effects on the morphology of the organism. In order to study the role of chitin synthesis in pellet formation we have deleted a chitin synthase gene (csmA) in Aspergillus niger strain ATCC 11414 using a PCR based deletion construct. This class of chitin synthases is only found in filamentous fungi and is not present in yeasts. The csmA genes contain a myosin motor domain at the N-terminus and a chitin synthesis domain at the C-terminus. They are believed to contribute to the specialized polar growth observed in filamentous fungi that is lacking in yeasts. The csmA deletion strain (csmAΔ) was subjected to minimal media with and without osmotic stabilizers as well as tested in citric acid production media. Without osmotic stabilizers, the mutant germlings were abnormally swollen, primarily in the subapical regions, and contained large vacuoles. However, this swelling is ultimately not inhibitory to growth as the germlings are able to recover and undergo polar growth. Colony formation was largely unaffected in the absence of osmotic stabilizers. In citric acid production media csmAΔ was observed to have a 2.5 fold increase in citric acid production. The controlled expression of this class of chitin synthases may be useful for improving production of organic acids in filamentous fungi.

Endothelial nitric oxide synthase gene haplotypes and diabetic nephropathy among Asian Indians

DEFF Research Database (Denmark)

Ahluwalia, Tarun Veer Singh; Ahuja, Monica; Rai, Taranjit Singh

2008-01-01

of the constitutive endothelial nitric oxide synthase gene (eNOS) polymorphisms with type 2 diabetic nephropathy. We genotyped three polymorphisms of eNOS (Two SNPs: -786T > C, 894G > T and one 27-bp repeat polymorphism in Intron 4 (27VNTR)) in type 2 diabetic nephropathy patients (cases: n = 195) and type 2 diabetic...... without nephropathy (controls: n = 255), using validated PCR-RFLP assays. We measured serum NO levels in these subjects and examined its correlation with diabetic nephropathy and eNOS genotypes. The frequency of CC (-786T > C), TT (894G > T) and aa genotypes (27VNTR) were significantly higher in diabetic...

Genome-wide identification, classification and expression profiling of nicotianamine synthase (NAS) gene family in maize

OpenAIRE

Zhou, Xiaojin; Li, Suzhen; Zhao, Qianqian; Liu, Xiaoqing; Zhang, Shaojun; Sun, Cheng; Fan, Yunliu; Zhang, Chunyi; Chen, Rumei

2013-01-01

Background Nicotianamine (NA), a ubiquitous molecule in plants, is an important metal ion chelator and the main precursor for phytosiderophores biosynthesis. Considerable progress has been achieved in cloning and characterizing the functions of nicotianamine synthase (NAS) in plants including barley, Arabidopsis and rice. Maize is not only an important cereal crop, but also a model plant for genetics and evolutionary study. The genome sequencing of maize was completed, and many gene families ...

Overexpression of the homologous lanosterol synthase gene in ganoderic acid biosynthesis in Ganoderma lingzhi.

Science.gov (United States)

Zhang, De-Huai; Li, Na; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei

2017-02-01

Ganoderic acids (GAs) in Ganoderma lingzhi exhibit anticancer and antimetastatic activities. GA yields can be potentially improved by manipulating G. lingzhi through genetic engineering. In this study, a putative lanosterol synthase (LS) gene was cloned and overexpressed in G. lingzhi. Results showed that its overexpression (OE) increased the ganoderic acid (GA) content and the accumulation of lanosterol and ergosterol in a submerged G. lingzhi culture. The maximum contents of GA-O, GA-Mk, GA-T, GA-S, GA-Mf, and GA-Me in transgenic strains were 46.6 ± 4.8, 24.3 ± 3.5, 69.8 ± 8.2, 28.9 ± 1.4, 15.4 ± 1.2, and 26.7 ± 3.1 μg/100 mg dry weight, respectively, these values being 6.1-, 2.2-, 3.2-, 4.8-, 2.0-, and 1.9-times higher than those in wild-type strains. In addition, accumulated amounts of lanosterol and ergosterol in transgenic strains were 2.3 and 1.4-fold higher than those in the control strains, respectively. The transcription level of LS was also increased by more than five times in the presence of the G. lingzhi glyceraldehyde-3-phosphate dehydrogenase gene promoter, whereas transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A enzyme and squalene synthase did not change significantly in transgenic strains. This study demonstrated that OE of the homologous LS gene can enhance lanosterol accumulation. A large precursor supply promotes GA biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.

Consumption of caffeinated beverages and the awareness of their caffeine content among Dutch students

NARCIS (Netherlands)

Mackus, Marlou; van de Loo, Aurora J A E; Benson, Sarah; Scholey, Andrew; Verster, Joris C

2016-01-01

The purpose of the current study was to examine the knowledge of caffeine content of a variety of caffeinated beverages among Dutch university students. A pencil-and-paper survey was conducted among N = 800 Dutch students. Most participants (87.8%) reported consuming caffeinated beverages during the

Caffeine Content of Tea and Coffee

African Journals Online (AJOL)

1974-03-13

Mar 13, 1974 ... The xanthines (caffeine, theophylline, and theobromine) occur in plants widely distributed throughout the world. Best known for the preparation of beverages are coffee beans which contain caffeine, tea leaves which contain caffeine and theophylline, and cocoa seeds which contain caffeine and ...

Heritability of caffeine metabolism

DEFF Research Database (Denmark)

Matthaei, Johannes; Tzvetkov, Mladen V; Strube, Jakob

2016-01-01

Heritability of caffeine pharmacokinetics and CYP1A2 activity is controversial. Here we analyzed the pharmacokinetics of caffeine, an in vivo probe drug for CYP1A2 and arylamine N-acetyltransferase 2 (NAT2) activity, in monozygotic and dizygotic twins. In the entire group, common and unique...... environmental effects explained most variation in caffeine AUC. Apparently, smoking and hormonal contraceptives masked the genetic effects on CYP1A2 activity. However, when excluding smokers and users of hormonal contraceptives, 89% of caffeine AUC variation was due to genetic effects and even in the entire...... group, 8% of caffeine AUC variation could be explained by a CYP1A1/1A2 promotor polymorphism (rs2470893). In contrast, nearly all of the variation (99%) of NAT2 activity was explained by genetic effects. This study illustrates two very different situations in pharmacogenetics, from an almost exclusively...

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites.

Science.gov (United States)

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-10-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi'an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi'an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%-99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites.

Nitric oxide synthase, calcitonin gene-related peptide and NK-1 receptor mechanisms are involved in GTN-induced neuronal activation

DEFF Research Database (Denmark)

Ramachandran, Roshni; Bhatt, Deepak Kumar; Ploug, Kenneth Beri

2014-01-01

BACKGROUND AND AIM: Infusion of glyceryltrinitrate (GTN), a nitric oxide (NO) donor, in awake, freely moving rats closely mimics a universally accepted human model of migraine and responds to sumatriptan treatment. Here we analyse the effect of nitric oxide synthase (NOS) and calcitonin gene-rela...

CORRELATION BETWEEN CAFFEINE CONTENTS OF GREEN ...

African Journals Online (AJOL)

KEY WORDS: Green coffee beans, Caffeine, Correlation between caffeine content and altitude of coffee plant,. UV-Vis .... The extraction of caffeine from green coffee bean samples in to water was carried out by the reported method ..... caffeine in proposed green tea standard reference materials by liquid chromatography.

Caffeine intake among adolescents in Delhi

Directory of Open Access Journals (Sweden)

Mridul Gera

2016-01-01

Full Text Available Background: Availability and advertising of caffeinated drinks is on the rise in Indian market. Excess caffeine intake may have deleterious effects on health. Objective: To estimate the daily consumption of caffeine among urban school-going adolescents from Delhi. Materials and Methods: A school-based survey was conducted to determine the amount and pattern of caffeine consumption among students of classes 9-12, using a self-administered questionnaire. Results: Of 300 participants (median age 15 year, 174 boys, 291 (97% were consuming caffeine [mean (SD: 121.0 (98.2 mg/day]. Nineteen (6% students were consuming more than 300 mg of caffeine per day. Tea/coffee contributed to more than 50% of the caffeine intake. The rest was derived from cola beverages, chocolates, and energy drinks. Conclusion: Average caffeine consumption among school-going adolescents from Delhi is high. The findings of this preliminary survey need to be confirmed in larger data sets.

Effects of caffeine on alcohol-related changes in behavioural control and perceived intoxication in light caffeine consumers.

Science.gov (United States)

Attwood, Angela S; Rogers, Peter J; Ataya, Alia F; Adams, Sally; Munafò, Marcus R

2012-06-01

Caffeinated alcoholic beverages have been associated with increased risk of alcohol-related harms. However, few studies have examined these combined effects on behavioural control, which is believed to underlie many of the negative effects of alcohol consumption. In addition, studies have often omitted subjective measures, and none have directly assessed the role of caffeine consumer history. To examine the combined effects of alcohol and caffeine on measures of behavioural control and perceived intoxication in abstinent, light caffeine consumers. Participants (n = 28; 50% male) attended four sessions at which they consumed one of the following beverages in a randomised order: placebo, alcohol alone (0.6 g/kg), caffeine alone (2.0 mg/kg), and alcohol/caffeine. They completed measures of mood, intoxication, anxiety and alcohol craving before and after a task battery comprising measures of behavioural control and reaction time performance. Caffeine attenuated alcohol-related performance deficits on stop-signal accuracy, had no effect on go-no-go performance deficits, and worsened accuracy on the Stroop task. Caffeine did not influence absolute changes in perceived intoxication but there was suggestion that caffeine may have changed the nature of intoxication with increases in stimulation. Caffeine appears to have mixed effects on alcohol intoxication that are task-dependent. We found increased stimulation in the alcohol/caffeine condition, supporting the contention that caffeinated alcoholic beverages enable an individual to drink for longer. Future research should model real world drinking behaviour by examining how these effects change across multiple drink administrations.

Caffeine withdrawal and high-intensity endurance cycling performance.

Science.gov (United States)

Irwin, Christopher; Desbrow, Ben; Ellis, Aleisha; O'Keeffe, Brooke; Grant, Gary; Leveritt, Michael

2011-03-01

In this study, we investigated the impact of a controlled 4-day caffeine withdrawal period on the effect of an acute caffeine dose on endurance exercise performance. Twelve well-trained and familiarized male cyclists, who were caffeine consumers (from coffee and a range of other sources), were recruited for the study. A double-blind placebo-controlled cross-over design was employed, involving four experimental trials. Participants abstained from dietary caffeine sources for 4 days before the trials and ingested capsules (one in the morning and one in the afternoon) containing either placebo or caffeine (1.5 mg · kg(-1) body weight · day(-1)). On day 5, capsules containing placebo or caffeine (3 mg · kg(-1) body weight) were ingested 90 min before completing a time trial, equivalent to one hour of cycling at 75% peak sustainable power output. Hence the study was designed to incorporate placebo-placebo, placebo-caffeine, caffeine-placebo, and caffeine-caffeine conditions. Performance time was significantly improved after acute caffeine ingestion by 1:49 ± 1:41 min (3.0%, P = 0.021) following a withdrawal period (placebo-placebo vs. placebo-caffeine), and by 2:07 ± 1:28 min (3.6%, P = 0.002) following the non-withdrawal period (caffeine-placebo vs. caffeine-caffeine). No significant difference was detected between the two acute caffeine trials (placebo-caffeine vs. caffeine-caffeine). Average heart rate throughout exercise was significantly higher following acute caffeine administration compared with placebo. No differences were observed in ratings of perceived exertion between trials. A 3 mg · kg(-1) dose of caffeine significantly improves exercise performance irrespective of whether a 4-day withdrawal period is imposed on habitual caffeine users.

Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013

OpenAIRE

Steven Steven; Yoni F Syukriani; Julius B Dewanto

2016-01-01

Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

Caffeine and 3-km cycling performance: Effects of mouth rinsing, genotype, and time of day.

Science.gov (United States)

Pataky, M W; Womack, C J; Saunders, M J; Goffe, J L; D'Lugos, A C; El-Sohemy, A; Luden, N D

2016-06-01

We assessed the efficacy of caffeine mouth rinsing on 3-km cycling performance and determined whether caffeine mouth rinsing affects performance gains influenced by the CYP1A2 polymorphism. Thirty-eight recreational cyclists completed four simulated 3-km time trials (TT). Subjects ingested either 6 mg/kg BW of caffeine or placebo 1 h prior to each TT. Additionally, 25 mL of 1.14% caffeine or placebo solution were mouth rinsed before each TT. The treatments were Placebo, caffeine Ingestion, caffeine Rinse and Ingestion+Rinse. Subjects were genotyped and classified as AA homozygotes or AC heterozygotes for the rs762551 polymorphism of the CYP1A2 gene involved in caffeine metabolism. Magnitude-based inferences were used to evaluate treatment differences in mean power output based on a predetermined meaningful treatment effect of 1.0%. AC heterozygotes (4.1%) and AA homozygotes (3.4%) benefited from Ingestion+Rinse, but only AC performed better with Ingestion (6.0%). Additionally, Rinse and Ingestion+Rinse elicited better performance relative to Placebo among subjects that performed prior to 10:00 h (Early) compared with after 10:00 h (Late). The present study provides additional evidence of genotype and time of day factors that affect the ergogenic value of caffeine intake that may allow for more personalized caffeine intake strategies to maximize performance. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Effects of smoking cues on caffeine urges in heavy smokers and caffeine consumers with and without schizophrenia.

Science.gov (United States)

Adolfo, Amy B; AhnAllen, Christopher G; Tidey, Jennifer W

2009-02-01

Cigarette smoking and caffeine use are established and problematic drug-use behaviors in people with schizophrenia. Associative links between drugs of abuse may occur but the relationship between caffeine use and cigarette smoking has received little attention in schizophrenia. In this cross-cue reactivity laboratory study, we examined the effects of neutral and smoking cues on craving for caffeinated beverages in participants with schizophrenia or schizoaffective disorder (SS; n=15) and non-psychiatric controls (CS; n=18) all of whom were heavy smokers and daily caffeine users. Participants were tested under non-abstinent and 5-hour abstinent conditions. SS tended to report greater daily levels of caffeine use than CS. Although this difference was not significant, that may be due to the small sample sizes as the size of this effect was large. Daily caffeine intake was significantly correlated with daily smoking rate in SS but not CS. A significant interaction between group and cue type after controlling for caffeine intake indicated that exposure to smoking cues increased urge for caffeinated beverages in SS but not CS. These results indicate support for associative connections between cigarette smoking cues and craving for caffeine in smokers with schizophrenia.

Caffeine dependence in combination with a family history of alcoholism as a predictor of continued use of caffeine during pregnancy.

Science.gov (United States)

Svikis, Dace S; Berger, Nathan; Haug, Nancy A; Griffiths, Roland R

2005-12-01

The purpose of the study was to examine whether caffeine dependence and a family history of alcoholism are associated with continued use of caffeine during pregnancy. Forty-four women seeking obstetrical care in an office-based practice completed questionnaires and provided saliva samples at three prenatal visits occurring 2-3, 3-4, and 7 months postconception. On visit 1, the patients received the physician's instructions to stop using caffeine. Structured interviews were used to assign a diagnosis of caffeine dependence (lifetime) and to identify family history of alcoholism. Outcome measures included self-reported levels of caffeine use and saliva caffeine levels at the three prenatal visits. Although most women eliminated or substantially reduced their caffeine consumption between pregnancy awareness and prenatal visit 1, those with a lifetime diagnosis of caffeine dependence and a family history of alcoholism had higher levels of caffeine use and lower rates of abstinence throughout pregnancy. Saliva caffeine levels confirmed these effects. Withdrawal symptoms, functional impairment, and craving were cited as reasons they failed to eliminate or cut back on caffeine use. Fifty percent of the women with both a lifetime diagnosis of caffeine dependence and a family history of alcoholism continued to use caffeine in amounts (>300 mg/day) greater than those considered safe during pregnancy, compared to none of the women without caffeine dependence and a family history of alcoholism. Women with a lifetime diagnosis of caffeine dependence and a family history of alcoholism also reported higher rates of past cigarette smoking and problematic alcohol use. Caffeine-dependent women with a family history of alcoholism were not able to follow their physician's advice to reduce or eliminate caffeine consumption during pregnancy, despite their wanting to do so. This subgroup may require more intensive intervention to ensure caffeine abstinence and may be at greater risk for

Multidrug resistance transporters Snq2p and Pdr5p mediate caffeine efflux in Saccharomyces cerevisiae.

Science.gov (United States)

Tsujimoto, Yoshiyuki; Shimizu, Yoshihiro; Otake, Kazuya; Nakamura, Tatsuya; Okada, Ryutaro; Miyazaki, Toshitaka; Watanabe, Kunihiko

2015-01-01

SNQ2 was identified as a caffeine-resistance gene by screening a genomic library of Saccharomyces cerevisiae in a multicopy vector YEp24. SNQ2 encodes an ATP-binding cassette transporter and is highly homologous to PDR5. Multicopy of PDR5 also conferred resistance to caffeine, while its resistance was smaller than that of SNQ2. Residual caffeine contents were analyzed after transiently exposing cells to caffeine. The ratios of caffeine contents were 21.3 ± 8.8% (YEp24-SNQ2) and 81.9 ± 8.7% (YEp24-PDR5) relative to control (YEp24, 100%). In addition, multicopies of SNQ2 or PDR5 conferred resistance to rhodamine 6G (R6G), which was widely used as a substrate for transport assay. R6G was exported by both transporters, and their efflux activities were inhibited by caffeine with half-maximal inhibitory concentrations of 5.3 ± 1.9 (YEp24-SNQ2) and 17.2 ± 9.6 mM (YEp24-PDR5). These results demonstrate that Snq2p is a more functional transporter of caffeine than Pdr5p in yeast cells.

21 CFR 182.1180 - Caffeine.

Science.gov (United States)

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Caffeine. 182.1180 Section 182.1180 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN....1180 Caffeine. (a) Product. Caffeine. (b) Tolerance. 0.02 percent. (c) Limitations, restrictions, or...

Does Caffeine Enhance Athletic Performance?

Directory of Open Access Journals (Sweden)

Marcou Juliana

2016-04-01

Conclusion: Caffeine consumption may enhance athletic endurance, based on strong evidence, but further research needs to be conducted. High caffeine doses than the optimal, 3-6 mg/kg, before exercise does not confer any additional improvement in athletic performance. Additional, higher caffeine doses may cause side effects in athletes.

The Cer-cqu gene cluster determines three key players in a β-diketone synthase polyketide pathway synthesizing aliphatics in epicuticular waxes.

Science.gov (United States)

Schneider, Lizette M; Adamski, Nikolai M; Christensen, Caspar Elo; Stuart, David B; Vautrin, Sonia; Hansson, Mats; Uauy, Cristobal; von Wettstein-Knowles, Penny

2016-03-09

Aliphatic compounds on plant surfaces, called epicuticular waxes, are the first line of defense against pathogens and pests, contribute to reducing water loss and determine other important phenotypes. Aliphatics can form crystals affecting light refraction, resulting in a color change and allowing identification of mutants in their synthesis or transport. The present study discloses three such Eceriferum (cer) genes in barley - Cer-c, Cer-q and Cer-u - known to be tightly linked and functioning in a biochemical pathway forming dominating amounts of β-diketone and hydroxy-β-diketones plus some esterified alkan-2-ols. These aliphatics are present in many Triticeae as well as dicotyledons such as Eucalyptus and Dianthus. Recently developed genomic resources and mapping populations in barley defined these genes to a small region on chromosome arm 2HS. Exploiting Cer-c and -u potential functions pinpointed five candidates, of which three were missing in apparent cer-cqu triple mutants. Sequencing more than 50 independent mutants for each gene confirmed their identification. Cer-c is a chalcone synthase-like polyketide synthase, designated diketone synthase (DKS), Cer-q is a lipase/carboxyl transferase and Cer-u is a P450 enzyme. All were highly expressed in pertinent leaf sheath tissue of wild type. A physical map revealed the order Cer-c, Cer-u, Cer-q with the flanking genes 101kb apart, confirming they are a gene cluster, Cer-cqu. Homology-based modeling suggests that many of the mutant alleles affect overall protein structure or specific active site residues. The rich diversity of identified mutations will facilitate future studies of three key enzymes involved in synthesis of plant apoplast waxes. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Gene-Environment Interaction in Parkinson's Disease

DEFF Research Database (Denmark)

Chuang, Yu-Hsuan; Lill, Christina M; Lee, Pei-Chen

2016-01-01

BACKGROUND AND PURPOSE: Drinking caffeinated coffee has been reported to provide protection against Parkinson's disease (PD). Caffeine is an adenosine A2A receptor (encoded by the gene ADORA2A) antagonist that increases dopaminergic neurotransmission and Cytochrome P450 1A2 (gene: CYP1A2...

Caffeine, mental health, and psychiatric disorders.

Science.gov (United States)

Lara, Diogo R

2010-01-01

Caffeine intake is so common that its pharmacological effects on the mind are undervalued. Since it is so readily available, individuals can adjust their own dose, time of administration and dose intervals of caffeine, according to the perceived benefits and side effects of each dose. This review focuses on human studies of caffeine in subjects with and without psychiatric disorders. Besides the possibility of mild drug dependence, caffeine may bring benefits that contribute to its widespread use. These benefits seem to be related to adaptation of mental energy to the context by increasing alertness, attention, and cognitive function (more evident in longer or more difficult tasks or situations of low arousal) and by elevating mood. Accordingly, moderate caffeine intake (caffeine can induce psychotic and manic symptoms, and more commonly, anxiety. Patients with panic disorder and performance social anxiety disorder seem to be particularly sensitive to the anxiogenic effects of caffeine, whereas preliminary data suggests that it may be effective for some patients with obsessive compulsive disorder (OCD). The threshold for the anxiogenic effect of caffeine is influenced by a polymorphism of the A2A receptor. In summary, caffeine can be regarded as a pharmacological tool to increase energy and effortful behavior in daily activities. More populational (cross-sectional and prospective) and experimental studies are necessary to establish the role of caffeine intake in psychiatric disorders, especially its putative efficacy on depressive mood and cognitive/attentional disorders.

Caffeine Toxicity Due to Supplement Use in Caffeine--Naïve Individual: A Cautionary Tale.

Science.gov (United States)

Lystrup, Robert M; Leggit, Jeffery C

2015-08-01

Thousands of military members self-medicate with dietary supplements containing unknown quantities of pharmacologically active compounds. These poorly regulated substances can cause real harm to the military population, especially when they contain stimulants such as caffeine. When taken regularly, caffeine has several performance-enhancing benefits. However, when used excessively or in vulnerable populations, caffeine can cause several unwanted side effects such as nervousness, sensory disturbances, insomnia, arrhythmia, excitability, inattentiveness, restlessness, mood changes, gastrointestinal disturbances, and even psychosis. Vulnerable patients include the caffeine-naïve, physiologically stressed, young, and mentally ill patients. One such case describes a caffeine-naïve service member who suffered an adverse reaction after taking an allegedly moderate dose of caffeine from a pill he obtained from a teammate. This case highlights the importance of supplement awareness among service members, increased provider vigilance, third party verification, and enhanced regulation on the approval and marketing of dietary supplements. Reprint & Copyright © 2015 Association of Military Surgeons of the U.S.

Seasonal influence on gene expression of monoterpene synthases in Salvia officinalis (Lamiaceae).

Science.gov (United States)

Grausgruber-Gröger, Sabine; Schmiderer, Corinna; Steinborn, Ralf; Novak, Johannes

2012-03-01

Garden sage (Salvia officinalis L., Lamiaceae) is one of the most important medicinal and aromatic plants and possesses antioxidant, antimicrobial, spasmolytic, astringent, antihidrotic and specific sensorial properties. The essential oil of the plant, formed mainly in very young leaves, is in part responsible for these activities. It is mainly composed of the monoterpenes 1,8-cineole, α- and β-thujone and camphor synthesized by the 1,8-cineole synthase, the (+)-sabinene synthase and the (+)-bornyl diphosphate synthase, respectively, and is produced and stored in epidermal glands. In this study, the seasonal influence on the formation of the main monoterpenes in young, still expanding leaves of field-grown sage plants was studied in two cultivars at the level of mRNA expression, analyzed by qRT-PCR, and at the level of end-products, analyzed by gas chromatography. All monoterpene synthases and monoterpenes were significantly influenced by cultivar and season. 1,8-Cineole synthase and its end product 1,8-cineole remained constant until August and then decreased slightly. The thujones increased steadily during the vegetative period. The transcript level of their corresponding terpene synthase, however, showed its maximum in the middle of the vegetative period and declined afterwards. Camphor remained constant until August and then declined, exactly correlated with the mRNA level of the corresponding terpene synthase. In summary, terpene synthase mRNA expression and respective end product levels were concordant in the case of 1,8-cineole (r=0.51 and 0.67 for the two cultivars, respectively; p<0.05) and camphor (r=0.75 and 0.82; p<0.05) indicating basically transcriptional control, but discordant for α-/β-thujone (r=-0.05 and 0.42; p=0.87 and 0.13, respectively). Copyright © 2011 Elsevier GmbH. All rights reserved.

Cloning and sequence analysis of sucrose phosphate synthase gene from varieties of Pennisetum species.

Science.gov (United States)

Li, H C; Lu, H B; Yang, F Y; Liu, S J; Bai, C J; Zhang, Y W

2015-03-31

Sucrose phosphate synthase (SPS) is an enzyme used by higher plants for sucrose synthesis. In this study, three primer sets were designed on the basis of known SPS sequences from maize (GenBank: NM_001112224.1) and sugarcane (GenBank: JN584485.1), and five novel SPS genes were identified by RT-PCR from the genomes of Pennisetum spp (the hybrid P. americanum x P. purpureum, P. purpureum Schum., P. purpureum Schum. cv. Red, P. purpureum Schum. cv. Taiwan, and P. purpureum Schum. cv. Mott). The cloned sequences showed 99.9% identity and 80-88% similarity to the SPS sequences of other plants. The SPS gene of hybrid Pennisetum had one nucleotide and four amino acid polymorphisms compared to the other four germplasms, and cluster analysis was performed to assess genetic diversity in this species. Additional characterization of the SPS gene product can potentially allow Pennisetum to be exploited as a biofuel source.

Molecular cloning and expression of Chimonanthus praecox farnesyl pyrophosphate synthase gene and its possible involvement in the biosynthesis of floral volatile sesquiterpenoids.

Science.gov (United States)

Xiang, Lin; Zhao, Kaige; Chen, Longqing

2010-01-01

Farnesyl pyrophosphate (FPP) synthase catalyzes the biosynthesis of FPP, which is the precursors of sesquiterpenoids such as floral scent volatiles, from isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP). cDNA encoding wintersweet (Chimonanthus praecox L.) FPP synthase was isolated by the RT-PCR and RACE methods. The deduced amino acid sequence showed a high identity to plant FPP synthases. Expression of the gene in Escherichia coli yielded FPPS activity that catalyzed the synthesis of FPP as a main product. Tissue-specific and developmental analyses of the mRNA levels of CpFPPS and volatile sesquiterpenoids levels in C. praecox flowers revealed that the FPPS may play a regulatory role in floral volatile sesquiterpenoids of wintersweet. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

Cloning and sequence analysis of chitin synthase gene fragments of Demodex mites*

Science.gov (United States)

Zhao, Ya-e; Wang, Zheng-hang; Xu, Yang; Xu, Ji-ru; Liu, Wen-yan; Wei, Meng; Wang, Chu-ying

2012-01-01

To our knowledge, few reports on Demodex studied at the molecular level are available at present. In this study our group, for the first time, cloned, sequenced and analyzed the chitin synthase (CHS) gene fragments of Demodex folliculorum, Demodex brevis, and Demodex canis (three isolates from each species) from Xi’an China, by designing specific primers based on the only partial sequence of the CHS gene of D. canis from Japan, retrieved from GenBank. Results show that amplification was successful only in three D. canis isolates and one D. brevis isolate out of the nine Demodex isolates. The obtained fragments were sequenced to be 339 bp for D. canis and 338 bp for D. brevis. The CHS gene sequence similarities between the three Xi’an D. canis isolates and one Japanese D. canis isolate ranged from 99.7% to 100.0%, and those between four D. canis isolates and one D. brevis isolate were 99.1%–99.4%. Phylogenetic trees based on maximum parsimony (MP) and maximum likelihood (ML) methods shared the same clusters, according with the traditional classification. Two open reading frames (ORFs) were identified in each CHS gene sequenced, and their corresponding amino acid sequences were located at the catalytic domain. The relatively conserved sequences could be deduced to be a CHS class A gene, which is associated with chitin synthesis in the integument of Demodex mites. PMID:23024043

Caffeine metabolites not caffeine protect against riboflavin photosensitized oxidative damage related to skin and eye health

DEFF Research Database (Denmark)

Scurachio, R. S.; Mattiucci, F.; Santos, W. G.

2016-01-01

. Caffeine metabolites rather than caffeine seem accordingly important for the observed protective effect against cutaneous melanoma identified for drinkers of regular but not of decaffeinated coffee. The caffeine metabolites, but not caffeine, were by time resolved single photon counting found to quench...... singlet excited riboflavin through exothermic formation of ground-state precursor complexes indicating importance of hydrogen bounding through keto-enol tautomer's for protection of oxidizable substrates and sensitive structures against riboflavin photosensitization....

