WorldWideScience

Sample records for cadmium 108 target

  1. Microphthalmia-associated transcription factor as the molecular target of cadmium toxicity in human melanocytes

    Energy Technology Data Exchange (ETDEWEB)

    Chantarawong, Wipa [Department of Molecular Biology and Applied Physiology, Tohoku University School of Medicine, Sendai (Japan); Inter Departmental Multidisciplinary Graduate Program in Bioscience, Faculty of Science, Kasetsart University, Bangkok (Thailand); Takeda, Kazuhisa; Sangartit, Weerapon; Yoshizawa, Miki [Department of Molecular Biology and Applied Physiology, Tohoku University School of Medicine, Sendai (Japan); Pradermwong, Kantimanee [Department of Zoology, Faculty of Science, Kasetsart University, Bangkok (Thailand); Shibahara, Shigeki, E-mail: shibahar@med.tohoku.ac.jp [Department of Molecular Biology and Applied Physiology, Tohoku University School of Medicine, Sendai (Japan)

    2014-11-28

    Highlights: • In human melanocytes, cadmium decreases the expression of MITF-M and tyrosinase and their mRNAs. • In human melanoma cells, cadmium decreases the expression of MITF-M protein and tyrosinase mRNA. • Expression of MITF-H is less sensitive to cadmium toxicity in melanocyte-linage cells. • Cadmium does not decrease the expression of MITF-H in retinal pigment epithelial cells. • MITF-M is the molecular target of cadmium toxicity in melanocytes. - Abstract: Dietary intake of cadmium is inevitable, causing age-related increase in cadmium accumulation in many organs, including hair, choroid and retinal pigment epithelium (RPE). Cadmium has been implicated in the pathogenesis of hearing loss and macular degeneration. The functions of cochlea and retina are maintained by melanocytes and RPE, respectively, and the differentiation of these pigment cells is regulated by microphthalmia-associated transcription factor (MITF). In the present study, we explored the potential toxicity of cadmium in the cochlea and retina by using cultured human melanocytes and human RPE cell lines. MITF consists of multiple isoforms, including melanocyte-specific MITF-M and widely expressed MITF-H. Levels of MITF-M protein and its mRNA in human epidermal melanocytes and HMV-II melanoma cells were decreased significantly by cadmium. In parallel with the MITF reduction, mRNA levels of tyrosinase, the key enzyme of melanin biosynthesis that is regulated by MITF-M, were also decreased. In RPE cells, however, the levels of total MITF protein, constituting mainly MITF-H, were not decreased by cadmium. We thus identify MITF-M as the molecular target of cadmium toxicity in melanocytes, thereby accounting for the increased risk of disability from melanocyte malfunction, such as hearing and vision loss among people with elevated cadmium exposure.

  2. Microphthalmia-associated transcription factor as the molecular target of cadmium toxicity in human melanocytes

    International Nuclear Information System (INIS)

    Highlights: • In human melanocytes, cadmium decreases the expression of MITF-M and tyrosinase and their mRNAs. • In human melanoma cells, cadmium decreases the expression of MITF-M protein and tyrosinase mRNA. • Expression of MITF-H is less sensitive to cadmium toxicity in melanocyte-linage cells. • Cadmium does not decrease the expression of MITF-H in retinal pigment epithelial cells. • MITF-M is the molecular target of cadmium toxicity in melanocytes. - Abstract: Dietary intake of cadmium is inevitable, causing age-related increase in cadmium accumulation in many organs, including hair, choroid and retinal pigment epithelium (RPE). Cadmium has been implicated in the pathogenesis of hearing loss and macular degeneration. The functions of cochlea and retina are maintained by melanocytes and RPE, respectively, and the differentiation of these pigment cells is regulated by microphthalmia-associated transcription factor (MITF). In the present study, we explored the potential toxicity of cadmium in the cochlea and retina by using cultured human melanocytes and human RPE cell lines. MITF consists of multiple isoforms, including melanocyte-specific MITF-M and widely expressed MITF-H. Levels of MITF-M protein and its mRNA in human epidermal melanocytes and HMV-II melanoma cells were decreased significantly by cadmium. In parallel with the MITF reduction, mRNA levels of tyrosinase, the key enzyme of melanin biosynthesis that is regulated by MITF-M, were also decreased. In RPE cells, however, the levels of total MITF protein, constituting mainly MITF-H, were not decreased by cadmium. We thus identify MITF-M as the molecular target of cadmium toxicity in melanocytes, thereby accounting for the increased risk of disability from melanocyte malfunction, such as hearing and vision loss among people with elevated cadmium exposure

  3. Microphthalmia-associated transcription factor as the molecular target of cadmium toxicity in human melanocytes.

    Science.gov (United States)

    Chantarawong, Wipa; Takeda, Kazuhisa; Sangartit, Weerapon; Yoshizawa, Miki; Pradermwong, Kantimanee; Shibahara, Shigeki

    2014-11-28

    Dietary intake of cadmium is inevitable, causing age-related increase in cadmium accumulation in many organs, including hair, choroid and retinal pigment epithelium (RPE). Cadmium has been implicated in the pathogenesis of hearing loss and macular degeneration. The functions of cochlea and retina are maintained by melanocytes and RPE, respectively, and the differentiation of these pigment cells is regulated by microphthalmia-associated transcription factor (MITF). In the present study, we explored the potential toxicity of cadmium in the cochlea and retina by using cultured human melanocytes and human RPE cell lines. MITF consists of multiple isoforms, including melanocyte-specific MITF-M and widely expressed MITF-H. Levels of MITF-M protein and its mRNA in human epidermal melanocytes and HMV-II melanoma cells were decreased significantly by cadmium. In parallel with the MITF reduction, mRNA levels of tyrosinase, the key enzyme of melanin biosynthesis that is regulated by MITF-M, were also decreased. In RPE cells, however, the levels of total MITF protein, constituting mainly MITF-H, were not decreased by cadmium. We thus identify MITF-M as the molecular target of cadmium toxicity in melanocytes, thereby accounting for the increased risk of disability from melanocyte malfunction, such as hearing and vision loss among people with elevated cadmium exposure. PMID:25449283

  4. KE108-conjugated unimolecular micelles loaded with a novel HDAC inhibitor thailandepsin-A for targeted neuroendocrine cancer therapy.

    Science.gov (United States)

    Chen, Guojun; Jaskula-Sztul, Renata; Harrison, April; Dammalapati, Ajitha; Xu, Wenjin; Cheng, Yiqiang; Chen, Herbert; Gong, Shaoqin

    2016-08-01

    Neuroendocrine (NE) cancers can cause significant patient morbidity. Besides surgery, there are no curative treatments for NE cancers and their metastases, emphasizing the need for the development of other forms of therapy. In this study, multifunctional unimolecular micelles were developed for targeted NE cancer therapy. The unimolecular micelles were formed by multi-arm star amphiphilic block copolymer poly(amidoamine)-poly(valerolactone)-poly(ethylene glycol) conjugated with KE108 peptide and Cy5 dye (abbreviated as PAMAM-PVL-PEG-KE108/Cy5). The unimolecular micelles with a spherical core-shell structure exhibited a uniform size distribution and excellent stability. The hydrophobic drug thailandepsin-A (TDP-A), a recently discovered HDAC inhibitor, was physically encapsulated into the hydrophobic core of the micelles. KE108 peptide, a somatostatin analog possessing high affinity for all five subtypes of somatostatin receptors (SSTR 1-5), commonly overexpressed in NE cancer cells, was used for the first time as an NE cancer targeting ligand. KE108 exhibited superior targeting abilities compared to other common somatostatin analogs, such as octreotide, in NE cancer cell lines. The in vitro assays demonstrated that the TDP-A-loaded, KE108-targeted micelles exhibited the best capabilities in suppressing NE cancer cell growth. Moreover, the in vivo near-infrared fluorescence imaging on NE-tumor-bearing nude mice showed that KE108-conjugated micelles exhibited the greatest tumor accumulation due to their passive targeting and active targeting capabilities. Finally, TDP-A-loaded and KE108-conjugated micelles possessed the best anticancer efficacy without detectable systemic toxicity. Thus, these novel TDP-A-loaded and KE108-conjugated unimolecular micelles offer a promising approach for targeted NE cancer therapy. PMID:27156249

  5. Diffusion-based separation methods: dry distillation of zinc, cadmium and mercury isotopes from irradiated targets

    International Nuclear Information System (INIS)

    Diffusion-based separation methods allow the extraction of produced radionuclides with a low loss of target material, which is of special importance when enriched target material is used. We present a simple, non-destructive and rapid method to separate radioactive isotopes of IIB group elements (zinc, cadmium and mercury) from IB group metal targets irradiated with protons. Irradiated target foils were heated to a temperature 20oC below the melting point of the target material. During these conditions at least 90% of the desired radioactivity was evaporated with negligible loss of target material. Separation time was 15 min for mercury, 60 min for cadmium and 120 min for zinc. (author)

  6. Cadmium carcinogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Waalkes, Michael P

    2003-12-10

    Cadmium is a heavy metal of considerable environmental and occupational concern. Cadmium compounds are classified as human carcinogens by several regulatory agencies. The most convincing data that cadmium is carcinogenic in humans comes from studies indicating occupational cadmium exposure is associated with lung cancer. Cadmium exposure has also been linked to human prostate and renal cancer, although this linkage is weaker than for lung cancer. Other target sites of cadmium carcinogenesis in humans, such as liver, pancreas and stomach, are considered equivocal. In animals, cadmium effectively induces cancers at multiple sites and by various routes. Cadmium inhalation in rats induces pulmonary adenocarcinomas, in accord with its role in human lung cancer. Cadmium can induce tumors and/or preneoplastic lesions within the rat prostate after ingestion or injection. At relatively high doses, cadmium induces benign testicular tumors in rats, but these appear to be due to early toxic lesions and loss of testicular function, rather than from a specific carcinogenic effect of cadmium. Like many other metals, cadmium salts will induce mesenchymal tumors at the site of subcutaneous (s.c.) or intramuscular (i.m.) injections, but the human relevance of these is dubious. Other targets of cadmium in rodents include the liver, adrenal, pancreas, pituitary, and hematopoietic system. With the exception of testicular tumors in rodents, the mechanisms of cadmium carcinogenesis are poorly defined. Cadmium can cause any number of molecular lesions that would be relevant to oncogenesis in various cellular model systems. Most studies indicate cadmium is poorly mutagenic and probably acts through indirect or epigenetic mechanisms, potentially including aberrant activation of oncogenes and suppression of apoptosis.

  7. Cadmium carcinogenesis

    International Nuclear Information System (INIS)

    Cadmium is a heavy metal of considerable environmental and occupational concern. Cadmium compounds are classified as human carcinogens by several regulatory agencies. The most convincing data that cadmium is carcinogenic in humans comes from studies indicating occupational cadmium exposure is associated with lung cancer. Cadmium exposure has also been linked to human prostate and renal cancer, although this linkage is weaker than for lung cancer. Other target sites of cadmium carcinogenesis in humans, such as liver, pancreas and stomach, are considered equivocal. In animals, cadmium effectively induces cancers at multiple sites and by various routes. Cadmium inhalation in rats induces pulmonary adenocarcinomas, in accord with its role in human lung cancer. Cadmium can induce tumors and/or preneoplastic lesions within the rat prostate after ingestion or injection. At relatively high doses, cadmium induces benign testicular tumors in rats, but these appear to be due to early toxic lesions and loss of testicular function, rather than from a specific carcinogenic effect of cadmium. Like many other metals, cadmium salts will induce mesenchymal tumors at the site of subcutaneous (s.c.) or intramuscular (i.m.) injections, but the human relevance of these is dubious. Other targets of cadmium in rodents include the liver, adrenal, pancreas, pituitary, and hematopoietic system. With the exception of testicular tumors in rodents, the mechanisms of cadmium carcinogenesis are poorly defined. Cadmium can cause any number of molecular lesions that would be relevant to oncogenesis in various cellular model systems. Most studies indicate cadmium is poorly mutagenic and probably acts through indirect or epigenetic mechanisms, potentially including aberrant activation of oncogenes and suppression of apoptosis

  8. Characterization of wheat miRNAs and their target genes responsive to cadmium stress.

    Science.gov (United States)

    Qiu, ZongBo; Hai, BenZhai; Guo, JunLi; Li, YongFang; Zhang, Liang

    2016-04-01

    A increasing number of microRNAs have been shown to play important regulatory roles in plant responses to various metal stresses. However, little information about miRNAs especially miRNAs responsive to cadmium (Cd) stress is available in wheat. To investigate the role of miRNAs in responses to Cd stress, wheat seedlings were subjected to 250 μM Cd solution for 6, 12, 24 and 48 h, and analyses of morphological and physiological changes as well as the expression of five miRNAs and their corresponding targets were carried out. Our results demonstrated that miRNAs and their targets were differentially expressed in leaves and roots of wheat seedlings exposed to Cd stress. Furthermore, miR398 may involve in oxidative stress tolerance by regulating its target CSD to participate in Cd stress. Among ten miRNA-target pairs studied, nine pairs showed complex regulation relationship in leaves and roots of wheat seedlings exposed to Cd stress. These findings suggested that miRNAs are involved in the mediation of Cd stress signaling responses in wheat. The characterization of the miRNAs and the associated targets in responses to Cd exposure provides a framework for understanding the molecular mechanism of heavy metal tolerance in plants. PMID:26854408

  9. Subcellular targets of cadmium nephrotoxicity: cadmium binding to renal membrane proteins in animals with or without protective metallothionein synthesis.

    OpenAIRE

    Nordberg, G F; Jin, T; Nordberg, M.

    1994-01-01

    Nephrotoxic effects of cadmium exposure are well established in humans and experimental animals. An early manifestation of such toxicity is calciuria a few hours after injection of CdMT in rats. Protection against calciuria and other adverse effects such as proteinuria (occurring later) is offered by pretreatment with Cd, which effectively induces metallothionein synthesis. In the present experiment, one group of animals was given pretreatment with CdCl2 to induce metallothionein synthesis. T...

  10. Inhaled Cadmium Oxide Nanoparticles: Their in Vivo Fate and Effect on Target Organs

    Directory of Open Access Journals (Sweden)

    Jana Dumkova

    2016-06-01

    Full Text Available The increasing amount of heavy metals used in manufacturing equivalently increases hazards of environmental pollution by industrial products such as cadmium oxide (CdO nanoparticles. Here, we aimed to unravel the CdO nanoparticle destiny upon their entry into lungs by inhalations, with the main focus on the ultrastructural changes that the nanoparticles may cause to tissues of the primary and secondary target organs. We indeed found the CdO nanoparticles to be transported from the lungs into secondary target organs by blood. In lungs, inhaled CdO nanoparticles caused significant alterations in parenchyma tissue including hyperemia, enlarged pulmonary septa, congested capillaries, alveolar emphysema and small areas of atelectasis. Nanoparticles were observed in the cytoplasm of cells lining bronchioles, in the alveolar spaces as well as inside the membranous pneumocytes and in phagosomes of lung macrophages. Nanoparticles even penetrated through the membrane into some organelles including mitochondria and they also accumulated in the cytoplasmic vesicles. In livers, inhalation caused periportal inflammation and local hepatic necrosis. Only minor changes such as diffusely thickened filtration membrane with intramembranous electron dense deposits were observed in kidney. Taken together, inhaled CdO nanoparticles not only accumulated in lungs but they were also transported to other organs causing serious damage at tissue as well as cellular level.

  11. Inhaled Cadmium Oxide Nanoparticles: Their in Vivo Fate and Effect on Target Organs.

    Science.gov (United States)

    Dumkova, Jana; Vrlikova, Lucie; Vecera, Zbynek; Putnova, Barbora; Docekal, Bohumil; Mikuska, Pavel; Fictum, Petr; Hampl, Ales; Buchtova, Marcela

    2016-01-01

    The increasing amount of heavy metals used in manufacturing equivalently increases hazards of environmental pollution by industrial products such as cadmium oxide (CdO) nanoparticles. Here, we aimed to unravel the CdO nanoparticle destiny upon their entry into lungs by inhalations, with the main focus on the ultrastructural changes that the nanoparticles may cause to tissues of the primary and secondary target organs. We indeed found the CdO nanoparticles to be transported from the lungs into secondary target organs by blood. In lungs, inhaled CdO nanoparticles caused significant alterations in parenchyma tissue including hyperemia, enlarged pulmonary septa, congested capillaries, alveolar emphysema and small areas of atelectasis. Nanoparticles were observed in the cytoplasm of cells lining bronchioles, in the alveolar spaces as well as inside the membranous pneumocytes and in phagosomes of lung macrophages. Nanoparticles even penetrated through the membrane into some organelles including mitochondria and they also accumulated in the cytoplasmic vesicles. In livers, inhalation caused periportal inflammation and local hepatic necrosis. Only minor changes such as diffusely thickened filtration membrane with intramembranous electron dense deposits were observed in kidney. Taken together, inhaled CdO nanoparticles not only accumulated in lungs but they were also transported to other organs causing serious damage at tissue as well as cellular level. PMID:27271611

  12. Inhaled Cadmium Oxide Nanoparticles: Their in Vivo Fate and Effect on Target Organs

    Science.gov (United States)

    Dumkova, Jana; Vrlikova, Lucie; Vecera, Zbynek; Putnova, Barbora; Docekal, Bohumil; Mikuska, Pavel; Fictum, Petr; Hampl, Ales; Buchtova, Marcela

    2016-01-01

    The increasing amount of heavy metals used in manufacturing equivalently increases hazards of environmental pollution by industrial products such as cadmium oxide (CdO) nanoparticles. Here, we aimed to unravel the CdO nanoparticle destiny upon their entry into lungs by inhalations, with the main focus on the ultrastructural changes that the nanoparticles may cause to tissues of the primary and secondary target organs. We indeed found the CdO nanoparticles to be transported from the lungs into secondary target organs by blood. In lungs, inhaled CdO nanoparticles caused significant alterations in parenchyma tissue including hyperemia, enlarged pulmonary septa, congested capillaries, alveolar emphysema and small areas of atelectasis. Nanoparticles were observed in the cytoplasm of cells lining bronchioles, in the alveolar spaces as well as inside the membranous pneumocytes and in phagosomes of lung macrophages. Nanoparticles even penetrated through the membrane into some organelles including mitochondria and they also accumulated in the cytoplasmic vesicles. In livers, inhalation caused periportal inflammation and local hepatic necrosis. Only minor changes such as diffusely thickened filtration membrane with intramembranous electron dense deposits were observed in kidney. Taken together, inhaled CdO nanoparticles not only accumulated in lungs but they were also transported to other organs causing serious damage at tissue as well as cellular level. PMID:27271611

  13. Target or barrier? The cell wall of early- and later- diverging plants vs cadmium toxicity: differences in the response mechanisms

    Directory of Open Access Journals (Sweden)

    Luigi eParrotta

    2015-03-01

    Full Text Available Increasing industrialization and urbanization result in emission of pollutants in the environment including toxic heavy metals, as cadmium and lead. Among the different heavy metals contaminating the environment, cadmium raises great concern, as it is ecotoxic and as such can heavily impact ecosystems. The cell wall is the first structure of plant cells to come in contact with heavy metals. Its composition, characterized by proteins, polysaccharides and in some instances lignin and other phenolic compounds, confers the ability to bind non-covalently and/or covalently heavy metals via functional groups. A strong body of evidence in the literature has shown the role of the cell wall in heavy metal response: it sequesters heavy metals, but at the same time its synthesis and composition can be severely affected. The present review analyzes the dual property of plant cell walls, i.e. barrier and target of heavy metals, by taking Cd toxicity as example. Following a summary of the known physiological and biochemical responses of plants to Cd, the review compares the wall-related mechanisms in early- and later-diverging land plants, by considering the diversity in cell wall composition. By doing so, common as well as unique response mechanisms to metal/cadmium toxicity are identified among plant phyla and discussed. After discussing the role of hyperaccumulators’ cell walls as a particular case, the review concludes by considering important aspects for plant engineering.

  14. Ribosomal genes as early targets of cadmium-induced toxicity in Chironomus riparius larvae

    International Nuclear Information System (INIS)

    Cadmium is a widespread environmental pollutant that causes severe impacts in organisms. Although the effects of cadmium on aquatic insects have been studied in terms of their toxicity and changes in developmental parameters, little is known about its molecular and genetic effects. We have investigated the alterations in the pattern of gene expression provoked by acute exposure to cadmium in Chironomus riparius Mg. (Diptera, Chironomidae), a sentinel organism widely used in aquatic toxicity testing. The early cytotoxic effects were evaluated using immunocytochemistry and specific fluorescent probes in fourth instar larvae after 12 h of 10 mM cadmium treatments; under these conditions no significant effect on larvae mortality was detected until after 36 h of exposure. The changes in the pattern of gene expression were analysed by means of DNA/RNA hybrid antibodies in the polytene chromosomes from salivary gland cells. A decrease in the activity of the nucleolus is especially remarkable, accompanied by a significant reduction in size and the modification in nucleolar architecture, as shown by FISH. The inhibition of rDNA transcription was further evaluated by Northern blot analysis, which showed a marked decrease in the level of preribosomal rRNA (54% 45S 12 h). However, the BR genes, whose products are the giant polypeptides that constitute the silk-like secretion for constructing housing tubes, remain active. Simultaneously, decondensation and activation take place at some chromosomal regions, especially at the centromeres. The changes observed in the pattern of gene expression do not resemble those found after heat shock or other cell stressors. These data provide the first evidence that cadmium interacts with ribosomal genes and results in a drastic impairment of the functional activity of the nucleolus, an essential organelle for cellular survival. Therefore, the depletion of ribosomes would be a long-term effect of Cd-induced cellular damage. These findings may

  15. Ribosomal genes as early targets of cadmium-induced toxicity in Chironomus riparius larvae

    Energy Technology Data Exchange (ETDEWEB)

    Planello, R. [Biologia Ambiental, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, Senda del Rey 9, 28040, Madrid (Spain); Martinez-Guitarte, J.L. [Biologia Ambiental, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, Senda del Rey 9, 28040, Madrid (Spain); Morcillo, G. [Biologia Ambiental, Facultad de Ciencias, Universidad Nacional de Educacion a Distancia, Senda del Rey 9, 28040, Madrid (Spain)]. E-mail: gmorcillo@ccia.uned.es

    2007-02-01

    Cadmium is a widespread environmental pollutant that causes severe impacts in organisms. Although the effects of cadmium on aquatic insects have been studied in terms of their toxicity and changes in developmental parameters, little is known about its molecular and genetic effects. We have investigated the alterations in the pattern of gene expression provoked by acute exposure to cadmium in Chironomus riparius Mg. (Diptera, Chironomidae), a sentinel organism widely used in aquatic toxicity testing. The early cytotoxic effects were evaluated using immunocytochemistry and specific fluorescent probes in fourth instar larvae after 12 h of 10 mM cadmium treatments; under these conditions no significant effect on larvae mortality was detected until after 36 h of exposure. The changes in the pattern of gene expression were analysed by means of DNA/RNA hybrid antibodies in the polytene chromosomes from salivary gland cells. A decrease in the activity of the nucleolus is especially remarkable, accompanied by a significant reduction in size and the modification in nucleolar architecture, as shown by FISH. The inhibition of rDNA transcription was further evaluated by Northern blot analysis, which showed a marked decrease in the level of preribosomal rRNA (54% 45S 12 h). However, the BR genes, whose products are the giant polypeptides that constitute the silk-like secretion for constructing housing tubes, remain active. Simultaneously, decondensation and activation take place at some chromosomal regions, especially at the centromeres. The changes observed in the pattern of gene expression do not resemble those found after heat shock or other cell stressors. These data provide the first evidence that cadmium interacts with ribosomal genes and results in a drastic impairment of the functional activity of the nucleolus, an essential organelle for cellular survival. Therefore, the depletion of ribosomes would be a long-term effect of Cd-induced cellular damage. These findings may

  16. Production of new superheavy Z=108-114 nuclei with $^{238}$U, $^{244}$Pu and $^{248,250}$Cm targets

    CERN Document Server

    Feng, Zhao-Qing; Li, Jun-Qing

    2009-01-01

    Within the framework of the dinuclear system (DNS) model, production cross sections of new superheavy nuclei with charged numbers Z=108-114 are analyzed systematically. Possible combinations based on the actinide nuclides $^{238}$U, $^{244}$Pu and $^{248,250}$Cm with the optimal excitation energies and evaporation channels are pointed out to synthesize new isotopes which lie between the nuclides produced in the cold fusion and the $^{48}$Ca induced fusion reactions experimentally, which are feasible to be constructed experimentally. It is found that the production cross sections of superheavy nuclei decrease drastically with the charged numbers of compound nuclei. Larger mass asymmetries of the entrance channels enhance the cross sections in 2n-5n channels.

