WorldWideScience

Sample records for cadmium 110 target

  1. Microphthalmia-associated transcription factor as the molecular target of cadmium toxicity in human melanocytes

    International Nuclear Information System (INIS)

    Highlights: • In human melanocytes, cadmium decreases the expression of MITF-M and tyrosinase and their mRNAs. • In human melanoma cells, cadmium decreases the expression of MITF-M protein and tyrosinase mRNA. • Expression of MITF-H is less sensitive to cadmium toxicity in melanocyte-linage cells. • Cadmium does not decrease the expression of MITF-H in retinal pigment epithelial cells. • MITF-M is the molecular target of cadmium toxicity in melanocytes. - Abstract: Dietary intake of cadmium is inevitable, causing age-related increase in cadmium accumulation in many organs, including hair, choroid and retinal pigment epithelium (RPE). Cadmium has been implicated in the pathogenesis of hearing loss and macular degeneration. The functions of cochlea and retina are maintained by melanocytes and RPE, respectively, and the differentiation of these pigment cells is regulated by microphthalmia-associated transcription factor (MITF). In the present study, we explored the potential toxicity of cadmium in the cochlea and retina by using cultured human melanocytes and human RPE cell lines. MITF consists of multiple isoforms, including melanocyte-specific MITF-M and widely expressed MITF-H. Levels of MITF-M protein and its mRNA in human epidermal melanocytes and HMV-II melanoma cells were decreased significantly by cadmium. In parallel with the MITF reduction, mRNA levels of tyrosinase, the key enzyme of melanin biosynthesis that is regulated by MITF-M, were also decreased. In RPE cells, however, the levels of total MITF protein, constituting mainly MITF-H, were not decreased by cadmium. We thus identify MITF-M as the molecular target of cadmium toxicity in melanocytes, thereby accounting for the increased risk of disability from melanocyte malfunction, such as hearing and vision loss among people with elevated cadmium exposure

  2. Microphthalmia-associated transcription factor as the molecular target of cadmium toxicity in human melanocytes

    Energy Technology Data Exchange (ETDEWEB)

    Chantarawong, Wipa [Department of Molecular Biology and Applied Physiology, Tohoku University School of Medicine, Sendai (Japan); Inter Departmental Multidisciplinary Graduate Program in Bioscience, Faculty of Science, Kasetsart University, Bangkok (Thailand); Takeda, Kazuhisa; Sangartit, Weerapon; Yoshizawa, Miki [Department of Molecular Biology and Applied Physiology, Tohoku University School of Medicine, Sendai (Japan); Pradermwong, Kantimanee [Department of Zoology, Faculty of Science, Kasetsart University, Bangkok (Thailand); Shibahara, Shigeki, E-mail: shibahar@med.tohoku.ac.jp [Department of Molecular Biology and Applied Physiology, Tohoku University School of Medicine, Sendai (Japan)

    2014-11-28

    Highlights: • In human melanocytes, cadmium decreases the expression of MITF-M and tyrosinase and their mRNAs. • In human melanoma cells, cadmium decreases the expression of MITF-M protein and tyrosinase mRNA. • Expression of MITF-H is less sensitive to cadmium toxicity in melanocyte-linage cells. • Cadmium does not decrease the expression of MITF-H in retinal pigment epithelial cells. • MITF-M is the molecular target of cadmium toxicity in melanocytes. - Abstract: Dietary intake of cadmium is inevitable, causing age-related increase in cadmium accumulation in many organs, including hair, choroid and retinal pigment epithelium (RPE). Cadmium has been implicated in the pathogenesis of hearing loss and macular degeneration. The functions of cochlea and retina are maintained by melanocytes and RPE, respectively, and the differentiation of these pigment cells is regulated by microphthalmia-associated transcription factor (MITF). In the present study, we explored the potential toxicity of cadmium in the cochlea and retina by using cultured human melanocytes and human RPE cell lines. MITF consists of multiple isoforms, including melanocyte-specific MITF-M and widely expressed MITF-H. Levels of MITF-M protein and its mRNA in human epidermal melanocytes and HMV-II melanoma cells were decreased significantly by cadmium. In parallel with the MITF reduction, mRNA levels of tyrosinase, the key enzyme of melanin biosynthesis that is regulated by MITF-M, were also decreased. In RPE cells, however, the levels of total MITF protein, constituting mainly MITF-H, were not decreased by cadmium. We thus identify MITF-M as the molecular target of cadmium toxicity in melanocytes, thereby accounting for the increased risk of disability from melanocyte malfunction, such as hearing and vision loss among people with elevated cadmium exposure.

  3. Synthesis, Crystal Structure and Electrochemical Properties of a Cadmium(II) Complex with α-Furoic Acid and 1,10-Phenanthroline

    Institute of Scientific and Technical Information of China (English)

    ZHANG Shao-Hua; LI Chang-Hong; LI Wei; YANG Ying-Qun

    2008-01-01

    A new cadmium complex [Cd(phen)3]·(ClO4)2·(α-FRA)·(H2O)3 was prepared by self-assembly of α-furoic acid, 1,10-phenanthroline (phen), and cadmium perchlorate. It crystal- lizes in the monoclinic system, space group P21/n, with a = 1.28130(15), b = 2.5957(3), c = 1.35449(16) nm, β = 109.395(2)o, V = 4.2492(9) nm3, Dc = 1.491 g/cm3, Z = 4, F(000) = 1926, GOOF = 1.023, the final R = 0.0729 and wR = 0.2086. The crystal structure analysis indicates that the cadmium ion is coordinated with six nitrogen atoms from six 1,10-phenanthroline molecules, giving a distorted octahedral coordination geometry. The cyclic voltametric behavior of the com- plex was also investigated.

  4. Microphthalmia-associated transcription factor as the molecular target of cadmium toxicity in human melanocytes.

    Science.gov (United States)

    Chantarawong, Wipa; Takeda, Kazuhisa; Sangartit, Weerapon; Yoshizawa, Miki; Pradermwong, Kantimanee; Shibahara, Shigeki

    2014-11-28

    Dietary intake of cadmium is inevitable, causing age-related increase in cadmium accumulation in many organs, including hair, choroid and retinal pigment epithelium (RPE). Cadmium has been implicated in the pathogenesis of hearing loss and macular degeneration. The functions of cochlea and retina are maintained by melanocytes and RPE, respectively, and the differentiation of these pigment cells is regulated by microphthalmia-associated transcription factor (MITF). In the present study, we explored the potential toxicity of cadmium in the cochlea and retina by using cultured human melanocytes and human RPE cell lines. MITF consists of multiple isoforms, including melanocyte-specific MITF-M and widely expressed MITF-H. Levels of MITF-M protein and its mRNA in human epidermal melanocytes and HMV-II melanoma cells were decreased significantly by cadmium. In parallel with the MITF reduction, mRNA levels of tyrosinase, the key enzyme of melanin biosynthesis that is regulated by MITF-M, were also decreased. In RPE cells, however, the levels of total MITF protein, constituting mainly MITF-H, were not decreased by cadmium. We thus identify MITF-M as the molecular target of cadmium toxicity in melanocytes, thereby accounting for the increased risk of disability from melanocyte malfunction, such as hearing and vision loss among people with elevated cadmium exposure. PMID:25449283

  5. Diffusion-based separation methods: dry distillation of zinc, cadmium and mercury isotopes from irradiated targets

    International Nuclear Information System (INIS)

    Diffusion-based separation methods allow the extraction of produced radionuclides with a low loss of target material, which is of special importance when enriched target material is used. We present a simple, non-destructive and rapid method to separate radioactive isotopes of IIB group elements (zinc, cadmium and mercury) from IB group metal targets irradiated with protons. Irradiated target foils were heated to a temperature 20oC below the melting point of the target material. During these conditions at least 90% of the desired radioactivity was evaporated with negligible loss of target material. Separation time was 15 min for mercury, 60 min for cadmium and 120 min for zinc. (author)

  6. Cadmium carcinogenesis

    International Nuclear Information System (INIS)

    Cadmium is a heavy metal of considerable environmental and occupational concern. Cadmium compounds are classified as human carcinogens by several regulatory agencies. The most convincing data that cadmium is carcinogenic in humans comes from studies indicating occupational cadmium exposure is associated with lung cancer. Cadmium exposure has also been linked to human prostate and renal cancer, although this linkage is weaker than for lung cancer. Other target sites of cadmium carcinogenesis in humans, such as liver, pancreas and stomach, are considered equivocal. In animals, cadmium effectively induces cancers at multiple sites and by various routes. Cadmium inhalation in rats induces pulmonary adenocarcinomas, in accord with its role in human lung cancer. Cadmium can induce tumors and/or preneoplastic lesions within the rat prostate after ingestion or injection. At relatively high doses, cadmium induces benign testicular tumors in rats, but these appear to be due to early toxic lesions and loss of testicular function, rather than from a specific carcinogenic effect of cadmium. Like many other metals, cadmium salts will induce mesenchymal tumors at the site of subcutaneous (s.c.) or intramuscular (i.m.) injections, but the human relevance of these is dubious. Other targets of cadmium in rodents include the liver, adrenal, pancreas, pituitary, and hematopoietic system. With the exception of testicular tumors in rodents, the mechanisms of cadmium carcinogenesis are poorly defined. Cadmium can cause any number of molecular lesions that would be relevant to oncogenesis in various cellular model systems. Most studies indicate cadmium is poorly mutagenic and probably acts through indirect or epigenetic mechanisms, potentially including aberrant activation of oncogenes and suppression of apoptosis

  7. Atomic force microscopy studies on growth mechanisms and defect formations on {l_brace}110{r_brace} faces of cadmium mercury thiocyanate crystals

    Energy Technology Data Exchange (ETDEWEB)

    Jiang, X.N.; Xu, D.; Yuan, D.R.; Sun, D.L.; Lu, M.K.; Zhang, G.H.; Guo, S.Y. [Shandong Univ., Jinan, SD (China). Inst. of Crystal Materials

    2001-07-01

    Growth mechanisms and defect formations on {l_brace}110{r_brace} faces of cadmium mercury thiocyanate crystals grown at 30 C ({sigma} = 0.24) were investigated by using atomic force microscopy (AFM). It was found that, under this condition, spiral dislocation controlled mechanism and 2D nucleation mechanism operates simultaneously and equally during growth, which is completely different from the traditional 2D nucleation and dislocation source controlled mechanisms. A number of 2D nucleus are formed at the large step terraces generated by dislocation sources, leading to the unequal growth rates of the elementary steps and thereby ''step bunches'' are caused. Various defects are formed under this growth condition, which is assumed to result from the incongruence between the steps generated by different sources. A new kind of 2D defect, corresponding to one growth layer in height, was observed for the first time. (orig.)

  8. Characterization of wheat miRNAs and their target genes responsive to cadmium stress.

    Science.gov (United States)

    Qiu, ZongBo; Hai, BenZhai; Guo, JunLi; Li, YongFang; Zhang, Liang

    2016-04-01

    A increasing number of microRNAs have been shown to play important regulatory roles in plant responses to various metal stresses. However, little information about miRNAs especially miRNAs responsive to cadmium (Cd) stress is available in wheat. To investigate the role of miRNAs in responses to Cd stress, wheat seedlings were subjected to 250 μM Cd solution for 6, 12, 24 and 48 h, and analyses of morphological and physiological changes as well as the expression of five miRNAs and their corresponding targets were carried out. Our results demonstrated that miRNAs and their targets were differentially expressed in leaves and roots of wheat seedlings exposed to Cd stress. Furthermore, miR398 may involve in oxidative stress tolerance by regulating its target CSD to participate in Cd stress. Among ten miRNA-target pairs studied, nine pairs showed complex regulation relationship in leaves and roots of wheat seedlings exposed to Cd stress. These findings suggested that miRNAs are involved in the mediation of Cd stress signaling responses in wheat. The characterization of the miRNAs and the associated targets in responses to Cd exposure provides a framework for understanding the molecular mechanism of heavy metal tolerance in plants. PMID:26854408

  9. Di-μ-acetato-κ3O,O′:O;κ3O:O,O′-bis[(acetato-κ2O,O′(1,10-phenanthroline-κ2N,N′cadmium(II

    Directory of Open Access Journals (Sweden)

    Miguel Angel Harvey

    2008-11-01

    Full Text Available The title compound, [Cd2(C2H3O24(C12H8N22], consists of dimeric units built up around a crystallographic symmetry centre. Each cadmium(II unit is chelated by a 1,10-phenanthroline (phen group and two acetate ligands, one of which also acts as a bridge, linking both seven-coordinated cadmium(II centres. The crystal structure is governed by a single π–π interaction between stacked phen groups [centroid–centroid distance 3.5209 (11 Å], leading to a planar structure parallel to (010.

  10. Subcellular targets of cadmium nephrotoxicity: cadmium binding to renal membrane proteins in animals with or without protective metallothionein synthesis.

    OpenAIRE

    Nordberg, G F; Jin, T; Nordberg, M.

    1994-01-01

    Nephrotoxic effects of cadmium exposure are well established in humans and experimental animals. An early manifestation of such toxicity is calciuria a few hours after injection of CdMT in rats. Protection against calciuria and other adverse effects such as proteinuria (occurring later) is offered by pretreatment with Cd, which effectively induces metallothionein synthesis. In the present experiment, one group of animals was given pretreatment with CdCl2 to induce metallothionein synthesis. T...

  11. Target hazard quotient evaluation of cadmium and lead in fish from Caspian Sea.

    Science.gov (United States)

    Basim, Yalda; Khoshnood, Zahra

    2016-02-01

    Heavy metals are being increasingly released into the natural waters from geological and anthropogenic sources. The distributions of several heavy metals such as cadmium (Cd) and lead (Pb) were investigated in muscle and liver of three different fish species seasonally collected from Caspian Sea (autumn 2011-summer 2012). The concentrations of all metals were lower in flesh than those recorded in liver due to their physiological roles. The target hazard quotient (THQ) index for fish was calculated. Estimation of THQ calculations for the contaminated fish consumption was calculated to evaluate the effect of pollution on health. Total metal THQ values of Pb and Cd for adults were 0.05 and 0.04 in Anzali and Noshahr, respectively, and for children were 0.08 and 0.05 in Anzali and Noshahr, respectively.

  12. Bis(1,10-phenanthroline-κ2 N,N′)bis­(thio­cyanato-κN)cadmium

    OpenAIRE

    Daniel Vallejo; Garikoitz Beobide; Oscar Castillo; Antonio Luque

    2011-01-01

    The title compound, [Cd(NCS)2(C12H8N2)2], has been obtained from the decomposition reaction of dithiooxamide in a dimethylformamide solution containing 1,10-phenanthroline (phen) and Cd(NO3)2·4H2O. Its crystal structure is formed by monuclear CdII entities in which the metal atom is sited on a twofold rotation axis. The CdII atom is six-coordinated in the form of a distorted octahedron by two chelating phenanthroline molecules and two thiocyanate anions coordinated through their N at...

  13. Inhaled Cadmium Oxide Nanoparticles: Their in Vivo Fate and Effect on Target Organs

    Science.gov (United States)

    Dumkova, Jana; Vrlikova, Lucie; Vecera, Zbynek; Putnova, Barbora; Docekal, Bohumil; Mikuska, Pavel; Fictum, Petr; Hampl, Ales; Buchtova, Marcela

    2016-01-01

    The increasing amount of heavy metals used in manufacturing equivalently increases hazards of environmental pollution by industrial products such as cadmium oxide (CdO) nanoparticles. Here, we aimed to unravel the CdO nanoparticle destiny upon their entry into lungs by inhalations, with the main focus on the ultrastructural changes that the nanoparticles may cause to tissues of the primary and secondary target organs. We indeed found the CdO nanoparticles to be transported from the lungs into secondary target organs by blood. In lungs, inhaled CdO nanoparticles caused significant alterations in parenchyma tissue including hyperemia, enlarged pulmonary septa, congested capillaries, alveolar emphysema and small areas of atelectasis. Nanoparticles were observed in the cytoplasm of cells lining bronchioles, in the alveolar spaces as well as inside the membranous pneumocytes and in phagosomes of lung macrophages. Nanoparticles even penetrated through the membrane into some organelles including mitochondria and they also accumulated in the cytoplasmic vesicles. In livers, inhalation caused periportal inflammation and local hepatic necrosis. Only minor changes such as diffusely thickened filtration membrane with intramembranous electron dense deposits were observed in kidney. Taken together, inhaled CdO nanoparticles not only accumulated in lungs but they were also transported to other organs causing serious damage at tissue as well as cellular level. PMID:27271611

  14. Inhaled Cadmium Oxide Nanoparticles: Their in Vivo Fate and Effect on Target Organs

    Directory of Open Access Journals (Sweden)

    Jana Dumkova

    2016-06-01

    Full Text Available The increasing amount of heavy metals used in manufacturing equivalently increases hazards of environmental pollution by industrial products such as cadmium oxide (CdO nanoparticles. Here, we aimed to unravel the CdO nanoparticle destiny upon their entry into lungs by inhalations, with the main focus on the ultrastructural changes that the nanoparticles may cause to tissues of the primary and secondary target organs. We indeed found the CdO nanoparticles to be transported from the lungs into secondary target organs by blood. In lungs, inhaled CdO nanoparticles caused significant alterations in parenchyma tissue including hyperemia, enlarged pulmonary septa, congested capillaries, alveolar emphysema and small areas of atelectasis. Nanoparticles were observed in the cytoplasm of cells lining bronchioles, in the alveolar spaces as well as inside the membranous pneumocytes and in phagosomes of lung macrophages. Nanoparticles even penetrated through the membrane into some organelles including mitochondria and they also accumulated in the cytoplasmic vesicles. In livers, inhalation caused periportal inflammation and local hepatic necrosis. Only minor changes such as diffusely thickened filtration membrane with intramembranous electron dense deposits were observed in kidney. Taken together, inhaled CdO nanoparticles not only accumulated in lungs but they were also transported to other organs causing serious damage at tissue as well as cellular level.

  15. Inhaled Cadmium Oxide Nanoparticles: Their in Vivo Fate and Effect on Target Organs.

    Science.gov (United States)

    Dumkova, Jana; Vrlikova, Lucie; Vecera, Zbynek; Putnova, Barbora; Docekal, Bohumil; Mikuska, Pavel; Fictum, Petr; Hampl, Ales; Buchtova, Marcela

    2016-01-01

    The increasing amount of heavy metals used in manufacturing equivalently increases hazards of environmental pollution by industrial products such as cadmium oxide (CdO) nanoparticles. Here, we aimed to unravel the CdO nanoparticle destiny upon their entry into lungs by inhalations, with the main focus on the ultrastructural changes that the nanoparticles may cause to tissues of the primary and secondary target organs. We indeed found the CdO nanoparticles to be transported from the lungs into secondary target organs by blood. In lungs, inhaled CdO nanoparticles caused significant alterations in parenchyma tissue including hyperemia, enlarged pulmonary septa, congested capillaries, alveolar emphysema and small areas of atelectasis. Nanoparticles were observed in the cytoplasm of cells lining bronchioles, in the alveolar spaces as well as inside the membranous pneumocytes and in phagosomes of lung macrophages. Nanoparticles even penetrated through the membrane into some organelles including mitochondria and they also accumulated in the cytoplasmic vesicles. In livers, inhalation caused periportal inflammation and local hepatic necrosis. Only minor changes such as diffusely thickened filtration membrane with intramembranous electron dense deposits were observed in kidney. Taken together, inhaled CdO nanoparticles not only accumulated in lungs but they were also transported to other organs causing serious damage at tissue as well as cellular level. PMID:27271611

  16. Nuclear model calculation and targetry recipe for production of 110mIn

    International Nuclear Information System (INIS)

    110mIn is potentially an important positron emitting that can be used in positron emission tomography. In this work, the excitation functions and production yields of 110Cd(d, 2n), 111Cd(d, 3n), natCd(d, xn), 110Cd(p, n), 111Cd(p, 2n), 112Cd(p, 3n) and natCd(p, xn) reactions to produce the 110mIn were calculated using nuclear model code TALYS and compared with the experimental data. The yield of isomeric state production of 110In was also compared with ground state production ones to reach the optimal energy range of projectile for the high yield production of metastable state. The results indicate that the 110Cd(p, n)110mIn is a high yield reaction with an isomeric ratio (σm/σg) of about 35 within the optimal incident energy range of 15–5 MeV. To make the target, cadmium was electroplated on a copper substrate in varying electroplating conditions such as PH, DC current density, temperature and time. A set of cold tests were also performed on the final sample under several thermal shocks to verify target resistance. The best electroplated cadmium target was irradiated with 15 MeV protons at current of 100 µA for one hour and the production yield of 110mIn and other byproducts were measured. - Highlights: • Optimization of a cadmium electroplating bath to produce high yield 110mIn. • Influence of targetry on isomeric cross section ratio 110mIn/110gIn. • Activity measurement for natCd(p, xn)110m,110g,111g,114mIn reactions

  17. Target or barrier? The cell wall of early- and later- diverging plants vs cadmium toxicity: differences in the response mechanisms

    Directory of Open Access Journals (Sweden)

    Luigi eParrotta

    2015-03-01

    Full Text Available Increasing industrialization and urbanization result in emission of pollutants in the environment including toxic heavy metals, as cadmium and lead. Among the different heavy metals contaminating the environment, cadmium raises great concern, as it is ecotoxic and as such can heavily impact ecosystems. The cell wall is the first structure of plant cells to come in contact with heavy metals. Its composition, characterized by proteins, polysaccharides and in some instances lignin and other phenolic compounds, confers the ability to bind non-covalently and/or covalently heavy metals via functional groups. A strong body of evidence in the literature has shown the role of the cell wall in heavy metal response: it sequesters heavy metals, but at the same time its synthesis and composition can be severely affected. The present review analyzes the dual property of plant cell walls, i.e. barrier and target of heavy metals, by taking Cd toxicity as example. Following a summary of the known physiological and biochemical responses of plants to Cd, the review compares the wall-related mechanisms in early- and later-diverging land plants, by considering the diversity in cell wall composition. By doing so, common as well as unique response mechanisms to metal/cadmium toxicity are identified among plant phyla and discussed. After discussing the role of hyperaccumulators’ cell walls as a particular case, the review concludes by considering important aspects for plant engineering.

  18. Ribosomal genes as early targets of cadmium-induced toxicity in Chironomus riparius larvae

    Energy Technology Data Exchange (ETDEWEB)

    Planello, R. [Biologia Ambiental, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, Senda del Rey 9, 28040, Madrid (Spain); Martinez-Guitarte, J.L. [Biologia Ambiental, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, Senda del Rey 9, 28040, Madrid (Spain); Morcillo, G. [Biologia Ambiental, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, Senda del Rey 9, 28040, Madrid (Spain)]. E-mail: gmorcillo@ccia.uned.es

    2007-02-01

    Cadmium is a widespread environmental pollutant that causes severe impacts in organisms. Although the effects of cadmium on aquatic insects have been studied in terms of their toxicity and changes in developmental parameters, little is known about its molecular and genetic effects. We have investigated the alterations in the pattern of gene expression provoked by acute exposure to cadmium in Chironomus riparius Mg. (Diptera, Chironomidae), a sentinel organism widely used in aquatic toxicity testing. The early cytotoxic effects were evaluated using immunocytochemistry and specific fluorescent probes in fourth instar larvae after 12 h of 10 mM cadmium treatments; under these conditions no significant effect on larvae mortality was detected until after 36 h of exposure. The changes in the pattern of gene expression were analysed by means of DNA/RNA hybrid antibodies in the polytene chromosomes from salivary gland cells. A decrease in the activity of the nucleolus is especially remarkable, accompanied by a significant reduction in size and the modification in nucleolar architecture, as shown by FISH. The inhibition of rDNA transcription was further evaluated by Northern blot analysis, which showed a marked decrease in the level of preribosomal rRNA (54% 45S 12 h). However, the BR genes, whose products are the giant polypeptides that constitute the silk-like secretion for constructing housing tubes, remain active. Simultaneously, decondensation and activation take place at some chromosomal regions, especially at the centromeres. The changes observed in the pattern of gene expression do not resemble those found after heat shock or other cell stressors. These data provide the first evidence that cadmium interacts with ribosomal genes and results in a drastic impairment of the functional activity of the nucleolus, an essential organelle for cellular survival. Therefore, the depletion of ribosomes would be a long-term effect of Cd-induced cellular damage. These findings may

  19. Ribosomal genes as early targets of cadmium-induced toxicity in Chironomus riparius larvae

    International Nuclear Information System (INIS)

    Cadmium is a widespread environmental pollutant that causes severe impacts in organisms. Although the effects of cadmium on aquatic insects have been studied in terms of their toxicity and changes in developmental parameters, little is known about its molecular and genetic effects. We have investigated the alterations in the pattern of gene expression provoked by acute exposure to cadmium in Chironomus riparius Mg. (Diptera, Chironomidae), a sentinel organism widely used in aquatic toxicity testing. The early cytotoxic effects were evaluated using immunocytochemistry and specific fluorescent probes in fourth instar larvae after 12 h of 10 mM cadmium treatments; under these conditions no significant effect on larvae mortality was detected until after 36 h of exposure. The changes in the pattern of gene expression were analysed by means of DNA/RNA hybrid antibodies in the polytene chromosomes from salivary gland cells. A decrease in the activity of the nucleolus is especially remarkable, accompanied by a significant reduction in size and the modification in nucleolar architecture, as shown by FISH. The inhibition of rDNA transcription was further evaluated by Northern blot analysis, which showed a marked decrease in the level of preribosomal rRNA (54% 45S 12 h). However, the BR genes, whose products are the giant polypeptides that constitute the silk-like secretion for constructing housing tubes, remain active. Simultaneously, decondensation and activation take place at some chromosomal regions, especially at the centromeres. The changes observed in the pattern of gene expression do not resemble those found after heat shock or other cell stressors. These data provide the first evidence that cadmium interacts with ribosomal genes and results in a drastic impairment of the functional activity of the nucleolus, an essential organelle for cellular survival. Therefore, the depletion of ribosomes would be a long-term effect of Cd-induced cellular damage. These findings may

  20. Genome-wide identification of Brassica napus microRNAs and their targets in response to cadmium.

    Science.gov (United States)

    Zhou, Zhao Sheng; Song, Jian Bo; Yang, Zhi Min

    2012-07-01

    MicroRNAs (miRNAs) are a distinct class of small RNAs in plants that not only regulate biological processes but also regulate response to environmental stresses. The toxic heavy metal cadmium (Cd) induces expression of several miRNAs in rapeseed (Brassica napus), but it is not known on a genome-wide scale how the expression of miRNAs and their target genes, is regulated by Cd. In this study, four small RNA libraries and four degradome libraries were constructed from Cd-treated and non-Cd-treated roots and shoots of B. napus seedlings. Using high-throughput sequencing, the study identified 84 conserved and non-conserved miRNAs (belonging to 37 miRNA families) from Cd-treated and non-treated B. napus, including 19 miRNA members that were not identified before. Some of the miRNAs were validated by RNA gel blotting. Most of the identified miRNAs were found to be differentially expressed in roots/shoots or regulated by Cd exposure. The study simultaneously identified 802 targets for the 37 (24 conserved and 13 non-conserved) miRNA families, from which there are 200, 537, and 65 targets, belonging to categories I, II, and III, respectively. In category I alone, many novel targets for miRNAs were identified and shown to be involved in plant response to Cd.

  1. Peculiarities of preparation of cadmium isotopes of high enrichment

    International Nuclear Information System (INIS)

    Cascade equipped by gas centrifuges with regard for requirements to structural materials operating with chemically active compounds (dimethylcadmium) was devised for preparation of high-enriched cadmium isotopes. Solutions of such problems as overcoming of isotope memory, compensation of the effect of isotope overlapping, operative analytical accompanying permitted to optimize separation process and to obtain cadmium isotopes of high enrichment degree: cadmium-116 ∼98.9 %, cadmium-114 ∼98.7 %, cadmium-113 ∼93.3 %, cadmium-112 ∼99.1 %, cadmium-110 ∼95.8 %

  2. Synthesis, spectral, electrochemical, crystal structure studies of two novel di-μ-halo-bis[halo(2,9-dimethyl-4,7-diphenyl-1,10-phenanthroline)cadmium(II)] dimer complexes and their thermolysis to nanometal oxides

    Science.gov (United States)

    Warad, Ismail; Abdoh, Muneer; Shivalingegowda, Naveen; Lokanath, Neartur Krishnappagowda; Salghi, Rachid; Al-Nuri, Mohammed; Jodeh, Shehdeh; Radi, Smaail; Hammouti, Belkheir

    2015-11-01

    Two new neutral dimer Cadmium(II) complexes, [Cd2(dmdphphen)2X4] and where X = Cl (complex 1), Br (complex 2), and dmdphphen = 2,9-dimethyl-4,7-diphenyl-1,10-phenanthroline, were synthesized and characterized by an elemental analysis, UV-Vis, IR, TG/DTA, CV and single crystal X-ray diffraction. Complex 1 crystallizes in the triclinic system with the space group P-1 with unit cell parameters a = 10.1124(8) Å, b = 10.8875(8) Å, c = 11.5730(9) Å, α = 108.323(3)°, β = 107.010(3)°, γ = 91.260(3)° V = 1147.51(15) Å3 and Z = 1. The Cd(II) ions are located in a slightly distorted square-pyramidal geometry. The complexes exhibit a quasi-reversible one electron response at -570 mV vs. Cp2Fe/Cp2Fe+, which has been assigned Cd(II)/Cd(III) couples. TG/DTA result shows that these complexes are very stable and decomposed through one step reaction. Calcination of Complex 1, revealed the formation of Cubic nanoparticle CdO.

  3. Cadmium sulfite hexahydrate revisited

    Directory of Open Access Journals (Sweden)

    Sergio Baggio

    2008-07-01

    Full Text Available The present structural revision of the title compound, tetracadmium tetrasulfite hexahydrate, [Cd4(SO34(H2O5]·H2O, is a low-temperature upgrade (T = 100 K and R = 0.017 of the original room-temperature structure reported by Kiers & Vos [Cryst. Struct. Commun. (1978. 7, 399–403; T = 293 K and R = 0.080. The compound is a three-dimensional polymer with four independent cadmium centres, four sulfite anions and six water molecules, five of them coordinated to two cadmium centres and the remaining one an unbound solvent molecule which completes the asymmetric unit. There are two types of cadmium environment: CdO8 (through four chelating sulfite ligands and CdO6 (by way of six monocoordinated ligands. The former groups form planar arrays [parallel to (001 and separated by half a unit cell translation along c], made up of chains running along [110] and [overline{1}10], respectively. These chains are, in turn, interconnected both in an intraplanar as well as in an interplanar fashion by the latter CdO6 polyhedra into a tight three-dimensional framework. There is, in addition, an extensive network of hydrogen bonds, in which all 12 water H atoms act as donors and eight O atoms from all four sulfite groups and two water molecules act as acceptors.

  4. Targeted genome editing in the rare actinomycete Actinoplanes sp. SE50/110 by using the CRISPR/Cas9 System.

    Science.gov (United States)

    Wolf, Timo; Gren, Tetiana; Thieme, Eric; Wibberg, Daniel; Zemke, Till; Pühler, Alfred; Kalinowski, Jörn

    2016-08-10

    The application of genome editing technologies, like CRISPR/Cas9 for industrially relevant microorganisms, is becoming increasingly important. Compared to other methods of genetic engineering the decisive factor is that CRISPR/Cas9 is relatively easy to apply and thus time and effort can be significantly reduced in organisms, which are otherwise genetically difficult to access. Because of its many advantages and opportunities, we adopted the CRISPR/Cas9 technology for Actinoplanes sp. SE50/110, the producer of the diabetes type II drug acarbose. The functionality of genome editing was successfully shown by the scarless and antibiotic marker-free deletion of the gene encoding the tyrosinase MelC, which catalyzes the formation of the dark pigment eumelanin in the wild type strain. The generated ΔmelC2 mutant of Actinoplanes sp. SE50/110 no longer produces this pigment and therefore the supernatant does not darken. Furthermore, it was shown that the plasmid containing the gene for the Cas9 protein was removed by increasing the temperature due to its temperature-sensitive replication. The precision of the intended mutation was proven and possible off-target effects caused by the genome editing system were ruled out by genome sequencing of several mutants. PMID:27262504

  5. Global Fitness Profiling Identifies Arsenic and Cadmium Tolerance Mechanisms in Fission Yeast

    Science.gov (United States)

    Guo, Lan; Ganguly, Abantika; Sun, Lingling; Suo, Fang; Du, Li-Lin; Russell, Paul

    2016-01-01

    Heavy metals and metalloids such as cadmium [Cd(II)] and arsenic [As(III)] are widespread environmental toxicants responsible for multiple adverse health effects in humans. However, the molecular mechanisms underlying metal-induced cytotoxicity and carcinogenesis, as well as the detoxification and tolerance pathways, are incompletely understood. Here, we use global fitness profiling by barcode sequencing to quantitatively survey the Schizosaccharomyces pombe haploid deletome for genes that confer tolerance of cadmium or arsenic. We identified 106 genes required for cadmium resistance and 110 genes required for arsenic resistance, with a highly significant overlap of 36 genes. A subset of these 36 genes account for almost all proteins required for incorporating sulfur into the cysteine-rich glutathione and phytochelatin peptides that chelate cadmium and arsenic. A requirement for Mms19 is explained by its role in directing iron–sulfur cluster assembly into sulfite reductase as opposed to promoting DNA repair, as DNA damage response genes were not enriched among those required for cadmium or arsenic tolerance. Ubiquinone, siroheme, and pyridoxal 5′-phosphate biosynthesis were also identified as critical for Cd/As tolerance. Arsenic-specific pathways included prefoldin-mediated assembly of unfolded proteins and protein targeting to the peroxisome, whereas cadmium-specific pathways included plasma membrane and vacuolar transporters, as well as Spt–Ada–Gcn5-acetyltransferase (SAGA) transcriptional coactivator that controls expression of key genes required for cadmium tolerance. Notable differences are apparent with corresponding screens in the budding yeast Saccharomyces cerevisiae, underscoring the utility of analyzing toxic metal defense mechanisms in both organisms. PMID:27558664

  6. Global Fitness Profiling Identifies Arsenic and Cadmium Tolerance Mechanisms in Fission Yeast

    Directory of Open Access Journals (Sweden)

    Lan Guo

    2016-10-01

    Full Text Available Heavy metals and metalloids such as cadmium [Cd(II] and arsenic [As(III] are widespread environmental toxicants responsible for multiple adverse health effects in humans. However, the molecular mechanisms underlying metal-induced cytotoxicity and carcinogenesis, as well as the detoxification and tolerance pathways, are incompletely understood. Here, we use global fitness profiling by barcode sequencing to quantitatively survey the Schizosaccharomyces pombe haploid deletome for genes that confer tolerance of cadmium or arsenic. We identified 106 genes required for cadmium resistance and 110 genes required for arsenic resistance, with a highly significant overlap of 36 genes. A subset of these 36 genes account for almost all proteins required for incorporating sulfur into the cysteine-rich glutathione and phytochelatin peptides that chelate cadmium and arsenic. A requirement for Mms19 is explained by its role in directing iron–sulfur cluster assembly into sulfite reductase as opposed to promoting DNA repair, as DNA damage response genes were not enriched among those required for cadmium or arsenic tolerance. Ubiquinone, siroheme, and pyridoxal 5′-phosphate biosynthesis were also identified as critical for Cd/As tolerance. Arsenic-specific pathways included prefoldin-mediated assembly of unfolded proteins and protein targeting to the peroxisome, whereas cadmium-specific pathways included plasma membrane and vacuolar transporters, as well as Spt–Ada–Gcn5-acetyltransferase (SAGA transcriptional coactivator that controls expression of key genes required for cadmium tolerance. Notable differences are apparent with corresponding screens in the budding yeast Saccharomyces cerevisiae, underscoring the utility of analyzing toxic metal defense mechanisms in both organisms.

  7. To problem about construction of cyclotron target for bombardment of metal zinc and cadmium targets on exterior beams of the accelerator U-120

    International Nuclear Information System (INIS)

    Full text: Industrial intrusion of diffusion-and-thermal methods of radionuclides separation it is impossible at use of traditional targets representing a Cu or Ag substrate, on which the starting isotopic enriched material is marked. For embodying these technologies it is necessary to modify a target so that completely to eliminate an opportunity of a physicochemical interaction (diffusion, alloy building) labilized material and target radionuclide with a substrate in requirements of heightened temperatures. One of the possible solutions of this problem - manufacture of substrates of cyclotron targets from high-melting inert materials. For the bombardment of metal Zn or Cd metal targets (production of 67Ga and 111In, basic medical radionuclides) on the on exterior beam of the accelerators U-120 designed the cyclotron target, where as a bottom for drawing a isotopic enriched materials will be utilized a tantalic substrate by a diameter of 28 mm and depth 750 microns. At centre of a substrate are made a dimple by a diameter 16 mm, where (from a melt) are superimposed metal Zn or Cd. For heat removal during bombardment: a) on the part of a tantalic substrate the target is washed by water, b) for refrigerating a obverse surface of a target the gaseous He will be utilized. The evaluation calculations are carried out: a) of the basic characteristics of a helium heat exchanger (for dissecting away of irradiated target from volume of the accelerator the titanium metal foil by depth 50 μm will be utilized), b) of strength of a Ta substrate (will be utilized at pressure of 'frigorific' water 0.5 MPa), c) of operating temperatures of a substrate and targets (Zn or Cd) at the bombardment by their of beams of deuterons (energy - 13/0 Me V, peak current of beam - 20 μA). Is ro tined, that the optimum interval of values of pressures of helium compounds 25-32 mm Hg; the build-up of pressure of helium gives in linear magnification of voltages and down stroke of ultimate strength

  8. Effects of Cadmium Stress on Seed Germination, Seedling Growth and Seed Amylase Activities in Rice (Oryza sativa)

    Institute of Scientific and Technical Information of China (English)

    HE Jun-yu; REN Yan-fang; ZHU Cheng; JIANG De-an

    2008-01-01

    Two rice varieties, Xiushui 110 with high cadmium (Cd) tolerance and Xiushui 11 with low Cd tolerance were used to study the effects of Cd stress on seed germination, seedling growth and amylase activities. The low cadmium concentration had little effect on seed germination rate. However, cadmium stress could significantly inhibit plumule and radicle growth, especially for radicle growth. Germination index, vigour index, radicle length and amylase activities of Xiushui 11 decreased more significantly with the increasing cadmium level compared with Xiushui 110. The cadmium content in seedlings of Xiushui 11 was higher than that in Xiushui 110 when the cadmium concentration exceeded 5 μmol/L, which caused lower mitotic index in root tips and amylase activities, and more serious cadmium toxicity in Xiushui 11.

  9. Reviews of the environmental effects of pollutants: IV. Cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Hammons, A.S.; Huff, J.E.; Braunstein, H.M.; Drury, J.S.; Shriner, C.R.; Lewis, E.B.; Whitfield, B.L.; Towill, L.E.

    1978-06-01

    This report is a comprehensive, multidisciplinary review of the health and environmental effects of cadmium and specific cadmium derivatives. More than 500 references are cited. The cadmium body burden in animals and humans results mainly from the diet. In the United States, the normal intake of cadmium for adult humans is estimated at about 50 ..mu..g per day. Tobacco smoke is a significant additional source of cadmium exposure. The kidneys and liver together contain about 50% of the total cadmium body burden. Acute cadmium poisoning is primarily an occupational problem, generally from inhalation of cadmium fumes or dusts. In the general population, incidents of acute poisoning by inhaled or ingested cadmium or its compounds are relatively rare. The kidney is the primary target organ for toxicity from prolonged low-level exposure to cadmium. No causal relationship has been established between cadmium exposure and human cancer, although a possible link between cadmium and prostate cancer has been indicated. Cadmium has been shown to be teratogenic in rats, hamsters, and mice, but no such effects have been proven in humans. Cadmium has been reported to increase the frequency of chromosomal aberrations in cultured Chinese hamster ovary cells and in human peripheral leukocytes. The major concern about environmental cadmium is the potential effects on the general population. There is no substantial evidence of hazard from current levels of cadmium in air, water, or food. However, because cadmium is a cumulative poison and because present intake provides a relatively small safety margin, there are adequate reasons for concern over possible future increases in background levels.

  10. Reviews of the environmental effects of pollutants: IV. Cadmium

    International Nuclear Information System (INIS)

    This report is a comprehensive, multidisciplinary review of the health and environmental effects of cadmium and specific cadmium derivatives. More than 500 references are cited. The cadmium body burden in animals and humans results mainly from the diet. In the United States, the normal intake of cadmium for adult humans is estimated at about 50 μg per day. Tobacco smoke is a significant additional source of cadmium exposure. The kidneys and liver together contain about 50% of the total cadmium body burden. Acute cadmium poisoning is primarily an occupational problem, generally from inhalation of cadmium fumes or dusts. In the general population, incidents of acute poisoning by inhaled or ingested cadmium or its compounds are relatively rare. The kidney is the primary target organ for toxicity from prolonged low-level exposure to cadmium. No causal relationship has been established between cadmium exposure and human cancer, although a possible link between cadmium and prostate cancer has been indicated. Cadmium has been shown to be teratogenic in rats, hamsters, and mice, but no such effects have been proven in humans. Cadmium has been reported to increase the frequency of chromosomal aberrations in cultured Chinese hamster ovary cells and in human peripheral leukocytes. The major concern about environmental cadmium is the potential effects on the general population. There is no substantial evidence of hazard from current levels of cadmium in air, water, or food. However, because cadmium is a cumulative poison and because present intake provides a relatively small safety margin, there are adequate reasons for concern over possible future increases in background levels

  11. Experimental and Monte Carlo study on production of 110mIn via natCd(p,xn) reaction

    International Nuclear Information System (INIS)

    110mIn with 69.1 min half-life was produced by proton bombardment on natural cadmium. The target was prepared by electroplating technique. To reach a high activity product, the optimum energy range of the irradiation was selected to be 15-5 MeV via theoretical calculation. Radiochemical separation of cadmium and indium was carried out by extraction method. It yielded 44.3 ± 8.8 GBq C-1 after 1 hour irradiation by 100 μA current. On the other hand, the production route was simulated using MCNPX and the production yield was estimated with a reasonable agreement compared to the measured and literature data. (author)

  12. Cadmium biosorption by baker’s yeast in aqueous suspension

    OpenAIRE

    Tálos Katalin; Pernyeszi Tímea; Majdik Cornelia; Hegedűsova Alzbeta; Páger Csilla

    2012-01-01

    The biosorption of cadmium from artificial aqueous solutions using native baker’s yeast was investigated. The highest metal uptake value was 110 mg g-1 in a suspension of 0.3 g L-1. The effect of pH, initial cadmium concentration, adsorption time and biosorbent dosage on biosorption by baker’s yeast was studied. The maximum biosorption capacity of cadmium by yeast was observed at pH 6.0. The adsorption equilibrium was reached within sixty minutes and the sorption process followed pseudo...

  13. Poly[[(1,10-phenanthroline{μ3-2,2′,2′′-[1,3,5-triazine-2,4,6-triyltris(sulfanediyl]triacetato}cadmium] 0.42-hydrate

    Directory of Open Access Journals (Sweden)

    Chun-Jing Chi

    2011-07-01

    Full Text Available The asymmetric unit of the title complex, {[Cd(C9H7N3O6S3(C12H8N2]·0.42H2O}n, contains a CdII atom, one doubly deprotonated 2,2′,2′′-[1,3,5-triazine-2,4,6-triyltris(sulfanediyl]triacetic acid ligand (HTTTA2−, a 1,10-phenanthroline (phen ligand and a fractionally occupied water molecule [site occupancy = 0.421 (15]. The CdII atom is six-coordinated within a distorted octahedral coordination geometry. Six coordination arises from four O atoms derived from three different HTTTA2− ligands, and two N atoms of the chelating phen molecule. The incompletely deprotonated triazine ligand adopts a μ3-η1:η1:η2 coordination mode, resulting in the formation of chains along the c axis based on Cd2O2 dimeric units. Adjacent chains are stacked through π–π stacking [3.533 (2 Å between phen and triazine rings] and C—H...O interactions, forming supramolecular sheets in the ab plane. Intra-and intermolecular O—H...O hydrogen bonds are also observed.

  14. POS 110 Course Tutorial / Snaptutorial

    OpenAIRE

    Selye

    2015-01-01

    For more classes visit www.snaptutorial.com POS 110 Exercise: Amending the Constitution POS 110 Assignment: Bureaucracy and You POS 110 Capstone CheckPoint POS 110 CheckPoint: Federal Court Structure POS 110 Assignment: Get to Know Your Member of Congress POS 110 Assignment: Civil Liberties and Civil Rights POS 110 Final Project: Democracy in America POS 110 CheckPoint: Defining Democracy POS 110 CheckPoint: American Civic Values POS 110 Week 2 Disc...

  15. POS 110 COURSE TUTORIAL/ indigohelp

    OpenAIRE

    jayadev

    2015-01-01

    For more classes visit www.indigohelp.com POS 110 Exercise: Amending the Constitution POS 110 Assignment: Bureaucracy and You POS 110 Capstone CheckPoint POS 110 CheckPoint: Federal Court Structure POS 110 Assignment: Get to Know Your Member of Congress POS 110 Assignment: Civil Liberties and Civil Rights POS 110 Final Project: Democracy in America POS 110 CheckPoint: Defining Democracy POS 110 CheckPoint: American Civic Values POS 110 Week 2 Discus...

  16. Cadmium toxicity and treatment.

    Science.gov (United States)

    Bernhoft, Robin A

    2013-01-01

    Cadmium is a heavy metal of considerable toxicity with destructive impact on most organ systems. It is widely distributed in humans, the chief sources of contamination being cigarette smoke, welding, and contaminated food and beverages. Toxic impacts are discussed and appear to be proportional to body burden of cadmium. Detoxification of cadmium with EDTA and other chelators is possible and has been shown to be therapeutically beneficial in humans and animals when done using established protocols.

  17. Cadmium Toxicity and Treatment

    Directory of Open Access Journals (Sweden)

    Robin A. Bernhoft

    2013-01-01

    Full Text Available Cadmium is a heavy metal of considerable toxicity with destructive impact on most organ systems. It is widely distributed in humans, the chief sources of contamination being cigarette smoke, welding, and contaminated food and beverages. Toxic impacts are discussed and appear to be proportional to body burden of cadmium. Detoxification of cadmium with EDTA and other chelators is possible and has been shown to be therapeutically beneficial in humans and animals when done using established protocols.

  18. Cadmium Toxicity and Treatment

    OpenAIRE

    Bernhoft, Robin A.

    2013-01-01

    Cadmium is a heavy metal of considerable toxicity with destructive impact on most organ systems. It is widely distributed in humans, the chief sources of contamination being cigarette smoke, welding, and contaminated food and beverages. Toxic impacts are discussed and appear to be proportional to body burden of cadmium. Detoxification of cadmium with EDTA and other chelators is possible and has been shown to be therapeutically beneficial in humans and animals when done using established proto...

  19. Zinc and cadmium monosalicylates

    Energy Technology Data Exchange (ETDEWEB)

    Kharitonov, Yu.Ya.; Tujebakhova, Z.K. (Moskovskij Khimiko-Tekhnologicheskij Inst. (USSR))

    1984-06-01

    Zinc and cadmium monosalicylates of the composition MSal, where M-Zn or Cd, Sal - twice deprotonated residue of salicylic acid O-HOC/sub 6/H/sub 4/COOH (H/sub 2/Sal), are singled out and characterized. When studying thermograms, thermogravigrams, IR absorption spectra, roentgenograms of cadmium salicylate compounds (Cd(OC/sub 6/H/sub 4/COO) and products of their thermal transformations, the processes of thermal decomposition of the compounds have been characterized. The process of cadmium monosalicylate decomposition takes place in one stage. Complete loss of salicylate acido group occurs in the range of 320-460 deg. At this decomposition stage cadmium oxide is formed. A supposition is made that cadmium complex has tetrahedral configuration, at that, each salicylate group plays the role of tetradentate-bridge ligand. The compound evidently has a polymer structure.

  20. Cross section measurement of alpha particle induced nuclear reactions on natural cadmium up to 52 MeV

    CERN Document Server

    Ditrói, F; Haba, H; Komori, Y; Aikawa, M

    2016-01-01

    Cross sections of alpha particle induced nuclear reactions have been measured on thin natural cadmium targets foils in the energy range from 11 to 51.2 MeV. This work was a part of our systematic study on excitation functions of light ion induced nuclear reactions on different target materials. Regarding the cross sections, the alpha induced reactions are not deeply enough investigated. Some of the produced isotopes are of medical interest, others have application in research and industry. The radioisotope $^{117m}$Sn is a very important theranostic (therapeutic + diagnostic) radioisotope, so special care was taken to the results for that isotope. The well-established stacked foil technique followed by gamma-spectrometry with HPGe gamma spectrometers were used. The target and monitor foils in the stack were commercial high purity metal foils. From the irradiated targets $^{117m}$Sn, $^{113}$Sn, $^{110}$Sn, $^{117m,g}$In, $^{116m}$In, $^{115m}$In, $^{114m}$In, $^{113m}$In, $^{111}$In, $^{110m,g}$In, $^{109m}$I...

  1. Cadmium status in Egypt

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    It is inferred from these studies that releases of Cd are still increasing and it is recommended that measures must be taken to reduce emissions of cadmium. Any cadmium discharged into the Egyptian environment may move from one compartment to another at varying rates,resulting in an accumulation in compartments such as soils and biota. Such accumulation can be expected to increase with continued emissions,and attention should be given to all sources of cadmium, natural as well as anthropogenic especially in the industrial cities in Egypt. Cadmium present in sewage, as well as industrial effluent (also, other liquid and solid wastes) and sewage sludge will increase levels in soils and is xpected to contribute to dietary levels and body burdens. The current information indicates that such effects may have to be evaluated over long periods of time, possibly as long as 50 - 100 years.

  2. Study on Systemic Separation of Palladium, Silver, Cadmium and Tin

    Institute of Scientific and Technical Information of China (English)

    YU; Zhen-hua; HUANG; Kun

    2013-01-01

    To accurately measure the yields of palladium,silver,cadmium and tin that generated from the fission of plutonium,radiochemical method is needed because there is much interference in using directγ-spectroscopy measurements.Usually,we want to get as much as possible the experiment data from one target,so it is required systemic separation of palladium,silver,cadmium and tin.Considering the

  3. Plausible Mechanisms of Cadmium Carcinogenesis

    Science.gov (United States)

    Cadmium is a transition metal and an ubiquitous environmental and industrial pollutant. Laboratory animal studies and epidemiological studies have shown that exposure to cadmium is associated with various organ toxicities and carcinogenic effects. Several national and internation...

  4. Cadmium absorption inhibitors for soil

    Energy Technology Data Exchange (ETDEWEB)

    Kitamura, S.

    1974-05-25

    Cadmium absorption by soil is one cause of soil pollution. Cadmium adsorption inhibitors were prepared by mixing alginic acid which contained brown algae (Ascophyllum nodosum) and an inorganic material, shell fossils. This mixture was highly effective in preventing cadmium absorption by the soil.

  5. Translocation of mercury and cadmium into the fruiting bodies of six higher fungi

    Energy Technology Data Exchange (ETDEWEB)

    Brunnert, H.; Zadrazil, F.

    1983-01-01

    The species- and metal-specific translocation of cadmium and mercury from the substrate to the fruiting bodies of 6 higher fungi has been investigated. The 6 species differed greatly in their ability to translocate cadmium and mercury. The highest translocation rates displayed Pleurotus flabellatus: 75.0% of the applied cadmium and 38.5% of the mercury could be recovered from the fruiting bodies. High translocation rates also found with Pleurotus ostreatus (19.3 and 38.5% for cadmium and mercury, respectively). This compares with only 1.27% of cadmium and 8.42% of mercury in Agaricus bisporus or 3.71% of cadmium and 3.63% of mercury in Pleurotus sajor caju. For Agaricus bisporus it was shown that there was proportionality of translocation over a 1:10 concentration range. In 4 out of 6 species there was a tendency towards higher heavy metal contents in later crops, when calculated on the basis of ..mu..g/g of dry fruiting body. In 4 out of 6 more mercury than cadmium was translocated into the fruiting bodies, the Cd/Hg ratios being 6.6, 2.0, 5.6, and 3.2, respectively. In Pleurotus sajor caju the ratio was about 1. Only in Pleurotus flabellatus more cadmium than mercury was found in the fruiting bodies (Cd/Hg ratio 0.65).

  6. POS 110 UOP Course Tutorial/ Tutorialrank

    OpenAIRE

    john

    2015-01-01

    For more course tutorials visit www.tutorialrank.com   POS 110 Exercise: Amending the Constitution POS 110 Assignment: Bureaucracy and You POS 110 Capstone CheckPoint POS 110 CheckPoint: Federal Court Structure POS 110 Assignment: Get to Know Your Member of Congress POS 110 Assignment: Civil Liberties and Civil Rights POS 110 Final Project: Democracy in America POS 110 CheckPoint: Defining Democracy POS 110 CheckPoint: American Civic Values ...

  7. Cadmium in Sweden - environmental risks

    Energy Technology Data Exchange (ETDEWEB)

    Parkman, H.; Iverfeldt, Aa. [Swedish Environmental Research Inst. (Sweden); Borg, H.; Lithner, G. [Stockholm Univ. (Sweden). Inst. for Applied Environmental Research

    1998-03-01

    This report aims at assessing possible effects of cadmium in the Swedish environment. Swedish soils and soft freshwater systems are, due to a generally poor buffering capacity, severely affected by acidification. In addition, the low salinity in the Baltic Sea imply a naturally poor organism structure, with some important organisms living close to their limit of physiological tolerance. Cadmium in soils is mobilized at low pH, and the availability and toxicity of cadmium in marine systems are enhanced at low salinity. The Swedish environment is therefore extra vulnerable to cadmium pollution. The average concentrations of cadmium in the forest mor layers, agricultural soils, and fresh-waters in Sweden are enhanced compared to `back-ground concentrations`, with a general increasing trend from the north to the south-west, indicating strong impact of atmospheric deposition of cadmium originating from the central parts of Europe. In Swedish sea water, total cadmium concentrations, and the fraction of bio-available `free` cadmium, generally increases with decreasing salinity. Decreased emissions of cadmium to the environment have led to decreasing atmospheric deposition during the last decade. The net accumulation of cadmium in the forest mor layer has stopped, and even started to decrease. In northern Sweden, this is due to the decreased deposition, but in southern Sweden the main reason is increased leakage of cadmium from the topsoil as a consequence of acidification. As a result, cadmium in the Swedish environments is undergoing an extended redistribution between different soil compartments, and from the soils to the aquatic systems. 90 refs, 23 figs, 2 tabs. With 3 page summary in Swedish

  8. CADMIUM – ENVIRONMENTAL HAZARD

    Directory of Open Access Journals (Sweden)

    Henryka Langauer-Lewowicka

    2010-06-01

    Full Text Available The paper presents some information about current status of cadmium as an environmental health problem. Agricultural uses of phosphate fertilizers, sewage sludge and industrial uses of Cd are the major source of widespread of this metal at trace levels into the general environment and human foodstuffs. It is well known that high cadmium (Cd exposure causes renal damage, anemia, enteropathy, osteoporosis, osteomalacia, whereas the dose-response relationship at low levels exposure is less established. During the last decade an increasing number of studies have found an adverse health effects due to low environmental exposure to Cd. Many authors try to determine the relationship between Cd intake and Cd toxicity indicators, especially dealing renal tubular damage. The level of b2-microglobulin in urine is regarded as the most sensitive biomarker of renal disfunction due to low environmental Cd concentrations.

  9. Exposure to environmental levels of waterborne cadmium impacts corticosteroidogenic and metabolic capacities, and compromises secondary stressor performance in rainbow trout

    Energy Technology Data Exchange (ETDEWEB)

    Sandhu, Navdeep [Department of Biology, University of Waterloo, Waterloo, Ontario N2L 3G1 (Canada); McGeer, James C. [Department of Biology, Wilfrid Laurier University, Waterloo, Ontario N2L 3C5 (Canada); Vijayan, Mathilakath M., E-mail: matt.vijayan@ucalgary.ca [Department of Biology, University of Waterloo, Waterloo, Ontario N2L 3G1 (Canada)

    2014-01-15

    Highlights: •Low level chronic waterborne cadmium exposure did not evoke a plasma cortisol response in rainbow trout. •Chronic cadmium exposure increases liver and gill metabolic capacities. •Chronic cadmium exposure disrupts head kidney steroidogenic capacity. •Chronic cadmium exposure disrupts glucocorticoid and mineralocorticoid receptor protein expressions in target tissues. •Chronic cadmium exposure compromises physiological performances to a secondary stressor in trout. -- Abstract: The physiological responses to waterborne cadmium exposure have been well documented; however, few studies have examined animal performances at low exposure concentrations of this metal. We tested the hypothesis that longer-term exposure to low levels of cadmium will compromise the steroidogenic and metabolic capacities, and reduce the cortisol response to a secondary stressor in fish. To test this, juvenile rainbow trout (Oncorhynchus mykiss) were exposed to 0 (control), 0.75 or 2.0 μg/L waterborne cadmium in a flow-through system and were sampled at 1, 7 and 28 d of exposure. There were only very slight disturbances in basal plasma cortisol, lactate or glucose levels in response to cadmium exposure over the 28 d period. Chronic cadmium exposure significantly affected key genes involved in corticosteroidogenesis, including melanocortin 2 receptor, steroidogenic acute regulatory protein and cytochrome P450 side chain cleavage enzyme. At 28 d, the high cadmium exposure group showed a significant drop in the glucocorticoid receptor and mineralocorticoid receptor protein expressions in the liver and brain, respectively. There were also perturbations in the metabolic capacities in the liver and gill of cadmium-exposed trout. Subjecting these fish to a secondary handling disturbance led to a significant attenuation of the stressor-induced plasma cortisol, glucose and lactate levels in the cadmium groups. Collectively, although trout appears to adjust to subchronic exposure

  10. Exposure to environmental levels of waterborne cadmium impacts corticosteroidogenic and metabolic capacities, and compromises secondary stressor performance in rainbow trout

    International Nuclear Information System (INIS)

    Highlights: •Low level chronic waterborne cadmium exposure did not evoke a plasma cortisol response in rainbow trout. •Chronic cadmium exposure increases liver and gill metabolic capacities. •Chronic cadmium exposure disrupts head kidney steroidogenic capacity. •Chronic cadmium exposure disrupts glucocorticoid and mineralocorticoid receptor protein expressions in target tissues. •Chronic cadmium exposure compromises physiological performances to a secondary stressor in trout. -- Abstract: The physiological responses to waterborne cadmium exposure have been well documented; however, few studies have examined animal performances at low exposure concentrations of this metal. We tested the hypothesis that longer-term exposure to low levels of cadmium will compromise the steroidogenic and metabolic capacities, and reduce the cortisol response to a secondary stressor in fish. To test this, juvenile rainbow trout (Oncorhynchus mykiss) were exposed to 0 (control), 0.75 or 2.0 μg/L waterborne cadmium in a flow-through system and were sampled at 1, 7 and 28 d of exposure. There were only very slight disturbances in basal plasma cortisol, lactate or glucose levels in response to cadmium exposure over the 28 d period. Chronic cadmium exposure significantly affected key genes involved in corticosteroidogenesis, including melanocortin 2 receptor, steroidogenic acute regulatory protein and cytochrome P450 side chain cleavage enzyme. At 28 d, the high cadmium exposure group showed a significant drop in the glucocorticoid receptor and mineralocorticoid receptor protein expressions in the liver and brain, respectively. There were also perturbations in the metabolic capacities in the liver and gill of cadmium-exposed trout. Subjecting these fish to a secondary handling disturbance led to a significant attenuation of the stressor-induced plasma cortisol, glucose and lactate levels in the cadmium groups. Collectively, although trout appears to adjust to subchronic exposure

  11. COMM 110 UOP Course Tutorial/ Tutorialrank

    OpenAIRE

    john

    2015-01-01

    For more course tutorials visit www.tutorialrank.com Tutorial Purchased: 3 Times, Rating: A+   COMM 110 Audience Analysis Worksheet COMM 110 Forms of Supporting Material Matrix COMM 110 Learning Team Global Warming Paper COMM 110 Learning Team Global Warming Presentation COMM 110 Learning Team Recession on Economy Paper COMM 110 Learning Team Recession on Economy Powerpoint COMM 110 Public Speech Critique- Obama Inauguration COMM 110 Public Spe...