The polyketide synthase gene pks4 is essential for sexual development and regulates fruiting body morphology in Sordaria macrospora.

Science.gov (United States)

Schindler, Daniel; Nowrousian, Minou

2014-07-01

Filamentous ascomycetes have long been known as producers of a variety of secondary metabolites, many of which have toxic effects on other organisms. However, the role of these metabolites in the biology of the fungi that produce them remains in most cases enigmatic. A major group of fungal secondary metabolites are polyketides. They are chemically diverse, but have in common that their chemical scaffolds are synthesized by polyketide synthases (PKSs). In a previous study, we analyzed development-dependent expression of pks genes in the filamentous ascomycete Sordaria macrospora. Here, we show that a deletion mutant of the pks4 gene is sterile, producing only protoperithecia but no mature perithecia, whereas overexpression of pks4 leads to enlarged, malformed fruiting bodies. Thus, correct expression levels of pks4 are essential for wild type-like perithecia formation. The predicted PKS4 protein has a domain structure that is similar to homologs in other fungi, but conserved residues of a methyl transferase domain present in other fungi are mutated in PKS4. Expression of several developmental genes is misregulated in the pks4 mutant. Surprisingly, the development-associated app gene is not downregulated in the mutant, in contrast to all other previously studied mutants with a block at the protoperithecial stage. Our data show that the polyketide synthase gene pks4 is essential for sexual development and plays a role in regulating fruiting body morphology. Copyright © 2014 Elsevier Inc. All rights reserved.

Characterization of individuals seeking treatment for caffeine dependence.

Science.gov (United States)

Juliano, Laura M; Evatt, Daniel P; Richards, Brian D; Griffiths, Roland R

2012-12-01

Previous investigations have identified individuals who meet criteria for Diagnostic and Statistical Manual of Mental Disorders (4th ed., text rev.; DSM-IV-TR; American Psychiatric Association, 2000) substance dependence as applied to caffeine, but there is little research on treatments for caffeine dependence. This study aimed to thoroughly characterize individuals who are seeking treatment for problematic caffeine use. Ninety-four individuals who identified as being psychologically or physically dependent on caffeine, or who had tried unsuccessfully to modify caffeine consumption participated in a face-to-face diagnostic clinical interview. They also completed measures concerning caffeine use and quitting history, reasons for seeking treatment, and standardized self-report measures of psychological functioning. Caffeine treatment seekers (mean age 41 years, 55% women) consumed an average of 548 mg caffeine per day. The primary source of caffeine was coffee for 50% of the sample and soft drinks for 37%. Eighty-eight percent reported prior serious attempts to modify caffeine use (mean 2.7 prior attempts), and 43% reported being advised by a medical professional to reduce or eliminate caffeine. Ninety-three percent met criteria for caffeine dependence when generic DSM-IV-TR substance dependence criteria were applied to caffeine use. The most commonly endorsed criteria were withdrawal (96%), persistent desire or unsuccessful efforts to control use (89%), and use despite knowledge of physical or psychological problems caused by caffeine (87%). The most common reasons for wanting to modify caffeine use were health-related (59%) and not wanting to be dependent on caffeine (35%). This investigation reveals that there are individuals with problematic caffeine use who are seeking treatment and suggests that there is a need for effective caffeine dependence treatments. 2013 APA, all rights reserved

Caffeine and cardiovascular health.

Science.gov (United States)

Turnbull, Duncan; Rodricks, Joseph V; Mariano, Gregory F; Chowdhury, Farah

2017-10-01

This report evaluates the scientific literature on caffeine with respect to potential cardiovascular outcomes, specifically relative risks of total cardiovascular disease (CVD), coronary heart disease (CHD) and acute myocardial infarction (AMI), effects on arrhythmia, heart failure, sudden cardiac arrest, stroke, blood pressure, hypertension, and other biomarkers of effect, including heart rate, cerebral blood flow, cardiac output, plasma homocysteine levels, serum cholesterol levels, electrocardiogram (EKG) parameters, heart rate variability, endothelial/platelet function and plasma/urine catecholamine levels. Caffeine intake has been associated with a range of reversible and transient physiological effects broadly and cardiovascular effects specifically. This report attempts to understand where the delineations exist in caffeine intake and corresponding cardiovascular effects among various subpopulations. The available literature suggests that cardiovascular effects experienced by caffeine consumers at levels up to 600 mg/day are in most cases mild, transient, and reversible, with no lasting adverse effect. The point at which caffeine intake may cause harm to the cardiovascular system is not readily identifiable in part because data on the effects of daily intakes greater than 600 mg is limited. However, the evidence considered within this review suggests that typical moderate caffeine intake is not associated with increased risks of total cardiovascular disease; arrhythmia; heart failure; blood pressure changes among regular coffee drinkers; or hypertension in baseline populations. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Coffee, caffeine, and sleep: A systematic review of epidemiological studies and randomized controlled trials.

Science.gov (United States)

Clark, Ian; Landolt, Hans Peter

2017-02-01

Caffeine is the most widely consumed psychoactive substance in the world. It is readily available in coffee and other foods and beverages, and is used to mitigate sleepiness, enhance performance, and treat apnea in premature infants. This review systematically explores evidence from epidemiological studies and randomized controlled trials as to whether coffee and caffeine have deleterious effects on sleep. Caffeine typically prolonged sleep latency, reduced total sleep time and sleep efficiency, and worsened perceived sleep quality. Slow-wave sleep and electroencephalographic (EEG) slow-wave activity were typically reduced, whereas stage-1, wakefulness, and arousals were increased. Dose- and timing-response relationships were established. The sleep of older adults may be more sensitive to caffeine compared to younger adults. Pronounced individual differences are also present in young people, and genetic studies isolated functional polymorphisms of genes implicated in adenosine neurotransmission and metabolism contributing to individual sensitivity to sleep disruption by caffeine. Most studies were conducted in male adults of Western countries, which limits the generalizability of the findings. Given the importance of good sleep for general health and functioning, longitudinal investigations aimed at establishing possible causal relationships among coffee- and caffeine-induced changes in sleep quality and health development are warranted. Copyright © 2016 Elsevier Ltd. All rights reserved.

Chronic ingestion of a low dose of caffeine induces tolerance to the performance benefits of caffeine.

Science.gov (United States)

Beaumont, Ross; Cordery, Philip; Funnell, Mark; Mears, Stephen; James, Lewis; Watson, Phillip

2017-10-01

This study examined effects of 4 weeks of caffeine supplementation on endurance performance. Eighteen low-habitual caffeine consumers (caffeine (1.5-3.0 mg · kg -1 day -1 ; titrated) or placebo for 28 days. Groups were matched for age, body mass, V̇O 2peak and W max (P > 0.05). Before supplementation, all participants completed one V̇O 2peak test, one practice trial and 2 experimental trials (acute 3 mg · kg -1 caffeine [precaf] and placebo [testpla]). During the supplementation period a second V̇O 2peak test was completed on day 21 before a final, acute 3 mg · kg -1 caffeine trial (postcaf) on day 29. Trials consisted of 60 min cycle exercise at 60% V̇O 2peak followed by a 30 min performance task. All participants produced more external work during the precaf trial than testpla, with increases in the caffeine (383.3 ± 75 kJ vs. 344.9 ± 80.3 kJ; Cohen's d effect size [ES] = 0.49; P = 0.001) and placebo (354.5 ± 55.2 kJ vs. 333.1 ± 56.4 kJ; ES = 0.38; P = 0.004) supplementation group, respectively. This performance benefit was no longer apparent after 4 weeks of caffeine supplementation (precaf: 383.3 ± 75.0 kJ vs. postcaf: 358.0 ± 89.8 kJ; ES = 0.31; P = 0.025), but was retained in the placebo group (precaf: 354.5 ± 55.2 kJ vs. postcaf: 351.8 ± 49.4 kJ; ES = 0.05; P > 0.05). Circulating caffeine, hormonal concentrations and substrate oxidation did not differ between groups (all P > 0.05). Chronic ingestion of a low dose of caffeine develops tolerance in low-caffeine consumers. Therefore, individuals with low-habitual intakes should refrain from chronic caffeine supplementation to maximise performance benefits from acute caffeine ingestion.

Identification, functional characterization and developmental regulation of sesquiterpene synthases from sunflower capitate glandular trichomes

Directory of Open Access Journals (Sweden)

Ro Dae-Kyun

2009-07-01

Full Text Available Abstract Background Sesquiterpene lactones are characteristic metabolites of Asteraceae (or Compositae which often display potent bioactivities and are sequestered in specialized organs such as laticifers, resin ducts, and trichomes. For characterization of sunflower sesquiterpene synthases we employed a simple method to isolate pure trichomes from anther appendages which facilitated the identification of these genes and investigation of their enzymatic functions and expression patterns during trichome development. Results Glandular trichomes of sunflower (Helianthus annuus L. were isolated, and their RNA was extracted to investigate the initial steps of sesquiterpene lactone biosynthesis. Reverse transcription-PCR experiments led to the identification of three sesquiterpene synthases. By combination of in vitro and in vivo characterization of sesquiterpene synthase gene products in Escherichia coli and Saccharomyces cerevisiae, respectively, two enzymes were identified as germacrene A synthases, the key enzymes of sesquiterpene lactone biosynthesis. Due to the very low in vitro activity, the third enzyme was expressed in vivo in yeast as a thioredoxin-fusion protein for functional characterization. In in vivo assays, it was identified as a multiproduct enzyme with the volatile sesquiterpene hydrocarbon δ-cadinene as one of the two main products with α-muuorlene, β-caryophyllene, α-humulene and α-copaene as minor products. The second main compound remained unidentified. For expression studies, glandular trichomes from the anther appendages of sunflower florets were isolated in particular developmental stages from the pre- to the post-secretory phase. All three sesquiterpene synthases were solely upregulated during the biosynthetically active stages of the trichomes. Expression in different aerial plant parts coincided with occurrence and maturity of trichomes. Young roots with root hairs showed expression of the sesquiterpene synthase genes

Caffeine tolerance: behavioral, electrophysiological and neurochemical evidence

International Nuclear Information System (INIS)

Chou, D.T.; Khan, S.; Forde, J.; Hirsh, K.R.

1985-01-01

The development of tolerance to the stimulatory action of caffeine upon mesencephalic reticular neurons and upon spontaneous locomotor activity was evaluated in rats after two weeks of chronic exposure to low doses of caffeine (5-10 mg/kg/day via their drinking water). These doses are achievable through dietary intake of caffeine-containing beverages in man. Concomitant measurement of [ 3 H]-CHA binding in the mesencephalic reticular formation was also carried out in order to explore the neurochemical basis of the development of tolerance. Caffeine, 2.5 mg/kg i.v., markedly increased the firing rate of reticular neurons in caffeine naive rats but failed to modify the neuronal activity in a group exposed chronically to low doses of caffeine. In addition, in spontaneous locomotor activity studies, the data show a distinct shift to the right of the caffeine dose-response curve in caffeine pretreated rats. These results clearly indicate that tolerance develops to the stimulatory action of caffeine upon the reticular formation at the single neuronal activity level as well as upon spontaneous locomotor activity. Furthermore, in chronically caffeine exposed rats, an increase in the number of binding sites for [ 3 H]-CHA was observed in reticular formation membranes without any change in receptor affinity. 28 references, 4 figures

Caffeine Consumption Among Naval Aviation Candidates.

Science.gov (United States)

Sather, Thomas E; Williams, Ronald D; Delorey, Donald R; Woolsey, Conrad L

2017-04-01

Education frequently dictates students need to study for prolonged periods of time to adequately prepare for examinations. This is especially true with aviation preflight indoctrination (API) candidates who have to assimilate large volumes of information in a limited amount of time during API training. The purpose of this study was to assess caffeine consumption patterns (frequency, type, and volume) among naval aviation candidates attending API to determine the most frequently consumed caffeinated beverage and to examine if the consumption of a nonenergy drink caffeinated beverage was related to energy drink consumption. Data were collected by means of an anonymous 44-item survey administered and completed by 302 students enrolled in API at Naval Air Station Pensacola, FL. Results indicated the most frequently consumed caffeinated beverage consumed by API students was coffee (86.4%), with daily coffee consumption being approximately 28% and the most frequent pattern of consumption being 2 cups per day (85%). The least frequently consumed caffeinated beverages reported were energy drinks (52%) and energy shots (29.1%). The present study also found that the consumption patterns (weekly and daily) of caffeinated beverages (coffee and cola) were positively correlated to energy drink consumption patterns. Naval aviation candidates' consumption of caffeinated beverages is comparable to other college and high school cohorts. This study found that coffee and colas were the beverages of choice, with energy drinks and energy shots being the least frequently reported caffeinated beverages used. Additionally, a relationship between the consumption of caffeinated beverages and energy drinks was identified.Sather TE, Williams RD, Delorey DR, Woolsey CL. Caffeine consumption among naval aviation candidates. Aerosp Med Hum Perform. 2017; 88(4):399-405.

Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean

OpenAIRE

Good, Laura Lee

2001-01-01

The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...

An (E,E)-a-farnesene synthase gene of soybean has a role in defense against nematodes and is involved in synthesizing insect-induced volatiles

Science.gov (United States)

Plant terpene synthase genes (TPSs) have roles in diverse biological processes. Here we report the functional characterization of one member of the soybean TP S gene family, which was designated GmAFS. Recombinant GmAFS produced in E.coli catalyzed the formation of a sesquiterpene (E,E)-a-farnesene....

Caffeine promotes wakefulness via dopamine signaling in Drosophila

Science.gov (United States)

Nall, Aleksandra H.; Shakhmantsir, Iryna; Cichewicz, Karol; Birman, Serge; Hirsh, Jay; Sehgal, Amita

2016-01-01

Caffeine is the most widely-consumed psychoactive drug in the world, but our understanding of how caffeine affects our brains is relatively incomplete. Most studies focus on effects of caffeine on adenosine receptors, but there is evidence for other, more complex mechanisms. In the fruit fly Drosophila melanogaster, which shows a robust diurnal pattern of sleep/wake activity, caffeine reduces nighttime sleep behavior independently of the one known adenosine receptor. Here, we show that dopamine is required for the wake-promoting effect of caffeine in the fly, and that caffeine likely acts presynaptically to increase dopamine signaling. We identify a cluster of neurons, the paired anterior medial (PAM) cluster of dopaminergic neurons, as the ones relevant for the caffeine response. PAM neurons show increased activity following caffeine administration, and promote wake when activated. Also, inhibition of these neurons abrogates sleep suppression by caffeine. While previous studies have focused on adenosine-receptor mediated mechanisms for caffeine action, we have identified a role for dopaminergic neurons in the arousal-promoting effect of caffeine. PMID:26868675

Effects of mutations in Pneumocystis carinii dihydropteroate synthase gene on outcome of AIDS-associated P. carinii pneumonia

DEFF Research Database (Denmark)

Helweg-Larsen, J; Benfield, Thomas; Eugen-Olsen, J

1999-01-01

Sulpha drugs are widely used for the treatment and long-term prophylaxis of Pneumocystis carinii pneumonia (PCP) in HIV-1-infected individuals. Sulpha resistance in many microorganisms is caused by point mutations in dihydropteroate synthase (DHPS), an enzyme that is essential for folate biosynth...... biosynthesis. We assessed whether mutations in the DHPS gene of P. carinii were associated with exposure to sulpha drugs and influenced outcome from PCP....

Caffeine as a Gelator

Directory of Open Access Journals (Sweden)

Nonappa

2016-03-01

Full Text Available Caffeine (a stimulant and ethanol (a depressant may have opposite effects in our body, but under in vitro conditions they can “gel” together. Caffeine, being one of the widely used stimulants, continued to surprise the scientific community with its unprecedented biological, medicinal and physicochemical properties. Here, we disclose the supramolecular self-assembly of anhydrous caffeine in a series of alcoholic and aromatic solvents, rendering a highly entangled microcrystalline network facilitating the encapsulation of the solvents as illustrated using direct imaging, microscopy analysis and NMR studies.

The Safety of Ingested Caffeine: A Comprehensive Review

Directory of Open Access Journals (Sweden)

Jennifer L. Temple

2017-05-01

Full Text Available Caffeine is the most widely consumed psychoactive drug in the world. Natural sources of caffeine include coffee, tea, and chocolate. Synthetic caffeine is also added to products to promote arousal, alertness, energy, and elevated mood. Over the past decade, the introduction of new caffeine-containing food products, as well as changes in consumption patterns of the more traditional sources of caffeine, has increased scrutiny by health authorities and regulatory bodies about the overall consumption of caffeine and its potential cumulative effects on behavior and physiology. Of particular concern is the rate of caffeine intake among populations potentially vulnerable to the negative effects of caffeine consumption: pregnant and lactating women, children and adolescents, young adults, and people with underlying heart or other health conditions, such as mental illness. Here, we review the research into the safety and safe doses of ingested caffeine in healthy and in vulnerable populations. We report that, for healthy adults, caffeine consumption is relatively safe, but that for some vulnerable populations, caffeine consumption could be harmful, including impairments in cardiovascular function, sleep, and substance use. We also identified several gaps in the literature on which we based recommendations for the future of caffeine research.

Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

International Nuclear Information System (INIS)

Franchi, Nicola; Piccinni, Ester; Ferro, Diana; Basso, Giuseppe; Spolaore, Barbara; Santovito, Gianfranco; Ballarin, Loriano

2014-01-01

Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal

Characterization and transcription studies of a phytochelatin synthase gene from the solitary tunicate Ciona intestinalis exposed to cadmium

Energy Technology Data Exchange (ETDEWEB)

Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Piccinni, Ester [Department of Biology, University of Padova, Padova (Italy); Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Basso, Giuseppe [Department of Woman and Child Health, University of Padova, Padova (Italy); Spolaore, Barbara [CRIBI Biotechnology Centre, University of Padova, Padova (Italy); Department of Pharmaceutical and Pharmacological Sciences, University of Padova, Padova (Italy); Santovito, Gianfranco, E-mail: gianfranco.santovito@unipd.it [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)

2014-07-01

Highlights: • Ciona intestinalis have a functional phytochelatin synthase (PCS) gene (cipcs). • CiPCS amino acid sequence is phylogentically related to other metazoan PCSs. • CiPCS catalyze the synthesis of PC2. • cipcs are mostly transcribed in circulating hemocytes, in both tunic and blood lacunae. • Cadmium exposure results in a significant increase of cipcs and cipcna transcription. - Abstract: The major thiol-containing molecules involved in controlling the level of intracellular ROS in eukaryotes, acting as a nonenzymatic detoxification system, are metallothioneins (MTs), glutathione (GSH) and phytochelatins (PCs). Both MTs and GSH are well-known in the animal kingdom. PC was considered a prerogative of the plant kingdom but, in 2001, a phytochelatin synthase (PCS) gene was described in the nematode Caenorhabditis elegans; additional genes encoding this enzyme were later described in the earthworm Eisenia fetida and in the parasitic nematode Schistosoma mansoni but scanty data are available, up to now, for Deuterostomes. Here, we describe the molecular characteristics and transcription pattern, in the presence of Cd, of a PCS gene from the invertebrate chordate Ciona intestinalis, a ubiquitous solitary tunicate and demonstrate the presence of PCs in tissue extracts. We also studied mRNA localization by in situ hybridization. In addition, we analyzed the behavior of hemocytes and tunic cells consequent to Cd exposure as well as the transcription pattern of the Ciona orthologous for proliferating cell nuclear antigen (PCNA), usually considered a proliferation marker, and observed that cell proliferation occurs after 96 h of Cd treatment. This matches the hypothesis of Cd-induced cell proliferation, as already suggested by previous data on the expression of a metallothionein gene in the same animal.

Aspirin, Butalbital, and Caffeine

Science.gov (United States)

The combination of aspirin, butalbital, and caffeine comes as a capsule and tablet to take by mouth. It usually is taken every 4 ... explain any part you do not understand. Take aspirin, butalbital, and caffeine exactly as directed. Do not ...

Reinforcing effects of caffeine in coffee and capsules.

Science.gov (United States)

Griffiths, R R; Bigelow, G E; Liebson, I A

1989-09-01

In a residential research ward the reinforcing and subjective effects of caffeine were studied under double-blind conditions in volunteer subjects with histories of heavy coffee drinking. In Experiment 1, 6 subjects had 13 opportunities each day to self-administer either a caffeine (100 mg) or a placebo capsule for periods of 14 to 61 days. All subjects developed a clear preference for caffeine, with intake of caffeine becoming relatively stable after preference had been attained. Preference for caffeine was demonstrated whether or not preference testing was preceded by a period of 10 to 37 days of caffeine abstinence, suggesting that a recent history of heavy caffeine intake (tolerance/dependence) was not a necessary condition for caffeine to function as a reinforcer. In Experiment 2, 6 subjects had 10 opportunities each day to self-administer a cup of coffee or (on different days) a capsule, dependent upon completing a work requirement that progressively increased and then decreased over days. Each day, one of four conditions was studied: caffeinated coffee (100 mg/cup), decaffeinated coffee, caffeine capsules (100 mg/capsule), or placebo capsules. Caffeinated coffee maintained the most self-administration, significantly higher than decaffeinated coffee and placebo capsules but not different from caffeine capsules. Both decaffeinated coffee and caffeine capsules were significantly higher than placebo capsules but not different from each other. In both experiments, subject ratings of "linking" of coffee or capsules covaried with the self-administration measures. These experiments provide the clearest demonstrations to date of the reinforcing effects of caffeine in capsules and in coffee.

Highly divergent mitochondrial ATP synthase complexes in Tetrahymena thermophila.

Directory of Open Access Journals (Sweden)

Praveen Balabaskaran Nina

2010-07-01

Full Text Available The F-type ATP synthase complex is a rotary nano-motor driven by proton motive force to synthesize ATP. Its F(1 sector catalyzes ATP synthesis, whereas the F(o sector conducts the protons and provides a stator for the rotary action of the complex. Components of both F(1 and F(o sectors are highly conserved across prokaryotes and eukaryotes. Therefore, it was a surprise that genes encoding the a and b subunits as well as other components of the F(o sector were undetectable in the sequenced genomes of a variety of apicomplexan parasites. While the parasitic existence of these organisms could explain the apparent incomplete nature of ATP synthase in Apicomplexa, genes for these essential components were absent even in Tetrahymena thermophila, a free-living ciliate belonging to a sister clade of Apicomplexa, which demonstrates robust oxidative phosphorylation. This observation raises the possibility that the entire clade of Alveolata may have invented novel means to operate ATP synthase complexes. To assess this remarkable possibility, we have carried out an investigation of the ATP synthase from T. thermophila. Blue native polyacrylamide gel electrophoresis (BN-PAGE revealed the ATP synthase to be present as a large complex. Structural study based on single particle electron microscopy analysis suggested the complex to be a dimer with several unique structures including an unusually large domain on the intermembrane side of the ATP synthase and novel domains flanking the c subunit rings. The two monomers were in a parallel configuration rather than the angled configuration previously observed in other organisms. Proteomic analyses of well-resolved ATP synthase complexes from 2-D BN/BN-PAGE identified orthologs of seven canonical ATP synthase subunits, and at least 13 novel proteins that constitute subunits apparently limited to the ciliate lineage. A mitochondrially encoded protein, Ymf66, with predicted eight transmembrane domains could be a

Caffeine Increases Hippocampal Sharp Waves in Vitro.

Science.gov (United States)

Watanabe, Yusuke; Ikegaya, Yuji

2017-01-01

Caffeine promotes memory consolidation. Memory consolidation is thought to depend at least in part on hippocampal sharp waves (SWs). In the present study, we investigated the effect of bath-application of caffeine in spontaneously occurring SWs in mouse acute hippocampal slices. Caffeine induced an about 100% increase in the event frequency of SWs at concentrations of 60 and 200 µM. The effect of caffeine was reversible after washout of caffeine and was mimicked by an adenosine A 1 receptor antagonist, but not by an A 2A receptor antagonist. Caffeine increased SWs even in dentate-CA3 mini-slices without the CA2 regions, in which adenosine A 1 receptors are abundantly expressed in the hippocampus. Thus, caffeine facilitates SWs by inhibiting adenosine A 1 receptors in the hippocampal CA3 region or the dentate gyrus.

Caffeinated Energy Drinks -- A Growing Problem

Science.gov (United States)

Reissig, Chad J.; Strain, Eric C.; Griffiths, Roland R.

2009-01-01

Since the introduction of Red Bull in Austria in 1987 and in the United States in 1997, the energy drink market has grown exponentially. Hundreds of different brands are now marketed, with caffeine content ranging from a modest 50 mg to an alarming 505 mg per can or bottle. Regulation of energy drinks, including content labeling and health warnings differs across countries, with some of the most lax regulatory requirements in the U.S. The absence of regulatory oversight has resulted in aggressive marketing of energy drinks, targeted primarily toward young males, for psychoactive, performance-enhancing and stimulant drug effects. There are increasing reports of caffeine intoxication from energy drinks, and it seems likely that problems with caffeine dependence and withdrawal will also increase. In children and adolescents who are not habitual caffeine users, vulnerability to caffeine intoxication may be markedly increased due to an absence of pharmacological tolerance. Genetic factors may also contribute to an individual’s vulnerability to caffeine related disorders including caffeine intoxication, dependence, and withdrawal. The combined use of caffeine and alcohol is increasing sharply, and studies suggest that such combined use may increase the rate of alcohol-related injury. Several studies suggest that energy drinks may serve as a gateway to other forms of drug dependence. Regulatory implications concerning labeling and advertising, and the clinical implications for children and adolescents are discussed. PMID:18809264

Determination of caffeine and identification of undeclared substances in dietary supplements and caffeine dietary exposure assessment.

Science.gov (United States)

Neves, Diana Brito da Justa; Caldas, Eloisa Dutra

2017-07-01

Caffeine is one of the most consumed stimulants in the world, and is a frequent ingredient of dietary supplements. The aims of this work were to validate a GC-MS method for the quantitation of caffeine and identification of other substances in supplements, mainly weight loss products, and to estimate the caffeine intake by consumers. Sample preparation included extraction with chloroform:water in ultrasonic bath, centrifugation and analysis of the organic layer for caffeine quantitation, and extraction with methanol for identification of other substances. A total of 213 samples of 52 supplement products not registered in Brazil and seized by the Brazilian Federal Police were analyzed. From the 109 samples that declared the amount of caffeine present, 26.6% contained more than 120% of the specified content. Considering the maximum recommended dose stated on the product labels, the consumption of 47.9% of the samples would lead to a daily intake of caffeine above the safe limit of 400 mg. Undeclared drugs, including sibutramine, phenolphthalein, amphepramone and femproporex were found in 28 samples. These results show that consumers of dietary supplements should be aware that these products might contain caffeine at levels that could represent potential health risks, in addition to undeclared pharmaceutical drugs. Copyright © 2017 Elsevier Ltd. All rights reserved.

Role of adenosine receptors in caffeine tolerance

International Nuclear Information System (INIS)

Holtzman, S.G.; Mante, S.; Minneman, K.P.

1991-01-01

Caffeine is a competitive antagonist at adenosine receptors. Receptor up-regulation during chronic drug treatment has been proposed to be the mechanism of tolerance to the behavioral stimulant effects of caffeine. This study reassessed the role of adenosine receptors in caffeine tolerance. Separate groups of rats were given scheduled access to drinking bottles containing plain tap water or a 0.1% solution of caffeine. Daily drug intake averaged 60-75 mg/kg and resulted in complete tolerance to caffeine-induced stimulation of locomotor activity, which could not be surmounted by increasing the dose of caffeine. 5'-N-ethylcarboxamidoadenosine (0.001-1.0 mg/kg) dose dependently decreased the locomotor activity of caffeine-tolerant rats and their water-treated controls but was 8-fold more potent in the latter group. Caffeine (1.0-10 mg/kg) injected concurrently with 5-N-ethylcarboxamidoadenosine antagonized the decreases in locomotor activity comparably in both groups. Apparent pA2 values for tolerant and control rats also were comparable: 5.05 and 5.11. Thus, the adenosine-antagonist activity of caffeine was undiminished in tolerant rats. The effects of chronic caffeine administration on parameters of adenosine receptor binding and function were measured in cerebral cortex. There were no differences between brain tissue from control and caffeine-treated rats in number and affinity of adenosine binding sites or in receptor-mediated increases (A2 adenosine receptor) and decreases (A1 adenosine receptor) in cAMP accumulation. These results are consistent with theoretical arguments that changes in receptor density should not affect the potency of a competitive antagonist. Experimental evidence and theoretical considerations indicate that up-regulation of adenosine receptors is not the mechanism of tolerance to caffeine-induced stimulation of locomotor activity

Role of adenosine receptors in caffeine tolerance

Energy Technology Data Exchange (ETDEWEB)

Holtzman, S.G.; Mante, S.; Minneman, K.P. (Emory Univ. School of Medicine, Atlanta, GA (USA))

1991-01-01

Caffeine is a competitive antagonist at adenosine receptors. Receptor up-regulation during chronic drug treatment has been proposed to be the mechanism of tolerance to the behavioral stimulant effects of caffeine. This study reassessed the role of adenosine receptors in caffeine tolerance. Separate groups of rats were given scheduled access to drinking bottles containing plain tap water or a 0.1% solution of caffeine. Daily drug intake averaged 60-75 mg/kg and resulted in complete tolerance to caffeine-induced stimulation of locomotor activity, which could not be surmounted by increasing the dose of caffeine. 5'-N-ethylcarboxamidoadenosine (0.001-1.0 mg/kg) dose dependently decreased the locomotor activity of caffeine-tolerant rats and their water-treated controls but was 8-fold more potent in the latter group. Caffeine (1.0-10 mg/kg) injected concurrently with 5-N-ethylcarboxamidoadenosine antagonized the decreases in locomotor activity comparably in both groups. Apparent pA2 values for tolerant and control rats also were comparable: 5.05 and 5.11. Thus, the adenosine-antagonist activity of caffeine was undiminished in tolerant rats. The effects of chronic caffeine administration on parameters of adenosine receptor binding and function were measured in cerebral cortex. There were no differences between brain tissue from control and caffeine-treated rats in number and affinity of adenosine binding sites or in receptor-mediated increases (A2 adenosine receptor) and decreases (A1 adenosine receptor) in cAMP accumulation. These results are consistent with theoretical arguments that changes in receptor density should not affect the potency of a competitive antagonist. Experimental evidence and theoretical considerations indicate that up-regulation of adenosine receptors is not the mechanism of tolerance to caffeine-induced stimulation of locomotor activity.