  17. Developments of 207Pb, 208Pb and 209Bi target wheels in the synthesis of 107Ns, 108Hs and 109Mt

    International Nuclear Information System (INIS)

    The developments of 207Pb, 208Pb and 209Bi target wheels and their applications in heavy-ion fusion reactions are reviewed. In both, fabrication and use, the centers of the evaporator or accelerator beams are focussed at wheel radii of 155 mm to specially shaped frames which generate very homogeneous target layers and very constant reaction and counting rates in the experiment. Target areas of up to ∼98% of a wheel's circumference of 974 mm can be provided. The preparation procedures for necessary C backings and protecting layers of C are described, and details are given for the developments of high-vacuum evaporations of 207Pb, 208Pb and 209Bi with deposition yields of 35-55% from tantalum crucibles. The applications of the target wheels in heavy-ion fusion reactions with beams of 54Cr and 58Fe at energies near the Coulomb barrier and intensities of ∼1012 particles/s are mentioned. The target parameters for the production runs of the new chemical elements 107Ns, 108Hs and 109Mt are included. (orig.)

  18. Celastrol prevents cadmium-induced neuronal cell death via targeting JNK and PTEN-Akt/mTOR network.

    Science.gov (United States)

    Chen, Sujuan; Gu, Chenjian; Xu, Chong; Zhang, Jinfei; Xu, Yijiao; Ren, Qian; Guo, Min; Huang, Shile; Chen, Long

    2014-01-01

    Cadmium (Cd), a toxic environmental contaminant, induces neurodegenerative diseases. Celastrol, a plant-derived triterpene, has shown neuroprotective effects in various disease models. However, little is known regarding the effect of celastrol on Cd-induced neurotoxicity. Here, we show that celastrol protected against Cd-induced apoptotic cell death in neuronal cells. This is supported by the findings that celastrol strikingly attenuated Cd-induced viability reduction, morphological change, nuclear fragmentation, and condensation, as well as activation of caspase-3 in neuronal cells. Concurrently, celastrol remarkably blocked Cd-induced phosphorylation of c-Jun N-terminal kinase (JNK), but not extracellular signal-regulated kinases 1/2 and p38, in neuronal cells. Inhibition of JNK by SP600125 or over-expression of dominant negative c-Jun potentiated celastrol protection against Cd-induced cell death. Furthermore, pre-treatment with celastrol prevented Cd down-regulation of phosphatase and tensin homolog deleted on chromosome 10 (PTEN) and activation of phosphoinositide 3'-kinase/protein kinase B (Akt)/mammalian target of rapamycin (mTOR) signaling in neuronal cells. Over-expression of wild-type PTEN enhanced celastrol inhibition of Cd-activated Akt/mTOR signaling and cell death in neuronal cells. The findings indicate that celastrol prevents Cd-induced neuronal cell death via targeting JNK and PTEN-Akt/mTOR network. Our results strongly suggest that celastrol may be exploited for the prevention of Cd-induced neurodegenerative disorders. Celastrol, a plant-derived triterpene, has shown neuroprotective effects. However, little is known regarding the effect of celastrol on cadmium (Cd) neurotoxicity. This study underscores that celastrol prevents Cd-induced neuronal apoptosis via inhibiting activation of JNK (c-Jun N-terminal kinase) and Akt/mTOR network. Celastrol suppresses Cd-activated Akt/mTOR pathway by elevating PTEN (phosphatase and tensin homolog). The

  19. Separation of no-carrier-added 113,117mSn and 113m,114mIn from alpha particle irradiated natural cadmium target

    International Nuclear Information System (INIS)

    A natural cadmium foil was irradiated by 42 MeV α-particles to produce 113,117mSn, 111,113m,114mIn simultaneously in the target matrix. After the complete decay of short lived radionuclides, long-lived NCA products were separated sequentially from the bulk cadmium by liquid-liquid extraction using di-(2-ethylhexyl)phosphoric acid (HDEHP) dissolved in cyclohexane as organic phase and HCl as aqueous phase. At the optimum condition, 10-2 M HCl and 5 % HDEHP, NCA In along with NCA Sn radionuclides (75 %) were separated from the bulk Cd resulting to high separation factors of 2.7 x 104 (DIn/DCd) and 500 (DSn/DCd), respectively. The NCA In was stripped back completely to the aqueous phase by 6 M HCl leaving NCA Sn in the HDEHP phase with a separation factor (DSn/DIn) of 3.94 x 106. (author)

  20. Application of multiwalled carbon nanotubes treated by potassium permanganate for determination of trace cadmium prior to flame atomic absorption spectrometry

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    In this study we investigated the enrichment ability of oxidized multiwalled carbon nanotubes (MWCNTs) and established a new method for the determination of trace cadmium in environment with flame atomic absorption spectrometry. The MWCNTs were oxidized by potassium permanganate under appropriate conditions before use as preconcentration packing. Parameters influencing the recoveries of target analytes were optimized. Under optimal conditions, the target analyte exhibited a good linearity (R2=0.9992)over the concentration range 0.5-50 ng/ml. The detection limit and precision of the proposed method were 0.15 ng/ml and 2.06%,respectively. The proposed method was applied to the determination of cadmium in real-world environmental samples and the recoveries were in the range of 91.3%-108.0%. All these experimental results indicated that this new procedure could be applied to the determination of trace cadmium in environmental waters.

  1. To problem about construction of cyclotron target for bombardment of metal zinc and cadmium targets on exterior beams of the accelerator U-120

    International Nuclear Information System (INIS)

    Full text: Industrial intrusion of diffusion-and-thermal methods of radionuclides separation it is impossible at use of traditional targets representing a Cu or Ag substrate, on which the starting isotopic enriched material is marked. For embodying these technologies it is necessary to modify a target so that completely to eliminate an opportunity of a physicochemical interaction (diffusion, alloy building) labilized material and target radionuclide with a substrate in requirements of heightened temperatures. One of the possible solutions of this problem - manufacture of substrates of cyclotron targets from high-melting inert materials. For the bombardment of metal Zn or Cd metal targets (production of 67Ga and 111In, basic medical radionuclides) on the on exterior beam of the accelerators U-120 designed the cyclotron target, where as a bottom for drawing a isotopic enriched materials will be utilized a tantalic substrate by a diameter of 28 mm and depth 750 microns. At centre of a substrate are made a dimple by a diameter 16 mm, where (from a melt) are superimposed metal Zn or Cd. For heat removal during bombardment: a) on the part of a tantalic substrate the target is washed by water, b) for refrigerating a obverse surface of a target the gaseous He will be utilized. The evaluation calculations are carried out: a) of the basic characteristics of a helium heat exchanger (for dissecting away of irradiated target from volume of the accelerator the titanium metal foil by depth 50 μm will be utilized), b) of strength of a Ta substrate (will be utilized at pressure of 'frigorific' water 0.5 MPa), c) of operating temperatures of a substrate and targets (Zn or Cd) at the bombardment by their of beams of deuterons (energy - 13/0 Me V, peak current of beam - 20 μA). Is ro tined, that the optimum interval of values of pressures of helium compounds 25-32 mm Hg; the build-up of pressure of helium gives in linear magnification of voltages and down stroke of ultimate strength

  2. Mercury, cadmium and lead contamination in seafood: a comparative study to evaluate the usefulness of Target Hazard Quotients.

    Science.gov (United States)

    Petroczi, A; Naughton, D P

    2009-02-01

    The aim of this paper is to explore the applicability of Target Hazard Quotient (THQ) estimations to inform on seafood hazards through metal contamination. The food recall data set was collated by the Laboratory of the Government Chemist (LGC, UK) over the period from January to November 2007. Pearson chi-square goodness of fit test, nonparametric correlation (Kendall tau) and Kruskal-Wallis test were used. Descriptive statistics and statistical analyses were computed by using Excel and SPSS 15.0. The vast majority of food alerts/recalls owing to metal contamination occur in seafood and during the summer months. Only swordfish and shark containing produce received over 10 recalls which were mainly for mercury contamination. Seafood produce originating from only 3 countries had over 10 recalls owing to metal contamination (Spain 50; France 11 and Indonesia 11). Based upon the food alert/recall system, the application of THQ estimations of risk in cases of metal contamination of seafood is questionable as THQ implies frequent if not daily exposure over a lifetime. Infrequent recalls owing to metal contamination and the absence of patterns make it highly unlikely that an individual would be subject to multiple exposures to significant levels of metal ions in seafood. PMID:19041361

  3. Reviews of the environmental effects of pollutants: IV. Cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Hammons, A.S.; Huff, J.E.; Braunstein, H.M.; Drury, J.S.; Shriner, C.R.; Lewis, E.B.; Whitfield, B.L.; Towill, L.E.

    1978-06-01

    This report is a comprehensive, multidisciplinary review of the health and environmental effects of cadmium and specific cadmium derivatives. More than 500 references are cited. The cadmium body burden in animals and humans results mainly from the diet. In the United States, the normal intake of cadmium for adult humans is estimated at about 50 ..mu..g per day. Tobacco smoke is a significant additional source of cadmium exposure. The kidneys and liver together contain about 50% of the total cadmium body burden. Acute cadmium poisoning is primarily an occupational problem, generally from inhalation of cadmium fumes or dusts. In the general population, incidents of acute poisoning by inhaled or ingested cadmium or its compounds are relatively rare. The kidney is the primary target organ for toxicity from prolonged low-level exposure to cadmium. No causal relationship has been established between cadmium exposure and human cancer, although a possible link between cadmium and prostate cancer has been indicated. Cadmium has been shown to be teratogenic in rats, hamsters, and mice, but no such effects have been proven in humans. Cadmium has been reported to increase the frequency of chromosomal aberrations in cultured Chinese hamster ovary cells and in human peripheral leukocytes. The major concern about environmental cadmium is the potential effects on the general population. There is no substantial evidence of hazard from current levels of cadmium in air, water, or food. However, because cadmium is a cumulative poison and because present intake provides a relatively small safety margin, there are adequate reasons for concern over possible future increases in background levels.

  4. Reviews of the environmental effects of pollutants: IV. Cadmium

    International Nuclear Information System (INIS)

    This report is a comprehensive, multidisciplinary review of the health and environmental effects of cadmium and specific cadmium derivatives. More than 500 references are cited. The cadmium body burden in animals and humans results mainly from the diet. In the United States, the normal intake of cadmium for adult humans is estimated at about 50 μg per day. Tobacco smoke is a significant additional source of cadmium exposure. The kidneys and liver together contain about 50% of the total cadmium body burden. Acute cadmium poisoning is primarily an occupational problem, generally from inhalation of cadmium fumes or dusts. In the general population, incidents of acute poisoning by inhaled or ingested cadmium or its compounds are relatively rare. The kidney is the primary target organ for toxicity from prolonged low-level exposure to cadmium. No causal relationship has been established between cadmium exposure and human cancer, although a possible link between cadmium and prostate cancer has been indicated. Cadmium has been shown to be teratogenic in rats, hamsters, and mice, but no such effects have been proven in humans. Cadmium has been reported to increase the frequency of chromosomal aberrations in cultured Chinese hamster ovary cells and in human peripheral leukocytes. The major concern about environmental cadmium is the potential effects on the general population. There is no substantial evidence of hazard from current levels of cadmium in air, water, or food. However, because cadmium is a cumulative poison and because present intake provides a relatively small safety margin, there are adequate reasons for concern over possible future increases in background levels

  5. On the mechanism of cadmium toxicity: Suppression of mitochondrial respiration by an organic complex of cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Korotkov, S.M.; Rozengart, E.V.; Suvorov, A.A.; Nesterov, V.P.; Khovanskikh, A.E. [Setchenow Institute of Evolutionary Physiology and Biochemistry, St. Petersburg (Russian Federation)

    1994-09-01

    Mitochondria are the main targets of the deleterious effect of cadmium. It was found that 94% of cadmium in mitochondria exists as a soluble complex with low-molecular-weight proteins, i.e., metallothioneins. The remaining 6% of cadmium is bound to protein structures of the mitochondrial matrix and, thereby cause the dysfunction of subcellular organelles in vivo. The mechanism of direct interaction of cadmium with the target protein is unknown; however, it is evident that the incorporation of cadmium into a complex with an organic ligand can significantly affect this process and eventually affect the interaction of cadmium with matrix proteins. It was of interest to compare the effects of an inorganic cadmium salt (hydrated Cd{sup 2+} cation) and an organic complex of cadmium [Cd(II)-1,3-bis-(chlorobenzylidenamino)guanidine, CBG] on rat liver mitochondrial respiration. This complex was earlier shown to display a wide range of biological activities. Particularly, it appeared to be more potent than Cd{sup 2+} in inhibiting monoamine oxidase.

  6. Cadmium chronic administration to lactating ewes. Reproductive performance, cadmium tissue accumulation and placental transfer

    Energy Technology Data Exchange (ETDEWEB)

    Floris, B.; Bomboi, G.; Sechi, P.; Marongiu, M. L. [Sassari Univ., Sassari (Italy). Dipt. di Biologia Animale; Pirino, S. [Sassari Univ., Sassari (Italy). Ist. di Patologia Generale, Anatomia Patologica e Clinica Ostetrico-chirurgica Veterinaria

    2000-12-01

    20 lactating ewes were allotted to two groups: 10 subjects received orally 100 mg/day of CdCl{sub 2} for 108 consecutive days, and the remaining 10 acted as control. Reproductive performance in ewes and cadmium tissue accumulation, both in ewes and their lambs, were investigated. The results showed that in ewes: 1) the regular cadmium intestinal intake negatively influences all reproductive parameters; 2) cadmium is particularly accumulated in kidney and liver, bur also in mammary gland, although at distinctly lower level; 3) chronic administration does not increase cadmium placental transfer in lactating pregnant subjects. [Italian] 20 pecore in lattazione sono state suddivise in 2 gruppi: 10 soggetti ricevettero per os 100 mg/giorno di CdCl{sub 2} per 108 giorni consecutivi, e i restanti 10 funsero da controllo. Sono stati studiati i parametri riproduttivi delle pecore e l'accumulo di cadmio nei tessuti, sia delle pecore che dei loro agnelli. I risultati hanno mostrato che negli ovini: 1) il regolare assorbimento intestinale di cadmio influenza negativamente tutti i parametri riproduttivi; 2) il cadmio viene accumulato principalmente nei reni e nel fegato, ma anche dalla ghiandola mammaria, sebbene in misura nettamente inferiore; 3) la somministrazione cronica di cadmio nei soggetti gravidi non incrementa il suo passaggio transplacentare.

  7. The vapour pressures over saturated aqueous solutions of cadmium chloride, cadmium bromide, cadmium iodide, cadmium nitrate, and cadmium sulphate

    Energy Technology Data Exchange (ETDEWEB)

    Apelblat, Alexander [Department of Chemical Engineering, Ben Gurion University of the Negev, P.O. Box 653, Beer Sheva 84105 (Israel)]. E-mail: apelblat@bgu.ac.il; Korin, Eli [Department of Chemical Engineering, Ben Gurion University of the Negev, P.O. Box 653, Beer Sheva 84105 (Israel)

    2007-07-15

    Vapour pressures of water over saturated solutions of cadmium salts (chloride, bromide, iodide, nitrate, and sulphate) were determined over the temperature range 280 K to 322 K and compared with the literature data. The vapour pressures determined were used to obtain the water activities, osmotic coefficients and the molar enthalpies of vaporization in the (cadmium salt + water) systems.

  8. The vapour pressures over saturated aqueous solutions of cadmium chloride, cadmium bromide, cadmium iodide, cadmium nitrate, and cadmium sulphate

    International Nuclear Information System (INIS)

    Vapour pressures of water over saturated solutions of cadmium salts (chloride, bromide, iodide, nitrate, and sulphate) were determined over the temperature range 280 K to 322 K and compared with the literature data. The vapour pressures determined were used to obtain the water activities, osmotic coefficients and the molar enthalpies of vaporization in the (cadmium salt + water) systems

  9. Cadmium status in Egypt

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    It is inferred from these studies that releases of Cd are still increasing and it is recommended that measures must be taken to reduce emissions of cadmium. Any cadmium discharged into the Egyptian environment may move from one compartment to another at varying rates,resulting in an accumulation in compartments such as soils and biota. Such accumulation can be expected to increase with continued emissions,and attention should be given to all sources of cadmium, natural as well as anthropogenic especially in the industrial cities in Egypt. Cadmium present in sewage, as well as industrial effluent (also, other liquid and solid wastes) and sewage sludge will increase levels in soils and is xpected to contribute to dietary levels and body burdens. The current information indicates that such effects may have to be evaluated over long periods of time, possibly as long as 50 - 100 years.

  10. 46 CFR 108.241 - Visual aids.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Visual aids. 108.241 Section 108.241 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Construction and Arrangement Helicopter Facilities § 108.241 Visual aids. (a) Each helicopter deck must—...

  11. 13 CFR 108.100 - Business form.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Business form. 108.100 Section 108.100 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW MARKETS VENTURE CAPITAL (âNMVCâ) PROGRAM Qualifications for the NMVC Program Organizing A Nmvc Company § 108.100 Business form. A...

  12. 10 CFR 1303.108 - Fees.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Fees. 1303.108 Section 1303.108 Energy NUCLEAR WASTE TECHNICAL REVIEW BOARD PUBLIC INFORMATION AND REQUESTS § 1303.108 Fees. (a) General. The Board shall charge for processing requests the FOIA in accordance with paragraph (c) of this section, except where...

  13. 49 CFR 195.108 - External pressure.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 3 2010-10-01 2010-10-01 false External pressure. 195.108 Section 195.108... PIPELINE Design Requirements § 195.108 External pressure. Any external pressure that will be exerted on the pipe must be provided for in designing a pipeline system....

  14. 46 CFR 108.143 - Accommodation space.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Accommodation space. 108.143 Section 108.143 Shipping... EQUIPMENT Construction and Arrangement Structural Fire Protection § 108.143 Accommodation space. (a) Each corridor bulkhead in an accommodation space must be an A class or B class bulkhead except if an A...

  15. 23 CFR 500.108 - SMS.

    Science.gov (United States)

    2010-04-01

    ... NHTSA, May 1996. Available for inspection and copying as prescribed in 49 CFR part 7, appendix D. (a... 23 Highways 1 2010-04-01 2010-04-01 false SMS. 500.108 Section 500.108 Highways FEDERAL HIGHWAY... SYSTEMS Management Systems § 500.108 SMS. An SMS is a systematic process with the goal of reducing...

  16. 13 CFR 108.690 - Examinations.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Examinations. 108.690 Section 108...) PROGRAM Recordkeeping, Reporting, and Examination Requirements for NMVC Companies Examinations of Nmvc Companies by Sba for Regulatory Compliance § 108.690 Examinations. All NMVC companies must submit to...

  17. 24 CFR 908.108 - Cost.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Cost. 908.108 Section 908.108..., RENTAL VOUCHER, AND MODERATE REHABILITATION PROGRAMS § 908.108 Cost. (a) General. The costs of the... computer hardware or software, or both, the cost of contracting for those services, or the cost...

  18. 46 CFR 108.471 - Water pump.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Water pump. 108.471 Section 108.471 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Fire Extinguishing Systems Foam Extinguishing Systems § 108.471 Water pump. Each water pump in a foam...

  19. 46 CFR 108.653 - Helicopter facilities.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Helicopter facilities. 108.653 Section 108.653 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Equipment Markings and Instructions § 108.653 Helicopter facilities. (a) Each helicopter...

  20. 46 CFR 108.486 - Helicopter decks.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Helicopter decks. 108.486 Section 108.486 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Fire Extinguishing Systems Fire Protection for Helicopter Facilities § 108.486 Helicopter decks....

  1. 46 CFR 108.231 - Application.

    Science.gov (United States)

    2010-10-01

    ... GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Construction and Arrangement Helicopter Facilities § 108.231 Application. Sections 108.231 through 108.241 apply to each unit with a helicopter landing facility....

  2. 46 CFR 108.717 - Radar.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Radar. 108.717 Section 108.717 Shipping COAST GUARD... Miscellaneous Equipment § 108.717 Radar. Each self-propelled unit of 1,600 gross tons and over in ocean or coastwise service must have— (a) A marine radar system for surface navigation; and (b) Facilities on...

  3. 22 CFR 41.108 - Medical examination.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Medical examination. 41.108 Section 41.108... AND NATIONALITY ACT, AS AMENDED Application for Nonimmigrant Visa § 41.108 Medical examination. (a) Requirements for medical examination. An applicant for a nonimmigrant visa shall be required to take a...

  4. 46 CFR 108.510 - Application.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Application. 108.510 Section 108.510 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Lifesaving Equipment § 108.510 Application. (a) For the purposes of this subpart— (1) Similar stage...

  5. 46 CFR 108.209 - Hospital spaces.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Hospital spaces. 108.209 Section 108.209 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Construction and Arrangement Accommodation Spaces § 108.209 Hospital spaces. (a) Each unit carrying twelve...

  6. 7 CFR 1260.108 - United States.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1260.108 Section 1260.108 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (MARKETING AGREEMENTS... Promotion and Research Order Definitions § 1260.108 United States. United States means the 50 States and...

  7. 46 CFR 108.709 - Litter.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Litter. 108.709 Section 108.709 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Miscellaneous Equipment § 108.709 Litter. Each unit must have a litter that is— (a) Stowed in a location that...

  8. 7 CFR 1150.108 - Eligible organization.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Eligible organization. 1150.108 Section 1150.108 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... Order Definitions § 1150.108 Eligible organization. Eligible organization means any organization...

  9. 13 CFR 108.370 - Conditional approval.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Conditional approval. 108.370 Section 108.370 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW MARKETS VENTURE CAPITAL (âNMVCâ) PROGRAM Evaluation and Selection of NMVC Companies § 108.370 Conditional approval....

  10. 46 CFR 108.499 - Fire axes.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Fire axes. 108.499 Section 108.499 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Fire Extinguishing Systems Miscellaneous Firefighting Equipment § 108.499 Fire axes. Each unit must have at least...

  11. 46 CFR 108.601 - Crane design.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Crane design. 108.601 Section 108.601 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Cranes Cranes § 108.601 Crane design. (a) Each crane and crane foundation on a unit must be designed...

  12. 28 CFR 551.108 - Performance pay.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Performance pay. 551.108 Section 551.108 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Pretrial Inmates § 551.108 Performance pay. The Warden may approve a pretrial inmate for performance...

  13. 32 CFR 10.8 - Amendment.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Amendment. 10.8 Section 10.8 National Defense Department of Defense OFFICE OF THE SECRETARY OF DEFENSE MILITARY COMMISSIONS MILITARY COMMISSION INSTRUCTIONS § 10.8 Amendment. The General Counsel may issue, supplement, amend, or revoke any...

  14. 12 CFR 347.108 - Portfolio investments.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Portfolio investments. 347.108 Section 347.108 Banks and Banking FEDERAL DEPOSIT INSURANCE CORPORATION REGULATIONS AND STATEMENTS OF GENERAL POLICY INTERNATIONAL BANKING § 347.108 Portfolio investments. (a) Portfolio investments. If a bank, directly...

