WorldWideScience

Sample records for cadmium 112 target

  1. Probable projectile-target combinations for the synthesis of super heavy nucleus $^{286}$112

    CERN Document Server

    Santhosh, K P

    2014-01-01

    The fusion cross sections for the reactions of all the projectile-target combinations found in the cold valleys of $^{286}$112 have been studied using scattering potential as the sum of Coulomb and proximity potential, so as to predict the most probable projectile-target combinations in heavy ion fusion reactions for the synthesis of super heavy nucleus $^{286}$112. While considering the nature of potential pockets and half lives of the colliding nuclei, the systems $^{82}$Ge + $^{204}$Hg, $^{80}$Ge + $^{206}$Hg and $^{78}$Zn + $^{208}$Pb found in the deep cold valley region and the systems $^{48}$Ca+$^{238}$U, $^{38}$S+$^{248}$Cm and $^{44}$Ar+$^{242}$Pu in the cold valleys are predicted to be the better optimal projectile-target combinations for the synthesis of super heavy nucleus $^{286}$112.

  2. Microphthalmia-associated transcription factor as the molecular target of cadmium toxicity in human melanocytes

    International Nuclear Information System (INIS)

    Highlights: • In human melanocytes, cadmium decreases the expression of MITF-M and tyrosinase and their mRNAs. • In human melanoma cells, cadmium decreases the expression of MITF-M protein and tyrosinase mRNA. • Expression of MITF-H is less sensitive to cadmium toxicity in melanocyte-linage cells. • Cadmium does not decrease the expression of MITF-H in retinal pigment epithelial cells. • MITF-M is the molecular target of cadmium toxicity in melanocytes. - Abstract: Dietary intake of cadmium is inevitable, causing age-related increase in cadmium accumulation in many organs, including hair, choroid and retinal pigment epithelium (RPE). Cadmium has been implicated in the pathogenesis of hearing loss and macular degeneration. The functions of cochlea and retina are maintained by melanocytes and RPE, respectively, and the differentiation of these pigment cells is regulated by microphthalmia-associated transcription factor (MITF). In the present study, we explored the potential toxicity of cadmium in the cochlea and retina by using cultured human melanocytes and human RPE cell lines. MITF consists of multiple isoforms, including melanocyte-specific MITF-M and widely expressed MITF-H. Levels of MITF-M protein and its mRNA in human epidermal melanocytes and HMV-II melanoma cells were decreased significantly by cadmium. In parallel with the MITF reduction, mRNA levels of tyrosinase, the key enzyme of melanin biosynthesis that is regulated by MITF-M, were also decreased. In RPE cells, however, the levels of total MITF protein, constituting mainly MITF-H, were not decreased by cadmium. We thus identify MITF-M as the molecular target of cadmium toxicity in melanocytes, thereby accounting for the increased risk of disability from melanocyte malfunction, such as hearing and vision loss among people with elevated cadmium exposure

  3. Microphthalmia-associated transcription factor as the molecular target of cadmium toxicity in human melanocytes

    Energy Technology Data Exchange (ETDEWEB)

    Chantarawong, Wipa [Department of Molecular Biology and Applied Physiology, Tohoku University School of Medicine, Sendai (Japan); Inter Departmental Multidisciplinary Graduate Program in Bioscience, Faculty of Science, Kasetsart University, Bangkok (Thailand); Takeda, Kazuhisa; Sangartit, Weerapon; Yoshizawa, Miki [Department of Molecular Biology and Applied Physiology, Tohoku University School of Medicine, Sendai (Japan); Pradermwong, Kantimanee [Department of Zoology, Faculty of Science, Kasetsart University, Bangkok (Thailand); Shibahara, Shigeki, E-mail: shibahar@med.tohoku.ac.jp [Department of Molecular Biology and Applied Physiology, Tohoku University School of Medicine, Sendai (Japan)

    2014-11-28

    Highlights: • In human melanocytes, cadmium decreases the expression of MITF-M and tyrosinase and their mRNAs. • In human melanoma cells, cadmium decreases the expression of MITF-M protein and tyrosinase mRNA. • Expression of MITF-H is less sensitive to cadmium toxicity in melanocyte-linage cells. • Cadmium does not decrease the expression of MITF-H in retinal pigment epithelial cells. • MITF-M is the molecular target of cadmium toxicity in melanocytes. - Abstract: Dietary intake of cadmium is inevitable, causing age-related increase in cadmium accumulation in many organs, including hair, choroid and retinal pigment epithelium (RPE). Cadmium has been implicated in the pathogenesis of hearing loss and macular degeneration. The functions of cochlea and retina are maintained by melanocytes and RPE, respectively, and the differentiation of these pigment cells is regulated by microphthalmia-associated transcription factor (MITF). In the present study, we explored the potential toxicity of cadmium in the cochlea and retina by using cultured human melanocytes and human RPE cell lines. MITF consists of multiple isoforms, including melanocyte-specific MITF-M and widely expressed MITF-H. Levels of MITF-M protein and its mRNA in human epidermal melanocytes and HMV-II melanoma cells were decreased significantly by cadmium. In parallel with the MITF reduction, mRNA levels of tyrosinase, the key enzyme of melanin biosynthesis that is regulated by MITF-M, were also decreased. In RPE cells, however, the levels of total MITF protein, constituting mainly MITF-H, were not decreased by cadmium. We thus identify MITF-M as the molecular target of cadmium toxicity in melanocytes, thereby accounting for the increased risk of disability from melanocyte malfunction, such as hearing and vision loss among people with elevated cadmium exposure.

  4. Microphthalmia-associated transcription factor as the molecular target of cadmium toxicity in human melanocytes.

    Science.gov (United States)

    Chantarawong, Wipa; Takeda, Kazuhisa; Sangartit, Weerapon; Yoshizawa, Miki; Pradermwong, Kantimanee; Shibahara, Shigeki

    2014-11-28

    Dietary intake of cadmium is inevitable, causing age-related increase in cadmium accumulation in many organs, including hair, choroid and retinal pigment epithelium (RPE). Cadmium has been implicated in the pathogenesis of hearing loss and macular degeneration. The functions of cochlea and retina are maintained by melanocytes and RPE, respectively, and the differentiation of these pigment cells is regulated by microphthalmia-associated transcription factor (MITF). In the present study, we explored the potential toxicity of cadmium in the cochlea and retina by using cultured human melanocytes and human RPE cell lines. MITF consists of multiple isoforms, including melanocyte-specific MITF-M and widely expressed MITF-H. Levels of MITF-M protein and its mRNA in human epidermal melanocytes and HMV-II melanoma cells were decreased significantly by cadmium. In parallel with the MITF reduction, mRNA levels of tyrosinase, the key enzyme of melanin biosynthesis that is regulated by MITF-M, were also decreased. In RPE cells, however, the levels of total MITF protein, constituting mainly MITF-H, were not decreased by cadmium. We thus identify MITF-M as the molecular target of cadmium toxicity in melanocytes, thereby accounting for the increased risk of disability from melanocyte malfunction, such as hearing and vision loss among people with elevated cadmium exposure. PMID:25449283

  5. The quadrupole moments of 195-197Ausup(m)(11/2) and the low temperature thermal relaxation of gold in cadmium

    International Nuclear Information System (INIS)

    sup(195, 197m)Hg has been oriented at low temperature in a cadmium single crystal. From the orientation pattern of the 388 keV gamma ray Vsub(zz)(HgCd) = +1.82(25)x1018 V/cm2 has been deduced. Using the dipole-relaxation mechanism on the gold isomeric state, the relaxation constant Csub(K) = 0.044(5)Ks, the quadrupole interaction frequencies γsub(Q)(195m-AuCd) = +395(18) MHz, γsub(Q)(197m-AuCd) = +380(58) MHz and delta(E2/M1 ; 261 keV) < 0 are obtained from the orientation pattern of the 261 and 279 keV gamma rays. Using literature electric field gradient of gold in cadmium, Q(195m-Au,11/2) = (+)1.41(10) b and Q(197m-Au,11/2) = (+)1.35(22) b can be deduced. (Auth.)

  6. Diffusion-based separation methods: dry distillation of zinc, cadmium and mercury isotopes from irradiated targets

    International Nuclear Information System (INIS)

    Diffusion-based separation methods allow the extraction of produced radionuclides with a low loss of target material, which is of special importance when enriched target material is used. We present a simple, non-destructive and rapid method to separate radioactive isotopes of IIB group elements (zinc, cadmium and mercury) from IB group metal targets irradiated with protons. Irradiated target foils were heated to a temperature 20oC below the melting point of the target material. During these conditions at least 90% of the desired radioactivity was evaporated with negligible loss of target material. Separation time was 15 min for mercury, 60 min for cadmium and 120 min for zinc. (author)

  7. Cadmium carcinogenesis

    International Nuclear Information System (INIS)

    Cadmium is a heavy metal of considerable environmental and occupational concern. Cadmium compounds are classified as human carcinogens by several regulatory agencies. The most convincing data that cadmium is carcinogenic in humans comes from studies indicating occupational cadmium exposure is associated with lung cancer. Cadmium exposure has also been linked to human prostate and renal cancer, although this linkage is weaker than for lung cancer. Other target sites of cadmium carcinogenesis in humans, such as liver, pancreas and stomach, are considered equivocal. In animals, cadmium effectively induces cancers at multiple sites and by various routes. Cadmium inhalation in rats induces pulmonary adenocarcinomas, in accord with its role in human lung cancer. Cadmium can induce tumors and/or preneoplastic lesions within the rat prostate after ingestion or injection. At relatively high doses, cadmium induces benign testicular tumors in rats, but these appear to be due to early toxic lesions and loss of testicular function, rather than from a specific carcinogenic effect of cadmium. Like many other metals, cadmium salts will induce mesenchymal tumors at the site of subcutaneous (s.c.) or intramuscular (i.m.) injections, but the human relevance of these is dubious. Other targets of cadmium in rodents include the liver, adrenal, pancreas, pituitary, and hematopoietic system. With the exception of testicular tumors in rodents, the mechanisms of cadmium carcinogenesis are poorly defined. Cadmium can cause any number of molecular lesions that would be relevant to oncogenesis in various cellular model systems. Most studies indicate cadmium is poorly mutagenic and probably acts through indirect or epigenetic mechanisms, potentially including aberrant activation of oncogenes and suppression of apoptosis

  8. Characterization of wheat miRNAs and their target genes responsive to cadmium stress.

    Science.gov (United States)

    Qiu, ZongBo; Hai, BenZhai; Guo, JunLi; Li, YongFang; Zhang, Liang

    2016-04-01

    A increasing number of microRNAs have been shown to play important regulatory roles in plant responses to various metal stresses. However, little information about miRNAs especially miRNAs responsive to cadmium (Cd) stress is available in wheat. To investigate the role of miRNAs in responses to Cd stress, wheat seedlings were subjected to 250 μM Cd solution for 6, 12, 24 and 48 h, and analyses of morphological and physiological changes as well as the expression of five miRNAs and their corresponding targets were carried out. Our results demonstrated that miRNAs and their targets were differentially expressed in leaves and roots of wheat seedlings exposed to Cd stress. Furthermore, miR398 may involve in oxidative stress tolerance by regulating its target CSD to participate in Cd stress. Among ten miRNA-target pairs studied, nine pairs showed complex regulation relationship in leaves and roots of wheat seedlings exposed to Cd stress. These findings suggested that miRNAs are involved in the mediation of Cd stress signaling responses in wheat. The characterization of the miRNAs and the associated targets in responses to Cd exposure provides a framework for understanding the molecular mechanism of heavy metal tolerance in plants. PMID:26854408

  9. Subcellular targets of cadmium nephrotoxicity: cadmium binding to renal membrane proteins in animals with or without protective metallothionein synthesis.

    OpenAIRE

    Nordberg, G F; Jin, T; Nordberg, M.

    1994-01-01

    Nephrotoxic effects of cadmium exposure are well established in humans and experimental animals. An early manifestation of such toxicity is calciuria a few hours after injection of CdMT in rats. Protection against calciuria and other adverse effects such as proteinuria (occurring later) is offered by pretreatment with Cd, which effectively induces metallothionein synthesis. In the present experiment, one group of animals was given pretreatment with CdCl2 to induce metallothionein synthesis. T...

  10. Target hazard quotient evaluation of cadmium and lead in fish from Caspian Sea.

    Science.gov (United States)

    Basim, Yalda; Khoshnood, Zahra

    2016-02-01

    Heavy metals are being increasingly released into the natural waters from geological and anthropogenic sources. The distributions of several heavy metals such as cadmium (Cd) and lead (Pb) were investigated in muscle and liver of three different fish species seasonally collected from Caspian Sea (autumn 2011-summer 2012). The concentrations of all metals were lower in flesh than those recorded in liver due to their physiological roles. The target hazard quotient (THQ) index for fish was calculated. Estimation of THQ calculations for the contaminated fish consumption was calculated to evaluate the effect of pollution on health. Total metal THQ values of Pb and Cd for adults were 0.05 and 0.04 in Anzali and Noshahr, respectively, and for children were 0.08 and 0.05 in Anzali and Noshahr, respectively.

  11. Human Cytomegalovirus miR-UL112-3p Targets TLR2 and Modulates the TLR2/IRAK1/NFκB Signaling Pathway.

    Directory of Open Access Journals (Sweden)

    Igor Landais

    2015-05-01

    Full Text Available Human Cytomegalovirus (HCMV encodes multiple microRNAs (miRNAs whose functions are just beginning to be uncovered. Using in silico approaches, we identified the Toll-Like Receptor (TLR innate immunity pathway as a possible target of HCMV miRNAs. Luciferase reporter assay screens further identified TLR2 as a target of HCMV miR-UL112-3p. TLR2 plays a major role in innate immune response by detecting both bacterial and viral ligands, including HCMV envelope proteins gB and gH. TLR2 activates a variety of signal transduction routes including the NFκB pathway. Furthermore, TLR2 plays an important role in controlling CMV infection both in humans and in mice. Immunoblot analysis of cells transfected with a miR-UL112-3p mimic revealed that endogenous TLR2 is down-regulated by miR-UL112-3p with similar efficiency as a TLR2-targeting siRNA (siTLR2. We next found that TLR2 protein level decreases at late times during HCMV infection and correlates with miR-UL112-3p accumulation in fibroblasts and monocytic THP1 cells. Confirming direct miR-UL112-3p targeting, down-regulation of endogenous TLR2 was not observed in cells infected with HCMV mutants deficient in miR-UL112-3p expression, but transfection of miR-UL112-3p in these cells restored TLR2 down-regulation. Using a NFκB reporter cell line, we found that miR-UL112-3p transfection significantly inhibited NFκB-dependent luciferase activity with similar efficiency as siTLR2. Consistent with this observation, miR-UL112-3p transfection significantly reduced the expression of multiple cytokines (IL-1β, IL-6 and IL-8 upon stimulation with a TLR2 agonist. Finally, miR-UL112-3p transfection significantly inhibited the TLR2-induced post-translational activation of IRAK1, a kinase located in the upstream section of the TLR2/NFκB signaling axis. To our knowledge, this is the first identified mechanism of TLR2 modulation by HCMV and is the first report of functional targeting of TLR2 by a viral miRNA. These

  12. Inhaled Cadmium Oxide Nanoparticles: Their in Vivo Fate and Effect on Target Organs

    Science.gov (United States)

    Dumkova, Jana; Vrlikova, Lucie; Vecera, Zbynek; Putnova, Barbora; Docekal, Bohumil; Mikuska, Pavel; Fictum, Petr; Hampl, Ales; Buchtova, Marcela

    2016-01-01

    The increasing amount of heavy metals used in manufacturing equivalently increases hazards of environmental pollution by industrial products such as cadmium oxide (CdO) nanoparticles. Here, we aimed to unravel the CdO nanoparticle destiny upon their entry into lungs by inhalations, with the main focus on the ultrastructural changes that the nanoparticles may cause to tissues of the primary and secondary target organs. We indeed found the CdO nanoparticles to be transported from the lungs into secondary target organs by blood. In lungs, inhaled CdO nanoparticles caused significant alterations in parenchyma tissue including hyperemia, enlarged pulmonary septa, congested capillaries, alveolar emphysema and small areas of atelectasis. Nanoparticles were observed in the cytoplasm of cells lining bronchioles, in the alveolar spaces as well as inside the membranous pneumocytes and in phagosomes of lung macrophages. Nanoparticles even penetrated through the membrane into some organelles including mitochondria and they also accumulated in the cytoplasmic vesicles. In livers, inhalation caused periportal inflammation and local hepatic necrosis. Only minor changes such as diffusely thickened filtration membrane with intramembranous electron dense deposits were observed in kidney. Taken together, inhaled CdO nanoparticles not only accumulated in lungs but they were also transported to other organs causing serious damage at tissue as well as cellular level. PMID:27271611

  13. Inhaled Cadmium Oxide Nanoparticles: Their in Vivo Fate and Effect on Target Organs

    Directory of Open Access Journals (Sweden)

    Jana Dumkova

    2016-06-01

    Full Text Available The increasing amount of heavy metals used in manufacturing equivalently increases hazards of environmental pollution by industrial products such as cadmium oxide (CdO nanoparticles. Here, we aimed to unravel the CdO nanoparticle destiny upon their entry into lungs by inhalations, with the main focus on the ultrastructural changes that the nanoparticles may cause to tissues of the primary and secondary target organs. We indeed found the CdO nanoparticles to be transported from the lungs into secondary target organs by blood. In lungs, inhaled CdO nanoparticles caused significant alterations in parenchyma tissue including hyperemia, enlarged pulmonary septa, congested capillaries, alveolar emphysema and small areas of atelectasis. Nanoparticles were observed in the cytoplasm of cells lining bronchioles, in the alveolar spaces as well as inside the membranous pneumocytes and in phagosomes of lung macrophages. Nanoparticles even penetrated through the membrane into some organelles including mitochondria and they also accumulated in the cytoplasmic vesicles. In livers, inhalation caused periportal inflammation and local hepatic necrosis. Only minor changes such as diffusely thickened filtration membrane with intramembranous electron dense deposits were observed in kidney. Taken together, inhaled CdO nanoparticles not only accumulated in lungs but they were also transported to other organs causing serious damage at tissue as well as cellular level.

  14. Inhaled Cadmium Oxide Nanoparticles: Their in Vivo Fate and Effect on Target Organs.

    Science.gov (United States)

    Dumkova, Jana; Vrlikova, Lucie; Vecera, Zbynek; Putnova, Barbora; Docekal, Bohumil; Mikuska, Pavel; Fictum, Petr; Hampl, Ales; Buchtova, Marcela

    2016-01-01

    The increasing amount of heavy metals used in manufacturing equivalently increases hazards of environmental pollution by industrial products such as cadmium oxide (CdO) nanoparticles. Here, we aimed to unravel the CdO nanoparticle destiny upon their entry into lungs by inhalations, with the main focus on the ultrastructural changes that the nanoparticles may cause to tissues of the primary and secondary target organs. We indeed found the CdO nanoparticles to be transported from the lungs into secondary target organs by blood. In lungs, inhaled CdO nanoparticles caused significant alterations in parenchyma tissue including hyperemia, enlarged pulmonary septa, congested capillaries, alveolar emphysema and small areas of atelectasis. Nanoparticles were observed in the cytoplasm of cells lining bronchioles, in the alveolar spaces as well as inside the membranous pneumocytes and in phagosomes of lung macrophages. Nanoparticles even penetrated through the membrane into some organelles including mitochondria and they also accumulated in the cytoplasmic vesicles. In livers, inhalation caused periportal inflammation and local hepatic necrosis. Only minor changes such as diffusely thickened filtration membrane with intramembranous electron dense deposits were observed in kidney. Taken together, inhaled CdO nanoparticles not only accumulated in lungs but they were also transported to other organs causing serious damage at tissue as well as cellular level. PMID:27271611

  15. Reversal of dendritic phenotypes in 16p11.2 microduplication mouse model neurons by pharmacological targeting of a network hub.

    Science.gov (United States)

    Blizinsky, Katherine D; Diaz-Castro, Blanca; Forrest, Marc P; Schürmann, Britta; Bach, Anthony P; Martin-de-Saavedra, Maria Dolores; Wang, Lei; Csernansky, John G; Duan, Jubao; Penzes, Peter

    2016-07-26

    The architecture of dendritic arbors contributes to neuronal connectivity in the brain. Conversely, abnormalities in dendrites have been reported in multiple mental disorders and are thought to contribute to pathogenesis. Rare copy number variations (CNVs) are genetic alterations that are associated with a wide range of mental disorders and are highly penetrant. The 16p11.2 microduplication is one of the CNVs most strongly associated with schizophrenia and autism, spanning multiple genes possibly involved in synaptic neurotransmission. However, disease-relevant cellular phenotypes of 16p11.2 microduplication and the driver gene(s) remain to be identified. We found increased dendritic arborization in isolated cortical pyramidal neurons from a mouse model of 16p11.2 duplication (dp/+). Network analysis identified MAPK3, which encodes ERK1 MAP kinase, as the most topologically important hub in protein-protein interaction networks within the 16p11.2 region and broader gene networks of schizophrenia-associated CNVs. Pharmacological targeting of ERK reversed dendritic alterations associated with dp/+ neurons, outlining a strategy for the analysis and reversal of cellular phenotypes in CNV-related psychiatric disorders. PMID:27402753

  16. Target or barrier? The cell wall of early- and later- diverging plants vs cadmium toxicity: differences in the response mechanisms

    Directory of Open Access Journals (Sweden)

    Luigi eParrotta

    2015-03-01

    Full Text Available Increasing industrialization and urbanization result in emission of pollutants in the environment including toxic heavy metals, as cadmium and lead. Among the different heavy metals contaminating the environment, cadmium raises great concern, as it is ecotoxic and as such can heavily impact ecosystems. The cell wall is the first structure of plant cells to come in contact with heavy metals. Its composition, characterized by proteins, polysaccharides and in some instances lignin and other phenolic compounds, confers the ability to bind non-covalently and/or covalently heavy metals via functional groups. A strong body of evidence in the literature has shown the role of the cell wall in heavy metal response: it sequesters heavy metals, but at the same time its synthesis and composition can be severely affected. The present review analyzes the dual property of plant cell walls, i.e. barrier and target of heavy metals, by taking Cd toxicity as example. Following a summary of the known physiological and biochemical responses of plants to Cd, the review compares the wall-related mechanisms in early- and later-diverging land plants, by considering the diversity in cell wall composition. By doing so, common as well as unique response mechanisms to metal/cadmium toxicity are identified among plant phyla and discussed. After discussing the role of hyperaccumulators’ cell walls as a particular case, the review concludes by considering important aspects for plant engineering.

  17. Ribosomal genes as early targets of cadmium-induced toxicity in Chironomus riparius larvae

    Energy Technology Data Exchange (ETDEWEB)

    Planello, R. [Biologia Ambiental, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, Senda del Rey 9, 28040, Madrid (Spain); Martinez-Guitarte, J.L. [Biologia Ambiental, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, Senda del Rey 9, 28040, Madrid (Spain); Morcillo, G. [Biologia Ambiental, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, Senda del Rey 9, 28040, Madrid (Spain)]. E-mail: gmorcillo@ccia.uned.es

    2007-02-01

    Cadmium is a widespread environmental pollutant that causes severe impacts in organisms. Although the effects of cadmium on aquatic insects have been studied in terms of their toxicity and changes in developmental parameters, little is known about its molecular and genetic effects. We have investigated the alterations in the pattern of gene expression provoked by acute exposure to cadmium in Chironomus riparius Mg. (Diptera, Chironomidae), a sentinel organism widely used in aquatic toxicity testing. The early cytotoxic effects were evaluated using immunocytochemistry and specific fluorescent probes in fourth instar larvae after 12 h of 10 mM cadmium treatments; under these conditions no significant effect on larvae mortality was detected until after 36 h of exposure. The changes in the pattern of gene expression were analysed by means of DNA/RNA hybrid antibodies in the polytene chromosomes from salivary gland cells. A decrease in the activity of the nucleolus is especially remarkable, accompanied by a significant reduction in size and the modification in nucleolar architecture, as shown by FISH. The inhibition of rDNA transcription was further evaluated by Northern blot analysis, which showed a marked decrease in the level of preribosomal rRNA (54% 45S 12 h). However, the BR genes, whose products are the giant polypeptides that constitute the silk-like secretion for constructing housing tubes, remain active. Simultaneously, decondensation and activation take place at some chromosomal regions, especially at the centromeres. The changes observed in the pattern of gene expression do not resemble those found after heat shock or other cell stressors. These data provide the first evidence that cadmium interacts with ribosomal genes and results in a drastic impairment of the functional activity of the nucleolus, an essential organelle for cellular survival. Therefore, the depletion of ribosomes would be a long-term effect of Cd-induced cellular damage. These findings may

  18. Ribosomal genes as early targets of cadmium-induced toxicity in Chironomus riparius larvae

    International Nuclear Information System (INIS)

    Cadmium is a widespread environmental pollutant that causes severe impacts in organisms. Although the effects of cadmium on aquatic insects have been studied in terms of their toxicity and changes in developmental parameters, little is known about its molecular and genetic effects. We have investigated the alterations in the pattern of gene expression provoked by acute exposure to cadmium in Chironomus riparius Mg. (Diptera, Chironomidae), a sentinel organism widely used in aquatic toxicity testing. The early cytotoxic effects were evaluated using immunocytochemistry and specific fluorescent probes in fourth instar larvae after 12 h of 10 mM cadmium treatments; under these conditions no significant effect on larvae mortality was detected until after 36 h of exposure. The changes in the pattern of gene expression were analysed by means of DNA/RNA hybrid antibodies in the polytene chromosomes from salivary gland cells. A decrease in the activity of the nucleolus is especially remarkable, accompanied by a significant reduction in size and the modification in nucleolar architecture, as shown by FISH. The inhibition of rDNA transcription was further evaluated by Northern blot analysis, which showed a marked decrease in the level of preribosomal rRNA (54% 45S 12 h). However, the BR genes, whose products are the giant polypeptides that constitute the silk-like secretion for constructing housing tubes, remain active. Simultaneously, decondensation and activation take place at some chromosomal regions, especially at the centromeres. The changes observed in the pattern of gene expression do not resemble those found after heat shock or other cell stressors. These data provide the first evidence that cadmium interacts with ribosomal genes and results in a drastic impairment of the functional activity of the nucleolus, an essential organelle for cellular survival. Therefore, the depletion of ribosomes would be a long-term effect of Cd-induced cellular damage. These findings may

  19. Genome-wide identification of Brassica napus microRNAs and their targets in response to cadmium.

    Science.gov (United States)

    Zhou, Zhao Sheng; Song, Jian Bo; Yang, Zhi Min

    2012-07-01

    MicroRNAs (miRNAs) are a distinct class of small RNAs in plants that not only regulate biological processes but also regulate response to environmental stresses. The toxic heavy metal cadmium (Cd) induces expression of several miRNAs in rapeseed (Brassica napus), but it is not known on a genome-wide scale how the expression of miRNAs and their target genes, is regulated by Cd. In this study, four small RNA libraries and four degradome libraries were constructed from Cd-treated and non-Cd-treated roots and shoots of B. napus seedlings. Using high-throughput sequencing, the study identified 84 conserved and non-conserved miRNAs (belonging to 37 miRNA families) from Cd-treated and non-treated B. napus, including 19 miRNA members that were not identified before. Some of the miRNAs were validated by RNA gel blotting. Most of the identified miRNAs were found to be differentially expressed in roots/shoots or regulated by Cd exposure. The study simultaneously identified 802 targets for the 37 (24 conserved and 13 non-conserved) miRNA families, from which there are 200, 537, and 65 targets, belonging to categories I, II, and III, respectively. In category I alone, many novel targets for miRNAs were identified and shown to be involved in plant response to Cd.

  20. Peculiarities of preparation of cadmium isotopes of high enrichment

    International Nuclear Information System (INIS)

    Cascade equipped by gas centrifuges with regard for requirements to structural materials operating with chemically active compounds (dimethylcadmium) was devised for preparation of high-enriched cadmium isotopes. Solutions of such problems as overcoming of isotope memory, compensation of the effect of isotope overlapping, operative analytical accompanying permitted to optimize separation process and to obtain cadmium isotopes of high enrichment degree: cadmium-116 ∼98.9 %, cadmium-114 ∼98.7 %, cadmium-113 ∼93.3 %, cadmium-112 ∼99.1 %, cadmium-110 ∼95.8 %

  1. Discovery of element 112

    Energy Technology Data Exchange (ETDEWEB)

    Hofmann, S. [GSI, Darmstadt (Germany)

    1996-12-31

    The new elements 110, 111, and 112 were synthesized and unambiguously identified in experiments at SHIP. Due to strong shell effects the dominant decay mode is not fission, but emission of alpha particles. Theoretical investigations predict that maximum shell effects should exist in nuclei near proton number 114 and neutron number 184. Measurements give hope that isotopes of element 114 close to the island of spherical Superheavy Elements could be produced by fusion reactions using {sup 118}Pb as target. systematic studies of the reaction cross-sections indicate that transfer of nucleons is the important process to initiate the fusion.

  2. To problem about construction of cyclotron target for bombardment of metal zinc and cadmium targets on exterior beams of the accelerator U-120

    International Nuclear Information System (INIS)

    Full text: Industrial intrusion of diffusion-and-thermal methods of radionuclides separation it is impossible at use of traditional targets representing a Cu or Ag substrate, on which the starting isotopic enriched material is marked. For embodying these technologies it is necessary to modify a target so that completely to eliminate an opportunity of a physicochemical interaction (diffusion, alloy building) labilized material and target radionuclide with a substrate in requirements of heightened temperatures. One of the possible solutions of this problem - manufacture of substrates of cyclotron targets from high-melting inert materials. For the bombardment of metal Zn or Cd metal targets (production of 67Ga and 111In, basic medical radionuclides) on the on exterior beam of the accelerators U-120 designed the cyclotron target, where as a bottom for drawing a isotopic enriched materials will be utilized a tantalic substrate by a diameter of 28 mm and depth 750 microns. At centre of a substrate are made a dimple by a diameter 16 mm, where (from a melt) are superimposed metal Zn or Cd. For heat removal during bombardment: a) on the part of a tantalic substrate the target is washed by water, b) for refrigerating a obverse surface of a target the gaseous He will be utilized. The evaluation calculations are carried out: a) of the basic characteristics of a helium heat exchanger (for dissecting away of irradiated target from volume of the accelerator the titanium metal foil by depth 50 μm will be utilized), b) of strength of a Ta substrate (will be utilized at pressure of 'frigorific' water 0.5 MPa), c) of operating temperatures of a substrate and targets (Zn or Cd) at the bombardment by their of beams of deuterons (energy - 13/0 Me V, peak current of beam - 20 μA). Is ro tined, that the optimum interval of values of pressures of helium compounds 25-32 mm Hg; the build-up of pressure of helium gives in linear magnification of voltages and down stroke of ultimate strength

  3. Reviews of the environmental effects of pollutants: IV. Cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Hammons, A.S.; Huff, J.E.; Braunstein, H.M.; Drury, J.S.; Shriner, C.R.; Lewis, E.B.; Whitfield, B.L.; Towill, L.E.

    1978-06-01

    This report is a comprehensive, multidisciplinary review of the health and environmental effects of cadmium and specific cadmium derivatives. More than 500 references are cited. The cadmium body burden in animals and humans results mainly from the diet. In the United States, the normal intake of cadmium for adult humans is estimated at about 50 ..mu..g per day. Tobacco smoke is a significant additional source of cadmium exposure. The kidneys and liver together contain about 50% of the total cadmium body burden. Acute cadmium poisoning is primarily an occupational problem, generally from inhalation of cadmium fumes or dusts. In the general population, incidents of acute poisoning by inhaled or ingested cadmium or its compounds are relatively rare. The kidney is the primary target organ for toxicity from prolonged low-level exposure to cadmium. No causal relationship has been established between cadmium exposure and human cancer, although a possible link between cadmium and prostate cancer has been indicated. Cadmium has been shown to be teratogenic in rats, hamsters, and mice, but no such effects have been proven in humans. Cadmium has been reported to increase the frequency of chromosomal aberrations in cultured Chinese hamster ovary cells and in human peripheral leukocytes. The major concern about environmental cadmium is the potential effects on the general population. There is no substantial evidence of hazard from current levels of cadmium in air, water, or food. However, because cadmium is a cumulative poison and because present intake provides a relatively small safety margin, there are adequate reasons for concern over possible future increases in background levels.

  4. Reviews of the environmental effects of pollutants: IV. Cadmium

    International Nuclear Information System (INIS)

    This report is a comprehensive, multidisciplinary review of the health and environmental effects of cadmium and specific cadmium derivatives. More than 500 references are cited. The cadmium body burden in animals and humans results mainly from the diet. In the United States, the normal intake of cadmium for adult humans is estimated at about 50 μg per day. Tobacco smoke is a significant additional source of cadmium exposure. The kidneys and liver together contain about 50% of the total cadmium body burden. Acute cadmium poisoning is primarily an occupational problem, generally from inhalation of cadmium fumes or dusts. In the general population, incidents of acute poisoning by inhaled or ingested cadmium or its compounds are relatively rare. The kidney is the primary target organ for toxicity from prolonged low-level exposure to cadmium. No causal relationship has been established between cadmium exposure and human cancer, although a possible link between cadmium and prostate cancer has been indicated. Cadmium has been shown to be teratogenic in rats, hamsters, and mice, but no such effects have been proven in humans. Cadmium has been reported to increase the frequency of chromosomal aberrations in cultured Chinese hamster ovary cells and in human peripheral leukocytes. The major concern about environmental cadmium is the potential effects on the general population. There is no substantial evidence of hazard from current levels of cadmium in air, water, or food. However, because cadmium is a cumulative poison and because present intake provides a relatively small safety margin, there are adequate reasons for concern over possible future increases in background levels

  5. SUPERGRAVITY IN 112D

    Directory of Open Access Journals (Sweden)

    Trunev A. P.

    2016-03-01

    Full Text Available In the study we consider the problem of determining the motion and similarity parameter to the system of worlds in a Riemannian space 112D with a common field of gravity. Centrally symmetric metric, depending on the 110 angle coordinates and the radial coordinate and time was investigated. It is assumed that there are intelligent beings in every world, striving for self-knowledge. By virtue of the presence of the world hierarchy in one of them there is a system of complete identification of each characteristic of the individual being with macroparameters his world. If sentient beings in all the world to create a device to simulate their own history in the form of a network of computers using the available material and the physical laws of his world, and the loss of information when displaying one world to another is 1%, then 37- th world played only 68.9449%. For Earthlings, it was found that the average similarity parameter of professional group in recognition by using astronomical parameters is 68.75%. Therefore, we can assume that the world system, including Earth, contains 37 "floors." Assuming that each "floor" takes three space dimensions, and all the "floors" connected by a single time, we find here that the number of dimensions of space-time of the whole system is 112. In the article the angular motion in a Riemannian space is considered. The effect of the separate worlds on other worlds is simulated. It has been shown that the physical laws in all worlds represent a single movement covering the markers in the form of the motion of atoms and elementary particles in a gravitational field in the 112D

  6. Electrodialytic removal of cadmium from straw combustion fly ash

    DEFF Research Database (Denmark)

    Hansen, Henrik K.; Ottosen, Lisbeth M.; Villumsen, Arne

    2004-01-01

    Fly ash from straw combustion contains valuable nutrients when returned to agricultural soils. In many instances, however, this fly ash may contain heavy metals, such as cadmium, at levels which often exceed the limits given by the Danish legislation. Thus before utilizing the nutrients, cadmium...... must be removed from these ashes. The use of an electrodialytic remediation method to remove cadmium from fly ash arising from straw combustion and containing 11.2 mg Cd kg$+-1$/ DM (dry matter) was accessed. After 36 days of remediation at a constant current density of 5.6 mA cm$+-2$/ more than 97......% of the cadmium had been removed from around 150 g ash on a dry basis. $CPY 2004 Society of Chemical Industry....

  7. Growth of cadmium oxide whiskers on cadmium sulphide single crystals with copper as growth activator

    Energy Technology Data Exchange (ETDEWEB)

    Koparanova, N.; Simov, S. (Bylgarska Akademiya na Naukite, Sofia. Inst. po Fizika na Tvyrdoto Tyalo); Genchev, D. (Bylgarska Akademiya na Naukite, Sofia. Inst. za Yadrena Izsledvaniya i Yadrena Energetika); Metchenov, G. (Research Inst. of Criminalistics and Criminology, Sofia (Bulgaria))

    1985-02-01

    Some results on the growth and morphology of cadmium oxide whiskers, obtained on cadmium sulphide single crystals with copper as a growth activator, are presented in this work. Cadmium oxide whiskers have been obtained on brace 112-bar0 brace faces of cadmium sulphide plates with a copper layer deposited in advance. The whiskers grew during the annealing of the plates in a weak stream of technically pure argon at temperatures 670 to 730 deg C for 15 min to 3.5 h. Details about the procedure have been given elsewhere. The composition and morphology of the whiskers have been studied by an X-ray microanalyser JEOL 35 DDS and a scanning electron microscope JEOL, JSM 35. The optical microscopic observations have shown that after annealing, a gray-black granular layer is formed on the cadmium sulphide single crystals and this layer can easily be separated from the crystal substrate. Under the granular layer the crystal is heavily damaged. The whiskers grow on the granular layer and they are coloured yellow-brown or red-brown. The maximum whisker length attains several hundreds of micrometres and in some cases up to 1 mm or more.

  8. Cadmium toxicity and treatment.

    Science.gov (United States)

    Bernhoft, Robin A

    2013-01-01

    Cadmium is a heavy metal of considerable toxicity with destructive impact on most organ systems. It is widely distributed in humans, the chief sources of contamination being cigarette smoke, welding, and contaminated food and beverages. Toxic impacts are discussed and appear to be proportional to body burden of cadmium. Detoxification of cadmium with EDTA and other chelators is possible and has been shown to be therapeutically beneficial in humans and animals when done using established protocols.

  9. Cadmium Toxicity and Treatment

    Directory of Open Access Journals (Sweden)

    Robin A. Bernhoft

    2013-01-01

    Full Text Available Cadmium is a heavy metal of considerable toxicity with destructive impact on most organ systems. It is widely distributed in humans, the chief sources of contamination being cigarette smoke, welding, and contaminated food and beverages. Toxic impacts are discussed and appear to be proportional to body burden of cadmium. Detoxification of cadmium with EDTA and other chelators is possible and has been shown to be therapeutically beneficial in humans and animals when done using established protocols.

  10. Cadmium Toxicity and Treatment

    OpenAIRE

    Bernhoft, Robin A.

    2013-01-01

    Cadmium is a heavy metal of considerable toxicity with destructive impact on most organ systems. It is widely distributed in humans, the chief sources of contamination being cigarette smoke, welding, and contaminated food and beverages. Toxic impacts are discussed and appear to be proportional to body burden of cadmium. Detoxification of cadmium with EDTA and other chelators is possible and has been shown to be therapeutically beneficial in humans and animals when done using established proto...

  11. Chemical identification and properties of element 112

    CERN Document Server

    Yakushev, A B; Zvára, I

    2002-01-01

    The second experiment on the chemical identification of element 112 performed at the FLNR (Dubna) is reported. Similar to the first test in 2000, the 2 mg/cm sup 2 sup n sup a sup t U target was bombarded with the 262-MeV sup 4 sup 8 Ca ions aiming at the production of sup 2 sup 8 sup 3 112, which as reported earlier decays by SF with a half-life of 3 min. The bombardment products recoiling from the target were thermalized in flowing helium and transported by the gas to detectors 25 m apart. Of all the heavy elements, the reaction products, only Hg, Rn and At were efficiently transported and thus selectively isolated. This time the beam dose was much higher (2.8 centre dot 10 sup 1 sup 8) and two different devices for detecting fission fragments and alpha particles were employed. The device used earlier was an assembly of sixteen PIPS detectors coated with Au to detect 'Hg-like' nuclides being adsorbed on Au at ambient temperature. The new one was a flow-through ionization chamber, 5000 cm sup 3 in volume, wh...

  12. Zinc and cadmium monosalicylates

    Energy Technology Data Exchange (ETDEWEB)

    Kharitonov, Yu.Ya.; Tujebakhova, Z.K. (Moskovskij Khimiko-Tekhnologicheskij Inst. (USSR))

    1984-06-01

    Zinc and cadmium monosalicylates of the composition MSal, where M-Zn or Cd, Sal - twice deprotonated residue of salicylic acid O-HOC/sub 6/H/sub 4/COOH (H/sub 2/Sal), are singled out and characterized. When studying thermograms, thermogravigrams, IR absorption spectra, roentgenograms of cadmium salicylate compounds (Cd(OC/sub 6/H/sub 4/COO) and products of their thermal transformations, the processes of thermal decomposition of the compounds have been characterized. The process of cadmium monosalicylate decomposition takes place in one stage. Complete loss of salicylate acido group occurs in the range of 320-460 deg. At this decomposition stage cadmium oxide is formed. A supposition is made that cadmium complex has tetrahedral configuration, at that, each salicylate group plays the role of tetradentate-bridge ligand. The compound evidently has a polymer structure.

  13. 19 CFR 11.2 - Manufactured tobacco.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Manufactured tobacco. 11.2 Section 11.2 Customs... PACKING AND STAMPING; MARKING Packing and Stamping § 11.2 Manufactured tobacco. (a) If the invoice and entry presented for manufactured tobacco specify all the information necessary for prompt...

  14. 27 CFR 41.112 - Tax return.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 2 2010-04-01 2010-04-01 false Tax return. 41.112 Section 41.112 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF... States Deferred Payment of Tax in Puerto Rico on Tobacco Products § 41.112 Tax return. The...

  15. 7 CFR 966.112 - Terms.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Terms. 966.112 Section 966.112 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and... Regulations Definitions § 966.112 Terms. Terms used in this subpart shall have the same meaning as when...

  16. 7 CFR 947.112 - Terms.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Terms. 947.112 Section 947.112 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and... § 947.112 Terms. Terms used in this subpart shall have the same meaning as when used in said...

  17. 7 CFR 945.112 - Terms.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Terms. 945.112 Section 945.112 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and... COUNTIES IN IDAHO, AND MALHEUR COUNTY, OREGON Rules and Regulations Definitions § 945.112 Terms. Terms...

  18. 21 CFR 163.112 - Breakfast cocoa.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Breakfast cocoa. 163.112 Section 163.112 Food and... CONSUMPTION CACAO PRODUCTS Requirements for Specific Standardized Cacao Products § 163.112 Breakfast cocoa. (a) Description. (1) Breakfast cocoa is the food prepared by pulverizing the material remaining after part of...

  19. 49 CFR 195.112 - New pipe.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 3 2010-10-01 2010-10-01 false New pipe. 195.112 Section 195.112 Transportation... PIPELINE Design Requirements § 195.112 New pipe. Any new pipe installed in a pipeline system must comply with the following: (a) The pipe must be made of steel of the carbon, low alloy-high strength, or...

  20. 32 CFR 865.112 - Decisional issues.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 6 2010-07-01 2010-07-01 false Decisional issues. 865.112 Section 865.112...-GENERAL PERSONNEL REVIEW BOARDS Air Force Discharge Review Board § 865.112 Decisional issues. (a) The decisional document shall discuss the issues that provide a basis for the decision whether there should be...

  1. 24 CFR 208.112 - Cost.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Cost. 208.112 Section 208.112... MULTIFAMILY SUBSIDIZED PROJECTS § 208.112 Cost. (a) The costs of the electronic transmission of the correctly... cost of contracting for those services, or the cost of centralizing the electronic...

  2. 7 CFR 1150.112 - Dairy products.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Dairy products. 1150.112 Section 1150.112 Agriculture... and Orders; Milk), DEPARTMENT OF AGRICULTURE DAIRY PROMOTION PROGRAM Dairy Promotion and Research Order Definitions § 1150.112 Dairy products. Dairy products means products manufactured for...

  3. 19 CFR 112.47 - Wrongful presentation.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Wrongful presentation. 112.47 Section 112.47 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY CARRIERS, CARTMEN, AND LIGHTERMEN Identification Cards § 112.47 Wrongful presentation. If...

  4. 49 CFR 572.112 - Head assembly.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 7 2010-10-01 2010-10-01 false Head assembly. 572.112 Section 572.112... 50th Percentile Male § 572.112 Head assembly. The head assembly consists of the head (drawing 78051-61X...) accelerometers that are mounted in conformance to § 572.36 (c). (a) Test procedure. (1) Soak the head assembly...

  5. 7 CFR 29.112 - Proper light.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Proper light. 29.112 Section 29.112 Agriculture... INSPECTION Regulations Inspectors, Samplers, and Weighers § 29.112 Proper light. Tobacco shall not be inspected or sampled for the purposes of the Act except when displayed in proper light for...

  6. 7 CFR 1160.112 - Research.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Research. 1160.112 Section 1160.112 Agriculture... Definitions § 1160.112 Research. Research means market research to support advertising and promotion efforts, including educational activities, research directed to product characteristics, and product...

  7. 40 CFR 61.112 - Standards.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Standards. 61.112 Section 61.112... EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS National Emission Standard for Equipment Leaks (Fugitive Emission Sources) of Benzene § 61.112 Standards. (a) Each owner or operator subject to the provisions...

  8. 9 CFR 112.3 - Diluent labels.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Diluent labels. 112.3 Section 112.3 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS PACKAGING AND LABELING § 112.3...

  9. 9 CFR 112.1 - General.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false General. 112.1 Section 112.1 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS PACKAGING AND LABELING § 112.1 General....

  10. 23 CFR 660.112 - Project development.

    Science.gov (United States)

    2010-04-01

    ... 23 Highways 1 2010-04-01 2010-04-01 false Project development. 660.112 Section 660.112 Highways FEDERAL HIGHWAY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION ENGINEERING AND TRAFFIC OPERATIONS SPECIAL PROGRAMS (DIRECT FEDERAL) Forest Highways § 660.112 Project development. (a) Projects to be administered...

  11. 40 CFR 92.112 - Analytical gases.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Analytical gases. 92.112 Section 92.112 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CONTROL OF AIR POLLUTION FROM LOCOMOTIVES AND LOCOMOTIVE ENGINES Test Procedures § 92.112 Analytical...

  12. 28 CFR 551.112 - Education.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Education. 551.112 Section 551.112 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Pretrial Inmates § 551.112 Education. (a) A pretrial inmate may participate in correspondence and...

  13. Cadmium status in Egypt

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    It is inferred from these studies that releases of Cd are still increasing and it is recommended that measures must be taken to reduce emissions of cadmium. Any cadmium discharged into the Egyptian environment may move from one compartment to another at varying rates,resulting in an accumulation in compartments such as soils and biota. Such accumulation can be expected to increase with continued emissions,and attention should be given to all sources of cadmium, natural as well as anthropogenic especially in the industrial cities in Egypt. Cadmium present in sewage, as well as industrial effluent (also, other liquid and solid wastes) and sewage sludge will increase levels in soils and is xpected to contribute to dietary levels and body burdens. The current information indicates that such effects may have to be evaluated over long periods of time, possibly as long as 50 - 100 years.

  14. Study on Systemic Separation of Palladium, Silver, Cadmium and Tin

    Institute of Scientific and Technical Information of China (English)

    YU; Zhen-hua; HUANG; Kun

    2013-01-01

    To accurately measure the yields of palladium,silver,cadmium and tin that generated from the fission of plutonium,radiochemical method is needed because there is much interference in using directγ-spectroscopy measurements.Usually,we want to get as much as possible the experiment data from one target,so it is required systemic separation of palladium,silver,cadmium and tin.Considering the

  15. Plausible Mechanisms of Cadmium Carcinogenesis

    Science.gov (United States)

    Cadmium is a transition metal and an ubiquitous environmental and industrial pollutant. Laboratory animal studies and epidemiological studies have shown that exposure to cadmium is associated with various organ toxicities and carcinogenic effects. Several national and internation...

  16. Manganese, nickel, selenium and cadmium in molluscs from the Magellan Strait, Chile.

    Science.gov (United States)

    Astorga España, M S; Rodríguez Rodríguez, E M; Díaz Romero, C

    2004-08-01

    The concentrations of manganese, selenium, nickel and cadmium were determined in 112 samples of molluscs belonging to mussels (Mytilus chilensis, n = 47) and limpets (Nacella deaurata, n = 65), which were collected from the coastline of the Magellan Strait, Chile. Four (6.2%) samples of limpets exceeded the maximum limits for cadmium established in Europe. Limpets showed higher mean manganese, nickel and cadmium concentrations than mussels, whilst the mean selenium concentration in mussels was higher. The consumption of one serving (100 g) of molluscs represents a considerable contribution to the dietary daily intake of selenium, and limpets make a significant contribution to the manganese and cadmium intakes. The sampling zone influenced the trace element concentrations, and different uptakes were observed between the mollusc species.

  17. Cadmium absorption inhibitors for soil

    Energy Technology Data Exchange (ETDEWEB)

    Kitamura, S.

    1974-05-25

    Cadmium absorption by soil is one cause of soil pollution. Cadmium adsorption inhibitors were prepared by mixing alginic acid which contained brown algae (Ascophyllum nodosum) and an inorganic material, shell fossils. This mixture was highly effective in preventing cadmium absorption by the soil.

  18. Inhibition of cellular Shp2 activity by a methyl ester analog of SPI-112.

    Science.gov (United States)

    Chen, Liwei; Pernazza, Daniele; Scott, Latanya M; Lawrence, Harshani R; Ren, Yuan; Luo, Yunting; Wu, Xin; Sung, Shen-Shu; Guida, Wayne C; Sebti, Said M; Lawrence, Nicholas J; Wu, Jie

    2010-09-15

    The protein tyrosine phosphatase (PTP) Shp2 (PTPN11) is an attractive target for anticancer drug discovery because it mediates growth factor signaling and its gain-of-function mutants are causally linked to leukemias. We previously synthesized SPI-112 from a lead compound of Shp2 inhibitor, NSC-117199. In this study, we demonstrated that SPI-112 bound to Shp2 by surface plasmon resonance (SPR) and displayed competitive inhibitor kinetics to Shp2. Like some other compounds in the PTP inhibitor discovery efforts, SPI-112 was not cell permeable, precluding its use in biological studies. To overcome the cell permeation issue, we prepared a methyl ester SPI-112 analog (SPI-112Me) that is predicted to be hydrolyzed to SPI-112 upon entry into cells. Fluorescence uptake assay and confocal imaging suggested that SPI-112Me was taken up by cells. Incubation of cells with SPI-112Me inhibited epidermal growth factor (EGF)-stimulated Shp2 PTP activity and Shp2-mediated paxillin dephosphorylation, Erk1/2 activation, and cell migration. SPI-112Me treatment also inhibited Erk1/2 activation by a Gab1-Shp2 chimera. Treatment of Shp2(E76K) mutant-transformed TF-1 myeloid cells with SPI-112Me resulted in inhibition of Shp2(E76K)-dependent cell survival, which is associated with inhibition of Shp2(E76K) PTP activity, Shp2(E76K)-induced Erk1/2 activation, and Bcl-XL expression. Furthermore, SPI-112Me enhanced interferon-gamma (IFN-gamma)-stimulated STAT1 tyrosine phosphorylation, ISRE-luciferase reporter activity, p21 expression, and the anti-proliferative effect. Thus, the SPI-112 methyl ester analog was able to inhibit cellular Shp2 PTP activity.

  19. 38 CFR 4.112 - Weight loss.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Weight loss. 4.112... DISABILITIES Disability Ratings The Digestive System § 4.112 Weight loss. For purposes of evaluating conditions in § 4.114, the term “substantial weight loss” means a loss of greater than 20 percent of...

  20. 24 CFR 904.112 - Operating reserve.

    Science.gov (United States)

    2010-04-01

    ...) Working capital for payment of a deficit in a homebuyer's NRMR, until such deficit is offset by future... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Operating reserve. 904.112 Section... LOW RENT HOUSING HOMEOWNERSHIP OPPORTUNITIES Turnkey III Program Description § 904.112...

  1. 40 CFR 63.112 - Emission standard.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 9 2010-07-01 2010-07-01 false Emission standard. 63.112 Section 63...) NATIONAL EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS FOR SOURCE CATEGORIES National Emission Standards... Process Vents, Storage Vessels, Transfer Operations, and Wastewater § 63.112 Emission standard. (a)...

  2. 40 CFR 65.112 - Standards: Compressors.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 15 2010-07-01 2010-07-01 false Standards: Compressors. 65.112 Section 65.112 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED... barrier fluid system and that prevents leakage of process fluid to the atmosphere except as provided...

  3. 7 CFR 3015.112 - Approval procedures.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 15 2010-01-01 2010-01-01 false Approval procedures. 3015.112 Section 3015.112 Agriculture Regulations of the Department of Agriculture (Continued) OFFICE OF THE CHIEF FINANCIAL OFFICER, DEPARTMENT OF AGRICULTURE UNIFORM FEDERAL ASSISTANCE REGULATIONS Programmatic Changes and Budget...

  4. 28 CFR 11.2 - Pilot program.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Pilot program. 11.2 Section 11.2 Judicial... Pilot program. The Assistant Attorney General for Administration, in consultation with the Executive Office for United States Attorneys, shall designate the districts that will participate in the...

  5. STS-112 Crew Interviews: Sellers

    Science.gov (United States)

    2002-01-01

    Piers Sellers is an Astronaut from Crowborough, UK. His Bachelor of Science degree is in Ecological science from Scotland's University of Edinburgh and his doctorate is in biometeorology from Leeds University in the UK. After two years of intense training, Sellers's first assignment as a Mission Specialist is on Flight 111 STS-112. The goal of this flight is to continue building the International Space Station. Sellers, accompanied by five astronauts, will install the S1 truss of the space station which will take three EVA's, or Extra Vehicular Activities to complete. In EVA 1, the highest priority, the S1 truss will be attached to the space station. EVA 2, the electrical work, will set up the radiator and cooling equipment for the station. EVA 3, the final process of the flight, will prepare the station for the next mission. The primary reason for installing the truss is to change the center of gravity of the station so when the next truss is installed, it will be at a symmetrical point.

  6. Cadmium in Sweden - environmental risks

    Energy Technology Data Exchange (ETDEWEB)

    Parkman, H.; Iverfeldt, Aa. [Swedish Environmental Research Inst. (Sweden); Borg, H.; Lithner, G. [Stockholm Univ. (Sweden). Inst. for Applied Environmental Research

    1998-03-01

    This report aims at assessing possible effects of cadmium in the Swedish environment. Swedish soils and soft freshwater systems are, due to a generally poor buffering capacity, severely affected by acidification. In addition, the low salinity in the Baltic Sea imply a naturally poor organism structure, with some important organisms living close to their limit of physiological tolerance. Cadmium in soils is mobilized at low pH, and the availability and toxicity of cadmium in marine systems are enhanced at low salinity. The Swedish environment is therefore extra vulnerable to cadmium pollution. The average concentrations of cadmium in the forest mor layers, agricultural soils, and fresh-waters in Sweden are enhanced compared to `back-ground concentrations`, with a general increasing trend from the north to the south-west, indicating strong impact of atmospheric deposition of cadmium originating from the central parts of Europe. In Swedish sea water, total cadmium concentrations, and the fraction of bio-available `free` cadmium, generally increases with decreasing salinity. Decreased emissions of cadmium to the environment have led to decreasing atmospheric deposition during the last decade. The net accumulation of cadmium in the forest mor layer has stopped, and even started to decrease. In northern Sweden, this is due to the decreased deposition, but in southern Sweden the main reason is increased leakage of cadmium from the topsoil as a consequence of acidification. As a result, cadmium in the Swedish environments is undergoing an extended redistribution between different soil compartments, and from the soils to the aquatic systems. 90 refs, 23 figs, 2 tabs. With 3 page summary in Swedish

  7. CADMIUM – ENVIRONMENTAL HAZARD

    Directory of Open Access Journals (Sweden)

    Henryka Langauer-Lewowicka

    2010-06-01

    Full Text Available The paper presents some information about current status of cadmium as an environmental health problem. Agricultural uses of phosphate fertilizers, sewage sludge and industrial uses of Cd are the major source of widespread of this metal at trace levels into the general environment and human foodstuffs. It is well known that high cadmium (Cd exposure causes renal damage, anemia, enteropathy, osteoporosis, osteomalacia, whereas the dose-response relationship at low levels exposure is less established. During the last decade an increasing number of studies have found an adverse health effects due to low environmental exposure to Cd. Many authors try to determine the relationship between Cd intake and Cd toxicity indicators, especially dealing renal tubular damage. The level of b2-microglobulin in urine is regarded as the most sensitive biomarker of renal disfunction due to low environmental Cd concentrations.

  8. Cadmium sulfite hexahydrate revisited

    Directory of Open Access Journals (Sweden)

    Sergio Baggio

    2008-07-01

    Full Text Available The present structural revision of the title compound, tetracadmium tetrasulfite hexahydrate, [Cd4(SO34(H2O5]·H2O, is a low-temperature upgrade (T = 100 K and R = 0.017 of the original room-temperature structure reported by Kiers & Vos [Cryst. Struct. Commun. (1978. 7, 399–403; T = 293 K and R = 0.080. The compound is a three-dimensional polymer with four independent cadmium centres, four sulfite anions and six water molecules, five of them coordinated to two cadmium centres and the remaining one an unbound solvent molecule which completes the asymmetric unit. There are two types of cadmium environment: CdO8 (through four chelating sulfite ligands and CdO6 (by way of six monocoordinated ligands. The former groups form planar arrays [parallel to (001 and separated by half a unit cell translation along c], made up of chains running along [110] and [overline{1}10], respectively. These chains are, in turn, interconnected both in an intraplanar as well as in an interplanar fashion by the latter CdO6 polyhedra into a tight three-dimensional framework. There is, in addition, an extensive network of hydrogen bonds, in which all 12 water H atoms act as donors and eight O atoms from all four sulfite groups and two water molecules act as acceptors.

  9. Dicty_cDB: SSA112 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSA112 (Link to dictyBase) - G20740 DDB0189738 Contig-U04308-1 SSA...112E (Link to Original site) SSA112F 568 SSA112Z 585 SSA112P 1153 SSA112E 585 Show SSA112 Library SS (Li... Contig Contig-U04308-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SS/SSA1-A/SSA...112Q.Seq.d/ Representative seq. ID SSA112E (Link to Original site) Representative DNA sequence >SSA112 (SSA...112Q) /CSM/SS/SSA1-A/SSA112Q.Seq.d/ AAAGCTCATTTACATTCATTTAAACATCATGCATCATCAGTTAATGGAATTTTACTTGGT

  10. Dicty_cDB: VSI112 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VS (Link to library) VSI112 (Link to dictyBase) - - - Contig-U14933-1 VSI112E (Link to Original site) VSI...112E (Link to Original site) Representative DNA sequence >VSI112 (VSI112Q) /CSM/VS/VSI1-A/VSI...isqskah*hh*k nnr**y Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value VSI112 (VSI...clear 8.0 %: cytoskeletal 4.0 %: mitochondrial 4.0 %: vesicles of secretory system >> prediction for VSI112 ...112F 504 VSI112Z 275 VSI112P 779 VSI112E 742 Show VSI112 Library VS (Link to library) Clone ID VSI

  11. 7 CFR 1220.112 - Industry information.

    Science.gov (United States)

    2010-01-01

    ... markets, new marketing strategies, or increased efficiency for the soybean industry, and activities to... Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING... CONSUMER INFORMATION Soybean Promotion and Research Order Definitions § 1220.112 Industry information....

  12. 12 CFR 19.112 - Informal hearing.

    Science.gov (United States)

    2010-01-01

    ... Removals, Suspensions, and Prohibitions When a Crime Is Charged or a Conviction is Obtained § 19.112... following the hearing, not to exceed five business days, to permit the petitioner or the appointed...