Alpha-tryptophan synthase of Isatis tinctoria: gene cloning and expression.

Science.gov (United States)

Salvini, M; Boccardi, T M; Sani, E; Bernardi, R; Tozzi, S; Pugliesi, C; Durante, M

2008-07-01

Indole producing reaction is a crux in the regulation of metabolite flow through the pathways and the coordination of primary and secondary product biosynthesis in plants. Indole is yielded transiently from indole-3-glycerol phosphate and immediately condensed with serine to give tryptophan, by the enzyme tryptophan synthase (TS). There is evidence that plant TS, like the bacterial complex, functions as an alpha beta heteromer. In few species, e.g. maize, are known enzymes, related with the TS alpha-subunit (TSA), able to catalyse reaction producing indole, which is free to enter the secondary metabolite pathways. In this contest, we searched for TSA and TSA related genes in Isatis tinctoria, a species producing the natural blue dye indigo. The It-TSA cDNA and the full-length exons/introns genomic region were isolated. The phylogenetic analysis indicates that It-TSA is more closely related to Arabidopsis thaliana At-T14E10.210 TSA (95.7% identity at the amino acid level) with respect to A. thaliana At-T10P11.11 TSA1-like (63%), Zea mays indole-3-glycerol phosphate lyase (54%), Z. mays TSA (53%), and Z. mays indole synthase (50%). The It-TSA cDNA was also able to complement an Escherichia coli trpA mutant. To examine the involvement of It-TSA in the biosynthesis of secondary metabolism compounds, It-TSA expression was tested in seedling grown under different light conditions. Semi-quantitative RT-PCR showed an increase in the steady-state level of It-TSA mRNA, paralleled by an increase of indigo and its precursor isatan B. Our results appear to indicate an involvement for It-TSA in indigo precursor synthesis and/or tryptophan biosynthesis.

Wounding stimulates ALLENE OXIDE SYNTHASE gene and increases the level of jasmonic acid in Ipomoea nil cotyledons

Directory of Open Access Journals (Sweden)

Emilia Wilmowicz

2016-03-01

Full Text Available Allene oxide synthase (AOS encodes the first enzyme in the lipoxygenase pathway, which is responsible for jasmonic acid (JA formation. In this study we report the molecular cloning and characterization of InAOS from Ipomoea nil. The full-length gene is composed of 1662 bp and encodes for 519 amino acids. The predicted InAOS contains PLN02648 motif, which is evolutionarily conserved and characteristic for functional enzymatic proteins. We have shown that wounding led to a strong stimulation of the examined gene activity in cotyledons and an increase in JA level, which suggest that this compound may be a modulator of stress responses in I. nil.

Chronic treatment with caffeine and its withdrawal modify the antidepressant-like activity of selective serotonin reuptake inhibitors in the forced swim and tail suspension tests in mice. Effects on Comt, Slc6a15 and Adora1 gene expression.

Science.gov (United States)

Szopa, Aleksandra; Doboszewska, Urszula; Herbet, Mariola; Wośko, Sylwia; Wyska, Elżbieta; Świąder, Katarzyna; Serefko, Anna; Korga, Agnieszka; Wlaź, Aleksandra; Wróbel, Andrzej; Ostrowska, Marta; Terlecka, Joanna; Kanadys, Adam; Poleszak, Ewa; Dudka, Jarosław; Wlaź, Piotr

2017-12-15

Recent preclinical and clinical data suggest that low dose of caffeine enhances the effects of common antidepressants. Here we investigated the effects of chronic administration of caffeine (5mg/kg, twice daily for 14days) and its withdrawal on day 15th on the activity of per se ineffective doses of fluoxetine (5mg/kg) and escitalopram (2mg/kg) given on day 15th. We found decreased immobility time in the forced swim and tail suspension tests in mice in which caffeine was administered simultaneously with antidepressants on day 15th following a 14-day caffeine treatment and no alterations in the spontaneous locomotor activity. A decrease in the level of escitalopram and an increase in the level of caffeine in serum were observed after concomitant administration of these compounds, while the joint administration of caffeine and fluoxetine was not associated with changes in their levels in serum or brain. Caffeine withdrawal caused a decrease in Adora1 mRNA level in the cerebral cortex (Cx). Administration of escitalopram or fluoxetine followed by caffeine withdrawal caused an increase in this gene expression, whereas administration of escitalopram, but not fluoxetine, on day 15th together with caffeine caused a decrease in Adora1 mRNA level in the Cx. Furthermore, antidepressant-like activity observed after joint administration of the tested drugs with caffeine was associated with decreased Slc6a15 mRNA level in the Cx. The results show that withdrawal of caffeine after its chronic intake may change activity of antidepressants with concomitant alterations within monoamine, adenosine and glutamate systems. Copyright © 2017 Elsevier Inc. All rights reserved.

Caffeine, sleep and quality of life

NARCIS (Netherlands)

Lorist, M.M.; Snel, J.; Verster, J.C.; Pandi-Perumal, S.R.; Streiner, D.L.

2008-01-01

Caffeine is regarded as a mild stimulant acting on the central nervous system that is responsible for a significant portion of the behavioural and physiological effects of coffee and tea. Motives why people take caffeine are reflected in consumption patterns. Early in the morning caffeine might help

Glycogen Metabolic Genes Are Involved in Trehalose-6-Phosphate Synthase-Mediated Regulation of Pathogenicity by the Rice Blast Fungus Magnaporthe oryzae

Science.gov (United States)

Wilson, Richard A.; Wang, Zheng-Yi; Kershaw, Michael J.; Talbot, Nicholas J.

2013-01-01

The filamentous fungus Magnaporthe oryzae is the causal agent of rice blast disease. Here we show that glycogen metabolic genes play an important role in plant infection by M. oryzae. Targeted deletion of AGL1 and GPH1, which encode amyloglucosidase and glycogen phosphorylase, respectively, prevented mobilisation of glycogen stores during appressorium development and caused a significant reduction in the ability of M. oryzae to cause rice blast disease. By contrast, targeted mutation of GSN1, which encodes glycogen synthase, significantly reduced the synthesis of intracellular glycogen, but had no effect on fungal pathogenicity. We found that loss of AGL1 and GPH1 led to a reduction in expression of TPS1 and TPS3, which encode components of the trehalose-6-phosphate synthase complex, that acts as a genetic switch in M. oryzae. Tps1 responds to glucose-6-phosphate levels and the balance of NADP/NADPH to regulate virulence-associated gene expression, in association with Nmr transcriptional inhibitors. We show that deletion of the NMR3 transcriptional inhibitor gene partially restores virulence to a Δagl1Δgph1 mutant, suggesting that glycogen metabolic genes are necessary for operation of the NADPH-dependent genetic switch in M. oryzae. PMID:24098112

Acute Ingestion of Caffeinated Chewing Gum Improves Repeated Sprint Performance of Team Sport Athletes With Low Habitual Caffeine Consumption.

Science.gov (United States)

Evans, Mark; Tierney, Peter; Gray, Nicola; Hawe, Greg; Macken, Maria; Egan, Brendan

2018-04-23

The effects of acute ingestion of caffeine on short-duration high-intensity performance are equivocal, while studies of novel modes of delivery and the efficacy of low doses of caffeine are warranted. The aims of the present study were to investigate the effect of acute ingestion of caffeinated chewing gum on repeated sprint performance (RSP) in team sport athletes, and whether habitual caffeine consumption alters the ergogenic effect, if any, on RSP. A total of 18 male team sport athletes undertook four RSP trials using a 40-m maximum shuttle run test, which incorporates 10 × 40-m sprints with 30 s between the start of each sprint. Each participant completed two familiarization sessions, followed by caffeine (CAF; caffeinated chewing gum; 200 mg caffeine) and placebo (PLA; noncaffeinated chewing gum) trials in a randomized, double-blind manner. RSP, assessed by sprint performance decrement (%), did not differ (p = .209; effect size = 0.16; N = 18) between CAF (5.00 ± 2.84%) and PLA (5.43 ± 2.68%). Secondary analysis revealed that low habitual caffeine consumers (130 mg/day, n = 6; 3.98 ± 2.57% vs. 3.80 ± 1.79%, respectively; p = .684; effect size = 0.08). The data suggest that a low dose of caffeine in the form of caffeinated chewing gum attenuates the sprint performance decrement during RSP by team sport athletes with low, but not moderate-to-high, habitual consumption of caffeine.

Nutrition Influences Caffeine-Mediated Sleep Loss in Drosophila.

Science.gov (United States)

Keebaugh, Erin S; Park, Jin Hong; Su, Chenchen; Yamada, Ryuichi; Ja, William W

2017-11-01

Plant-derived caffeine is regarded as a defensive compound produced to prevent herbivory. Caffeine is generally repellent to insects and often used to study the neurological basis for aversive responses in the model insect, Drosophila melanogaster. Caffeine is also studied for its stimulatory properties where sleep or drowsiness is suppressed across a range of species. Since limiting access to food also inhibits fly sleep-an effect known as starvation-induced sleep suppression-we tested whether aversion to caffeinated food results in reduced nutrient intake and assessed how this might influence fly studies on the stimulatory effects of caffeine. We measured sleep and total consumption during the first 24 hours of exposure to caffeinated diets containing a range of sucrose concentrations to determine the relative influence of caffeine and nutrient ingestion on sleep. Experiments were replicated using three fly strains. Caffeine reduced total consumption and nighttime sleep, but only at intermediate sucrose concentrations. Although sleep can be modeled by an exponential dose response to nutrient intake, caffeine-mediated sleep loss cannot be explained by absolute caffeine or sucrose ingestion alone. Instead, reduced sleep strongly correlates with changes in total consumption due to caffeine. Other bitter compounds phenocopy the effect of caffeine on sleep and food intake. Our results suggest that a major effect of dietary caffeine is on fly feeding behavior. Changes in feeding behavior may drive caffeine-mediated sleep loss. Future studies using psychoactive compounds should consider the potential impact of nutrition when investigating effects on sleep. © Sleep Research Society 2017. Published by Oxford University Press on behalf of the Sleep Research Society. All rights reserved. For permissions, please e-mail journals.permissions@oup.com.

SNP in Chalcone Synthase gene is associated with variation of 6-gingerol content in contrasting landraces of Zingiber officinale.Roscoe.

Science.gov (United States)

Ghosh, Subhabrata; Mandi, Swati Sen

2015-07-25

Zingiber officinale, medicinally the most important species within Zingiber genus, contains 6-gingerol as the active principle. This compound obtained from rhizomes of Z.officinale, has immense medicinal importance and is used in various herbal drug formulations. Our record of variation in content of this active principle, viz. 6-gingerol, in land races of this drug plant collected from different locations correlated with our Gene expression studies exhibiting high Chalcone Synthase gene (Chalcone Synthase is the rate limiting enzyme of 6-gingerol biosynthesis pathway) expression in high 6-gingerol containing landraces than in the low 6-gingerol containing landraces. Sequencing of Chalcone Synthase cDNA and subsequent multiple sequence alignment revealed seven SNPs between these contrasting genotypes. Converting this nucleotide sequence to amino acid sequence, alteration of two amino acids becomes evident; one amino acid change (asparagine to serine at position 336) is associated with base change (A→G) and another change (serine to leucine at position 142) is associated with the base change (C→T). Since asparagine at position 336 is one of the critical amino acids of the catalytic triad of Chalcone Synthase enzyme, responsible for substrate binding, our study suggests that landraces with a specific amino acid change viz. Asparagine (found in high 6-gingerol containing landraces) to serine causes low 6-gingerol content. This is probably due to a weak enzyme substrate association caused by the absence of asparagine in the catalytic triad. Detailed study of this finding could also help to understand molecular mechanism associated with variation in 6-gingerol content in Z.officinale genotypes and thereby strategies for developing elite genotypes containing high 6-gingerol content. Copyright © 2015 Elsevier B.V. All rights reserved.

Caffeine and the olfactory bulb.

Science.gov (United States)

Hadfield, M G

1997-08-01

Caffeine, a popular CNS stimulant, is the most widely used neuroactive drug. Present in coffee, tea, chocolate, and soft drinks as well as over-the-counter and prescription medications, it influences millions of users. This agent has achieved recent notoriety because its dependency consequences and addictive potential have been re-examined and emphasized. Caffeine's central actions are thought to be mediated through adenosine (A) receptors and monoamine neurotransmitters. The present article suggests that the olfactory bulb (OB) may be an important site in the brain that is responsible for caffeine's central actions in several species. This conclusion is based on the extraordinarily robust and selective effects of caffeine on norepinephrine (NE), dopamine (DA), and particularly serotonin (5HT) utilization in the OB of mice. We believe that these phenomena should be given appropriate consideration as a basis for caffeine's central actions, even in primates. Concurrently, we review a rich rodent literature concerned with A, 5HT, NE, and DA receptors in the OB and related structures along with other monoamine parameters. We also review a more limited literature concerned with the primate OB. Finally, we cite the literature that treats the dependency and addictive effects of caffeine in humans, and relate the findings to possible olfactory mechanisms.

Design, formulation and evaluation of caffeine chewing gum.

Science.gov (United States)

Aslani, Abolfazl; Jalilian, Fatemeh

2013-01-01

Caffeine which exists in drinks such as coffee as well as in drug dosage forms in the global market is among the materials that increase alertness and decrease fatigue. Compared to other forms of caffeine, caffeine gum can create faster and more prominent effects. In this study, the main goal is to design a new formulation of caffeine gum with desirable taste and assess its physicochemical properties. Caffeine gum was prepared by softening of gum bases and then mixing with other formulation ingredients. To decrease the bitterness of caffeine, sugar, aspartame, liquid glucose, sorbitol, manitol, xylitol, and various flavors were used. Caffeine release from gum base was investigated by mechanical chewing set. Content uniformity test was also performed on the gums. The gums were evaluated in terms of organoleptic properties by the Latin-Square design at different stages. After making 22 formulations of caffeine gums, F11 from 20 mg caffeine gums and F22 from 50 mg caffeine gums were chosen as the best formulation in organoleptic properties. Both types of gum released about 90% of their own drug content after 30 min. Drug content of 20 and 50 mg caffeine gum was about 18.2-21.3 mg and 45.7-53.6 mg respectively. In this study, 20 and 50 mg caffeine gums with suitable and desirable properties (i.e., good taste and satisfactory release) were formulated. The best flavor for caffeine gum was cinnamon. Both kinds of 20 and 50 mg gums succeeded in content uniformity test.

An aureobasidin A resistance gene isolated from Aspergillus is a homolog of yeast AUR1, a gene responsible for inositol phosphorylceramide (IPC) synthase activity.

Science.gov (United States)

Kuroda, M; Hashida-Okado, T; Yasumoto, R; Gomi, K; Kato, I; Takesako, K

1999-03-01

The AUR1 gene of Saccharomyces cerevisiae, mutations in which confer resistance to the antibiotic aureobasidin A, is necessary for inositol phosphorylceramide (IPC) synthase activity. We report the molecular cloning and characterization of the Aspergillus nidulans aurA gene, which is homologous to AUR1. A single point mutation in the aurA gene of A. nidulans confers a high level of resistance to aureobasidin A. The A. nidulans aurA gene was used to identify its homologs in other Aspergillus species, including A. fumigatus, A. niger, and A. oryzae. The deduced amino acid sequence of an aurA homolog from the pathogenic fungus A. fumigatus showed 87% identity to that of A. nidulans. The AurA proteins of A. nidulans and A. fumigatus shared common characteristics in primary structure, including sequence, hydropathy profile, and N-glycosylation sites, with their S. cerevisiae, Schizosaccharomyces pombe, and Candida albicans counterparts. These results suggest that the aureobasidin resistance gene is conserved evolutionarily in various fungi.

Evaluating Dependence Criteria for Caffeine

OpenAIRE

Striley, Catherine L.W.; Griffiths, Roland R.; Cottler, Linda B.

2011-01-01

Background: Although caffeine is the most widely used mood-altering drug in the world, few studies have operationalized and characterized Diagnostic and Statistical Manual IV (DSM-IV) substance dependence criteria applied to caffeine. Methods: As a part of a nosological study of substance use disorders funded by the National Institute on Drug Abuse, we assessed caffeine use and dependence symptoms among high school and college students, drug treatment patients, and pain clinic patients who re...

Caffeine as a cause of urticaria-angioedema

Directory of Open Access Journals (Sweden)

Linda Tognetti

2014-01-01

Full Text Available We report the case of a young woman presenting with recurrent urticaria. The episodes occurred both in and out of the workplace. On three occasions it presented as urticaria-angioedema, requiring emergency care on one occassion. A thorough clinical history along with serological and allergological tests allowed a diagnosis of caffeine-induced urticaria-angioedema. We advised the patient to follow a caffeine-free diet and to avoid all caffeine or methylxanthine-containing drugs. After two years of caffeine abstinence, she had not experienced any further episodes of urticaria-angioedema. Only a few cases of caffeine-induced urticaria and/or anaphylaxis have been reported till date, with varying outcomes in allergologic investigations. Moreover, several cases are probably undiagnosed or misdiagnosed as idiopathic urticaria or as occupational allergy. We speculate that hypersensitivity to caffeine rather than autoimmine reaction may be the probable cause of urticaria. Caffeine should considered as a potential urticaria-inducing agent and should be included in the allergological test series.

Caffeine deprivation affects vigilance performance and mood.

Science.gov (United States)

Lane, J D; Phillips-Bute, B G

1998-08-01

The effects of brief caffeine deprivation on vigilance performance, mood, and symptoms of caffeine withdrawal were studied in habitual coffee drinkers. Thirty male and female coffee drinkers were tested twice at midday (1130 to 1330 hours) after mornings in which they either consumed caffeinated beverages ad lib or abstained. Vigilance performance was tested with a 30-min computerized visual monitoring task. Mood and withdrawal symptom reports were collected by questionnaires. Caffeine deprivation was associated with impaired vigilance performance characterized by a reduction in the percentage of targets detected and an increase in response time, and by subjective reports of decreased vigor and increased fatigue and symptoms characterized by sleepiness, headache, and reduced ability to work. Even short periods of caffeine deprivation, equivalent in length to skipping regular morning coffee, can produce deficits in sustained attention and noticeable unpleasant caffeine-withdrawal symptoms in habitual coffee drinkers. Such symptoms may be a common side-effect of habitual caffeine consumption that contributes to the maintenance of this behavior.

The absence of caffeine inhibition of post-replication repair in excision deficient strains of Escherichia coli B and K12

International Nuclear Information System (INIS)

McCulley, C.M.; Johnson, R.C.

1976-01-01

The effect of caffeine on postreplication repair, as seen in alkaline sucrose gradients, conjugation, and ultraviolet light (UV) survival, was studied in excision deficient strains of Escherichia coli K12 and B. A caffeine concentration of 2 mg/ml was chosen for the study which did not inhibit colony formation. Both E. coli K12 AB2500 and E. coli B WWP2 were more sensitive to UV when plated on caffeine plates. Conjugation was not inhibited in the E. coli K12 strain; however, the same procedure confirmed caffeine inhibition in the E. coli B strain. Caffeine did not inhibit postreplication repair in either strain, as determined by sedimentation profile studies of DNA on alkaline sucrose gradients. No strand breakage or degradation was observed in parental or post-UV replicated DNA for as long as 50 min incubation in caffeine. Thus caffeine concentrations that inhibited two recA gene product related phenomena did not cause immediate changes in size of DNA or inhibit the rate of a DNA gap generating postreplication type of DNA repair

Cloning and expression analysis of two dehydrodolichyl diphosphate synthase genes from Tripterygium wilfordii

Directory of Open Access Journals (Sweden)

Lin-Hui Gao

2018-01-01

Full Text Available Objective: To clone and investigate two dehydrodolichyl diphosphate synthase genes of Tripterygium wilfordii by bioinformatics and tissue expression analysis. Materials and Methods: According to the T. wifordii transcriptome database, specific primers were designed to clone the TwDHDDS1 and TwDHDDS2 genes via PCR. Based on the cloned sequences, protein structure prediction, multiple sequence alignment and phylogenetic tree construction were performed. The expression levels of the genes in different tissues of T. wilfordii were measured by real-time quantitative PCR. Results: The TwDHDDS1 gene encompassed a 873 bp open reading frame (ORF and encoded a protein of 290 amino acids. The calculated molecular weight of the translated protein was about 33.46 kDa, and the theoretical isoelectric point (pI was 8.67. The TwDHDDS2 encompassed a 768 bp ORF, encoding a protein of 255 amino acids with a calculated molecular weight of about 21.19 kDa, and a theoretical isoelectric point (pI of 7.72. Plant tissue expression analysis indicated that TwDHDDS1 and TwDHDDS2 both have relatively ubiquitous expression in all sampled organ tissues, but showed the highest transcription levels in the stems. Conclusions: The results of this study provide a basis for further functional studies of TwDHDDS1 and TwDHDDS2. Most importantly, these genes are promising genetic targets for the regulation of the biosynthetic pathways of important bioactive terpenoids such as triptolide.

Characterization of Individuals Seeking Treatment for Caffeine Dependence

OpenAIRE

Juliano, Laura M.; Evatt, Daniel P.; Richards, Brian D.; Griffiths, Roland R.

2012-01-01

Previous investigations have identified individuals who meet criteria for DSM-IV-TR substance dependence as applied to caffeine, but there is little research on treatments for caffeine dependence. This study aimed to thoroughly characterize individuals who are seeking treatment for problematic caffeine use. Ninety-four individuals who identified as being psychologically or physically dependent on caffeine, or who had tried unsuccessfully to modify caffeine consumption participated in a face-t...

A fluvoxamine-caffeine interaction study

DEFF Research Database (Denmark)

Jeppesen, U; Loft, S; Poulsen, H E

1996-01-01

The selective serotonin reuptake inhibitor fluvoxamine is a very potent inhibitor of the liver enzyme CYP1A2, which is the major P450 catalysing the biotransformation of caffeine. Thus, a pharmacokinetic study was undertaken with the purpose of documenting a drug-drug interaction between fluvoxam......The selective serotonin reuptake inhibitor fluvoxamine is a very potent inhibitor of the liver enzyme CYP1A2, which is the major P450 catalysing the biotransformation of caffeine. Thus, a pharmacokinetic study was undertaken with the purpose of documenting a drug-drug interaction between...... fluvoxamine and caffeine. The study was carried out as a randomized, in vivo, cross-over study including eight healthy volunteers. In Period A of the study, each subject took 200 mg caffeine orally, and in Period B, the subjects took fluvoxamine 50 mg per day for 4 days and 100 mg per day for 8 days. On day 8...... fluvoxamine treatment may lead to caffeine intoxication. Finally, our study provides additional evidence that fluvoxamine can be used to probe CYP1A2 in drug metabolism....

Energy drinks and the neurophysiological impact of caffeine.

Science.gov (United States)

Persad, Leeana Aarthi Bagwath

2011-01-01

Caffeine is the most widely used psychoactive stimulant with prevalent use across all age groups. It is a naturally occurring substance found in the coffee bean, tea leaf, the kola nut, cocoa bean. Recently there has been an increase in energy drink consumption leading to caffeine abuse, with aggressive marketing and poor awareness on the consequences of high caffeine use. With caffeine consumption being so common, it is vital to know the impact caffeine has on the body, as its effects can influence cardio-respiratory, endocrine, and perhaps most importantly neurological systems. Detrimental effects have being described especially since an over consumption of caffeine has being noted. This review focuses on the neurophysiological impact of caffeine and its biochemical pathways in the human body.

Energy drinks and the neurophysiological impacts of caffeine

Directory of Open Access Journals (Sweden)

Leeana eBagwath Persad

2011-10-01

Full Text Available Caffeine is the most widely used psychoactive stimulant with prevalent use across all age groups. It is a naturally occurring substance found in the coffee bean, tea leaf, the kola nut, cocoa bean. Recently there has been an increase in energy drink consumption leading to caffeine abuse, with aggressive marketing and poor awareness on the consequences of high caffeine use. With caffeine consumption being so common, it is vital to know the impact caffeine has on the body, as its effects can influence cardio-respiratory, endocrine and perhaps most importantly neurological systems. Detrimental effects have being described especially since an over consumption of caffeine has being noted. This review focuses on the neurophysiological impact of caffeine and its biochemical pathways in the human body.

Caffeine and cognition in functional magnetic resonance imaging.

Science.gov (United States)

Koppelstaetter, Florian; Poeppel, Thorsten D; Siedentopf, Christian M; Ischebeck, Anja; Kolbitsch, Christian; Mottaghy, Felix M; Felber, Stephan R; Jaschke, Werner R; Krause, Bernd J

2010-01-01

Caffeine has been consumed since ancient times due to its beneficial effects on attention, psychomotor function, and memory. Caffeine exerts its action mainly through an antagonism of cerebral adenosine receptors, although there are important secondary effects on other neurotransmitter systems. Recently, functional MRI (fMRI) entered the field of neuropharmacology to explore the intracerebral sites and mechanisms of action of pharmacological agents. However, as caffeine possesses vasoconstrictive properties it may interfere with the mechanisms underlying the functional contrast in fMRI. Yet, only a limited number of studies dealt with the effect of caffeine on measures in fMRI. Even fewer neuroimaging studies examined the effects that caffeine exerts on cognition: Portas and colleagues used fMRI in an attentional task under different levels of arousal (sleep deprivation or caffeine administration), concluding that the thalamus is involved in mediating the interaction of attention and arousal. Bendlin and colleagues found caffeine to stabilize the extent of neuronal activation in repetitive word stem completion, counteracting the general task practice effect. Recently, Koppelstaetter and colleagues assessed the effect of caffeine on verbal working memory demonstrating a modulatory effect of caffeine on brain regions (medial frontopolar and anterior cingulate cortex) that have been associated with attentional and executive functions. This review surveys and discusses neuroimaging findings on 1) how caffeine affects the contrast underlying fMRI techniques, particularly the blood oxygen level dependent contrast (BOLD fMRI), and 2) how caffeine operates on neuronal activity underlying cognition, to understand the effect of caffeine on behavior and its neurobiological underpinnings.

Replicative bypass repair of ultraviolet damage to DNA of mammalian cells: caffeine sensitive and caffeine resistant mechanism

International Nuclear Information System (INIS)

Fujiwara, Y.; Tatsumi, M.

1976-01-01

Replicative bypass repair of UV damage to DNA was studied in a wide variaty of human, mouse and hamster cells in culture. Survival curve analysis revealed that in established cell lines (mouse L, Chinese hamster V79, HeLa S3 and SV40-transformed xeroderma pigmentosum (XP), post-UV caffeine treatment potentiated cell killing by reducing the extrapolation number and mean lethal UV fluence (Do). In the Do reduction as the result of random inactivation by caffeine of sensitive repair there were marked clonal differences among such cell lines, V79 being most sensitive to caffeine potentiation. However, other diploid cell lines (normal human, excision-defective XP and Syrian hamster) exhibited no obvious reduction in Do by caffeine. In parallel, alkaline sucrose sedimentation results showed that the conversion of initially smaller segments of DNA synthesized after irradiation with 10 J/m 2 to high-molecular-weight DNA was inhibited by caffeine in transformed XP cells, but not in the diploid human cell lines. Exceptionally, diploid XP variants had a retarded ability of bypass repair which was drastically prevented by caffeine, so that caffeine enhanced the lethal effect of UV. Neutral CsCl study on the bypass repair mechanism by use of bromodeoxyuridine for DNA synthesis on damaged template suggests that the pyrimodine dimer acts as a block to replication and subsequently it is circumvented presumably by a new process involving replicative bypassing following strand displacement, rather than by gap-filling de novo. This mechanism worked similarly in normal and XP cells, whether or not caffeine was present, indicating that excision of dimer is not always necessary. However, replicative bypassing became defective in XP variant and transformed XP cells when caffeine was present. It appears, therefore, that the replicative bypass repair process is either caffeine resistant or sensitive, depending on the cell type used, but not necessarily on the excision repair capability

Silymarin and caffeine combination ameliorates experimentally-induced hepatic fibrosis through down-regulation of LPAR1 expression.