  15. Study on Systemic Separation of Palladium, Silver, Cadmium and Tin

    Institute of Scientific and Technical Information of China (English)

    YU; Zhen-hua; HUANG; Kun

    2013-01-01

    To accurately measure the yields of palladium,silver,cadmium and tin that generated from the fission of plutonium,radiochemical method is needed because there is much interference in using directγ-spectroscopy measurements.Usually,we want to get as much as possible the experiment data from one target,so it is required systemic separation of palladium,silver,cadmium and tin.Considering the

  16. Thermalization of 14-MeV neutrons and cadmium ratios for iodine and silver

    International Nuclear Information System (INIS)

    14-MeV neutrons from a PW5310 Philips neutron generator were moderated in paraffin and from activation of solutions of NaI and AgNO3 cadmium ratios of 128I and 108Ag were determined. Values of thermal-neutron flux at different moderating distances were also estimated. (author)

  17. Cadmium inhibits acid secretion in stimulated frog gastric mucosa

    International Nuclear Information System (INIS)

    Cadmium, a toxic environmental pollutant, affects the function of different organs such as lungs, liver and kidney. Less is known about its toxic effects on the gastric mucosa. The aim of this study was to investigate the mechanisms by which cadmium impacts on the physiology of gastric mucosa. To this end, intact amphibian mucosae were mounted in Ussing chambers and the rate of acid secretion, short circuit current (Isc), transepithelial potential (Vt) and resistance (Rt) were recorded in the continuous presence of cadmium. Addition of cadmium (20 μM to 1 mM) on the serosal but not luminal side of the mucosae resulted in inhibition of acid secretion and increase in NPPB-sensitive, chloride-dependent short circuit current. Remarkably, cadmium exerted its effects only on histamine-stimulated tissues. Experiments with TPEN, a cell-permeant chelator for heavy metals, showed that cadmium acts from the intracellular side of the acid secreting cells. Furthermore, cadmium-induced inhibition of acid secretion and increase in Isc cannot be explained by an action on: 1) H2 histamine receptor, 2) Ca2+ signalling 3) adenylyl cyclase or 4) carbonic anhydrase. Conversely, cadmium was ineffective in the presence of the H+/K+-ATPase blocker omeprazole suggesting that the two compounds likely act on the same target. Our findings suggest that cadmium affects the functionality of histamine-stimulated gastric mucosa by inhibiting the H+/K+-ATPase from the intracellular side. These data shed new light on the toxic effect of this dangerous environmental pollutant and may result in new avenues for therapeutic intervention in acute and chronic intoxication.

  18. Nephrotoxicity of cadmium & lead.

    Science.gov (United States)

    Gonick, H C

    2008-10-01

    Cadmium and lead are divalent cations with a propensity to settle in the proximal tubule of the nephron, leading to nephrotoxicity. The pathophysiological results, however, tend to diverge. Cadmium in sufficient cumulative dosage leads to the production of the Fanconi syndrome, a generalized proximal tubular reabsorptive defect thought to be related to inhibition of both ATP production and Na-K-ATPase activity. On the other hand, lead accumulation in the proximal tubule leads to hyperuricaemia and gout, presumably by inhibiting uric acid secretion, and diminished glomerular filteration rate (GFR). Fanconi syndrome is seen unusually only in children and experimental animals. Cadmium nephrotoxicity is heralded by increased excretion of beta2-microglobulin, retinol binding protein and alpha1-microglobulin, indicative of decreased proximal tubule function. Beta2-microglobulinuria is not found in lead nephropathy. In lead nephropathy albuminuria is absent or minimal whereas in cadmium nephropathy albuminuria is variable. From the standpoint of pathology, both entities are characterized by tubulointerstitial disease and fibrosis, but only early lead nephropathy is characterized by the presence of proximal tubule nuclear inclusion bodies, due to the combination of lead with a lead binding-protein. PMID:19106433

  19. 13 CFR 108.20 - Legal basis and applicability of this part 108.

    Science.gov (United States)

    2010-01-01

    ... MARKETS VENTURE CAPITAL (âNMVCâ) PROGRAM Introduction to Part 108 § 108.20 Legal basis and applicability... applicable SBA regulations, accounting guidelines and valuation guidelines for NMVC Companies, available...

  20. 13 CFR 108.110 - Qualified management.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Qualified management. 108.110 Section 108.110 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW MARKETS VENTURE CAPITAL... management. An Applicant must show, to the satisfaction of SBA, that its current or proposed management...

  1. 48 CFR 1.108 - FAR conventions.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false FAR conventions. 1.108... ACQUISITION REGULATIONS SYSTEM Purpose, Authority, Issuance 1.108 FAR conventions. The following conventions provide guidance for interpreting the FAR: (a) Words and terms. Definitions in Part 2 apply to the...

  2. 14 CFR 1213.108 - Multimedia materials.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Multimedia materials. 1213.108 Section 1213... AND INFORMATION MEDIA § 1213.108 Multimedia materials. (a) NASA's multimedia material, from all... original or duplicate files of news-oriented imagery and other digital multimedia material generated...

  3. 46 CFR 108.477 - Fire hydrants.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Fire hydrants. 108.477 Section 108.477 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT...) Each hydrant must have a combination nozzle and applicator. Fire Protection for Helicopter Facilities...

  4. 46 CFR 108.497 - Fireman's outfits.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Fireman's outfits. 108.497 Section 108.497 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND..., Marine Inspection; (b) A Type II or Type III flashlight constructed and marked in accordance with ASTM...

  5. 21 CFR 108.25 - Acidified foods.

    Science.gov (United States)

    2010-04-01

    ...-handling techniques, food protection principles, personal hygiene, plant sanitation practices, pH controls... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Acidified foods. 108.25 Section 108.25 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR...

  6. 13 CFR 108.360 - Evaluation criteria.

    Science.gov (United States)

    2010-01-01

    ... Section 108.360 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW MARKETS VENTURE CAPITAL (âNMVCâ) PROGRAM Evaluation and Selection of NMVC Companies § 108.360 Evaluation criteria. SBA will... Developmental Venture Capital investments in the LI Areas in which the Applicant intends to invest; (f)...

  7. 34 CFR 300.108 - Physical education.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 2 2010-07-01 2010-07-01 false Physical education. 300.108 Section 300.108 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF SPECIAL EDUCATION AND REHABILITATIVE SERVICES, DEPARTMENT OF EDUCATION ASSISTANCE TO STATES FOR THE EDUCATION OF CHILDREN...

  8. 24 CFR 3280.108 - Interior passage.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 5 2010-04-01 2010-04-01 false Interior passage. 3280.108 Section... DEVELOPMENT MANUFACTURED HOME CONSTRUCTION AND SAFETY STANDARDS Planning Considerations § 3280.108 Interior passage. (a) Interior doors having passage hardware without a privacy lock, or with a privacy lock...

  9. Contacting cadmium deposition from spent industrial solutions

    International Nuclear Information System (INIS)

    Cadmium metal deposition from spent industrial solutions by cadmium (2) reduction with dispersed aluminium is studied. The influence of temperature, reagent concentration and the presence of complexing agents on the yield and purity of isolated cadmium metal is examined

  10. Cadmium in Sweden - environmental risks

    Energy Technology Data Exchange (ETDEWEB)

    Parkman, H.; Iverfeldt, Aa. [Swedish Environmental Research Inst. (Sweden); Borg, H.; Lithner, G. [Stockholm Univ. (Sweden). Inst. for Applied Environmental Research

    1998-03-01

    This report aims at assessing possible effects of cadmium in the Swedish environment. Swedish soils and soft freshwater systems are, due to a generally poor buffering capacity, severely affected by acidification. In addition, the low salinity in the Baltic Sea imply a naturally poor organism structure, with some important organisms living close to their limit of physiological tolerance. Cadmium in soils is mobilized at low pH, and the availability and toxicity of cadmium in marine systems are enhanced at low salinity. The Swedish environment is therefore extra vulnerable to cadmium pollution. The average concentrations of cadmium in the forest mor layers, agricultural soils, and fresh-waters in Sweden are enhanced compared to `back-ground concentrations`, with a general increasing trend from the north to the south-west, indicating strong impact of atmospheric deposition of cadmium originating from the central parts of Europe. In Swedish sea water, total cadmium concentrations, and the fraction of bio-available `free` cadmium, generally increases with decreasing salinity. Decreased emissions of cadmium to the environment have led to decreasing atmospheric deposition during the last decade. The net accumulation of cadmium in the forest mor layer has stopped, and even started to decrease. In northern Sweden, this is due to the decreased deposition, but in southern Sweden the main reason is increased leakage of cadmium from the topsoil as a consequence of acidification. As a result, cadmium in the Swedish environments is undergoing an extended redistribution between different soil compartments, and from the soils to the aquatic systems. 90 refs, 23 figs, 2 tabs. With 3 page summary in Swedish

  11. Cadmium sulfite hexahydrate revisited

    Directory of Open Access Journals (Sweden)

    Sergio Baggio

    2008-07-01

    Full Text Available The present structural revision of the title compound, tetracadmium tetrasulfite hexahydrate, [Cd4(SO34(H2O5]·H2O, is a low-temperature upgrade (T = 100 K and R = 0.017 of the original room-temperature structure reported by Kiers & Vos [Cryst. Struct. Commun. (1978. 7, 399–403; T = 293 K and R = 0.080. The compound is a three-dimensional polymer with four independent cadmium centres, four sulfite anions and six water molecules, five of them coordinated to two cadmium centres and the remaining one an unbound solvent molecule which completes the asymmetric unit. There are two types of cadmium environment: CdO8 (through four chelating sulfite ligands and CdO6 (by way of six monocoordinated ligands. The former groups form planar arrays [parallel to (001 and separated by half a unit cell translation along c], made up of chains running along [110] and [overline{1}10], respectively. These chains are, in turn, interconnected both in an intraplanar as well as in an interplanar fashion by the latter CdO6 polyhedra into a tight three-dimensional framework. There is, in addition, an extensive network of hydrogen bonds, in which all 12 water H atoms act as donors and eight O atoms from all four sulfite groups and two water molecules act as acceptors.

  12. 13 CFR 108.200 - Adequate capital for NMVC Companies.

    Science.gov (United States)

    2010-01-01

    ... Companies. 108.200 Section 108.200 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW MARKETS VENTURE CAPITAL (âNMVCâ) PROGRAM Qualifications for the NMVC Program Capitalizing A Nmvc Company § 108.200 Adequate capital for NMVC Companies. You must meet the requirements of §§ 108.200-108.230 in order...

  13. Analysis of the swimming velocity of cadmium-stressed Daphnia magna

    International Nuclear Information System (INIS)

    The swimming velocity of the waterflea Daphnia magna is dependent on its body size. Therefore, environmental factors like toxic stress that influence growth also influence swimming velocity. An experiment was set up to test whether exposure to cadmium would reduce only growth, with a concomitant decrease in velocity, or whether it would reduce velocity below the swimming velocity of similarly-sized control animals. Daphnids were exposed for 10 days to free cadmium ion concentrations ranging from 1x10-8 to 1x10-7 M Cd2+, and body size and swimming velocity were measured every 2 days. The results showed that cadmium decreased both growth and velocity, i.e. exposed daphnids swam slower than similarly-sized control daphnids. Swimming velocity provided no indication of successful acclimation in any cadmium treatment. Food consumption and assimilation were reduced by exposure to cadmium. This reduced food intake may have, at least partially, caused the decreased growth rates. However, since reduced food intake does not affect swimming velocity, the reduced swimming velocity must be attributed to toxic effects of cadmium, other than those on food intake. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  14. Exposure to environmental levels of waterborne cadmium impacts corticosteroidogenic and metabolic capacities, and compromises secondary stressor performance in rainbow trout

    International Nuclear Information System (INIS)

    Highlights: •Low level chronic waterborne cadmium exposure did not evoke a plasma cortisol response in rainbow trout. •Chronic cadmium exposure increases liver and gill metabolic capacities. •Chronic cadmium exposure disrupts head kidney steroidogenic capacity. •Chronic cadmium exposure disrupts glucocorticoid and mineralocorticoid receptor protein expressions in target tissues. •Chronic cadmium exposure compromises physiological performances to a secondary stressor in trout. -- Abstract: The physiological responses to waterborne cadmium exposure have been well documented; however, few studies have examined animal performances at low exposure concentrations of this metal. We tested the hypothesis that longer-term exposure to low levels of cadmium will compromise the steroidogenic and metabolic capacities, and reduce the cortisol response to a secondary stressor in fish. To test this, juvenile rainbow trout (Oncorhynchus mykiss) were exposed to 0 (control), 0.75 or 2.0 μg/L waterborne cadmium in a flow-through system and were sampled at 1, 7 and 28 d of exposure. There were only very slight disturbances in basal plasma cortisol, lactate or glucose levels in response to cadmium exposure over the 28 d period. Chronic cadmium exposure significantly affected key genes involved in corticosteroidogenesis, including melanocortin 2 receptor, steroidogenic acute regulatory protein and cytochrome P450 side chain cleavage enzyme. At 28 d, the high cadmium exposure group showed a significant drop in the glucocorticoid receptor and mineralocorticoid receptor protein expressions in the liver and brain, respectively. There were also perturbations in the metabolic capacities in the liver and gill of cadmium-exposed trout. Subjecting these fish to a secondary handling disturbance led to a significant attenuation of the stressor-induced plasma cortisol, glucose and lactate levels in the cadmium groups. Collectively, although trout appears to adjust to subchronic exposure

  15. Exposure to environmental levels of waterborne cadmium impacts corticosteroidogenic and metabolic capacities, and compromises secondary stressor performance in rainbow trout

    Energy Technology Data Exchange (ETDEWEB)

    Sandhu, Navdeep [Department of Biology, University of Waterloo, Waterloo, Ontario N2L 3G1 (Canada); McGeer, James C. [Department of Biology, Wilfrid Laurier University, Waterloo, Ontario N2L 3C5 (Canada); Vijayan, Mathilakath M., E-mail: matt.vijayan@ucalgary.ca [Department of Biology, University of Waterloo, Waterloo, Ontario N2L 3G1 (Canada)

    2014-01-15

    Highlights: •Low level chronic waterborne cadmium exposure did not evoke a plasma cortisol response in rainbow trout. •Chronic cadmium exposure increases liver and gill metabolic capacities. •Chronic cadmium exposure disrupts head kidney steroidogenic capacity. •Chronic cadmium exposure disrupts glucocorticoid and mineralocorticoid receptor protein expressions in target tissues. •Chronic cadmium exposure compromises physiological performances to a secondary stressor in trout. -- Abstract: The physiological responses to waterborne cadmium exposure have been well documented; however, few studies have examined animal performances at low exposure concentrations of this metal. We tested the hypothesis that longer-term exposure to low levels of cadmium will compromise the steroidogenic and metabolic capacities, and reduce the cortisol response to a secondary stressor in fish. To test this, juvenile rainbow trout (Oncorhynchus mykiss) were exposed to 0 (control), 0.75 or 2.0 μg/L waterborne cadmium in a flow-through system and were sampled at 1, 7 and 28 d of exposure. There were only very slight disturbances in basal plasma cortisol, lactate or glucose levels in response to cadmium exposure over the 28 d period. Chronic cadmium exposure significantly affected key genes involved in corticosteroidogenesis, including melanocortin 2 receptor, steroidogenic acute regulatory protein and cytochrome P450 side chain cleavage enzyme. At 28 d, the high cadmium exposure group showed a significant drop in the glucocorticoid receptor and mineralocorticoid receptor protein expressions in the liver and brain, respectively. There were also perturbations in the metabolic capacities in the liver and gill of cadmium-exposed trout. Subjecting these fish to a secondary handling disturbance led to a significant attenuation of the stressor-induced plasma cortisol, glucose and lactate levels in the cadmium groups. Collectively, although trout appears to adjust to subchronic exposure

  16. Cadmium in blood and hypertension

    Energy Technology Data Exchange (ETDEWEB)

    Eum, Ki-Do; Lee, Mi-Sun [Department of Environmental Health, Graduate School of Public Health and Institute of Health and Environment, Seoul National University, Seoul (Korea, Republic of); Paek, Domyung [Department of Environmental Health, Graduate School of Public Health and Institute of Health and Environment, Seoul National University, Seoul (Korea, Republic of)], E-mail: paekdm@snu.ac.kr

    2008-12-15

    Objectives:: This study is to examine the effect of cadmium exposure on blood pressure in Korean general population. Methods:: The study population consisted of 958 men and 944 women who participated in the 2005 Korean National Health and Nutrition Examination Survey (KNHANES), in which blood pressure and blood cadmium were measured from each participant. Results:: The mean blood cadmium level was 1.67 {mu}g/L (median level 1.55). The prevalence of hypertension was 26.2%. The blood cadmium level was significantly higher among those subjects with hypertension than those without (mean level 1.77 versus 1.64 {mu}g/dL). After adjusting for covariates, the odds ratio of hypertension comparing the highest to the lowest tertile of cadmium in blood was 1.51 (95% confidence interval 1.13 to 2.05), and a dose-response relationship was observed. Systolic, diastolic, and mean arterial blood pressure were all positively associated with blood cadmium level, and this effect of cadmium on blood pressure was markedly stronger when the kidney function was reduced. Conclusions:: Cadmium exposures at the current level may have increased the blood pressure of Korean general population.

  17. Cadmium in blood and hypertension

    International Nuclear Information System (INIS)

    Objectives:: This study is to examine the effect of cadmium exposure on blood pressure in Korean general population. Methods:: The study population consisted of 958 men and 944 women who participated in the 2005 Korean National Health and Nutrition Examination Survey (KNHANES), in which blood pressure and blood cadmium were measured from each participant. Results:: The mean blood cadmium level was 1.67 μg/L (median level 1.55). The prevalence of hypertension was 26.2%. The blood cadmium level was significantly higher among those subjects with hypertension than those without (mean level 1.77 versus 1.64 μg/dL). After adjusting for covariates, the odds ratio of hypertension comparing the highest to the lowest tertile of cadmium in blood was 1.51 (95% confidence interval 1.13 to 2.05), and a dose-response relationship was observed. Systolic, diastolic, and mean arterial blood pressure were all positively associated with blood cadmium level, and this effect of cadmium on blood pressure was markedly stronger when the kidney function was reduced. Conclusions:: Cadmium exposures at the current level may have increased the blood pressure of Korean general population

  18. Projectbeschrijving Cadmium-informatiepunt (CIP)

    OpenAIRE

    Meijer PJ

    1989-01-01

    To minimize the use of cadmium the Central Government has decided to perform the purchase of products and materials within the Central Government as much as possible within the Draft Cadmium Decree. The activities to achieve this are as far as could be seen at the start of the project in june 1989, mentioned in this report.

  19. 29 CFR 1926.1127 - Cadmium.

    Science.gov (United States)

    2010-07-01

    ... containment of cadmium or materials containing cadmium on the site or location at which construction...) SAFETY AND HEALTH REGULATIONS FOR CONSTRUCTION Toxic and Hazardous Substances § 1926.1127 Cadmium. (a... forms, in all construction work where an employee may potentially be exposed to cadmium....

  20. Cadmium exposure in the Swedish environment

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-03-01

    This report gives a thorough description of cadmium in the Swedish environment. It comprises three parts: Cadmium in Sweden - environmental risks;, Cadmium in goods - contribution to environmental exposure;, and Cadmium in fertilizers, soil, crops and foods - the Swedish situation. Separate abstracts have been prepared for all three parts

  1. Cadmium in newborns

    OpenAIRE

    Eklund, Gunilla

    2003-01-01

    Cadmium (Cd) is a well-known nephrotoxic environmental contaminant but there are indications that the developing nervous system might be even more sensitive to Cd than the kidneys in adults. Infants are exposed to Cd from various formulas and infant diets and the gastrointestinal Cd uptake is believed to be higher in newborns than in adults. Cd levels monitored in infant foods ranged between 0.74 and 27.0 µg/kg. Cow's milk formulas had the lowest levels and cereal-based formulas had up to 21 ...

  2. Cadmium sulfite hexahydrate revisited

    OpenAIRE

    Sergio Baggio; Andrés Ibáñez; Ricardo Baggio

    2008-01-01

    The present structural revision of the title compound, tetracadmium tetrasulfite hexahydrate, [Cd4(SO3)4(H2O)5]·H2O, is a low-temperature upgrade (T = 100 K and R = 0.017) of the original room-temperature structure reported by Kiers & Vos [Cryst. Struct. Commun. (1978). 7, 399–403; T = 293 K and R = 0.080). The compound is a three-dimensional polymer with four independent cadmium centres, four sulfite anions and six water molecules, five of them coordinated to two c...

  3. Cadmium and zinc

    International Nuclear Information System (INIS)

    Cadmium and zinc are naturally occurring trace metals that are often considered together because of their close geochemical association and similarities in chemical reactivity. The loss of two electrons from an atom of Cd or Zn imparts to each an electron configuration with completely filled d orbitals; this results in a highly stable 2/sup +/ oxidation state. But Cd and Zn differ greatly in their significance to biological systems. Whereas Zn is an essential nutrient for plants, animals, and humans, Cd is best known for its toxicity to plants and as a causative agent of several disease syndromes in animals and humans

  4. Biomonitoring of cadmium in pig production

    OpenAIRE

    Lindén, Anna

    2002-01-01

    Cadmium is a nephrotoxic metal with increasing levels in arable soils. The non-smoking population is exposed to cadmium mainly from vegetable food, especially cereal products. The major part of pig feed is cereals, and accumulated cadmium in pig kidney could reflect cadmium in the local agricultural environment. In this thesis, the possibility to use pig kidney as a bioindicator of the availability of cadmium in the agricultural environment was evaluated. There were significant correlations b...

  5. RNA-Seq identifies key reproductive gene expression alterations in response to cadmium exposure.

    Science.gov (United States)

    Hu, Hanyang; Lu, Xing; Cen, Xiang; Chen, Xiaohua; Li, Feng; Zhong, Shan

    2014-01-01

    Cadmium is a common toxicant that is detrimental to many tissues. Although a number of transcriptional signatures have been revealed in different tissues after cadmium treatment, the genes involved in the cadmium caused male reproductive toxicity, and the underlying molecular mechanism remains unclear. Here we observed that the mice treated with different amount of cadmium in their rodent chow for six months exhibited reduced serum testosterone. We then performed RNA-seq to comprehensively investigate the mice testicular transcriptome to further elucidate the mechanism. Our results showed that hundreds of genes expression altered significantly in response to cadmium treatment. In particular, we found several transcriptional signatures closely related to the biological processes of regulation of hormone, gamete generation, and sexual reproduction, respectively. The expression of several testosterone synthetic key enzyme genes, such as Star, Cyp11a1, and Cyp17a1, were inhibited by the cadmium exposure. For better understanding of the cadmium-mediated transcriptional regulatory mechanism of the genes, we computationally analyzed the transcription factors binding sites and the mircoRNAs targets of the differentially expressed genes. Our findings suggest that the reproductive toxicity by cadmium exposure is implicated in multiple layers of deregulation of several biological processes and transcriptional regulation in mice. PMID:24982889

  6. RNA-Seq Identifies Key Reproductive Gene Expression Alterations in Response to Cadmium Exposure

    Directory of Open Access Journals (Sweden)

    Hanyang Hu

    2014-01-01

    Full Text Available Cadmium is a common toxicant that is detrimental to many tissues. Although a number of transcriptional signatures have been revealed in different tissues after cadmium treatment, the genes involved in the cadmium caused male reproductive toxicity, and the underlying molecular mechanism remains unclear. Here we observed that the mice treated with different amount of cadmium in their rodent chow for six months exhibited reduced serum testosterone. We then performed RNA-seq to comprehensively investigate the mice testicular transcriptome to further elucidate the mechanism. Our results showed that hundreds of genes expression altered significantly in response to cadmium treatment. In particular, we found several transcriptional signatures closely related to the biological processes of regulation of hormone, gamete generation, and sexual reproduction, respectively. The expression of several testosterone synthetic key enzyme genes, such as Star, Cyp11a1, and Cyp17a1, were inhibited by the cadmium exposure. For better understanding of the cadmium-mediated transcriptional regulatory mechanism of the genes, we computationally analyzed the transcription factors binding sites and the mircoRNAs targets of the differentially expressed genes. Our findings suggest that the reproductive toxicity by cadmium exposure is implicated in multiple layers of deregulation of several biological processes and transcriptional regulation in mice.

  7. Yeast Interacting Proteins Database: YLR108C, YLR108C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YLR108C - Protein of unknown function; green ... fluorescent protein (GFP)-fusion protein localizes ... as prey (1) YLR108C - Protein of unknown function; green ... fluorescent protein (GFP)-fusion protein localizes ... me - Bait description Protein of unknown function; green ... fluorescent protein (GFP)-fusion protein localizes ...

  8. Potentiometric titration of excess cadmium in cadmium selenide

    International Nuclear Information System (INIS)

    A simple and rapid potentiometric technique for determining excess cadmium in CdSe has been developed. Reaction with AgNO3 is used for sample treatment. Silver, formed in the AgNO3 reaction with excess Cd is determined with the help of KI. When using the given method of analysis the relative standard deviation is equal to 0.08-0.21. The real detection limit of excess cadmium is 9x10-7 g

  9. 40 CFR 108.4 - Investigation by Regional Administrator.