  13. Dicty_cDB: CHS112 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHS112 (Link to dictyBase) - - - Contig-U15579-1 - (Link to Original site) CHS1...12F 166 - - - - - - Show CHS112 Library CH (Link to library) Clone ID CHS112 (Link to dicty...iol.tsukuba.ac.jp/CSM/CH/CHS1-A/CHS112Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >CHS112 (CHS112Q) /CSM/CH/CHS1-A/CHS112Q.Seq.d/ ATGAACATTTAATAAAT... mitochondrial 4.0 %: vacuolar 4.0 %: plasma membrane 4.0 %: extracellular, including cell wall >> prediction for CHS1

  14. Exposure to environmental levels of waterborne cadmium impacts corticosteroidogenic and metabolic capacities, and compromises secondary stressor performance in rainbow trout

    Energy Technology Data Exchange (ETDEWEB)

    Sandhu, Navdeep [Department of Biology, University of Waterloo, Waterloo, Ontario N2L 3G1 (Canada); McGeer, James C. [Department of Biology, Wilfrid Laurier University, Waterloo, Ontario N2L 3C5 (Canada); Vijayan, Mathilakath M., E-mail: matt.vijayan@ucalgary.ca [Department of Biology, University of Waterloo, Waterloo, Ontario N2L 3G1 (Canada)

    2014-01-15

    Highlights: •Low level chronic waterborne cadmium exposure did not evoke a plasma cortisol response in rainbow trout. •Chronic cadmium exposure increases liver and gill metabolic capacities. •Chronic cadmium exposure disrupts head kidney steroidogenic capacity. •Chronic cadmium exposure disrupts glucocorticoid and mineralocorticoid receptor protein expressions in target tissues. •Chronic cadmium exposure compromises physiological performances to a secondary stressor in trout. -- Abstract: The physiological responses to waterborne cadmium exposure have been well documented; however, few studies have examined animal performances at low exposure concentrations of this metal. We tested the hypothesis that longer-term exposure to low levels of cadmium will compromise the steroidogenic and metabolic capacities, and reduce the cortisol response to a secondary stressor in fish. To test this, juvenile rainbow trout (Oncorhynchus mykiss) were exposed to 0 (control), 0.75 or 2.0 μg/L waterborne cadmium in a flow-through system and were sampled at 1, 7 and 28 d of exposure. There were only very slight disturbances in basal plasma cortisol, lactate or glucose levels in response to cadmium exposure over the 28 d period. Chronic cadmium exposure significantly affected key genes involved in corticosteroidogenesis, including melanocortin 2 receptor, steroidogenic acute regulatory protein and cytochrome P450 side chain cleavage enzyme. At 28 d, the high cadmium exposure group showed a significant drop in the glucocorticoid receptor and mineralocorticoid receptor protein expressions in the liver and brain, respectively. There were also perturbations in the metabolic capacities in the liver and gill of cadmium-exposed trout. Subjecting these fish to a secondary handling disturbance led to a significant attenuation of the stressor-induced plasma cortisol, glucose and lactate levels in the cadmium groups. Collectively, although trout appears to adjust to subchronic exposure

  15. Exposure to environmental levels of waterborne cadmium impacts corticosteroidogenic and metabolic capacities, and compromises secondary stressor performance in rainbow trout

    International Nuclear Information System (INIS)

    Highlights: •Low level chronic waterborne cadmium exposure did not evoke a plasma cortisol response in rainbow trout. •Chronic cadmium exposure increases liver and gill metabolic capacities. •Chronic cadmium exposure disrupts head kidney steroidogenic capacity. •Chronic cadmium exposure disrupts glucocorticoid and mineralocorticoid receptor protein expressions in target tissues. •Chronic cadmium exposure compromises physiological performances to a secondary stressor in trout. -- Abstract: The physiological responses to waterborne cadmium exposure have been well documented; however, few studies have examined animal performances at low exposure concentrations of this metal. We tested the hypothesis that longer-term exposure to low levels of cadmium will compromise the steroidogenic and metabolic capacities, and reduce the cortisol response to a secondary stressor in fish. To test this, juvenile rainbow trout (Oncorhynchus mykiss) were exposed to 0 (control), 0.75 or 2.0 μg/L waterborne cadmium in a flow-through system and were sampled at 1, 7 and 28 d of exposure. There were only very slight disturbances in basal plasma cortisol, lactate or glucose levels in response to cadmium exposure over the 28 d period. Chronic cadmium exposure significantly affected key genes involved in corticosteroidogenesis, including melanocortin 2 receptor, steroidogenic acute regulatory protein and cytochrome P450 side chain cleavage enzyme. At 28 d, the high cadmium exposure group showed a significant drop in the glucocorticoid receptor and mineralocorticoid receptor protein expressions in the liver and brain, respectively. There were also perturbations in the metabolic capacities in the liver and gill of cadmium-exposed trout. Subjecting these fish to a secondary handling disturbance led to a significant attenuation of the stressor-induced plasma cortisol, glucose and lactate levels in the cadmium groups. Collectively, although trout appears to adjust to subchronic exposure

  16. Cadmium in blood and hypertension

    Energy Technology Data Exchange (ETDEWEB)

    Eum, Ki-Do; Lee, Mi-Sun [Department of Environmental Health, Graduate School of Public Health and Institute of Health and Environment, Seoul National University, Seoul (Korea, Republic of); Paek, Domyung [Department of Environmental Health, Graduate School of Public Health and Institute of Health and Environment, Seoul National University, Seoul (Korea, Republic of)], E-mail: paekdm@snu.ac.kr

    2008-12-15

    Objectives:: This study is to examine the effect of cadmium exposure on blood pressure in Korean general population. Methods:: The study population consisted of 958 men and 944 women who participated in the 2005 Korean National Health and Nutrition Examination Survey (KNHANES), in which blood pressure and blood cadmium were measured from each participant. Results:: The mean blood cadmium level was 1.67 {mu}g/L (median level 1.55). The prevalence of hypertension was 26.2%. The blood cadmium level was significantly higher among those subjects with hypertension than those without (mean level 1.77 versus 1.64 {mu}g/dL). After adjusting for covariates, the odds ratio of hypertension comparing the highest to the lowest tertile of cadmium in blood was 1.51 (95% confidence interval 1.13 to 2.05), and a dose-response relationship was observed. Systolic, diastolic, and mean arterial blood pressure were all positively associated with blood cadmium level, and this effect of cadmium on blood pressure was markedly stronger when the kidney function was reduced. Conclusions:: Cadmium exposures at the current level may have increased the blood pressure of Korean general population.

  17. Projectbeschrijving Cadmium-informatiepunt (CIP)

    NARCIS (Netherlands)

    Meijer PJ

    1989-01-01

    To minimize the use of cadmium the Central Government has decided to perform the purchase of products and materials within the Central Government as much as possible within the Draft Cadmium Decree. The activities to achieve this are as far as could be seen at the start of the project in june 19

  18. Projectbeschrijving Cadmium-informatiepunt (CIP)

    OpenAIRE

    Meijer PJ

    1989-01-01

    To minimize the use of cadmium the Central Government has decided to perform the purchase of products and materials within the Central Government as much as possible within the Draft Cadmium Decree. The activities to achieve this are as far as could be seen at the start of the project in june 1989, mentioned in this report.

  19. Dicty_cDB: SLA112 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLA112 (Link to dictyBase) - - - Contig-U16358-1 | Contig-U16510-1 SLA...112P (Link to Original site) SLA112F 583 SLA112Z 606 SLA112P 1169 - - Show SLA112 Library SL (Link to library) Clone ID SLA...358-1 | Contig-U16510-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLA1-A/SLA...112Q.Seq.d/ Representative seq. ID SLA112P (Link to Original site) Representative DNA sequence >SLA112 (SLA...112Q) /CSM/SL/SLA1-A/SLA112Q.Seq.d/ ATTTGCGGTAACGTCCAATTATGGAAAGGTGCCTCCACCACTTCACTCATTACATTAGCC

  20. 29 CFR 1926.1127 - Cadmium.

    Science.gov (United States)

    2010-07-01

    ... containment of cadmium or materials containing cadmium on the site or location at which construction...) SAFETY AND HEALTH REGULATIONS FOR CONSTRUCTION Toxic and Hazardous Substances § 1926.1127 Cadmium. (a... forms, in all construction work where an employee may potentially be exposed to cadmium....

  1. Cadmium exposure in the Swedish environment

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-03-01

    This report gives a thorough description of cadmium in the Swedish environment. It comprises three parts: Cadmium in Sweden - environmental risks;, Cadmium in goods - contribution to environmental exposure;, and Cadmium in fertilizers, soil, crops and foods - the Swedish situation. Separate abstracts have been prepared for all three parts

  2. Susceptibility of early life stages of Xenopus laevis to cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Herkovits, J.; Perez-Coll, C.S. [Inst. de Ciencias Ambientales y Salud, Buenos Aires (Argentina). Programa Seguridad Quimica; Cardellini, P.; Pavanati, C. [Univ. degli Studi di Padova Via Trieste (Italy). Dept. di Biologia

    1997-02-01

    The susceptibility of Xenopus laevis to cadmium during different stages of development was evaluated by exposing embryos to cadmium concentrations ranging from 0.1 to 10 mg Cd{sup 2+}/L for 24, 48, and 72 h and assessing lethality and malformations. Susceptibility increased from the two blastomeres stage (stage 2) to stage 40, in which the 24-h LC100 was 1.13 mg Cd{sup 2+}/L, and resistance increased from this stage onward. Malformations occurred at all developmental stages evaluated, the most common being reduced size, incurvated axis, underdeveloped or abnormally developed fin, microcephaly, and microphtalmy. Scanning electron microscopy revealed changes in the ectodermal surface ranging from slightly vaulted cells to a severe reduction in the number of ciliated cells as the concentration of cadmium increased. The intraspecific variation evaluated in embryos (from four sets of parents) at seven developmental stages, expressed as the coefficient of variation of the LC100, ranged from 10 to 112% and reflects the capacity of Xenopus laevis to adapt to changing environmental conditions at different embryonic stages.

  3. Cadmium in newborns

    OpenAIRE

    Eklund, Gunilla

    2003-01-01

    Cadmium (Cd) is a well-known nephrotoxic environmental contaminant but there are indications that the developing nervous system might be even more sensitive to Cd than the kidneys in adults. Infants are exposed to Cd from various formulas and infant diets and the gastrointestinal Cd uptake is believed to be higher in newborns than in adults. Cd levels monitored in infant foods ranged between 0.74 and 27.0 µg/kg. Cow's milk formulas had the lowest levels and cereal-based formulas had up to 21 ...

  4. 13 CFR Appendix A to Part 112 - Appendix A to Part 112

    Science.gov (United States)

    2010-01-01

    ... development centers Small Business Act, sec. 21 and Pub. L. 96-302. International Trade Program Small Business... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Appendix A to Part 112 A Appendix A to Part 112 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NONDISCRIMINATION...

  5. Burnup of Cadmium Decoupler Material in the Spallation Neutron Source Moderators

    Energy Technology Data Exchange (ETDEWEB)

    Murphy, BD

    2001-08-21

    At the Spallation Neutron Source being constructed at Oak Ridge National Laboratory, power levels will be greater than at any other operating pulsed spallation neutron scattering facility. Some of the moderators at the facility will contain cadmium that will be used to tailor neutron time distributions by absorbing low-energy neutrons. Because of the higher operating power levels, indications are that there will be considerable burnup of this cadmium during the lifetime of the moderators. Cadmium burnup rates have been calculated for locations around the moderators. Assumed operating conditions for these calculations were a 2-mA beam of 1-GeV protons on the mercury target for 5,000 operating hours per year and a three-year lifetime for the moderators and inner-plug assembly. With the present proposed cadmium thickness in the moderator region (0.05 cm), Monte Carlo calculations indicate considerable depletion of the active cadmium isotope. In places, the calculations indicate complete depletion. An obvious solution to the problem would be to increase the cadmium thickness with a concomitant increase in heat load. Results from some cadmium heating calculations are also presented for a cadmium thickness of 0.05 cm.

  6. RNA-Seq identifies key reproductive gene expression alterations in response to cadmium exposure.

    Science.gov (United States)

    Hu, Hanyang; Lu, Xing; Cen, Xiang; Chen, Xiaohua; Li, Feng; Zhong, Shan

    2014-01-01

    Cadmium is a common toxicant that is detrimental to many tissues. Although a number of transcriptional signatures have been revealed in different tissues after cadmium treatment, the genes involved in the cadmium caused male reproductive toxicity, and the underlying molecular mechanism remains unclear. Here we observed that the mice treated with different amount of cadmium in their rodent chow for six months exhibited reduced serum testosterone. We then performed RNA-seq to comprehensively investigate the mice testicular transcriptome to further elucidate the mechanism. Our results showed that hundreds of genes expression altered significantly in response to cadmium treatment. In particular, we found several transcriptional signatures closely related to the biological processes of regulation of hormone, gamete generation, and sexual reproduction, respectively. The expression of several testosterone synthetic key enzyme genes, such as Star, Cyp11a1, and Cyp17a1, were inhibited by the cadmium exposure. For better understanding of the cadmium-mediated transcriptional regulatory mechanism of the genes, we computationally analyzed the transcription factors binding sites and the mircoRNAs targets of the differentially expressed genes. Our findings suggest that the reproductive toxicity by cadmium exposure is implicated in multiple layers of deregulation of several biological processes and transcriptional regulation in mice. PMID:24982889

  7. RNA-Seq Identifies Key Reproductive Gene Expression Alterations in Response to Cadmium Exposure

    Directory of Open Access Journals (Sweden)

    Hanyang Hu

    2014-01-01

    Full Text Available Cadmium is a common toxicant that is detrimental to many tissues. Although a number of transcriptional signatures have been revealed in different tissues after cadmium treatment, the genes involved in the cadmium caused male reproductive toxicity, and the underlying molecular mechanism remains unclear. Here we observed that the mice treated with different amount of cadmium in their rodent chow for six months exhibited reduced serum testosterone. We then performed RNA-seq to comprehensively investigate the mice testicular transcriptome to further elucidate the mechanism. Our results showed that hundreds of genes expression altered significantly in response to cadmium treatment. In particular, we found several transcriptional signatures closely related to the biological processes of regulation of hormone, gamete generation, and sexual reproduction, respectively. The expression of several testosterone synthetic key enzyme genes, such as Star, Cyp11a1, and Cyp17a1, were inhibited by the cadmium exposure. For better understanding of the cadmium-mediated transcriptional regulatory mechanism of the genes, we computationally analyzed the transcription factors binding sites and the mircoRNAs targets of the differentially expressed genes. Our findings suggest that the reproductive toxicity by cadmium exposure is implicated in multiple layers of deregulation of several biological processes and transcriptional regulation in mice.

  8. Cadmium immobilization by hydroxyapatite

    Directory of Open Access Journals (Sweden)

    Smičiklas Ivana D.

    2003-01-01

    Full Text Available The contamination of air, soil and water by cadmium is a great environmental problem. If cadmium occurs in nature in ionic form, soluble in water, it easily enters into the food chain. Hydroxyapatite (HAP, Ca-o(POAe(OH2 is a sparingly soluble salt and an excellent matrix for the removal of heavy metals from solutions. Considerable research attention has been paid to the bond between Cc/2+ ions and synthetic hydroxyapatite of known composition. The sorption mechanism is complex. The dominant process is ion exchange, but surface adsorption, surface complexation and coprecipitation can also contribute to the overall mechanism. The sorption capacity depends on the characteristics of hydroxyapatite itself and on the experimental conditions. Under optimum conditions a maximum capacity of 0.8 mol Cd2+/mol HAP can be achieved. HAP is a potential sorbent for the remediation of contaminated water and soil, for industrial waste treatment, and it is also referenced as a material that can be used as a barrier around waste depositories.

  9. Cadmium(2) complexes of cytosine

    International Nuclear Information System (INIS)

    Complexes of cadmium(2) with cytosine obtained from aqueous or physiological solutions at room temperature are reported. The complexes were characterized by spectroscopic, conductometric, 1H-NMR, and 13C-NMR measurements and also by thermogravimetry. (Authors)

  10. Discovery of the Cadmium Isotopes

    OpenAIRE

    Amos, S.; Thoennessen, M

    2009-01-01

    Thirty-seven cadmium isotopes have so far been observed; the discovery of these isotopes is discussed. For each isotope a brief summary of the first refereed publication, including the production and identification method, is presented.

  11. Collinear laser spectroscopy of atomic cadmium

    CERN Document Server

    Frömmgen, Nadja; Bissell, Mark L; Bieroń, Jacek; Blaum, Klaus; Cheal, Bradley; Flanagan, Kieran; Fritzsche, Stephan; Geppert, Christopher; Hammen, Michael; Kowalska, Magdalena; Kreim, Kim; Krieger, Andreas; Neugart, Rainer; Neyens, Gerda; Rajabali, Mustafa M; Nörtershäuser, Wilfried; Papuga, Jasna; Yordanov, Deyan T

    2015-01-01

    Hyperfine structure $A$ and $B$ factors of the atomic $5s\\,5p\\,\\; ^3\\rm{P}_2 \\rightarrow 5s\\,6s\\,\\; ^3\\rm{S}_1$ transition are determined from collinear laser spectroscopy data of $^{107-123}$Cd and $^{111m-123m}$Cd. Nuclear magnetic moments and electric quadrupole moments are extracted using reference dipole moments and calculated electric field gradients, respectively. The hyperfine structure anomaly for isotopes with $s_{1/2}$ and $d_{5/2}$ nuclear ground states and isomeric $h_{11/2}$ states is evaluated and a linear relationship is observed for all nuclear states except $s_{1/2}$. This corresponds to the Moskowitz-Lombardi rule that was established in the mercury region of the nuclear chart but in the case of cadmium the slope is distinctively smaller than for mercury. In total four atomic and ionic levels were analyzed and all of them exhibit a similar behaviour. The electric field gradient for the atomic $5s\\,5p\\,\\; ^3\\mathrm{P}_2$ level is derived from multi-configuration Dirac-Hartree-Fock calculatio...

  12. 48 CFR 870.112 - Telecommunications equipment.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Telecommunications... DEPARTMENT SUPPLEMENTARY REGULATIONS SPECIAL PROCUREMENT CONTROLS Controls 870.112 Telecommunications... specifications for telecommunications equipment, as defined in VA manual MP-6, Part VIII (available at any...

  13. 13 CFR 112.3 - Discrimination prohibited.

    Science.gov (United States)

    2010-01-01

    ... ASSISTED PROGRAMS OF SBA-EFFECTUATION OF TITLE VI OF THE CIVIL RIGHTS ACT OF 1964 § 112.3 Discrimination... ground of race, color or national origin be excluded from participation in, be denied the benefits of, or..., directly or through contractual or other arrangements, on ground of race, color or national origin:...

  14. Cadmium telluride nuclear radiation detectors

    International Nuclear Information System (INIS)

    The characteristics and performance of undoped high resistivity cadmium telluride detectors are compared to chlorine lifted counters. It is shown, in particular, that Undodep CdTe is in fact aluminium doped and that compensation occurs, as an silicon or germanium, by pair and triplet formation between the group III donor and the doubly charged cadmium vacancy acceptor. Furthermore, in chlorine doped samples, the polarization effect results from the unpaired level at Esub(c)-0,6eV

  15. Speciation of Dissolved Cadmium

    DEFF Research Database (Denmark)

    Holm, Peter Engelund; Andersen, Sjur; Christensen, Thomas Højlund

    1995-01-01

    ) method separates dissolved Cd into free divalent Cd (Cd 2+) and complexed Cd and furthermore separates the latter into the operationally defined forms: labile, slowly labile and stable complexes. The dialysis (ED) method determines high molecular weight Cd complexes (above 1000mol. wt). For both methods...... the reproducibility was good. By combining the results of the GEOCHEM calculations in terms of the inorganic complexes, and the IE results, the fractions of free and inorganically complexed Cd were estimated. The IE and ED results furthermore provided information about the organic complexes. Selected environmental......Equilibrium dialysis and ion exchange methods, as well as computer calculations (GEOCHEM), were applied for speciation of dissolved cadmium (Cd) in test solutions and leachate samples. The leachate samples originated from soil, compost, landfill waste and industrial waste. The ion exchange (IE...

  16. Differences in urine cadmium associations with kidney outcomes based on serum creatinine and cystatin C

    Energy Technology Data Exchange (ETDEWEB)

    Weaver, Virginia M., E-mail: vweaver@jhsph.edu [Division of Occupational and Environmental Health, Department of Environmental Health Sciences, Johns Hopkins University Bloomberg School of Public Health, 615N. Wolfe St., Rm. 7041, Baltimore, MD 21205 (United States); Department of Medicine, Johns Hopkins University School of Medicine, Baltimore, MD (United States); Welch Center for Prevention, Epidemiology and Clinical Research, Johns Hopkins Medical Institutions, Baltimore, MD (United States); Kim, Nam-Soo; Lee, Byung-Kook [Institute of Industrial Medicine, SoonChunHyang University, Asan (Korea, Republic of); Parsons, Patrick J. [Laboratory of Inorganic and Nuclear Chemistry, Wadsworth Center, New York State Department of Health, Albany, NY (United States); Department of Environmental Health Sciences, School of Public Health, University at Albany, Albany, NY (United States); Spector, June [Department of Environmental and Occupational Health Sciences, University of Washington, Seattle, WA (United States); Fadrowski, Jeffrey [Welch Center for Prevention, Epidemiology and Clinical Research, Johns Hopkins Medical Institutions, Baltimore, MD (United States); Department of Pediatrics, Johns Hopkins School of Medicine, Baltimore, MD (United States); Jaar, Bernard G. [Department of Medicine, Johns Hopkins University School of Medicine, Baltimore, MD (United States); Welch Center for Prevention, Epidemiology and Clinical Research, Johns Hopkins Medical Institutions, Baltimore, MD (United States); Department of Epidemiology, Johns Hopkins University Bloomberg School of Public Health, Baltimore, MD (United States); Steuerwald, Amy J. [Laboratory of Inorganic and Nuclear Chemistry, Wadsworth Center, New York State Department of Health, Albany, NY (United States); Department of Environmental Health Sciences, School of Public Health, University at Albany, Albany, NY (United States); Todd, Andrew C. [Department of Preventive Medicine, Mount Sinai School of Medicine, New York, NY (United States); and others

    2011-11-15

    Cadmium is a well-known nephrotoxicant; chronic exposure increases risk for chronic kidney disease. Recently, however, associations between urine cadmium and higher creatinine-based estimated glomerular filtration rate (eGFR) have been reported. Analyses utilizing alternate biomarkers of kidney function allow evaluation of potential mechanisms for these observations. We compared associations of urine cadmium with kidney function measures based on serum cystatin C to those with serum creatinine in 712 lead workers. Mean (standard deviation) molybdenum-corrected urine cadmium, Modification of Diet in Renal Disease (MDRD) eGFR and multi-variable cystatin C eGFR were 1.02 (0.65) {mu}g/g creatinine, and 97.4 (19.2) and 112.0 (17.7) mL/min/1.73 m{sup 2}, respectively. The eGFR measures were moderately correlated (r{sub s}=0.5; p<0.001). After adjustment, ln (urine cadmium) was not associated with serum cystatin-C-based measures. However, higher ln (urine cadmium) was associated with higher creatinine-based eGFRs including the MDRD and an equation incorporating serum cystatin C and creatinine (beta-coefficient=4.1 mL/min/1.73 m{sup 2}; 95% confidence interval=1.6, 6.6). Urine creatinine was associated with serum creatinine-based but not cystatin-C-based eGFRs. These results support a biomarker-specific, rather than a kidney function, effect underlying the associations observed between higher urine cadmium and creatinine-based kidney function measures. Given the routine use of serum and urine creatinine in kidney and biomarker research, additional research to elucidate the mechanism(s) for these associations is essential.

  17. Histological changes, apoptosis and metallothionein levels in Triturus carnifex (Amphibia, Urodela) exposed to environmental cadmium concentrations.

    Science.gov (United States)

    Capaldo, Anna; Gay, Flaminia; Scudiero, Rosaria; Trinchella, Francesca; Caputo, Ivana; Lepretti, Marilena; Marabotti, Anna; Esposito, Carla; Laforgia, Vincenza

    2016-04-01

    The aim of this study was to verify if the freshwater safety values established from the European Community (1998) and the Italian Ministry of Health (2001) for cadmium (44.5nM/L in drinking water and 178nM/L in sewage waters) were safe for amphibians, since at these same concentrations cadmium induced endocrine disruption in the newt Triturus carnifex. Adult male specimens of T. carnifex were exposed daily to cadmium (44.5nM/L and 178nM/L as CdCl2, nominal concentrations), respectively, during 3- and 9-months; at the same time, control newts were exposed to tap water only. The accumulation of cadmium in the skin, liver and kidney, the levels of metallothioneins in the skin and the liver, the expression of metallothionein mRNA in the liver, as well as the presence of histological alterations and of apoptosis in the target organs were evaluated. The 9-months exposure induced cadmium accumulation in all the tissues examined; moreover, histological changes were observed in all the tissues examined, irrespective of the dose or the time of exposure. Apoptosis was only detected in the kidney, whereas metallothioneins and metallothionein mRNA did not increase. This study demonstrates that the existing chronic water quality criterion established for cadmium induces in the newt T. carnifex cadmium accumulation and histological alterations in the target organs examined. Together with our previous results, showing that, at these same concentrations, cadmium induced endocrine disruption, the present results suggest that the existing chronic water quality criterion for cadmium appears to be not protective of amphibians.

  18. Histological changes, apoptosis and metallothionein levels in Triturus carnifex (Amphibia, Urodela) exposed to environmental cadmium concentrations.

    Science.gov (United States)

    Capaldo, Anna; Gay, Flaminia; Scudiero, Rosaria; Trinchella, Francesca; Caputo, Ivana; Lepretti, Marilena; Marabotti, Anna; Esposito, Carla; Laforgia, Vincenza

    2016-04-01

    The aim of this study was to verify if the freshwater safety values established from the European Community (1998) and the Italian Ministry of Health (2001) for cadmium (44.5nM/L in drinking water and 178nM/L in sewage waters) were safe for amphibians, since at these same concentrations cadmium induced endocrine disruption in the newt Triturus carnifex. Adult male specimens of T. carnifex were exposed daily to cadmium (44.5nM/L and 178nM/L as CdCl2, nominal concentrations), respectively, during 3- and 9-months; at the same time, control newts were exposed to tap water only. The accumulation of cadmium in the skin, liver and kidney, the levels of metallothioneins in the skin and the liver, the expression of metallothionein mRNA in the liver, as well as the presence of histological alterations and of apoptosis in the target organs were evaluated. The 9-months exposure induced cadmium accumulation in all the tissues examined; moreover, histological changes were observed in all the tissues examined, irrespective of the dose or the time of exposure. Apoptosis was only detected in the kidney, whereas metallothioneins and metallothionein mRNA did not increase. This study demonstrates that the existing chronic water quality criterion established for cadmium induces in the newt T. carnifex cadmium accumulation and histological alterations in the target organs examined. Together with our previous results, showing that, at these same concentrations, cadmium induced endocrine disruption, the present results suggest that the existing chronic water quality criterion for cadmium appears to be not protective of amphibians. PMID:26851569

  19. Isotope yields from central 112,124Sn+112,124Sn collisions, dynamical emission?

    CERN Document Server

    Liu, T X; Van Goethem, M J; Lynch, W G; Shomin, R; Tan, W P; Tsang, M B; Verde, G; Wagner, A; Xi Hong Fei; Xu, H S; Colonna, M; Di Toro, M; Zielinska-Pfabé, M; Wolter, H H; Beaulieu, L; Davin, B; Larochelle, Y; Lefort, T; De Souza, R T; Yañez, R; Viola, V E; Charity, R J; Sobotka, L G

    2004-01-01

    Isotopic yields for light particles and intermediate mass fragments have been measured for 112Sn+112Sn, 112Sn+124Sn, 124Sn+112Sn and 124Sn+124Sn central collisions at E/A=50 MeV and compared with predictions of stochastic mean field calculations. These calculations predict a sensitivity of the isotopic distributions to the density dependence of the asymmetry term of the nuclear equation of state. However, the secondary decay of the excited fragments modifies significantly the primary isotopic distributions and these modifications are rather sensitive to theoretical uncertainties in the excitation energies of the hot fragments. The predicted final isotope distributions are narrower than the experimental data and the sensitivity of the predicted yields to the density dependence of the asymmetry term is reduced.

  20. Zinc-induced protection against cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Early, J.L.; Schnell, R.C.

    1978-02-01

    Pretreatment of male rats with cadmium acetate potentiates the duration of hexobarbital hypnosis and inhibits the rate of hepatic microsomal drug metabolism. Pretreatment of rats with zinc acetate protects against these alterations in drug action elicited by cadmium.

  1. Bioavailability of cadmium from linseed and cocoa

    DEFF Research Database (Denmark)

    Hansen, Max; Sloth, Jens Jørgen; Rasmussen, Rie Romme

    In Denmark and EU the exposure of cadmium from food is at a level that is relatively close to the Tolerable Daily Intake (TDI). This report describes an investigation of the bioavailability of cadmium in selected food items known to contain high levels of cadmium. The purpose was to provide data ...... or crushed linseed nor the intake of cocoa and chocolate....

  2. Mechanisms of cadmium carcinogenesis

    International Nuclear Information System (INIS)

    Cadmium (Cd), a heavy metal of considerable occupational and environmental concern, has been classified as a human carcinogen by the International Agency for Research on Cancer (IARC). The carcinogenic potential of Cd as well as the mechanisms underlying carcinogenesis following exposure to Cd has been studied using in vitro cell culture and in vivo animal models. Exposure of cells to Cd results in their transformation. Administration of Cd in animals results in tumors of multiple organs/tissues. Also, a causal relationship has been noticed between exposure to Cd and the incidence of lung cancer in human. It has been demonstrated that Cd induces cancer by multiple mechanisms and the most important among them are aberrant gene expression, inhibition of DNA damage repair, induction of oxidative stress, and inhibition of apoptosis. The available evidence indicates that, perhaps, oxidative stress plays a central role in Cd carcinogenesis because of its involvement in Cd-induced aberrant gene expression, inhibition of DNA damage repair, and apoptosis.

  3. Identification and characterization of antifungal active substances of Streptomyces hygroscopicus BS-112.

    Science.gov (United States)

    Zhang, Nan; Song, Zhen; Xie, Yuhua; Cui, Ping; Jiang, Hongxia; Yang, Tao; Ju, Ruicheng; Zhao, Yuhua; Li, Jinyu; Liu, Xunli

    2013-08-01

    An antifungal Actinomyces BS-112 strain, with Aspergillus flavus as the target pathogen, was isolated from soil in the forest land of Mountain Tai. This strain showed a strong antagonistic activity against various mold fungi in food and feed. Strain BS-112 was identified as Streptomyces hygroscopicus based on its morphologic, cultural, physiological, biochemical characteristics, cell wall components and 16S rDNA sequence. Four active components were separated and purified from strain BS-112. These four antifungal components were identified as tetrins A and B and tetramycins A and B using spectroscopic analysis including mass spectrometry and nuclear magnetic resonance spectroscopy. Tetrins A and B and tetramycins A and B strongly inhibited the growth of A. flavus, A. alutaceus, A. niger, and A. fumigatus in vitro. PMID:23468248

  4. 46 CFR 112.55-10 - Storage battery charging.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Storage battery charging. 112.55-10 Section 112.55-10... AND POWER SYSTEMS Storage Battery Installation § 112.55-10 Storage battery charging. (a) Each storage battery installation for emergency lighting and power, and starting batteries for an emergency diesel...

  5. 19 CFR 112.42 - Application for identification card.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Application for identification card. 112.42 Section 112.42 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY CARRIERS, CARTMEN, AND LIGHTERMEN Identification Cards § 112.42 Application for identification card. An application for...

  6. 19 CFR 112.43 - Form of identification card.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 1 2010-04-01 2010-04-01 false Form of identification card. 112.43 Section 112.43 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF HOMELAND SECURITY; DEPARTMENT OF THE TREASURY CARRIERS, CARTMEN, AND LIGHTERMEN Identification Cards § 112.43 Form of identification card. The identification card shall be issued...

  7. 41 CFR 101-1.112 - Change lines.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Change lines. 101-1.112 Section 101-1.112 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS GENERAL 1-INTRODUCTION 1.1-Regulation System § 101-1.112...

  8. 27 CFR 478.112 - Importation by a licensed importer.

    Science.gov (United States)

    2010-04-01

    ... importer. 478.112 Section 478.112 Alcohol, Tobacco Products, and Firearms BUREAU OF ALCOHOL, TOBACCO... Importation § 478.112 Importation by a licensed importer. (a) No firearm, firearm barrel, or ammunition shall be imported or brought into the United States by a licensed importer (as defined in § 478.11)...

  9. 29 CFR 1978.112 - Arbitration or other proceedings.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 9 2010-07-01 2010-07-01 false Arbitration or other proceedings. 1978.112 Section 1978.112... ACT OF 1982 (STAA) Rules of Procedure Miscellaneous Provisions § 1978.112 Arbitration or other... remedies under grievance arbitration proceedings in collective bargaining agreements. In addition,...

  10. 5 CFR 185.112 - Notice of hearing.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Notice of hearing. 185.112 Section 185.112 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PROGRAM FRAUD CIVIL REMEDIES § 185.112 Notice of hearing. (a) When the ALJ receives the complaint and answer, the...

  11. 36 CFR 406.112-406.129 - [Reserved

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false 406.112-406.129 Section 406.112-406.129 Parks, Forests, and Public Property AMERICAN BATTLE MONUMENTS COMMISSION ENFORCEMENT OF... COMMISSION §§ 406.112-406.129...

  12. 42 CFR 56.112 - Publications and copyright.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Publications and copyright. 56.112 Section 56.112... HEALTH SERVICES General Provisions § 56.112 Publications and copyright. Except as may otherwise be provided under the terms and conditions of the award, the grantee may copyright without prior approval...

  13. 46 CFR 112.50-3 - Hydraulic starting.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Hydraulic starting. 112.50-3 Section 112.50-3 Shipping... POWER SYSTEMS Emergency Diesel and Gas Turbine Engine Driven Generator Sets § 112.50-3 Hydraulic starting. A hydraulic starting system must meet the following: (a) The hydraulic starting system must be...

  14. 47 CFR 69.112 - Direct-trunked transport.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 3 2010-10-01 2010-10-01 false Direct-trunked transport. 69.112 Section 69.112... Computation of Charges § 69.112 Direct-trunked transport. (a) A flat-rated direct-trunked transport charge... other persons that use telephone company direct-trunked transport facilities. (b)(1) For...

  15. 4 CFR 11.2 - Practice by attorneys.

    Science.gov (United States)

    2010-01-01

    ... 4 Accounts 1 2010-01-01 2010-01-01 false Practice by attorneys. 11.2 Section 11.2 Accounts GOVERNMENT ACCOUNTABILITY OFFICE PERSONNEL SYSTEM RECOGNITION OF ATTORNEYS AND OTHER REPRESENTATIVES § 11.2 Practice by attorneys. Any person who is a member in good standing of the bar of the Supreme Court of...

  16. 9 CFR 112.8 - For export only.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false For export only. 112.8 Section 112.8 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS PACKAGING AND LABELING § 112.8 For...

  17. 38 CFR 3.112 - Fractions of one cent.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Fractions of one cent. 3.112 Section 3.112 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS ADJUDICATION Pension, Compensation, and Dependency and Indemnity Compensation Administrative § 3.112 Fractions of...

  18. 45 CFR 690.112 - Review by institution.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 3 2010-10-01 2010-10-01 false Review by institution. 690.112 Section 690.112... OF HUMAN SUBJECTS § 690.112 Review by institution. Research covered by this policy that has been... the institution. However, those officials may not approve the research if it has not been approved...

  19. 45 CFR 46.112 - Review by institution.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Review by institution. 46.112 Section 46.112... SUBJECTS Basic HHS Policy for Protection of Human Research Subjects § 46.112 Review by institution... review and approval or disapproval by officials of the institution. However, those officials may...

  20. 10 CFR 745.112 - Review by institution.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Review by institution. 745.112 Section 745.112 Energy DEPARTMENT OF ENERGY PROTECTION OF HUMAN SUBJECTS § 745.112 Review by institution. Research covered by this... disapproval by officials of the institution. However, those officials may not approve the research if it...

  1. 7 CFR 1c.112 - Review by institution.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 1 2010-01-01 2010-01-01 false Review by institution. 1c.112 Section 1c.112 Agriculture Office of the Secretary of Agriculture PROTECTION OF HUMAN SUBJECTS § 1c.112 Review by institution... review and approval or disapproval by officials of the institution. However, those officials may...

  2. 46 CFR 112.50-5 - Electric starting.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Electric starting. 112.50-5 Section 112.50-5 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) ELECTRICAL ENGINEERING EMERGENCY LIGHTING AND POWER SYSTEMS Emergency Diesel and Gas Turbine Engine Driven Generator Sets § 112.50-5 Electric...

  3. 7 CFR 4287.112 - Interest rate adjustments.

    Science.gov (United States)

    2010-01-01

    ... increases in interest rates will be permitted except the normal fluctuations in approved variable interest... 7 Agriculture 15 2010-01-01 2010-01-01 false Interest rate adjustments. 4287.112 Section 4287.112... Loans § 4287.112 Interest rate adjustments. (a) Reductions. The borrower, lender, and holder (if...

  4. 46 CFR 112.55-15 - Capacity of storage batteries.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Capacity of storage batteries. 112.55-15 Section 112.55... LIGHTING AND POWER SYSTEMS Storage Battery Installation § 112.55-15 Capacity of storage batteries. (a) A storage battery for an emergency lighting and power system must have the capacity— (1) To close...

  5. Oral cadmium chloride intoxication in mice

    DEFF Research Database (Denmark)

    Andersen, O; Nielsen, J B; Svendsen, P

    1988-01-01

    Diethyldithiocarbamate (DDC) is known to alleviate acute toxicity due to injection of cadmium salts. However, when cadmium chloride was administered by the oral route, DDC enhanced rather than alleviated the acute toxicity; both oral and intraperitoneal (i.p.) administration of DDC had this effect....... Thus, orally administered DDC enhanced cadmium-induced duodenal and ileal tissue damage and inhibition of peristalsis, as indicated by an increased intestinal transit time. At low cadmium doses, the whole-body retention of cadmium was increased by oral DDC administration. Intraperitoneally administered...

  6. Arsenic-cadmium interaction in rats.

    Science.gov (United States)

    Díaz-Barriga, F; Llamas, E; Mejía, J J; Carrizales, L; Santoyo, M E; Vega-Vega, L; Yáñez, L

    1990-11-01

    Simultaneous exposure to cadmium and arsenic is highly probable in the urban area of San Luis Potosi, Mexico due to common localization of copper and zinc smelters. Therefore, in this work, rats were intraperitoneally exposed either to cadmium or arsenic alone, or simultaneously to both metals. The effects of these treatments on three different toxicological parameters were studied. Cadmium modified the LD50 of arsenic and conversely arsenic modified the LD50 for cadmium. At the histopathological level, arsenic appeared to protect against the cadmium effects, especially on testes. This protective effect seemed to be related to the glutathione levels found in this tissue: rats exposed to both arsenic and cadmium, presented glutathione values intermediate to those observed after exposure to either metal alone; arsenic had the highest value and cadmium the lowest. In liver, rats exposed to arsenic, cadmium or arsenic and cadmium, presented glutathione values below those in the saline group, with the lowest value corresponding to the arsenic and cadmium treatment. The results appear to support the proposed interaction between arsenic and cadmium and coexposure to both metals seems to alter certain effects produced by either metal alone. PMID:2219140

  7. Determination of cadmium in biological samples.

    Science.gov (United States)

    Klotz, Katrin; Weistenhöfer, Wobbeke; Drexler, Hans

    2013-01-01

    Analyses of cadmium concentrations in biological material are performed using inductively coupled plasma mass spectrometry (ICP-MS) and atomic absorption spectrometry (AAS), but also electrochemical methods, neutron activation analysis (NAA), and X-ray fluorescence spectrometry (XRF). The predominant sample matrices include blood, plasma, serum, and urine, as well as hair, saliva, and tissue of kidney cortex, lung, and liver. While cadmium in blood reveals rather the recent exposure situation, cadmium in urine reflects the body burden and is an indicator for the cumulative long term exposure.After chronic exposure, cadmium accumulates in the human body and causes kidney diseases, especially lesions of proximal tubular cells. A tubular proteinuria causes an increase in urinary excretion of microproteins. Excretions of retinol binding protein (RBP), β2-microglobulin (β2-M), and α1-microglobulin are validated biomarkers for analyzing cadmium effects. For this purpose, immunological procedures such as ELISA, and radio- and latex-immunoassays are used.However, proteinuria is not specific to cadmium, but can also occur after exposure to other nephrotoxic agents or due to various kidney diseases. In summary, cadmium in urine and blood are the most specific biomarkers of cadmium exposure. A combination of parameters of exposure (cadmium in blood, cadmium in urine) and parameters of effect (e.g., β2-M, RBP) is required to reveal cadmium-induced nephrological effects. PMID:23430771

  8. Insulin Expression in Rats Exposed to Cadmium

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Objectives To investigate the effects of cadmium exposure on insulin expression in rats. Methods Eighteen adult SD assessed. The levels of cadmium and zinc in pancreas, blood and urine glucose, serum insulin and urine NAG (N-acyetyl-β-glucosaminidase) were determined. The gene expressions of metallothionein (MT) and insulin were also measured,and the oral glucose tolerance tests (OGTT) were carried out. Results The contents of cadmium in pancreas in cadmium-treated rats were higher than that in the control group, which was associated with slight increase of zinc in pancreas.not change significantly after cadmium administration, and the UNAG had no change in Cd-treated group. The gene expression the change of the expression of insulin, MT-Ⅰ and MT-Ⅱ genes. Cadmium can influence the biosynthesis of insulin, but does not induce the release of insulin. The dysfunction of pancreas occurs earlier than that of kidney after administration of cadmium.

  9. Attempts to chemically investigate element 112

    International Nuclear Information System (INIS)

    Two experiments aiming at the chemical investigation of element 112 produced in the heavy ion induced nuclear fusion reaction of 48Ca with 238U were performed at the Gesellschaft fuer Schwerionenforschung (GSI), Darmstadt, Germany. Both experiments were designed to determine the adsorption enthalpy of element 112 on a gold surface using a thermochromatography setup. The temperature range covered in the thermochromatography experiments allowed the adsorption of Hg at about 35 C and of Rn at about -180 C. Reports from the Flerov Laboratory for Nuclear Reactions (FLNR), Dubna, Russia claim production of a 5-min spontaneous fission (SF) activity assigned to 283112 for the 238U(48Ca,3n) 283112 reaction. Hence, experiment 1 was designed to detect spontaneously fissioning (SF) isotopes of element 112 with half-lives (t1/2) longer than about 20 s. 11 high-energy events were detected. 7 events exhibit a deposition pattern resembling a chromatographic peak in the vicinity of Rn deposition. However, the energy of the events observed in experiment 2 was lower than expected for a SF-decay of 283112. Therefore, these events could not be unambiguously attributed to the decay of 283112. In contradiction with earlier publications newer reports from FLNR Dubna claim that 283112 decays by α-particle emission (Eα = 9.5 MeV) with t1/2 = 4 s followed by a SF-decay of 279Ds (t1/2 = 0.2 s). Therefore, experiment 2 was designed to be sensitive to both claimed decay properties of 283112. However, during this experiment neither short α-SF correlations nor SF co-incidences were detected. The conclusion is that 283112 was not unambiguously detected, neither in experiment 1 nor in experiment 2. (orig.)

  10. Astronaut Sellers Performs STS-112 EVA

    Science.gov (United States)

    2002-01-01

    Launched October 7, 2002 aboard the Space Shuttle Orbiter Atlantis, the STS-112 mission lasted 11 days and performed three sessions of Extra Vehicular Activity (EVA). Its primary mission was to install the Starboard Side Integrated Truss Structure (S1) and Equipment Translation Aid (CETA) Cart to the International Space Station (ISS). The S1 truss provides structural support for the orbiting research facility's radiator panels, which use ammonia to cool the Station's complex power system. The S1 truss, attached to the S0 (S Zero) truss installed by the previous STS-110 mission, flows 637 pounds of anhydrous ammonia through three heat rejection radiators. The truss is 45-feet long, 15-feet wide, 10-feet tall, and weighs approximately 32,000 pounds. The CETA is the first of two human-powered carts that will ride along the International Space Station's railway providing a mobile work platform for future extravehicular activities by astronauts. In this photograph, Astronaut Piers J. Sellers uses both a handrail on the Destiny Laboratory and a foot restraint on the Space Station Remote Manipulator System or Canadarm2 to remain stationary while performing work at the end of the STS-112 mission's second space walk. A cloud-covered Earth provides the backdrop for the scene.

  11. Enhanced performance of hybrid solar cells using longer arms of quantum cadmium selenide tetrapods

    KAUST Repository

    Lee, Kyu-Sung

    2011-12-01

    We demonstrate that enhanced device performance of hybrid solar cells based on tetrapod (TP)-shaped cadmium selenide (CdSe) nanoparticles and conjugated polymer of poly (3-hexylthiophene) (P3HT) can be obtained by using longer armed tetrapods which aids in better spatial connectivity, thus decreasing charge hopping events which lead to better charge transport. Longer tetrapods with 10 nm arm length lead to improved power conversion efficiency of 1.12% compared to 0.80% of device having 5 nm short-armed tetrapods:P3HT photoactive blends.

  12. Cadmium detoxification processes in the digestive gland of cephalopods in relation to accumulated cadmium concentrations

    OpenAIRE

    Bustamante, Paco; Cosson, Richard; Gallien, Isabelle; Caurant, Florence; Miramand, Pierre

    2002-01-01

    International audience The high concentrations of cadmium recorded in the digestive gland of cephalopods from various temperate and subpolar waters suggest that these molluscs have developed efficient cadmium detoxification mechanisms. The subcellular distribution of cadmium in the digestive gland cells was investigated in seven cephalopod species from the Bay of Biscay (France) and the Faroe Islands. In most species, cadmium was mainly found in the cytosolic fraction of the digestive glan...

  13. Cadmium content of plants as affected by soil cadmium concentration

    Energy Technology Data Exchange (ETDEWEB)

    Lehoczky, E. [Pannon Univ. of Agricultural Sciences, Keszthely (Hungary); Szabados, I.; Marth, P. [Plant Health and Soil Conservation Station, Higany (Hungary)

    1996-12-31

    Pot experiments were conducted in greenhouse conditions to study the effects of increasing cadmium (Cd) levels on biomass production and Cd contents in corn, (Zea mays L.), garlic (Allium sativum L.), and spinach (Spinacia oleracea L.). Plants were grown in two soil types: Eutric cambisol soil and A gleyic luvisol soil. Spinach proved to be the most sensitive to Cd treatments as its biomass considerably decreased with the increasing Cd levels. Cadmium contents of the three crops increased with increasing levels of Cd applications. Statistical differences were observed in the Cd contents of crops depending on soil type. With the same Cd rates, Cd tissue concentration of test plants grown in the strongly acidic Gleyic luvisol soil were many times higher than that of plants grown in a neutral Eutric cambisol soil. 14 refs., 4 tabs.

  14. Cadmium Exposure and Pancreatic Cancer in South Louisiana

    OpenAIRE

    Luckett, Brian G.; L. Joseph Su; Rood, Jennifer C.; Elizabeth T. H. Fontham

    2012-01-01

    Cadmium has been hypothesized to be a pancreatic carcinogen. We test the hypothesis that cadmium exposure is a risk factor for pancreatic cancer with a population-based case-control study sampled from a population with persistently high rates of pancreatic cancer (south Louisiana). We tested potential dietary and nondietary sources of cadmium for their association with urinary cadmium concentrations which reflect long-term exposure to cadmium due to the accumulation of cadmium in the kidney c...

  15. Zone refining of cadmium and related characterization

    Indian Academy of Sciences (India)

    N R Munirathnam; D S Prasad; Ch Sudheer; J V Rao; T L Prakash

    2005-06-01

    We present the zone refining results of cadmium using horizontal resistive zone refiner under constant flow of moisture free hydrogen gas. The boron impurity in cadmium can be avoided using quartz (GE 214 grade) boat in lieu of high pure graphite boat. The analytical results using inductively coupled plasma optical emission spectrometry (ICPOES) show that majority of the impurities are less than the detection limits. Comparatively, zinc is the most difficult impurity element to remove in cadmium matrix by zone refining.

  16. Electrodialytic Removal of Cadmium from Straw Ash

    DEFF Research Database (Denmark)

    Hansen, Henrik; Ottosen, Lisbeth M.; Villumsen, Arne;

    1999-01-01

    A problem with flyash from straw and wood combustion is the high level of heavy metals, especially cadmium. Two electrodialytic remediation experiments were carried out on cadmium polluted flyash from straw combustion. The flyash could be cleaned to 1/3 of its initial level after 24 days...... of remediation. Further removal of cadmium could be possible with longer remediation time or a higher current density...

  17. Cadmium induces carcinogenesis in BEAS-2B cells through ROS-dependent activation of PI3K/AKT/GSK-3β/β-catenin signaling

    Energy Technology Data Exchange (ETDEWEB)

    Son, Young-Ok; Wang, Lei; Poyil, Pratheeshkumar; Budhraja, Amit; Hitron, J. Andrew; Zhang, Zhuo [Graduate Center for Toxicology, College of Medicine, University of Kentucky, Lexington, KY (United States); Lee, Jeong-Chae [Graduate Center for Toxicology, College of Medicine, University of Kentucky, Lexington, KY (United States); School of Dentistry and Institute of Oral Biosciences (BK21 program), Research Center of Bioactive Materials, Chonbuk National University, Jeonju 561-756 (Korea, Republic of); Shi, Xianglin, E-mail: xshi5@email.uky.edu [Graduate Center for Toxicology, College of Medicine, University of Kentucky, Lexington, KY (United States)

    2012-10-15

    -dependent signaling as potential therapeutic targets in cadmium carcinogenesis.

  18. Cadmium induces carcinogenesis in BEAS-2B cells through ROS-dependent activation of PI3K/AKT/GSK-3β/β-catenin signaling

    International Nuclear Information System (INIS)

    -dependent signaling as potential therapeutic targets in cadmium carcinogenesis.

  19. Cadmium-mediated disruption of cortisol biosynthesis involves suppression of corticosteroidogenic genes in rainbow trout

    Energy Technology Data Exchange (ETDEWEB)

    Sandhu, Navdeep [Department of Biology, University of Waterloo, 200 University Avenue West, Waterloo, Ontario N2L 3G1 (Canada); Vijayan, Mathilakath M., E-mail: mvijayan@uwaterloo.ca [Department of Biology, University of Waterloo, 200 University Avenue West, Waterloo, Ontario N2L 3G1 (Canada)

    2011-05-15

    Cadmium is widely distributed in the aquatic environment and is toxic to fish even at sublethal concentrations. This metal is an endocrine disruptor, and one well established role in teleosts is the suppression of adrenocorticotrophic hormone (ACTH)-stimulated cortisol biosynthesis by the interrenal tissue. However the mechanism(s) leading to this steroid suppression is poorly understood. We tested the hypothesis that cadmium targets genes encoding proteins critical for corticosteroid biosynthesis, including melanocortin 2 receptor (MC2R), steroidogenic acute regulatory protein (StAR) and cytochrome P450 side chain cleavage enzyme (P450scc), in rainbow trout (Oncorhynchus mykiss). To test this, head kidney slices (containing the interrenal tissues) were incubated in vitro with cadmium chloride (0, 10, 100 and 1000 nM) for 4 h either in the presence or absence of ACTH (0.5 IU/mL). In the unstimulated head kidney slices, cadmium exposure did not affect basal cortisol secretion and the mRNA levels of MC2R and P450scc, while StAR gene expression was significantly reduced. Cadmium exposure significantly suppressed ACTH-stimulated cortisol production in a dose-related fashion. This cadmium-mediated suppression in corticosteroidogenesis corresponded with a significant reduction in MC2R, StAR and P450scc mRNA levels in trout head kidney slices. The inhibition of ACTH-stimulated cortisol production and suppression of genes involved in corticosteroidogenesis by cadmium were completely abolished in the presence of 8-Bromo-cAMP (a cAMP analog). Overall, cadmium disrupts the expression of genes critical for corticosteroid biosynthesis in rainbow trout head kidney slices. However, the rescue of cortisol production as well as StAR and P450scc gene expressions by cAMP analog suggests that cadmium impact occurs upstream of cAMP production. We propose that MC2R signaling, the primary step in ACTH-induced cortocosteroidogenesis, is a key target for cadmium-mediated disruption of

  20. Cadmium-mediated disruption of cortisol biosynthesis involves suppression of corticosteroidogenic genes in rainbow trout

    International Nuclear Information System (INIS)

    Cadmium is widely distributed in the aquatic environment and is toxic to fish even at sublethal concentrations. This metal is an endocrine disruptor, and one well established role in teleosts is the suppression of adrenocorticotrophic hormone (ACTH)-stimulated cortisol biosynthesis by the interrenal tissue. However the mechanism(s) leading to this steroid suppression is poorly understood. We tested the hypothesis that cadmium targets genes encoding proteins critical for corticosteroid biosynthesis, including melanocortin 2 receptor (MC2R), steroidogenic acute regulatory protein (StAR) and cytochrome P450 side chain cleavage enzyme (P450scc), in rainbow trout (Oncorhynchus mykiss). To test this, head kidney slices (containing the interrenal tissues) were incubated in vitro with cadmium chloride (0, 10, 100 and 1000 nM) for 4 h either in the presence or absence of ACTH (0.5 IU/mL). In the unstimulated head kidney slices, cadmium exposure did not affect basal cortisol secretion and the mRNA levels of MC2R and P450scc, while StAR gene expression was significantly reduced. Cadmium exposure significantly suppressed ACTH-stimulated cortisol production in a dose-related fashion. This cadmium-mediated suppression in corticosteroidogenesis corresponded with a significant reduction in MC2R, StAR and P450scc mRNA levels in trout head kidney slices. The inhibition of ACTH-stimulated cortisol production and suppression of genes involved in corticosteroidogenesis by cadmium were completely abolished in the presence of 8-Bromo-cAMP (a cAMP analog). Overall, cadmium disrupts the expression of genes critical for corticosteroid biosynthesis in rainbow trout head kidney slices. However, the rescue of cortisol production as well as StAR and P450scc gene expressions by cAMP analog suggests that cadmium impact occurs upstream of cAMP production. We propose that MC2R signaling, the primary step in ACTH-induced cortocosteroidogenesis, is a key target for cadmium-mediated disruption of

  1. Bioavailability of cadmium from linseed and cocoa

    OpenAIRE

    Hansen, Max; Rasmussen, Rie Romme; Sloth, Jens Jørgen

    2014-01-01

    The exposure of the European population to cadmium from food is high compared with the tolerable weekly intake of 2.5 μg/kg bodyweight set by EFSA in 2009. Only few studies on the bioavailability of cadmium from different food sources has been performed but this information in very important for the food authorities in order to give correct advises to the population. The aim of this study was to investigate the bioavailability of cadmium from whole linseed, crushed linseed, cocoa and cadmium ...

  2. The Epigenetic Effects of Prenatal Cadmium Exposure.

    Science.gov (United States)

    Vilahur, Nadia; Vahter, Marie; Broberg, Karin

    2015-06-01

    Prenatal exposure to the highly toxic and common pollutant cadmium has been associated with adverse effects on child health and development. However, the underlying biological mechanisms of cadmium toxicity remain partially unsolved. Epigenetic disruption due to early cadmium exposure has gained attention as a plausible mode of action, since epigenetic signatures respond to environmental stimuli and the fetus undergoes drastic epigenomic rearrangements during embryogenesis. In the current review, we provide a critical examination of the literature addressing prenatal cadmium exposure and epigenetic effects in human, animal, and in vitro studies. We conducted a PubMed search and obtained eight recent studies addressing this topic, focusing almost exclusively on DNA methylation. These studies provide evidence that cadmium alters epigenetic signatures in the DNA of the placenta and of the newborns, and some studies indicated marked sexual differences for cadmium-related DNA methylation changes. Associations between early cadmium exposure and DNA methylation might reflect interference with de novo DNA methyltransferases. More studies, especially those including environmentally relevant doses, are needed to confirm the toxicoepigenomic effects of prenatal cadmium exposure and how that relates to the observed health effects of cadmium in childhood and later life.

  3. Improvement of cadmium phytoremediation after soil inoculation with a cadmium-resistant Micrococcus sp.

    Science.gov (United States)

    Sangthong, Chirawee; Setkit, Kunchaya; Prapagdee, Benjaphorn

    2016-01-01

    Cadmium-resistant Micrococcus sp. TISTR2221, a plant growth-promoting bacterium, has stimulatory effects on the root lengths of Zea mays L. seedlings under toxic cadmium conditions compared to uninoculated seedlings. The performance of Micrococcus sp. TISTR2221 on promoting growth and cadmium accumulation in Z. mays L. was investigated in a pot experiment. The results indicated that Micrococcus sp. TISTR2221significantly promoted the root length, shoot length, and dry biomass of Z. mays L. transplanted in both uncontaminated and cadmium-contaminated soils. Micrococcus sp. TISTR2221 significantly increased cadmium accumulation in the roots and shoots of Z. mays L. compared to uninoculated plants. At the beginning of the planting period, cadmium accumulated mainly in the shoots. With a prolonged duration of cultivation, cadmium content increased in the roots. As expected, little cadmium was found in maize grains. Soil cadmium was significantly reduced with time, and the highest percentage of cadmium removal was found in the bacterial-inoculated Z. mays L. after transplantation for 6 weeks. We conclude that Micrococcus sp. TISTR2221 is a potent bioaugmenting agent, facilitating cadmium phytoextraction in Z. mays L.

  4. Activation of 112Cd by deuteron induced reactions up to 50 MeV: An alternative for 111In production?

    International Nuclear Information System (INIS)

    Highlights: • Enriched 112Cd targets were irradiated with 50 MeV deuterons. • Reaction cross sections for activation products 109,110g,111In and 111,110g,106Ag. • Comparisons with the results of the TENDL-2013 library based on TALYS 1.4 code. • Weighted sums of cross sections from TENDL-2013 were compared to literature results on natCd. • Production capabilities for 111In are compared to the 112Cd(p,2n)111In route. - Abstract: In stacked foil irradiations with an incident 50 MeV deuteron beam on highly enriched 112Cd targets, the excitation functions for 109,110g,111In and 111,110g,106Ag were determined, relative to the monitor reactions natAl(d,x)22,24Na. The results were compared to the scarce literature values on enriched Cd isotopes. Through combination of reaction cross section data on all stable Cd isotopes listed in the on-line library TENDL-2013 (calculated with the TALYS 1.4 theoretical code) a comparison with our earlier study on natCd is made. The possible production of 111In through 112Cd(d,3n), as an alternative to 112Cd(p,2n), is discussed

  5. 9 CFR 112.6 - Packaging biological products.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Packaging biological products. 112.6... AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS PACKAGING AND LABELING § 112.6 Packaging biological products. (a) Each multiple-dose final container of a biological...

  6. 14 CFR 1240.112 - Presentation of awards.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Presentation of awards. 1240.112 Section... CONTRIBUTIONS Awards for Scientific and Technical Contributions § 1240.112 Presentation of awards. (a) Monetary... employees of NASA contractors will be forwarded to contractor officials for suitable presentation....

  7. 40 CFR 112.20 - Facility response plans.

    Science.gov (United States)

    2010-07-01

    ... Pollution Contingency Plan (40 CFR part 300) and applicable Area Contingency Plans prepared pursuant to... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Facility response plans. 112.20 Section 112.20 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS...