Science.gov (United States)

Eraky, Salma M; El-Mesery, Mohamed; El-Karef, Amro; Eissa, Laila A; El-Gayar, Amal M

2018-05-01

Lysophosphatidic acid is a lipid mediator that is supposed to be implicated in hepatic fibrosis. Silymarin and caffeine are natural compounds known for their anti-inflammatory and antioxidant effects. Our study aimed to explore the effect of silymarin, caffeine, and their combination on lysophosphatidic acid receptor 1 (LPAR1) pathway in thioacetamide (TAA)-induced hepatic fibrosis. Hepatic fibrosis was induced in male Sprague-Dawley rats by intraperitoneal injection of 200 mg/kg of TAA twice a week for 8 weeks. Silymarin (50 mg/kg), caffeine (50 mg/kg), and their combination (50 mg/kg silymarin + 50 mg/kg caffeine) were orally given to rats every day for 8 weeks along with TAA injection. Liver functions were measured. Histopathological examination of liver tissues was performed using hematoxylin and eosin and Masson's trichrome staining. mRNA expressions of LPAR1, transforming growth factor beta 1 (TGF-β1), connective tissue growth factor (CTGF), and alpha smooth muscle actin (α-SMA) were measured using RT-PCR. LPAR1 tissue expression was scored using immunohistochemistry. Silymarin, caffeine, and their combination significantly improved liver function. They caused significant decrease in fibrosis and necro-inflammatory scores. Combination of silymain and caffeine caused a significant decrease in the necro-inflammatory score than the single treatment with silymarin or caffeine. In addition, silymarin, caffeine, and their combination significantly decreased hepatic LPAR1, TGF-β1, CTGF, and α-SMA gene expressions and LPAR1 tissue expression. Silymarin, caffeine, and their combination protect against liver fibrosis through down-regulation of LPAR1, TGF-β1, and CTGF. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

A 31 bp VNTR in the cystathionine beta-synthase (CBS) gene is associated with reduced CBS activity and elevated post-load homocysteine levels

NARCIS (Netherlands)

Lievers, K.J.; Kluijtmans, L.A.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraay-Emmerzaal, van D.; Heijer, den M.; Trijbels, F.J.M.; Blom, H.J.

2001-01-01

Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine -synthase (CBS) deficiency has been excluded as a major

Caffeine, exercise and the brain.

Science.gov (United States)

Meeusen, Romain; Roelands, Bart; Spriet, Lawrence L

2013-01-01

Caffeine can improve exercise performance when it is ingested at moderate doses (3-6 mg/kg body mass). Caffeine also has an effect on the central nervous system (CNS), and it is now recognized that most of the performance-enhancing effect of caffeine is accomplished through the antagonism of the adenosine receptors, influencing the dopaminergic and other neurotransmitter systems. Adenosine and dopamine interact in the brain, and this might be one mechanism to explain how the important components of motivation (i.e. vigor, persistence and work output) and higher-order brain processes are involved in motor control. Caffeine maintains a higher dopamine concentration especially in those brain areas linked with 'attention'. Through this neurochemical interaction, caffeine improves sustained attention, vigilance, and reduces symptoms of fatigue. Other aspects that are localized in the CNS are a reduction in skeletal muscle pain and force sensation, leading to a reduction in perception of effort during exercise and therefore influencing the motivational factors to sustain effort during exercise. Because not all CNS aspects have been examined in detail, one should consider that a placebo effect may also be present. Overall, it appears that the performance-enhancing effects of caffeine reside in the brain, although more research is necessary to reveal the exact mechanisms through which the CNS effect is established. Copyright © 2013 Nestec Ltd., Vevey/S. Karger AG, Basel.

Associations of Urinary Caffeine and Caffeine Metabolites With Arterial Stiffness in a Large Population-Based Study.

Science.gov (United States)

Ponte, Belen; Pruijm, Menno; Ackermann, Daniel; Ehret, Georg; Ansermot, Nicolas; Staessen, Jan A; Vogt, Bruno; Pechère-Bertschi, Antoinette; Burnier, Michel; Martin, Pierre-Yves; Eap, Chin B; Bochud, Murielle; Guessous, Idris

2018-05-01

To assess the influence of caffeine on arterial stiffness by exploring the association of urinary excretion of caffeine and its related metabolites with pulse pressure (PP) and pulse wave velocity (PWV). Families were randomly selected from the general population of 3 Swiss cities from November 25, 2009, through April 4, 2013. Pulse pressure was defined as the difference between the systolic and diastolic blood pressures obtained by 24-hour ambulatory monitoring. Carotid-femoral PWV was determined by applanation tonometry. Urinary caffeine, paraxanthine, theophylline, and theobromine excretions were measured in 24-hour urine collections. Multivariate linear and logistic mixed models were used to explore the associations of quartiles of urinary caffeine and metabolite excretions with PP, high PP, and PWV. We included 863 participants with a mean ± SD age of 47.1±17.6 years, 24-hour PP of 41.9±9.2 mm Hg, and PWV of 8.0±2.3 m/s. Mean (SE) brachial PP decreased from 43.5 (0.5) to 40.5 (0.6) mm Hg from the lowest to the highest quartiles of 24-hour urinary caffeine excretion (P<.001). The odds ratio (95% CI) of high PP decreased linearly from 1.0 to 0.52 (0.31-0.89), 0.38 (0.22-0.65), and 0.31 (0.18-0.55) from the lowest to the highest quartile of 24-hour urinary caffeine excretion (P<.001). Mean (SE) PWV in the highest caffeine excretion quartile was significantly lower than in the lowest quartile (7.8 [0.1] vs 8.1 [0.1] m/s; P=.03). Similar associations were found for paraxanthine and theophylline, whereas no associations were found with theobromine. Urinary caffeine, paraxanthine, and theophylline excretions were associated with decreased parameters of arterial stiffness, suggesting a protective effect of caffeine intake beyond its blood pressure-lowering effect. Copyright © 2017 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.

RNAi and Homologous Over-Expression Based Functional Approaches Reveal Triterpenoid Synthase Gene-Cycloartenol Synthase Is Involved in Downstream Withanolide Biosynthesis in Withania somnifera.

Directory of Open Access Journals (Sweden)

Smrati Mishra

Full Text Available Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides.

Fast inhibition of glutamate-activated currents by caffeine.

Directory of Open Access Journals (Sweden)

Nicholas P Vyleta

Full Text Available BACKGROUND: Caffeine stimulates calcium-induced calcium release (CICR in many cell types. In neurons, caffeine stimulates CICR presynaptically and thus modulates neurotransmitter release. METHODOLOGY/PRINCIPAL FINDINGS: Using the whole-cell patch-clamp technique we found that caffeine (20 mM reversibly increased the frequency and decreased the amplitude of miniature excitatory postsynaptic currents (mEPSCs in neocortical neurons. The increase in mEPSC frequency is consistent with a presynaptic mechanism. Caffeine also reduced exogenously applied glutamate-activated currents, confirming a separate postsynaptic action. This inhibition developed in tens of milliseconds, consistent with block of channel currents. Caffeine (20 mM did not reduce currents activated by exogenous NMDA, indicating that caffeine block is specific to non-NMDA type glutamate receptors. CONCLUSIONS/SIGNIFICANCE: Caffeine-induced inhibition of mEPSC amplitude occurs through postsynaptic block of non-NMDA type ionotropic glutamate receptors. Caffeine thus has both pre and postsynaptic sites of action at excitatory synapses.

Endothelial Nitric Oxide Synthase Gene Polymorphism (G894T and Diabetes Mellitus (Type II among South Indians

Directory of Open Access Journals (Sweden)

T. Angeline

2011-01-01

Full Text Available The objective of the study is to find out whether the endothelial nitric oxide synthase (eNOS G894T single-nucleotide polymorphism is associated with type 2 diabetes mellitus in South Indian (Tamil population. A total number of 260 subjects comprising 100 type 2 diabetic mellitus patients and 160 healthy individuals with no documented history of diabetes were included for the study. DNA was isolated, and eNOS G894T genotyping was performed using the polymerase chain reaction followed by restriction enzyme analysis using Ban II. The genotype distribution in patients and controls were compatible with the Hardy-Weinberg expectations (P>0.05. Odds ratio indicates that the occurrence of mutant genotype (GT/TT was 7.2 times (95% CI = 4.09–12.71 more frequent in the cases than in controls. Thus, the present study demonstrates that there is an association of endothelial nitric oxide synthase gene (G894T polymorphism with diabetes mellitus among South Indians.

A 31 bp VNTR in the cystathionine beta-synthase (CBS) gene is associated with reduced CBS activity and elevated post-load homocysteine levels.

NARCIS (Netherlands)

Lievers, K.J.; Kluijtmans, L.A.J.; Heil, S.G.; Boers, G.H.J.; Verhoef, P.; Oppenraaij-Emmerzaal, D. van; Heijer, M. den; Trijbels, J.M.F.; Blom, H.J.

2001-01-01

Molecular defects in genes encoding enzymes involved in homocysteine metabolism may account for mild hyperhomocysteinaemia, an independent and graded risk factor for cardiovascular disease (CVD). Although heterozygosity for cystathionine beta-synthase (CBS) deficiency has been excluded as a major

Caffeine reduces dipyridamole-induced myocardial ischemia

International Nuclear Information System (INIS)

Smits, P.; Aengevaeren, W.R.; Corstens, F.H.; Thien, T.

1989-01-01

The mechanism of action of coronary vasodilation after dipyridamole may be based on inhibition of cellular uptake of circulating endogenous adenosine. Since caffeine has been reported to be a competitive antagonist of adenosine we studied the effect of caffeine on the outcome of dipiridamole- 201 Tl cardiac imaging in one patient. During caffeine abstinence dipyridamole induced myocardial ischemia with down-slope ST depressions on the ECG, and reversible perfusion defects on the scintigrams. When the test was repeated 1 wk later on similar conditions, but now shortly after infusion of caffeine (4 mg/kg), the ECG showed nodepressions, and the scintigrams only slight signs of ischemia. We conclude that when caffeine abstinence is not sufficient, the widespread use of coffee and related products may be responsible for false-negative findings in dipyridamole-201Tl cardiac imaging

Caffeine reduces dipyridamole-induced myocardial ischemia

Energy Technology Data Exchange (ETDEWEB)

Smits, P.; Aengevaeren, W.R.; Corstens, F.H.; Thien, T. (Univ. of Nijmegen (Netherlands))

1989-10-01

The mechanism of action of coronary vasodilation after dipyridamole may be based on inhibition of cellular uptake of circulating endogenous adenosine. Since caffeine has been reported to be a competitive antagonist of adenosine we studied the effect of caffeine on the outcome of dipiridamole-{sup 201}Tl cardiac imaging in one patient. During caffeine abstinence dipyridamole induced myocardial ischemia with down-slope ST depressions on the ECG, and reversible perfusion defects on the scintigrams. When the test was repeated 1 wk later on similar conditions, but now shortly after infusion of caffeine (4 mg/kg), the ECG showed nodepressions, and the scintigrams only slight signs of ischemia. We conclude that when caffeine abstinence is not sufficient, the widespread use of coffee and related products may be responsible for false-negative findings in dipyridamole-201Tl cardiac imaging.

HPLC determination of caffeine in coffee beverage

Science.gov (United States)

Fajara, B. E. P.; Susanti, H.

2017-11-01

Coffee is the second largest beverage which is consumed by people in the world, besides the water. One of the compounds which contained in coffee is caffeine. Caffeine has the pharmacological effect such as stimulating the central nervous system. The purpose of this study is to determine the level of caffeine in coffee beverages with HPLC method. Three branded coffee beverages which include in 3 of Top Brand Index 2016 Phase 2 were used as samples. Qualitative analysis was performed by Parry method, Dragendorff reagent, and comparing the retention time between sample and caffeine standard. Quantitative analysis was done by HPLC method with methanol-water (95:5v/v) as mobile phase and ODS as stationary phasewith flow rate 1 mL/min and UV 272 nm as the detector. The level of caffeine data was statistically analyzed using Anova at 95% confidence level. The Qualitative analysis showed that the three samples contained caffeine. The average of caffeine level in coffee bottles of X, Y, and Z were 138.048 mg/bottle, 109.699 mg/bottle, and 147.669 mg/bottle, respectively. The caffeine content of the three coffee beverage samples are statistically different (pcoffee beverage samples were not meet the requirements set by the Indonesian Standard Agency of 50 mg/serving.

Creatine and Caffeine: Considerations for Concurrent Supplementation.

Science.gov (United States)

Trexler, Eric T; Smith-Ryan, Abbie E

2015-12-01

Nutritional supplementation is a common practice among athletes, with creatine and caffeine among the most commonly used ergogenic aids. Hundreds of studies have investigated the ergogenic potential of creatine supplementation, with consistent improvements in strength and power reported for exercise bouts of short duration (≤ 30 s) and high intensity. Caffeine has been shown to improve endurance exercise performance, but results are mixed in the context of strength and sprint performance. Further, there is conflicting evidence from studies comparing the ergogenic effects of coffee and caffeine anhydrous supplementation. Previous research has identified independent mechanisms by which creatine and caffeine may improve strength and sprint performance, leading to the formulation of multi-ingredient supplements containing both ingredients. Although scarce, research has suggested that caffeine ingestion may blunt the ergogenic effect of creatine. While a pharmacokinetic interaction is unlikely, authors have suggested that this effect may be explained by opposing effects on muscle relaxation time or gastrointestinal side effects from simultaneous consumption. The current review aims to evaluate the ergogenic potential of creatine and caffeine in the context of high-intensity exercise. Research directly comparing coffee and caffeine anhydrous is discussed, along with previous studies evaluating the concurrent supplementation of creatine and caffeine.

Effects of Caffeine on Auditory Brainstem Response

Directory of Open Access Journals (Sweden)

Saleheh Soleimanian

2008-06-01

Full Text Available Background and Aim: Blocking of the adenosine receptor in central nervous system by caffeine can lead to increasing the level of neurotransmitters like glutamate. As the adenosine receptors are present in almost all brain areas like central auditory pathway, it seems caffeine can change conduction in this way. The purpose of this study was to evaluate the effects of caffeine on latency and amplitude of auditory brainstem response(ABR.Materials and Methods: In this clinical trial study 43 normal 18-25 years old male students were participated. The subjects consumed 0, 2 and 3 mg/kg BW caffeine in three different sessions. Auditory brainstem responses were recorded before and 30 minute after caffeine consumption. The results were analyzed by Friedman and Wilcoxone test to assess the effects of caffeine on auditory brainstem response.Results: Compared to control group the latencies of waves III,V and I-V interpeak interval of the cases decreased significantly after 2 and 3mg/kg BW caffeine consumption. Wave I latency significantly decreased after 3mg/kg BW caffeine consumption(p<0.01. Conclusion: Increasing of the glutamate level resulted from the adenosine receptor blocking brings about changes in conduction in the central auditory pathway.

Isolation and expression of two polyketide synthase genes from Trichoderma harzianum 88 during mycoparasitism.

Science.gov (United States)

Yao, Lin; Tan, Chong; Song, Jinzhu; Yang, Qian; Yu, Lijie; Li, Xinling

2016-01-01

Metabolites of mycoparasitic fungal species such as Trichoderma harzianum 88 have important biological roles. In this study, two new ketoacyl synthase (KS) fragments were isolated from cultured Trichoderma harzianum 88 mycelia using degenerate primers and analysed using a phylogenetic tree. The gene fragments were determined to be present as single copies in Trichoderma harzianum 88 through southern blot analysis using digoxigenin-labelled KS gene fragments as probes. The complete sequence analysis in formation of pksT-1 (5669bp) and pksT-2 (7901bp) suggests that pksT-1 exhibited features of a non-reducing type I fungal PKS, whereas pksT-2 exhibited features of a highly reducing type I fungal PKS. Reverse transcription polymerase chain reaction indicated that the isolated genes are differentially regulated in Trichoderma harzianum 88 during challenge with three fungal plant pathogens, which suggests that they participate in the response of Trichoderma harzianum 88 to fungal plant pathogens. Furthermore, disruption of the pksT-2 encoding ketosynthase-acyltransferase domains through Agrobacterium-mediated gene transformation indicated that pksT-2 is a key factor for conidial pigmentation in Trichoderma harzianum 88. Copyright © 2016 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Effects and mechanisms of caffeine to improve immunological and metabolic abnormalities in diet-induced obese rats.

Science.gov (United States)

Liu, Chih-Wei; Tsai, Hung-Cheng; Huang, Chia-Chang; Tsai, Chang-Youh; Su, Yen-Bo; Lin, Ming-Wei; Lee, Kuei-Chuan; Hsieh, Yun-Cheng; Li, Tzu-Hao; Huang, Shiang-Fen; Yang, Ying-Ying; Hou, Ming-Chih; Lin, Han-Chieh; Lee, Fa-Yauh; Lee, Shou-Dong

2018-05-01

In obesity, there are no effective therapies for parallel immune and metabolic abnormalities, including systemic/tissue insulin-resistance/inflammation, adiposity and hepatic steatosis. Caffeine has anti-inflammation, antihepatic steatosis, and anti-insulin resistance effects. In this study, we evaluated the effects and molecular mechanisms of 6 wk of caffeine treatment (HFD-caf) on immunological and metabolic abnormalities of high-fat diet (HFD)-induced obese rats. Compared with HFD vehicle (HFD-V) rats, in HFD-caf rats the suppressed circulating immune cell inflammatory [TNFα, MCP-1, IL-6, intercellular adhesion molecule 1 (ICAM-1), and nitrite] profiles were accompanied by decreased liver, white adipose tissue (WAT), and muscle macrophages and their intracellular cytokine levels. Metabolically, the increase in metabolic rates reduced lipid accumulation in various tissues, resulting in reduced adiposity, lower fat mass, decreased body weight, amelioration of hepatic steatosis, and improved systemic/muscle insulin resistance. Further mechanistic approaches revealed an upregulation of tissue lipogenic [(SREBP1c, fatty acid synthase, acetyl-CoA carboxylase)/insulin-sensitizing (GLUT4 and p-IRS1)] markers in HFD-caf rats. Significantly, ex vivo experiments revealed that the cytokine release by the cocultured peripheral blood mononuclear cell (monocyte) and WAT (adipocyte), which are known to stimulate macrophage migration and hepatocyte lipogenesis, were lower in HFD-V groups than HFD-caf groups. Caffeine treatment simultaneously ameliorates immune and metabolic pathogenic signals present in tissue to normalize immunolgical and metabolic abnormalities found in HFD-induced obese rats.

Determination of CaffeineIn Beverages: A Review

OpenAIRE

Igelige Gerald; David Ebuka Arthur; Adebiyi Adedayo

2014-01-01

Caffeine is a well-known stimulant which is added as an ingredient to various carbonated soft drinks. Caffeine has drawn more attention due to its physiological effects beyond that of its stimulatory effect. Consumers are interested in knowing the exact amounts of caffeine existing in beverages. However, limited data exist, especially for store brand beverages. Therefore, it is pertinent to review the various methods that will effectively determine the caffeine contents in different carbonate...

Variation in caffeine concentration in single coffee beans.

Science.gov (United States)

Fox, Glen P; Wu, Alex; Yiran, Liang; Force, Lesleigh

2013-11-13

Twenty-eight coffee samples from around the world were tested for caffeine levels to develop near-infrared reflectance spectroscopy (NIRS) calibrations for whole and ground coffee. Twenty-five individual beans from five of those coffees were used to develop a NIRS calibration for caffeine concentration in single beans. An international standard high-performance liquid chromatography method was used to analyze for caffeine content. Coffee is a legal stimulant and possesses a number of heath properties. However, there is variation in the level of caffeine in brewed coffee and other caffeinated beverages. Being able to sort beans on the basis of caffeine concentration will improve quality control in the level of caffeine in those beverages. The range in caffeine concentration was from 0.01 mg/g (decaffeinated coffee) to 19.9 mg/g (Italian coffee). The majority of coffees were around 10.0-12.0 mg/g. The NIRS results showed r(2) values for bulk unground and ground coffees were >0.90 with standard errors coffee beans. One application of this calibration could be sorting beans on caffeine concentration to provide greater quality control for high-end markets. Furthermore, bean sorting may open new markets for novel coffee products.

Caffeine products consumption habits of vilnius university students

OpenAIRE

Acus, Edgaras

2017-01-01

A small amount of caffeine in caffeine-containing products helps with stimulating labor activity, but an overdose of caffeine can cause a health hazard, so it is important to pay close attention to the use of caffeine-containing products. The use of psychoactive drugs is very important public health problem, because students attitude to addictive substances can influence their behavior in their family, the labor market and in society in general. Although caffeine is a natural product, but the...

Cloning and sequence analysis of putative type II fatty acid synthase ...

Indian Academy of Sciences (India)

Prakash

Cloning and sequence analysis of putative type II fatty acid synthase genes from Arachis hypogaea L. ... acyl carrier protein (ACP), malonyl-CoA:ACP transacylase, β-ketoacyl-ACP .... Helix II plays a dominant role in the interaction ... main distinguishing features of plant ACPs in plastids and ..... synthase component; J. Biol.

First discovery of two polyketide synthase genes for mitorubrinic acid and mitorubrinol yellow pigment biosynthesis and implications in virulence of Penicillium marneffei.

Directory of Open Access Journals (Sweden)

Patrick C Y Woo

Full Text Available BACKGROUND: The genome of P. marneffei, the most important thermal dimorphic fungus causing respiratory, skin and systemic mycosis in China and Southeast Asia, possesses 23 polyketide synthase (PKS genes and 2 polyketide synthase nonribosomal peptide synthase hybrid (PKS-NRPS genes, which is of high diversity compared to other thermal dimorphic pathogenic fungi. We hypothesized that the yellow pigment in the mold form of P. marneffei could also be synthesized by one or more PKS genes. METHODOLOGY/PRINCIPAL FINDINGS: All 23 PKS and 2 PKS-NRPS genes of P. marneffei were systematically knocked down. A loss of the yellow pigment was observed in the mold form of the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants. Sequence analysis showed that PKS11 and PKS12 are fungal non-reducing PKSs. Ultra high performance liquid chromatography-photodiode array detector/electrospray ionization-quadruple time of flight-mass spectrometry (MS and MS/MS analysis of the culture filtrates of wild type P. marneffei and the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants showed that the yellow pigment is composed of mitorubrinic acid and mitorubrinol. The survival of mice challenged with the pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants was significantly better than those challenged with wild type P. marneffei (P<0.05. There was also statistically significant decrease in survival of pks11 knockdown, pks12 knockdown and pks11pks12 double knockdown mutants compared to wild type P. marneffei in both J774 and THP1 macrophages (P<0.05. CONCLUSIONS/SIGNIFICANCE: The yellow pigment of the mold form of P. marneffei is composed of mitorubrinol and mitorubrinic acid. This represents the first discovery of PKS genes responsible for mitorubrinol and mitorubrinic acid biosynthesis. pks12 and pks11 are probably responsible for sequential use in the biosynthesis of mitorubrinol and mitorubrinic acid

Geranylfarnesyl diphosphate synthase from Methanosarcina mazei: Different role, different evolution

International Nuclear Information System (INIS)

Ogawa, Takuya; Yoshimura, Tohru; Hemmi, Hisashi

2010-01-01

The gene of (all-E) geranylfarnesyl diphosphate synthase that is responsible for the biosynthesis of methanophenazine, an electron carrier utilized for methanogenesis, was cloned from a methanogenic archaeon Methanosarcina mazei Goe1. The properties of the recombinant enzyme and the results of phylogenetic analysis suggest that the enzyme is closely related to (all-E) prenyl diphosphate synthases that are responsible for the biosynthesis of respiratory quinones, rather than to the enzymes involved in the biosynthesis of archaeal membrane lipids, including (all-E) geranylfarnesyl diphosphate synthase from a thermophilic archaeon.

Energy Drinks and the Neurophysiological Impact of Caffeine

OpenAIRE

Persad, Leeana Aarthi Bagwath

2011-01-01

Caffeine is the most widely used psychoactive stimulant with prevalent use across all age groups. It is a naturally occurring substance found in the coffee bean, tea leaf, the kola nut, cocoa bean. Recently there has been an increase in energy drink consumption leading to caffeine abuse, with aggressive marketing and poor awareness on the consequences of high caffeine use. With caffeine consumption being so common, it is vital to know the impact caffeine has on the body, as its effects can in...

Energy drinks and the neurophysiological impacts of caffeine

OpenAIRE

Leeana eBagwath Persad

2011-01-01

Caffeine is the most widely used psychoactive stimulant with prevalent use across all age groups. It is a naturally occurring substance found in the coffee bean, tea leaf, the kola nut, cocoa bean. Recently there has been an increase in energy drink consumption leading to caffeine abuse, with aggressive marketing and poor awareness on the consequences of high caffeine use. With caffeine consumption being so common, it is vital to know the impact caffeine has on the body, as its effects can in...

Caffeine effects on mood and memory.

Science.gov (United States)

Herz, R S

1999-09-01

The purpose of the present research was to assess whether a psychoactive dose of caffeine would have differential affects on the mood dimensions of arousal versus feelings of pleasantness and whether these mood alterations would influence memory either by (1) the experience of arousal at learning and/or (2) altered and congruent mood states at learning and recall. To address these questions, the administration of 5 mg/kg caffeine or placebo at learning and retrieval sessions was manipulated and subjects' mood was evaluated by several different self-report measures. Sixteen words were incidentally studied during the learning session and memory was evaluated by the number of words correctly recalled at the retrieval session two days later. Results revealed that caffeine reliably increased arousal, but did not affect any emotion dimensions related to feelings of pleasure. Subjects who received caffeine at learning and retrieval were also in equivalent mood states at both sessions. Moreover, caffeine did not produce any effects on memory; thus, neither hypothesis concerning the influence of arousal on memory was supported. These data show that caffeine is a useful method for manipulating arousal in the laboratory without influencing feelings of pleasantness or learning and memory performance.

Temporal patterns of caffeine intake in the United States.

Science.gov (United States)

Martyn, Danika; Lau, Annette; Richardson, Philip; Roberts, Ashley

2018-01-01

To investigate whether caffeine intake among adolescents and adults in the U.S. varies across the week or throughout the day, data from a 7-day online beverage consumption survey (2010-2011) were analyzed. Mean (206.8-213.0 mg/day) and 90th percentile (437.4-452.6 mg/day) daily caffeine intakes among consumers 13 years and older were relatively constant across the week with no marked difference among weekdays versus weekend days. Percent consumers of caffeinated beverages likewise remained stable across the week. Mean daily caffeine intake for coffee and energy drink consumers 13 years and older was higher than contributions for tea and carbonated soft drink consumers. Caffeinated beverage consumers (13 + yrs) consumed most of their caffeine in the morning (61% versus 21% and 18% in the afternoon and evening) which was driven by coffee. Caffeinated beverage consumption patterns among adolescents (13-17 yrs) - who typically consume less daily caffeine - were more evenly distributed throughout the day. These findings provide insight into U.S. temporal caffeine consumption patterns among specific caffeinated beverage consumers and different age brackets. These data suggest that while caffeine intakes do not vary from day-to-day, mornings generally drive the daily caffeine intake of adults and is predominantly attributed to coffee. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Caffeine Use Disorder: A Comprehensive Review and Research Agenda.

Science.gov (United States)

Meredith, Steven E; Juliano, Laura M; Hughes, John R; Griffiths, Roland R

2013-09-01

Caffeine is the most commonly used drug in the world. Although consumption of low to moderate doses of caffeine is generally safe, an increasing number of clinical studies are showing that some caffeine users become dependent on the drug and are unable to reduce consumption despite knowledge of recurrent health problems associated with continued use. Thus, the World Health Organization and some health care professionals recognize caffeine dependence as a clinical disorder. In this comprehensive literature review, we summarize published research on the biological evidence for caffeine dependence; we provide a systematic review of the prevalence of caffeine dependence and rates of endorsement of clinically meaningful indicators of distress and functional impairment among habitual caffeine users; we discuss the diagnostic criteria for Caffeine Use Disorder-a condition for further study included in the Diagnostic and Statistical Manual of Mental Disorders ( 5 th ed .); and we outline a research agenda to help guide future clinical, epidemiological, and genetic investigations of caffeine dependence. Numerous controlled laboratory investigations reviewed in this article show that caffeine produces behavioral and physiological effects similar to other drugs of dependence. Moreover, several recent clinical studies indicate that caffeine dependence is a clinically meaningful disorder that affects a nontrivial proportion of caffeine users. Nevertheless, more research is needed to determine the reliability, validity, and prevalence of this clinically important health problem.

Valencene synthase from the heartwood of Nootka cypress (Callitropsis nootkatensis) for biotechnological production of valencene.

Science.gov (United States)

Beekwilder, Jules; van Houwelingen, Adèle; Cankar, Katarina; van Dijk, Aalt D J; de Jong, René M; Stoopen, Geert; Bouwmeester, Harro; Achkar, Jihane; Sonke, Theo; Bosch, Dirk

2014-02-01

Nootkatone is one of the major terpenes in the heartwood of the Nootka cypress Callitropsis nootkatensis. It is an oxidized sesquiterpene, which has been postulated to be derived from valencene. Both valencene and nootkatone are used for flavouring citrus beverages and are considered among the most valuable terpenes used at commercial scale. Functional evaluation of putative terpene synthase genes sourced by large-scale EST sequencing from Nootka cypress wood revealed a valencene synthase gene (CnVS). CnVS expression in different tissues from the tree correlates well with nootkatone content, suggesting that CnVS represents the first dedicated gene in the nootkatone biosynthetic pathway in C. nootkatensis The gene belongs to the gymnosperm-specific TPS-d subfamily of terpenes synthases and its protein sequence has low similarity to known citrus valencene synthases. In vitro, CnVS displays high robustness under different pH and temperature regimes, potentially beneficial properties for application in different host and physiological conditions. Biotechnological production of sesquiterpenes has been shown to be feasible, but productivity of microbial strains expressing valencene synthase from Citrus is low, indicating that optimization of valencene synthase activity is needed. Indeed, expression of CnVS in Saccharomyces cerevisiae indicated potential for higher yields. In an optimized Rhodobacter sphaeroides strain, expression of CnVS increased valencene yields 14-fold to 352 mg/L, bringing production to levels with industrial potential. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Caffeine addiction: Need for awareness and research and regulatory measures.