    Science.gov (United States)

    2010-07-01

    ... Administrator. 108.4 Section 108.4 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS EMPLOYEE PROTECTION HEARINGS § 108.4 Investigation by Regional Administrator. Upon receipt of any request meeting the requirements of § 108.3, the Regional Administrator shall conduct a full...

  10. 46 CFR 108.703 - Self-contained breathing apparatus.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Self-contained breathing apparatus. 108.703 Section 108... DESIGN AND EQUIPMENT Miscellaneous Equipment § 108.703 Self-contained breathing apparatus. (a) Each unit must be equipped with a self-contained breathing apparatus described in § 108.497(a) to use...

  11. 27 CFR 555.108 - Importation.

    Science.gov (United States)

    2010-04-01

    ... section are in addition to, and are not in lieu of, any applicable requirement under 27 CFR Part 447. (d) For additional requirements relating to the importation of plastic explosives into the United States....108 Importation. (a) Explosive materials imported or brought into the United States by a...

  12. 46 CFR 108.235 - Construction.

    Science.gov (United States)

    2010-10-01

    ... limit drop test in 14 CFR 29.725, or a load of not less than 75 percent of the helicopter maximum weight... GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Construction and Arrangement Helicopter Facilities § 108.235 Construction. (a) Each helicopter deck must...

  13. 27 CFR 9.108 - Ozark Mountain.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Ozark Mountain. 9.108... Ozark Mountain. (a) Name. The name of the viticultural area described in this section is “Ozark Mountain.” (b) Approved maps. The appropriate maps for determining the boundaries of Ozark Mountain...

  14. 46 CFR 108.447 - Piping.

    Science.gov (United States)

    2010-10-01

    ..., DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Fire Extinguishing Systems Fixed Carbon Dioxide Fire Extinguishing Systems § 108.447 Piping. (a) Each pipe, valve... inside and outside from corrosion. (d) Each CO2 system must have a pressure relief valve set to...

  15. Cadmium(2) complexes of cytosine

    International Nuclear Information System (INIS)

    Complexes of cadmium(2) with cytosine obtained from aqueous or physiological solutions at room temperature are reported. The complexes were characterized by spectroscopic, conductometric, 1H-NMR, and 13C-NMR measurements and also by thermogravimetry. (Authors)

  16. Discovery of the Cadmium Isotopes

    OpenAIRE

    Amos, S.; Thoennessen, M

    2009-01-01

    Thirty-seven cadmium isotopes have so far been observed; the discovery of these isotopes is discussed. For each isotope a brief summary of the first refereed publication, including the production and identification method, is presented.

  17. Cadmium telluride nuclear radiation detectors

    International Nuclear Information System (INIS)

    The characteristics and performance of undoped high resistivity cadmium telluride detectors are compared to chlorine lifted counters. It is shown, in particular, that Undodep CdTe is in fact aluminium doped and that compensation occurs, as an silicon or germanium, by pair and triplet formation between the group III donor and the doubly charged cadmium vacancy acceptor. Furthermore, in chlorine doped samples, the polarization effect results from the unpaired level at Esub(c)-0,6eV

  18. Speciation of Dissolved Cadmium

    DEFF Research Database (Denmark)

    Holm, Peter Engelund; Andersen, Sjur; Christensen, Thomas Højlund

    1995-01-01

    Equilibrium dialysis and ion exchange methods, as well as computer calculations (GEOCHEM), were applied for speciation of dissolved cadmium (Cd) in test solutions and leachate samples. The leachate samples originated from soil, compost, landfill waste and industrial waste. The ion exchange (IE......) method separates dissolved Cd into free divalent Cd (Cd 2+) and complexed Cd and furthermore separates the latter into the operationally defined forms: labile, slowly labile and stable complexes. The dialysis (ED) method determines high molecular weight Cd complexes (above 1000mol. wt). For both methods...... the reproducibility was good. By combining the results of the GEOCHEM calculations in terms of the inorganic complexes, and the IE results, the fractions of free and inorganically complexed Cd were estimated. The IE and ED results furthermore provided information about the organic complexes. Selected...

  19. Cadmium accumulation and depuration in Anodonta anatina exposed to cadmium chloride or cadmium-EDTA complex

    Energy Technology Data Exchange (ETDEWEB)

    Holwerda, D.A.; Hemelraad, J.; Veenhof, P.R.; Zandee, D.I.

    1988-03-01

    The authors have previously reported on the uptake and distribution of cadmium in unionids, experimentally exposed to cadmium chloride. The purpose of the present investigation was to study the effect of metal chelation on cadmium kinetics, including metal elimination in the post-exposure phase. Generally, chelation of ionic metal by natural substances like humic acids or by synthetic compounds like EDTA decreases its environmental toxicity through a diminished rate of uptake, as compared with the free ion. The influences of metal chelation on bioconcentration and on toxicity do not always run parallel. To their knowledge, there are no data on the effect of chelation on metal kinetics in freshwater clams. Data on rates of cadmium elimination from aquatic invertebrates are highly divergent, but Cd excretion is invariably found to be smaller than uptake.

  20. Lead and cadmium levels of commonly administered pediatric syrups in Nigeria: A public health concern?

    Energy Technology Data Exchange (ETDEWEB)

    Orisakwe, Orish Ebere, E-mail: eorish@aol.com [Toxicology Unit, Department of Pharmacology,College of Health Sciences, Nnamdi Azikiwe University,Nnewi Campus. P.M.B. 5001, Nnewi, Anambra State (Nigeria); Nduka, John Kanayochukwu [Environmental Chemistry and Toxicology Research Unit, Pure and Industrial Chemistry Department, Nnamdi Azikiwe University, P.M.B. 5025, Awka Anambra State (Nigeria)

    2009-11-15

    Fifty different pediatric syrups were randomly sampled from patent medicine stores and pharmaceutical shops within Awka, in Anambra State between November 2007 and May 2008. Syrups were ashed before digestion using conc. aqua regia, HCl:HNO{sub 3} (3:1) and lead and cadmium were assayed with AAS 205A. Results revealed that 60 and 98% of the sample size had lead and cadmium respectively. The lead levels ranged from 0.01 in chloroquine to 1.08 mg/l in magcid suspension. The highest level of cadmium was seen in magcid suspension with concentration of 2.45 mg/l while lowest concentration of 0.01 in emzolyn and colipan. About 41.2% of the locally made syrup had none detectable levels of lead while all the syrup had detectable levels of cadmium. Lead levels ranged from 0.01 mg/l in cadiphen manufactured in Dholka, India to 0.09 in maxiquine made in England. About 68.8% of the imported syrups of the imported syrups had non detectable levels of lead. Chloramphenicol and zentel albendazole syrups had 0.60 and 0.88 mg/l of cadmium respectively. Bellis cough syrup showed the lowest level (0.01 mg/l) of cadmium. Only erythromycin suspension representing 6.3% had non detectable level of cadmium of the imported syrups. Due to the Cd and Pb levels found, we suggest that the behaviour scenario (here, self administration without medical assistance) should be properly taken under control. Along with this, contamination sources or vulnerable practices during syrups preparation should be also assessed in a tiered approach, towards the minimization of noxious presence in syrups and the promotion of quality of Nigerian-made products.

  1. Lead and cadmium levels of commonly administered pediatric syrups in Nigeria: a public health concern?

    Science.gov (United States)

    Orisakwe, Orish Ebere; Nduka, John Kanayochukwu

    2009-11-15

    Fifty different pediatric syrups were randomly sampled from patent medicine stores and pharmaceutical shops within Awka, in Anambra State between November 2007 and May 2008. Syrups were ashed before digestion using conc. aqua regia, HCl:HNO(3) (3:1) and lead and cadmium were assayed with AAS 205A. Results revealed that 60 and 98% of the sample size had lead and cadmium respectively. The lead levels ranged from 0.01 in chloroquine to 1.08 mg/l in magcid suspension. The highest level of cadmium was seen in magcid suspension with concentration of 2.45 mg/l while lowest concentration of 0.01 in emzolyn and colipan. About 41.2% of the locally made syrup had none detectable levels of lead while all the syrup had detectable levels of cadmium. Lead levels ranged from 0.01 mg/l in cadiphen manufactured in Dholka, India to 0.09 in maxiquine made in England. About 68.8% of the imported syrups of the imported syrups had non detectable levels of lead. Chloramphenicol and zentel albendazole syrups had 0.60 and 0.88 mg/l of cadmium respectively. Bellis cough syrup showed the lowest level (0.01 mg/l) of cadmium. Only erythromycin suspension representing 6.3% had non detectable level of cadmium of the imported syrups. Due to the Cd and Pb levels found, we suggest that the behaviour scenario (here, self administration without medical assistance) should be properly taken under control. Along with this, contamination sources or vulnerable practices during syrups preparation should be also assessed in a tiered approach, towards the minimization of noxious presence in syrups and the promotion of quality of Nigerian-made products. PMID:19765804

  2. Lead and cadmium levels of commonly administered pediatric syrups in Nigeria: A public health concern?

    International Nuclear Information System (INIS)

    Fifty different pediatric syrups were randomly sampled from patent medicine stores and pharmaceutical shops within Awka, in Anambra State between November 2007 and May 2008. Syrups were ashed before digestion using conc. aqua regia, HCl:HNO3 (3:1) and lead and cadmium were assayed with AAS 205A. Results revealed that 60 and 98% of the sample size had lead and cadmium respectively. The lead levels ranged from 0.01 in chloroquine to 1.08 mg/l in magcid suspension. The highest level of cadmium was seen in magcid suspension with concentration of 2.45 mg/l while lowest concentration of 0.01 in emzolyn and colipan. About 41.2% of the locally made syrup had none detectable levels of lead while all the syrup had detectable levels of cadmium. Lead levels ranged from 0.01 mg/l in cadiphen manufactured in Dholka, India to 0.09 in maxiquine made in England. About 68.8% of the imported syrups of the imported syrups had non detectable levels of lead. Chloramphenicol and zentel albendazole syrups had 0.60 and 0.88 mg/l of cadmium respectively. Bellis cough syrup showed the lowest level (0.01 mg/l) of cadmium. Only erythromycin suspension representing 6.3% had non detectable level of cadmium of the imported syrups. Due to the Cd and Pb levels found, we suggest that the behaviour scenario (here, self administration without medical assistance) should be properly taken under control. Along with this, contamination sources or vulnerable practices during syrups preparation should be also assessed in a tiered approach, towards the minimization of noxious presence in syrups and the promotion of quality of Nigerian-made products.

  3. Zinc-induced protection against cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Early, J.L.; Schnell, R.C.

    1978-02-01

    Pretreatment of male rats with cadmium acetate potentiates the duration of hexobarbital hypnosis and inhibits the rate of hepatic microsomal drug metabolism. Pretreatment of rats with zinc acetate protects against these alterations in drug action elicited by cadmium.

  4. Bioavailability of cadmium from linseed and cocoa

    DEFF Research Database (Denmark)

    Hansen, Max; Sloth, Jens Jørgen; Rasmussen, Rie Romme

    In Denmark and EU the exposure of cadmium from food is at a level that is relatively close to the Tolerable Daily Intake (TDI). This report describes an investigation of the bioavailability of cadmium in selected food items known to contain high levels of cadmium. The purpose was to provide data ...... crushed linseed nor the intake of cocoa and chocolate....

  5. Cadmium purification and quantification using immunochromatography.

    Science.gov (United States)

    Sasaki, Kazuhiro; Yongvongsoontorn, Nunnarpas; Tawarada, Kei; Ohnishi, Yoshikazu; Arakane, Tamami; Kayama, Fujio; Abe, Kaoru; Oguma, Shinichi; Ohmura, Naoya

    2009-06-10

    One of the pathways by which cadmium enters human beings is through the consumption of agricultural products. The monitoring of cadmium has a significant role in the management of cadmium intake. Cadmium purification and quantification using immunochromatography were conducted in this study as an alternative means of cadmium analysis. The samples used in this study were rice, tomato, lettuce, garden pea, Arabidopsis thaliana (a widely used model organism for studying plants), soil, and fertilizer. The cadmium immunochromatography has been produced from the monoclonal antibody Nx2C3, which recognize the chelate form of cadmium, Cd.EDTA. The immunochromatography can be used for quantification of cadmium in a range from 0.01 to 0.1 mg/L at 20% mean coefficient of variance. A chelate column employing quaternary ammonium salts was used for the purification of cadmium from HCl extracts of samples. Recoveries of cadmium were near 100%, and the lowest recovery was 76.6% from rice leaves. The estimated cadmium concentrations from the immunochromatography procedure were evaluated by comparison with the results of instrumental analysis (ICP-AES or ICP-MS). By comparison of HCl extracts analyzed by ICP-MS and column eluates analyzed by immunochromatography of the samples, the estimated cadmium concentrations were closely similar, and their recoveries were from 98 to 116%. PMID:19489614

  6. Mechanisms of cadmium carcinogenesis

    International Nuclear Information System (INIS)

    Cadmium (Cd), a heavy metal of considerable occupational and environmental concern, has been classified as a human carcinogen by the International Agency for Research on Cancer (IARC). The carcinogenic potential of Cd as well as the mechanisms underlying carcinogenesis following exposure to Cd has been studied using in vitro cell culture and in vivo animal models. Exposure of cells to Cd results in their transformation. Administration of Cd in animals results in tumors of multiple organs/tissues. Also, a causal relationship has been noticed between exposure to Cd and the incidence of lung cancer in human. It has been demonstrated that Cd induces cancer by multiple mechanisms and the most important among them are aberrant gene expression, inhibition of DNA damage repair, induction of oxidative stress, and inhibition of apoptosis. The available evidence indicates that, perhaps, oxidative stress plays a central role in Cd carcinogenesis because of its involvement in Cd-induced aberrant gene expression, inhibition of DNA damage repair, and apoptosis.

  7. Cadmium uptake by plants

    Energy Technology Data Exchange (ETDEWEB)

    Haghiri, F.

    1973-01-01

    Absorption of /sup 115m/Cd by soybean (Gylcine max l.) plants via foliar and root systems and translocation into the seed was determined. The uptake of /sup 115m/Cd by soybeans via the root system was more efficient than that of the foliar placement. Growth and Cd concentrations of soybean and wheat (Triticum aestivum l.) tops were influenced by soil-applied Cd. In both crops, the Cd concentration of plant tops increased while yield decreased with increasing levels of applied Cd. Cadmium toxicitiy began to occur in both crops at the lowest level of soil applied Cd (2.5 ppM). With soybean plants, Cd toxicity symptoms resembled fe chlorosis. For wheat plants there were no visual symptoms other than the studied growth. The relative concentration of Cd found in several vegetable crops varied depending on the plant species. The relative Cd concentration in descending order for various vegetables was lettuce (Lactuca sativa l.) > radish top (Raphanus sativus l.) > celery stalk (Apium graveolens l.) > celery leaves greater than or equal to green pepper (Capsicum frutescens l.) > radish roots.

  8. 46 CFR 108.451 - CO2 storage.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false CO2 storage. 108.451 Section 108.451 Shipping COAST... Fire Extinguishing Systems Fixed Carbon Dioxide Fire Extinguishing Systems § 108.451 CO2 storage. (a) Except as provided in paragraph (b) of this section, each cylinder of a CO2 system must be outside...

  9. 46 CFR 108.433 - Quantity of CO2: General.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Quantity of CO2: General. 108.433 Section 108.433... Quantity of CO2: General. Each CO2 system must have enough gas to meet the quantity requirements of § 108.439 for the space requiring the greatest amount of CO2....

  10. 46 CFR 108.201 - Size of sleeping spaces.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Size of sleeping spaces. 108.201 Section 108.201... AND EQUIPMENT Construction and Arrangement Accommodation Spaces § 108.201 Size of sleeping spaces. (a) No sleeping space may berth more than four persons, except that a sleeping space for personnel...

  11. 46 CFR 108.199 - Arrangement of sleeping spaces.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Arrangement of sleeping spaces. 108.199 Section 108.199... AND EQUIPMENT Construction and Arrangement Accommodation Spaces § 108.199 Arrangement of sleeping spaces. To the extent practicable, each occupation group must be berthed together in sleeping...

  12. 12 CFR 702.108 - Risk mitigation credit.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 6 2010-01-01 2010-01-01 false Risk mitigation credit. 702.108 Section 702.108... CORRECTIVE ACTION Net Worth Classification § 702.108 Risk mitigation credit. (a) Who may apply. A credit union may apply for a risk mitigation credit if on any of the current or three preceding effective...

  13. 42 CFR 66.108 - Payments to institutions.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Payments to institutions. 66.108 Section 66.108..., TRAINING NATIONAL RESEARCH SERVICE AWARDS Direct Awards § 66.108 Payments to institutions. The institution... individual by the institution. The Secretary shall determine the amount of payments based upon...

  14. 5 CFR 185.108 - Service of complaint.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Service of complaint. 185.108 Section 185.108 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PROGRAM FRAUD CIVIL REMEDIES § 185.108 Service of complaint. (a) Service of a complaint must be made by certified...

  15. 5 CFR 180.108 - Settlement of claims.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Settlement of claims. 180.108 Section 180.108 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS EMPLOYEES' PERSONAL PROPERTY CLAIMS § 180.108 Settlement of claims. (a) Authority. Associate Directors and...

  16. 42 CFR 424.108 - Payment to a hospital.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 3 2010-10-01 2010-10-01 false Payment to a hospital. 424.108 Section 424.108... by a Nonparticipating Hospital § 424.108 Payment to a hospital. (a) Conditions for payment. Medicare pays the hospital for emergency services if the hospital— (1) Has in effect a statement of election...

  17. 13 CFR 400.108 - Restrictions on lobbying.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Restrictions on lobbying. 400.108 Section 400.108 Business Credit and Assistance EMERGENCY STEEL GUARANTEE LOAN BOARD EMERGENCY STEEL GUARANTEE LOAN PROGRAM Board Procedures § 400.108 Restrictions on lobbying. (a) No funds received through...

  18. 13 CFR 500.108 - Restrictions on lobbying.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Restrictions on lobbying. 500.108 Section 500.108 Business Credit and Assistance EMERGENCY OIL AND GAS GUARANTEED LOAN BOARD EMERGENCY OIL AND GAS GUARANTEED LOAN PROGRAM Board Procedures § 500.108 Restrictions on lobbying. (a) No...

  19. 46 CFR 108.239 - Fuel transfer equipment.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Fuel transfer equipment. 108.239 Section 108.239 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Construction and Arrangement Helicopter Facilities § 108.239 Fuel transfer equipment....

  20. 40 CFR 108.7 - Hearing before Administrator.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Hearing before Administrator. 108.7 Section 108.7 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS EMPLOYEE PROTECTION HEARINGS § 108.7 Hearing before Administrator. At his option, the Administrator...

  1. 40 CFR 600.108-78 - Analytical gases.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 29 2010-07-01 2010-07-01 false Analytical gases. 600.108-78 Section 600.108-78 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) ENERGY POLICY FUEL... Model Year Automobiles-Test Procedures § 600.108-78 Analytical gases. The analytical gases for all...

  2. 29 CFR 779.108 - Goods produced for commerce.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false Goods produced for commerce. 779.108 Section 779.108 Labor... Coverage Employees Engaged in Commerce Or in the Production of Goods for Commerce § 779.108 Goods produced for commerce. Goods are “produced for commerce” if they are “produced, manufactured, mined, handled...

  3. 46 CFR 108.210 - Hospital space not required.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Hospital space not required. 108.210 Section 108.210 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Construction and Arrangement Accommodation Spaces § 108.210 Hospital space not...

  4. 13 CFR 108.2003 - Grant issuance fee for SSBICs.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Grant issuance fee for SSBICs. 108.2003 Section 108.2003 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW MARKETS VENTURE CAPITAL (âNMVCâ) PROGRAM Requirements and Procedures for Operational Assistance Grants to NMVC Companies and SSBICs § 108.2003 Grant issuance...

  5. 13 CFR 108.2007 - Grant award to SSBICs.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Grant award to SSBICs. 108.2007 Section 108.2007 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW MARKETS VENTURE CAPITAL (âNMVCâ) PROGRAM Requirements and Procedures for Operational Assistance Grants to NMVC Companies and SSBICs § 108.2007 Grant award to SSBICs....

  6. 13 CFR 108.330 - Grant issuance fee.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Grant issuance fee. 108.330 Section 108.330 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW MARKETS VENTURE CAPITAL (âNMVCâ) PROGRAM Application and Approval Process for NMVC Company Designation § 108.330 Grant issuance fee. An Applicant must pay to SBA a...

  7. 46 CFR 108.635 - Self-contained breathing apparatus.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Self-contained breathing apparatus. 108.635 Section 108... DESIGN AND EQUIPMENT Equipment Markings and Instructions § 108.635 Self-contained breathing apparatus. Each locker or space containing self-contained breathing apparatus must be marked: “SELF...

  8. 29 CFR 825.108 - Public agency coverage.

    Science.gov (United States)

    2010-07-01

    ...) A State or a political subdivision of a State constitutes a single public agency and, therefore, a... 29 Labor 3 2010-07-01 2010-07-01 false Public agency coverage. 825.108 Section 825.108 Labor... AND MEDICAL LEAVE ACT OF 1993 Coverage Under the Family and Medical Leave Act § 825.108 Public...

  9. 7 CFR 1160.108 - Fluid milk processor.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 9 2010-01-01 2009-01-01 true Fluid milk processor. 1160.108 Section 1160.108... Order Definitions § 1160.108 Fluid milk processor. (a) Fluid milk processor means any person who... term fluid milk processor shall not include in each of the respective fiscal periods those persons...

  10. 5 CFR 950.108 - Preventing coercive activity.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 2 2010-01-01 2010-01-01 false Preventing coercive activity. 950.108 Section 950.108 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT (CONTINUED) CIVIL SERVICE... PRIVATE VOLUNTARY ORGANIZATIONS General Provisions § 950.108 Preventing coercive activity. True...

  11. 13 CFR 108.350 - Eligibility and completeness.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Eligibility and completeness. 108.350 Section 108.350 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW MARKETS VENTURE CAPITAL (âNMVCâ) PROGRAM Evaluation and Selection of NMVC Companies § 108.350 Eligibility and...

  12. 46 CFR 108.463 - Foam rate: Protein.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Foam rate: Protein. 108.463 Section 108.463 Shipping... EQUIPMENT Fire Extinguishing Systems Foam Extinguishing Systems § 108.463 Foam rate: Protein. (a) If the outlets of a protein foam extinguishing system are in a space, the foam rate at each outlet must be...

  13. 46 CFR 108.627 - Carbon dioxide alarm.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Carbon dioxide alarm. 108.627 Section 108.627 Shipping... EQUIPMENT Equipment Markings and Instructions § 108.627 Carbon dioxide alarm. Each carbon dioxide alarm must be identified by marking: “WHEN ALARM SOUNDS VACATE AT ONCE. CARBON DIOXIDE BEING RELEASED” next...

  14. 29 CFR 552.108 - Child labor provisions.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 3 2010-07-01 2010-07-01 false Child labor provisions. 552.108 Section 552.108 Labor... OF THE FAIR LABOR STANDARDS ACT TO DOMESTIC SERVICE Interpretations § 552.108 Child labor provisions. Congress made no change in section 12 as regards domestic service employees. Accordingly, the child...

  15. 46 CFR 108.707 - First aid kit.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false First aid kit. 108.707 Section 108.707 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Miscellaneous Equipment § 108.707 First aid kit. Each unit must have a first-aid kit approved by the Mine...

  16. Nickel cadmium battery expert system

    Science.gov (United States)

    1986-01-01

    The applicability of artificial intelligence methodologies for the automation of energy storage management, in this case, nickel cadmium batteries, is demonstrated. With the Hubble Space Telescope Electrical Power System (HST/EPS) testbed as the application domain, an expert system was developed which incorporates the physical characterization of the EPS, in particular, the nickel cadmium batteries, as well as the human's operational knowledge. The expert system returns not only fault diagnostics but also status and advice along with justifications and explanations in the form of decision support.