  8. 40 CFR Appendix C to Part 112 - Substantial Harm Criteria

    Science.gov (United States)

    2010-07-01

    ... could cause injury (as defined at 40 CFR 112.2) to fish and wildlife and sensitive environments. For... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Substantial Harm Criteria C Appendix C to Part 112 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS...

  9. 29 CFR 1917.112 - Guarding of edges.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 7 2010-07-01 2010-07-01 false Guarding of edges. 1917.112 Section 1917.112 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... structures leading to pilings or vessel mooring or berthing installations, which present a hazard of...

  10. New Element no. 112 prepared from Zink and Lead

    DEFF Research Database (Denmark)

    Berg, Rolf W.

    1996-01-01

    The preparation of element no. 112 in the Periodic Table of the Elements has been reviewed in a popular scientific magazine.......The preparation of element no. 112 in the Periodic Table of the Elements has been reviewed in a popular scientific magazine....

  11. 9 CFR 112.5 - Review and approval of labeling.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Review and approval of labeling. 112.5 Section 112.5 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS PACKAGING AND...

  12. 9 CFR 112.7 - Special additional requirements.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Special additional requirements. 112.7 Section 112.7 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS PACKAGING AND...

  13. 9 CFR 112.10 - Special packaging and labeling.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Special packaging and labeling. 112.10 Section 112.10 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE VIRUSES, SERUMS, TOXINS, AND ANALOGOUS PRODUCTS; ORGANISMS AND VECTORS PACKAGING AND...

  14. 22 CFR 225.112 - Review by institution.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Review by institution. 225.112 Section 225.112... institution. Research covered by this policy that has been approved by an IRB may be subject to further appropriate review and approval or disapproval by officials of the institution. However, those officials...

  15. 14 CFR 1230.112 - Review by institution.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Review by institution. 1230.112 Section... SUBJECTS § 1230.112 Review by institution. Research covered by this policy that has been approved by an IRB... institution. However, those officials may not approve the research if it has not been approved by an IRB....

  16. 34 CFR 97.112 - Review by institution.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 1 2010-07-01 2010-07-01 false Review by institution. 97.112 Section 97.112 Education... institution. Research covered by this policy that has been approved by an IRB may be subject to further appropriate review and approval or disapproval by officials of the institution. However, those officials...

  17. 15 CFR 27.112 - Review by institution.

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false Review by institution. 27.112 Section... § 27.112 Review by institution. Research covered by this policy that has been approved by an IRB may be subject to further appropriate review and approval or disapproval by officials of the institution....

  18. 16 CFR 1028.112 - Review by institution.

    Science.gov (United States)

    2010-01-01

    ... 16 Commercial Practices 2 2010-01-01 2010-01-01 false Review by institution. 1028.112 Section 1028... § 1028.112 Review by institution. Research covered by this policy that has been approved by an IRB may be subject to further appropriate review and approval or disapproval by officials of the institution....

  19. 9 CFR 11.2 - Prohibitions concerning exhibitors.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Prohibitions concerning exhibitors. 11.2 Section 11.2 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF... free of protrusions, projections, rust, corrosion, or rough or sharp edges. (7)(i) Boots, collars,...

  20. 7 CFR 1703.112 - Expedited telecommunications loans

    Science.gov (United States)

    2010-01-01

    .... See 7 CFR part 1737 for loans and 7 CFR part 1744 for advances under this section. ... 7 Agriculture 11 2010-01-01 2010-01-01 false Expedited telecommunications loans 1703.112 Section... § 1703.112 Expedited telecommunications loans RUS will expedite consideration and determination of...

  1. Cadmium Modulates Biofilm Formation by Staphylococcus epidermidis

    NARCIS (Netherlands)

    Wu, Xueqing; Santos, Regiane R.; Fink-Gremmels, Johanna

    2015-01-01

    The aim of the study was to evaluate the effect of cadmium exposure on Staphylococcus epidermidis (ATCC 35984) biofilm formation. Bacteria were cultured in the absence or presence of different concentrations (0-50 mu M) of cadmium. Biofilm formation and bacterial viability were assessed. Quantitativ

  2. Assessment of potential soybean cadmium excluder cultivars at different concentrations of Cd in soils.

    Science.gov (United States)

    Zhi, Yang; He, Kangxin; Sun, Ting; Zhu, Yongqiang; Zhou, Qixing

    2015-09-01

    The selection of cadmium-excluding cultivars has been used to minimize the transfer of cadmium into the human food chain. In this experiment, five Chinese soybean plants were grown in three soils with different concentrations of Cd (0.15, 0.75 and 1.12mg/kg). Variations in uptake, enrichment, and translocation of Cd among these soybean cultivars were studied. The results indicated that the concentration of Cd in seeds that grew at 1.12mg/kg Cd in soils exceeded the permitted maximum levels in soybeans. Therefore, our results indicated that even some soybean cultivars grown on soils with permitted levels of Cd might accumulate higher concentrations of Cd in seeds that are hazardous to human health. The seeds of these five cultivars were further assessed for interactions between Cd and other mineral nutrient elements such as Ca, Cu, Fe, Mg, Mn and Zn. High Cd concentration in soil was found to inhibit the uptake of Mn. Furthermore, Fe and Zn accumulations were found to be enhanced in the seeds of all of the five soybean cultivars in response to high Cd concentration. Cultivar Tiefeng 31 was found to fit the criteria for a Cd-excluding cultivar under different concentrations of Cd in soils.

  3. Cadmium stress in wheat seedlings: growth, cadmium accumulation and photosynthesis

    DEFF Research Database (Denmark)

    Ci, Dunwei; Jiang, Dong; Wollenweber, Bernd;

    2010-01-01

    Seedlings of wheat (Triticum aestivum L.) cultivars Jing 411, Jinmai 30 and Yangmai 10 were exposed to 0, 10, 20, 30, 40 or 50 μM of CdCl2 in a solution culture experiment. The effects of cadmium (Cd) stress on wheat growth, leaf photon energy conversion, gas exchange, and Cd accumulation in wheat...... parameters were generally depressed by Cd stress, especially under the high Cd concentrations. Cd concentration and accumulation in both shoots and roots increased with increasing external Cd concentrations. Relationships between corrected parameters of growth, photosynthesis and fluorescence and corrected...

  4. Immunoassay for Cadmium Detection and Quantification

    Institute of Scientific and Technical Information of China (English)

    GONG-LIANG LIU; JU-FANG WANG; ZHI-YONG LI; SHI-ZHONG LIANG; XIAO-NING WANG

    2009-01-01

    Objective To detect cadmium in environmental and food samples by graphite furnace atomic absorption spectroscopy (GFAAS) and inductively coupled plasma atomic emission spectroscopy (ICPAES). Methods An indirect competitive enzyme-linked immunosorbent assay (IC-ELISA) was developed based on a cadmium-specific monoclonal antibody.IC-ELISA for cadmium in environmental and food samples was evaluated. Results IC-ELISA showed an IC50 of 45.6 μg/L with a detection limit of 1.95 μg/L for cadmium,and showed a mean recovery ranging 97.67%-107.08%.The coefficient of variations for intra- and iuterassay was 3.41%-6.61% and 4.70%-9.21%,respectively.The correlation coefficient between IC-ELISA and GFAAS was 0.998. Conclusion IC-ELISA can detect and quantify cadmium residue in environmental or food samples.

  5. Development of cadmium/silver/palladium separation by ion chromatography with quadrupole inductively coupled plasma mass spectrometry detection for off-line cadmium isotopic measurements

    International Nuclear Information System (INIS)

    A separation method was investigated to perform off-line cadmium isotopic measurements on a 109Ag transmutation target. Ion chromatography (IC) with Q ICPMS detection (quadrupole inductively coupled plasma mass spectrometry detection) was chosen to separate cadmium from the isobarically interfering elements, silver and palladium, present in the sample. The optimization of chromatographic conditions was particularly studied. Several anion and cation columns (Dionex AG11 (R), CS10 (R) and CS12 (R)) were compared with different mobile phases (HNO3, HCl). The separation procedure was achieved with a carboxylate-functionalized cation exchange CS12 column using 0.5 M HNO3 as eluent. The developed technique yielded satisfactory results in terms of separation factors (greater than 5) and provides an efficient solution to obtain rapidly purified cadmium fractions (decontamination factors higher 100,000 for silver and palladium) which can directly be analyzed by multi collection inductively coupled plasma mass spectrometry (MC ICPMS). By applying the proposed procedure, accurate and precise cadmium isotope ratios were determined for the irradiated 109Ag transmutation target. (authors)

  6. Multiple effects of cadmium on the photosynthetic apparatus of Avicennia germinans L. as probed by OJIP chlorophyll fluorescence measurements

    Energy Technology Data Exchange (ETDEWEB)

    Gonzales-Mendoza, D.; Zapata-Perez, O. [Cinvestav Unidad Merida, Yucatan (Mexico). Dept. de Recursos del Mar; Espadas y Gil, F.; Santamaria, J.M. [Unidad de Biotecnologia, CICY, Yucatan (Mexico)

    2007-03-15

    The toxic effects of cadmium on the photosynthetic apparatus of Avicennia germinans were evaluated by means of the chlorophyll fluorescence transient O-J-I-P. The chlorophyll fluorescence transients were recorded in vivo with high time resolution and analyzed according to the OJIP-test that can quantify the performance of photosystem II. Cadmium-treated plants showed a decrease in yield for primary photochemistry, TR{sup 0}/ABS. The performance index of photosystem II (PSII), PI{sub ABS}, decreased due to cadmium treatment. This performance index is the combination of the indexes of three independent parameters: (1) total number of active reaction centers per absorption (RC/ABS), (2) yield of primary photochemistry (TR{sup 0}/ABS), and (3) efficiency with which a trapped exciton can move an electron into the electron transport chain (ET{sup 0}/TR{sup 0}). Additionally, the F{sub 0}/F{sub v} registered the highest sensitivity to the metal, thus indicating that the water-splitting apparatus of the oxidizing side of PSII is the primary site of action of cadmium. In summary, cadmium affects several targets of photosystem II. More specifically the main targets of cadmium, according to the OJIP-test, can be listed as a decrease in the number of active reaction centers and damage to the activity of the water-splitting complex. (orig.)

  7. Cadmium mobility and accumulation in soils of the European Communities

    NARCIS (Netherlands)

    Fraters B; van Beurden AUCJ

    1993-01-01

    In this overview of the effects of cadmium pollution on agricultural soils in the European Community, both the cadmium loads on agricultural land and the soil sensitivity to cadmium accumulation have been estimated. Cadmium loads have been estimated separately for arable land and grassland. The ef

  8. Cadmium chloride alters mRNA levels of angiogenesis related genes in primary human endometrial endothelial cells grown in vitro.

    Science.gov (United States)

    Helmestam, Malin; Stavreus-Evers, Anneli; Olovsson, Matts

    2010-11-01

    Cadmium, is known to cause adverse reproductive effects, and classified as an endocrine disrupting chemical (EDC). Human endometrial endothelial cells (HEEC) have a key role in the regulation of endometrial angiogenesis. These cells are known to express estrogen receptors, a feature that makes them potential targets for EDCs such as cadmium. We have designed a co-culture system, in which HEEC were grown in the same cell culture medium as endometrial stromal cells but in separate, communicating chambers. With quantitative PCR, we investigated changes in mRNA expression of genes associated with angiogenesis, sex steroids and endothelial cell specific functions. We found that cadmium altered the mRNA expression of the two important angiogenic molecules VEGF-A and PLGF. Cadmium might thus affect endometrial angiogenesis and as a consequence cause endometrial dysfunction with an increased risk for fertility problems. PMID:20580663

  9. Global Fitness Profiling Identifies Arsenic and Cadmium Tolerance Mechanisms in Fission Yeast

    Science.gov (United States)

    Guo, Lan; Ganguly, Abantika; Sun, Lingling; Suo, Fang; Du, Li-Lin; Russell, Paul

    2016-01-01

    Heavy metals and metalloids such as cadmium [Cd(II)] and arsenic [As(III)] are widespread environmental toxicants responsible for multiple adverse health effects in humans. However, the molecular mechanisms underlying metal-induced cytotoxicity and carcinogenesis, as well as the detoxification and tolerance pathways, are incompletely understood. Here, we use global fitness profiling by barcode sequencing to quantitatively survey the Schizosaccharomyces pombe haploid deletome for genes that confer tolerance of cadmium or arsenic. We identified 106 genes required for cadmium resistance and 110 genes required for arsenic resistance, with a highly significant overlap of 36 genes. A subset of these 36 genes account for almost all proteins required for incorporating sulfur into the cysteine-rich glutathione and phytochelatin peptides that chelate cadmium and arsenic. A requirement for Mms19 is explained by its role in directing iron–sulfur cluster assembly into sulfite reductase as opposed to promoting DNA repair, as DNA damage response genes were not enriched among those required for cadmium or arsenic tolerance. Ubiquinone, siroheme, and pyridoxal 5′-phosphate biosynthesis were also identified as critical for Cd/As tolerance. Arsenic-specific pathways included prefoldin-mediated assembly of unfolded proteins and protein targeting to the peroxisome, whereas cadmium-specific pathways included plasma membrane and vacuolar transporters, as well as Spt–Ada–Gcn5-acetyltransferase (SAGA) transcriptional coactivator that controls expression of key genes required for cadmium tolerance. Notable differences are apparent with corresponding screens in the budding yeast Saccharomyces cerevisiae, underscoring the utility of analyzing toxic metal defense mechanisms in both organisms. PMID:27558664

  10. Global Fitness Profiling Identifies Arsenic and Cadmium Tolerance Mechanisms in Fission Yeast

    Directory of Open Access Journals (Sweden)

    Lan Guo

    2016-10-01

    Full Text Available Heavy metals and metalloids such as cadmium [Cd(II] and arsenic [As(III] are widespread environmental toxicants responsible for multiple adverse health effects in humans. However, the molecular mechanisms underlying metal-induced cytotoxicity and carcinogenesis, as well as the detoxification and tolerance pathways, are incompletely understood. Here, we use global fitness profiling by barcode sequencing to quantitatively survey the Schizosaccharomyces pombe haploid deletome for genes that confer tolerance of cadmium or arsenic. We identified 106 genes required for cadmium resistance and 110 genes required for arsenic resistance, with a highly significant overlap of 36 genes. A subset of these 36 genes account for almost all proteins required for incorporating sulfur into the cysteine-rich glutathione and phytochelatin peptides that chelate cadmium and arsenic. A requirement for Mms19 is explained by its role in directing iron–sulfur cluster assembly into sulfite reductase as opposed to promoting DNA repair, as DNA damage response genes were not enriched among those required for cadmium or arsenic tolerance. Ubiquinone, siroheme, and pyridoxal 5′-phosphate biosynthesis were also identified as critical for Cd/As tolerance. Arsenic-specific pathways included prefoldin-mediated assembly of unfolded proteins and protein targeting to the peroxisome, whereas cadmium-specific pathways included plasma membrane and vacuolar transporters, as well as Spt–Ada–Gcn5-acetyltransferase (SAGA transcriptional coactivator that controls expression of key genes required for cadmium tolerance. Notable differences are apparent with corresponding screens in the budding yeast Saccharomyces cerevisiae, underscoring the utility of analyzing toxic metal defense mechanisms in both organisms.

  11. The presence of cadmium in the intertidal environments of a moderately impacted coastal lagoon in western Portugal (Óbidos Lagoon)--spatial and seasonal evaluations.

    Science.gov (United States)

    Pedro, Carmen A; Santos, Márcia S S; Ferreira, Susana M F; Gonçalves, Sílvia C

    2016-01-01

    A seasonal environmental monitoring program was carried out (winter 2009 to summer 2010) to evaluate the spatial and seasonal cadmium concentrations in the intertidal environments of the Óbidos Lagoon (Portugal). Also, some environmental parameters were monitored at each sampling station. Both the water and the sediment samples were contaminated, although to different degrees. In general, cadmium contamination appears to be mostly focused on the inner areas of the lagoon, namely, in Barrosa's arm, which receives a small tributary contaminated by agro-industrial activities. Only cadmium concentration in sediment showed to be significantly influenced by seasons. Some environmental parameters presented spatial and temporal heterogeneity which influenced, to some extent, cadmium bioavailability. The results of this study allow a better understanding of the environmental quality of this ecosystem regarding cadmium contamination and may assist in the definition of future coastal management measures specifically targeted to trace metal contamination and pollution monitoring.

  12. Metyrosine in psychosis associated with 22q11.2 deletion syndrome: case report.

    Science.gov (United States)

    Carandang, Carlo G; Scholten, Monique C

    2007-02-01

    This report describes the use of metyrosine (Demser) in an adolescent male with psychosis associated with the 22q11.2 deletion syndrome (velocardiofacial syndrome; VCFS), diagnosed by fluorescence in situ hybridization (FISH). He presented with multiple features of 22q11.2 deletion syndrome, including ventricular septal defect, palatal abnormalities, speech and motor delays, attention deficits, mood lability, and psychosis. After a failed trial of an atypical antipsychotic to address the psychosis, metyrosine was initiated, with significant reduction of psychotic symptoms and mood lability. Metyrosine treatment allowed this youth to live at home and to attend school, after months of recurrent psychiatric hospitalizations. The successful treatment of metyrosine for psychosis associated with VCFS represents a first in psychiatry, where a known biochemical abnormality in a psychiatric disorder was corrected by a treatment that targets the biochemical pathway, leading to reduction of psychiatric symptoms and improvement of functioning.

  13. STS-112 Flight Day 4 Highlights

    Science.gov (United States)

    2002-10-01

    On the fourth day of STS-112, its crew (Jeffrey Ashby, Commander; Pamela Melroy, Pilot; David Wolf, Mission Specialist; Piers Sellers, Mission Specialist; Sandra Magnus, Mission Specialist; Fyodor Yurchikhin, Mission Specialist) onboard Atlantis and the Expedition 5 crew (Valery Korzun, Commander; Peggy Whitson, Flight Engineer; Sergei Treschev, Flight Engineer) onboard the International Space Station (ISS) are seen preparing for the installation of the S1 truss structure. Inside the Destiny Laboratory Module, Korzun and other crewmembers are seen as they busily prepare for the work of the day. Sellers dons an oxygen mask and uses an exercise machine in order to purge the nitrogen from his bloodstream, in preparation for an extravehicular activity (EVA). Whitson uses the ISS's Canadarm 2 robotic arm to grapple the S1 truss and remove it from Atlantis' payload bay, with the assistance of Magnus. Using the robotic arm, Whitson slowly maneuvers the 15 ton truss structure into alignment with its attachment point on the starboard side of the S0 truss structure, where the carefully orchestrated mating procedures take place. There is video footage of the entire truss being rotated and positioned by the arm, and ammonia tank assembly on the structure is visible, with Earth in the background. Following the completion of the second stage capture, the robotic arm is ungrappled from truss. Sellers and Wolf are shown exiting the the Quest airlock hatch to begin their EVA. They are shown performing a variety of tasks on the now attached S1 truss structure, including work on the Crew Equipment Translation Cart (CETA), the S-band Antenna Assembly, and umbilical cables that provide power and remote operation capability to cameras. During their EVA, they are shown using a foot platform on the robotic arm. Significant portions of their activities are shown from the vantage of helmet mounted video cameras. The video closes with a final shot of the ISS and its new S1 truss.

  14. Biomedical Results of ISS Expeditions 1-12

    Science.gov (United States)

    Fogarty, Jennifer; Sams, Clarence F.

    2007-01-01

    A viewgraph presentation on biomedical data from International Space Station (ISS) Expeditions 1-12 is shown. The topics include: 1) ISS Expeditions 1-12; 2) Biomedical Data; 3) Physiological Assessments; 4) Bone Mineral Density; 5) Bone Mineral Density Recovery; 6) Orthostatic Tolerance; 7) Postural Stability Set of Sensory Organ Test 6; 8) Performance Assessment; 9) Aerobic Capacity of the Astronaut Corps; 10) Pre-flight Aerobic Fitness of ISS Astronauts; 11) In-flight and Post-flight Aerobic Capacity of the Astronaut Corps; and 12) ISS Functional Fitness Expeditions 1-12.

  15. Response of Saccharomyces cerevisiae to cadmium stress

    Energy Technology Data Exchange (ETDEWEB)

    Moreira, Luciana Mara Costa; Ribeiro, Frederico Haddad; Neves, Maria Jose [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil). Lab. de Radiobiologia], e-mail: luamatu@uol.com.br; Porto, Barbara Abranches Araujo; Amaral, Angela M.; Menezes, Maria Angela B.C. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Lab. de Ativacao Neutronica], e-mail: menezes@cdtn.br; Rosa, Carlos Augusto [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Microbiologia], e-mail: carlrosa@icb.ufmg

    2009-07-01

    The intensification of industrial activity has been greatly contributing with the increase of heavy metals in the environment. Among these heavy metals, cadmium becomes a serious pervasive environmental pollutant. The cadmium is a heavy metal with no biological function, very toxic and carcinogenic at low concentrations. The toxicity of cadmium and several other metals can be mainly attributed to the multiplicity of coordination complexes and clusters that they can form. Some aspects of the cellular response to cadmium were extensively investigated in the yeast Saccharomyces cerevisiae. The primary site of interaction between many toxic metals and microbial cells is the plasma membrane. Plasma-membrane permeabilisation has been reported in a variety of microorganisms following cadmium exposure, and is considered one mechanism of cadmium toxicity in the yeast. In this work, using the yeast strain S. cerevisiae W303-WT, we have investigated the relationships between Cd uptake and release of cellular metal ions (K{sup +} and Na{sup +}) using neutron activation technique. The neutron activation was an easy, rapid and suitable technique for doing these metal determinations on yeast cells; was observed the change in morphology of the strains during the process of Cd accumulation, these alterations were observed by Transmission Electron Microscopy (TEM) and Scanning Electron Microscopy (SEM) during incorporation of cadmium. (author)

  16. Response of Pleurotus ostreatus to cadmium exposure

    Energy Technology Data Exchange (ETDEWEB)

    Favero, N.; Bressa, G.; Costa, P. (Univ. of Padua (Italy))

    1990-08-01

    The possibility of utilizing agroindustrial wastes in the production of edible, high-quality products (e.g., mushrooms) implies the risk of bringing toxic substances, such as heavy metals, into the human food chain. Thus, growth in the presence of cadmium and cadmium accumulation limits have been studied in the industrially cultivated fungus P. ostreatus. Fruit body production is substantially unaffected in the presence of 25, 139, and 285 mg Cd/kg of dried substrate. Cadmium concentration in fruit bodies is related to cadmium substrate level, the metal being present at higher levels in caps (22-56 mg/kg dry wt) than in stems (13-36 mg/kg dry wt). Concentration factor (CF), very low in the controls (about 2), further decreases in treated specimens. The presence of a cadmium control mechanism in this fungi species is suggested. Fruit body cadmium levels could, however, represent a risk for P. ostreatus consumers, according to FAO/WHO limits related to weekly cadmium intake.

  17. Cadmium Toxicity to Ringed Seals (Phoca hispida)

    DEFF Research Database (Denmark)

    Sonne, Christian; Dietz, R.; Riget, F. F.;

    as laboratory mammals. We have studied possible cadmium induced histopathological changes in the kidneys as well as a demineralisation of the skeletal system (DXA-scanning of lumbal vertebraes). No obvious cadmium induced toxic changes were found. Food composition and physiological adaptations may explain......Cadmium concentrations in kidneys from ringed seals (Phoca hispida) from North West Greenland (Qaanaaq) are high. Concentrations range at level known to induce renal toxic effects (mainly tubulopathy) and demineralisation (osteopenia) of the skeletal system (Fanconi's Syndrome) in humans as well...

  18. Psalms 111–112: Big Story, Little Story

    OpenAIRE

    Jack Collins

    2016-01-01

    This study argues that the juxtaposition of Psalms 111–112 offers wisdom for life. Psalm 111, in stressing God’s mighty deeds of redemption for his people, focuses on the “big story” for the whole people; Psalm 112, in stressing “wisdom,” encourages each member of God’s people in a day-to-day walk, a “little story,” that contributes to the big story of the whole people.

  19. Final Technical Report 09 LW 112

    Energy Technology Data Exchange (ETDEWEB)

    Lenhoff, R J

    2010-11-28

    Since the development of new antibiotics is out-paced by the emergence of bacterial resistance to existing antibiotics, it is crucial to understand the genetic mechanisms underlying resistance existing antibiotics. At the center of this mystery is a poorly understood phenomenon, heteroresistance: the coexistence of multiple subpopulations with varying degrees of antibiotic resistance. A better understanding of the fundamental basis of heteroresistance could result in sorely needed breakthroughs in treatment options. This project proposed to leverage a novel microfluidic (microchemostat) technology to probe the heteroresistance phenomenon in bacteria, with the aim of restoring the efficacy of existing {beta}-lactam antibiotics. The clinically important bacteria Methicillin Resistant S. aureus (MRSA) was used as the test case of bacteria that exhibits antibiotic heteroresistance. MRSA is difficult to treat because it is resistant to all {beta}-lactam antibiotics, as well as other classes of antimicrobials. Whereas {beta}-lactams such as methicillin and oxacillin are the preferred antibiotics to treat S. aureus infections due to their efficacy and low side effects, accurate determination and use of oxacillin/methicillin dosage is hampered by heteroresistance. In fact, invasive MRSA infections now account for about 95,000 deaths per year, a number that exceeds the deaths due to either influenza or HIV (12). In some MRSA strains, two subpopulations of cells may coexist: both populations carry the mecA gene that confers resistance, but mecA is differentially expressed so that only a small number of cells are observed during in vitro testing. Why this occurs is not understood. Prior experiments have sought to explain this phenomenon with conflicting results, with technology being the primary barrier to test the system sufficiently. This is the final report on work accomplished under the Lab-wide LDRD project 09-LW-112. This project was awarded to Frederick Balagadde who

  20. Tissue-specific accumulation of cadmium in subcellular compartments of eastern oysters Crassostrea virginica Gmelin (Bivalvia: Ostreidae)

    Energy Technology Data Exchange (ETDEWEB)

    Sokolova, I.M. [Biology Department, University of North Carolina at Charlotte, 9201 University City Blvd., Charlotte, NC 28223 (United States)]. E-mail: insokolo@uncc.edu; Ringwood, A.H. [Biology Department, University of North Carolina at Charlotte, 9201 University City Blvd., Charlotte, NC 28223 (United States); Johnson, C. [Johnson C. Smith University, 100 Beatties Ford Road, Charlotte, NC 28216 (United States)

    2005-09-10

    Cadmium distribution was studied in different subcellular fractions of gill and hepatopancreas tissues of eastern oysters Crassostrea virginica. Oysters were exposed for up to 21 days to low sublethal Cd concentrations (25 {mu}g L{sup -1}). Gill and hepatopancreas tissues were sampled and divided into organelle fractions and cytosol by differential centrifugation. Organelle content of different fractions was verified by activities of marker enzymes, citrate synthase and acid phosphatase for mitochondria and lysosomes, respectively. In both tissue types, there was a significant accumulation of cadmium in cytosol reaching 230-350 ng mg{sup -1} protein. Among organelles, mitochondria were the main target for Cd bioaccumulation in gills (250-300 ng mg{sup -1} protein), whereas in hepatopancreas tissues, the highest cadmium accumulation occurred in lysosomes (90-94 ng mg{sup -1} protein). Although 75-83% of total cadmium burden was associated with the cytosol reflecting high volume fraction of this compartment, Cd concentrations in organelle fractions reached levels that could cause dysfunction of mitochondria and lysosomes. Organ- and organelle-specific patterns of cadmium bioaccumulation support our previous in vivo studies, which showed adverse effects of cadmium exposures on mitochondrial oxidation in gills and on the lysosomal system of hepatopancreas. This may have important implications for the development of biomarkers of effect for heavy metals and for understanding the mechanisms of toxic effects of metals.

  1. Market for nickel-cadmium batteries

    Science.gov (United States)

    Putois, F.

    Besides the lead/acid battery market, which has seen a tremendous development linked with the car industry, the alkaline rechargeable battery market has also been expanded for more than twenty years, especially in the field of portable applications with nickel-cadmium batteries. Today, nickel-cadmium batteries have to face newcomers on the market, such as nickel-metal hydride, which is another alkaline couple, and rechargeable lithium batteries; these new battery systems have better performances in some areas. This work illustrates the status of the market for nickel-cadmium batteries and their applications. Also, for two major applications—the cordless tool and the electric vehicles—the competitive situation of nickel-cadmium batteries; facing new systems such as nickel-metal hydride and lithium ion cells are discussed.

  2. RISK ASSESSMENT AND MANAGEMENT OF ENVIRONMENTAL CADMIUM

    Science.gov (United States)

    Cadmium consumed in foods grown on soils contaminated by industrial Cd+Zn discharge has caused renal tubular dysfunction in exposed humans in discrete situations. However, lack of understanding about environmental Cd has caused wide concern that generalpopulations may...

  3. Subcellular site and nature of intracellular cadmium in plants

    Energy Technology Data Exchange (ETDEWEB)

    Wagner, George J.

    1979-01-01

    The mechanisms underlying heavy metal accumulation, toxicity and tolerance in higher plants are poorly understood. Since subcellular processes are undoubtedly involved in all these phenomena, it is of interest to study the extent of, subcellular site of and nature of intracellularly accumulated cadmium in higher plants. Whole plants supplied /sup 109/CdCl/sub 2/ or /sup 112/CdSO/sub 4/ accumulated Cd into roots and aerial tissues. Preparation of protoplasts from aerial tissue followed by subcellular fractionation of the protoplasts to obtain intact vacuoles, chloroplasts and cytosol revealed the presence of Cd in the cytosol but not in vacuoles or chloroplasts. Particulate materials containing other cell components were also labeled. Of the /sup 109/Cd supplied to plants, 2 to 10% was recovered in both cytosol preparations and in particulate materials. Cytosol contained proteinaceous--Cd complexes, free metal and low molecular weight Cd complexes. Labeling of protoplasts gave similar results. No evidence was obtained for the production of volatile Cd complexes in tobacco.

  4. Some Aspects of Sealed Nickel Cadmium Cells

    Directory of Open Access Journals (Sweden)

    P. K. Saha

    1967-11-01

    Full Text Available Sealed Nickel Cadmium Cell system is termed till today as the most reliable power pack for electronic apparatus specially in low temperature use. This paper brings out the development and production of sealed nickel cadmium cells of pocket plate construction. The author who has gained experience in production of Ni-Cd cells in East Germany discusses also the major problems faced by the battery manufactures of to-day.

  5. Effect of dietary zinc deficiency on the accumulation of cadmium and metallothionein in selected tissues of the rat

    Energy Technology Data Exchange (ETDEWEB)

    Waalkes, M.P.

    1986-01-01

    The effect of continuous dietary zinc deficiency on the metabolism of the toxic heavy metal cadmium has not been widely studied. This investigation was designed to assess the effects of subadequate dietary zinc intake on the accumulation of dietary cadmium and on metallothionein (MT) and zinc concentrations in target organs of cadmium toxicity. Adult male Wistar rats (180-200 g) were allowed, ad libitum, diets either adequate (60 ppm) or deficient (7 ppm) in zinc for a total of 9 wk. The zinc-deficient diet resulted in an approximately 40% reduction in plasma zinc (assessed at 3, 6, and 9 wk) in the absence of overt signs of zinc deficiency (i.e., reduced weight gain, alopecia, etc.). Separate groups of rats were also maintained on zinc-defined diets for a total of 9 wk, but cadmium was added to the diet (0, 12.5, 25, 50, 100, and 200 ppm) a the end of wk 3 and maintained at that level throughout the remaining 6 wk of the study, when the rats were killed. The feeding of the zinc-deficient diet markedly enhanced the accumulation of cadmium in the liver, kidney, and testes. Hepatic, renal, and testicular zinc concentrations were not affected by suboptimal zinc intake alone. However, marked reductions in renal and testicular zinc concentrations were caused by zinc deficiency in concert with cadmium exposure. MT levels, when related to tissue cadmium concentrations, were elevated to a significantly lesser extent in the kidneys of zinc-deficient animals. These results indicate that marginal zinc deficiency markedly increases cadmium accumulation in various organs and reduces zinc content and MT induction in some organs.

  6. Cadmium zinc telluride spectral modeling

    International Nuclear Information System (INIS)

    Cadmium zinc telluride (CZT) detectors are the highest resolution room temperature gamma-ray detectors available for isotopic analysis. As with germanium detectors, accurate isotopic analysis using spectra requires peak deconvolution. The CZT peak shapes are asymmetric, with a long low energy tail. The asymmetry is a result of the physics of the electron/hole transport in the semiconductor. An accurate model of the physics of the electron/hole transport through an electric field will allow the parameterization of the peak shapes as a function of energy. In turn this leads to the ability to perform accurate spectral deconvolution and therefore accurate isotopic analysis. The model and the peak-shape parameterization as a function of energy will be presented

  7. Isospin transport in 84Kr + 112,124Sn collisions at Fermi energies

    CERN Document Server

    Barlini, S; Casini, G; Maurenzig, P R; Olmi, A; Bini, M; Carboni, S; Pasquali, G; Poggi, G; Stefanini, A A; Bougault, R; Bonnet, E; Borderie, B; Chbihi, A; Frankland, J D; Gruyer, D; Lopez, O; Neindre, N Le; Parlog, M; Rivet, M F; Vient, E; Rosato, E; Spadaccini, G; Vigilante, M; Bruno, M; Marchi, T; Morelli, L; Cinausero, M; Degerlier, M; Gramegna, F; Kozik, T; Twarog, T; Alba, R; Maiolino, C; Santonocito, D

    2013-01-01

    Isotopically resolved fragments with Z<=20 have been studied with high resolution telescopes in a test run for the FAZIA collaboration. The fragments were produced by the collision of a 84Kr beam at 35 MeV/nucleon with a n-rich (124Sn) and a n-poor (112Sn) target. The fragments, detected close to the grazing angle, are mainly emitted from the phase-space region of the projectile. The fragment isotopic content clearly depends on the n-richness of the target and it is a direct evidence of isospin diffusion between projectile and target. The observed enhanced neutron richness of light fragments emitted from the phase-space region close to the center of mass of the system can be interpreted as an effect of isospin drift in the diluted neck region.

  8. Isospin transport in 84Kr+112,124Sn collisions at Fermi energies

    Science.gov (United States)

    Barlini, S.; Piantelli, S.; Casini, G.; Maurenzig, P. R.; Olmi, A.; Bini, M.; Carboni, S.; Pasquali, G.; Poggi, G.; Stefanini, A. A.; Bougault, R.; Bonnet, E.; Borderie, B.; Chbihi, A.; Frankland, J. D.; Gruyer, D.; Lopez, O.; Le Neindre, N.; Pârlog, M.; Rivet, M. F.; Vient, E.; Rosato, E.; Spadaccini, G.; Vigilante, M.; Bruno, M.; Marchi, T.; Morelli, L.; Cinausero, M.; Degerlier, M.; Gramegna, F.; Kozik, T.; Twaróg, T.; Alba, R.; Maiolino, C.; Santonocito, D.

    2013-05-01

    Isotopically resolved fragments with Z≲20 have been studied with a high-resolution telescope in a test run for the FAZIA Collaboration. The fragments were produced by the collision of a 84Kr beam at 35 MeV/nucleon with a neutron-rich (124Sn) and a neutron-poor (112Sn) target. The fragments, detected close to the grazing angle, are mainly emitted from the phase-space region of the projectile. The fragment isotopic content clearly depends on the neutron richness of the target and this is direct evidence of isospin diffusion between projectile and target. The observed enhanced neutron richness of light fragments emitted from the phase-space region close to the center of mass of the system can be interpreted as an effect of isospin drift in the diluted neck region.

  9. Cadmium leaching from thermal treated and gamma irradiated Mexican aluminosilicates

    Energy Technology Data Exchange (ETDEWEB)

    Davila-Rangel, J.I. [Departamento de Quimica, Instituto Nacional de Investigaciones Nucleares, Apdo. Postal 18-1027, Mexico 11801, D.F. (Mexico); Unidad Academica Centro Regional de Estudios Nucleares, Universidad Autonoma de Zacatecas Cipres 10, Frac. La Penuela, Zacatecas, Zacatecas 98068 (Mexico); Facultad de Ciencias, Universidad Autonoma del Estado de Mexico, Instituto Literario No. 100 Col. Centro C.P. 50000, Toluca, Edo. de Mexico (Mexico); Solache-Rios, M. [Departamento de Quimica, Instituto Nacional de Investigaciones Nucleares, Apdo. Postal 18-1027, Mexico 11801, D.F. (Mexico)], E-mail: msr@nuclear.inin.mx

    2008-10-15

    Thermal and radiation effects on the leaching of cadmium from two cadmium exchanged zeolitic tuffs and one clay were determined. The cadmium exchanged aluminosilicates were heated at different temperatures (500, 700, 900 and 1100 {sup o}C), and the materials were then treated with NaCl (1 M and 5 M) and HNO{sub 3} (0.001 M and 1 M) solutions to determine the leaching behaviour of cadmium from the materials. The stability of cadmium in the materials increased as the heating temperature was increased. Cadmium leaching from gamma irradiated and heated materials at 1100 {sup o}C was higher than leaching from non-irradiated samples.

  10. Cadmium leaching from thermal treated and gamma irradiated Mexican aluminosilicates

    International Nuclear Information System (INIS)

    Thermal and radiation effects on the leaching of cadmium from two cadmium exchanged zeolitic tuffs and one clay were determined. The cadmium exchanged aluminosilicates were heated at different temperatures (500, 700, 900 and 1100 oC), and the materials were then treated with NaCl (1 M and 5 M) and HNO3 (0.001 M and 1 M) solutions to determine the leaching behaviour of cadmium from the materials. The stability of cadmium in the materials increased as the heating temperature was increased. Cadmium leaching from gamma irradiated and heated materials at 1100 oC was higher than leaching from non-irradiated samples

  11. Application of multiwalled carbon nanotubes treated by potassium permanganate for determination of trace cadmium prior to flame atomic absorption spectrometry

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    In this study we investigated the enrichment ability of oxidized multiwalled carbon nanotubes (MWCNTs) and established a new method for the determination of trace cadmium in environment with flame atomic absorption spectrometry. The MWCNTs were oxidized by potassium permanganate under appropriate conditions before use as preconcentration packing. Parameters influencing the recoveries of target analytes were optimized. Under optimal conditions, the target analyte exhibited a good linearity (R2=0.9992)over the concentration range 0.5-50 ng/ml. The detection limit and precision of the proposed method were 0.15 ng/ml and 2.06%,respectively. The proposed method was applied to the determination of cadmium in real-world environmental samples and the recoveries were in the range of 91.3%-108.0%. All these experimental results indicated that this new procedure could be applied to the determination of trace cadmium in environmental waters.

  12. Cadmium removal by Lemna minor and Spirodela polyrhiza.

    Science.gov (United States)

    Chaudhuri, Devaleena; Majumder, Arunabha; Misra, Amal K; Bandyopadhyay, Kaushik

    2014-01-01

    The present study investigates the ability of two genus of duckweed (Lemna minor and Spirodela polyrhiza) to phytoremediate cadmium from aqueous solution. Duckweed was exposed to six different cadmium concentrations, such as, 0.5,1.0,1.5, 2.0, 2.5, and 3.0 mg/L and the experiment was continued for 22 days. Water samples were collected periodically for estimation of residual cadmium content in aqueous solution. At the end of treatment period plant samples were collected and accumulated cadmium content was measured. Cadmium toxicity was observed through relative growth factor and changes in chlorophyll content Experimental results showed that Lemna minor and Spirodela polyrhiza were capable of removing 42-78% and 52-75% cadmium from media depending upon initial cadmium concentrations. Cadmium was removed following pseudo second order kinetic model Maximum cadmium accumulation in Lemna minor was 4734.56 mg/kg at 2 mg/L initial cadmium concentration and 7711.00 mg/kg in Spirodela polyrhiza at 3 mg/L initial cadmium concentration at the end of treatment period. Conversely in both cases maximum bioconcentration factor obtained at lowest initial cadmium concentrations, i.e., 0.5 mg/L, were 3295.61 and 4752.00 for Lemna minor and Spirodela polyrhiza respectively. The present study revealed that both Lemna minor and Spirodela polyrhiza was potential cadmium accumulator. PMID:24933906

  13. The WZNW model on PSU(1,1|2)

    CERN Document Server

    Götz, G; Schomerus, V; Gotz, Gerhard; Quella, Thomas; Schomerus, Volker

    2007-01-01

    According to the work of Berkovits, Vafa and Witten (hep-th/9902098), the non-linear sigma model on the supergroup PSU(1,1|2) is the essential building block for string theory on AdS(3)xS(3)xT(4). Models associated with a non-vanishing value of the RR flux can be obtained through a psu(1,1|2) invariant marginal deformation of the WZNW model on PSU(1,1|2). We take this as a motivation to present a manifestly psu(1,1|2) covariant construction of the model at the Wess-Zumino point, corresponding to a purely NSNS background 3-form flux. At this point the model possesses an enhanced psu(1,1|2) current algebra symmetry whose representation theory, including explicit character formulas, is developed systematically in the first part of the paper. The space of vertex operators and a free fermion representation for their correlation functions is our main subject in the second part. Contrary to a widespread claim, bosonic and fermionic fields are necessarily coupled to each other. The interaction changes the supersymmet...

  14. Radio emission variability and proper motions of WR 112

    CERN Document Server

    Yam, J O; Rodríguez, L F; Rodríguez-Gómez, V

    2014-01-01

    We analyzed 64 radio observations at the frequency of 8.4 GHz of the Wolf-Rayet star WR 112, taken from the Very Large Array archive. These observations cover a time baseline of 13 years, from June 2000 to July 2013. The radio structure of WR 112 is consistent with it being a point source in all the epochs and with its flux density varying from 0.6 mJy to 2.1 mJy. We tried to search for periodicities in these variations but our results were not conclusive. We also looked for extended emission from the infrared nebula that surrounds WR 112, settimg upper limits of 50 $\\mu$Jy. Finally, we used the highest angular resolution images to measure the proper motions of WR 112, obtaining $\\mu_\\alpha\\cos \\delta = -2.6 \\pm 1.1 \\mbox{ mas yr$^{-1}$}$, and $\\mu_\\delta = -5.4 \\pm 1.4 \\mbox{ mas yr$^{-1}$}$. These proper motions are smaller than those previously reported, but still suggest significant peculiar motions for WR 112.

  15. Tank characterization data report: Tank 241-C-112

    Energy Technology Data Exchange (ETDEWEB)

    Simpson, B.C.; Borsheim, G.L.; Jensen, L.

    1993-09-01

    Tank 241-C-112 is a Hanford Site Ferrocyanide Watch List tank that was most recently sampled in March 1992. Analyses of materials obtained from tank 241-C-112 were conducted to support the resolution of the Ferrocyanide Unreviewed Safety Question (USQ) and to support Hanford Federal Facility Agreement and Consent Order (Tri-Party Agreement) Milestone M-10-00. Analysis of core samples obtained from tank 241-C-112 strongly indicates that the fuel concentration in the tank waste will not support a propagating exothermic reaction. Analysis of the process history of the tank as well as studies of simulants provided valuable information about the physical and chemical condition of the waste. This information, in combination with the analysis of the tank waste, sup ports the conclusion that an exothermic reaction in tank 241-C-112 is not plausible. Therefore, the contents of tank 241-C-112 present no imminent threat to the workers at the Hanford Site, the public, or the environment from its forrocyanide inventory. Because an exothermic reaction is not credible, the consequences of this accident scenario, as promulgated by the General Accounting Office, are not applicable.

  16. Tank characterization data report: Tank 241-C-112

    International Nuclear Information System (INIS)

    Tank 241-C-112 is a Hanford Site Ferrocyanide Watch List tank that was most recently sampled in March 1992. Analyses of materials obtained from tank 241-C-112 were conducted to support the resolution of the Ferrocyanide Unreviewed Safety Question (USQ) and to support Hanford Federal Facility Agreement and Consent Order (Tri-Party Agreement) Milestone M-10-00. Analysis of core samples obtained from tank 241-C-112 strongly indicates that the fuel concentration in the tank waste will not support a propagating exothermic reaction. It is probable that tank 241-C-112 exceeds the 1,000 g-mol inventory criteria established for the Ferrocyanide USQ; however, extensive energetic analysis of the waste has determined a maximum exothermic value of -9 cal/g dry waste. This value is substantially below any levels of concern (-75 cal/g). In addition, an investigation of potential mechanisms to generate concentration levels of radionuclides high enough to be of concern was performed. No credible mechanism was postulated that could initiate the formation of such concentration levels in the tank. Tank 241-C-112 waste is a complex material made up primarily of water and inert salts. The insoluble solids are a mixture of phosphates, sulfates, and hydroxides in combination with aluminum, calcium, iron, nickel, and uranium. Disodium nickel ferrocyanide and sodium cesium nickel ferrocyanide probably exist in the tank; however, there appears to have been significant degradation of this material since the waste was initially settled in the tank

  17. Tank characterization data report: Tank 241-C-112

    International Nuclear Information System (INIS)

    Tank 241-C-112 is a Hanford Site Ferrocyanide Watch List tank that was most recently sampled in March 1992. Analyses of materials obtained from tank 241-C-112 were conducted to support the resolution of the Ferrocyanide Unreviewed Safety Question (USQ) and to support Hanford Federal Facility Agreement and Consent Order (Tri-Party Agreement) Milestone M-10-00. Analysis of core samples obtained from tank 241-C-112 strongly indicates that the fuel concentration in the tank waste will not support a propagating exothermic reaction. Analysis of the process history of the tank as well as studies of simulants provided valuable information about the physical and chemical condition of the waste. This information, in combination with the analysis of the tank waste, sup ports the conclusion that an exothermic reaction in tank 241-C-112 is not plausible. Therefore, the contents of tank 241-C-112 present no imminent threat to the workers at the Hanford Site, the public, or the environment from its forrocyanide inventory. Because an exothermic reaction is not credible, the consequences of this accident scenario, as promulgated by the General Accounting Office, are not applicable

  18. Cadmium exposure induces hematuria in Korean adults

    International Nuclear Information System (INIS)

    Introduction: Toxic heavy metals have adverse effects on human health. However, the risk of hematuria caused by heavy metal exposure has not been evaluated. Methods: Data from 4701 Korean adults were obtained in the Korean National Health and Nutritional Examination Survey (2008–2010). Blood levels of the toxic heavy metals cadmium, lead, and mercury were measured. Hematuria was defined as a result of ≥+1 on a urine dipstick test. The odds ratios (ORs) for hematuria were measured according to the blood heavy metal levels after adjusting for multiple variables. Results: Individuals with blood cadmium levels in the 3rd and 4th quartiles had a greater OR for hematuria than those in the 1st quartile group: 3rd quartile, 1.35 (1.019–1.777; P=0.037); 4th quartile, 1.52 (1.140–2.017; P=0.004). When blood cadmium was considered as a log-transformed continuous variable, the correlation between blood cadmium and hematuria was significant: OR, 1.97 (1.224–3.160; Ptrend=0.005). In contrast, no significant correlations between hematuria and blood lead or mercury were found in the multivariate analyses. Discussion: The present study shows that high cadmium exposure is associated with a risk of hematuria. -- Highlights: • A high level of blood cadmium is associated with a high risk of hematuria. • This correlation is independent of several confounding factors. • Blood levels of lead and mercury are not associated with risk of hematuria. • This is the first study on the correlation between cadmium exposure and hematuria risk

  19. Cadmium exposure induces hematuria in Korean adults

    Energy Technology Data Exchange (ETDEWEB)

    Han, Seung Seok [Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744 (Korea, Republic of); Kim, Myounghee, E-mail: dkkim73@gmail.com [Department of Dental Hygiene, College of Health Science, Eulji University, Gyeonggi-do 461-713 (Korea, Republic of); Lee, Su Mi [Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744 (Korea, Republic of); Lee, Jung Pyo [Department of Internal Medicine, Seoul National University Boramae Medical Center, Seoul 156-707 (Korea, Republic of); Kim, Sejoong [Department of Internal Medicine, Seoul National University Bundang Hospital, Gyeonggi-do 463-707 (Korea, Republic of); Joo, Kwon Wook [Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744 (Korea, Republic of); Lim, Chun Soo [Department of Internal Medicine, Seoul National University Boramae Medical Center, Seoul 156-707 (Korea, Republic of); Kim, Yon Su; Kim, Dong Ki [Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744 (Korea, Republic of)

    2013-07-15

    Introduction: Toxic heavy metals have adverse effects on human health. However, the risk of hematuria caused by heavy metal exposure has not been evaluated. Methods: Data from 4701 Korean adults were obtained in the Korean National Health and Nutritional Examination Survey (2008–2010). Blood levels of the toxic heavy metals cadmium, lead, and mercury were measured. Hematuria was defined as a result of ≥+1 on a urine dipstick test. The odds ratios (ORs) for hematuria were measured according to the blood heavy metal levels after adjusting for multiple variables. Results: Individuals with blood cadmium levels in the 3rd and 4th quartiles had a greater OR for hematuria than those in the 1st quartile group: 3rd quartile, 1.35 (1.019–1.777; P=0.037); 4th quartile, 1.52 (1.140–2.017; P=0.004). When blood cadmium was considered as a log-transformed continuous variable, the correlation between blood cadmium and hematuria was significant: OR, 1.97 (1.224–3.160; P{sub trend}=0.005). In contrast, no significant correlations between hematuria and blood lead or mercury were found in the multivariate analyses. Discussion: The present study shows that high cadmium exposure is associated with a risk of hematuria. -- Highlights: • A high level of blood cadmium is associated with a high risk of hematuria. • This correlation is independent of several confounding factors. • Blood levels of lead and mercury are not associated with risk of hematuria. • This is the first study on the correlation between cadmium exposure and hematuria risk.

  20. Hazards to wildlife from soil-borne cadmium reconsidered

    Science.gov (United States)

    Beyer, W.N.

    2000-01-01

    Cadmium is a toxic element that should be included in environmental risk assessments of contaminated soils. This paper argues, however, that hazards to wildlife from cadmium have often been overstated. The literature contains only meager evidence that wild animals have been seriously harmed by cadmium, even at severely contaminated sites. Although some researchers have reported that wildlife have accumulated concentrations of cadmium in their kidneys that were above suggested injury thresholds, the thresholds may be disputed, since they were well below the World Health Organization criterion of 200 mg/kg (wet weight) of cadmium in the renal cortex for protecting human health. Recent risk assessments have concluded that soil cadmium concentrations less than 1 mg/kg are toxic to soil organisms and wildlife, which implies that background concentrations of cadmium naturally found in soils are hazardous. An examination of the databases used to support these assessments suggested that the toxicity of cadmium has been exaggerated.

  1. Clinicopathologic features of 112 cases with mantle cell lymphoma

    Institute of Scientific and Technical Information of China (English)

    Dong-Mei Zhou; Gang Chen; Xiong-Wei Zheng; Wei-Feng Zhu; Bao-Zhen Chen

    2015-01-01

    Objective:hTis study aims to explore the clinicopathologic features of 112 patients with mantle cell lymphoma (MCL). Methods:Data from 112 MCL cases were collected, and immunohistochemical assay was conducted. Fluorescence in situ hybridization (FISH) detected a break in the CCND1 gene. hTe t-test was used in the statistical analysis. Results:All tumor cells in the 112 cases expressed B cell-related antigen, including 1 blastoid subtype and 1 polymorphic subtype. Among all cases, 106 expressed CD5 and 104 expressed cyclin D1. A break in the CCND1 gene was not found in 3 cases with CD5-MCL. IgH/CCND1 polyploid was observed in 2 classic cases. Conclusion:MCL is a type of special immunophenotypic B-cell lymphoma. hTe prognoses of blastoid and polymorphic subtypes are poor. Special subtypes should be classiifed during diagnosis.

  2. On the effect of thallium additions on cadmium amalgam potentials

    International Nuclear Information System (INIS)

    A study has been made of the influence of additives of thallium on potentials of cadmium amalgams with thallium contents of 10, 20, 30, and 40 at.% at 20, 40, 60, and 80 deg C. Additives of thallium have been found to shift the potential of cadmium amalgams towards the range of negative values which indicates an increase in the activity of cadmium. A possibility of calculation of the potential shift for heterogeneous cadmium amalgams on introducing thallium has been shown

  3. STS-112 M.S. Sellers suits up for launch

    Science.gov (United States)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. - During suitup for launch, STS-112 Mission Specialist Piers Sellers smiles in anticipation of his first Shuttle flight. STS-112 is the 15th assembly flight to the International Space Station, carrying the S1 Integrated Truss Structure and the Crew and Equipment Translation Aid (CETA) Cart A. The CETA is the first of two human-powered carts that will ride along the ISS railway, providing mobile work platforms for future spacewalking astronauts. On the 11-day mission, three spacewalks are planned to attach the S1 truss to the Station. Launch is scheduled for 3:46 p.m. EDT from Launch Pad 39B.

  4. Recycling of Spent Nickel-Cadmium Batteries

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    A technique for recycling spent nickel-cadmium batteries, which makes separation of cadmium and nickel possible, is developed by laboratory-scale experiments. NH3-H2CO3 aqueous solution was used in this leaching technique. Since neutralization and/or solvent extraction were not required in the separation procedure of nickel and cadmium, the closed systemization of the process becomes possible. Experimental results show that, (1) if the NH3 concentration of leaching solution is sufficiently high and the ratio of H2CO3 to NH3 is properly adjusted, both Ni(OH)2 and Cd(OH)2 react with NH3 and quickly dissolve into leaching solution, and (2) Ni(OH)2 can be converted into insoluble NiO by calcination at 500€癈, and CdO from Cd(OH)2 by calcination maintains good solubility in NH3-H2CO3 aqueous solution. As a conclusion, the recycling technique characterized by two step leaching can be developed based on such changes in dissolution behavior by calcination. Meanwhile, the yields of 99.8% for nickel and 97.6% for cadmium are obtained, and the purities of recovered nickel and cadmium are 99.9% and 98.6%, respectively.

  5. Effect of anions on Toxicity of Cadmium Applied to MIcrobial Biomass in Red Soil

    Institute of Scientific and Technical Information of China (English)

    K.S.KHAN; XIEZHENGMIAO; 等

    1997-01-01

    A laboratory incubation experiment was conducted to elucidat the effects of associated anions on toxicity of cadmium applied to microbial biomass in the red soil. Cadmium was applied at six different levels,i.e.,O(background),5,15,30,60 and 100μg g-1 soil in the form of either cadmium acetate or cadmium chloride. Application of cadmium as cadmium acetate markedly reduced the soil microbial biomass carbon compared to cadmium applied as cadmium chlorde at all the tested levels.Similarly,organic carbon to biomass carbon ration in the soil was markedly increased by increasing the level of the cadmium in the soil as cadmium acetate,while the change wa much smaller in the case of cadmium chloride at the same cadmium levels.The results suggested that due consideration should be given to the source of cadmium while deciding the cadmium levles in experiments.

  6. Cadmium induces cadmium-tolerant gene expression in the filamentous fungus Trichoderma harzianum.

    Science.gov (United States)

    Cacciola, Santa O; Puglisi, Ivana; Faedda, Roberto; Sanzaro, Vincenzo; Pane, Antonella; Lo Piero, Angela R; Evoli, Maria; Petrone, Goffredo

    2015-11-01

    The filamentous fungus Trichoderma harzianum, strain IMI 393899, was able to grow in the presence of the heavy metals cadmium and mercury. The main objective of this research was to study the molecular mechanisms underlying the tolerance of the fungus T. harzianum to cadmium. The suppression subtractive hybridization (SSH) method was used for the characterization of the genes of T. harzianum implicated in cadmium tolerance compared with those expressed in the response to the stress induced by mercury. Finally, the effects of cadmium exposure were also validated by measuring the expression levels of the putative genes coding for a glucose transporter, a plasma membrane ATPase, a Cd(2+)/Zn(2+) transporter protein and a two-component system sensor histidine kinase YcbA, by real-time-PCR. By using the aforementioned SSH strategy, it was possible to identify 108 differentially expressed genes of the strain IMI 393899 of T. harzianum grown in a mineral substrate with the addition of cadmium. The expressed sequence tags identified by SSH technique were encoding different genes that may be involved in different biological processes, including those associated to primary and secondary metabolism, intracellular transport, transcription factors, cell defence, signal transduction, DNA metabolism, cell growth and protein synthesis. Finally, the results show that in the mechanism of tolerance to cadmium a possible signal transduction pathway could activate a Cd(2+)/Zn(2+) transporter protein and/or a plasma membrane ATPase that could be involved in the compartmentalization of cadmium inside the cell. PMID:26349455

  7. Cadmium-113m as a biogeochemical tracer for cadmium in Lake Michigan

    International Nuclear Information System (INIS)

    The Lake Michigan watershed has been sampled for 113mCd. This long-lived metastable isotope of cadmium allowed independent evaluation of cadmium distribution in this dynamic ecosystem. 113mCd analysis was not hampered by contamination or loss. These are problems which have plagued stable cadmium measurements. Sensitivity and specificity were necessary concerns. 113mCd has been preconcentrated from large samples in order to obtain sufficient activity for quantification. Specificity for the gross beta activity measured was secured in a rigorous ion exchange decontamination. Confirmation of the suspected 113mCd beta source was checked by reverse tracer analysis and modified Feather analysis range-energy relationships. The 113mCd activities confirm the expected semiconservative behavior for cadmium. This behavior manifests itself in a long residence time for cadmium in Lake Michigan. The inefficiency of outflow removal, the low sedimentation rate and the unquantified sediment resuspension and release of cadmium are factors contributing to this residence time. Steady state concentration of cadmium in Lake Michigan will increase if present input rates persist

  8. Mitochondrial Toxicity of Cadmium Telluride Quantum Dot Nanoparticles in Mammalian Hepatocytes

    OpenAIRE

    Nguyen, Kathy C; Rippstein, Peter; Tayabali, Azam F.; Willmore, William G.

    2015-01-01

    There are an increasing number of studies indicating that mitochondria are relevant targets in nanomaterial-induced toxicity. However, the underlying mechanisms by which nanoparticles (NPs) interact with these organelles and affect their functions are unknown. The aim of this study was to investigate the effects of cadmium telluride quantum dot (CdTe-QD) NPs on mitochondria in human hepatocellular carcinoma HepG2 cells. CdTe-QD treatment resulted in the enlargement of mitochondria as examined...

  9. Study of direct and sequential break-up reactions in 6Li+ 112Sn system

    International Nuclear Information System (INIS)

    The 6Li projectile while moving in the field of a target nucleus can not only dissociate into α+d but it can also first exchange a few nucleon with the target and then break up into two fragments. Identification of all these processes is important to understand the break-up mechanism of 6Li projectile and also to find the origin of the high yield of alpha particle production in such a reaction. In this paper, we present the exclusive measurement of breakup cross sections in 6Li+112Sn reaction exploring the above possibilities. Cross sections for both sequential as well as direct breakup are measured and compared with the theoretical calculations. The measured elastic scattering angular distributions were used as a constraint to the potential parameters that were used in the calculations to explain both elastic scattering and the breakup processes simultaneously

  10. Reduction of Cadmium Uptake of Rice Plants Using Soil Amendments in High Cadmium Contaminated Soil: A Pot Experiment

    Directory of Open Access Journals (Sweden)

    Dian Siswanto

    2013-05-01

    Full Text Available The aims of this study were to investigate the effect of agricultural residues on reducing cadmium uptake in rice plants. The rice plants growing on no cadmium/free cadmium soils (N, Cd soils (Cds, and Cd soils each amended with 1% w/w of coir pith (CP, coir pith modified with sodium hydroxide (CPm and corncob (CC under high cadmium contaminated soil with an average 145 mg Cd kg-1 soil were investigated. The results showed that the cumulative transpiration of rice grown in various treatments under high cadmium contaminated soil followed the order: Cds > CPm ≥ CP ≥ CC. These transpirations directly influenced cadmium accumulation in shoots and husks of rice plants. The CC and CP seemed to work to reduce the cadmium uptake by rice plants indicated by accumulated cadmium in the husk that were 2.47 and 7.38 mg Cd kg-1 dry weight, respectively. Overall, transpiration tended to drive cadmium accumulation in plants for rice grown in high cadmium contaminated soil. The more that plants uptake cadmium, the lower cadmium that remains in the soil.