Science.gov (United States)

Jain, Shobhit; Srivastava, Adya Shanker; Verma, Raghunath Prasad; Maggu, Gaurav

2017-02-04

Caffeine consumption has been constantly growing in India especially among children and youngsters. Addictive potential of caffeine has long been reported, still there is lack of awareness about caffeine abuse in India. There is an intense need for appropriate public health regulatory measures and awareness about addictive potential & harms related to caffeine. To the best of our knowledge this is first case from India highlighting several important issues with progressive caffeine abuse resulting in dependence leading to physical, psychological, academic and social consequences; psychotic symptoms during intoxication; predisposing factors as impulsivity and novelty seeking traits in pre-morbid personality; psychosis in family; poor awareness of health hazards even among medical professionals. Widely variable caffeine containing products are available but caffeine content or its safety limit is not mentioned on caffeine products in India. Due to harmful consequences, legal availability to children, growing consumption of caffeine products, it is utmost essential to recognize caffeine as addictive substance and impose regulatory measures on sale, advertisement, maximum caffeine content, health consequences and safety limits of caffeine containing products. Further school teachers, parents and medical practitioners need to be made aware of health hazards of caffeine. Caffeine use shall always be enquired from patients presenting with psychiatric complaints. Further research and survey are required on caffeine use and related problems. Copyright © 2017 Elsevier B.V. All rights reserved.

Identification, Functional Characterization, and Evolution of Terpene Synthases from a Basal Dicot1[OPEN

Science.gov (United States)

Yahyaa, Mosaab; Matsuba, Yuki; Brandt, Wolfgang; Doron-Faigenboim, Adi; Bar, Einat; McClain, Alan; Davidovich-Rikanati, Rachel; Lewinsohn, Efraim; Pichersky, Eran; Ibdah, Mwafaq

2015-01-01

Bay laurel (Laurus nobilis) is an agriculturally and economically important dioecious tree in the basal dicot family Lauraceae used in food and drugs and in the cosmetics industry. Bay leaves, with their abundant monoterpenes and sesquiterpenes, are used to impart flavor and aroma to food, and have also drawn attention in recent years because of their potential pharmaceutical applications. To identify terpene synthases (TPSs) involved in the production of these volatile terpenes, we performed RNA sequencing to profile the transcriptome of L. nobilis leaves. Bioinformatic analysis led to the identification of eight TPS complementary DNAs. We characterized the enzymes encoded by three of these complementary DNAs: a monoterpene synthase that belongs to the TPS-b clade catalyzes the formation of mostly 1,8-cineole; a sesquiterpene synthase belonging to the TPS-a clade catalyzes the formation of mainly cadinenes; and a diterpene synthase of the TPS-e/f clade catalyzes the formation of geranyllinalool. Comparison of the sequences of these three TPSs indicated that the TPS-a and TPS-b clades of the TPS gene family evolved early in the evolution of the angiosperm lineage, and that geranyllinalool synthase activity is the likely ancestral function in angiosperms of genes belonging to an ancient TPS-e/f subclade that diverged from the kaurene synthase gene lineages before the split of angiosperms and gymnosperms. PMID:26157114

Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

Directory of Open Access Journals (Sweden)

Hongxia Miao

Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

Science.gov (United States)

Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

2014-01-01

Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

Functional Characterization of Sesquiterpene Synthase from Polygonum minus

Directory of Open Access Journals (Sweden)

Su-Fang Ee

2014-01-01

Full Text Available Polygonum minus is an aromatic plant, which contains high abundance of terpenoids, especially the sesquiterpenes C15H24. Sesquiterpenes were believed to contribute to the many useful biological properties in plants. This study aimed to functionally characterize a full length sesquiterpene synthase gene from P. minus. P. minus sesquiterpene synthase (PmSTS has a complete open reading frame (ORF of 1689 base pairs encoding a 562 amino acid protein. Similar to other sesquiterpene synthases, PmSTS has two large domains: the N-terminal domain and the C-terminal metal-binding domain. It also consists of three conserved motifs: the DDXXD, NSE/DTE, and RXR. A three-dimensional protein model for PmSTS built clearly distinguished the two main domains, where conserved motifs were highlighted. We also constructed a phylogenetic tree, which showed that PmSTS belongs to the angiosperm sesquiterpene synthase subfamily Tps-a. To examine the function of PmSTS, we expressed this gene in Arabidopsis thaliana. Two transgenic lines, designated as OE3 and OE7, were further characterized, both molecularly and functionally. The transgenic plants demonstrated smaller basal rosette leaves, shorter and fewer flowering stems, and fewer seeds compared to wild type plants. Gas chromatography-mass spectrometry analysis of the transgenic plants showed that PmSTS was responsible for the production of β-sesquiphellandrene.

Caffeine use and dependence in adolescents: one-year follow-up.

Science.gov (United States)

Oberstar, Joel V; Bernstein, Gail A; Thuras, Paul D

2002-01-01

The objectives were to conduct a 1-year follow-up of daily caffeine-using adolescents to further describe caffeine dependence symptoms and to determine whether caffeine dependence is associated with other substance dependence disorders. Twenty-one of 36 (58.3%) adolescents who participated in a study of caffeine dependence returned for follow-up. The previous study was a case series of adolescents who consumed caffeine daily and met some Diagnostic and Statistical Manual of Mental Disorders (fourth edition) substance dependence criteria as applied to caffeine. At follow-up, caffeine consumption from beverages was 179.9 +/- 151.8 mg/day. Of the 21 teenagers, 23.8% (n = 5) met criteria for caffeine dependence. Four of these participants developed caffeine dependence during the follow-up period. Other substance dependence disorders were not overrepresented in the caffeine dependent group compared to the caffeine nondependent group. The most commonly reported withdrawal symptoms in dependent teenagers (at baseline and follow-up combined) were feeling drowsy/tired, fatigued, or sluggish/slowed down (83.3% each) and headache (75.0%). Caffeine dependence occurs in some adolescents who drink caffeine daily and is marked by symptoms similar to those found in adults.

Antibacterial activity of caffeine against plant pathogenic bacteria.

Science.gov (United States)

Sledz, Wojciech; Los, Emilia; Paczek, Agnieszka; Rischka, Jacek; Motyka, Agata; Zoledowska, Sabina; Piosik, Jacek; Lojkowska, Ewa

2015-01-01

The objective of the present study was to evaluate the antibacterial properties of a plant secondary metabolite - caffeine. Caffeine is present in over 100 plant species. Antibacterial activity of caffeine was examined against the following plant-pathogenic bacteria: Ralstonia solanacearum (Rsol), Clavibacter michiganesis subsp. sepedonicus (Cms), Dickeya solani (Dsol), Pectobacterium atrosepticum (Pba), Pectobacterium carotovorum subsp. carotovorum (Pcc), Pseudomonas syringae pv. tomato (Pst), and Xanthomonas campestris subsp. campestris (Xcc). MIC and MBC values ranged from 5 to 20 mM and from 43 to 100 mM, respectively. Caffeine increased the bacterial generation time of all tested species and caused changes in cell morphology. The influence of caffeine on the synthesis of DNA, RNA and proteins was investigated in cultures of plant pathogenic bacteria with labelled precursors: [(3)H]thymidine, [(3)H]uridine or (14)C leucine, respectively. RNA biosynthesis was more affected than DNA or protein biosynthesis in bacterial cells treated with caffeine. Treatment of Pba with caffeine for 336 h did not induce resistance to this compound. Caffeine application reduced disease symptoms caused by Dsol on chicory leaves, potato slices, and whole potato tubers. The data presented indicate caffeine as a potential tool for the control of diseases caused by plant-pathogenic bacteria, especially under storage conditions.

Caffeine, coffee, and appetite control: a review.

Science.gov (United States)

Schubert, Matthew M; Irwin, Christopher; Seay, Rebekah F; Clarke, Holly E; Allegro, Deanne; Desbrow, Ben

2017-12-01

Coffee and caffeine consumption has global popularity. However, evidence for the potential of these dietary constituents to influence energy intake, gut physiology, and appetite perceptions remains unclear. The purpose of this review was to examine the evidence regarding coffee and caffeine's influence on energy intake and appetite control. The literature was examined for studies that assessed the effects of caffeine and coffee on energy intake, gastric emptying, appetite-related hormones, and perceptual measures of appetite. The literature review indicated that coffee administered 3-4.5 h before a meal had minimal influence on food and macronutrient intake, while caffeine ingested 0.5-4 h before a meal may suppress acute energy intake. Evidence regarding the influence of caffeine and coffee on gastric emptying, appetite hormones, and appetite perceptions was equivocal. The influence of covariates such as genetics of caffeine metabolism and bitter taste phenotype remain unknown; longer controlled studies are needed.

Energy drink consumption and impact on caffeine risk.

Science.gov (United States)

Thomson, Barbara M; Campbell, Donald M; Cressey, Peter; Egan, Ursula; Horn, Beverley

2014-01-01

The impact of caffeine from energy drinks occurs against a background exposure from naturally occurring caffeine (coffee, tea, cocoa and foods containing these ingredients) and caffeinated beverages (kola-type soft drinks). Background caffeine exposure, excluding energy drinks, was assessed for six New Zealand population groups aged 15 years and over (n = 4503) by combining concentration data for 53 caffeine-containing foods with consumption information from the 2008/09 New Zealand Adult Nutrition Survey (ANS). Caffeine exposure for those who consumed energy drinks (n = 138) was similarly assessed, with inclusion of energy drinks. Forty-seven energy drink products were identified on the New Zealand market in 2010. Product volumes ranged from 30 to 600 ml per unit, resulting in exposures of 10-300 mg caffeine per retail unit consumed. A small percentage, 3.1%, of New Zealanders reported consuming energy drinks, with most energy drink consumers (110/138) drinking one serving per 24 h. The maximum number of energy drinks consumed per 24 h was 14 (total caffeine of 390 mg). A high degree of brand loyalty was evident. Since only a minor proportion of New Zealanders reported consuming energy drinks, a greater number of New Zealanders exceeded a potentially adverse effect level (AEL) of 3 mg kg(-1) bw day(-1) for caffeine from caffeine-containing foods than from energy drinks. Energy drink consumption is not a risk at a population level because of the low prevalence of consumption. At an individual level, however, teenagers, adults (20-64 years) and females (16-44 years) were more likely to exceed the AEL by consuming energy drinks in combination with caffeine-containing foods.

Cloning and expression of pineapple sucrose- phosphate synthase ...

African Journals Online (AJOL)

hope&shola

2010-12-06

Dec 6, 2010 ... phosphate; EDTA, ethylene diamine tetraacetic acid; Ivr, invertase; SS .... phenolics, tannins and artifacts due to differences of tissue composition ..... Banana sucrose-phosphate synthase gene expression during fruit ripening.

Impact of caffeine and coffee on our health.

Science.gov (United States)

Gonzalez de Mejia, Elvira; Ramirez-Mares, Marco Vinicio

2014-10-01

Coffee is the most frequently consumed caffeine-containing beverage. The caffeine in coffee is a bioactive compound with stimulatory effects on the central nervous system and a positive effect on long-term memory. Although coffee consumption has been historically linked to adverse health effects, new research indicates that coffee consumption may be beneficial. Here we discuss the impact of coffee and caffeine on health and bring attention to the changing caffeine landscape that includes new caffeine-containing energy drinks and supplements, often targeting children and adolescents. Copyright © 2014 Elsevier Ltd. All rights reserved.

Molecular cloning and expression of a novel trehalose synthase gene from Enterobacter hormaechei

Directory of Open Access Journals (Sweden)

Yue Ming

2009-06-01

Full Text Available Abstract Background Trehalose synthase (TreS which converts maltose to trehalose is considered to be a potential biocatalyst for trehalose production. This enzymatic process has the advantage of simple reaction and employs an inexpensive substrate. Therefore, new TreS producing bacteria with suitable enzyme properties are expected to be isolated from extreme environment. Results Six TreS producing strains were isolated from a specimen obtained from soil of the Tibetan Plateau using degenerate PCR. A novel treS gene from Enterobacter hormaechei was amplified using thermal asymmetric interlaced PCR. The gene contained a 1626 bp open reading frame encoding 541 amino acids. The gene was expressed in Escherichia coli, and the recombinant TreS was purified and characterized. The purified TreS had a molecular mass of 65 kDa and an activity of 18.5 U/mg. The optimum temperature and pH for the converting reaction were 37°C and 6, respectively. Hg2+, Zn2+, Cu2+and SDS inhibited the enzyme activity at different levels whereas Mn2+ showed an enhancing effect by 10%. Conclusion In this study, several TreS producing strains were screened from a source of soil bacteria. The characterization of the recombinant TreS of Enterobacter hormaechei suggested its potential application. Consequently, a strategy for isolation of TreS producing strains and cloning of novel treS genes from natural sources was demonstrated.

Expectation of having consumed caffeine can improve performance and mood.

Science.gov (United States)

Dawkins, Lynne; Shahzad, Fatima-Zahra; Ahmed, Suada S; Edmonds, Caroline J

2011-12-01

We explored whether caffeine, and expectation of having consumed caffeine, affects attention, reward responsivity and mood using double-blinded methodology. 88 participants were randomly allocated to 'drink-type' (caffeinated/decaffeinated coffee) and 'expectancy' (told caffeinated/told decaffeinated coffee) manipulations. Both caffeine and expectation of having consumed caffeine improved attention and psychomotor speed. Expectation enhanced self-reported vigour and reward responsivity. Self-reported depression increased at post-drink for all participants, but less in those receiving or expecting caffeine. These results suggest caffeine expectation can affect mood and performance but do not support a synergistic effect. Copyright © 2011 Elsevier Ltd. All rights reserved.

The pH dependent Raman spectroscopic study of caffeine

Science.gov (United States)

Kang, Jian; Gu, Huaimin; Zhong, Liang; Hu, Yongjun; Liu, Fang

2011-02-01

First of all the surface enhanced Raman spectroscopy (SERS) and normal Raman spectra of caffeine aqueous solution were obtained at different pH values. In order to obtain the detailed vibrational assignments of the Raman spectroscopy, the geometry of caffeine molecule was optimized by density functional theory (DFT) calculation. By comparing the SERS of caffeine with its normal spectra at different pH values; it is concluded that pH value can dramatically affect the SERS of caffeine, but barely affect the normal Raman spectrum of caffeine aqueous solution. It can essentially affect the reorientation of caffeine molecule to the Ag colloid surface, but cannot impact the vibration of functional groups and chemical bonds in caffeine molecule.

Cigarette, alcohol, and caffeine consumption

DEFF Research Database (Denmark)

Rasch, Vibeke

2003-01-01

OBJECTIVE: To study the association between cigarette, alcohol, and caffeine consumption and the occurrence of spontaneous abortion. METHODS: The study population consisted of 330 women with spontaneous abortion and 1168 pregnant women receiving antenatal care. A case-control design was utilized;...... units alcohol per week and 375 mg or more caffeine per day during pregnancy may increase the risk of spontaneous abortion.......OBJECTIVE: To study the association between cigarette, alcohol, and caffeine consumption and the occurrence of spontaneous abortion. METHODS: The study population consisted of 330 women with spontaneous abortion and 1168 pregnant women receiving antenatal care. A case-control design was utilized......; cases were defined as women with a spontaneous abortion in gestational week 6-16 and controls as women with a live fetus in gestational week 6-16. The variables studied comprise age, parity, occupational situation, cigarette, alcohol, and caffeine consumption. The association between cigarette, alcohol...

Expectation of having consumed caffeine can improve performance and mood

OpenAIRE

Dawkins, Lynne; Shahzad, Fatima-Zahra; Ahmed, Suada S.; Edmonds, Caroline J.

2011-01-01

We explored whether caffeine, and expectation of having consumed caffeine, affects attention, reward responsivity and mood using double-blinded methodology. 88 participants were randomly allocated to ‘drink-type’ (caffeinated/decaffeinated coffee) and ‘expectancy’ (told caffeinated/told decaffeinated coffee) manipulations. Both caffeine and expectation of having consumed caffeine improved attention and psychomotor speed. Expectation enhanced self-reported vigour and reward responsivity. Self-...

[Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

Science.gov (United States)

Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

2010-01-01

Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

Low-dose caffeine physical dependence in humans.

Science.gov (United States)

Griffiths, R R; Evans, S M; Heishman, S J; Preston, K L; Sannerud, C A; Wolf, B; Woodson, P P

1990-12-01

This study investigated the effects of terminating low dose levels of caffeine (100 mg/day) in 7 normal humans. Substitution of placebo capsules for caffeine capsules occurred under double-blind conditions while subjects rated various dimensions of their mood and behavior. In the first phase of the study, substitution of placebo for 12 consecutive days resulted in an orderly withdrawal syndrome in 4 subjects which peaked on days 1 or 2 and progressively decreased toward prewithdrawal levels over about 1 week. Data from the remaining three subjects provided no evidence of withdrawal. In the second phase of the study, the generality of the withdrawal effect was examined by repeatedly substituting placebo for 100 mg/day of caffeine for 1-day periods separated by an average of 9 days. Despite differences within and across subjects with respect to the presence, nature and magnitude of symptoms, each of the seven subjects demonstrated a statistically significant withdrawal effect. Although the phenomenon of caffeine withdrawal has been described previously, the present report documents that the incidence of caffeine withdrawal is higher (100% of subjects), the daily dose level at which withdrawal occurs is lower (roughly equivalent to the amount of caffeine in a single cup of strong brewed coffee or 3 cans of caffeinated soft drink) and the range of symptoms experienced is broader (including headache, fatigue and other dysphoric mood changes, muscle pain/stiffness, flu-like feelings, nausea/vomiting and craving for caffeine) than heretofore recognized.

Air pollution alters brain and pituitary endothelin-1 and inducible nitric oxide synthase gene expression.

Science.gov (United States)

Thomson, Errol M; Kumarathasan, Prem; Calderón-Garcidueñas, Lilian; Vincent, Renaud

2007-10-01

Recent work suggests that air pollution is a risk factor for cerebrovascular and neurodegenerative disease. Effects of inhaled pollutants on the production of vasoactive factors such as endothelin (ET) and nitric oxide (NO) in the brain may be relevant to disease pathogenesis. Inhaled pollutants increase circulating levels of ET-1 and ET-3, and the pituitary is a potential source of plasma ET, but the effects of pollutants on the expression of ET and NO synthase genes in the brain and pituitary are not known. In the present study, Fischer-344 rats were exposed by nose-only inhalation to particles (0, 5, 50mg/m3 EHC-93), ozone (0, 0.4, 0.8 ppm), or combinations of particles and ozone for 4 h. Real-time reverse transcription polymerase chain reaction was used to measure mRNA levels in the cerebral hemisphere and pituitary 0 and 24 h post-exposure. Ozone inhalation significantly increased preproET-1 but decreased preproET-3 mRNAs in the cerebral hemisphere, while increasing mRNA levels of preproET-1, preproET-3, and the ET-converting enzyme (ECE)-1 in the pituitary. Inducible NO synthase (iNOS) was initially decreased in the cerebral hemisphere after ozone inhalation, but increased 24 h post-exposure. Particles decreased tumour necrosis factor (TNF)-alpha mRNA in the cerebral hemisphere, and both particles and ozone decreased TNF-alpha mRNA in the pituitary. Our results show that ozone and particulate matter rapidly modulate the expression of genes involved in key vasoregulatory pathways in the brain and pituitary, substantiating the notion that inhaled pollutants induce cerebrovascular effects.

Functional Genomics Reveals That a Compact Terpene Synthase Gene Family Can Account for Terpene Volatile Production in Apple1[W

Science.gov (United States)

Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.

2013-01-01

Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

Regulation of cerebrospinal fluid production by caffeine consumption

Directory of Open Access Journals (Sweden)

Yoon Sik

2009-09-01

Full Text Available Abstract Background Caffeine is the most commonly consumed psycho-stimulant in the world. The effects of caffeine on the body have been extensively studied; however, its effect on the structure of the brain has not been investigated to date. Results In the present study we found that the long-term consumption of caffeine can induce ventriculomegaly; this was observed in 40% of the study rats. In the caffeine-treated rats with ventriculomegaly, there was increased production of CSF, associated with the increased expression of Na+, K+-ATPase and increased cerebral blood flow (CBF. In contrast to the chronic effects, acute treatment with caffeine decreased the production of CSF, suggesting 'effect inversion' associated with caffeine, which was mediated by increased expression of the A1 adenosine receptor, in the choroid plexus of rats chronically treated with caffeine. The involvement of the A1 adenosine receptor in the effect inversion of caffeine was further supported by the induction of ventriculomegaly and Na+, K+-ATPase, in A1 agonist-treated rats. Conclusion The results of this study show that long-term consumption of caffeine can induce ventriculomegaly, which is mediated in part by increased production of CSF. Moreover, we also showed that adenosine receptor signaling can regulate the production of CSF by controlling the expression of Na+, K+-ATPase and CBF.

Determination of the caffeine contents of various food items within the Austrian market and validation of a caffeine assessment tool (CAT).

Science.gov (United States)

Rudolph, E; Färbinger, A; König, J

2012-01-01

The caffeine content of 124 products, including coffee, coffee-based beverages, energy drinks, tea, colas, yoghurt and chocolate, were determined using RP-HPLC with UV detection after solid-phase extraction. Highest concentrations of caffeine were found for coffee prepared from pads (755 mg l⁻¹) and regular filtered coffee (659 mg l⁻¹). The total caffeine content of coffee and chocolate-based beverages was between 15 mg l⁻¹ in chocolate milk and 448 mg l⁻¹ in canned ice coffee. For energy drinks the caffeine content varied in a range from 266 to 340 mg l⁻¹. Caffeine concentrations in tea and ice teas were between 13 and 183 mg l⁻¹. Coffee-flavoured yoghurts ranged from 33 to 48 mg kg⁻¹. The caffeine concentration in chocolate and chocolate bars was between 17 mg kg⁻¹ in whole milk chocolate and 551 mg kg⁻¹ in a chocolate with coffee filling. A caffeine assessment tool was developed and validated by a 3-day dietary record (r²= 0.817, p < 0.01) using these analytical data and caffeine saliva concentrations (r²= 0.427, p < 0.01).

Caffeine and sports performance.

Science.gov (United States)

Burke, Louise M

2008-12-01

Athletes are among the groups of people who are interested in the effects of caffeine on endurance and exercise capacity. Although many studies have investigated the effect of caffeine ingestion on exercise, not all are suited to draw conclusions regarding caffeine and sports performance. Characteristics of studies that can better explore the issues of athletes include the use of well-trained subjects, conditions that reflect actual practices in sport, and exercise protocols that simulate real-life events. There is a scarcity of field-based studies and investigations involving elite performers. Researchers are encouraged to use statistical analyses that consider the magnitude of changes, and to establish whether these are meaningful to the outcome of sport. The available literature that follows such guidelines suggests that performance benefits can be seen with moderate amounts (~3 mg.kg-1 body mass) of caffeine. Furthermore, these benefits are likely to occur across a range of sports, including endurance events, stop-and-go events (e.g., team and racquet sports), and sports involving sustained high-intensity activity lasting from 1-60 min (e.g., swimming, rowing, and middle and distance running races). The direct effects on single events involving strength and power, such as lifts, throws, and sprints, are unclear. Further studies are needed to better elucidate the range of protocols (timing and amount of doses) that produce benefits and the range of sports to which these may apply. Individual responses, the politics of sport, and the effects of caffeine on other goals, such as sleep, hydration, and refuelling, also need to be considered.

Relationship between single nucleotide polymorphism of glycogen synthase gene of Pacific oyster Crassostrea gigas and its glycogen content

Science.gov (United States)

Liu, Siwei; Li, Qi; Yu, Hong; Kong, Lingfeng

2017-02-01

Glycogen is important not only for the energy supplementary of oysters, but also for human consumption. High glycogen content can improve the stress survival of oyster. A key enzyme in glycogenesis is glycogen synthase that is encoded by glycogen synthase gene GYS. In this study, the relationship between single nucleotide polymorphisms (SNPs) in coding regions of Crassostrea gigas GYS (Cg-GYS) and individual glycogen content was investigated with 321 individuals from five full-sib families. Single-strand conformation polymorphism (SSCP) procedure was combined with sequencing to confirm individual SNP genotypes of Cg-GYS. Least-square analysis of variance was performed to assess the relationship of variation in glycogen content of C. gigas with single SNP genotype and SNP haplotype. As a consequence, six SNPs were found in coding regions to be significantly associated with glycogen content ( P glycogen content ( P glycogen content and provided molecular biological information for the selective breeding of good quality traits of C. gigas.

Inhibitory effects of caffeine on hippocampal neurogenesis and function.

Science.gov (United States)

Han, Myoung-Eun; Park, Kyu-Hyun; Baek, Sun-Yong; Kim, Bong-Seon; Kim, Jae-Bong; Kim, Hak-Jin; Oh, Sae-Ock

2007-05-18

Caffeine is one of the most extensively consumed psychostimulants in the world. However, compared to short-term effects of caffeine, the long-term effects of caffeine consumption on learning and memory are poorly characterized. The present study found that long-term consumption of low dose caffeine (0.3 g/L) slowed hippocampus-dependent learning and impaired long-term memory. Caffeine consumption for 4 weeks also significantly reduced hippocampal neurogenesis compared to controls. From these results, we concluded that long-term consumption of caffeine could inhibit hippocampus-dependent learning and memory partially through inhibition of hippocampal neurogenesis.

Caffeine exposure during rat brain development causes memory impairment in a sex selective manner that is offset by caffeine consumption throughout life.

Science.gov (United States)

Ardais, Ana Paula; Rocha, Andréia S; Borges, Maurício Felisberto; Fioreze, Gabriela T; Sallaberry, Cássia; Mioranzza, Sabrina; Nunes, Fernanda; Pagnussat, Natália; Botton, Paulo Henrique S; Cunha, Rodrigo A; Porciúncula, Lisiane de Oliveira

2016-04-15

Caffeine is the psychostimulant most consumed worldwide. In moderate doses, it affords a beneficial effect in adults and upon aging, but has a deleterious effect during brain development. We now tested if caffeine consumption by rats (0.1, 0.3, 1.0 g/L in the drinking water, only during active cycle and weekdays) during adulthood could revert the potentially negative effects of caffeine during early life. Thus, we compared caffeine intake starting 15 days before mating and lasting either up to weaning (development) or up to adulthood, on behavior and synaptic proteins in male and female rats. Recognition memory was impaired only in female rats receiving caffeine (0.3 and 1.0 g/L) during development, coincident with increased proBDNF and unchanged BDNF levels in the hippocampus. Caffeine in both treatment regimens caused hyperlocomotion only in male rats, whereas anxiety-related behavior was attenuated in both sexes by caffeine (1.0 g/L) throughout life. Both caffeine treatment regimens decreased GFAP (as an astrocyte marker) and SNAP-25 (as a nerve terminals marker) in the hippocampus from male rats. TrkB receptor was decreased in the hippocampus from both sexes and treatment regimens. These findings revealed that caffeine intake during a specific time window of brain development promotes sex-dependent behavioral outcomes related to modification in BDNF signaling. Furthermore, caffeine throughout life can overcome the deleterious effects of caffeine on recognition memory during brain development in female rats. Copyright © 2016 Elsevier B.V. All rights reserved.

Evaluation of caffeine as a radioprotector in gamma-irradiated C57BL/6N male mice

Energy Technology Data Exchange (ETDEWEB)

Kim, Ji Hyang; Yoon, Yong Dal [Hanyang University, Seoul (Korea, Republic of); Kim, Jin Kyu [KAERI, Taejon (Korea, Republic of)

2002-10-01

Caffeine is the main psychoactive ingredient of coffee, tea, even colas with a high frequency of concurrent use in humans. Caffeine has been recently reported as a scavenger of hydroxyl radical in millimolar levels and a potential radioprotector in chronically exposed rodent. This study was performed to investigate the functional radioprotection of caffeine in gamma-irradiated mice. Eight-week-old male C57BL/6N mice were irradiated with 6.5 Gy. A caffeine treated group was administrated 80 mg/ kg body weight by i.p injection, a single exposure, at 1 hour before irradiation. The remaining mice were kept as sham controls. At 6 hours after irradiation, we measured the body and organ weight, collected serum, and testes were removed and processed for paraffin sections and isolation of total RNA. Hormonal analysis was performed by means of radioimmunoassay (RIA) in serum. Semiquantitative reverse transcription-reverse chain reaction (RT-PCR) was used to evaluate the expression kinetics of the apoptotic genes after irradiation. The weight of body and organ and H-E stained slide did not show a difference between groups. The circulating testosterone significantly decreased in irradiated group. RT-PCR data represented that the expression of Fas antigen, p21, p53, bax, and bcl2 related radiation-induced apoptosis showed the specific patterns comparable to that of caffeine-untreated group. Specially, bax mRNA dramatically increased in irradiated group, except caffeine-treated irradiated. Taken together, caffeine can protect an early apoptotic initiation against gamma radiation and may act as a radioprotector.