  17. Insulin Expression in Rats Exposed to Cadmium

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Objectives To investigate the effects of cadmium exposure on insulin expression in rats. Methods Eighteen adult SD assessed. The levels of cadmium and zinc in pancreas, blood and urine glucose, serum insulin and urine NAG (N-acyetyl-β-glucosaminidase) were determined. The gene expressions of metallothionein (MT) and insulin were also measured,and the oral glucose tolerance tests (OGTT) were carried out. Results The contents of cadmium in pancreas in cadmium-treated rats were higher than that in the control group, which was associated with slight increase of zinc in pancreas.not change significantly after cadmium administration, and the UNAG had no change in Cd-treated group. The gene expression the change of the expression of insulin, MT-Ⅰ and MT-Ⅱ genes. Cadmium can influence the biosynthesis of insulin, but does not induce the release of insulin. The dysfunction of pancreas occurs earlier than that of kidney after administration of cadmium.

  18. Studies of 3He Induced Nuclear Reactions on Cadmium

    International Nuclear Information System (INIS)

    Excitation functions of 3He induced nuclear reactions on natural cadmium were measured using the standard stacked foil technique and high resolution gamma ray spectroscopy. The experimental cross sections for the nuclear reactions natCd(3He,xnp )117m,g,116m115m,114m,113m,111,110m,g,109,108,107 In were measured from their threshold energy up to 27 MeV. The integral yields for some medically important products were determined. Theoretical calculations using the nuclear codes ALICE- IPPE, TAL YS, and EMPIRE-3 were used to describe the formation of these products. Theoretical and experimental results were compared with each other. K

  19. Crystal structures of human 108V and 108M catechol O-methyltransferase

    Energy Technology Data Exchange (ETDEWEB)

    Rutherford, K.; Le Trong, I.; Stenkamp, R.E.; Parson, W.W. (UWASH)

    2008-08-01

    Catechol O-methyltransferase (COMT) plays important roles in the metabolism of catecholamine neurotransmitters and catechol estrogens. The development of COMT inhibitors for use in the treatment of Parkinson's disease has been aided by crystallographic structures of the rat enzyme. However, the human and rat proteins have significantly different substrate specificities. Additionally, human COMT contains a common valine-methionine polymorphism at position 108. The methionine protein is less stable than the valine polymorph, resulting in decreased enzyme activity and protein levels in vivo. Here we describe the crystal structures of the 108V and 108M variants of the soluble form of human COMT bound with S-adenosylmethionine (SAM) and a substrate analog, 3,5-dinitrocatechol. The polymorphic residue 108 is located in the {alpha}5-{beta}3 loop, buried in a hydrophobic pocket {approx}16 {angstrom} from the SAM-binding site. The 108V and 108M structures are very similar overall [RMSD of C{sup {alpha}} atoms between two structures (C{sup {alpha}} RMSD) = 0.2 {angstrom}], and the active-site residues are superposable, in accord with the observation that SAM stabilizes 108M COMT. However, the methionine side chain is packed more tightly within the polymorphic site and, consequently, interacts more closely with residues A22 ({alpha}2) and R78 ({alpha}4) than does valine. These interactions of the larger methionine result in a 0.7-{angstrom} displacement in the backbone structure near residue 108, which propagates along {alpha}1 and {alpha}5 toward the SAM-binding site. Although the overall secondary structures of the human and rat proteins are very similar (C{sup {alpha}} RMSD = 0.4 {angstrom}), several nonconserved residues are present in the SAM-(I89M, I91M, C95Y) and catechol- (C173V, R201M, E202K) binding sites. The human protein also contains three additional solvent-exposed cysteine residues (C95, C173, C188) that may contribute to intermolecular disulfide bond

  20. Search of the first excited states 0+ of 108Cd and106Cd

    International Nuclear Information System (INIS)

    108Cd and 106Cd nuclei have been studied from the β+/EC decay of 108In and 106In using the isocele II isotope separator working on-line with the Orsay synchrocyclotron. In order to produce indium nuclei, a molten tin target is irradiated by protons (E = 200 MeV) or 3He (E = 270 MeV). The comparison of saturation activity measured after mass separation with the one measured before mass-separation has allowed us to determine the average delay-time of indium isotopes and the overall efficiency of the separator. Single γ rays, conversion electrons rays, γ-γ-t and γ-e--t coincidence measurements have been performed to build level schemes of 108Cd and 106Cd. In 108Cd, the first excited 0+ state has been established unambiguously. This state preferably decays to the 22+ and not to the 21+ as it does in the even-even neighbouring Cd nuclei. An excited 0+ state is proposed in 106Cd. These states could not be interpreted as headstate of collective band corresponding to a shape different from the ground state one. On the other hand, the model of G. Alaga (vibrator + two proton holes), as well as the IBA2 F. Iachello one seem to be able to describe the low-lying states properties. Finally, the feeding balance and the deduced log ft values have led us to discuss the possible values of the 108In and 106In isomeric state spins

  1. Cadmium in jamaican bush teas.

    Science.gov (United States)

    Hoo Fung, L A; Rattray, V R; Lalor, G C

    2014-01-01

    Samples of Jamaican plants used as bush teas were collected from households in high soil-cadmium (Cd) areas of central Jamaica and analysed by graphite furnace atomic absorption spectrophotometry for total cadmium and for cadmium extractable with a hot water brew as prepared for human consumption to determine their contribution to dietary cadmium exposure. The concentrations ranged from < 0.03 to 6.85 µg/g for total Cd, between 1 and 15% of which was extracted with a hot water brew. One cup (200 ml) of the teas examined was found to contain < 0.04-1.18 µg of Cd and would contribute 0.1-0.3 µg of Cd to a person's dietary intake. This is significantly below the provisional tolerable weekly intake (PTWI) of 7 µg Cd/kg body weight established by the World Health Organization (WHO). While this suggests that bush tea consumption does not contribute significantly to the PTWI, some of the teas examined exceed the WHO recommendation of less than 0.3 mg/kg Cd for medicinal plants. PMID:25303189

  2. Dicty_cDB: CHJ108 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available |AC116984.2 Dictyostelium discoideum chromosome 2 map 2567470-3108875 strain AX4, complete sequence. 62 3e-...uence. 38 0.006 8 AC116305 |AC116305.2 Dictyostelium discoideum chromosome 2 map 1005175-1418323 strain AX4, complete seq... reticulum 8.0 %: nuclear >> prediction for CHJ108 is exc 5' end seq. ID CHJ108F 5' end seq. >CHJ108F.Seq AT...iol.tsukuba.ac.jp/CSM/CH/CHJ1-A/CHJ108Q.Seq.d/ Representative seq. ID - (Link to Original site) Represe...ntative DNA sequence >CHJ108 (CHJ108Q) /CSM/CH/CHJ1-A/CHJ108Q.Seq.d/ ATTATTCAATTTTATTT

  3. Application of small diameter nozzles systems for cyclotron targets cooling

    International Nuclear Information System (INIS)

    In the present work estimating calculations of cadmium targets cooling conditions under proton beam irradiation are cited. Irradiation conditions and targets parameters are as follows: a) proton initial energy - 16 MeV, beam current - 20 μA; b) metallic cadmium layer thickness - 660 μm; target diameter - 9 mm, it squire - 0.64 cm2; c) vanadium substrate thickness, on which the cadmium layer is fixed - 200 μm; d) proton energy losses in the target - 15 MeV, heat release in the cadmium layer - 300 W, heat release on the target surface - 471 W·cm-2; e) proton energy losses in the substrate - 1 MeV, heat release in vanadium - 15 W. For the calculation the system of 7 nozzles was selected. It is noted, that cooling change by single jet of nozzle systems with small diameter provides to heat transfer coefficient increase and sharply reduces (into 3 times) water flow

  4. Cadmium detoxification processes in the digestive gland of cephalopods in relation to accumulated cadmium concentrations

    OpenAIRE

    Bustamante, Paco; Cosson, Richard; Gallien, Isabelle; Caurant, Florence; Miramand, Pierre

    2002-01-01

    International audience The high concentrations of cadmium recorded in the digestive gland of cephalopods from various temperate and subpolar waters suggest that these molluscs have developed efficient cadmium detoxification mechanisms. The subcellular distribution of cadmium in the digestive gland cells was investigated in seven cephalopod species from the Bay of Biscay (France) and the Faroe Islands. In most species, cadmium was mainly found in the cytosolic fraction of the digestive glan...

  5. Cadmium content of plants as affected by soil cadmium concentration

    Energy Technology Data Exchange (ETDEWEB)

    Lehoczky, E. [Pannon Univ. of Agricultural Sciences, Keszthely (Hungary); Szabados, I.; Marth, P. [Plant Health and Soil Conservation Station, Higany (Hungary)

    1996-12-31

    Pot experiments were conducted in greenhouse conditions to study the effects of increasing cadmium (Cd) levels on biomass production and Cd contents in corn, (Zea mays L.), garlic (Allium sativum L.), and spinach (Spinacia oleracea L.). Plants were grown in two soil types: Eutric cambisol soil and A gleyic luvisol soil. Spinach proved to be the most sensitive to Cd treatments as its biomass considerably decreased with the increasing Cd levels. Cadmium contents of the three crops increased with increasing levels of Cd applications. Statistical differences were observed in the Cd contents of crops depending on soil type. With the same Cd rates, Cd tissue concentration of test plants grown in the strongly acidic Gleyic luvisol soil were many times higher than that of plants grown in a neutral Eutric cambisol soil. 14 refs., 4 tabs.

  6. Cadmium-induced Cancers in Animals and in Humans

    OpenAIRE

    Huff, James; Lunn, Ruth M.; Waalkes, Michael P.; Tomatis, Lorenzo; Infante, Peter F.

    2007-01-01

    Discovered in the early 1800s, the use of cadmium and various cadmium salts started to become industrially important near the close of the 19th century, rapidly thereafter began to flourish, yet has diminished more recently. Most cadmium used in the United States is a byproduct from the smelting of zinc, lead, or copper ores, and is used to manufacture batteries. Carcinogenic activity of cadmium was discovered first in animals and only subsequently in humans. Cadmium and cadmium compounds hav...

  7. Cadmium Exposure and Pancreatic Cancer in South Louisiana

    OpenAIRE

    Luckett, Brian G.; L. Joseph Su; Rood, Jennifer C.; Elizabeth T. H. Fontham

    2012-01-01

    Cadmium has been hypothesized to be a pancreatic carcinogen. We test the hypothesis that cadmium exposure is a risk factor for pancreatic cancer with a population-based case-control study sampled from a population with persistently high rates of pancreatic cancer (south Louisiana). We tested potential dietary and nondietary sources of cadmium for their association with urinary cadmium concentrations which reflect long-term exposure to cadmium due to the accumulation of cadmium in the kidney c...

  8. Aluminium-based Coatings for Cadmium Replacement

    OpenAIRE

    Cardilli , Emanuele

    2008-01-01

    Cadmium electroplating is widely used in the aerospace industry for the corrosion protection of high strength steels. Cadmium is also used as compatible coating to reduce the galvanic corrosion generated in the assembly of components manufactured with different materials. However, environmental and safety concerns over the high toxicity of cadmium has led to the investigation of suitable replacements. Aluminium coatings are promising coatings for the replacement of electropl...

  9. Zone refining of cadmium and related characterization

    Indian Academy of Sciences (India)

    N R Munirathnam; D S Prasad; Ch Sudheer; J V Rao; T L Prakash

    2005-06-01

    We present the zone refining results of cadmium using horizontal resistive zone refiner under constant flow of moisture free hydrogen gas. The boron impurity in cadmium can be avoided using quartz (GE 214 grade) boat in lieu of high pure graphite boat. The analytical results using inductively coupled plasma optical emission spectrometry (ICPOES) show that majority of the impurities are less than the detection limits. Comparatively, zinc is the most difficult impurity element to remove in cadmium matrix by zone refining.

  10. Cadmium induces carcinogenesis in BEAS-2B cells through ROS-dependent activation of PI3K/AKT/GSK-3β/β-catenin signaling

    Energy Technology Data Exchange (ETDEWEB)

    Son, Young-Ok; Wang, Lei; Poyil, Pratheeshkumar; Budhraja, Amit; Hitron, J. Andrew; Zhang, Zhuo [Graduate Center for Toxicology, College of Medicine, University of Kentucky, Lexington, KY (United States); Lee, Jeong-Chae [Graduate Center for Toxicology, College of Medicine, University of Kentucky, Lexington, KY (United States); School of Dentistry and Institute of Oral Biosciences (BK21 program), Research Center of Bioactive Materials, Chonbuk National University, Jeonju 561-756 (Korea, Republic of); Shi, Xianglin, E-mail: xshi5@email.uky.edu [Graduate Center for Toxicology, College of Medicine, University of Kentucky, Lexington, KY (United States)

    2012-10-15

    -dependent signaling as potential therapeutic targets in cadmium carcinogenesis.

  11. Cadmium induces carcinogenesis in BEAS-2B cells through ROS-dependent activation of PI3K/AKT/GSK-3β/β-catenin signaling

    International Nuclear Information System (INIS)

    -dependent signaling as potential therapeutic targets in cadmium carcinogenesis.

  12. Cadmium-mediated disruption of cortisol biosynthesis involves suppression of corticosteroidogenic genes in rainbow trout.

    Science.gov (United States)

    Sandhu, Navdeep; Vijayan, Mathilakath M

    2011-05-01

    Cadmium is widely distributed in the aquatic environment and is toxic to fish even at sublethal concentrations. This metal is an endocrine disruptor, and one well established role in teleosts is the suppression of adrenocorticotrophic hormone (ACTH)-stimulated cortisol biosynthesis by the interrenal tissue. However the mechanism(s) leading to this steroid suppression is poorly understood. We tested the hypothesis that cadmium targets genes encoding proteins critical for corticosteroid biosynthesis, including melanocortin 2 receptor (MC2R), steroidogenic acute regulatory protein (StAR) and cytochrome P450 side chain cleavage enzyme (P450scc), in rainbow trout (Oncorhynchus mykiss). To test this, head kidney slices (containing the interrenal tissues) were incubated in vitro with cadmium chloride (0, 10, 100 and 1000nM) for 4h either in the presence or absence of ACTH (0.5IU/mL). In the unstimulated head kidney slices, cadmium exposure did not affect basal cortisol secretion and the mRNA levels of MC2R and P450scc, while StAR gene expression was significantly reduced. Cadmium exposure significantly suppressed ACTH-stimulated cortisol production in a dose-related fashion. This cadmium-mediated suppression in corticosteroidogenesis corresponded with a significant reduction in MC2R, StAR and P450scc mRNA levels in trout head kidney slices. The inhibition of ACTH-stimulated cortisol production and suppression of genes involved in corticosteroidogenesis by cadmium were completely abolished in the presence of 8-Bromo-cAMP (a cAMP analog). Overall, cadmium disrupts the expression of genes critical for corticosteroid biosynthesis in rainbow trout head kidney slices. However, the rescue of cortisol production as well as StAR and P450scc gene expressions by cAMP analog suggests that cadmium impact occurs upstream of cAMP production. We propose that MC2R signaling, the primary step in ACTH-induced cortocosteroidogenesis, is a key target for cadmium-mediated disruption of

  13. Cadmium-mediated disruption of cortisol biosynthesis involves suppression of corticosteroidogenic genes in rainbow trout

    Energy Technology Data Exchange (ETDEWEB)

    Sandhu, Navdeep [Department of Biology, University of Waterloo, 200 University Avenue West, Waterloo, Ontario N2L 3G1 (Canada); Vijayan, Mathilakath M., E-mail: mvijayan@uwaterloo.ca [Department of Biology, University of Waterloo, 200 University Avenue West, Waterloo, Ontario N2L 3G1 (Canada)

    2011-05-15

    Cadmium is widely distributed in the aquatic environment and is toxic to fish even at sublethal concentrations. This metal is an endocrine disruptor, and one well established role in teleosts is the suppression of adrenocorticotrophic hormone (ACTH)-stimulated cortisol biosynthesis by the interrenal tissue. However the mechanism(s) leading to this steroid suppression is poorly understood. We tested the hypothesis that cadmium targets genes encoding proteins critical for corticosteroid biosynthesis, including melanocortin 2 receptor (MC2R), steroidogenic acute regulatory protein (StAR) and cytochrome P450 side chain cleavage enzyme (P450scc), in rainbow trout (Oncorhynchus mykiss). To test this, head kidney slices (containing the interrenal tissues) were incubated in vitro with cadmium chloride (0, 10, 100 and 1000 nM) for 4 h either in the presence or absence of ACTH (0.5 IU/mL). In the unstimulated head kidney slices, cadmium exposure did not affect basal cortisol secretion and the mRNA levels of MC2R and P450scc, while StAR gene expression was significantly reduced. Cadmium exposure significantly suppressed ACTH-stimulated cortisol production in a dose-related fashion. This cadmium-mediated suppression in corticosteroidogenesis corresponded with a significant reduction in MC2R, StAR and P450scc mRNA levels in trout head kidney slices. The inhibition of ACTH-stimulated cortisol production and suppression of genes involved in corticosteroidogenesis by cadmium were completely abolished in the presence of 8-Bromo-cAMP (a cAMP analog). Overall, cadmium disrupts the expression of genes critical for corticosteroid biosynthesis in rainbow trout head kidney slices. However, the rescue of cortisol production as well as StAR and P450scc gene expressions by cAMP analog suggests that cadmium impact occurs upstream of cAMP production. We propose that MC2R signaling, the primary step in ACTH-induced cortocosteroidogenesis, is a key target for cadmium-mediated disruption of

  14. Cadmium-mediated disruption of cortisol biosynthesis involves suppression of corticosteroidogenic genes in rainbow trout

    International Nuclear Information System (INIS)

    Cadmium is widely distributed in the aquatic environment and is toxic to fish even at sublethal concentrations. This metal is an endocrine disruptor, and one well established role in teleosts is the suppression of adrenocorticotrophic hormone (ACTH)-stimulated cortisol biosynthesis by the interrenal tissue. However the mechanism(s) leading to this steroid suppression is poorly understood. We tested the hypothesis that cadmium targets genes encoding proteins critical for corticosteroid biosynthesis, including melanocortin 2 receptor (MC2R), steroidogenic acute regulatory protein (StAR) and cytochrome P450 side chain cleavage enzyme (P450scc), in rainbow trout (Oncorhynchus mykiss). To test this, head kidney slices (containing the interrenal tissues) were incubated in vitro with cadmium chloride (0, 10, 100 and 1000 nM) for 4 h either in the presence or absence of ACTH (0.5 IU/mL). In the unstimulated head kidney slices, cadmium exposure did not affect basal cortisol secretion and the mRNA levels of MC2R and P450scc, while StAR gene expression was significantly reduced. Cadmium exposure significantly suppressed ACTH-stimulated cortisol production in a dose-related fashion. This cadmium-mediated suppression in corticosteroidogenesis corresponded with a significant reduction in MC2R, StAR and P450scc mRNA levels in trout head kidney slices. The inhibition of ACTH-stimulated cortisol production and suppression of genes involved in corticosteroidogenesis by cadmium were completely abolished in the presence of 8-Bromo-cAMP (a cAMP analog). Overall, cadmium disrupts the expression of genes critical for corticosteroid biosynthesis in rainbow trout head kidney slices. However, the rescue of cortisol production as well as StAR and P450scc gene expressions by cAMP analog suggests that cadmium impact occurs upstream of cAMP production. We propose that MC2R signaling, the primary step in ACTH-induced cortocosteroidogenesis, is a key target for cadmium-mediated disruption of

  15. Bioavailability of cadmium from linseed and cocoa

    OpenAIRE

    Hansen, Max; Rasmussen, Rie Romme; Sloth, Jens Jørgen

    2014-01-01

    The exposure of the European population to cadmium from food is high compared with the tolerable weekly intake of 2.5 μg/kg bodyweight set by EFSA in 2009. Only few studies on the bioavailability of cadmium from different food sources has been performed but this information in very important for the food authorities in order to give correct advises to the population. The aim of this study was to investigate the bioavailability of cadmium from whole linseed, crushed linseed, cocoa and cadmium ...

  16. 46 CFR 108.697 - Buoyant work vests.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Buoyant work vests. 108.697 Section 108.697 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Miscellaneous Equipment § 108.697 Buoyant work vests. (a) Each buoyant work vest on a unit must be approved under Subpart 160.053 or...

  17. Lead and cadmium in food

    International Nuclear Information System (INIS)

    The amounts of lead and cadmium produced and processed in these days are considerable. As a result, our environment is increasingly polluted by heavy metals and industrial installations, motor vehicles or incinerating plants appear to be among the main culprits here. Air and water are the media permitting the entry of heavy metals into our natural environment where they accumulate in the soil and then gradually migrate into the plants. Their further transport in the food constitutes the third step in the environmental spread of heavy metals. The consumption of muscle and organ meats, of vegetables, fruits, canned food and drinking water is unavoidably associated with some ingestion of lead and cadmium. The degree to which they are taken up and stored in different tissues is determined by absorption properties and the nutritional state of the organism. Cadmium tends to accumulate in the kidneys, lead is mainly stored in the bones. A continuously increasing uptake finally results in health injuries that range from unspecific complaints to damaged kidneys or bones and disorders of liver function. Children and elderly people are at a particular risk here. The level of food contamination is such that screening for heavy metals must be rigorously carried out once appropriate legal thresholds have been set, which ought to be based on proven detrimental effects of lead and cadmium on our health and also take account of infants and children or any other risk groups, where particular caution must be exercised. It should be pointed out that such thresholds have so far not been determined. (orig./MG)

  18. Historical perspectives on cadmium toxicology

    International Nuclear Information System (INIS)

    The first health effects of cadmium (Cd) were reported already in 1858. Respiratory and gastrointestinal symptoms occurred among persons using Cd-containing polishing agent. The first experimental toxicological studies are from 1919. Bone effects and proteinuria in humans were reported in the 1940's. After World War II, a bone disease with fractures and severe pain, the itai-itai disease, a form of Cd-induced renal osteomalacia, was identified in Japan. Subsequently, the toxicokinetics and toxicodynamics of Cd were described including its binding to the protein metallothionein. International warnings of health risks from Cd-pollution were issued in the 1970's. Reproductive and carcinogenic effects were studied at an early stage, but a quantitative assessment of these effects in humans is still subject to considerable uncertainty. The World Health Organization in its International Program on Chemical Safety, WHO/IPCS (1992) (Cadmium. Environmental Health Criteria Document 134, IPCS. WHO, Geneva, 1-280.) identified renal dysfunction as the critical effect and a crude quantitative evaluation was presented. In the 1990's and 2000 several epidemiological studies have reported adverse health effects, sometimes at low environmental exposures to Cd, in population groups in Japan, China, Europe and USA (reviewed in other contributions to the present volume). The early identification of an important role of metallothionein in cadmium toxicology formed the basis for recent studies using biomarkers of susceptibility to development of Cd-related renal dysfunction such as gene expression of metallothionein in peripheral lymphocytes and autoantibodies against metallothionein in blood plasma. Findings in these studies indicate that very low exposure levels to cadmium may give rise to renal dysfunction among sensitive subgroups of human populations such as persons with diabetes.

  19. Cadmium accumulation by Axonopus compressus (Sw.) P. Beauv and Cyperus rotundas Linn growing in cadmium solution and cadmium-zinc contaminated soil

    OpenAIRE

    Paitip Thiravetyan; Vibol Sao; Woranan Nakbanpote

    2007-01-01

    This research investigated the phyto-remediation potentials of Cyperus rotundas Linn (Nutgrass) and Axonopus compressus (Sw.) P. Beauv (Carpetgrass) for cadmium removal from cadmium solution andcadmium-zinc contaminated soil. Plants growth in the solution showed that cadmium decreased the relative growth rate of both grasses. However, the amount of cadmium accumulated in shoot and root was increasedwith the increase in cadmium concentration and exposure time. Growth in fertile soil mixed with...