  11. Bireactor Electronuclear Systems with Liquid Cadmium Valve

    CERN Document Server

    Bznuni, S A; Zhamkochyan, V M; ASosnin, A N; Polanski, A; Khudaverdyan, A H

    2002-01-01

    Three main types of bireactor electronuclear systems are discussed. From the point of view of assuring high level of functional characteristics and safety bireactor electronuclear systems with booster using enriched uranium (20 %) and with a liquid cadmium valve appears to be the most effective. It is shown by means of Monte-Carlo modeling that such operation conditions can be achieved which lead to the destruction of the intermediate cadmium layer making the systems supercritical (k_{eff}>1). One can avoid the problem by using a special design of the liquid cadmium valve. In comparison with other nuclear systems (critical reactors, one-reactor electronuclear systems) cascade electronuclear systems have essential advantages allowing the decrease of the proton beam current by one order of magnitude and providing at same time the necessary level of power generation and neutron flux. Availability of both the thermal and fast cones allows one to transmute not only transuranics but also the fission products - cesi...

  12. ELECTROKINETIC REMEDIATION STUDY FOR CADMIUM CONTAMINATED SOIL

    Directory of Open Access Journals (Sweden)

    P. Bala Ramudu

    2007-09-01

    Full Text Available This paper presents the results of an experimental research undertaken to evaluate different purging solutions to enhance the removal of cadmium from spiked contaminated field soil by electrokinetic remediation. Three experiments were conducted when soil was saturated with deionised water and subsequently deionised water, ammonium citrate and sodium citrate were used as purging solutions at anode end. One experiment was conducted when the soil was saturated with ammonium citrate and itself was used as the purging solution. Results showed that 49% reduction of cadmium concentration was achieved in the case of soil saturated (washed with ammonium citrate as well as purging solution also was ammonium citrate. The soil pH and washing solutions were the most important factors in controlling the removal of cadmium in electrokinetic remediation process.

  13. 13 CFR 112.4 - Discrimination in employment.

    Science.gov (United States)

    2010-01-01

    ....4 Section 112.4 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NONDISCRIMINATION IN... Discrimination in employment. Small business concerns and development companies which apply for or receive any... employment practices of the recipient or other persons subject to the regulation tends, on the grounds...

  14. 14 CFR 1214.112 - Patent, data and information matters.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Patent, data and information matters. 1214... Customers § 1214.112 Patent, data and information matters. (a) Patent and data rights. NASA will not acquire rights to inventions, patents or proprietary data which may be used in, or arise from, activities...

  15. 40 CFR 51.112 - Demonstration of adequacy.

    Science.gov (United States)

    2010-07-01

    ... REQUIREMENTS FOR PREPARATION, ADOPTION, AND SUBMITTAL OF IMPLEMENTATION PLANS Control Strategy § 51.112... implements. (1) The adequacy of a control strategy shall be demonstrated by means of applicable air quality... substitution of a model may be made on a case-by-case basis or, where appropriate, on a generic basis for...

  16. 47 CFR 68.112 - Hearing aid-compatibility.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 3 2010-10-01 2010-10-01 false Hearing aid-compatibility. 68.112 Section 68... Hearing aid-compatibility. (a) Coin telephones. All new and existing coin-operated telephones, whether... work stations and mail rooms. Such non-common area telephones are required to be hearing aid...

  17. 38 CFR 75.112 - Definitions and terms.

    Science.gov (United States)

    2010-07-01

    ...) INFORMATION SECURITY MATTERS Data Breaches § 75.112 Definitions and terms. For purposes of this subpart... personal privacy and proprietary information. Data breach means the loss or theft of, or other unauthorized... if a data breach has resulted in the misuse of sensitive personal information. Fraud...

  18. 5 CFR 550.112 - Computation of overtime work.

    Science.gov (United States)

    2010-01-01

    ... by the General Services Administration (41 CFR 300-3.1); and (2) Travel from home to work and vice... ADMINISTRATION (GENERAL) Premium Pay Overtime Pay § 550.112 Computation of overtime work. The computation of the... overtime pay purposes the total number of hours of work in an administrative workweek. (g) Time in...

  19. Teeme lumele hädaabinumbri 112 / Edvi Freiberg

    Index Scriptorium Estoniae

    Freiberg, Edvi, 1953-

    2012-01-01

    Häirekeskus koostöös Tallinna Nurmenuku lasteaiaga kutsuvad kõiki lasteaedu ja koole tegema 6.–11. veebruarini oma õuele lumest või lumele hädaabinumbri 112, et meenutada, millisele numbrile saab hädaabi vajaduse korral helistada kogu Euroopas

  20. 40 CFR 265.112 - Closure plan; amendment of plan.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Closure plan; amendment of plan. 265... DISPOSAL FACILITIES Closure and Post-Closure § 265.112 Closure plan; amendment of plan. (a) Written plan... have a written closure plan. Until final closure is completed and certified in accordance with §...

  1. 40 CFR 264.112 - Closure plan; amendment of plan.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Closure plan; amendment of plan. 264... Closure and Post-Closure § 264.112 Closure plan; amendment of plan. (a) Written plan. (1) The owner or operator of a hazardous waste management facility must have a written closure plan. In addition,...

  2. 40 CFR 280.112 - Drawing on financial assurance mechanisms.

    Science.gov (United States)

    2010-07-01

    ... required under 40 CFR part 280, subpart F; or (2) The Director has received either: (i) Certification from... 40 Protection of Environment 26 2010-07-01 2010-07-01 false Drawing on financial assurance... OF UNDERGROUND STORAGE TANKS (UST) Financial Responsibility § 280.112 Drawing on financial...

  3. 45 CFR 1706.112-1706.129 - [Reserved

    Science.gov (United States)

    2010-10-01

    ... Welfare Regulations Relating to Public Welfare (Continued) NATIONAL COMMISSION ON LIBRARIES AND INFORMATION SCIENCE ENFORCEMENT OF NONDISCRIMINATION ON THE BASIS OF HANDICAP IN PROGRAMS OR ACTIVITIES CONDUCTED BY NATIONAL COMMISSION ON LIBRARIES AND INFORMATION SCIENCE §§ 1706.112-1706.129...

  4. 40 CFR 98.112 - GHGs to report.

    Science.gov (United States)

    2010-07-01

    ... Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) MANDATORY GREENHOUSE GAS REPORTING Ferroalloy Production § 98.112 GHGs to report. You must report: (a) Process CO2 emissions from each electric arc furnace (EAF) used for the production of any ferroalloy listed in §...

  5. 41 CFR 101-25.112 - Energy conservation policy.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Energy conservation...-General Policies § 101-25.112 Energy conservation policy. (a) Agency officials responsible for procurement..., which has been established pursuant to Public Law 94-163, Energy Policy and Conservation Act. (b)...

  6. 42 CFR 401.112 - Availability of administrative staff manuals.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 2 2010-10-01 2010-10-01 false Availability of administrative staff manuals. 401... § 401.112 Availability of administrative staff manuals. All CMS administrative staff manuals and... Rulings. These manuals are generally not printed in a sufficient quantity to permit sale or other...

  7. 20 CFR 653.112 - State agency program budget plans.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false State agency program budget plans. 653.112... State agency program budget plans. (a) Each State agency, in its annual program budget plan, shall..., respectively. For significant MSFW States, ETA shall establish program performance indicators reflecting...

  8. 42 CFR 422.112 - Access to services.

    Science.gov (United States)

    2010-10-01

    ... Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICARE PROGRAM MEDICARE ADVANTAGE PROGRAM Benefits and Beneficiary Protections § 422.112 Access to... Medicare enrollee, are available and accessible under the plan. To accomplish this, the MA...

  9. 42 CFR 411.112 - Documentation of conformance.

    Science.gov (United States)

    2010-10-01

    ....112 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES MEDICARE PROGRAM EXCLUSIONS FROM MEDICARE AND LIMITATIONS ON MEDICARE PAYMENT Limitations on Payment for... coverage, benefit levels and limitations with respect to persons entitled to Medicare on the basis of...

  10. 28 CFR 46.112 - Review by institution.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Review by institution. 46.112 Section 46... Review by institution. Research covered by this policy that has been approved by an IRB may be subject to further appropriate review and approval or disapproval by officials of the institution. However,...

  11. 40 CFR 26.112 - Review by institution.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Review by institution. 26.112 Section... Review by institution. Research covered by this policy that has been approved by an IRB may be subject to further appropriate review and approval or disapproval by officials of the institution. However,...

  12. 15 CFR 930.112 - Request for Secretarial mediation.

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 3 2010-01-01 2010-01-01 false Request for Secretarial mediation. 930... RESOURCE MANAGEMENT FEDERAL CONSISTENCY WITH APPROVED COASTAL MANAGEMENT PROGRAMS Secretarial Mediation § 930.112 Request for Secretarial mediation. (a) The Secretary or other head of a Federal agency, or...

  13. MN112: a new Galactic candidate Luminous Blue Variable

    CERN Document Server

    Gvaramadze, V V; Fabrika, S; Sholukhova, O; Berdnikov, L N; Cherepashchuk, A M; Zharova, A V

    2009-01-01

    We report the discovery of a new Galactic candidate Luminous Blue Variable (cLBV) via detection of an infrared circular nebula and follow-up spectroscopy of its central star. The nebula, MN112, is one of many dozens of circular nebulae detected at 24 $\\mu$m the Spitzer Space Telescope archival data, whose morphology is similar to that of nebulae associated with known (c)LBVs and related evolved massive stars. Specifically, the core-halo morphology of MN112 bears a striking resemblance to the circumstellar nebula associated with the Galactic cLBV GAL 079.29+00.46, which suggests that both nebulae might have a similar origin and that the central star of MN112 is a LBV. The spectroscopy of the central star showed that its spectrum is almost identical to that of the bona fide LBV P Cygni, which also supports the LBV classification of the object. To further constrain the nature of MN112, we searched for signatures of possible high-amplitude ($\\ga 1$ mag) photometric variability of the central star using archival a...

  14. 25 CFR 900.112 - What are construction phases?

    Science.gov (United States)

    2010-04-01

    ... is explained in more detail in § 900.122; (2) The planning phase. The phase during which planning... investigation and selection activities are completed in this phase if not conducted as part of the planning... 25 Indians 2 2010-04-01 2010-04-01 false What are construction phases? 900.112 Section...

  15. Genetics Home Reference: 22q11.2 deletion syndrome

    Science.gov (United States)

    ... Seattle, Washington Children's Hospital of Philadelphia Cincinnati Children's Hospital Medical Center Disease InfoSearch: 22q11.2 Deletion Syndrome Emory University School of Medicine Genetics Education Materials for School Success (GEMSS) MalaCards: chromosome 22q11. ...

  16. 40 CFR 1033.112 - Emission diagnostics for SCR systems.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 32 2010-07-01 2010-07-01 false Emission diagnostics for SCR systems....112 Emission diagnostics for SCR systems. Engines equipped with SCR systems using separate reductant.... This section does not apply for SCR systems using the engine's fuel as the reductant. (a)...

  17. Increased cadmium and lead uptake of a cadmium hyperaccumulator tomato by cadmium-resistant bacteria.

    Science.gov (United States)

    He, Lin-Yan; Chen, Zhao-Jin; Ren, Gai-Di; Zhang, Yan-Feng; Qian, Meng; Sheng, Xia-Fang

    2009-07-01

    Two cadmium (Cd)-resistant strains Pseudomonas sp. RJ10 and Bacillus sp. RJ16 were investigated for their effects on the soil Cd and lead (Pb) solubilization and promotion of plant growth and Cd and Pb uptakes of a Cd-hyperaccumulator tomato. In the heavy metal-contaminated inoculated soil, the CaCl(2)-extractable Cd and Pb were increased by 58-104% and 67-93%, respectively, compared to the uninoculation control. The bacteria produced indole acetic acid, siderophore and 1-aminocyclopropane-1-carboxylate deaminase. Root elongation assay conducted on tomato under gnotobiotic conditions demonstrated increase in root elongation of inoculated tomato seedlings compared to the control plants. An increase in Cd and Pb contents of above-ground tissues varied from 92% to 113% and from 73% to 79% in inoculated plants growing in heavy metal-contaminated soil compared to the uninoculation control, respectively. These results show that the bacteria could be exploited for bacteria enhanced-phytoextraction of Cd- and Pb-polluted soils. PMID:19368973

  18. Treatment of cadmium dust with two-stage leaching process

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    The treatment of cadmium dust with a two-stage leaching process was investigated to replace the existing sulphation roast-leaching processes. The process parameters in the first stage leaching were basically similar to the neutralleaching in zinc hydrometallurgy. The effects of process parameters in the second stage leaching on the extraction of zincand cadmium were mainly studied. The experimental results indicated that zinc and cadmium could be efficiently recoveredfrom the cadmium dust by two-stage leaching process. The extraction percentages of zinc and cadmium in two stage leach-ing reached 95% and 88% respectively under the optimum conditions. The total extraction percentage of Zn and Cdreached 94%.

  19. Cadmium toxicity in the free-living nematode, Caenorhabditis elegans

    Energy Technology Data Exchange (ETDEWEB)

    Popham, J.D.; Webster, J.M.

    1979-10-01

    The effect of cadmium on the fecundity, growth, and fine structure of the free-living nematode Caenorhabditis elegans was studied. High concentrations of cadmium significantly decreased the fecundity and growth of these organisms. Electron microscopy showed that cadmium modifies the structure of the mitochondria in the esophagus and intestine, causes the formation of inclusion bodies in the nucleus of esophageal cells, and alters the morphology of cytosomes in the intestinal cells. The results suggest that the decreased fecundity and growth of cadmium-exposed C. elegans may be due to cadmium interfering with nutrient uptake or assimilation or both.

  20. Thermodynamic properties of cadmium in lead amalgam dilute solution

    International Nuclear Information System (INIS)

    Investigation of thermodynamic properties of cadmium dilute solutions in lead amalgam is carried out by means of electromotive force technique within 453-523 K temperature range. Cadmium thermodynamic functions are calculated: activity, activity ratio, Libbs partial energy and its excess value and integral characteristics, respectively. When changing cadmium content from 0.01 up to 0.1 χcd at T=473 K, logarithm of activity ratio does not depend on alloy composition, that is, Heury's law is fulfilled. Increase of cadmium content in amalgam results in the essential reduction of mercury and cadmium reaction

  1. Urinary excretion of cadmium and zinc among persons from Sweden

    Energy Technology Data Exchange (ETDEWEB)

    Elinder, C.G.; Kjellstrom, T.; Linnman, L.; Pershagen, G.

    1978-06-01

    Cadmium and zinc concentrations in the urine of 132 Swedes, including 50 pairs of identical twins, were measured. Atomic absorption spectrophotometry procedures were developed for the analysis. Cadmium concentration increased with age and was higher among smokers than among nonsmokers. Estimated 24-hr excretion of cadmium among nonsmokers increased from about 0.25 to 0.40 ..mu..g in persons from 20 to 70 years old. The 24-hr cadmium excretions among nonsmokers in different age-groups fitted better to total kidney burden than to daily cadmium intake from food. Zinc excretion, on the other hand, decreased after the age of 20.

  2. Effects of pollution on lead and cadmium concentration and correlation with biochemical parameters in blood of human population nearby Kosovo thermo power plants

    Directory of Open Access Journals (Sweden)

    L. Zeneli

    2008-01-01

    Full Text Available This study describes an investigation of lead and cadmium pollution of Kosovo environment as a result of outflow from the coal processing industry. In a comparative study of lead and cadmium concentration in blood of human population of two different environments in Kosovo, one nearby Kosovo Thermo Power Plants, (Obiliq a highly polluted environment and the other that is considered as relatively clean rural environment (Dragash. Analysis has shown that emission of particulate in fly ash from Thermo Power Plants during 2005 has exceeded EU standards by 400-500% and that lead concentration was 18mg kg-1 and cadmium concentration was -1 of ash. A series of determinations of lead and cadmium concentrations in blood of population that lives in this environment, have shown direct effects in biochemical parameters CRE (Creatinin, DB (Direct Bilirubine, TB (Total Bilirubine, AST (Aspartat Aminotransferaza, CK (Creatin Kinaza and CHE (Cholenisteraza in human organism. The results that were achieved in this study showed a significant difference in average lead and cadmium concentration in the blood of the investigated group of peoples that lives in the area near by the Power Plants, from a control group that lives in a rural unpolluted environment. Lead and cadmium has been analyzed in 50 samples taken from persons from industrial zone and 25 samples in controlled group. The level of lead concentration was 23.0-112.1 µg L-1in geometric average 46.05 µg L-1, cadmium concentration was 0.44-6.02 µg L-1 in geometric average of 1.56µg L-1. Controlled group from the rural relatively clean environment showed lead concentration of 6.7-33.8 µg L-1 in geometric avarage 17.76 µg L-1 and cadmium concentration of 0.21-1.8 µg L-1 or in geometric average of 0.73 µg L-1. In conclusion in exposed subjects, pollution from coal burning in Power Plant is very important factor for level of lead and cadmium concentration in blood of tested population.

  3. Cadmium telluride quantum dots advances and applications

    CERN Document Server

    Donegan, John

    2013-01-01

    Optical Properties of Bulk and Nanocrystalline Cadmium Telluride, Núñez Fernández and M.I. VasilevskiyAqueous Synthesis of Colloidal CdTe Nanocrystals, V. Lesnyak, N. Gaponik, and A. EychmüllerAssemblies of Thiol-Capped CdTe Nanocrystals, N. GaponikFörster Resonant Energy Transfer in CdTe Nanocrystal Quantum Dot Structures, M. Lunz and A.L. BradleyEmission of CdTe Nanocrystals Coupled to Microcavities, Y.P. Rakovich and J.F. DoneganBiological Applications of Cadmium Telluride Semiconductor Quantum Dots, A. Le Cign

  4. Elektrokemisk fjernelse af cadmium fra bioasker

    DEFF Research Database (Denmark)

    Pedersen, Anne Juul; Ottosen, Lisbeth M.; Simonsen, Peter;

    Posteren viser resultater fra elektrokemiske rensningsforsøg på bioasker udført i forbindelse med PSO projekt 5205 "Elektrokemisk fjernelse af cadmium fra bioasker i pilotskala og vurdering af mulighederne for nyttiggørelse af behandlet aske i beton".......Posteren viser resultater fra elektrokemiske rensningsforsøg på bioasker udført i forbindelse med PSO projekt 5205 "Elektrokemisk fjernelse af cadmium fra bioasker i pilotskala og vurdering af mulighederne for nyttiggørelse af behandlet aske i beton"....

  5. Cadmium exposure and pancreatic cancer in south Louisiana.

    Science.gov (United States)

    Luckett, Brian G; Su, L Joseph; Rood, Jennifer C; Fontham, Elizabeth T H

    2012-01-01

    Cadmium has been hypothesized to be a pancreatic carcinogen. We test the hypothesis that cadmium exposure is a risk factor for pancreatic cancer with a population-based case-control study sampled from a population with persistently high rates of pancreatic cancer (south Louisiana). We tested potential dietary and nondietary sources of cadmium for their association with urinary cadmium concentrations which reflect long-term exposure to cadmium due to the accumulation of cadmium in the kidney cortex. Increasing urinary cadmium concentrations were significantly associated with an increasing risk of pancreatic cancer (2nd quartile OR = 3.34, 3rd = 5.58, 4th = 7.70; test for trend P ≤ 0.0001). Potential sources of cadmium exposure, as documented in the scientific literature, found to be statistically significantly associated with increased risk of pancreatic cancer included working as a plumber, pipefitter or welder (OR = 5.88) and high consumption levels of red meat (4th quartile OR = 6.18) and grains (4th quartile OR = 3.38). Current cigarette smoking, at least 80 pack years of smoking, occupational exposure to cadmium and paints, working in a shipyard, and high consumption of grains were found to be statistically significantly associated with increased concentrations of urinary cadmium. This study provides epidemiologic evidence that cadmium is a potential human pancreatic carcinogen. PMID:23319964

  6. Cadmium Exposure and Pancreatic Cancer in South Louisiana

    Directory of Open Access Journals (Sweden)

    Brian G. Luckett

    2012-01-01

    Full Text Available Cadmium has been hypothesized to be a pancreatic carcinogen. We test the hypothesis that cadmium exposure is a risk factor for pancreatic cancer with a population-based case-control study sampled from a population with persistently high rates of pancreatic cancer (south Louisiana. We tested potential dietary and nondietary sources of cadmium for their association with urinary cadmium concentrations which reflect long-term exposure to cadmium due to the accumulation of cadmium in the kidney cortex. Increasing urinary cadmium concentrations were significantly associated with an increasing risk of pancreatic cancer (2nd quartile OR = 3.34, 3rd = 5.58, 4th = 7.70; test for trend P≤0.0001. Potential sources of cadmium exposure, as documented in the scientific literature, found to be statistically significantly associated with increased risk of pancreatic cancer included working as a plumber, pipefitter or welder (OR = 5.88 and high consumption levels of red meat (4th quartile OR = 6.18 and grains (4th quartile OR = 3.38. Current cigarette smoking, at least 80 pack years of smoking, occupational exposure to cadmium and paints, working in a shipyard, and high consumption of grains were found to be statistically significantly associated with increased concentrations of urinary cadmium. This study provides epidemiologic evidence that cadmium is a potential human pancreatic carcinogen.

  7. Isospin effects on two-particle correlation functions in E/A=61 MeV Ar-36+Sn-112,Sn-124 reactions

    NARCIS (Netherlands)

    Ghetti, R; Avdeichikov, [No Value; Jakobsson, B; Golubev, P; Helgesson, J; Colonna, N; Tagliente, G; Wilschut, HW; Kopecky, S; Kravchuk, VL; Anderson, EW; Nadel-Turonski, P; Westerberg, L; Bellini, [No Value; Sperduto, ML; Sutera, C

    2004-01-01

    Small-angle, two-particle correlation functions have been measured for Ar-36+Sn-112,Sn-124 collisions at E/A=61 MeV. Total momentum gated neutron-proton (np) and proton-proton (pp) correlations are stronger for the Sn-124 target. Some of the correlation functions for particle pairs involving deutero

  8. Study of cadmium electrochemical deposition in sulfate medium

    Energy Technology Data Exchange (ETDEWEB)

    Montiel, T.; Solorza, O.; Sanchez, H.

    2000-03-01

    The cadmium electrochemical deposition process from sulfate medium was studied by means of different electrochemical techniques in both stationary and nonstationary diffusion regimes. The kinetics of the electrochemical reduction of cadmium on solid cadmium electrodes was examined and the kinetic parameters are presented, as well as the diffusion coefficient derived from the different techniques. Temperature has an important effect on the cadmium reduction kinetics, and the activation energy of the process was evaluated. The electrochemical deposition of cadmium is a complex process due to the coexistence of adsorption and nucleation processes; the adsorbed electroactive species appears to be Cd{sup +2}, and a mechanism for cadmium electrodeposition on solid cadmium electrodes is proposed.

  9. Murine strain differences and the effects of zinc on cadmium concentrations in tissues after acute cadmium exposure

    Energy Technology Data Exchange (ETDEWEB)

    King, L.M. [ARS USDA, Germplasm and Gamete Physiology Lab., Beltsville, MD (United States); Anderson, M.B. [Dept. of Anatomy, Tulane Univ. School of Medicine, New Orleans, LA (United States); Sikka, S.C. [Dept. of Urology, Tulane Univ. School of Medicine, New Orleans, LA (United States); George, W.J. [Dept. of Pharmacology, Tulane Univ. School of Medicine, New Orleans, LA (United States)

    1998-10-01

    The role of strain differences in cadmium tissue distribution was studied using sensitive (129/J) and resistant (A/J) mice. These murine strains have previously been shown to differ in their susceptibility to cadmium-induced testicular toxicity. Cadmium concentration was measured in testis, epididymis, seminal vesicle, liver, and kidney at 24 h after cadmium chloride exposure (4, 10, and 20 {mu}mol/kg CdCl{sub 2}). The 129/J mice exhibited a significant increase in cadmium concentration in testis, epididymis, and seminal vesicle at all cadmium doses used, compared to A/J mice. However, cadmium concentrations in liver and kidney were not different between the strains, at any dose, indicating that cadmium uptake is similar in these organs at 24 h. These murine strains demonstrate similar hepatic and renal cadmium uptake but significantly different cadmium accumulation in the reproductive organs at 24 h. The mechanism of the protective effect of zinc on cadmium toxicity was studied by assessing the impact of zinc acetate (ZnAc) treatment on cadmium concentrations in 129/J mice after 24 h. Zinc pretreatment (250 {mu}mol/kg ZnAc), given 24 h prior to 20 {mu}mol/kg CdCl{sub 2} administration, significantly decreased the amount of cadmium in the testis, epididymis, and seminal vesicle of 129/J mice, and significantly increased the cadmium content of the liver after 24 h. Cadmium levels in the kidney were unaffected at this time. Zinc pretreatment also prevented the cadmium-induced decrease in testicular sperm concentration and epididymal sperm motility seen in 129/J mice. These findings suggest that the differences in the two murine strains may be attributed partly to the differential accumulation of cadmium in murine gonads. This may be caused by strain differences in the specificity of cadmium transport mechanisms. The protective role of zinc in cadmium-induced testicular toxicity in the sensitive strain may be due to an interference in the cadmium uptake by susceptible

  10. Micronutrient Cadmium in the Oceans, Distribution and Stable Isotope Fractionation

    Science.gov (United States)

    Abouchami, W.; Galer, S. J.; Feldmann, H.; Andreae, M. O.; de Baar, H.; Middag, R.; Klunder, M.; Laan, P.

    2012-12-01

    the vertical distribution of Cd concentration and isotope ratios in the water column, as these reflect the combined effects of physical, chemical, and biological processes that control the export of carbon to the deep ocean. Cadmium concentration depth profiles show typical nutrient-like distributions with differences in the Cd-maxima depths, consistent with those of phosphate and reveal changes in the depth of re-mineralization of Cd and PO4 across the Antarctic. A strong surface-to-depth isotope gradient is seen in all profiles with high ɛ112/110Cd values in the mixed layer of up to +4.5 and low values of about +1.2, identifying deep Antarctic waters with a Cd-light isotope signature. The depth zone of maximum changes in Cd concentration and ɛ112/110Cd values coincide with that of the apparent oxygen utilization, a tracer of carbon export, demonstrating the role of Cd as an important nutrient for marine ecosystems. Examination of property-property co-variations provide new insights into the cycling of Cd and other trace metals which will be discussed, with emphasis on the significance of the global oceanic Cd-phosphate correlation and use and pitfalls of Cd isotopes as tracer of past changes in the strength of the biological carbon pump and the thermohaline circulation. [1] Boyle et al. (1976), Nature 263, 42-44. [2] Bruland (1980), EPSL, 47, 176-198. [3] Abouchami et al. (2011), EPSL 305, 83-91.

  11. Effects of bacteria on cadmium bioaccumulation in the cadmium hyperaccumulator plant Beta vulgaris var. cicla L.

    Science.gov (United States)

    Chen, Su; Chao, Lei; Sun, Lina; Sun, Tieheng

    2013-01-01

    To investigate the effects of two cadmium-tolerant bacteria, Staphylococcus pasteuri (S. pasteuri X1) and Agrobacterium tumefaciens (A. tumefaciens X2), on cadmium uptake by the cadmium hyperaccumulator plant Beta vulgaris var. cicla L., a pot experiment with artificially contaminated soil was conducted. The results demonstrated that both cadmium-tolerant bacteria enhanced the dry weight of Beta vulgaris var. cicla L. The total dry weights of plants in the control CK20, S. pasteuri X1 and A. tumefaciens X2 treatments were 0.85, 1.13, and 1.38 g/pot, respectively. Compared with the control CK20 findings, the total dry weight of plants was increased by 32.8 and 61.1% after inoculation with S. pasteuri X1 and A. tumefaciens X2, respectively, indicating that A. tumefaciens X2 more strongly promoted the growth of Beta vulgaris var. cicla L. than S. pasteuri X1. In addition, inoculation with S. pasteuri X1 and A. tumefaciens X2 significantly (p < 0.05) promoted cadmium uptake by plants and improved the bioaccumulation of cadmium by the plants from the soil. Moreover, the inoculation of S. pasteuri X1 and A. tumefaciens X2 effectively facilitated the transfer of cadmium in the soil from the Fe-Mn oxide and residual fractions to the soluble plus exchangeable and weakly specially adsorbed fractions in the rhizosphere soils of plants. The bacterial enhancement of cadmium phytoavailability might provide a potential and promising method to increase the efficiency of phytoextraction. PMID:23488173

  12. CADMIUM EXPOSURE VIA FOOD CROPS: A CASE STUDY OF INTENSIVE FARMING AREA

    Directory of Open Access Journals (Sweden)

    Raagheni Munisamy

    2013-01-01

    Full Text Available Cadmium (Cd is ubiquitous in environment and may enter food chain through intense application of phosphate fertilizers to agricultural crops. A cross-sectional study was conducted at Kuala Terla and Blue Valley farming villages, Cameron Highlands to determine cadmium concentration in vegetables and soil and to determine the health risks among respondents. A total of 87 respondents were selected based on inclusive and exclusive criteria. A set of pre-tested questionnaires utilized to obtain socio-demographic information and to predict health risks faced by the respondents based on their vegetable ingestion rate. The Average Daily Dose (ADD and Target Hazard Quotient (THQ were determined in this study. Convenient sampling method was employed to obtain 15 paired soil and vegetable samples. Cadmium concentration in the samples was acid digested prior analysis using Flame Atomic Absorption Spectrophotometer (FAAS. The mean ± standard deviation concentrations of Cd in vegetable samples were 0.13±0.082 mg kg-1, within the acceptable range specified by Malaysia Food Regulation 1985 (1 mg kg-1. For sol samples, the mean ± standard deviation concentration of Cd was 2.78±2.83 mg kg-1. Eight out of 11 soil samples exceed the permissible limit of Cd outlined by The Dutch Standard (1 mg kg-1. The findings on THQ demonstrated that all respondents are within the acceptable non-carcinogenic health risk (THQ<1. The results also exhibit that there is no correlation between cadmium in soils and vegetables. There are unlikely potential adverse health impacts arising from Cd through vegetables consumption in this study. Respondents are advised to have a medical check-up in order to determine Cd body burden thus eliminating the risks of acquiring cadmium related diseases.

  13. Urinary cadmium and estimated dietary cadmium in the Women's Health Initiative.

    Science.gov (United States)

    Quraishi, Sabah M; Adams, Scott V; Shafer, Martin; Meliker, Jaymie R; Li, Wenjun; Luo, Juhua; Neuhouser, Marian L; Newcomb, Polly A

    2016-01-01

    Cadmium, a heavy metal dispersed in the environment as a result of industrial and agricultural applications, has been implicated in several human diseases including renal disease, cancers, and compromised bone health. In the general population, the predominant sources of cadmium exposure are tobacco and diet. Urinary cadmium (uCd) reflects long-term exposure and has been frequently used to assess cadmium exposure in epidemiological studies; estimated dietary intake of cadmium (dCd) has also been used in several studies. The validity of dCd in comparison with uCd is unclear. This study aimed to compare dCd, estimated from food frequency questionnaires, to uCd measured in spot urine samples from 1,002 participants of the Women's Health Initiative. Using linear regression, we found that dCd was not statistically significantly associated with uCd (β=0.006, P-value=0.14). When stratified by smoking status, dCd was not significantly associated with uCd both in never smokers (β=0.006, P-value=0.09) and in ever smokers (β=0.003, P-value=0.67). Our results suggest that because of the lack of association between estimated dCd and measured uCd, dietary estimation of cadmium exposure should be used with caution in epidemiologic studies.

  14. RISK ASSESSMENT FOR CADMIUM IN PHOSPHATE FERTILIZERS

    Science.gov (United States)

    Cadmium induced renal tubular dysfunction occurred where subsistence rice farmers produced their lifetime dietary rice on Zn-mine waste contaminated soils in Japan and other Asian countries. Research has shown that polished rice Cd is greatly increased while grain Zn is not incre...

  15. Field scale behaviour of cadmium in soil.

    NARCIS (Netherlands)

    Boekhold, A.E.

    1992-01-01

    Although total heavy metal contents of soil are often used to express the degree of contamination, they are of little value to judge environmental effects. The main objective of this thesis was to develop and test methodologies with which environmental risks of cadmium pollution of field soils can b

  16. Mobiliteit van cadmium in de bodem

    NARCIS (Netherlands)

    Chardon, W.J.

    1984-01-01

    The adsorption of cadmium by twelve Dutch soils was investigated under widely varying circumstances. The adsorption can be described with the Freundlich equation; the parameters of this equation can be predicted using the properties of the soil (pH, organic carbon and clay content).The adsorption ap

  17. Cadmium isotope variations in the Southern Ocean

    NARCIS (Netherlands)

    Xue, Z.; Rehkämper, M.; Horner, T.J.; Abouchami, W.; Middag, R.; van de Flierd, T.; de Baar, H.J.W.

    2013-01-01

    Cadmium concentrations and isotope compositions were determined for 47 seawater samples from the high nutrient low chlorophyll (HNLC) zone of the Atlantic sector of the Southern Ocean. The samples include 13 surface waters from a transect of the Weddell Gyre and 3 depth profiles from the Weddell Sea

  18. Structural and optical properties of (112̅2) InGaN quantum wells compared to (0001) and (112̅0)

    Science.gov (United States)

    Pristovsek, Markus; Han, Yisong; Zhu, Tongtong; Oehler, Fabrice; Tang, Fengzai; Oliver, Rachel A.; Humphreys, Colin J.; Tytko, Darius; Choi, Pyuck-Pa; Raabe, Dierk; Brunner, Frank; Weyers, Markus

    2016-08-01

    We benchmarked growth, microstructure and photo luminescence (PL) of (112̅2) InGaN quantum wells (QWs) against (0001) and (112̅0). In incorporation, growth rate and the critical thickness of (112̅2) QWs are slightly lower than (0001) QWs, while the In incorporation on (112̅0) is reduced by a factor of three. A small step-bunching causes slight fluctuations of the emission wavelength. Transmission electron microscopy as well as atom probe tomography (APT) found very flat interfaces with little In segregation even for 20% In content. APT frequency distribution analysis revealed some deviation from a random InGaN alloy, but not as severe as for (112̅0). The slight deviation of (112̅2) QWs from an ideal random alloy did not broaden the 300 K PL, the line widths were similar for (112̅2) and (0001) while (112̅0) QWs were broader. Despite the high structural quality and narrow PL, the integrated PL signal at 300 K was about 4× lower on (112̅2) and more than 10× lower on (112̅0).

  19. Neuroimaging correlates of 22q11.2 deletion syndrome: implications for schizophrenia research.

    Science.gov (United States)

    Boot, E; van Amelsvoort, T A M J

    2012-01-01

    22q11.2 Deletion syndrome (22q11DS) is the most common known recurrent copy-number variant disorder. It is also the most common known genetic risk factor for schizophrenia. The greater homogeneity of subjects with schizophrenia in 22q11DS compared with schizophrenia in the wider non-deleted population may help to identify much needed information on neuroanatomical substrates, and neurochemical and neurofunctional mechanisms that may modulate the risk for schizophrenia. Identification of the underlying pathophysiology creates opportunities for developing genotype-specific, biology-based and targeted treatments to prevent, delay or minimize the severity of schizophrenia in both 22q11DS and the wider non-deleted population. This article reviews neuroimaging studies that focused on brain structure and function in this high-risk population, with particular attention to schizophrenia research. We also discuss the evidence on the role of candidate genes within the 22q11.2 region, with particular reference to catechol-O-methyl transferase (COMT) and proline dehydrogenase (PRODH). PMID:23279171

  20. STS-112 crew arrives at KSC's SLF for launch

    Science.gov (United States)

    2002-01-01

    KENNEDY SPACE CENTER, FLA. -- STS-112 Mission Specialist Fyodor Yurchikhin, who is with the Russian Space Agency, shows his happiness at returning to KSC to prepare for launch. He will be making his first Shuttle flight. STS-112, aboard Space Shuttle Atlantis, is the 15th assembly mission to the International Space Station. Atlantis will be carrying the S1 Integrated Truss Structure, the first starboard truss segment, to be attached to the central truss segment, S0, and the Crew and Equipment Translation Aid (CETA) Cart A. The CETA is the first of two human-powered carts that will ride along the ISS railway, providing mobile work platforms for future spacewalking astronauts. The 11-day mission includes three spacewalks. Launch is scheduled for Oct. 2 betw een 2 and 6 p.m.

  1. Some notes on writing a commentary: Isaiah 1-12

    Directory of Open Access Journals (Sweden)

    A. Groenewald

    2009-07-01

    Full Text Available I was requested by the editors of the �Historical Commentary on the Old Testament� (HCOT to contribute two volumes on Isaiah in this series. This present article, however, focuses only on volume I: Isaiah 1-12. The aim of this article can be summarised in six points. Some introductory remarks are made with regard to the genre of commentary writing. Secondly, the viewpoint of the HCOT series is outlined; in other words its methodological and epistemological viewpoint. Thirdly, recent developments in the study of the book of Isaiah are discussed. Fourthly, my own objectives and hypothesis with regard to this project are outlined. Fifthly, a short overview of Isaiah 1-12 on a synchronic level is given. Sixthly, my research methodology is defined as a �diachronically reflected synchronic� reading of the Isaianic text. In the last section some concluding remarks are made.

  2. Cadmium phytoextraction potential of different Alyssum species

    Energy Technology Data Exchange (ETDEWEB)

    Barzanti, R., E-mail: rbarzanti@supereva.it [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Colzi, I., E-mail: ilariacolzi@hotmail.it [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Arnetoli, M., E-mail: miluscia@gmail.com [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Gallo, A., E-mail: galloalessia@hotmail.com [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Pignattelli, S., E-mail: sara.pignattelli@gmail.com [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Gabbrielli, R., E-mail: gabbrielli@unifi.it [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Gonnelli, C., E-mail: cristina.gonnelli@unifi.it [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy)

    2011-11-30

    Highlights: Black-Right-Pointing-Pointer The possibility of using serpentine plants for phytoextraction of Cd was investigated. Black-Right-Pointing-Pointer Variation in Cd tolerance, accumulation and translocation in three Alyssum plants with different phenotypes were found. Black-Right-Pointing-Pointer Alyssum montanum showed higher Cd tolerance and accumulation than the Ni hyperaccumulator Alyssum bertolonii. Black-Right-Pointing-Pointer As for the kinetic parameters of the Cd uptake system, A. montanum presented a low apparent K{sub m} value. Black-Right-Pointing-Pointer The V{sub max} values were not significantly different among the plants. - Abstract: This work was planned for providing useful information about the possibility of using serpentine adapted plants for phytoextraction of cadmium, element scarcely represented in such metalliferous environment. To this aim, we investigated variation in cadmium tolerance, accumulation and translocation in three Alyssum plants with different phenotypes: Alyssum bertolonii, that is a serpentine endemic nickel hyperaccumulator, and two populations of Alyssum montanum, one adapted and one not adapted to serpentine soils. Plants were hydroponically cultivated in presence of increasing concentrations of CdSO{sub 4} for two weeks. For the metal concentration used in the experiments, the three different Alyssum populations showed variation in cadmium tolerance, accumulation and content. The serpentine adapted population of A. montanum showed statistically higher cadmium tolerance and accumulation than A. bertolonii and the population of A. montanum not adapted to serpentine soil thus deserving to be investigated for phytoextraction purposes. Furthermore, as for the kinetic parameters of the cadmium uptake system, A. montanum serpentine population presented a low apparent K{sub m} value, suggesting a high affinity for this metal of its uptake system, whereas the V{sub max} values were not significantly different among the

  3. Cadmium and Chrome Concentrations in Human Milk

    Directory of Open Access Journals (Sweden)

    Sima Nazarpour

    2014-04-01

    Full Text Available Introduction: Nutrition of children has the highest priority in any program aimed at children's health care. Milk contaminated with various toxic elements can have adverse effects on children's health. This study aimed to determine the concentration of heavy metals including cadmium(Cd and chromium (Cr of breast feeding women’s milk in Varamin. Methods: This is a cross sectional study. In the present study, chromium and cadmium levels in milk of 100 mothers attending clinics in the city of Varamin were measured in four to eight weeks after delivery, using atomic absorption spectrometry. Results: The mean values (±SD of Cd and Cr in human milk were 5±6.9 μg/ml and 3±2.7 μg/ml respectively. Result of Linear regression showed that cadmium levels were higher in breast milk of people living close to the factory or industrial center. Also, the chromium levels were higher in the breast milk of women in cases of: Smoking by spouses, consumption of imported rice, consumption of mineral water, and living close to the factory or an industrial center. Conclusion: This study showed that the relationship of some factors such as living near a factory or an industrial center, smoking by spouse, the type of consumed rice and water, with the level of cadmium and chromium. Cadmium and chromium levels of breast milk in this study were higher than the levels of these elements mentioned in the reviewed articles and international standard. Because some variables, such as living near a factory or an industrial center, smoking by spouse, the type of consumed rice and water can affect the amount of entering elements in breast milk. Actions can be taken to reduce or eliminate these variables in order to decrease the mentioned elements in human milk.

  4. Candida Arthritis: Analysis of 112 Pediatric and Adult Cases

    OpenAIRE

    Gamaletsou, Maria N; Rammaert, Blandine; Bueno, Marimelle A.; Sipsas, Nikolaos V.; Moriyama, Brad; Kontoyiannis, Dimitrios P.; Roilides, Emmanuel; Zeller, Valerie; Taj-Aldeen, Saad J; Miller, Andy O.; Petraitiene, Ruta; Lortholary, Olivier; Thomas J Walsh

    2015-01-01

    Background.  Candida arthritis is a debilitating form of deeply invasive candidiasis. However, its epidemiology, clinical manifestations, management, and outcome are not well understood. Methods.  Cases of Candida arthritis were reviewed from 1967 through 2014. Variables included Candida spp in joint and/or adjacent bone, underlying conditions, clinical manifestations, inflammatory biomarkers, diagnostic imaging, management, and outcome. Results.  Among 112 evaluable cases, 62% were males and...

  5. Recurrent 16p11.2 microdeletions in autism.

    Science.gov (United States)

    Kumar, Ravinesh A; KaraMohamed, Samer; Sudi, Jyotsna; Conrad, Donald F; Brune, Camille; Badner, Judith A; Gilliam, T Conrad; Nowak, Norma J; Cook, Edwin H; Dobyns, William B; Christian, Susan L

    2008-02-15

    Autism is a childhood neurodevelopmental disorder with a strong genetic component, yet the identification of autism susceptibility loci remains elusive. We investigated 180 autism probands and 372 control subjects by array comparative genomic hybridization (aCGH) using a 19K whole-genome tiling path bacterial artificial chromosome microarray to identify submicroscopic chromosomal rearrangements specific to autism. We discovered a recurrent 16p11.2 microdeletion in two probands with autism and none in controls. The deletion spans approximately 500-kb and is flanked by approximately 147-kb segmental duplications (SDs) that are >99% identical, a common characteristic of genomic disorders. We assessed the frequency of this new autism genomic disorder by screening an additional 532 probands and 465 controls by quantitative PCR and identified two more patients but no controls with the microdeletion, indicating a combined frequency of 0.6% (4/712 autism versus 0/837 controls; Fisher exact test P = 0.044). We confirmed all 16p11.2 deletions using fluorescence in situ hybridization, microsatellite analyses and aCGH, and mapped the approximate deletion breakpoints to the edges of the flanking SDs using a custom-designed high-density oligonucleotide microarray. Bioinformatic analysis localized 12 of the 25 genes within the microdeletion to nodes in one interaction network. We performed phenotype analyses and found no striking features that distinguish patients with the 16p11.2 microdeletion as a distinct autism subtype. Our work reports the first frequency, breakpoint, bioinformatic and phenotypic analyses of a de novo 16p11.2 microdeletion that represents one of the most common recurrent genomic disorders associated with autism to date.

  6. THE UNIFIED FIELD THEORY AND SUPERGRAVITY IN 112D

    Directory of Open Access Journals (Sweden)

    Trunev A. P.

    2016-05-01

    Full Text Available In the paper the problem of constructing a unified field theory based on the theory of supergravity in the 112D is discussed. It is assumed that in the 112-dimensional Riemann space there are 37 three-dimensional worlds coexist having a single time and associated gravity. Investigated centrally symmetric metric depends on the radial coordinate in the observable physical space of one of the worlds. It is assumed that in the 112D performed the wave equation of the general form, describing the dynamics of the scalar field. From this equation, the wave equation is displayed in the fourdimensional space-time, containing terms describing the contribution of extra dimensions. It is shown that the quantum numbers of the problem allow us to describe the structure of the atom and the atomic nucleus on the assumption that given the total mass of the central body. The problem on the dynamics of the scalar field in the 112D in a centrally symmetric metric has been described. Built of field quantization theory in general, and in the particular case of metrics depending on the Weierstrass elliptic functions. It is shown that in this case there are bounded periodic potentials and corresponding periodic solutions that depend on the energy and angular momentum projection, and on the invariants of the Weierstrass function. It is found that in an excited state with a sufficiently large magnitude of the angular momentum of the projection portion of the radial wave function is periodic in a limited range, while the ground state allowed waves on all axes of the radial coordinate. The connection of the solutions to the Yang-Mills theories discussed

  7. Hepatoprotective activity of Moringa oleifera against cadmium toxicity in rats

    Directory of Open Access Journals (Sweden)

    Reetu Toppo

    2015-04-01

    Full Text Available Aim: The present investigation has been conducted to evaluate the hepatoprotective activity of Moringa oleifera against cadmium-induced toxicity in rats. Materials and Methods: For this study, 18 Wistar albino rats were taken. Control group, Group I rats were given cadmium chloride @ 200 ppm per kg and Group II rats were treated with M. oleifera extract @ 500 mg/kg along with cadmium chloride @ 200 ppm per kg (daily oral for 28 days. On 29th day, animals were slaughtered and various parameters were determined. Serum biomarkers, oxidative stress parameters, histomorphological examination were carried out with estimation of cadmium concentration in liver tissues. Results: Oral administration of cadmium chloride @ 200 ppm/kg for 28 days resulted in a significant increase in aspartate aminotransferase (AST, alanine transaminase (ALT, alkaline phosphatase (ALP, significant (p≤0.01 increase of lipid peroxidation (LPO and decrease in superoxide dismutase (SOD, and increase in cadmium accumulation in liver. Treatment with M. oleifera @ 500 mg/kg significantly (p<0.01 decreased the elevated ALP, AST, ALT, LPO levels and increase in SOD levels, and as compared to cadmium chloride treated group. However, there was no significant difference in cadmium concentration in liver when compared with cadmium chloride treated group. Conclusion: The study conclude that supplementation of M. oleifera (500 mg/kg, daily oral for 28 days has shown protection against cadmium-induced hepatotoxicity.

  8. Modelling of Cadmium Transport in Soil-Crop System

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    A model for simulating cadmium transport in a soil-plant system was built using a commercial simu lating program named Powersim on the basis of input-output processes happening in the soil-plant system.Convective and dispersive transport processes of cadmium in soil profile are embedded. Simulations on a daily base have been done up to a total simulating time of 250 years. Results show that applications of sewage sludge and fertilizer at the simulated rates would only cause slight cadmium accumulations in each layer of the soil, and cadmium accumulation would be levelling off, reaching an equilibrium concentrations layer by layer downward after certain time. The time scale to reach an equilibrium concentration varies from 10 years for the top three layers to over 250 years for the bottom layers. Plant cadmium uptake would increase from 52 ug m-2 under initial soil cadmium concentrations to 65 μg m-2 under equilibrium soil cadmium concentrations, which would not exceed the maximum allowable cadmium concentration in wheat grains. Main parameters which influence cadmium accumulation and transport in soil are total cadmium input, rainfall, evaporation, plant uptake and soil properties.

  9. Candidate Genes and the Behavioral Phenotype in 22q11.2 Deletion Syndrome

    Science.gov (United States)

    Prasad, Sarah E.; Howley, Sarah; Murphy, Kieran C.

    2008-01-01

    There is an overwhelming evidence that children and adults with 22q11.2 deletion syndrome (22q11.2DS) have a characteristic behavioral phenotype. In particular, there is a growing body of evidence that indicates an unequivocal association between 22q11.2DS and schizophrenia, especially in adulthood. Deletion of 22q11.2 is the third highest risk…

  10. 42 CFR 423.112 - Establishment of prescription drug plan service areas.

    Science.gov (United States)

    2010-10-01

    ... areas. 423.112 Section 423.112 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICARE PROGRAM VOLUNTARY MEDICARE PRESCRIPTION DRUG BENEFIT Benefits and Beneficiary Protections § 423.112 Establishment of prescription drug plan service areas....

  11. 21 CFR 20.112 - Voluntary drug experience reports submitted by physicians and hospitals.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 1 2010-04-01 2010-04-01 false Voluntary drug experience reports submitted by physicians and hospitals. 20.112 Section 20.112 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF....112 Voluntary drug experience reports submitted by physicians and hospitals. (a) A voluntary...

  12. 37 CFR 10.112 - Preserving identity of funds and property of client.

    Science.gov (United States)

    2010-07-01

    ... OFFICE Patent and Trademark Office Code of Professional Responsibility § 10.112 Preserving identity of... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Preserving identity of funds and property of client. 10.112 Section 10.112 Patents, Trademarks, and Copyrights UNITED STATES...

  13. 29 CFR 794.112 - Only independent and local enterprises qualify for exemption.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false Only independent and local enterprises qualify for exemption. 794.112 Section 794.112 Labor Regulations Relating to Labor (Continued) WAGE AND HOUR DIVISION... Act âindependently Owned and Controlled Local Enterpriseâ § 794.112 Only independent and...

  14. 40 CFR Appendix F to Part 112 - Facility-Specific Response Plan

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Facility-Specific Response Plan F Appendix F to Part 112 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS OIL POLLUTION PREVENTION Pt. 112, App. F Appendix F to Part 112—Facility-Specific Response Plan...

  15. 40 CFR Appendix D to Part 112 - Determination of a Worst Case Discharge Planning Volume

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Determination of a Worst Case Discharge Planning Volume D Appendix D to Part 112 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS OIL POLLUTION PREVENTION Pt. 112, App. D Appendix D to Part 112—Determination of...

  16. 40 CFR Appendix G to Part 112 - Tier I Qualified Facility SPCC Plan

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Tier I Qualified Facility SPCC Plan G Appendix G to Part 112 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS OIL POLLUTION PREVENTION Pt. 112, App. G Appendix G to Part 112—Tier I Qualified Facility SPCC...

  17. 40 CFR 112.21 - Facility response training and drills/exercises.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Facility response training and drills/exercises. 112.21 Section 112.21 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS OIL POLLUTION PREVENTION Response Requirements § 112.21 Facility response training and...

  18. Children with Chromosome 22q11.2 Deletion Syndrome Exhibit Impaired Spatial Working Memory

    Science.gov (United States)

    Wong, Ling M.; Riggins, Tracy; Harvey, Danielle; Cabaral, Margarita; Simon, Tony J.

    2014-01-01

    Individuals with chromosome 22q11.2 deletion syndrome (22q11.2DS) have been shown to have impairments in processing spatiotemporal information. The authors examined whether children with 22q11.2DS exhibit impairments in spatial working memory performance due to these weaknesses, even when controlling for maintenance of attention. Children with…

  19. 33 CFR 100.112 - Swim the Bay, Narragansett Bay, Narragansett, RI.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Swim the Bay, Narragansett Bay, Narragansett, RI. 100.112 Section 100.112 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY REGATTAS AND MARINE PARADES SAFETY OF LIFE ON NAVIGABLE WATERS § 100.112 Swim the...

  20. 9 CFR 590.112 - Suspension of license or authority; revocation.

    Science.gov (United States)

    2010-01-01

    ...; revocation. 590.112 Section 590.112 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE... INSPECTION ACT) Performance of Service § 590.112 Suspension of license or authority; revocation. Pending... to offer as to why his license should not be suspended or revoked. After the expiration of...

  1. 50 CFR 86.112 - What are the advantages of doing a survey?

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 6 2010-10-01 2010-10-01 false What are the advantages of doing a survey? 86.112 Section 86.112 Wildlife and Fisheries UNITED STATES FISH AND WILDLIFE SERVICE, DEPARTMENT OF... INFRASTRUCTURE GRANT (BIG) PROGRAM How States Will Complete Access Needs Surveys § 86.112 What are the...

  2. 40 CFR 60.112a - Standard for volatile organic compounds (VOC).

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 6 2010-07-01 2010-07-01 false Standard for volatile organic compounds (VOC). 60.112a Section 60.112a Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED... Commenced After May 18, 1978, and Prior to July 23, 1984 § 60.112a Standard for volatile organic...

  3. 40 CFR 60.112 - Standard for volatile organic compounds (VOC).

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 6 2010-07-01 2010-07-01 false Standard for volatile organic compounds (VOC). 60.112 Section 60.112 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... After June 11, 1973, and Prior to May 19, 1978 § 60.112 Standard for volatile organic compounds...

  4. 46 CFR 112.20-10 - Diesel or gas turbine driven emergency power source.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Diesel or gas turbine driven emergency power source. 112... Power Source § 112.20-10 Diesel or gas turbine driven emergency power source. Simultaneously with the operation of the transfer means under § 112.20-5, the diesel engine or gas turbine driving the...

  5. 46 CFR 112.05-3 - Main-emergency bus-tie.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Main-emergency bus-tie. 112.05-3 Section 112.05-3 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) ELECTRICAL ENGINEERING EMERGENCY LIGHTING AND POWER SYSTEMS General § 112.05-3 Main-emergency bus-tie. Each bus-tie between a main...

  6. 5 CFR 930.112 - Identification card or document in possession.

    Science.gov (United States)

    2010-01-01

    ... possession. 930.112 Section 930.112 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT (CONTINUED) CIVIL... Vehicle Operators § 930.112 Identification card or document in possession. The operator or incidental... his or her possession at all times while driving a Government-owned or -leased motor vehicle....

  7. 19 CFR 141.112 - Liens for freight, charges, or contribution in general average.

    Science.gov (United States)

    2010-04-01

    ... general average. 141.112 Section 141.112 Customs Duties U.S. CUSTOMS AND BORDER PROTECTION, DEPARTMENT OF....112 Liens for freight, charges, or contribution in general average. (a) Definitions. The following are... connected with the transportation of the goods. (3) General average. “General average” means the...

  8. Supplemental design requirements document enhanced radioactive and mixed waste storage Phase V Project W-112

    Energy Technology Data Exchange (ETDEWEB)

    Ocampo, V.P.; Boothe, G.F.; Greager, T.M.; Johnson, K.D.; Kooiker, S.L.; Martin, J.D.

    1994-11-01

    This document provides additional and supplemental information to WHC-SD-W112-FDC-001, Project W-112 for radioactive and mixed waste storage. It provides additional requirements for the design and summarizes Westinghouse Hanford Company key design guidance and establishes the technical baseline agreements to be used for definitive design of the Project W-112 facilities.

  9. Investigation of the influence of cadmium processing on zinc gallium oxide:manganese thin films for photoluminescent and thin film electroluminescent applications

    Science.gov (United States)

    Flynn, Michael John

    Cadmium processing of ZnGa2O4 films provides a new fabrication route for phosphor powders and thin films. It relies on the enhanced diffusion due to the large vacancy concentration left by the sublimation of cadmium. Photoluminescent powders can be made with a single high temperature firing. Thin film devices can be processed at a significantly lower temperature, expanding the range of available substrates. Powders and thin films of ZnGa2O4:Mn were fabricated using starting materials in which between 0% and 50% of the ZnO was substituted by CdO. It was found that the emission spectra of the various compositions was unaffected by the change in composition, peaking at 504 nm, with the colour coordinates x = 0.08 and y = 0.69. The invariance of the emission spectrum is due to the spinel crystal structure exhibited by the compound. However, the maximum PL brightness was obtained from powders in which 10% of the ZnO had been substituted by CdO in the starting materials. The improved brightness is the result of better manganese incorporation which resulted from CdO sublimation during processing. This left a large vacancy concentration which enhanced the diffusion, and hence the manganese incorporation. In the case of thin films sputtered from cadmium processed targets, the composition of the films as deposited closely mirrored that of the target starting materials. The as deposited films were not luminescent and had to be annealed in vacuum in order to activate the manganese. EDX of these films showed that all of the cadmium had sublimed during the anneal. Very long anneal times also resulted in the loss of zinc. The decomposition products were amorphous or nanocrystalline. These films had an identical PL emission to the powders. The loss of cadmium correlated with the onset of bright 254 nm photoluminescence in the films, indicating that cadmium loss aided in the activation of the manganese. This was the result of the enhanced diffusion due to the large vacancy

  10. Assessment and management of risk to wildlife from cadmium

    International Nuclear Information System (INIS)

    Cadmium, a nonessential heavy metal that comes from natural and anthropogenic sources, is a teratogen, carcinogen, and a possible mutagen. Assessment of potential risk from cadmium requires understanding environmental exposure, mainly from ingestion, although there is some local exposure through inhalation. Chronic exposure is more problematic than acute exposure for wildlife. There is evidence for bioaccumulation, particularly in freshwater organisms, but evidence for biomagnification up the food chain is inconsistent; in some bird studies, cadmium levels were higher in species that are higher on the food chain than those that are lower. Some freshwater and marine invertebrates are more adversely affected by cadmium exposure than are birds and mammals. There is very little experimental laboratory research on the effects of cadmium in amphibians, birds and reptiles, and almost no data from studies of wildlife in nature. Managing the risk from cadmium to wildlife involves assessment (including ecological risk assessment), biomonitoring, setting benchmarks of effects, regulations and enforcement, and source reduction

  11. Study on electrokinetic remediation of cadmium contaminated soils

    Institute of Scientific and Technical Information of China (English)

    SHI Wen-xin; CUI Chong-wei; YU Shui-li; FENG Wei-ming

    2007-01-01

    Kaolinite from a lead-zinc mining district, which was spiked with cadmium, has been treated by electrokinetics to investigate effects of treatment time and applied voltage gradient. The results showed that the increased test duration had induced a higher removal rate of cadmium. Being treated for 7 days, cadmium was removed from kaolinite dramatically. It was also found that higher removal rate happened when a higher voltage gradient was applied and cadmium accumulated near the cathode because pH increased. Increase of pH near the cathode caused accumulation of cadmium. Moreover, it was observed that cation exchange membrane which was placed between kaolinite and cathode could make pH lower than the initial value and avoid the higher pH near the cathode. As a result, the high concentration accumulation of cadmium near the cathode was avoided.

  12. Research and Development of Cadmium Sulphoselenide Red Pigment

    Institute of Scientific and Technical Information of China (English)

    WU Jianfeng; LI Kun; XU Xiaohong; ZHANG Yaxiang; XU Xiaoyang; LAO Xinbin

    2015-01-01

    Cadmium sulphoselenide was synthesized continuous substitution solid solution and the only known pigment to yield bright red color on ceramic decoration. Encapsulated cadmium sulphoselenide pigments could yield abundant hues from yellow to red with high opacity at high temperature. The color generation has a linear function relation with the substitution rate. The encapsulation formation process of zirconium silicate encapsulated cadmium sulphoselenide was shown. Insufifcient encapsulation efifciency and potential hazard to human and environment had limited the industrial application of cadmium sulphoselenide red pigment. Ink-jet printing decoration required ifne size cadmium sulphoselenide red pigment on ceramic decoration. The review mainly focused on the synthesis techniques and industrial application of cadmium sulphoselenide red pigment.