Evaluation of caffeine as a radioprotector in gamma-irradiated C57BL/6N male mice

International Nuclear Information System (INIS)

Kim, Ji Hyang; Yoon, Yong Dal; Kim, Jin Kyu

2002-01-01

Caffeine is the main psychoactive ingredient of coffee, tea, even colas with a high frequency of concurrent use in humans. Caffeine has been recently reported as a scavenger of hydroxyl radical in millimolar levels and a potential radioprotector in chronically exposed rodent. This study was performed to investigate the functional radioprotection of caffeine in gamma-irradiated mice. Eight-week-old male C57BL/6N mice were irradiated with 6.5 Gy. A caffeine treated group was administrated 80 mg/ kg body weight by i.p injection, a single exposure, at 1 hour before irradiation. The remaining mice were kept as sham controls. At 6 hours after irradiation, we measured the body and organ weight, collected serum, and testes were removed and processed for paraffin sections and isolation of total RNA. Hormonal analysis was performed by means of radioimmunoassay (RIA) in serum. Semiquantitative reverse transcription-reverse chain reaction (RT-PCR) was used to evaluate the expression kinetics of the apoptotic genes after irradiation. The weight of body and organ and H-E stained slide did not show a difference between groups. The circulating testosterone significantly decreased in irradiated group. RT-PCR data represented that the expression of Fas antigen, p21, p53, bax, and bcl2 related radiation-induced apoptosis showed the specific patterns comparable to that of caffeine-untreated group. Specially, bax mRNA dramatically increased in irradiated group, except caffeine-treated irradiated. Taken together, caffeine can protect an early apoptotic initiation against gamma radiation and may act as a radioprotector

Caffeine, Diabetes, Cognition, and Dementia

NARCIS (Netherlands)

Biessels, Geert Jan

2010-01-01

People with diabetes mellitus are at increased risk of cognitive dysfunction. This review explores the relation between caffeine intake, diabetes, cognition and dementia, focusing on type 2 diabetes (T2DM). Epidemiological studies on caffeine/coffee intake and T2DM risk are reviewed. Next, the

Effects of Smoking Cues on Caffeine Urges in Heavy Smokers and Caffeine Consumers with and without Schizophrenia

OpenAIRE

Adolfo, Amy B.; AhnAllen, Christopher G.; Tidey, Jennifer W.

2008-01-01

Cigarette smoking and caffeine use are established and problematic drug-use behaviors in people with schizophrenia. Associative links between drugs of abuse may occur but the relationship between caffeine use and cigarette smoking has received little attention in schizophrenia. In this cross-cue reactivity laboratory study, we examined the effects of neutral and smoking cues on craving for caffeinated beverages in participants with schizophrenia or schizoaffective disorder (SS; n = 15) and no...

Separating neural and vascular effects of caffeine using simultaneous EEG–FMRI: Differential effects of caffeine on cognitive and sensorimotor brain responses

Science.gov (United States)

Diukova, Ana; Ware, Jennifer; Smith, Jessica E.; Evans, C. John; Murphy, Kevin; Rogers, Peter J.; Wise, Richard G.

2012-01-01

The effects of caffeine are mediated through its non-selective antagonistic effects on adenosine A1 and A2A adenosine receptors resulting in increased neuronal activity but also vasoconstriction in the brain. Caffeine, therefore, can modify BOLD FMRI signal responses through both its neural and its vascular effects depending on receptor distributions in different brain regions. In this study we aim to distinguish neural and vascular influences of a single dose of caffeine in measurements of task-related brain activity using simultaneous EEG–FMRI. We chose to compare low-level visual and motor (paced finger tapping) tasks with a cognitive (auditory oddball) task, with the expectation that caffeine would differentially affect brain responses in relation to these tasks. To avoid the influence of chronic caffeine intake, we examined the effect of 250 mg of oral caffeine on 14 non and infrequent caffeine consumers in a double-blind placebo-controlled cross-over study. Our results show that the task-related BOLD signal change in visual and primary motor cortex was significantly reduced by caffeine, while the amplitude and latency of visual evoked potentials over occipital cortex remained unaltered. However, during the auditory oddball task (target versus non-target stimuli) caffeine significantly increased the BOLD signal in frontal cortex. Correspondingly, there was also a significant effect of caffeine in reducing the target evoked response potential (P300) latency in the oddball task and this was associated with a positive potential over frontal cortex. Behavioural data showed that caffeine also improved performance in the oddball task with a significantly reduced number of missed responses. Our results are consistent with earlier studies demonstrating altered flow-metabolism coupling after caffeine administration in the context of our observation of a generalised caffeine-induced reduction in cerebral blood flow demonstrated by arterial spin labelling (19

Caffeine markedly sensitizes human mesothelioma cell lines to pemetrexed

Science.gov (United States)

Min, Sang Hee; Goldman, I. David; Zhao, Rongbao

2013-01-01

Pemetrexed is a new generation antifolate approved for the treatment of mesothelioma and non-small cell lung cancer. Caffeine is known to augment radiation or chemotherapeutic drug-induced cell killing. The current study addresses the impact of caffeine on the activity of pemetrexed in mesothelioma cell lines. Caffeine enhanced pemetrexed activity in all four mesothelioma cell lines tested (H2052, H2373, H28 and MSTO-211H). Caffeine sensitized H2052 cells in a dose- and schedule-dependent manner, and was associated with a markedly decreased clonogenic survival. Caffeine sensitization occurred only in cells subjected to pulse, but not continuous, exposure to pemetrexed. Similar pemetrexed sensitization was also observed with the clinically better tolerated caffeine analog, theobromine. Pemetrexed sensitization by caffeine was associated with an increase in pemetrexed-induced phosphorylation of ataxia-telangiectasia-mutated (ATM) and Chk1. These data indicate that caffeine and its analog, theobromine, may be a useful approach to enhance pemetrexed-based chemotherapy. PMID:17594092

Analysis of genetic variation of inducible nitric oxide synthase and ...

African Journals Online (AJOL)

The genetic diversity of 100 Malaysian native chickens was investigated using polymerase chain reaction-restriction fragment polymorphism (PCR-RFLP) for two candidate genes: inducible nitric oxide synthase (INOS) and natural resistance-associated macrophage protein 1 (NRAMP1). The two genes were selected ...

Neuroprotection by caffeine in the MPTP model of parkinson's disease and its dependence on adenosine A2A receptors.

Science.gov (United States)

Xu, K; Di Luca, D G; Orrú, M; Xu, Y; Chen, J-F; Schwarzschild, M A

2016-05-13

Considerable epidemiological and laboratory data have suggested that caffeine, a nonselective adenosine receptor antagonist, may protect against the underlying neurodegeneration of parkinson's disease (PD). Although both caffeine and more specific antagonists of the A2A subtype of adenosine receptor (A2AR) have been found to confer protection in animal models of PD, the dependence of caffeine's neuroprotective effects on the A2AR is not known. To definitively determine its A2AR dependence, the effect of caffeine on 1-methyl-4-phenyl-1,2,3,6 tetra-hydropyridine (MPTP) neurotoxicity was compared in wild-type (WT) and A2AR gene global knockout (A2A KO) mice, as well as in central nervous system (CNS) cell type-specific (conditional) A2AR knockout (cKO) mice that lack the receptor either in postnatal forebrain neurons or in astrocytes. In WT and in heterozygous A2AR KO mice caffeine pretreatment (25mg/kgip) significantly attenuated MPTP-induced depletion of striatal dopamine. By contrast in homozygous A2AR global KO mice caffeine had no effect on MPTP toxicity. In forebrain neuron A2AR cKO mice, caffeine lost its locomotor stimulant effect, whereas its neuroprotective effect was mostly preserved. In astrocytic A2AR cKO mice, both caffeine's locomotor stimulant and protective properties were undiminished. Taken together, these results indicate that neuroprotection by caffeine in the MPTP model of PD relies on the A2AR, although the specific cellular localization of these receptors remains to be determined. Copyright © 2016 IBRO. All rights reserved.

Analysis of acetohydroxyacid synthase1 gene in chickpea conferring resistance to imazamox herbicide.

Science.gov (United States)

Jain, Parul; Tar'an, Bunyamin

2014-11-01

Chickpea (Cicer arietinum L.) production in the Canadian prairies is challenging due to a lack of effective weed management mainly because of poor competition ability of the crop and limited registered herbicide options. Chickpea genotype with resistance to imidazolinone (IMI) herbicides has been identified. A point mutation in the acetohydroxyacid synthase1 (AHAS1) gene at C581 to T581, resulting in an amino acid substitution from Ala194 to Val194 (position 205, standardized to arabidopsis), confers the resistance to imazamox in chickpea. However, the molecular mechanism leading to the resistance is not fully understood. In many plant species, contrasting transcription levels of AHAS gene has been implicated in the resistant and susceptible genotypes in response to IMI. The objectives of this research were to compare the AHAS gene expression and AHAS enzyme activity in resistant and susceptible chickpea cultivars in response to imazamox herbicide treatment. Results from RT-qPCR indicated that there is no significant change in the transcript levels of AHAS1 between the susceptible and the resistant genotypes in response to imazamox treatment. Protein hydrophobic cluster analysis, protein-ligand docking analysis, and AHAS enzyme activity assay all indicated that the resistance to imazamox in chickpea is due to the alteration of interaction of the AHAS1 enzyme with the imazamox herbicide.

Exercise and sport performance with low doses of caffeine.

Science.gov (United States)

Spriet, Lawrence L

2014-11-01

Caffeine is a popular work-enhancing supplement that has been actively researched since the 1970s. The majority of research has examined the effects of moderate to high caffeine doses (5-13 mg/kg body mass) on exercise and sport. These caffeine doses have profound effects on the responses to exercise at the whole-body level and are associated with variable results and some undesirable side effects. Low doses of caffeine (caffeine doses (1) do not alter the peripheral whole-body responses to exercise; (2) improve vigilance, alertness, and mood and cognitive processes during and after exercise; and (3) are associated with few, if any, side effects. Therefore, the ergogenic effect of low caffeine doses appears to result from alterations in the central nervous system. However, several aspects of consuming low doses of caffeine remain unresolved and suffer from a paucity of research, including the potential effects on high-intensity sprint and burst activities. The responses to low doses of caffeine are also variable and athletes need to determine whether the ingestion of ~200 mg of caffeine before and/or during training and competitions is ergogenic on an individual basis.

Cloning and Expression of the PHA Synthase Gene From a Locally Isolated Chromobacterium sp. USM2

Directory of Open Access Journals (Sweden)

Bhubalan, K.

2010-01-01

Full Text Available Chromobacterium sp. USM2, a locally isolated bacterium was found to synthesize poly(3-hydroxybutyrate-co-3-hydroxyvalerate, P(3HB-co-3HV copolymer with high 3HV monomer composition. The PHA synthase gene was cloned and expressed in Cupriavidus necator PHB¯4 to investigate the possibilities of incorporating other monomer. The recombinant successfully incorporated 3-hydroxyhexanoate (3HHx monomer when fed with crude palm kernel oil (CPKO as the sole carbon source. Approximately 63 ± 2 wt% of P(3HB-co-3HHx copolymer with 4 mol% of 3HHx was synthesized from 5 g/L of oil after 48 h of cultivation. In addition, P(3HB-co-3HV-co-3HHx terpolymer with 9 mol% 3HV and 4 mol% 3HHx could be synthesized with a mixture of CPKO and sodium valerate. The presence of 3HV and 3HHx monomers in the copolymer and terpolymer was further confirmed with +H-NMR analysis. This locally isolated PHA synthase has demonstrated its ability to synthesize P(3HB-co-3HHx copolymer from a readily available and renewable carbon source; CPKO, without the addition of 3HHx precursors.

Caffeine intake by patients with autosomal dominant polycystic kidney disease

International Nuclear Information System (INIS)

Vendramini, L.C.; Nishiura, J.L.; Baxmann, A.C.; Heilberg, I.P.

2012-01-01

Because caffeine may induce cyst and kidney enlargement in autosomal dominant polycystic kidney disease (ADPKD), we evaluated caffeine intake and renal volume using renal ultrasound in ADPKD patients. Caffeine intake was estimated by the average of 24-h dietary recalls obtained on 3 nonconsecutive days in 102 ADPKD patients (68 females, 34 males; 39 ± 12 years) and compared to that of 102 healthy volunteers (74 females, 28 males; 38 ± 14 years). The awareness of the need for caffeine restriction was assessed. Clinical and laboratory data were obtained from the medical records of the patients. Mean caffeine intake was significantly lower in ADPKD patients versus controls (86 vs 134 mg/day), and 63% of the ADPKD patients had been previously aware of caffeine restriction. Caffeine intake did not correlate with renal volume in ADPKD patients. There were no significant differences between the renal volumes of patients in the highest and lowest tertiles of caffeine consumption. Finally, age-adjusted multiple linear regression revealed that renal volume was associated with hypertension, chronic kidney disease stage 3 and the time since diagnosis, but not with caffeine intake. The present small cross-sectional study indicated a low level of caffeine consumption by ADPKD patients when compared to healthy volunteers, which was most likely due to prior awareness of the need for caffeine restriction. Within the range of caffeine intake observed by ADPKD patients in this study (0-471 mg/day), the renal volume was not directly associated with caffeine intake

Caffeine intake by patients with autosomal dominant polycystic kidney disease

Energy Technology Data Exchange (ETDEWEB)

Vendramini, L.C.; Nishiura, J.L.; Baxmann, A.C.; Heilberg, I.P. [Disciplina de Nefrologia, Departamento de Medicina, Universidade Federal de São Paulo, São Paulo, SP (Brazil)

2012-07-20

Because caffeine may induce cyst and kidney enlargement in autosomal dominant polycystic kidney disease (ADPKD), we evaluated caffeine intake and renal volume using renal ultrasound in ADPKD patients. Caffeine intake was estimated by the average of 24-h dietary recalls obtained on 3 nonconsecutive days in 102 ADPKD patients (68 females, 34 males; 39 ± 12 years) and compared to that of 102 healthy volunteers (74 females, 28 males; 38 ± 14 years). The awareness of the need for caffeine restriction was assessed. Clinical and laboratory data were obtained from the medical records of the patients. Mean caffeine intake was significantly lower in ADPKD patients versus controls (86 vs 134 mg/day), and 63% of the ADPKD patients had been previously aware of caffeine restriction. Caffeine intake did not correlate with renal volume in ADPKD patients. There were no significant differences between the renal volumes of patients in the highest and lowest tertiles of caffeine consumption. Finally, age-adjusted multiple linear regression revealed that renal volume was associated with hypertension, chronic kidney disease stage 3 and the time since diagnosis, but not with caffeine intake. The present small cross-sectional study indicated a low level of caffeine consumption by ADPKD patients when compared to healthy volunteers, which was most likely due to prior awareness of the need for caffeine restriction. Within the range of caffeine intake observed by ADPKD patients in this study (0-471 mg/day), the renal volume was not directly associated with caffeine intake.

[birthweight And Caffeine Consumption].

OpenAIRE

Bicalho, Gladys Gripp; Barros Filho, Antônio de Azevedo

2015-01-01

To assess the association between maternal caffeine consumption during pregnancy and low birth weight, prematurity and intrauterine growth retardation. A case-control was carried out and 354 newborns of single labor with birthweight 3,000 g (controls) were analyzed. Caffeine consumption was calculated based on daily consumption of coffee, soft drinks and tea. Results were adjusted using multiple logistic regression for the following confounders: mother's age, schooling, income, marital status...

D-ribose--an additive with caffeine.

Science.gov (United States)

Herrick, Jim; Shecterle, L M; St Cyr, J A

2009-05-01

Caffeine acts as a stimulant, in which approximately 90% of people in the United States consume daily. Besides its beneficial effects, many individuals have experienced unpleasant reactions following the consumption of caffeine: such as insomnia, an increase in heart rate, feelings of nervousness, headaches, occasional lightheadedness, a state of "jitters," and a potential "crash" state following its metabolism. Researchers have proposed mechanisms responsible for caffeine's interactions, which include its blocking capacity of adenosine receptors, its role with the pituitary gland, increasing levels of dopamine, and its role with the intracellular release of calcium from the sarcoplasmic reticulum, which is dependent on intracellular adenosine triphosphate levels. Specific substrates have been investigated to lessen the undesirable effects of caffeine and still preserve its stimulatory benefits. The results of these investigations have produced no positive consensus. However, D-ribose, an important pentose carbohydrate in the energy molecule of adenosine triphosphate, as well as our genetic code and other cellular processes, could offer such a solution to this problem. D-ribose could potentially aid in maintaining or potentially lowering extra-cellular adenosine concentrations, aid in the flux of intracellular calcium, aid in intracellular energy production, and potentially lessen the perceived "crash" state felt by many. Every cell requires adequate levels of energy to maintain its integrity and function. Caffeine has the potential to task this energy equilibrium. D-ribose with caffeine may be the substrate to aid in the potential intracellular energy demand, aid in lessening the perceived unpleasant side effects of caffeine, and still preserving the desired benefits of this stimulant consumed by all of us daily.

Caffeine effects on resting-state arousal.

Science.gov (United States)

Barry, Robert J; Rushby, Jacqueline A; Wallace, Mark J; Clarke, Adam R; Johnstone, Stuart J; Zlojutro, Ilinka

2005-11-01

This study examined the use of caffeine to manipulate arousal level without the confounds associated with task-related activation. From previous work in our laboratory, an increase in skin conductance level (SCL) and EEG alpha frequency, together with a global decrease in alpha power, were used as markers of arousal increase, and we sought to identify these effects with caffeine ingestion. We examined the effect of a single oral dose of caffeine (250 mg) in a randomised double-blind placebo-controlled repeated-measures cross-over study. Eighteen healthy university students (mean age 21 years; 13/18 females) participated in two sessions 1 week apart. EEG and autonomic data (SCL, heart rate, systolic and diastolic blood pressure, and respiration rate) from a 2 min eyes-closed epoch, commencing approximately 30 min after ingestion of caffeine or placebo, were examined. Caffeine was associated with increased SCL, a global reduction in EEG power in the alpha band, and a global increase in alpha frequency. There were no cardiovascular effects. The positive results are consistent with recent electrodermal and EEG studies of arousal and suggest that caffeine may be utilised as a task-free means of manipulating arousal in future investigations. Further work is necessary to clarify the absence of cardiovascular effects, and to integrate those data with emerging conceptualisations of arousal and activation. The present data support the use of caffeine as a simple tool to explore the role of arousal in both normal and atypical functioning, and this may be useful in determining the validity and importance of supposed hyper- or hypo-arousal in such syndromes as attention-deficit/hyperactivity disorder (AD/HD).

Root parasitic plant Orobanche aegyptiaca and shoot parasitic plant Cuscuta australis obtained Brassicaceae-specific strictosidine synthase-like genes by horizontal gene transfer.

Science.gov (United States)

Zhang, Dale; Qi, Jinfeng; Yue, Jipei; Huang, Jinling; Sun, Ting; Li, Suoping; Wen, Jian-Fan; Hettenhausen, Christian; Wu, Jinsong; Wang, Lei; Zhuang, Huifu; Wu, Jianqiang; Sun, Guiling

2014-01-13

Besides gene duplication and de novo gene generation, horizontal gene transfer (HGT) is another important way of acquiring new genes. HGT may endow the recipients with novel phenotypic traits that are important for species evolution and adaption to new ecological niches. Parasitic systems expectedly allow the occurrence of HGT at relatively high frequencies due to their long-term physical contact. In plants, a number of HGT events have been reported between the organelles of parasites and the hosts, but HGT between host and parasite nuclear genomes has rarely been found. A thorough transcriptome screening revealed that a strictosidine synthase-like (SSL) gene in the root parasitic plant Orobanche aegyptiaca and the shoot parasitic plant Cuscuta australis showed much higher sequence similarities with those in Brassicaceae than with those in their close relatives, suggesting independent gene horizontal transfer events from Brassicaceae to these parasites. These findings were strongly supported by phylogenetic analysis and their identical unique amino acid residues and deletions. Intriguingly, the nucleus-located SSL genes in Brassicaceae belonged to a new member of SSL gene family, which were originated from gene duplication. The presence of introns indicated that the transfer occurred directly by DNA integration in both parasites. Furthermore, positive selection was detected in the foreign SSL gene in O. aegyptiaca but not in C. australis. The expression of the foreign SSL genes in these two parasitic plants was detected in multiple development stages and tissues, and the foreign SSL gene was induced after wounding treatment in C. australis stems. These data imply that the foreign genes may still retain certain functions in the recipient species. Our study strongly supports that parasitic plants can gain novel nuclear genes from distantly related host species by HGT and the foreign genes may execute certain functions in the new hosts.

Administration of Caffeine in Alternate Forms

OpenAIRE

Wickham, Kate A.; Spriet, Lawrence L.

2018-01-01

There has been recent interest in the ergogenic effects of caffeine delivered in low doses (~ 200 mg or ~ 3 mg/kg body mass) and administered in forms other than capsules, coffee and sports drinks, including chewing gum, bars, gels, mouth rinses, energy drinks and aerosols. Caffeinated chewing gum is absorbed quicker through the buccal mucosa compared with capsule delivery and absorption in the gut, although total caffeine absorption over time is not different. Rapid absorption may be importa...

Acute intermittent porphyria: A single-base deletion and a nonsense mutation in the human hydroxymethylbilane synthase gene, predicting truncations of the enzyme polypeptide

Energy Technology Data Exchange (ETDEWEB)

Lee, G.L.; Astrin, K.H.; Desnick, R.J. [Mount Sinai School of Medicine, New York, NY (United States)

1995-08-28

Acute intermittent porphyria (AIP) is an autosomal-dominant inborn error of metabolism that results from the half-normal activity of the third enzyme in the heme biosynthetic pathway, hydroxymethylbilane synthase (HMB-synthase). AIP is an ecogenetic condition, since the life-threatening acute attacks are precipitated by various factors, including drugs, alcohol, fasting, and certain hormones. Biochemical diagnosis is problematic, and the identification of mutations in the HMB-synthase gene provides accurate detection of presymptomatic heterozygotes, permitting avoidance of the acute precipitating factors. By direct solid-phase sequencing, two mutations causing AIP were identified, an adenine deletion at position 629 in exon 11(629delA), which alters the reading frame and predicts premature truncation of the enzyme protein after amino acid 255, and a nonsense mutation in exon 12 (R225X). These mutations were confirmed by either restriction enzyme analysis or family studies of symptomatic patients, permitting accurate presymptomatic diagnosis of affected relatives. 29 refs., 2 figs.

Isolation of developing secondary xylem specific cellulose synthase ...

Indian Academy of Sciences (India)

The present study aimed at identifying developing secondary xylem specific cellulose synthase genes from .... the First strand cDNA synthesis kit (Fermentas, Pittsburgh,. USA). .... ing height of the rooted cutting, girth of the stem, leaf area.

Identification, isolation and evaluation of a constitutive sucrose phosphate synthase gene promoter from tomato

International Nuclear Information System (INIS)

Naqvi, R.Z.; Mubeen, H.; Maqsood, A.; Khatoon, A.

2017-01-01

Sucrose phosphate synthase (SPS) is one of the abundantly expressed genes in plants. The promoters of SPS gene was identified, analyzed and retrieved from high throughput genomic sequence (HTGS) database. The cis-acting regulatory elements and transcription start sites of promoter were identified through different bioinformatics tools. The SPS promoter was isolated from Solanum lycopersicum and was initially cloned in TA vector (pTZ57R/T). Later on this promoter was transferred to a plant expression binary vector, pGR1 (pGRSPS) that was used for the transient GUS expression studies in various tissues of Nicotiana tabacum. SPS promoter was also cloned in plant stable expression vector pGA482 (pGASPS) and was transformed in Nicotiana tabacum through Agrobacterium-mediated transformation method. The histochemical GUS expression analysis of both transient and stable transgenic plants for this promoter indicated its functional importance in regulating gene expression in a constitutive manner. It was concluded that SPS promoter is constitutively expressed with a strength equivalent to CaMV 2X35S promoter. The promoter isolated through these studies may be effectively substituted in plant genetic engineering with other constitutive promoter for transgene expression in economically important agricultural crops. (author)

Fewer but heavier caffeine consumers in schizophrenia: a case-control study.

Science.gov (United States)

Gurpegui, Manuel; Aguilar, M Carmen; Martínez-Ortega, José M; Jurado, Dolores; Diaz, Francisco J; Quintana, Hernando M; de Leon, Jose

2006-09-01

According to the literature, there is an association between schizophrenia and caffeine consumption, but it is not clear whether schizophrenia is associated with either higher prevalence of daily caffeine intake or the amount consumed. In this study we compared our previously published schizophrenia patients (n=250) with a control sample (n=290) after controlling for demographic variables and tobacco and alcohol consumption. Current caffeine intake was less frequent in schizophrenia patients (59%, 147/250) than in controls (70%, 204/290). In the multivariate analyses, caffeine intake was less frequent at an older age and in schizophrenia patients, and more frequent in smokers and alcohol users. Among caffeine consumers, heavy caffeine intake (> or =200 mg/day) was significantly associated with schizophrenia (64%, 94/147 in schizophrenia versus 36%, 73/204 in controls), as well as older age and smoking. Daily amount of caffeine intake and smoked cigarettes correlated significantly in the schizophrenia group but not in the control group; the correlation of caffeine intake with nicotine dependence was low and non-significant in both groups. The association between current smoking and heavy caffeine intake may be partly explained by a pharmacokinetic effect: tobacco smoke compounds induce caffeine metabolism by the cytochrome P450 1A2. Although schizophrenia by itself may be associated with heavy caffeine intake in caffeine users, part of this association was explained by the association between schizophrenia and smoking. The relationship between caffeine and alcohol intake appeared to be more complex; alcohol and caffeine use were significantly associated, but within caffeine users alcohol was associated with less frequent heavy caffeine consumption among smokers. In future studies, the measurement of plasma caffeine levels will help both to better define heavy caffeine intake and to control for smoking pharmacokinetic effects.

Differential cognitive effects of energy drink ingredients: caffeine, taurine, and glucose.

Science.gov (United States)

Giles, Grace E; Mahoney, Caroline R; Brunyé, Tad T; Gardony, Aaron L; Taylor, Holly A; Kanarek, Robin B

2012-10-01

Energy drinks containing caffeine, taurine, and glucose may improve mood and cognitive performance. However, there are no studies assessing the individual and interactive effects of these ingredients. We evaluated the effects of caffeine, taurine, and glucose alone and in combination on cognitive performance and mood in 24-hour caffeine-abstained habitual caffeine consumers. Using a randomized, double-blind, mixed design, 48 habitual caffeine consumers (18 male, 30 female) who were 24-hour caffeine deprived received one of four treatments (200 mg caffeine/0 mg taurine, 0 mg caffeine/2000 mg taurine, 200 mg caffeine/2000 mg taurine, 0 mg caffeine/0 mg taurine), on each of four separate days, separated by a 3-day wash-out period. Between-participants treatment was a glucose drink (50 g glucose, placebo). Salivary cortisol, mood and heart rate were measured. An attention task was administered 30-minutes post-treatment, followed by a working memory and reaction time task 60-minutes post-treatment. Caffeine enhanced executive control and working memory, and reduced simple and choice reaction time. Taurine increased choice reaction time but reduced reaction time in the working memory tasks. Glucose alone slowed choice reaction time. Glucose in combination with caffeine, enhanced object working memory and in combination with taurine, enhanced orienting attention. Limited glucose effects may reflect low task difficulty relative to subjects' cognitive ability. Caffeine reduced feelings of fatigue and increased tension and vigor. Taurine reversed the effects of caffeine on vigor and caffeine-withdrawal symptoms. No effects were found for salivary cortisol or heart rate. Caffeine, not taurine or glucose, is likely responsible for reported changes in cognitive performance following consumption of energy drinks, especially in caffeine-withdrawn habitual caffeine consumers. Copyright © 2012 Elsevier Inc. All rights reserved.

Reinforcing effects of caffeine in coffee and capsules.

OpenAIRE

Griffiths, R R; Bigelow, G E; Liebson, I A

1989-01-01

In a residential research ward the reinforcing and subjective effects of caffeine were studied under double-blind conditions in volunteer subjects with histories of heavy coffee drinking. In Experiment 1, 6 subjects had 13 opportunities each day to self-administer either a caffeine (100 mg) or a placebo capsule for periods of 14 to 61 days. All subjects developed a clear preference for caffeine, with intake of caffeine becoming relatively stable after preference had been attained. Preference ...

Caffeine Withdrawal and Dependence: A Convenience Survey Among Addiction Professionals.

Science.gov (United States)

Budney, Alan J; Brown, Pamela C; Griffiths, Roland R; Hughes, John R; Juliano, Laura M

2013-06-01

Caffeine withdrawal was included in the research appendix of the DSM-IV to encourage additional research to assist with determining its status for the next version of the manual. Caffeine dependence was not included because of a lack of empirical research at the time of publication. This study assessed the beliefs of addiction professionals about the clinical importance of caffeine withdrawal and dependence. A 6-item survey was developed and delivered electronically to the members of six professional organizations that focus on addiction. Open-ended comments were also solicited. Five hundred members responded. The majority (95%) thought that cessation of caffeine could produce a withdrawal syndrome, and that caffeine withdrawal can have clinical importance (73%); however, only half (48%) thought that caffeine withdrawal should be included in the Diagnostic and Statistical Manual of Mental Disorders (DSM). A majority (58%) believed that some people develop caffeine dependence; however, only 44% indicated that it should be in the DSM. Comments suggested that trepidation about inclusion of caffeine diagnoses was due to the concerns about the field of psychiatry being criticized for including common disorders with a relatively low clinical severity. Others, however, expressed an urgent need to take caffeine-related problems more seriously. The majority of addiction professionals believe that caffeine withdrawal and dependence disorders exist and are clinically important; however, these professionals are divided in whether caffeine withdrawal and dependence should be included in DSM. Wider dissemination of the extant literature on caffeine withdrawal and additional research on caffeine dependence will be needed to provide additional guidance to policymakers and healthcare workers.