  20. Improvement of cadmium phytoremediation after soil inoculation with a cadmium-resistant Micrococcus sp.

    Science.gov (United States)

    Sangthong, Chirawee; Setkit, Kunchaya; Prapagdee, Benjaphorn

    2016-01-01

    Cadmium-resistant Micrococcus sp. TISTR2221, a plant growth-promoting bacterium, has stimulatory effects on the root lengths of Zea mays L. seedlings under toxic cadmium conditions compared to uninoculated seedlings. The performance of Micrococcus sp. TISTR2221 on promoting growth and cadmium accumulation in Z. mays L. was investigated in a pot experiment. The results indicated that Micrococcus sp. TISTR2221significantly promoted the root length, shoot length, and dry biomass of Z. mays L. transplanted in both uncontaminated and cadmium-contaminated soils. Micrococcus sp. TISTR2221 significantly increased cadmium accumulation in the roots and shoots of Z. mays L. compared to uninoculated plants. At the beginning of the planting period, cadmium accumulated mainly in the shoots. With a prolonged duration of cultivation, cadmium content increased in the roots. As expected, little cadmium was found in maize grains. Soil cadmium was significantly reduced with time, and the highest percentage of cadmium removal was found in the bacterial-inoculated Z. mays L. after transplantation for 6 weeks. We conclude that Micrococcus sp. TISTR2221 is a potent bioaugmenting agent, facilitating cadmium phytoextraction in Z. mays L. PMID:26336850

  1. Dicty_cDB: VSJ108 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VS (Link to library) VSJ108 (Link to dictyBase) - - - Contig-U15456-1 VSJ108P (Link to Original ... _1( U60995 |pid:none) Schistosoma mansoni aspartic proteinas ... 189 2e-71 protein update 2009. 3.25 PSORT psg: ...

  2. 48 CFR 37.108 - Small business Certificate of Competency.

    Science.gov (United States)

    2010-10-01

    ... of Competency. 37.108 Section 37.108 Federal Acquisition Regulations System FEDERAL ACQUISITION... business Certificate of Competency. In those service contracts for which the Government requires the highest competence obtainable, as evidenced in a solicitation by a request for a...

  3. 50 CFR 20.108 - Nontoxic shot zones.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 6 2010-10-01 2010-10-01 false Nontoxic shot zones. 20.108 Section 20.108... Nontoxic shot zones. Beginning September 1, 1991, the contiguous 48 United States, and the States of Alaska... United States, are designated for the purpose of § 20.21(j) as nontoxic shot zones for hunting...

  4. 7 CFR 3550.108 - Security requirements (loans only).

    Science.gov (United States)

    2010-01-01

    ... 7 CFR part 1927, subpart B. These requirements need not be followed for: (1) Loans where the total... 7 Agriculture 15 2010-01-01 2010-01-01 false Security requirements (loans only). 3550.108 Section... 306C Water and Waste Disposal Grants § 3550.108 Security requirements (loans only). When the...

  5. 46 CFR 108.489 - Helicopter fueling facilities.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Helicopter fueling facilities. 108.489 Section 108.489 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Fire Extinguishing Systems Fire Protection for Helicopter Facilities §...

  6. 46 CFR 108.487 - Helicopter deck fueling operations.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Helicopter deck fueling operations. 108.487 Section 108.487 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Fire Extinguishing Systems Fire Protection for Helicopter Facilities §...

  7. 46 CFR 108.223 - Guards on exposed equipment.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Guards on exposed equipment. 108.223 Section 108.223 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN... contact by personnel. Helicopter Facilities...

  8. 46 CFR 108.425 - Fire hoses and associated equipment.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Fire hoses and associated equipment. 108.425 Section 108.425 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS... oil fuel units; and (2) Helicopter decks....

  9. 7 CFR 1437.108-1437.200 - [Reserved

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false 1437.108-1437.200 Section 1437.108-1437.200 Agriculture Regulations of the Department of Agriculture (Continued) COMMODITY CREDIT CORPORATION, DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS NONINSURED CROP DISASTER ASSISTANCE...

  10. 33 CFR 100.108 - Great Kennebec River Whatever Race.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Great Kennebec River Whatever Race. 100.108 Section 100.108 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND... Whatever Race. (a) Regulated Area. That portion of the Kennebec River, extending bank to bank, between...

  11. 13 CFR 108.320 - Contents of comprehensive business plan.

    Science.gov (United States)

    2010-01-01

    ... plan. 108.320 Section 108.320 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW MARKETS... Contents of comprehensive business plan. (a) Executive summary. The executive summary must include a... or entity, or any other firm or entity essential to the success of the Applicant's business plan....

  12. 13 CFR 108.120 - Economic development primary mission.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Economic development primary mission. 108.120 Section 108.120 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW MARKETS... Economic development primary mission. The primary mission of a NMVC Company must be economic development...

  13. Dicty_cDB: AFC108 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFC108 (Link to dictyBase) - - - Contig-U16540-1 AFC108P (Link to Original ... ATTAGTATGTTTGGTTTTAGTTTTCTCAACATTATCAATTAGTAATGCAAATCC GGAACA TGATAAATGGTGGAAACCTCCTCC TAGAAATTGTGATAGTTTGT ... ACAAAGAAATT CTTTTGTGTAGAAGATAATGGAAATGGTTGTGGAAATGCTCC ATTAAGTTGTATGAAAGA TTCAAAAACCGATGCAATTTATGAGATTTGGA ... GG AGTTTGTGAATGGGTTGACCCAGTACCATGTATGGGTACATCATGTTGTCC ACGTTATCC ... AGTTTGTAAGGGTGGTGGTGGCGGTGGTGGACCAGTCTCAC ... CATGTAAGAATGTAATTTG TCC XXXXXXXXXXAAGGATTCAATTGTGTCGAATTTGGTGGAACCGCCAATTGT ...

  14. 7 CFR 993.108 - Non-human consumption outlet.

    Science.gov (United States)

    2010-01-01

    ... CALIFORNIA Administrative Rules and Regulations Definitions § 993.108 Non-human consumption outlet. Non-human consumption outlet means any livestock feeder or manufacturer of inedible syrup, industrial alcohol, animal... 7 Agriculture 8 2010-01-01 2010-01-01 false Non-human consumption outlet. 993.108 Section...

  15. 12 CFR 220.108 - International Bank Securities.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 3 2010-01-01 2010-01-01 false International Bank Securities. 220.108 Section... SYSTEM CREDIT BY BROKERS AND DEALERS (REGULATION T) Interpretations § 220.108 International Bank... International Bank for Reconstruction and Development (including any guaranty by the bank, whether or...

  16. 46 CFR 108.649 - Lifejackets, immersion suits, and lifebuoys.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Lifejackets, immersion suits, and lifebuoys. 108.649... DRILLING UNITS DESIGN AND EQUIPMENT Equipment Markings and Instructions § 108.649 Lifejackets, immersion... with the appropriate symbol from IMO Resolution A.760(18). (c) Each immersion suit or...

  17. 42 CFR 431.108 - Effective date of provider agreements.

    Science.gov (United States)

    2010-10-01

    ... perform. (b) All requirements are met on the date of survey. The agreement is effective on the date the... 42 Public Health 4 2010-10-01 2010-10-01 false Effective date of provider agreements. 431.108... Administrative Requirements: Provider Relations § 431.108 Effective date of provider agreements....

  18. 9 CFR 108.3 - Preparation of plot plans.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Preparation of plot plans. 108.3... LICENSED ESTABLISHMENTS § 108.3 Preparation of plot plans. Plot plans shall show all of the buildings on a... on the plot plan the use of immediate adjacent properties such as, residential area, pasture,...

  19. Oral cadmium chloride intoxication in mice

    DEFF Research Database (Denmark)

    Andersen, O; Nielsen, J B; Svendsen, P

    1988-01-01

    Diethyldithiocarbamate (DDC) is known to alleviate acute toxicity due to injection of cadmium salts. However, when cadmium chloride was administered by the oral route, DDC enhanced rather than alleviated the acute toxicity; both oral and intraperitoneal (i.p.) administration of DDC had this effec...

  20. Cadmium Modulates Biofilm Formation by Staphylococcus epidermidis

    NARCIS (Netherlands)

    Wu, Xueqing; Santos, Regiane R.; Fink-Gremmels, Johanna

    2015-01-01

    The aim of the study was to evaluate the effect of cadmium exposure on Staphylococcus epidermidis (ATCC 35984) biofilm formation. Bacteria were cultured in the absence or presence of different concentrations (0-50 mu M) of cadmium. Biofilm formation and bacterial viability were assessed. Quantitativ

  1. Cadmium Toxicity to Ringed Seals (Phoca hispida)

    DEFF Research Database (Denmark)

    Sonne, Christian; Dietz, R.; Riget, F. F.;

    Cadmium concentrations in kidneys from ringed seals (Phoca hispida) from North West Greenland (Qaanaaq) are high. Concentrations range at level known to induce renal toxic effects (mainly tubulopathy) and demineralisation (osteopenia) of the skeletal system (Fanconi's Syndrome) in humans as well...... the absence of toxic effects of cadmium in ringed seal...

  2. Electrodialytic Removal of Cadmium from Straw Ash

    DEFF Research Database (Denmark)

    Hansen, Henrik; Ottosen, Lisbeth M.; Villumsen, Arne;

    1999-01-01

    A problem with flyash from straw and wood combustion is the high level of heavy metals, especially cadmium. Two electrodialytic remediation experiments were carried out on cadmium polluted flyash from straw combustion. The flyash could be cleaned to 1/3 of its initial level after 24 days of...

  3. Development of cadmium/silver/palladium separation by ion chromatography with quadrupole inductively coupled plasma mass spectrometry detection for off-line cadmium isotopic measurements

    International Nuclear Information System (INIS)

    A separation method was investigated to perform off-line cadmium isotopic measurements on a 109Ag transmutation target. Ion chromatography (IC) with Q ICPMS detection (quadrupole inductively coupled plasma mass spectrometry detection) was chosen to separate cadmium from the isobarically interfering elements, silver and palladium, present in the sample. The optimization of chromatographic conditions was particularly studied. Several anion and cation columns (Dionex AG11 (R), CS10 (R) and CS12 (R)) were compared with different mobile phases (HNO3, HCl). The separation procedure was achieved with a carboxylate-functionalized cation exchange CS12 column using 0.5 M HNO3 as eluent. The developed technique yielded satisfactory results in terms of separation factors (greater than 5) and provides an efficient solution to obtain rapidly purified cadmium fractions (decontamination factors higher 100,000 for silver and palladium) which can directly be analyzed by multi collection inductively coupled plasma mass spectrometry (MC ICPMS). By applying the proposed procedure, accurate and precise cadmium isotope ratios were determined for the irradiated 109Ag transmutation target. (authors)

  4. Molecular and cellular mechanisms of cadmium carcinogenesis

    International Nuclear Information System (INIS)

    Cadmium is a heavy metal, which is widely used in industry, affecting human health through occupational and environmental exposure. In mammals, it exerts multiple toxic effects and has been classified as a human carcinogen by the International Agency for Research on Cancer. Cadmium affects cell proliferation, differentiation, apoptosis and other cellular activities. Cd2+ does not catalyze Fenton-type reactions because it does not accept or donate electrons under physiological conditions, and it is only weakly genotoxic. Hence, indirect mechanisms are implicated in the carcinogenicity of cadmium. In this review multiple mechanisms are discussed, such as modulation of gene expression and signal transduction, interference with enzymes of the cellular antioxidant system and generation of reactive oxygen species (ROS), inhibition of DNA repair and DNA methylation, role in apoptosis and disruption of E-cadherin-mediated cell-cell adhesion. Cadmium affects both gene transcription and translation. The major mechanisms of gene induction by cadmium known so far are modulation of cellular signal transduction pathways by enhancement of protein phosphorylation and activation of transcription and translation factors. Cadmium interferes with antioxidant defense mechanisms and stimulates the production of reactive oxygen species, which may act as signaling molecules in the induction of gene expression and apoptosis. The inhibition of DNA repair processes by cadmium represents a mechanism by which cadmium enhances the genotoxicity of other agents and may contribute to the tumor initiation by this metal. The disruption of E-cadherin-mediated cell-cell adhesion by cadmium probably further stimulates the development of tumors. It becomes clear that there exist multiple mechanisms which contribute to the carcinogenicity of cadmium, although the relative weights of these contributions are difficult to estimate

  5. Cadmium blood concentrations in relation to nutrition.

    Science.gov (United States)

    Krajcovicová-Kudládková, Marica; Ursínyová, Monika; Masánová, Vlasta; Béderová, Alzbeta; Valachovicová, Martina

    2006-09-01

    Cadmium is a toxic element ubiquitous in the environment, which damages biological systems in various ways. The major source of cadmium exposure is food. High cadmium content in the soil leads to high cadmium concentrations in certain plants such as grains (above all surface layers and germs), oil or non-oil seeds, fruit and vegetables. These food commodities are the crucial components of a vegetarian nutrition. Blood cadmium concentrations were measured in two non-smoking population groups: the vegetarian group (n = 80) and the non-vegetarian (control) group of general population on traditional mixed diet (n = 84). The significantly higher blood cadmium content (1.78 +/- 0.22 vs. 0.45 +/- 0.04 microg/l) was measured in vegetarian group. Healthy risk values > 5 microg/l were found in 6 vegetarians vs. no non-vegetarian. The highest cadmium concentration (3.15 +/- 0.77 microg/l) was measured in vegan subgroup (plant food only, n = 10) and that value decreased with increasing animal food consumption (1.75 +/- 0.36 microg/l, lactovegetarian and lactoovovegetarian subgroup/added dairy products and eggs, n = 41/, 1.34 +/- 0.21 microg/I, semivegetarian subgroup /as a previous subgroup and added white meat, n = 291). Risk vegetarians vs. non-risk vegetarians consume significantly higher amounts of whole grain products, grain sprouts and oil seeds. Blood cadmium content is directly influenced by age (r = 0.32, p vegetarianism (r = 0.5, p Vegetarians have significantly higher plasma concentrations of natural antioxidants. The sufficient antioxidative protection against cadmium induced free radical formation in vegetarians may inhibit the harmful effects of greater cadmium intake from plant food. PMID:17152224

  6. Peculiarities of preparation of cadmium isotopes of high enrichment

    International Nuclear Information System (INIS)

    Cascade equipped by gas centrifuges with regard for requirements to structural materials operating with chemically active compounds (dimethylcadmium) was devised for preparation of high-enriched cadmium isotopes. Solutions of such problems as overcoming of isotope memory, compensation of the effect of isotope overlapping, operative analytical accompanying permitted to optimize separation process and to obtain cadmium isotopes of high enrichment degree: cadmium-116 ∼98.9 %, cadmium-114 ∼98.7 %, cadmium-113 ∼93.3 %, cadmium-112 ∼99.1 %, cadmium-110 ∼95.8 %

  7. The role of microRNAs in copper and cadmium homeostasis

    International Nuclear Information System (INIS)

    Essential heavy metals (e.g., copper) and non-essential metals (e.g., cadmium) are both toxic to plants at high concentrations. Recently, microRNAs (miRNAs) have emerged as important modulators of plants adaptive response to heavy metal stress. Plant miRNAs negatively regulate target mRNAs by post-transcriptional cleavage. miR398 regulates copper homeostasis via down-regulating the expression of Cu,Zn-superoxide dismutase (CSD), a scavenger of superoxide radicals. miR393 and miR171 play an important role in cadmium stress mediation. This review focuses on the recent advance in the involvement of miRNAs in copper and cadmium stress regulatory networks in plants.

  8. 0gs+→21+ Transition Strengths in 106Sn and 108Sn

    International Nuclear Information System (INIS)

    The reduced transition probabilities, B(E2;0gs+→21+), have been measured in the radioactive isotopes 108,106Sn using subbarrier Coulomb excitation at the REX-ISOLDE facility at CERN. Deexcitation γ rays were detected by the highly segmented MINIBALL Ge-detector array. The results, B(E2;0gs+→21+)=0.222(19)e2b2 for 108Sn and B(E2;0gs+→21+)=0.195(39)e2b2 for 106Sn were determined relative to a stable 58Ni target. The resulting B(E2) values are ∼30% larger than shell-model predictions and deviate from the generalized seniority model. This experimental result may point towards a weakening of the N=Z=50 shell closure

  9. Response of Saccharomyces cerevisiae to cadmium stress

    Energy Technology Data Exchange (ETDEWEB)

    Moreira, Luciana Mara Costa; Ribeiro, Frederico Haddad; Neves, Maria Jose [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil). Lab. de Radiobiologia], e-mail: luamatu@uol.com.br; Porto, Barbara Abranches Araujo; Amaral, Angela M.; Menezes, Maria Angela B.C. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Lab. de Ativacao Neutronica], e-mail: menezes@cdtn.br; Rosa, Carlos Augusto [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Microbiologia], e-mail: carlrosa@icb.ufmg

    2009-07-01

    The intensification of industrial activity has been greatly contributing with the increase of heavy metals in the environment. Among these heavy metals, cadmium becomes a serious pervasive environmental pollutant. The cadmium is a heavy metal with no biological function, very toxic and carcinogenic at low concentrations. The toxicity of cadmium and several other metals can be mainly attributed to the multiplicity of coordination complexes and clusters that they can form. Some aspects of the cellular response to cadmium were extensively investigated in the yeast Saccharomyces cerevisiae. The primary site of interaction between many toxic metals and microbial cells is the plasma membrane. Plasma-membrane permeabilisation has been reported in a variety of microorganisms following cadmium exposure, and is considered one mechanism of cadmium toxicity in the yeast. In this work, using the yeast strain S. cerevisiae W303-WT, we have investigated the relationships between Cd uptake and release of cellular metal ions (K{sup +} and Na{sup +}) using neutron activation technique. The neutron activation was an easy, rapid and suitable technique for doing these metal determinations on yeast cells; was observed the change in morphology of the strains during the process of Cd accumulation, these alterations were observed by Transmission Electron Microscopy (TEM) and Scanning Electron Microscopy (SEM) during incorporation of cadmium. (author)

  10. Dicty_cDB: SSM108 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available _2966( CP001022 |pid:none) Exiguobacterium sibiricum 255-1... 43 0.007 AP009256_1251( AP009256 |pid:none) Bifidobacterium adolescent...fqlsgkkkgkk kkkkkinininysselfkkkiklkliiv*ncl Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits...ogy vs DNA Score E Sequences producing significant alignments: (bits) Value N AX346223 |AX346223.1 Sequence...ogy vs Protein Score E Sequences producing significant alignments: (bits) Valu...8Z (Link to Original site) Representative DNA sequence >SSM108 (SSM108Q) /CSM/SS/SSM1-A/SSM108Q.Seq.d/ XXXXX

  11. Novel fluorescent silver nanoparticles: sensitive and selective turn off sensor for cadmium ions

    Science.gov (United States)

    Makwana, Bharat A.; Vyas, Disha J.; Bhatt, Keyur D.; Darji, Savan; Jain, Vinod K.

    2016-04-01

    The synthesis of metal nanoparticles by eco-friendly and reliable processes is an important aspect in many fields. In this study, octamethoxy resorcin [4] arene tetrahydrazide (OMRTH)-reduced and stabilized silver nanoparticles were synthesized via a simple one-pot method. Synthesized silver nanoparticles were characterized by UV-visible spectroscopy, transmission electron microscopy (TEM) and particle size analyzer (PSA). Furthermore, the application of OMRTH-AgNps as a simple, cost-effective and sensitive fluorescent sensor for rapid detection of cadmium was explored. Under optimum conditions, the fluorescence intensity of OMRTH-AgNps was inversely proportional to the cadmium concentration. Using OMRTH-AgNps as a selective and sensitive fluorescent probe, cadmium can be detected at a minimum concentration level of 10-8 M in a facile way of fluorescence quenching, i.e., by a "turn off" mechanism. The method has been successfully applied for determination of Cd[II] ions in groundwater and industrial effluent wastewater samples.

  12. Cadmium - a complex environmental problem. Part II. Cadmium in sludges used as fertilizer

    Energy Technology Data Exchange (ETDEWEB)

    Davis, R.D.

    1984-02-15

    Utilisation of sewage sludge as a fertilizer is the most economic disposal route for inland sewage-treatment works. Much of the cadmium in wastewater is concentrated into sludge. It is impracticable to reduce cadmium concentrations in sludge below certain levels. Cadmium is a principal factor limiting the use of sludge on land. Investigations are described which have attempted to identify and to determine the availability of forms of cadmium in soil. There is considerable research interest in cadmium in soil solution which is likely to be directly available for crop uptake. Another area of interest is the apparent disappearance of cadmium from sludge-treated soil. Soil analysis often cannot fully account for the cadmium added in sludge. Apart from the effect of soil conditions, especially pH value, crop uptake varies according to the particular crop examined. Highest concentrations of cadmium occur in tobacco, lettuce, spinach and other leafy vegetables. Using crop uptake data from field trials it is possible to relate potential human dietary intake of cadmium, on which hazard depends, to soil concentrations of cadmium, which can be controlled by regulating applications of sludge. This provides an objective basis for limits for cadmium concentrations in soils receiving sludge. Transfer of cadmium via farm animals to meat and dairy products for human consumption is thought to be minimal, even allowing for some direct ingestion of sludge-treated soil by the animals. Evidence from these and other investigations suggests that a loading rate limit of 5 kg Cd/ha (equivalent to a soil concentration of about 3.5 mg Cd/kg) affords adequate protection to the foodchain where sludge is used on agricultural land.

  13. Effect of iron upon cadmium-manganese and cadmium-iron interaction

    International Nuclear Information System (INIS)

    Increase cadmium production has enhanced the potential danger of this toxic metal including its effect upon the metabolism of some essential elements as, for instance, manganese of some essential elements as, for instance, manganese and iron. Relevant data about the cadmium-manganese interaction are rather scanty. Since there are more data of the effect of iron on the metabolism of either of these ions independently. The authors decided to investigate how the presence of iron affected the interaction between cadmium and manganese and how cadmium alone or in combination with the additional iron affected iron transfer and retention in the intestinal wall

  14. 13 CFR 108.504 - Equipment and office requirements.

    Science.gov (United States)

    2010-01-01

    ... VENTURE CAPITAL (âNMVCâ) PROGRAM Managing the Operations of a NMVC Company General Requirements § 108.504 Equipment and office requirements. (a) Computer capability. You must have a personal computer with a...

  15. 46 CFR 108.197 - Construction of accommodation spaces.

    Science.gov (United States)

    2010-10-01

    ... UNITS DESIGN AND EQUIPMENT Construction and Arrangement Accommodation Spaces § 108.197 Construction of accommodation spaces. (a) Each sleeping, mess, recreational, or hospital space that is adjacent to or... readily enter any sleeping, mess, recreational, or hospital space....

  16. 46 CFR 108.203 - Berths and lockers.

    Science.gov (United States)

    2010-10-01

    ... EQUIPMENT Construction and Arrangement Accommodation Spaces § 108.203 Berths and lockers. (a) Each sleeping... pipe, ventilating duct, or other overhead installation. (i) Each berth must have a berth light....

  17. ACUPUNCTURE TREATMENT OF 108 CASES OF NERVOUS TINNITUS

    Institute of Scientific and Technical Information of China (English)

    LEI Qiu-hui

    2005-01-01

    @@ The author of the present paper treated 108 cases of nervous tinnitus with electroacupuncture from March 1989 to March 2004, and achieved a markedly effective therapeutic effect. Following is the report.

  18. 13 CFR 108.130 - Identified Low Income Geographic Areas.

    Science.gov (United States)

    2010-01-01

    ... VENTURE CAPITAL (âNMVCâ) PROGRAM Qualifications for the NMVC Program Organizing A Nmvc Company § 108.130... intends to make Developmental Venture Capital investments and provide Operational Assistance under...