  13. In search of biomonitors for cadmium: cadmium content of wild Swedish fauna during 1973-1976.

    Science.gov (United States)

    Frank, A

    1986-12-01

    Forty-five species of birds and 22 species of mammals of the terrestrial and aquatic fauna, herbivores as well as carnivores, were investigated during the period 1973-1976 for cadmium-accumulating properties in order to find biomonitors for cadmium in the Swedish environment. The herbivores of the terrestrial fauna, birds as well as mammals, are preferred to carnivores, since they demonstrate generally higher renal Cd levels. The moose (Alces alces), roe deer (Capreolus capreolus) and hare (Lepus europeus and Lepus timidus) were found to be suitable as biomonitors because of their common occurrence and uniform geographical distribution. The eider duck (Somateria mollissima), although a short-distance migrating bird whose diet is composed mainly of mussels and crustaceans, and which lives along a great part of the Swedish coastline, is suggested as a biomonitor of cadmium for the aquatic environment. The accumulation rate of cadmium in the kidneys is rapid. Renal levels of cadmium in the parts per million range are reached 10 weeks after hatching. Juvenile birds should be collected for monitoring purposes before leaving their feeding domains at the end of the summer. PMID:3810147

  14. Oral cadmium exposure of adults in Germany. 1: Cadmium content of foodstuffs and beverages.

    Science.gov (United States)

    Müller, M; Anke, M; Hartmann, E; Illing-Günther, H

    1996-04-01

    The cadmium contents of 94 and 105 foodstuffs bought in six-fold repetition in 1988 and in nine-fold repetition in 1991, respectively were analysed within the framework of a market-basket study. These foodstuffs were typical of German eating habits. Additionally, 170 samples of drinking water were investigated. The cadmium concentrations of the foodstuffs were comparable with results of recent studies carried out in Europe and North America. Fruit, milk and dairy products, sugar and sugar-rich foodstuffs as well as beverages showed mean cadmium contents cakes and pastries as well as farinaceous products were within the range of 20-40 ng/g. The most important bread, cakes and pastries (wheat and rye bread, toasted bread, rolls) contained 25-35 ng/g. A median cadmium concentration of 0.2 micrograms/l was found in the drinking water. As expected, liver and kidneys showed the highest cadmium levels of 73 and 204 ng/g, respectively on average. PMID:8718751

  15. Hepatotoxicity of Cadmium and Roles of Mitigating Agents

    Directory of Open Access Journals (Sweden)

    Elias Adikwu

    2013-12-01

    Full Text Available There are increasing reports on cadmium associated hepatotoxicity, due to these reports this study reviewed relevant literature on cadmium associated hepatotoxicity with emphasis on doses, route of administration, salt forms (cadmium compounds and the roles of mitigating agents. Reports have shown that continuous exposure of the liver to cadmium has led to hepatotoxicity. Humans are generally exposed to cadmium by two main routes, inhalation and ingestion. In this study, evaluation of relevant literature showed that irrespective of route of administration and salt forms cadmium hepatotoxicity is dose and time dependent. Cadmium associated hepatotoxicity manifested through impaired functions of hepatic biomarkers (transaminases, enzymatic and non enzymatic antioxidants. Histopathological damage to liver architecture manifested as swelling of hepatocytes, focal necrosis, hepatocytes degeneration, dilatation of ribosomes, damage of membrane-bounded lysosomes, nuclear pyknosis and cytoplasm vacuolization. Deterioration of mitochondrial cristae, deposition of collagen fibrils, hypertrophy of kuffer cells, congestion in central veins and sinusoids, infiltration of mixed inflammatory cells and peripheral hemorrhage also occurred. Hepatotoxic effect of cadmium was mitigated by Vitamin C, Vitamin E, Manganese (11 Chloride, N-acetylcysteine and Selenium. Extracts of plant origin including Solanum tuberosum, Calycopteris floribunda Hibiscus sabdariffa mitigated cadmium induced hepatotoxicity. Chemical substances of animal origin including honey and camel milk were reported to have ameliorated cadmium induced hepatotoxicity. One of the mechanisms of cadmium induced hepatotoxicity is reported to be associated with the up regulation of reactive oxygen species (oxidative stress which caused oxidative damage to lipid contents of membranes and direct liver injury. Conclusion cadmium is dose and time dependently hepatotoxic irrespective of route of administration

  16. Assessment of soil contamination. Measuring devices for arsenic, berryllium, lead, cadmium, mercury and selenium. Wirkung von Bodenkontaminationen. Messlatten fuer Arsen, Beryllium, Blei, Cadmium, Quecksilber und Selen

    Energy Technology Data Exchange (ETDEWEB)

    Blumenbach, D.; Kloke, A.; Luehr, H.P.

    1991-12-01

    To assess soil contamination with respect to the suitability of the site concerned, it is essential to obtain knowledge of the relationship between soil contamination levels and the effect of the contaminants on a targets meriting protection (e.g. human beings, plants, soil organisms). In this final report, data obtained from literature on the inorganic pollutants arsenic, lead, cadmium, mercury, selenium and beryllium are compiled, and for selected targets an overview is given of the damage occurring at the various concentration levels studies. The present data, together with information on the envisaged use of the site and on soil properties influencing the pollutant's transport to the protected target, can be used to assess soil quality. Threshold values for use in decision-making cannot be derived directly from the presented data, as such data can only convey a picture of the range of the harmful concentrations given in the literature. (orig.).

  17. studies on the use of organic and inorganic ion exchangers for separation of indium(III) from cadmium(II) using analytical methods

    International Nuclear Information System (INIS)

    Organic and inorganic ion exchangers have many applications not only in the industrial, environmental and the nuclear fields but also in the separation of metal ions. This may be returned to its high measured capacity, high selectivity for some metal ions, low solubility, high chemical radiation stability and easy to use.Indium and cadmium are produced from cyclotron target where the solvent extraction represents an ordinary method for separation of indium and cadmium from its target. In the present work, More than chromatographic columns were successfully used for the separation and recovery of indium(III) and cadmium(II) ions from di-component system in aqueous solution using organic and inorganic ion exchangers. The work was carried out in three main parts;1- In the first part, the commercial resin (Dowex50w-x8) was used for the separation of indium from cadmium. The effect of pH, the weight of resin, and equilibrium time on the sorption process of both metal ions were determined. It was found that the adsorption percentage was more than 99% at pH 4 (as optimum pH value) using batch experiment. The results show that indium was first extracted while cadmium is slightly extracted at this pH value. The recovery of indium and cadmium is about 98% using hydrochloric acid as best eluent. The ion exchange/complexing properties of Dowex50w-x8 resin containing various substituted groups towards indium and cadmium cations were investigated.2- In the second part, Zn(II)polymethacrylates, and poly (acrylamide-acrylic acid), as synthetic organic ion exchangers were prepared by gamma irradiation polymerization technique of the corresponding monomer at 30 kGy. The obtained organic resins were mixed with indium ions to determine its capacity in aqueous solutions using batch experiment.

  18. Extraction-photometric determination of cadmium in meat products

    Energy Technology Data Exchange (ETDEWEB)

    Krylova, A.N.; Malyarova, M.A.; Zhulenko, V.N.

    1986-06-01

    As a result of industrial discharges, burning of solid and liquid fuels, and recycling of metal scrap, cadmium compounds enter the atmosphere and drop into the water and soil causing contamination. In this paper, a method was developed for determining cadmium in meat products. It involves wet ashing the sample, extractive separation of the cadmium as the diethyldithiocarbamate, reextraction, and determination as cadmium dithizonate or as a complex with 2,2'-dipyridyl. The detection limit with dithizone is 0.005 mg/kg and with 2,2'-dipyridyl 0.05 mg/kg. An analysis is shown to take less than 60 minutes.

  19. Cadmium elemination from phosphoric acid by ionic flotation

    International Nuclear Information System (INIS)

    The ion flotation process for the recovery of cadmium from wet phosphoric acid (30%P2O5) has been studied. This technique combines a chemical recation between the collector and the cadmium to form a precipitate (sublate) which is carried to the surface of the solution by air bubbles. the resulting foam containing the cadmium may then separated from solution. The influence of parameters such as collector and cadmium concentration as well as iron content have been investigated for the case a synthetic acid (30% P2O5). The result have been applied to the industrial phosphoric acid produced from Djebel Onk's phosphates (Algeria)

  20. Bioremoval of cadmium by lemna minor in different aquatic conditions

    Energy Technology Data Exchange (ETDEWEB)

    Uysal, Yagmur [Dept. of Environmental Engineering, Kahramanmaras Sutcu Imam University, Kahramanmaras (Turkey); Taner, Fadime [Dept. of Environmental Engineering, Mersin University, Mersin (Turkey)

    2010-04-15

    This study was undertaken to determine the cadmium removal efficiency of Lemna minor when it was used for treatment of wastewater having different characteristics, i. e., pH, temperature and cadmium concentration. Plants were cultivated in different pH solutions (4.5-8.0) and temperatures (15-35 C) in the presence of cadmium (0.1-10.0 mg/L) for 168 h. The amount of biomass obtained in the study period, the concentrations of cadmium in the tissues and in the media and net uptake of cadmium by Lemna have been determined for each condition. The percentages of cadmium uptake (PMU) and bioconcentration factors (BCF) were also calculated. The highest accumulation was obtained for the highest cadmium concentration of 10.0 mg Cd/L as 11.668 mg Cd/g at pH 6.0, and as 38.650 mg Cd/g at 35 C and pH 5.0. The cadmium accumulation gradually increased with initial concentration of the medium, but the opposite trend was observed for the PMU. However, the maximum PMU was obtained as 52.2% in the solution with the lowest concentration of 0.1 mg Cd/L. A mathematical model was used to describe the cadmium uptake and the equation obtained was seen to fit the experimental data very well. (Abstract Copyright [2010], Wiley Periodicals, Inc.)

  1. Effects of Cadmium on BMP Induced Bone Formation

    Institute of Scientific and Technical Information of China (English)

    陈秋生; 徐顺清

    2003-01-01

    To demonstrate the direct effects of cadmium on activities of bone morphogenetic protein (BMP), a complex containing BMP and cadmium chloride (CdCl2) was implanted beneath the abdominal skin of young male Wistar rats. The activity of BMP was studied by observing the histological changes, and measuring the activity of alkaline phosphatase (ALP) and acid phosphatase (ACP) and calcium content of the implants at different time points. Our results showed that during bone formation induced by BMP, cadmium inhibited the activities of osteoblasts and osteoclasts, and slowed the deposition of calcium. It is concluded that cadmium can directly affect biological activities of BMP directly.

  2. β—Correction Spectrophotometric Determination of Cadmium with Cadion

    Institute of Scientific and Technical Information of China (English)

    郜洪文

    1995-01-01

    Cadmium has been determined by β-correction spectrophotometry with cadion,p-nitrobenzenediazoaminoaz-obenzone,and a non-ionic surfactant,tuiton X-100.The real absorbance of a Cd-cadion chelate in the colored solution can be accurately determined and the complex-ratio of cadion with Cd(II) has been worked out to be 2.Beer's law is obeyed over the concentration range of 0-0.20mg/1 cadmium and the detec-tion limit for cadmium is only 0.003mg/1.Satisfactory experimental results are presented with respect to the determination of trace cadmium in wastewaters.

  3. Elektrokemisk fjernelse af cadmium fra bioasker

    DEFF Research Database (Denmark)

    Pedersen, Anne Juul; Ottosen, Lisbeth M.; Simonsen, Peter;

    Hosliggende rapport formidler resultaterne fra PSO-projektet: ”Elektrokemisk fjernelse af cadmium fra bioasker” (PSO-F&U 3206), finansieret af Elkraft System og Energi E2 A/S. Projektet blev gennemført i perioden 01.05.2003 – 30.06.2004, og partnerne var Energi E2 A/S, BYG-DTU og Krüger A/S, med...... BYG-DTU som den primært udførende part. Projektets formål var at undersøge, om den elektrodialytiske rensningsmetode kunne bruges til at reducere indholdet af cadmium i asker fra biobrændsel (f.eks. træflis og halm) med henblik på nyttiggørelse af askerne. Projektet havde nær sammenhæng med det...

  4. Investigations of Spectroscopic Factors and Sum Rules from the Single Neutron Transfer Reaction 111Cd(d→$\\overrightarrow {\\rm{d}} $,p112Cd

    Directory of Open Access Journals (Sweden)

    Jamieson D.S.

    2014-03-01

    Full Text Available Cadmium isotopes have been presented for decades as excellent examples of vibrational nuclei, with low-lying levels interpreted as multi-phonon quadrupole, octupole, and mixed-symmetry states. A large amount of spectroscopic data has been obtained through various experimental studies of cadmiumisotopes. In the present work, the 111Cd(d→$\\overrightarrow {\\rm{d}} $,p112Cd reaction was used to investigate the single-particle structure of the 112Cd nucleus. A 22 MeV beam of polarized deuterons was obtained at the Maier-Leibnitz laboratory in Garching, Germany. The reaction ejectiles were momentum analyzed using a Q3D spectrograph, and 130 levels have been identified up to 4.2 MeV of excitation energy. Using DWBA analysis with optical model calculations, spin-parity assignments have been made for observed levels, and spectroscopic factors have been extracted from the experimental angular distributions of differential cross section and analyzing power. In this high energy resolution investigation, many additional levels have been observed compared with the previous (d,p study using 8 MeV deuterons [1]. There were a total of 44 new levels observed, and the parity assignments of 34 levels were improved.

  5. Isospin transport in 84Kr+112,124Sn reactions at Fermi energies

    Science.gov (United States)

    Piantelli, S.; Casini, G.; Olmi, A.; Barlini, S.; Bini, M.; Carboni, S.; Maurenzig, P. R.; Pasquali, G.; Poggi, G.; Stefanini, A. A.; Bougault, R.; Le Neindre, N.; Lopez, O.; Parlog, M.; Vient, E.; Bonnet, E.; Chbihi, A.; Frankland, J. D.; Gruyer, D.; Rosato, E.; Spadaccini, G.; Vigilante, M.; Borderie, B.; Rivet, M. F.; Bruno, M.; Morelli, L.; Cinausero, M.; Degerlier, M.; Gramegna, F.; Marchi, T.; Alba, R.; Maiolino, C.; Santonocito, D.; Kozik, T.; Twarog, T.

    2014-03-01

    Isospin transport phenomena in dissipative heavy ion collisions have been investigated at Fermi energies with a beam of 84Kr at 35AMeV. A comparison of the /Z of light and medium products forward-emitted in the centre of mass frame when the beam impinges on two different targets, the n-poor 112Sn and the n-rich 124Sn, is presented. Data were collected by means of a three-layer telescope with very good performances in terms of mass identification (full isotopic resolution up to Z ~ 20 for ions punching through the first detector layer) built by the FAZIA Collaboration and located just beyond the grazing angle for both reactions. The /Z of the products detected when the n-rich target is used is always higher than that associated to the n-poor one; since the detector was able to measure only fragments coming from the QuasiProjectile decay and/or neck emission, the observed behaviour can be ascribed to the isospin diffusion process, driven by the isospin gradient between QuasiProjectile and QuasiTarget. Moreover, for light fragments the /Z as a function of the lab velocity of the fragment is observed to increase when we move from the QuasiProjectile velocity to the centre of mass (neck zone). This effect can be interpreted as an evidence of isospin drift driven by the density gradient between the QuasiProjectile zone (at normal density) and the more diluted neck zone.

  6. Isospin transport in 84Kr+112,124Sn reactions at Fermi energies

    CERN Document Server

    Piantelli, S; Olmi, A; Barlini, S; Bini, M; Carboni, S; Maurenzig, P R; Pasquali, G; Poggi, G; Stefanini, A A; Bougault, R; LeNeindre, N; Lopez, O; Parlog, M; Vient, E; Bonnet, E; Chbihi, A; Frankland, J D; Gruyer, D; Rosato, E; Spadaccini, G; Vigilante, M; Borderie, B; Rivet, M F; Bruno, M; Morelli, L; Cinausero, M; Degerlier, M; Gramegna, F; Marchi, T; Alba, R; Maiolino, C; Santonocito, D; Kozik, T; Twarog, T

    2013-01-01

    Isospin transport phenomena in dissipative heavy ion collisions have been investigated at Fermi energies with a beam of 84Kr at 35AMeV. A comparison of the /Z of light and medium products forward-emitted in the centre of mass frame when the beam impinges on a n-poor 112Sn and a n-rich 124Sn targets is presented. Data were collected by means of a three-layer telescope with very good performances in terms of mass identification (full isotopic resolution up to Z about 20 for ions punching through the first detector layer) built by the FAZIA Collaboration and located just beyond the grazing angle for both reactions. The /Z of the decay products emitted when the n-rich target is used is always higher than that associated to the n-poor one. Since the detector was able to measure only fragments coming from the QuasiProjectile decay and/or neck emission, the observed behaviour can be ascribed to the isospin diffusion, driven by the isospin gradient between QuasiProjectile and QuasiTarget. Moreover, for light fragment...

  7. Electron mobility in mercury cadmium telluride

    Science.gov (United States)

    Patterson, James D.

    1988-01-01

    A previously developed program, which includes all electronic interactions thought to be important, does not correctly predict the value of electron mobility in mercury cadmium telluride particularly near room temperature. Part of the reason for this discrepancy is thought to be the way screening is handled. It seems likely that there are a number of contributors to errors in the calculation. The objective is to survey the calculation, locate reasons for differences between experiment and calculation, and suggest improvements.

  8. Prevention of cadmium bioaccumulation by herbal adaptogens

    OpenAIRE

    K Bharavi; A. Gopala Reddy; G S Rao; Ravi Kumar, P.; D Srinivas Kumar; P Prabhu Prasadini

    2011-01-01

    Objectives : To evaluate the effect of various herbal adaptogens such as shade-dried powders of Withania somnifera, Ocimum sanctum, Asperagus recemosus, Andrographis paniculata, Asphaltum panjabinum (Shilajith), Gymnema sylvestre, Spirulina platensis, and Panex ginseng on cadmium (Cd)-induced oxidative stress and its accumulation in broiler chicken. Materials and Methods : A total of 80 male broiler chicks of day old age were randomly assigned to 10 equal groups. Group 1 birds were fed wi...

  9. ELECTROKINETIC REMEDIATION STUDY FOR CADMIUM CONTAMINATED SOIL

    OpenAIRE

    P. Bala Ramudu; R. P. Tiwari; Srivastava, R. K.

    2007-01-01

    This paper presents the results of an experimental research undertaken to evaluate different purging solutions to enhance the removal of cadmium from spiked contaminated field soil by electrokinetic remediation. Three experiments were conducted when soil was saturated with deionised water and subsequently deionised water, ammonium citrate and sodium citrate were used as purging solutions at anode end. One experiment was conducted when the soil was saturated with ammonium citrate and itself wa...

  10. Bioavailability of cadmium from linseed and cocoa

    DEFF Research Database (Denmark)

    Hansen, Max; Rasmussen, Rie Romme; Sloth, Jens Jørgen

    2014-01-01

    for the food authorities in order to give correct advises to the population. The aim of this study was to investigate the bioavailability of cadmium from whole linseed, crushed linseed, cocoa and cadmium chloride in rats. An experiment where 40 rats were divided into 4 groups and a control group and dosed...... with whole linseed, crushed linseed, cocoa and CdCl2 for 3 weeks was performed. Linseed or cocoa made up 10% of the feed (by weight) and was added as a replacement for carbohydrate source. The rats were dosed for 3 weeks and the cadmium content in the rats' kidneys was measured by ICPMS as a biomarker...... be measured in the kidney compared to the calculated total intake was as follows: Control 2.0 %, Crushed linseed 0.9 %, whole linseed, 1.5 %, cocoa 0.7 % and CdCl2 4.6 %. Based on this study it could not be concluded that the bioavailability in rats form whole linseed is lower that for crushed linseed...

  11. Cadmium biosorption rate in protonated Sargassum biomass

    Energy Technology Data Exchange (ETDEWEB)

    Yang, J.; Volesky, B. [McGill Univ., Montreal, Quebec (Canada). Dept. of Chemical Engineering

    1999-03-01

    Biosorption of the heavy metal ion Cd{sup 2+} by protonated nonliving brown alga Sargassum fluitans biomass was accompanied by the release of hydrogen protons from the biomass. The uptake of cadmium and the release of proton matched each other throughout the biosorption process. The end-point titration methodology was used to maintain the constant pH 4.0 for developing the dynamic sorption rate. The sorption isotherm could be well represented by the Langmuir sorption model. A mass transfer model assuming the intraparticle diffusion in a one-dimensional thin plate as a controlling step was developed to describe the overall biosorption rate of cadmium ions in flat seaweed biomass particles. The overall biosorption mathematical model equations were solved numerically yielding the effective diffusion coefficient D{sub e} about 3.5 {times} 10{sup {minus}6} cm{sup 2}/s. This value matches that obtained for the desorption process and is approximately half of that of the molecular diffusion coefficient for cadmium ions in aqueous solution.

  12. Soil ecotoxicity assessment using cadmium sensitive plants

    International Nuclear Information System (INIS)

    The crop plants, sorghum and cucumber, can be used as indicator species to assess ecotoxicity of soils contaminated by cadmium. - Four crop plant species (sweet corn, Zea may; wheat, Triticum aestivum; cucumber, Cucumis sativus; and sorghum, Sorghum bicolor) were tested to assess an ecotoxicity in cadmium-amended soils. The measurement endpoints used were seed germination and seedling growth (shoot and root). The presence of cadmium decreased the seedling growth. The medium effective concentration values (EC50) for shoot or root growth were calculated by the Trimmed Spearman-Karber method. Due to the greater accumulation of Cd to the roots, root growth was a more sensitive endpoint than shoot growth. Bioavailability and transport of Cd within plant were related to concentration and species. The ratio of bioaccumulation factor (BAF) in the shoots to the roots indicated high immobilization of Cd in the roots. Seed germination was insensitive to Cd toxicity, and is not recommended for a suitable assay. Among the test plants and test endpoints, root growth of sorghum and cucumber appears to be a good protocol to assess ecotoxicity of soils contaminated by Cd

  13. Soil ecotoxicity assessment using cadmium sensitive plants

    Energy Technology Data Exchange (ETDEWEB)

    An, Youn-Joo

    2004-01-01

    The crop plants, sorghum and cucumber, can be used as indicator species to assess ecotoxicity of soils contaminated by cadmium. - Four crop plant species (sweet corn, Zea may; wheat, Triticum aestivum; cucumber, Cucumis sativus; and sorghum, Sorghum bicolor) were tested to assess an ecotoxicity in cadmium-amended soils. The measurement endpoints used were seed germination and seedling growth (shoot and root). The presence of cadmium decreased the seedling growth. The medium effective concentration values (EC50) for shoot or root growth were calculated by the Trimmed Spearman-Karber method. Due to the greater accumulation of Cd to the roots, root growth was a more sensitive endpoint than shoot growth. Bioavailability and transport of Cd within plant were related to concentration and species. The ratio of bioaccumulation factor (BAF) in the shoots to the roots indicated high immobilization of Cd in the roots. Seed germination was insensitive to Cd toxicity, and is not recommended for a suitable assay. Among the test plants and test endpoints, root growth of sorghum and cucumber appears to be a good protocol to assess ecotoxicity of soils contaminated by Cd.

  14. MB89R112:RFID标签芯片

    Institute of Scientific and Technical Information of China (English)

    2012-01-01

    富士通半导体(上海)有限公司推出其FerVID家族推出用于RFID标签的一款新的芯片MB89R112。该芯片用于高频RFID标签,带9kB的FRAM内存。FerVID家族产品使用铁电存储器(FRAM),具有写入速度快,高频可重写,耐辐射,低功耗操作等特点。

  15. Experimental and simulational result multipactors in 112 MHz QWR injector

    Energy Technology Data Exchange (ETDEWEB)

    Xin, T. [Brookhaven National Lab. (BNL), Upton, NY (United States); Ben-Zvi, I. [Brookhaven National Lab. (BNL), Upton, NY (United States); Stony Brook Univ., NY (United States); Belomestnykh, S. [Brookhaven National Lab. (BNL), Upton, NY (United States); Stony Brook Univ., NY (United States); Brutus, J. C. [Brookhaven National Lab. (BNL), Upton, NY (United States); Skaritka, J. [Brookhaven National Lab. (BNL), Upton, NY (United States); Wu, Q. [Brookhaven National Lab. (BNL), Upton, NY (United States); Xiao, B. [Brookhaven National Lab. (BNL), Upton, NY (United States)

    2015-05-03

    The first RF commissioning of 112 MHz QWR superconducting electron gun was done in late 2014. The coaxial Fundamental Power Coupler (FPC) and Cathode Stalk (stalk) were installed and tested for the first time. During this experiment, we observed several multipacting barriers at different gun voltage levels. The simulation work was done within the same range. The comparison between the experimental observation and the simulation results are presented in this paper. The observations during the test are consisted with the simulation predictions. We were able to overcome most of the multipacting barriers and reach 1.8 MV gun voltage under pulsed mode after several round of conditioning processes.

  16. Reduction of Cadmium Uptake of Rice Plants Using Soil Amendments in High Cadmium Contaminated Soil: A Pot Experiment

    OpenAIRE

    Dian Siswanto; Parinda Suksabye; Paitip Thiravetyan

    2013-01-01

    The aims of this study were to investigate the effect of agricultural residues on reducing cadmium uptake in rice plants. The rice plants growing on no cadmium/free cadmium soils (N), Cd soils (Cds), and Cd soils each amended with 1% w/w of coir pith (CP), coir pith modified with sodium hydroxide (CPm) and corncob (CC) under high cadmium contaminated soil with an average 145 mg Cd kg-1 soil were investigated. The results showed that the cumulative transpiration of rice grown in various treatm...

  17. Influence of a high level of dietary cadmium on cadmium content in milk, excretion, and cow performance

    Energy Technology Data Exchange (ETDEWEB)

    Miller, W.J.; Lampp, B.; Powell, G.W.; Salotti, C.A.; Blackmon, D.M.

    1967-01-01

    Three Holstein cows were each given 3.0 g of cadmium daily (two equal doses) for two weeks by gelatin capsules. There was a sharp drop in concentrate consumption for the first few days of cadmium administration but, by the second week, consumption returned to normal. Milk production declined sharply for several days and then increased appreciably, but to a level still substantially lower than that of controls during the last five days cadmium was given. When cadmium treatments ceased, milk production increased by 50%. Fat content of milk was elevated considerably during the week when production was most reduced. Cows given cadmium lost considerable weight. There were no other clinical manifestations of toxicity. As determined by the chromic oxide indicator method and twice-daily grab samples, fecal excretion of cadmium for the second week averaged 82% of that given. The cadmium level in the urine was below the limits of detectability of the method (0.5 ppm of urine). The cadmium content of the milk was less than 0.1 ppm of the milk, which was the lower reliability limit of the procedure used. On this basis less than 0.22% of the amount administered appeared in the milk. In vitro studies demonstrated that cadmium combines with the casein and whey protein fractions of the milk readily, with the amount combined being linear when levels from 1.0 to 25.0 ppm are added to milk. Smaller amounts were present in the lactose and mineral fractions.

  18. Cadmium sulfate complexing with thiourea during preparation of cadmium sulfide films

    International Nuclear Information System (INIS)

    Composition of complexes deposited from cadmium sulfate and thiourea(TU) aqueous solution is studied. Its influence on cadmium sulfide film deposition during solution spraying is ascertained. It is shown that with increase of TU concentration in aqueous solution gradual substitution of TU molecules for the first sphere SO42- ions takes place. As a result CdS deposition from these solutions is initiated when the ratio of CdSO4:TU concentrations is 1:2 and for prepartation of uniform films a five-fold TU excess as a minimum is necessary

  19. Identification of a yeast artificial chromosome (YAC) spanning the synovial sarcoma-specific t(X;18)(p11.2;q11.2) breakpoint

    NARCIS (Netherlands)

    de Leeuw, B; Berger, W; Sinke, R J; Suijkerbuijk, R F; Gilgenkrantz, S; Geraghty, M T; Valle, D; Monaco, A P; Lehrach, H; Ropers, H H

    1993-01-01

    A somatic cell hybrid containing the synovial sarcoma-associated t(X;18)(p11.2;q11.2) derivative (der(X)) chromosome was used to characterize the translocation breakpoint region on the X chromosome. By using Southern hybridization of DNA from this der(X) hybrid in conjunction with Xp-region specific

  20. Correlative characteristic of cadmium in soils of steppe Dnieper region

    Directory of Open Access Journals (Sweden)

    N. M. Tsvetkova

    2015-09-01

    Full Text Available Much attention is paid to searching for methods of establishing environmental standards for objective assessment of admissibility of anthropogenic load on the biosphere. The main pollutants of the environment are xenobiotics; heavy metals such as cadmium occupy hold a special place among them. Cadmium is one of the most dangerous environmental toxic agents, belonging to the 1stclass of hazard. Due to insufficient and fragmented information available on the distribution of cadmium in the city edaphotopes, it’s necessary to conduct additional research, taking into account the properties of soils and the biological characteristics of every element. The paper shows the ratio of cadmium in soils and soil-forming rocks of steppe Dnieper region. Environmental assessment of cadmium content in Dniprodzerzhinsk city soilsis made, and the problem of topsoil contamination of the city as a territory of high anthropogenic load is considered. It is found that the content of cadmium down the profile in natural soil increases. Enrichment of the topsoil with cadmium occurs due to contamination. The value of movable forms content, expressed as a percentage of the total content, varies from 12% to 70%, providing the evidence of the technogenic origin of cadmium in Dniprodzerzhinsk city topsoil. General and proximate correlation analyses of interrelation of soil cadmium and specifically selected characteristics of soil (pH, humus, sulfate ions, dry solid, chloride ions, total alkalinity, hygroscopic moisture were made. It is established that cadmium concentration in the movable forms of natural soils of the steppe Dnieper region depends primarily on pH value. With the increase in pH value, concentration of movable cadmium in soil increases.

  1. Cadmium induces transcription independently of intracellular calcium mobilization.

    Directory of Open Access Journals (Sweden)

    Brooke E Tvermoes

    Full Text Available BACKGROUND: Exposure to cadmium is associated with human pathologies and altered gene expression. The molecular mechanisms by which cadmium affects transcription remain unclear. It has been proposed that cadmium activates transcription by altering intracellular calcium concentration ([Ca(2+](i and disrupting calcium-mediated intracellular signaling processes. This hypothesis is based on several studies that may be technically problematic; including the use of BAPTA chelators, BAPTA-based fluorescent sensors, and cytotoxic concentrations of metal. METHODOLOGY/PRINCIPAL FINDING: In the present report, the effects of cadmium on [Ca(2+](i under non-cytotoxic and cytotoxic conditions was monitored using the protein-based calcium sensor yellow cameleon (YC3.60, which was stably expressed in HEK293 cells. In HEK293 constitutively expressing YC3.60, this calcium sensor was found to be insensitive to cadmium. Exposing HEK293::YC3.60 cells to non-cytotoxic cadmium concentrations was sufficient to induce transcription of cadmium-responsive genes but did not affect [Ca(2+](i mobilization or increase steady-state mRNA levels of calcium-responsive genes. In contrast, exposure to cytotoxic concentrations of cadmium significantly reduced intracellular calcium stores and altered calcium-responsive gene expression. CONCLUSIONS/SIGNIFICANCE: These data indicate that at low levels, cadmium induces transcription independently of intracellular calcium mobilization. The results also support a model whereby cytotoxic levels of cadmium activate calcium-responsive transcription as a general response to metal-induced intracellular damage and not via a specific mechanism. Thus, the modulation of intracellular calcium may not be a primary mechanism by which cadmium regulates transcription.

  2. Critical review of animal carcinogenesis by cadmium and its inorganic compounds

    International Nuclear Information System (INIS)

    Animal carcinogenic biassays relative to 6 inorganic cadmium substances (cadmium metal, cadmium oxide, cadmium sulfide, cadmium sulfate, cadmium chloride and cadmium acetate) are reviewed (speciation). Critical evaluation of literature data on carcinogenicity has been performed by making reference to E.C. guidelines of good laboratory practice. There are few data on routes relevant for human risk assessment: experiments on inhalation demonstrate lung carcinogenicity of cadmium oxide, cadmium sulfide, cadmium sulfate and cadmium chloride in rats but not in mice nor in hamsters; no carcinogenic effects of cadmium compounds are observed following oral administration. For routes of less or no relevance for human risk assessment, some results are clearly positive: subcutaneous injection induces cancers in situ (various cadmium compounds), testicular tumours (cadmium sulfate and cadmium chloride) and prostatic tumours (cadmium chloride) but such effects are not observed using relevant malignancies in rats. With respect to other no relevant routes (intraperitoneal, intrarenal...) tumours are incidentally produced in situ, but not in remote organs. Numerous studies fail to demonstrate cadmium carcinogenicity, but methodologically acceptable negative ones are very limited in number. Accordingly strain dependent effects and dose effect relationship could not be thoroughly assessed

  3. 112例不明原因发热病因分析%112 cases of fever of unknown origin

    Institute of Scientific and Technical Information of China (English)

    蒋锐; 谢明; 王龙; 向永胜

    2011-01-01

    目的 探讨不明原因发热(FUO)的病因.方法 对医院2006年11月-2009年10月收治的112例不明原因发热患者的临床资料进行回顾性分析.结果 112例患者中,有98例最终明确诊断,确诊率为87.5%;感染性疾病62例,占63.3%,其中结核18例,占28.4%,结缔组织病19例,占19.4%,以成人Still病、系统性红斑狼疮多见;恶性肿瘤15例,占15.3%,以造血组织肿瘤多见,尤其是恶性淋巴瘤;仍有14例诊断不明,占12.5%.结论 FUO的病因中,感染性疾病的发病率远高于非感染性疾病,而非感染性疾病中,结缔组织疾病及恶性肿瘤所占比例较高;经全面而详细的临床资料采集及相关的辅助检查,大部分不明原因发热可以明确诊断.%OBJECTIVE To discuss the reason of fever unknown origin (FUO).METHODS From Nov 2006 to Oct 2009, 112 cases in our hospital were treated in patients with fever of unknown origin were retrospectively analyzed clinical data.RESULTS Totally 112 patients in the final diagnosis of 98 cases, diagnosis was 87.5%.Infectious diseases accounted for 63.3%, in which TB accounted for 28.4% (18/62), connective tissue disease accounted for 19.4% (19/98), adult Still disease, systemic lupus erythematosus, rheumatoid arthritis, more common.Cancer accounted for 15.3% to hematopoietic tissue tumors more common, especially in malignant lymphoma.Still 12.5% in the diagnosis was unknown.CONCLUSIONS Cause of FUO in the incidence of infectious diseases is much higher than non-infectious diseases, not infectious diseases, connective tissue diseases and a high proportion of malignant tumors, following a thorough and detailed clinical data collection and related auxiliary examination, most of the diagnosis of fever of unknown origin can be clearly diagnosed.

  4. Gene expression profiling in rat kidney after intratracheal exposure to cadmium-doped nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Coccini, Teresa, E-mail: teresa.coccini@fsm.it; Roda, Elisa [University of Pavia, European Centre for Nanomedicine (Italy); Fabbri, Marco; Sacco, Maria Grazia; Gribaldo, Laura [European Commission Institute for Health and Consumer Protection (IHCP), JRC (Italy); Manzo, Luigi [University of Pavia, European Centre for Nanomedicine (Italy)

    2012-08-15

    While nephrotoxicity of cadmium is well documented, very limited information exists on renal effects of exposure to cadmium-containing nanomaterials. In this work, 'omics' methodologies have been used to assess the action of cadmium-containing silica nanoparticles (Cd-SiNPs) in the kidney of Sprague-Dawley rats exposed intratracheally. Groups of animals received a single dose of Cd-SiNPs (1 mg/rat), CdCl{sub 2} (400 {mu}g/rat) or 0.1 ml saline (control). Renal gene expression was evaluated 7 and 30 days post exposure by DNA microarray technology using the Agilent Whole Rat Genome Microarray 4x44K. Gene modulating effects were observed in kidney at both time periods after treatment with Cd-SiNPs. The number of differentially expressed genes being 139 and 153 at the post exposure days 7 and 30, respectively. Renal gene expression changes were also observed in the kidney of CdCl{sub 2}-treated rats with a total of 253 and 70 probes modulated at 7 and 30 days, respectively. Analysis of renal gene expression profiles at day 7 indicated in both Cd-SiNP and CdCl{sub 2} groups downregulation of several cluster genes linked to immune function, oxidative stress, and inflammation processes. Differing from day 7, the majority of cluster gene categories modified by nanoparticles in kidney 30 days after dosing were genes implicated in cell regulation and apoptosis. Modest renal gene expression changes were observed at day 30 in rats treated with CdCl{sub 2}. These results indicate that kidney may be a susceptible target for subtle long-lasting molecular alterations produced by cadmium nanoparticles locally instilled in the lung.

  5. HAND-FOOT-MOUTH DISEASE IN QINGDAO: AN EPIDEMIOLOGICAL AND CLINICAL ANALYSIS OF 112 CASES%青岛市112例手足口病病人临床流行病学特征分析

    Institute of Scientific and Technical Information of China (English)

    李延年; 王海燕; 孙波; 谭丽莉; 李萍; 赵真

    2012-01-01

    目的 探讨青岛市手足口病的临床流行病学特征.方法 回顾性分析我院2010年春夏季诊治的112例手足口病病人的临床流行病学特征.结果 112例中,6岁以下儿童占96.11%,确认有密切接触史者91例(81.25%);临床表现为发热105例(93.75%),手足部皮疹各112例(100%)和104例(92.86%),口腔疱疹及口腔疼痛112例(100%),厌食102例(91.07%),咳嗽41例(36.61%),呕吐13例(11.61%),头痛9例(8.03%),腹泻5例(4.46%).有107例病人(95.54%)1周内治愈,3例10 d内治愈,1例并发病毒性心肌炎,1例出现腹泻,所有病人均无休克、脑炎等严重并发症,无死亡病例.结论 做到早发现、早诊断、早隔离、早治疗是关键,同时应加强疫情监测,将防控工作的重点放在幼儿园和小学.%Objective To investigate the clinical epidemiology of hand-foot-mouth (HFM) disease in Qingdao. Methods A retrospective analysis of clinical epidemiological features in 112 patients with HFM disease treated in our hospital during spring-summer season of 2010. Results Of the 112 cases, children under six years old accounted for 96,11%, those who had a close contact history was confirmed in 91(81. 25%). Clinical manifestations were as follows- fever 105(93. 75%), skin rash on hand and foot 112(100%) and 104(92.86%), respectively, herpes and pain of mouth 112(100%), anorexia 102(91.07%), cough 41(36.61%), vomiting 13(11.61%), headache nine (8. 03%), and diarrhea five (4.46%). After treatment, 107(95.54%) were cured within one week, three within 10 days, one complicated viral myocarditis and one developed diarrhea. No severe complications, such as shock and encephalitis, and death were recorded. Conclusion Early identification, early treatment, and early isolation are the key for this condition. Epidemic situation monitoring should be enhanced. Kindergartens and primary schools should be targeted as the focal point for prevention and control of this disease.

  6. Long non-coding RNAs as novel expression signatures modulate DNA damage and repair in cadmium toxicology

    Science.gov (United States)

    Zhou, Zhiheng; Liu, Haibai; Wang, Caixia; Lu, Qian; Huang, Qinhai; Zheng, Chanjiao; Lei, Yixiong

    2015-10-01

    Increasing evidence suggests that long non-coding RNAs (lncRNAs) are involved in a variety of physiological and pathophysiological processes. Our study was to investigate whether lncRNAs as novel expression signatures are able to modulate DNA damage and repair in cadmium(Cd) toxicity. There were aberrant expression profiles of lncRNAs in 35th Cd-induced cells as compared to untreated 16HBE cells. siRNA-mediated knockdown of ENST00000414355 inhibited the growth of DNA-damaged cells and decreased the expressions of DNA-damage related genes (ATM, ATR and ATRIP), while increased the expressions of DNA-repair related genes (DDB1, DDB2, OGG1, ERCC1, MSH2, RAD50, XRCC1 and BARD1). Cadmium increased ENST00000414355 expression in the lung of Cd-exposed rats in a dose-dependent manner. A significant positive correlation was observed between blood ENST00000414355 expression and urinary/blood Cd concentrations, and there were significant correlations of lncRNA-ENST00000414355 expression with the expressions of target genes in the lung of Cd-exposed rats and the blood of Cd exposed workers. These results indicate that some lncRNAs are aberrantly expressed in Cd-treated 16HBE cells. lncRNA-ENST00000414355 may serve as a signature for DNA damage and repair related to the epigenetic mechanisms underlying the cadmium toxicity and become a novel biomarker of cadmium toxicity.

  7. Levels of arsenic, cadmium, lead and mercury in the branchial plate and muscle tissue of mobulid rays

    International Nuclear Information System (INIS)

    Highlights: • Branchial plate and muscle tissue from mobulid rays were analysed for certain metals. • Mean concentrations of cadmium in Mobula japanica were above the EC ML. • Mean inorganic arsenic concentration in Mobula japanica muscle equalled the FSANZ ML. • Mean concentration of lead in Manta alfredi muscle tissue exceeded EC and Codex MLs. • There were significant correlations between the types of tissues for some metals. - Abstract: Mobulid rays are targeted in fisheries for their branchial plates, for use in Chinese medicine. Branchial plate and muscle tissue from Mobula japanica were collected from fish markets in Sri Lanka, and muscle tissue biopsies from Manta alfredi in Australia. These were analysed for arsenic, cadmium, lead and mercury and compared to maximum levels (MLs) set by Food Standards Australia and New Zealand (FSANZ), European Commission (EC) and Codex Alimentarius Commission. The estimated intake for a vulnerable human age group was compared to minimal risk levels set by the Agency for Toxic Substances and Disease Registry. The mean inorganic arsenic concentration in M. japanica muscle was equivalent to the FSANZ ML while cadmium exceeded the EC ML. The mean concentration of lead in M. alfredi muscle tissue exceeded EC and Codex MLs. There were significant positive linear correlations between branchial plate and muscle tissue concentrations for arsenic, cadmium and lead

  8. Cadmium interferes with the degradation of ATF5 via a post-ubiquitination step of the proteasome degradation pathway

    International Nuclear Information System (INIS)

    ATF5 is a member of the CREB/ATF family of transcription factors. In the current study, using a transient transfection system to express FLAG epitope fusion proteins of ATF5, we have shown that CdCl2 or NaAsO3 increases the protein levels of ATF5 in cells, and that cadmium stabilizes the ATF5 protein. Proteasome inhibitors had a similar effect to cadmium on the cellular accumulation of ATF5. Proteasome inhibition led to an increase in ubiquitinated ATF5, while cadmium did not appear to reduce the extent of ATF5 ubiquitination. ATF5 contains a putative nuclear export signal within its N-terminus. We demonstrated that whereas deletion of N-terminal region resulted in a increase of ATF5 levels, this region does not appear to be involved in the ubiquitination of ATF5. These results indicate that ATF5 is targeted for degradation by the ubiquitin-proteasome pathway, and that cadmium slows the rate of ATF5 degradation via a post-ubiquitination mechanism.

  9. Comparative genomic analyses identify common molecular pathways modulated upon exposure to low doses of arsenic and cadmium

    Directory of Open Access Journals (Sweden)

    Fry Rebecca C

    2011-04-01

    Full Text Available Abstract Background Exposure to the toxic metals arsenic and cadmium is associated with detrimental health effects including cancers of various organs. While arsenic and cadmium are well known to cause adverse health effects at high doses, the molecular impact resulting from exposure to environmentally relevant doses of these metals remains largely unexplored. Results In this study, we examined the effects of in vitro exposure to either arsenic or cadmium in human TK6 lymphoblastoid cells using genomics and systems level pathway mapping approaches. A total of 167 genes with differential expression were identified following exposure to either metal with surprisingly no overlap between the two. Real-time PCR was used to confirm target gene expression changes. The gene sets were overlaid onto protein-protein interaction maps to identify metal-induced transcriptional networks. Interestingly, both metal-induced networks were significantly enriched for proteins involved in common biological processes such as tumorigenesis, inflammation, and cell signaling. These findings were further supported by gene set enrichment analysis. Conclusions This study is the first to compare the transcriptional responses induced by low dose exposure to cadmium and arsenic in human lymphoblastoid cells. These results highlight that even at low levels of exposure both metals can dramatically influence the expression of important cellular pathways.

  10. Drikkevands optagelse af cadmium og bly fra armaturer

    DEFF Research Database (Denmark)

    Nielsen, K.

    Notatet omfatter rapporter fra to forsøgsrækker vedr. brugsvands optagelse af bly og cadmium. Den første omhandler brugsvandsarmaturers afgivelse af bly og cadmium til syntetisk brugsvand med en sammensætning svarende til en sur, blød vandtype. Forsøgene omfatter 10 armaturer og armaturdele...

  11. Cadmium-induced ectopic apoptosis in zebrafish embryos

    Energy Technology Data Exchange (ETDEWEB)

    Chan, Po Kwok; Cheng, Shuk Han [Department of Biology and Chemistry, City University of Hong Kong, 83 Tat Chee Avenue, Kowloon (Hong Kong)

    2003-02-01

    In this study, we tested the hypothesis that cadmium-induced developmental toxicity was mediated via ectopic occurrence of apoptosis during embryonic development. We employed confocal microscopy to acquire images of whole-mount staining of apoptotic cells in zebrafish embryo exposed to 100 {mu}M cadmium from 5 hours post fertilisation (hpf) to 28 hpf. Three-dimensional reconstruction of the images was performed and the spatial and temporal distributions of apoptotic cells in the embryos were compared. In cadmium-treated embryos with varying degrees of gross developmental malformations, significantly higher numbers of apoptotic cells were detected with this method. In order to detect the precise locations of apoptotic cells, we performed terminal deoxynucleotidyl transferase-mediated dUTP nick end labelling (TUNEL) assay in sectioned embryos. In the degenerating neural tube of cadmium-treated embryos apoptotic cells were detected, while in the healthy neural tube of the untreated controls no apoptotic cells were found. We then employed flow cytometry to investigate whether cadmium exposure would affect the dynamics of apoptosis or induce any abnormalities in cell-cycle progression. It appeared that cadmium did not induce cell-cycle arrest. The percentages of apoptotic cells did not differ in the two groups at 13, 16 or 19 hpf. At 28 hpf, however, a significantly higher percentage of apoptotic cells were found in the cadmium-treated group. Exposure to cadmium, therefore, induced ectopic apoptosis at 28 hpf without affecting the dynamics of apoptosis at earlier developmental stages. (orig.)

  12. Cadmium inhibits neurogenesis in zebrafish embryonic brain development

    Energy Technology Data Exchange (ETDEWEB)

    Chow, Elly Suk Hen [Division of Biology, California Institute of Technology, 1200 California Boulevard, Pasadena, CA 91125 (United States); Hui, Michelle Nga Yu; Lin Chunchi [Department of Biology and Chemistry, City University of Hong Kong, 83 Tat Chee Avenue, Kowloon, Hong Kong (China); Cheng Shukhan [Department of Biology and Chemistry, City University of Hong Kong, 83 Tat Chee Avenue, Kowloon, Hong Kong (China)], E-mail: bhcheng@cityu.edu.hk

    2008-05-01

    Cadmium is a non-essential heavy metal found abundantly in the environment. Children of women exposed to cadmium during pregnancy display lower motor and perceptual abilities. High cadmium body burden in children is also related to impaired intelligence and lowered school achievement. However, little is known about the molecular and cellular basis of developmental neurotoxicity in the sensitive early life stages of animals. In this study, we explore neurological deficits caused by cadmium during early embryonic stages in zebrafish by examining regionalization of the neural tube, pattern formation and cell fate determination, commitment of proneural genes and induction of neurogenesis. We show that cadmium-treated embryos developed a smaller head with unclear boundaries between the brain subdivisions, particularly in the mid-hindbrain region. Embryos display normal anterior to posterior regionalization; however, the commitment of neural progenitor cells was affected by cadmium. We observe prominent reductions in the expression of several proneuronal genes including ngn1 in cell clusters, zash1a in the developing optic tectum, and zash1b in the telencephalon and tectum. Cadmium-treated embryos also have fewer differentiated neurons and glia in the facial sensory ganglia as indicated by decreased zn-12 expression. Also, a lower transcription level of neurogenic genes, ngn1 and neuroD, is observed in neurons. Our data suggest that cadmium-induced neurotoxicity can be caused by impaired neurogenesis, resulting in markedly reduced neuronal differentiation and axonogenesis.

  13. Epigenetic Effects of Cadmium [Abstract and Poster 2014

    Science.gov (United States)

    We have reviewed the literature on in vitro and in vivo experiments as well as human studies on cadmium to understand the epigenetic mechanisms involved in cadmium- induced toxicity and carcinogenicity. This presentation will identify gaps in our current understanding and suggest...

  14. Electrolytic indium refining from cadmium in glycerine electrolyte

    International Nuclear Information System (INIS)

    The results of investigations directed on development of electrochemical indium cleaning from cadmium in glycerine base electrolyte are presented. Optimal operational conditions, specific consumption of reactants and electric power are determined. Relationship between variation of concentration of cadmium impurity in refined metal and duration of electrolysis is revealed. The method for determination of cleaning time is proposed. Developed process was put into commercial operation

  15. Method of making a thin film cadmium telluride solar cell

    International Nuclear Information System (INIS)

    A method for making a photovoltaic cell is described comprising the steps of: (a) depositing a transparent or semi-transparent conductive window layer onto a substrate; (b) depositing a layer of cadmium telluride including phosphorus onto the window layer; (c) depositing a layer of lead telluride onto the layer of cadmium telluride; and (d) depositing a metallic electrode onto the lead telluride layer

  16. Removing cadmium from electroplating wastewater by waste saccharomyces cerevisiae

    Institute of Scientific and Technical Information of China (English)

    DAI Shu-juan; WEI De-zhou; ZHOU Dong-qin; JIA Chun-yun; WANG Yu-juan; LIU Wen-gang

    2008-01-01

    The appropriate condition and scheme of removing cadmium from electroplating wastewater were investigated by adsorption-precipitation method using waste saccharomyces cerevisiae(WSC) as sorbent. Effect factors on biosorption of cadmium in cadmium-containing electroplating wastewater by waste saccharomyces cerevisiae and precipitation process of waste saccharomyces cerevisiae after adsorbing cadmium were studied. The results show that removal rate of cadmium is over 88% after 30 min adsorbing under the condition of cadmium concentration 26 mg/L, the dosage of waste saccharomyces cerevisiae 16.25 g/L, temperature 18 ℃, pH 6.0 and precipitation time 4 h. Biosorption-precipitation method is effective to remove cadmium in cadmium-containing electroplating wastewater by waste saccharomyces cerevisiae. The SEM, infrared spectroscopy and Zeta-potential of the cells show that chemical chelating is the main adsorption form; electrostatic attraction, hydrogen bonding and van der Waals force all function in adsorption process; and ―NH2―,―C=O―,―C=O―NH―,―CH3, ―OH are the main adsorption groups.

  17. Cadmium and zinc reversibly arrest development of Artemia larvae

    Energy Technology Data Exchange (ETDEWEB)

    Bagshaw, J.C.; Rafiee, P.; Matthews, C.O.; MacRae, T.H.

    1986-08-01

    Despite the widespread distribution of heavy metals such as cadmium and zinc in the environment and their well-known cytotoxicity and embryotoxicity in mammals, comparatively little is known about their effect on aquatic organisms, particularly invertebrates. Post-gastrula and early larval development of the brine shrimp, Artemia, present some useful advantages for studies of developmental aspects of environmental toxicology. Dormant encysted gastrulae, erroneously called brine shrimp eggs, can be obtained commercially and raised in the laboratory under completely defined conditions. Following a period of post-gastrula development within the cyst, pre-nauplius larvae emerge through a crack in the cyst shell. A few hours later, free-swimming nauplius larvae hatch. Cadmium is acutely toxic to both adults and nauplius larvae of Artemia, but the reported LC50s are as high as 10 mM, depending on larval age. In this paper the authors show that pre-nauplius larvae prior to hatching are much more sensitive to cadmium than are hatched nauplius larvae. At 0.1 ..mu..m, cadmium retards development and hatching of larvae; higher concentrations block hatching almost completely and thus are lethal. However, the larvae arrested at the emergence stage survive for 24 hours or more before succumbing to the effects of cadmium, and during this period the potentially lethal effect is reversible if the larvae are placed in cadmium-free medium. The effects of zinc parallel those of cadmium, although zinc is somewhat less toxic than cadmium at equal concentrations.

  18. Cadmium Removal from Aqueous Solutions by Ground Pine Cone

    Directory of Open Access Journals (Sweden)

    H Izanloo, S Nasseri

    2005-01-01

    Full Text Available A study on the removal of cadmium ions from aqueous solutions by pine cone was conducted in batch conditions. Kinetic data and equilibrium removal isotherms were obtained. The influence of different experimental parameters such as contact time, initial concentration of cadmium, pine cone mass and particle size, and temperature on the kinetics of cadmium removal was studied. Results showed that the main parameters that played an important role in removal phenomenon were initial cadmium concentration, particle size and pine cone mass. The necessary time to reach equilibrium was between 4 and 7 hours based on the initial concentration of cadmium. The capacity of cadmium adsorption at equilibrium increased with the decrease of pine cone particle size. The capacity of cadmium adsorption at equilibrium by pine cone increased with the quantity of pine cone introduced (1–4 g/L. Temperature in the range of 20-30°C showed a restricted effect on the removal kinetics (13.56 mg/g at 20°C and a low capacity of adsorption about 11.48 mg/g at 30°C. The process followed pseudo second-order kinetics. The cadmium uptake of pine cone was quantitatively evaluated using adsorption isotherms. Results indicated that the Langmuir model gave a better fit to the experimental data in comparison with the Freundlich equation.

  19. Effect of environmental exposure to Cadmium on pregnancy outcome

    Directory of Open Access Journals (Sweden)

    F. Ramezanzadeh

    2010-04-01

    Full Text Available "n "n "nBackgrounds andObjectives:The objective of the present study was to evaluate the potential effect of environmental exposure to toxic metal (cadmium on pregnancy outcome and fetal growth."nMaterials and Methods: 330 normal pregnant women were randomly selected from vali-e-asr hospital, from July 2003 through Feb. 2005. Cadmium was measured in umbilical cord blood and mother whole blood of postpartum women without occupational exposure to metals in Tehran, Iran, using inductively coupled plasma mass spectrometry"nResult: Whole blood cadmium and cord blood cadmium ranged from 0/00 to 6/30 μg/L ,respectivly. in the group higher level of maternal blood cadmium (> 0.40 μg/L 1cm decrease was seen in neonatal birth height. (p = 0.007 There was a significant association between cadmium exposure and birth weight.Mann-whitney test showed that, maternal blood cadmium level, was significantly negatively associated with neonatal birth weight (z = -1.83, P < 0.06."nConclusion: It was concluded that environmental exposure to cadmium significantly reduces neonatal birth height.

  20. Risk of overestimation of urinary cadmium concentrations: interference from molybdenum

    Directory of Open Access Journals (Sweden)

    Cañas A.I.

    2013-04-01

    Full Text Available We show here that the selection of analytical method is critical when measuring low levels of cadmium in human urine. Cadmium is today usually analyzed by Inductively Coupled Plasma Mass Spectrometry (ICP-MS, which has a higher sensitivity than Atomic Absorption Spectroscopy (AAS. ICP-MS cadmium measurements show interference from tin (114Sn and molybdenum oxides, which can result in an overestimation of cadmium levels. The 114Sn interference is stable and can be mathematically corrected. Molybdenum concentrations in urine are variable and different from individual to individual. We have estimated the degree of error which molybdenum interference introduces in the measurement of cadmium in urine by conventional ICP-MS. 268 urine samples from mothers and their children were measured. Removal of the molybdenum oxide interference (DRC-ICP-MS method reduced urinary cadmium concentrations significantly (47.8%. The urinary molybdenum concentration in children was higher than in their mothers, resulting in greater overestimation. Our results clearly show that the DRC method is essential for reliable measurements of urinary cadmium concentrations, particularly in children. Furthermore, care should be taken when comparing Human Biomonitoring data for cadmium in urine and attention should be paid to which analytical method has been used (e.g. AAS and ICP-Ms, and especially if the measurements have been corrected for molybdenum interference.

  1. Identification of proteins that interact with murine cytomegalovirus early protein M112-113 in brain

    Institute of Scientific and Technical Information of China (English)

    WANG Hui; LIU Xing-lou; SHU Sai-nan; HUANG Yong-jian; FANG Feng

    2011-01-01

    Background Murine cytomegalovirus (MCMV) early protein M112-113 is involved in viral DNA replication and believed to play a crucial role in the viral pathogenesis.To investigate the biological function of M112-113 protein in the pathogenesis of the brain disorders caused by cytomegalovirus (CMV),a screening for proteins interacting with M112-113 was performed by a yeast two-hybrid system.Methods Bait plasmid pGBKT7-M112-113 was constructed and transformed into AH109 yeast.After confirmation of the expression of MCMV M112-113 in yeast,the bait yeast was mated with a prey yeast containing mouse brain cDNA library plasmid to screen the proteins interacting with M112-113.Interactions between M112-113 and the obtained proteins were verified by yeast two-hybrid assay and chemiluminescent co-immunoprecipitaion.Results Two proteins interacting with M112-113 were identified,including metastasis-associated 1 (MTA1) and zinc finger,CCHC domain containing 18 (ZCCHC18).M112-113 protein could interact with MTA1 or ZCCHC18 in yeast and mammalian cells.Conclusion The interactions of M112-113 with MTA1 or ZCCHC18 may be related to the pathogenesis of MCMV-associated disease in central nervous system.

  2. The effect of phosphate fertilizer cadmium on cadmium in soils and crops

    NARCIS (Netherlands)

    Smilde, K.W.; Luit, van B.

    1983-01-01

    Een van de oorzaken, waardoor bodemvervuiling met cadmium optreedt en dus een bevordering van cadmiumopname door het gewas, is toepassing van fosfaatkunstmest, waarin zich verschillende gehaltes van dit zware metaal bevinden. Dit rapport behandelt het onderzoek naar de stijging van het cadmiumgehalt

  3. SORPTION OF CADMIUM ONTO DIFFERENT FRACTIONS OF BIOSOLIDS AND CADMIUM SALT AMENDED SOILS

    Science.gov (United States)

    Biosolids and Cd salt-amended soils were collected from a long-term field experiment established in 1976. Cadmium sorption experiments were conducted on different fractions of soils amended with biosolids, Cd salt, and unamended soils (control). The organic carbon (OC) of soils ...

  4. Comparison of toxicity and disposition of cadmium chloride and cadmium metallothionein in rats.

    NARCIS (Netherlands)

    Groten, J.P.