  12. COMM 110 UOP COURSE Tutorial/UOPHELP

    OpenAIRE

    starc

    2015-01-01

    For more course tutorials visit www.uophelp.com     COMM 110 Audience Analysis Worksheet COMM 110 Forms of Supporting Material Matrix COMM 110 Learning Team Global Warming Paper COMM 110 Learning Team Global Warming Presentation COMM 110 Learning Team Recession on Economy Paper COMM 110 Learning Team Recession on Economy Powerpoint COMM 110 Public Speech Critique- Obama Inauguration COMM 110 Public Speech Paper -Steve Jobs

  13. COMM 110 UOP Course/ uophelp.com

    OpenAIRE

    royal1

    2015-01-01

    For more course tutorials visit www.uophelp.com     COMM 110 Audience Analysis Worksheet COMM 110 Forms of Supporting Material Matrix COMM 110 Learning Team Global Warming Paper COMM 110 Learning Team Global Warming Presentation COMM 110 Learning Team Recession on Economy Paper COMM 110 Learning Team Recession on Economy Powerpoint COMM 110 Public Speech Critique- Obama Inauguration COMM 110 Public Speech Paper -Steve Jobs  

  14. COMM 110 uop course tutorial/tutorialoutlet

    OpenAIRE

    naresh 1

    2015-01-01

    For more course tutorials visit www.tutorialoutlet.com   COMM 110 Audience Analysis Worksheet COMM 110 Forms of Supporting Material Matrix COMM 110 Learning Team Global Warming Paper COMM 110 Learning Team Global Warming Presentation COMM 110 Learning Team Recession on Economy Paper COMM 110 Learning Team Recession on Economy Powerpoint COMM 110 Public Speech Critique- Obama Inauguration COMM 110 Public Speech Paper -Steve Jobs  

  15. Cadmium in blood and hypertension

    Energy Technology Data Exchange (ETDEWEB)

    Eum, Ki-Do; Lee, Mi-Sun [Department of Environmental Health, Graduate School of Public Health and Institute of Health and Environment, Seoul National University, Seoul (Korea, Republic of); Paek, Domyung [Department of Environmental Health, Graduate School of Public Health and Institute of Health and Environment, Seoul National University, Seoul (Korea, Republic of)], E-mail: paekdm@snu.ac.kr

    2008-12-15

    Objectives:: This study is to examine the effect of cadmium exposure on blood pressure in Korean general population. Methods:: The study population consisted of 958 men and 944 women who participated in the 2005 Korean National Health and Nutrition Examination Survey (KNHANES), in which blood pressure and blood cadmium were measured from each participant. Results:: The mean blood cadmium level was 1.67 {mu}g/L (median level 1.55). The prevalence of hypertension was 26.2%. The blood cadmium level was significantly higher among those subjects with hypertension than those without (mean level 1.77 versus 1.64 {mu}g/dL). After adjusting for covariates, the odds ratio of hypertension comparing the highest to the lowest tertile of cadmium in blood was 1.51 (95% confidence interval 1.13 to 2.05), and a dose-response relationship was observed. Systolic, diastolic, and mean arterial blood pressure were all positively associated with blood cadmium level, and this effect of cadmium on blood pressure was markedly stronger when the kidney function was reduced. Conclusions:: Cadmium exposures at the current level may have increased the blood pressure of Korean general population.

  16. Projectbeschrijving Cadmium-informatiepunt (CIP)

    NARCIS (Netherlands)

    Meijer PJ

    1989-01-01

    To minimize the use of cadmium the Central Government has decided to perform the purchase of products and materials within the Central Government as much as possible within the Draft Cadmium Decree. The activities to achieve this are as far as could be seen at the start of the project in june 19

  17. Projectbeschrijving Cadmium-informatiepunt (CIP)

    OpenAIRE

    Meijer PJ

    1989-01-01

    To minimize the use of cadmium the Central Government has decided to perform the purchase of products and materials within the Central Government as much as possible within the Draft Cadmium Decree. The activities to achieve this are as far as could be seen at the start of the project in june 1989, mentioned in this report.

  18. 29 CFR 1926.1127 - Cadmium.

    Science.gov (United States)

    2010-07-01

    ... containment of cadmium or materials containing cadmium on the site or location at which construction...) SAFETY AND HEALTH REGULATIONS FOR CONSTRUCTION Toxic and Hazardous Substances § 1926.1127 Cadmium. (a... forms, in all construction work where an employee may potentially be exposed to cadmium....

  19. Cadmium exposure in the Swedish environment

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-03-01

    This report gives a thorough description of cadmium in the Swedish environment. It comprises three parts: Cadmium in Sweden - environmental risks;, Cadmium in goods - contribution to environmental exposure;, and Cadmium in fertilizers, soil, crops and foods - the Swedish situation. Separate abstracts have been prepared for all three parts

  20. 有机二磺酸镉配合物%Organic-Disulfonate Ligand Cadmium(Ⅱ) Coordination Compound

    Institute of Scientific and Technical Information of China (English)

    谢永荣; 叶琼

    2005-01-01

    The crystal structure of [Cd(DBDA)(phen)2(H2O)](H2O)2 (1) (DBDA=2,2'-dimethoxy-1,1'-binaphthylene6,6'-disulfonate, phen=1,10-phenanthroline) composes of a cadmium center which is surrounded by four nitrogenatoms from 1,10-phenathroline as well as two oxygen atoms from water and sulfonate group of DBDA that also participates in H-bonding interactions to form 3D network. CCDC: 277920.

  1. Cadmium in newborns

    OpenAIRE

    Eklund, Gunilla

    2003-01-01

    Cadmium (Cd) is a well-known nephrotoxic environmental contaminant but there are indications that the developing nervous system might be even more sensitive to Cd than the kidneys in adults. Infants are exposed to Cd from various formulas and infant diets and the gastrointestinal Cd uptake is believed to be higher in newborns than in adults. Cd levels monitored in infant foods ranged between 0.74 and 27.0 µg/kg. Cow's milk formulas had the lowest levels and cereal-based formulas had up to 21 ...

  2. X-ray computed tomography system utilizing a cadmium telluride detector

    OpenAIRE

    佐藤, 英一; 野宮, 聖一郎; 人見, 啓太朗; 尾鍋, 秀明; 河合, 敏明; 小川, 彰; 佐藤, 成大; 市丸, 俊夫; サトウ, エイイチ; ノミヤ, セイイチロウ; ヒトミ, ケイタロウ; オナベ, ヒデアキ; カワイ, トシアキ; オガワ, アキラ; サトウ, シゲヒロ

    2007-01-01

    A simple x-ray computed tomography(CT) system utilizing a cadmium telluride detector is described. The CT system is of the first generation type and consists of an x-ray generator, a turn table, a translation table, a motor drive unit, a cadmium telluride detector, an interface unit for the detector, and a personal computer(PC). Tomography was performed by the repetition of the translation and rotation of an object. The maximum values of the tube voltage and the tube current were 110kV and 2....

  3. Temperature anomalies of optical properties in cadmium diphosphide crystal

    International Nuclear Information System (INIS)

    The temperature dependence of refractive indices of ordinary and extraordinary rays (no, ne) in the temperature region 20-110 degrees Celsius for different directions in cadmium diphosphide crystal are presented in the given work. It is obtained that no and n increase with temperature growth. It is shown the thermo optical coefficient for ne depends on direction of laser beam relatively optical axis of the crystal and for no it doesn't depend. Several anomalies in the form of steps and bends are revealed on the curves of the temperature dependence of refractive indices. The detected features are connected with the transitions between commensurate and incommensurate phases. (authors)

  4. Burnup of Cadmium Decoupler Material in the Spallation Neutron Source Moderators

    Energy Technology Data Exchange (ETDEWEB)

    Murphy, BD

    2001-08-21

    At the Spallation Neutron Source being constructed at Oak Ridge National Laboratory, power levels will be greater than at any other operating pulsed spallation neutron scattering facility. Some of the moderators at the facility will contain cadmium that will be used to tailor neutron time distributions by absorbing low-energy neutrons. Because of the higher operating power levels, indications are that there will be considerable burnup of this cadmium during the lifetime of the moderators. Cadmium burnup rates have been calculated for locations around the moderators. Assumed operating conditions for these calculations were a 2-mA beam of 1-GeV protons on the mercury target for 5,000 operating hours per year and a three-year lifetime for the moderators and inner-plug assembly. With the present proposed cadmium thickness in the moderator region (0.05 cm), Monte Carlo calculations indicate considerable depletion of the active cadmium isotope. In places, the calculations indicate complete depletion. An obvious solution to the problem would be to increase the cadmium thickness with a concomitant increase in heat load. Results from some cadmium heating calculations are also presented for a cadmium thickness of 0.05 cm.

  5. RNA-Seq identifies key reproductive gene expression alterations in response to cadmium exposure.

    Science.gov (United States)

    Hu, Hanyang; Lu, Xing; Cen, Xiang; Chen, Xiaohua; Li, Feng; Zhong, Shan

    2014-01-01

    Cadmium is a common toxicant that is detrimental to many tissues. Although a number of transcriptional signatures have been revealed in different tissues after cadmium treatment, the genes involved in the cadmium caused male reproductive toxicity, and the underlying molecular mechanism remains unclear. Here we observed that the mice treated with different amount of cadmium in their rodent chow for six months exhibited reduced serum testosterone. We then performed RNA-seq to comprehensively investigate the mice testicular transcriptome to further elucidate the mechanism. Our results showed that hundreds of genes expression altered significantly in response to cadmium treatment. In particular, we found several transcriptional signatures closely related to the biological processes of regulation of hormone, gamete generation, and sexual reproduction, respectively. The expression of several testosterone synthetic key enzyme genes, such as Star, Cyp11a1, and Cyp17a1, were inhibited by the cadmium exposure. For better understanding of the cadmium-mediated transcriptional regulatory mechanism of the genes, we computationally analyzed the transcription factors binding sites and the mircoRNAs targets of the differentially expressed genes. Our findings suggest that the reproductive toxicity by cadmium exposure is implicated in multiple layers of deregulation of several biological processes and transcriptional regulation in mice. PMID:24982889

  6. RNA-Seq Identifies Key Reproductive Gene Expression Alterations in Response to Cadmium Exposure

    Directory of Open Access Journals (Sweden)

    Hanyang Hu

    2014-01-01

    Full Text Available Cadmium is a common toxicant that is detrimental to many tissues. Although a number of transcriptional signatures have been revealed in different tissues after cadmium treatment, the genes involved in the cadmium caused male reproductive toxicity, and the underlying molecular mechanism remains unclear. Here we observed that the mice treated with different amount of cadmium in their rodent chow for six months exhibited reduced serum testosterone. We then performed RNA-seq to comprehensively investigate the mice testicular transcriptome to further elucidate the mechanism. Our results showed that hundreds of genes expression altered significantly in response to cadmium treatment. In particular, we found several transcriptional signatures closely related to the biological processes of regulation of hormone, gamete generation, and sexual reproduction, respectively. The expression of several testosterone synthetic key enzyme genes, such as Star, Cyp11a1, and Cyp17a1, were inhibited by the cadmium exposure. For better understanding of the cadmium-mediated transcriptional regulatory mechanism of the genes, we computationally analyzed the transcription factors binding sites and the mircoRNAs targets of the differentially expressed genes. Our findings suggest that the reproductive toxicity by cadmium exposure is implicated in multiple layers of deregulation of several biological processes and transcriptional regulation in mice.

  7. Cadmium immobilization by hydroxyapatite

    Directory of Open Access Journals (Sweden)

    Smičiklas Ivana D.

    2003-01-01

    Full Text Available The contamination of air, soil and water by cadmium is a great environmental problem. If cadmium occurs in nature in ionic form, soluble in water, it easily enters into the food chain. Hydroxyapatite (HAP, Ca-o(POAe(OH2 is a sparingly soluble salt and an excellent matrix for the removal of heavy metals from solutions. Considerable research attention has been paid to the bond between Cc/2+ ions and synthetic hydroxyapatite of known composition. The sorption mechanism is complex. The dominant process is ion exchange, but surface adsorption, surface complexation and coprecipitation can also contribute to the overall mechanism. The sorption capacity depends on the characteristics of hydroxyapatite itself and on the experimental conditions. Under optimum conditions a maximum capacity of 0.8 mol Cd2+/mol HAP can be achieved. HAP is a potential sorbent for the remediation of contaminated water and soil, for industrial waste treatment, and it is also referenced as a material that can be used as a barrier around waste depositories.

  8. Dietary cadmium intake and the risk of cancer: a meta-analysis.

    Directory of Open Access Journals (Sweden)

    Young Ae Cho

    Full Text Available BACKGROUND: Diet is a major source of cadmium intake among the non-smoking general population. Recent studies have determined that cadmium exposure may produce adverse health effects at lower exposure levels than previously predicted. We conducted a meta-analysis to combine and analyze the results of previous studies that have investigated the association of dietary cadmium intake and cancer risk. METHODS: We searched PubMed, EMBASE, and MEDLINE database for case-control and cohort studies that assessed the association of dietary cadmium intake and cancer risk. We performed a meta-analysis using eight eligible studies to summarize the data and summary relative risks (RRs and 95% confidence intervals (CIs were calculated using a random effects model. RESULTS: Overall, dietary cadmium intake showed no statistically significant association with cancer risk (RR = 1.10; 95% CI: 0.99-1.22, for highest vs. lowest dietary cadmium group. However, there was strong evidence of heterogeneity, and subgroup analyses were conducted using the study design, geographical location, and cancer type. In subgroup analyses, the positive associations between dietary cadmium intake and cancer risk were observed among studies with Western populations (RR = 1.15; 95% CI: 1.08-1.23 and studies investigating some hormone-related cancers (prostate, breast, and endometrial cancers. CONCLUSION: Our analysis found a positive association between dietary cadmium intake and cancer risk among studies conducted in Western countries, particularly with hormone-related cancers. Additional experimental and epidemiological studies are required to verify our findings.

  9. Cadmium(2) complexes of cytosine

    International Nuclear Information System (INIS)

    Complexes of cadmium(2) with cytosine obtained from aqueous or physiological solutions at room temperature are reported. The complexes were characterized by spectroscopic, conductometric, 1H-NMR, and 13C-NMR measurements and also by thermogravimetry. (Authors)

  10. Discovery of the Cadmium Isotopes

    OpenAIRE

    Amos, S.; Thoennessen, M

    2009-01-01

    Thirty-seven cadmium isotopes have so far been observed; the discovery of these isotopes is discussed. For each isotope a brief summary of the first refereed publication, including the production and identification method, is presented.

  11. 110x110 optical mode transfer matrix inversion.

    Science.gov (United States)

    Carpenter, Joel; Eggleton, Benjamin J; Schröder, Jochen

    2014-01-13

    The largest complete mode transfer matrix of a fiber is measured consisting of 110 spatial and polarization modes. This matrix is then inverted and the pattern required to produce a desired output at the receiver are launched at the transmitter.

  12. Cadmium telluride nuclear radiation detectors

    International Nuclear Information System (INIS)

    The characteristics and performance of undoped high resistivity cadmium telluride detectors are compared to chlorine lifted counters. It is shown, in particular, that Undodep CdTe is in fact aluminium doped and that compensation occurs, as an silicon or germanium, by pair and triplet formation between the group III donor and the doubly charged cadmium vacancy acceptor. Furthermore, in chlorine doped samples, the polarization effect results from the unpaired level at Esub(c)-0,6eV

  13. Speciation of Dissolved Cadmium

    DEFF Research Database (Denmark)

    Holm, Peter Engelund; Andersen, Sjur; Christensen, Thomas Højlund

    1995-01-01

    ) method separates dissolved Cd into free divalent Cd (Cd 2+) and complexed Cd and furthermore separates the latter into the operationally defined forms: labile, slowly labile and stable complexes. The dialysis (ED) method determines high molecular weight Cd complexes (above 1000mol. wt). For both methods...... the reproducibility was good. By combining the results of the GEOCHEM calculations in terms of the inorganic complexes, and the IE results, the fractions of free and inorganically complexed Cd were estimated. The IE and ED results furthermore provided information about the organic complexes. Selected environmental......Equilibrium dialysis and ion exchange methods, as well as computer calculations (GEOCHEM), were applied for speciation of dissolved cadmium (Cd) in test solutions and leachate samples. The leachate samples originated from soil, compost, landfill waste and industrial waste. The ion exchange (IE...

  14. Studies on the Interaction of Dinitratobis(phen) Cadmium Complex with DNA

    Institute of Scientific and Technical Information of China (English)

    YUAN,Cai-Xia; WU,Yan-Bo; WEI,Yi-Bin; YANG,Pin; ZHU,Miao-Li

    2007-01-01

    DNA-binding properties of the dinitratobis(phen) cadmium complex [Cd(phen)2(NO3)2] (where phen =1,10-phenanthroline) have been investigated with absorption titration, fluorescence spectroscopy, viscosity measurement, molecular modeling and density functional theory (DFT) calculations. The results indictate DNA-binding mode of the complex to be weak groove binding rather than partial intercalative interaction expected of the extended planar aromatic phen ring. In addition, the DNA cleavage study was carried out by gel electrophoresis experiment. The results showed that the complex both hardly cleaves pBR322 DNA in the absence and present ascorbate. So it is suggested that the formation of cadmium complex can decrease cadmium toxicity to some extents.

  15. Histological changes, apoptosis and metallothionein levels in Triturus carnifex (Amphibia, Urodela) exposed to environmental cadmium concentrations.

    Science.gov (United States)

    Capaldo, Anna; Gay, Flaminia; Scudiero, Rosaria; Trinchella, Francesca; Caputo, Ivana; Lepretti, Marilena; Marabotti, Anna; Esposito, Carla; Laforgia, Vincenza

    2016-04-01

    The aim of this study was to verify if the freshwater safety values established from the European Community (1998) and the Italian Ministry of Health (2001) for cadmium (44.5nM/L in drinking water and 178nM/L in sewage waters) were safe for amphibians, since at these same concentrations cadmium induced endocrine disruption in the newt Triturus carnifex. Adult male specimens of T. carnifex were exposed daily to cadmium (44.5nM/L and 178nM/L as CdCl2, nominal concentrations), respectively, during 3- and 9-months; at the same time, control newts were exposed to tap water only. The accumulation of cadmium in the skin, liver and kidney, the levels of metallothioneins in the skin and the liver, the expression of metallothionein mRNA in the liver, as well as the presence of histological alterations and of apoptosis in the target organs were evaluated. The 9-months exposure induced cadmium accumulation in all the tissues examined; moreover, histological changes were observed in all the tissues examined, irrespective of the dose or the time of exposure. Apoptosis was only detected in the kidney, whereas metallothioneins and metallothionein mRNA did not increase. This study demonstrates that the existing chronic water quality criterion established for cadmium induces in the newt T. carnifex cadmium accumulation and histological alterations in the target organs examined. Together with our previous results, showing that, at these same concentrations, cadmium induced endocrine disruption, the present results suggest that the existing chronic water quality criterion for cadmium appears to be not protective of amphibians.

  16. Histological changes, apoptosis and metallothionein levels in Triturus carnifex (Amphibia, Urodela) exposed to environmental cadmium concentrations.

    Science.gov (United States)

    Capaldo, Anna; Gay, Flaminia; Scudiero, Rosaria; Trinchella, Francesca; Caputo, Ivana; Lepretti, Marilena; Marabotti, Anna; Esposito, Carla; Laforgia, Vincenza

    2016-04-01

    The aim of this study was to verify if the freshwater safety values established from the European Community (1998) and the Italian Ministry of Health (2001) for cadmium (44.5nM/L in drinking water and 178nM/L in sewage waters) were safe for amphibians, since at these same concentrations cadmium induced endocrine disruption in the newt Triturus carnifex. Adult male specimens of T. carnifex were exposed daily to cadmium (44.5nM/L and 178nM/L as CdCl2, nominal concentrations), respectively, during 3- and 9-months; at the same time, control newts were exposed to tap water only. The accumulation of cadmium in the skin, liver and kidney, the levels of metallothioneins in the skin and the liver, the expression of metallothionein mRNA in the liver, as well as the presence of histological alterations and of apoptosis in the target organs were evaluated. The 9-months exposure induced cadmium accumulation in all the tissues examined; moreover, histological changes were observed in all the tissues examined, irrespective of the dose or the time of exposure. Apoptosis was only detected in the kidney, whereas metallothioneins and metallothionein mRNA did not increase. This study demonstrates that the existing chronic water quality criterion established for cadmium induces in the newt T. carnifex cadmium accumulation and histological alterations in the target organs examined. Together with our previous results, showing that, at these same concentrations, cadmium induced endocrine disruption, the present results suggest that the existing chronic water quality criterion for cadmium appears to be not protective of amphibians. PMID:26851569

  17. Zinc-induced protection against cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Early, J.L.; Schnell, R.C.

    1978-02-01

    Pretreatment of male rats with cadmium acetate potentiates the duration of hexobarbital hypnosis and inhibits the rate of hepatic microsomal drug metabolism. Pretreatment of rats with zinc acetate protects against these alterations in drug action elicited by cadmium.

  18. Bioavailability of cadmium from linseed and cocoa

    DEFF Research Database (Denmark)

    Hansen, Max; Sloth, Jens Jørgen; Rasmussen, Rie Romme

    In Denmark and EU the exposure of cadmium from food is at a level that is relatively close to the Tolerable Daily Intake (TDI). This report describes an investigation of the bioavailability of cadmium in selected food items known to contain high levels of cadmium. The purpose was to provide data ...... or crushed linseed nor the intake of cocoa and chocolate....

  19. Mechanisms of cadmium carcinogenesis

    International Nuclear Information System (INIS)

    Cadmium (Cd), a heavy metal of considerable occupational and environmental concern, has been classified as a human carcinogen by the International Agency for Research on Cancer (IARC). The carcinogenic potential of Cd as well as the mechanisms underlying carcinogenesis following exposure to Cd has been studied using in vitro cell culture and in vivo animal models. Exposure of cells to Cd results in their transformation. Administration of Cd in animals results in tumors of multiple organs/tissues. Also, a causal relationship has been noticed between exposure to Cd and the incidence of lung cancer in human. It has been demonstrated that Cd induces cancer by multiple mechanisms and the most important among them are aberrant gene expression, inhibition of DNA damage repair, induction of oxidative stress, and inhibition of apoptosis. The available evidence indicates that, perhaps, oxidative stress plays a central role in Cd carcinogenesis because of its involvement in Cd-induced aberrant gene expression, inhibition of DNA damage repair, and apoptosis.

  20. Oral cadmium chloride intoxication in mice

    DEFF Research Database (Denmark)

    Andersen, O; Nielsen, J B; Svendsen, P

    1988-01-01

    Diethyldithiocarbamate (DDC) is known to alleviate acute toxicity due to injection of cadmium salts. However, when cadmium chloride was administered by the oral route, DDC enhanced rather than alleviated the acute toxicity; both oral and intraperitoneal (i.p.) administration of DDC had this effect....... Thus, orally administered DDC enhanced cadmium-induced duodenal and ileal tissue damage and inhibition of peristalsis, as indicated by an increased intestinal transit time. At low cadmium doses, the whole-body retention of cadmium was increased by oral DDC administration. Intraperitoneally administered...

  1. Arsenic-cadmium interaction in rats.

    Science.gov (United States)

    Díaz-Barriga, F; Llamas, E; Mejía, J J; Carrizales, L; Santoyo, M E; Vega-Vega, L; Yáñez, L

    1990-11-01

    Simultaneous exposure to cadmium and arsenic is highly probable in the urban area of San Luis Potosi, Mexico due to common localization of copper and zinc smelters. Therefore, in this work, rats were intraperitoneally exposed either to cadmium or arsenic alone, or simultaneously to both metals. The effects of these treatments on three different toxicological parameters were studied. Cadmium modified the LD50 of arsenic and conversely arsenic modified the LD50 for cadmium. At the histopathological level, arsenic appeared to protect against the cadmium effects, especially on testes. This protective effect seemed to be related to the glutathione levels found in this tissue: rats exposed to both arsenic and cadmium, presented glutathione values intermediate to those observed after exposure to either metal alone; arsenic had the highest value and cadmium the lowest. In liver, rats exposed to arsenic, cadmium or arsenic and cadmium, presented glutathione values below those in the saline group, with the lowest value corresponding to the arsenic and cadmium treatment. The results appear to support the proposed interaction between arsenic and cadmium and coexposure to both metals seems to alter certain effects produced by either metal alone. PMID:2219140

  2. Determination of cadmium in biological samples.

    Science.gov (United States)

    Klotz, Katrin; Weistenhöfer, Wobbeke; Drexler, Hans

    2013-01-01

    Analyses of cadmium concentrations in biological material are performed using inductively coupled plasma mass spectrometry (ICP-MS) and atomic absorption spectrometry (AAS), but also electrochemical methods, neutron activation analysis (NAA), and X-ray fluorescence spectrometry (XRF). The predominant sample matrices include blood, plasma, serum, and urine, as well as hair, saliva, and tissue of kidney cortex, lung, and liver. While cadmium in blood reveals rather the recent exposure situation, cadmium in urine reflects the body burden and is an indicator for the cumulative long term exposure.After chronic exposure, cadmium accumulates in the human body and causes kidney diseases, especially lesions of proximal tubular cells. A tubular proteinuria causes an increase in urinary excretion of microproteins. Excretions of retinol binding protein (RBP), β2-microglobulin (β2-M), and α1-microglobulin are validated biomarkers for analyzing cadmium effects. For this purpose, immunological procedures such as ELISA, and radio- and latex-immunoassays are used.However, proteinuria is not specific to cadmium, but can also occur after exposure to other nephrotoxic agents or due to various kidney diseases. In summary, cadmium in urine and blood are the most specific biomarkers of cadmium exposure. A combination of parameters of exposure (cadmium in blood, cadmium in urine) and parameters of effect (e.g., β2-M, RBP) is required to reveal cadmium-induced nephrological effects. PMID:23430771

  3. Insulin Expression in Rats Exposed to Cadmium

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Objectives To investigate the effects of cadmium exposure on insulin expression in rats. Methods Eighteen adult SD assessed. The levels of cadmium and zinc in pancreas, blood and urine glucose, serum insulin and urine NAG (N-acyetyl-β-glucosaminidase) were determined. The gene expressions of metallothionein (MT) and insulin were also measured,and the oral glucose tolerance tests (OGTT) were carried out. Results The contents of cadmium in pancreas in cadmium-treated rats were higher than that in the control group, which was associated with slight increase of zinc in pancreas.not change significantly after cadmium administration, and the UNAG had no change in Cd-treated group. The gene expression the change of the expression of insulin, MT-Ⅰ and MT-Ⅱ genes. Cadmium can influence the biosynthesis of insulin, but does not induce the release of insulin. The dysfunction of pancreas occurs earlier than that of kidney after administration of cadmium.

  4. Measurements and model calculations of the 110Cd(n,#betta#)/sup 111m/Cd cross section

    International Nuclear Information System (INIS)

    The cross section for the 110Cd(n,#betta#)/sup 111m/Cd reaction has been measured in the energy 0.14 to 1.5 MeV by means of activation. Both natural cadmium and 110Cd- and 111Cd-enriched samples were used in the measurements in order to distinguish the capture activation reaction from the 111Cd(n,n')/sup 111m/Cd reaction, which becomes involved due to the presence of 111Cd in the samples. Optical, statistical and gamma-ray cascade model calculations were performed in order to explain the energy dependence of the capture activation cross section

  5. PBXN-110 Burn Rate Estimate

    Energy Technology Data Exchange (ETDEWEB)

    Glascoe, E

    2008-08-11

    It is estimated that PBXN-110 will burn laminarly with a burn function of B = (0.6-1.3)*P{sup 1.0} (B is the burn rate in mm/s and P is pressure in MPa). This paper provides a brief discussion of how this burn behavior was estimated.

  6. The ferromagnetic monolayer Fe(110) on W(110)

    International Nuclear Information System (INIS)

    Ferromagnetic order in the pseudomorphic monolayer Fe(110) on W(110) was analyzed experimentally using Conversion Electron Moessbauer Spectroscopy (CEMS) and Torsion Oscillation Magnetometry (TOM). The monolayer is thermodynamically stable, crystallizes to large monolayer patches at elevated temperatures and therefore forms an excellent approximation to the ideal monolayer structure. It is ferromagnetic below a Curie-temperature Tcsub(,mono,) which is given by (282±3) K for the Ag-coated layer, (290±10) K for coating by Cu, Ag or Au and ≅ 210 K for the free monolayer. For the Ag-coated monolayer, ground state hyperfine field Bhf(0) = (11.9±0.3) T and magnetic moment per atom μ=2.53 μB could be determined, in fair agreement with theoretical predictions. Unusual properties of the phase transition are detected by the combination of both experimental techniques. Strong magnetic anisotropies, which are essential for ferromagnetic order, are determined by CEMS. (orig.)

  7. Cadmium detoxification processes in the digestive gland of cephalopods in relation to accumulated cadmium concentrations

    OpenAIRE

    Bustamante, Paco; Cosson, Richard; Gallien, Isabelle; Caurant, Florence; Miramand, Pierre

    2002-01-01

    International audience The high concentrations of cadmium recorded in the digestive gland of cephalopods from various temperate and subpolar waters suggest that these molluscs have developed efficient cadmium detoxification mechanisms. The subcellular distribution of cadmium in the digestive gland cells was investigated in seven cephalopod species from the Bay of Biscay (France) and the Faroe Islands. In most species, cadmium was mainly found in the cytosolic fraction of the digestive glan...

  8. Cadmium content of plants as affected by soil cadmium concentration

    Energy Technology Data Exchange (ETDEWEB)

    Lehoczky, E. [Pannon Univ. of Agricultural Sciences, Keszthely (Hungary); Szabados, I.; Marth, P. [Plant Health and Soil Conservation Station, Higany (Hungary)

    1996-12-31

    Pot experiments were conducted in greenhouse conditions to study the effects of increasing cadmium (Cd) levels on biomass production and Cd contents in corn, (Zea mays L.), garlic (Allium sativum L.), and spinach (Spinacia oleracea L.). Plants were grown in two soil types: Eutric cambisol soil and A gleyic luvisol soil. Spinach proved to be the most sensitive to Cd treatments as its biomass considerably decreased with the increasing Cd levels. Cadmium contents of the three crops increased with increasing levels of Cd applications. Statistical differences were observed in the Cd contents of crops depending on soil type. With the same Cd rates, Cd tissue concentration of test plants grown in the strongly acidic Gleyic luvisol soil were many times higher than that of plants grown in a neutral Eutric cambisol soil. 14 refs., 4 tabs.

  9. Cadmium Exposure and Pancreatic Cancer in South Louisiana

    OpenAIRE

    Luckett, Brian G.; L. Joseph Su; Rood, Jennifer C.; Elizabeth T. H. Fontham

    2012-01-01

    Cadmium has been hypothesized to be a pancreatic carcinogen. We test the hypothesis that cadmium exposure is a risk factor for pancreatic cancer with a population-based case-control study sampled from a population with persistently high rates of pancreatic cancer (south Louisiana). We tested potential dietary and nondietary sources of cadmium for their association with urinary cadmium concentrations which reflect long-term exposure to cadmium due to the accumulation of cadmium in the kidney c...

  10. Studies of 3He Induced Nuclear Reactions on Cadmium

    International Nuclear Information System (INIS)

    Excitation functions of 3He induced nuclear reactions on natural cadmium were measured using the standard stacked foil technique and high resolution gamma ray spectroscopy. The experimental cross sections for the nuclear reactions natCd(3He,xnp )117m,g,116m115m,114m,113m,111,110m,g,109,108,107 In were measured from their threshold energy up to 27 MeV. The integral yields for some medically important products were determined. Theoretical calculations using the nuclear codes ALICE- IPPE, TAL YS, and EMPIRE-3 were used to describe the formation of these products. Theoretical and experimental results were compared with each other. K

  11. 49 CFR 110.80 - Procurement.

    Science.gov (United States)

    2010-10-01

    ... CFR 18.36. ... 49 Transportation 2 2010-10-01 2010-10-01 false Procurement. 110.80 Section 110.80 Transportation..., DEPARTMENT OF TRANSPORTATION HAZARDOUS MATERIALS AND OIL TRANSPORTATION HAZARDOUS MATERIALS PUBLIC...

  12. Zone refining of cadmium and related characterization

    Indian Academy of Sciences (India)

    N R Munirathnam; D S Prasad; Ch Sudheer; J V Rao; T L Prakash

    2005-06-01

    We present the zone refining results of cadmium using horizontal resistive zone refiner under constant flow of moisture free hydrogen gas. The boron impurity in cadmium can be avoided using quartz (GE 214 grade) boat in lieu of high pure graphite boat. The analytical results using inductively coupled plasma optical emission spectrometry (ICPOES) show that majority of the impurities are less than the detection limits. Comparatively, zinc is the most difficult impurity element to remove in cadmium matrix by zone refining.

  13. Electrodialytic Removal of Cadmium from Straw Ash

    DEFF Research Database (Denmark)

    Hansen, Henrik; Ottosen, Lisbeth M.; Villumsen, Arne;

    1999-01-01

    A problem with flyash from straw and wood combustion is the high level of heavy metals, especially cadmium. Two electrodialytic remediation experiments were carried out on cadmium polluted flyash from straw combustion. The flyash could be cleaned to 1/3 of its initial level after 24 days...... of remediation. Further removal of cadmium could be possible with longer remediation time or a higher current density...

  14. Cadmium induces carcinogenesis in BEAS-2B cells through ROS-dependent activation of PI3K/AKT/GSK-3β/β-catenin signaling

    Energy Technology Data Exchange (ETDEWEB)

    Son, Young-Ok; Wang, Lei; Poyil, Pratheeshkumar; Budhraja, Amit; Hitron, J. Andrew; Zhang, Zhuo [Graduate Center for Toxicology, College of Medicine, University of Kentucky, Lexington, KY (United States); Lee, Jeong-Chae [Graduate Center for Toxicology, College of Medicine, University of Kentucky, Lexington, KY (United States); School of Dentistry and Institute of Oral Biosciences (BK21 program), Research Center of Bioactive Materials, Chonbuk National University, Jeonju 561-756 (Korea, Republic of); Shi, Xianglin, E-mail: xshi5@email.uky.edu [Graduate Center for Toxicology, College of Medicine, University of Kentucky, Lexington, KY (United States)

    2012-10-15

    -dependent signaling as potential therapeutic targets in cadmium carcinogenesis.

  15. Cadmium induces carcinogenesis in BEAS-2B cells through ROS-dependent activation of PI3K/AKT/GSK-3β/β-catenin signaling

    International Nuclear Information System (INIS)

    -dependent signaling as potential therapeutic targets in cadmium carcinogenesis.

  16. Fractionation of Stable Cadmium Isotopes in the Cadmium Tolerant Ricinus communis and Hyperaccumulator Solanum nigrum

    Science.gov (United States)

    Wei, Rongfei; Guo, Qingjun; Wen, Hanjie; Liu, Congqiang; Yang, Junxing; Peters, Marc; Hu, Jian; Zhu, Guangxu; Zhang, Hanzhi; Tian, Liyan; Han, Xiaokun; Ma, Jie; Zhu, Chuanwei; Wan, Yingxin

    2016-01-01

    Cadmium (Cd) isotopes provide new insights into Cd uptake, transport and storage mechanisms in plants. Therefore, the present study adopted the Cd-tolerant Ricinus communis and Cd-hyperaccumulator Solanum nigrum, which were cultured under controlled conditions in a nutrient solution with variable Cd supply, to test the isotopic fractionation of Cd during plant uptake. The Cd isotope compositions of nutrient solutions and organs of the plants were measured by multiple collector inductively coupled plasma mass spectrometry (MC-ICPMS). The mass balance of Cd isotope yields isotope fractionations between plant and Cd source (δ114/110Cdorgans-solution) of −0.70‰ to −0.22‰ in Ricinus communis and −0.51‰ to −0.33‰ in Solanum nigrum. Moreover, Cd isotope fractionation during Cd transport from stem to leaf differs between the Cd-tolerant and -hyperaccumulator species. Based on these results, the processes (diffusion, adsorption, uptake or complexation), which may induce Cd isotope fractionation in plants, have been discussed. Overall, the present study indicates potential applications of Cd isotopes for investigating plant physiology. PMID:27076359

  17. Fractionation of Stable Cadmium Isotopes in the Cadmium Tolerant Ricinus communis and Hyperaccumulator Solanum nigrum

    Science.gov (United States)

    Wei, Rongfei; Guo, Qingjun; Wen, Hanjie; Liu, Congqiang; Yang, Junxing; Peters, Marc; Hu, Jian; Zhu, Guangxu; Zhang, Hanzhi; Tian, Liyan; Han, Xiaokun; Ma, Jie; Zhu, Chuanwei; Wan, Yingxin

    2016-04-01

    Cadmium (Cd) isotopes provide new insights into Cd uptake, transport and storage mechanisms in plants. Therefore, the present study adopted the Cd-tolerant Ricinus communis and Cd-hyperaccumulator Solanum nigrum, which were cultured under controlled conditions in a nutrient solution with variable Cd supply, to test the isotopic fractionation of Cd during plant uptake. The Cd isotope compositions of nutrient solutions and organs of the plants were measured by multiple collector inductively coupled plasma mass spectrometry (MC-ICPMS). The mass balance of Cd isotope yields isotope fractionations between plant and Cd source (δ114/110Cdorgans-solution) of ‑0.70‰ to ‑0.22‰ in Ricinus communis and ‑0.51‰ to ‑0.33‰ in Solanum nigrum. Moreover, Cd isotope fractionation during Cd transport from stem to leaf differs between the Cd-tolerant and -hyperaccumulator species. Based on these results, the processes (diffusion, adsorption, uptake or complexation), which may induce Cd isotope fractionation in plants, have been discussed. Overall, the present study indicates potential applications of Cd isotopes for investigating plant physiology.

  18. Fractionation of Stable Cadmium Isotopes in the Cadmium Tolerant Ricinus communis and Hyperaccumulator Solanum nigrum

    Science.gov (United States)

    Wei, Rongfei; Guo, Qingjun; Wen, Hanjie; Liu, Congqiang; Yang, Junxing; Peters, Marc; Hu, Jian; Zhu, Guangxu; Zhang, Hanzhi; Tian, Liyan; Han, Xiaokun; Ma, Jie; Zhu, Chuanwei; Wan, Yingxin

    2016-04-01

    Cadmium (Cd) isotopes provide new insights into Cd uptake, transport and storage mechanisms in plants. Therefore, the present study adopted the Cd-tolerant Ricinus communis and Cd-hyperaccumulator Solanum nigrum, which were cultured under controlled conditions in a nutrient solution with variable Cd supply, to test the isotopic fractionation of Cd during plant uptake. The Cd isotope compositions of nutrient solutions and organs of the plants were measured by multiple collector inductively coupled plasma mass spectrometry (MC-ICPMS). The mass balance of Cd isotope yields isotope fractionations between plant and Cd source (δ114/110Cdorgans-solution) of -0.70‰ to -0.22‰ in Ricinus communis and -0.51‰ to -0.33‰ in Solanum nigrum. Moreover, Cd isotope fractionation during Cd transport from stem to leaf differs between the Cd-tolerant and -hyperaccumulator species. Based on these results, the processes (diffusion, adsorption, uptake or complexation), which may induce Cd isotope fractionation in plants, have been discussed. Overall, the present study indicates potential applications of Cd isotopes for investigating plant physiology.

  19. Cadmium-mediated disruption of cortisol biosynthesis involves suppression of corticosteroidogenic genes in rainbow trout

    Energy Technology Data Exchange (ETDEWEB)

    Sandhu, Navdeep [Department of Biology, University of Waterloo, 200 University Avenue West, Waterloo, Ontario N2L 3G1 (Canada); Vijayan, Mathilakath M., E-mail: mvijayan@uwaterloo.ca [Department of Biology, University of Waterloo, 200 University Avenue West, Waterloo, Ontario N2L 3G1 (Canada)

    2011-05-15

    Cadmium is widely distributed in the aquatic environment and is toxic to fish even at sublethal concentrations. This metal is an endocrine disruptor, and one well established role in teleosts is the suppression of adrenocorticotrophic hormone (ACTH)-stimulated cortisol biosynthesis by the interrenal tissue. However the mechanism(s) leading to this steroid suppression is poorly understood. We tested the hypothesis that cadmium targets genes encoding proteins critical for corticosteroid biosynthesis, including melanocortin 2 receptor (MC2R), steroidogenic acute regulatory protein (StAR) and cytochrome P450 side chain cleavage enzyme (P450scc), in rainbow trout (Oncorhynchus mykiss). To test this, head kidney slices (containing the interrenal tissues) were incubated in vitro with cadmium chloride (0, 10, 100 and 1000 nM) for 4 h either in the presence or absence of ACTH (0.5 IU/mL). In the unstimulated head kidney slices, cadmium exposure did not affect basal cortisol secretion and the mRNA levels of MC2R and P450scc, while StAR gene expression was significantly reduced. Cadmium exposure significantly suppressed ACTH-stimulated cortisol production in a dose-related fashion. This cadmium-mediated suppression in corticosteroidogenesis corresponded with a significant reduction in MC2R, StAR and P450scc mRNA levels in trout head kidney slices. The inhibition of ACTH-stimulated cortisol production and suppression of genes involved in corticosteroidogenesis by cadmium were completely abolished in the presence of 8-Bromo-cAMP (a cAMP analog). Overall, cadmium disrupts the expression of genes critical for corticosteroid biosynthesis in rainbow trout head kidney slices. However, the rescue of cortisol production as well as StAR and P450scc gene expressions by cAMP analog suggests that cadmium impact occurs upstream of cAMP production. We propose that MC2R signaling, the primary step in ACTH-induced cortocosteroidogenesis, is a key target for cadmium-mediated disruption of

  20. Cadmium-mediated disruption of cortisol biosynthesis involves suppression of corticosteroidogenic genes in rainbow trout

    International Nuclear Information System (INIS)

    Cadmium is widely distributed in the aquatic environment and is toxic to fish even at sublethal concentrations. This metal is an endocrine disruptor, and one well established role in teleosts is the suppression of adrenocorticotrophic hormone (ACTH)-stimulated cortisol biosynthesis by the interrenal tissue. However the mechanism(s) leading to this steroid suppression is poorly understood. We tested the hypothesis that cadmium targets genes encoding proteins critical for corticosteroid biosynthesis, including melanocortin 2 receptor (MC2R), steroidogenic acute regulatory protein (StAR) and cytochrome P450 side chain cleavage enzyme (P450scc), in rainbow trout (Oncorhynchus mykiss). To test this, head kidney slices (containing the interrenal tissues) were incubated in vitro with cadmium chloride (0, 10, 100 and 1000 nM) for 4 h either in the presence or absence of ACTH (0.5 IU/mL). In the unstimulated head kidney slices, cadmium exposure did not affect basal cortisol secretion and the mRNA levels of MC2R and P450scc, while StAR gene expression was significantly reduced. Cadmium exposure significantly suppressed ACTH-stimulated cortisol production in a dose-related fashion. This cadmium-mediated suppression in corticosteroidogenesis corresponded with a significant reduction in MC2R, StAR and P450scc mRNA levels in trout head kidney slices. The inhibition of ACTH-stimulated cortisol production and suppression of genes involved in corticosteroidogenesis by cadmium were completely abolished in the presence of 8-Bromo-cAMP (a cAMP analog). Overall, cadmium disrupts the expression of genes critical for corticosteroid biosynthesis in rainbow trout head kidney slices. However, the rescue of cortisol production as well as StAR and P450scc gene expressions by cAMP analog suggests that cadmium impact occurs upstream of cAMP production. We propose that MC2R signaling, the primary step in ACTH-induced cortocosteroidogenesis, is a key target for cadmium-mediated disruption of

  1. Bioavailability of cadmium from linseed and cocoa

    OpenAIRE

    Hansen, Max; Rasmussen, Rie Romme; Sloth, Jens Jørgen

    2014-01-01

    The exposure of the European population to cadmium from food is high compared with the tolerable weekly intake of 2.5 μg/kg bodyweight set by EFSA in 2009. Only few studies on the bioavailability of cadmium from different food sources has been performed but this information in very important for the food authorities in order to give correct advises to the population. The aim of this study was to investigate the bioavailability of cadmium from whole linseed, crushed linseed, cocoa and cadmium ...

  2. The Epigenetic Effects of Prenatal Cadmium Exposure.

    Science.gov (United States)

    Vilahur, Nadia; Vahter, Marie; Broberg, Karin

    2015-06-01

    Prenatal exposure to the highly toxic and common pollutant cadmium has been associated with adverse effects on child health and development. However, the underlying biological mechanisms of cadmium toxicity remain partially unsolved. Epigenetic disruption due to early cadmium exposure has gained attention as a plausible mode of action, since epigenetic signatures respond to environmental stimuli and the fetus undergoes drastic epigenomic rearrangements during embryogenesis. In the current review, we provide a critical examination of the literature addressing prenatal cadmium exposure and epigenetic effects in human, animal, and in vitro studies. We conducted a PubMed search and obtained eight recent studies addressing this topic, focusing almost exclusively on DNA methylation. These studies provide evidence that cadmium alters epigenetic signatures in the DNA of the placenta and of the newborns, and some studies indicated marked sexual differences for cadmium-related DNA methylation changes. Associations between early cadmium exposure and DNA methylation might reflect interference with de novo DNA methyltransferases. More studies, especially those including environmentally relevant doses, are needed to confirm the toxicoepigenomic effects of prenatal cadmium exposure and how that relates to the observed health effects of cadmium in childhood and later life.

  3. 7 CFR 922.110 - Container exemption.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Container exemption. 922.110 Section 922.110... COUNTIES IN WASHINGTON Container Exemption; Waivers of Inspection and Certification § 922.110 Container exemption. Whenever container limitations are effective pursuant to § 922.52, a handler may make...

  4. 21 CFR 164.110 - Mixed nuts.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Mixed nuts. 164.110 Section 164.110 Food and Drugs... CONSUMPTION TREE NUT AND PEANUT PRODUCTS Requirements for Specific Standardized Tree Nut and Peanut Products § 164.110 Mixed nuts. (a) Mixed nuts is the food consisting of a mixture of four or more of the...

  5. 10 CFR 110.50 - Terms.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Terms. 110.50 Section 110.50 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) EXPORT AND IMPORT OF NUCLEAR EQUIPMENT AND MATERIAL License Terms and Related Provisions § 110.50 Terms. (a) General and specific licenses. (1) Each license is subject to all...

  6. 14 CFR 1250.110 - Judicial review.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Judicial review. 1250.110 Section 1250.110... PROGRAMS OF NASA-EFFECTUATION OF TITLE VI OF THE CIVIL RIGHTS ACT OF 1964 § 1250.110 Judicial review. Action taken pursuant to section 602 of the Act is subject to judicial review as provided in section...

  7. 41 CFR 105-1.110 - Deviation.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Deviation. 105-1.110 Section 105-1.110 Public Contracts and Property Management Federal Property Management Regulations System (Continued) GENERAL SERVICES ADMINISTRATION 1-INTRODUCTION 1.1-Regulations System § 105-1.110 Deviation....

  8. 41 CFR 115-1.110 - Deviations.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Deviations. 115-1.110 Section 115-1.110 Public Contracts and Property Management Federal Property Management Regulations System (Continued) ENVIRONMENTAL PROTECTION AGENCY 1-INTRODUCTION 1.1-Regulation System § 115-1.110...

  9. 49 CFR 174.110 - Car magazine.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Car magazine. 174.110 Section 174.110...) Materials § 174.110 Car magazine. When specially authorized by the carrier, Division 1.1 or 1.2 (explosive... packages of Class 1 (explosive) materials are placed in a “magazine” box made of sound lumber not less...

  10. 33 CFR 110.53 - Niantic, Conn.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Niantic, Conn. 110.53 Section 110.53 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.53 Niantic, Conn. Beginning on the shoreline at latitude...

  11. 7 CFR 4280.110 - Grant funding.

    Science.gov (United States)

    2010-01-01

    ...-kind contributions are acceptable in accordance with 7 CFR part 3015 of this title. (2) Passive third... 7 Agriculture 15 2010-01-01 2010-01-01 false Grant funding. 4280.110 Section 4280.110 Agriculture... Improvements Program Section A. Grants § 4280.110 Grant funding. (a) The amount of grant funds that will...

  12. 7 CFR 330.110 - Seals.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 5 2010-01-01 2010-01-01 false Seals. 330.110 Section 330.110 Agriculture Regulations...; GARBAGE General Provisions § 330.110 Seals. (a) Use authorized; form. Whenever, in the opinion of the... United States, or interstate, seals may be applied to openings, packages, or articles requiring...

  13. 7 CFR 1280.110 - Information.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Information. 1280.110 Section 1280.110 Agriculture... INFORMATION ORDER Lamb Promotion, Research, and Information Order Definitions § 1280.110 Information. Information means information and programs that are designed to increase efficiency in producing lambs,...

  14. 41 CFR 101-1.110 - Deviation.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Deviation. 101-1.110 Section 101-1.110 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS GENERAL 1-INTRODUCTION 1.1-Regulation System § 101-1.110...

  15. 32 CFR 865.110 - Decision process.

    Science.gov (United States)

    2010-07-01

    ... and 32 CFR part 70: available official military records, documentary evidence submitted by or on... 32 National Defense 6 2010-07-01 2010-07-01 false Decision process. 865.110 Section 865.110...-GENERAL PERSONNEL REVIEW BOARDS Air Force Discharge Review Board § 865.110 Decision process. (a) The...

  16. 10 CFR 110.5 - Licensing requirements.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Licensing requirements. 110.5 Section 110.5 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) EXPORT AND IMPORT OF NUCLEAR EQUIPMENT AND MATERIAL General Provisions § 110.5 Licensing requirements. Except as provided under subpart B of this part, no person may...

  17. 27 CFR 24.110 - Organizational documents.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Organizational documents. 24.110 Section 24.110 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS WINE Establishment and Operations Application § 24.110...

  18. 7 CFR 4290.110 - Qualified management.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 15 2010-01-01 2010-01-01 false Qualified management. 4290.110 Section 4290.110... Qualifications for the RBIC Program Organizing A Rbic § 4290.110 Qualified management. An Applicant must show, to the satisfaction of the Secretary, that its current or proposed management team is qualified and...

  19. 9 CFR 3.110 - Veterinary care.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Veterinary care. 3.110 Section 3.110... WELFARE STANDARDS Specifications for the Humane Handling, Care, Treatment, and Transportation of Marine Mammals Animal Health and Husbandry Standards § 3.110 Veterinary care. (a) Newly acquired marine...

  20. 34 CFR 110.32 - Mediation.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 1 2010-07-01 2010-07-01 false Mediation. 110.32 Section 110.32 Education Regulations..., Conciliation, and Enforcement Procedures § 110.32 Mediation. (a) ED promptly refers to the Federal Mediation and Conciliation Service or to the mediation agency designated by the Secretary of Health and...

  1. 45 CFR 235.110 - Fraud.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 2 2010-10-01 2010-10-01 false Fraud. 235.110 Section 235.110 Public Welfare... CHILDREN AND FAMILIES, DEPARTMENT OF HEALTH AND HUMAN SERVICES ADMINISTRATION OF FINANCIAL ASSISTANCE PROGRAMS § 235.110 Fraud. State plan requirements: A State plan under title I, IV-A, X, XIV, or XVI of...

  2. 10 CFR 110.64 - Civil penalty.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Civil penalty. 110.64 Section 110.64 Energy NUCLEAR... Enforcement § 110.64 Civil penalty. (a) In response to a violation, the Commission may institute a proceeding to impose a civil penalty under section 234 of the Atomic Energy Act by issuing a notice to...

  3. 7 CFR 917.110 - Communications.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Communications. 917.110 Section 917.110 Agriculture... CALIFORNIA Rules and Regulations General § 917.110 Communications. Unless otherwise prescribed in this... commodity committee, all reports, applications, submittals, requests, and communications in connection...

  4. 10 CFR 110.4 - Communications.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Communications. 110.4 Section 110.4 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) EXPORT AND IMPORT OF NUCLEAR EQUIPMENT AND MATERIAL General Provisions § 110.4 Communications. Except where otherwise specified in this part, all communications and...

  5. 49 CFR 110.20 - Definitions.

    Science.gov (United States)

    2010-10-01

    ... groups or organizations: elected State and local officials; law enforcement, firefighting, civil defense... 49 Transportation 2 2010-10-01 2010-10-01 false Definitions. 110.20 Section 110.20 Transportation... TRAINING AND PLANNING GRANTS § 110.20 Definitions. Unless defined in this part, all terms defined in 49...

  6. 46 CFR 403.110 - Accounting entities.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 8 2010-10-01 2010-10-01 false Accounting entities. 403.110 Section 403.110 Shipping COAST GUARD (GREAT LAKES PILOTAGE), DEPARTMENT OF HOMELAND SECURITY GREAT LAKES PILOTAGE UNIFORM ACCOUNTING SYSTEM General § 403.110 Accounting entities. Each Association shall be a separate...

  7. 21 CFR 172.110 - BHA.

    Science.gov (United States)

    2010-04-01

    ... Preservatives § 172.110 BHA. The food additive BHA (butylated hydroxyanisole) alone or in combination with other... 21 Food and Drugs 3 2010-04-01 2009-04-01 true BHA. 172.110 Section 172.110 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR...

  8. 49 CFR 230.110 - Pilots.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Pilots. 230.110 Section 230.110 Transportation... and Equalizing System § 230.110 Pilots. (a) General provisions. Pilots shall be securely attached... clearance. The minimum clearance of pilot above the rail shall be 3 inches and the maximum clearance...

  9. Improvement of cadmium phytoremediation after soil inoculation with a cadmium-resistant Micrococcus sp.

    Science.gov (United States)

    Sangthong, Chirawee; Setkit, Kunchaya; Prapagdee, Benjaphorn

    2016-01-01

    Cadmium-resistant Micrococcus sp. TISTR2221, a plant growth-promoting bacterium, has stimulatory effects on the root lengths of Zea mays L. seedlings under toxic cadmium conditions compared to uninoculated seedlings. The performance of Micrococcus sp. TISTR2221 on promoting growth and cadmium accumulation in Z. mays L. was investigated in a pot experiment. The results indicated that Micrococcus sp. TISTR2221significantly promoted the root length, shoot length, and dry biomass of Z. mays L. transplanted in both uncontaminated and cadmium-contaminated soils. Micrococcus sp. TISTR2221 significantly increased cadmium accumulation in the roots and shoots of Z. mays L. compared to uninoculated plants. At the beginning of the planting period, cadmium accumulated mainly in the shoots. With a prolonged duration of cultivation, cadmium content increased in the roots. As expected, little cadmium was found in maize grains. Soil cadmium was significantly reduced with time, and the highest percentage of cadmium removal was found in the bacterial-inoculated Z. mays L. after transplantation for 6 weeks. We conclude that Micrococcus sp. TISTR2221 is a potent bioaugmenting agent, facilitating cadmium phytoextraction in Z. mays L.

  10. The isotopic composition of dissolved cadmium in the water column of the West Philippine Sea

    Directory of Open Access Journals (Sweden)

    Shun-Chung eYang

    2014-11-01

    Full Text Available The dissolved concentration and isotopic compositions of cadmium (Cd in the seawater of the West Philippine Sea were determined. In general, Cd isotopic composition in the water column decreased with depth, with ε114/110Cd (ε114/110Cd = [(114Cd/110Cdsample / (114Cd/110CdNIST 3108 - 1]×10000 ranging from +7.2 to +10.1 in the top 60 m, from +4.8 to +5.1 between 100 and 150 m, peaking at +8.2 at 200 m, decreasing from +4.5 to +3.3 from 400 to 1000 m, and remaining constant at +3.0 from 1000 m and deeper. Different to a Rayleigh fractionation model, the isotopic composition and log scale concentrations of Cd do not exhibit a linear relationship. However, from the deep water to thermocline, the variations in Cd concentration and ε114/110Cd are relevant to the variations of temperature and salinity, indicating that water mixing is the dominant processes determining the concentration and isotopic composition in the interval. At 200 m where North Pacific Tropic Water dominates the water mass, the elevated ε114/110Cd could be linked to the composition in the upper portions of the water mass. In the top 150 m, the ε114/110Cd varies similarly to the phytoplankton community structures, implying that Cd uptake by various phytoplankton species may be associated with the isotopic variation. However, the effects of atmospheric inputs to the ε114/110Cd in the surface water cannot be excluded. A box model calculation is used to constrain the contributions of various processes to the Cd isotopes of surface water, and the results indicate that the Cd concentration and isotopic composition in most of the water body of the region are controlled by physical mixing, while the effects of biological fractionation and atmospheric inputs are limited in the euphotic zone.

  11. Cadmium Modulates Biofilm Formation by Staphylococcus epidermidis

    NARCIS (Netherlands)

    Wu, Xueqing; Santos, Regiane R.; Fink-Gremmels, Johanna

    2015-01-01

    The aim of the study was to evaluate the effect of cadmium exposure on Staphylococcus epidermidis (ATCC 35984) biofilm formation. Bacteria were cultured in the absence or presence of different concentrations (0-50 mu M) of cadmium. Biofilm formation and bacterial viability were assessed. Quantitativ

  12. Cadmium stress in wheat seedlings: growth, cadmium accumulation and photosynthesis

    DEFF Research Database (Denmark)

    Ci, Dunwei; Jiang, Dong; Wollenweber, Bernd;

    2010-01-01

    Seedlings of wheat (Triticum aestivum L.) cultivars Jing 411, Jinmai 30 and Yangmai 10 were exposed to 0, 10, 20, 30, 40 or 50 μM of CdCl2 in a solution culture experiment. The effects of cadmium (Cd) stress on wheat growth, leaf photon energy conversion, gas exchange, and Cd accumulation in wheat...... parameters were generally depressed by Cd stress, especially under the high Cd concentrations. Cd concentration and accumulation in both shoots and roots increased with increasing external Cd concentrations. Relationships between corrected parameters of growth, photosynthesis and fluorescence and corrected...

  13. Immunoassay for Cadmium Detection and Quantification

    Institute of Scientific and Technical Information of China (English)

    GONG-LIANG LIU; JU-FANG WANG; ZHI-YONG LI; SHI-ZHONG LIANG; XIAO-NING WANG

    2009-01-01

    Objective To detect cadmium in environmental and food samples by graphite furnace atomic absorption spectroscopy (GFAAS) and inductively coupled plasma atomic emission spectroscopy (ICPAES). Methods An indirect competitive enzyme-linked immunosorbent assay (IC-ELISA) was developed based on a cadmium-specific monoclonal antibody.IC-ELISA for cadmium in environmental and food samples was evaluated. Results IC-ELISA showed an IC50 of 45.6 μg/L with a detection limit of 1.95 μg/L for cadmium,and showed a mean recovery ranging 97.67%-107.08%.The coefficient of variations for intra- and iuterassay was 3.41%-6.61% and 4.70%-9.21%,respectively.The correlation coefficient between IC-ELISA and GFAAS was 0.998. Conclusion IC-ELISA can detect and quantify cadmium residue in environmental or food samples.