  19. Tripolyphosphates of potassium-cadmium and ammonium-cadmium

    International Nuclear Information System (INIS)

    Formation of barely soluble compounds during interaction of ammonium and potassium tripolyphosphates with cadmium nitrate in aqueous solutions (0.1-2.0 mol% concentration, the temperature 20 deg C), is investigated. KCd2P3O10x7H2O, NH4Cd2P3O10x7H2O crystallohydrates and Cd5(P3O10)2xhH2O (x=10-13) X-ray amorphous salt, that are dissolved in potassium and ammonium tripolyphosphate solution with formation of Cd2+:P3O105-=1:1 and 1:2 complexes, are separated. In K5P3O10-Cd(NO3)2-H2O system Cd2+:P3O105-=1:1 complex is crystallized in a mixture with varied composition amorphous phase

  20. Analysis and characterization of double shell tank 241-AP-108

    International Nuclear Information System (INIS)

    This document is the first part of a three-part report describing the analysis and characterization of double shell tank 241-AP-108 which is located at the Hanford Reservation.This document is the analytical laboratory data package entitled 'Analysis and Characterization of Double Shell Tank 241-AP-108' which contains a case sampling history, the sampling protocols, the analytical procedures, sampling and analysis quality assurance and quality control measures, and chemical analysis results for samples obtained from the tank

  1. Tissue-specific accumulation of cadmium in subcellular compartments of eastern oysters Crassostrea virginica Gmelin (Bivalvia: Ostreidae)

    International Nuclear Information System (INIS)

    Cadmium distribution was studied in different subcellular fractions of gill and hepatopancreas tissues of eastern oysters Crassostrea virginica. Oysters were exposed for up to 21 days to low sublethal Cd concentrations (25 μg L-1). Gill and hepatopancreas tissues were sampled and divided into organelle fractions and cytosol by differential centrifugation. Organelle content of different fractions was verified by activities of marker enzymes, citrate synthase and acid phosphatase for mitochondria and lysosomes, respectively. In both tissue types, there was a significant accumulation of cadmium in cytosol reaching 230-350 ng mg-1 protein. Among organelles, mitochondria were the main target for Cd bioaccumulation in gills (250-300 ng mg-1 protein), whereas in hepatopancreas tissues, the highest cadmium accumulation occurred in lysosomes (90-94 ng mg-1 protein). Although 75-83% of total cadmium burden was associated with the cytosol reflecting high volume fraction of this compartment, Cd concentrations in organelle fractions reached levels that could cause dysfunction of mitochondria and lysosomes. Organ- and organelle-specific patterns of cadmium bioaccumulation support our previous in vivo studies, which showed adverse effects of cadmium exposures on mitochondrial oxidation in gills and on the lysosomal system of hepatopancreas. This may have important implications for the development of biomarkers of effect for heavy metals and for understanding the mechanisms of toxic effects of metals

  2. Market for nickel-cadmium batteries

    Science.gov (United States)

    Putois, F.

    Besides the lead/acid battery market, which has seen a tremendous development linked with the car industry, the alkaline rechargeable battery market has also been expanded for more than twenty years, especially in the field of portable applications with nickel-cadmium batteries. Today, nickel-cadmium batteries have to face newcomers on the market, such as nickel-metal hydride, which is another alkaline couple, and rechargeable lithium batteries; these new battery systems have better performances in some areas. This work illustrates the status of the market for nickel-cadmium batteries and their applications. Also, for two major applications—the cordless tool and the electric vehicles—the competitive situation of nickel-cadmium batteries; facing new systems such as nickel-metal hydride and lithium ion cells are discussed.

  3. External costs of cadmium emissions to soil

    DEFF Research Database (Denmark)

    Pizzol, Massimo; Smart, James C. R.; Thomsen, Marianne

    2014-01-01

    concentration to be calculated for each scenario. Human exposure was determined based on soil-crop bioconcentration factors for cadmium and dietary intake rates of Danish food crops. Updated dose-response functions linking lifetime cadmium intake to the probability of developing cadmium-induced renal disease...... and osteoporosis were applied. These impacts were converted into monetary values by using the EU standard value of a life-year adjusted for quality of life experience. Annualized cost per unit of phosphorus and cadmium are presented, discounted and undiscounted, for comparison. Application of struvite (magnesium...... ammonium phosphate) and mineral fertilizer produced the lowest external health costs, followed by the fertilizer products wastewater sludge and pig manure. The external cost estimates produced in this study could be used to design economic policy instruments to encourage use of cleaner fertilizer products....

  4. Soybean phytoremediation of cadmium polluted agricultural soils

    OpenAIRE

    Mihajlov, Ljupco; Zajkova-Paneva, Vesna; Balabanova, Biljana

    2015-01-01

    Soil pollution with cadmium is a result of the strengthened industrial development, especially in the areas of drilling, exploitation and processing of mineral raw materials. On the territory of the Republic of Macedonia there are several areas with significant higher content of cadmium in the soil, including the vicinity of the mine lead and zinc “Zletovo” near the town of Probištip. Phytoremediation is one of the most convenient techniques for remediation of heavy metals from conta...

  5. Cadmium poisoning. Knowledge of the risk

    International Nuclear Information System (INIS)

    This data sheet provides an up-to-date summary of information on cadmium poisoning. The following points are examined: - the problem of increasing pollution of soil, water and the food chain; - physical and chemical properties, manufacture, industrial applications; - the toxic action of cadmium and its derivatives; - methods and apparatus for taking and analysis samples from the atmosphere and from body fluids; - existing French regulations; - technical control and medical surveillance

  6. Cathodoluminescence of cadmium diphosphide crystals

    International Nuclear Information System (INIS)

    An investigation is made of the cathodoluminescence spectra of CdP2 crystals in the temperature range 6 to 300 K. A pulsing beam of high energy electrons (40 kV) is used in the experiment. The samples investigated are undoped, heat annealed in vacuum or saturated vapours of cadmium, and also doped with As and Bi, elements isoelectronic to phosphorus. The experimental results show that the fine structure present in the higher energywing (2.02 to 2.14 eV) depends on the concentration of the uncontrolled nitrogen impurity in CdP2. Atoms of nitrogen give rise to exciton-impurity complexes, leading to intense narrow peaks in the spectrum of cathodoluminescence. Their location and nature are shown in a table. (author)

  7. Cadmium zinc telluride spectral modeling

    International Nuclear Information System (INIS)

    Cadmium zinc telluride (CZT) detectors are the highest resolution room temperature gamma-ray detectors available for isotopic analysis. As with germanium detectors, accurate isotopic analysis using spectra requires peak deconvolution. The CZT peak shapes are asymmetric, with a long low energy tail. The asymmetry is a result of the physics of the electron/hole transport in the semiconductor. An accurate model of the physics of the electron/hole transport through an electric field will allow the parameterization of the peak shapes as a function of energy. In turn this leads to the ability to perform accurate spectral deconvolution and therefore accurate isotopic analysis. The model and the peak-shape parameterization as a function of energy will be presented

  8. Effect of dietary zinc deficiency on the accumulation of cadmium and metallothionein in selected tissues of the rat

    Energy Technology Data Exchange (ETDEWEB)

    Waalkes, M.P.

    1986-01-01

    The effect of continuous dietary zinc deficiency on the metabolism of the toxic heavy metal cadmium has not been widely studied. This investigation was designed to assess the effects of subadequate dietary zinc intake on the accumulation of dietary cadmium and on metallothionein (MT) and zinc concentrations in target organs of cadmium toxicity. Adult male Wistar rats (180-200 g) were allowed, ad libitum, diets either adequate (60 ppm) or deficient (7 ppm) in zinc for a total of 9 wk. The zinc-deficient diet resulted in an approximately 40% reduction in plasma zinc (assessed at 3, 6, and 9 wk) in the absence of overt signs of zinc deficiency (i.e., reduced weight gain, alopecia, etc.). Separate groups of rats were also maintained on zinc-defined diets for a total of 9 wk, but cadmium was added to the diet (0, 12.5, 25, 50, 100, and 200 ppm) a the end of wk 3 and maintained at that level throughout the remaining 6 wk of the study, when the rats were killed. The feeding of the zinc-deficient diet markedly enhanced the accumulation of cadmium in the liver, kidney, and testes. Hepatic, renal, and testicular zinc concentrations were not affected by suboptimal zinc intake alone. However, marked reductions in renal and testicular zinc concentrations were caused by zinc deficiency in concert with cadmium exposure. MT levels, when related to tissue cadmium concentrations, were elevated to a significantly lesser extent in the kidneys of zinc-deficient animals. These results indicate that marginal zinc deficiency markedly increases cadmium accumulation in various organs and reduces zinc content and MT induction in some organs.

  9. Cadmium leaching from thermal treated and gamma irradiated Mexican aluminosilicates

    International Nuclear Information System (INIS)

    Thermal and radiation effects on the leaching of cadmium from two cadmium exchanged zeolitic tuffs and one clay were determined. The cadmium exchanged aluminosilicates were heated at different temperatures (500, 700, 900 and 1100 oC), and the materials were then treated with NaCl (1 M and 5 M) and HNO3 (0.001 M and 1 M) solutions to determine the leaching behaviour of cadmium from the materials. The stability of cadmium in the materials increased as the heating temperature was increased. Cadmium leaching from gamma irradiated and heated materials at 1100 oC was higher than leaching from non-irradiated samples

  10. Cadmium affects retinogenesis during zebrafish embryonic development

    International Nuclear Information System (INIS)

    Ocular malformations are commonly observed in embryos of aquatic species after exposure to toxicants. Using zebrafish embryos as the model organism, we showed that cadmium exposure from sphere stage (4 hpf) to end of segmentation stage (24 hpf) induced microphthalmia in cadmium-treated embryos. Embryos with eye defects were then assessed for visual abilities. Cadmium-exposed embryos were behaviorally blind, showing hyperpigmentation and loss of camouflage response to light. We investigated the cellular basis of the formation of the small eyes phenotype and the induction of blindness by studying retina development and retinotectal projections. Retinal progenitors were found in cadmium-treated embryos albeit in smaller numbers. The number of retinal ganglion cells (RGC), the first class of retinal cells to differentiate during retinogenesis, was reduced, while photoreceptor cells, the last batch of retinal neurons to differentiate, were absent. Cadmium also affected the propagation of neurons in neurogenic waves. The neurons remained in the ventronasal area and failed to spread across the retina. Drastically reduced RGC axons and disrupted optic stalk showed that the optic nerves did not extend from the retina beyond the chiasm into the tectum. Our data suggested that impairment in neuronal differentiation of the retina, disruption in RGC axon formation and absence of cone photoreceptors were the causes of microphthalmia and visual impairment in cadmium-treated embryos

  11. Cadmium removal by Lemna minor and Spirodela polyrhiza.

    Science.gov (United States)

    Chaudhuri, Devaleena; Majumder, Arunabha; Misra, Amal K; Bandyopadhyay, Kaushik

    2014-01-01

    The present study investigates the ability of two genus of duckweed (Lemna minor and Spirodela polyrhiza) to phytoremediate cadmium from aqueous solution. Duckweed was exposed to six different cadmium concentrations, such as, 0.5,1.0,1.5, 2.0, 2.5, and 3.0 mg/L and the experiment was continued for 22 days. Water samples were collected periodically for estimation of residual cadmium content in aqueous solution. At the end of treatment period plant samples were collected and accumulated cadmium content was measured. Cadmium toxicity was observed through relative growth factor and changes in chlorophyll content Experimental results showed that Lemna minor and Spirodela polyrhiza were capable of removing 42-78% and 52-75% cadmium from media depending upon initial cadmium concentrations. Cadmium was removed following pseudo second order kinetic model Maximum cadmium accumulation in Lemna minor was 4734.56 mg/kg at 2 mg/L initial cadmium concentration and 7711.00 mg/kg in Spirodela polyrhiza at 3 mg/L initial cadmium concentration at the end of treatment period. Conversely in both cases maximum bioconcentration factor obtained at lowest initial cadmium concentrations, i.e., 0.5 mg/L, were 3295.61 and 4752.00 for Lemna minor and Spirodela polyrhiza respectively. The present study revealed that both Lemna minor and Spirodela polyrhiza was potential cadmium accumulator. PMID:24933906

  12. Protective effect of probiotic bacteria against cadmium-induced genotoxicity in rat hepatocytes in vivo and in vitro

    OpenAIRE

    Đurašević Siniša F.; Jama Adel M.; Mitić-Ćulafić Dragana; Kolarević S.; Knežević-Vukčević Jelena

    2012-01-01

    The protective effect of probiotic bacteria against cadmium (Cd)-induced genotoxicity was studied in rat hepatocytes in vivo and in vitro. Male Wistar rats, Rattus norvegicus, were treated for five weeks with (i) CdCl2 (70 ppm in the drinking water), (ii) a mixture of lyophilized probiotic bacteria Lactobacillus rhamnosus, L. acidophilus and Bifido-bacterium longum (5×108 cfu/g of food), or (iii) CdCl2 and probiotic bacteria. In addition, single cells obtained from the untreated rat liv...

  13. Effects of cadmium on nickel electrodes in nickel-cadmium cells

    International Nuclear Information System (INIS)

    Nickel cadmium battery cells containing nicel electrodes that are not treated with cadmium during the manufacturing process have a history of performance variability and capacity problems in various cell test programs. In this work cadmium additions to the nickel electrode are examined to determine the effects on the fundamental electrochemical processes occurring at this electrode. The results indicate that cadmium treatments improve recharge efficiency by increasing the potential required for oxygen evolution from the nickel electrode, thus decreasing the overcharge rate at a given voltage and allowing the nickel electrode to attain a higher state of charge. The effects of cadmium treatment become particularly important for stable cell operation at temperatures above 10 C, and for capacity maintenance under conditions of long term, low rate trickle charge

  14. In vivo labeling of amyloid with BF-108.

    Science.gov (United States)

    Suemoto, Takahiro; Okamura, Nobuyuki; Shiomitsu, Tsuyoshi; Suzuki, Masako; Shimadzu, Hiroshi; Akatsu, Hiroyasu; Yamamoto, Takayuki; Kudo, Yukitsuka; Sawada, Tohru

    2004-01-01

    Detection of aggregated amyloid-beta (Abeta) with a non-invasive imaging modality such as positron emission tomography (PET) was suggested to be ideal for the diagnosis of Alzheimer's disease (AD) prior to the onset of clinical symptoms. We have been searching for imaging probe candidates with a high affinity for aggregated Abeta in vitro and in vivo and high lipophilicity, a characteristic that allows for the permeation of the blood-brain barrier (BBB). As analyzed by Thioflavin T (ThT) assay and octanol/water partition coefficient test (PC), 3-diethylamino-6-(2-fluoroethyl)ethylaminoacridine (BF-108) were found to have high affinity for Abeta aggregates in vitro and high lipophilicity. Intravenously administrated BF-108 labeled Abeta aggregates injected into the amygdala as observed under a fluorescence microscope, showing this compound's permeability of BBB and an ability to label Abeta in vivo. BF-108 also labeled neuritic senile plaques (SPs), neurofibrillary tangles, and amyloid-laden vessels in temporal and hippocampal sections from AD patients. Following intravenous administration of BF-108 to an APP23 transgenic (TG) mouse, in vivo labeling of endogenous plaques was seen in brain sections by fluorescence microscopy. These properties suggest the potential utility of BF-108 for in vivo imaging of AD pathology. PMID:14687882

  15. Cadmium exposure induces hematuria in Korean adults

    International Nuclear Information System (INIS)

    Introduction: Toxic heavy metals have adverse effects on human health. However, the risk of hematuria caused by heavy metal exposure has not been evaluated. Methods: Data from 4701 Korean adults were obtained in the Korean National Health and Nutritional Examination Survey (2008–2010). Blood levels of the toxic heavy metals cadmium, lead, and mercury were measured. Hematuria was defined as a result of ≥+1 on a urine dipstick test. The odds ratios (ORs) for hematuria were measured according to the blood heavy metal levels after adjusting for multiple variables. Results: Individuals with blood cadmium levels in the 3rd and 4th quartiles had a greater OR for hematuria than those in the 1st quartile group: 3rd quartile, 1.35 (1.019–1.777; P=0.037); 4th quartile, 1.52 (1.140–2.017; P=0.004). When blood cadmium was considered as a log-transformed continuous variable, the correlation between blood cadmium and hematuria was significant: OR, 1.97 (1.224–3.160; Ptrend=0.005). In contrast, no significant correlations between hematuria and blood lead or mercury were found in the multivariate analyses. Discussion: The present study shows that high cadmium exposure is associated with a risk of hematuria. -- Highlights: • A high level of blood cadmium is associated with a high risk of hematuria. • This correlation is independent of several confounding factors. • Blood levels of lead and mercury are not associated with risk of hematuria. • This is the first study on the correlation between cadmium exposure and hematuria risk

  16. Cadmium exposure induces hematuria in Korean adults

    Energy Technology Data Exchange (ETDEWEB)

    Han, Seung Seok [Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744 (Korea, Republic of); Kim, Myounghee, E-mail: dkkim73@gmail.com [Department of Dental Hygiene, College of Health Science, Eulji University, Gyeonggi-do 461-713 (Korea, Republic of); Lee, Su Mi [Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744 (Korea, Republic of); Lee, Jung Pyo [Department of Internal Medicine, Seoul National University Boramae Medical Center, Seoul 156-707 (Korea, Republic of); Kim, Sejoong [Department of Internal Medicine, Seoul National University Bundang Hospital, Gyeonggi-do 463-707 (Korea, Republic of); Joo, Kwon Wook [Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744 (Korea, Republic of); Lim, Chun Soo [Department of Internal Medicine, Seoul National University Boramae Medical Center, Seoul 156-707 (Korea, Republic of); Kim, Yon Su; Kim, Dong Ki [Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744 (Korea, Republic of)

    2013-07-15

    Introduction: Toxic heavy metals have adverse effects on human health. However, the risk of hematuria caused by heavy metal exposure has not been evaluated. Methods: Data from 4701 Korean adults were obtained in the Korean National Health and Nutritional Examination Survey (2008–2010). Blood levels of the toxic heavy metals cadmium, lead, and mercury were measured. Hematuria was defined as a result of ≥+1 on a urine dipstick test. The odds ratios (ORs) for hematuria were measured according to the blood heavy metal levels after adjusting for multiple variables. Results: Individuals with blood cadmium levels in the 3rd and 4th quartiles had a greater OR for hematuria than those in the 1st quartile group: 3rd quartile, 1.35 (1.019–1.777; P=0.037); 4th quartile, 1.52 (1.140–2.017; P=0.004). When blood cadmium was considered as a log-transformed continuous variable, the correlation between blood cadmium and hematuria was significant: OR, 1.97 (1.224–3.160; P{sub trend}=0.005). In contrast, no significant correlations between hematuria and blood lead or mercury were found in the multivariate analyses. Discussion: The present study shows that high cadmium exposure is associated with a risk of hematuria. -- Highlights: • A high level of blood cadmium is associated with a high risk of hematuria. • This correlation is independent of several confounding factors. • Blood levels of lead and mercury are not associated with risk of hematuria. • This is the first study on the correlation between cadmium exposure and hematuria risk.

  17. Copper-cadmium interaction in mice: effects of copper status on retention and distribution of cadmium after cadmium exposure

    International Nuclear Information System (INIS)

    The role of increased dietary copper in altering the accumulation of cadmium and other metals in tissues, was investigated. Female Swiss-Webster mice were pretreated with cadmium or copper in drinking water for three weeks prior to cadmium exposure for an additional nine weeks, with sub groups from each dose level receiving Cu additions to the Cd supplemented water. In Cd pretreated animals, a significant decrease was observed in Cd concentrations in liver and kidney when Cu was added to Cd in drinking water. Cadmium levels in soluble protein fractions of liver of animals administered 5 ppm Cd were approximately three fold greater than that for the same Cd dose when Cu was added. The same was the case for the metallothionein-like protein fraction (MTP) of the liver cytosol. In copper pretreated animals similar trends were noted in that brain, spleen, liver (but not kidney) Cd levels were decreased in animals receiving Cu additions to the Cd dose. Increased binding of Cd to the MTP fraction was observed after both in vivo and in vitro exposure of intestinal mucosal cells to cadmium

  18. On the effect of thallium additions on cadmium amalgam potentials

    International Nuclear Information System (INIS)

    A study has been made of the influence of additives of thallium on potentials of cadmium amalgams with thallium contents of 10, 20, 30, and 40 at.% at 20, 40, 60, and 80 deg C. Additives of thallium have been found to shift the potential of cadmium amalgams towards the range of negative values which indicates an increase in the activity of cadmium. A possibility of calculation of the potential shift for heterogeneous cadmium amalgams on introducing thallium has been shown

  19. Crystallographic structure of ubiquitin in complex with cadmium ions

    Directory of Open Access Journals (Sweden)

    Cheung Peter

    2009-12-01

    Full Text Available Abstract Background Ubiquitination plays a critical role in regulating many cellular processes, from DNA repair and gene transcription to cell cycle and apoptosis. It is catalyzed by a specific enzymatic cascade ultimately leading to the conjugation of ubiquitin to lysine residues of the target protein that can be the ubiquitin molecule itself and to the formation of poly-ubiquitin chains. Findings We present the crystal structure at 3.0 Å resolution of bovine ubiquitin crystallized in presence of cadmium ions. Two molecules of ubiquitin are present in the asymmetric unit. Interestingly this non-covalent dimeric arrangement brings Lys-6 and Lys-63 of each crystallographically-independent monomer in close contact with the C-terminal ends of the other monomer. Residues Leu-8, Ile-44 and Val-70 that form a hydrophobic patch at the surface of the Ub monomer are trapped at the dimer interface. Conclusions The structural basis for signalling by poly-Ub chains relies on a visualization of conformations of alternatively linked poly-Ub chains. This arrangement of ubiquitin could illustrate how linkages involving Lys-6 or Lys-63 of ubiquitin are produced in the cell. It also details how ubiquitin molecules can specifically chelate cadmium ions.

  20. STS-108 backup crew member Padalka in an M-113

    Science.gov (United States)

    2001-01-01

    KENNEDY SPACE CENTER, Fla. -- Joining the STS-108 crew and Expedition 4 crew, cosmonaut Gennadi Padalka is ready to practice driving an M-113 armored personnel carrier. Padalka completed training in 2000 for a space flight on Soyuz-TM transport vehicle as a commander of an ISS contingency crew and is part of a backup crew for the Expedition 4. STS-108 is a Utilization Flight that will carry the replacement Expedition 4 crew to the International Space Station, as well as the Multi-Purpose Logistics Module Raffaello, filled with supplies and equipment. The l1-day mission is scheduled for launch Nov. 29 on Space Shuttle Endeavour.

  1. Final characterization report for the 108-F Biological Laboratory

    International Nuclear Information System (INIS)

    This report provides a compilation of characterization data for the 108-F Biological Laboratory collected during the period of May 7, 1996 through August 29, 1996. The 108-F Biology Laboratory is located on the Hanford Site in Richland, Washington. The characterization activities were organized and implemented to evaluate the radiological status of the laboratory and to identify hazardous materials. This report reflects the current conditions and status of the laboratory. Information in this report is intended to be utilized to prepare an accurate cost estimate for building demolition, to aid in planning decontamination and demolition activities, and allow proper disposal of demolition debris

  2. Effect of anions on Toxicity of Cadmium Applied to MIcrobial Biomass in Red Soil

    Institute of Scientific and Technical Information of China (English)

    K.S.KHAN; XIEZHENGMIAO; 等

    1997-01-01

    A laboratory incubation experiment was conducted to elucidat the effects of associated anions on toxicity of cadmium applied to microbial biomass in the red soil. Cadmium was applied at six different levels,i.e.,O(background),5,15,30,60 and 100μg g-1 soil in the form of either cadmium acetate or cadmium chloride. Application of cadmium as cadmium acetate markedly reduced the soil microbial biomass carbon compared to cadmium applied as cadmium chlorde at all the tested levels.Similarly,organic carbon to biomass carbon ration in the soil was markedly increased by increasing the level of the cadmium in the soil as cadmium acetate,while the change wa much smaller in the case of cadmium chloride at the same cadmium levels.The results suggested that due consideration should be given to the source of cadmium while deciding the cadmium levles in experiments.

  3. Cadmium-113m as a biogeochemical tracer for cadmium in Lake Michigan

    International Nuclear Information System (INIS)

    The Lake Michigan watershed has been sampled for 113mCd. This long-lived metastable isotope of cadmium allowed independent evaluation of cadmium distribution in this dynamic ecosystem. 113mCd analysis was not hampered by contamination or loss. These are problems which have plagued stable cadmium measurements. Sensitivity and specificity were necessary concerns. 113mCd has been preconcentrated from large samples in order to obtain sufficient activity for quantification. Specificity for the gross beta activity measured was secured in a rigorous ion exchange decontamination. Confirmation of the suspected 113mCd beta source was checked by reverse tracer analysis and modified Feather analysis range-energy relationships. The 113mCd activities confirm the expected semiconservative behavior for cadmium. This behavior manifests itself in a long residence time for cadmium in Lake Michigan. The inefficiency of outflow removal, the low sedimentation rate and the unquantified sediment resuspension and release of cadmium are factors contributing to this residence time. Steady state concentration of cadmium in Lake Michigan will increase if present input rates persist

  4. Comparison of radioisotopic studied calcium metabolism in the orally administered and inhaled cadmium rat

    International Nuclear Information System (INIS)

    The radioisotopic study of calcium metabolism in the rat after oral administration of cadmium, 8 mg/kg during 13 weeks, has shown two different effects of this ion: 1) in the intestine, cadmium inhibits the absorption of calcium by active transport; 2) in the deep bone compartment, the decrease of the bone calcium used for the crystallization and slowly exchangeable with the calcium central pool (serum, extracellular and soft tissues calcium) is combined with a reduction of the exchange rates between the two compartments. When administered through a microparticle aerosol inhalation (1 mg/m3 of air, 30 mn a day, during 12 weeks), cadmium's main target organ is the deep bone compartment. For both modes of administration, the slowing down of osteogenesis is confirmed by a drop in serum alkaline phosphatase after a four weeks period which reflects a decrease of the osteoblastic activity. Therefore it appears that the effects on bones observed during the chronic oral cadmium administration, do not result from a malabsorption of intestine calcium but also from the very action the Cd++ ion on the bone crystallization process

  5. Mitochondrial Toxicity of Cadmium Telluride Quantum Dot Nanoparticles in Mammalian Hepatocytes

    OpenAIRE

    Nguyen, Kathy C; Rippstein, Peter; Tayabali, Azam F.; Willmore, William G.