    1992-01-01

    In Chapter 1 of this thesis a general introduction is presented with a survey of the literature. It gives a brief overview of the factors involved in the absorption, metabolism and toxicity of Cd after oral intake.In short, the main source of environmental exposure to cadmium for no

  5. Cadmium chronic administration to lactating ewes. Reproductive performance, cadmium tissue accumulation and placental transfer

    Energy Technology Data Exchange (ETDEWEB)

    Floris, B.; Bomboi, G.; Sechi, P.; Marongiu, M. L. [Sassari Univ., Sassari (Italy). Dipt. di Biologia Animale; Pirino, S. [Sassari Univ., Sassari (Italy). Ist. di Patologia Generale, Anatomia Patologica e Clinica Ostetrico-chirurgica Veterinaria

    2000-12-01

    20 lactating ewes were allotted to two groups: 10 subjects received orally 100 mg/day of CdCl{sub 2} for 108 consecutive days, and the remaining 10 acted as control. Reproductive performance in ewes and cadmium tissue accumulation, both in ewes and their lambs, were investigated. The results showed that in ewes: 1) the regular cadmium intestinal intake negatively influences all reproductive parameters; 2) cadmium is particularly accumulated in kidney and liver, bur also in mammary gland, although at distinctly lower level; 3) chronic administration does not increase cadmium placental transfer in lactating pregnant subjects. [Italian] 20 pecore in lattazione sono state suddivise in 2 gruppi: 10 soggetti ricevettero per os 100 mg/giorno di CdCl{sub 2} per 108 giorni consecutivi, e i restanti 10 funsero da controllo. Sono stati studiati i parametri riproduttivi delle pecore e l'accumulo di cadmio nei tessuti, sia delle pecore che dei loro agnelli. I risultati hanno mostrato che negli ovini: 1) il regolare assorbimento intestinale di cadmio influenza negativamente tutti i parametri riproduttivi; 2) il cadmio viene accumulato principalmente nei reni e nel fegato, ma anche dalla ghiandola mammaria, sebbene in misura nettamente inferiore; 3) la somministrazione cronica di cadmio nei soggetti gravidi non incrementa il suo passaggio transplacentare.

  6. Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

    International Nuclear Information System (INIS)

    Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt, which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed

  7. Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

    Energy Technology Data Exchange (ETDEWEB)

    Adámik, Matej [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Bažantová, Pavla [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava (Czech Republic); Navrátilová, Lucie; Polášková, Alena [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Pečinka, Petr [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava (Czech Republic); Holaňová, Lucie [Department of Chemical Drugs, Faculty of Pharmacy, University of Veterinary and Pharmaceutical Sciences, Palackého 1/3, 61242 Brno (Czech Republic); Tichý, Vlastimil [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Brázdová, Marie, E-mail: maruska@ibp.cz [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Department of Chemical Drugs, Faculty of Pharmacy, University of Veterinary and Pharmaceutical Sciences, Palackého 1/3, 61242 Brno (Czech Republic)

    2015-01-02

    Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt, which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.

  8. Adsorption of cadmium from aqueous solutions by perlite.

    Science.gov (United States)

    Mathialagan, T; Viraraghavan, T

    2002-10-14

    The present study examined the use of perlite for the removal of cadmium from aqueous solutions. The effects of pH and contact time on the adsorption process were examined. The optimum pH for adsorption was found to be 6.0. Residual cadmium concentration reached equilibrium in 6h and the rate of cadmium adsorption by perlite was rapid in the first hour of the reaction time. Ho's pseudo-second-order model best described the kinetics of the reaction. Batch adsorption experiments conducted at room temperature (22+/-1 degrees C) showed that the adsorption pattern followed the Freundlich isotherm model. The maximum removal of cadmium obtained from batch studies was 55%. Thomas model was used to describe the adsorption data from column studies. The results generally showed that perlite could be considered as a potential adsorbent for cadmium removal from aqueous solutions.

  9. Cadmium adsorption in montmorillonite as affected by glyphosate

    Institute of Scientific and Technical Information of China (English)

    WANG Yu-jun; ZHOU Dong-mei; LUO Xiao-san; SUN Rui-juan; CHEN Huai-man

    2004-01-01

    Behaviors of soil heavy metals are often affected by coexisting herbicides due to their physical and chemical interaction. Effect of glyphosate, an herbicide containing -PO32- and -COOH groups, on cadmium adsorption in montmorillonite was studied in detail. The results showed that cadmium adsorption quantity in montmorillonite increased with increasing soil solution pH and cadmium concentration as usual, but decreased with glyphosate, which is due to the formation of a low affinity complex of Cd and glyphosate and decreasing solution pH induced by glyphosate addition. When the equilibrium solution pH was below 6.7, glyphosate has little effect on cadmium adsorption, but when the equilibrium solution pH was above 6.7, glyphosate significantly decreased cadmium adsorption quantity in montmorillonite. In addition, the adding order of Cd and glyphosate also influenced Cd adsorption quantity in montmorillonite.

  10. Synthesis of cadmium chalcogenide nanotubes at room temperature

    KAUST Repository

    Pan, Jun

    2012-10-01

    Cadmium chalcogenide (CdE, E=S, Se, Te) polycrystalline nanotubes have been synthesized from precursor of CdS/cadmium thiolate complex at room temperature. The precursor was hydrothermally synthesized at 180 °C using thioglycolic acid (TGA) and cadmium acetate as starting materials. The transformation from the rod-like precursor of CdS/cadmium thiolate complex to CdS, CdSe and CdTe nanotubes were performed under constant stirring at room temperature in aqueous solution containing S 2-, Se 2- and Te 2-, respectively. The nanotube diameter can be controlled from 150 to 400 nm related to the dimension of templates. The XRD patterns show the cadmium chalcogenide nanotubes all corresponding to face-centered cubic structure. © 2012 Elsevier B.V. All rights reserved.

  11. Determination of the cadmium and copper content inherent to metallothionein

    Energy Technology Data Exchange (ETDEWEB)

    Raspor, B.; Kozar, S.; Pavicic, J.; Juric, D. [Ruder Boskovic Institute, Center for Marine Research Zagreb, P.O.B. 1016, HR-10 001 Zagreb (Croatia)

    1998-05-01

    The reliability of the voltammetric determination of the cadmium and copper content (at pH 1.0), inherent to metallothionein (MT) isolated from the digestive gland of Mytilus galloprovincialis, was investigated. An artifact signal enhancement of copper, caused by the cupric-thionein complex adsorption at the mercury electrode, was established. This artifact was removed by UV-digestion of the sample for 15-20 h prior to analysis. A similar artifact was not detected for cadmium, because at this pH the cadmium-thionein complex has dissociated, and cadmium exists in the ionic form. Therefore, the voltammetric analysis of the cadmium content can be performed directly at pH 1.0, without prior UV-digestion of the sample. (orig.) With 3 figs., 1 tab., 12 refs.

  12. Effect of pregnancy on cadmium-treated rats

    Energy Technology Data Exchange (ETDEWEB)

    Takizama, Y. (Akita Univ. School of Medicine, Japan); Nakamura, I.; Kurayama, R.; Hirasawa, F.; Kawai, K.

    1982-01-01

    It is well known that itai-itai disease with the osteopathy is broken out among multiparas, 40 years of age and up Japanese residents. In this paper we described an experimental study of effect of pregnancy on cadmium treated rats. Female mature rats were administered drinking water containing 50 and 200 ppm cadmium as CdCl/sub 2/. During 180 days of the experiment, three times of pregnancy were succesful, though slight depression of body weight gain was noticed in the 200 ppm group. The cadmium was accumulated in the kidneys, liver and bone proportionally to the amount of cadmium administered. No significant change was recognized in serum calcium, phosphorus and alkaline phosphatase levels after 180 days. Though cadmium 200 ppm treated rats showed slight histological lesions in the proximal convoluted tubules of the kidney, there appeared to be no osteomalacia including excess formation of osteoid tissue.

  13. Irradiation performance of PFBR MOX fuel after 112 GWd/t burn-up

    Energy Technology Data Exchange (ETDEWEB)

    Venkiteswaran, C.N., E-mail: cnv@igcar.gov.in; Jayaraj, V.V.; Ojha, B.K.; Anandaraj, V.; Padalakshmi, M.; Vinodkumar, S.; Karthik, V.; Vijaykumar, Ran; Vijayaraghavan, A.; Divakar, R.; Johny, T.; Joseph, Jojo; Thirunavakkarasu, S.; Saravanan, T.; Philip, John; Rao, B.P.C.; Kasiviswanathan, K.V.; Jayakumar, T.

    2014-06-01

    The 500 MWe Prototype Fast Breeder Reactor (PFBR) which is in advanced stage of construction at Kalpakkam, India, will use mixed oxide (MOX) fuel with a target burnup of 100 GWd/t. The fuel pellet is of annular design to enable operation at a peak linear power of 450 W/cm with the requirement of minimum duration of pre-conditioning. The performance of the MOX fuel and the D9 clad and wrapper material was assessed through Post Irradiation Examinations (PIE) after test irradiation of 37 fuel pin subassembly in Fast Breeder Test Reactor (FBTR) to a burn-up of 112 GWd/t. Fission product distribution, swelling and fuel–clad gap evolution, central hole diameter variation, restructuring, fission gas release and clad wastage due to fuel–clad chemical interaction were evaluated through non-destructive and destructive examinations. The examinations have indicated that the MOX fuel can safely attain the desired target burn-up in PFBR.

  14. Auditory Evoked M100 Response Latency is Delayed in Children with 16p11.2 Deletion but not 16p11.2 Duplication.

    Science.gov (United States)

    Jenkins, Julian; Chow, Vivian; Blaskey, Lisa; Kuschner, Emily; Qasmieh, Saba; Gaetz, Leah; Edgar, J Christopher; Mukherjee, Pratik; Buckner, Randall; Nagarajan, Srikantan S; Chung, Wendy K; Spiro, John E; Sherr, Elliott H; Berman, Jeffrey I; Roberts, Timothy P L

    2016-05-01

    Individuals with the 16p11.2 BP4-BP5 copy number variant (CNV) exhibit a range of behavioral phenotypes that may include mild impairment in cognition and clinical diagnoses of autism spectrum disorder (ASD). To better understand auditory processing impairments in populations with this chromosomal variation, auditory evoked responses were examined in children with the 16p11.2 deletion, 16p11.2 duplication, and age-matched controls. Stimuli consisted of sinusoidal binaural tones presented passively while children underwent recording with magnetoencephalography (MEG). The primary indicator of auditory processing impairment was the latency of the ∼100-ms "M100" auditory response detected by MEG, with the 16p11.2 deletion population exhibiting profoundly delayed M100 latencies relative to controls. This delay remained even after controlling for potential confounds such as age and cognitive ability. No significant difference in M100 latency was observed between 16p11.2 duplication carriers and controls. Additionally, children meeting diagnostic criteria for ASD (16p11.2 deletion carriers) exhibited nonsignificant latency delays when compared with the corresponding CNV carriers not meeting criteria for ASD. Present results indicate that 16p11.2 deletion is associated with auditory processing delays analogous to (but substantially more pronounced than) those previously reported in "idiopathic" ASD. PMID:25678630

  15. Onset of deformation at $N = 112$ in Bi nuclei

    CERN Document Server

    Pai, H; Raut, R; Basu, S K; Goswami, A; Chanda, S; Bhattacharjee, T; Bhattacharyya, S; Bhattacharya, C; Bhattacharya, S; Banerjee, S R; Kundu, S; Banerjee, K; Dey, A; Rana, T K; Meena, J K; Gupta, D; Mukhopadhyay, S; Bhattacharya, Srijit; Bhattacharya, Sudeb; Ganguly, S; Kshetri, R; Pradhan, M K

    2012-01-01

    The high spin states in $^{195}$Bi has been studied by $\\gamma$-ray spectroscopic method using the $^{181}$Ta($^{20}$Ne, 6n) fusion evaporation reaction at 130 MeV. The $\\gamma\\gamma$ coincidence data were taken using an array of 8 clover HPGe detectors. The spin and parity assignments of the excited states have been made from the measured directional correlation from oriented states (DCO) ratios and integrated polarization asymmetry (IPDCO) ratios. The results show, for the first time, the evidence of a rotational like band based on a 13/2$^+$ band head in this nucleus, indicating the onset of deformation at neutron number $N = 112$ for the Bismuth isotopes. The results obtained were found to be consistent with the prediction of the total Routhian surface calculations using Woods Saxon potential. The same calculations also predict a change in shape from oblate to triaxial in $^{195}$Bi at high rotational frequency.

  16. Effects of diethyldithiocarbamate on the toxicokinetics of cadmium chloride in mice

    DEFF Research Database (Denmark)

    Andersen, O; Nielsen, J B

    1989-01-01

    Diethyldithiocarbamate (DDC) efficiently alleviates the acute toxicity of injected cadmium chloride, but enhances the acute toxicity of orally administered cadmium chloride. Further, DDC induces extensive changes in organ distribution of cadmium, and mobilizes aged cadmium depots. The present study...... investigates effects of DDC on the toxicokinetics of cadmium at lower doses of cadmium than those used in previous studies. During single exposure to subtoxic oral doses of cadmium chloride DDC enhanced intestinal cadmium absorption, both after intraperitoneal and oral administration of DDC. In such acute...... exposure experiments orally administered DDC only slightly changed the relative organ distribution of absorbed cadmium, while intraperitoneal administration of DDC induced extensive changes in organ preference of absorbed cadmium. The relative hepatic and testicular deposition was reduced, while...

  17. Management of Thoracic Empyema: Review of 112 Cases

    Directory of Open Access Journals (Sweden)

    Ommolbanin Abed

    2012-03-01

    Full Text Available To review our experience in treatment of patients with thoracic empyema at a teaching hospital chart of patients were retrospectively reviewed over a 72-month period. A total of 112 patients (94 men, 18 women, mean age: 39, range: 6-89 years underwent therapeutic procedures for thoracic empyema between 2001-2006. The causes of empyema included parapneumonic empyema (60.7%, thoracic trauma (20.5%, surgical procedures (7.1% and seeding from an extra-pulmonary source (11.7%. Multiloculated empyemas were documented in 45 patients (40%. Insertion of chest tube was the first procedure in 103 patients (92%. Nineteen patients (17% were treated by thoracotomy, ten patients (8.9% had fibrinolytic therapy, eight patients (7.2% underwent video assisted thoracic surgery (VATS and sixteen patients (14.3% had subsequent radiologic-guided drainage. Thoracotomy-Decortication was successful in 90% of patients undergoing surgery and the least successful intervention was tube thoracostomy alone. Twelve of 112 patients (10.7% died in the hospital including one patient in the thoracotomy group. Long-term follow-up was available in 67 patients including all of patients requiring surgery and fibrinolytic therapy. Thirty four patients (50% obtained complete functional recovery. Simple drainage as the first procedure for the treatment of thoracic empyema has a high failure rate. Selection of a therapeutic option should be based on age, underlying disease, stage of the empyema, state of the loculation, local expertise and availability. Surgical procedures such as VATS or thoracotomy are recommended as the first procedure in elderly patients and advanced empyema.

  18. Fast-neutron scattering from elemental cadmium

    International Nuclear Information System (INIS)

    Neutron differential-elastic-scattering cross sections of elemental cadmium are measured from approx. = 1.5 to 4.0 MeV at incident-neutron energy intervals of 50 to 200 keV and at 10 to 20 scattering angles distributed between approx. = 20 and 160 degrees. Concurrently, lumped-level neutron inelastic-excitation cross sections are measured. The experimental results are used to deduce parameters of an optical-statistical model that is descriptive of the observables and are compared with corresponding quantities given in ENDF/B-V

  19. Search for $\\beta^+$EC and ECEC processes in $^{112}$Sn

    CERN Document Server

    Barabash, A S; Nachab, A; Konovalov, S I; Umatov, V

    2009-01-01

    Limits on $\\beta^+$EC (here EC denotes electron capture) and ECEC processes in $^{112}$Sn have been obtained using a 380 cm$^3$ HPGe detector and an external source consisting of 53.355 g enriched tin (94.32% of $^{112}$Sn). A limit with 90% C.L. on the $^{112}$Sn half-life of $4.7\\times 10^{20}$ y for the ECEC(0$\

  20. Uptake and metabolism of the novel peptide angiotensin-(1-12 by neonatal cardiac myocytes.

    Directory of Open Access Journals (Sweden)

    Sarfaraz Ahmad

    Full Text Available BACKGROUND: Angiotensin-(1-12 [Ang-(1-12] functions as an endogenous substrate for the productions of Ang II and Ang-(1-7 by a non-renin dependent mechanism. This study evaluated whether Ang-(1-12 is incorporated by neonatal cardiac myocytes and the enzymatic pathways of ¹²⁵I-Ang-(1-12 metabolism in the cardiac myocyte medium from WKY and SHR rats. METHODOLOGY/PRINCIPAL FINDINGS: The degradation of ¹²⁵I-Ang-(1-12 (1 nmol/L in the cultured medium of these cardiac myocytes was evaluated in the presence and absence of inhibitors for angiotensin converting enzymes 1 and 2, neprilysin and chymase. In both strains uptake of ¹²⁵I-Ang-(1-12 by myocytes occurred in a time-dependent fashion. Uptake of intact Ang-(1-12 was significantly greater in cardiac myocytes of SHR as compared to WKY. In the absence of renin angiotensin system (RAS enzymes inhibitors the hydrolysis of labeled Ang-(1-12 and the subsequent generation of smaller Ang peptides from Ang-(1-12 was significantly greater in SHR compared to WKY controls. ¹²⁵I-Ang-(1-12 degradation into smaller Ang peptides fragments was significantly inhibited (90% in WKY and 71% in SHR in the presence of all RAS enzymes inhibitors. Further analysis of peptide fractions generated through the incubation of Ang-(1-12 in the myocyte medium demonstrated a predominant hydrolytic effect of angiotensin converting enzyme and neprilysin in WKY and an additional role for chymase in SHR. CONCLUSIONS/SIGNIFICANCE: These studies demonstrate that neonatal myocytes sequester angiotensin-(1-12 and revealed the enzymes involved in the conversion of the dodecapeptide substrate to biologically active angiotensin peptides.

  1. Prodromal Symptoms in Adolescents with 22q11.2 Deletion Syndrome and Schizotypal Personality Disorder

    OpenAIRE

    Shapiro, DI; Cubells, JF; Ousley, OY; Rockers, K; Walker, EF

    2011-01-01

    Adolescents with 22q11.2 Deletion Syndrome (22q11.2DS) and Schizotypal Personality Disorder (SPD) are at increased risk for the development of psychosis based, respectively, on genetic or behavioral factors. Thus both groups would be expected to manifest heightened rates of the prodromal signs that typically precede psychosis. Although there are now standardized procedures for assessing prodromal symptoms, there has been little research on the manifestation of these symptoms in 22q11.2DS pati...

  2. Quantitative in vivo elemental analysis using X-ray fluorescence and scattering techniques. Applications to cadmium, lead and bone mineral

    International Nuclear Information System (INIS)

    The X-ray fluorescence technique for in vivo determination of cadmium concentration in the human body has been considerably improved so that the minimum concentration now is 10 μg/g for a skin-organ distance of 50 mm and a measurement time of 30 minutes. The technique has been used for measurements of cadmium in the kidney cortex of 60 non-occupationally exposed persons, showing twice the concentration (26±9 μg/g) in a sub-group of frequent tobacco smokers compared with a group of non-smokers (10±11 μg/g). Concentrations of lead in the skeleton of 112 persons have been measured at three bone sites (finger bone, tibia, heel bone) using in vivo XRF techniques either based on Co-57 or Cd-109 sources. There was a good correlation between lead levels at the three bone sites as well as to cumulative exposure index. However, the association between the amount of chelatable lead and measured bone lead levels was poor. The retention of lead in the skeleton of 14 retired workers, now studied for up to 18 years after retirement, shows a half-time of 16 years. 43 refs

  3. Modeling cadmium in the feed chain and cattle organs

    Directory of Open Access Journals (Sweden)

    van der Fels-Klerx, I.

    2011-01-01

    Full Text Available The objectives of this study were to estimate cadmium contamination levels in different scenarios related to soil characteristics and assumptions regarding cadmium accumulation in the animal tissues, using quantitative supply chain modeling. The model takes into account soil cadmium levels, soil pH, soil-to-plant transfer, animal consumption patterns, and transfer into animal organs (liver and kidneys. The model was applied to cattle up to the age of six years which were fed roughage (maize and grass and compound feed. Cadmium content in roughage and cadmium intake by cattle were calculated for six different (soil scenarios varying in soil cadmium levels and soil pH. For each of the six scenarios, the carry-over of cadmium from intake into the cattle organs was estimated applying two model assumptions, i.e., linear accumulation and a steady state situation. The results showed that only in the most extreme soil scenario (cadmium level 2.5 mg.kg-1, pH 4.5, cadmium exceeded the EC maximum tolerated level in roughage. Assuming linear accumulation, cadmium levels in organs of cattle up to six years of age, ranged from 0.37-4.03 mg.kg-1 of fresh weight for kidneys and from 0.07 to 0.77 mg.kg-1 of fresh weight for livers. The maximum tolerated levels in one or both organs were exceeded in several scenarios. When considering organ excretion of cadmium, internal cadmium levels in organs were approximately one order of magnitude lower as compared to the results of the linear accumulation model. In this case only in the most extreme soil scenario, the maximum tolerated level in the kidney was exceeded. It was concluded that the difference between the two assumptions (linear model versus a steady state situation to estimate cadmium carry-over in cattle is negligible in the animal's first five years of life, but will become relevant at higher ages. For the current case, the linear approach is a good descriptor for worst case situations. Furthermore, this

  4. Sources of cadmium exposure among healthy premenopausal women

    International Nuclear Information System (INIS)

    Background: Cadmium, a persistent and widespread environmental pollutant, has been associated with kidney function impairment and several diseases. Cigarettes are the dominant source of cadmium exposure among smokers; the primary source of cadmium in non-smokers is food. We investigated sources of cadmium exposure in a sample of healthy women. Methods: In a cross-sectional study, 191 premenopausal women completed a health questionnaire and a food frequency questionnaire. The cadmium content of spot urine samples was measured with inductively-coupled plasma mass spectrometry and normalized to urine creatinine content. Multivariable linear regression was used to estimate the strength of association between smoking habits and, among non-smokers, usual foods consumed and urinary cadmium, adjusted for age, race, multivitamin and supplement use, education, estimated total energy intake, and parity. Results: Geometric mean urine creatinine-normalized cadmium concentration (uCd) of women with any history of cigarette smoking was 0.43 μg/g (95% confidence interval (CI): 0.38-0.48 μg/g) and 0.30 μg/g (0.27-0.33 μg/g) among never-smokers, and increased with pack-years of smoking. Analysis of dietary data among women with no reported history of smoking suggested that regular consumption of eggs, hot cereals, organ meats, tofu, vegetable soups, leafy greens, green salad, and yams was associated with uCd. Consumption of tofu products showed the most robust association with uCd; each weekly serving of tofu was associated with a 22% (95% CI: 11-33%) increase in uCd. Thus, uCd was estimated to be 0.11 μg/g (95% CI: 0.06-0.15 μg/g) higher among women who consumed any tofu than among those who consumed none. Conclusions: Cigarette smoking is likely the most important source of cadmium exposure among smokers. Among non-smokers, consumption of specific foods, notably tofu, is associated with increased urine cadmium concentration. - Research highlights: →Urine cadmium, usual

  5. Sources of cadmium exposure among healthy premenopausal women

    Energy Technology Data Exchange (ETDEWEB)

    Adams, Scott V., E-mail: sadams@fhcrc.org [Fred Hutchinson Cancer Research Center, PO Box 19024, M4-B402, Seattle, WA 98109 (United States); Department of Epidemiology, University of Washington, Box 357236, Seattle, WA 98195 (United States); Newcomb, Polly A. [Fred Hutchinson Cancer Research Center, PO Box 19024, M4-B402, Seattle, WA 98109 (United States); Department of Epidemiology, University of Washington, Box 357236, Seattle, WA 98195 (United States); Shafer, Martin M. [Environmental Chemistry and Technology Program, University of Wisconsin and Wisconsin State Laboratory of Hygiene, Madison, WI (United States); Atkinson, Charlotte [Department of Oral and Dental Science, Bristol Dental School, Bristol (United Kingdom); Bowles, Erin J. Aiello [Group Health Research Institute, Seattle, WA (United States); Newton, Katherine M. [Department of Epidemiology, University of Washington, Box 357236, Seattle, WA 98195 (United States); Group Health Research Institute, Seattle, WA (United States); Lampe, Johanna W. [Fred Hutchinson Cancer Research Center, PO Box 19024, M4-B402, Seattle, WA 98109 (United States); Department of Epidemiology, University of Washington, Box 357236, Seattle, WA 98195 (United States)

    2011-04-01

    Background: Cadmium, a persistent and widespread environmental pollutant, has been associated with kidney function impairment and several diseases. Cigarettes are the dominant source of cadmium exposure among smokers; the primary source of cadmium in non-smokers is food. We investigated sources of cadmium exposure in a sample of healthy women. Methods: In a cross-sectional study, 191 premenopausal women completed a health questionnaire and a food frequency questionnaire. The cadmium content of spot urine samples was measured with inductively-coupled plasma mass spectrometry and normalized to urine creatinine content. Multivariable linear regression was used to estimate the strength of association between smoking habits and, among non-smokers, usual foods consumed and urinary cadmium, adjusted for age, race, multivitamin and supplement use, education, estimated total energy intake, and parity. Results: Geometric mean urine creatinine-normalized cadmium concentration (uCd) of women with any history of cigarette smoking was 0.43 {mu}g/g (95% confidence interval (CI): 0.38-0.48 {mu}g/g) and 0.30 {mu}g/g (0.27-0.33 {mu}g/g) among never-smokers, and increased with pack-years of smoking. Analysis of dietary data among women with no reported history of smoking suggested that regular consumption of eggs, hot cereals, organ meats, tofu, vegetable soups, leafy greens, green salad, and yams was associated with uCd. Consumption of tofu products showed the most robust association with uCd; each weekly serving of tofu was associated with a 22% (95% CI: 11-33%) increase in uCd. Thus, uCd was estimated to be 0.11 {mu}g/g (95% CI: 0.06-0.15 {mu}g/g) higher among women who consumed any tofu than among those who consumed none. Conclusions: Cigarette smoking is likely the most important source of cadmium exposure among smokers. Among non-smokers, consumption of specific foods, notably tofu, is associated with increased urine cadmium concentration. - Research highlights: {yields

  6. Completion Report for Model Evaluation Well ER-11-2: Corrective Action Unit 98: Frenchman Flat

    Energy Technology Data Exchange (ETDEWEB)

    NSTec Underground Test Area and Boreholes Programs and Operations

    2013-01-22

    tritium above levels detectable by field methods were encountered in this hole. No well development or hydrologic testing was conducted in this well immediately after completion, and future well development, sampling, and hydrologic testing planned for this well will be limited due to the diameter of the piezometer string. The stratigraphy, general lithology, and the water level are as expected, but the section of geology encountered is higher than expected due to faulting. No tritium above the minimum detection limit of the field equipment was detected because the target aquifer (the Topopah Spring aquifer) at Well ER-11-2 is structurally higher than expected and thus unsaturated.

  7. Impairment induced by chronic occupational cadmium exposure during brazing process

    International Nuclear Information System (INIS)

    Cadmium (CD) is considered a metal of the 20th century to which all inhabitants of develop societies are exposed. Long-term occupational and environmental exposure to CD often results in renal dysfunction as the kidney is considered the critical target organ. The aim of this work was to evalutate both resporatory and renal manifestations induced by occupational exposure to CD compounds during brazing process, and suggesting a protocol for prevention and control for CD- induced health effects. This study was conducted on 20 males occupationally exposed workers. They are divided into two groups: Group-1 included (10) exposed smokers and group-2 included (10) exposed non-smokers. Results of both groups were compared with those of 10 healthy age and sex matched non-smokers. All subjects were subjected to detailed history taking and laboratory investigations including blood and urinary CD, liver profile (SGOT, SGPT and alkline phosphates), kindey function tests (blood urea, creatinine and urinary beta2- microglobulin). The level of Cd in the atmosphere of the work plase air was also assessed to detect the degree of exposure as it was about 6 times greater than thesave level (1 mu /m3).(1) This study demonstrated elevation levels of blood CD, urea, creatinine and urinary CD and beta2 -microglobulin for both exposed worker groups than the controls. In additions no appreciable were noted for liver function tests, although the levels fell within normal range

  8. Accumulation and distribution of arsenic and cadmium by tea plants

    Institute of Scientific and Technical Information of China (English)

    Yuan-zhi SHI; Jian-yun RUAN; Lifeng MA; Wen-yan HAN; Fang WANG

    2008-01-01

    It is important to research the rules about accumulation and distribution of arsenic and cadmium by tea plants, which will give us some scientific ideas about how to control the contents of arsenic and cadmium in tea. In this study, by field inves- tigation and pot trial, we found that mobility of arsenic and cadmium in tea plants was low. Most arsenic and cadmium absorbed were fixed in feeding roots and only small amount was transported to the above-ground parts. Distribution of arsenic and cadmium, based on their concentrations of unit dry matter, in tea plants grown on un-contaminated soil was in the order: feeding roots>stems≈main roots>old leaves>young leaves. When tea plants were grown on polluted soils simulated by adding salts of these two metals, feeding roots possibly acted as a buffer and defense, and arsenic and cadmium were transported less to the above- ground parts. The concentration of cadmium in soil significantly and negatively correlated with chlorophyll content, photosyn- thetic rate, transpiration rate and biomass production of tea plants.

  9. Cadmium Uptake in Synechococcus aquatilis (Reynaud Strain SY01

    Directory of Open Access Journals (Sweden)

    Ruperto Vallarta Jr.

    1998-12-01

    Full Text Available Cadmium uptake in Synechococcus aquatilis (Reynaud Strain SY01 showed a biphasic behavior, with an initial rapid passive cell wall interaction phase and a later slow intracellular cation uptake process. The cell wall uptake process followed Michaelis-Menten kinetics. The apparent Km of the uptake system was 38.89 µM, a relatively high affinity Km value compared to other metal uptake systems. Fitting of experimental data to the Langmuir and Freundlich adsorption isotherms showed that binding of cadmium to the cell surface was monolayer and/or multilayer, although the monolayer adsorption was more probable, as exemplified by a high correlation coefficient. This could be explained by the presence of a strong primary binding site which was responsible for a monolayer adsorption and a weak secondary binding site which could be responsible for a multilayer adsorption. The uptake process was found to be relatively specific for cadmium. Equimolar amounts (200 µM of cobalt, nickel, magnesium, and copper did not significantly affect cadmium uptake. Synechococcus aquatilis Strain SY01 cells also showed an efflux mechanism for cadmium, although the amount of excluded cadmium was insignificant compared with the amount of adsorbed cadmium in the cell wall.

  10. Bacterial bioremediation of aquatic cadmium 11 of area of Pakistan

    International Nuclear Information System (INIS)

    Cadmium Cd/sup +2/ pollution arises mainly from contamination of minerals used in agriculture and from industrial process. The usual situation is of large volume of soil and H/sub 2/O that are contaminated with low but significant concentration of Cd/sup +2/. Cadmium is one of the most dangerous heavy metal both to human health and aquatic ecosystem. Microorganisms have developed different strategies to regulate uptake and to detoxify heavy metals viz; by different mechanisms i.e. by adsorption to cell surface, by intercellular accumulation, precipitation, biosynthesis of metallothioneins to volatile compounds. Microcosm experiments in chemostat incubated at 20 deg. C showed that Cadmium Contamination does not greatly affect bacterial communities in cultures contaminated with up to 1mg CdI/sup -1/. acterial productivity remains unchanged and Cadmium- resistant strains arise quickly and in great number. The cadmium accumulation by bacteria depend on the bacterial productivity. The free bacteria can accumulate up to 1200 ppm Cadmium Where as the adhering bacteria concentrate up to 6100 ppm. At a steady state, 11-29% Cadmium is removed from the water phase of cultures. This paper includes Cd (II) removal by Bacteria from waste water of Wah Cantonment Pakistan. (author)

  11. Gadolinium chloride pretreatment ameliorates acute cadmium-induced hepatotoxicity.

    Science.gov (United States)

    Kyriakou, Loukas G; Tzirogiannis, Konstantinos N; Demonakou, Maria D; Kourentzi, Kalliopi T; Mykoniatis, Michael G; Panoutsopoulos, Georgios I

    2013-08-01

    Cadmium is a known industrial and environmental pollutant. It causes hepatotoxicity upon acute administration. Features of cadmium-induced acute hepatoxicity encompass necrosis, apoptosis, peliosis and inflammatory infiltration. Gadolinium chloride (GdCl3) may prevent cadmium-induced hepatotoxicity by suppressing Kupffer cells. The effect of GdCl3 pretreatment on a model of acute cadmium-induced liver injury was investigated. Male Wistar rats 4-5 months old were injected intraperitoneally with normal saline followed by cadmium chloride (CdCl2; 6.5 mg/kg) or GdCl3 (10 mg/kg) followed by CdCl2 (6.5 mg/kg; groups I and II, respectively). Rats of both the groups were killed at 9, 12, 16, 24, 48 and 60 h after cadmium intoxication. Liver sections were analyzed for necrosis, apoptosis, peliosis and mitoses. Liver regeneration was also evaluated by tritiated thymidine incorporation into hepatic DNA. Serum levels of aspartate aminotransferase (AST) and alanine aminotransferase (ALT) were also determined. Hepatic necrosis, hepatocyte and nonparenchymal cell apoptosis and macroscopic and microscopic types of peliosis hepatis were minimized by gadolinium pretreatment. Serum levels of AST and ALT were also greatly diminished in rats of group II. Tritiated thymidine incorporation into hepatic DNA was increased in gadolinium pretreatment rats. Kupffer cell activation was minimal in both the groups of rats. Gadolinium pretreatment attenuates acute cadmium-induced liver injury in young Wistar rats, with mechanisms other than Kupffer cell elimination.

  12. Screening of Amaranth Cultivars (Amaranthus mangostanus L.) for Cadmium Hyperaccumulation

    Institute of Scientific and Technical Information of China (English)

    FAN Hong-li; ZHOU Wei

    2009-01-01

    The potential harm of soil cadmium pollution to ecological environment and human health has been increasingly widely concerned. Phytoremediation, as a kind of new and effective technology, has become an important method for cleaning up cadmium in contaminated sites. The amaranth (Amaranthus mangostanus L.) is widely distributed and has abundant varieties in China, its rapid growth and large biomass can be served as candidate for cadmium hyperaccumulators for phytoremediation. To obtain cadmium hyper-accumulator, Cd uptake in 23 amaranth euitivars from different ecological region was investigated under hydroponic culture condition. Meanwhile, pot experiment was established to probe phytoremediation potentiality of Cd contaminated soil by amaranth. Three treatment (Cd 5, 10, and 25 mg kg-1) were imposed to red soil, yellow brown soil, and vegetable soil. The results showed that under hydroponic culture with Cd 3 mg L-1, the cadmium concentration in the shoots of the cultivar Tianxingmi reached 260 mg kg-1, and its total cadmium uptake was the highest among various cultivars. In the treatment Cd 25 mg kg-1, the cadmium concentration in the shoots of the cultivar Tianxingmi reached 212 mg kg-1, while bioaccumulation factor and shoot purification rate reached 8.50 and 3.8%, respectively. Further, the total biomass and shoot biomass were not decreased significantly under Cd exposure.These results suggested that eultivar Tianxingmi is a typical Cd hyperaccumulator, and can be expected to be used in phytoremediation of Cd contaminated soil.

  13. Blood cadmium concentration and lipid profile in Korean adults

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Kisok, E-mail: kimkisok@kmu.ac.kr [Department of Public Health, Keimyung University, 1000 Shindang-dong, Daegu 704-701 (Korea, Republic of)

    2012-01-15

    Although animal experiments have shown that cadmium exposure induces alterations in lipid profiles, no epidemiological study of this relationship has been performed. The objective of this study was to evaluate the association between blood cadmium concentration and blood lipid levels in Korean adults. A cross-sectional study comprising participants (n=3903) aged 20 years or older from the 2005, 2008, and 2009 Korea National Health and Nutrition Examination Surveys was conducted. Demographic characteristics and dietary intake were obtained from the participants by questionnaire, and cadmium and lipid levels were determined by analysis of blood samples. After adjusting for demographic and dietary factors, blood concentration of cadmium was positively associated with the risk of low high-density lipoprotein cholesterol (HDL-C) in a dose-dependent manner (p for trend <0.001). In addition, the odds ratios (ORs) of a high triglyceride to HDL-C ratio was significantly increased in the high blood cadmium groups [OR=1.36; 95% confidence interval (CI), 1.03-1.79 for fourth quintile and OR=1.41; 95% CI, 1.07-1.86 for fifth quintile] compared with the lowest quintile group. However, high blood cadmium was not associated with a risk of high total cholesterol, high low-density lipoprotein cholesterol, or high triglycerides. These data suggest that an increased cadmium body burden increases the risk of dyslipidemia, mainly due to the increased risk of low HDL-C and the high ratio of triglycerides to HDL-C.

  14. Cadmium minimization in wheat: A critical review.

    Science.gov (United States)

    Rizwan, Muhammad; Ali, Shafaqat; Abbas, Tahir; Zia-Ur-Rehman, Muhammad; Hannan, Fakhir; Keller, Catherine; Al-Wabel, Mohammad I; Ok, Yong Sik

    2016-08-01

    Cadmium (Cd) accumulation in wheat (Triticum aestivum L.) and its subsequent transfer to food chain is a major environmental issue worldwide. Understanding wheat response to Cd stress and its management for aiming to reduce Cd uptake and accumulation in wheat may help to improve wheat growth and grain quality. This paper reviewed the toxic effects, tolerance mechanisms, and management of Cd stress in wheat. It was concluded that Cd decreased germination, growth, mineral nutrients, photosynthesis and grain yield of wheat and plant response to Cd toxicity varies with cultivars, growth conditions and duration of stress applied. Cadmium caused oxidative stress and genotoxicity in wheat plants. Stimulation of antioxidant defense system, osmoregulation, ion homeostasis and over production of signalling molecules are important adaptive strategies of wheat under Cd stress. Exogenous application of plant growth regulators, inorganic amendments, proper fertilization, silicon, and organic, manures and biochar, amendments are commonly used for the reduction of Cd uptake in wheat. Selection of low Cd-accumulating wheat cultivars, crop rotation, soil type, and exogenous application of microbes are among the other agronomic practices successfully employed in reducing Cd uptake by wheat. These management practices could enhance wheat tolerance to Cd stress and reduce the transfer of Cd to the food chain. However, their long-term sustainability in reducing Cd uptake by wheat needs further assessment.

  15. Selenium protection from cadmium and chromium poisoning

    International Nuclear Information System (INIS)

    The interaction of selenium with cadmium and chromium was studied in 168 chicken-broilers (DWCxWR) divided into four equal groups. Eight-week old control animals received an intravenous dose of /sup 115m/Cd Chloride 370 KBq/Kg (Group I), or 51Cr Chloride 370 KBq/Kg (Group II). The kinetics of these isotopes were studied by scintillation spectrometry (NaI/TI) carried out for whole blood, plasma, plasma proteins, urine, feces and homogenates of all organs at various time intervals. Animals in Groups III and IV received eight subcutaneous doses of sodium selenate (5ug) at 8-week intervals prior to /sup 115m/Cd or 51Cr. The kinetics of these elements were studied as in the previous two groups. It was found that selenium affected those kinetics in two ways: (a) by increasing the excretion of Cd by 11 +/- 3% (P < 0.001) and that of Cr by 7 +/- 1% (P < 0.001); and (b) by favoring redistribution of those elements, with significant (P < 0.001) reductions in liver, endocrine glands and kidney and increases (P < 0.01) in bone. The study suggests that selenium protects the animals' vital organs from environmental pollutants, such as cadmium and chromium

  16. Cadmium minimization in wheat: A critical review.

    Science.gov (United States)

    Rizwan, Muhammad; Ali, Shafaqat; Abbas, Tahir; Zia-Ur-Rehman, Muhammad; Hannan, Fakhir; Keller, Catherine; Al-Wabel, Mohammad I; Ok, Yong Sik

    2016-08-01

    Cadmium (Cd) accumulation in wheat (Triticum aestivum L.) and its subsequent transfer to food chain is a major environmental issue worldwide. Understanding wheat response to Cd stress and its management for aiming to reduce Cd uptake and accumulation in wheat may help to improve wheat growth and grain quality. This paper reviewed the toxic effects, tolerance mechanisms, and management of Cd stress in wheat. It was concluded that Cd decreased germination, growth, mineral nutrients, photosynthesis and grain yield of wheat and plant response to Cd toxicity varies with cultivars, growth conditions and duration of stress applied. Cadmium caused oxidative stress and genotoxicity in wheat plants. Stimulation of antioxidant defense system, osmoregulation, ion homeostasis and over production of signalling molecules are important adaptive strategies of wheat under Cd stress. Exogenous application of plant growth regulators, inorganic amendments, proper fertilization, silicon, and organic, manures and biochar, amendments are commonly used for the reduction of Cd uptake in wheat. Selection of low Cd-accumulating wheat cultivars, crop rotation, soil type, and exogenous application of microbes are among the other agronomic practices successfully employed in reducing Cd uptake by wheat. These management practices could enhance wheat tolerance to Cd stress and reduce the transfer of Cd to the food chain. However, their long-term sustainability in reducing Cd uptake by wheat needs further assessment. PMID:27062345

  17. Cadmium determination in Lentinus edodes mushroom species

    Directory of Open Access Journals (Sweden)

    Vera Akiko Maihara

    2012-09-01

    Full Text Available Many studies have drawn attention to the occurrence and concentration of toxic elements found in the fruiting body of mushrooms. Some edible mushroom species are known to accumulate high levels of inorganic contaminants, mainly cadmium, mercury, and lead. There are about 2,000 known edible mushroom species, but only 25 of them are cultivated and used as food. In Brazil, the most marketed and consumed mushroom species are Agaricus bisporus, known as Paris champignon, Lentinus edodes, or Shitake and Pleurotus sp, also called Shimeji or Hiratake. In this study, the concentration of cadmium was determined in Lentinus edodes mushrooms from different cities in São Paulo state and some samples imported from Japan and China. The analyses were performed by graphite furnace atomic absorption spectrometry after HNO3-H2O2 digestion. The results showed a lower concentration of Cd in the mushrooms cultivated in São Paulo (0.0079 to 0.023 mg.kg-1 in natura than that of the mushrooms cultivated abroad (0.125 to 0.212 mg.kg-1 in natura. Although there is no tolerance limit for Cd in mushrooms in Brazil, the results show that Lentinus edodes mushrooms can be safely consumed.

  18. Isospin transport in 84Kr+112,124Sn reactions at Fermi energies

    Directory of Open Access Journals (Sweden)

    Piantelli S.

    2014-03-01

    Full Text Available Isospin transport phenomena in dissipative heavy ion collisions have been investigated at Fermi energies with a beam of 84Kr at 35AMeV. A comparison of the 〈N〉/Z of light and medium products forward-emitted in the centre of mass frame when the beam impinges on two different targets, the n-poor 112Sn and the n-rich 124Sn, is presented. Data were collected by means of a three-layer telescope with very good performances in terms of mass identification (full isotopic resolution up to Z ~ 20 for ions punching through the first detector layer built by the FAZIA Collaboration and located just beyond the grazing angle for both reactions. The 〈N〉/Z of the products detected when the n-rich target is used is always higher than that associated to the n-poor one; since the detector was able to measure only fragments coming from the QuasiProjectile decay and/or neck emission, the observed behaviour can be ascribed to the isospin diffusion process, driven by the isospin gradient between QuasiProjectile and QuasiTarget. Moreover, for light fragments the 〈N〉/Z as a function of the lab velocity of the fragment is observed to increase when we move from the QuasiProjectile velocity to the centre of mass (neck zone. This effect can be interpreted as an evidence of isospin drift driven by the density gradient between the QuasiProjectile zone (at normal density and the more diluted neck zone.

  19. Exposure dose response relationships of the freshwater bivalve Hyridella australis to cadmium spiked sediments

    Energy Technology Data Exchange (ETDEWEB)

    Marasinghe Wadige, Chamani P.M., E-mail: chamani.marasinghe.wadige@canberra.edu.au; Maher, William A.; Taylor, Anne M.; Krikowa, Frank

    2014-07-01

    Highlights: • The exposure–dose–response approach was used to assess cadmium exposure and toxicity. • Accumulated cadmium in H. australis reflected the sediment cadmium exposure. • Spill over of cadmium into the biologically active pool was observed. • Increased cadmium resulted in measurable biological effects. • H. australis has the potential to be a cadmium biomonitor in freshwater environments. - Abstract: To understand how benthic biota may respond to the additive or antagonistic effects of metal mixtures in the environment it is first necessary to examine their responses to the individual metals. In this context, laboratory controlled single metal-spiked sediment toxicity tests are useful to assess this. The exposure–dose–response relationships of Hyridella australis to cadmium-spiked sediments were, therefore, investigated in laboratory microcosms. H. australis was exposed to individual cadmium spiked sediments (<0.05 (control), 4 ± 0.3 (low) and 15 ± 1 (high) μg/g dry mass) for 28 days. Dose was measured as cadmium accumulation in whole soft body and individual tissues at weekly intervals over the exposure period. Dose was further examined as sub-cellular localisation of cadmium in hepatopancreas tissues. The biological responses in terms of enzymatic and cellular biomarkers were measured in hepatopancreas tissues at day 28. H. australis accumulated cadmium from spiked sediments with an 8-fold (low exposure organisms) and 16-fold (high exposure organisms) increase at day 28 compared to control organisms. The accumulated tissue cadmium concentrations reflected the sediment cadmium exposure at day 28. Cadmium accumulation in high exposure organisms was inversely related to the tissue calcium concentrations. Gills of H. australis showed significantly higher cadmium accumulation than the other tissues. Accumulated cadmium in biologically active and biologically detoxified metal pools was not significantly different in cadmium exposed

  20. Cadmium-induced inhibition of photosynthesis and long-term acclimation to cadmium stress in the hyperaccumulator Thlaspi caerulescens.

    Science.gov (United States)

    Küpper, Hendrik; Parameswaran, Aravind; Leitenmaier, Barbara; Trtílek, Martin; Setlík, Ivan

    2007-01-01

    Acclimation of hyperaccumulators to heavy metal-induced stress is crucial for phytoremediation and was investigated using the hyperaccumulator Thlaspi caerulescens and the nonaccumulators T. fendleri and T. ochroleucum. Spatially and spectrally resolved kinetics of in vivo absorbance and fluorescence were measured with a novel fluorescence kinetic microscope. At the beginning of growth on cadmium (Cd), all species suffered from toxicity, but T. caerulescens subsequently recovered completely. During stress, a few mesophyll cells in T. caerulescens became more inhibited and accumulated more Cd than the majority; this heterogeneity disappeared during acclimation. Chlorophyll fluorescence parameters related to photochemistry were more strongly affected by Cd stress than nonphotochemical parameters, and only photochemistry showed acclimation. Cd acclimation in T. caerulescens shows that part of its Cd tolerance is inducible and involves transient physiological heterogeneity as an emergency defence mechanism. Differential effects of Cd stress on photochemical vs nonphotochemical parameters indicate that Cd inhibits the photosynthetic light reactions more than the Calvin-Benson cycle. Differential spectral distribution of Cd effects on photochemical vs nonphotochemical quenching shows that Cd inhibits at least two different targets in/around photosystem II (PSII). Spectrally homogeneous maximal PSII efficiency (F(v)/F(m)) suggests that in healthy T. caerulescens all chlorophylls fluorescing at room temperature are PSII-associated. PMID:17688582

  1. Cadmium biosorption by baker’s yeast in aqueous suspension

    OpenAIRE

    Tálos Katalin; Pernyeszi Tímea; Majdik Cornelia; Hegedűsova Alzbeta; Páger Csilla

    2012-01-01

    The biosorption of cadmium from artificial aqueous solutions using native baker’s yeast was investigated. The highest metal uptake value was 110 mg g-1 in a suspension of 0.3 g L-1. The effect of pH, initial cadmium concentration, adsorption time and biosorbent dosage on biosorption by baker’s yeast was studied. The maximum biosorption capacity of cadmium by yeast was observed at pH 6.0. The adsorption equilibrium was reached within sixty minutes and the sorption process followed pseudo...

  2. Chromosomal Locus for Cadmium Resistance in Pseudomonas putida Consisting of a Cadmium-Transporting ATPase and a MerR Family Response Regulator

    OpenAIRE

    Lee, Seon-Woo; Glickmann, Eric; Cooksey, Donald A.

    2001-01-01

    Pseudomonads from environmental sources vary widely in their sensitivity to cadmium, but the basis for this resistance is largely uncharactarized. A chromosomal fragment encoding cadmium resistance was cloned from Pseudomonas putida 06909, a rhizosphere bacterium, and sequence analysis revealed two divergently transcribed genes, cadA and cadR. CadA was similar to cadmium-transporting ATPases known mostly from gram-positive bacteria, and to ZntA, a lead-, zinc-, and cadmium-transporting ATPase...

  3. Inclusion free cadmium zinc tellurium and cadmium tellurium crystals and associated growth method

    Science.gov (United States)

    Bolotnikov, Aleskey E.; James, Ralph B.

    2010-07-20

    The present disclosure provides systems and methods for crystal growth of cadmium zinc tellurium (CZT) and cadmium tellurium (CdTe) crystals with an inverted growth reactor chamber. The inverted growth reactor chamber enables growth of single, large, high purity CZT and CdTe crystals that can be used, for example, in X-ray and gamma detection, substrates for infrared detectors, or the like. The inverted growth reactor chamber enables reductions in the presence of Te inclusions, which are recognized as an important limiting factor in using CZT or CdTe as radiation detectors. The inverted growth reactor chamber can be utilized with existing crystal growth techniques such as the Bridgman crystal growth mechanism and the like. In an exemplary embodiment, the inverted growth reactor chamber is a U-shaped ampoule.

  4. Fractionation of Stable Cadmium Isotopes in the Cadmium Tolerant Ricinus communis and Hyperaccumulator Solanum nigrum

    OpenAIRE

    Rongfei Wei; Qingjun Guo; Hanjie Wen; Congqiang Liu; Junxing Yang; Marc Peters; Jian Hu; Guangxu Zhu; Hanzhi Zhang; Liyan Tian; Xiaokun Han; Jie Ma; Chuanwei Zhu; Yingxin Wan

    2016-01-01

    Cadmium (Cd) isotopes provide new insights into Cd uptake, transport and storage mechanisms in plants. Therefore, the present study adopted the Cd-tolerant Ricinus communis and Cd-hyperaccumulator Solanum nigrum, which were cultured under controlled conditions in a nutrient solution with variable Cd supply, to test the isotopic fractionation of Cd during plant uptake. The Cd isotope compositions of nutrient solutions and organs of the plants were measured by multiple collector inductively cou...

  5. 37 CFR 11.2 - Director of the Office of Enrollment and Discipline.

    Science.gov (United States)

    2010-07-01

    ... Enrollment and Discipline. 11.2 Section 11.2 Patents, Trademarks, and Copyrights UNITED STATES PATENT AND... Discipline. (a) Appointment. The USPTO Director shall appoint a Director of the Office of Enrollment and Discipline (OED Director). In the event of a vacancy in the office of the OED Director, the USPTO...

  6. 45 CFR 400.112 - Child welfare services for refugee children.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 2 2010-10-01 2010-10-01 false Child welfare services for refugee children. 400.112 Section 400.112 Public Welfare Regulations Relating to Public Welfare OFFICE OF REFUGEE RESETTLEMENT, ADMINISTRATION FOR CHILDREN AND FAMILIES, DEPARTMENT OF HEALTH AND HUMAN SERVICES...

  7. 12 CFR 221.112 - Loans by bank in capacity as trustee.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Loans by bank in capacity as trustee. 221.112... CARRYING MARGIN STOCK (REGULATION U) Interpretations § 221.112 Loans by bank in capacity as trustee. (a... been pledged as collateral for loans. Loans are not made, under the plan, from bank funds,...

  8. 46 CFR 112.25-5 - Failure of power from the normal source.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Failure of power from the normal source. 112.25-5... EMERGENCY LIGHTING AND POWER SYSTEMS Emergency Systems Having an Automatic Starting Diesel Engine or Gas Turbine Driven Emergency Power Source as the Sole Emergency Power Source § 112.25-5 Failure of power...

  9. 7 CFR 1.12 - Handling information from a private business.

    Science.gov (United States)

    2010-01-01

    ... is not exempt by law from disclosure). Afford business information submitter reasonable time in which... 7 Agriculture 1 2010-01-01 2010-01-01 false Handling information from a private business. 1.12... Records § 1.12 Handling information from a private business. Each USDA agency is responsible for...

  10. Autism Spectrum Disorder, Developmental and Psychiatric Features in 16p11.2 Duplication

    Science.gov (United States)

    Green Snyder, LeeAnne; D'Angelo, Debra; Chen, Qixuan; Bernier, Raphael; Goin-Kochel, Robin P.; Wallace, Arianne Stevens; Gerdts, Jennifer; Kanne, Stephen; Berry, Leandra; Blaskey, Lisa; Kuschner, Emily; Roberts, Timothy; Sherr, Elliot; Martin, Christa L.; Ledbetter, David H.; Spiro, John E.; Chung, Wendy K.; Hanson, Ellen

    2016-01-01

    The 16p11.2 duplication (BP4-BP5) is associated with Autism Spectrum Disorder (ASD), although significant heterogeneity exists. Quantitative ASD, behavioral and neuropsychological measures and DSM-IV diagnoses in child and adult carriers were compared with familial non-carrier controls, and to published results from deletion carriers. The 16p11.2

  11. 42 CFR 421.112 - Considerations relating to the effective and efficient administration of the program.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 3 2010-10-01 2010-10-01 false Considerations relating to the effective and efficient administration of the program. 421.112 Section 421.112 Public Health CENTERS FOR MEDICARE... services could be interrupted; (5) Economy in the delivery of intermediary services; (6) Timeliness in...

  12. Electrochemical removal of cadmium from bio-ash; Elektrokemisk fjernelse af cadmium fra bioasker

    Energy Technology Data Exchange (ETDEWEB)

    Juul Pedersen, Anne; Ottosen, Lisbeth M.; Simonsen, Peter; Christensen, Terkel C.

    2004-07-01

    The potential of using the method electrodialytic remediation for removal of cadmium from bioashes has been investigated. Five different types of fly ash from biomass combustion were included in the study: 1) A straw combustion fly ash from grate-firing at Avedoere power plant. 2) A fly ash from co-firing of wood and fuel oil at Avedoere power plant. 3) A suspended, grain size fractionated straw fly ash, obtained from PSO project FU 2201, fine and coarse size fraction. The ash was originally produced at Avedoere power plant. 4) A straw pellet fly ash from dust-firing at Amager power plant. Thr five ashes were characterised, and a series of preliminary elekctrodialytic remediation experiments were conducted on each ash. In spite a significant differences between the five ashes with respect to parameters such as pH and content of cadmium, all ashes showed promising remediation potential. For all ashes cadmium concentrations below the regulatory limits for recycling were reached in one or more of the preliminary remediation experiements. The best results were obtained with the suspended straw ash from PSO FU 2201, whereas the results with the wood chips ash, due to a high initial pH value, were less sucessful, meaning that the remediation process was progressing more slowly. (BA)

  13. Candida Arthritis: Analysis of 112 Pediatric and Adult Cases.

    Science.gov (United States)

    Gamaletsou, Maria N; Rammaert, Blandine; Bueno, Marimelle A; Sipsas, Nikolaos V; Moriyama, Brad; Kontoyiannis, Dimitrios P; Roilides, Emmanuel; Zeller, Valerie; Taj-Aldeen, Saad J; Miller, Andy O; Petraitiene, Ruta; Lortholary, Olivier; Walsh, Thomas J

    2016-01-01

    Background.  Candida arthritis is a debilitating form of deeply invasive candidiasis. However, its epidemiology, clinical manifestations, management, and outcome are not well understood. Methods.  Cases of Candida arthritis were reviewed from 1967 through 2014. Variables included Candida spp in joint and/or adjacent bone, underlying conditions, clinical manifestations, inflammatory biomarkers, diagnostic imaging, management, and outcome. Results.  Among 112 evaluable cases, 62% were males and 36% were pediatric. Median age was 40 years (range, osteomyelitis was present in 30% of cases. Candida albicans constituted 63%, Candida tropicalis 14%, and Candida parapsilosis 11%. Most cases (66%) arose de novo, whereas 34% emerged during antifungal therapy. Osteolysis occurred in 42%, joint-effusion in 31%, and soft tissue extension in 21%. Amphotericin and fluconazole were the most commonly used agents. Surgical interventions included debridement in 25%, irrigation 10%, and drainage 12%. Complete or partial response was achieved in 96% and relapse in 16%. Conclusion.  Candida arthritis mainly emerges as a de novo infection in usually non-immunosuppressed patients with hips and knees being most commonly infected. Localizing symptoms are frequent, and the most common etiologic agents are C albicans, C tropicalis, and C parapsilosis. Management of Candida arthritis remains challenging with a clear risk of relapse, despite antifungal therapy. PMID:26858961

  14. Imaging of tuberculosis. Pt. 2. Abdominal manifestations in 112 patients

    Energy Technology Data Exchange (ETDEWEB)

    Lundstedt, C. [Dept. of Diagnostic Radiology, King Faisal Specialist Hospital and Research Centre, Riyadh (Saudi Arabia); Nyman, R. [Dept. of Diagnostic Radiology, King Faisal Specialist Hospital and Research Centre, Riyadh (Saudi Arabia); Brismar, J. [Dept. of Diagnostic Radiology, King Faisal Specialist Hospital and Research Centre, Riyadh (Saudi Arabia); Hugosson, C. [Dept. of Diagnostic Radiology, King Faisal Specialist Hospital and Research Centre, Riyadh (Saudi Arabia); Kagevi, I. [Dept. of Diagnostic Radiology, King Faisal Specialist Hospital and Research Centre, Riyadh (Saudi Arabia)

    1996-07-01

    Purpose: To describe the radiological findings of tuberculosis (TB) of the abdomen as reflected at our hospital. Material and Methods: The radiological files of 503 patients (referred to our institution mainly because of a clinical suspicion of malignancy, and found to have culture- or biopsy-proven TB) were reviewed in order to analyze the spectrum of the TB manifestations in this group of patients. Results: Abdominal manifestations were found in 112 patients, in 1/3 abdominal disease was the only evidence of TB. More than half of the patients also had chest TB. The most common abdominal TB manifestations were peritonitis and lymph node enlargement, each occurring in about 1/3 of the patients. Also 1/3 had genitourinary TB manifestations. About 1/5 had TB of the liver, spleen or pancreas or in the gastrointestinal tract, respectively. Multiple organ involvement was common. Conclusion: The need to consider TB in the differential diagnosis in patients with obscure abdominal symptoms, especially with multiple organ involvement, is stressed. (orig.).

  15. THEORY OF PHYSICAL CONSTANTS AND SUPERGRAVITY IN 112D

    Directory of Open Access Journals (Sweden)

    Trunev A. P.