  14. Development of cadmium/silver/palladium separation by ion chromatography with quadrupole inductively coupled plasma mass spectrometry detection for off-line cadmium isotopic measurements

    International Nuclear Information System (INIS)

    A separation method was investigated to perform off-line cadmium isotopic measurements on a 109Ag transmutation target. Ion chromatography (IC) with Q ICPMS detection (quadrupole inductively coupled plasma mass spectrometry detection) was chosen to separate cadmium from the isobarically interfering elements, silver and palladium, present in the sample. The optimization of chromatographic conditions was particularly studied. Several anion and cation columns (Dionex AG11 (R), CS10 (R) and CS12 (R)) were compared with different mobile phases (HNO3, HCl). The separation procedure was achieved with a carboxylate-functionalized cation exchange CS12 column using 0.5 M HNO3 as eluent. The developed technique yielded satisfactory results in terms of separation factors (greater than 5) and provides an efficient solution to obtain rapidly purified cadmium fractions (decontamination factors higher 100,000 for silver and palladium) which can directly be analyzed by multi collection inductively coupled plasma mass spectrometry (MC ICPMS). By applying the proposed procedure, accurate and precise cadmium isotope ratios were determined for the irradiated 109Ag transmutation target. (authors)

  15. Multiple effects of cadmium on the photosynthetic apparatus of Avicennia germinans L. as probed by OJIP chlorophyll fluorescence measurements

    Energy Technology Data Exchange (ETDEWEB)

    Gonzales-Mendoza, D.; Zapata-Perez, O. [Cinvestav Unidad Merida, Yucatan (Mexico). Dept. de Recursos del Mar; Espadas y Gil, F.; Santamaria, J.M. [Unidad de Biotecnologia, CICY, Yucatan (Mexico)

    2007-03-15

    The toxic effects of cadmium on the photosynthetic apparatus of Avicennia germinans were evaluated by means of the chlorophyll fluorescence transient O-J-I-P. The chlorophyll fluorescence transients were recorded in vivo with high time resolution and analyzed according to the OJIP-test that can quantify the performance of photosystem II. Cadmium-treated plants showed a decrease in yield for primary photochemistry, TR{sup 0}/ABS. The performance index of photosystem II (PSII), PI{sub ABS}, decreased due to cadmium treatment. This performance index is the combination of the indexes of three independent parameters: (1) total number of active reaction centers per absorption (RC/ABS), (2) yield of primary photochemistry (TR{sup 0}/ABS), and (3) efficiency with which a trapped exciton can move an electron into the electron transport chain (ET{sup 0}/TR{sup 0}). Additionally, the F{sub 0}/F{sub v} registered the highest sensitivity to the metal, thus indicating that the water-splitting apparatus of the oxidizing side of PSII is the primary site of action of cadmium. In summary, cadmium affects several targets of photosystem II. More specifically the main targets of cadmium, according to the OJIP-test, can be listed as a decrease in the number of active reaction centers and damage to the activity of the water-splitting complex. (orig.)

  16. Cadmium mobility and accumulation in soils of the European Communities

    NARCIS (Netherlands)

    Fraters B; van Beurden AUCJ

    1993-01-01

    In this overview of the effects of cadmium pollution on agricultural soils in the European Community, both the cadmium loads on agricultural land and the soil sensitivity to cadmium accumulation have been estimated. Cadmium loads have been estimated separately for arable land and grassland. The ef

  17. Cadmium chloride alters mRNA levels of angiogenesis related genes in primary human endometrial endothelial cells grown in vitro.

    Science.gov (United States)

    Helmestam, Malin; Stavreus-Evers, Anneli; Olovsson, Matts

    2010-11-01

    Cadmium, is known to cause adverse reproductive effects, and classified as an endocrine disrupting chemical (EDC). Human endometrial endothelial cells (HEEC) have a key role in the regulation of endometrial angiogenesis. These cells are known to express estrogen receptors, a feature that makes them potential targets for EDCs such as cadmium. We have designed a co-culture system, in which HEEC were grown in the same cell culture medium as endometrial stromal cells but in separate, communicating chambers. With quantitative PCR, we investigated changes in mRNA expression of genes associated with angiogenesis, sex steroids and endothelial cell specific functions. We found that cadmium altered the mRNA expression of the two important angiogenic molecules VEGF-A and PLGF. Cadmium might thus affect endometrial angiogenesis and as a consequence cause endometrial dysfunction with an increased risk for fertility problems. PMID:20580663

  18. The presence of cadmium in the intertidal environments of a moderately impacted coastal lagoon in western Portugal (Óbidos Lagoon)--spatial and seasonal evaluations.

    Science.gov (United States)

    Pedro, Carmen A; Santos, Márcia S S; Ferreira, Susana M F; Gonçalves, Sílvia C

    2016-01-01

    A seasonal environmental monitoring program was carried out (winter 2009 to summer 2010) to evaluate the spatial and seasonal cadmium concentrations in the intertidal environments of the Óbidos Lagoon (Portugal). Also, some environmental parameters were monitored at each sampling station. Both the water and the sediment samples were contaminated, although to different degrees. In general, cadmium contamination appears to be mostly focused on the inner areas of the lagoon, namely, in Barrosa's arm, which receives a small tributary contaminated by agro-industrial activities. Only cadmium concentration in sediment showed to be significantly influenced by seasons. Some environmental parameters presented spatial and temporal heterogeneity which influenced, to some extent, cadmium bioavailability. The results of this study allow a better understanding of the environmental quality of this ecosystem regarding cadmium contamination and may assist in the definition of future coastal management measures specifically targeted to trace metal contamination and pollution monitoring.

  19. Amelioration Effect of Zinc and Iron Supplementation on Selected Oxidative Stress Enzymes in Liver and Kidney of Cadmium-Treated Male Albino Rat

    OpenAIRE

    Jamakala, Obaiah; Rani, Usha A.

    2015-01-01

    Cadmium (Cd) is a highly toxic, nonessential heavy metal with many industrial uses that can contribute to a well-defined spectrum of diseases in animals as well as in humans. The present study examines the effect of zinc (Zn) and iron (Fe) supplementation on oxidative stress enzymes in Cd-treated rats. Wistar strain male albino rats were treated with cadmium chloride (CdCl2) at a dose of 1/10th LD50/48 h, that is, 22.5 mg/kg body weight for 7, 15, and 30 days (d) time intervals. The 15d Cd-tr...

  20. Response of Saccharomyces cerevisiae to cadmium stress

    Energy Technology Data Exchange (ETDEWEB)

    Moreira, Luciana Mara Costa; Ribeiro, Frederico Haddad; Neves, Maria Jose [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil). Lab. de Radiobiologia], e-mail: luamatu@uol.com.br; Porto, Barbara Abranches Araujo; Amaral, Angela M.; Menezes, Maria Angela B.C. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Lab. de Ativacao Neutronica], e-mail: menezes@cdtn.br; Rosa, Carlos Augusto [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Microbiologia], e-mail: carlrosa@icb.ufmg

    2009-07-01

    The intensification of industrial activity has been greatly contributing with the increase of heavy metals in the environment. Among these heavy metals, cadmium becomes a serious pervasive environmental pollutant. The cadmium is a heavy metal with no biological function, very toxic and carcinogenic at low concentrations. The toxicity of cadmium and several other metals can be mainly attributed to the multiplicity of coordination complexes and clusters that they can form. Some aspects of the cellular response to cadmium were extensively investigated in the yeast Saccharomyces cerevisiae. The primary site of interaction between many toxic metals and microbial cells is the plasma membrane. Plasma-membrane permeabilisation has been reported in a variety of microorganisms following cadmium exposure, and is considered one mechanism of cadmium toxicity in the yeast. In this work, using the yeast strain S. cerevisiae W303-WT, we have investigated the relationships between Cd uptake and release of cellular metal ions (K{sup +} and Na{sup +}) using neutron activation technique. The neutron activation was an easy, rapid and suitable technique for doing these metal determinations on yeast cells; was observed the change in morphology of the strains during the process of Cd accumulation, these alterations were observed by Transmission Electron Microscopy (TEM) and Scanning Electron Microscopy (SEM) during incorporation of cadmium. (author)

  1. Response of Pleurotus ostreatus to cadmium exposure

    Energy Technology Data Exchange (ETDEWEB)

    Favero, N.; Bressa, G.; Costa, P. (Univ. of Padua (Italy))

    1990-08-01

    The possibility of utilizing agroindustrial wastes in the production of edible, high-quality products (e.g., mushrooms) implies the risk of bringing toxic substances, such as heavy metals, into the human food chain. Thus, growth in the presence of cadmium and cadmium accumulation limits have been studied in the industrially cultivated fungus P. ostreatus. Fruit body production is substantially unaffected in the presence of 25, 139, and 285 mg Cd/kg of dried substrate. Cadmium concentration in fruit bodies is related to cadmium substrate level, the metal being present at higher levels in caps (22-56 mg/kg dry wt) than in stems (13-36 mg/kg dry wt). Concentration factor (CF), very low in the controls (about 2), further decreases in treated specimens. The presence of a cadmium control mechanism in this fungi species is suggested. Fruit body cadmium levels could, however, represent a risk for P. ostreatus consumers, according to FAO/WHO limits related to weekly cadmium intake.

  2. Cadmium Toxicity to Ringed Seals (Phoca hispida)

    DEFF Research Database (Denmark)

    Sonne, Christian; Dietz, R.; Riget, F. F.;

    as laboratory mammals. We have studied possible cadmium induced histopathological changes in the kidneys as well as a demineralisation of the skeletal system (DXA-scanning of lumbal vertebraes). No obvious cadmium induced toxic changes were found. Food composition and physiological adaptations may explain......Cadmium concentrations in kidneys from ringed seals (Phoca hispida) from North West Greenland (Qaanaaq) are high. Concentrations range at level known to induce renal toxic effects (mainly tubulopathy) and demineralisation (osteopenia) of the skeletal system (Fanconi's Syndrome) in humans as well...

  3. Dicty_cDB: SLB110 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLB110 (Link to dictyBase) - - - - SLB110Z (Link to Original site) - - SLB...110Z 574 - - - - Show SLB110 Library SL (Link to library) Clone ID SLB110 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLB1-A/SLB...110Q.Seq.d/ Representative seq. ID SLB110Z (Link to Original site) R...epresentative DNA sequence >SLB110 (SLB110Q) /CSM/SL/SLB1-A/SLB110Q.Seq.d/ XXXXXXXXXXAAATCAGTCGAAATGCATCACGG

  4. 18 CFR 401.110 - Fees.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Fees. 401.110 Section... MANUAL RULES OF PRACTICE AND PROCEDURE Public Access to Records and Information § 401.110 Fees. (a) Unless waived in accordance with the provisions of § 401.111, the following fees shall be imposed...

  5. 15 CFR 923.110 - Allocation formula.

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 3 2010-01-01 2010-01-01 false Allocation formula. 923.110 Section... Grants § 923.110 Allocation formula. (a) As required by subsection 306(a), the Secretary may make grants...) Allocation formula factors and weighting. Each State eligible to receive a financial assistance award...

  6. 34 CFR 300.110 - Program options.

    Science.gov (United States)

    2010-07-01

    ... agency, including art, music, industrial arts, consumer and homemaking education, and vocational... 34 Education 2 2010-07-01 2010-07-01 false Program options. 300.110 Section 300.110 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF SPECIAL EDUCATION...

  7. 7 CFR 989.110 - Varietal types.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Varietal types. 989.110 Section 989.110 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... raisins that possess characteristics similar to those produced from Black Corinth or White Corinth...

  8. 42 CFR 426.110 - Definitions.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 3 2010-10-01 2010-10-01 false Definitions. 426.110 Section 426.110 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICARE PROGRAM REVIEW OF NATIONAL COVERAGE DETERMINATIONS AND LOCAL COVERAGE DETERMINATIONS General...

  9. 10 CFR 110.113 - Commission action.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Commission action. 110.113 Section 110.113 Energy NUCLEAR... Commission action. (a) Upon completion of a hearing, the Commission will issue a written opinion including... hearing issues; and (4) Take other action, as appropriate....

  10. 50 CFR 600.110 - Intercouncil fisheries.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 8 2010-10-01 2010-10-01 false Intercouncil fisheries. 600.110 Section 600.110 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND ATMOSPHERIC ADMINISTRATION, DEPARTMENT OF COMMERCE MAGNUSON-STEVENS ACT PROVISIONS Regional Fishery Management Councils §...

  11. 13 CFR 130.110 - Definitions.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Definitions. 130.110 Section 130.110 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION SMALL BUSINESS DEVELOPMENT CENTERS... awards Federal funds and recipient organizations provide services to the small business...

  12. 7 CFR 762.110 - Loan application.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Loan application. 762.110 Section 762.110 Agriculture Regulations of the Department of Agriculture (Continued) FARM SERVICE AGENCY, DEPARTMENT OF AGRICULTURE... of debts over $1,000; (3) Three years financial history; (4) Three years of production history...

  13. 21 CFR 150.110 - Fruit butter.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Fruit butter. 150.110 Section 150.110 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION FRUIT BUTTERS, JELLIES, PRESERVES, AND RELATED PRODUCTS Requirements for Specific...

  14. 13 CFR 108.110 - Qualified management.

    Science.gov (United States)

    2010-01-01

    ... Relevant Venture Capital Finance, necessary for investing in the types of businesses contemplated by the... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Qualified management. 108.110 Section 108.110 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW MARKETS VENTURE...

  15. 38 CFR 51.110 - Resident assessment.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Resident assessment. 51.110 Section 51.110 Pensions, Bonuses, and Veterans' Relief DEPARTMENT OF VETERANS AFFAIRS (CONTINUED.... (d) Submission of assessments. Each assessment (initial, annual, change in condition, and...

  16. 27 CFR 21.110 - Gasoline, unleaded.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Gasoline, unleaded. 21.110....110 Gasoline, unleaded. Conforms to specifications as established by the American Society for Testing...-79. Any of the “seasonal and geographical” volatility classes for unleaded gasoline are...

  17. 10 CFR 110.6 - Retransfers.

    Science.gov (United States)

    2010-01-01

    ... COMMISSION (CONTINUED) EXPORT AND IMPORT OF NUCLEAR EQUIPMENT AND MATERIAL General Provisions § 110.6... nuclear equipment and material (see definition of “obligated” in § 110.2). (b) Requests for authority to... material, requires authorization by the Department of Energy, unless, the export to the new destination...

  18. 21 CFR 160.110 - Frozen eggs.

    Science.gov (United States)

    2010-04-01

    ... Frozen eggs. (a) Frozen eggs, frozen whole eggs, frozen mixed eggs is the food prepared by freezing... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Frozen eggs. 160.110 Section 160.110 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR...

  19. 42 CFR 136.110 - Facilities construction.

    Science.gov (United States)

    2010-10-01

    ... in the procurement standards for HHS grantees made applicable by subpart P of 45 CFR part 74. (4... 42 Public Health 1 2010-10-01 2010-10-01 false Facilities construction. 136.110 Section 136.110..., DEPARTMENT OF HEALTH AND HUMAN SERVICES INDIAN HEALTH Grants for Development, Construction, and Operation...

  20. Tissue-specific accumulation of cadmium in subcellular compartments of eastern oysters Crassostrea virginica Gmelin (Bivalvia: Ostreidae)

    Energy Technology Data Exchange (ETDEWEB)

    Sokolova, I.M. [Biology Department, University of North Carolina at Charlotte, 9201 University City Blvd., Charlotte, NC 28223 (United States)]. E-mail: insokolo@uncc.edu; Ringwood, A.H. [Biology Department, University of North Carolina at Charlotte, 9201 University City Blvd., Charlotte, NC 28223 (United States); Johnson, C. [Johnson C. Smith University, 100 Beatties Ford Road, Charlotte, NC 28216 (United States)

    2005-09-10

    Cadmium distribution was studied in different subcellular fractions of gill and hepatopancreas tissues of eastern oysters Crassostrea virginica. Oysters were exposed for up to 21 days to low sublethal Cd concentrations (25 {mu}g L{sup -1}). Gill and hepatopancreas tissues were sampled and divided into organelle fractions and cytosol by differential centrifugation. Organelle content of different fractions was verified by activities of marker enzymes, citrate synthase and acid phosphatase for mitochondria and lysosomes, respectively. In both tissue types, there was a significant accumulation of cadmium in cytosol reaching 230-350 ng mg{sup -1} protein. Among organelles, mitochondria were the main target for Cd bioaccumulation in gills (250-300 ng mg{sup -1} protein), whereas in hepatopancreas tissues, the highest cadmium accumulation occurred in lysosomes (90-94 ng mg{sup -1} protein). Although 75-83% of total cadmium burden was associated with the cytosol reflecting high volume fraction of this compartment, Cd concentrations in organelle fractions reached levels that could cause dysfunction of mitochondria and lysosomes. Organ- and organelle-specific patterns of cadmium bioaccumulation support our previous in vivo studies, which showed adverse effects of cadmium exposures on mitochondrial oxidation in gills and on the lysosomal system of hepatopancreas. This may have important implications for the development of biomarkers of effect for heavy metals and for understanding the mechanisms of toxic effects of metals.

  1. Market for nickel-cadmium batteries

    Science.gov (United States)

    Putois, F.

    Besides the lead/acid battery market, which has seen a tremendous development linked with the car industry, the alkaline rechargeable battery market has also been expanded for more than twenty years, especially in the field of portable applications with nickel-cadmium batteries. Today, nickel-cadmium batteries have to face newcomers on the market, such as nickel-metal hydride, which is another alkaline couple, and rechargeable lithium batteries; these new battery systems have better performances in some areas. This work illustrates the status of the market for nickel-cadmium batteries and their applications. Also, for two major applications—the cordless tool and the electric vehicles—the competitive situation of nickel-cadmium batteries; facing new systems such as nickel-metal hydride and lithium ion cells are discussed.

  2. RISK ASSESSMENT AND MANAGEMENT OF ENVIRONMENTAL CADMIUM

    Science.gov (United States)

    Cadmium consumed in foods grown on soils contaminated by industrial Cd+Zn discharge has caused renal tubular dysfunction in exposed humans in discrete situations. However, lack of understanding about environmental Cd has caused wide concern that generalpopulations may...

  3. Some Aspects of Sealed Nickel Cadmium Cells

    Directory of Open Access Journals (Sweden)

    P. K. Saha

    1967-11-01

    Full Text Available Sealed Nickel Cadmium Cell system is termed till today as the most reliable power pack for electronic apparatus specially in low temperature use. This paper brings out the development and production of sealed nickel cadmium cells of pocket plate construction. The author who has gained experience in production of Ni-Cd cells in East Germany discusses also the major problems faced by the battery manufactures of to-day.

  4. Effect of dietary zinc deficiency on the accumulation of cadmium and metallothionein in selected tissues of the rat

    Energy Technology Data Exchange (ETDEWEB)

    Waalkes, M.P.

    1986-01-01

    The effect of continuous dietary zinc deficiency on the metabolism of the toxic heavy metal cadmium has not been widely studied. This investigation was designed to assess the effects of subadequate dietary zinc intake on the accumulation of dietary cadmium and on metallothionein (MT) and zinc concentrations in target organs of cadmium toxicity. Adult male Wistar rats (180-200 g) were allowed, ad libitum, diets either adequate (60 ppm) or deficient (7 ppm) in zinc for a total of 9 wk. The zinc-deficient diet resulted in an approximately 40% reduction in plasma zinc (assessed at 3, 6, and 9 wk) in the absence of overt signs of zinc deficiency (i.e., reduced weight gain, alopecia, etc.). Separate groups of rats were also maintained on zinc-defined diets for a total of 9 wk, but cadmium was added to the diet (0, 12.5, 25, 50, 100, and 200 ppm) a the end of wk 3 and maintained at that level throughout the remaining 6 wk of the study, when the rats were killed. The feeding of the zinc-deficient diet markedly enhanced the accumulation of cadmium in the liver, kidney, and testes. Hepatic, renal, and testicular zinc concentrations were not affected by suboptimal zinc intake alone. However, marked reductions in renal and testicular zinc concentrations were caused by zinc deficiency in concert with cadmium exposure. MT levels, when related to tissue cadmium concentrations, were elevated to a significantly lesser extent in the kidneys of zinc-deficient animals. These results indicate that marginal zinc deficiency markedly increases cadmium accumulation in various organs and reduces zinc content and MT induction in some organs.

  5. Cadmium zinc telluride spectral modeling

    International Nuclear Information System (INIS)

    Cadmium zinc telluride (CZT) detectors are the highest resolution room temperature gamma-ray detectors available for isotopic analysis. As with germanium detectors, accurate isotopic analysis using spectra requires peak deconvolution. The CZT peak shapes are asymmetric, with a long low energy tail. The asymmetry is a result of the physics of the electron/hole transport in the semiconductor. An accurate model of the physics of the electron/hole transport through an electric field will allow the parameterization of the peak shapes as a function of energy. In turn this leads to the ability to perform accurate spectral deconvolution and therefore accurate isotopic analysis. The model and the peak-shape parameterization as a function of energy will be presented

  6. Cadmium leaching from thermal treated and gamma irradiated Mexican aluminosilicates

    Energy Technology Data Exchange (ETDEWEB)

    Davila-Rangel, J.I. [Departamento de Quimica, Instituto Nacional de Investigaciones Nucleares, Apdo. Postal 18-1027, Mexico 11801, D.F. (Mexico); Unidad Academica Centro Regional de Estudios Nucleares, Universidad Autonoma de Zacatecas Cipres 10, Frac. La Penuela, Zacatecas, Zacatecas 98068 (Mexico); Facultad de Ciencias, Universidad Autonoma del Estado de Mexico, Instituto Literario No. 100 Col. Centro C.P. 50000, Toluca, Edo. de Mexico (Mexico); Solache-Rios, M. [Departamento de Quimica, Instituto Nacional de Investigaciones Nucleares, Apdo. Postal 18-1027, Mexico 11801, D.F. (Mexico)], E-mail: msr@nuclear.inin.mx

    2008-10-15

    Thermal and radiation effects on the leaching of cadmium from two cadmium exchanged zeolitic tuffs and one clay were determined. The cadmium exchanged aluminosilicates were heated at different temperatures (500, 700, 900 and 1100 {sup o}C), and the materials were then treated with NaCl (1 M and 5 M) and HNO{sub 3} (0.001 M and 1 M) solutions to determine the leaching behaviour of cadmium from the materials. The stability of cadmium in the materials increased as the heating temperature was increased. Cadmium leaching from gamma irradiated and heated materials at 1100 {sup o}C was higher than leaching from non-irradiated samples.

  7. Cadmium leaching from thermal treated and gamma irradiated Mexican aluminosilicates

    International Nuclear Information System (INIS)

    Thermal and radiation effects on the leaching of cadmium from two cadmium exchanged zeolitic tuffs and one clay were determined. The cadmium exchanged aluminosilicates were heated at different temperatures (500, 700, 900 and 1100 oC), and the materials were then treated with NaCl (1 M and 5 M) and HNO3 (0.001 M and 1 M) solutions to determine the leaching behaviour of cadmium from the materials. The stability of cadmium in the materials increased as the heating temperature was increased. Cadmium leaching from gamma irradiated and heated materials at 1100 oC was higher than leaching from non-irradiated samples

  8. Application of multiwalled carbon nanotubes treated by potassium permanganate for determination of trace cadmium prior to flame atomic absorption spectrometry

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    In this study we investigated the enrichment ability of oxidized multiwalled carbon nanotubes (MWCNTs) and established a new method for the determination of trace cadmium in environment with flame atomic absorption spectrometry. The MWCNTs were oxidized by potassium permanganate under appropriate conditions before use as preconcentration packing. Parameters influencing the recoveries of target analytes were optimized. Under optimal conditions, the target analyte exhibited a good linearity (R2=0.9992)over the concentration range 0.5-50 ng/ml. The detection limit and precision of the proposed method were 0.15 ng/ml and 2.06%,respectively. The proposed method was applied to the determination of cadmium in real-world environmental samples and the recoveries were in the range of 91.3%-108.0%. All these experimental results indicated that this new procedure could be applied to the determination of trace cadmium in environmental waters.

  9. Cadmium removal by Lemna minor and Spirodela polyrhiza.

    Science.gov (United States)

    Chaudhuri, Devaleena; Majumder, Arunabha; Misra, Amal K; Bandyopadhyay, Kaushik

    2014-01-01

    The present study investigates the ability of two genus of duckweed (Lemna minor and Spirodela polyrhiza) to phytoremediate cadmium from aqueous solution. Duckweed was exposed to six different cadmium concentrations, such as, 0.5,1.0,1.5, 2.0, 2.5, and 3.0 mg/L and the experiment was continued for 22 days. Water samples were collected periodically for estimation of residual cadmium content in aqueous solution. At the end of treatment period plant samples were collected and accumulated cadmium content was measured. Cadmium toxicity was observed through relative growth factor and changes in chlorophyll content Experimental results showed that Lemna minor and Spirodela polyrhiza were capable of removing 42-78% and 52-75% cadmium from media depending upon initial cadmium concentrations. Cadmium was removed following pseudo second order kinetic model Maximum cadmium accumulation in Lemna minor was 4734.56 mg/kg at 2 mg/L initial cadmium concentration and 7711.00 mg/kg in Spirodela polyrhiza at 3 mg/L initial cadmium concentration at the end of treatment period. Conversely in both cases maximum bioconcentration factor obtained at lowest initial cadmium concentrations, i.e., 0.5 mg/L, were 3295.61 and 4752.00 for Lemna minor and Spirodela polyrhiza respectively. The present study revealed that both Lemna minor and Spirodela polyrhiza was potential cadmium accumulator. PMID:24933906

  10. Cadmium exposure induces hematuria in Korean adults

    International Nuclear Information System (INIS)

    Introduction: Toxic heavy metals have adverse effects on human health. However, the risk of hematuria caused by heavy metal exposure has not been evaluated. Methods: Data from 4701 Korean adults were obtained in the Korean National Health and Nutritional Examination Survey (2008–2010). Blood levels of the toxic heavy metals cadmium, lead, and mercury were measured. Hematuria was defined as a result of ≥+1 on a urine dipstick test. The odds ratios (ORs) for hematuria were measured according to the blood heavy metal levels after adjusting for multiple variables. Results: Individuals with blood cadmium levels in the 3rd and 4th quartiles had a greater OR for hematuria than those in the 1st quartile group: 3rd quartile, 1.35 (1.019–1.777; P=0.037); 4th quartile, 1.52 (1.140–2.017; P=0.004). When blood cadmium was considered as a log-transformed continuous variable, the correlation between blood cadmium and hematuria was significant: OR, 1.97 (1.224–3.160; Ptrend=0.005). In contrast, no significant correlations between hematuria and blood lead or mercury were found in the multivariate analyses. Discussion: The present study shows that high cadmium exposure is associated with a risk of hematuria. -- Highlights: • A high level of blood cadmium is associated with a high risk of hematuria. • This correlation is independent of several confounding factors. • Blood levels of lead and mercury are not associated with risk of hematuria. • This is the first study on the correlation between cadmium exposure and hematuria risk

  11. Cadmium exposure induces hematuria in Korean adults

    Energy Technology Data Exchange (ETDEWEB)

    Han, Seung Seok [Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744 (Korea, Republic of); Kim, Myounghee, E-mail: dkkim73@gmail.com [Department of Dental Hygiene, College of Health Science, Eulji University, Gyeonggi-do 461-713 (Korea, Republic of); Lee, Su Mi [Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744 (Korea, Republic of); Lee, Jung Pyo [Department of Internal Medicine, Seoul National University Boramae Medical Center, Seoul 156-707 (Korea, Republic of); Kim, Sejoong [Department of Internal Medicine, Seoul National University Bundang Hospital, Gyeonggi-do 463-707 (Korea, Republic of); Joo, Kwon Wook [Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744 (Korea, Republic of); Lim, Chun Soo [Department of Internal Medicine, Seoul National University Boramae Medical Center, Seoul 156-707 (Korea, Republic of); Kim, Yon Su; Kim, Dong Ki [Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744 (Korea, Republic of)

    2013-07-15

    Introduction: Toxic heavy metals have adverse effects on human health. However, the risk of hematuria caused by heavy metal exposure has not been evaluated. Methods: Data from 4701 Korean adults were obtained in the Korean National Health and Nutritional Examination Survey (2008–2010). Blood levels of the toxic heavy metals cadmium, lead, and mercury were measured. Hematuria was defined as a result of ≥+1 on a urine dipstick test. The odds ratios (ORs) for hematuria were measured according to the blood heavy metal levels after adjusting for multiple variables. Results: Individuals with blood cadmium levels in the 3rd and 4th quartiles had a greater OR for hematuria than those in the 1st quartile group: 3rd quartile, 1.35 (1.019–1.777; P=0.037); 4th quartile, 1.52 (1.140–2.017; P=0.004). When blood cadmium was considered as a log-transformed continuous variable, the correlation between blood cadmium and hematuria was significant: OR, 1.97 (1.224–3.160; P{sub trend}=0.005). In contrast, no significant correlations between hematuria and blood lead or mercury were found in the multivariate analyses. Discussion: The present study shows that high cadmium exposure is associated with a risk of hematuria. -- Highlights: • A high level of blood cadmium is associated with a high risk of hematuria. • This correlation is independent of several confounding factors. • Blood levels of lead and mercury are not associated with risk of hematuria. • This is the first study on the correlation between cadmium exposure and hematuria risk.

  12. Hazards to wildlife from soil-borne cadmium reconsidered

    Science.gov (United States)

    Beyer, W.N.

    2000-01-01

    Cadmium is a toxic element that should be included in environmental risk assessments of contaminated soils. This paper argues, however, that hazards to wildlife from cadmium have often been overstated. The literature contains only meager evidence that wild animals have been seriously harmed by cadmium, even at severely contaminated sites. Although some researchers have reported that wildlife have accumulated concentrations of cadmium in their kidneys that were above suggested injury thresholds, the thresholds may be disputed, since they were well below the World Health Organization criterion of 200 mg/kg (wet weight) of cadmium in the renal cortex for protecting human health. Recent risk assessments have concluded that soil cadmium concentrations less than 1 mg/kg are toxic to soil organisms and wildlife, which implies that background concentrations of cadmium naturally found in soils are hazardous. An examination of the databases used to support these assessments suggested that the toxicity of cadmium has been exaggerated.

  13. 22 CFR 513.110 - Coverage.

    Science.gov (United States)

    2010-04-01

    ... GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (GRANTS) General § 513.110 Coverage. (a) These regulations... respect to participants and principals in the covered transactions and activities described in...

  14. 33 CFR 110.51 - Groton, Conn.

    Science.gov (United States)

    2010-07-01

    ... REGULATIONS Special Anchorage Areas § 110.51 Groton, Conn. The waters between an unnamed cove and Pine Island... the anchor of a vessel at anchor may be used. Fixed mooring pilings or stakes are prohibited....

  15. On the effect of thallium additions on cadmium amalgam potentials

    International Nuclear Information System (INIS)

    A study has been made of the influence of additives of thallium on potentials of cadmium amalgams with thallium contents of 10, 20, 30, and 40 at.% at 20, 40, 60, and 80 deg C. Additives of thallium have been found to shift the potential of cadmium amalgams towards the range of negative values which indicates an increase in the activity of cadmium. A possibility of calculation of the potential shift for heterogeneous cadmium amalgams on introducing thallium has been shown

  16. Recycling of Spent Nickel-Cadmium Batteries

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    A technique for recycling spent nickel-cadmium batteries, which makes separation of cadmium and nickel possible, is developed by laboratory-scale experiments. NH3-H2CO3 aqueous solution was used in this leaching technique. Since neutralization and/or solvent extraction were not required in the separation procedure of nickel and cadmium, the closed systemization of the process becomes possible. Experimental results show that, (1) if the NH3 concentration of leaching solution is sufficiently high and the ratio of H2CO3 to NH3 is properly adjusted, both Ni(OH)2 and Cd(OH)2 react with NH3 and quickly dissolve into leaching solution, and (2) Ni(OH)2 can be converted into insoluble NiO by calcination at 500€癈, and CdO from Cd(OH)2 by calcination maintains good solubility in NH3-H2CO3 aqueous solution. As a conclusion, the recycling technique characterized by two step leaching can be developed based on such changes in dissolution behavior by calcination. Meanwhile, the yields of 99.8% for nickel and 97.6% for cadmium are obtained, and the purities of recovered nickel and cadmium are 99.9% and 98.6%, respectively.

  17. Effect of anions on Toxicity of Cadmium Applied to MIcrobial Biomass in Red Soil

    Institute of Scientific and Technical Information of China (English)

    K.S.KHAN; XIEZHENGMIAO; 等

    1997-01-01

    A laboratory incubation experiment was conducted to elucidat the effects of associated anions on toxicity of cadmium applied to microbial biomass in the red soil. Cadmium was applied at six different levels,i.e.,O(background),5,15,30,60 and 100μg g-1 soil in the form of either cadmium acetate or cadmium chloride. Application of cadmium as cadmium acetate markedly reduced the soil microbial biomass carbon compared to cadmium applied as cadmium chlorde at all the tested levels.Similarly,organic carbon to biomass carbon ration in the soil was markedly increased by increasing the level of the cadmium in the soil as cadmium acetate,while the change wa much smaller in the case of cadmium chloride at the same cadmium levels.The results suggested that due consideration should be given to the source of cadmium while deciding the cadmium levles in experiments.

  18. Cadmium induces cadmium-tolerant gene expression in the filamentous fungus Trichoderma harzianum.

    Science.gov (United States)

    Cacciola, Santa O; Puglisi, Ivana; Faedda, Roberto; Sanzaro, Vincenzo; Pane, Antonella; Lo Piero, Angela R; Evoli, Maria; Petrone, Goffredo

    2015-11-01

    The filamentous fungus Trichoderma harzianum, strain IMI 393899, was able to grow in the presence of the heavy metals cadmium and mercury. The main objective of this research was to study the molecular mechanisms underlying the tolerance of the fungus T. harzianum to cadmium. The suppression subtractive hybridization (SSH) method was used for the characterization of the genes of T. harzianum implicated in cadmium tolerance compared with those expressed in the response to the stress induced by mercury. Finally, the effects of cadmium exposure were also validated by measuring the expression levels of the putative genes coding for a glucose transporter, a plasma membrane ATPase, a Cd(2+)/Zn(2+) transporter protein and a two-component system sensor histidine kinase YcbA, by real-time-PCR. By using the aforementioned SSH strategy, it was possible to identify 108 differentially expressed genes of the strain IMI 393899 of T. harzianum grown in a mineral substrate with the addition of cadmium. The expressed sequence tags identified by SSH technique were encoding different genes that may be involved in different biological processes, including those associated to primary and secondary metabolism, intracellular transport, transcription factors, cell defence, signal transduction, DNA metabolism, cell growth and protein synthesis. Finally, the results show that in the mechanism of tolerance to cadmium a possible signal transduction pathway could activate a Cd(2+)/Zn(2+) transporter protein and/or a plasma membrane ATPase that could be involved in the compartmentalization of cadmium inside the cell. PMID:26349455

  19. Cadmium-113m as a biogeochemical tracer for cadmium in Lake Michigan

    International Nuclear Information System (INIS)

    The Lake Michigan watershed has been sampled for 113mCd. This long-lived metastable isotope of cadmium allowed independent evaluation of cadmium distribution in this dynamic ecosystem. 113mCd analysis was not hampered by contamination or loss. These are problems which have plagued stable cadmium measurements. Sensitivity and specificity were necessary concerns. 113mCd has been preconcentrated from large samples in order to obtain sufficient activity for quantification. Specificity for the gross beta activity measured was secured in a rigorous ion exchange decontamination. Confirmation of the suspected 113mCd beta source was checked by reverse tracer analysis and modified Feather analysis range-energy relationships. The 113mCd activities confirm the expected semiconservative behavior for cadmium. This behavior manifests itself in a long residence time for cadmium in Lake Michigan. The inefficiency of outflow removal, the low sedimentation rate and the unquantified sediment resuspension and release of cadmium are factors contributing to this residence time. Steady state concentration of cadmium in Lake Michigan will increase if present input rates persist

  20. Mitochondrial Toxicity of Cadmium Telluride Quantum Dot Nanoparticles in Mammalian Hepatocytes

    OpenAIRE

    Nguyen, Kathy C; Rippstein, Peter; Tayabali, Azam F.; Willmore, William G.

    2015-01-01

    There are an increasing number of studies indicating that mitochondria are relevant targets in nanomaterial-induced toxicity. However, the underlying mechanisms by which nanoparticles (NPs) interact with these organelles and affect their functions are unknown. The aim of this study was to investigate the effects of cadmium telluride quantum dot (CdTe-QD) NPs on mitochondria in human hepatocellular carcinoma HepG2 cells. CdTe-QD treatment resulted in the enlargement of mitochondria as examined...

  1. Do cadmium, lead, and aluminum in drinking water increase the risk of hip fractures? A NOREPOS study.

    Science.gov (United States)

    Dahl, Cecilie; Søgaard, Anne Johanne; Tell, Grethe S; Flaten, Trond Peder; Hongve, Dag; Omsland, Tone Kristin; Holvik, Kristin; Meyer, Haakon E; Aamodt, Geir

    2014-01-01

    The aim of this study was to investigate relations between cadmium, lead, and aluminum in municipality drinking water and the incidence of hip fractures in the Norwegian population. A trace metals survey in 566 waterworks was linked geographically to hip fractures from hospitals throughout the country (1994-2000). In all those supplied from these waterworks, 5,438 men and 13,629 women aged 50-85 years suffered a hip fracture. Poisson regression models were fitted, adjusting for age, region of residence, urbanization, and type of water source as well as other possibly bone-related water quality factors. Effect modification by background variables and interactions between water quality factors were examined (correcting for false discovery rate). Men exposed to a relatively high concentration of cadmium (IRR = 1.10; 95 % CI 1.01, 1.20) had an increased risk of fracture. The association between relatively high lead and hip fracture risk was significant in the oldest age group (66-85 years) for both men (IRR = 1.11; 95 % CI 1.02, 1.21) and women (IRR = 1.10; 95 % CI 1.04, 1.16). Effect modification by degree of urbanization on hip fracture risk in men was also found for all three metals: cadmium, lead, and aluminum. In summary, a relatively high concentration of cadmium, lead, and aluminum measured in drinking water increased the risk of hip fractures, but the associations depended on gender, age, and urbanization degree. This study could help in elucidating the complex effects on bone health by risk factors found in the environment.

  2. Reduction of Cadmium Uptake of Rice Plants Using Soil Amendments in High Cadmium Contaminated Soil: A Pot Experiment

    Directory of Open Access Journals (Sweden)

    Dian Siswanto

    2013-05-01

    Full Text Available The aims of this study were to investigate the effect of agricultural residues on reducing cadmium uptake in rice plants. The rice plants growing on no cadmium/free cadmium soils (N, Cd soils (Cds, and Cd soils each amended with 1% w/w of coir pith (CP, coir pith modified with sodium hydroxide (CPm and corncob (CC under high cadmium contaminated soil with an average 145 mg Cd kg-1 soil were investigated. The results showed that the cumulative transpiration of rice grown in various treatments under high cadmium contaminated soil followed the order: Cds > CPm ≥ CP ≥ CC. These transpirations directly influenced cadmium accumulation in shoots and husks of rice plants. The CC and CP seemed to work to reduce the cadmium uptake by rice plants indicated by accumulated cadmium in the husk that were 2.47 and 7.38 mg Cd kg-1 dry weight, respectively. Overall, transpiration tended to drive cadmium accumulation in plants for rice grown in high cadmium contaminated soil. The more that plants uptake cadmium, the lower cadmium that remains in the soil.

  3. Dicty_cDB: CHR110 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHR110 (Link to dictyBase) - - - Contig-U16366-1 | Contig-U16429-1 CHR...110P (Link to Original site) CHR110F 651 CHR110Z 703 CHR110P 1334 - - Show CHR110 Library CH (Link to library) Clone ID CHR...366-1 | Contig-U16429-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CH/CHR1-A/CHR...110Q.Seq.d/ Representative seq. ID CHR110P (Link to Original site) Representative DNA sequence >CHR110 (CHR...110Q) /CSM/CH/CHR1-A/CHR110Q.Seq.d/ ATTAATTTTAATTTATATAAATTACCTTATTACTTAAAGATGACAACAAATAATCCATTT

  4. Dicty_cDB: CHP110 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHP110 (Link to dictyBase) - - - Contig-U10711-1 | Contig-U13105-1 CHP1...10P (Link to Original site) CHP110F 130 CHP110Z 390 CHP110P 500 - - Show CHP110 Library CH (Link to library) Clone ID CHP1...11-1 | Contig-U13105-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CH/CHP1-A/CHP1...10Q.Seq.d/ Representative seq. ID CHP110P (Link to Original site) Representative DNA sequence >CHP110 (CHP1...10Q) /CSM/CH/CHP1-A/CHP110Q.Seq.d/ TGTTGGCCTACTGGNACCTCCAACAAATAACAACCAACTTAGNATTTGTCAATTATATAT

  5. Bireactor Electronuclear Systems with Liquid Cadmium Valve

    CERN Document Server

    Bznuni, S A; Zhamkochyan, V M; ASosnin, A N; Polanski, A; Khudaverdyan, A H

    2002-01-01

    Three main types of bireactor electronuclear systems are discussed. From the point of view of assuring high level of functional characteristics and safety bireactor electronuclear systems with booster using enriched uranium (20 %) and with a liquid cadmium valve appears to be the most effective. It is shown by means of Monte-Carlo modeling that such operation conditions can be achieved which lead to the destruction of the intermediate cadmium layer making the systems supercritical (k_{eff}>1). One can avoid the problem by using a special design of the liquid cadmium valve. In comparison with other nuclear systems (critical reactors, one-reactor electronuclear systems) cascade electronuclear systems have essential advantages allowing the decrease of the proton beam current by one order of magnitude and providing at same time the necessary level of power generation and neutron flux. Availability of both the thermal and fast cones allows one to transmute not only transuranics but also the fission products - cesi...

  6. ELECTROKINETIC REMEDIATION STUDY FOR CADMIUM CONTAMINATED SOIL

    Directory of Open Access Journals (Sweden)

    P. Bala Ramudu

    2007-09-01

    Full Text Available This paper presents the results of an experimental research undertaken to evaluate different purging solutions to enhance the removal of cadmium from spiked contaminated field soil by electrokinetic remediation. Three experiments were conducted when soil was saturated with deionised water and subsequently deionised water, ammonium citrate and sodium citrate were used as purging solutions at anode end. One experiment was conducted when the soil was saturated with ammonium citrate and itself was used as the purging solution. Results showed that 49% reduction of cadmium concentration was achieved in the case of soil saturated (washed with ammonium citrate as well as purging solution also was ammonium citrate. The soil pH and washing solutions were the most important factors in controlling the removal of cadmium in electrokinetic remediation process.

  7. Increased cadmium and lead uptake of a cadmium hyperaccumulator tomato by cadmium-resistant bacteria.

    Science.gov (United States)

    He, Lin-Yan; Chen, Zhao-Jin; Ren, Gai-Di; Zhang, Yan-Feng; Qian, Meng; Sheng, Xia-Fang

    2009-07-01

    Two cadmium (Cd)-resistant strains Pseudomonas sp. RJ10 and Bacillus sp. RJ16 were investigated for their effects on the soil Cd and lead (Pb) solubilization and promotion of plant growth and Cd and Pb uptakes of a Cd-hyperaccumulator tomato. In the heavy metal-contaminated inoculated soil, the CaCl(2)-extractable Cd and Pb were increased by 58-104% and 67-93%, respectively, compared to the uninoculation control. The bacteria produced indole acetic acid, siderophore and 1-aminocyclopropane-1-carboxylate deaminase. Root elongation assay conducted on tomato under gnotobiotic conditions demonstrated increase in root elongation of inoculated tomato seedlings compared to the control plants. An increase in Cd and Pb contents of above-ground tissues varied from 92% to 113% and from 73% to 79% in inoculated plants growing in heavy metal-contaminated soil compared to the uninoculation control, respectively. These results show that the bacteria could be exploited for bacteria enhanced-phytoextraction of Cd- and Pb-polluted soils. PMID:19368973

  8. Treatment of cadmium dust with two-stage leaching process

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    The treatment of cadmium dust with a two-stage leaching process was investigated to replace the existing sulphation roast-leaching processes. The process parameters in the first stage leaching were basically similar to the neutralleaching in zinc hydrometallurgy. The effects of process parameters in the second stage leaching on the extraction of zincand cadmium were mainly studied. The experimental results indicated that zinc and cadmium could be efficiently recoveredfrom the cadmium dust by two-stage leaching process. The extraction percentages of zinc and cadmium in two stage leach-ing reached 95% and 88% respectively under the optimum conditions. The total extraction percentage of Zn and Cdreached 94%.

  9. Cadmium toxicity in the free-living nematode, Caenorhabditis elegans

    Energy Technology Data Exchange (ETDEWEB)

    Popham, J.D.; Webster, J.M.

    1979-10-01

    The effect of cadmium on the fecundity, growth, and fine structure of the free-living nematode Caenorhabditis elegans was studied. High concentrations of cadmium significantly decreased the fecundity and growth of these organisms. Electron microscopy showed that cadmium modifies the structure of the mitochondria in the esophagus and intestine, causes the formation of inclusion bodies in the nucleus of esophageal cells, and alters the morphology of cytosomes in the intestinal cells. The results suggest that the decreased fecundity and growth of cadmium-exposed C. elegans may be due to cadmium interfering with nutrient uptake or assimilation or both.

  10. Thermodynamic properties of cadmium in lead amalgam dilute solution

    International Nuclear Information System (INIS)

    Investigation of thermodynamic properties of cadmium dilute solutions in lead amalgam is carried out by means of electromotive force technique within 453-523 K temperature range. Cadmium thermodynamic functions are calculated: activity, activity ratio, Libbs partial energy and its excess value and integral characteristics, respectively. When changing cadmium content from 0.01 up to 0.1 χcd at T=473 K, logarithm of activity ratio does not depend on alloy composition, that is, Heury's law is fulfilled. Increase of cadmium content in amalgam results in the essential reduction of mercury and cadmium reaction

  11. Urinary excretion of cadmium and zinc among persons from Sweden

    Energy Technology Data Exchange (ETDEWEB)

    Elinder, C.G.; Kjellstrom, T.; Linnman, L.; Pershagen, G.

    1978-06-01

    Cadmium and zinc concentrations in the urine of 132 Swedes, including 50 pairs of identical twins, were measured. Atomic absorption spectrophotometry procedures were developed for the analysis. Cadmium concentration increased with age and was higher among smokers than among nonsmokers. Estimated 24-hr excretion of cadmium among nonsmokers increased from about 0.25 to 0.40 ..mu..g in persons from 20 to 70 years old. The 24-hr cadmium excretions among nonsmokers in different age-groups fitted better to total kidney burden than to daily cadmium intake from food. Zinc excretion, on the other hand, decreased after the age of 20.

  12. Cadmium telluride quantum dots advances and applications

    CERN Document Server

    Donegan, John

    2013-01-01

    Optical Properties of Bulk and Nanocrystalline Cadmium Telluride, Núñez Fernández and M.I. VasilevskiyAqueous Synthesis of Colloidal CdTe Nanocrystals, V. Lesnyak, N. Gaponik, and A. EychmüllerAssemblies of Thiol-Capped CdTe Nanocrystals, N. GaponikFörster Resonant Energy Transfer in CdTe Nanocrystal Quantum Dot Structures, M. Lunz and A.L. BradleyEmission of CdTe Nanocrystals Coupled to Microcavities, Y.P. Rakovich and J.F. DoneganBiological Applications of Cadmium Telluride Semiconductor Quantum Dots, A. Le Cign

  13. Elektrokemisk fjernelse af cadmium fra bioasker

    DEFF Research Database (Denmark)

    Pedersen, Anne Juul; Ottosen, Lisbeth M.; Simonsen, Peter;

    Posteren viser resultater fra elektrokemiske rensningsforsøg på bioasker udført i forbindelse med PSO projekt 5205 "Elektrokemisk fjernelse af cadmium fra bioasker i pilotskala og vurdering af mulighederne for nyttiggørelse af behandlet aske i beton".......Posteren viser resultater fra elektrokemiske rensningsforsøg på bioasker udført i forbindelse med PSO projekt 5205 "Elektrokemisk fjernelse af cadmium fra bioasker i pilotskala og vurdering af mulighederne for nyttiggørelse af behandlet aske i beton"....

  14. The morphology of the artery of heart and aorta after combined irradiation and cadmium and lead salts treatment

    Directory of Open Access Journals (Sweden)

    Ostrovskaya S.S.

    2007-01-01

    Full Text Available The purpose of the work was to study the morphology of the heart and aorta in combined action of irradiation with cadmium and lead. 60 Vistar line male rats divided into 6 groups were used. Rats of the 1,2, and 3 groups were treated by a total single gamma-irradiation in the dose 0,5 Gr. 3 months after irradiation they were treated with 1/10 LD50 in 1 ml 0,9% NaC1 chloride cadmium (1,4 groups and lead acetate (2,5 groups intraperitoneally during 10 with following 15-day regeneration period. Rats of the 3 and 6 groups irradiated and non-irradiated (the last group was a control one were treated 1 ml 0,9% of NaC1. In 10 and 15 days the heart and portion of the aorta at the level of valves were dissected for histologic examination. Combined action of irradiation, salts of cadmium and lead causes the increase of vessel index in heart arteries, thickening of aorta walls in rats that suggest that sclerosis of arteries develops. In cadmium intoxication this process accelerates predominantly in the vessels of a small caliber, while in lead intoxication – in large vessels. In both cases this process has reversible character. Combined action of irradiation and lead, irradiation and cadmium induces progressed development of sclerosis of arteries. We conclude that accelerated development of sclerosis of arteries and the aorta is one of the manifestation of potentiating effect of a combined influence of irradiation and heavy metals.

  15. Nuclear structure of 110Pd and 110Cd isobar by interacting boson model (ibm-1)

    International Nuclear Information System (INIS)

    This paper presents a computational study in the field of nuclear structure by interacting boson model (IBM) to represents very important step formed in the description of collective nuclear excitations and the properties of electromagnetic transition. The ground state energy bands and the reduced transition probabilities B(E2) ↓ up to 81+ level of even-even nuclei 110Pd and 110Cd have been calculated by interacting boson model (IBM-1) and compared with previous experimental values. The set of parameters used in this calculation is the best approximation that has been carried out so far. The ratio of the excitation energies of the first 4+ and the first 2+ excited states, R4/2, is also calculated and an achievable degree of agreement has been investigated in transitional symmetry U(5) - O(6) for 110Cd and O(6) for 110Pd nuclei. We have been compared B(E2) values of 110Pd and 110Cd nuclei with theoretically and experimentally and their systematic studies as a function of angular momentum (L). We have been studied systematically the ratios RL = E(L+) / E(21+) and R = B(E2 : L+- > (L - 2)+) / B(E2 : 2+ -> 0+) of those nuclei in the ground-state band. Moreover, we have compared the attention to the analogy between the rotational frequency in ordinary space and Fermi energy in gauge space between 110Pd and 110Cd nuclei.

  16. Cadmium exposure and pancreatic cancer in south Louisiana.

    Science.gov (United States)

    Luckett, Brian G; Su, L Joseph; Rood, Jennifer C; Fontham, Elizabeth T H

    2012-01-01

    Cadmium has been hypothesized to be a pancreatic carcinogen. We test the hypothesis that cadmium exposure is a risk factor for pancreatic cancer with a population-based case-control study sampled from a population with persistently high rates of pancreatic cancer (south Louisiana). We tested potential dietary and nondietary sources of cadmium for their association with urinary cadmium concentrations which reflect long-term exposure to cadmium due to the accumulation of cadmium in the kidney cortex. Increasing urinary cadmium concentrations were significantly associated with an increasing risk of pancreatic cancer (2nd quartile OR = 3.34, 3rd = 5.58, 4th = 7.70; test for trend P ≤ 0.0001). Potential sources of cadmium exposure, as documented in the scientific literature, found to be statistically significantly associated with increased risk of pancreatic cancer included working as a plumber, pipefitter or welder (OR = 5.88) and high consumption levels of red meat (4th quartile OR = 6.18) and grains (4th quartile OR = 3.38). Current cigarette smoking, at least 80 pack years of smoking, occupational exposure to cadmium and paints, working in a shipyard, and high consumption of grains were found to be statistically significantly associated with increased concentrations of urinary cadmium. This study provides epidemiologic evidence that cadmium is a potential human pancreatic carcinogen. PMID:23319964

  17. Cadmium Exposure and Pancreatic Cancer in South Louisiana

    Directory of Open Access Journals (Sweden)

    Brian G. Luckett

    2012-01-01

    Full Text Available Cadmium has been hypothesized to be a pancreatic carcinogen. We test the hypothesis that cadmium exposure is a risk factor for pancreatic cancer with a population-based case-control study sampled from a population with persistently high rates of pancreatic cancer (south Louisiana. We tested potential dietary and nondietary sources of cadmium for their association with urinary cadmium concentrations which reflect long-term exposure to cadmium due to the accumulation of cadmium in the kidney cortex. Increasing urinary cadmium concentrations were significantly associated with an increasing risk of pancreatic cancer (2nd quartile OR = 3.34, 3rd = 5.58, 4th = 7.70; test for trend P≤0.0001. Potential sources of cadmium exposure, as documented in the scientific literature, found to be statistically significantly associated with increased risk of pancreatic cancer included working as a plumber, pipefitter or welder (OR = 5.88 and high consumption levels of red meat (4th quartile OR = 6.18 and grains (4th quartile OR = 3.38. Current cigarette smoking, at least 80 pack years of smoking, occupational exposure to cadmium and paints, working in a shipyard, and high consumption of grains were found to be statistically significantly associated with increased concentrations of urinary cadmium. This study provides epidemiologic evidence that cadmium is a potential human pancreatic carcinogen.

  18. Study of cadmium electrochemical deposition in sulfate medium

    Energy Technology Data Exchange (ETDEWEB)

    Montiel, T.; Solorza, O.; Sanchez, H.

    2000-03-01

    The cadmium electrochemical deposition process from sulfate medium was studied by means of different electrochemical techniques in both stationary and nonstationary diffusion regimes. The kinetics of the electrochemical reduction of cadmium on solid cadmium electrodes was examined and the kinetic parameters are presented, as well as the diffusion coefficient derived from the different techniques. Temperature has an important effect on the cadmium reduction kinetics, and the activation energy of the process was evaluated. The electrochemical deposition of cadmium is a complex process due to the coexistence of adsorption and nucleation processes; the adsorbed electroactive species appears to be Cd{sup +2}, and a mechanism for cadmium electrodeposition on solid cadmium electrodes is proposed.

  19. Murine strain differences and the effects of zinc on cadmium concentrations in tissues after acute cadmium exposure

    Energy Technology Data Exchange (ETDEWEB)

    King, L.M. [ARS USDA, Germplasm and Gamete Physiology Lab., Beltsville, MD (United States); Anderson, M.B. [Dept. of Anatomy, Tulane Univ. School of Medicine, New Orleans, LA (United States); Sikka, S.C. [Dept. of Urology, Tulane Univ. School of Medicine, New Orleans, LA (United States); George, W.J. [Dept. of Pharmacology, Tulane Univ. School of Medicine, New Orleans, LA (United States)

    1998-10-01

    The role of strain differences in cadmium tissue distribution was studied using sensitive (129/J) and resistant (A/J) mice. These murine strains have previously been shown to differ in their susceptibility to cadmium-induced testicular toxicity. Cadmium concentration was measured in testis, epididymis, seminal vesicle, liver, and kidney at 24 h after cadmium chloride exposure (4, 10, and 20 {mu}mol/kg CdCl{sub 2}). The 129/J mice exhibited a significant increase in cadmium concentration in testis, epididymis, and seminal vesicle at all cadmium doses used, compared to A/J mice. However, cadmium concentrations in liver and kidney were not different between the strains, at any dose, indicating that cadmium uptake is similar in these organs at 24 h. These murine strains demonstrate similar hepatic and renal cadmium uptake but significantly different cadmium accumulation in the reproductive organs at 24 h. The mechanism of the protective effect of zinc on cadmium toxicity was studied by assessing the impact of zinc acetate (ZnAc) treatment on cadmium concentrations in 129/J mice after 24 h. Zinc pretreatment (250 {mu}mol/kg ZnAc), given 24 h prior to 20 {mu}mol/kg CdCl{sub 2} administration, significantly decreased the amount of cadmium in the testis, epididymis, and seminal vesicle of 129/J mice, and significantly increased the cadmium content of the liver after 24 h. Cadmium levels in the kidney were unaffected at this time. Zinc pretreatment also prevented the cadmium-induced decrease in testicular sperm concentration and epididymal sperm motility seen in 129/J mice. These findings suggest that the differences in the two murine strains may be attributed partly to the differential accumulation of cadmium in murine gonads. This may be caused by strain differences in the specificity of cadmium transport mechanisms. The protective role of zinc in cadmium-induced testicular toxicity in the sensitive strain may be due to an interference in the cadmium uptake by susceptible

  20. 10 CFR 110.62 - Order to show cause.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Order to show cause. 110.62 Section 110.62 Energy NUCLEAR... Enforcement § 110.62 Order to show cause. (a) In response to an alleged violation, described in § 110.60, the... cause: (1) Stating the alleged violation and proposed enforcement action; and (2) Informing the...

  1. 46 CFR 110.25-3 - Procedure for submitting plans.

    Science.gov (United States)

    2010-10-01

    .... Editorial Note: For Federal Register citations affecting § 110.25-3, see the list of CFR Sections Affected... 46 Shipping 4 2010-10-01 2010-10-01 false Procedure for submitting plans. 110.25-3 Section 110.25... PROVISIONS Plan Submittal § 110.25-3 Procedure for submitting plans. (a) The plans required by §...

  2. Effects of bacteria on cadmium bioaccumulation in the cadmium hyperaccumulator plant Beta vulgaris var. cicla L.

    Science.gov (United States)

    Chen, Su; Chao, Lei; Sun, Lina; Sun, Tieheng

    2013-01-01

    To investigate the effects of two cadmium-tolerant bacteria, Staphylococcus pasteuri (S. pasteuri X1) and Agrobacterium tumefaciens (A. tumefaciens X2), on cadmium uptake by the cadmium hyperaccumulator plant Beta vulgaris var. cicla L., a pot experiment with artificially contaminated soil was conducted. The results demonstrated that both cadmium-tolerant bacteria enhanced the dry weight of Beta vulgaris var. cicla L. The total dry weights of plants in the control CK20, S. pasteuri X1 and A. tumefaciens X2 treatments were 0.85, 1.13, and 1.38 g/pot, respectively. Compared with the control CK20 findings, the total dry weight of plants was increased by 32.8 and 61.1% after inoculation with S. pasteuri X1 and A. tumefaciens X2, respectively, indicating that A. tumefaciens X2 more strongly promoted the growth of Beta vulgaris var. cicla L. than S. pasteuri X1. In addition, inoculation with S. pasteuri X1 and A. tumefaciens X2 significantly (p < 0.05) promoted cadmium uptake by plants and improved the bioaccumulation of cadmium by the plants from the soil. Moreover, the inoculation of S. pasteuri X1 and A. tumefaciens X2 effectively facilitated the transfer of cadmium in the soil from the Fe-Mn oxide and residual fractions to the soluble plus exchangeable and weakly specially adsorbed fractions in the rhizosphere soils of plants. The bacterial enhancement of cadmium phytoavailability might provide a potential and promising method to increase the efficiency of phytoextraction. PMID:23488173

  3. CADMIUM EXPOSURE VIA FOOD CROPS: A CASE STUDY OF INTENSIVE FARMING AREA

    Directory of Open Access Journals (Sweden)

    Raagheni Munisamy

    2013-01-01

    Full Text Available Cadmium (Cd is ubiquitous in environment and may enter food chain through intense application of phosphate fertilizers to agricultural crops. A cross-sectional study was conducted at Kuala Terla and Blue Valley farming villages, Cameron Highlands to determine cadmium concentration in vegetables and soil and to determine the health risks among respondents. A total of 87 respondents were selected based on inclusive and exclusive criteria. A set of pre-tested questionnaires utilized to obtain socio-demographic information and to predict health risks faced by the respondents based on their vegetable ingestion rate. The Average Daily Dose (ADD and Target Hazard Quotient (THQ were determined in this study. Convenient sampling method was employed to obtain 15 paired soil and vegetable samples. Cadmium concentration in the samples was acid digested prior analysis using Flame Atomic Absorption Spectrophotometer (FAAS. The mean ± standard deviation concentrations of Cd in vegetable samples were 0.13±0.082 mg kg-1, within the acceptable range specified by Malaysia Food Regulation 1985 (1 mg kg-1. For sol samples, the mean ± standard deviation concentration of Cd was 2.78±2.83 mg kg-1. Eight out of 11 soil samples exceed the permissible limit of Cd outlined by The Dutch Standard (1 mg kg-1. The findings on THQ demonstrated that all respondents are within the acceptable non-carcinogenic health risk (THQ<1. The results also exhibit that there is no correlation between cadmium in soils and vegetables. There are unlikely potential adverse health impacts arising from Cd through vegetables consumption in this study. Respondents are advised to have a medical check-up in order to determine Cd body burden thus eliminating the risks of acquiring cadmium related diseases.