Caffeine antagonism of alcohol-induced driving impairment.

Science.gov (United States)

Liguori, A; Robinson, J H

2001-07-01

The extent to which caffeine antagonizes alcohol-induced impairment of simulated automobile driving at the current lowest legal American limit (0.08% BrAC) was the focus of this study. Fifteen adults swallowed a capsule (0, 200, or 400 mg caffeine) then drank a beverage (0.0 or 0.6 g/kg ethanol) in a within-subject, double-blind, randomized procedure. Forty-five minutes later, participants completed a test battery of subjective effects scales, dynamic posturography, critical flicker fusion (CFF), choice reaction time (CRT), divided attention (Stroop test), and simulated driving. Alcohol alone increased ratings of 'dizzy', 'drug effect', and 'high', slowed CRT and brake latency, and increased body sway. Caffeine alone increased ratings of 'alert' and 'jittery', but did not significantly affect body sway or psychomotor performance. Both caffeine doses comparably counteracted alcohol impairment of brake latency but not CRT or body sway. Brake latency with either alcohol-caffeine combination remained significantly longer than that with placebo. Stroop and CFF performance were unaffected by any drug condition. The results suggest that caffeine may increase alertness and improve reaction time after alcohol use but will not completely counteract alcohol impairment in a driver.

Caffeine Content in Popular Energy Drinks and Energy Shots.

Science.gov (United States)

Attipoe, Selasi; Leggit, Jeffrey; Deuster, Patricia A

2016-09-01

The use of energy beverages is high among the general population and military personnel. Previous studies have reported discrepancies between the actual amount of caffeine in products and the amount of caffeine on stated labels. Thus, the purpose of this study was to examine the content of caffeine listed on the labels of various energy drinks and energy shots. Top-selling energy drinks (n = 9) and energy shots (n = 5) were purchased from retail stores. Three of each of the 14 products were purchased and analyzed for caffeine content by an independent laboratory. Of the 14 products tested, 5 did not provide caffeine amounts on their facts panel-of those, 3 listed caffeine as an ingredient and 2 listed caffeine as part of a proprietary blend. The remaining 9 (of 14) products stated the amounts of caffeine on their labels, all of which were within 15% of the amount indicated on the label. In this study, although the energy beverages that indicated the amount of caffeine it contained had values within ±15% of the amount listed on the label, a potentially acceptable range, this finding is not acceptable with regard to current labeling regulations, which require added ingredients to total 100%. Reprint & Copyright © 2016 Association of Military Surgeons of the U.S.

The influence of CYP1A2 genotype in the blood pressure response to caffeine ingestion is affected by physical activity status and caffeine consumption level.

Science.gov (United States)

Soares, Rogerio Nogueira; Schneider, Augusto; Valle, Sandra Costa; Schenkel, Paulo Cavalheiro

2018-03-06

This study aimed to investigate whether the influence of CYP1A2 genotype in the blood pressure (BP) response to caffeine ingestion was affected by physical activity status and habitual caffeine consumption. Thirty-seven participants (19-50 years old) took place in the study and were categorized according to i) genotype: CYP1A2 (AA) "fast metabolizer", and CYP1A2 (AC) "slow metabolizer"; ii) physical activity level: sedentary (S) and physically active (A); and iii) caffeine consumption level: non-habitual caffeine consumer (NC) and habitual heavy caffeine consumer (C). All groups had BP assessed before (basal) and 1 hourh after (post) caffeine ingestion (6 mg·kg -1 ). It was observed that AC genotype individuals had increased basal-DBP and post-caffeine SBP when compared to AA individuals. Additionally, acute caffeine ingestion increased SBP only in the AC group. It was also found that physical activity only modulated the BP responses to acute caffeine ingestion in AC individuals. Furthermore, the results indicated that the habitual heavy caffeine consumers AC individuals had increased basal-DBP when compared to the AA ones. Our results suggest that the influence of CYP1A2 genotype in the basal and post-caffeine BP response to caffeine ingestion is modified by physical activity status and caffeine consumption level. Copyright © 2018 Elsevier Inc. All rights reserved.

Invertebrate Trehalose-6-Phosphate Synthase Gene: Genetic Architecture, Biochemistry, Physiological Function, and Potential Applications

Directory of Open Access Journals (Sweden)

Bin Tang

2018-01-01

Full Text Available The non-reducing disaccharide trehalose is widely distributed among various organisms. It plays a crucial role as an instant source of energy, being the major blood sugar in insects. In addition, it helps countering abiotic stresses. Trehalose synthesis in insects and other invertebrates is thought to occur via the trehalose-6-phosphate synthase (TPS and trehalose-6-phosphate phosphatase (TPP pathways. In many insects, the TPP gene has not been identified, whereas multiple TPS genes that encode proteins harboring TPS/OtsA and TPP/OtsB conserved domains have been found and cloned in the same species. The function of the TPS gene in insects and other invertebrates has not been reviewed in depth, and the available information is quite fragmented. The present review discusses the current understanding of the trehalose synthesis pathway, TPS genetic architecture, biochemistry, physiological function, and potential sensitivity to insecticides. We note the variability in the number of TPS genes in different invertebrate species, consider whether trehalose synthesis may rely only on the TPS gene, and discuss the results of in vitro TPS overexpression experiment. Tissue expression profile and developmental characteristics of the TPS gene indicate that it is important in energy production, growth and development, metamorphosis, stress recovery, chitin synthesis, insect flight, and other biological processes. We highlight the molecular and biochemical properties of insect TPS that make it a suitable target of potential pest control inhibitors. The application of trehalose synthesis inhibitors is a promising direction in insect pest control because vertebrates do not synthesize trehalose; therefore, TPS inhibitors would be relatively safe for humans and higher animals, making them ideal insecticidal agents without off-target effects.

Teratogenic effects of caffeine and clomipramine on rat fetus

Directory of Open Access Journals (Sweden)

Takzare N

2012-09-01

Full Text Available Background: Obsessive-compulsive disorders and depression have a high prevalence during pregnancy therefore, pregnant women may take clomipramine and also take other drugs or consume foods that contain caffeine. As investigations about the teratogenic effects of clomipramine and its concurrent administration with caffeine during organogenesis period are scarce, we aimed to study the teratogenicity of simultaneous administration of clomipramine and caffeine in rat fetus.Methods: After dividing 42 pregnant rats to several case and control groups, we injected different doses of caffeine and clomipramine to the animals. All the injections were performed on the eighth until the 15th day of pregnancy. We removed the fetuses on the 17th day of pregnancy and studied the morphological features and apparent anomalies of the fetuses macroscopically. Results: We found a significant rate of mortality, apparent anomalies, abnormal torsion, shrinkage of skin and subcutaneous bleeding in fetuses of rats receiving high doses of caffeine or a combination of caffeine and clomipramine. Statistical analysis of the data revealed a significant increase (P?0.001 in teratogenicity of high doses of caffeine and its combination with clomipramine. Conclusion: This study implies simultaneous intake of high amounts of caffeine and clomipramine lead to teratogenicity. We recommend pregnant women to avoid uncontrolled consumption of foods that contain caffeine or drugs that contain high amounts of this substance. They should not also take clomipramine with caffeine in the first trimester of pregnancy.

Isolation and identification of a thermophilic strain producing trehalose synthase from geothermal water in China.

Science.gov (United States)

Zhu, Yueming; Zhang, Jun; Wei, Dongsheng; Wang, Yufan; Chen, Xiaoyun; Xing, Laijun; Li, Mingchun

2008-08-01

A slightly thermophilic strain, CBS-01, producing trehalose synthase (TreS), was isolated from geothermal water in this study. According to the phenotypic characteristics and phylogenetic analysis of the 16s rRNA gene sequence, it was identified as Meiothermus ruber. The trehalose synthase gene of Meiothermus ruber CBS-01 was cloned by polymerase chain reaction and sequenced. The TreS gene consisted of 2,895 nucleotides, which specified a 964-amino-acid protein. This novel TreS catalyzed reversible interconversion of maltose and trehalose.

Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome.

Science.gov (United States)

Müller, Christina A; Oberauner-Wappis, Lisa; Peyman, Armin; Amos, Gregory C A; Wellington, Elizabeth M H; Berg, Gabriele

2015-08-01

Sphagnum bog ecosystems are among the oldest vegetation forms harboring a specific microbial community and are known to produce an exceptionally wide variety of bioactive substances. Although the Sphagnum metagenome shows a rich secondary metabolism, the genes have not yet been explored. To analyze nonribosomal peptide synthetases (NRPSs) and polyketide synthases (PKSs), the diversity of NRPS and PKS genes in Sphagnum-associated metagenomes was investigated by in silico data mining and sequence-based screening (PCR amplification of 9,500 fosmid clones). The in silico Illumina-based metagenomic approach resulted in the identification of 279 NRPSs and 346 PKSs, as well as 40 PKS-NRPS hybrid gene sequences. The occurrence of NRPS sequences was strongly dominated by the members of the Protebacteria phylum, especially by species of the Burkholderia genus, while PKS sequences were mainly affiliated with Actinobacteria. Thirteen novel NRPS-related sequences were identified by PCR amplification screening, displaying amino acid identities of 48% to 91% to annotated sequences of members of the phyla Proteobacteria, Actinobacteria, and Cyanobacteria. Some of the identified metagenomic clones showed the closest similarity to peptide synthases from Burkholderia or Lysobacter, which are emerging bacterial sources of as-yet-undescribed bioactive metabolites. This report highlights the role of the extreme natural ecosystems as a promising source for detection of secondary compounds and enzymes, serving as a source for biotechnological applications. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Likelihood analysis of the chalcone synthase genes suggests the role of positive selection in morning glories (Ipomoea).

Science.gov (United States)

Yang, Ji; Gu, Hongya; Yang, Ziheng

2004-01-01

Chalcone synthase (CHS) is a key enzyme in the biosynthesis of flavonoides, which are important for the pigmentation of flowers and act as attractants to pollinators. Genes encoding CHS constitute a multigene family in which the copy number varies among plant species and functional divergence appears to have occurred repeatedly. In morning glories (Ipomoea), five functional CHS genes (A-E) have been described. Phylogenetic analysis of the Ipomoea CHS gene family revealed that CHS A, B, and C experienced accelerated rates of amino acid substitution relative to CHS D and E. To examine whether the CHS genes of the morning glories underwent adaptive evolution, maximum-likelihood models of codon substitution were used to analyze the functional sequences in the Ipomoea CHS gene family. These models used the nonsynonymous/synonymous rate ratio (omega = d(N)/ d(S)) as an indicator of selective pressure and allowed the ratio to vary among lineages or sites. Likelihood ratio test suggested significant variation in selection pressure among amino acid sites, with a small proportion of them detected to be under positive selection along the branches ancestral to CHS A, B, and C. Positive Darwinian selection appears to have promoted the divergence of subfamily ABC and subfamily DE and is at least partially responsible for a rate increase following gene duplication.

Effect of Carbohydrate, Caffeine, and Carbohydrate + Caffeine Mouth Rinsing on Intermittent Running Performance in Collegiate Male Lacrosse Athletes.

Science.gov (United States)

Dolan, Patrick; Witherbee, Kyle E; Peterson, Kimi M; Kerksick, Chad M

2017-09-01

Dolan, P, Witherbee, KE, Peterson, KM, and Kerksick, CM. Effect of carbohydrate, caffeine, and carbohydrate + caffeine mouth rinsing on intermittent running performance in collegiate male lacrosse athletes. J Strength Cond Res 31(9): 2473-2479, 2017-Recently, an interest has developed in the potential to rinse the oral cavity with key nutrients to impact various types of exercise and presumably sporting performance. Although multiple studies examining carbohydrate mouth rinsing have been completed, conflicting evidence surrounding caffeine mouth rinsing persists, and no research has explored its ability to impact high-intensity, intermittent running performance. This study investigated the independent and synergistic ability of carbohydrate and caffeine mouth rinsing to improve intermittent running performance. The Yo-Yo Intermittent Recovery Test-Level 1 (Yo-Yo Level 1) was completed in 10 collegiate (National Collegiate Athletic Association [NCAA] Division II) male lacrosse players after a 10-second mouth rinse with a solution of either carbohydrate (CHO), caffeine (CAF), carbohydrate + caffeine (CHO + CAF), placebo (H2O), or a no rinse control (CON). No significant improvements in Yo-Yo IRT-1 performance were found (p > 0.05). Perceptual indications of effort (i.e., rating of their perceived exertion [RPE]) were significantly lower (p ≤ 0.05) in CHO and CHO + CAF when compared with CON after speed level 11. Interestingly, RPE levels were nonsignificantly lower in all but one level of the Yo-Yo Level 1 for CHO in comparison with other groups. Carbohydrate and caffeine mouth rinsing seems to exert no impact on running performance before maximal intermittent running in a group of male collegiate lacrosse players.

The effect of caffeine on p53-dependent radioresponses in undifferentiated mouse embryonal carcinoma cells after X-ray and UV-irradiations

International Nuclear Information System (INIS)

Taga, Masataka; Shiraishi, Kazunori; Shimura, Tsutomu; Uematsu, Norio; Kato, Tomohisa; Niwa, Ohtsura; Nishimune, Yoshitake; Aizawa, Shinichi; Oshimura, Mitsuo

2000-01-01

The effect of caffeine was studied on the radioresponses of undifferentiated mouse embryonal carcinoma cells (EC cells) with or without the functional p53. The radioresponses studied included radiosensitivity, the activation of p53, apoptosis with characteristic DNA ladder formation and cell cycle progression. An undifferentiated mouse EC cell line, ECA2, and a newly established p53-deficient EC cell line, p53δ, were used in the present study. The status of the p53 gene did not significantly affect the colony survivals of undifferentiated EC cells to X-rays and UV. Although a post-irradiation treatment with caffeine sensitized both lines to X-rays marginally, the sensitization was prominent for UV regardless of the p53 status of the cells. The activation of a p53 responsible lacZ reporter construct was observed in stably transfected ECA2 cells after X-ray and UV irradiations. Caffeine suppressed the X-ray induced activation of the lacZ reporter, while it drastically enhanced the activation after UV irradiation. X-rays and UV readily triggered the apoptosis of ECA2 cells with the characteristic DNA ladder. Although UV-induced DNA ladder formation was enhanced by caffeine, that induced by X-rays was unaffected. Therefore, the effects of caffeine on the p53-dependent radioresponses were found to be agent specific: suppression for the X-ray induced and augmentation for the UV induced. In contrast to p53-proficient ECA2 cells, smear-like DNA degradation was observed for irradiated p53δ cells, suggesting the presence of a mode of cell death without DNA ladder formation. UV induction of the smear-like DNA degradation was enhanced in the presence of caffeine. Regardless of the state of the p53 gene, G1/S arrest was not observed in X-ray and UV irradiated EC cells. X-rays induced G2/M arrest in both lines, which was abrogated by caffeine, while G2/M arrest after UV was unaffected by a caffeine treatment. These results indicate that the radioresponses of undifferentiated

The effect of caffeine on p53-dependent radioresponses in undifferentiated mouse embryonal carcinoma cells after X-ray and UV-irradiations

Energy Technology Data Exchange (ETDEWEB)

Taga, Masataka; Shiraishi, Kazunori; Shimura, Tsutomu; Uematsu, Norio; Kato, Tomohisa; Niwa, Ohtsura [Kyoto Univ. (Japan). Radiation Biology Center; Nishimune, Yoshitake; Aizawa, Shinichi; Oshimura, Mitsuo

2000-09-01

The effect of caffeine was studied on the radioresponses of undifferentiated mouse embryonal carcinoma cells (EC cells) with or without the functional p53. The radioresponses studied included radiosensitivity, the activation of p53, apoptosis with characteristic DNA ladder formation and cell cycle progression. An undifferentiated mouse EC cell line, ECA2, and a newly established p53-deficient EC cell line, p53{delta}, were used in the present study. The status of the p53 gene did not significantly affect the colony survivals of undifferentiated EC cells to X-rays and UV. Although a post-irradiation treatment with caffeine sensitized both lines to X-rays marginally, the sensitization was prominent for UV regardless of the p53 status of the cells. The activation of a p53 responsible lacZ reporter construct was observed in stably transfected ECA2 cells after X-ray and UV irradiations. Caffeine suppressed the X-ray induced activation of the lacZ reporter, while it drastically enhanced the activation after UV irradiation. X-rays and UV readily triggered the apoptosis of ECA2 cells with the characteristic DNA ladder. Although UV-induced DNA ladder formation was enhanced by caffeine, that induced by X-rays was unaffected. Therefore, the effects of caffeine on the p53-dependent radioresponses were found to be agent specific: suppression for the X-ray induced and augmentation for the UV induced. In contrast to p53-proficient ECA2 cells, smear-like DNA degradation was observed for irradiated p53{delta} cells, suggesting the presence of a mode of cell death without DNA ladder formation. UV induction of the smear-like DNA degradation was enhanced in the presence of caffeine. Regardless of the state of the p53 gene, G1/S arrest was not observed in X-ray and UV irradiated EC cells. X-rays induced G2/M arrest in both lines, which was abrogated by caffeine, while G2/M arrest after UV was unaffected by a caffeine treatment. These results indicate that the radioresponses of

Genomic Analysis of Terpene Synthase Family and Functional Characterization of Seven Sesquiterpene Synthases from Citrus sinensis

Directory of Open Access Journals (Sweden)

Berta Alquézar

2017-08-01

Full Text Available Citrus aroma and flavor, chief traits of fruit quality, are derived from their high content in essential oils of most plant tissues, including leaves, stems, flowers, and fruits. Accumulated in secretory cavities, most components of these oils are volatile terpenes. They contribute to defense against herbivores and pathogens, and perhaps also protect tissues against abiotic stress. In spite of their importance, our understanding of the physiological, biochemical, and genetic regulation of citrus terpene volatiles is still limited. The availability of the sweet orange (Citrus sinensis L. Osbeck genome sequence allowed us to characterize for the first time the terpene synthase (TPS family in a citrus type. CsTPS is one of the largest angiosperm TPS families characterized so far, formed by 95 loci from which just 55 encode for putative functional TPSs. All TPS angiosperm families, TPS-a, TPS-b, TPS-c, TPS-e/f, and TPS-g were represented in the sweet orange genome, with 28, 18, 2, 2, and 5 putative full length genes each. Additionally, sweet orange β-farnesene synthase, (Z-β-cubebene/α-copaene synthase, two β-caryophyllene synthases, and three multiproduct enzymes yielding β-cadinene/α-copaene, β-elemene, and β-cadinene/ledene/allo-aromandendrene as major products were identified, and functionally characterized via in vivo recombinant Escherichia coli assays.

Characterization of two trpE genes encoding anthranilate synthase α-subunit in Azospirillum brasilense

International Nuclear Information System (INIS)

Ge Shimei; Xie Baoen; Chen Sanfeng

2006-01-01

The previous report from our laboratory has recently identified a new trpE gene (termed trpE 2 ) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE 1 (G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE 1 (G) while these sequence features did not exist in front of trpE 2 . The β-galactosidase activity of an A. brasilense strain carrying a trpE 2 -lacZ fusion remained constant at different tryptophan concentrations, but the β-galactosidase activity of the same strain carrying a trpE 1 (G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE 1 (G) is regulated at the transcriptional level by attenuation while trpE 2 is constantly expressed. The anthranilate synthase assays with trpE 1 (G) - and trpE 2 - mutants demonstrated that TrpE 1 (G) fusion protein is feedback inhibited by tryptophan while TrpE 2 protein is not. We also found that both trpE 1 (G) and trpE 2 gene products were involved in IAA synthesis

Caffeine delays autonomic recovery following acute exercise.

Science.gov (United States)

Bunsawat, Kanokwan; White, Daniel W; Kappus, Rebecca M; Baynard, Tracy

2015-11-01

Impaired autonomic recovery of heart rate (HR) following exercise is associated with an increased risk of sudden death. Caffeine, a potent stimulator of catecholamine release, has been shown to augment blood pressure (BP) and sympathetic nerve activity; however, whether caffeine alters autonomic function after a bout of exercise bout remains unclear. In a randomized, crossover study, 18 healthy individuals (26 ± 1 years; 23.9 ± 0.8 kg·m(-2)) ingested caffeine (400 mg) or placebo pills, followed by a maximal treadmill test to exhaustion. Autonomic function and ventricular depolarization/repolarization were determined using heart rate variability (HRV) and corrected QT interval (QTc), respectively, at baseline, 5, 15, and 30 minutes post-exercise. Maximal HR (HRmax) was greater with caffeine (192 ± 2 vs. 190 ± 2 beat·min(-1), p < 0.05). During recovery, HR, mean arterial pressure (MAP), and diastolic blood pressure (DBP) remained elevated with caffeine (p < 0.05). Natural log transformation of low-to-high frequency ratio (LnLF/LnHF) of HRV was increased compared with baseline at all time points in both trials (p < 0.05), with less of an increase during 5 and 15 minutes post-exercise in the caffeine trial (p < 0.05). QTc increased from baseline at all time points in both trials, with greater increases in the caffeine trial (p < 0.05). Caffeine ingestion disrupts post-exercise autonomic recovery because of increased sympathetic nerve activity. The prolonged sympathetic recovery time could subsequently hinder baroreflex function during recovery and disrupt the stability of autonomic function, potentiating a pro-arrhythmogenic state in young adults. © The European Society of Cardiology 2014.

The Interaction of Sorbitol with Caffeine in Aqueous Solution.

Science.gov (United States)

Tavagnacco, Letizia; Brady, John W; Cesàro, Attilio

2013-09-01

Molecular dynamics simulations were carried out on a system of caffeine interacting with the sugar alcohol sorbitol. The system examined had a caffeine concentration 0.083 m and a sugar concentration 1.08 m. The trajectories of all molecules in the system were collected over a period of 80 ns and analyzed to determine whether there is any tendency for sorbitol to bind to caffeine, and if so, by what mechanism. The results show that the sorbitol molecules have an affinity for the caffeine molecules and that the binding occurred by the interaction of the aliphatic hydrophobic protons of the sugar with the caffeine face. This intermolecular association via face-to-face stacking, as suggested by simulation studies, is similar to that found for sucrose and for D-glucose, which overwhelmingly exists in the pyranose ring chair form in aqueous solution, as well as for caffeine-caffeine association. The sorbitol molecules, however, exist as relatively extended chains and are, therefore, topologically quite different from the sugars sucrose and glucose. The comparison of the average conformation of sorbitol molecules bound to caffeine with that of molecules in the free state shows a substantial similarity.

Endorsement of DSM-IV dependence criteria among caffeine users.

Science.gov (United States)

Hughes, J R; Oliveto, A H; Liguori, A; Carpenter, J; Howard, T

1998-10-01

The purpose of this article is to determine whether some caffeine users endorse clinical indicators of dependence and abuse. We asked 162 randomly-selected caffeine users generic DSM-IV criteria for dependence, abuse, intoxication and withdrawal pertaining to their caffeine use in the last year via a structured telephone interview. The prevalence of endorsement of dependence items was 56% for strong desire or unsuccessful attempt to stop use, 50% for spending a great deal of time with the drug, 28% for using more than intended, 18% for withdrawal, 14% for using despite knowledge of harm, 8% for tolerance and 1% for foregoing activities to use. Seven percent of users met DSM-IV criteria for caffeine intoxication and, among those who had tried to stop caffeine permanently, 24% met DSM-IV research criteria for caffeine withdrawal. Test-retest interviews for dependency agreed in 29/30 cases (97%). Eight expert substance abuse clinicians agreed with self-endorsed caffeine dependence 91% of the time. Our results replicate earlier work and suggest that a substantial proportion of caffeine users exhibit dependence-like behaviors. Further studies are needed to determine whether such users exhibit a clinically significant syndrome of drug dependence.

Caffeine Use Disorder: A Review of the Evidence and Future Implications.

Science.gov (United States)

Addicott, Merideth A

2014-09-01

The latest edition of the Diagnostic and Statistical Manual (DSM-5) has introduced new provisions for caffeine-related disorders. Caffeine Withdrawal is now an officially recognized diagnosis, and criteria for caffeine use disorder have been proposed for additional study. caffeine use disorder is intended to be characterized by cognitive, behavioral, and physiological symptoms indicative of caffeine use despite significant caffeine-related problems, similar to other Substance Use Disorders. However, since nonproblematic caffeine use is so common and widespread, it may be difficult for some health professionals to accept that caffeine use can result in the same types of pathological behaviors caused by alcohol, cocaine, opiates, or other drugs of abuse. Yet there is evidence that some individuals are psychologically and physiologically dependent on caffeine, although the prevalence and severity of these problems is unknown. This article reviews the recent changes to the DSM, the concerns regarding these changes, and some potential impacts these changes could have on caffeine consumers.

Caffeine Consumption Patterns and Beliefs of College Freshmen

Science.gov (United States)

McIlvain, Gary E.; Noland, Melody P.; Bickel, Robert

2011-01-01

Background: Caffeine consumption by young people has increased dramatically over the last decade through increased coffee consumption and "energy drinks." In higher amounts, caffeine causes many adverse effects that are cause for concern. Purpose: Purposes of this study were to determine: (1) the amount of caffeine consumed by a sample…

Caffeine in the management of patients with headache.

Science.gov (United States)

Lipton, Richard B; Diener, Hans-Christoph; Robbins, Matthew S; Garas, Sandy Yacoub; Patel, Ketu

2017-10-24

Caffeinated headache medications, either alone or in combination with other treatments, are widely used by patients with headache. Clinicians should be familiar with their use as well as the chemistry, pharmacology, dietary and medical sources, clinical benefits, and potential safety issues of caffeine. In this review, we consider the role of caffeine in the over-the-counter treatment of headache. The MEDLINE and Cochrane databases were searched by combining "caffeine" with the terms "headache," "migraine," and "tension-type." Studies that were not placebo-controlled or that involved medications available only with a prescription, as well as those not assessing patients with migraine and/or tension-type headache (TTH), were excluded. Compared with analgesic medication alone, combinations of caffeine with analgesic medications, including acetaminophen, acetylsalicylic acid, and ibuprofen, showed significantly improved efficacy in the treatment of patients with TTH or migraine, with favorable tolerability in the vast majority of patients. The most common adverse events were nervousness (6.5%), nausea (4.3%), abdominal pain/discomfort (4.1%), and dizziness (3.2%). This review provides evidence for the role of caffeine as an analgesic adjuvant in the acute treatment of primary headache with over-the-counter drugs, caffeine doses of 130 mg enhance the efficacy of analgesics in TTH and doses of ≥100 mg enhance benefits in migraine. Additional studies are needed to assess the relationship between caffeine dosing and clinical benefits in patients with TTH and migraine.

Genome-wide identification of galactinol synthase (GolS) genes in Solanum lycopersicum and Brachypodium distachyon.

Science.gov (United States)

Filiz, Ertugrul; Ozyigit, Ibrahim Ilker; Vatansever, Recep

2015-10-01

GolS genes stand as potential candidate genes for molecular breeding and/or engineering programs in order for improving abiotic stress tolerance in plant species. In this study, a total of six galactinol synthase (GolS) genes/proteins were retrieved for Solanum lycopersicum and Brachypodium distachyon. GolS protein sequences were identified to include glyco_transf_8 (PF01501) domain structure, and to have a close molecular weight (36.40-39.59kDa) and amino acid length (318-347 aa) with a slightly acidic pI (5.35-6.40). The sub-cellular location was mainly predicted as cytoplasmic. S. lycopersicum genes located on chr 1 and 2, and included one segmental duplication while genes of B. distachyon were only on chr 1 with one tandem duplication. GolS sequences were found to have well conserved motif structures. Cis-acting analysis was performed for three abiotic stress responsive elements, including ABA responsive element (ABRE), dehydration and cold responsive elements (DRE/CRT) and low-temperature responsive element (LTRE). ABRE elements were found in all GolS genes, except for SlGolS4; DRE/CRT was not detected in any GolS genes and LTRE element found in SlGolS1 and BdGolS1 genes. AU analysis in UTR and ORF regions indicated that SlGolS and BdGolS mRNAs may have a short half-life. SlGolS3 and SlGolS4 genes may generate more stable transcripts since they included AATTAAA motif for polyadenylation signal POLASIG2. Seconder structures of SlGolS proteins were well conserved than that of BdGolS. Some structural divergences were detected in 3D structures and predicted binding sites exhibited various patterns in GolS proteins. Copyright © 2015 Elsevier Ltd. All rights reserved.

Caffeine triggers behavioral and neurochemical alterations in adolescent rats.