    2016-04-01

    Full Text Available In this article we discuss a version of the metric theory of the fundamental interactions in which it is assumed that the physical constants due to the presence of extra dimensions of space-time. The estimation of the number of physical constants based on the theory of supergravity in 112D is that the minimum number of constants is equal to 222, and the maximum number - 1404928. At present, the number of parameters that characterize the elementary particles, isotopes and chemical elements is about 150920. This number is 9.3 less than the maximum possible number of parameters that indicate still great potential of modern science. Functions describing the area and volume of a unit hypersphere, embedded in a Riemannian space of arbitrary dimension, were used to find the fundamental physical constants. A satisfactory agreement with a relative error of 0.03% calculated and experimental values of the fine structure constant found out. For the ratio of the average mass of a nucleon to the electron mass is obtained coincidence with the experimental value with an accuracy of 0.002%. The proposed theory of physical constants different from that Bartini theory that established the optimal dimension of the space is a hypersphere 5 and 7, rather than 6 as in Bartini theory. The problems of the compactification of extra dimensions in describing the motion in fourdimensional space-time are discussed

  16. CERN: Fixed target targets

    International Nuclear Information System (INIS)

    Full text: While the immediate priority of CERN's research programme is to exploit to the full the world's largest accelerator, the LEP electron-positron collider and its concomitant LEP200 energy upgrade (January, page 1), CERN is also mindful of its long tradition of diversified research. Away from LEP and preparations for the LHC proton-proton collider to be built above LEP in the same 27-kilometre tunnel, CERN is also preparing for a new generation of heavy ion experiments using a new source, providing heavier ions (April 1992, page 8), with first physics expected next year. CERN's smallest accelerator, the LEAR Low Energy Antiproton Ring continues to cover a wide range of research topics, and saw a record number of hours of operation in 1992. The new ISOLDE on-line isotope separator was inaugurated last year (July, page 5) and physics is already underway. The remaining effort concentrates around fixed target experiments at the SPS synchrotron, which formed the main thrust of CERN's research during the late 1970s. With the SPS and LEAR now approaching middle age, their research future was extensively studied last year. Broadly, a vigorous SPS programme looks assured until at least the end of 1995. Decisions for the longer term future of the West Experimental Area of the SPS will have to take into account the heavy demand for test beams from work towards experiments at big colliders, both at CERN and elsewhere. The North Experimental Area is the scene of larger experiments with longer lead times. Several more years of LEAR exploitation are already in the pipeline, but for the longer term, the ambitious Superlear project for a superconducting ring (January 1992, page 7) did not catch on. Neutrino physics has a long tradition at CERN, and this continues with the preparations for two major projects, the Chorus and Nomad experiments (November 1991, page 7), to start next year in the West Area. Delicate neutrino oscillation effects could become

  17. Collinear laser spectroscopy of atomic cadmium

    OpenAIRE

    Frömmgen, Nadja; Balabanski, Dimiter L.; Bissell, Mark L.; Bieroń, Jacek; Blaum, Klaus; Cheal, Bradley; Flanagan, Kieran; Fritzsche, Stephan; Geppert, Christopher; Hammen, Michael; Kowalska, Magdalena; Kreim, Kim; Krieger, Andreas; Neugart, Rainer; Neyens, Gerda

    2015-01-01

    Hyperfine structure $A$ and $B$ factors of the atomic $5s\\,5p\\,\\; ^3\\rm{P}_2 \\rightarrow 5s\\,6s\\,\\; ^3\\rm{S}_1$ transition are determined from collinear laser spectroscopy data of $^{107-123}$Cd and $^{111m-123m}$Cd. Nuclear magnetic moments and electric quadrupole moments are extracted using reference dipole moments and calculated electric field gradients, respectively. The hyperfine structure anomaly for isotopes with $s_{1/2}$ and $d_{5/2}$ nuclear ground states and isomeric $h_{11/2}$ sta...

  18. Soil biogeochemistry, plant physiology and phytoremediation of cadmium contaminated soils

    Science.gov (United States)

    Cadmium (Cd) loading in soil and the environment has been accelerated worldwide due to enhanced industrialization and intensified agricultural production, particularly in the developing countries. Soil Cd pollution, resulting from both anthropogenic and geogenic sources, has posed an increasing chal...

  19. A Study of Growth of Cadmium Oxide Nano structure

    International Nuclear Information System (INIS)

    Cadmium oxide nano structure were synthesized by solid-vapor deposition without catalyst. Cadmium Oxide powder was heated to 1320 K in a tube furnace, and the resultant vapor was carried to the silicon substrate zone by an argon flow. Field electron scanning electron microscopy revealed that the product was dendrite-like petals of Cadmium Oxide nano structure. The grown nano structure had random orientations and a grain size of 30 nm. Photoluminescence spectroscopy was conducted to investigate the optical properties of the nano structures. The red-shift direct band gap energy of Cadmium Oxide nano structure was at 548 nm (2.26 eV), whereas that of CdO bulk was at 491 nm (2.5 eV). (author)

  20. Polycrystalline Thin-Film Research: Cadmium Telluride (Fact Sheet)

    Energy Technology Data Exchange (ETDEWEB)

    2011-06-01

    Capabilities fact sheet that includes scope, core competencies and capabilities, and contact/web information for Polycrystalline Thin-Film Research: Cadmium Telluride at the National Center for Photovoltaics.

  1. Literature review on pickling inhibitors and cadmium electroplating processes

    Science.gov (United States)

    Elsea, A. R.; Fletcher, E. E.; Groeneveld, T. P.

    1969-01-01

    Because introduction of hydrogen during bright-cadmium electroplating of high strength steels causes hydrogen-stress cracking, a program was undertaken to evaluate various processes and materials. Report describes effectiveness of inhibitors for reducing hydrogen absorption by steels.

  2. EFFECTS OF CADMIUM ON THE REPRODUCTIVE AXIS OF JAPANESE MEDAKA

    Science.gov (United States)

    Cadmium (Cd) is a ubquitous element and a significant inorganic pollutant that has previously been found to bioaccumulate in reproductive organs of fish and disrupt important endocrine processes, especially those involved in synthesis, release and metabolism of hormones. Clearly,...

  3. A Facile Glycosylation of Spirostanol Catalyzed by Cadmium Carbonate

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    A facile glycosylation for the synthesis of spirostanol glycosides was reported. Using cadmium carbonate as a catalyst in CH3CN, a series of saponins was synthesized efficiently in a satisfactory yield.

  4. Ion exchange of Cobalt and Cadmium in Zeolite X

    International Nuclear Information System (INIS)

    The growing development in the industry has an important contribution to the environmental damage, where the natural effluents are each day more contaminated by toxic elements, such as: mercury, chromium, lead and cadmium. So as to separate such elements it has sorbent must have enough stability, and have a sharp capacity of sorption. In this work it was studied the sorption behavior of cobalt and on the other hand, cadmium in aqueous solutions, which along with sodic form of the Zeolite X, undergoes a phenomenon of ionic interchange. Such interchange was verify to different concentration of cadmium, cobalt and hydronium ion. The content of cobalt and sodium in the interchanged samples was detected through the neutronic activation analysis. The results disclose a higher selectivity for cadmium than cobalt. (Author)

  5. Intense 1.6 μm fluorescence of Nd3+ doped cadmium bismuth silicate glasses

    International Nuclear Information System (INIS)

    In this work, Judd-Ofelt analysis is applied to rare-earth (RE = Nd3+) doped cadmium bismuth silicate (20CdO⋅xSiO2⋅(79.5−x)Bi2O3⋅0.5Nd2O3 (CSBN)) glasses in order to evaluate their potential as well as both glass laser systems and optical materials. The phenomenological Judd-Ofelt parameters (Ω2, Ω4, Ω6) are determined for RE ions with their quality factors and compared with the equivalent parameters for several other hosts. The calculated value of stimulated emission cross-section for 4F3/2→4I11/2 has high and varies 14.72×10−20 to 9.66×10−20 cm2 with Bi2O3 content in the host glass. The results point out that the glass system is good candidate for the development of photonics devices which are operating near infrared spectral range. Further, the FTIR results reveal that the glasses have BiO6, SiO4 and non-bridging oxygen as local structure

  6. Prediction of cadmium concentration in selected home-produced vegetables.

    Science.gov (United States)

    Bešter, Petra Karo; Lobnik, Franc; Eržen, Ivan; Kastelec, Damijana; Zupan, Marko

    2013-10-01

    Soil contaminated with cadmium presents a potential hazard for humans, animals and plants. The latter play a major role in the transfer of cadmium to the food chain. The uptake of cadmium and its accumulation by plants is dependent on various soil, plants and environmental factors. In order to identify soil properties with statistically significant influence on cadmium concentration in vegetables and to reduce the collection of data, time and costs, regression models can be applied. The main objective of this research was to develop regression models to predict the concentration of cadmium in 9-vegetable species: zucchini, tomato, cabbage, onion, potato, carrot, red beet, endive and chicory, based on soil properties. Soil samples were collected from 123 home gardens of the Municipality of Celje and 59 of these gardens were also included in vegetable sampling. The concentration of elements (e.g. arsenic, cadmium, copper, lead, and zinc) in the samples was determined by Inductively Coupled Plasma Mass Spectrometry. Single (for cabbage, potato, red beet and chicory) and multiple (for tomato, onion, carrot and endive) linear regression models were developed. There was no statistically significant regression model for zucchini. The most significant parameter for the influencing the cadmium concentration in vegetables was the concentration of cadmium in soil. Other important soil properties were the content of organic matter, pH-value and the concentration of manganese. It was concluded that consuming carrots, red beets, endives, onions, potatoes and chicory which are grown in gardens with Cd concentrations (mgkg(-1) DW) above 2.4, 3.2, 6.3, 7.9, 8.3 and 10.9, respectively, might represent an important contribution to dietary Cd exposure. PMID:23886800

  7. Surfactant Mediated Cadmium Determination with Dithizone in Aqueous Solution

    OpenAIRE

    Ismael, Fouad Jawad

    2014-01-01

    ABSTRACT: Cadmium is a toxic and hazardous trace metal that has become a serious environmental pollutant since industrialization and intensive farming began in late 19th century. Although there are many established wet-chemical and instrumental methods for qualitative and quantitative determination of cadmium, most involve the formation of the Cd-dithizone complex in the presence of the highly toxic potassium cyanide which is then extracted into carcinogenic chlorinated organic solvents such ...

  8. Ecotoxicity and genotoxicity of cadmium in different marine trophic levels.

    Science.gov (United States)

    Pavlaki, Maria D; Araújo, Mário J; Cardoso, Diogo N; Silva, Ana Rita R; Cruz, Andreia; Mendo, Sónia; Soares, Amadeu M V M; Calado, Ricardo; Loureiro, Susana

    2016-08-01

    Cadmium ecotoxicity and genotoxicity was assessed in three representative species of different trophic levels of marine ecosystems - the calanoid copepod Acartia tonsa, the decapod shrimp, Palaemon varians and the pleuronectiform fish Solea senegalensis. Ecotoxicity endpoints assessed in this study were adult survival, hatching success and larval development ratio (LDR) for A. tonsa, survival of the first larval stage (zoea I) and post-larvae of P. varians, egg and larvae survival, as well as the presence of malformations in the larval stage of S. senegalensis. In vivo genotoxicity was assessed on adult A. tonsa, the larval and postlarval stage of P. varians and newly hatched larvae of S. senegalensis using the comet assay. Results showed that the highest sensitivity to cadmium is displayed by A. tonsa, with the most sensitive endpoint being the LDR of nauplii to copepodites. Sole eggs displayed the highest tolerance to cadmium compared to the other endpoints evaluated for all tested species. Recorded cadmium toxicity was (by increasing order): S. senegalensis eggs < P. varians post-larvae < P. varians zoea I < S. senegalensis larvae < A. tonsa eggs < A. tonsa LDR. DNA damage to all species exposed to cadmium increased with increasing concentrations. Overall, understanding cadmium chemical speciation is paramount to reliably evaluate the effects of this metal in marine ecosystems. Cadmium is genotoxic to all three species tested and therefore may differentially impact individuals and populations of marine taxa. As A. tonsa was the most sensitive species and occupies a lower trophic level, it is likely that cadmium contamination may trigger bottom-up cascading effects in marine trophic interactions. PMID:27203468

  9. Avalanche multiplication of electrons and holes in cadmium telluride

    CERN Document Server

    Demich, N V

    2001-01-01

    Determination of the ratio of the coefficients of the electrons and holes of the diode structures impact ionization is carried out with the purpose of optimizing the parameters of the avalanche diodes from the cadmium telluride. It is shown experimentally, that the process of the impact ionization in the cadmium telluride is stimulated by holes. The ratio of the coefficients of the holes and electrons impact ionization constitutes approx = 30-40

  10. Association between blood cadmium levels and malnutrition in peritoneal dialysis

    OpenAIRE

    Hsu, Ching-Wei; Lin, Ja-Liang; Lin-Tan, Dan-Tzu; Huang, Wen-Hung; Chen, Kuan-Hsing; Yen, Tzung-Hai

    2014-01-01

    Background Malnutrition is associated with an increased risk of cardiovascular death and may cause protein-energy wasting in individuals with chronic kidney disease. A previous study demonstrated that blood cadmium levels (BCLs) were associated with malnutrition in maintenance hemodialysis (MHD) patients. However, the correlation between cadmium exposure and malnutrition remains unclear in chronic peritoneal dialysis (CPD) patients. This study examined the possible adverse effects of environm...

  11. Harmful effects of cadmium on olfactory system in mice.

    Science.gov (United States)

    Bondier, Jean-Robert; Michel, Germaine; Propper, Alain; Badot, Pierre-Marie

    2008-10-01

    The inhalation of certain metals can result in olfactory epithelial injury, an altered sense of smell, and direct delivery of the metal from the olfactory epithelium to the olfactory bulbs and other parts of the central nervous system. The purpose of this study was to examine whether mice given an intranasal instillation of cadmium would develop altered olfactory function and to assess whether cadmium may be transported directly from the olfactory epithelium to the central nervous system. To evaluate cadmium's ability to induce anosmia and on the basis of olfactory epithelium sensitivity to metals, the aim of this study was first to study cadmium effects on the olfactory function and secondly to check whether cadmium may be transported from the nasal area to the central nervous system. After an intranasal instillation of a solution containing CdCl2 at 136 mM, we observed in treated mice: (1) a partial destruction of the olfactory epithelium, which is reduced to three or four basal cell layers followed by a progressive regeneration; (2) a loss of odor discrimination with a subsequent recovery; and (3) a cadmium uptake by olfactory bulbs demonstrated using atomic absorption spectrophotometry, but not by other parts of the central nervous system. Cadmium was delivered to the olfactory bulbs, most likely along the olfactory nerve, thereby bypassing the intact blood-brain barrier. We consider that cadmium can penetrate olfactory epithelium and hence be transported to olfactory bulbs. The olfactory route could therefore be a likely way to reach the brain and should be taken into account for occupational risk assessments for this metal.

  12. Sputter target

    Science.gov (United States)

    Gates, Willard G.; Hale, Gerald J.

    1980-01-01

    The disclosure relates to an improved sputter target for use in the deposition of hard coatings. An exemplary target is given wherein titanium diboride is brazed to a tantalum backing plate using a gold-palladium-nickel braze alloy.

  13. Cadmium removal in a biosorption column

    Energy Technology Data Exchange (ETDEWEB)

    Volesky, B.; Prasetyo, I. (McGill Univ., Montreal, Quebec (Canada). Dept. of Chemical Engineering)

    1994-05-01

    New biosorbent material derived from a ubiquitous brown marine alga Ascophyllum nodosum has been examined in packed-bed flow-through sorption columns. It effectively removed 10 mg/L of cadmium down to 1.5 ppb levels in the effluent, representing 99.985% removal. The experimental methodology used was based on the early Bohart and Adams sorption model, resulting in quantitative determination of the characteristic process parameters which can be used for performance comparison and process design. An average metal loading of the biosorbent (N[sub 0]) determined was 30 mg Cd/g, corresponding closely to that observed for the batch equilibrium metal concentration of 10 mg Cd/L. The critical bed depth (D[sub min]) for the potable water effluent quality standard varied with the column feed flow rate from 20 to 50 cm. The sorption column mass transfer and dispersion coefficients were determined, which are also required for solving the sorption model equations.

  14. Cadmium substituted high permeability lithium ferrite

    Indian Academy of Sciences (India)

    S S Bellad; S C Watawe; A M Shaikh; B K Chougule

    2000-04-01

    Polycrystalline Li0.5–/2 Cd Fe2.5–/2O4 ferrites where = 0, 0.1, 0.2, 0.3, 0.4, 0.5 and 0.6 were prepared by a double sintering ceramic technique and characterized by X-ray diffraction and scanning electron microscopy (SEM). The lattice parameter is found to increase monotonically with the cadmium content. It is explained in terms of the sizes of component ions. The grain size of the samples increases up to = 0.3 and then it decreases for higher values of . A similar trend is observed in the variation of Ms with Cd2+ content. The initial permeability () is however found to increase continuously with . The increase in is attributed to decrease of anisotropy constant K1 and higher grain size of the samples.

  15. Synthesis and Electroluminescence Characterization of Cadmium Complex

    Directory of Open Access Journals (Sweden)

    Rahulkumar

    2011-01-01

    Full Text Available We have synthesized and characterized a new electroluminescence material,Cadmium [(2-(2-hydroxyphenylbenzoxazole(8-hydoxyquinoline] Cd(HPBq. The absorption spectra of this material show maxima at 378 nm. It may be attributed due to π° – π* transition. The photoluminescence showed peak at 520 nm. TGA data of the material shows stability up to 370 °C .Organic light emitting diode have been fabricated with this material and the fundamental structures of the device is ITO/α-NPD/ Cd(HPBq/BCP/Alq3/LiF/Al exhibited a luminescence peak at 550 nm. The maximum luminescence of the device was 295 cd/m2 with current density of 6687 A/m2 at 20 V. The maximum current efficiency of OLED was 1.01 cd/A at 17 V and power efficiency was 1.01 lm/w at 17 V.

  16. Soil Cadmium Regulates Antioxidases in Sorghum

    Institute of Scientific and Technical Information of China (English)

    LIU Da-lin; ZHANG Shu-pan; CHEN Zheng; QIU Wei-wei

    2010-01-01

    The regulatory mechanism of soil cadmium(Cd)on antioxidases in sorghum was studied using 3 sorghum species viz.,sweet sorghum[Sorghum bicolor(L.)]Moench.cv.Hunnigreen,sorghum hybrid sudangrass(Sorghum bicolor × S.sudanense,cv.Everlush)and sudangrass[Sorghum sudanense(Piper)Stapf cv.Xinjiang].The results showed that low concentrations of Cd2+(≤10 mg kg-1)induced the activities of 4 antioxidases in leaves of the 3 species of sorghum,but high Cd2+concentrations(≥50 mg kg-1)significantly reduced the activities of all the four antioxidases.The glutathione(GSH)contents in leaves of the 3 species of sorghum correlated positively with the Cd2+concentrations.The maximum antioxidase activities were observed at the elongation stage of sorghum during the whole growth period.

  17. Flotation of cadmium-loaded biomass.

    Science.gov (United States)

    Matis, K A; Zouboulis, A I

    1994-07-01

    Biosorption of heavy metal ions such as Cd(2+) by dead biomass has been recognized as a potential alternative to existing removal technologies applied to wastewater treatment. Two bacterial strains were studied in the laboratory, streptomyces griseus and S. clavuligerus, an industrial by-product. Both washed and unwashed samples were examined. Foam flotation proposed in this work as the separation state following biosorption. Effective biomass separation was conducted in the presence of a frother, ethanol. The pH of the solution was a crucial parameter for flotation and also for metal binding. Other basic parameters of flotation examined were the initial cadmium concentration in the dilute aqueous solution and the quantity of biomass used. A study of zeta-potential measurements of the actinomycetes was carried out under the conditions used in the separation; surface tension was also measured. These provided useful information on the process. PMID:18618752

  18. Temsirolimus in the treatment of renal cell carcinoma associated with Xp11.2 translocation/TFE gene fusion proteins: a case report and review of literature

    Directory of Open Access Journals (Sweden)

    James Brown

    2009-12-01

    Full Text Available Xp11.2 translocation renal cell carcinomas (TRCCs are a rare family of tumors newly recognized by the World Health Organization (WHO in 2004. These tumors result in the fusion of partner genes to the TFE3 gene located on Xp11.2. They are most common in the pediatric population, but have been recently implicated in adult renal cell carcinoma (RCC presenting at an early age. TFE3-mediated direct transcriptional upregulation of the Met tyrosine kinase receptor triggers dramatic activation of downstream signaling pathways including the protein kinase B (Akt/phosphatidylinositol-3 kinase (PI3K and mammalian target of rapamycin (mTOR pathways. Temsirolimus is an inhibitor of mammalian target of rapamycin (mTOR kinase, a component of intracellular signaling pathways involved in the growth and proliferation of malignant cells. Here we present a case of a 22-year old female who has been treated with temsirolimus for her Xp11.2/TFE3 gene fusion RCC.

  19. Cadmium in goods - contribution to environmental exposure

    Energy Technology Data Exchange (ETDEWEB)

    Bergbaeck, B.; Jonsson, Arne [Kalmar Univ. (Sweden). Dept. of Natural Science

    1998-03-01

    The total amount of Cd used in Sweden since 1940 is approximately 5000 tonnes, including alloys, fertilizers and impurities in zinc. The stock of Cd in goods in the Swedish anthroposphere is dominated by NiCd-batteries. However, when one considers the degree of exposure to corrosion, Cd stabilizers are dominant. Emissions of Cd from industrial plants and other point sources have been historically important. However, these point source emissions must be seen in relation to the increasingly significant fugitive `consumption emissions`, from the use and/or end-use of various goods. In this study, methods of reconstructing the flows of cadmium (Cd) and estimating the emissions over time are discussed. This is done through studies of the development of production, technology, trade and the longevity of metals in Swedish society. This last part in the chain will form the `consumption emissions` calculated from emission factors giving the proportion of the cadmium content in goods that eventually will reach the environment. The main accumulation of metals in the anthroposphere occurs in urban areas where the influx of metals is greatest. Urban areas probably represent `hot spots` as far as this type of environmental impact is concerned. Extreme Cd concentrations in surface sediments in central Stockholm indicate an ongoing release of Cd from the anthroposphere. The sources are so far unknown, i.e. this Cd flow to the biosphere cannot be explained in terms of deposition or emissions from point sources. Approximately 40 tonnes of Cd in goods are exposed to corrosion in varying degrees. This stock is dominated by Cd in stabilizers and pigments, and as impurities in Zn 15 refs, 2 figs, 8 tabs

  20. Tantalum-cadmium film coatings: Preparation, phase composition, and structure

    Science.gov (United States)

    Tuleushev, Yu. Zh.; Volodin, V. N.; Zhakanbaev, E. A.

    2015-01-01

    Ion-plasma sputtering and codeposition of ultrafine Ta and Cd particles were used for the first time to prepare solid solutions, namely, alloys with up to 66.2 at % Cd in the form of coatings; the fact of such a production confirms the thermal-fluctuation melting and coalescence of small particles. When the coatings are formed by tantalum and cadmium nanolayers, the mutual dissolution of the components takes place, which is accompanied by the formation of solid solutions of one metal in the other. When the cadmium concentration is above 44 at %, the β-Ta tetragonal lattice transforms into the α-Ta body-centered cubic lattice. Beginning from 74.4 at % Cd, a hexagonal structure typical of cadmium is formed, and tantalum is present in the coatings in the form of amorphous phase. The formation of β-Ta- and Cd-based interstitial and α-Ta-based substitute solid solutions is stated. At 700°C, cadmium evaporates from Ta-based solid solutions, and porous tantalum is formed. The evaporation of cadmium from coatings, which consist of the mixture of tantalum solid solution in cadmium and amorphous tantalum, leads to the formation of tantalum characterized by a highly developed surface. The prepared Ta-based materials assume the technological application of the results of the investigation.

  1. Trichosporon jirovecii-mediated synthesis of cadmium sulfide nanoparticles.

    Science.gov (United States)

    El-Baz, Ashraf Farag; Sorour, Noha Mohamed; Shetaia, Youssria Mohamed

    2016-05-01

    Cadmium sulphide is one of the most promising materials for solar cells and of great interest due to its useful applications in photonics and electronics, thus the development of bio-mediated synthesis of cadmium sulphide nanoparticles (CdS NPs) is one of the essential areas in nanoparticles. The present study demonstrates for the first time the eco-friendly biosynthesis of CdS NPs using the yeast Trichosporon jirovecii. The biosynthesis of CdS NPs were confirmed by UV-Vis spectrum and characterized by X-ray diffraction assay and electron microscopy. Scanning and transmission electron microscope analyses shows the formation of spherical CdS NPs with a size range of about 6-15 nm with a mean Cd:S molar ratio of 1.0:0.98. T. jirovecii produced hydrogen sulfide on cysteine containing medium confirmed by positive cysteine-desulfhydrase activity and the colony color turned yellow on 0.1 mM cadmium containing medium. T. jirovecii tolerance to cadmium was increased by the UV treatment and three 0.6 mM cadmium tolerant mutants were generated upon the UV radiation treatment. The overall results indicated that T. jirovecii could tolerate cadmium toxicity by its conversion into CdS NPs on cysteine containing medium using cysteine-desulfhydrase as a defense response mechanism. PMID:26467054

  2. Properties of fission fragments for Z =112 -116 superheavy nuclei

    Science.gov (United States)

    Kaur, Gurjit; Sandhu, Kirandeep; Sharma, Manoj K.

    2016-07-01

    The dynamical cluster decay model (DCM) is applied to understand the dynamics of 48Ca+238U,244Pu,248Cm reactions at comparable excitation energies across the barrier. To understand the capture stage of *286112 ,*292114 , and *296116 nuclei, the compound nucleus formation probability is calculated. The indication of PC Nprocess such as quasifission may occur at the capture stage of the 48Ca induced reactions. To understand this further, the comparative decay analysis of *286112 ,*292114 and *296116 , nuclei is carried out using β2 i deformations within hot optimum orientation criteria, and the calculated fission cross sections find nice agreement with available data. The fission mass distribution shows a double humped structure where a symmetric peak observed around the Sn region appears to find its genesis in a symmetric quasifission component. On the other hand, the emergence of peaks around Pb in the decay of Z =112 , 114, and 116 nuclei signify the possible presence of asymmetric quasifission. Higher and broader asymmetric quasifission peaks are observed for *296116 and *292114 nuclei as compared to *286112 nucleus. Beside this, the total kinetic energy (TKE) distribution of the decay fragments is also explored by using different proximity potentials, such as Prox-77, Prox-88, and Prox-00. Prox-88 seems to perform better and the calculated TKE values find relatively better comparison at lower angular momentum states. The possible role of different radii of the decaying nuclei is also exercised to understand the TKE ¯ dynamics of 48Ca+238U,244Pu,248Cm reactions.

  3. The Role of Exopolymers in Protection of Ralstonia sp., a Cadmium-resistant Bacterium, from Cadmium Toxicity

    OpenAIRE

    Anchulee Watcharamusik; Benjaphorn Prapagdee

    2008-01-01

    Production of exopolymers is one of heavy metal resistance mechanisms in bacteria. Ralstonia sp. TAK1, a cadmium-resistant bacterium, was isolated from a high cadmium (Cd) contaminated soil at the zinc mine, Tak province, Thailand. The bacterium was cultivated in LB broth and its growth was monitored. The yields of exopolymers were measured by the phenol-sulfuric method at different growth phases. The levels of Cd resistance were quantitatively determined by survival cell assay. The highest a...

  4. Correlations of urinary cadmium with hypertension and diabetes in persons living in cadmium-contaminated villages in northwestern Thailand: A population study

    International Nuclear Information System (INIS)

    Risk for hypertension and diabetes has not been conclusively found to be a result of cadmium exposure. A population-based study was conducted in 2009 to examine the correlations of urinary cadmium, a good biomarker of long-term cadmium exposure, with hypertension and diabetes in persons aged 35 years and older who lived in the 12 cadmium-contaminated rural villages in northwestern Thailand. A total of 5273 persons were interviewed and screened for urinary cadmium, hypertension, and diabetes. The geometric mean level of urinary cadmium for women (2.4±2.3 μg/g creatinine) was significantly greater than that for men (2.0±2.2 μg/g creatinine). Hypertension was presented in 29.8% of the study population and diabetes was detected in 6.6%. The prevalence of hypertension significantly increased from 25.0% among persons in the lowest tertile of urinary cadmium to 35.0% in the highest tertile. In women, the rate of hypertension significantly increased with increasing urinary cadmium levels in both ever and never smokers, after adjusting for age, alcohol consumption, body mass index, and diabetes. In men, such association was less significantly found in never smokers. The study revealed no significant association between urinary cadmium and diabetes in either gender. Our study supports the hypothesis that environmental exposure to cadmium may increase the risk of hypertension. Risk for diabetes in relation to cadmium exposure remains uncertain in this exposed population.

  5. Correlations of urinary cadmium with hypertension and diabetes in persons living in cadmium-contaminated villages in northwestern Thailand: A population study

    Energy Technology Data Exchange (ETDEWEB)

    Swaddiwudhipong, Witaya, E-mail: swaddi@hotmail.com [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Mahasakpan, Pranee [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Limpatanachote, Pisit; Krintratun, Somyot [Department of Internal Medicine, Mae Sot General Hospital, Tak (Thailand)

    2010-08-15

    Risk for hypertension and diabetes has not been conclusively found to be a result of cadmium exposure. A population-based study was conducted in 2009 to examine the correlations of urinary cadmium, a good biomarker of long-term cadmium exposure, with hypertension and diabetes in persons aged 35 years and older who lived in the 12 cadmium-contaminated rural villages in northwestern Thailand. A total of 5273 persons were interviewed and screened for urinary cadmium, hypertension, and diabetes. The geometric mean level of urinary cadmium for women (2.4{+-}2.3 {mu}g/g creatinine) was significantly greater than that for men (2.0{+-}2.2 {mu}g/g creatinine). Hypertension was presented in 29.8% of the study population and diabetes was detected in 6.6%. The prevalence of hypertension significantly increased from 25.0% among persons in the lowest tertile of urinary cadmium to 35.0% in the highest tertile. In women, the rate of hypertension significantly increased with increasing urinary cadmium levels in both ever and never smokers, after adjusting for age, alcohol consumption, body mass index, and diabetes. In men, such association was less significantly found in never smokers. The study revealed no significant association between urinary cadmium and diabetes in either gender. Our study supports the hypothesis that environmental exposure to cadmium may increase the risk of hypertension. Risk for diabetes in relation to cadmium exposure remains uncertain in this exposed population.

  6. Effects of Soil pH,Texture,Moisture,Organic Matter and Cadmium Content on Cadmium Diffusion Coefficient

    Institute of Scientific and Technical Information of China (English)

    WUQI-TANG; J.L.MOREL; 等

    1994-01-01

    The supply of cadmium from soil to plant roots mainly depends on the diffusion prooess.This work was conducted to study the effects of some soil properties on cadmium diffusion coefficient (D) in soil. Measurements were made using the Shofield and Graham-Bryce's isotopic labelling method.Cadmium diffusion coefficients varied from 10-7to 10-9 cms2-1.Higher values were observed in acid sandy soils and lower values in calcareous clay soils.Liming an acid soil resulted in a substantial decrease of D.Addition of cadmium as nitrate salt generally increased D,while addition of sewage sludge and organic matter resulted in a significant decrease of cadmium diffusion.The rhizospheric activity also induced a moderate reduction in D.The relationships between D(10-9cms2-1)on the on hand and soil pH.moisture(Mc,g kg-1) ,organic matter(OM,g kg-1),clay(Cy,gkg-1)and cadmium content(Cd,mgkg-1) on the other were obtained by the multiple regression:D=182.1-29.91pH+0.210Mc-0.303OM+0.011Cy+1.64Cd(R2=0.859,n=22).

  7. Effects of cadmium accumulation from suspended sediments and phytoplankton on the Oyster Saccostrea glomerata

    International Nuclear Information System (INIS)

    Highlights: • Saccostrea glomerata accumulated cadmium from sediments and phytoplankton. • Effects were similar for both pathways. • Antioxidant capacity, lipid peroxidation and lysosomal destabilisation were affected. • Clear exposure–dose–response relationships were demonstrated. - Abstract: Metals are accumulated by filter feeding organisms via water, ingestion of suspended sediments or food. The uptake pathway can affect metal toxicity. Saccostrea glomerata were exposed to cadmium through cadmium-spiked suspended sediments (19 and 93 μg/g dry mass) and cadmium-enriched phytoplankton (1.6–3 μg/g dry mass) and cadmium uptake and effects measured. Oysters accumulated appreciable amounts of cadmium from both low and high cadmium spiked suspended sediment treatments (5.9 ± 0.4 μg/g and 23 ± 2 μg/g respectively compared to controls 0.97 ± 0.05 μg/g dry mass). Only a small amount of cadmium was accumulated by ingestion of cadmium-enriched phytoplankton (1.9 ± 0.1 μg/g compared to controls 1.2 ± 0.1 μg/g). In the cadmium spiked suspended sediment experiments, most cadmium was desorbed from sediments and cadmium concentrations in S. glomerata were significantly related to dissolved cadmium concentrations (4–21 μg/L) in the overlying water. In the phytoplankton feeding experiment cadmium concentrations in overlying water were <0.01 μg/L. In both exposure experiments, cadmium-exposed oysters showed a significant reduction in total antioxidant capacity and significantly increased lipid peroxidation and percentage of destabilised lysosomes. Destabilised lysosomes in the suspended sediments experiments also resulted from stress of exposure to the suspended sediments. The study demonstrated that exposure to cadmium via suspended sediments and to low concentrations of cadmium through the ingestion of phytoplankton, can cause sublethal stress to S. glomerata

  8. Effects of cadmium accumulation from suspended sediments and phytoplankton on the Oyster Saccostrea glomerata

    Energy Technology Data Exchange (ETDEWEB)

    Schmitz, Helena A.; Maher, William A., E-mail: bill.maher@canberra.edu.au; Taylor, Anne M.; Krikowa, Frank

    2015-03-15

    Highlights: • Saccostrea glomerata accumulated cadmium from sediments and phytoplankton. • Effects were similar for both pathways. • Antioxidant capacity, lipid peroxidation and lysosomal destabilisation were affected. • Clear exposure–dose–response relationships were demonstrated. - Abstract: Metals are accumulated by filter feeding organisms via water, ingestion of suspended sediments or food. The uptake pathway can affect metal toxicity. Saccostrea glomerata were exposed to cadmium through cadmium-spiked suspended sediments (19 and 93 μg/g dry mass) and cadmium-enriched phytoplankton (1.6–3 μg/g dry mass) and cadmium uptake and effects measured. Oysters accumulated appreciable amounts of cadmium from both low and high cadmium spiked suspended sediment treatments (5.9 ± 0.4 μg/g and 23 ± 2 μg/g respectively compared to controls 0.97 ± 0.05 μg/g dry mass). Only a small amount of cadmium was accumulated by ingestion of cadmium-enriched phytoplankton (1.9 ± 0.1 μg/g compared to controls 1.2 ± 0.1 μg/g). In the cadmium spiked suspended sediment experiments, most cadmium was desorbed from sediments and cadmium concentrations in S. glomerata were significantly related to dissolved cadmium concentrations (4–21 μg/L) in the overlying water. In the phytoplankton feeding experiment cadmium concentrations in overlying water were <0.01 μg/L. In both exposure experiments, cadmium-exposed oysters showed a significant reduction in total antioxidant capacity and significantly increased lipid peroxidation and percentage of destabilised lysosomes. Destabilised lysosomes in the suspended sediments experiments also resulted from stress of exposure to the suspended sediments. The study demonstrated that exposure to cadmium via suspended sediments and to low concentrations of cadmium through the ingestion of phytoplankton, can cause sublethal stress to S. glomerata.

  9. Cadmium: A toxin and a nutrient for marine phytoplankton. Doctoral thesis

    Energy Technology Data Exchange (ETDEWEB)

    Lee, J.G.

    1995-06-01

    Although cadmium is known to be very toxic, it exhibits nutrient-like vertical concentration profiles in the open ocean. Cadmium enhances the growth of the marine diatom Thalassiosira weissflogii, a chlorophyte and some prymnesiophytes at inorganic zinc and cadmium concentrations typical of surface seawater. Detailed studies of T. weissflogii show that cadmium is also regulated like a nutrient over a wide range of external inorganic cadmium (5-500pM) and inorganic zinc (2-16pM) concentrations. The cellular cadmium concentration is maintained at relatively constant levels both through uptake and, at high inorganic cadmium concentrations (5nM), export of cadmium, most likely complexed to the metal-binding polypeptide phytochelatin. Cadmium may play an essential role in carbon uptake under conditions of zinc limitation. The same low level of inorganic cadmium that enhances the growth of T. weissflogii restores the activity of carbonic anhydrase, thought to be the key enzyme limiting growth at low zinc. Cadmium coelutes with a least one of the multiple isoforms of carbonic anhydrase produced by T. weissfiogii and covaries with activity of this isoform. The substitution of cadmium for zinc in carbonic anhydrase links the geochemical cycle of cadmium to those of zinc and carbon.

  10. Scattering of polarized protons by nickel, strontium, cadmium, indium and tin isotopes

    International Nuclear Information System (INIS)

    Proton scattering experiments are described using polarized protons of 20.4 or 24.6 MeV and target nuclides with (nearly) one closed shell: 60Ni, 64Ni, 86Sr, 88Sr, 110Cd, 112Cd, 114Cd, 115In, 116Sn, 118Sn, 120Sn, 122Sn, 124Sn. The experimental arrangement is outlined and the results are presented. The data are analysed using the direct scattering theory and two currently available, nuclear models - the collective (macroscopic) and the shell (microscopic) models. (C.F.)

  11. SNP Microarray in FISH Negative Clinically Suspected 22q11.2 Microdeletion Syndrome

    OpenAIRE

    Ashutosh Halder; Manish Jain; Amanpreet Kaur Kalsi

    2016-01-01

    The present study evaluated the role of SNP microarray in 101 cases of clinically suspected FISH negative (noninformative/normal) 22q11.2 microdeletion syndrome. SNP microarray was carried out using 300 K HumanCytoSNP-12 BeadChip array or CytoScan 750 K array. SNP microarray identified 8 cases of 22q11.2 microdeletions and/or microduplications in addition to cases of chromosomal abnormalities and other pathogenic/likely pathogenic CNVs. Clinically suspected specific deletions (22q11.2) were d...

  12. Thrombocytopenia and Postpartum Hemorrhage in a Woman with Chromosome 22q11.2 Deletion Syndrome

    Science.gov (United States)

    Deng, Kathy; Nanda, Deepak

    2016-01-01

    Chromosome 22q11.2 deletion syndrome, also known as DiGeorge or velocardiofacial syndrome, is associated with a wide spectrum of phenotypic features. It is known to be associated with severe macrothrombocytopenia. Postpartum hemorrhage is a leading cause of maternal morbidity and mortality globally. Chromosome 22q11.2 deletion syndrome is rare cause of thrombocytopenia that can be a significant risk factor for life-threatening postpartum hemorrhage. We report a case of postpartum hemorrhage in a woman with 22q11.2 deletion syndrome causing severe macrothrombocytopenia. PMID:27366335

  13. Cadmium assessment on the intertidal water margins from the Óbidos Lagoon (western coast of Portugal

    Directory of Open Access Journals (Sweden)

    Marcia S.S. Santos

    2014-04-01

    Full Text Available The Óbidos Lagoon is the largest shallow coastal lagoon in Portugal. Like any other brackish water system, it has been potentially exposed to different sources of contamination (e.g. livestock farming, domestic and industrial sewage. Trace metals are persistent elements present in the water and sediments in their elemental and organic/inorganic forms. In fact, Cadmium is extremely pollutant due to its great solubility in water and high toxicity for organisms. Also, it is classified as a priority substance according to the European Union Water Frame directive. In this context, a seasonal environmental monitoring program was implemented in the intertidal water margins of the Óbidos Lagoon to assess the presence of Cadmium. In 2009 and 2010, eight sampling stations (S distributed on the shores of the Óbidos Lagoon were chosen and water and sediments were seasonally collected. In all samples, cadmium concentrations were analyzed by Atomic Absorption Spectrometry, with Graphite Furnace Technique. Cadmium dissolved in the water samples was only detected during summer months, with the highest values in the Barrosa’s arm (S3: 0.35 mg/l in 2009, and at the station further downstream (S1: 0.19 mg/l in 2010. In the suspended fraction of the water samples the trace metal was detectable in all seasons, with the maximum concentration at the Barrosa’s arm (S4: 1.04 mg/l in the winter of 2010. Cadmium was not detectable in the sediments during the summers and was sporadically present in the autumn and in the winter of 2009. The highest concentration in the sediments was observed at the Barrosa´s arm (S4: 140.78 mg/kg in the spring of 2010. As a whole, cadmium contamination appears to be mostly focused on the inner areas of the lagoon, at the Barrosa´s arm, but a clear seasonal pattern of variation was not detectable. These results allow a better understanding of the environmental quality of this ecosystem and may assist in the definition of coastal

  14. An HPLC-ICP-MS technique for determination of cadmium-phytochelatins in genetically modified Arabidopsis thaliana.

    Science.gov (United States)

    Sadi, Baki B M; Vonderheide, Anne P; Gong, Ji-Ming; Schroeder, Julian I; Shann, Jodi R; Caruso, Joseph A

    2008-01-01

    A reversed-phase high-performance liquid chromatographic technique was developed to separate cadmium-phytochelatin complexes (Cd-PC2, Cd-PC3, and Cd-PC4) of interest in the plant Arapidopsis thaliana. High-performance liquid chromatography (HPLC) was coupled to an inductively coupled plasma mass spectrometric (ICP-MS) system with some modification to the interface. This was done in order to sustain the plasma with optimum sensitivity for cadmium detection in the presence of the high methanol loads used in the gradient elution of the reversed-phase separation. The detection limits were found to be 91.8 ngl(-1), 77.2 ngl(-1) and 49.2 ngl(-1) for Cd-PC2, Cd-PC3, and Cd-PC4 respectively. The regression coefficients (r2) for Cd-PC2 to Cd-PC4 detection ranged from 0.998 to 0.999. The method was then used to investigate the occurrence and effect of cadmium-phytochelatin complexes in wild-type Arabidopsis and a phytochelatin-deficient mutant cad1-3 that had been genetically modified to ectopically express the wheat TaPCS1 phytochelatin synthase enzyme. The primary complex found in both wild-type and transgenic plants was Cd-PC2. In both lines, higher levels of Cd-PC2 were found in shoots than in roots, showing that phytochelatin synthases contribute to the accumulation of cadmium in shoots, in the Cd-PC2 form. Genetic modification did, however, impact the overall accumulation of Cd. Transgenic plants contained almost two times more cadmium in the form of Cd-PC2 in their roots than did the corresponding wild-type plants. Similarly, the shoot samples of the modified species also contained more (by 1.6 times) cadmium in the form of Cd-PC2 than the wild type. The enhanced role of PC2 in the transgenic Arabidopsis correlates with data showing long-distance transport of Cd in transgenic plants. Targeted transgenic expression of non-native phytochelatin synthases may contribute to improving the efficiency of plants for phytoremediation.

  15. 镉暴露对人体骨骼影响的研究进展%Research progress on effect of cadmium exposure on human skeleton

    Institute of Scientific and Technical Information of China (English)

    王雨昕; 李筱薇; 赖建强

    2015-01-01

    ABSTRACT:Cadmium is a heavy metal pollutant, it is non-biodegradable in the environment and its half-life within human body is as long as 10~30 years. The skeleton is considered to be the main target organ for cadmium toxicity, and researches had confirmed the correlation between cadmium toxicity and bone mineral density decrease as well as osteoporosis. This paper summarized the research on the effect of cadmium toxicity on human skeleton in different countries. The effect of cadmium exposure on skeleton varied with different target populations, and was especially strong on the elder persons. So the target population should be grouped more reasonable in these kinds of studies. People who not only live in the polluted area but also have high urinary cadmium level should be classified as the high cadmium exposure group. Also, higher calcium intake was the protective factor of bone mineral density. The risk for cadmium exposure on osteoporosis and fractures may be enlarged due to the ignorance of the combined effect on intake of calcium and cadmium exposure. The calcium intake of target population should also be considered in grouping, only in this way we can discuss the real risk of osteoporosis and fractures caused by cadmium exposure.%镉是一种环境重金属污染物,在环境中不能进行生物降解,在人体内半衰期长达10-30年。骨骼是镉的重要靶器官,已有研究证实镉是诱发骨密度降低和骨质疏松症发生的危险因素之一。本文综述了镉暴露对人体骨骼影响的国内外相关文献。结果表明,镉暴露对人体骨骼的影响因目标人群的不同而存在差异,且主要受影响人群为中老年人,因此研究时应对目标人群进行合理分组,将镉污染区内尿镉浓度较高的人群划分为高暴露组较为合适。此外,高钙摄入量是人体骨密度的保护因素,但是目前罕有研究将目标人群的钙摄入量的状况和镉暴露状况相

  16. Role of oxidative stress in cadmium toxicity and carcinogenesis

    International Nuclear Information System (INIS)

    Cadmium (Cd) is a toxic metal, targeting the lung, liver, kidney, and testes following acute intoxication, and causing nephrotoxicity, immunotoxicity, osteotoxicity and tumors after prolonged exposures. Reactive oxygen species (ROS) are often implicated in Cd toxicology. This minireview focused on direct evidence for the generation of free radicals in intact animals following acute Cd overload and discussed the association of ROS in chronic Cd toxicity and carcinogenesis. Cd-generated superoxide anion, hydrogen peroxide, and hydroxyl radicals in vivo have been detected by the electron spin resonance spectra, which are often accompanied by activation of redox sensitive transcription factors (e.g., NF-κB, AP-1 and Nrf2) and alteration of ROS-related gene expression. It is generally agreed upon that oxidative stress plays important roles in acute Cd poisoning. However, following long-term Cd exposure at environmentally-relevant low levels, direct evidence for oxidative stress is often obscure. Alterations in ROS-related gene expression during chronic exposures are also less significant compared to acute Cd poisoning. This is probably due to induced adaptation mechanisms (e.g., metallothionein and glutathione) following chronic Cd exposures, which in turn diminish Cd-induced oxidative stress. In chronic Cd-transformed cells, less ROS signals are detected with fluorescence probes. Acquired apoptotic tolerance renders damaged cells to proliferate with inherent oxidative DNA lesions, potentially leading to tumorigenesis. Thus, ROS are generated following acute Cd overload and play important roles in tissue damage. Adaptation to chronic Cd exposure reduces ROS production, but acquired Cd tolerance with aberrant gene expression plays important roles in chronic Cd toxicity and carcinogenesis.

  17. Detected CFCs: UV Absorption Spectra, Atmospheric Lifetimes, Global Warming and Ozone Depletion Potentials for CFC-112, CFC-112a, CFC-113a and CFC-114a

    Science.gov (United States)

    Bernard, F.; Davis, M. E.; McGillen, M.; Fleming, E. L.; Burkholder, J. B.

    2015-12-01

    Chlorofluorocarbons (CFCs) are ozone depleting substances (ODSs) and potent greenhouse gases. Measurements have observed CFC-112 (CFCl2CFCl2), CFC-112a (CF2ClCCl3), and CFC-113a (CCl3CF3) in the atmosphere (Laube et al., 2014). The current atmospheric abundances of CFC-112 and CFC-112a are ~0.4 and ~0.06 ppt, respectively, with decreasing abundance since 1995. In contrast, CFC-113a was found to show continuous growth over the past 50 years with a current atmospheric abundance of ~0.5 ppt. The major atmospheric removal process for these compounds is expected to be UV photolysis in the stratosphere. To date there is, however, no UV absorption spectra for these compounds available in the literature. To better determine the atmospheric lifetimes and environmental impact of these CFCs, laboratory measurements of the UV absorption spectra of CFC-112, CFC-112a, CFC-113a, and CFC-114a (Cl2FCF3) between 195 and 235 nm and over the temperature range 207 to 323 K were performed. Spectrum parametrizations were developed for use in atmospheric models. Atmospheric lifetimes and ozone depletion potentials (ODPs) were calculated using the Goddard Space Flight Center 2-D atmospheric chemistry model. Infrared absorption spectra of these compounds were also measured and used to calculate their global warming potentials. The results of the laboratory measurements and model calculations will be presented. J. C. Laube et al., Newly detected ozone-depleting substances in the atmosphere, Nature Geoscience, 7, 266-269, 2014

  18. CONCENTRATION OF CADMIUM IN MEAT AND SELECTED MEATS PRODUCTS

    Directory of Open Access Journals (Sweden)

    Anetta Lukáčová

    2015-02-01

    Full Text Available The cadmium concentrations depend on the environmental conditions and food production methods. The monitoring of cadmium concentration in meat is important for human health. The concentrations of cadmium in meat and meat products collected from central Slovakia, in the central Europe region and from different countries of West Europe were assessed using by AA spectrometer with graphite furnace (PerkinElmer AAnalyst 80, MA, USA. Within starting materials we detected the highest values of cadmium in beef from foreign production (0.1101 ppm, followed by pork from foreign production (0.0901 ppm in Lovecka salama and pork thigh (0.0523 ppm in selected ham. In Lovecka salami we were found the highest concentration of cadmium in final samples from foreign starting materials, followed by homogenized samples from foreign starting materials, final samples from domestic starting materials and homogenized samples from domestic starting materials (0.3728, 0.3549, 0.2387, 0.2112 ppm, respectively. The highest concentration of cadmium in selected ham were found in final products from foreign starting materials, homogenized samples from foreign starting materials, final products from domestic starting materials and homogenized samples from domestic starting materials (0.1453, 0.1382,0.0810, 0.0734 ppm, respectively. The obtained results suggested that the concentrations of cadmium are higher in homogenized samples and final products in Lovecka salami and selected ham in comparison with to starting materials. Technological process of meat processing can create a potential source of heavy metals in final products.

  19. Predictors of urinary cadmium levels in adult females

    Energy Technology Data Exchange (ETDEWEB)

    McElroy, Jane A. [University of Wisconsin Paul P. Carbone Comprehensive Cancer Center, 610 Walnut Street, 370 WARF, Madison, WI 53726 (United States)]. E-mail: jamcelroy@wisc.edu; Shafer, Martin M. [University of Wisconsin, Environmental Chemistry and Technology Program, 600 N Park Street, Madison, WI 53706 (United States); Hampton, John M. [University of Wisconsin Paul P. Carbone Comprehensive Cancer Center, 610 Walnut Street, 370 WARF, Madison, WI 53726 (United States); Newcomb, Polly A. [University of Wisconsin Paul P. Carbone Comprehensive Cancer Center, 610 Walnut Street, 370 WARF, Madison, WI 53726 (United States); Fred Hutchinson Cancer Research Center, Cancer Prevention Program, 1100 Fairview Ave N, M4-B402 PO Box 19024, Seattle, WA 98109 (United States)

    2007-09-01

    Ubiquitous exposure to low levels of cadmium has raised concern about adverse health effects. The aim of this study was to identify characteristics of non-occupationally exposed adult females that correlated with creatinine-adjusted urinary cadmium levels. In our population-based study, trained interviewers collected information from 254 female Wisconsin residents aged 20-69 years on tobacco use, limited dietary consumption patterns, reproductive history, demographics, and residential history. Participants provided spot-urine specimens collected at home. Urine cadmium concentrations were quantified using inductively-coupled plasma mass spectrometry and creatinine levels were also determined. Least square means and 95% confidence intervals for the natural log of the creatinine-adjusted urinary cadmium levels were calculated for each characteristic using multivariate analysis of variance adjusting for age and smoking status. Results were calculated on the log scale and then transformed to the original scale by taking the exponent of each of the values. We observed statistically significant increasing creatinine-adjusted urinary cadmium mean levels relative to smoking status, older age, parity, lower body surface area, mineral zinc supplement consumption, and high income. We did not observe a difference relative to consumption of organ meats, crustaceans, alcohol, multivitamins, multiminerals or homegrown vegetables, age of menopause, menarche of participant or oldest daughter, menopausal status or urban-rural residential location. Approximately 40% of the variance in creatinine-adjusted urinary cadmium levels in adult women was explained by several characteristics. Similar to other studies, age and smoking were the strongest determinants of creatinine-adjusted urinary cadmium concentration.

  20. Cadmium, ATPase-P, yeast. From transport to toxicity

    International Nuclear Information System (INIS)

    Two projects has been developed during my PhD. One consisting in the functional study of CadA, the Cd2+-ATPase from Listeria monocytogenes, the other one was focused on the toxicity of cadmium and the associated response of the yeast Saccharomyces cerevisiae. This two studies used a a phenotype of sensitivity to cadmium induced by CadA expression in yeast. This phenotype was used as a screening tool to identify essential amino acids of Cd transport by CadA and to study cadmium toxicity and the corresponding yeast cellular response. CadA actively transports Cd using ATP hydrolysis as energy source. Directed mutagenesis of the membranous polar, sulphur and charged amino-acids revealed that Cd transport pathway implied four transmembrane segments (Tm) and more precisely the cysteine C354, C356 and proline P355 of the CPC motif located in Tm6, aspartate D692 in Tm8, glutamate E164 in Tm4 and methionine M149 in Tm5. From our studies, 2 Cd ions would be translocated for each hydrolysis ATP. Expression of CadA in the yeast Saccharomyces cerevisiae induces an hypersensitivity to Cd. A wild type cell can grow up to 100 μm cadmium whereas CadA expressing yeast cannot grow with 1 μm cadmium in the culture medium. This cadmium sensitivity was due to the localisation of CadA in the endoplasmic reticulum membrane. Transport of cadmium in this compartment produces an accumulation of mis-folded proteins that induces the Unfolded Protein Response (UPR). As UPR also occurs in a wild type yeast exposed to low Cd concentration, one can point out endoplasmic reticulum as a extremely sensitive cellular compartment. UPR also appears as an early response to Cd as it happens far before any visible signs of toxicity. (author)

  1. Effect of Biochar on Relieving Cadmium Stress and Reducing Accumulation in Super japonica Rice

    Institute of Scientific and Technical Information of China (English)

    ZHANG Zhen-yu; MENG Jun; DANG Shu; CHEN Wen-fu

    2014-01-01

    It is of great importance to solve the threats induced by cadmium pollution on crops. This paper examined the effect of biochar on cadmium accumulation in japonica rice and revealed the mechanism underlying the response of protective enzyme system to cadmium stress. Biochar derived from rice straw was applied at two application rates under three cadmium concentrations. Shennong 265, super japonica rice variety, was selected as the test crop. The results indicated that cadmium content in above-ground biomass of rice increased with increasing soil cadmium concentrations, but the biochar application could suppress the accumulation of cadmium to some extent. Under high concentrations of cadmium, content of free proline and MDA (malondialdehyde) were high, so did the SOD (superoxide dismutase), POD (peroxidase) and CAT (catalase) activity in the lfag leaf of rice. However, the protective enzyme activities remained at low level when biochar was added.

  2. File list: His.Adp.05.H2BS112GlcNAc.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Adp.05.H2BS112GlcNAc.AllCell hg19 Histone H2BS112GlcNAc Adipocyte SRX760966,SRX...760963,SRX760964,SRX760965,SRX760962 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/His.Adp.05.H2BS112GlcNAc.AllCell.bed ...

  3. File list: His.Adp.20.H2BS112GlcNAc.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.Adp.20.H2BS112GlcNAc.AllCell hg19 Histone H2BS112GlcNAc Adipocyte SRX760962,SRX...760966,SRX760963,SRX760965,SRX760964 http://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/His.Adp.20.H2BS112GlcNAc.AllCell.bed ...

  4. File list: His.PSC.05.H2BS112GlcNAc.AllCell [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available His.PSC.05.H2BS112GlcNAc.AllCell hg19 Histone H2BS112GlcNAc Pluripotent stem cell h...ttp://dbarchive.biosciencedbc.jp/kyushu-u/hg19/assembled/His.PSC.05.H2BS112GlcNAc.AllCell.bed ...

  5. 40 CFR Appendix B to Part 112 - Memorandum of Understanding Among the Secretary of the Interior, Secretary of Transportation, and...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Memorandum of Understanding Among the... Agency B Appendix B to Part 112 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS OIL POLLUTION PREVENTION Pt. 112, App. B Appendix B to Part 112—Memorandum...

  6. 40 CFR Appendix A to Part 112 - Memorandum of Understanding Between the Secretary of Transportation and the Administrator of the...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Memorandum of Understanding Between... Appendix A to Part 112 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS OIL POLLUTION PREVENTION Pt. 112, App. A Appendix A to Part 112—Memorandum of Understanding...

  7. 46 CFR 112.20-5 - Failure of power from the normal source or final emergency power source.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Failure of power from the normal source or final emergency power source. 112.20-5 Section 112.20-5 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY... and a Final Emergency Power Source § 112.20-5 Failure of power from the normal source or...

  8. 20 CFR 404.112 - When we consider certain employees of private nonprofit organizations to be fully insured.

    Science.gov (United States)

    2010-04-01

    ... nonprofit organizations to be fully insured. 404.112 Section 404.112 Employees' Benefits SOCIAL SECURITY... Coverage Fully Insured Status § 404.112 When we consider certain employees of private nonprofit organizations to be fully insured. If you are age 55 or over on January 1, 1984, and are on that date...

  9. Accumulation and effects of cadmium on guppy (Poecilia reticulata) fed cadmium-dosed cladocera (Moina macrocopa)

    Energy Technology Data Exchange (ETDEWEB)

    Hatakeyama, S.; Yasuno, M.

    1982-08-01

    The study examines the rate of cadmium uptake and body burdens which cause adverse effects on the survival and growth of guppies when they are exposed to Cd dosed in zooplankton (Moina macrocopa) and Cd dissolved in water. Eight guppies fed Moina dosed at 20 ..mu..g Cd/L water died before 10 days. Growth of the remainder of the guppies exposed at this rate was impaired initially but was returned to control level around the 10th day of the study. (JMT)

  10. Cadmium chloride induced cell injury through oxidative stress%镉通过氧化应激机制诱导LLC-PK1细胞损伤

    Institute of Scientific and Technical Information of China (English)

    方鑫; 李海玲; 安彩艳

    2014-01-01

    目的:探讨镉诱导猪肾近曲小管上皮细胞(LLC-PK1)毒性及氧化应激在其中的作用。方法用不同浓度的氯化镉刺激细胞9h和25μmol/L的氯化镉刺激细胞不同时间,采用Formazan 分析细胞存活率反映镉对细胞的损伤程度;以还原型谷胱甘肽(GSH)为靶点,影响GSH浓度的两个试剂BSO和NAC,观察镉诱导细胞损伤中氧化应激的作用。结果随着氯化镉染毒时间延长,细胞存活率下降,同样,随着剂量的增加,细胞的存活率逐渐也下降。同时BSO加重镉诱导的细胞损伤,NAC完全抑制镉诱导的细胞损伤。结论氯化镉对LLC- PK1细胞具有明显的毒性,细胞损伤是通过氧化应激介导,且与细胞内的谷胱甘肽的水平有着密切关系。%Objective To investigate the possible mechanisms of cadmium chloride-induced LLC-PK1 cell toxicity and the role of oxidative stress during the progress. Methods LLC-PK1 cells were treated with different concentrations of cadmium chloride for 9h,and different times at the same dose of cadmium chloride (25μmol/L), respectively.Formazan was used to analyze the cells viability.GSH was taken as a target,and the role of oxidative stress in the progress of cadmium chloride-induced cell injury was assessed by BSO and NAC. Results With the increasing of treatment time and cadmium concentration,Cadmium-induced cell toxicity became more serious and the viability of cells decreased.The cell susceptibility to cadmium chloride could be substantially altered by glutathione (GSH)-modulating agents.Depletion of GSH with BSO increased, whereas supply of cells with NAC decreased subsequent cell injury. Conclusion Cadmium chloride induced cell injury through oxidative stress,which was closely associated with the expression level of intracellular GSH.

  11. Cadmium Impairs p53 Activity in HepG2 Cells

    OpenAIRE

    Urani, C.; Melchioretto, P.; M. Fabbri; Bowe, G.; Maserati, E.; Gribaldo, L.

    2014-01-01

    Cadmium and cadmium compounds are contaminants of the environment, food, and drinking water and are important constituents of cigarette smoke. Cd exposure has also been associated with airborne particulate CdO and with Cd-containing quantum dots in medical therapy. Adverse cadmium effects reported in the literature have stimulated during recent years an ongoing discussion to better elucidate cadmium outcomes at cell and molecular level. The present work is designed to gain an insight into the...