  4. Dicty_cDB: VFF110 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VF (Link to library) VFF110 (Link to dictyBase) - - - Contig-U10843-1 VFF110P (Link... to Original site) VFF110F 496 VFF110Z 306 VFF110P 802 - - Show VFF110 Library VF (Link to library) Clone ID VFF110 (Link to dict...yBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig Contig-U10843-1 Original site URL http://dict...AVKVMLKQVDQKTLTDF RKEVAIMSKIFHPNIVLFLGACTSTPGKLMICTELMKGNLESLL--- ---XIFKVXXNGGIXXQXIXXPQGKFQXXKSKXXRXKXLITG...VYKGRCRLKDVAVKVMLKQVDQKTLTDF RKEVAIMSKIFHPNIVLFLGACTSTPGKLMICTELMKGNLESLL--- ---qflklxxmxvfxxkxfxxpkvnskxxkv

  5. 1-10 Mbar Laser-Driven Shocks Using the Janus Laser Facility

    Energy Technology Data Exchange (ETDEWEB)

    Dunn, J; Price, D F; Moon, S J; Cauble, R C; Springer, P T; Ng, A

    2001-08-10

    We report preliminary results using the Lawrence Livermore National Laboratory (LLNL) Janus laser facility to generate high pressure laser-driven shocks in the 1-10 Mbar regime. These experiments address various issues, including shock steadiness, planarity, uniformity and low target preheat, important for making precision EOS measurements on a small (E < 250 J) laser facility. A brief description of the experimental techniques, target design and measurements will be given.

  6. Urinary cadmium and estimated dietary cadmium in the Women's Health Initiative.

    Science.gov (United States)

    Quraishi, Sabah M; Adams, Scott V; Shafer, Martin; Meliker, Jaymie R; Li, Wenjun; Luo, Juhua; Neuhouser, Marian L; Newcomb, Polly A

    2016-01-01

    Cadmium, a heavy metal dispersed in the environment as a result of industrial and agricultural applications, has been implicated in several human diseases including renal disease, cancers, and compromised bone health. In the general population, the predominant sources of cadmium exposure are tobacco and diet. Urinary cadmium (uCd) reflects long-term exposure and has been frequently used to assess cadmium exposure in epidemiological studies; estimated dietary intake of cadmium (dCd) has also been used in several studies. The validity of dCd in comparison with uCd is unclear. This study aimed to compare dCd, estimated from food frequency questionnaires, to uCd measured in spot urine samples from 1,002 participants of the Women's Health Initiative. Using linear regression, we found that dCd was not statistically significantly associated with uCd (β=0.006, P-value=0.14). When stratified by smoking status, dCd was not significantly associated with uCd both in never smokers (β=0.006, P-value=0.09) and in ever smokers (β=0.003, P-value=0.67). Our results suggest that because of the lack of association between estimated dCd and measured uCd, dietary estimation of cadmium exposure should be used with caution in epidemiologic studies.

  7. 21 CFR 110.110 - Natural or unavoidable defects in food for human use that present no health hazard.

    Science.gov (United States)

    2010-04-01

    ... use that present no health hazard. 110.110 Section 110.110 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION CURRENT GOOD MANUFACTURING... unavoidable defects in food for human use that present no health hazard. (a) Some foods, even when...

  8. RISK ASSESSMENT FOR CADMIUM IN PHOSPHATE FERTILIZERS

    Science.gov (United States)

    Cadmium induced renal tubular dysfunction occurred where subsistence rice farmers produced their lifetime dietary rice on Zn-mine waste contaminated soils in Japan and other Asian countries. Research has shown that polished rice Cd is greatly increased while grain Zn is not incre...

  9. Field scale behaviour of cadmium in soil.

    NARCIS (Netherlands)

    Boekhold, A.E.

    1992-01-01

    Although total heavy metal contents of soil are often used to express the degree of contamination, they are of little value to judge environmental effects. The main objective of this thesis was to develop and test methodologies with which environmental risks of cadmium pollution of field soils can b

  10. Mobiliteit van cadmium in de bodem

    NARCIS (Netherlands)

    Chardon, W.J.

    1984-01-01

    The adsorption of cadmium by twelve Dutch soils was investigated under widely varying circumstances. The adsorption can be described with the Freundlich equation; the parameters of this equation can be predicted using the properties of the soil (pH, organic carbon and clay content).The adsorption ap

  11. Cadmium isotope variations in the Southern Ocean

    NARCIS (Netherlands)

    Xue, Z.; Rehkämper, M.; Horner, T.J.; Abouchami, W.; Middag, R.; van de Flierd, T.; de Baar, H.J.W.

    2013-01-01

    Cadmium concentrations and isotope compositions were determined for 47 seawater samples from the high nutrient low chlorophyll (HNLC) zone of the Atlantic sector of the Southern Ocean. The samples include 13 surface waters from a transect of the Weddell Gyre and 3 depth profiles from the Weddell Sea

  12. Tracing Cadmium in the Environment: an Evolving Stable Isotope Approach

    Science.gov (United States)

    Bullen, T. D.; Bouse, R. M.; Brown, C. L.; Croteau, M.; Luoma, S. N.; Topping, B. R.

    2005-05-01

    Cadmium (Cd) is a trace constituent in rocks and waters, and like many transition metals is an essential dietary nutrient at low levels but highly toxic in elevated doses. In many respects, cadmium behaves chemically like calcium (Ca) and thus substitutes for Ca in liquid-solid partitioning reactions and generally follows Ca through biogeochemical cycles and metabolic processes. Cd is comprised of 8 stable isotopes, and given the isotopic systematics of environmental Ca it is likely that variations in the stable isotope composition of Cd in natural materials will result from both inorganic and biologic processes. In order to assess the potential of Cd isotope variations to reveal information about sources, metabolic and biogeochemical pathways and fates of environmental Cd, we have initiated a broad study of the stable isotope composition of Cd in a variety of natural and anthropogenically-influenced systems. As an example, here we report the results of the first systematic study of the stable isotope composition of Cd in biologic materials. We focused on the isotopic variability of Cd in tissues of two species of clam collected from the San Francisco Bay estuary, Potamocorbula amurensis which resides in brackish water and Corbicula fluminea which resides in fresh and slightly brackish water. Both clam species concentrate Cd in their soft and hard tissues. During both low-flow conditions in August and high-flow conditions in April, δ116Cd of soft tissues of Potamocorbula was consistently negative and increased down-estuary with increasing salinity (δ116Cd is defined as the per mil difference of the 116Cd/110Cd ratio between a sample and our standard, igneous rock BIR-1). Samples collected in August were systematically displaced to higher δ116Cd than those collected in April. Soft tissues of Corbicula collected in both August and April from upstream, fully fresh-water sampling sites had identical δ116Cd, while soft tissues of Corbicula collected from our site at

  13. Cadmium phytoextraction potential of different Alyssum species

    Energy Technology Data Exchange (ETDEWEB)

    Barzanti, R., E-mail: rbarzanti@supereva.it [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Colzi, I., E-mail: ilariacolzi@hotmail.it [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Arnetoli, M., E-mail: miluscia@gmail.com [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Gallo, A., E-mail: galloalessia@hotmail.com [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Pignattelli, S., E-mail: sara.pignattelli@gmail.com [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Gabbrielli, R., E-mail: gabbrielli@unifi.it [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Gonnelli, C., E-mail: cristina.gonnelli@unifi.it [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy)

    2011-11-30

    Highlights: Black-Right-Pointing-Pointer The possibility of using serpentine plants for phytoextraction of Cd was investigated. Black-Right-Pointing-Pointer Variation in Cd tolerance, accumulation and translocation in three Alyssum plants with different phenotypes were found. Black-Right-Pointing-Pointer Alyssum montanum showed higher Cd tolerance and accumulation than the Ni hyperaccumulator Alyssum bertolonii. Black-Right-Pointing-Pointer As for the kinetic parameters of the Cd uptake system, A. montanum presented a low apparent K{sub m} value. Black-Right-Pointing-Pointer The V{sub max} values were not significantly different among the plants. - Abstract: This work was planned for providing useful information about the possibility of using serpentine adapted plants for phytoextraction of cadmium, element scarcely represented in such metalliferous environment. To this aim, we investigated variation in cadmium tolerance, accumulation and translocation in three Alyssum plants with different phenotypes: Alyssum bertolonii, that is a serpentine endemic nickel hyperaccumulator, and two populations of Alyssum montanum, one adapted and one not adapted to serpentine soils. Plants were hydroponically cultivated in presence of increasing concentrations of CdSO{sub 4} for two weeks. For the metal concentration used in the experiments, the three different Alyssum populations showed variation in cadmium tolerance, accumulation and content. The serpentine adapted population of A. montanum showed statistically higher cadmium tolerance and accumulation than A. bertolonii and the population of A. montanum not adapted to serpentine soil thus deserving to be investigated for phytoextraction purposes. Furthermore, as for the kinetic parameters of the cadmium uptake system, A. montanum serpentine population presented a low apparent K{sub m} value, suggesting a high affinity for this metal of its uptake system, whereas the V{sub max} values were not significantly different among the

  14. Cadmium and Chrome Concentrations in Human Milk

    Directory of Open Access Journals (Sweden)

    Sima Nazarpour

    2014-04-01

    Full Text Available Introduction: Nutrition of children has the highest priority in any program aimed at children's health care. Milk contaminated with various toxic elements can have adverse effects on children's health. This study aimed to determine the concentration of heavy metals including cadmium(Cd and chromium (Cr of breast feeding women’s milk in Varamin. Methods: This is a cross sectional study. In the present study, chromium and cadmium levels in milk of 100 mothers attending clinics in the city of Varamin were measured in four to eight weeks after delivery, using atomic absorption spectrometry. Results: The mean values (±SD of Cd and Cr in human milk were 5±6.9 μg/ml and 3±2.7 μg/ml respectively. Result of Linear regression showed that cadmium levels were higher in breast milk of people living close to the factory or industrial center. Also, the chromium levels were higher in the breast milk of women in cases of: Smoking by spouses, consumption of imported rice, consumption of mineral water, and living close to the factory or an industrial center. Conclusion: This study showed that the relationship of some factors such as living near a factory or an industrial center, smoking by spouse, the type of consumed rice and water, with the level of cadmium and chromium. Cadmium and chromium levels of breast milk in this study were higher than the levels of these elements mentioned in the reviewed articles and international standard. Because some variables, such as living near a factory or an industrial center, smoking by spouse, the type of consumed rice and water can affect the amount of entering elements in breast milk. Actions can be taken to reduce or eliminate these variables in order to decrease the mentioned elements in human milk.

  15. 5 CFR 950.110 - Prohibited discrimination.

    Science.gov (United States)

    2010-01-01

    ... Section 950.110 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT (CONTINUED) CIVIL SERVICE..., handicap, or political affiliation is prohibited in all aspects of the management and the execution of the... part to participate in the CFC, merely because such organization is organized by, on behalf of, or...

  16. 27 CFR 9.110 - San Benito.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false San Benito. 9.110 Section... Benito. (a) Name. The name of the viticultural area described in this section is “San Benito.” (b) Approved maps. The appropriate maps for determining the boundaries of San Benito viticultural area are...

  17. 24 CFR 1710.110 - Roads.

    Science.gov (United States)

    2010-04-01

    ... (4) Who is responsible for road maintenance? If the roads are to be maintained by a public authority... for maintaining the roads and that, if maintenance is not performed, the roads may soon deteriorate... 24 Housing and Urban Development 5 2010-04-01 2010-04-01 false Roads. 1710.110 Section...

  18. 21 CFR 145.110 - Canned applesauce.

    Science.gov (United States)

    2010-04-01

    ... and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION CANNED FRUITS Requirements for Specific Standardized Canned Fruits § 145.110 Canned.... (1980), section 22.024, “Soluble Solids by Refractometer in Fresh and Canned Fruits, Jams,...

  19. Hepatoprotective activity of Moringa oleifera against cadmium toxicity in rats

    Directory of Open Access Journals (Sweden)

    Reetu Toppo

    2015-04-01

    Full Text Available Aim: The present investigation has been conducted to evaluate the hepatoprotective activity of Moringa oleifera against cadmium-induced toxicity in rats. Materials and Methods: For this study, 18 Wistar albino rats were taken. Control group, Group I rats were given cadmium chloride @ 200 ppm per kg and Group II rats were treated with M. oleifera extract @ 500 mg/kg along with cadmium chloride @ 200 ppm per kg (daily oral for 28 days. On 29th day, animals were slaughtered and various parameters were determined. Serum biomarkers, oxidative stress parameters, histomorphological examination were carried out with estimation of cadmium concentration in liver tissues. Results: Oral administration of cadmium chloride @ 200 ppm/kg for 28 days resulted in a significant increase in aspartate aminotransferase (AST, alanine transaminase (ALT, alkaline phosphatase (ALP, significant (p≤0.01 increase of lipid peroxidation (LPO and decrease in superoxide dismutase (SOD, and increase in cadmium accumulation in liver. Treatment with M. oleifera @ 500 mg/kg significantly (p<0.01 decreased the elevated ALP, AST, ALT, LPO levels and increase in SOD levels, and as compared to cadmium chloride treated group. However, there was no significant difference in cadmium concentration in liver when compared with cadmium chloride treated group. Conclusion: The study conclude that supplementation of M. oleifera (500 mg/kg, daily oral for 28 days has shown protection against cadmium-induced hepatotoxicity.

  20. Modelling of Cadmium Transport in Soil-Crop System

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    A model for simulating cadmium transport in a soil-plant system was built using a commercial simu lating program named Powersim on the basis of input-output processes happening in the soil-plant system.Convective and dispersive transport processes of cadmium in soil profile are embedded. Simulations on a daily base have been done up to a total simulating time of 250 years. Results show that applications of sewage sludge and fertilizer at the simulated rates would only cause slight cadmium accumulations in each layer of the soil, and cadmium accumulation would be levelling off, reaching an equilibrium concentrations layer by layer downward after certain time. The time scale to reach an equilibrium concentration varies from 10 years for the top three layers to over 250 years for the bottom layers. Plant cadmium uptake would increase from 52 ug m-2 under initial soil cadmium concentrations to 65 μg m-2 under equilibrium soil cadmium concentrations, which would not exceed the maximum allowable cadmium concentration in wheat grains. Main parameters which influence cadmium accumulation and transport in soil are total cadmium input, rainfall, evaporation, plant uptake and soil properties.

  1. Deficiency of p110δ Isoform of the Phosphoinositide 3 Kinase Leads to Enhanced Resistance to Leishmania donovani

    OpenAIRE

    Forough Khadem; Zhirong Mou; Dong Liu; Sanjay Varikuti; Abhay Satoskar; Uzonna, Jude E.

    2014-01-01

    Background Visceral leishmaniasis is the most clinically relevant and dangerous form of human leishmaniasis. Most traditional drugs for treatment of leishmaniasis are toxic, possess many adverse reactions and drug resistance is emerging. Therefore, there is urgent need for identification of new therapeutic targets. Recently, we found that mice with an inactivating knock-in mutation in the p110δ isoform of pi3k, (p110δd910a) are hyper resistant to L. major, develop minimal cutaneous lesion and...

  2. Investigation of the influence of cadmium processing on zinc gallium oxide:manganese thin films for photoluminescent and thin film electroluminescent applications

    Science.gov (United States)

    Flynn, Michael John

    Cadmium processing of ZnGa2O4 films provides a new fabrication route for phosphor powders and thin films. It relies on the enhanced diffusion due to the large vacancy concentration left by the sublimation of cadmium. Photoluminescent powders can be made with a single high temperature firing. Thin film devices can be processed at a significantly lower temperature, expanding the range of available substrates. Powders and thin films of ZnGa2O4:Mn were fabricated using starting materials in which between 0% and 50% of the ZnO was substituted by CdO. It was found that the emission spectra of the various compositions was unaffected by the change in composition, peaking at 504 nm, with the colour coordinates x = 0.08 and y = 0.69. The invariance of the emission spectrum is due to the spinel crystal structure exhibited by the compound. However, the maximum PL brightness was obtained from powders in which 10% of the ZnO had been substituted by CdO in the starting materials. The improved brightness is the result of better manganese incorporation which resulted from CdO sublimation during processing. This left a large vacancy concentration which enhanced the diffusion, and hence the manganese incorporation. In the case of thin films sputtered from cadmium processed targets, the composition of the films as deposited closely mirrored that of the target starting materials. The as deposited films were not luminescent and had to be annealed in vacuum in order to activate the manganese. EDX of these films showed that all of the cadmium had sublimed during the anneal. Very long anneal times also resulted in the loss of zinc. The decomposition products were amorphous or nanocrystalline. These films had an identical PL emission to the powders. The loss of cadmium correlated with the onset of bright 254 nm photoluminescence in the films, indicating that cadmium loss aided in the activation of the manganese. This was the result of the enhanced diffusion due to the large vacancy

  3. Assessment and management of risk to wildlife from cadmium

    International Nuclear Information System (INIS)

    Cadmium, a nonessential heavy metal that comes from natural and anthropogenic sources, is a teratogen, carcinogen, and a possible mutagen. Assessment of potential risk from cadmium requires understanding environmental exposure, mainly from ingestion, although there is some local exposure through inhalation. Chronic exposure is more problematic than acute exposure for wildlife. There is evidence for bioaccumulation, particularly in freshwater organisms, but evidence for biomagnification up the food chain is inconsistent; in some bird studies, cadmium levels were higher in species that are higher on the food chain than those that are lower. Some freshwater and marine invertebrates are more adversely affected by cadmium exposure than are birds and mammals. There is very little experimental laboratory research on the effects of cadmium in amphibians, birds and reptiles, and almost no data from studies of wildlife in nature. Managing the risk from cadmium to wildlife involves assessment (including ecological risk assessment), biomonitoring, setting benchmarks of effects, regulations and enforcement, and source reduction

  4. Study on electrokinetic remediation of cadmium contaminated soils

    Institute of Scientific and Technical Information of China (English)

    SHI Wen-xin; CUI Chong-wei; YU Shui-li; FENG Wei-ming

    2007-01-01

    Kaolinite from a lead-zinc mining district, which was spiked with cadmium, has been treated by electrokinetics to investigate effects of treatment time and applied voltage gradient. The results showed that the increased test duration had induced a higher removal rate of cadmium. Being treated for 7 days, cadmium was removed from kaolinite dramatically. It was also found that higher removal rate happened when a higher voltage gradient was applied and cadmium accumulated near the cathode because pH increased. Increase of pH near the cathode caused accumulation of cadmium. Moreover, it was observed that cation exchange membrane which was placed between kaolinite and cathode could make pH lower than the initial value and avoid the higher pH near the cathode. As a result, the high concentration accumulation of cadmium near the cathode was avoided.

  5. Research and Development of Cadmium Sulphoselenide Red Pigment

    Institute of Scientific and Technical Information of China (English)

    WU Jianfeng; LI Kun; XU Xiaohong; ZHANG Yaxiang; XU Xiaoyang; LAO Xinbin

    2015-01-01

    Cadmium sulphoselenide was synthesized continuous substitution solid solution and the only known pigment to yield bright red color on ceramic decoration. Encapsulated cadmium sulphoselenide pigments could yield abundant hues from yellow to red with high opacity at high temperature. The color generation has a linear function relation with the substitution rate. The encapsulation formation process of zirconium silicate encapsulated cadmium sulphoselenide was shown. Insufifcient encapsulation efifciency and potential hazard to human and environment had limited the industrial application of cadmium sulphoselenide red pigment. Ink-jet printing decoration required ifne size cadmium sulphoselenide red pigment on ceramic decoration. The review mainly focused on the synthesis techniques and industrial application of cadmium sulphoselenide red pigment.

  6. Surface structure and optical property of amorphous carbon nanotubes hybridized with cadmium selenide quantum dots

    Energy Technology Data Exchange (ETDEWEB)

    Tan, Kim Han, E-mail: kimhan8419@gmail.com; Johan, Mohd Rafie [University of Malaya, Nanomaterials Engineering Research Group, Advanced Materials Research Laboratory, Department of Mechanical Engineering (Malaysia)

    2013-09-15

    Amorphous carbon nanotubes ({alpha}-CNTs) were synthesized by a chemical reaction between ferrocene and ammonium chloride at low temperature. The as-synthesized {alpha}-CNTs were then hybridized with cadmium selenide quantum dots (CdSe QDs) through a simple chemical process. Raman spectra reveal the amorphous nature of the {alpha}-CNTs surface. X-ray diffraction pattern confirmed the amorphous phase of carbon and the formation of CdSe QDs crystalline phase. Field emission scanning electron microscopy and transmission electron microscopy (TEM and HRTEM) indicate that the successfully formed hybridized {alpha}-CNTs-CdSe QDs possess an average outer diameter in the range of 110-130 nm. The CdSe QDs fall in the size range of 15-40 nm. UV-visible spectroscopy showed quantum confinement effect due to the attachment of CdSe QDs on the surface of {alpha}-CNTs.

  7. In search of biomonitors for cadmium: cadmium content of wild Swedish fauna during 1973-1976.

    Science.gov (United States)

    Frank, A

    1986-12-01

    Forty-five species of birds and 22 species of mammals of the terrestrial and aquatic fauna, herbivores as well as carnivores, were investigated during the period 1973-1976 for cadmium-accumulating properties in order to find biomonitors for cadmium in the Swedish environment. The herbivores of the terrestrial fauna, birds as well as mammals, are preferred to carnivores, since they demonstrate generally higher renal Cd levels. The moose (Alces alces), roe deer (Capreolus capreolus) and hare (Lepus europeus and Lepus timidus) were found to be suitable as biomonitors because of their common occurrence and uniform geographical distribution. The eider duck (Somateria mollissima), although a short-distance migrating bird whose diet is composed mainly of mussels and crustaceans, and which lives along a great part of the Swedish coastline, is suggested as a biomonitor of cadmium for the aquatic environment. The accumulation rate of cadmium in the kidneys is rapid. Renal levels of cadmium in the parts per million range are reached 10 weeks after hatching. Juvenile birds should be collected for monitoring purposes before leaving their feeding domains at the end of the summer. PMID:3810147

  8. Growth of cadmium oxide whiskers on cadmium sulphide single crystals with copper as growth activator

    Energy Technology Data Exchange (ETDEWEB)

    Koparanova, N.; Simov, S. (Bylgarska Akademiya na Naukite, Sofia. Inst. po Fizika na Tvyrdoto Tyalo); Genchev, D. (Bylgarska Akademiya na Naukite, Sofia. Inst. za Yadrena Izsledvaniya i Yadrena Energetika); Metchenov, G. (Research Inst. of Criminalistics and Criminology, Sofia (Bulgaria))

    1985-02-01

    Some results on the growth and morphology of cadmium oxide whiskers, obtained on cadmium sulphide single crystals with copper as a growth activator, are presented in this work. Cadmium oxide whiskers have been obtained on brace 112-bar0 brace faces of cadmium sulphide plates with a copper layer deposited in advance. The whiskers grew during the annealing of the plates in a weak stream of technically pure argon at temperatures 670 to 730 deg C for 15 min to 3.5 h. Details about the procedure have been given elsewhere. The composition and morphology of the whiskers have been studied by an X-ray microanalyser JEOL 35 DDS and a scanning electron microscope JEOL, JSM 35. The optical microscopic observations have shown that after annealing, a gray-black granular layer is formed on the cadmium sulphide single crystals and this layer can easily be separated from the crystal substrate. Under the granular layer the crystal is heavily damaged. The whiskers grow on the granular layer and they are coloured yellow-brown or red-brown. The maximum whisker length attains several hundreds of micrometres and in some cases up to 1 mm or more.

  9. Oral cadmium exposure of adults in Germany. 1: Cadmium content of foodstuffs and beverages.

    Science.gov (United States)

    Müller, M; Anke, M; Hartmann, E; Illing-Günther, H

    1996-04-01

    The cadmium contents of 94 and 105 foodstuffs bought in six-fold repetition in 1988 and in nine-fold repetition in 1991, respectively were analysed within the framework of a market-basket study. These foodstuffs were typical of German eating habits. Additionally, 170 samples of drinking water were investigated. The cadmium concentrations of the foodstuffs were comparable with results of recent studies carried out in Europe and North America. Fruit, milk and dairy products, sugar and sugar-rich foodstuffs as well as beverages showed mean cadmium contents cakes and pastries as well as farinaceous products were within the range of 20-40 ng/g. The most important bread, cakes and pastries (wheat and rye bread, toasted bread, rolls) contained 25-35 ng/g. A median cadmium concentration of 0.2 micrograms/l was found in the drinking water. As expected, liver and kidneys showed the highest cadmium levels of 73 and 204 ng/g, respectively on average. PMID:8718751

  10. Hepatotoxicity of Cadmium and Roles of Mitigating Agents

    Directory of Open Access Journals (Sweden)

    Elias Adikwu

    2013-12-01

    Full Text Available There are increasing reports on cadmium associated hepatotoxicity, due to these reports this study reviewed relevant literature on cadmium associated hepatotoxicity with emphasis on doses, route of administration, salt forms (cadmium compounds and the roles of mitigating agents. Reports have shown that continuous exposure of the liver to cadmium has led to hepatotoxicity. Humans are generally exposed to cadmium by two main routes, inhalation and ingestion. In this study, evaluation of relevant literature showed that irrespective of route of administration and salt forms cadmium hepatotoxicity is dose and time dependent. Cadmium associated hepatotoxicity manifested through impaired functions of hepatic biomarkers (transaminases, enzymatic and non enzymatic antioxidants. Histopathological damage to liver architecture manifested as swelling of hepatocytes, focal necrosis, hepatocytes degeneration, dilatation of ribosomes, damage of membrane-bounded lysosomes, nuclear pyknosis and cytoplasm vacuolization. Deterioration of mitochondrial cristae, deposition of collagen fibrils, hypertrophy of kuffer cells, congestion in central veins and sinusoids, infiltration of mixed inflammatory cells and peripheral hemorrhage also occurred. Hepatotoxic effect of cadmium was mitigated by Vitamin C, Vitamin E, Manganese (11 Chloride, N-acetylcysteine and Selenium. Extracts of plant origin including Solanum tuberosum, Calycopteris floribunda Hibiscus sabdariffa mitigated cadmium induced hepatotoxicity. Chemical substances of animal origin including honey and camel milk were reported to have ameliorated cadmium induced hepatotoxicity. One of the mechanisms of cadmium induced hepatotoxicity is reported to be associated with the up regulation of reactive oxygen species (oxidative stress which caused oxidative damage to lipid contents of membranes and direct liver injury. Conclusion cadmium is dose and time dependently hepatotoxic irrespective of route of administration

  11. Experimental evidence for cadmium uptake via calcium channels in the aquatic insect Chironomus staegeri

    International Nuclear Information System (INIS)

    We used the chironomid Chironomus staegeri to investigate the mechanism of cadmium (Cd) uptake in aquatic insects. We exposed C. staegeri larvae to a low nominal Cd concentration (50 nM) for 3 days and measured the effects of calcium (Ca) concentration (0.1-10 mM Ca) as well as the Ca channel blockers lanthanum and verapamil on Cd accumulation. When Ca2+ concentrations were increased above a control (0.1 mM Ca2+) to 1-10 mM, Cd accumulation by larvae was inhibited by from 46 to 88%, respectively. A simple theoretical model of Cd-Ca competition for uptake sites fitted our observations well. Cadmium accumulation was significantly inhibited in a concentration-dependent manner by both La (73% at 10 μM and 92% at 100 μM) and verapamil (59% at 100 μM and 85% at 300 μM). Our findings represent strong evidence that Cd entry into these insects occurs through Ca channels. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  12. Gender Difference of Cadmium-induced Renal Tubular Dysfunction for Inhabitants in Toyama,Japan

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Objective The aim of the present study was to compare the gender differencefor cadmium-induced renal tubular dysfunction between the male and female inhabitants. MethodsUrinary β2-microglobulin was measured in 299 male (94%) and 342 female (92%) inhabitants aged54 - 72 years,and the development of renal tubular dysfunction for 11 years was studied in the 62married couples from them. Results A significantly higher cumulative incidence was found in bothmen and women in cudmium-polluted area,showing 68. 4% in men and 64.8% in women compared to15.3 % in men and 5.9 % in women in the reference areas. Relative risk of renal tubular dysfunctionin females (11.0) was higher than males (4.5). The ratios of urinary β2-nicroglobulin and glucosewere higher in women than those in men in both the cadmium-polluted areas and the reference areas.Conclusion Although almost identical incidences were detected between men and wonen, the changesin excretion of β2-microglobulin and glucose was greater in women than those in men. These findings sug-gest that renal tubular dysfunction might be more progressive in women than that in men.

  13. Rac1-mediated membrane raft localization of PI3K/p110β is required for its activation by GPCRs or PTEN loss

    Science.gov (United States)

    Cizmecioglu, Onur; Ni, Jing; Xie, Shaozhen; Zhao, Jean J; Roberts, Thomas M

    2016-01-01

    We aimed to understand how spatial compartmentalization in the plasma membrane might contribute to the functions of the ubiquitous class IA phosphoinositide 3-kinase (PI3K) isoforms, p110α and p110β. We found that p110β localizes to membrane rafts in a Rac1-dependent manner. This localization potentiates Akt activation by G-protein-coupled receptors (GPCRs). Thus genetic targeting of a Rac1 binding-deficient allele of p110β to rafts alleviated the requirement for p110β-Rac1 association for GPCR signaling, cell growth and migration. In contrast, p110α, which does not play a physiological role in GPCR signaling, is found to reside in nonraft regions of the plasma membrane. Raft targeting of p110α allowed its EGFR-mediated activation by GPCRs. Notably, p110β dependent, PTEN null tumor cells critically rely upon raft-associated PI3K activity. Collectively, our findings provide a mechanistic account of how membrane raft localization regulates differential activation of distinct PI3K isoforms and offer insight into why PTEN-deficient cancers depend on p110β. DOI: http://dx.doi.org/10.7554/eLife.17635.001

  14. Micronutrient Cadmium in the Oceans, Distribution and Stable Isotope Fractionation

    Science.gov (United States)

    Abouchami, W.; Galer, S. J.; Feldmann, H.; Andreae, M. O.; de Baar, H.; Middag, R.; Klunder, M.; Laan, P.

    2012-12-01

    the vertical distribution of Cd concentration and isotope ratios in the water column, as these reflect the combined effects of physical, chemical, and biological processes that control the export of carbon to the deep ocean. Cadmium concentration depth profiles show typical nutrient-like distributions with differences in the Cd-maxima depths, consistent with those of phosphate and reveal changes in the depth of re-mineralization of Cd and PO4 across the Antarctic. A strong surface-to-depth isotope gradient is seen in all profiles with high ɛ112/110Cd values in the mixed layer of up to +4.5 and low values of about +1.2, identifying deep Antarctic waters with a Cd-light isotope signature. The depth zone of maximum changes in Cd concentration and ɛ112/110Cd values coincide with that of the apparent oxygen utilization, a tracer of carbon export, demonstrating the role of Cd as an important nutrient for marine ecosystems. Examination of property-property co-variations provide new insights into the cycling of Cd and other trace metals which will be discussed, with emphasis on the significance of the global oceanic Cd-phosphate correlation and use and pitfalls of Cd isotopes as tracer of past changes in the strength of the biological carbon pump and the thermohaline circulation. [1] Boyle et al. (1976), Nature 263, 42-44. [2] Bruland (1980), EPSL, 47, 176-198. [3] Abouchami et al. (2011), EPSL 305, 83-91.

  15. STS-110 Flight Day 8 Highlights

    Science.gov (United States)

    2002-01-01

    On Flight Day 8 of the STS-110 mission, the combined members of the Atlantis STS-110 crew and the International Space Station (ISS) Expedition 4 crew, Commanders Michael J. Bloomfield and Yury I. Onufrienko, respectively, answer questions posed to them by press members on the ground. Topics covered include: challenges of long term space habitation, adequacy of training for the on-orbit construction of the space station, details on the Mobile Transporter (MT) railcar system. Footage of the MT directly precedes and follows the extended question and answer portion of the video. The MT is seen from a variety of angles, as it slowly moves from Workstation 4 to Workstation 5 in order to test its ability to grapple to a fixed point along the track. The MT will eventually be used as a base for the robot arm in order to perform maintenance and assembly tasks on the ISS.

  16. Chemisorption of Guanine on Cu(110)

    Science.gov (United States)

    Matos, Jeronimo; Kara, Abdelkader

    2011-03-01

    We use density functional theory (PBE) to calculate the adsorption of a guanine molecule on Cu(110). At saturation coverage, guanine adsorbs tilted with the oxygen atom strongly bound to one of the surface atoms at a height of 2.12 Å above this surface atom with a binding energy of 430 meV/molecule. The substrate top layer atoms show a buckling of 0.22 Å , while the molecule experiences a twist from the flat configuration in the gas phase. The dz 2 state of the copper atom -that is bound to the oxygen atom- presents an enhancement in its density near the Fermi level. We calculated a drop in the work function of 0.34 eV upon adsorption of guanine on Cu(110). These effects classify this system as chemisorption.

  17. Assessment of soil contamination. Measuring devices for arsenic, berryllium, lead, cadmium, mercury and selenium. Wirkung von Bodenkontaminationen. Messlatten fuer Arsen, Beryllium, Blei, Cadmium, Quecksilber und Selen

    Energy Technology Data Exchange (ETDEWEB)

    Blumenbach, D.; Kloke, A.; Luehr, H.P.

    1991-12-01

    To assess soil contamination with respect to the suitability of the site concerned, it is essential to obtain knowledge of the relationship between soil contamination levels and the effect of the contaminants on a targets meriting protection (e.g. human beings, plants, soil organisms). In this final report, data obtained from literature on the inorganic pollutants arsenic, lead, cadmium, mercury, selenium and beryllium are compiled, and for selected targets an overview is given of the damage occurring at the various concentration levels studies. The present data, together with information on the envisaged use of the site and on soil properties influencing the pollutant's transport to the protected target, can be used to assess soil quality. Threshold values for use in decision-making cannot be derived directly from the presented data, as such data can only convey a picture of the range of the harmful concentrations given in the literature. (orig.).

  18. studies on the use of organic and inorganic ion exchangers for separation of indium(III) from cadmium(II) using analytical methods

    International Nuclear Information System (INIS)

    Organic and inorganic ion exchangers have many applications not only in the industrial, environmental and the nuclear fields but also in the separation of metal ions. This may be returned to its high measured capacity, high selectivity for some metal ions, low solubility, high chemical radiation stability and easy to use.Indium and cadmium are produced from cyclotron target where the solvent extraction represents an ordinary method for separation of indium and cadmium from its target. In the present work, More than chromatographic columns were successfully used for the separation and recovery of indium(III) and cadmium(II) ions from di-component system in aqueous solution using organic and inorganic ion exchangers. The work was carried out in three main parts;1- In the first part, the commercial resin (Dowex50w-x8) was used for the separation of indium from cadmium. The effect of pH, the weight of resin, and equilibrium time on the sorption process of both metal ions were determined. It was found that the adsorption percentage was more than 99% at pH 4 (as optimum pH value) using batch experiment. The results show that indium was first extracted while cadmium is slightly extracted at this pH value. The recovery of indium and cadmium is about 98% using hydrochloric acid as best eluent. The ion exchange/complexing properties of Dowex50w-x8 resin containing various substituted groups towards indium and cadmium cations were investigated.2- In the second part, Zn(II)polymethacrylates, and poly (acrylamide-acrylic acid), as synthetic organic ion exchangers were prepared by gamma irradiation polymerization technique of the corresponding monomer at 30 kGy. The obtained organic resins were mixed with indium ions to determine its capacity in aqueous solutions using batch experiment.

  19. Extraction-photometric determination of cadmium in meat products

    Energy Technology Data Exchange (ETDEWEB)

    Krylova, A.N.; Malyarova, M.A.; Zhulenko, V.N.

    1986-06-01

    As a result of industrial discharges, burning of solid and liquid fuels, and recycling of metal scrap, cadmium compounds enter the atmosphere and drop into the water and soil causing contamination. In this paper, a method was developed for determining cadmium in meat products. It involves wet ashing the sample, extractive separation of the cadmium as the diethyldithiocarbamate, reextraction, and determination as cadmium dithizonate or as a complex with 2,2'-dipyridyl. The detection limit with dithizone is 0.005 mg/kg and with 2,2'-dipyridyl 0.05 mg/kg. An analysis is shown to take less than 60 minutes.

  20. Cadmium elemination from phosphoric acid by ionic flotation

    International Nuclear Information System (INIS)

    The ion flotation process for the recovery of cadmium from wet phosphoric acid (30%P2O5) has been studied. This technique combines a chemical recation between the collector and the cadmium to form a precipitate (sublate) which is carried to the surface of the solution by air bubbles. the resulting foam containing the cadmium may then separated from solution. The influence of parameters such as collector and cadmium concentration as well as iron content have been investigated for the case a synthetic acid (30% P2O5). The result have been applied to the industrial phosphoric acid produced from Djebel Onk's phosphates (Algeria)

  1. Bioremoval of cadmium by lemna minor in different aquatic conditions

    Energy Technology Data Exchange (ETDEWEB)

    Uysal, Yagmur [Dept. of Environmental Engineering, Kahramanmaras Sutcu Imam University, Kahramanmaras (Turkey); Taner, Fadime [Dept. of Environmental Engineering, Mersin University, Mersin (Turkey)

    2010-04-15

    This study was undertaken to determine the cadmium removal efficiency of Lemna minor when it was used for treatment of wastewater having different characteristics, i. e., pH, temperature and cadmium concentration. Plants were cultivated in different pH solutions (4.5-8.0) and temperatures (15-35 C) in the presence of cadmium (0.1-10.0 mg/L) for 168 h. The amount of biomass obtained in the study period, the concentrations of cadmium in the tissues and in the media and net uptake of cadmium by Lemna have been determined for each condition. The percentages of cadmium uptake (PMU) and bioconcentration factors (BCF) were also calculated. The highest accumulation was obtained for the highest cadmium concentration of 10.0 mg Cd/L as 11.668 mg Cd/g at pH 6.0, and as 38.650 mg Cd/g at 35 C and pH 5.0. The cadmium accumulation gradually increased with initial concentration of the medium, but the opposite trend was observed for the PMU. However, the maximum PMU was obtained as 52.2% in the solution with the lowest concentration of 0.1 mg Cd/L. A mathematical model was used to describe the cadmium uptake and the equation obtained was seen to fit the experimental data very well. (Abstract Copyright [2010], Wiley Periodicals, Inc.)

  2. Effects of Cadmium on BMP Induced Bone Formation

    Institute of Scientific and Technical Information of China (English)

    陈秋生; 徐顺清

    2003-01-01

    To demonstrate the direct effects of cadmium on activities of bone morphogenetic protein (BMP), a complex containing BMP and cadmium chloride (CdCl2) was implanted beneath the abdominal skin of young male Wistar rats. The activity of BMP was studied by observing the histological changes, and measuring the activity of alkaline phosphatase (ALP) and acid phosphatase (ACP) and calcium content of the implants at different time points. Our results showed that during bone formation induced by BMP, cadmium inhibited the activities of osteoblasts and osteoclasts, and slowed the deposition of calcium. It is concluded that cadmium can directly affect biological activities of BMP directly.

  3. β—Correction Spectrophotometric Determination of Cadmium with Cadion

    Institute of Scientific and Technical Information of China (English)

    郜洪文

    1995-01-01

    Cadmium has been determined by β-correction spectrophotometry with cadion,p-nitrobenzenediazoaminoaz-obenzone,and a non-ionic surfactant,tuiton X-100.The real absorbance of a Cd-cadion chelate in the colored solution can be accurately determined and the complex-ratio of cadion with Cd(II) has been worked out to be 2.Beer's law is obeyed over the concentration range of 0-0.20mg/1 cadmium and the detec-tion limit for cadmium is only 0.003mg/1.Satisfactory experimental results are presented with respect to the determination of trace cadmium in wastewaters.

  4. Nuclear target development

    Energy Technology Data Exchange (ETDEWEB)

    Greene, J.P.; Thomas, G.E.

    1995-08-01

    The Physics Division operates a target development laboratory that produces thin foil targets needed for experiments performed at the ATLAS and Dynamitron accelerators. Targets are not only produced for the Physics Division but also for other divisions and occasionally for other laboratories and universities. In the past year, numerous targets were fabricated by vacuum evaporation either as self-supporting foils or on various substrates. Targets produced included Ag, Au, {sup 10,11}B, {sup 138}Ba, Be, {sup 12}C, {sup 40}Ca, {sup 116}Cd, {sup 155,160}Gd, {sup 76}Ge, In, LID, {sup 6}LiH, Melamine, Mg, {sup 142,150}Nd, {sup 58}Ni, {sup 206,208}Pb, {sup 194}Pt, {sup 28}Si, {sup 144,148}Sm, {sup 120,122,124}Sn, Ta, {sup 130}Te, ThF{sub 4}, {sup 46,50}Ti, TiH, U, UF{sub 4}, {sup 182}W and {sup 170}Yb. Polypropylene and aluminized polypropylene, along with metallized Mylar were produced for experiments at ATLAS. A number of targets of {sup 11}B of various thickness were made for the DEP 2-MeV Van de Graff accelerator. An increased output of foils fabricated using our small rolling mill included targets of Au, C, {sup 50}Cr, Cu, {sup 155,160}Gd, Mg, {sup 58}Ni, {sup 208}Pb, {sup 105,110}Pd. Sc, Ti, and {sup 64,66}Zn.

  5. Elektrokemisk fjernelse af cadmium fra bioasker

    DEFF Research Database (Denmark)

    Pedersen, Anne Juul; Ottosen, Lisbeth M.; Simonsen, Peter;

    Hosliggende rapport formidler resultaterne fra PSO-projektet: ”Elektrokemisk fjernelse af cadmium fra bioasker” (PSO-F&U 3206), finansieret af Elkraft System og Energi E2 A/S. Projektet blev gennemført i perioden 01.05.2003 – 30.06.2004, og partnerne var Energi E2 A/S, BYG-DTU og Krüger A/S, med...... BYG-DTU som den primært udførende part. Projektets formål var at undersøge, om den elektrodialytiske rensningsmetode kunne bruges til at reducere indholdet af cadmium i asker fra biobrændsel (f.eks. træflis og halm) med henblik på nyttiggørelse af askerne. Projektet havde nær sammenhæng med det...

  6. Anomalous Nernst Effect with Magnetocrystalline Anisotropy (110)

    Science.gov (United States)

    Chesman, Carlos; Costa Neto, Jose; Department of Physics-UFRN Team

    2014-03-01

    When a ferromagnetic material is submitted to a temperature gradient and the magnetic field generates voltage on the edges of the samples, this is called the Anomalous Nernst Effect (ANE). The Heusler alloys that currently exhibit this effect are the most promising for spintronics and spin caloritronics. In this study we perform a theoretical investigation of voltage curves associated to the ANE, when the material displays magnetocrystalline anisotropy for experimental results in two configurations, ANE versus applied magnetic field and planar angle variations of ANE. We analyzed three types of magnetocrystalline anisotropy: cubic anisotropy (100) with C4 symmetry, uniaxial anisotropy with C2 symmetry and cubic anisotropy (110). The aim was to prove that cubic anisotropy (110) is equivalent to anisotropy (100) combined with uniaxial anisotropy. Theoretical fitting of experimental ANE data demonstrates this total equivalence and that a new interpretation with the use of cubic anisotropy (110) may be due to the atomic arrangement of the so-called full-Heusler. Comparative analyses of Co2FeAl and Co2MnGe alloys will be presented. CNPq, CAPES, FAPERN.

  7. Electron mobility in mercury cadmium telluride

    Science.gov (United States)

    Patterson, James D.

    1988-01-01

    A previously developed program, which includes all electronic interactions thought to be important, does not correctly predict the value of electron mobility in mercury cadmium telluride particularly near room temperature. Part of the reason for this discrepancy is thought to be the way screening is handled. It seems likely that there are a number of contributors to errors in the calculation. The objective is to survey the calculation, locate reasons for differences between experiment and calculation, and suggest improvements.

  8. Prevention of cadmium bioaccumulation by herbal adaptogens

    OpenAIRE

    K Bharavi; A. Gopala Reddy; G S Rao; Ravi Kumar, P.; D Srinivas Kumar; P Prabhu Prasadini

    2011-01-01

    Objectives : To evaluate the effect of various herbal adaptogens such as shade-dried powders of Withania somnifera, Ocimum sanctum, Asperagus recemosus, Andrographis paniculata, Asphaltum panjabinum (Shilajith), Gymnema sylvestre, Spirulina platensis, and Panex ginseng on cadmium (Cd)-induced oxidative stress and its accumulation in broiler chicken. Materials and Methods : A total of 80 male broiler chicks of day old age were randomly assigned to 10 equal groups. Group 1 birds were fed wi...

  9. ELECTROKINETIC REMEDIATION STUDY FOR CADMIUM CONTAMINATED SOIL

    OpenAIRE

    P. Bala Ramudu; R. P. Tiwari; Srivastava, R. K.

    2007-01-01

    This paper presents the results of an experimental research undertaken to evaluate different purging solutions to enhance the removal of cadmium from spiked contaminated field soil by electrokinetic remediation. Three experiments were conducted when soil was saturated with deionised water and subsequently deionised water, ammonium citrate and sodium citrate were used as purging solutions at anode end. One experiment was conducted when the soil was saturated with ammonium citrate and itself wa...

  10. 28 CFR 34.110 - Management of peer reviews.

    Science.gov (United States)

    2010-07-01

    ... Section 34.110 Judicial Administration DEPARTMENT OF JUSTICE OJJDP COMPETITION AND PEER REVIEW PROCEDURES Peer Review § 34.110 Management of peer reviews. A technical support contractor may assist in managing the peer review process....

  11. Bioavailability of cadmium from linseed and cocoa

    DEFF Research Database (Denmark)

    Hansen, Max; Rasmussen, Rie Romme; Sloth, Jens Jørgen

    2014-01-01

    for the food authorities in order to give correct advises to the population. The aim of this study was to investigate the bioavailability of cadmium from whole linseed, crushed linseed, cocoa and cadmium chloride in rats. An experiment where 40 rats were divided into 4 groups and a control group and dosed...... with whole linseed, crushed linseed, cocoa and CdCl2 for 3 weeks was performed. Linseed or cocoa made up 10% of the feed (by weight) and was added as a replacement for carbohydrate source. The rats were dosed for 3 weeks and the cadmium content in the rats' kidneys was measured by ICPMS as a biomarker...... be measured in the kidney compared to the calculated total intake was as follows: Control 2.0 %, Crushed linseed 0.9 %, whole linseed, 1.5 %, cocoa 0.7 % and CdCl2 4.6 %. Based on this study it could not be concluded that the bioavailability in rats form whole linseed is lower that for crushed linseed...

  12. Cadmium biosorption rate in protonated Sargassum biomass

    Energy Technology Data Exchange (ETDEWEB)

    Yang, J.; Volesky, B. [McGill Univ., Montreal, Quebec (Canada). Dept. of Chemical Engineering

    1999-03-01

    Biosorption of the heavy metal ion Cd{sup 2+} by protonated nonliving brown alga Sargassum fluitans biomass was accompanied by the release of hydrogen protons from the biomass. The uptake of cadmium and the release of proton matched each other throughout the biosorption process. The end-point titration methodology was used to maintain the constant pH 4.0 for developing the dynamic sorption rate. The sorption isotherm could be well represented by the Langmuir sorption model. A mass transfer model assuming the intraparticle diffusion in a one-dimensional thin plate as a controlling step was developed to describe the overall biosorption rate of cadmium ions in flat seaweed biomass particles. The overall biosorption mathematical model equations were solved numerically yielding the effective diffusion coefficient D{sub e} about 3.5 {times} 10{sup {minus}6} cm{sup 2}/s. This value matches that obtained for the desorption process and is approximately half of that of the molecular diffusion coefficient for cadmium ions in aqueous solution.

  13. Soil ecotoxicity assessment using cadmium sensitive plants

    International Nuclear Information System (INIS)

    The crop plants, sorghum and cucumber, can be used as indicator species to assess ecotoxicity of soils contaminated by cadmium. - Four crop plant species (sweet corn, Zea may; wheat, Triticum aestivum; cucumber, Cucumis sativus; and sorghum, Sorghum bicolor) were tested to assess an ecotoxicity in cadmium-amended soils. The measurement endpoints used were seed germination and seedling growth (shoot and root). The presence of cadmium decreased the seedling growth. The medium effective concentration values (EC50) for shoot or root growth were calculated by the Trimmed Spearman-Karber method. Due to the greater accumulation of Cd to the roots, root growth was a more sensitive endpoint than shoot growth. Bioavailability and transport of Cd within plant were related to concentration and species. The ratio of bioaccumulation factor (BAF) in the shoots to the roots indicated high immobilization of Cd in the roots. Seed germination was insensitive to Cd toxicity, and is not recommended for a suitable assay. Among the test plants and test endpoints, root growth of sorghum and cucumber appears to be a good protocol to assess ecotoxicity of soils contaminated by Cd

  14. Soil ecotoxicity assessment using cadmium sensitive plants

    Energy Technology Data Exchange (ETDEWEB)

    An, Youn-Joo

    2004-01-01

    The crop plants, sorghum and cucumber, can be used as indicator species to assess ecotoxicity of soils contaminated by cadmium. - Four crop plant species (sweet corn, Zea may; wheat, Triticum aestivum; cucumber, Cucumis sativus; and sorghum, Sorghum bicolor) were tested to assess an ecotoxicity in cadmium-amended soils. The measurement endpoints used were seed germination and seedling growth (shoot and root). The presence of cadmium decreased the seedling growth. The medium effective concentration values (EC50) for shoot or root growth were calculated by the Trimmed Spearman-Karber method. Due to the greater accumulation of Cd to the roots, root growth was a more sensitive endpoint than shoot growth. Bioavailability and transport of Cd within plant were related to concentration and species. The ratio of bioaccumulation factor (BAF) in the shoots to the roots indicated high immobilization of Cd in the roots. Seed germination was insensitive to Cd toxicity, and is not recommended for a suitable assay. Among the test plants and test endpoints, root growth of sorghum and cucumber appears to be a good protocol to assess ecotoxicity of soils contaminated by Cd.

  15. Reduction of Cadmium Uptake of Rice Plants Using Soil Amendments in High Cadmium Contaminated Soil: A Pot Experiment

    OpenAIRE

    Dian Siswanto; Parinda Suksabye; Paitip Thiravetyan

    2013-01-01

    The aims of this study were to investigate the effect of agricultural residues on reducing cadmium uptake in rice plants. The rice plants growing on no cadmium/free cadmium soils (N), Cd soils (Cds), and Cd soils each amended with 1% w/w of coir pith (CP), coir pith modified with sodium hydroxide (CPm) and corncob (CC) under high cadmium contaminated soil with an average 145 mg Cd kg-1 soil were investigated. The results showed that the cumulative transpiration of rice grown in various treatm...

  16. Influence of a high level of dietary cadmium on cadmium content in milk, excretion, and cow performance

    Energy Technology Data Exchange (ETDEWEB)

    Miller, W.J.; Lampp, B.; Powell, G.W.; Salotti, C.A.; Blackmon, D.M.

    1967-01-01

    Three Holstein cows were each given 3.0 g of cadmium daily (two equal doses) for two weeks by gelatin capsules. There was a sharp drop in concentrate consumption for the first few days of cadmium administration but, by the second week, consumption returned to normal. Milk production declined sharply for several days and then increased appreciably, but to a level still substantially lower than that of controls during the last five days cadmium was given. When cadmium treatments ceased, milk production increased by 50%. Fat content of milk was elevated considerably during the week when production was most reduced. Cows given cadmium lost considerable weight. There were no other clinical manifestations of toxicity. As determined by the chromic oxide indicator method and twice-daily grab samples, fecal excretion of cadmium for the second week averaged 82% of that given. The cadmium level in the urine was below the limits of detectability of the method (0.5 ppm of urine). The cadmium content of the milk was less than 0.1 ppm of the milk, which was the lower reliability limit of the procedure used. On this basis less than 0.22% of the amount administered appeared in the milk. In vitro studies demonstrated that cadmium combines with the casein and whey protein fractions of the milk readily, with the amount combined being linear when levels from 1.0 to 25.0 ppm are added to milk. Smaller amounts were present in the lactose and mineral fractions.

  17. Cadmium sulfate complexing with thiourea during preparation of cadmium sulfide films

    International Nuclear Information System (INIS)

    Composition of complexes deposited from cadmium sulfate and thiourea(TU) aqueous solution is studied. Its influence on cadmium sulfide film deposition during solution spraying is ascertained. It is shown that with increase of TU concentration in aqueous solution gradual substitution of TU molecules for the first sphere SO42- ions takes place. As a result CdS deposition from these solutions is initiated when the ratio of CdSO4:TU concentrations is 1:2 and for prepartation of uniform films a five-fold TU excess as a minimum is necessary

  18. 42 CFR 460.110 - Bill of rights.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 4 2010-10-01 2010-10-01 false Bill of rights. 460.110 Section 460.110 Public...) Participant Rights § 460.110 Bill of rights. (a) Written bill of rights. A PACE organization must have a written participant bill of rights designed to protect and promote the rights of each participant....

  19. 33 CFR 110.111 - Marina del Rey Harbor, Calif.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Marina del Rey Harbor, Calif. 110.111 Section 110.111 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.111 Marina del Rey Harbor, Calif. An area...

  20. 33 CFR 110.230 - Puget Sound Area, Wash.

    Science.gov (United States)

    2010-07-01

    ... citations affecting § 110.230, see the List of CFR Sections Affected, which appears in the Finding Aids... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Puget Sound Area, Wash. 110.230... ANCHORAGE REGULATIONS Anchorage Grounds § 110.230 Puget Sound Area, Wash. (a) The anchorage...

  1. 33 CFR 110.208 - Buffalo Harbor, N.Y.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Buffalo Harbor, N.Y. 110.208 Section 110.208 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Anchorage Grounds § 110.208 Buffalo Harbor, N.Y. (a) The anchorage...

  2. 33 CFR 110.87 - Henderson Harbor, N.Y.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Henderson Harbor, N.Y. 110.87 Section 110.87 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.87 Henderson Harbor, N.Y. (a) Area A. The area in...

  3. 33 CFR 110.84b - Buffalo, N.Y.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Buffalo, N.Y. 110.84b Section 110.84b Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.84b Buffalo, N.Y. The area within the Port of Buffalo known as...

  4. 46 CFR 126.110 - Inspection after accident.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Inspection after accident. 126.110 Section 126.110... CERTIFICATION General § 126.110 Inspection after accident. (a) The owner or operator of an OSV shall make the vessel available for inspection by a marine inspector— (1) Each time an accident occurs, or a defect...

  5. 33 CFR 110.210 - San Diego Harbor, CA.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false San Diego Harbor, CA. 110.210 Section 110.210 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Anchorage Grounds § 110.210 San Diego Harbor, CA. (a) The anchorage grounds. (1) Special anchorage for U.S. Government...

  6. 33 CFR 110.25 - Salem Sound, Mass.

    Science.gov (United States)

    2010-07-01

    ... described in 33 CFR 110.25(a) to the point of beginning. (f) Marblehead Harbor, Marblehead, MA. The area... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Salem Sound, Mass. 110.25 Section... ANCHORAGE REGULATIONS Special Anchorage Areas § 110.25 Salem Sound, Mass. (a) Beverly Harbor, north of...

  7. 33 CFR 110.38 - Edgartown Harbor, Mass.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Edgartown Harbor, Mass. 110.38 Section 110.38 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.38 Edgartown Harbor, Mass. An area in the inner...

  8. 33 CFR 110.37 - Sesuit Harbor, Dennis, Mass.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Sesuit Harbor, Dennis, Mass. 110.37 Section 110.37 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.37 Sesuit Harbor, Dennis, Mass. All the...

  9. 33 CFR 110.29 - Boston Inner Harbor, Mass.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Boston Inner Harbor, Mass. 110.29 Section 110.29 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.29 Boston Inner Harbor, Mass. (a) Vicinity of...

  10. 33 CFR 110.45 - Onset Bay, Mass.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Onset Bay, Mass. 110.45 Section 110.45 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.45 Onset Bay, Mass. Northerly of a line extending...

  11. 33 CFR 110.142 - Nantucket Harbor, Mass.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Nantucket Harbor, Mass. 110.142 Section 110.142 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Anchorage Grounds § 110.142 Nantucket Harbor, Mass. (a) The anchorage grounds. In...

  12. 33 CFR 110.32 - Hingham Harbor, Hingham, Mass.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Hingham Harbor, Hingham, Mass. 110.32 Section 110.32 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.32 Hingham Harbor, Hingham, Mass. (a) Area...

  13. 11 CFR 110.18 - Voting age population.

    Science.gov (United States)

    2010-01-01

    ... 11 Federal Elections 1 2010-01-01 2010-01-01 false Voting age population. 110.18 Section 110.18... PROHIBITIONS § 110.18 Voting age population. There is annually published by the Department of Commerce in the Federal Register an estimate of the voting age population based on an estimate of the voting...

  14. 34 CFR 82.110 - Certification and disclosure.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 1 2010-07-01 2010-07-01 false Certification and disclosure. 82.110 Section 82.110 Education Office of the Secretary, Department of Education NEW RESTRICTIONS ON LOBBYING General § 82.110... representation is forwarded. Submitting an erroneous certification or disclosure constitutes a failure to...

  15. 46 CFR 7.110 - Mamala Bay, HI.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 1 2010-10-01 2010-10-01 false Mamala Bay, HI. 7.110 Section 7.110 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY PROCEDURES APPLICABLE TO THE PUBLIC BOUNDARY LINES Hawaii § 7.110 Mamala Bay, HI. A line drawn from Barbers Point Light to Diamond Head Light. Pacific Coast...

  16. 33 CFR 110.74b - Apollo Beach, Fla.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Apollo Beach, Fla. 110.74b Section 110.74b Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.74b Apollo Beach, Fla. Beginning at a...

  17. 33 CFR 110.238 - Apra Harbor, Guam.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Apra Harbor, Guam. 110.238 Section 110.238 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY ANCHORAGES ANCHORAGE REGULATIONS Anchorage Grounds § 110.238 Apra Harbor, Guam. (a) The anchorage grounds (Datum: WGS 84). (1) General Anchorage. The...