Science.gov (United States)

Ardais, A P; Borges, M F; Rocha, A S; Sallaberry, C; Cunha, R A; Porciúncula, L O

2014-06-13

Caffeine is the psychostimulant most consumed worldwide but concerns arise about the growing intake of caffeine-containing drinks by adolescents since the effects of caffeine on cognitive functions and neurochemical aspects of late brain maturation during adolescence are poorly known. We now studied the behavioral impact in adolescent male rats of regular caffeine intake at low (0.1mg/mL), moderate (0.3mg/mL) and moderate/high (1.0mg/mL) doses only during their active period (from 7:00 P.M. to 7:00 A.M.). All tested doses of caffeine were devoid of effects on locomotor activity, but triggered anxiogenic effects. Caffeine (0.3 and 1mg/mL) improved the performance in the object recognition task, but the higher dose of caffeine (1.0mg/mL) decreased the habituation to an open-field arena, suggesting impaired non-associative memory. All tested doses of caffeine decreased the density of glial fibrillary acidic protein and synaptosomal-associated protein-25, but failed to modify neuron-specific nuclear protein immunoreactivity in the hippocampus and cerebral cortex. Caffeine (0.3-1mg/mL) increased the density of brain-derived neurotrophic factor (BDNF) and proBDNF density as well as adenosine A1 receptor density in the hippocampus, whereas the higher dose of caffeine (1mg/mL) increased the density of proBDNF and BDNF and decreased A1 receptor density in the cerebral cortex. These findings document an impact of caffeine consumption in adolescent rats with a dual impact on anxiety and recognition memory, associated with changes in BDNF levels and decreases of astrocytic and nerve terminal markers without overt neuronal damage in hippocampal and cortical regions. Copyright © 2014 IBRO. Published by Elsevier Ltd. All rights reserved.

Electrophysiological studies in healthy subjects involving caffeine.

Science.gov (United States)

de Carvalho, Mamede; Marcelino, Erica; de Mendonça, Alexandre

2010-01-01

We review the electrophysiological studies concerning the effects of caffeine on muscle, lower and upper motor neuron excitability and cognition. Several different methods have been used, such as electromyography, recruitment analysis, H-reflex, transcranial magnetic stimulation (TMS), electroencephalography and event-related potentials. The positive effect of caffeine on vigilance, attention, speed of reaction, information processing and arousal is supported by a number of electrophysiological studies. The evidence in favor of an increased muscle fiber resistance is not definitive, but higher or lower motor neuron excitability can occur as a consequence of a greater excitation of the descending input from the brainstem and upper motor neurons. TMS can address the influence of caffeine on the upper motor neuron. Previous studies showed that cortico-motor threshold and intracortical excitatory and inhibitory pathways are not influenced by caffeine. Nonetheless, our results indicate that cortical silent period (CSP) is reduced in resting muscles after caffeine consumption, when stimulating the motor cortex with intensities slightly above threshold. We present new data demonstrating that this effect is also observed in fatigued muscle. We conclude that CSP can be considered a surrogate marker of the effect of caffeine in the brain, in particular of its central ergogenic effect.

Biosynthesis of caffeine by tea-leaf extracts. Enzymic formation of theobromine from 7-methylxanthine and of caffeine from theobromine.

Science.gov (United States)

Suzuki, T; Takahashi, E

1975-01-01

1. Extracts prepared from tea leaves with Polyclar AT (insoluble polyvinylpyrrolidine) contained two methyltransferase activities catalysing the transfer of methyl groups from S-adenosylmethionine to 7-methylxanthine, producing theobromine, and to theobromine, producing caffeine. 2. The methyltransferases exhibited the same pH optimum (8.4) and a similar pattern of effects by metal ions, thiol inhibitors and metal-chelating reagents, both for theobromine and caffeine synthesis. Mg2+, Mn2+ and Ca2+ slightly stimulated enzyme activity but they were not essential. Paraxanthine was shown to be most active among methylxanthines, as the methyl acceptor. However, the formation of paraxanthine from 1-methylxanthine was very low and that from 7-methylxanthine was nil, suggesting that the synthesis of caffeine from paraxanthine is of little importance in intact plants. Xanthine, xanthosine, XMP and hypoxanthine were all inactive as methyl acceptors, whereas [2(-14)C]xanthine and [8(-14)C]hypoxanthine were catabolized to allantoin and urea by tea-leaf extracts. The apparent Km values are as follows: 7-methylxanthine, 1.0 times 10(-14)M; theobromine, 1.0 times 10(-3)M; paraxanthine, 0.2 times 10(-3)M; S-adenosylmethionine, 0.25 times 10(-4)M (with each of the three substrates). 3. The results suggest that the pathway for caffeine biosynthesis is as follows: 7-methylxanthine leads to theobromine leads to caffeine. In contrast, it is suggested that theophylline is synthesized from 1-methylxanthine. The methyl groups of the purine ring of caffeine are all derived directly from the methyl group of S-adenosylmethionine. Little is known about the pathways leading to the formation of 7-methylxanthine. 4. A good correlation between caffeine synthesis and shoot formation or growth of tea seedlings was shown, suggesting that the methylating systems in caffeine synthesis are closely associated with purine nucleotide and nucleic acid metabolism in tea plants. PMID:238504

Withdrawal syndrome after the double-blind cessation of caffeine consumption.

Science.gov (United States)

Silverman, K; Evans, S M; Strain, E C; Griffiths, R R

1992-10-15

People who stop consuming caffeine may have symptoms, but the incidence and severity of caffeine withdrawal are not known. This study was performed to determine the effects in the general population of ending one's dietary intake of caffeine. We studied 62 normal adults whose intake of caffeine was low to moderate (mean amount, 235 mg--the equivalent of 2.5 cups of coffee--per day). They completed questionnaires about symptoms and tests of their mood and performance when consuming their normal diets (base-line period) and at the end of each of two two-day periods during which they consumed caffeine-free diets and under double-blind conditions received capsules containing placebo (placebo period) or caffeine (caffeine period) in amounts equal to their daily caffeine consumption. More subjects had abnormally high Beck Depression Inventory scores (11 percent), high scores on the trait scale of the State-Trait Anxiety Inventory (8 percent), low vigor scores (11 percent) and high fatigue scores (8 percent) on the Profile of Mood States, and moderate or severe headache (52 percent) during the placebo period than during either the base-line period (2, 0, 0, 0, and 2 percent, respectively; P less than 0.05) or the caffeine period (3, 2, 2, 0, and 6 percent; P less than 0.05). More subjects reported unauthorized use of medications during the placebo period (13 percent) than during the caffeine period (2 percent, P = 0.017). Performance of a tapping task was slower during the placebo period than during the base-line and caffeine periods (P less than 0.01). Persons who consume low or moderate amounts of caffeine may have a withdrawal syndrome after their daily consumption of caffeine ceases.

Gene expression profiles of inducible nitric oxide synthase and cytokines in Leishmania major-infected macrophage-like RAW 264.7 cells treated with gallic acid

NARCIS (Netherlands)

Radtke, O.A.; Kiderlen, A.F.; Kayser, Oliver; Kolodziej, H

2004-01-01

The effects of gallic acid on the gene expressions of inducible nitric oxide synthase (iNOS) and the cytokines interleukin (IL)-1, IL-10, IL-12, IL-18, TNF-alpha, and interferon (IFN)-gamma were investigated by reverse-transcription polymerase chain reaction (RT-PCR). The experiments were performed

A Possible Trifunctional β-Carotene Synthase Gene Identified in the Draft Genome of Aurantiochytrium sp. Strain KH105

Directory of Open Access Journals (Sweden)

Hiroaki Iwasaka

2018-04-01

Full Text Available Labyrinthulomycetes have been regarded as a promising industrial source of xanthophylls, including astaxanthin and canthaxanthin, polyunsaturated fatty acids such as docosahexaenoic acid and docosapentaenoic acid, ω-3 oils, and terpenic hydrocarbons, such as sterols and squalene. A Thraustochytrid, Aurantiochytrium sp. KH105 produces carotenoids, including astaxanthin, with strong antioxidant activity. To gain genomic insights into this capacity, we decoded its 97-Mbp genome and characterized genes for enzymes involved in carotenoid biosynthesis. Interestingly, all carotenogenic genes, as well as other eukaryotic genes, appeared duplicated, suggesting that this strain is diploid. In addition, among the five genes involved in the pathway from geranylgeranyl pyrophosphate to astaxanthin, geranylgeranyl phytoene synthase (crtB, phytoene desaturase (crtI and lycopene cyclase (crtY were fused into single gene (crtIBY with no internal stop codons. Functionality of the trifunctional enzyme, CrtIBY, to catalyze the reaction from geranylgeranyl diphosphate to β-carotene was confirmed using a yeast assay system and mass spectrometry. Furthermore, analyses of differential gene expression showed characteristic up-regulation of carotenoid biosynthetic genes during stationary and starvation phases under these culture conditions. This suggests genetic engineering events to promote more efficient production of carotenoids. We also showed an occurrence of crtIBY in other Thraustochytrid species.

Caffeine Inhibits Acetylcholinesterase, But Not Butyrylcholinesterase

Directory of Open Access Journals (Sweden)

Petr Dobes

2013-05-01

Full Text Available Caffeine is an alkaloid with a stimulant effect in the body. It can interfere in transmissions based on acetylcholine, epinephrine, norepinephrine, serotonin, dopamine and glutamate. Clinical studies indicate that it can be involved in the slowing of Alzheimer disease pathology and some other effects. The effects are not well understood. In the present work, we focused on the question whether caffeine can inhibit acetylcholinesterase (AChE and/or, butyrylcholinesterase (BChE, the two enzymes participating in cholinergic neurotransmission. A standard Ellman test with human AChE and BChE was done for altering concentrations of caffeine. The test was supported by an in silico examination as well. Donepezil and tacrine were used as standards. In compliance with Dixon’s plot, caffeine was proved to be a non-competitive inhibitor of AChE and BChE. However, inhibition of BChE was quite weak, as the inhibition constant, Ki, was 13.9 ± 7.4 mol/L. Inhibition of AChE was more relevant, as Ki was found to be 175 ± 9 µmol/L. The predicted free energy of binding was −6.7 kcal/mol. The proposed binding orientation of caffeine can interact with Trp86, and it can be stabilize by Tyr337 in comparison to the smaller Ala328 in the case of human BChE; thus, it can explain the lower binding affinity of caffeine for BChE with reference to AChE. The biological relevance of the findings is discussed.

Studies of action of heavy metals on caffeine degradation by ...

African Journals Online (AJOL)

Caffeine is an important naturally occurring compound that can be degraded by bacteria. Excessive caffeine consumption is known to have some adverse problems. Previously, Leifsonia sp. strain SIU capable of degrading caffeine was isolated from agricultural soil. The bacterium was tested for its ability to degrade caffeine ...

Polyhydroxyalkanoate production by a novel bacterium Massilia sp. UMI-21 isolated from seaweed, and molecular cloning of its polyhydroxyalkanoate synthase gene.

Science.gov (United States)

Han, Xuerong; Satoh, Yasuharu; Kuriki, Yumi; Seino, Teruyuki; Fujita, Shinji; Suda, Takanori; Kobayashi, Takanori; Tajima, Kenji

2014-11-01

We successfully isolated one microorganism (UMI-21) from Ulva, a green algae that contains starch. The strain UMI-21 can produce polyhydroxyalkanoate (PHA) from starch, maltotriose, or maltose as a sole carbon source. Taxonomic studies and 16S rDNA sequence analysis revealed that strain UMI-21 was phylogenetically related to species of the genus Massilia. The PHA content under the cultivation condition using a 10-L jar fermentor was 45.5% (w/w). This value was higher than that obtained after cultivation in a flask, suggesting the possibility of large-scale PHA production by UMI-21 from starch. A major issue for the industrial production of microbial PHAs is the very high production cost. Starch is a relatively inexpensive substrate that is also found in abundant seaweeds such as Ulva. Therefore, the strain isolated in this study may be very useful for producing PHA from seaweeds containing polysaccharides such as starch. In addition, a 3.7-kbp DNA fragment containing the whole PHA synthase gene (phaC) was obtained from the strain UMI-21. The results of open reading frame (ORF) analysis suggested that the DNA fragment contained two ORFs, which were composed of 1740 (phaC) and 564 bp (phaR). The deduced amino acid sequence of PhaC from strain UMI-21 shared high similarity with PhaC from Ralstonia eutropha, which is a representative PHA-producing bacterium with a class I PHA synthase. This is the first report for the cloning of the PHA synthase gene from Massilia species. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Identification and characterization of two bisabolene synthases from linear glandular trichomes of sunflower (Helianthus annuus L., Asteraceae).

Science.gov (United States)

Aschenbrenner, Anna-Katharina; Kwon, Moonhyuk; Conrad, Jürgen; Ro, Dae-Kyun; Spring, Otmar

2016-04-01

Sunflower is known to produce a variety of bisabolene-type sesquiterpenes and accumulates these substances in trichomes of leaves, stems and flowering parts. A bioinformatics approach was used to identify the enzyme responsible for the initial step in the biosynthesis of these compounds from its precursor farnesyl pyrophosphate. Based on sequence similarity with a known bisabolene synthases from Arabidopsis thaliana AtTPS12, candidate genes of Helianthus were searched in EST-database and used to design specific primers. PCR experiments identified two candidates in the RNA pool of linear glandular trichomes of sunflower. Their sequences contained the typical motifs of sesquiterpene synthases and their expression in yeast functionally characterized them as bisabolene synthases. Spectroscopic analysis identified the stereochemistry of the product of both enzymes as (Z)-γ-bisabolene. The origin of the two sunflower bisabolene synthase genes from the transcripts of linear trichomes indicates that they may be involved in the synthesis of sesquiterpenes produced in these trichomes. Comparison of the amino acid sequences of the sunflower bisabolene synthases showed high similarity with sesquiterpene synthases from other Asteracean species and indicated putative evolutionary origin from a β-farnesene synthase. Copyright © 2016 Elsevier Ltd. All rights reserved.

Caffeine enhances working memory for extraverts.

Science.gov (United States)

Smillie, Luke D; Gökçen, Elif

2010-12-01

Using a randomized double-blind placebo-controlled design we examined the effects of caffeine on working memory (WM) as a function of extraverted personality. Participants (N=59) received 200mg of caffeine and placebo in counterbalanced-order over two sessions prior to completing a 'N-Back' WM paradigm. Findings revealed that caffeine administration relative to the placebo condition resulted in heightened WM performance, but only for extraverted participants. We suggest based on previous theory and research that dopamine function (DA) may be the most plausible mechanism underlying this finding. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

[Caffeine: a nutrient, a drug or a drug of abuse].

Science.gov (United States)

Pardo Lozano, Ricardo; Alvarez García, Yolanda; Barral Tafalla, Diego; Farré Albaladejo, Magí

2007-01-01

Coffee, tea, chocolate and caffeinated drinks are the main sources of caffeine, which is consumed in almost all ages and socioeconomic levels. Caffeine acts as a non-selective adenosine receptor antagonist in the central nervous system. Its main effects are as psychostimulant, acting in addition on the respiratory, muscular and cardiovascular systems. Basically, caffeine is metabolized by the hepatic cytochrome P-450 1A2 enzymes (CYP1A2). Several drugs can interact with its metabolism. The observed interindividual differences of its effects can be explained by variations in its metabolism. The main therapeutic use of caffeine is bronchodilator in respiratory diseases. Other possible uses are under investigation. Acute or chronic consumption of caffeine can induce several adverse effects, including intoxication that can be lethal. Finally, caffeine can be considered a drug of abuse. It has positive reinforcing actions, produces tolerance, and a withdrawal syndrome after stopping its consumption. Caffeine can cause different mental disorders such as dependence, which is not included in the DSM-IV-R, withdrawal syndrome and intoxication. Depending on its use, caffeine can be considered a nutrient, a drug or a drug of abuse.

Caffeine, cognitive failures and health in a non-working community sample.

Science.gov (United States)

Smith, Andrew P

2009-01-01

Most studies of the effects of caffeine on performance have been conducted in the laboratory and further information is required on the real-life effects of caffeine consumption on cognition. In addition, possible effects of caffeine consumption on a range of health outcomes should also be assessed in these studies to enable cost-benefit analyses to be conducted. Secondary analyses of a large epidemiological database (N = 3223 non-working participants, 57% female, with a mean age of 49.6 years, range 17-92 years) were conducted to examine associations between caffeine consumption (mean caffeine consumption was 140 mg/day, range 0-1800 mg) and cognitive failures (errors of memory, attention and action) in a non-working sample. Associations between caffeine consumption and physical and mental health problems were also examined. The study involved secondary analyses of a database formed by combining the Bristol Stress and Health at Work and Cardiff Health and Safety at Work studies. Associations between caffeine consumption and frequency of cognitive failures and health outcomes were examined in a sample of non-workers. After controlling for possible confounding factors significant associations between caffeine consumption and fewer cognitive failures were observed. Initial analyses suggested that many health variables were associated with regular level of caffeine consumption. However, most of the significant effects of caffeine disappeared when demographic and lifestyle factors were controlled for. Consumption of caffeine was, however, associated with a reduced risk of depression. These effects were also observed in separate analyses examining the source of the caffeine (coffee and tea). Overall, the results show that caffeine consumption may benefit cognitive functioning in a non-working population. This confirms earlier findings from working samples. This beneficial effect of caffeine was not associated with negative health consequences. Indeed, consumption of

The paradox of caffeine-zolpidem interaction: a network analysis.

Science.gov (United States)

Myslobodsky, Michael

2009-10-01

A widely prescribed and potent short-acting hypnotic, zolpidem has become the mainstay for the treatment of middle-of-the-night sleeplessness. It is expected to be antagonized by caffeine. Paradoxically, in some cases caffeine appears to slightly enhance zolpidem sedation. The pharmacokinetic and pharmacodynamic nature of this odd effect remains unexplored. The purpose of this study is to reproduce a hypothetical molecular network recruited by caffeine when co-administered with zolpidem using Ingenuity Pathway Analysis. Thus generated, network drew attention to several possible contributors to caffeine sedation, such as tachykinin precursor 1, cannabinoid, and GABA receptors. The present overview is centered on the possibility that caffeine potentiation of zolpidem sedation does not involve a centralized interaction of specific neurotransmitters, but rather is contributed by its antioxidant capacity. It is proposed that by modifying the cellular redox state, caffeine ultimately reduces the pool of reactive oxygen species, thereby increasing the bioavailability of endogenous melatonin for interaction with zolpidem. This side effect of caffeine encourages further studies of multiple antioxidants as an attractive way to potentially increasing somnolence.

Action of caffeine on x-irradiated HeLa cells. VII. Evidence that caffeine enhances expression of potentially lethal radiation damage

International Nuclear Information System (INIS)

Beetham, K.L.; Tolmach, L.J.

1984-01-01

HeLa cells irradiated with 2 Gy of 220-kV X rays suffer a 60-70% loss of colony-forming ability which is increased to 90% by postirradiation treatment with 10 mM caffeine for 6 hr. The detailed postirradiation patterns of cell death and sister-cell fusion in such cultures and in cultures in which the colony-forming ability was brought to about the same level by treatment with a larger (4 Gy) X-ray dose alone or by longer (48 hr) treatment with 10 mM caffeine alone were recorded by time-lapse cinemicrography. Because the patterns of cell death and fusion differ radically in irradiated and in caffeine-treated cultures, the response of the additional cells killed by the combined treatment can be identified as X-ray induced rather than caffeine induced. The appearance of cultures after several days of incubation confirms the similarity of the post-treatment patterns of proliferation in cultures suffering enhanced killing to those occurring in cultures treated with larger doses of X rays alone. It is concluded that x rays do not sensitize cells to caffeine, but rather that caffeine enhanced the expression of potentially lethal radiation-induced damage

[Caffeine--common ingredient in a diet and its influence on human health].

Science.gov (United States)

Wierzejska, Regina

2012-01-01

Caffeine is widely consumed by people of all ages. In the last period a market of caffeine-containing products, particularly energy drinks and food supplements increased. Caffeine for years is under discussion, whether has positive whether adverse impact on health. Children are a group of special anxieties. Caffeine is a stimulant of central nervous system and therefore is probably the most commonly used psychoactive substance in the world. The physiological effect of caffeine and the lack of nutrition value causes a great interest its impact on health, especially with reference to the risk of cardiovascular diseases. Results of scientific research are not clear. The influence of caffeine on the human body is conditioned with the individual metabolism of caffeine which also depends on many endogenic and environmental factors. According to the current knowledge moderate caffeine intake by healthy adults at a dose level of 400 mg a day is not associated with adverse effects, but it also depends on other health determinants of a lifestyle. Excessive caffeine consumption can cause negative health consequences such as psychomotor agitation, insomnia, headache, gastrointestinal complaints. Adverse effect of caffeine intoxication is classified in World Health Organization's International Classification of Diseases (ICD-10). Metabolism of caffeine by pregnant woman is slowed down. Caffeine and its metabolites pass freely across the placenta into a fetus. For this reason pregnant women should limit caffeine intake. Children and adolescents should also limit daily caffeine consumption. It results from the influence of caffeine on the central nervous system in the period of rapid growth and the final stage of brain development, calcium balance and sleep duration. Average daily caffeine consumption in European countries ranging from 280-490 mg. The highest caffeine intake is in Scandinavian countries what results from the great consumption of the coffee. As far as caffeine

2-Methyl-3-buten-2-ol (MBO) synthase expression in Nostoc punctiforme leads to over production of phytols.

Science.gov (United States)

Gupta, Dinesh; Ip, Tina; Summers, Michael L; Basu, Chhandak

2015-01-01

Phytol is a diterpene alcohol of medicinal importance and it also has potential to be used as biofuel. We found over production of phytol in Nostoc punctiforme by expressing a 2-Methyl-3-buten-2-ol (MBO) synthase gene. MBO synthase catalyzes the conversion of dimethylallyl pyrophosphate (DMAPP) into MBO, a volatile hemiterpene alcohol, in Pinus sabiniana. The result of enhanced phytol production in N. punctiforme, instead of MBO, could be explained by one of the 2 models: either the presence of a native prenyltransferase enzyme with a broad substrate specificity, or appropriation of a MBO synthase metabolic intermediate by a native geranyl diphosphate (GDP) synthase. In this work, an expression vector with an indigenous petE promoter for gene expression in the cyanobacterium N. punctiforme was constructed and MBO synthase gene expression was successfully shown using reverse transcriptase (RT)-PCR and SDS-PAGE. Gas chromatography--mass spectrophotometry (GC-MS) was performed to confirm phytol production from the transgenic N. punctiforme strains. We conclude that the expression of MBO synthase in N. punctiforme leads to overproduction of an economically important compound, phytol. This study provides insights about metabolic channeling of isoprenoids in cyanobacteria and also illustrates the challenges of bioengineering non-native hosts to produce economically important compounds.

Caffeine Extraction from Raw and Roasted Coffee Beans.

Science.gov (United States)

Chiang, Donyau; Lin, Chih-Yang; Hu, Chen-Ti; Lee, Sanboh

2018-04-01

Coffee is a stimulant, psychoactive, popular daily beverage, and its caffeine affects human physiological health and behavior. These important issues prompted us to study caffeine extraction from both the raw and roasted coffee beans of 3 types at different temperatures. A hemispheric model is developed to simulate the extraction process of the caffeine from the coffee beans of hemisphere is proposed. The experimental data are in good agreement with the predicted model. The effective diffusivities of caffeine in both the raw and roasted beans increase with temperature in all 3 types. An incubation period, decreasing with increasing temperature, is observed in all samples studied. Caffeine extraction in roasted beans is more rapid than that for the raw beans and the time difference is significant at low temperatures. In both the raw and roasted samples, caffeine diffusion in the raw beans and the incubation behavior are thermally activated processes. Single activation energies are obtained for diffusion within the extraction temperature range for all beans tested with the exception of one type of the coffee beans, Mandheling, which exhibits 2 activation energies in raw samples. The surface energies of the epidermis of the raw beans and roasted beans obtained from the contact angle measurements are used to interpret the difference of incubation periods. This study has a potential application to the decaffeinated coffee industry.Caffeine affects human physiological health and behavior so that caffeine extraction from coffee beans of different types at different temperatures is important for product refining and customers. © 2018 Institute of Food Technologists®.

Structure of the human beta-ketoacyl [ACP] synthase from the mitochondrial type II fatty acid synthase

DEFF Research Database (Denmark)

Christensen, Caspar Elo; Kragelund, Birthe B; von Wettstein-Knowles, Penny

2007-01-01

Two distinct ways of organizing fatty acid biosynthesis exist: the multifunctional type I fatty acid synthase (FAS) of mammals, fungi, and lower eukaryotes with activities residing on one or two polypeptides; and the dissociated type II FAS of prokaryotes, plastids, and mitochondria with individual...... activities encoded by discrete genes. The beta-ketoacyl [ACP] synthase (KAS) moiety of the mitochondrial FAS (mtKAS) is targeted by the antibiotic cerulenin and possibly by the other antibiotics inhibiting prokaryotic KASes: thiolactomycin, platensimycin, and the alpha-methylene butyrolactone, C75. The high...... degree of structural similarity between mitochondrial and prokaryotic KASes complicates development of novel antibiotics targeting prokaryotic KAS without affecting KAS domains of cytoplasmic FAS. KASes catalyze the C(2) fatty acid elongation reaction using either a Cys-His-His or Cys-His-Asn catalytic...

Caffeine Use Disorder: A Comprehensive Review and Research Agenda

OpenAIRE

Meredith, Steven E.; Juliano, Laura M.; Hughes, John R.; Griffiths, Roland R.

2013-01-01

Caffeine is the most commonly used drug in the world. Although consumption of low to moderate doses of caffeine is generally safe, an increasing number of clinical studies are showing that some caffeine users become dependent on the drug and are unable to reduce consumption despite knowledge of recurrent health problems associated with continued use. Thus, the World Health Organization and some health care professionals recognize caffeine dependence as a clinical disorder. In this comprehensi...

Post-study caffeine administration enhances memory consolidation in humans.

Science.gov (United States)

Borota, Daniel; Murray, Elizabeth; Keceli, Gizem; Chang, Allen; Watabe, Joseph M; Ly, Maria; Toscano, John P; Yassa, Michael A

2014-02-01

It is currently not known whether caffeine has an enhancing effect on long-term memory in humans. We used post-study caffeine administration to test its effect on memory consolidation using a behavioral discrimination task. Caffeine enhanced performance 24 h after administration according to an inverted U-shaped dose-response curve; this effect was specific to consolidation and not retrieval. We conclude that caffeine enhanced consolidation of long-term memories in humans.

Exercise and Sport Performance with Low Doses of Caffeine

OpenAIRE

Spriet, Lawrence L.

2014-01-01

Caffeine is a popular work-enhancing supplement that has been actively researched since the 1970s. The majority of research has examined the effects of moderate to high caffeine doses (5–13 mg/kg body mass) on exercise and sport. These caffeine doses have profound effects on the responses to exercise at the whole-body level and are associated with variable results and some undesirable side effects. Low doses of caffeine (

Caffeine: How Much Is Too Much?

Science.gov (United States)

Healthy Lifestyle Nutrition and healthy eating Caffeine has its perks, but it can pose problems too. Find out how much is too much and if you need to curb ... By Mayo Clinic Staff If you rely on caffeine to wake you up and keep you going, ...

Molecular Dynamics Simulation Studies of Caffeine Aggregation in Aqueous Solution

OpenAIRE

Tavagnacco, Letizia; Schnupf, Udo; Mason, Philip E.; Saboungi, Marie-Louise; Cesàro, Attilio; Brady, John W.

2011-01-01

Molecular dynamics simulations were carried out on a system of eight independent caffeine molecules in a periodic box of water at 300 K, representing a solution near the solubility limit for caffeine at room temperature, using a newly-developed CHARMM-type force field for caffeine in water. Simulations were also conducted for single caffeine molecules in water using two different water models (TIP3P and TIP4P). Water was found to structure in a complex fashion around the planar caffeine molec...

Caffeine and blood pressure response: sex, age, and hormonal status.

Science.gov (United States)

Farag, Noha H; Whitsett, Thomas L; McKey, Barbara S; Wilson, Michael F; Vincent, Andrea S; Everson-Rose, Susan A; Lovallo, William R

2010-06-01

The pressor effect of caffeine has been established in young men and premenopausal women. The effect of caffeine on blood pressure (BP) remains unknown in postmenopausal women and in relation to hormone replacement therapy (HRT) use. In a randomized, 2-week cross-over design, we studied 165 healthy men and women in 6 groups: men and premenopausal women (35-49 yrs) vs. men and postmenopausal women (50-64 yrs), with postmenopausal women divided into those taking no hormone replacements (HR), estrogen alone, or estrogen and progesterone. Testing during one week of the study involved 6 days of caffeine maintenance at home (80 mg, 3x/day) followed by testing of responses to a challenge dose of caffeine (250 mg) in the laboratory. The other week involved ingesting placebos on maintenance and lab days. Resting BP responses to caffeine were measured at baseline and at 45 to 60 min following caffeine vs placebo ingestion, using automated monitors. Ingestion of caffeine resulted in a significant increase in systolic BP in all 6 groups (4 +/- .6, p < 0.01). Diastolic BP significantly increased in response to caffeine in all (3 +/- .4, p < 0.04) but the group of older men (2 +/- 1.0, p = 0.1). The observed pressor responses to caffeine did not vary by age. Caffeine resulted in an increase in BP in healthy, normotensive, young and older men and women. This finding warrants the consideration of caffeine in the lifestyle interventions recommended for BP control across the age span.