  12. Cadmium Stress Induced Changes in Antioxidant Enzymes, Lipid Peroxidation and Hydrogen Peroxide Contents in Barley Seedlings

    OpenAIRE

    Amel Alayat; Lynda Souiki; Mohammed Reda Djebar; Zine Eddine Boumedris; Ouissem Moumeni; Houria Berrebbah

    2015-01-01

    Cadmium pollution is a problem of increasing significance for ecological, nutritional and environmental reasons. Different plant species and varieties show a wide range of plasticity in Cadmium tolerance, from a high degree of sensitivity to the hyper-accumulating phenotype of some tolerant plants. To avoid Cadmium toxicity, plants adopt various defense strategies. The present study was undertaken to assess and investigate the antioxidant responses of barley (Hordeum vulgare) L.) to cadmium t...

  13. A method for making a cadmium anode for a hermetically sealed alkaline storage battery

    Energy Technology Data Exchange (ETDEWEB)

    Morioka, Y.; Yosikhira, Y.

    1983-07-14

    Metallic cadmium powder and a glue solution are added to CdO powder. The compound is applied to a current tap and dried. The powder form metallic cadmium is prepared from a mixture of zinc and nickel powder which is dispersed in a solution of cadmium salts. As a result of the replacement reaction, a spongy metallic cadmium is produced which contains nickel. The sponge is ground. The obtained powder is used as an additive for the CdO.

  14. Livolin Forte Ameliorates Cadmium-Induced Kidney Injury in Wistar Rats

    Directory of Open Access Journals (Sweden)

    Akomolafe Rufus O.

    2016-06-01

    Full Text Available The kidney, which is an integral part of the drug excretion system, was reported as one of the targets of cadmium toxicity. Early events of cadmium toxicity in the cell include a decrease in cell membrane fluidity, breakdown of its integrity, and impairment of its repair mechanisms. Phosphatidylcholine and vitamin E have a marked fluidizing effect on cellular membranes. We hypothesized that Livolin forte (LIV could attenuate kidney damage induced by cadmium in rats. Twenty-five adult male Wistar rats were divided into five groups of five rats each: group I (control group received 0.3 ml/kg/day of propylene glycol for six weeks; group II was given 5 mg/kg/day of cadmium (Cd i.p for 5 consecutive days; group III rats were treated in a similar way as group II but were allowed a recovery period of 4 weeks; group IV was treated with LIV (5.2 mg/kg/day for a period of 4 weeks after inducing renal injury with Cd similarly to group II; and group V was allowed a recovery period of 2 weeks after a 4-week LIV treatment (5.2 mg/kg/day following Cd administration. A significant increase in plasma creatinine, urea, uric acid, and TBARS were observed in groups II and III compared to the control rats. Significant reductions in total protein, glucose, and GSH activity were also recorded. The urine concentrations of creatinine, urea, and uric acid in groups II and III were significantly lower than the control group. Th is finding was accompanied by a significant decrease in creatinine and urea clearance. Post-treatment with LIV caused significant decreases in plasma creatinine, urea, uric acid, and TBARS. Significant increases in total protein, glucose, and GSH activity of groups IV and V were observed compared to group II. A significant increase in urine concentrations of creatinine, urea, and uric acid and significant decreases in total protein, glucose, and GSH activity were observed in groups IV and V compared to group II. Photomicrographs of the rat kidneys

  15. Application of path analysis to urinary findings of cadmium-induced renal dysfunction.

    Science.gov (United States)

    Abe, T; Kobayashi, E; Okubo, Y; Suwazono, Y; Kido, T; Shaikh, Z A; Nogawa, K

    2001-01-01

    In order to identify some causal relations among various urinary indices of cadmium-induced renal dysfunction, such as glucose, total protein, amino nitrogen, beta 2-microglobulin (beta 2-m), metallothionein (MT), and cadmium (Cd), we applied path analysis method to previous epidemiological studies targeting the residents of the Cd-polluted Kakehashi River basin of Ishikawa Prefecture, Japan. We obtained a diagram-termed path model, representing some causal relations among the above urinary indices. It shows that urinary Cd is located at the beginning point in the diagram, and Cd-induced renal dysfunction develops in the following order: Cd exposure-->increase of beta 2-m and/or MT excretion-->increase of amino-N and/or total protein excretion-->increase of glucose excretion. It was proved mathematically, that in the case of both males and females, increased excretions of beta 2-m and/or MT were the most sensitive urinary indices of the early stage of chronic Cd-induced renal dysfunction.

  16. 112 muutub ühtseks hädaabinumbriks / Hannes Krause

    Index Scriptorium Estoniae

    Krause, Hannes

    2005-01-01

    Kavandatakse häirekeskuse hädaabinumbri 112 ja politsei hädaabinumbri 110 liitmist. Politseiameti komissar Andrus Kroon kahest hädaabinumbri ühendamise võimalusest. Lisa: Hädaabinumbrid Euroopas

  17. Nrf2 activation prevents cadmium-induced acute liver injury

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Kai C. [Department of Pharmacology, Toxicology, and Therapeutics, University of Kansas Medical Center, Kansas City, KS (United States); Liu, Jie J. [Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS (United States); Klaassen, Curtis D., E-mail: cklaasse@kumc.edu [Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS (United States)

    2012-08-15

    Oxidative stress plays an important role in cadmium-induced liver injury. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that up-regulates cytoprotective genes in response to oxidative stress. To investigate the role of Nrf2 in cadmium-induced hepatotoxicity, Nrf2-null mice, wild-type mice, kelch-like ECH-associated protein 1-knockdown (Keap1-KD) mice with enhanced Nrf2, and Keap1-hepatocyte knockout (Keap1-HKO) mice with maximum Nrf2 activation were treated with cadmium chloride (3.5 mg Cd/kg, i.p.). Blood and liver samples were collected 8 h thereafter. Cadmium increased serum alanine aminotransferase (ALT) and lactate dehydrogenase (LDH) activities, and caused extensive hepatic hemorrhage and necrosis in the Nrf2-null mice. In contrast, Nrf2-enhanced mice had lower serum ALT and LDH activities and less morphological alternations in the livers than wild-type mice. H{sub 2}DCFDA (2′,7′-dichlorodihydrofluoresein diacetate) staining of primary hepatocytes isolated from the four genotypes of mice indicated that oxidative stress was higher in Nrf2-null cells, and lower in Nrf2-enhanced cells than in wild-type cells. To further investigate the mechanism of the protective effect of Nrf2, mRNA of metallothionein (MT) and other cytoprotective genes were determined. Cadmium markedly induced MT-1 and MT-2 in livers of all four genotypes of mice. In contrast, genes involved in glutathione synthesis and reducing reactive oxygen species, including glutamate-cysteine ligase (Gclc), glutathione peroxidase-2 (Gpx2), and sulfiredoxin-1 (Srxn-1) were only induced in Nrf2-enhanced mice, but not in Nrf2-null mice. In conclusion, the present study shows that Nrf2 activation prevents cadmium-induced oxidative stress and liver injury through induction of genes involved in antioxidant defense rather than genes that scavenge Cd. -- Highlights: ► Cadmium caused extensive hepatic hemorrhage and necrosis in Nrf2-null mice. ► Keap1-KD and Keap1-HKO mice

  18. Nrf2 activation prevents cadmium-induced acute liver injury

    International Nuclear Information System (INIS)

    Oxidative stress plays an important role in cadmium-induced liver injury. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that up-regulates cytoprotective genes in response to oxidative stress. To investigate the role of Nrf2 in cadmium-induced hepatotoxicity, Nrf2-null mice, wild-type mice, kelch-like ECH-associated protein 1-knockdown (Keap1-KD) mice with enhanced Nrf2, and Keap1-hepatocyte knockout (Keap1-HKO) mice with maximum Nrf2 activation were treated with cadmium chloride (3.5 mg Cd/kg, i.p.). Blood and liver samples were collected 8 h thereafter. Cadmium increased serum alanine aminotransferase (ALT) and lactate dehydrogenase (LDH) activities, and caused extensive hepatic hemorrhage and necrosis in the Nrf2-null mice. In contrast, Nrf2-enhanced mice had lower serum ALT and LDH activities and less morphological alternations in the livers than wild-type mice. H2DCFDA (2′,7′-dichlorodihydrofluoresein diacetate) staining of primary hepatocytes isolated from the four genotypes of mice indicated that oxidative stress was higher in Nrf2-null cells, and lower in Nrf2-enhanced cells than in wild-type cells. To further investigate the mechanism of the protective effect of Nrf2, mRNA of metallothionein (MT) and other cytoprotective genes were determined. Cadmium markedly induced MT-1 and MT-2 in livers of all four genotypes of mice. In contrast, genes involved in glutathione synthesis and reducing reactive oxygen species, including glutamate-cysteine ligase (Gclc), glutathione peroxidase-2 (Gpx2), and sulfiredoxin-1 (Srxn-1) were only induced in Nrf2-enhanced mice, but not in Nrf2-null mice. In conclusion, the present study shows that Nrf2 activation prevents cadmium-induced oxidative stress and liver injury through induction of genes involved in antioxidant defense rather than genes that scavenge Cd. -- Highlights: ► Cadmium caused extensive hepatic hemorrhage and necrosis in Nrf2-null mice. ► Keap1-KD and Keap1-HKO mice were

  19. Assessment of radio modulatory potential of emblica against radiation and cadmium induced biochemical changes in kidney of Swiss albino mice

    International Nuclear Information System (INIS)

    Ionizing radiation Induces cellular damage through direct ionization of DNA and other cellular targets and indirectly via reactive oxygen species which may include effects from epigenetic changes. It has been known since ancient times that Cadmium is virtually toxic to every organ of body including renal system. Radioprotectors are compounds that are designed to reduce the damage in normal tissue caused by radiation and cadmium. Emblica officinalis extract has been shown to possess high antioxidative, anticancer, lipid lowering, antisclerotic, hepatoprotective and anti-HIV potential. It is highly nutritious and important dietary source of vitamin. Emblica contains a polyphenols, especially tannins and other phenolic compounds. Considering antioxidant properties of Emblica, the aim of this study was to access the efficacy of Emblica in reducing radiation and cadmium induced changes in mouse kidney. For this purpose four male mice were randomly assigned into six treatment groups. The mice in the treatment groups II to VII treated respectively with cadmium chloride, radiation (7.0 Gy) combined treatment and drug treated groups. All biochemical parameters of the control groups were compared with the respective experimental groups. An increase in the value of total proteins, glycogen, acid phosphatase, alkaline phosphatase activity and RNA was observed up to day-14 in the non drug treated group and day 7 in the Emblica treated groups. Thereafter value declined up to day-28 without reaching to normal. Whereas the value of cholesterol and DNA showed a decreasing trend up to day-14 in non drug treated groups and day-7 in Emblica treated groups. The biochemical findings indicated the drug treated section of the kidney showed slightly/no degenerative changes. The treated groups demonstrating the ability of Emblica to inhibit oxidative stress thus preventing renal injury. (author)

  20. ASSESSMENT OF CADMIUM EXPOSURE AND TOXICITY RISK IN AN AMERICAN VEGETARIAN POPULATION

    Science.gov (United States)

    It has been postulated that nonvegetarians may be exposed to less cadmium than vegetarians because of the cadmium-poor meat in their diet. This study attempts to test this possibility by measuring the cadmium exposure and accumulation in a population subgroup that includes many v...

  1. 76 FR 57682 - Petition Requesting Regulations Restricting Cadmium in Children's Products

    Science.gov (United States)

    2011-09-16

    ... cadmium in children's products, especially toy metal jewelry. On September 6, 2011, the Commission granted... cadmium in children's jewelry is published by ASTM International, Inc. (``ASTM'') within three months after September 16, 2011. If a voluntary standard for cadmium in children's jewelry is published by...

  2. 40 CFR 415.640 - Applicability; description of the cadmium pigments and salts production subcategory.

    Science.gov (United States)

    2010-07-01

    ... cadmium pigments and salts production subcategory. 415.640 Section 415.640 Protection of Environment... POINT SOURCE CATEGORY Cadmium Pigments and Salts Production Subcategory § 415.640 Applicability; description of the cadmium pigments and salts production subcategory. The provisions of this subpart...

  3. Subcellular Localization of Cadmium in Chlorella vulgaris Beijerinck Strain Bt-09

    Directory of Open Access Journals (Sweden)

    P.B. Lintongan

    2004-06-01

    Full Text Available Growth response curves of Chlorella vulgaris Beijerinck strain Bt-09 to sublethal concentrations of cadmium were evaluated. The growth responses of this microalgal isolate was determined through analysis of chlorophyll a levels. Cadmium was effectively taken up by the cells as determined by Flame Atomic Absorption Spectrophotometry (F-AAS. Subcellular fractionation was undertaken to locate sites that accumulate cadmium.

  4. SNF1-related protein kinases type 2 are involved in plant responses to cadmium stress.

    NARCIS (Netherlands)

    A. Kulik; A. Anielska-Mazur; M. Bucholc; E. Koen; E. Szymańska; A. Żmieńko; E. Krzywińska; I. Wawer; F. McLoughlin; D. Ruszkowski; M. Figlerowicz; C. Testerink; A. Sklodowska; D. Wendehenne; G. Dobrowolska

    2012-01-01

    Cadmium ions are notorious environmental pollutants. To adapt to cadmium-induced deleterious effects plants have developed sophisticated defense mechanisms. However, the signaling pathways underlying the plant response to cadmium are still elusive. Our data demonstrate that SnRK2s (for SNF1-related

  5. Kinetic parameters and TL mechanism in cadmium tetra borate phosphor

    Energy Technology Data Exchange (ETDEWEB)

    Annalakshmi, O. [Radiological Safety Division, Materials Physics Division, Indira Gandhi Centre for Atomic Research, Kalpakkam-603102 (India); Jose, M.T., E-mail: mtj@igcar.gov.in [Radiological Safety Division, Materials Physics Division, Indira Gandhi Centre for Atomic Research, Kalpakkam-603102 (India); Sridevi, J. [Central Leather Research Institute, Council of Scientific and Industrial Research, Chennai 600 020, Tamilnadhu (India); Venkatraman, B. [Radiological Safety Division, Materials Physics Division, Indira Gandhi Centre for Atomic Research, Kalpakkam-603102 (India); Amarendra, G. [Materials Physics Division, Indira Gandhi Centre for Atomic Research, Kalpakkam-603102 (India); Mandal, A.B. [Central Leather Research Institute, Council of Scientific and Industrial Research, Chennai 600 020, Tamilnadhu (India)

    2014-03-15

    Polycrystalline powder samples of cadmium tetra borate were synthesized by a simple solid state sintering technique and gamma irradiated sample showed a simple Thermoluminescence (TL) glow peak around 460 K. The TL kinetic parameters of gamma irradiated phosphor were determined by initial rise (IR), isothermal decay (ID), peak shape (PS), variable heating rate (VHR) and glow curve de-convolution method. The kinetic parameters such as activation energy (E), frequency factor (s) and order of kinetics (b) were calculated by IR, ID, PS and VHR methods are in the order of ∼1.05 eV, 10{sup 9}–10{sup 12} s{sup −1} and 1.58, respectively. From the results of TL and PL emission studies carried out on the phosphor revealed that the defect centers related to TL is different from that for PL. EPR measurements were carried out to identify the defect centers formed in cadmium tetra borate phosphor on gamma irradiation. Based on EPR studies the mechanism for TL process in cadmium tetra borate is proposed in this paper -- Highlights: • Polycrystalline powder samples of undoped cadmium tetra borate synthesized. • Cadmium tetra borate phosphor exhibits a dosimetric peak at 458 K. • Kinetic parameters of the trap responsible for TL evaluated. • TL mechanism is proposed from TL to EPR correlation studies.

  6. Cadmium sorption characteristics of phosphorylated sago starch-extraction residue

    International Nuclear Information System (INIS)

    The residue produced by the extraction of sago starch is usually discarded as a waste material. In this study, we phosphorylated the sago starch-extraction residue with phosphoryl chloride and used the phosphorylated residue to remove cadmium from wastewater. The phosphoric ester functionality in the phosphorylated residue was evaluated by means of infrared microspectrometry and solid-state NMR. The dependence of the cadmium sorption behavior on pH, contact time, and electrolyte concentration and the maximum sorption capacity of the phosphorylated residue were also studied. The cadmium sorption varied with pH and electrolyte concentration, and the maximum sorption capacity was 25.2 mg g-1, which is almost half the capacity of commercially available weakly acidic cation exchange resins. The phosphorylated residue could be reused several times, although cadmium sorption gradually decreased as the number of sorption-desorption cycles increased. The phosphorylated residue sorbed cadmium rapidly, which is expected to be favorable for the continuous operation in a column.

  7. Lead and cadmium in indoor air and the urban environment

    International Nuclear Information System (INIS)

    The present study was conducted to find potential terrestrial biomonitors for heavy metals in indoor air in an urban environment. TSP, PM10, and PM2.5 were collected in three retirement facilities in the urban area of Vienna. In addition, particulate matter and soil, vegetation, and isopods (Porcellio scaber L.) were collected in the adjacent garden areas. Aerosols were sampled with a low-volume air sampler. The sampled materials were wet ashed and total lead and cadmium contents were determined. Water-soluble heavy metal concentrations were measured in aqueous extracts from air exposed filters, soil, and vegetation. Lead and cadmium were analyzed by graphite furnace AAS. Lead contents in the vegetation were inferred from water-soluble lead in soils. Lead in isopods generally reflected the contents in vegetation. Cadmium in plants probably derived from soil solutions as well as from atmospheric input. Isopods reflected the total cadmium contents in soils. Particulate matter was dominated by PM2.5, both with respect to mass concentrations and to heavy metal contents. The indoor aerosol was found to be influenced by human activity, indoor sources, and outdoor particles. Relationships between indoor airborne heavy metals and the contents in vegetation (lead and cadmium: positive) and isopods (lead: negative) were identified to have the potential for biomonitoring indoor air quality. - Urban vegetation and isopods are potential indicators for indoor aerial heavy metals

  8. Lead and cadmium in indoor air and the urban environment.

    Science.gov (United States)

    Komarnicki, Günter J K

    2005-07-01

    The present study was conducted to find potential terrestrial biomonitors for heavy metals in indoor air in an urban environment. TSP, PM(10), and PM(2.5) were collected in three retirement facilities in the urban area of Vienna. In addition, particulate matter and soil, vegetation, and isopods (Porcellio scaber L.) were collected in the adjacent garden areas. Aerosols were sampled with a low-volume air sampler. The sampled materials were wet ashed and total lead and cadmium contents were determined. Water-soluble heavy metal concentrations were measured in aqueous extracts from air exposed filters, soil, and vegetation. Lead and cadmium were analyzed by graphite furnace AAS. Lead contents in the vegetation were inferred from water-soluble lead in soils. Lead in isopods generally reflected the contents in vegetation. Cadmium in plants probably derived from soil solutions as well as from atmospheric input. Isopods reflected the total cadmium contents in soils. Particulate matter was dominated by PM(2.5), both with respect to mass concentrations and to heavy metal contents. The indoor aerosol was found to be influenced by human activity, indoor sources, and outdoor particles. Relationships between indoor airborne heavy metals and the contents in vegetation (lead and cadmium: positive) and isopods (lead: negative) were identified to have the potential for biomonitoring indoor air quality.

  9. Prevalence and Nature of Hearing Loss in 22q11.2 Deletion Syndrome

    Science.gov (United States)

    Van Eynde, Charlotte; Swillen, Ann; Lambeens, Elien; Verhaert, Nicolas; Desloovere, Christian; Luts, Heleen; Vander Poorten, Vincent; Devriendt, Koenraad; Hens, Greet

    2016-01-01

    Purpose: The purpose of this study was to clarify the prevalence, type, severity, and age-dependency of hearing loss in 22q11.2 deletion syndrome. Method: Extensive audiological measurements were conducted in 40 persons with proven 22q11.2 deletion (aged 6-36 years). Besides air and bone conduction thresholds in the frequency range between 0.125…

  10. The Development of Cognitive Control in Children with Chromosome 22q11.2 Deletion Syndrome

    Directory of Open Access Journals (Sweden)

    Heather M Shapiro

    2014-06-01

    Full Text Available Chromosome 22q11.2 Deletion Syndrome (22q11.2DS is caused by the most common human microdeletion, and it is associated with cognitive impairments across many domains. While impairments in cognitive control have been described in children with 22q11.2DS, the nature and development of these impairments are not clear. Children with 22q11.2DS and typically developing children (TD were tested on four well-validated tasks aimed at measuring specific foundational components of cognitive control: response inhibition, cognitive flexibility, and working memory. Molecular assays were also conducted in order to examine genotype of catechol-O-methyltransferase (COMT, a gene located within the deleted region in 22q11.2DS and hypothesized to play a role in cognitive control. Mixed model regression analyses were used to examine group differences, as well as age-related effects on cognitive control component processes in a cross-sectional analysis. Regression models with COMT genotype were also conducted in order to examine potential effects of the different variants of the gene. Response inhibition, cognitive flexibility, and working memory were impaired in children with 22q11.2DS relative to TD children, even after accounting for global intellectual functioning (as measured by full-scale IQ. When compared with TD individuals, children with 22q11.2DS demonstrated atypical age-related patterns of response inhibition and cognitive flexibility. Both groups demonstrated typical age-related associations with working memory. The results of this cross-sectional analysis suggest a specific aberration in the development of systems mediating response inhibition in a sub-set of children with 22q11.2DS. It will be important to follow up with longitudinal analyses to directly examine these developmental trajectories, and correlate neurocognitive variables with clinical and adaptive outcome measures.

  11. Cadmium in insects after ash fertilization

    Institute of Scientific and Technical Information of China (English)

    Martin Lodenius; Jussi Josefsson; Kari Heli(o)vaara; Esa Tulisalo; Matti Nummelin

    2009-01-01

    Ash fertilization of forests returns nutrients to forest ecosystems and has a positive effect on soil pH.but it also may elevate Cd concentrations of forest biota.Cadmium concentrations of some forest insects(Formica ants.carabids and Coleopteran larvac from decaying wood)were investigated in southern Finland where two plots were fertilized with wood ash,while two other plots represented anfertilized control plots.In ants,mean Cd concentration was 3.6±1.4 mg/kg.with nest workers having significantly higher concen-trations than workers trapped in pitfall traps.Concentrations at fertilized and unfertilized plots were similar.In carabid beetles,the average Cd concentration of Carabus glabratus was 0.44±0.36 mg/kg.with no significant difference between control plots and fertilized plots.In another carabid beetle,Pterostichus niger,mean Cd concentration was higher at fertilized plots compared to control plots.We conclude that the variation of Cd concentra-tions in the insects studied is more efficiently controlled by species-specific differences than fertilization history of the forest floor.

  12. Thin-film cadmium telluride solar cells

    Science.gov (United States)

    Chu, T. L.

    1987-10-01

    Cadmium telluride, with a room-temperature band-gap energy of 1.5 eV, is a promising thin-film photovoltaic material. The major objective of this research has been to demonstrate thin-film CdTe heterojunction solar cells with a total area greater than 1 sq cm and photovoltaic efficiencies of 13 percent or more. Thin-film p-CdTe/CdS/SnO2:F/glass solar cells with an AM1.5 efficiency of 10.5 percent have been reported previously. This report contains results of work done on: (1) the deposition, resistivity control, and characterization of p-CdTe films by the close-spaced sublimation process; (2) the deposition of large-band-gap window materials; (3) the electrical properties of CdS/CdTe heterojunctions; (4) the formation of stable, reproducible, ohmic contacts (such as p-HgTe) to p-CdTe; and (5) the preparation and evaluation of heterojunction solar cells.

  13. Cadmium uptake by rat red blood cells

    International Nuclear Information System (INIS)

    Rat red blood cells were employed to study the uptake of cadmium (109Cd). Suspensions of red blood cells were exposed to Cd concentrations (both bound and free) observed following in vivo Cd administration. Cd uptake was biphasic with an initial rapid phase (0C was one-fourth of that at 370C. The metabolic inhibitors: sodium fluoride (1mM), potassium cyanide (1mM) and carbonyl cyanide-m-chlorophenyl hydrazone (2μM) and the Na+-K+-ATPase inhibitor, ouabain (1mM) did not reduce Cd (50μM) uptake into red blood cells. This suggests that the uptake of Cd into red blood cells was not an active process. Incubation of Cd (10μM) with an equimolar concentration of Zn did not alter uptake of Cd into red blood cells, but at 5 and 10 times higher concentrations of Zn, Cd uptake was enhanced 5-fold. Mercury at one-tenth and equimolar concentrations of Cd increased Cd uptake by red blood cells 2-fold. N-Ethylmaleimide (0.5-5mM), which irreversibly inactivates membrane sulfhydryl groups, decreased Cd uptake. The data indicate that Cd uptake into rat red blood cells occurs by passive transport and that alterations of sulfhydryls of red blood cell membrane may modulate the process. (author)

  14. Cadmium accumulation and subcellular distribution in relation to cadmium chloride induced cytotoxicity in vitro

    International Nuclear Information System (INIS)

    A bovine kidney cell culture system was used to assess what relationship cadmium (Cd) uptake and subcellular distribution had to cadmium chloride induced cytotoxicity. Twenty-four hour incubation with 0.1-10 μM Cd elicited 0-90% cytotoxicity. Fifty percent cytotoxicity was estimated to result from 0.8 μM Cd. A concentration-related Cd accumulation paralleled the cytotoxicity profile. The time-course for Cd accumulation was linear for the first 6 h of exposure and plateaued by 18 h post-exposure. When the degree of cytotoxicity was compared with the cellular Cd burden at 24 h post-treatment a least-squares linear regression analysis (r=0.93) indicated a direct relationship. Subcellular distribution studies indicated greater than 90% Cd recovery from the soluble supernatant (105,000 g) at all levels of cytotoxicity studied. Metallothionein sequestered less than 25% of the cellular Cd. As a result of the correlation of the degree of cytotoxicity with the cellular Cd burden and the independence of subcellular distribution from cytotoxicity, a cumulative mechanism of toxicity for Cd in MDBK cells was suggested. (author)

  15. PWS/AS MS-MLPA Confirms Maternal Origin of 15q11.2 Microduplication

    Directory of Open Access Journals (Sweden)

    Angelika J. Dawson

    2015-01-01

    Full Text Available The proximal region of the long arm of chromosome 15q11.2-q13 is associated with various neurodevelopmental disorders, including Prader-Willi (PWS and Angelman (AS syndromes, autism, and other developmental abnormalities resulting from deletions and duplications. In addition, this region encompasses imprinted genes that cause PWS or AS, depending on the parent-of-origin. This imprinting allows for diagnosis of PWS or AS based on methylation status using methylation sensitive (MS multiplex ligation dependent probe amplification (MLPA. Maternally derived microduplications at 15q11.2-q13 have been associated with autism and other neuropsychiatric disorders. Multiple methods have been used to determine the parent-of-origin for 15q11.2-q13 microdeletions and microduplications. In the present study, a four-year-old nondysmorphic female patient with developmental delay was found to have a de novo ~5 Mb duplication within 15q11.2 by oligonucleotide genomic array. In order to determine the significance of this microduplication to the clinical phenotype, the parent-of-origin needed to be identified. The PWS/AS MS-MLPA assay is generally used to distinguish between deletion and uniparental disomy (UPD of 15q11.2-q13, resulting in either PWS or AS. However, our study shows that PWS/AS MS-MLPA can also efficiently distinguish the parental origin of duplications of 15q11.2-q13.

  16. MicroRNA Profiling of Neurons Generated Using Induced Pluripotent Stem Cells Derived from Patients with Schizophrenia and Schizoaffective Disorder, and 22q11.2 Del.

    Directory of Open Access Journals (Sweden)

    Dejian Zhao

    Full Text Available We are using induced pluripotent stem cell (iPSC technology to study neuropsychiatric disorders associated with 22q11.2 microdeletions (del, the most common known schizophrenia (SZ-associated genetic factor. Several genes in the region have been implicated; a promising candidate is DGCR8, which codes for a protein involved in microRNA (miRNA biogenesis. We carried out miRNA expression profiling (miRNA-seq on neurons generated from iPSCs derived from controls and SZ patients with 22q11.2 del. Using thresholds of p<0.01 for nominal significance and 1.5-fold differences in expression, 45 differentially expressed miRNAs were detected (13 lower in SZ and 32 higher. Of these, 6 were significantly down-regulated in patients after correcting for genome wide significance (FDR<0.05, including 4 miRNAs that map to the 22q11.2 del region. In addition, a nominally significant increase in the expression of several miRNAs was found in the 22q11.2 neurons that were previously found to be differentially expressed in autopsy samples and peripheral blood in SZ and autism spectrum disorders (e.g., miR-34, miR-4449, miR-146b-3p, and miR-23a-5p. Pathway and function analysis of predicted mRNA targets of the differentially expressed miRNAs showed enrichment for genes involved in neurological disease and psychological disorders for both up and down regulated miRNAs. Our findings suggest that: i. neurons with 22q11.2 del recapitulate the miRNA expression patterns expected of 22q11.2 haploinsufficiency, ii. differentially expressed miRNAs previously identified using autopsy samples and peripheral cells, both of which have significant methodological problems, are indeed disrupted in neuropsychiatric disorders and likely have an underlying genetic basis.

  17. Antiproton Target

    CERN Multimedia

    1980-01-01

    Antiproton target used for the AA (antiproton accumulator). The first type of antiproton production target used from 1980 to 1982 comprised a rod of copper 3mm diameter and 120mm long embedded in a graphite cylinder that was itself pressed into a finned aluminium container. This assembly was air-cooled and it was used in conjunction with the Van der Meer magnetic horn. In 1983 Fermilab provided us with lithium lenses to replace the horn with a view to increasing the antiproton yield by about 30%. These lenses needed a much shorter target made of heavy metal - iridium was chosen for this purpose. The 50 mm iridium rod was housed in an extension to the original finned target container so that it could be brought very close to the entrance to the lithium lens. Picture 1 shows this target assembly and Picture 2 shows it mounted together with the lithium lens. These target containers had a short lifetime due to a combination of beam heating and radiation damage. This led to the design of the water-cooled target in...

  18. Cadmium accumulation characteristics and removal potentials of high cadmium accumulating rice line grown in cadmium-contaminated soils.

    Science.gov (United States)

    Tang, Hao; Li, Tingxuan; Yu, Haiying; Zhang, Xizhou

    2016-08-01

    Phytoextraction is a promising technique to remove cadmium (Cd) from contaminated soils. In this research, the two different Cd accumulation rice lines of Lu527-8 (the high Cd accumulating rice line) and Lu527-4 (the normal rice line) were grown in soils with different Cd treatments (0, 5, 10, and 20 mg kg(-1) soil) to evaluate Cd accumulation characteristics and Cd removal potentials. When the concentration of Cd in soil increased, Lu527-8 showed less symptoms of phytotoxicity when compared to Lu527-4. Furthermore, Lu527-8 demonstrated greater shoot Cd accumulation (321.17-964.95 mg plant(-1)) than Lu527-4 (50.37-201.66 μg plant(-1)) at the jointing and filling stages. The soil available Cd content of Lu527-8 significantly decreased by 26.92-38.97 and 27.77-63.44 % at the jointing and filling stages, respectively. Meanwhile, the total Cd content in soil also reduced by 11.64-46.75 and 21.41-54.11 % at jointing and filling stages, respectively. When the Cd concentration in soil was 20 mg kg(-1), the Cd extraction rate in shoots of Lu527-8 reached 2.12 and 2.85 % which increased 10.60 and 6.48 times compared with that of Lu527-4 at the jointing and filling stages, respectively. In conclusion, this study demonstrates that Lu527-8 shows great abilities of Cd accumulation and Cd removal potential from contaminated soils with different Cd treatments and it is a promising species for phytoextraction of Cd-contaminated soils.

  19. Renal and blood pressure effects from environmental cadmium exposure in Thai children

    Energy Technology Data Exchange (ETDEWEB)

    Swaddiwudhipong, Witaya, E-mail: swaddi@hotmail.com [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Mahasakpan, Pranee [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Jeekeeree, Wanpen [Department of Medical Technology, Mae Sot General Hospital, Tak 63110 (Thailand); Funkhiew, Thippawan [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Sanjum, Rungaroon; Apiwatpaiboon, Thitikarn [Department of Medical Technology, Mae Sot General Hospital, Tak 63110 (Thailand); Phopueng, Ittipol [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand)

    2015-01-15

    Very few studies have shown renal and blood pressure effects from environmental cadmium exposure in children. This population study examined associations between urinary cadmium excretion, a good biomarker of long-term cadmium exposure, and renal dysfunctions and blood pressure in environmentally exposed Thai children. Renal functions including urinary excretion of β{sub 2}-microglobulin, calcium (early renal effects), and total protein (late renal effect), and blood pressure were measured in 594 primary school children. Of the children studied, 19.0% had urinary cadmium ≥1 μg/g creatinine. The prevalence of urinary cadmium ≥1 μg/g creatinine was significantly higher in girls and in those consuming rice grown in cadmium-contaminated areas. The geometric mean levels of urinary β{sub 2}-microglobulin, calcium, and total protein significantly increased with increasing tertiles of urinary cadmium. The analysis did not show increased blood pressure with increasing tertiles of urinary cadmium. After adjusting for age, sex, and blood lead levels, the analysis showed significant positive associations between urinary cadmium and urinary β{sub 2}-microglobulin and urinary calcium, but not urinary total protein nor blood pressure. Our findings provide evidence that environmental cadmium exposure can affect renal functions in children. A follow-up study is essential to assess the clinical significance and progress of renal effects in these children. - Highlights: • Few studies show renal effects from environmental cadmium exposure in children. • We report renal and blood pressure effects from cadmium exposure in Thai children. • Urinary β{sub 2}-microglobulin and calcium increased with increasing urinary cadmium. • The study found no association between urinary cadmium levels and blood pressure. • Environmental cadmium exposure can affect renal functions in children.

  20. Renal and blood pressure effects from environmental cadmium exposure in Thai children

    International Nuclear Information System (INIS)

    Very few studies have shown renal and blood pressure effects from environmental cadmium exposure in children. This population study examined associations between urinary cadmium excretion, a good biomarker of long-term cadmium exposure, and renal dysfunctions and blood pressure in environmentally exposed Thai children. Renal functions including urinary excretion of β2-microglobulin, calcium (early renal effects), and total protein (late renal effect), and blood pressure were measured in 594 primary school children. Of the children studied, 19.0% had urinary cadmium ≥1 μg/g creatinine. The prevalence of urinary cadmium ≥1 μg/g creatinine was significantly higher in girls and in those consuming rice grown in cadmium-contaminated areas. The geometric mean levels of urinary β2-microglobulin, calcium, and total protein significantly increased with increasing tertiles of urinary cadmium. The analysis did not show increased blood pressure with increasing tertiles of urinary cadmium. After adjusting for age, sex, and blood lead levels, the analysis showed significant positive associations between urinary cadmium and urinary β2-microglobulin and urinary calcium, but not urinary total protein nor blood pressure. Our findings provide evidence that environmental cadmium exposure can affect renal functions in children. A follow-up study is essential to assess the clinical significance and progress of renal effects in these children. - Highlights: • Few studies show renal effects from environmental cadmium exposure in children. • We report renal and blood pressure effects from cadmium exposure in Thai children. • Urinary β2-microglobulin and calcium increased with increasing urinary cadmium. • The study found no association between urinary cadmium levels and blood pressure. • Environmental cadmium exposure can affect renal functions in children

  1. Analysis Of The Underpotential Deposition Of Cadmium On Copper

    Directory of Open Access Journals (Sweden)

    Kowalik R.

    2015-09-01

    Full Text Available In this study the process of deposition of cadmium on polycrystalline copper electrode in sulfate solution was investigated. The process of underpotential and bulk deposition was analyzed by classical electrochemical method: cyclic voltammetry(CV, anodic stripping voltammetry(ASV and electrochemical quartz crystal microbalance(EQCM. The obtained results were compared with electrochemical impedance spectroscopy(EIS measurements. CV, EQCM and EIS results suggest that the UPD of cadmium starts below potential −0.4 V vs Ag/AgCl. Additionally the stripping analysis indicates the formation of cadmium monolayer with different density of deposited atoms depending on the applied potential. The transition from UPD to bulk deposition occurs below potential −0,7 V.

  2. Effects of macromolecular chelators on intestinal cadmium absorption in mice

    Energy Technology Data Exchange (ETDEWEB)

    Andersen, O.; Nielsen, J.B.; Bulman, R.A.

    1989-01-01

    Suppression of absorption by macromolecular chelators have been sucessful with several metals. In this paper a series of immobilized chelators ranging from DTPA to S-containing soft bases have been synthetized and investigated for ability to suppress intestinal uptake of /sup 109/Cd/sup 2+/ in mice. Dextran-O-ethyl-mercaptan, xanthates derived from polysaccharides and polyvinyl alcohol, dithiocarbamates of polyethylene imine and aminoethyl cellulose, and DTPA immobilized on aminopropyl silica were all ineffective. DTPA immobilized on aminoethyl cellulose even enhanced the intestinal uptake. The macromolecular chelators were without extensive effect on organ distribution of absorbed cadmium, except for dithiocarbamate immobilized on polyethylene imine, which enhanced the deposition of cadmium in several organs including the brain. Although the results are discouragign, they indicate that desing and synthesis of immobilized vicinal dithio compounds may represent an avenue for development of non-absorbable chelators with high affinity for cadmium.

  3. Biosorption of Cadmium by Fungal Biomass of Aspergillus niger

    Institute of Scientific and Technical Information of China (English)

    QI YANG; JIAN-LONG WANG; ZHI XING

    2005-01-01

    Objective To investigate the removal of cadmium from aqueous solution by waste fungal biomass of Aspergillus niger, originated from citric acid fermentation industry. Methods Batch adsorption test was used to study the biosorption equilibrium and isotherm. The Cd2+ concentration was measured with atomic adsorption spectrophotometer (AAS) HITACHI 180-80. Results The biosorption achieved equilibrium within 30 min. The adsorption isotherm could be described by Freundlich adsorption model, and the constants KF and 1/n were determined to be 2.07 and 0.18, respectively, and the correlation efficiency was 0.97. The optimal pH for Cd adsorption was 6.0. The cadmium-laden biomass could be effectively regenerated using 0.1 N HCl. Conclusion The waste biomass of Aspergillus niger, a by-product of fermentation industry, is a potential biosorbent for the removal of cadmium from aqueous solution.

  4. Cadmium-induced oxidative stress in potato tuber

    Directory of Open Access Journals (Sweden)

    Andrzej Stroiński

    2014-02-01

    Full Text Available Short-term treatment of tuber discs of potato (Solanum tuberosum L. with cadmium chloride elevated the concentration of active oxygen species (.O-2, H202 and activated the antioxidative system. Two cultivars, Bintje and Bzura, susceptible and tolerant, respectively, to cadmium were examined. In more tolerant, control tissues the activity of ascorbic acid peroxidase (AAP and catalase (CAT was higher than in the sensitive ones. During first hours of stress, the inhibition of superoxide dismutase (SOD, CAT and AAP was observed and it comes from inactivation of enzymes by cadmium ions. A subsequent activity increase of the enzymes aroused earlier in tolerant tissues. It seems therefore, that tolerant tissues possess a more efficient antioxidative system.

  5. Antifungal activity of nicotine and its cadmium complex

    International Nuclear Information System (INIS)

    Nicotine and its metal complex; Cd(II)-nicotine were isolated from leaves of Nicotiana tabacum using various metal ions by the reported techniques and studied for their antifungal activities against fourteen different species of fungi. For comparative study, pure sample of nicotine and metal salt used for complexation; cadmium(II) iodide was also subjected to antifungal tests with the same species of fungus under similar conditions. Results indicated that nicotine is quite effective against the rare pathogenic and Non pathogenic fungi but comparatively less effective against Pathogenic fungi. Nicotine was found to be completely ineffective against the selected species of Occasional pathogenic fungi. Cadmium(II) iodide effectively inhibited Pathogenic and Non pathogenic fungi whereas relatively ineffective against the Occasional pathogenic and Rare pathogenic fungi. On the other hand, Cadmium(II) nicotine complex inhibited all the selected species of fungi except Fusarium solani. (author)

  6. THE CADMIUM INTAKE OF SELECTED LEGUMES IN MODEL CONDITIONS

    Directory of Open Access Journals (Sweden)

    Pavol Trebichalský

    2012-12-01

    Full Text Available The work is to evaluate the extent of risk transfer of heavy metals from soil burdensome to their different levels of consumption of selected parts of the crop. The goal to be achieved in conditions of simulated vegetation pot experiments. To implement the experiment, we used the agricultural soil of land site Výčapy - Opatovce. The experiments use two types of leguminous plants: Faba beans (Faba vulgaris M., a variety MERLIN lentil dishes (Lens esculentum variety NELKA. In one experimental tank was weighed 5 kg of soil mixed with 1 kg of silica sand, and the bottom of the container we put a small drainage layer of gravel. Within each container, we applied the calculated dose of the basic fertilizer, as well as various amounts of soluble salts of cadmium observed. Crops are harvested when fully ripe and the  wet mineralization of plant samples was determined by heavy metals AAS method for device VARIAN 240FS. Significant ratio of cadmium is in the aboveground biomass of the legumes. Lentils take into aboveground biomass much more cadmium than  faba beans. The cadmium content in the first two variants is significantly lower than in the next two in both crops. We may conclude that the faba beans, and lentils to accumulate an increased amount of cadmium in soil in a relatively large amount of seeds. Although it is clear that Faba bean received cadmium content was compared with more lentils. Due to the significant accumulation of Cd by plants lentils and excessive production of the aboveground biomass is potentially usable lens as fytoremediation crop recovery for metalic polluted soils.doi:10.5219/221

  7. Cadmium effects and accumulation in cultures of Prorocentrum micans (dinophyta)

    Science.gov (United States)

    Kayser, H.; Sperling, K.-R.

    1980-03-01

    Effects and accumulation of cadmium were studied in unialgal 10-1 batch-culture experiments with the dinoflagellate Prorocentrum micans Ehrenberg. Tests were made using sterile filtered North Sea water enriched with nitrate and phosphate only in order to avoid disturbances by complex formation. Cadmium was added to the cultures in amounts of 100 to 0.13 µg l-1. In one series it was added at the start of the experiments and in a second one after a growth period of 1 week. Addition of only 1.2 µg Cd l-1 reduces multiplication rates and maximum cell densities of the algae. Not until 0.4 µg Cd-1 does growth correspond to that of the controls. Cadmium concentrations were measured, after filtration, in the culture medium and in the biomass by means of flameless AAS. The cadmium content in algae increased from 2.7 µg g-1 (dry weight) in controls to 500 µg g-1 (dry weight) in media containing 100 µg Cd l-1. Uptake occurred rapidly during the first few days of the experiments, slowed down somewhat during exponential growth stage, and increased during decay of the cultures. Cadmium content of culture media remained nearly constant (Series 1) or decreased only slowly during experimental time (Series 2). The highest concentration factor was measured in the controls. It decreased with increasing metal concentration in the medium and increased with experimental time. Structural modifications of the cells were visible after Lugol fixation only, indicating brittleness of the cell walls. P. micans has shown to be extremely sensitive to cadmium and to accumulate this metal.

  8. Cadmium effects and accumulation in cultures of Prorocentrum micans (Dinophyta)

    Energy Technology Data Exchange (ETDEWEB)

    Kayser, H.; Sperling, K.R.

    1980-01-01

    Effects and accumulation of cadmium were studied in 10-l batch-culture experiments with the dinoflagellate Prorocentrum micans Ehrenberg. Tests were made using sterile filtered North Sea water enriched with nitrate and phosphate only in order to avoid disturbances by complex formation. Cadmium was added to the cultures in amounts of 100 to 0.13 ..mu..g l/sup -1/. In one series it was added at the start of the experiments and in a second one after a growth period of 1 week. Addition of only 1.2 ..mu..g Cd l/sup -1/ reduces multiplication rates and maximum cell densities of the algae. Not until 0.4 ..mu..g Cd l/sup -1/ does growth correspond to that of the controls. Cadmium concentrations were measured, after filtration, in the culture medium and the biomass by means of flameless AAS. The cadmium content in algae increased from 2.7 ..mu..g g/sup -1/ (dry weight) in controls to 500 ..mu..g g/sup -1/ (dry weight) in media containing 100 ..mu..g Cd l/sup -1/. Uptake occurred rapidly during the first few days of the experiments, slowed down somewhat during exponential growth stage, and increased during decay of the cultures. Cadmium content of culture media remained nearly constant or decreased only slowly during experimental time. The highest concentration factor was measured in the controls. It decreased with increasing metal concentration in the medium and increased with experimental time. Structural modifications of the cells were visible after Lugol fixation only, indicating brittleness of the cell walls. P. micans has shown to be extremely sensitive to cadmium and to accumulate this metal.

  9. Lead and Cadmium Content of Korbal Rice in Northern Iran

    Directory of Open Access Journals (Sweden)

    A Bakhtiarian

    2001-09-01

    Full Text Available Every year the entrance of factory wastes such as Shiraz Petrochemical Complex, Marvdasht sugar cube factory, and Charmineh factory, and other industrial units into the Kor and Sivand rivers and also the entrance of the Marvdasht and Zarghan city sewer system wastes into the Kor river and the use of their water in the cultivation of the rice has caused a significant increase in the lead and cadmium content of the grains of rice. To study the effect of the Kor river's pollution on the lead and cadmium content of the Korbal rice samples. The results of the study show that the lead and cadmium content of the grains of rice, 57 samples of 6 different types of rice were prepared in 19 different stations in Korbal region and also 18 samples of 6 different types of rice, cultivated with unpolluted water, were prepared in the National Institute of Rice Research (Gilan. A comparison of the pollution level of the Korbal and Gilan rice samples shows a significant difference and indicates the significant effect of the pollution of the river on the lead and cadmium content of the Korbal rice samples. The results of the study show that the lead and cadmium content of the hybrid, prolific, and late rice sample types were greater than that of unprolific and early types, such that the amount of these two elements were highest in the Hassani type (the lead content was 0.9625 ppm and the cadmium content was 0.0793 ppm, whereas the Gasroddashti type which blooms earlier and is long seeded has the lowest amount of these two elements.

  10. Cadmium toxicity to ringed seals (Phoca hispida): an epidemiological study of possible cadmium-induced nephropathy and osteodystrophy in ringed seals (Phoca hispida) from Qaanaaq in Northwest Greenland

    DEFF Research Database (Denmark)

    Sonne-Hansen, C; Dietz, R; Leifsson, P S;

    2002-01-01

    . Experience from cadmium-poisoned humans and laboratory mammals indicates that concentrations above 50-200 microg/g wet wt. may induce histopathological changes. Overall, 31 of the ringed seals had cadmium concentrations in the kidney cortex above 50 microg/g wet wt., 11 had concentrations above 100 and one......The Greenland marine food chains contain high levels of cadmium, mercury and selenium. Concentrations of cadmium in the kidney of ringed seals (Phoca hispida) from the municipalities of Qaanaaq and Upernavik (Northwest Greenland) are among the highest recorded in the Arctic. The purpose...... of the study was to determine whether cadmium-induced damage in the kidneys and the skeletal system could be detected among 100 ringed seals from Northwest Greenland. The cadmium concentrations in the kidney cortex ranged from 0 to 248 microg/g wet weight (mean=44.5, N=100) in the 99 kidneys examined...

  11. Effect of pH on cadmium biosorption by coconut copra meal

    International Nuclear Information System (INIS)

    Biosorption of cadmium ion by coconut copra meal, an agricultural waste product was investigated as a function of initial solution pH and initial cadmium concentration. Pseudo-second-order kinetic analyses were performed to determine the rate constant of biosorption, the equilibrium capacity, and initial biosorption rate. Cadmium biosorption by copra meal was found to be dependent on the initial solution pH and initial cadmium concentration. Ion exchange occurred in the initial biosorption period. In addition, mathematical relationships were drawn to relate the change in the solution hydrogen ion concentration with equilibrium biosorption capacity, initial cadmium concentration, and equilibrium biosorption capacity

  12. Contribution of an Auxin to the Uptake of Nickel and Cadmium in Maize Seedlings

    Institute of Scientific and Technical Information of China (English)

    GUO DONG-SHENG; XI YU-YING; WANG AI-YING; ZHANG JUN; YUAN XIAO-YING

    1999-01-01

    Maize seedlings were cultured in nickel or cadmium contaminated sand treated with α-naphthylacetic acid (NAA). The effects of NAA on nickel and cadmium uptake in roots, shoots, and subcellular fractions (cell wall, nuclei and remained parts of seedling cells) were determined. The data showed growth promotion when NAA was applied at low concentrations and inhibition at high concentrations. Uptake of nickel and cadmium content increased concurrently in roots and shoots. In the subcellular fraction, nickel and cadmium was greatest in the cell wall. The changes in growth had greatest correlation with nickel and cadmium content in the subcellular fraction.

  13. Purification and characterization of a cadmium-induced metallothionein from the shore crab Carcinus maenas (L.)

    DEFF Research Database (Denmark)

    Pedersen, K L; Pedersen, S N; Højrup, P;

    1994-01-01

    Two metallothionein variants were purified from the midgut gland of crabs (Carcinus maenas) exposed to a high cadmium concentration (2 p.p.m.). One of the variants was purified from crabs exposed to a low cadmium concentration (0.5 p.p.m.). The purification method involved acetone precipitation...... from crabs exposed to the high cadmium concentration differed only by a single residue of methionine at the N-terminus. The single variant isolated from crabs exposed to the low cadmium concentration was the one without the N-terminal methionine, indicating that high cadmium concentrations either...

  14. Zinc-Nickel Codeposition in Sulfate Solution Combined Effect of Cadmium and Boric Acid

    Directory of Open Access Journals (Sweden)

    Y. Addi

    2011-01-01

    Full Text Available The combined effect of cadmium and boric acid on the electrodeposition of zinc-nickel from a sulfate has been investigated. The presence of cadmium ion decreases zinc in the deposit. In solution, cadmium inhibits the zinc ion deposition and suppresses it when deposition potential value is more negative than −1.2 V. Low concentration of CdSO4 reduces the anomalous nature of Zn-Ni deposit. Boric acid decreases current density and shifts potential discharge of nickel and hydrogen to more negative potential. The combination of boric acid and cadmium increases the percentage of nickel in the deposit. Boric acid and cadmium.

  15. Spectroscopic study of cadmium (II) complexes with heterocyclic dithiocarbamate ligands

    Energy Technology Data Exchange (ETDEWEB)

    Garcia-Fontan, S. (Departamento de Quimica Pura y Aplicada, Universidad de Vigo (Spain)); Rodriguez-Seoane, P. (Departamento de Quimica Pura y Aplicada, Universidad de Vigo (Spain)); Casas, J.S. (Departamento de Quimica Inorganica, Universidad de Santiago de Compostela (Spain)); Sordo, J. (Departamento de Quimica Inorganica, Universidad de Santiago de Compostela (Spain)); Jones, M.M. (Department of Chemistry and Center in Molecular Toxicology, Vanderbilt University, Nashville, TN (United States))

    1993-09-15

    Cadmium(II) dithiocarbamates Cd(dtc)[sub 2] (dtc=4-carboxamidopiperidine-1-carbodithioate, morpholine-1-carbodithioate or 4-(2-hydroxyethyl)piperazine-1-carbodithioate) and Cd(dtc)[sub 2].H[sub 2]O (dtc=4-hydroxypiperidine-1-carbodithioate)[r brace] have been prepared and characterized by thermal analysis and IR and NMR ([sup 13]C, [sup 113]Cd) spectrometry. Two of these ligands have previously been shown capable of removing cadmium from its aged in vivo storage sites. The use of solid state [sup 13]C NMR measurements to establish the coordination mode of the dithiocarbomate ligands is also examined and the difficulties which arise are discussed. (orig.)

  16. Synthesis and characterization of cadmium doped lead–borate glasses

    Indian Academy of Sciences (India)

    A A Alemi; H Sedghi; A R Mirmohseni; V Golsanamlu

    2006-02-01

    Cadmium doped lead–borate glasses were prepared from the melts in appropriate proportions of PbO2, H3BO3 and (15–40 mol%) CdO mixture in the temperature range 700–950°C. The infrared spectra of the glasses in the range 400–4000 cm-1 show their structures. No boroxol ring formation was observed in the structure of these glasses. Furthermore, doped cadmium atoms were not seen in tetrahedral coordination. But the conversion of three-fold to four-fold coordination of boron atoms in the structure of glasses was observed.

  17. Cadmium resistance from Staphylococcus aureus plasmid pI258 cadA gene results from a cadmium-efflux ATPase.

    OpenAIRE

    Nucifora, G; Chu, L; Misra, T K; Silver, S

    1989-01-01

    Cadmium resistance specified by the cadA determinant of Staphylococcus aureus plasmid pI258 results from the functioning of a cadmium-efflux system. In the nucleotide sequence of the DNA fragment containing the cadA determinant, two open reading frames were identified. The larger one, corresponding to a predicted polypeptide of 727 amino acid residues, is necessary and sufficient for expression of cadmium resistance. Comparison of the CadA amino acid sequence with known protein sequences sugg...

  18. Biosorption of cadmium by endophytic fungus (EF) Microsphaeropsis sp. LSE10 isolated from cadmium hyperaccumulator Solanum nigrum L.

    Science.gov (United States)

    Xiao, Xiao; Luo, Shenglian; Zeng, Guangming; Wei, Wanzhi; Wan, Yong; Chen, Liang; Guo, Hanjun; Cao, Zhe; Yang, Lixia; Chen, Jueliang; Xi, Qiang

    2010-03-01

    A novel technology to obtain highly efficient biosorbent from the endophytes of a hyperaccumulator is reported. This technology is more convenient than the traditional method of obtaining biosorbents by experimentally screening many types of biomass by trial and error. Using this technology, endophytic fungus (EF) LSE10 was isolated from the cadmium hyperaccumulator Solanum nigrum L. It was identified as Microsphaeropsis sp. When cultured in vitro, the biomass yield of this EF was more than twice that of none-endophytic fungus (NEF) Rhizopus cohnii. Subsequently, it was used as a biosorbent for biosorption of cadmium from the aqueous solution. The results showed that the maximum biosorption capacity was 247.5mg/g (2.2 mmol/g) which was much higher than those of other adsorbents, including biosorbents and activated carbon. Carboxyl, amino, sulphonate and hydroxyl groups on EF LSE10 surface were responsible for the biosorption of cadmium. PMID:19854641

  19. Concentration of cadmium in cacao beans and its relationship with soil cadmium in southern Ecuador

    Energy Technology Data Exchange (ETDEWEB)

    Chavez, E. [University of Florida, Institute of Food and Agricultural Science, Indian River Research and Education Center, Fort Pierce, FL 34945 (United States); Escuela Superior Politecnica del Litoral, Centro de Investigaciones Biotecnologicas del Ecuador, Guayaquil, Guayas (Ecuador); He, Z.L., E-mail: zhe@ufl.edu [University of Florida, Institute of Food and Agricultural Science, Indian River Research and Education Center, Fort Pierce, FL 34945 (United States); Stoffella, P.J. [University of Florida, Institute of Food and Agricultural Science, Indian River Research and Education Center, Fort Pierce, FL 34945 (United States); Mylavarapu, R.S. [University of Florida, Institute of Food and Agricultural Science, Soil and Water Science Department, Gainesville, FL 33611 (United States); Li, Y.C. [University of Florida, Institute of Food and Agricultural Science, Tropical Research and Education Center, Homestead, FL 33031 (United States); Moyano, B. [Escuela Superior Politecnica del Litoral, Centro de Investigaciones Biotecnologicas del Ecuador, Guayaquil, Guayas (Ecuador); Baligar, V.C. [United State Department of Agriculture, ARS, Beltsville, MD 20705 (United States)

    2015-11-15

    Cadmium (Cd) content in cacao beans above a critical level (0.6 mg kg{sup −1}) has raised concerns in the consumption of cacao-based chocolate. Little is available regarding Cd concentration in soil and cacao in Ecuador. The aim of this study was to determine the status of Cd in both, soils and cacao plants, in southern Ecuador. Soil samples were collected from 19 farms at 0–5, 5–15, 15–30, and 30–50 cm depths, whereas plant samples were taken from four nearby trees. Total recoverable and extractable Cd were measured at the different soil depths. Total recoverable Cd ranged from 0.88 to 2.45 and 0.06 to 2.59, averaged 1.54 and 0.85 mg kg{sup −1}, respectively in the surface and subsurface soils whereas the corresponding values for M3-extractable Cd were 0.08 to 1.27 and 0.02 to 0.33 with mean values of 0.40 and 0.10 mg kg{sup −1}. Surface soil in all sampling sites had total recoverable Cd above the USEPA critical level for agricultural soils (0.43 mg kg{sup −1}), indicating that Cd pollution occurs. Since both total recoverable and M3-extractable Cd significantly decreased depth wise, anthropogenic activities are more likely the source of contamination. Cadmium in cacao tissues decreased in the order of beans > shell > > leaves. Cadmium content in cacao beans ranged from 0.02 to 3.00, averaged 0.94 mg kg{sup −1}, and 12 out of 19 sites had bean Cd content above the critical level. Bean Cd concentration was highly correlated with M3- or HCl-extractable Cd at both the 0–5 and 5–15 cm depths (r = 0.80 and 0.82 for M3, and r = 0.78 and 0.82 for HCl; P < 0.01). These results indicate that accumulation of Cd in surface layers results in excessive Cd in cacao beans and M3- or HCl-extractable Cd are suitable methods for predicting available Cd in the studied soils. - Highlights: • > 60% of the studied sites had a Cd content in cacao beans above the critical level. • Bean Cd concentration was closely correlated with available Cd in soil. • Soil

  20. Concentration of cadmium in cacao beans and its relationship with soil cadmium in southern Ecuador

    International Nuclear Information System (INIS)

    Cadmium (Cd) content in cacao beans above a critical level (0.6 mg kg−1) has raised concerns in the consumption of cacao-based chocolate. Little is available regarding Cd concentration in soil and cacao in Ecuador. The aim of this study was to determine the status of Cd in both, soils and cacao plants, in southern Ecuador. Soil samples were collected from 19 farms at 0–5, 5–15, 15–30, and 30–50 cm depths, whereas plant samples were taken from four nearby trees. Total recoverable and extractable Cd were measured at the different soil depths. Total recoverable Cd ranged from 0.88 to 2.45 and 0.06 to 2.59, averaged 1.54 and 0.85 mg kg−1, respectively in the surface and subsurface soils whereas the corresponding values for M3-extractable Cd were 0.08 to 1.27 and 0.02 to 0.33 with mean values of 0.40 and 0.10 mg kg−1. Surface soil in all sampling sites had total recoverable Cd above the USEPA critical level for agricultural soils (0.43 mg kg−1), indicating that Cd pollution occurs. Since both total recoverable and M3-extractable Cd significantly decreased depth wise, anthropogenic activities are more likely the source of contamination. Cadmium in cacao tissues decreased in the order of beans > shell > > leaves. Cadmium content in cacao beans ranged from 0.02 to 3.00, averaged 0.94 mg kg−1, and 12 out of 19 sites had bean Cd content above the critical level. Bean Cd concentration was highly correlated with M3- or HCl-extractable Cd at both the 0–5 and 5–15 cm depths (r = 0.80 and 0.82 for M3, and r = 0.78 and 0.82 for HCl; P < 0.01). These results indicate that accumulation of Cd in surface layers results in excessive Cd in cacao beans and M3- or HCl-extractable Cd are suitable methods for predicting available Cd in the studied soils. - Highlights: • > 60% of the studied sites had a Cd content in cacao beans above the critical level. • Bean Cd concentration was closely correlated with available Cd in soil. • Soil Cd contamination is likely