  18. 10 CFR 110.43 - Import licensing criteria.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Import licensing criteria. 110.43 Section 110.43 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) EXPORT AND IMPORT OF NUCLEAR EQUIPMENT AND MATERIAL Review of License Applications § 110.43 Import licensing criteria. The review of license applications for...

  19. 30 CFR 62.110 - Noise exposure assessment.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Noise exposure assessment. 62.110 Section 62.110 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR UNIFORM MINE HEALTH REGULATIONS OCCUPATIONAL NOISE EXPOSURE § 62.110 Noise exposure assessment. (a) The mine operator must establish a system of monitoring that...

  20. 14 CFR 1263.110 - Intention to provide guidance.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Intention to provide guidance. 1263.110 Section 1263.110 Aeronautics and Space NATIONAL AERONAUTICS AND SPACE ADMINISTRATION DEMAND FOR INFORMATION OR TESTIMONY SERVED ON AGENCY EMPLOYEES; PROCEDURES § 1263.110 Intention to provide guidance....

  1. 21 CFR 135.110 - Ice cream and frozen custard.

    Science.gov (United States)

    2010-04-01

    ....110 Ice cream and frozen custard. (a) Description. (1) Ice cream is a food produced by freezing, while... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Ice cream and frozen custard. 135.110 Section 135.110 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES...

  2. 21 CFR 801.110 - Retail exemption for prescription devices.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Retail exemption for prescription devices. 801.110 Section 801.110 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES LABELING Exemptions From Adequate Directions for Use § 801.110 Retail...

  3. miR-129-3p controls centrosome number in metastatic prostate cancer cells by repressing CP110.

    Science.gov (United States)

    Bijnsdorp, Irene V; Hodzic, Jasmina; Lagerweij, Tonny; Westerman, Bart; Krijgsman, Oscar; Broeke, Jurjen; Verweij, Frederik; Nilsson, R Jonas A; Rozendaal, Lawrence; van Beusechem, Victor W; van Moorselaar, Jeroen A; Wurdinger, Thomas; Geldof, Albert A

    2016-03-29

    The centrosome plays a key role in cancer invasion and metastasis. However, it is unclear how abnormal centrosome numbers are regulated when prostate cancer (PCa) cells become metastatic. CP110 was previously described for its contribution of centrosome amplification (CA) and early development of aggressive cell behaviour. However its regulation in metastatic cells remains unclear. Here we identified miR-129-3p as a novel metastatic microRNA. CP110 was identified as its target protein. In PCa cells that have metastatic capacity, CP110 expression was repressed by miR-129-3p. High miR-129-3p expression levels increased cell invasion, while increasing CP110 levels decreased cell invasion. Overexpression of CP110 in metastatic PCa cells resulted in a decrease in the number of metastasis. In tissues of PCa patients, low CP110 and high miR-129-3p expression levels correlated with metastasis, but not with the expression of genes related to EMT. Furthermore, overexpression of CP110 in metastatic PCa cells resulted in excessive-CA (E-CA), and a change in F-actin distribution which is in agreement with their reduced metastatic capacity. Our data demonstrate that miR-129-3p functions as a CA gatekeeper in metastatic PCa cells by maintaining pro-metastatic centrosome amplification (CA) and preventing anti-metastatic E-CA.

  4. Correlative characteristic of cadmium in soils of steppe Dnieper region

    Directory of Open Access Journals (Sweden)

    N. M. Tsvetkova

    2015-09-01

    Full Text Available Much attention is paid to searching for methods of establishing environmental standards for objective assessment of admissibility of anthropogenic load on the biosphere. The main pollutants of the environment are xenobiotics; heavy metals such as cadmium occupy hold a special place among them. Cadmium is one of the most dangerous environmental toxic agents, belonging to the 1stclass of hazard. Due to insufficient and fragmented information available on the distribution of cadmium in the city edaphotopes, it’s necessary to conduct additional research, taking into account the properties of soils and the biological characteristics of every element. The paper shows the ratio of cadmium in soils and soil-forming rocks of steppe Dnieper region. Environmental assessment of cadmium content in Dniprodzerzhinsk city soilsis made, and the problem of topsoil contamination of the city as a territory of high anthropogenic load is considered. It is found that the content of cadmium down the profile in natural soil increases. Enrichment of the topsoil with cadmium occurs due to contamination. The value of movable forms content, expressed as a percentage of the total content, varies from 12% to 70%, providing the evidence of the technogenic origin of cadmium in Dniprodzerzhinsk city topsoil. General and proximate correlation analyses of interrelation of soil cadmium and specifically selected characteristics of soil (pH, humus, sulfate ions, dry solid, chloride ions, total alkalinity, hygroscopic moisture were made. It is established that cadmium concentration in the movable forms of natural soils of the steppe Dnieper region depends primarily on pH value. With the increase in pH value, concentration of movable cadmium in soil increases.

  5. Cadmium induces transcription independently of intracellular calcium mobilization.

    Directory of Open Access Journals (Sweden)

    Brooke E Tvermoes

    Full Text Available BACKGROUND: Exposure to cadmium is associated with human pathologies and altered gene expression. The molecular mechanisms by which cadmium affects transcription remain unclear. It has been proposed that cadmium activates transcription by altering intracellular calcium concentration ([Ca(2+](i and disrupting calcium-mediated intracellular signaling processes. This hypothesis is based on several studies that may be technically problematic; including the use of BAPTA chelators, BAPTA-based fluorescent sensors, and cytotoxic concentrations of metal. METHODOLOGY/PRINCIPAL FINDING: In the present report, the effects of cadmium on [Ca(2+](i under non-cytotoxic and cytotoxic conditions was monitored using the protein-based calcium sensor yellow cameleon (YC3.60, which was stably expressed in HEK293 cells. In HEK293 constitutively expressing YC3.60, this calcium sensor was found to be insensitive to cadmium. Exposing HEK293::YC3.60 cells to non-cytotoxic cadmium concentrations was sufficient to induce transcription of cadmium-responsive genes but did not affect [Ca(2+](i mobilization or increase steady-state mRNA levels of calcium-responsive genes. In contrast, exposure to cytotoxic concentrations of cadmium significantly reduced intracellular calcium stores and altered calcium-responsive gene expression. CONCLUSIONS/SIGNIFICANCE: These data indicate that at low levels, cadmium induces transcription independently of intracellular calcium mobilization. The results also support a model whereby cytotoxic levels of cadmium activate calcium-responsive transcription as a general response to metal-induced intracellular damage and not via a specific mechanism. Thus, the modulation of intracellular calcium may not be a primary mechanism by which cadmium regulates transcription.

  6. Critical review of animal carcinogenesis by cadmium and its inorganic compounds

    International Nuclear Information System (INIS)

    Animal carcinogenic biassays relative to 6 inorganic cadmium substances (cadmium metal, cadmium oxide, cadmium sulfide, cadmium sulfate, cadmium chloride and cadmium acetate) are reviewed (speciation). Critical evaluation of literature data on carcinogenicity has been performed by making reference to E.C. guidelines of good laboratory practice. There are few data on routes relevant for human risk assessment: experiments on inhalation demonstrate lung carcinogenicity of cadmium oxide, cadmium sulfide, cadmium sulfate and cadmium chloride in rats but not in mice nor in hamsters; no carcinogenic effects of cadmium compounds are observed following oral administration. For routes of less or no relevance for human risk assessment, some results are clearly positive: subcutaneous injection induces cancers in situ (various cadmium compounds), testicular tumours (cadmium sulfate and cadmium chloride) and prostatic tumours (cadmium chloride) but such effects are not observed using relevant malignancies in rats. With respect to other no relevant routes (intraperitoneal, intrarenal...) tumours are incidentally produced in situ, but not in remote organs. Numerous studies fail to demonstrate cadmium carcinogenicity, but methodologically acceptable negative ones are very limited in number. Accordingly strain dependent effects and dose effect relationship could not be thoroughly assessed

  7. Determination of cadmium and zinc isotope ratios in sheep's blood and organ tissue by electrothermal vaporization inductively coupled plasma mass spectrometry

    International Nuclear Information System (INIS)

    A method is described for the determination of Cd and Zn isotope ratios in sheep's blood and organ tissue. Samples were digested with nitric acid using a microwave oven. Cadmium and Zn were separated from matrix components using adsorption chromatography prior to isotope ratio measurement by electrothermal vaporization inductively coupled plasma mass spectrometry. A concentration factor of 35 was achieved. Limits of detection for the determination of Cd and Zn in blood were 0.34 and 0.40 pg g-1, respectively. Cadmium isotope ratios (111Cd: 106Cd; 111Cd: 110Cd) were determined with a precision of 2-3% for both peak height and area count measurements. Zinc isotope ratios (68Zn: 67Zn; 68Zn: 66Zn) were determined with a precision of 2% for peak height measurements and 1% for peak area count measurements. (Author)

  8. Associations of neonatal lead, cadmium, chromium and nickel co-exposure with DNA oxidative damage in an electronic waste recycling town

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Wenqing; Huang, Yue; Wang, Xiaoling; Zhang, Jingwen; Wu, Kusheng, E-mail: kswu@stu.edu.cn

    2014-02-01

    Objective: This study aimed to evaluate the effects of toxic heavy metal co-exposure on DNA oxidative damage in neonates from a primitive e-waste recycling region, Guiyu town, China. Methods: Our participants included 201 pregnant women: 126 from Guiyu town and 75 from Jinping district of Shantou city, where no e-waste recycling and dismantling activities existed. Structured interview questionnaires were administered to the pregnant women and umbilical cord blood (UCB) samples were collected after delivery. The UCB concentrations of lead, cadmium, chromium, and nickel were analyzed by graphite furnace atomic absorption spectrometry (GFAAS). Levels of UCB plasma 8-hydroxydeoxyguanosine (8-OHdG, a DNA oxidative damage biomarker) were determined by enzyme-linked immunosorbent assay. Results: Our results suggested that UCB lead and cadmium concentrations in neonates of Guiyu were significantly higher than those of Jinping (lead: median 110.45 ng/mL vs. 57.31 ng/mL; cadmium: median 2.50 ng/mL vs. 0.33 ng/mL, both P < 0.001). Parents' residence in Guiyu, and parents' work related to e-waste recycling were the risk factors associated with neonate's UCB lead and cadmium levels. No significant difference of UCB plasma 8-OHdG levels was found between Guiyu and the control area. After adjusting for potential confounders, cord plasma 8-OHdG concentrations (ng/mL) were positively associated with blood cadmium (β = 0.126 ng/mL, 95% CI: 0.055 to 0.198 ng/mL), chromium (β = 0.086 ng/mL, 95% CI: 0.014 to 0.158 ng/mL) and nickel (β = 0.215 ng/mL, 95% CI: 0.113 to 0.317 ng/mL) concentrations. Conclusions: The primitive e-waste recycling and dismantling activities may contribute to the elevated umbilical cord blood toxic heavy metal levels in neonates born in Guiyu. Exposures to cadmium, chromium and nickel were associated with increased oxidative DNA damage in neonates. - Highlights: • DNA oxidative damage levels (8-OHdG) in neonates from Guiyu were assessed.

  9. Associations of neonatal lead, cadmium, chromium and nickel co-exposure with DNA oxidative damage in an electronic waste recycling town

    International Nuclear Information System (INIS)

    Objective: This study aimed to evaluate the effects of toxic heavy metal co-exposure on DNA oxidative damage in neonates from a primitive e-waste recycling region, Guiyu town, China. Methods: Our participants included 201 pregnant women: 126 from Guiyu town and 75 from Jinping district of Shantou city, where no e-waste recycling and dismantling activities existed. Structured interview questionnaires were administered to the pregnant women and umbilical cord blood (UCB) samples were collected after delivery. The UCB concentrations of lead, cadmium, chromium, and nickel were analyzed by graphite furnace atomic absorption spectrometry (GFAAS). Levels of UCB plasma 8-hydroxydeoxyguanosine (8-OHdG, a DNA oxidative damage biomarker) were determined by enzyme-linked immunosorbent assay. Results: Our results suggested that UCB lead and cadmium concentrations in neonates of Guiyu were significantly higher than those of Jinping (lead: median 110.45 ng/mL vs. 57.31 ng/mL; cadmium: median 2.50 ng/mL vs. 0.33 ng/mL, both P < 0.001). Parents' residence in Guiyu, and parents' work related to e-waste recycling were the risk factors associated with neonate's UCB lead and cadmium levels. No significant difference of UCB plasma 8-OHdG levels was found between Guiyu and the control area. After adjusting for potential confounders, cord plasma 8-OHdG concentrations (ng/mL) were positively associated with blood cadmium (β = 0.126 ng/mL, 95% CI: 0.055 to 0.198 ng/mL), chromium (β = 0.086 ng/mL, 95% CI: 0.014 to 0.158 ng/mL) and nickel (β = 0.215 ng/mL, 95% CI: 0.113 to 0.317 ng/mL) concentrations. Conclusions: The primitive e-waste recycling and dismantling activities may contribute to the elevated umbilical cord blood toxic heavy metal levels in neonates born in Guiyu. Exposures to cadmium, chromium and nickel were associated with increased oxidative DNA damage in neonates. - Highlights: • DNA oxidative damage levels (8-OHdG) in neonates from Guiyu were assessed. • Neonatal lead

  10. Gene expression profiling in rat kidney after intratracheal exposure to cadmium-doped nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Coccini, Teresa, E-mail: teresa.coccini@fsm.it; Roda, Elisa [University of Pavia, European Centre for Nanomedicine (Italy); Fabbri, Marco; Sacco, Maria Grazia; Gribaldo, Laura [European Commission Institute for Health and Consumer Protection (IHCP), JRC (Italy); Manzo, Luigi [University of Pavia, European Centre for Nanomedicine (Italy)

    2012-08-15

    While nephrotoxicity of cadmium is well documented, very limited information exists on renal effects of exposure to cadmium-containing nanomaterials. In this work, 'omics' methodologies have been used to assess the action of cadmium-containing silica nanoparticles (Cd-SiNPs) in the kidney of Sprague-Dawley rats exposed intratracheally. Groups of animals received a single dose of Cd-SiNPs (1 mg/rat), CdCl{sub 2} (400 {mu}g/rat) or 0.1 ml saline (control). Renal gene expression was evaluated 7 and 30 days post exposure by DNA microarray technology using the Agilent Whole Rat Genome Microarray 4x44K. Gene modulating effects were observed in kidney at both time periods after treatment with Cd-SiNPs. The number of differentially expressed genes being 139 and 153 at the post exposure days 7 and 30, respectively. Renal gene expression changes were also observed in the kidney of CdCl{sub 2}-treated rats with a total of 253 and 70 probes modulated at 7 and 30 days, respectively. Analysis of renal gene expression profiles at day 7 indicated in both Cd-SiNP and CdCl{sub 2} groups downregulation of several cluster genes linked to immune function, oxidative stress, and inflammation processes. Differing from day 7, the majority of cluster gene categories modified by nanoparticles in kidney 30 days after dosing were genes implicated in cell regulation and apoptosis. Modest renal gene expression changes were observed at day 30 in rats treated with CdCl{sub 2}. These results indicate that kidney may be a susceptible target for subtle long-lasting molecular alterations produced by cadmium nanoparticles locally instilled in the lung.

  11. Long non-coding RNAs as novel expression signatures modulate DNA damage and repair in cadmium toxicology

    Science.gov (United States)

    Zhou, Zhiheng; Liu, Haibai; Wang, Caixia; Lu, Qian; Huang, Qinhai; Zheng, Chanjiao; Lei, Yixiong

    2015-10-01

    Increasing evidence suggests that long non-coding RNAs (lncRNAs) are involved in a variety of physiological and pathophysiological processes. Our study was to investigate whether lncRNAs as novel expression signatures are able to modulate DNA damage and repair in cadmium(Cd) toxicity. There were aberrant expression profiles of lncRNAs in 35th Cd-induced cells as compared to untreated 16HBE cells. siRNA-mediated knockdown of ENST00000414355 inhibited the growth of DNA-damaged cells and decreased the expressions of DNA-damage related genes (ATM, ATR and ATRIP), while increased the expressions of DNA-repair related genes (DDB1, DDB2, OGG1, ERCC1, MSH2, RAD50, XRCC1 and BARD1). Cadmium increased ENST00000414355 expression in the lung of Cd-exposed rats in a dose-dependent manner. A significant positive correlation was observed between blood ENST00000414355 expression and urinary/blood Cd concentrations, and there were significant correlations of lncRNA-ENST00000414355 expression with the expressions of target genes in the lung of Cd-exposed rats and the blood of Cd exposed workers. These results indicate that some lncRNAs are aberrantly expressed in Cd-treated 16HBE cells. lncRNA-ENST00000414355 may serve as a signature for DNA damage and repair related to the epigenetic mechanisms underlying the cadmium toxicity and become a novel biomarker of cadmium toxicity.

  12. Levels of arsenic, cadmium, lead and mercury in the branchial plate and muscle tissue of mobulid rays

    International Nuclear Information System (INIS)

    Highlights: • Branchial plate and muscle tissue from mobulid rays were analysed for certain metals. • Mean concentrations of cadmium in Mobula japanica were above the EC ML. • Mean inorganic arsenic concentration in Mobula japanica muscle equalled the FSANZ ML. • Mean concentration of lead in Manta alfredi muscle tissue exceeded EC and Codex MLs. • There were significant correlations between the types of tissues for some metals. - Abstract: Mobulid rays are targeted in fisheries for their branchial plates, for use in Chinese medicine. Branchial plate and muscle tissue from Mobula japanica were collected from fish markets in Sri Lanka, and muscle tissue biopsies from Manta alfredi in Australia. These were analysed for arsenic, cadmium, lead and mercury and compared to maximum levels (MLs) set by Food Standards Australia and New Zealand (FSANZ), European Commission (EC) and Codex Alimentarius Commission. The estimated intake for a vulnerable human age group was compared to minimal risk levels set by the Agency for Toxic Substances and Disease Registry. The mean inorganic arsenic concentration in M. japanica muscle was equivalent to the FSANZ ML while cadmium exceeded the EC ML. The mean concentration of lead in M. alfredi muscle tissue exceeded EC and Codex MLs. There were significant positive linear correlations between branchial plate and muscle tissue concentrations for arsenic, cadmium and lead

  13. Cadmium interferes with the degradation of ATF5 via a post-ubiquitination step of the proteasome degradation pathway

    International Nuclear Information System (INIS)

    ATF5 is a member of the CREB/ATF family of transcription factors. In the current study, using a transient transfection system to express FLAG epitope fusion proteins of ATF5, we have shown that CdCl2 or NaAsO3 increases the protein levels of ATF5 in cells, and that cadmium stabilizes the ATF5 protein. Proteasome inhibitors had a similar effect to cadmium on the cellular accumulation of ATF5. Proteasome inhibition led to an increase in ubiquitinated ATF5, while cadmium did not appear to reduce the extent of ATF5 ubiquitination. ATF5 contains a putative nuclear export signal within its N-terminus. We demonstrated that whereas deletion of N-terminal region resulted in a increase of ATF5 levels, this region does not appear to be involved in the ubiquitination of ATF5. These results indicate that ATF5 is targeted for degradation by the ubiquitin-proteasome pathway, and that cadmium slows the rate of ATF5 degradation via a post-ubiquitination mechanism.

  14. Comparative genomic analyses identify common molecular pathways modulated upon exposure to low doses of arsenic and cadmium

    Directory of Open Access Journals (Sweden)

    Fry Rebecca C

    2011-04-01

    Full Text Available Abstract Background Exposure to the toxic metals arsenic and cadmium is associated with detrimental health effects including cancers of various organs. While arsenic and cadmium are well known to cause adverse health effects at high doses, the molecular impact resulting from exposure to environmentally relevant doses of these metals remains largely unexplored. Results In this study, we examined the effects of in vitro exposure to either arsenic or cadmium in human TK6 lymphoblastoid cells using genomics and systems level pathway mapping approaches. A total of 167 genes with differential expression were identified following exposure to either metal with surprisingly no overlap between the two. Real-time PCR was used to confirm target gene expression changes. The gene sets were overlaid onto protein-protein interaction maps to identify metal-induced transcriptional networks. Interestingly, both metal-induced networks were significantly enriched for proteins involved in common biological processes such as tumorigenesis, inflammation, and cell signaling. These findings were further supported by gene set enrichment analysis. Conclusions This study is the first to compare the transcriptional responses induced by low dose exposure to cadmium and arsenic in human lymphoblastoid cells. These results highlight that even at low levels of exposure both metals can dramatically influence the expression of important cellular pathways.

  15. Drikkevands optagelse af cadmium og bly fra armaturer

    DEFF Research Database (Denmark)

    Nielsen, K.

    Notatet omfatter rapporter fra to forsøgsrækker vedr. brugsvands optagelse af bly og cadmium. Den første omhandler brugsvandsarmaturers afgivelse af bly og cadmium til syntetisk brugsvand med en sammensætning svarende til en sur, blød vandtype. Forsøgene omfatter 10 armaturer og armaturdele...

  16. Cadmium-induced ectopic apoptosis in zebrafish embryos

    Energy Technology Data Exchange (ETDEWEB)

    Chan, Po Kwok; Cheng, Shuk Han [Department of Biology and Chemistry, City University of Hong Kong, 83 Tat Chee Avenue, Kowloon (Hong Kong)

    2003-02-01

    In this study, we tested the hypothesis that cadmium-induced developmental toxicity was mediated via ectopic occurrence of apoptosis during embryonic development. We employed confocal microscopy to acquire images of whole-mount staining of apoptotic cells in zebrafish embryo exposed to 100 {mu}M cadmium from 5 hours post fertilisation (hpf) to 28 hpf. Three-dimensional reconstruction of the images was performed and the spatial and temporal distributions of apoptotic cells in the embryos were compared. In cadmium-treated embryos with varying degrees of gross developmental malformations, significantly higher numbers of apoptotic cells were detected with this method. In order to detect the precise locations of apoptotic cells, we performed terminal deoxynucleotidyl transferase-mediated dUTP nick end labelling (TUNEL) assay in sectioned embryos. In the degenerating neural tube of cadmium-treated embryos apoptotic cells were detected, while in the healthy neural tube of the untreated controls no apoptotic cells were found. We then employed flow cytometry to investigate whether cadmium exposure would affect the dynamics of apoptosis or induce any abnormalities in cell-cycle progression. It appeared that cadmium did not induce cell-cycle arrest. The percentages of apoptotic cells did not differ in the two groups at 13, 16 or 19 hpf. At 28 hpf, however, a significantly higher percentage of apoptotic cells were found in the cadmium-treated group. Exposure to cadmium, therefore, induced ectopic apoptosis at 28 hpf without affecting the dynamics of apoptosis at earlier developmental stages. (orig.)

  17. Cadmium inhibits neurogenesis in zebrafish embryonic brain development

    Energy Technology Data Exchange (ETDEWEB)

    Chow, Elly Suk Hen [Division of Biology, California Institute of Technology, 1200 California Boulevard, Pasadena, CA 91125 (United States); Hui, Michelle Nga Yu; Lin Chunchi [Department of Biology and Chemistry, City University of Hong Kong, 83 Tat Chee Avenue, Kowloon, Hong Kong (China); Cheng Shukhan [Department of Biology and Chemistry, City University of Hong Kong, 83 Tat Chee Avenue, Kowloon, Hong Kong (China)], E-mail: bhcheng@cityu.edu.hk

    2008-05-01

    Cadmium is a non-essential heavy metal found abundantly in the environment. Children of women exposed to cadmium during pregnancy display lower motor and perceptual abilities. High cadmium body burden in children is also related to impaired intelligence and lowered school achievement. However, little is known about the molecular and cellular basis of developmental neurotoxicity in the sensitive early life stages of animals. In this study, we explore neurological deficits caused by cadmium during early embryonic stages in zebrafish by examining regionalization of the neural tube, pattern formation and cell fate determination, commitment of proneural genes and induction of neurogenesis. We show that cadmium-treated embryos developed a smaller head with unclear boundaries between the brain subdivisions, particularly in the mid-hindbrain region. Embryos display normal anterior to posterior regionalization; however, the commitment of neural progenitor cells was affected by cadmium. We observe prominent reductions in the expression of several proneuronal genes including ngn1 in cell clusters, zash1a in the developing optic tectum, and zash1b in the telencephalon and tectum. Cadmium-treated embryos also have fewer differentiated neurons and glia in the facial sensory ganglia as indicated by decreased zn-12 expression. Also, a lower transcription level of neurogenic genes, ngn1 and neuroD, is observed in neurons. Our data suggest that cadmium-induced neurotoxicity can be caused by impaired neurogenesis, resulting in markedly reduced neuronal differentiation and axonogenesis.

  18. Epigenetic Effects of Cadmium [Abstract and Poster 2014

    Science.gov (United States)

    We have reviewed the literature on in vitro and in vivo experiments as well as human studies on cadmium to understand the epigenetic mechanisms involved in cadmium- induced toxicity and carcinogenicity. This presentation will identify gaps in our current understanding and suggest...

  19. Electrolytic indium refining from cadmium in glycerine electrolyte

    International Nuclear Information System (INIS)

    The results of investigations directed on development of electrochemical indium cleaning from cadmium in glycerine base electrolyte are presented. Optimal operational conditions, specific consumption of reactants and electric power are determined. Relationship between variation of concentration of cadmium impurity in refined metal and duration of electrolysis is revealed. The method for determination of cleaning time is proposed. Developed process was put into commercial operation

  20. Method of making a thin film cadmium telluride solar cell

    International Nuclear Information System (INIS)

    A method for making a photovoltaic cell is described comprising the steps of: (a) depositing a transparent or semi-transparent conductive window layer onto a substrate; (b) depositing a layer of cadmium telluride including phosphorus onto the window layer; (c) depositing a layer of lead telluride onto the layer of cadmium telluride; and (d) depositing a metallic electrode onto the lead telluride layer

  1. Removing cadmium from electroplating wastewater by waste saccharomyces cerevisiae

    Institute of Scientific and Technical Information of China (English)

    DAI Shu-juan; WEI De-zhou; ZHOU Dong-qin; JIA Chun-yun; WANG Yu-juan; LIU Wen-gang

    2008-01-01

    The appropriate condition and scheme of removing cadmium from electroplating wastewater were investigated by adsorption-precipitation method using waste saccharomyces cerevisiae(WSC) as sorbent. Effect factors on biosorption of cadmium in cadmium-containing electroplating wastewater by waste saccharomyces cerevisiae and precipitation process of waste saccharomyces cerevisiae after adsorbing cadmium were studied. The results show that removal rate of cadmium is over 88% after 30 min adsorbing under the condition of cadmium concentration 26 mg/L, the dosage of waste saccharomyces cerevisiae 16.25 g/L, temperature 18 ℃, pH 6.0 and precipitation time 4 h. Biosorption-precipitation method is effective to remove cadmium in cadmium-containing electroplating wastewater by waste saccharomyces cerevisiae. The SEM, infrared spectroscopy and Zeta-potential of the cells show that chemical chelating is the main adsorption form; electrostatic attraction, hydrogen bonding and van der Waals force all function in adsorption process; and ―NH2―,―C=O―,―C=O―NH―,―CH3, ―OH are the main adsorption groups.

  2. Cadmium and zinc reversibly arrest development of Artemia larvae

    Energy Technology Data Exchange (ETDEWEB)

    Bagshaw, J.C.; Rafiee, P.; Matthews, C.O.; MacRae, T.H.

    1986-08-01

    Despite the widespread distribution of heavy metals such as cadmium and zinc in the environment and their well-known cytotoxicity and embryotoxicity in mammals, comparatively little is known about their effect on aquatic organisms, particularly invertebrates. Post-gastrula and early larval development of the brine shrimp, Artemia, present some useful advantages for studies of developmental aspects of environmental toxicology. Dormant encysted gastrulae, erroneously called brine shrimp eggs, can be obtained commercially and raised in the laboratory under completely defined conditions. Following a period of post-gastrula development within the cyst, pre-nauplius larvae emerge through a crack in the cyst shell. A few hours later, free-swimming nauplius larvae hatch. Cadmium is acutely toxic to both adults and nauplius larvae of Artemia, but the reported LC50s are as high as 10 mM, depending on larval age. In this paper the authors show that pre-nauplius larvae prior to hatching are much more sensitive to cadmium than are hatched nauplius larvae. At 0.1 ..mu..m, cadmium retards development and hatching of larvae; higher concentrations block hatching almost completely and thus are lethal. However, the larvae arrested at the emergence stage survive for 24 hours or more before succumbing to the effects of cadmium, and during this period the potentially lethal effect is reversible if the larvae are placed in cadmium-free medium. The effects of zinc parallel those of cadmium, although zinc is somewhat less toxic than cadmium at equal concentrations.

  3. Cadmium Removal from Aqueous Solutions by Ground Pine Cone

    Directory of Open Access Journals (Sweden)

    H Izanloo, S Nasseri

    2005-01-01

    Full Text Available A study on the removal of cadmium ions from aqueous solutions by pine cone was conducted in batch conditions. Kinetic data and equilibrium removal isotherms were obtained. The influence of different experimental parameters such as contact time, initial concentration of cadmium, pine cone mass and particle size, and temperature on the kinetics of cadmium removal was studied. Results showed that the main parameters that played an important role in removal phenomenon were initial cadmium concentration, particle size and pine cone mass. The necessary time to reach equilibrium was between 4 and 7 hours based on the initial concentration of cadmium. The capacity of cadmium adsorption at equilibrium increased with the decrease of pine cone particle size. The capacity of cadmium adsorption at equilibrium by pine cone increased with the quantity of pine cone introduced (1–4 g/L. Temperature in the range of 20-30°C showed a restricted effect on the removal kinetics (13.56 mg/g at 20°C and a low capacity of adsorption about 11.48 mg/g at 30°C. The process followed pseudo second-order kinetics. The cadmium uptake of pine cone was quantitatively evaluated using adsorption isotherms. Results indicated that the Langmuir model gave a better fit to the experimental data in comparison with the Freundlich equation.

  4. Effect of environmental exposure to Cadmium on pregnancy outcome

    Directory of Open Access Journals (Sweden)

    F. Ramezanzadeh

    2010-04-01

    Full Text Available "n "n "nBackgrounds andObjectives:The objective of the present study was to evaluate the potential effect of environmental exposure to toxic metal (cadmium on pregnancy outcome and fetal growth."nMaterials and Methods: 330 normal pregnant women were randomly selected from vali-e-asr hospital, from July 2003 through Feb. 2005. Cadmium was measured in umbilical cord blood and mother whole blood of postpartum women without occupational exposure to metals in Tehran, Iran, using inductively coupled plasma mass spectrometry"nResult: Whole blood cadmium and cord blood cadmium ranged from 0/00 to 6/30 μg/L ,respectivly. in the group higher level of maternal blood cadmium (> 0.40 μg/L 1cm decrease was seen in neonatal birth height. (p = 0.007 There was a significant association between cadmium exposure and birth weight.Mann-whitney test showed that, maternal blood cadmium level, was significantly negatively associated with neonatal birth weight (z = -1.83, P < 0.06."nConclusion: It was concluded that environmental exposure to cadmium significantly reduces neonatal birth height.

  5. Risk of overestimation of urinary cadmium concentrations: interference from molybdenum

    Directory of Open Access Journals (Sweden)

    Cañas A.I.

    2013-04-01

    Full Text Available We show here that the selection of analytical method is critical when measuring low levels of cadmium in human urine. Cadmium is today usually analyzed by Inductively Coupled Plasma Mass Spectrometry (ICP-MS, which has a higher sensitivity than Atomic Absorption Spectroscopy (AAS. ICP-MS cadmium measurements show interference from tin (114Sn and molybdenum oxides, which can result in an overestimation of cadmium levels. The 114Sn interference is stable and can be mathematically corrected. Molybdenum concentrations in urine are variable and different from individual to individual. We have estimated the degree of error which molybdenum interference introduces in the measurement of cadmium in urine by conventional ICP-MS. 268 urine samples from mothers and their children were measured. Removal of the molybdenum oxide interference (DRC-ICP-MS method reduced urinary cadmium concentrations significantly (47.8%. The urinary molybdenum concentration in children was higher than in their mothers, resulting in greater overestimation. Our results clearly show that the DRC method is essential for reliable measurements of urinary cadmium concentrations, particularly in children. Furthermore, care should be taken when comparing Human Biomonitoring data for cadmium in urine and attention should be paid to which analytical method has been used (e.g. AAS and ICP-Ms, and especially if the measurements have been corrected for molybdenum interference.

  6. Simulations of the premelting of Al(110)

    DEFF Research Database (Denmark)

    Stoltze, Per

    1990-01-01

    The premelting of Al(110) is studied by molecular dynamics simulations using the potential for Al derived from effective medium theory. We find a progressive disordering of the surface region as the bulk melting point is approached. This disorder is mediated by the formation of adatom–vacancy pairs....... Based on the calculated radial distribution function and the analytical expression for the energy, it is demonstrated that the thermodynamics of disorder and melting is reflected in the single particle properties by a decrease in the number of nearest neighbors. The Debye temperature for the surface...

  7. 110 KV DEMOKENTTÄ JA MUUNTAJAVIKOJEN SIMULOINTI

    OpenAIRE

    Antinaho, Tero

    2015-01-01

    Työn aiheena oli sähkövoimatekniikan laboratorion oppimisympäristön 110 kV demolaitteisto ja muuntajan vikojen simulointi. Työn tavoitteena oli ottaa käyt-töön muuntajavikojen ja maasulkuvikojen simulointi ja luoda sähköturvallisuus huomioiden käyttöohjeet vikojen simulointiin. Käyttöohjeet tulevat Lapin Ammat-tikorkeakoululle sähkövoimatekniikan laboratoriossa oppimistarkoitukseen. Itse demolaitteisto on uusi ammattikorkeakoulun sähkövoimalaboratoriossa. Työ tehtiin 2015 helmi- ja huhtikuun ...

  8. The effect of phosphate fertilizer cadmium on cadmium in soils and crops

    NARCIS (Netherlands)

    Smilde, K.W.; Luit, van B.

    1983-01-01

    Een van de oorzaken, waardoor bodemvervuiling met cadmium optreedt en dus een bevordering van cadmiumopname door het gewas, is toepassing van fosfaatkunstmest, waarin zich verschillende gehaltes van dit zware metaal bevinden. Dit rapport behandelt het onderzoek naar de stijging van het cadmiumgehalt

  9. SORPTION OF CADMIUM ONTO DIFFERENT FRACTIONS OF BIOSOLIDS AND CADMIUM SALT AMENDED SOILS

    Science.gov (United States)

    Biosolids and Cd salt-amended soils were collected from a long-term field experiment established in 1976. Cadmium sorption experiments were conducted on different fractions of soils amended with biosolids, Cd salt, and unamended soils (control). The organic carbon (OC) of soils ...

  10. Comparison of toxicity and disposition of cadmium chloride and cadmium metallothionein in rats.

    NARCIS (Netherlands)

    Groten, J.P.

    1992-01-01

    In Chapter 1 of this thesis a general introduction is presented with a survey of the literature. It gives a brief overview of the factors involved in the absorption, metabolism and toxicity of Cd after oral intake.In short, the main source of environmental exposure to cadmium for no

  11. Cadmium chronic administration to lactating ewes. Reproductive performance, cadmium tissue accumulation and placental transfer

    Energy Technology Data Exchange (ETDEWEB)

    Floris, B.; Bomboi, G.; Sechi, P.; Marongiu, M. L. [Sassari Univ., Sassari (Italy). Dipt. di Biologia Animale; Pirino, S. [Sassari Univ., Sassari (Italy). Ist. di Patologia Generale, Anatomia Patologica e Clinica Ostetrico-chirurgica Veterinaria

    2000-12-01

    20 lactating ewes were allotted to two groups: 10 subjects received orally 100 mg/day of CdCl{sub 2} for 108 consecutive days, and the remaining 10 acted as control. Reproductive performance in ewes and cadmium tissue accumulation, both in ewes and their lambs, were investigated. The results showed that in ewes: 1) the regular cadmium intestinal intake negatively influences all reproductive parameters; 2) cadmium is particularly accumulated in kidney and liver, bur also in mammary gland, although at distinctly lower level; 3) chronic administration does not increase cadmium placental transfer in lactating pregnant subjects. [Italian] 20 pecore in lattazione sono state suddivise in 2 gruppi: 10 soggetti ricevettero per os 100 mg/giorno di CdCl{sub 2} per 108 giorni consecutivi, e i restanti 10 funsero da controllo. Sono stati studiati i parametri riproduttivi delle pecore e l'accumulo di cadmio nei tessuti, sia delle pecore che dei loro agnelli. I risultati hanno mostrato che negli ovini: 1) il regolare assorbimento intestinale di cadmio influenza negativamente tutti i parametri riproduttivi; 2) il cadmio viene accumulato principalmente nei reni e nel fegato, ma anche dalla ghiandola mammaria, sebbene in misura nettamente inferiore; 3) la somministrazione cronica di cadmio nei soggetti gravidi non incrementa il suo passaggio transplacentare.

  12. Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

    International Nuclear Information System (INIS)

    Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt, which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed

  13. Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

    Energy Technology Data Exchange (ETDEWEB)

    Adámik, Matej [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Bažantová, Pavla [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava (Czech Republic); Navrátilová, Lucie; Polášková, Alena [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Pečinka, Petr [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava (Czech Republic); Holaňová, Lucie [Department of Chemical Drugs, Faculty of Pharmacy, University of Veterinary and Pharmaceutical Sciences, Palackého 1/3, 61242 Brno (Czech Republic); Tichý, Vlastimil [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Brázdová, Marie, E-mail: maruska@ibp.cz [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Department of Chemical Drugs, Faculty of Pharmacy, University of Veterinary and Pharmaceutical Sciences, Palackého 1/3, 61242 Brno (Czech Republic)

    2015-01-02

    Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt, which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.

  14. Adsorption of cadmium from aqueous solutions by perlite.

    Science.gov (United States)

    Mathialagan, T; Viraraghavan, T

    2002-10-14

    The present study examined the use of perlite for the removal of cadmium from aqueous solutions. The effects of pH and contact time on the adsorption process were examined. The optimum pH for adsorption was found to be 6.0. Residual cadmium concentration reached equilibrium in 6h and the rate of cadmium adsorption by perlite was rapid in the first hour of the reaction time. Ho's pseudo-second-order model best described the kinetics of the reaction. Batch adsorption experiments conducted at room temperature (22+/-1 degrees C) showed that the adsorption pattern followed the Freundlich isotherm model. The maximum removal of cadmium obtained from batch studies was 55%. Thomas model was used to describe the adsorption data from column studies. The results generally showed that perlite could be considered as a potential adsorbent for cadmium removal from aqueous solutions.

  15. Cadmium adsorption in montmorillonite as affected by glyphosate

    Institute of Scientific and Technical Information of China (English)

    WANG Yu-jun; ZHOU Dong-mei; LUO Xiao-san; SUN Rui-juan; CHEN Huai-man

    2004-01-01

    Behaviors of soil heavy metals are often affected by coexisting herbicides due to their physical and chemical interaction. Effect of glyphosate, an herbicide containing -PO32- and -COOH groups, on cadmium adsorption in montmorillonite was studied in detail. The results showed that cadmium adsorption quantity in montmorillonite increased with increasing soil solution pH and cadmium concentration as usual, but decreased with glyphosate, which is due to the formation of a low affinity complex of Cd and glyphosate and decreasing solution pH induced by glyphosate addition. When the equilibrium solution pH was below 6.7, glyphosate has little effect on cadmium adsorption, but when the equilibrium solution pH was above 6.7, glyphosate significantly decreased cadmium adsorption quantity in montmorillonite. In addition, the adding order of Cd and glyphosate also influenced Cd adsorption quantity in montmorillonite.

  16. Synthesis of cadmium chalcogenide nanotubes at room temperature

    KAUST Repository

    Pan, Jun

    2012-10-01

    Cadmium chalcogenide (CdE, E=S, Se, Te) polycrystalline nanotubes have been synthesized from precursor of CdS/cadmium thiolate complex at room temperature. The precursor was hydrothermally synthesized at 180 °C using thioglycolic acid (TGA) and cadmium acetate as starting materials. The transformation from the rod-like precursor of CdS/cadmium thiolate complex to CdS, CdSe and CdTe nanotubes were performed under constant stirring at room temperature in aqueous solution containing S 2-, Se 2- and Te 2-, respectively. The nanotube diameter can be controlled from 150 to 400 nm related to the dimension of templates. The XRD patterns show the cadmium chalcogenide nanotubes all corresponding to face-centered cubic structure. © 2012 Elsevier B.V. All rights reserved.

  17. Determination of the cadmium and copper content inherent to metallothionein

    Energy Technology Data Exchange (ETDEWEB)

    Raspor, B.; Kozar, S.; Pavicic, J.; Juric, D. [Ruder Boskovic Institute, Center for Marine Research Zagreb, P.O.B. 1016, HR-10 001 Zagreb (Croatia)

    1998-05-01

    The reliability of the voltammetric determination of the cadmium and copper content (at pH 1.0), inherent to metallothionein (MT) isolated from the digestive gland of Mytilus galloprovincialis, was investigated. An artifact signal enhancement of copper, caused by the cupric-thionein complex adsorption at the mercury electrode, was established. This artifact was removed by UV-digestion of the sample for 15-20 h prior to analysis. A similar artifact was not detected for cadmium, because at this pH the cadmium-thionein complex has dissociated, and cadmium exists in the ionic form. Therefore, the voltammetric analysis of the cadmium content can be performed directly at pH 1.0, without prior UV-digestion of the sample. (orig.) With 3 figs., 1 tab., 12 refs.

  18. Effect of pregnancy on cadmium-treated rats

    Energy Technology Data Exchange (ETDEWEB)

    Takizama, Y. (Akita Univ. School of Medicine, Japan); Nakamura, I.; Kurayama, R.; Hirasawa, F.; Kawai, K.

    1982-01-01

    It is well known that itai-itai disease with the osteopathy is broken out among multiparas, 40 years of age and up Japanese residents. In this paper we described an experimental study of effect of pregnancy on cadmium treated rats. Female mature rats were administered drinking water containing 50 and 200 ppm cadmium as CdCl/sub 2/. During 180 days of the experiment, three times of pregnancy were succesful, though slight depression of body weight gain was noticed in the 200 ppm group. The cadmium was accumulated in the kidneys, liver and bone proportionally to the amount of cadmium administered. No significant change was recognized in serum calcium, phosphorus and alkaline phosphatase levels after 180 days. Though cadmium 200 ppm treated rats showed slight histological lesions in the proximal convoluted tubules of the kidney, there appeared to be no osteomalacia including excess formation of osteoid tissue.

  19. Effects of diethyldithiocarbamate on the toxicokinetics of cadmium chloride in mice

    DEFF Research Database (Denmark)

    Andersen, O; Nielsen, J B

    1989-01-01

    Diethyldithiocarbamate (DDC) efficiently alleviates the acute toxicity of injected cadmium chloride, but enhances the acute toxicity of orally administered cadmium chloride. Further, DDC induces extensive changes in organ distribution of cadmium, and mobilizes aged cadmium depots. The present study...... investigates effects of DDC on the toxicokinetics of cadmium at lower doses of cadmium than those used in previous studies. During single exposure to subtoxic oral doses of cadmium chloride DDC enhanced intestinal cadmium absorption, both after intraperitoneal and oral administration of DDC. In such acute...... exposure experiments orally administered DDC only slightly changed the relative organ distribution of absorbed cadmium, while intraperitoneal administration of DDC induced extensive changes in organ preference of absorbed cadmium. The relative hepatic and testicular deposition was reduced, while...

  20. 110警情处置%Disposal of 110 police situation

    Institute of Scientific and Technical Information of China (English)

    于厚亮

    2012-01-01

    近些年,随着公安机关工作的深入人心,使"110"完全融进了民众的日常生活,形成了老百姓有困难找警察的思维模式,但是受于公安机关权限限制,实际上对很多问题没有能力也没有权力去处置,本文对110警情处置中常见的案件类型在处置过程中的问题进行概括分析,并提出相应的解决办法。%In recent years,with the taking root of the work of the public security organs,"110" completely melt into the daily life of the population,forming a thinking mode of asking a police officer for help,but by the restrictions to the public security organs,actually a lot of problems can not or even do not have the right to be disposed.This article took an overview of the problems in the disposal of 110 police situation common types of cases and proposed appropriate solutions.

  1. Fast-neutron scattering from elemental cadmium

    International Nuclear Information System (INIS)

    Neutron differential-elastic-scattering cross sections of elemental cadmium are measured from approx. = 1.5 to 4.0 MeV at incident-neutron energy intervals of 50 to 200 keV and at 10 to 20 scattering angles distributed between approx. = 20 and 160 degrees. Concurrently, lumped-level neutron inelastic-excitation cross sections are measured. The experimental results are used to deduce parameters of an optical-statistical model that is descriptive of the observables and are compared with corresponding quantities given in ENDF/B-V

  2. Modeling cadmium in the feed chain and cattle organs

    Directory of Open Access Journals (Sweden)

    van der Fels-Klerx, I.

    2011-01-01

    Full Text Available The objectives of this study were to estimate cadmium contamination levels in different scenarios related to soil characteristics and assumptions regarding cadmium accumulation in the animal tissues, using quantitative supply chain modeling. The model takes into account soil cadmium levels, soil pH, soil-to-plant transfer, animal consumption patterns, and transfer into animal organs (liver and kidneys. The model was applied to cattle up to the age of six years which were fed roughage (maize and grass and compound feed. Cadmium content in roughage and cadmium intake by cattle were calculated for six different (soil scenarios varying in soil cadmium levels and soil pH. For each of the six scenarios, the carry-over of cadmium from intake into the cattle organs was estimated applying two model assumptions, i.e., linear accumulation and a steady state situation. The results showed that only in the most extreme soil scenario (cadmium level 2.5 mg.kg-1, pH 4.5, cadmium exceeded the EC maximum tolerated level in roughage. Assuming linear accumulation, cadmium levels in organs of cattle up to six years of age, ranged from 0.37-4.03 mg.kg-1 of fresh weight for kidneys and from 0.07 to 0.77 mg.kg-1 of fresh weight for livers. The maximum tolerated levels in one or both organs were exceeded in several scenarios. When considering organ excretion of cadmium, internal cadmium levels in organs were approximately one order of magnitude lower as compared to the results of the linear accumulation model. In this case only in the most extreme soil scenario, the maximum tolerated level in the kidney was exceeded. It was concluded that the difference between the two assumptions (linear model versus a steady state situation to estimate cadmium carry-over in cattle is negligible in the animal's first five years of life, but will become relevant at higher ages. For the current case, the linear approach is a good descriptor for worst case situations. Furthermore, this

  3. Sources of cadmium exposure among healthy premenopausal women

    International Nuclear Information System (INIS)

    Background: Cadmium, a persistent and widespread environmental pollutant, has been associated with kidney function impairment and several diseases. Cigarettes are the dominant source of cadmium exposure among smokers; the primary source of cadmium in non-smokers is food. We investigated sources of cadmium exposure in a sample of healthy women. Methods: In a cross-sectional study, 191 premenopausal women completed a health questionnaire and a food frequency questionnaire. The cadmium content of spot urine samples was measured with inductively-coupled plasma mass spectrometry and normalized to urine creatinine content. Multivariable linear regression was used to estimate the strength of association between smoking habits and, among non-smokers, usual foods consumed and urinary cadmium, adjusted for age, race, multivitamin and supplement use, education, estimated total energy intake, and parity. Results: Geometric mean urine creatinine-normalized cadmium concentration (uCd) of women with any history of cigarette smoking was 0.43 μg/g (95% confidence interval (CI): 0.38-0.48 μg/g) and 0.30 μg/g (0.27-0.33 μg/g) among never-smokers, and increased with pack-years of smoking. Analysis of dietary data among women with no reported history of smoking suggested that regular consumption of eggs, hot cereals, organ meats, tofu, vegetable soups, leafy greens, green salad, and yams was associated with uCd. Consumption of tofu products showed the most robust association with uCd; each weekly serving of tofu was associated with a 22% (95% CI: 11-33%) increase in uCd. Thus, uCd was estimated to be 0.11 μg/g (95% CI: 0.06-0.15 μg/g) higher among women who consumed any tofu than among those who consumed none. Conclusions: Cigarette smoking is likely the most important source of cadmium exposure among smokers. Among non-smokers, consumption of specific foods, notably tofu, is associated with increased urine cadmium concentration. - Research highlights: →Urine cadmium, usual

  4. Sources of cadmium exposure among healthy premenopausal women

    Energy Technology Data Exchange (ETDEWEB)

    Adams, Scott V., E-mail: sadams@fhcrc.org [Fred Hutchinson Cancer Research Center, PO Box 19024, M4-B402, Seattle, WA 98109 (United States); Department of Epidemiology, University of Washington, Box 357236, Seattle, WA 98195 (United States); Newcomb, Polly A. [Fred Hutchinson Cancer Research Center, PO Box 19024, M4-B402, Seattle, WA 98109 (United States); Department of Epidemiology, University of Washington, Box 357236, Seattle, WA 98195 (United States); Shafer, Martin M. [Environmental Chemistry and Technology Program, University of Wisconsin and Wisconsin State Laboratory of Hygiene, Madison, WI (United States); Atkinson, Charlotte [Department of Oral and Dental Science, Bristol Dental School, Bristol (United Kingdom); Bowles, Erin J. Aiello [Group Health Research Institute, Seattle, WA (United States); Newton, Katherine M. [Department of Epidemiology, University of Washington, Box 357236, Seattle, WA 98195 (United States); Group Health Research Institute, Seattle, WA (United States); Lampe, Johanna W. [Fred Hutchinson Cancer Research Center, PO Box 19024, M4-B402, Seattle, WA 98109 (United States); Department of Epidemiology, University of Washington, Box 357236, Seattle, WA 98195 (United States)

    2011-04-01

    Background: Cadmium, a persistent and widespread environmental pollutant, has been associated with kidney function impairment and several diseases. Cigarettes are the dominant source of cadmium exposure among smokers; the primary source of cadmium in non-smokers is food. We investigated sources of cadmium exposure in a sample of healthy women. Methods: In a cross-sectional study, 191 premenopausal women completed a health questionnaire and a food frequency questionnaire. The cadmium content of spot urine samples was measured with inductively-coupled plasma mass spectrometry and normalized to urine creatinine content. Multivariable linear regression was used to estimate the strength of association between smoking habits and, among non-smokers, usual foods consumed and urinary cadmium, adjusted for age, race, multivitamin and supplement use, education, estimated total energy intake, and parity. Results: Geometric mean urine creatinine-normalized cadmium concentration (uCd) of women with any history of cigarette smoking was 0.43 {mu}g/g (95% confidence interval (CI): 0.38-0.48 {mu}g/g) and 0.30 {mu}g/g (0.27-0.33 {mu}g/g) among never-smokers, and increased with pack-years of smoking. Analysis of dietary data among women with no reported history of smoking suggested that regular consumption of eggs, hot cereals, organ meats, tofu, vegetable soups, leafy greens, green salad, and yams was associated with uCd. Consumption of tofu products showed the most robust association with uCd; each weekly serving of tofu was associated with a 22% (95% CI: 11-33%) increase in uCd. Thus, uCd was estimated to be 0.11 {mu}g/g (95% CI: 0.06-0.15 {mu}g/g) higher among women who consumed any tofu than among those who consumed none. Conclusions: Cigarette smoking is likely the most important source of cadmium exposure among smokers. Among non-smokers, consumption of specific foods, notably tofu, is associated with increased urine cadmium concentration. - Research highlights: {yields

  5. Impairment induced by chronic occupational cadmium exposure during brazing process

    International Nuclear Information System (INIS)

    Cadmium (CD) is considered a metal of the 20th century to which all inhabitants of develop societies are exposed. Long-term occupational and environmental exposure to CD often results in renal dysfunction as the kidney is considered the critical target organ. The aim of this work was to evalutate both resporatory and renal manifestations induced by occupational exposure to CD compounds during brazing process, and suggesting a protocol for prevention and control for CD- induced health effects. This study was conducted on 20 males occupationally exposed workers. They are divided into two groups: Group-1 included (10) exposed smokers and group-2 included (10) exposed non-smokers. Results of both groups were compared with those of 10 healthy age and sex matched non-smokers. All subjects were subjected to detailed history taking and laboratory investigations including blood and urinary CD, liver profile (SGOT, SGPT and alkline phosphates), kindey function tests (blood urea, creatinine and urinary beta2- microglobulin). The level of Cd in the atmosphere of the work plase air was also assessed to detect the degree of exposure as it was about 6 times greater than thesave level (1 mu /m3).(1) This study demonstrated elevation levels of blood CD, urea, creatinine and urinary CD and beta2 -microglobulin for both exposed worker groups than the controls. In additions no appreciable were noted for liver function tests, although the levels fell within normal range

  6. 1?10 kW Stationary Combined Heat and Power Systems Status and Technical Potential: Independent Review

    Energy Technology Data Exchange (ETDEWEB)

    Maru, H. C.; Singhal, S. C.; Stone, C.; Wheeler, D.

    2010-11-01

    This independent review examines the status and technical potential of 1-10 kW stationary combined heat and power fuel cell systems and analyzes the achievability of the DOE cost, efficiency, and durability targets for 2012, 2015, and 2020.

  7. Accumulation and distribution of arsenic and cadmium by tea plants

    Institute of Scientific and Technical Information of China (English)

    Yuan-zhi SHI; Jian-yun RUAN; Lifeng MA; Wen-yan HAN; Fang WANG

    2008-01-01

    It is important to research the rules about accumulation and distribution of arsenic and cadmium by tea plants, which will give us some scientific ideas about how to control the contents of arsenic and cadmium in tea. In this study, by field inves- tigation and pot trial, we found that mobility of arsenic and cadmium in tea plants was low. Most arsenic and cadmium absorbed were fixed in feeding roots and only small amount was transported to the above-ground parts. Distribution of arsenic and cadmium, based on their concentrations of unit dry matter, in tea plants grown on un-contaminated soil was in the order: feeding roots>stems≈main roots>old leaves>young leaves. When tea plants were grown on polluted soils simulated by adding salts of these two metals, feeding roots possibly acted as a buffer and defense, and arsenic and cadmium were transported less to the above- ground parts. The concentration of cadmium in soil significantly and negatively correlated with chlorophyll content, photosyn- thetic rate, transpiration rate and biomass production of tea plants.

  8. Cadmium Uptake in Synechococcus aquatilis (Reynaud Strain SY01

    Directory of Open Access Journals (Sweden)

    Ruperto Vallarta Jr.

    1998-12-01

    Full Text Available Cadmium uptake in Synechococcus aquatilis (Reynaud Strain SY01 showed a biphasic behavior, with an initial rapid passive cell wall interaction phase and a later slow intracellular cation uptake process. The cell wall uptake process followed Michaelis-Menten kinetics. The apparent Km of the uptake system was 38.89 µM, a relatively high affinity Km value compared to other metal uptake systems. Fitting of experimental data to the Langmuir and Freundlich adsorption isotherms showed that binding of cadmium to the cell surface was monolayer and/or multilayer, although the monolayer adsorption was more probable, as exemplified by a high correlation coefficient. This could be explained by the presence of a strong primary binding site which was responsible for a monolayer adsorption and a weak secondary binding site which could be responsible for a multilayer adsorption. The uptake process was found to be relatively specific for cadmium. Equimolar amounts (200 µM of cobalt, nickel, magnesium, and copper did not significantly affect cadmium uptake. Synechococcus aquatilis Strain SY01 cells also showed an efflux mechanism for cadmium, although the amount of excluded cadmium was insignificant compared with the amount of adsorbed cadmium in the cell wall.

  9. Bacterial bioremediation of aquatic cadmium 11 of area of Pakistan

    International Nuclear Information System (INIS)

    Cadmium Cd/sup +2/ pollution arises mainly from contamination of minerals used in agriculture and from industrial process. The usual situation is of large volume of soil and H/sub 2/O that are contaminated with low but significant concentration of Cd/sup +2/. Cadmium is one of the most dangerous heavy metal both to human health and aquatic ecosystem. Microorganisms have developed different strategies to regulate uptake and to detoxify heavy metals viz; by different mechanisms i.e. by adsorption to cell surface, by intercellular accumulation, precipitation, biosynthesis of metallothioneins to volatile compounds. Microcosm experiments in chemostat incubated at 20 deg. C showed that Cadmium Contamination does not greatly affect bacterial communities in cultures contaminated with up to 1mg CdI/sup -1/. acterial productivity remains unchanged and Cadmium- resistant strains arise quickly and in great number. The cadmium accumulation by bacteria depend on the bacterial productivity. The free bacteria can accumulate up to 1200 ppm Cadmium Where as the adhering bacteria concentrate up to 6100 ppm. At a steady state, 11-29% Cadmium is removed from the water phase of cultures. This paper includes Cd (II) removal by Bacteria from waste water of Wah Cantonment Pakistan. (author)

  10. Gadolinium chloride pretreatment ameliorates acute cadmium-induced hepatotoxicity.

    Science.gov (United States)

    Kyriakou, Loukas G; Tzirogiannis, Konstantinos N; Demonakou, Maria D; Kourentzi, Kalliopi T; Mykoniatis, Michael G; Panoutsopoulos, Georgios I

    2013-08-01

    Cadmium is a known industrial and environmental pollutant. It causes hepatotoxicity upon acute administration. Features of cadmium-induced acute hepatoxicity encompass necrosis, apoptosis, peliosis and inflammatory infiltration. Gadolinium chloride (GdCl3) may prevent cadmium-induced hepatotoxicity by suppressing Kupffer cells. The effect of GdCl3 pretreatment on a model of acute cadmium-induced liver injury was investigated. Male Wistar rats 4-5 months old were injected intraperitoneally with normal saline followed by cadmium chloride (CdCl2; 6.5 mg/kg) or GdCl3 (10 mg/kg) followed by CdCl2 (6.5 mg/kg; groups I and II, respectively). Rats of both the groups were killed at 9, 12, 16, 24, 48 and 60 h after cadmium intoxication. Liver sections were analyzed for necrosis, apoptosis, peliosis and mitoses. Liver regeneration was also evaluated by tritiated thymidine incorporation into hepatic DNA. Serum levels of aspartate aminotransferase (AST) and alanine aminotransferase (ALT) were also determined. Hepatic necrosis, hepatocyte and nonparenchymal cell apoptosis and macroscopic and microscopic types of peliosis hepatis were minimized by gadolinium pretreatment. Serum levels of AST and ALT were also greatly diminished in rats of group II. Tritiated thymidine incorporation into hepatic DNA was increased in gadolinium pretreatment rats. Kupffer cell activation was minimal in both the groups of rats. Gadolinium pretreatment attenuates acute cadmium-induced liver injury in young Wistar rats, with mechanisms other than Kupffer cell elimination.

  11. Screening of Amaranth Cultivars (Amaranthus mangostanus L.) for Cadmium Hyperaccumulation

    Institute of Scientific and Technical Information of China (English)

    FAN Hong-li; ZHOU Wei

    2009-01-01

    The potential harm of soil cadmium pollution to ecological environment and human health has been increasingly widely concerned. Phytoremediation, as a kind of new and effective technology, has become an important method for cleaning up cadmium in contaminated sites. The amaranth (Amaranthus mangostanus L.) is widely distributed and has abundant varieties in China, its rapid growth and large biomass can be served as candidate for cadmium hyperaccumulators for phytoremediation. To obtain cadmium hyper-accumulator, Cd uptake in 23 amaranth euitivars from different ecological region was investigated under hydroponic culture condition. Meanwhile, pot experiment was established to probe phytoremediation potentiality of Cd contaminated soil by amaranth. Three treatment (Cd 5, 10, and 25 mg kg-1) were imposed to red soil, yellow brown soil, and vegetable soil. The results showed that under hydroponic culture with Cd 3 mg L-1, the cadmium concentration in the shoots of the cultivar Tianxingmi reached 260 mg kg-1, and its total cadmium uptake was the highest among various cultivars. In the treatment Cd 25 mg kg-1, the cadmium concentration in the shoots of the cultivar Tianxingmi reached 212 mg kg-1, while bioaccumulation factor and shoot purification rate reached 8.50 and 3.8%, respectively. Further, the total biomass and shoot biomass were not decreased significantly under Cd exposure.These results suggested that eultivar Tianxingmi is a typical Cd hyperaccumulator, and can be expected to be used in phytoremediation of Cd contaminated soil.

  12. Blood cadmium concentration and lipid profile in Korean adults

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Kisok, E-mail: kimkisok@kmu.ac.kr [Department of Public Health, Keimyung University, 1000 Shindang-dong, Daegu 704-701 (Korea, Republic of)

    2012-01-15

    Although animal experiments have shown that cadmium exposure induces alterations in lipid profiles, no epidemiological study of this relationship has been performed. The objective of this study was to evaluate the association between blood cadmium concentration and blood lipid levels in Korean adults. A cross-sectional study comprising participants (n=3903) aged 20 years or older from the 2005, 2008, and 2009 Korea National Health and Nutrition Examination Surveys was conducted. Demographic characteristics and dietary intake were obtained from the participants by questionnaire, and cadmium and lipid levels were determined by analysis of blood samples. After adjusting for demographic and dietary factors, blood concentration of cadmium was positively associated with the risk of low high-density lipoprotein cholesterol (HDL-C) in a dose-dependent manner (p for trend <0.001). In addition, the odds ratios (ORs) of a high triglyceride to HDL-C ratio was significantly increased in the high blood cadmium groups [OR=1.36; 95% confidence interval (CI), 1.03-1.79 for fourth quintile and OR=1.41; 95% CI, 1.07-1.86 for fifth quintile] compared with the lowest quintile group. However, high blood cadmium was not associated with a risk of high total cholesterol, high low-density lipoprotein cholesterol, or high triglycerides. These data suggest that an increased cadmium body burden increases the risk of dyslipidemia, mainly due to the increased risk of low HDL-C and the high ratio of triglycerides to HDL-C.

  13. Klinik for demensudredning--110 konsekutive patienter

    DEFF Research Database (Denmark)

    Johannsen, Peter; Ehlers, L; Abelskov, K E;

    1997-01-01

    medication. Ten patients received acetylsalicylic acid (150 mg Q.D.) and two a levo-dopa-type drug. Twenty-six patients were followed by gerontopsychiatric district care. Because only 47% of the patients suspected of dementia actually fulfilled dementia criteria, the evaluation suggests that patients......Case reports of 110 patients referred to a neurological dementia clinic were reviewed to evaluate a standardized diagnostic program. The patients were evaluated by a neurologist, a gerontopsychiatrist, and a neuropsychologist. ICD-10 criteria were used. Fifty-two patients had dementia while 58 had...... not; of these, 27 suffered from other non-dementia diseases and 31 were without dementia or other psychiatric or neurological disease. Thirteen patients with Alzheimer's disease were treated with tacrine. Four patients underwent cobalamin substitution treatment and seven started antidepressant...

  14. The Hsp110 molecular chaperone stabilizes apolipoprotein B from endoplasmic reticulum-associated degradation (ERAD).

    Science.gov (United States)

    Hrizo, Stacy L; Gusarova, Viktoria; Habiel, David M; Goeckeler, Jennifer L; Fisher, Edward A; Brodsky, Jeffrey L

    2007-11-01

    Apolipoprotein B (apoB) is the most abundant protein in low density lipoproteins and plays key roles in cholesterol homeostasis. The co-translational degradation of apoB is controlled by fatty acid levels in the endoplasmic reticulum (ER) and is mediated by the proteasome. To define the mechanism of apoB degradation, we employed a cell-free system in which proteasome-dependent degradation is recapitulated with yeast cytosol, and we developed an apoB yeast expression system. We discovered that a yeast Hsp110, Sse1p, associates with and stabilizes apoB, which contrasts with data indicating that select Hsp70s and Hsp90s facilitate apoB degradation. However, the Ssb Hsp70 chaperones have no effect on apoB turnover. To determine whether our results are relevant in mammalian cells, Hsp110 was overexpressed in hepatocytes, and enhanced apoB secretion was observed. This study indicates that chaperones within distinct complexes can play unique roles during ER-associated degradation (ERAD), establishes a role for Sse1/Hsp110 in ERAD, and identifies Hsp110 as a target to lower cholesterol. PMID:17823116

  15. Cadmium minimization in wheat: A critical review.

    Science.gov (United States)

    Rizwan, Muhammad; Ali, Shafaqat; Abbas, Tahir; Zia-Ur-Rehman, Muhammad; Hannan, Fakhir; Keller, Catherine; Al-Wabel, Mohammad I; Ok, Yong Sik

    2016-08-01

    Cadmium (Cd) accumulation in wheat (Triticum aestivum L.) and its subsequent transfer to food chain is a major environmental issue worldwide. Understanding wheat response to Cd stress and its management for aiming to reduce Cd uptake and accumulation in wheat may help to improve wheat growth and grain quality. This paper reviewed the toxic effects, tolerance mechanisms, and management of Cd stress in wheat. It was concluded that Cd decreased germination, growth, mineral nutrients, photosynthesis and grain yield of wheat and plant response to Cd toxicity varies with cultivars, growth conditions and duration of stress applied. Cadmium caused oxidative stress and genotoxicity in wheat plants. Stimulation of antioxidant defense system, osmoregulation, ion homeostasis and over production of signalling molecules are important adaptive strategies of wheat under Cd stress. Exogenous application of plant growth regulators, inorganic amendments, proper fertilization, silicon, and organic, manures and biochar, amendments are commonly used for the reduction of Cd uptake in wheat. Selection of low Cd-accumulating wheat cultivars, crop rotation, soil type, and exogenous application of microbes are among the other agronomic practices successfully employed in reducing Cd uptake by wheat. These management practices could enhance wheat tolerance to Cd stress and reduce the transfer of Cd to the food chain. However, their long-term sustainability in reducing Cd uptake by wheat needs further assessment.

  16. Selenium protection from cadmium and chromium poisoning

    International Nuclear Information System (INIS)

    The interaction of selenium with cadmium and chromium was studied in 168 chicken-broilers (DWCxWR) divided into four equal groups. Eight-week old control animals received an intravenous dose of /sup 115m/Cd Chloride 370 KBq/Kg (Group I), or 51Cr Chloride 370 KBq/Kg (Group II). The kinetics of these isotopes were studied by scintillation spectrometry (NaI/TI) carried out for whole blood, plasma, plasma proteins, urine, feces and homogenates of all organs at various time intervals. Animals in Groups III and IV received eight subcutaneous doses of sodium selenate (5ug) at 8-week intervals prior to /sup 115m/Cd or 51Cr. The kinetics of these elements were studied as in the previous two groups. It was found that selenium affected those kinetics in two ways: (a) by increasing the excretion of Cd by 11 +/- 3% (P < 0.001) and that of Cr by 7 +/- 1% (P < 0.001); and (b) by favoring redistribution of those elements, with significant (P < 0.001) reductions in liver, endocrine glands and kidney and increases (P < 0.01) in bone. The study suggests that selenium protects the animals' vital organs from environmental pollutants, such as cadmium and chromium

  17. Cadmium minimization in wheat: A critical review.

    Science.gov (United States)

    Rizwan, Muhammad; Ali, Shafaqat; Abbas, Tahir; Zia-Ur-Rehman, Muhammad; Hannan, Fakhir; Keller, Catherine; Al-Wabel, Mohammad I; Ok, Yong Sik

    2016-08-01

    Cadmium (Cd) accumulation in wheat (Triticum aestivum L.) and its subsequent transfer to food chain is a major environmental issue worldwide. Understanding wheat response to Cd stress and its management for aiming to reduce Cd uptake and accumulation in wheat may help to improve wheat growth and grain quality. This paper reviewed the toxic effects, tolerance mechanisms, and management of Cd stress in wheat. It was concluded that Cd decreased germination, growth, mineral nutrients, photosynthesis and grain yield of wheat and plant response to Cd toxicity varies with cultivars, growth conditions and duration of stress applied. Cadmium caused oxidative stress and genotoxicity in wheat plants. Stimulation of antioxidant defense system, osmoregulation, ion homeostasis and over production of signalling molecules are important adaptive strategies of wheat under Cd stress. Exogenous application of plant growth regulators, inorganic amendments, proper fertilization, silicon, and organic, manures and biochar, amendments are commonly used for the reduction of Cd uptake in wheat. Selection of low Cd-accumulating wheat cultivars, crop rotation, soil type, and exogenous application of microbes are among the other agronomic practices successfully employed in reducing Cd uptake by wheat. These management practices could enhance wheat tolerance to Cd stress and reduce the transfer of Cd to the food chain. However, their long-term sustainability in reducing Cd uptake by wheat needs further assessment. PMID:27062345

  18. Cadmium determination in Lentinus edodes mushroom species

    Directory of Open Access Journals (Sweden)

    Vera Akiko Maihara

    2012-09-01

    Full Text Available Many studies have drawn attention to the occurrence and concentration of toxic elements found in the fruiting body of mushrooms. Some edible mushroom species are known to accumulate high levels of inorganic contaminants, mainly cadmium, mercury, and lead. There are about 2,000 known edible mushroom species, but only 25 of them are cultivated and used as food. In Brazil, the most marketed and consumed mushroom species are Agaricus bisporus, known as Paris champignon, Lentinus edodes, or Shitake and Pleurotus sp, also called Shimeji or Hiratake. In this study, the concentration of cadmium was determined in Lentinus edodes mushrooms from different cities in São Paulo state and some samples imported from Japan and China. The analyses were performed by graphite furnace atomic absorption spectrometry after HNO3-H2O2 digestion. The results showed a lower concentration of Cd in the mushrooms cultivated in São Paulo (0.0079 to 0.023 mg.kg-1 in natura than that of the mushrooms cultivated abroad (0.125 to 0.212 mg.kg-1 in natura. Although there is no tolerance limit for Cd in mushrooms in Brazil, the results show that Lentinus edodes mushrooms can be safely consumed.

  19. Exposure dose response relationships of the freshwater bivalve Hyridella australis to cadmium spiked sediments

    Energy Technology Data Exchange (ETDEWEB)

    Marasinghe Wadige, Chamani P.M., E-mail: chamani.marasinghe.wadige@canberra.edu.au; Maher, William A.; Taylor, Anne M.; Krikowa, Frank

    2014-07-01

    Highlights: • The exposure–dose–response approach was used to assess cadmium exposure and toxicity. • Accumulated cadmium in H. australis reflected the sediment cadmium exposure. • Spill over of cadmium into the biologically active pool was observed. • Increased cadmium resulted in measurable biological effects. • H. australis has the potential to be a cadmium biomonitor in freshwater environments. - Abstract: To understand how benthic biota may respond to the additive or antagonistic effects of metal mixtures in the environment it is first necessary to examine their responses to the individual metals. In this context, laboratory controlled single metal-spiked sediment toxicity tests are useful to assess this. The exposure–dose–response relationships of Hyridella australis to cadmium-spiked sediments were, therefore, investigated in laboratory microcosms. H. australis was exposed to individual cadmium spiked sediments (<0.05 (control), 4 ± 0.3 (low) and 15 ± 1 (high) μg/g dry mass) for 28 days. Dose was measured as cadmium accumulation in whole soft body and individual tissues at weekly intervals over the exposure period. Dose was further examined as sub-cellular localisation of cadmium in hepatopancreas tissues. The biological responses in terms of enzymatic and cellular biomarkers were measured in hepatopancreas tissues at day 28. H. australis accumulated cadmium from spiked sediments with an 8-fold (low exposure organisms) and 16-fold (high exposure organisms) increase at day 28 compared to control organisms. The accumulated tissue cadmium concentrations reflected the sediment cadmium exposure at day 28. Cadmium accumulation in high exposure organisms was inversely related to the tissue calcium concentrations. Gills of H. australis showed significantly higher cadmium accumulation than the other tissues. Accumulated cadmium in biologically active and biologically detoxified metal pools was not significantly different in cadmium exposed

  20. Cadmium-induced inhibition of photosynthesis and long-term acclimation to cadmium stress in the hyperaccumulator Thlaspi caerulescens.

    Science.gov (United States)

    Küpper, Hendrik; Parameswaran, Aravind; Leitenmaier, Barbara; Trtílek, Martin; Setlík, Ivan

    2007-01-01

    Acclimation of hyperaccumulators to heavy metal-induced stress is crucial for phytoremediation and was investigated using the hyperaccumulator Thlaspi caerulescens and the nonaccumulators T. fendleri and T. ochroleucum. Spatially and spectrally resolved kinetics of in vivo absorbance and fluorescence were measured with a novel fluorescence kinetic microscope. At the beginning of growth on cadmium (Cd), all species suffered from toxicity, but T. caerulescens subsequently recovered completely. During stress, a few mesophyll cells in T. caerulescens became more inhibited and accumulated more Cd than the majority; this heterogeneity disappeared during acclimation. Chlorophyll fluorescence parameters related to photochemistry were more strongly affected by Cd stress than nonphotochemical parameters, and only photochemistry showed acclimation. Cd acclimation in T. caerulescens shows that part of its Cd tolerance is inducible and involves transient physiological heterogeneity as an emergency defence mechanism. Differential effects of Cd stress on photochemical vs nonphotochemical parameters indicate that Cd inhibits the photosynthetic light reactions more than the Calvin-Benson cycle. Differential spectral distribution of Cd effects on photochemical vs nonphotochemical quenching shows that Cd inhibits at least two different targets in/around photosystem II (PSII). Spectrally homogeneous maximal PSII efficiency (F(v)/F(m)) suggests that in healthy T. caerulescens all chlorophylls fluorescing at room temperature are PSII-associated. PMID:17688582

  1. 33 CFR 110.232 - Southeast Alaska.

    Science.gov (United States)

    2010-07-01

    ... require a nonself propelled vessel to be attended by a tug while moored, anchored, or remaining within the... sufficient size to permit target indication on the radar screen of commercial type radar; or (ii) Have...

  2. The self assembly of thymine at Au(110)/liquid interfaces

    Energy Technology Data Exchange (ETDEWEB)

    Molina Contreras, J.R. [Departamento de Ingenieria Electrica y Electronica, Instituto Tecnologico de Aguascalientes, Mexico (Mexico); Smith, C.I.; Bowfield, A.; Weightman, P. [Physics Department, University of Liverpool (United Kingdom); Tillner, F. [Fachbereich Physik, Universitaet Konstanz (Germany)

    2012-06-15

    We show that thymine self-assembles into an ordered structure when adsorbed at a Au(110)/liquid interface. Reflection anisotropy spectroscopy (RAS) shows that as found for cytosine and adenine the adsorbed thymine molecules are oriented essentially vertically on the Au(110) surface with the molecule aligned along one of the principal axes of the Au(110) surface. Simulations of the RA spectra to an empirical model indicates that as found for adsorbed cytosine and adenine, thymine is aligned along the [1 anti 10] direction on the Au(110) surface. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  3. Chromosomal Locus for Cadmium Resistance in Pseudomonas putida Consisting of a Cadmium-Transporting ATPase and a MerR Family Response Regulator

    OpenAIRE

    Lee, Seon-Woo; Glickmann, Eric; Cooksey, Donald A.

    2001-01-01

    Pseudomonads from environmental sources vary widely in their sensitivity to cadmium, but the basis for this resistance is largely uncharactarized. A chromosomal fragment encoding cadmium resistance was cloned from Pseudomonas putida 06909, a rhizosphere bacterium, and sequence analysis revealed two divergently transcribed genes, cadA and cadR. CadA was similar to cadmium-transporting ATPases known mostly from gram-positive bacteria, and to ZntA, a lead-, zinc-, and cadmium-transporting ATPase...

  4. Inclusion free cadmium zinc tellurium and cadmium tellurium crystals and associated growth method

    Science.gov (United States)

    Bolotnikov, Aleskey E.; James, Ralph B.

    2010-07-20

    The present disclosure provides systems and methods for crystal growth of cadmium zinc tellurium (CZT) and cadmium tellurium (CdTe) crystals with an inverted growth reactor chamber. The inverted growth reactor chamber enables growth of single, large, high purity CZT and CdTe crystals that can be used, for example, in X-ray and gamma detection, substrates for infrared detectors, or the like. The inverted growth reactor chamber enables reductions in the presence of Te inclusions, which are recognized as an important limiting factor in using CZT or CdTe as radiation detectors. The inverted growth reactor chamber can be utilized with existing crystal growth techniques such as the Bridgman crystal growth mechanism and the like. In an exemplary embodiment, the inverted growth reactor chamber is a U-shaped ampoule.

  5. Deficiency of p110δ isoform of the phosphoinositide 3 kinase leads to enhanced resistance to Leishmania donovani.

    Directory of Open Access Journals (Sweden)

    Forough Khadem

    2014-06-01

    Full Text Available Visceral leishmaniasis is the most clinically relevant and dangerous form of human leishmaniasis. Most traditional drugs for treatment of leishmaniasis are toxic, possess many adverse reactions and drug resistance is emerging. Therefore, there is urgent need for identification of new therapeutic targets. Recently, we found that mice with an inactivating knock-in mutation in the p110δ isoform of pi3k, (p110δ(d910a are hyper resistant to L. major, develop minimal cutaneous lesion and rapidly clear their parasite. Here, we investigated whether pi3k signaling also regulates resistance to L. donovani, one of the causative agents of visceral leishmaniasis.WT and p110δ(D910A mice (on a BALB/c background were infected with L. donovani. At different time points, parasite burden and granuloma formation were assessed. T and B cell responses in the liver and spleen were determined. In addition, Tregs were expanded in vivo and its impact on resistance was assessed. We found that p110δ(D910A mice had significantly reduced splenomegaly and hepatomegaly and these organs harbored significantly fewer parasites than those of WT mice. Interestingly, infected p110δ(D910A mice liver contains fewer and less organized granulomas than their infected WT counterparts. Cells from p110δ(D910A mice were significantly impaired in their ability to produce cytokines compared to WT mice. The percentage and absolute numbers of Tregs in infected p110δ(D910A mice were lower than those in WT mice throughout the course of infection. In vivo expansion of Tregs in infected p110δ(D910A mice abolished their enhanced resistance to L. donovani infection.Our results indicate that the enhanced resistance of p110δ(D910A mice to L. donovani infection is due to impaired activities of Tregs. They further show that resistance to Leishmania in the absence of p110δ signaling is independent of parasite species, suggesting that targeting the PI3K signaling pathway may be useful for

  6. Fractionation of Stable Cadmium Isotopes in the Cadmium Tolerant Ricinus communis and Hyperaccumulator Solanum nigrum

    OpenAIRE

    Rongfei Wei; Qingjun Guo; Hanjie Wen; Congqiang Liu; Junxing Yang; Marc Peters; Jian Hu; Guangxu Zhu; Hanzhi Zhang; Liyan Tian; Xiaokun Han; Jie Ma; Chuanwei Zhu; Yingxin Wan

    2016-01-01

    Cadmium (Cd) isotopes provide new insights into Cd uptake, transport and storage mechanisms in plants. Therefore, the present study adopted the Cd-tolerant Ricinus communis and Cd-hyperaccumulator Solanum nigrum, which were cultured under controlled conditions in a nutrient solution with variable Cd supply, to test the isotopic fractionation of Cd during plant uptake. The Cd isotope compositions of nutrient solutions and organs of the plants were measured by multiple collector inductively cou...

  7. Electrochemical removal of cadmium from bio-ash; Elektrokemisk fjernelse af cadmium fra bioasker

    Energy Technology Data Exchange (ETDEWEB)

    Juul Pedersen, Anne; Ottosen, Lisbeth M.; Simonsen, Peter; Christensen, Terkel C.

    2004-07-01

    The potential of using the method electrodialytic remediation for removal of cadmium from bioashes has been investigated. Five different types of fly ash from biomass combustion were included in the study: 1) A straw combustion fly ash from grate-firing at Avedoere power plant. 2) A fly ash from co-firing of wood and fuel oil at Avedoere power plant. 3) A suspended, grain size fractionated straw fly ash, obtained from PSO project FU 2201, fine and coarse size fraction. The ash was originally produced at Avedoere power plant. 4) A straw pellet fly ash from dust-firing at Amager power plant. Thr five ashes were characterised, and a series of preliminary elekctrodialytic remediation experiments were conducted on each ash. In spite a significant differences between the five ashes with respect to parameters such as pH and content of cadmium, all ashes showed promising remediation potential. For all ashes cadmium concentrations below the regulatory limits for recycling were reached in one or more of the preliminary remediation experiements. The best results were obtained with the suspended straw ash from PSO FU 2201, whereas the results with the wood chips ash, due to a high initial pH value, were less sucessful, meaning that the remediation process was progressing more slowly. (BA)

  8. CERN: Fixed target targets

    International Nuclear Information System (INIS)

    Full text: While the immediate priority of CERN's research programme is to exploit to the full the world's largest accelerator, the LEP electron-positron collider and its concomitant LEP200 energy upgrade (January, page 1), CERN is also mindful of its long tradition of diversified research. Away from LEP and preparations for the LHC proton-proton collider to be built above LEP in the same 27-kilometre tunnel, CERN is also preparing for a new generation of heavy ion experiments using a new source, providing heavier ions (April 1992, page 8), with first physics expected next year. CERN's smallest accelerator, the LEAR Low Energy Antiproton Ring continues to cover a wide range of research topics, and saw a record number of hours of operation in 1992. The new ISOLDE on-line isotope separator was inaugurated last year (July, page 5) and physics is already underway. The remaining effort concentrates around fixed target experiments at the SPS synchrotron, which formed the main thrust of CERN's research during the late 1970s. With the SPS and LEAR now approaching middle age, their research future was extensively studied last year. Broadly, a vigorous SPS programme looks assured until at least the end of 1995. Decisions for the longer term future of the West Experimental Area of the SPS will have to take into account the heavy demand for test beams from work towards experiments at big colliders, both at CERN and elsewhere. The North Experimental Area is the scene of larger experiments with longer lead times. Several more years of LEAR exploitation are already in the pipeline, but for the longer term, the ambitious Superlear project for a superconducting ring (January 1992, page 7) did not catch on. Neutrino physics has a long tradition at CERN, and this continues with the preparations for two major projects, the Chorus and Nomad experiments (November 1991, page 7), to start next year in the West Area. Delicate neutrino oscillation effects could become

  9. Expression of PI3Kp110α and PI3Kp110β in the colorectal conventional adenoma, serrated lesions and adenoma with canceration and their significance

    OpenAIRE

    Wu, Shuhua; Li, Tangyue; Mu, Qinghai; Li, Yangyang; Gao, Xiangqian; He, Shuang; Sun, Chenbo

    2015-01-01

    Aims: To evaluate the expression and clinical significance of PI3Kp110α and PI3Kp110β in colorectal conventional adenoma, serrated lesions and adenoma with canceration. Methods and results: Immunohistochemistry and Western blot analysis were conducted to detect the expression of p110α and p110β in normal colorectal tissues, conventional adenoma, serrated lesions and adenoma canceration. Results revealed that the expression of P110α and P110β in the adenoma canceration was significantly higher...

  10. Soil biogeochemistry, plant physiology and phytoremediation of cadmium contaminated soils

    Science.gov (United States)

    Cadmium (Cd) loading in soil and the environment has been accelerated worldwide due to enhanced industrialization and intensified agricultural production, particularly in the developing countries. Soil Cd pollution, resulting from both anthropogenic and geogenic sources, has posed an increasing chal...

  11. A Study of Growth of Cadmium Oxide Nano structure

    International Nuclear Information System (INIS)

    Cadmium oxide nano structure were synthesized by solid-vapor deposition without catalyst. Cadmium Oxide powder was heated to 1320 K in a tube furnace, and the resultant vapor was carried to the silicon substrate zone by an argon flow. Field electron scanning electron microscopy revealed that the product was dendrite-like petals of Cadmium Oxide nano structure. The grown nano structure had random orientations and a grain size of 30 nm. Photoluminescence spectroscopy was conducted to investigate the optical properties of the nano structures. The red-shift direct band gap energy of Cadmium Oxide nano structure was at 548 nm (2.26 eV), whereas that of CdO bulk was at 491 nm (2.5 eV). (author)

  12. Polycrystalline Thin-Film Research: Cadmium Telluride (Fact Sheet)

    Energy Technology Data Exchange (ETDEWEB)

    2011-06-01

    Capabilities fact sheet that includes scope, core competencies and capabilities, and contact/web information for Polycrystalline Thin-Film Research: Cadmium Telluride at the National Center for Photovoltaics.

  13. Electrodialytic removal of cadmium from straw combustion fly ash

    DEFF Research Database (Denmark)

    Hansen, Henrik K.; Ottosen, Lisbeth M.; Villumsen, Arne

    2004-01-01

    Fly ash from straw combustion contains valuable nutrients when returned to agricultural soils. In many instances, however, this fly ash may contain heavy metals, such as cadmium, at levels which often exceed the limits given by the Danish legislation. Thus before utilizing the nutrients, cadmium...... must be removed from these ashes. The use of an electrodialytic remediation method to remove cadmium from fly ash arising from straw combustion and containing 11.2 mg Cd kg$+-1$/ DM (dry matter) was accessed. After 36 days of remediation at a constant current density of 5.6 mA cm$+-2$/ more than 97......% of the cadmium had been removed from around 150 g ash on a dry basis. $CPY 2004 Society of Chemical Industry....

  14. Literature review on pickling inhibitors and cadmium electroplating processes

    Science.gov (United States)

    Elsea, A. R.; Fletcher, E. E.; Groeneveld, T. P.

    1969-01-01

    Because introduction of hydrogen during bright-cadmium electroplating of high strength steels causes hydrogen-stress cracking, a program was undertaken to evaluate various processes and materials. Report describes effectiveness of inhibitors for reducing hydrogen absorption by steels.

  15. EFFECTS OF CADMIUM ON THE REPRODUCTIVE AXIS OF JAPANESE MEDAKA

    Science.gov (United States)

    Cadmium (Cd) is a ubquitous element and a significant inorganic pollutant that has previously been found to bioaccumulate in reproductive organs of fish and disrupt important endocrine processes, especially those involved in synthesis, release and metabolism of hormones. Clearly,...

  16. A Facile Glycosylation of Spirostanol Catalyzed by Cadmium Carbonate

    Institute of Scientific and Technical Information of China (English)

    2003-01-01

    A facile glycosylation for the synthesis of spirostanol glycosides was reported. Using cadmium carbonate as a catalyst in CH3CN, a series of saponins was synthesized efficiently in a satisfactory yield.

  17. Ion exchange of Cobalt and Cadmium in Zeolite X

    International Nuclear Information System (INIS)

    The growing development in the industry has an important contribution to the environmental damage, where the natural effluents are each day more contaminated by toxic elements, such as: mercury, chromium, lead and cadmium. So as to separate such elements it has sorbent must have enough stability, and have a sharp capacity of sorption. In this work it was studied the sorption behavior of cobalt and on the other hand, cadmium in aqueous solutions, which along with sodic form of the Zeolite X, undergoes a phenomenon of ionic interchange. Such interchange was verify to different concentration of cadmium, cobalt and hydronium ion. The content of cobalt and sodium in the interchanged samples was detected through the neutronic activation analysis. The results disclose a higher selectivity for cadmium than cobalt. (Author)

  18. Prediction of cadmium concentration in selected home-produced vegetables.

    Science.gov (United States)

    Bešter, Petra Karo; Lobnik, Franc; Eržen, Ivan; Kastelec, Damijana; Zupan, Marko

    2013-10-01

    Soil contaminated with cadmium presents a potential hazard for humans, animals and plants. The latter play a major role in the transfer of cadmium to the food chain. The uptake of cadmium and its accumulation by plants is dependent on various soil, plants and environmental factors. In order to identify soil properties with statistically significant influence on cadmium concentration in vegetables and to reduce the collection of data, time and costs, regression models can be applied. The main objective of this research was to develop regression models to predict the concentration of cadmium in 9-vegetable species: zucchini, tomato, cabbage, onion, potato, carrot, red beet, endive and chicory, based on soil properties. Soil samples were collected from 123 home gardens of the Municipality of Celje and 59 of these gardens were also included in vegetable sampling. The concentration of elements (e.g. arsenic, cadmium, copper, lead, and zinc) in the samples was determined by Inductively Coupled Plasma Mass Spectrometry. Single (for cabbage, potato, red beet and chicory) and multiple (for tomato, onion, carrot and endive) linear regression models were developed. There was no statistically significant regression model for zucchini. The most significant parameter for the influencing the cadmium concentration in vegetables was the concentration of cadmium in soil. Other important soil properties were the content of organic matter, pH-value and the concentration of manganese. It was concluded that consuming carrots, red beets, endives, onions, potatoes and chicory which are grown in gardens with Cd concentrations (mgkg(-1) DW) above 2.4, 3.2, 6.3, 7.9, 8.3 and 10.9, respectively, might represent an important contribution to dietary Cd exposure. PMID:23886800

  19. Surfactant Mediated Cadmium Determination with Dithizone in Aqueous Solution

    OpenAIRE

    Ismael, Fouad Jawad

    2014-01-01

    ABSTRACT: Cadmium is a toxic and hazardous trace metal that has become a serious environmental pollutant since industrialization and intensive farming began in late 19th century. Although there are many established wet-chemical and instrumental methods for qualitative and quantitative determination of cadmium, most involve the formation of the Cd-dithizone complex in the presence of the highly toxic potassium cyanide which is then extracted into carcinogenic chlorinated organic solvents such ...

  20. Ecotoxicity and genotoxicity of cadmium in different marine trophic levels.

    Science.gov (United States)

    Pavlaki, Maria D; Araújo, Mário J; Cardoso, Diogo N; Silva, Ana Rita R; Cruz, Andreia; Mendo, Sónia; Soares, Amadeu M V M; Calado, Ricardo; Loureiro, Susana

    2016-08-01

    Cadmium ecotoxicity and genotoxicity was assessed in three representative species of different trophic levels of marine ecosystems - the calanoid copepod Acartia tonsa, the decapod shrimp, Palaemon varians and the pleuronectiform fish Solea senegalensis. Ecotoxicity endpoints assessed in this study were adult survival, hatching success and larval development ratio (LDR) for A. tonsa, survival of the first larval stage (zoea I) and post-larvae of P. varians, egg and larvae survival, as well as the presence of malformations in the larval stage of S. senegalensis. In vivo genotoxicity was assessed on adult A. tonsa, the larval and postlarval stage of P. varians and newly hatched larvae of S. senegalensis using the comet assay. Results showed that the highest sensitivity to cadmium is displayed by A. tonsa, with the most sensitive endpoint being the LDR of nauplii to copepodites. Sole eggs displayed the highest tolerance to cadmium compared to the other endpoints evaluated for all tested species. Recorded cadmium toxicity was (by increasing order): S. senegalensis eggs < P. varians post-larvae < P. varians zoea I < S. senegalensis larvae < A. tonsa eggs < A. tonsa LDR. DNA damage to all species exposed to cadmium increased with increasing concentrations. Overall, understanding cadmium chemical speciation is paramount to reliably evaluate the effects of this metal in marine ecosystems. Cadmium is genotoxic to all three species tested and therefore may differentially impact individuals and populations of marine taxa. As A. tonsa was the most sensitive species and occupies a lower trophic level, it is likely that cadmium contamination may trigger bottom-up cascading effects in marine trophic interactions. PMID:27203468

  1. Avalanche multiplication of electrons and holes in cadmium telluride

    CERN Document Server

    Demich, N V

    2001-01-01

    Determination of the ratio of the coefficients of the electrons and holes of the diode structures impact ionization is carried out with the purpose of optimizing the parameters of the avalanche diodes from the cadmium telluride. It is shown experimentally, that the process of the impact ionization in the cadmium telluride is stimulated by holes. The ratio of the coefficients of the holes and electrons impact ionization constitutes approx = 30-40

  2. Association between blood cadmium levels and malnutrition in peritoneal dialysis

    OpenAIRE

    Hsu, Ching-Wei; Lin, Ja-Liang; Lin-Tan, Dan-Tzu; Huang, Wen-Hung; Chen, Kuan-Hsing; Yen, Tzung-Hai

    2014-01-01

    Background Malnutrition is associated with an increased risk of cardiovascular death and may cause protein-energy wasting in individuals with chronic kidney disease. A previous study demonstrated that blood cadmium levels (BCLs) were associated with malnutrition in maintenance hemodialysis (MHD) patients. However, the correlation between cadmium exposure and malnutrition remains unclear in chronic peritoneal dialysis (CPD) patients. This study examined the possible adverse effects of environm...

  3. Harmful effects of cadmium on olfactory system in mice.

    Science.gov (United States)

    Bondier, Jean-Robert; Michel, Germaine; Propper, Alain; Badot, Pierre-Marie

    2008-10-01

    The inhalation of certain metals can result in olfactory epithelial injury, an altered sense of smell, and direct delivery of the metal from the olfactory epithelium to the olfactory bulbs and other parts of the central nervous system. The purpose of this study was to examine whether mice given an intranasal instillation of cadmium would develop altered olfactory function and to assess whether cadmium may be transported directly from the olfactory epithelium to the central nervous system. To evaluate cadmium's ability to induce anosmia and on the basis of olfactory epithelium sensitivity to metals, the aim of this study was first to study cadmium effects on the olfactory function and secondly to check whether cadmium may be transported from the nasal area to the central nervous system. After an intranasal instillation of a solution containing CdCl2 at 136 mM, we observed in treated mice: (1) a partial destruction of the olfactory epithelium, which is reduced to three or four basal cell layers followed by a progressive regeneration; (2) a loss of odor discrimination with a subsequent recovery; and (3) a cadmium uptake by olfactory bulbs demonstrated using atomic absorption spectrophotometry, but not by other parts of the central nervous system. Cadmium was delivered to the olfactory bulbs, most likely along the olfactory nerve, thereby bypassing the intact blood-brain barrier. We consider that cadmium can penetrate olfactory epithelium and hence be transported to olfactory bulbs. The olfactory route could therefore be a likely way to reach the brain and should be taken into account for occupational risk assessments for this metal.

  4. Sputter target

    Science.gov (United States)

    Gates, Willard G.; Hale, Gerald J.

    1980-01-01

    The disclosure relates to an improved sputter target for use in the deposition of hard coatings. An exemplary target is given wherein titanium diboride is brazed to a tantalum backing plate using a gold-palladium-nickel braze alloy.

  5. Cadmium removal in a biosorption column

    Energy Technology Data Exchange (ETDEWEB)

    Volesky, B.; Prasetyo, I. (McGill Univ., Montreal, Quebec (Canada). Dept. of Chemical Engineering)

    1994-05-01

    New biosorbent material derived from a ubiquitous brown marine alga Ascophyllum nodosum has been examined in packed-bed flow-through sorption columns. It effectively removed 10 mg/L of cadmium down to 1.5 ppb levels in the effluent, representing 99.985% removal. The experimental methodology used was based on the early Bohart and Adams sorption model, resulting in quantitative determination of the characteristic process parameters which can be used for performance comparison and process design. An average metal loading of the biosorbent (N[sub 0]) determined was 30 mg Cd/g, corresponding closely to that observed for the batch equilibrium metal concentration of 10 mg Cd/L. The critical bed depth (D[sub min]) for the potable water effluent quality standard varied with the column feed flow rate from 20 to 50 cm. The sorption column mass transfer and dispersion coefficients were determined, which are also required for solving the sorption model equations.

  6. Cadmium substituted high permeability lithium ferrite

    Indian Academy of Sciences (India)

    S S Bellad; S C Watawe; A M Shaikh; B K Chougule

    2000-04-01

    Polycrystalline Li0.5–/2 Cd Fe2.5–/2O4 ferrites where = 0, 0.1, 0.2, 0.3, 0.4, 0.5 and 0.6 were prepared by a double sintering ceramic technique and characterized by X-ray diffraction and scanning electron microscopy (SEM). The lattice parameter is found to increase monotonically with the cadmium content. It is explained in terms of the sizes of component ions. The grain size of the samples increases up to = 0.3 and then it decreases for higher values of . A similar trend is observed in the variation of Ms with Cd2+ content. The initial permeability () is however found to increase continuously with . The increase in is attributed to decrease of anisotropy constant K1 and higher grain size of the samples.

  7. Synthesis and Electroluminescence Characterization of Cadmium Complex

    Directory of Open Access Journals (Sweden)

    Rahulkumar

    2011-01-01

    Full Text Available We have synthesized and characterized a new electroluminescence material,Cadmium [(2-(2-hydroxyphenylbenzoxazole(8-hydoxyquinoline] Cd(HPBq. The absorption spectra of this material show maxima at 378 nm. It may be attributed due to π° – π* transition. The photoluminescence showed peak at 520 nm. TGA data of the material shows stability up to 370 °C .Organic light emitting diode have been fabricated with this material and the fundamental structures of the device is ITO/α-NPD/ Cd(HPBq/BCP/Alq3/LiF/Al exhibited a luminescence peak at 550 nm. The maximum luminescence of the device was 295 cd/m2 with current density of 6687 A/m2 at 20 V. The maximum current efficiency of OLED was 1.01 cd/A at 17 V and power efficiency was 1.01 lm/w at 17 V.

  8. Soil Cadmium Regulates Antioxidases in Sorghum

    Institute of Scientific and Technical Information of China (English)

    LIU Da-lin; ZHANG Shu-pan; CHEN Zheng; QIU Wei-wei

    2010-01-01

    The regulatory mechanism of soil cadmium(Cd)on antioxidases in sorghum was studied using 3 sorghum species viz.,sweet sorghum[Sorghum bicolor(L.)]Moench.cv.Hunnigreen,sorghum hybrid sudangrass(Sorghum bicolor × S.sudanense,cv.Everlush)and sudangrass[Sorghum sudanense(Piper)Stapf cv.Xinjiang].The results showed that low concentrations of Cd2+(≤10 mg kg-1)induced the activities of 4 antioxidases in leaves of the 3 species of sorghum,but high Cd2+concentrations(≥50 mg kg-1)significantly reduced the activities of all the four antioxidases.The glutathione(GSH)contents in leaves of the 3 species of sorghum correlated positively with the Cd2+concentrations.The maximum antioxidase activities were observed at the elongation stage of sorghum during the whole growth period.

  9. Flotation of cadmium-loaded biomass.

    Science.gov (United States)

    Matis, K A; Zouboulis, A I

    1994-07-01

    Biosorption of heavy metal ions such as Cd(2+) by dead biomass has been recognized as a potential alternative to existing removal technologies applied to wastewater treatment. Two bacterial strains were studied in the laboratory, streptomyces griseus and S. clavuligerus, an industrial by-product. Both washed and unwashed samples were examined. Foam flotation proposed in this work as the separation state following biosorption. Effective biomass separation was conducted in the presence of a frother, ethanol. The pH of the solution was a crucial parameter for flotation and also for metal binding. Other basic parameters of flotation examined were the initial cadmium concentration in the dilute aqueous solution and the quantity of biomass used. A study of zeta-potential measurements of the actinomycetes was carried out under the conditions used in the separation; surface tension was also measured. These provided useful information on the process. PMID:18618752

  10. 110 GHz, 1 MW Gyrotron Design Upgrades

    Science.gov (United States)

    Cauffman, Steve; Felch, Kevin; Borchard, Philipp; Cahalan, Pat; Chu, Sam; Dubrule, Craig

    1999-11-01

    Communications and Power Industries has incorporated a number of design changes into its most recent series of 110 GHz 1 MW gyrotrons, for use in ECH and ECCD experiments on the DIII-D tokamak. Two development gyrotrons previously installed at DIII-D used a modulating-anode electron gun design and output windows consisting of double-disk face-cooled sapphire on one system and an edge-cooled CVD diamond disk on the other. Three new systems presently in fabrication and test employ (a) a single-anode electron gun to avoid excitation of spurious modes during turn-on and turn-off and to simplify power supply requirements, (b) a modified TE_22,6 cavity to reduce competition from neighboring modes, (c) a two inch aperture edge-cooled CVD diamond window to allow transmission of a 1 MW Gaussian output beam, (d) a superconducting magnet system with a cryo-cooler to reduce liquid helium consumption, and (e) a number of internal and external plumbing simplifications to make cooling system connections more straightforward. Initial test results, if available, will be presented.

  11. Cadmium in goods - contribution to environmental exposure

    Energy Technology Data Exchange (ETDEWEB)

    Bergbaeck, B.; Jonsson, Arne [Kalmar Univ. (Sweden). Dept. of Natural Science

    1998-03-01

    The total amount of Cd used in Sweden since 1940 is approximately 5000 tonnes, including alloys, fertilizers and impurities in zinc. The stock of Cd in goods in the Swedish anthroposphere is dominated by NiCd-batteries. However, when one considers the degree of exposure to corrosion, Cd stabilizers are dominant. Emissions of Cd from industrial plants and other point sources have been historically important. However, these point source emissions must be seen in relation to the increasingly significant fugitive `consumption emissions`, from the use and/or end-use of various goods. In this study, methods of reconstructing the flows of cadmium (Cd) and estimating the emissions over time are discussed. This is done through studies of the development of production, technology, trade and the longevity of metals in Swedish society. This last part in the chain will form the `consumption emissions` calculated from emission factors giving the proportion of the cadmium content in goods that eventually will reach the environment. The main accumulation of metals in the anthroposphere occurs in urban areas where the influx of metals is greatest. Urban areas probably represent `hot spots` as far as this type of environmental impact is concerned. Extreme Cd concentrations in surface sediments in central Stockholm indicate an ongoing release of Cd from the anthroposphere. The sources are so far unknown, i.e. this Cd flow to the biosphere cannot be explained in terms of deposition or emissions from point sources. Approximately 40 tonnes of Cd in goods are exposed to corrosion in varying degrees. This stock is dominated by Cd in stabilizers and pigments, and as impurities in Zn 15 refs, 2 figs, 8 tabs

  12. 33 CFR 110.81 - Muskegon Lake, Mich.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Muskegon Lake, Mich. 110.81... ANCHORAGE REGULATIONS Special Anchorage Areas § 110.81 Muskegon Lake, Mich. (a) Muskegon Lake West. The waters of the southwest side of Muskegon Lake enclosed by a line beginning at latitude 43°13′24″...

  13. 33 CFR 110.72 - Blackhole Creek, Md.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Blackhole Creek, Md. 110.72... ANCHORAGE REGULATIONS Special Anchorage Areas § 110.72 Blackhole Creek, Md. The waters on the west side of Blackhole Creek, a tributary of Magothy River, southwest of a line bearing 310°30′ from the most...

  14. 49 CFR 110.40 - Activities eligible for funding.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Activities eligible for funding. 110.40 Section... MATERIALS PUBLIC SECTOR TRAINING AND PLANNING GRANTS § 110.40 Activities eligible for funding. (a) Planning. Eligible State applicants may receive funding for the following activities: (1) Development,...

  15. 41 CFR 109-40.110-2 - Minority business enterprises.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Minority business enterprises. 109-40.110-2 Section 109-40.110-2 Public Contracts and Property Management Federal Property Management Regulations System (Continued) DEPARTMENT OF ENERGY PROPERTY MANAGEMENT REGULATIONS...

  16. 41 CFR 109-40.110-1 - Small business assistance.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Small business assistance. 109-40.110-1 Section 109-40.110-1 Public Contracts and Property Management Federal Property Management Regulations System (Continued) DEPARTMENT OF ENERGY PROPERTY MANAGEMENT REGULATIONS...

  17. 24 CFR 990.110 - Operating fund formula.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Operating fund formula. 990.110... DEVELOPMENT THE PUBLIC HOUSING OPERATING FUND PROGRAM Purpose, Applicability, Formula, and Definitions § 990.110 Operating fund formula. (a) General formula. (1) The amount of annual contributions...

  18. 49 CFR 110.120 - Deviation from this part.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 2 2010-10-01 2010-10-01 false Deviation from this part. 110.120 Section 110.120 Transportation Other Regulations Relating to Transportation PIPELINE AND HAZARDOUS MATERIALS SAFETY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION HAZARDOUS MATERIALS AND OIL TRANSPORTATION HAZARDOUS MATERIALS PUBLIC SECTOR TRAINING AND PLANNING...

  19. 11 CFR 110.19 - Contributions by minors.

    Science.gov (United States)

    2010-01-01

    ... Federal Elections FEDERAL ELECTION COMMISSION GENERAL CONTRIBUTION AND EXPENDITURE LIMITATIONS AND... contributions to any candidate or political committee that in the aggregate do not exceed the limitations on contributions of 11 CFR 110.1 and 110.5, if— (a) The decision to contribute is made knowingly and voluntarily...

  20. Study of multiphonon γγ-band in 110Ru

    International Nuclear Information System (INIS)

    The present work is to discuss the excitation energies and odd-even staggering patterns in one-phonon (K = 2) and two-phonon (K = 4) of 110Ru nucleus using Modified Soft Rotor Formula (MSRF). The calculations of the present work are compared with experimental data of 110Ru nucleus taken

  1. 33 CFR 110.30 - Boston Harbor, Mass.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Boston Harbor, Mass. 110.30... ANCHORAGE REGULATIONS Special Anchorage Areas § 110.30 Boston Harbor, Mass. (a) Vicinity of South Boston... the local Harbor Master, Hull, Mass. (m) Hingham Harbor Area 1. Beginning at position latitude...

  2. 33 CFR 110.26 - Marblehead Harbor, Marblehead, Mass.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Marblehead Harbor, Marblehead, Mass. 110.26 Section 110.26 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND..., Mass. The area comprises that portion of the harbor lying between the extreme low water line...

  3. 33 CFR 110.45a - Mattapoisett Harbor, Mattapoisett, Mass.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Mattapoisett Harbor, Mattapoisett, Mass. 110.45a Section 110.45a Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND..., Mattapoisett, Mass. (a) Area No. 1 beginning at a point on the shore at latitude 41°39′23″ N., longitude...

  4. 7 CFR 900.110 - Application for arbitration.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Application for arbitration. 900.110 Section 900.110... Application for arbitration. An application for arbitration by a cooperative shall be in writing and shall... time and place for arbitration hearing. The applicant shall send a copy of the application to...

  5. 42 CFR 84.110 - Gas masks; description.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Gas masks; description. 84.110 Section 84.110 Public Health PUBLIC HEALTH SERVICE, DEPARTMENT OF HEALTH AND HUMAN SERVICES OCCUPATIONAL SAFETY AND... specific gas or vapor), or those which generate high heats or reaction with sorbent materials in...

  6. 40 CFR 89.110 - Emission control information label.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 20 2010-07-01 2010-07-01 false Emission control information label. 89.110 Section 89.110 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CONTROL OF EMISSIONS FROM NEW AND IN-USE NONROAD COMPRESSION-IGNITION ENGINES Emission Standards and Certification Provisions §...

  7. 33 CFR 110.186 - Port Everglades, Florida.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Port Everglades, Florida. 110.186... ANCHORAGE REGULATIONS Anchorage Grounds § 110.186 Port Everglades, Florida. (a) The anchorage grounds. The... entrance to Port Everglades, is an area bounded by a line connecting points with the following...

  8. 23 CFR 635.110 - Licensing and qualification of contractors.

    Science.gov (United States)

    2010-04-01

    ... 23 Highways 1 2010-04-01 2010-04-01 false Licensing and qualification of contractors. 635.110... TRAFFIC OPERATIONS CONSTRUCTION AND MAINTENANCE Contract Procedures § 635.110 Licensing and qualification... licensing contractors, who may bid for, be awarded, or perform Federal-aid highway contracts, shall...

  9. 40 CFR 300.110 - National Response Team.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 27 2010-07-01 2010-07-01 false National Response Team. 300.110... PLAN Responsibility and Organization for Response § 300.110 National Response Team. National planning... agencies named in § 300.175(b). Each agency shall designate a member to the team and sufficient...

  10. 42 CFR 411.110 - Basis for determination of nonconformance.

    Science.gov (United States)

    2010-10-01

    ... Section 411.110 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES MEDICARE PROGRAM EXCLUSIONS FROM MEDICARE AND LIMITATIONS ON MEDICARE PAYMENT Limitations on Payment for Services Covered Under Group Health Plans: General Provisions § 411.110 Basis...

  11. 33 CFR 110.77 - Amistad Reservoir, Tex.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Amistad Reservoir, Tex. 110.77... ANCHORAGE REGULATIONS Special Anchorage Areas § 110.77 Amistad Reservoir, Tex. (a) Diablo East, Tex. That portion of the Amistad Reservoir enclosed by a line connecting the following points, excluding a...

  12. 21 CFR 176.110 - Acrylamide-acrylic acid resins.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Acrylamide-acrylic acid resins. 176.110 Section 176... Substances for Use Only as Components of Paper and Paperboard § 176.110 Acrylamide-acrylic acid resins. Acrylamide-acrylic acid resins may be safely used as components of articles intended for use in...

  13. 21 CFR 110.5 - Current good manufacturing practice.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Current good manufacturing practice. 110.5 Section...) FOOD FOR HUMAN CONSUMPTION CURRENT GOOD MANUFACTURING PRACTICE IN MANUFACTURING, PACKING, OR HOLDING HUMAN FOOD General Provisions § 110.5 Current good manufacturing practice. (a) The criteria...

  14. 48 CFR 1337.110-70 - Personnel security processing requirements.

    Science.gov (United States)

    2010-10-01

    ... where foreign national access to any DOC facility or DOC IT system is required. The language of the... 48 Federal Acquisition Regulations System 5 2010-10-01 2010-10-01 false Personnel security processing requirements. 1337.110-70 Section 1337.110-70 Federal Acquisition Regulations System DEPARTMENT...

  15. Tantalum-cadmium film coatings: Preparation, phase composition, and structure

    Science.gov (United States)

    Tuleushev, Yu. Zh.; Volodin, V. N.; Zhakanbaev, E. A.

    2015-01-01

    Ion-plasma sputtering and codeposition of ultrafine Ta and Cd particles were used for the first time to prepare solid solutions, namely, alloys with up to 66.2 at % Cd in the form of coatings; the fact of such a production confirms the thermal-fluctuation melting and coalescence of small particles. When the coatings are formed by tantalum and cadmium nanolayers, the mutual dissolution of the components takes place, which is accompanied by the formation of solid solutions of one metal in the other. When the cadmium concentration is above 44 at %, the β-Ta tetragonal lattice transforms into the α-Ta body-centered cubic lattice. Beginning from 74.4 at % Cd, a hexagonal structure typical of cadmium is formed, and tantalum is present in the coatings in the form of amorphous phase. The formation of β-Ta- and Cd-based interstitial and α-Ta-based substitute solid solutions is stated. At 700°C, cadmium evaporates from Ta-based solid solutions, and porous tantalum is formed. The evaporation of cadmium from coatings, which consist of the mixture of tantalum solid solution in cadmium and amorphous tantalum, leads to the formation of tantalum characterized by a highly developed surface. The prepared Ta-based materials assume the technological application of the results of the investigation.

  16. Trichosporon jirovecii-mediated synthesis of cadmium sulfide nanoparticles.

    Science.gov (United States)

    El-Baz, Ashraf Farag; Sorour, Noha Mohamed; Shetaia, Youssria Mohamed

    2016-05-01

    Cadmium sulphide is one of the most promising materials for solar cells and of great interest due to its useful applications in photonics and electronics, thus the development of bio-mediated synthesis of cadmium sulphide nanoparticles (CdS NPs) is one of the essential areas in nanoparticles. The present study demonstrates for the first time the eco-friendly biosynthesis of CdS NPs using the yeast Trichosporon jirovecii. The biosynthesis of CdS NPs were confirmed by UV-Vis spectrum and characterized by X-ray diffraction assay and electron microscopy. Scanning and transmission electron microscope analyses shows the formation of spherical CdS NPs with a size range of about 6-15 nm with a mean Cd:S molar ratio of 1.0:0.98. T. jirovecii produced hydrogen sulfide on cysteine containing medium confirmed by positive cysteine-desulfhydrase activity and the colony color turned yellow on 0.1 mM cadmium containing medium. T. jirovecii tolerance to cadmium was increased by the UV treatment and three 0.6 mM cadmium tolerant mutants were generated upon the UV radiation treatment. The overall results indicated that T. jirovecii could tolerate cadmium toxicity by its conversion into CdS NPs on cysteine containing medium using cysteine-desulfhydrase as a defense response mechanism. PMID:26467054

  17. Restorative Effects of Zinc and Selenium on Cadmium-induced Kidney Oxidative Damage in Rats

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    To investigate whether cadmium-induced oxidative stress in the kidney is influenced by zinc and selenium. Methods Five groups of rats were maintained: (A) Cd (CdCl2,400 μg@kg-1 day-1 intraperitoneal injection); (B) Cd+Zn (ZnC12, 20mg kg-1.day-1 hypodermic injection); (C) Cd+Se (Na2SeO3, 350 μg.kg-1.day-1 via a stomach tube); (D) Cd+Zn+Se; (E)treated with physiological saline as a sham-handled control. The rats were given treatmenl for a period of 4 weeks. The activities of superoxide dismutase (SOD), glutathione peroxidase (GH-Px), catalase (CAT), and the level of malondialdehyde (MDA) in the kidney tissue were measured to assess the oxidative stress. Urinary lactate dehydrogenase (LDH) activity was used as an indicator of tubular cell damage caused by lipid peroxidation. Results In group C and D, activities of SOD (110.5 ± 5.2, 126.8 ± 7.0; P < 0.05) and GSH-Px (85.7 ± 4.9,94.6 ± 7.3; P < 0.05) were higher than those in group A(84.7 ± 3.3; 56.9 ± 3.8); and in group B, only the activity of GSH-Px (80.0 + 4.3, P < 0.01) increased in comparison with that in group A (56.9 ± 3.8). Significant increase of MDA (P < 0.05) was seen in group B (31.1 ± 4.7) and C (35.0 + 4.1) when compared with control values (17.2 ± 1.8). No difference was found in the level of MDA between group D (18.9 ± 2.6) and control. The activity of LDH in urine of control group (0.06 ± 0.02) was lower than that of group A (0.46 ± 0.19, P<0.05), B (0.10± 0.05, P<0.05) and C (0.14 ± 0.07, P<0.05), and there was no significant change between control (0.06 + 0.02) and group D (0.08 ± 0.02). Conclusion Zinc or selenium could partially alleviate the oxidative stress induced by cadmium in kidney, but administration cadmium in combination with zinc and selenium efficiently protects kidney from cadmiuminduced oxidative damage.

  18. Results of testing the LPT-110 heavy hydraulic hammers

    Energy Technology Data Exchange (ETDEWEB)

    Kralev, I.; Georgiev, G.; Uzunov, Kh.; Mitkov, K.; Rashkeev, N.

    1988-03-01

    Outlines results of tests on five prototype Bulgarian hydraulic drill hammers - the LPT-110.1, LPT-110.2, LPT-110.3, LPT-110.4 and LPT-110.6 produced by te Probivna Tekhnika laboratory. Three aspects of performance were tested by the Mintyazhmash factory laboratory in the USSR; (1) energy of individual piston blows, (2) blow frequency (blows/min), (3) consumption of working fluid. Technical characteristics are summarized in a table for piston diameters of 58 and 72 mm, stroke length of 50 mm, drilling power from 4.80-15.75 kW, hydraulic fluid working pressure 8.9-12.7 MPa, fluid consumption 80-160 dm/min. Results are presented in three tbles and one diagram. Manufacture of these hammers by the MeGIKoo association should begin in early 1989.

  19. Energy transfer in porous anodic alumina/rhodamine 110 nanocomposites

    Energy Technology Data Exchange (ETDEWEB)

    Elhouichet, H., E-mail: habib.elhouichet@fst.rnu.tn [Laboratoire de Physico-Chimie des Materiaux Mineraux et leurs Applications, Centre National de Recherches en Sciences des Materiaux, B.P. 95, Hammam-Lif 2050 (Tunisia); Departement de Physique, Faculte des Sciences de Tunis, University of Tunis Elmanar 2092 Tunis (Tunisia); Harima, N.; Koyama, H. [Hyogo University of Teacher Education, Kato, Hyogo 673-1494 (Japan); Gaponenko, N.V. [Belarusian State University of Informatics and Radioelectronics, P. Browki St. 6, 220013 Minsk (Belarus)

    2012-09-15

    We have used porous anodic alumina (PAA) films as templates for embedding rhodamine 110 (Rh110) molecules and examined their photoluminescence (PL) properties in detail. The analysis of the polarization memory (PM) of PL strongly suggests that there is a significant energy transfer from PAA to Rh110 molecules. The effect of annealing the PAA layer on the PL properties of the nanocomposite has been studied. The results show that the energy transfer becomes more efficient in annealed PAA. - Highlights: Black-Right-Pointing-Pointer Porous anodic alumina-rhodamine 110 nanocomposites are elaborated. Black-Right-Pointing-Pointer Efficient energy transfer from the host to Rh110 molecules is evidenced from measurements of photoluminescence and degree of polarization memory spectra. Black-Right-Pointing-Pointer Thermal annealing of porous anodic alumina can improve the process of excitation transfer.

  20. Interaction of cadmium and zinc in biological samples of smokers and chewing tobacco female mouth cancer patients

    Energy Technology Data Exchange (ETDEWEB)

    Kazi, Tasneem Gul, E-mail: tgkazi@yahoo.com [National Center of Excellence in Analytical Chemistry, University of Sindh, Jamshoro 76080 (Pakistan); Wadhwa, Sham Kumar, E-mail: wadhwashamkumar@yahoo.com [National Center of Excellence in Analytical Chemistry, University of Sindh, Jamshoro 76080 (Pakistan); Afridi, Hassan Imran, E-mail: hassanimranafridi@yahoo.com [National Center of Excellence in Analytical Chemistry, University of Sindh, Jamshoro 76080 (Pakistan); Kazi, Naveed, E-mail: tgkazi@yahoo.com [Liaquat University of Medical and Health Sciences, Jamshoro 76080 (Pakistan); Kandhro, Ghulam Abbas [National Center of Excellence in Analytical Chemistry, University of Sindh, Jamshoro 76080 (Pakistan); Baig, Jamil Ahmed, E-mail: jab_mughal@yahoo.com [National Center of Excellence in Analytical Chemistry, University of Sindh, Jamshoro 76080 (Pakistan); Shah, Abdul Qadir, E-mail: aqshah07@yahoo.com [National Center of Excellence in Analytical Chemistry, University of Sindh, Jamshoro 76080 (Pakistan); Kolachi, Nida Fatima [National Center of Excellence in Analytical Chemistry, University of Sindh, Jamshoro 76080 (Pakistan); Arain, Muhammad Balal, E-mail: bilal_ku2004@yahoo.com [Department of Mathematics and Basic Sciences, NED University of Engineering and Technology, Karachi 75270 (Pakistan)

    2010-04-15

    Epidemiologic studies suggest that zinc (Zn) deficiency and high accumulation of cadmium (Cd) may be associated with increased risk of cancer. The incidence of mouth cancer has increased among females, who possess habits of chewing tobacco with gradients (areca nut and betel quid) and smoking tobacco in Pakistan. In present study, we measured the concentration of Cd and Zn in 96 mouth cancer patients (MCPs) and 110 female controls/referents (67 smoker and chewing tobacco), while 43 have none of smoking and chewing tobacco habits, belongs to different cities of Pakistan. Both controls and patients have same age group (ranged 35-65 years), socio-economic status, localities and dietary habits. The Zn and Cd were determined by flame/graphite furnace atomic absorption spectrophotometer, prior to microwave assisted acid digestion method. The Cd/Zn ratio in both biological samples was also calculated. The results of this study showed that the mean value of Zn was lower, while the mean concentration of Cd was higher in the blood and scalp hair samples of MCPs as compared to control subjects (p < 0.001). The controls chewing and smoking tobacco have high level of Cd in both biological samples as compared to those have not smoking or chewing tobacco (p < 0.012). The Cd/Zn ratio was higher in MCPs than control subjects. This study is compelling evidence in support of positive associations between cadmium, cigarette smoking, deficiency of Zn and cancer risk.

  1. Interaction of cadmium and zinc in biological samples of smokers and chewing tobacco female mouth cancer patients

    International Nuclear Information System (INIS)

    Epidemiologic studies suggest that zinc (Zn) deficiency and high accumulation of cadmium (Cd) may be associated with increased risk of cancer. The incidence of mouth cancer has increased among females, who possess habits of chewing tobacco with gradients (areca nut and betel quid) and smoking tobacco in Pakistan. In present study, we measured the concentration of Cd and Zn in 96 mouth cancer patients (MCPs) and 110 female controls/referents (67 smoker and chewing tobacco), while 43 have none of smoking and chewing tobacco habits, belongs to different cities of Pakistan. Both controls and patients have same age group (ranged 35-65 years), socio-economic status, localities and dietary habits. The Zn and Cd were determined by flame/graphite furnace atomic absorption spectrophotometer, prior to microwave assisted acid digestion method. The Cd/Zn ratio in both biological samples was also calculated. The results of this study showed that the mean value of Zn was lower, while the mean concentration of Cd was higher in the blood and scalp hair samples of MCPs as compared to control subjects (p < 0.001). The controls chewing and smoking tobacco have high level of Cd in both biological samples as compared to those have not smoking or chewing tobacco (p < 0.012). The Cd/Zn ratio was higher in MCPs than control subjects. This study is compelling evidence in support of positive associations between cadmium, cigarette smoking, deficiency of Zn and cancer risk.

  2. The Role of Exopolymers in Protection of Ralstonia sp., a Cadmium-resistant Bacterium, from Cadmium Toxicity

    OpenAIRE

    Anchulee Watcharamusik; Benjaphorn Prapagdee

    2008-01-01

    Production of exopolymers is one of heavy metal resistance mechanisms in bacteria. Ralstonia sp. TAK1, a cadmium-resistant bacterium, was isolated from a high cadmium (Cd) contaminated soil at the zinc mine, Tak province, Thailand. The bacterium was cultivated in LB broth and its growth was monitored. The yields of exopolymers were measured by the phenol-sulfuric method at different growth phases. The levels of Cd resistance were quantitatively determined by survival cell assay. The highest a...

  3. Correlations of urinary cadmium with hypertension and diabetes in persons living in cadmium-contaminated villages in northwestern Thailand: A population study

    International Nuclear Information System (INIS)

    Risk for hypertension and diabetes has not been conclusively found to be a result of cadmium exposure. A population-based study was conducted in 2009 to examine the correlations of urinary cadmium, a good biomarker of long-term cadmium exposure, with hypertension and diabetes in persons aged 35 years and older who lived in the 12 cadmium-contaminated rural villages in northwestern Thailand. A total of 5273 persons were interviewed and screened for urinary cadmium, hypertension, and diabetes. The geometric mean level of urinary cadmium for women (2.4±2.3 μg/g creatinine) was significantly greater than that for men (2.0±2.2 μg/g creatinine). Hypertension was presented in 29.8% of the study population and diabetes was detected in 6.6%. The prevalence of hypertension significantly increased from 25.0% among persons in the lowest tertile of urinary cadmium to 35.0% in the highest tertile. In women, the rate of hypertension significantly increased with increasing urinary cadmium levels in both ever and never smokers, after adjusting for age, alcohol consumption, body mass index, and diabetes. In men, such association was less significantly found in never smokers. The study revealed no significant association between urinary cadmium and diabetes in either gender. Our study supports the hypothesis that environmental exposure to cadmium may increase the risk of hypertension. Risk for diabetes in relation to cadmium exposure remains uncertain in this exposed population.

  4. Correlations of urinary cadmium with hypertension and diabetes in persons living in cadmium-contaminated villages in northwestern Thailand: A population study

    Energy Technology Data Exchange (ETDEWEB)

    Swaddiwudhipong, Witaya, E-mail: swaddi@hotmail.com [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Mahasakpan, Pranee [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Limpatanachote, Pisit; Krintratun, Somyot [Department of Internal Medicine, Mae Sot General Hospital, Tak (Thailand)

    2010-08-15

    Risk for hypertension and diabetes has not been conclusively found to be a result of cadmium exposure. A population-based study was conducted in 2009 to examine the correlations of urinary cadmium, a good biomarker of long-term cadmium exposure, with hypertension and diabetes in persons aged 35 years and older who lived in the 12 cadmium-contaminated rural villages in northwestern Thailand. A total of 5273 persons were interviewed and screened for urinary cadmium, hypertension, and diabetes. The geometric mean level of urinary cadmium for women (2.4{+-}2.3 {mu}g/g creatinine) was significantly greater than that for men (2.0{+-}2.2 {mu}g/g creatinine). Hypertension was presented in 29.8% of the study population and diabetes was detected in 6.6%. The prevalence of hypertension significantly increased from 25.0% among persons in the lowest tertile of urinary cadmium to 35.0% in the highest tertile. In women, the rate of hypertension significantly increased with increasing urinary cadmium levels in both ever and never smokers, after adjusting for age, alcohol consumption, body mass index, and diabetes. In men, such association was less significantly found in never smokers. The study revealed no significant association between urinary cadmium and diabetes in either gender. Our study supports the hypothesis that environmental exposure to cadmium may increase the risk of hypertension. Risk for diabetes in relation to cadmium exposure remains uncertain in this exposed population.

  5. Effects of Soil pH,Texture,Moisture,Organic Matter and Cadmium Content on Cadmium Diffusion Coefficient

    Institute of Scientific and Technical Information of China (English)

    WUQI-TANG; J.L.MOREL; 等

    1994-01-01

    The supply of cadmium from soil to plant roots mainly depends on the diffusion prooess.This work was conducted to study the effects of some soil properties on cadmium diffusion coefficient (D) in soil. Measurements were made using the Shofield and Graham-Bryce's isotopic labelling method.Cadmium diffusion coefficients varied from 10-7to 10-9 cms2-1.Higher values were observed in acid sandy soils and lower values in calcareous clay soils.Liming an acid soil resulted in a substantial decrease of D.Addition of cadmium as nitrate salt generally increased D,while addition of sewage sludge and organic matter resulted in a significant decrease of cadmium diffusion.The rhizospheric activity also induced a moderate reduction in D.The relationships between D(10-9cms2-1)on the on hand and soil pH.moisture(Mc,g kg-1) ,organic matter(OM,g kg-1),clay(Cy,gkg-1)and cadmium content(Cd,mgkg-1) on the other were obtained by the multiple regression:D=182.1-29.91pH+0.210Mc-0.303OM+0.011Cy+1.64Cd(R2=0.859,n=22).

  6. Effects of cadmium accumulation from suspended sediments and phytoplankton on the Oyster Saccostrea glomerata

    International Nuclear Information System (INIS)

    Highlights: • Saccostrea glomerata accumulated cadmium from sediments and phytoplankton. • Effects were similar for both pathways. • Antioxidant capacity, lipid peroxidation and lysosomal destabilisation were affected. • Clear exposure–dose–response relationships were demonstrated. - Abstract: Metals are accumulated by filter feeding organisms via water, ingestion of suspended sediments or food. The uptake pathway can affect metal toxicity. Saccostrea glomerata were exposed to cadmium through cadmium-spiked suspended sediments (19 and 93 μg/g dry mass) and cadmium-enriched phytoplankton (1.6–3 μg/g dry mass) and cadmium uptake and effects measured. Oysters accumulated appreciable amounts of cadmium from both low and high cadmium spiked suspended sediment treatments (5.9 ± 0.4 μg/g and 23 ± 2 μg/g respectively compared to controls 0.97 ± 0.05 μg/g dry mass). Only a small amount of cadmium was accumulated by ingestion of cadmium-enriched phytoplankton (1.9 ± 0.1 μg/g compared to controls 1.2 ± 0.1 μg/g). In the cadmium spiked suspended sediment experiments, most cadmium was desorbed from sediments and cadmium concentrations in S. glomerata were significantly related to dissolved cadmium concentrations (4–21 μg/L) in the overlying water. In the phytoplankton feeding experiment cadmium concentrations in overlying water were <0.01 μg/L. In both exposure experiments, cadmium-exposed oysters showed a significant reduction in total antioxidant capacity and significantly increased lipid peroxidation and percentage of destabilised lysosomes. Destabilised lysosomes in the suspended sediments experiments also resulted from stress of exposure to the suspended sediments. The study demonstrated that exposure to cadmium via suspended sediments and to low concentrations of cadmium through the ingestion of phytoplankton, can cause sublethal stress to S. glomerata

  7. Effects of cadmium accumulation from suspended sediments and phytoplankton on the Oyster Saccostrea glomerata

    Energy Technology Data Exchange (ETDEWEB)

    Schmitz, Helena A.; Maher, William A., E-mail: bill.maher@canberra.edu.au; Taylor, Anne M.; Krikowa, Frank

    2015-03-15

    Highlights: • Saccostrea glomerata accumulated cadmium from sediments and phytoplankton. • Effects were similar for both pathways. • Antioxidant capacity, lipid peroxidation and lysosomal destabilisation were affected. • Clear exposure–dose–response relationships were demonstrated. - Abstract: Metals are accumulated by filter feeding organisms via water, ingestion of suspended sediments or food. The uptake pathway can affect metal toxicity. Saccostrea glomerata were exposed to cadmium through cadmium-spiked suspended sediments (19 and 93 μg/g dry mass) and cadmium-enriched phytoplankton (1.6–3 μg/g dry mass) and cadmium uptake and effects measured. Oysters accumulated appreciable amounts of cadmium from both low and high cadmium spiked suspended sediment treatments (5.9 ± 0.4 μg/g and 23 ± 2 μg/g respectively compared to controls 0.97 ± 0.05 μg/g dry mass). Only a small amount of cadmium was accumulated by ingestion of cadmium-enriched phytoplankton (1.9 ± 0.1 μg/g compared to controls 1.2 ± 0.1 μg/g). In the cadmium spiked suspended sediment experiments, most cadmium was desorbed from sediments and cadmium concentrations in S. glomerata were significantly related to dissolved cadmium concentrations (4–21 μg/L) in the overlying water. In the phytoplankton feeding experiment cadmium concentrations in overlying water were <0.01 μg/L. In both exposure experiments, cadmium-exposed oysters showed a significant reduction in total antioxidant capacity and significantly increased lipid peroxidation and percentage of destabilised lysosomes. Destabilised lysosomes in the suspended sediments experiments also resulted from stress of exposure to the suspended sediments. The study demonstrated that exposure to cadmium via suspended sediments and to low concentrations of cadmium through the ingestion of phytoplankton, can cause sublethal stress to S. glomerata.

  8. Cadmium: A toxin and a nutrient for marine phytoplankton. Doctoral thesis

    Energy Technology Data Exchange (ETDEWEB)

    Lee, J.G.

    1995-06-01

    Although cadmium is known to be very toxic, it exhibits nutrient-like vertical concentration profiles in the open ocean. Cadmium enhances the growth of the marine diatom Thalassiosira weissflogii, a chlorophyte and some prymnesiophytes at inorganic zinc and cadmium concentrations typical of surface seawater. Detailed studies of T. weissflogii show that cadmium is also regulated like a nutrient over a wide range of external inorganic cadmium (5-500pM) and inorganic zinc (2-16pM) concentrations. The cellular cadmium concentration is maintained at relatively constant levels both through uptake and, at high inorganic cadmium concentrations (5nM), export of cadmium, most likely complexed to the metal-binding polypeptide phytochelatin. Cadmium may play an essential role in carbon uptake under conditions of zinc limitation. The same low level of inorganic cadmium that enhances the growth of T. weissflogii restores the activity of carbonic anhydrase, thought to be the key enzyme limiting growth at low zinc. Cadmium coelutes with a least one of the multiple isoforms of carbonic anhydrase produced by T. weissfiogii and covaries with activity of this isoform. The substitution of cadmium for zinc in carbonic anhydrase links the geochemical cycle of cadmium to those of zinc and carbon.

  9. Cadmium assessment on the intertidal water margins from the Óbidos Lagoon (western coast of Portugal

    Directory of Open Access Journals (Sweden)

    Marcia S.S. Santos

    2014-04-01

    Full Text Available The Óbidos Lagoon is the largest shallow coastal lagoon in Portugal. Like any other brackish water system, it has been potentially exposed to different sources of contamination (e.g. livestock farming, domestic and industrial sewage. Trace metals are persistent elements present in the water and sediments in their elemental and organic/inorganic forms. In fact, Cadmium is extremely pollutant due to its great solubility in water and high toxicity for organisms. Also, it is classified as a priority substance according to the European Union Water Frame directive. In this context, a seasonal environmental monitoring program was implemented in the intertidal water margins of the Óbidos Lagoon to assess the presence of Cadmium. In 2009 and 2010, eight sampling stations (S distributed on the shores of the Óbidos Lagoon were chosen and water and sediments were seasonally collected. In all samples, cadmium concentrations were analyzed by Atomic Absorption Spectrometry, with Graphite Furnace Technique. Cadmium dissolved in the water samples was only detected during summer months, with the highest values in the Barrosa’s arm (S3: 0.35 mg/l in 2009, and at the station further downstream (S1: 0.19 mg/l in 2010. In the suspended fraction of the water samples the trace metal was detectable in all seasons, with the maximum concentration at the Barrosa’s arm (S4: 1.04 mg/l in the winter of 2010. Cadmium was not detectable in the sediments during the summers and was sporadically present in the autumn and in the winter of 2009. The highest concentration in the sediments was observed at the Barrosa´s arm (S4: 140.78 mg/kg in the spring of 2010. As a whole, cadmium contamination appears to be mostly focused on the inner areas of the lagoon, at the Barrosa´s arm, but a clear seasonal pattern of variation was not detectable. These results allow a better understanding of the environmental quality of this ecosystem and may assist in the definition of coastal

  10. An HPLC-ICP-MS technique for determination of cadmium-phytochelatins in genetically modified Arabidopsis thaliana.

    Science.gov (United States)

    Sadi, Baki B M; Vonderheide, Anne P; Gong, Ji-Ming; Schroeder, Julian I; Shann, Jodi R; Caruso, Joseph A

    2008-01-01

    A reversed-phase high-performance liquid chromatographic technique was developed to separate cadmium-phytochelatin complexes (Cd-PC2, Cd-PC3, and Cd-PC4) of interest in the plant Arapidopsis thaliana. High-performance liquid chromatography (HPLC) was coupled to an inductively coupled plasma mass spectrometric (ICP-MS) system with some modification to the interface. This was done in order to sustain the plasma with optimum sensitivity for cadmium detection in the presence of the high methanol loads used in the gradient elution of the reversed-phase separation. The detection limits were found to be 91.8 ngl(-1), 77.2 ngl(-1) and 49.2 ngl(-1) for Cd-PC2, Cd-PC3, and Cd-PC4 respectively. The regression coefficients (r2) for Cd-PC2 to Cd-PC4 detection ranged from 0.998 to 0.999. The method was then used to investigate the occurrence and effect of cadmium-phytochelatin complexes in wild-type Arabidopsis and a phytochelatin-deficient mutant cad1-3 that had been genetically modified to ectopically express the wheat TaPCS1 phytochelatin synthase enzyme. The primary complex found in both wild-type and transgenic plants was Cd-PC2. In both lines, higher levels of Cd-PC2 were found in shoots than in roots, showing that phytochelatin synthases contribute to the accumulation of cadmium in shoots, in the Cd-PC2 form. Genetic modification did, however, impact the overall accumulation of Cd. Transgenic plants contained almost two times more cadmium in the form of Cd-PC2 in their roots than did the corresponding wild-type plants. Similarly, the shoot samples of the modified species also contained more (by 1.6 times) cadmium in the form of Cd-PC2 than the wild type. The enhanced role of PC2 in the transgenic Arabidopsis correlates with data showing long-distance transport of Cd in transgenic plants. Targeted transgenic expression of non-native phytochelatin synthases may contribute to improving the efficiency of plants for phytoremediation.

  11. 镉暴露对人体骨骼影响的研究进展%Research progress on effect of cadmium exposure on human skeleton

    Institute of Scientific and Technical Information of China (English)

    王雨昕; 李筱薇; 赖建强

    2015-01-01

    ABSTRACT:Cadmium is a heavy metal pollutant, it is non-biodegradable in the environment and its half-life within human body is as long as 10~30 years. The skeleton is considered to be the main target organ for cadmium toxicity, and researches had confirmed the correlation between cadmium toxicity and bone mineral density decrease as well as osteoporosis. This paper summarized the research on the effect of cadmium toxicity on human skeleton in different countries. The effect of cadmium exposure on skeleton varied with different target populations, and was especially strong on the elder persons. So the target population should be grouped more reasonable in these kinds of studies. People who not only live in the polluted area but also have high urinary cadmium level should be classified as the high cadmium exposure group. Also, higher calcium intake was the protective factor of bone mineral density. The risk for cadmium exposure on osteoporosis and fractures may be enlarged due to the ignorance of the combined effect on intake of calcium and cadmium exposure. The calcium intake of target population should also be considered in grouping, only in this way we can discuss the real risk of osteoporosis and fractures caused by cadmium exposure.%镉是一种环境重金属污染物,在环境中不能进行生物降解,在人体内半衰期长达10-30年。骨骼是镉的重要靶器官,已有研究证实镉是诱发骨密度降低和骨质疏松症发生的危险因素之一。本文综述了镉暴露对人体骨骼影响的国内外相关文献。结果表明,镉暴露对人体骨骼的影响因目标人群的不同而存在差异,且主要受影响人群为中老年人,因此研究时应对目标人群进行合理分组,将镉污染区内尿镉浓度较高的人群划分为高暴露组较为合适。此外,高钙摄入量是人体骨密度的保护因素,但是目前罕有研究将目标人群的钙摄入量的状况和镉暴露状况相

  12. Role of oxidative stress in cadmium toxicity and carcinogenesis

    International Nuclear Information System (INIS)

    Cadmium (Cd) is a toxic metal, targeting the lung, liver, kidney, and testes following acute intoxication, and causing nephrotoxicity, immunotoxicity, osteotoxicity and tumors after prolonged exposures. Reactive oxygen species (ROS) are often implicated in Cd toxicology. This minireview focused on direct evidence for the generation of free radicals in intact animals following acute Cd overload and discussed the association of ROS in chronic Cd toxicity and carcinogenesis. Cd-generated superoxide anion, hydrogen peroxide, and hydroxyl radicals in vivo have been detected by the electron spin resonance spectra, which are often accompanied by activation of redox sensitive transcription factors (e.g., NF-κB, AP-1 and Nrf2) and alteration of ROS-related gene expression. It is generally agreed upon that oxidative stress plays important roles in acute Cd poisoning. However, following long-term Cd exposure at environmentally-relevant low levels, direct evidence for oxidative stress is often obscure. Alterations in ROS-related gene expression during chronic exposures are also less significant compared to acute Cd poisoning. This is probably due to induced adaptation mechanisms (e.g., metallothionein and glutathione) following chronic Cd exposures, which in turn diminish Cd-induced oxidative stress. In chronic Cd-transformed cells, less ROS signals are detected with fluorescence probes. Acquired apoptotic tolerance renders damaged cells to proliferate with inherent oxidative DNA lesions, potentially leading to tumorigenesis. Thus, ROS are generated following acute Cd overload and play important roles in tissue damage. Adaptation to chronic Cd exposure reduces ROS production, but acquired Cd tolerance with aberrant gene expression plays important roles in chronic Cd toxicity and carcinogenesis.

  13. CONCENTRATION OF CADMIUM IN MEAT AND SELECTED MEATS PRODUCTS

    Directory of Open Access Journals (Sweden)

    Anetta Lukáčová

    2015-02-01

    Full Text Available The cadmium concentrations depend on the environmental conditions and food production methods. The monitoring of cadmium concentration in meat is important for human health. The concentrations of cadmium in meat and meat products collected from central Slovakia, in the central Europe region and from different countries of West Europe were assessed using by AA spectrometer with graphite furnace (PerkinElmer AAnalyst 80, MA, USA. Within starting materials we detected the highest values of cadmium in beef from foreign production (0.1101 ppm, followed by pork from foreign production (0.0901 ppm in Lovecka salama and pork thigh (0.0523 ppm in selected ham. In Lovecka salami we were found the highest concentration of cadmium in final samples from foreign starting materials, followed by homogenized samples from foreign starting materials, final samples from domestic starting materials and homogenized samples from domestic starting materials (0.3728, 0.3549, 0.2387, 0.2112 ppm, respectively. The highest concentration of cadmium in selected ham were found in final products from foreign starting materials, homogenized samples from foreign starting materials, final products from domestic starting materials and homogenized samples from domestic starting materials (0.1453, 0.1382,0.0810, 0.0734 ppm, respectively. The obtained results suggested that the concentrations of cadmium are higher in homogenized samples and final products in Lovecka salami and selected ham in comparison with to starting materials. Technological process of meat processing can create a potential source of heavy metals in final products.

  14. Predictors of urinary cadmium levels in adult females

    Energy Technology Data Exchange (ETDEWEB)

    McElroy, Jane A. [University of Wisconsin Paul P. Carbone Comprehensive Cancer Center, 610 Walnut Street, 370 WARF, Madison, WI 53726 (United States)]. E-mail: jamcelroy@wisc.edu; Shafer, Martin M. [University of Wisconsin, Environmental Chemistry and Technology Program, 600 N Park Street, Madison, WI 53706 (United States); Hampton, John M. [University of Wisconsin Paul P. Carbone Comprehensive Cancer Center, 610 Walnut Street, 370 WARF, Madison, WI 53726 (United States); Newcomb, Polly A. [University of Wisconsin Paul P. Carbone Comprehensive Cancer Center, 610 Walnut Street, 370 WARF, Madison, WI 53726 (United States); Fred Hutchinson Cancer Research Center, Cancer Prevention Program, 1100 Fairview Ave N, M4-B402 PO Box 19024, Seattle, WA 98109 (United States)

    2007-09-01

    Ubiquitous exposure to low levels of cadmium has raised concern about adverse health effects. The aim of this study was to identify characteristics of non-occupationally exposed adult females that correlated with creatinine-adjusted urinary cadmium levels. In our population-based study, trained interviewers collected information from 254 female Wisconsin residents aged 20-69 years on tobacco use, limited dietary consumption patterns, reproductive history, demographics, and residential history. Participants provided spot-urine specimens collected at home. Urine cadmium concentrations were quantified using inductively-coupled plasma mass spectrometry and creatinine levels were also determined. Least square means and 95% confidence intervals for the natural log of the creatinine-adjusted urinary cadmium levels were calculated for each characteristic using multivariate analysis of variance adjusting for age and smoking status. Results were calculated on the log scale and then transformed to the original scale by taking the exponent of each of the values. We observed statistically significant increasing creatinine-adjusted urinary cadmium mean levels relative to smoking status, older age, parity, lower body surface area, mineral zinc supplement consumption, and high income. We did not observe a difference relative to consumption of organ meats, crustaceans, alcohol, multivitamins, multiminerals or homegrown vegetables, age of menopause, menarche of participant or oldest daughter, menopausal status or urban-rural residential location. Approximately 40% of the variance in creatinine-adjusted urinary cadmium levels in adult women was explained by several characteristics. Similar to other studies, age and smoking were the strongest determinants of creatinine-adjusted urinary cadmium concentration.

  15. Cadmium, ATPase-P, yeast. From transport to toxicity

    International Nuclear Information System (INIS)

    Two projects has been developed during my PhD. One consisting in the functional study of CadA, the Cd2+-ATPase from Listeria monocytogenes, the other one was focused on the toxicity of cadmium and the associated response of the yeast Saccharomyces cerevisiae. This two studies used a a phenotype of sensitivity to cadmium induced by CadA expression in yeast. This phenotype was used as a screening tool to identify essential amino acids of Cd transport by CadA and to study cadmium toxicity and the corresponding yeast cellular response. CadA actively transports Cd using ATP hydrolysis as energy source. Directed mutagenesis of the membranous polar, sulphur and charged amino-acids revealed that Cd transport pathway implied four transmembrane segments (Tm) and more precisely the cysteine C354, C356 and proline P355 of the CPC motif located in Tm6, aspartate D692 in Tm8, glutamate E164 in Tm4 and methionine M149 in Tm5. From our studies, 2 Cd ions would be translocated for each hydrolysis ATP. Expression of CadA in the yeast Saccharomyces cerevisiae induces an hypersensitivity to Cd. A wild type cell can grow up to 100 μm cadmium whereas CadA expressing yeast cannot grow with 1 μm cadmium in the culture medium. This cadmium sensitivity was due to the localisation of CadA in the endoplasmic reticulum membrane. Transport of cadmium in this compartment produces an accumulation of mis-folded proteins that induces the Unfolded Protein Response (UPR). As UPR also occurs in a wild type yeast exposed to low Cd concentration, one can point out endoplasmic reticulum as a extremely sensitive cellular compartment. UPR also appears as an early response to Cd as it happens far before any visible signs of toxicity. (author)

  16. Effect of Biochar on Relieving Cadmium Stress and Reducing Accumulation in Super japonica Rice

    Institute of Scientific and Technical Information of China (English)

    ZHANG Zhen-yu; MENG Jun; DANG Shu; CHEN Wen-fu

    2014-01-01

    It is of great importance to solve the threats induced by cadmium pollution on crops. This paper examined the effect of biochar on cadmium accumulation in japonica rice and revealed the mechanism underlying the response of protective enzyme system to cadmium stress. Biochar derived from rice straw was applied at two application rates under three cadmium concentrations. Shennong 265, super japonica rice variety, was selected as the test crop. The results indicated that cadmium content in above-ground biomass of rice increased with increasing soil cadmium concentrations, but the biochar application could suppress the accumulation of cadmium to some extent. Under high concentrations of cadmium, content of free proline and MDA (malondialdehyde) were high, so did the SOD (superoxide dismutase), POD (peroxidase) and CAT (catalase) activity in the lfag leaf of rice. However, the protective enzyme activities remained at low level when biochar was added.

  17. Accumulation and effects of cadmium on guppy (Poecilia reticulata) fed cadmium-dosed cladocera (Moina macrocopa)

    Energy Technology Data Exchange (ETDEWEB)

    Hatakeyama, S.; Yasuno, M.

    1982-08-01

    The study examines the rate of cadmium uptake and body burdens which cause adverse effects on the survival and growth of guppies when they are exposed to Cd dosed in zooplankton (Moina macrocopa) and Cd dissolved in water. Eight guppies fed Moina dosed at 20 ..mu..g Cd/L water died before 10 days. Growth of the remainder of the guppies exposed at this rate was impaired initially but was returned to control level around the 10th day of the study. (JMT)

  18. Cadmium chloride induced cell injury through oxidative stress%镉通过氧化应激机制诱导LLC-PK1细胞损伤

    Institute of Scientific and Technical Information of China (English)

    方鑫; 李海玲; 安彩艳

    2014-01-01

    目的:探讨镉诱导猪肾近曲小管上皮细胞(LLC-PK1)毒性及氧化应激在其中的作用。方法用不同浓度的氯化镉刺激细胞9h和25μmol/L的氯化镉刺激细胞不同时间,采用Formazan 分析细胞存活率反映镉对细胞的损伤程度;以还原型谷胱甘肽(GSH)为靶点,影响GSH浓度的两个试剂BSO和NAC,观察镉诱导细胞损伤中氧化应激的作用。结果随着氯化镉染毒时间延长,细胞存活率下降,同样,随着剂量的增加,细胞的存活率逐渐也下降。同时BSO加重镉诱导的细胞损伤,NAC完全抑制镉诱导的细胞损伤。结论氯化镉对LLC- PK1细胞具有明显的毒性,细胞损伤是通过氧化应激介导,且与细胞内的谷胱甘肽的水平有着密切关系。%Objective To investigate the possible mechanisms of cadmium chloride-induced LLC-PK1 cell toxicity and the role of oxidative stress during the progress. Methods LLC-PK1 cells were treated with different concentrations of cadmium chloride for 9h,and different times at the same dose of cadmium chloride (25μmol/L), respectively.Formazan was used to analyze the cells viability.GSH was taken as a target,and the role of oxidative stress in the progress of cadmium chloride-induced cell injury was assessed by BSO and NAC. Results With the increasing of treatment time and cadmium concentration,Cadmium-induced cell toxicity became more serious and the viability of cells decreased.The cell susceptibility to cadmium chloride could be substantially altered by glutathione (GSH)-modulating agents.Depletion of GSH with BSO increased, whereas supply of cells with NAC decreased subsequent cell injury. Conclusion Cadmium chloride induced cell injury through oxidative stress,which was closely associated with the expression level of intracellular GSH.

  19. Cadmium Impairs p53 Activity in HepG2 Cells

    OpenAIRE

    Urani, C.; Melchioretto, P.; M. Fabbri; Bowe, G.; Maserati, E.; Gribaldo, L.

    2014-01-01

    Cadmium and cadmium compounds are contaminants of the environment, food, and drinking water and are important constituents of cigarette smoke. Cd exposure has also been associated with airborne particulate CdO and with Cd-containing quantum dots in medical therapy. Adverse cadmium effects reported in the literature have stimulated during recent years an ongoing discussion to better elucidate cadmium outcomes at cell and molecular level. The present work is designed to gain an insight into the...

  20. Cadmium Stress Induced Changes in Antioxidant Enzymes, Lipid Peroxidation and Hydrogen Peroxide Contents in Barley Seedlings

    OpenAIRE

    Amel Alayat; Lynda Souiki; Mohammed Reda Djebar; Zine Eddine Boumedris; Ouissem Moumeni; Houria Berrebbah

    2015-01-01

    Cadmium pollution is a problem of increasing significance for ecological, nutritional and environmental reasons. Different plant species and varieties show a wide range of plasticity in Cadmium tolerance, from a high degree of sensitivity to the hyper-accumulating phenotype of some tolerant plants. To avoid Cadmium toxicity, plants adopt various defense strategies. The present study was undertaken to assess and investigate the antioxidant responses of barley (Hordeum vulgare) L.) to cadmium t...

  1. A method for making a cadmium anode for a hermetically sealed alkaline storage battery

    Energy Technology Data Exchange (ETDEWEB)

    Morioka, Y.; Yosikhira, Y.

    1983-07-14

    Metallic cadmium powder and a glue solution are added to CdO powder. The compound is applied to a current tap and dried. The powder form metallic cadmium is prepared from a mixture of zinc and nickel powder which is dispersed in a solution of cadmium salts. As a result of the replacement reaction, a spongy metallic cadmium is produced which contains nickel. The sponge is ground. The obtained powder is used as an additive for the CdO.

  2. Livolin Forte Ameliorates Cadmium-Induced Kidney Injury in Wistar Rats

    Directory of Open Access Journals (Sweden)

    Akomolafe Rufus O.

    2016-06-01

    Full Text Available The kidney, which is an integral part of the drug excretion system, was reported as one of the targets of cadmium toxicity. Early events of cadmium toxicity in the cell include a decrease in cell membrane fluidity, breakdown of its integrity, and impairment of its repair mechanisms. Phosphatidylcholine and vitamin E have a marked fluidizing effect on cellular membranes. We hypothesized that Livolin forte (LIV could attenuate kidney damage induced by cadmium in rats. Twenty-five adult male Wistar rats were divided into five groups of five rats each: group I (control group received 0.3 ml/kg/day of propylene glycol for six weeks; group II was given 5 mg/kg/day of cadmium (Cd i.p for 5 consecutive days; group III rats were treated in a similar way as group II but were allowed a recovery period of 4 weeks; group IV was treated with LIV (5.2 mg/kg/day for a period of 4 weeks after inducing renal injury with Cd similarly to group II; and group V was allowed a recovery period of 2 weeks after a 4-week LIV treatment (5.2 mg/kg/day following Cd administration. A significant increase in plasma creatinine, urea, uric acid, and TBARS were observed in groups II and III compared to the control rats. Significant reductions in total protein, glucose, and GSH activity were also recorded. The urine concentrations of creatinine, urea, and uric acid in groups II and III were significantly lower than the control group. Th is finding was accompanied by a significant decrease in creatinine and urea clearance. Post-treatment with LIV caused significant decreases in plasma creatinine, urea, uric acid, and TBARS. Significant increases in total protein, glucose, and GSH activity of groups IV and V were observed compared to group II. A significant increase in urine concentrations of creatinine, urea, and uric acid and significant decreases in total protein, glucose, and GSH activity were observed in groups IV and V compared to group II. Photomicrographs of the rat kidneys

  3. Application of path analysis to urinary findings of cadmium-induced renal dysfunction.

    Science.gov (United States)

    Abe, T; Kobayashi, E; Okubo, Y; Suwazono, Y; Kido, T; Shaikh, Z A; Nogawa, K

    2001-01-01

    In order to identify some causal relations among various urinary indices of cadmium-induced renal dysfunction, such as glucose, total protein, amino nitrogen, beta 2-microglobulin (beta 2-m), metallothionein (MT), and cadmium (Cd), we applied path analysis method to previous epidemiological studies targeting the residents of the Cd-polluted Kakehashi River basin of Ishikawa Prefecture, Japan. We obtained a diagram-termed path model, representing some causal relations among the above urinary indices. It shows that urinary Cd is located at the beginning point in the diagram, and Cd-induced renal dysfunction develops in the following order: Cd exposure-->increase of beta 2-m and/or MT excretion-->increase of amino-N and/or total protein excretion-->increase of glucose excretion. It was proved mathematically, that in the case of both males and females, increased excretions of beta 2-m and/or MT were the most sensitive urinary indices of the early stage of chronic Cd-induced renal dysfunction.

  4. A miniature Rotary Compressor with a 1:10 compression ratio

    Science.gov (United States)

    Dmitriev, Olly; Tabota, Eugene; Arbon EurIng, Ian; FIMechE, CEng

    2015-08-01

    Micro compressors have applications in medical devices, robotics and “nanosatellites”. The problem of active cooling for photo detectors in “nano-satellites” becomes more important because the majority of space missions target Earth observation, and passive cooling does not provide the required temperatures to achieve the desired SNR levels. Reciprocating compressors used in cryocoolers cause vibrations. VERT Rotors has built an ultralow-vibration rotary compressor with 40mm-long screws, and our prototype delivered 1:10 compression ratio. This “nano” compressor is a non-conventional conical type consisting of an Inner conical screw rotor revolving inside an Outer screw rotor.

  5. Surface potentials of (111), (110) and (100) oriented CeO2-x thin films

    Science.gov (United States)

    Wardenga, Hans F.; Klein, Andreas

    2016-07-01

    Differently oriented CeO2 thin films were prepared by radio frequency magnetron sputter deposition from a nominally undoped CeO2 target. (111), (110) and (100) oriented films were achieved by deposition onto Al2O3(0001)/Pt(111), MgO(110)/Pt(110) and SrTiO3:Nb(100) substrates, respectively. Epitaxial growth is verified using X-ray diffraction analysis. The films were analyzed by in situ photoelectron spectroscopy to determine the ionization potential, work function, Fermi level position and Ce3+ concentration at the surface in dependence of crystal orientation, deposition conditions and post-deposition treatment in reducing and oxidizing atmosphere. We observed a very high variation of the work function and ionization potential of more than 2 eV for all surface orientations, while the Fermi level varies by only 0.3 eV within the energy gap. The work function generally decreases with increasing Ce3+ surface concentration but comparatively high Ce3+ concentrations remain even after strongly oxidizing treatments. This is related to the presence of subsurface oxygen vacancies.

  6. Nrf2 activation prevents cadmium-induced acute liver injury

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Kai C. [Department of Pharmacology, Toxicology, and Therapeutics, University of Kansas Medical Center, Kansas City, KS (United States); Liu, Jie J. [Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS (United States); Klaassen, Curtis D., E-mail: cklaasse@kumc.edu [Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS (United States)

    2012-08-15

    Oxidative stress plays an important role in cadmium-induced liver injury. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that up-regulates cytoprotective genes in response to oxidative stress. To investigate the role of Nrf2 in cadmium-induced hepatotoxicity, Nrf2-null mice, wild-type mice, kelch-like ECH-associated protein 1-knockdown (Keap1-KD) mice with enhanced Nrf2, and Keap1-hepatocyte knockout (Keap1-HKO) mice with maximum Nrf2 activation were treated with cadmium chloride (3.5 mg Cd/kg, i.p.). Blood and liver samples were collected 8 h thereafter. Cadmium increased serum alanine aminotransferase (ALT) and lactate dehydrogenase (LDH) activities, and caused extensive hepatic hemorrhage and necrosis in the Nrf2-null mice. In contrast, Nrf2-enhanced mice had lower serum ALT and LDH activities and less morphological alternations in the livers than wild-type mice. H{sub 2}DCFDA (2′,7′-dichlorodihydrofluoresein diacetate) staining of primary hepatocytes isolated from the four genotypes of mice indicated that oxidative stress was higher in Nrf2-null cells, and lower in Nrf2-enhanced cells than in wild-type cells. To further investigate the mechanism of the protective effect of Nrf2, mRNA of metallothionein (MT) and other cytoprotective genes were determined. Cadmium markedly induced MT-1 and MT-2 in livers of all four genotypes of mice. In contrast, genes involved in glutathione synthesis and reducing reactive oxygen species, including glutamate-cysteine ligase (Gclc), glutathione peroxidase-2 (Gpx2), and sulfiredoxin-1 (Srxn-1) were only induced in Nrf2-enhanced mice, but not in Nrf2-null mice. In conclusion, the present study shows that Nrf2 activation prevents cadmium-induced oxidative stress and liver injury through induction of genes involved in antioxidant defense rather than genes that scavenge Cd. -- Highlights: ► Cadmium caused extensive hepatic hemorrhage and necrosis in Nrf2-null mice. ► Keap1-KD and Keap1-HKO mice

  7. Nrf2 activation prevents cadmium-induced acute liver injury

    International Nuclear Information System (INIS)

    Oxidative stress plays an important role in cadmium-induced liver injury. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that up-regulates cytoprotective genes in response to oxidative stress. To investigate the role of Nrf2 in cadmium-induced hepatotoxicity, Nrf2-null mice, wild-type mice, kelch-like ECH-associated protein 1-knockdown (Keap1-KD) mice with enhanced Nrf2, and Keap1-hepatocyte knockout (Keap1-HKO) mice with maximum Nrf2 activation were treated with cadmium chloride (3.5 mg Cd/kg, i.p.). Blood and liver samples were collected 8 h thereafter. Cadmium increased serum alanine aminotransferase (ALT) and lactate dehydrogenase (LDH) activities, and caused extensive hepatic hemorrhage and necrosis in the Nrf2-null mice. In contrast, Nrf2-enhanced mice had lower serum ALT and LDH activities and less morphological alternations in the livers than wild-type mice. H2DCFDA (2′,7′-dichlorodihydrofluoresein diacetate) staining of primary hepatocytes isolated from the four genotypes of mice indicated that oxidative stress was higher in Nrf2-null cells, and lower in Nrf2-enhanced cells than in wild-type cells. To further investigate the mechanism of the protective effect of Nrf2, mRNA of metallothionein (MT) and other cytoprotective genes were determined. Cadmium markedly induced MT-1 and MT-2 in livers of all four genotypes of mice. In contrast, genes involved in glutathione synthesis and reducing reactive oxygen species, including glutamate-cysteine ligase (Gclc), glutathione peroxidase-2 (Gpx2), and sulfiredoxin-1 (Srxn-1) were only induced in Nrf2-enhanced mice, but not in Nrf2-null mice. In conclusion, the present study shows that Nrf2 activation prevents cadmium-induced oxidative stress and liver injury through induction of genes involved in antioxidant defense rather than genes that scavenge Cd. -- Highlights: ► Cadmium caused extensive hepatic hemorrhage and necrosis in Nrf2-null mice. ► Keap1-KD and Keap1-HKO mice were

  8. Assessment of radio modulatory potential of emblica against radiation and cadmium induced biochemical changes in kidney of Swiss albino mice

    International Nuclear Information System (INIS)

    Ionizing radiation Induces cellular damage through direct ionization of DNA and other cellular targets and indirectly via reactive oxygen species which may include effects from epigenetic changes. It has been known since ancient times that Cadmium is virtually toxic to every organ of body including renal system. Radioprotectors are compounds that are designed to reduce the damage in normal tissue caused by radiation and cadmium. Emblica officinalis extract has been shown to possess high antioxidative, anticancer, lipid lowering, antisclerotic, hepatoprotective and anti-HIV potential. It is highly nutritious and important dietary source of vitamin. Emblica contains a polyphenols, especially tannins and other phenolic compounds. Considering antioxidant properties of Emblica, the aim of this study was to access the efficacy of Emblica in reducing radiation and cadmium induced changes in mouse kidney. For this purpose four male mice were randomly assigned into six treatment groups. The mice in the treatment groups II to VII treated respectively with cadmium chloride, radiation (7.0 Gy) combined treatment and drug treated groups. All biochemical parameters of the control groups were compared with the respective experimental groups. An increase in the value of total proteins, glycogen, acid phosphatase, alkaline phosphatase activity and RNA was observed up to day-14 in the non drug treated group and day 7 in the Emblica treated groups. Thereafter value declined up to day-28 without reaching to normal. Whereas the value of cholesterol and DNA showed a decreasing trend up to day-14 in non drug treated groups and day-7 in Emblica treated groups. The biochemical findings indicated the drug treated section of the kidney showed slightly/no degenerative changes. The treated groups demonstrating the ability of Emblica to inhibit oxidative stress thus preventing renal injury. (author)

  9. ASSESSMENT OF CADMIUM EXPOSURE AND TOXICITY RISK IN AN AMERICAN VEGETARIAN POPULATION

    Science.gov (United States)

    It has been postulated that nonvegetarians may be exposed to less cadmium than vegetarians because of the cadmium-poor meat in their diet. This study attempts to test this possibility by measuring the cadmium exposure and accumulation in a population subgroup that includes many v...

  10. 76 FR 57682 - Petition Requesting Regulations Restricting Cadmium in Children's Products

    Science.gov (United States)

    2011-09-16

    ... cadmium in children's products, especially toy metal jewelry. On September 6, 2011, the Commission granted... cadmium in children's jewelry is published by ASTM International, Inc. (``ASTM'') within three months after September 16, 2011. If a voluntary standard for cadmium in children's jewelry is published by...

  11. 40 CFR 415.640 - Applicability; description of the cadmium pigments and salts production subcategory.

    Science.gov (United States)

    2010-07-01

    ... cadmium pigments and salts production subcategory. 415.640 Section 415.640 Protection of Environment... POINT SOURCE CATEGORY Cadmium Pigments and Salts Production Subcategory § 415.640 Applicability; description of the cadmium pigments and salts production subcategory. The provisions of this subpart...

  12. Subcellular Localization of Cadmium in Chlorella vulgaris Beijerinck Strain Bt-09

    Directory of Open Access Journals (Sweden)

    P.B. Lintongan

    2004-06-01

    Full Text Available Growth response curves of Chlorella vulgaris Beijerinck strain Bt-09 to sublethal concentrations of cadmium were evaluated. The growth responses of this microalgal isolate was determined through analysis of chlorophyll a levels. Cadmium was effectively taken up by the cells as determined by Flame Atomic Absorption Spectrophotometry (F-AAS. Subcellular fractionation was undertaken to locate sites that accumulate cadmium.

  13. SNF1-related protein kinases type 2 are involved in plant responses to cadmium stress.

    NARCIS (Netherlands)

    A. Kulik; A. Anielska-Mazur; M. Bucholc; E. Koen; E. Szymańska; A. Żmieńko; E. Krzywińska; I. Wawer; F. McLoughlin; D. Ruszkowski; M. Figlerowicz; C. Testerink; A. Sklodowska; D. Wendehenne; G. Dobrowolska

    2012-01-01

    Cadmium ions are notorious environmental pollutants. To adapt to cadmium-induced deleterious effects plants have developed sophisticated defense mechanisms. However, the signaling pathways underlying the plant response to cadmium are still elusive. Our data demonstrate that SnRK2s (for SNF1-related

  14. Kinetic parameters and TL mechanism in cadmium tetra borate phosphor

    Energy Technology Data Exchange (ETDEWEB)

    Annalakshmi, O. [Radiological Safety Division, Materials Physics Division, Indira Gandhi Centre for Atomic Research, Kalpakkam-603102 (India); Jose, M.T., E-mail: mtj@igcar.gov.in [Radiological Safety Division, Materials Physics Division, Indira Gandhi Centre for Atomic Research, Kalpakkam-603102 (India); Sridevi, J. [Central Leather Research Institute, Council of Scientific and Industrial Research, Chennai 600 020, Tamilnadhu (India); Venkatraman, B. [Radiological Safety Division, Materials Physics Division, Indira Gandhi Centre for Atomic Research, Kalpakkam-603102 (India); Amarendra, G. [Materials Physics Division, Indira Gandhi Centre for Atomic Research, Kalpakkam-603102 (India); Mandal, A.B. [Central Leather Research Institute, Council of Scientific and Industrial Research, Chennai 600 020, Tamilnadhu (India)

    2014-03-15

    Polycrystalline powder samples of cadmium tetra borate were synthesized by a simple solid state sintering technique and gamma irradiated sample showed a simple Thermoluminescence (TL) glow peak around 460 K. The TL kinetic parameters of gamma irradiated phosphor were determined by initial rise (IR), isothermal decay (ID), peak shape (PS), variable heating rate (VHR) and glow curve de-convolution method. The kinetic parameters such as activation energy (E), frequency factor (s) and order of kinetics (b) were calculated by IR, ID, PS and VHR methods are in the order of ∼1.05 eV, 10{sup 9}–10{sup 12} s{sup −1} and 1.58, respectively. From the results of TL and PL emission studies carried out on the phosphor revealed that the defect centers related to TL is different from that for PL. EPR measurements were carried out to identify the defect centers formed in cadmium tetra borate phosphor on gamma irradiation. Based on EPR studies the mechanism for TL process in cadmium tetra borate is proposed in this paper -- Highlights: • Polycrystalline powder samples of undoped cadmium tetra borate synthesized. • Cadmium tetra borate phosphor exhibits a dosimetric peak at 458 K. • Kinetic parameters of the trap responsible for TL evaluated. • TL mechanism is proposed from TL to EPR correlation studies.

  15. Cadmium sorption characteristics of phosphorylated sago starch-extraction residue

    International Nuclear Information System (INIS)

    The residue produced by the extraction of sago starch is usually discarded as a waste material. In this study, we phosphorylated the sago starch-extraction residue with phosphoryl chloride and used the phosphorylated residue to remove cadmium from wastewater. The phosphoric ester functionality in the phosphorylated residue was evaluated by means of infrared microspectrometry and solid-state NMR. The dependence of the cadmium sorption behavior on pH, contact time, and electrolyte concentration and the maximum sorption capacity of the phosphorylated residue were also studied. The cadmium sorption varied with pH and electrolyte concentration, and the maximum sorption capacity was 25.2 mg g-1, which is almost half the capacity of commercially available weakly acidic cation exchange resins. The phosphorylated residue could be reused several times, although cadmium sorption gradually decreased as the number of sorption-desorption cycles increased. The phosphorylated residue sorbed cadmium rapidly, which is expected to be favorable for the continuous operation in a column.

  16. Lead and cadmium in indoor air and the urban environment

    International Nuclear Information System (INIS)

    The present study was conducted to find potential terrestrial biomonitors for heavy metals in indoor air in an urban environment. TSP, PM10, and PM2.5 were collected in three retirement facilities in the urban area of Vienna. In addition, particulate matter and soil, vegetation, and isopods (Porcellio scaber L.) were collected in the adjacent garden areas. Aerosols were sampled with a low-volume air sampler. The sampled materials were wet ashed and total lead and cadmium contents were determined. Water-soluble heavy metal concentrations were measured in aqueous extracts from air exposed filters, soil, and vegetation. Lead and cadmium were analyzed by graphite furnace AAS. Lead contents in the vegetation were inferred from water-soluble lead in soils. Lead in isopods generally reflected the contents in vegetation. Cadmium in plants probably derived from soil solutions as well as from atmospheric input. Isopods reflected the total cadmium contents in soils. Particulate matter was dominated by PM2.5, both with respect to mass concentrations and to heavy metal contents. The indoor aerosol was found to be influenced by human activity, indoor sources, and outdoor particles. Relationships between indoor airborne heavy metals and the contents in vegetation (lead and cadmium: positive) and isopods (lead: negative) were identified to have the potential for biomonitoring indoor air quality. - Urban vegetation and isopods are potential indicators for indoor aerial heavy metals

  17. Lead and cadmium in indoor air and the urban environment.

    Science.gov (United States)

    Komarnicki, Günter J K

    2005-07-01

    The present study was conducted to find potential terrestrial biomonitors for heavy metals in indoor air in an urban environment. TSP, PM(10), and PM(2.5) were collected in three retirement facilities in the urban area of Vienna. In addition, particulate matter and soil, vegetation, and isopods (Porcellio scaber L.) were collected in the adjacent garden areas. Aerosols were sampled with a low-volume air sampler. The sampled materials were wet ashed and total lead and cadmium contents were determined. Water-soluble heavy metal concentrations were measured in aqueous extracts from air exposed filters, soil, and vegetation. Lead and cadmium were analyzed by graphite furnace AAS. Lead contents in the vegetation were inferred from water-soluble lead in soils. Lead in isopods generally reflected the contents in vegetation. Cadmium in plants probably derived from soil solutions as well as from atmospheric input. Isopods reflected the total cadmium contents in soils. Particulate matter was dominated by PM(2.5), both with respect to mass concentrations and to heavy metal contents. The indoor aerosol was found to be influenced by human activity, indoor sources, and outdoor particles. Relationships between indoor airborne heavy metals and the contents in vegetation (lead and cadmium: positive) and isopods (lead: negative) were identified to have the potential for biomonitoring indoor air quality.

  18. Reinvestigation of the beta-decay of {sup 110}Mo

    Energy Technology Data Exchange (ETDEWEB)

    Wang, J.C.; Dendooven, P.; Hankonen, S.; Huikari, J.; Jokinen, A.; Kolhinen, V.S.; Lhersonneau, G.; Nieminen, A.; Peraejaervi, K.; Rinta-Antila, S.; Aeystoe, J. [Department of Physics, University of Jyvaeskylae, FIN-40351, Jyvaeskylae (Finland)

    2004-01-01

    The beta-decay of the neutron-rich nucleus {sup 110}Mo, separated by the IGISOL on-line mass separator from other fission products, has been investigated by using beta-gamma and gamma-gamma coincidence techniques. The decay scheme of {sup 110}Mo has been revised, including 3 new excited states and 7 new {gamma} transitions in {sup 110}Tc. The {beta}-feedings were measured and log ft values and B(GT) values were deduced based on a Q{sub {beta}}-value from systematics. Three excited 1{sup +} states in {sup 110}Tc fed by spin-flip allowed-unhindered beta transitions were identified. The deduced beta-decay strengths are compared with the Gamow-Teller strength distribution obtained from a macroscopic-microscopic calculation. The role of the asymptotic quantum numbers in the context of the allowed beta-decay is discussed. (orig.)

  19. 33 CFR 110.74 - Marco Island, Marco River, Fla.

    Science.gov (United States)

    2010-07-01

    ... ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.74 Marco Island, Marco River, Fla. Beginning... place will be allowed. Fixed mooring piles or stakes are prohibited. All moorings shall be so...

  20. 33 CFR 110.90 - San Diego Harbor, Calif.

    Science.gov (United States)

    2010-07-01

    ... ANCHORAGE REGULATIONS Special Anchorage Areas § 110.90 San Diego Harbor, Calif. (a) Area A-1. In North San... District. Temporary floats or buoys for marking anchors are allowed. Fixed moorings, piles or stakes...

  1. 33 CFR 110.128 - Columbia River at Portland, Oreg.

    Science.gov (United States)

    2010-07-01

    ... ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.128 Columbia River at Portland, Oreg. The waters of the Columbia River between Sand Island and Government Island, bounded on the west by pile...

  2. 33 CFR 110.50c - Mumford Cove, Groton, Conn.

    Science.gov (United States)

    2010-07-01

    ... ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.50c Mumford Cove, Groton, Conn. (a) Area No. 1... be allowed. Fixed mooring piles or stakes will be prohibited. The anchoring of vessels and placing...

  3. 33 CFR 110.58 - Cos Cob Harbor, Greenwich, Conn.

    Science.gov (United States)

    2010-07-01

    ... ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.58 Cos Cob Harbor, Greenwich, Conn. (a) Area A... or buoys for marking anchors will be allowed. Fixed mooring piles or stakes are prohibited....

  4. 33 CFR 110.50 - Stonington Harbor, Conn.

    Science.gov (United States)

    2010-07-01

    ... ANCHORAGE REGULATIONS Special Anchorage Areas § 110.50 Stonington Harbor, Conn. (a) Area No. 1. Beginning at... mooring stake or pile is prohibited. The General Statutes of the State of Connecticut authorizes...

  5. 33 CFR 110.127c - Trinidad Bay, Calif.

    Science.gov (United States)

    2010-07-01

    ... ANCHORAGE REGULATIONS Special Anchorage Areas § 110.127c Trinidad Bay, Calif. The waters of Trinidad Bay... floats and buoys for anchoring will be allowed in the area. Fixed moorings, piles or stakes...

  6. 33 CFR 110.59 - Eastern Long Island, NY.

    Science.gov (United States)

    2010-07-01

    ... ANCHORAGE REGULATIONS Special Anchorage Areas § 110.59 Eastern Long Island, NY. (a) Huntington Harbor... a vessel at anchor may be used. Fixed mooring piles or stakes are prohibited. (d) Cold Spring...

  7. 33 CFR 110.50d - Mystic Harbor, Noank, Conn.

    Science.gov (United States)

    2010-07-01

    ... ANCHORAGES ANCHORAGE REGULATIONS Special Anchorage Areas § 110.50d Mystic Harbor, Noank, Conn. (a) The area... or buoys for marking anchors will be allowed but fixed piles or stakes are prohibited. All...

  8. Collinear laser spectroscopy of atomic cadmium

    CERN Document Server

    Frömmgen, Nadja; Bissell, Mark L; Bieroń, Jacek; Blaum, Klaus; Cheal, Bradley; Flanagan, Kieran; Fritzsche, Stephan; Geppert, Christopher; Hammen, Michael; Kowalska, Magdalena; Kreim, Kim; Krieger, Andreas; Neugart, Rainer; Neyens, Gerda; Rajabali, Mustafa M; Nörtershäuser, Wilfried; Papuga, Jasna; Yordanov, Deyan T

    2015-01-01

    Hyperfine structure $A$ and $B$ factors of the atomic $5s\\,5p\\,\\; ^3\\rm{P}_2 \\rightarrow 5s\\,6s\\,\\; ^3\\rm{S}_1$ transition are determined from collinear laser spectroscopy data of $^{107-123}$Cd and $^{111m-123m}$Cd. Nuclear magnetic moments and electric quadrupole moments are extracted using reference dipole moments and calculated electric field gradients, respectively. The hyperfine structure anomaly for isotopes with $s_{1/2}$ and $d_{5/2}$ nuclear ground states and isomeric $h_{11/2}$ states is evaluated and a linear relationship is observed for all nuclear states except $s_{1/2}$. This corresponds to the Moskowitz-Lombardi rule that was established in the mercury region of the nuclear chart but in the case of cadmium the slope is distinctively smaller than for mercury. In total four atomic and ionic levels were analyzed and all of them exhibit a similar behaviour. The electric field gradient for the atomic $5s\\,5p\\,\\; ^3\\mathrm{P}_2$ level is derived from multi-configuration Dirac-Hartree-Fock calculatio...

  9. Cadmium in insects after ash fertilization

    Institute of Scientific and Technical Information of China (English)

    Martin Lodenius; Jussi Josefsson; Kari Heli(o)vaara; Esa Tulisalo; Matti Nummelin

    2009-01-01

    Ash fertilization of forests returns nutrients to forest ecosystems and has a positive effect on soil pH.but it also may elevate Cd concentrations of forest biota.Cadmium concentrations of some forest insects(Formica ants.carabids and Coleopteran larvac from decaying wood)were investigated in southern Finland where two plots were fertilized with wood ash,while two other plots represented anfertilized control plots.In ants,mean Cd concentration was 3.6±1.4 mg/kg.with nest workers having significantly higher concen-trations than workers trapped in pitfall traps.Concentrations at fertilized and unfertilized plots were similar.In carabid beetles,the average Cd concentration of Carabus glabratus was 0.44±0.36 mg/kg.with no significant difference between control plots and fertilized plots.In another carabid beetle,Pterostichus niger,mean Cd concentration was higher at fertilized plots compared to control plots.We conclude that the variation of Cd concentra-tions in the insects studied is more efficiently controlled by species-specific differences than fertilization history of the forest floor.

  10. Thin-film cadmium telluride solar cells

    Science.gov (United States)

    Chu, T. L.

    1987-10-01

    Cadmium telluride, with a room-temperature band-gap energy of 1.5 eV, is a promising thin-film photovoltaic material. The major objective of this research has been to demonstrate thin-film CdTe heterojunction solar cells with a total area greater than 1 sq cm and photovoltaic efficiencies of 13 percent or more. Thin-film p-CdTe/CdS/SnO2:F/glass solar cells with an AM1.5 efficiency of 10.5 percent have been reported previously. This report contains results of work done on: (1) the deposition, resistivity control, and characterization of p-CdTe films by the close-spaced sublimation process; (2) the deposition of large-band-gap window materials; (3) the electrical properties of CdS/CdTe heterojunctions; (4) the formation of stable, reproducible, ohmic contacts (such as p-HgTe) to p-CdTe; and (5) the preparation and evaluation of heterojunction solar cells.

  11. Cadmium uptake by rat red blood cells

    International Nuclear Information System (INIS)

    Rat red blood cells were employed to study the uptake of cadmium (109Cd). Suspensions of red blood cells were exposed to Cd concentrations (both bound and free) observed following in vivo Cd administration. Cd uptake was biphasic with an initial rapid phase (0C was one-fourth of that at 370C. The metabolic inhibitors: sodium fluoride (1mM), potassium cyanide (1mM) and carbonyl cyanide-m-chlorophenyl hydrazone (2μM) and the Na+-K+-ATPase inhibitor, ouabain (1mM) did not reduce Cd (50μM) uptake into red blood cells. This suggests that the uptake of Cd into red blood cells was not an active process. Incubation of Cd (10μM) with an equimolar concentration of Zn did not alter uptake of Cd into red blood cells, but at 5 and 10 times higher concentrations of Zn, Cd uptake was enhanced 5-fold. Mercury at one-tenth and equimolar concentrations of Cd increased Cd uptake by red blood cells 2-fold. N-Ethylmaleimide (0.5-5mM), which irreversibly inactivates membrane sulfhydryl groups, decreased Cd uptake. The data indicate that Cd uptake into rat red blood cells occurs by passive transport and that alterations of sulfhydryls of red blood cell membrane may modulate the process. (author)

  12. Cadmium accumulation and subcellular distribution in relation to cadmium chloride induced cytotoxicity in vitro

    International Nuclear Information System (INIS)

    A bovine kidney cell culture system was used to assess what relationship cadmium (Cd) uptake and subcellular distribution had to cadmium chloride induced cytotoxicity. Twenty-four hour incubation with 0.1-10 μM Cd elicited 0-90% cytotoxicity. Fifty percent cytotoxicity was estimated to result from 0.8 μM Cd. A concentration-related Cd accumulation paralleled the cytotoxicity profile. The time-course for Cd accumulation was linear for the first 6 h of exposure and plateaued by 18 h post-exposure. When the degree of cytotoxicity was compared with the cellular Cd burden at 24 h post-treatment a least-squares linear regression analysis (r=0.93) indicated a direct relationship. Subcellular distribution studies indicated greater than 90% Cd recovery from the soluble supernatant (105,000 g) at all levels of cytotoxicity studied. Metallothionein sequestered less than 25% of the cellular Cd. As a result of the correlation of the degree of cytotoxicity with the cellular Cd burden and the independence of subcellular distribution from cytotoxicity, a cumulative mechanism of toxicity for Cd in MDBK cells was suggested. (author)

  13. Coverage induced structural transformations of tetracene on Ag(110)

    Science.gov (United States)

    Takasugi, Kazushiro; Yokoyama, Takashi

    2016-03-01

    Self-assembly of tetracene on an anisotropic surface of Ag(110) has been investigated using scanning tunneling microscopy and low-energy electron diffraction. We observe multistage structural transformations of the self-assembled tetracene on Ag(110) as a function of molecular coverages, which are accompanied by the changes in molecular orientations. They are analyzed by a balance between multiple molecule-molecule and anisotropic substrate-molecule interactions.

  14. Adsorptionsmechanismen von Perylen und PTCDA auf Ag(110)

    OpenAIRE

    Ellerbrake, R. (Rainer)

    2003-01-01

    Das Adsorptionsverhalten der aromatischen Kohlenwasserstoffe Perylen und PTCDA, per Vakuumsublimation auf Ag(110) aufgedampft, wird mit experimentellen und theoretischen Methoden untersucht. TDS-, XPS-, STM und LEED-Untersuchungen zeigen, dass sich Perylen auf Ag(110) im Monolagenbereich nahe Raumtemperatur bzgl. der Bedeckung wie ein 2D van der Waals-Gas verhält. Erst nahe der geschlossenen Monolage bilden sich periodische, aber inkommensurable Strukturen aus. Computer...

  15. A novel 1,10-seco withanolide from Physalis peruviana.

    Science.gov (United States)

    Fang, Sheng-Tao; Liu, Ji-Kai; Li, Bo

    2010-07-01

    A novel 1,10-seco withanolide, 1,10-seco withaperuvin C (1), together with four known withanolides, 4 beta-hydroxywithanolide E (2), visconolide (3), withanolide F (4), and withaphysanolide (5), was isolated from the aerial parts of Physalis peruviana. The structures of compounds 1-5 were determined on the basis of spectroscopic methods including extensive 1D and 2D NMR analysis. In addition, the possible biogenetic relationships among these five withanolides are discussed. PMID:20628942

  16. Mechanisms of self-diffusion on Pt(110)

    DEFF Research Database (Denmark)

    Lorensen, Henrik Qvist; Nørskov, Jens Kehlet; Jacobsen, Karsten Wedel

    1999-01-01

    The self-diffusion of Pt on the missing row reconstructed Pt(110) surface is discussed based on density functional calculations of activation energy barriers. Different competing diffusion mechanisms are considered and we show that several different diffusion paths along the reconstruction troughs...... are of relevance. The analysis leads to another interpretation of the recently observed double jumps at the Pt(110) surface. [S0163-1829(99)51732-3]....

  17. Growth of Al on a W(110) surface

    Energy Technology Data Exchange (ETDEWEB)

    Choi, D.S., E-mail: dschoi@kangwon.ac.kr; Kim, D.H.

    2012-07-01

    Using low energy electron diffraction and low energy ion scattering spectroscopy, we investigated the growth mode of Al on a W(110) surface at room temperature and at 1000 K. We found that Al grew on the W(110) surface in the Frank-van der Merwe mode when the W substrate was kept at room temperature during Al deposition. It was found that at a coverage higher than 2 monolayer (ML) in Al grown at room temperature, Al atoms had a well-ordered face centered cubic (fcc) (111) surface. The [11{sup Macron }0] direction of the Al grown at room temperature on the (111) surface was parallel to the [001] direction of the W(110) substrate surface. When the temperature of the W substrate was kept at 1000 K, the adsorbed Al atoms grew in the Volmer-Weber mode. The 1.5 ML Al/W(110) surface prepared at 1000 K shows two domains of the fcc Al(111) surfaces along with a W(110) surface. We also found that the early stage of Al film growth shows W(110) structure. However as the film becomes thicker (above 3.5-4 layers) the Al face is turned into fcc (111) face. - Highlights: Black-Right-Pointing-Pointer We investigated the growth behavior of Al on the W(110) surface. Black-Right-Pointing-Pointer Al grew in the Frank-van der Merwe mode when the W was kept at room temperature. Black-Right-Pointing-Pointer Al grew in the Volmer-Weber mode when the W was kept at 1000 K. Black-Right-Pointing-Pointer The Al film grown at room temperature has the (111) surface. Black-Right-Pointing-Pointer [11{sup Macron }0] direction on the Al(111) was the same as [001] on the W(110) substrate.

  18. Structure of the Hsp110:Hsc70 Nucleotide Exchange Machine

    OpenAIRE

    Schuermann, Jonathan P.; Jiang, Jianwen; Cuellar, Jorge; Llorca, Oscar; Wang, Liping; Gimenez, Luis E.; Jin, Suping; Taylor, Alexander B.; Demeler, Borries; Morano, Kevin A.; Hart, P. John; Valpuesta, Jose M.; Lafer, Eileen M.; Sousa, Rui

    2008-01-01

    Hsp70s mediate protein folding, translocation, and macromolecular complex remodeling reactions. Their activities are regulated by proteins that exchange ADP for ATP from the nucleotide-binding domain (NBD) of the Hsp70. These nucleotide exchange factors (NEFs) include the Hsp110s, which are themselves members of the Hsp70 family. We report the structure of an Hsp110:Hsc70 nucleotide exchange complex. The complex is characterized by extensive protein:protein interactions and symmetric bridging...

  19. Transcriptomic analysis of cadmium stress response in the heavy metal hyperaccumulator Sedum alfredii Hance.

    Science.gov (United States)

    Gao, Jun; Sun, Ling; Yang, Xiaoe; Liu, Jian-Xiang

    2014-01-01

    The Sedum alfredii Hance hyperaccumulating ecotype (HE) has the ability to hyperaccumulate cadmium (Cd), as well as zinc (Zn) and lead (Pb) in above-ground tissues. Although many physiological studies have been conducted with these plants, the molecular mechanisms underlying their hyper-tolerance to heavy metals are largely unknown. Here we report on the generation of 9.4 gigabases of adaptor-trimmed raw sequences and the assembly of 57,162 transcript contigs in S. alfredii Hance (HE) shoots by the combination of Roche 454 and Illumina/Solexa deep sequencing technologies. We also have functionally annotated the transcriptome and analyzed the transcriptome changes upon Cd hyperaccumulation in S. alfredii Hance (HE) shoots. There are 110 contigs and 123 contigs that were up-regulated (Fold Change ≥ 2.0) and down-regulated (Fold Change

  20. Transcriptomic analysis of cadmium stress response in the heavy metal hyperaccumulator Sedum alfredii Hance.

    Directory of Open Access Journals (Sweden)

    Jun Gao

    Full Text Available The Sedum alfredii Hance hyperaccumulating ecotype (HE has the ability to hyperaccumulate cadmium (Cd, as well as zinc (Zn and lead (Pb in above-ground tissues. Although many physiological studies have been conducted with these plants, the molecular mechanisms underlying their hyper-tolerance to heavy metals are largely unknown. Here we report on the generation of 9.4 gigabases of adaptor-trimmed raw sequences and the assembly of 57,162 transcript contigs in S. alfredii Hance (HE shoots by the combination of Roche 454 and Illumina/Solexa deep sequencing technologies. We also have functionally annotated the transcriptome and analyzed the transcriptome changes upon Cd hyperaccumulation in S. alfredii Hance (HE shoots. There are 110 contigs and 123 contigs that were up-regulated (Fold Change ≥ 2.0 and down-regulated (Fold Change

  1. Exposure of rainbow trout milt to mercury and cadmium alters sperm motility parameters and reproductive success

    International Nuclear Information System (INIS)

    In the current work, seminal plasma was used for the first time as an incubation medium for monitoring short-time exposure effects of sublethal concentrations of mercury and cadmium ions on rainbow trout sperm. Sperm motility parameters (CASA) and hatching rates were used as gamete quality markers. Additionally live/dead sperm viability test and comet assay of DNA fragmentation were performed. We demonstrated that computer-assisted sperm motility analysis (CASA) may serve as a predictor of reproductive success, when milt contaminated with heavy metals is used. Results presented in this study demonstrate that mercury ions altered sperm motility characteristics at 1-10 mg Hg2+/l and 10 mg Cd2+/l and hatching rates at 10 mg Hg2+/l and 10 mg Cd2+/l after 4 h of exposure. Although mercury ions affected sperm motility parameters immediately after dilution with milt as well as at 4 h of exposure, no differences in sperm motility parameters were found between intact and mercury-treated milt after 24 h of exposure. Our results suggest that rainbow trout seminal plasma has a protective role against the toxic effects of mercury ions of rainbow trout sperm motility.

  2. Cadmium Accumulation Characteristics of Winter Weed Lapsana apogonoides in Paddy Field%稻田冬季杂草稻槎菜的镉积累特性研究

    Institute of Scientific and Technical Information of China (English)

    林立金; 石军; 刘春阳; 马倩倩; 何静; 钟程操; 黄佳璟; 温铿; 廖明安

    2016-01-01

    In order to screen more cadmium hyperaccumulators for cadmium contaminated paddy field remedia-tion,the pot and plot experiments were conducted to study the cadmium accumulation characteristics and ecophysio-logical characteristics of winter weed Lapsana apogonoides in paddy field.The preliminary and further experiments showed that the root biomass,shoot biomass,whole plant biomass and resistance coefficient of L.apogonoides de-creased first and increased later and decreased again with the increase of cadmium concentration in soil,and there was no significant toxic characteristic in any treatment.With the increase of soil cadmium concentration,the cadmi-um contents in root and shoot of L.apogonoides increased.When the soil cadmium concentration was 75 mg /kg,the cadmium contents in shoots of preliminary and further experiments were 1 19.50,1 10.1 1 mg /kg,respectively,which reached the critical value of cadmium hyperaccumulator(100 mg /kg).The root bioconcentration factor(BCF)and shoot BCF were greater than 1 ,and translocation factor(TF)exceeded 1 when the soil cadmium treatment was grea-ter than 0 mg /kg.The cadmium accumulation amounts in root,shoot and whole plant of L.apogonoides increased with the increase of soil cadmium concentration,and had highly significant linear regression relationship with soil cadmium concentration.The further experiment showed the chlorophyll content decreased first and increased later and decreased again with the increase of cadmium concentration in soil,SOD activity increased first and decreased later,and POD activity decreased first and increased later,which were related to the special physiological mechanism of L.apogonoides.In plot experiment,the cadmium accumulation amount in shoot of L.apogonoides was 1.10 -1.13 mg /m2 at soil cadmium level of 2.04 -2.89 mg /kg.Therefore,L.apogonoides was a cadmium hyperaccumulator which could be used to remedy the cadmium contaminated paddy field in winter.%为进一步筛选出更多的

  3. Antiproton production target of the AA

    CERN Multimedia

    Photographic Service

    1980-01-01

    The target rods were initially of tungsten, later of iridium. Diameters were around 3 mm and the lengths 60-110 mm. The rod is embedded in graphite, pressed into an aluminium body with cooling fins for forced air cooling. The 26 GeV proton beam from the PS was focused to the dimension of the rod. To aim precisely at its centre, the target was fitted with a scintillator screen, with circles at every 5 mm radius. Both scintillator and target had to stand pulses of 1.4E13 protons every 4.8 s, without interruption for many months.

  4. Antiproton Target

    CERN Multimedia

    1980-01-01

    Antiproton target used for the AA (antiproton accumulator). The first type of antiproton production target used from 1980 to 1982 comprised a rod of copper 3mm diameter and 120mm long embedded in a graphite cylinder that was itself pressed into a finned aluminium container. This assembly was air-cooled and it was used in conjunction with the Van der Meer magnetic horn. In 1983 Fermilab provided us with lithium lenses to replace the horn with a view to increasing the antiproton yield by about 30%. These lenses needed a much shorter target made of heavy metal - iridium was chosen for this purpose. The 50 mm iridium rod was housed in an extension to the original finned target container so that it could be brought very close to the entrance to the lithium lens. Picture 1 shows this target assembly and Picture 2 shows it mounted together with the lithium lens. These target containers had a short lifetime due to a combination of beam heating and radiation damage. This led to the design of the water-cooled target in...

  5. Cadmium accumulation characteristics and removal potentials of high cadmium accumulating rice line grown in cadmium-contaminated soils.

    Science.gov (United States)

    Tang, Hao; Li, Tingxuan; Yu, Haiying; Zhang, Xizhou

    2016-08-01

    Phytoextraction is a promising technique to remove cadmium (Cd) from contaminated soils. In this research, the two different Cd accumulation rice lines of Lu527-8 (the high Cd accumulating rice line) and Lu527-4 (the normal rice line) were grown in soils with different Cd treatments (0, 5, 10, and 20 mg kg(-1) soil) to evaluate Cd accumulation characteristics and Cd removal potentials. When the concentration of Cd in soil increased, Lu527-8 showed less symptoms of phytotoxicity when compared to Lu527-4. Furthermore, Lu527-8 demonstrated greater shoot Cd accumulation (321.17-964.95 mg plant(-1)) than Lu527-4 (50.37-201.66 μg plant(-1)) at the jointing and filling stages. The soil available Cd content of Lu527-8 significantly decreased by 26.92-38.97 and 27.77-63.44 % at the jointing and filling stages, respectively. Meanwhile, the total Cd content in soil also reduced by 11.64-46.75 and 21.41-54.11 % at jointing and filling stages, respectively. When the Cd concentration in soil was 20 mg kg(-1), the Cd extraction rate in shoots of Lu527-8 reached 2.12 and 2.85 % which increased 10.60 and 6.48 times compared with that of Lu527-4 at the jointing and filling stages, respectively. In conclusion, this study demonstrates that Lu527-8 shows great abilities of Cd accumulation and Cd removal potential from contaminated soils with different Cd treatments and it is a promising species for phytoextraction of Cd-contaminated soils.

  6. Renal and blood pressure effects from environmental cadmium exposure in Thai children

    Energy Technology Data Exchange (ETDEWEB)

    Swaddiwudhipong, Witaya, E-mail: swaddi@hotmail.com [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Mahasakpan, Pranee [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Jeekeeree, Wanpen [Department of Medical Technology, Mae Sot General Hospital, Tak 63110 (Thailand); Funkhiew, Thippawan [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Sanjum, Rungaroon; Apiwatpaiboon, Thitikarn [Department of Medical Technology, Mae Sot General Hospital, Tak 63110 (Thailand); Phopueng, Ittipol [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand)

    2015-01-15

    Very few studies have shown renal and blood pressure effects from environmental cadmium exposure in children. This population study examined associations between urinary cadmium excretion, a good biomarker of long-term cadmium exposure, and renal dysfunctions and blood pressure in environmentally exposed Thai children. Renal functions including urinary excretion of β{sub 2}-microglobulin, calcium (early renal effects), and total protein (late renal effect), and blood pressure were measured in 594 primary school children. Of the children studied, 19.0% had urinary cadmium ≥1 μg/g creatinine. The prevalence of urinary cadmium ≥1 μg/g creatinine was significantly higher in girls and in those consuming rice grown in cadmium-contaminated areas. The geometric mean levels of urinary β{sub 2}-microglobulin, calcium, and total protein significantly increased with increasing tertiles of urinary cadmium. The analysis did not show increased blood pressure with increasing tertiles of urinary cadmium. After adjusting for age, sex, and blood lead levels, the analysis showed significant positive associations between urinary cadmium and urinary β{sub 2}-microglobulin and urinary calcium, but not urinary total protein nor blood pressure. Our findings provide evidence that environmental cadmium exposure can affect renal functions in children. A follow-up study is essential to assess the clinical significance and progress of renal effects in these children. - Highlights: • Few studies show renal effects from environmental cadmium exposure in children. • We report renal and blood pressure effects from cadmium exposure in Thai children. • Urinary β{sub 2}-microglobulin and calcium increased with increasing urinary cadmium. • The study found no association between urinary cadmium levels and blood pressure. • Environmental cadmium exposure can affect renal functions in children.

  7. Renal and blood pressure effects from environmental cadmium exposure in Thai children

    International Nuclear Information System (INIS)

    Very few studies have shown renal and blood pressure effects from environmental cadmium exposure in children. This population study examined associations between urinary cadmium excretion, a good biomarker of long-term cadmium exposure, and renal dysfunctions and blood pressure in environmentally exposed Thai children. Renal functions including urinary excretion of β2-microglobulin, calcium (early renal effects), and total protein (late renal effect), and blood pressure were measured in 594 primary school children. Of the children studied, 19.0% had urinary cadmium ≥1 μg/g creatinine. The prevalence of urinary cadmium ≥1 μg/g creatinine was significantly higher in girls and in those consuming rice grown in cadmium-contaminated areas. The geometric mean levels of urinary β2-microglobulin, calcium, and total protein significantly increased with increasing tertiles of urinary cadmium. The analysis did not show increased blood pressure with increasing tertiles of urinary cadmium. After adjusting for age, sex, and blood lead levels, the analysis showed significant positive associations between urinary cadmium and urinary β2-microglobulin and urinary calcium, but not urinary total protein nor blood pressure. Our findings provide evidence that environmental cadmium exposure can affect renal functions in children. A follow-up study is essential to assess the clinical significance and progress of renal effects in these children. - Highlights: • Few studies show renal effects from environmental cadmium exposure in children. • We report renal and blood pressure effects from cadmium exposure in Thai children. • Urinary β2-microglobulin and calcium increased with increasing urinary cadmium. • The study found no association between urinary cadmium levels and blood pressure. • Environmental cadmium exposure can affect renal functions in children

  8. Analysis Of The Underpotential Deposition Of Cadmium On Copper

    Directory of Open Access Journals (Sweden)

    Kowalik R.

    2015-09-01

    Full Text Available In this study the process of deposition of cadmium on polycrystalline copper electrode in sulfate solution was investigated. The process of underpotential and bulk deposition was analyzed by classical electrochemical method: cyclic voltammetry(CV, anodic stripping voltammetry(ASV and electrochemical quartz crystal microbalance(EQCM. The obtained results were compared with electrochemical impedance spectroscopy(EIS measurements. CV, EQCM and EIS results suggest that the UPD of cadmium starts below potential −0.4 V vs Ag/AgCl. Additionally the stripping analysis indicates the formation of cadmium monolayer with different density of deposited atoms depending on the applied potential. The transition from UPD to bulk deposition occurs below potential −0,7 V.

  9. Effects of macromolecular chelators on intestinal cadmium absorption in mice

    Energy Technology Data Exchange (ETDEWEB)

    Andersen, O.; Nielsen, J.B.; Bulman, R.A.

    1989-01-01

    Suppression of absorption by macromolecular chelators have been sucessful with several metals. In this paper a series of immobilized chelators ranging from DTPA to S-containing soft bases have been synthetized and investigated for ability to suppress intestinal uptake of /sup 109/Cd/sup 2+/ in mice. Dextran-O-ethyl-mercaptan, xanthates derived from polysaccharides and polyvinyl alcohol, dithiocarbamates of polyethylene imine and aminoethyl cellulose, and DTPA immobilized on aminopropyl silica were all ineffective. DTPA immobilized on aminoethyl cellulose even enhanced the intestinal uptake. The macromolecular chelators were without extensive effect on organ distribution of absorbed cadmium, except for dithiocarbamate immobilized on polyethylene imine, which enhanced the deposition of cadmium in several organs including the brain. Although the results are discouragign, they indicate that desing and synthesis of immobilized vicinal dithio compounds may represent an avenue for development of non-absorbable chelators with high affinity for cadmium.

  10. Biosorption of Cadmium by Fungal Biomass of Aspergillus niger

    Institute of Scientific and Technical Information of China (English)

    QI YANG; JIAN-LONG WANG; ZHI XING

    2005-01-01

    Objective To investigate the removal of cadmium from aqueous solution by waste fungal biomass of Aspergillus niger, originated from citric acid fermentation industry. Methods Batch adsorption test was used to study the biosorption equilibrium and isotherm. The Cd2+ concentration was measured with atomic adsorption spectrophotometer (AAS) HITACHI 180-80. Results The biosorption achieved equilibrium within 30 min. The adsorption isotherm could be described by Freundlich adsorption model, and the constants KF and 1/n were determined to be 2.07 and 0.18, respectively, and the correlation efficiency was 0.97. The optimal pH for Cd adsorption was 6.0. The cadmium-laden biomass could be effectively regenerated using 0.1 N HCl. Conclusion The waste biomass of Aspergillus niger, a by-product of fermentation industry, is a potential biosorbent for the removal of cadmium from aqueous solution.

  11. Cadmium-induced oxidative stress in potato tuber

    Directory of Open Access Journals (Sweden)

    Andrzej Stroiński

    2014-02-01

    Full Text Available Short-term treatment of tuber discs of potato (Solanum tuberosum L. with cadmium chloride elevated the concentration of active oxygen species (.O-2, H202 and activated the antioxidative system. Two cultivars, Bintje and Bzura, susceptible and tolerant, respectively, to cadmium were examined. In more tolerant, control tissues the activity of ascorbic acid peroxidase (AAP and catalase (CAT was higher than in the sensitive ones. During first hours of stress, the inhibition of superoxide dismutase (SOD, CAT and AAP was observed and it comes from inactivation of enzymes by cadmium ions. A subsequent activity increase of the enzymes aroused earlier in tolerant tissues. It seems therefore, that tolerant tissues possess a more efficient antioxidative system.

  12. Antifungal activity of nicotine and its cadmium complex

    International Nuclear Information System (INIS)

    Nicotine and its metal complex; Cd(II)-nicotine were isolated from leaves of Nicotiana tabacum using various metal ions by the reported techniques and studied for their antifungal activities against fourteen different species of fungi. For comparative study, pure sample of nicotine and metal salt used for complexation; cadmium(II) iodide was also subjected to antifungal tests with the same species of fungus under similar conditions. Results indicated that nicotine is quite effective against the rare pathogenic and Non pathogenic fungi but comparatively less effective against Pathogenic fungi. Nicotine was found to be completely ineffective against the selected species of Occasional pathogenic fungi. Cadmium(II) iodide effectively inhibited Pathogenic and Non pathogenic fungi whereas relatively ineffective against the Occasional pathogenic and Rare pathogenic fungi. On the other hand, Cadmium(II) nicotine complex inhibited all the selected species of fungi except Fusarium solani. (author)

  13. THE CADMIUM INTAKE OF SELECTED LEGUMES IN MODEL CONDITIONS

    Directory of Open Access Journals (Sweden)

    Pavol Trebichalský

    2012-12-01

    Full Text Available The work is to evaluate the extent of risk transfer of heavy metals from soil burdensome to their different levels of consumption of selected parts of the crop. The goal to be achieved in conditions of simulated vegetation pot experiments. To implement the experiment, we used the agricultural soil of land site Výčapy - Opatovce. The experiments use two types of leguminous plants: Faba beans (Faba vulgaris M., a variety MERLIN lentil dishes (Lens esculentum variety NELKA. In one experimental tank was weighed 5 kg of soil mixed with 1 kg of silica sand, and the bottom of the container we put a small drainage layer of gravel. Within each container, we applied the calculated dose of the basic fertilizer, as well as various amounts of soluble salts of cadmium observed. Crops are harvested when fully ripe and the  wet mineralization of plant samples was determined by heavy metals AAS method for device VARIAN 240FS. Significant ratio of cadmium is in the aboveground biomass of the legumes. Lentils take into aboveground biomass much more cadmium than  faba beans. The cadmium content in the first two variants is significantly lower than in the next two in both crops. We may conclude that the faba beans, and lentils to accumulate an increased amount of cadmium in soil in a relatively large amount of seeds. Although it is clear that Faba bean received cadmium content was compared with more lentils. Due to the significant accumulation of Cd by plants lentils and excessive production of the aboveground biomass is potentially usable lens as fytoremediation crop recovery for metalic polluted soils.doi:10.5219/221

  14. Cadmium effects and accumulation in cultures of Prorocentrum micans (dinophyta)

    Science.gov (United States)

    Kayser, H.; Sperling, K.-R.

    1980-03-01

    Effects and accumulation of cadmium were studied in unialgal 10-1 batch-culture experiments with the dinoflagellate Prorocentrum micans Ehrenberg. Tests were made using sterile filtered North Sea water enriched with nitrate and phosphate only in order to avoid disturbances by complex formation. Cadmium was added to the cultures in amounts of 100 to 0.13 µg l-1. In one series it was added at the start of the experiments and in a second one after a growth period of 1 week. Addition of only 1.2 µg Cd l-1 reduces multiplication rates and maximum cell densities of the algae. Not until 0.4 µg Cd-1 does growth correspond to that of the controls. Cadmium concentrations were measured, after filtration, in the culture medium and in the biomass by means of flameless AAS. The cadmium content in algae increased from 2.7 µg g-1 (dry weight) in controls to 500 µg g-1 (dry weight) in media containing 100 µg Cd l-1. Uptake occurred rapidly during the first few days of the experiments, slowed down somewhat during exponential growth stage, and increased during decay of the cultures. Cadmium content of culture media remained nearly constant (Series 1) or decreased only slowly during experimental time (Series 2). The highest concentration factor was measured in the controls. It decreased with increasing metal concentration in the medium and increased with experimental time. Structural modifications of the cells were visible after Lugol fixation only, indicating brittleness of the cell walls. P. micans has shown to be extremely sensitive to cadmium and to accumulate this metal.

  15. Cadmium effects and accumulation in cultures of Prorocentrum micans (Dinophyta)

    Energy Technology Data Exchange (ETDEWEB)

    Kayser, H.; Sperling, K.R.

    1980-01-01

    Effects and accumulation of cadmium were studied in 10-l batch-culture experiments with the dinoflagellate Prorocentrum micans Ehrenberg. Tests were made using sterile filtered North Sea water enriched with nitrate and phosphate only in order to avoid disturbances by complex formation. Cadmium was added to the cultures in amounts of 100 to 0.13 ..mu..g l/sup -1/. In one series it was added at the start of the experiments and in a second one after a growth period of 1 week. Addition of only 1.2 ..mu..g Cd l/sup -1/ reduces multiplication rates and maximum cell densities of the algae. Not until 0.4 ..mu..g Cd l/sup -1/ does growth correspond to that of the controls. Cadmium concentrations were measured, after filtration, in the culture medium and the biomass by means of flameless AAS. The cadmium content in algae increased from 2.7 ..mu..g g/sup -1/ (dry weight) in controls to 500 ..mu..g g/sup -1/ (dry weight) in media containing 100 ..mu..g Cd l/sup -1/. Uptake occurred rapidly during the first few days of the experiments, slowed down somewhat during exponential growth stage, and increased during decay of the cultures. Cadmium content of culture media remained nearly constant or decreased only slowly during experimental time. The highest concentration factor was measured in the controls. It decreased with increasing metal concentration in the medium and increased with experimental time. Structural modifications of the cells were visible after Lugol fixation only, indicating brittleness of the cell walls. P. micans has shown to be extremely sensitive to cadmium and to accumulate this metal.

  16. Lead and Cadmium Content of Korbal Rice in Northern Iran

    Directory of Open Access Journals (Sweden)

    A Bakhtiarian

    2001-09-01

    Full Text Available Every year the entrance of factory wastes such as Shiraz Petrochemical Complex, Marvdasht sugar cube factory, and Charmineh factory, and other industrial units into the Kor and Sivand rivers and also the entrance of the Marvdasht and Zarghan city sewer system wastes into the Kor river and the use of their water in the cultivation of the rice has caused a significant increase in the lead and cadmium content of the grains of rice. To study the effect of the Kor river's pollution on the lead and cadmium content of the Korbal rice samples. The results of the study show that the lead and cadmium content of the grains of rice, 57 samples of 6 different types of rice were prepared in 19 different stations in Korbal region and also 18 samples of 6 different types of rice, cultivated with unpolluted water, were prepared in the National Institute of Rice Research (Gilan. A comparison of the pollution level of the Korbal and Gilan rice samples shows a significant difference and indicates the significant effect of the pollution of the river on the lead and cadmium content of the Korbal rice samples. The results of the study show that the lead and cadmium content of the hybrid, prolific, and late rice sample types were greater than that of unprolific and early types, such that the amount of these two elements were highest in the Hassani type (the lead content was 0.9625 ppm and the cadmium content was 0.0793 ppm, whereas the Gasroddashti type which blooms earlier and is long seeded has the lowest amount of these two elements.

  17. Cadmium toxicity to ringed seals (Phoca hispida): an epidemiological study of possible cadmium-induced nephropathy and osteodystrophy in ringed seals (Phoca hispida) from Qaanaaq in Northwest Greenland

    DEFF Research Database (Denmark)

    Sonne-Hansen, C; Dietz, R; Leifsson, P S;

    2002-01-01

    . Experience from cadmium-poisoned humans and laboratory mammals indicates that concentrations above 50-200 microg/g wet wt. may induce histopathological changes. Overall, 31 of the ringed seals had cadmium concentrations in the kidney cortex above 50 microg/g wet wt., 11 had concentrations above 100 and one......The Greenland marine food chains contain high levels of cadmium, mercury and selenium. Concentrations of cadmium in the kidney of ringed seals (Phoca hispida) from the municipalities of Qaanaaq and Upernavik (Northwest Greenland) are among the highest recorded in the Arctic. The purpose...... of the study was to determine whether cadmium-induced damage in the kidneys and the skeletal system could be detected among 100 ringed seals from Northwest Greenland. The cadmium concentrations in the kidney cortex ranged from 0 to 248 microg/g wet weight (mean=44.5, N=100) in the 99 kidneys examined...

  18. Effect of pH on cadmium biosorption by coconut copra meal

    International Nuclear Information System (INIS)

    Biosorption of cadmium ion by coconut copra meal, an agricultural waste product was investigated as a function of initial solution pH and initial cadmium concentration. Pseudo-second-order kinetic analyses were performed to determine the rate constant of biosorption, the equilibrium capacity, and initial biosorption rate. Cadmium biosorption by copra meal was found to be dependent on the initial solution pH and initial cadmium concentration. Ion exchange occurred in the initial biosorption period. In addition, mathematical relationships were drawn to relate the change in the solution hydrogen ion concentration with equilibrium biosorption capacity, initial cadmium concentration, and equilibrium biosorption capacity

  19. Contribution of an Auxin to the Uptake of Nickel and Cadmium in Maize Seedlings

    Institute of Scientific and Technical Information of China (English)

    GUO DONG-SHENG; XI YU-YING; WANG AI-YING; ZHANG JUN; YUAN XIAO-YING

    1999-01-01

    Maize seedlings were cultured in nickel or cadmium contaminated sand treated with α-naphthylacetic acid (NAA). The effects of NAA on nickel and cadmium uptake in roots, shoots, and subcellular fractions (cell wall, nuclei and remained parts of seedling cells) were determined. The data showed growth promotion when NAA was applied at low concentrations and inhibition at high concentrations. Uptake of nickel and cadmium content increased concurrently in roots and shoots. In the subcellular fraction, nickel and cadmium was greatest in the cell wall. The changes in growth had greatest correlation with nickel and cadmium content in the subcellular fraction.

  20. Purification and characterization of a cadmium-induced metallothionein from the shore crab Carcinus maenas (L.)

    DEFF Research Database (Denmark)

    Pedersen, K L; Pedersen, S N; Højrup, P;

    1994-01-01

    Two metallothionein variants were purified from the midgut gland of crabs (Carcinus maenas) exposed to a high cadmium concentration (2 p.p.m.). One of the variants was purified from crabs exposed to a low cadmium concentration (0.5 p.p.m.). The purification method involved acetone precipitation...... from crabs exposed to the high cadmium concentration differed only by a single residue of methionine at the N-terminus. The single variant isolated from crabs exposed to the low cadmium concentration was the one without the N-terminal methionine, indicating that high cadmium concentrations either...

  1. Zinc-Nickel Codeposition in Sulfate Solution Combined Effect of Cadmium and Boric Acid

    Directory of Open Access Journals (Sweden)

    Y. Addi

    2011-01-01

    Full Text Available The combined effect of cadmium and boric acid on the electrodeposition of zinc-nickel from a sulfate has been investigated. The presence of cadmium ion decreases zinc in the deposit. In solution, cadmium inhibits the zinc ion deposition and suppresses it when deposition potential value is more negative than −1.2 V. Low concentration of CdSO4 reduces the anomalous nature of Zn-Ni deposit. Boric acid decreases current density and shifts potential discharge of nickel and hydrogen to more negative potential. The combination of boric acid and cadmium increases the percentage of nickel in the deposit. Boric acid and cadmium.

  2. Radiation from 170 GeV electrons and positrons traversing thin Si and Ge crystals near the <110> axis

    Energy Technology Data Exchange (ETDEWEB)

    Bak, J.F.; Moeller, S.P.; Petersen, J.B.B.; Soerensen, A.H.; Uggerhoej, E.; Barberis, D.; Elsener, K.; Brodbeck, T.J.; Newton, D.; Wilson, G.W.

    1988-10-20

    The first results from a broad angular beam experiment on emission of high-energy photons from 170 GeV electrons and positrons are presented. The targets were 0.5 mm thick Si and Ge crystals. A dramatic enhancement in the emitted radiation is found for angles of incidence close to the <110> axis. The experimental results are compared to a constant-field cascade calculation.

  3. Spectroscopic study of cadmium (II) complexes with heterocyclic dithiocarbamate ligands

    Energy Technology Data Exchange (ETDEWEB)

    Garcia-Fontan, S. (Departamento de Quimica Pura y Aplicada, Universidad de Vigo (Spain)); Rodriguez-Seoane, P. (Departamento de Quimica Pura y Aplicada, Universidad de Vigo (Spain)); Casas, J.S. (Departamento de Quimica Inorganica, Universidad de Santiago de Compostela (Spain)); Sordo, J. (Departamento de Quimica Inorganica, Universidad de Santiago de Compostela (Spain)); Jones, M.M. (Department of Chemistry and Center in Molecular Toxicology, Vanderbilt University, Nashville, TN (United States))

    1993-09-15

    Cadmium(II) dithiocarbamates Cd(dtc)[sub 2] (dtc=4-carboxamidopiperidine-1-carbodithioate, morpholine-1-carbodithioate or 4-(2-hydroxyethyl)piperazine-1-carbodithioate) and Cd(dtc)[sub 2].H[sub 2]O (dtc=4-hydroxypiperidine-1-carbodithioate)[r brace] have been prepared and characterized by thermal analysis and IR and NMR ([sup 13]C, [sup 113]Cd) spectrometry. Two of these ligands have previously been shown capable of removing cadmium from its aged in vivo storage sites. The use of solid state [sup 13]C NMR measurements to establish the coordination mode of the dithiocarbomate ligands is also examined and the difficulties which arise are discussed. (orig.)

  4. Synthesis and characterization of cadmium doped lead–borate glasses

    Indian Academy of Sciences (India)

    A A Alemi; H Sedghi; A R Mirmohseni; V Golsanamlu

    2006-02-01

    Cadmium doped lead–borate glasses were prepared from the melts in appropriate proportions of PbO2, H3BO3 and (15–40 mol%) CdO mixture in the temperature range 700–950°C. The infrared spectra of the glasses in the range 400–4000 cm-1 show their structures. No boroxol ring formation was observed in the structure of these glasses. Furthermore, doped cadmium atoms were not seen in tetrahedral coordination. But the conversion of three-fold to four-fold coordination of boron atoms in the structure of glasses was observed.

  5. Cadmium resistance from Staphylococcus aureus plasmid pI258 cadA gene results from a cadmium-efflux ATPase.

    OpenAIRE

    Nucifora, G; Chu, L; Misra, T K; Silver, S

    1989-01-01

    Cadmium resistance specified by the cadA determinant of Staphylococcus aureus plasmid pI258 results from the functioning of a cadmium-efflux system. In the nucleotide sequence of the DNA fragment containing the cadA determinant, two open reading frames were identified. The larger one, corresponding to a predicted polypeptide of 727 amino acid residues, is necessary and sufficient for expression of cadmium resistance. Comparison of the CadA amino acid sequence with known protein sequences sugg...

  6. Biosorption of cadmium by endophytic fungus (EF) Microsphaeropsis sp. LSE10 isolated from cadmium hyperaccumulator Solanum nigrum L.

    Science.gov (United States)

    Xiao, Xiao; Luo, Shenglian; Zeng, Guangming; Wei, Wanzhi; Wan, Yong; Chen, Liang; Guo, Hanjun; Cao, Zhe; Yang, Lixia; Chen, Jueliang; Xi, Qiang

    2010-03-01

    A novel technology to obtain highly efficient biosorbent from the endophytes of a hyperaccumulator is reported. This technology is more convenient than the traditional method of obtaining biosorbents by experimentally screening many types of biomass by trial and error. Using this technology, endophytic fungus (EF) LSE10 was isolated from the cadmium hyperaccumulator Solanum nigrum L. It was identified as Microsphaeropsis sp. When cultured in vitro, the biomass yield of this EF was more than twice that of none-endophytic fungus (NEF) Rhizopus cohnii. Subsequently, it was used as a biosorbent for biosorption of cadmium from the aqueous solution. The results showed that the maximum biosorption capacity was 247.5mg/g (2.2 mmol/g) which was much higher than those of other adsorbents, including biosorbents and activated carbon. Carboxyl, amino, sulphonate and hydroxyl groups on EF LSE10 surface were responsible for the biosorption of cadmium. PMID:19854641

  7. Concentration of cadmium in cacao beans and its relationship with soil cadmium in southern Ecuador

    Energy Technology Data Exchange (ETDEWEB)

    Chavez, E. [University of Florida, Institute of Food and Agricultural Science, Indian River Research and Education Center, Fort Pierce, FL 34945 (United States); Escuela Superior Politecnica del Litoral, Centro de Investigaciones Biotecnologicas del Ecuador, Guayaquil, Guayas (Ecuador); He, Z.L., E-mail: zhe@ufl.edu [University of Florida, Institute of Food and Agricultural Science, Indian River Research and Education Center, Fort Pierce, FL 34945 (United States); Stoffella, P.J. [University of Florida, Institute of Food and Agricultural Science, Indian River Research and Education Center, Fort Pierce, FL 34945 (United States); Mylavarapu, R.S. [University of Florida, Institute of Food and Agricultural Science, Soil and Water Science Department, Gainesville, FL 33611 (United States); Li, Y.C. [University of Florida, Institute of Food and Agricultural Science, Tropical Research and Education Center, Homestead, FL 33031 (United States); Moyano, B. [Escuela Superior Politecnica del Litoral, Centro de Investigaciones Biotecnologicas del Ecuador, Guayaquil, Guayas (Ecuador); Baligar, V.C. [United State Department of Agriculture, ARS, Beltsville, MD 20705 (United States)

    2015-11-15

    Cadmium (Cd) content in cacao beans above a critical level (0.6 mg kg{sup −1}) has raised concerns in the consumption of cacao-based chocolate. Little is available regarding Cd concentration in soil and cacao in Ecuador. The aim of this study was to determine the status of Cd in both, soils and cacao plants, in southern Ecuador. Soil samples were collected from 19 farms at 0–5, 5–15, 15–30, and 30–50 cm depths, whereas plant samples were taken from four nearby trees. Total recoverable and extractable Cd were measured at the different soil depths. Total recoverable Cd ranged from 0.88 to 2.45 and 0.06 to 2.59, averaged 1.54 and 0.85 mg kg{sup −1}, respectively in the surface and subsurface soils whereas the corresponding values for M3-extractable Cd were 0.08 to 1.27 and 0.02 to 0.33 with mean values of 0.40 and 0.10 mg kg{sup −1}. Surface soil in all sampling sites had total recoverable Cd above the USEPA critical level for agricultural soils (0.43 mg kg{sup −1}), indicating that Cd pollution occurs. Since both total recoverable and M3-extractable Cd significantly decreased depth wise, anthropogenic activities are more likely the source of contamination. Cadmium in cacao tissues decreased in the order of beans > shell > > leaves. Cadmium content in cacao beans ranged from 0.02 to 3.00, averaged 0.94 mg kg{sup −1}, and 12 out of 19 sites had bean Cd content above the critical level. Bean Cd concentration was highly correlated with M3- or HCl-extractable Cd at both the 0–5 and 5–15 cm depths (r = 0.80 and 0.82 for M3, and r = 0.78 and 0.82 for HCl; P < 0.01). These results indicate that accumulation of Cd in surface layers results in excessive Cd in cacao beans and M3- or HCl-extractable Cd are suitable methods for predicting available Cd in the studied soils. - Highlights: • > 60% of the studied sites had a Cd content in cacao beans above the critical level. • Bean Cd concentration was closely correlated with available Cd in soil. • Soil

  8. Concentration of cadmium in cacao beans and its relationship with soil cadmium in southern Ecuador

    International Nuclear Information System (INIS)

    Cadmium (Cd) content in cacao beans above a critical level (0.6 mg kg−1) has raised concerns in the consumption of cacao-based chocolate. Little is available regarding Cd concentration in soil and cacao in Ecuador. The aim of this study was to determine the status of Cd in both, soils and cacao plants, in southern Ecuador. Soil samples were collected from 19 farms at 0–5, 5–15, 15–30, and 30–50 cm depths, whereas plant samples were taken from four nearby trees. Total recoverable and extractable Cd were measured at the different soil depths. Total recoverable Cd ranged from 0.88 to 2.45 and 0.06 to 2.59, averaged 1.54 and 0.85 mg kg−1, respectively in the surface and subsurface soils whereas the corresponding values for M3-extractable Cd were 0.08 to 1.27 and 0.02 to 0.33 with mean values of 0.40 and 0.10 mg kg−1. Surface soil in all sampling sites had total recoverable Cd above the USEPA critical level for agricultural soils (0.43 mg kg−1), indicating that Cd pollution occurs. Since both total recoverable and M3-extractable Cd significantly decreased depth wise, anthropogenic activities are more likely the source of contamination. Cadmium in cacao tissues decreased in the order of beans > shell > > leaves. Cadmium content in cacao beans ranged from 0.02 to 3.00, averaged 0.94 mg kg−1, and 12 out of 19 sites had bean Cd content above the critical level. Bean Cd concentration was highly correlated with M3- or HCl-extractable Cd at both the 0–5 and 5–15 cm depths (r = 0.80 and 0.82 for M3, and r = 0.78 and 0.82 for HCl; P < 0.01). These results indicate that accumulation of Cd in surface layers results in excessive Cd in cacao beans and M3- or HCl-extractable Cd are suitable methods for predicting available Cd in the studied soils. - Highlights: • > 60% of the studied sites had a Cd content in cacao beans above the critical level. • Bean Cd concentration was closely correlated with available Cd in soil. • Soil Cd contamination is likely

  9. Concentration of cadmium in cacao beans and its relationship with soil cadmium in southern Ecuador.

    Science.gov (United States)

    Chavez, E; He, Z L; Stoffella, P J; Mylavarapu, R S; Li, Y C; Moyano, B; Baligar, V C

    2015-11-15

    Cadmium (Cd) content in cacao beans above a critical level (0.6 mg kg(-1)) has raised concerns in the consumption of cacao-based chocolate. Little is available regarding Cd concentration in soil and cacao in Ecuador. The aim of this study was to determine the status of Cd in both, soils and cacao plants, in southern Ecuador. Soil samples were collected from 19 farms at 0-5, 5-15, 15-30, and 30-50 cm depths, whereas plant samples were taken from four nearby trees. Total recoverable and extractable Cd were measured at the different soil depths. Total recoverable Cd ranged from 0.88 to 2.45 and 0.06 to 2.59, averaged 1.54 and 0.85 mg kg(-1), respectively in the surface and subsurface soils whereas the corresponding values for M3-extractable Cd were 0.08 to 1.27 and 0.02 to 0.33 with mean values of 0.40 and 0.10 mg kg(-1). Surface soil in all sampling sites had total recoverable Cd above the USEPA critical level for agricultural soils (0.43 mg kg(-1)), indicating that Cd pollution occurs. Since both total recoverable and M3-extractable Cd significantly decreased depth wise, anthropogenic activities are more likely the source of contamination. Cadmium in cacao tissues decreased in the order of beans>shell>leaves. Cadmium content in cacao beans ranged from 0.02 to 3.00, averaged 0.94 mg kg(-1), and 12 out of 19 sites had bean Cd content above the critical level. Bean Cd concentration was highly correlated with M3- or HCl-extractable Cd at both the 0-5 and 5-15 cm depths (r=0.80 and 0.82 for M3, and r=0.78 and 0.82 for HCl; Pbeans and M3- or HCl-extractable Cd are suitable methods for predicting available Cd in the studied soils.

  10. Cadmium potentiates toxicity of cypermethrin in zebrafish.

    Science.gov (United States)

    Yang, Ye; Ye, Xiaoqing; He, Buyuan; Liu, Jing

    2016-02-01

    Co-occurrence of pesticides such as synthetic pyrethroids and metals in aquatic ecosystems raises concerns over their combined ecological effects. Cypermethrin, 1 of the top 5 synthetic pyrethroids in use, has been extensively detected in surface water. Cadmium (Cd) has been recognized as 1 of the most toxic metals and is a common contaminant in the aquatic system. However, little information is available regarding their joint toxicity. In the present study, combined toxicity of cypermethrin and Cd and the underlying mechanisms were investigated. Zebrafish embryos and adults were exposed to the individual contaminant or binary mixtures. Co-exposure to cypermethrin and Cd produced synergistic effects on the occurrence of crooked body, pericardial edema, and noninflation of swim bladder. The addition of Cd significantly potentiated cypermethrin-induced spasms and caused more oxidative stress in zebrafish larvae. Cypermethrin-mediated induction of transcription levels and catalytic activities of cytochrome P450 (CYP) enzyme were significantly down-regulated by Cd in both zebrafish larvae and adults. Chemical analytical data showed that in vitro elimination of cypermethrin by CYP1A1 was inhibited by Cd. The addition of Cd caused an elevation of in vivo cypermethrin residue levels in the mixture-exposed adult zebrafish. These results suggest that the enhanced toxicity of cypermethrin in the presence of Cd results from the inhibitory effects of Cd on CYP-mediated biotransformation of this pesticide. The authors' findings provide a deeper understanding of the mechanistic basis accounting for the joint toxicity of cypermethrin and Cd. PMID:26267556

  11. Potentiation of cadmium nephrotoxicity by acetaminophen

    Energy Technology Data Exchange (ETDEWEB)

    Bernard, A.M.; Russis, R. de; Ouled Amor, A.; Lauwerys, R.R.

    1988-10-01

    The possible interactions between acetaminophen and cadmium (Cd) on the kidney were investigated in female Sprague-Dawley rats. Acetaminophen was administered in the food at an average dose of 900 mg/kg and Cd in drinking water at the concentration of 200 ppm. The treatment with acetaminophen and Cd lasted 2 and 10 months, respectively. No interaction between Cd and acetaminophen was observed during the period of their concomitant administration: the increase in albuminuria caused by Cd and acetaminophen was additive, while the tubular impairment caused by acetaminophen (increased ..beta../sub 2/-microglobulinuria and decreased kidney concentrating ability) was not exacerbated by Cd. None of these treatments affected the glomerular filtration rate. Four months after the end of acetaminophen treatment, the renal changes had almost completely disappeared in the rats which had received the analgesic alone. Those continously exposed to Cd had developed slight tubular damage, as evidenced by an increased urinary excretion of ..beta../sub 2/-microglobulin and ..beta..-N-acetylglucosaminidase. By contrast, rats pretreated with acetaminophen for 2 months and exposed to Cd showed a marked increase in urinary excretion of albumin and ..beta../sub 2/-microglobulin, suggesting an interaction between both treatments. At the end of the study, only the interaction with ..beta../sub 2/-microglobulin excretion was still evident; that with the urinary excretion of ..beta..-N-acetylglucosaminidase and albumin having been masked by the chronic progessive nephrosis affecting most animals at that stage. As acetaminophen had no effect on the renal accumulation of Cd, it may be concluded that pretreatment with this analygesic at a dose causing slight tubular dysfunction renders rat kidney more sensitive to the nephrotoxic action of Cd. This observation may be of clinical relevance for population groups occupationally or environmentally exposed to Cd.

  12. [Physiological response and bioaccumulation of Panax notoginseng to cadmium under hydroponic].

    Science.gov (United States)

    Li, Zi-wei; Yang, Ye; Cui, Xiu-ming; Liao, Pei-ran; Ge, Jin; Wang, Cheng-xiao; Yang, Xiao-yan; Liu, Da-hui

    2015-08-01

    The physiological response and bioaccumulation of 2-year-old Panax notoginseng to cadmium stress was investigated under a hydroponic experiment with different cadmium concentrations (0, 2.5, 5, 10 μmol · L(-1)). Result showed that low concentration (2.5 μmol · L(-1)) of cadmium could stimulate the activities of SOD, POD, APX in P. notoginseng, while high concentration (10 μmol · L(-1)) treatment made activities of antioxidant enzyme descended obviously. But, no matter how high the concentration of cadmium was, the activities of CAT were inhibited. The Pn, Tr, Gs in P. notoginseng decreased gradually with the increase of cadmium concentration, however Ci showed a trend from rise to decline. The enrichment coefficients of different parts in P. notoginseng ranked in the order of hair root > root > rhizome > leaf > stem, and all enrichment coefficients decreased with the increase of concentration of cadmium treatments; while the cadmium content in different parts of P. notoginseng and the transport coefficients rose. To sum up, cadmium could affect antioxidant enzyme system and photosynthetic system of P. notoginseng; P. notoginseng had the ability of cadmium enrichment, so we should plant it in suitable place reduce for reducing the absorption of cadmium; and choose medicinal parts properly to lessen cadmium intake. PMID:26677685

  13. Thin-film cadmium telluride photovoltaics: ES and H issues, solutions, and perspectives

    International Nuclear Information System (INIS)

    Photovoltaics (PV) is a growing business worldwide, with new technologies evolving towards potentially large-volume production. PV use produces no emissions, thus offsetting many potential environmental problems. However, the new PV technologies also bring unfamiliar environment, safety, and health (ES and H) challenges that require innovative solutions. This is a summary of the issues, solutions, and perspectives associated with the use of cadmium in one of the new and important PV technologies: thin-film, cadmium telluride (CdTe) PV, which is being developed and commercialized by several companies including Solar Cells Inc. (Toledo, Ohio), BP Solar (Fairfield, California), and Matsushita (Japan). The principal ES and H issue for thin-film cadmium telluride PV is the potential introduction of cadmium--a toxic heavy metal--into the air or water. The amount of cadmium in thin-film PV, however, is quite small--one nickel cadmium flashlight battery has about as much cadmium (7 g) as a square meter of PV module using current technology--and a typical cordless power tool will have 5--10 batteries. CdTe modules are also very well sealed, limiting the chance of release. Nonetheless, minimizing the amount of cadmium in cadmium telluride modules and preventing the introduction of that cadmium into the environment is a top priority for National Renewable Energy Laboratory researchers and cadmium telluride PV manufacturers

  14. Reduced cadmium-induced cytotoxicity in cultured liver cells following 5-azacytidine pretreatment

    Energy Technology Data Exchange (ETDEWEB)

    Waalkes, M.P.; Wilson, M.J.; Poirier, L.A.

    1985-11-01

    Recent work indicated that administration of the pyrimidine analog 5-azacytidine (AZA), either to cells in culture or to rats, results in an enhancement of expression of the metallothionein (MT) gene. Since MT is thought to play a central role in the detoxification of cadmium, the present study was designed to assess the effect of AZA pretreatment on cadmium cytotoxicity. Cultured rat liver cells in log phase of growth were first exposed to AZA (8 microM). Forty-eight hours later, cadmium was added. A modest increase in MT amounts over control was detected after AZA treatment alone. Cadmium alone resulted in a 10-fold increase in MT concentrations. The combination of AZA pretreatment followed by cadmium exposure caused a 23-fold increase in MT concentrations over control. Treatment with the DNA synthesis inhibitor hydroxyurea (HU) eliminated the enhancing effect of AZA pretreatment on cadmium induction of MT, indicating that cell division is required. AZA-pretreated cells were also harvested and incubated in suspension with cadmium for 0 to 90 min. AZA-pretreated cells showed marked reductions in cadmium-induced cytotoxicity as reflected by reduced intracellular potassium loss, glutamic-oxaloacetic transaminase loss, and lipid peroxidation following cadmium exposure. Results suggest that AZA pretreatment induces tolerance to cadmium cytotoxicity which appears to be due to an increased capacity to synthesize MT rather than high quantities of preexisting MT at the time of cadmium exposure.

  15. Reduced cadmium-induced cytotoxicity in cultured liver cells following 5-azacytidine pretreatment

    International Nuclear Information System (INIS)

    Recent work indicated that administration of the pyrimidine analog 5-azacytidine (AZA), either to cells in culture or to rats, results in an enhancement of expression of the metallothionein (MT) gene. Since MT is thought to play a central role in the detoxification of cadmium, the present study was designed to assess the effect of AZA pretreatment on cadmium cytotoxicity. Cultured rat liver cells in log phase of growth were first exposed to AZA (8 microM). Forty-eight hours later, cadmium was added. A modest increase in MT amounts over control was detected after AZA treatment alone. Cadmium alone resulted in a 10-fold increase in MT concentrations. The combination of AZA pretreatment followed by cadmium exposure caused a 23-fold increase in MT concentrations over control. Treatment with the DNA synthesis inhibitor hydroxyurea (HU) eliminated the enhancing effect of AZA pretreatment on cadmium induction of MT, indicating that cell division is required. AZA-pretreated cells were also harvested and incubated in suspension with cadmium for 0 to 90 min. AZA-pretreated cells showed marked reductions in cadmium-induced cytotoxicity as reflected by reduced intracellular potassium loss, glutamic-oxaloacetic transaminase loss, and lipid peroxidation following cadmium exposure. Results suggest that AZA pretreatment induces tolerance to cadmium cytotoxicity which appears to be due to an increased capacity to synthesize MT rather than high quantities of preexisting MT at the time of cadmium exposure

  16. Dietary intake and urinary level of cadmium and breast cancer risk: A meta-analysis.

    Science.gov (United States)

    Lin, Jinbo; Zhang, Fang; Lei, Yixiong

    2016-06-01

    Cadmium, a human carcinogenic heavy metal, has been reported to be associated with breast cancer risk; however, the results from the epidemiological studies are not always consistent. The objective of this study was to quantitatively summarize the current evidence for the relationship between cadmium exposure and breast cancer risk using meta-analysis methods. Six studies determining the dietary cadmium intake level and five studies evaluating the urinary cadmium level were identified in a systematic search of MEDLINE and PubMed databases, and the associations between these levels and breast cancer risk were analysed. The pooled estimates under the random-effects model suggested that higher urinary cadmium levels were associated with an increased risk for breast cancer (highest versus lowest quantile, pooled odds ratio [OR]=2.24, 95% confidence interval [95%CI]=1.49-3.35) and a 1μg/g creatinine increase in urinary cadmium led to a 1.02-fold increment of breast cancer (pooled OR=2.02, 95%CI=1.34-3.03); however, pooled estimates for dietary cadmium intake found no significant association between cadmium exposure and breast cancer risk (highest versus lowest quantile, pooled relative risk [RR]=1.01, 95%CI=0.89-1.15). These results suggest that cadmium exposure may lead to an increased risk of breast cancer, and urinary cadmium levels can serve as a reliable biomarker for long-term cadmium exposure and may predict the breast cancer risk.

  17. [Physiological response and bioaccumulation of Panax notoginseng to cadmium under hydroponic].

    Science.gov (United States)

    Li, Zi-wei; Yang, Ye; Cui, Xiu-ming; Liao, Pei-ran; Ge, Jin; Wang, Cheng-xiao; Yang, Xiao-yan; Liu, Da-hui

    2015-08-01

    The physiological response and bioaccumulation of 2-year-old Panax notoginseng to cadmium stress was investigated under a hydroponic experiment with different cadmium concentrations (0, 2.5, 5, 10 μmol · L(-1)). Result showed that low concentration (2.5 μmol · L(-1)) of cadmium could stimulate the activities of SOD, POD, APX in P. notoginseng, while high concentration (10 μmol · L(-1)) treatment made activities of antioxidant enzyme descended obviously. But, no matter how high the concentration of cadmium was, the activities of CAT were inhibited. The Pn, Tr, Gs in P. notoginseng decreased gradually with the increase of cadmium concentration, however Ci showed a trend from rise to decline. The enrichment coefficients of different parts in P. notoginseng ranked in the order of hair root > root > rhizome > leaf > stem, and all enrichment coefficients decreased with the increase of concentration of cadmium treatments; while the cadmium content in different parts of P. notoginseng and the transport coefficients rose. To sum up, cadmium could affect antioxidant enzyme system and photosynthetic system of P. notoginseng; P. notoginseng had the ability of cadmium enrichment, so we should plant it in suitable place reduce for reducing the absorption of cadmium; and choose medicinal parts properly to lessen cadmium intake.

  18. Ecological toxicity of reactive X-3B red dye and cadmium acting on wheat (Triticum aestivum)

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Ecological toxicity of reactive X-3B red dye and cadmium in both their single form and their combined form on wheat was studied using the experimental method of seed and root exposure. The single-factor exposure indicated that the inhibitory rate of wheat root elongation was significantly increased with the increase in the concentration of the dye in the cultural solution, although seed germination of wheat was not sensitive to the dye. The toxicity of cadmium was greatly higher than that of the dye, but low concentration cadmium (< 40 mg/L) could promote the germination of wheat seed. Interactive effects of the dye and cadmium on wheat were complicated. There was no significant correlation between the inhibitory rate of seed germination and the concentrations of the dye and cadmium. Low concentration cadmium could strengthen the toxicity of the dye acting on root elongation. On the contrary, high concentration cadmium could weaken the toxicity of the dye acting on root elongation.

  19. Dissolution ad uptake of cadmium from dental gold solder alloy implants

    International Nuclear Information System (INIS)

    Pure metallic cadmium was irradiated by means of thermal neutrons. The irradiated cadmium (115Cd) was placed in bags of gold foil and the bags were implanted subcutaneously in the neck region of mice. Two and 3 d respectively after implantation the mice were killed, the bags removed and the animals subjected to whole-body autoradiography. The autoradiograms revealed an uptake of 115Cd in liver and kidney. In another experiment specimens of a cadmium-containing dental gold solder alloy, a cadmium-free dental casting gold alloy and soldered assemblies made of these two alloys were implanted subcutaneously in the neck region of mice. The animals were killed after 6 months; cadmium analysis showed significant increases in the cadmium concentration in liver and kidney of those mice which had been given implants of gold solder alloy. The study clearly shows that due to electrochemical corrosion cadmium can be released from implants and accumulated in the kidneys and the liver. (author)

  20. A New Klebsiella planticola Strain (Cd-1) Grows Anaerobically at High Cadmium Concentrations and Precipitates Cadmium Sulfide

    OpenAIRE

    Sharma, Pramod K.; Balkwill, David L.; Frenkel, Anatoly; Vairavamurthy, Murthy A.

    2000-01-01

    Heavy metal resistance by bacteria is a topic of much importance to the bioremediation of contaminated soils and sediments. We report here the isolation of a highly cadmium-resistant Klebsiella planticola strain, Cd-1, from reducing salt marsh sediments. The strain grows in up to 15 mM CdCl2 under a wide range of NaCl concentrations and at acidic or neutral pH. In growth medium amended with thiosulfate, it precipitated significant amounts of cadmium sulfide (CdS), as confirmed by x-absorption...