    2015-01-01

    There are an increasing number of studies indicating that mitochondria are relevant targets in nanomaterial-induced toxicity. However, the underlying mechanisms by which nanoparticles (NPs) interact with these organelles and affect their functions are unknown. The aim of this study was to investigate the effects of cadmium telluride quantum dot (CdTe-QD) NPs on mitochondria in human hepatocellular carcinoma HepG2 cells. CdTe-QD treatment resulted in the enlargement of mitochondria as examined...

  6. 13 CFR 108.10 - Description of the New Markets Venture Capital Program.

    Science.gov (United States)

    2010-01-01

    ... Venture Capital Program. 108.10 Section 108.10 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW MARKETS VENTURE CAPITAL (âNMVCâ) PROGRAM Introduction to Part 108 § 108.10 Description of the New Markets Venture Capital Program. The New Markets Venture Capital (“NMVC”) Program is...

  7. CONTROL OF CADMIUM CARBONATE PRECIPITATION INTERFERENCES DURING THE DIALYSIS OF CADMIUM IN HIGH BICARBONATE ALKALINITY AQUATIC-LIFE BIOASSAY WATERS

    Science.gov (United States)

    The precipitation of cadmium carbonate during the dialysis of cadmium in a high bicarbonate alkalinity natural water, was linked to a significant source of error when determining dialyzate cadmium concentrations. The relative standard deviation was reduced by approximately four-f...

  8. Cadmium accumulation by Axonopus compressus (Sw. P. Beauv and Cyperus rotundas Linn growing in cadmium solution and cadmium-zinc contaminated soil

    Directory of Open Access Journals (Sweden)

    Paitip Thiravetyan

    2007-05-01

    Full Text Available This research investigated the phyto-remediation potentials of Cyperus rotundas Linn (Nutgrass and Axonopus compressus (Sw. P. Beauv (Carpetgrass for cadmium removal from cadmium solution andcadmium-zinc contaminated soil. Plants growth in the solution showed that cadmium decreased the relative growth rate of both grasses. However, the amount of cadmium accumulated in shoot and root was increasedwith the increase in cadmium concentration and exposure time. Growth in fertile soil mixed with Cd-contaminated zinc silicate residue (65% Si, 19% Ca, 2% Zn, 1% Mg and 0.03% Cd at the ratio of 50:50 (w/wfor 30 days showed that C. rotundas Linn accumulated cadmium in root and shoot to 2,178 and 1,144 mg kg-1 dry weight, respectively. A. compressus (Sw. P. Beauv accumulated cadmium in root and shoot to 1,965and 669 mg kg-1 dry weight, respectively. Scanning electron microscope connected to energy-dispersive X-ray spectroscopy suggested that the mechanism of cadmium accumulation by both grasses involved thecadmium precipitation in the stable form of cadmium silicate, which indicated that C. rotundas Linn and A. compressus (Sw. P. Beauv could be grown to prevent soil erosion and to remediate cadmium-contaminatedsoil.

  9. ELECTROKINETIC REMEDIATION STUDY FOR CADMIUM CONTAMINATED SOIL

    Directory of Open Access Journals (Sweden)

    P. Bala Ramudu

    2007-09-01

    Full Text Available This paper presents the results of an experimental research undertaken to evaluate different purging solutions to enhance the removal of cadmium from spiked contaminated field soil by electrokinetic remediation. Three experiments were conducted when soil was saturated with deionised water and subsequently deionised water, ammonium citrate and sodium citrate were used as purging solutions at anode end. One experiment was conducted when the soil was saturated with ammonium citrate and itself was used as the purging solution. Results showed that 49% reduction of cadmium concentration was achieved in the case of soil saturated (washed with ammonium citrate as well as purging solution also was ammonium citrate. The soil pH and washing solutions were the most important factors in controlling the removal of cadmium in electrokinetic remediation process.

  10. Bireactor Electronuclear Systems with Liquid Cadmium Valve

    CERN Document Server

    Bznuni, S A; Zhamkochyan, V M; ASosnin, A N; Polanski, A; Khudaverdyan, A H

    2002-01-01

    Three main types of bireactor electronuclear systems are discussed. From the point of view of assuring high level of functional characteristics and safety bireactor electronuclear systems with booster using enriched uranium (20 %) and with a liquid cadmium valve appears to be the most effective. It is shown by means of Monte-Carlo modeling that such operation conditions can be achieved which lead to the destruction of the intermediate cadmium layer making the systems supercritical (k_{eff}>1). One can avoid the problem by using a special design of the liquid cadmium valve. In comparison with other nuclear systems (critical reactors, one-reactor electronuclear systems) cascade electronuclear systems have essential advantages allowing the decrease of the proton beam current by one order of magnitude and providing at same time the necessary level of power generation and neutron flux. Availability of both the thermal and fast cones allows one to transmute not only transuranics but also the fission products - cesi...

  11. Cadmium tungstate ceramics for application as scintillator

    International Nuclear Information System (INIS)

    The aim of the present work is the production of cadmium tungstate scintillator ceramics (CdWO4 - CWO). The route of production employed was the solid state synthesis. Before the calcination, the precursors cadmium oxide and tungsten oxide were homogenized in an agate mortar. Bismuth oxide was used in the production of doped ceramics with 1% in mol of bismuth, in order to improve de efficiency of the scintillators. Since there is a possibility of Cd2+ loss at temperatures above 1000 deg C, ceramics with 1% of cadmium oxide excess were also produced. The crystalline phase was obtained after two calcination, according to X-Ray diffraction results. For the characterization, radioluminescence measurements were performed under β and X-radiation. Images of the surface of the sintered ceramic were registered by Atomic Force Microscopy. The density of ceramics bodies was calculated by the Archimedes' method and compared with the theoretical density (7.99 g/cm3). (author)

  12. 46 CFR 108.641 - Instructions for changing steering gear.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Instructions for changing steering gear. 108.641 Section... steering gear. Instructions stating, in order, the different steps to be taken for changing to emergency and secondary steering gear must be posted in the steering gear room and at each secondary...

  13. 39 CFR 601.108 - SDR Official disagreement resolution.

    Science.gov (United States)

    2010-07-01

    ... 39 Postal Service 1 2010-07-01 2010-07-01 false SDR Official disagreement resolution. 601.108... disagreement resolution. (a) General. If a disagreement under § 601.107 is not resolved within 10 days after it... supplier is not satisfied with the contracting officer's resolution of the disagreement, or if the...

  14. 29 CFR 1603.108 - Settlement and alternative dispute resolution.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 4 2010-07-01 2010-07-01 false Settlement and alternative dispute resolution. 1603.108... Settlement and alternative dispute resolution. (a) The parties are at all times free to settle all or part of... a neutral mediator or to any other alternative dispute resolution process authorized by...

  15. Marine fishes from the Seychelles: 108 new records

    OpenAIRE

    Randall, J.E.; Egmond, van, H.

    1994-01-01

    The following 108 species of fishes are recorded for the first time from the Seychelles: Himantura granulata, Gymnothorax breedeni, G. chilospilus, G. fimbriatus, G. melatremus, G. nudivomer, G. zonipectis, Rhinomuraena quaesita, Uropterygius macrocephalus, Kaupichthys diodontus, Synodus binotatus, S. jaculum, Trachinocephalus myops, Ophidion smithi, Carapus mourlani, Brosmophyciops pautzkei, Antennarius hispidus, Myripristis berndti, M. melanosticta, Eurypegasus draconis, Cosmocampus banneri...

  16. 46 CFR 108.233 - Location and size.

    Science.gov (United States)

    2010-10-01

    ... COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Construction and Arrangement Helicopter Facilities § 108.233 Location and size. (a) Each helicopter deck must be— (1) At least the size of the rotor diameter of the largest single main...

  17. 46 CFR 108.496 - Semiportable fire extinguishers.

    Science.gov (United States)

    2010-10-01

    ... Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN... extinguisher required by Table 108.495(a), except a wheeled size V extinguisher provided for a helicopter... rolling out of control under heavy sea conditions: (1) Each size V extinguisher required for a...

  18. 46 CFR 108.237 - Fuel storage facilities.

    Science.gov (United States)

    2010-10-01

    ... Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Construction and Arrangement Helicopter Facilities § 108.237 Fuel storage facilities. (a) Helicopter fuel storage tanks must be installed as far as practicable from— (1) The landing area; and...

  19. 7 CFR 1463.108 - Payment to eligible tobacco producers.

    Science.gov (United States)

    2010-01-01

    ... eligible producer that produced tobacco that was marketed, or considered by CCC as planted under a... 7 Agriculture 10 2010-01-01 2010-01-01 false Payment to eligible tobacco producers. 1463.108... CORPORATION, DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS 2005-2014 TOBACCO...

  20. 40 CFR 57.108 - Comparable existing SIP provisions.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 5 2010-07-01 2010-07-01 false Comparable existing SIP provisions. 57... (CONTINUED) PRIMARY NONFERROUS SMELTER ORDERS General § 57.108 Comparable existing SIP provisions... subject under the applicable EPA-approved State Implementation Plan (SIP) for sulfur dioxide in lieu...

  1. 36 CFR 228.108 - Surface use requirements.

    Science.gov (United States)

    2010-07-01

    ...) Control water runoff; (iii) Remove, or control, solid wastes, toxic substances, and hazardous substances... resources. The operator shall treat or dispose of produced water, drilling fluid, and other waste generated... MINERALS Oil and Gas Resources Authorization of Occupancy within A Leasehold § 228.108 Surface...

  2. 50 CFR 14.108 - Food and water.

    Science.gov (United States)

    2010-10-01

    ... Wild Mammals and Birds to the United States § 14.108 Food and water. (a) No carrier shall accept any wild mammal or bird for transport to the United States unless written instructions from the shipper... or bird requiring drinking water shall have uncontaminated water suitable for drinking made...

  3. 5 CFR 177.108 - Referral to Department of Justice.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Referral to Department of Justice. 177... ADMINISTRATIVE CLAIMS UNDER THE FEDERAL TORT CLAIMS ACT § 177.108 Referral to Department of Justice. When Department of Justice approval or consultation is required, or the advice of the Department of Justice...

  4. Characterization plan for the 108-F Biological Laboratory

    International Nuclear Information System (INIS)

    This characterization plan describes the sample collection and sample analysis activities to characterize the 108-F Biological Laboratory, which is located at the Hanford Site in Richland, Washington. The analytical data will be used to identify the radiological contamination and presence of hazardous materials to support disposal of the demolition debris

  5. 19 CFR 360.108 - Loss of electronic licensing privileges.

    Science.gov (United States)

    2010-04-01

    ... MONITORING AND ANALYSIS SYSTEM § 360.108 Loss of electronic licensing privileges. Should Commerce determine... system, Commerce may revoke its electronic licensing privileges without prior notice. The filer will then... 19 Customs Duties 3 2010-04-01 2010-04-01 false Loss of electronic licensing privileges....

  6. 13 CFR 108.340 - Evaluation and selection-general.

    Science.gov (United States)

    2010-01-01

    ... VENTURE CAPITAL (âNMVCâ) PROGRAM Evaluation and Selection of NMVC Companies § 108.340 Evaluation and... Applicants in such a way as to promote Developmental Venture Capital investments nationwide and in both urban... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Evaluation and...

  7. 13 CFR 108.2006 - Evaluation and selection of SSBICs.

    Science.gov (United States)

    2010-01-01

    ... VENTURE CAPITAL (âNMVCâ) PROGRAM Requirements and Procedures for Operational Assistance Grants to NMVC Companies and SSBICs § 108.2006 Evaluation and selection of SSBICs. SBA will evaluate and select an SSBIC... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Evaluation and selection of...

  8. 13 CFR 108.310 - Contents of application.

    Science.gov (United States)

    2010-01-01

    ... Section 108.310 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW MARKETS VENTURE CAPITAL... Applicant must indicate— (1) The specific amount of Regulatory Capital it proposes to raise (which amount... of which must be not less than $1,500,000 or 30 percent of the Regulatory Capital it proposes...

  9. 28 CFR 34.108 - Selection of reviewers.

    Science.gov (United States)

    2010-07-01

    ... division with responsibility for a particular program or project will propose a selection of peer reviewers from an extensive and varied pool of juvenile justice and delinquency prevention experts for approval....108 Judicial Administration DEPARTMENT OF JUSTICE OJJDP COMPETITION AND PEER REVIEW PROCEDURES...

  10. Increased cadmium and lead uptake of a cadmium hyperaccumulator tomato by cadmium-resistant bacteria.

    Science.gov (United States)

    He, Lin-Yan; Chen, Zhao-Jin; Ren, Gai-Di; Zhang, Yan-Feng; Qian, Meng; Sheng, Xia-Fang

    2009-07-01

    Two cadmium (Cd)-resistant strains Pseudomonas sp. RJ10 and Bacillus sp. RJ16 were investigated for their effects on the soil Cd and lead (Pb) solubilization and promotion of plant growth and Cd and Pb uptakes of a Cd-hyperaccumulator tomato. In the heavy metal-contaminated inoculated soil, the CaCl(2)-extractable Cd and Pb were increased by 58-104% and 67-93%, respectively, compared to the uninoculation control. The bacteria produced indole acetic acid, siderophore and 1-aminocyclopropane-1-carboxylate deaminase. Root elongation assay conducted on tomato under gnotobiotic conditions demonstrated increase in root elongation of inoculated tomato seedlings compared to the control plants. An increase in Cd and Pb contents of above-ground tissues varied from 92% to 113% and from 73% to 79% in inoculated plants growing in heavy metal-contaminated soil compared to the uninoculation control, respectively. These results show that the bacteria could be exploited for bacteria enhanced-phytoextraction of Cd- and Pb-polluted soils. PMID:19368973

  11. Treatment of cadmium dust with two-stage leaching process

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    The treatment of cadmium dust with a two-stage leaching process was investigated to replace the existing sulphation roast-leaching processes. The process parameters in the first stage leaching were basically similar to the neutralleaching in zinc hydrometallurgy. The effects of process parameters in the second stage leaching on the extraction of zincand cadmium were mainly studied. The experimental results indicated that zinc and cadmium could be efficiently recoveredfrom the cadmium dust by two-stage leaching process. The extraction percentages of zinc and cadmium in two stage leach-ing reached 95% and 88% respectively under the optimum conditions. The total extraction percentage of Zn and Cdreached 94%.

  12. Thermodynamic properties of cadmium in lead amalgam dilute solution

    International Nuclear Information System (INIS)

    Investigation of thermodynamic properties of cadmium dilute solutions in lead amalgam is carried out by means of electromotive force technique within 453-523 K temperature range. Cadmium thermodynamic functions are calculated: activity, activity ratio, Libbs partial energy and its excess value and integral characteristics, respectively. When changing cadmium content from 0.01 up to 0.1 χcd at T=473 K, logarithm of activity ratio does not depend on alloy composition, that is, Heury's law is fulfilled. Increase of cadmium content in amalgam results in the essential reduction of mercury and cadmium reaction

  13. Urinary excretion of cadmium and zinc among persons from Sweden

    Energy Technology Data Exchange (ETDEWEB)

    Elinder, C.G.; Kjellstrom, T.; Linnman, L.; Pershagen, G.

    1978-06-01

    Cadmium and zinc concentrations in the urine of 132 Swedes, including 50 pairs of identical twins, were measured. Atomic absorption spectrophotometry procedures were developed for the analysis. Cadmium concentration increased with age and was higher among smokers than among nonsmokers. Estimated 24-hr excretion of cadmium among nonsmokers increased from about 0.25 to 0.40 ..mu..g in persons from 20 to 70 years old. The 24-hr cadmium excretions among nonsmokers in different age-groups fitted better to total kidney burden than to daily cadmium intake from food. Zinc excretion, on the other hand, decreased after the age of 20.

  14. Determination of cadmium in biodiesel using microemulsion and electrothermal atomization atomic absorption spectrometry.

    Science.gov (United States)

    Lima, Adriana S; Silva, Deise G; Teixeira, Leonardo S G

    2015-01-01

    This work aimed to prepare biodiesel microemulsions for the subsequent quantification of cadmium via graphite furnace atomic absorption spectrometry (GFAAS). The biodiesel samples were prepared using n-propanol as an emulsifier, 10% (v/v) nitric acid as the aqueous phase, and biodiesel. Pseudoternary phase diagrams were constructed to determine the microemulsion region with the specified components. The optimized conditions for microemulsion formation were 57.6% (v/v) n-propanol, 21.2% (v/v) biodiesel, and 21.2% (v/v) nitric acid solution. The stability of the microemulsified system was investigated using aqueous and organic standards, and the system was found to be stable for at least 240 min. The applied pyrolysis and atomization temperatures were 800 and 2000 °C, respectively, and 5 μg of aluminum was used as the chemical modifier. The obtained limits of detection and quantification were 0.2 and 0.5 μg kg(-1), respectively, and the characteristic mass was 1.6 pg. The precision, expressed as the relative standard deviation (% R.S.D., n = 10), was 2.5% for a sample with a cadmium concentration of 6.5 μg kg(-1). The accuracy was determined from addition and recovery experiments, with results varying from 93 to 108% recovery. This study demonstrates that the proposed method based on the use of a microemulsion formation in sample preparation can be applied as an efficient alternative for the determination of cadmium in biodiesel by GFAAS. Cadmium determination in biodiesel samples of different origins (soybean, corn, cotton, and sunflower) was evaluated after acid digestion using the inductively coupled plasma-mass spectrometry (ICP-MS) technique, and the obtained results were compared to the results obtained using the proposed method. The paired t test (95% confidence level) did not show significant differences. The concentrations of cadmium found ranged from 5.3 to 8.0 μg kg(-1). PMID:25381584

  15. Cadmium telluride quantum dots advances and applications

    CERN Document Server

    Donegan, John

    2013-01-01

    Optical Properties of Bulk and Nanocrystalline Cadmium Telluride, Núñez Fernández and M.I. VasilevskiyAqueous Synthesis of Colloidal CdTe Nanocrystals, V. Lesnyak, N. Gaponik, and A. EychmüllerAssemblies of Thiol-Capped CdTe Nanocrystals, N. GaponikFörster Resonant Energy Transfer in CdTe Nanocrystal Quantum Dot Structures, M. Lunz and A.L. BradleyEmission of CdTe Nanocrystals Coupled to Microcavities, Y.P. Rakovich and J.F. DoneganBiological Applications of Cadmium Telluride Semiconductor Quantum Dots, A. Le Cign

  16. Metallothionein protection of cadmium toxicity

    International Nuclear Information System (INIS)

    The discovery of the cadmium (Cd)-binding protein from horse kidney in 1957 marked the birth of research on this low-molecular weight, cysteine-rich protein called metallothionein (MT) in Cd toxicology. MT plays minimal roles in the gastrointestinal absorption of Cd, but MT plays important roles in Cd retention in tissues and dramatically decreases biliary excretion of Cd. Cd-bound to MT is responsible for Cd accumulation in tissues and the long biological half-life of Cd in the body. Induction of MT protects against acute Cd-induced lethality, as well as acute toxicity to the liver and lung. Intracellular MT also plays important roles in ameliorating Cd toxicity following prolonged exposures, particularly chronic Cd-induced nephrotoxicity, osteotoxicity, and toxicity to the lung, liver, and immune system. There is an association between human and rodent Cd exposure and prostate cancers, especially in the portions where MT is poorly expressed. MT expression in Cd-induced tumors varies depending on the type and the stage of tumor development. For instance, high levels of MT are detected in Cd-induced sarcomas at the injection site, whereas the sarcoma metastases are devoid of MT. The use of MT-transgenic and MT-null mice has greatly helped define the role of MT in Cd toxicology, with the MT-null mice being hypersensitive and MT-transgenic mice resistant to Cd toxicity. Thus, MT is critical for protecting human health from Cd toxicity. There are large individual variations in MT expression, which might in turn predispose some people to Cd toxicity.

  17. Cadmium exposure and pancreatic cancer in south Louisiana.

    Science.gov (United States)

    Luckett, Brian G; Su, L Joseph; Rood, Jennifer C; Fontham, Elizabeth T H

    2012-01-01

    Cadmium has been hypothesized to be a pancreatic carcinogen. We test the hypothesis that cadmium exposure is a risk factor for pancreatic cancer with a population-based case-control study sampled from a population with persistently high rates of pancreatic cancer (south Louisiana). We tested potential dietary and nondietary sources of cadmium for their association with urinary cadmium concentrations which reflect long-term exposure to cadmium due to the accumulation of cadmium in the kidney cortex. Increasing urinary cadmium concentrations were significantly associated with an increasing risk of pancreatic cancer (2nd quartile OR = 3.34, 3rd = 5.58, 4th = 7.70; test for trend P ≤ 0.0001). Potential sources of cadmium exposure, as documented in the scientific literature, found to be statistically significantly associated with increased risk of pancreatic cancer included working as a plumber, pipefitter or welder (OR = 5.88) and high consumption levels of red meat (4th quartile OR = 6.18) and grains (4th quartile OR = 3.38). Current cigarette smoking, at least 80 pack years of smoking, occupational exposure to cadmium and paints, working in a shipyard, and high consumption of grains were found to be statistically significantly associated with increased concentrations of urinary cadmium. This study provides epidemiologic evidence that cadmium is a potential human pancreatic carcinogen. PMID:23319964

  18. Cadmium Exposure and Pancreatic Cancer in South Louisiana

    Directory of Open Access Journals (Sweden)

    Brian G. Luckett

    2012-01-01

    Full Text Available Cadmium has been hypothesized to be a pancreatic carcinogen. We test the hypothesis that cadmium exposure is a risk factor for pancreatic cancer with a population-based case-control study sampled from a population with persistently high rates of pancreatic cancer (south Louisiana. We tested potential dietary and nondietary sources of cadmium for their association with urinary cadmium concentrations which reflect long-term exposure to cadmium due to the accumulation of cadmium in the kidney cortex. Increasing urinary cadmium concentrations were significantly associated with an increasing risk of pancreatic cancer (2nd quartile OR = 3.34, 3rd = 5.58, 4th = 7.70; test for trend P≤0.0001. Potential sources of cadmium exposure, as documented in the scientific literature, found to be statistically significantly associated with increased risk of pancreatic cancer included working as a plumber, pipefitter or welder (OR = 5.88 and high consumption levels of red meat (4th quartile OR = 6.18 and grains (4th quartile OR = 3.38. Current cigarette smoking, at least 80 pack years of smoking, occupational exposure to cadmium and paints, working in a shipyard, and high consumption of grains were found to be statistically significantly associated with increased concentrations of urinary cadmium. This study provides epidemiologic evidence that cadmium is a potential human pancreatic carcinogen.

  19. Determination of cadmium(II) using glassy carbon electrodes modified with cupferron, β-naphthol, and multiwalled carbon nanotubes

    International Nuclear Information System (INIS)

    We report on a simple and reliable method for the determination of trace cadmium ion using a glassy carbon electrode (GCE) modified with cupferron, β-naphthol and MWCNTs. The operational mechanism consists of several steps: first, the ligand cupferron on the modified electrode reacts with Cd2+ ion to form a chelate compound. Next, this chelate is adsorbed by the carrier β-following the principle of organic co-precipitation. Finally, the coprecipitated complex is detected by the GCE. This scheme is interesting because it combines preconcentration and electrochemical detection. Two linear responses are obtained, one in the concentration range of 5.0 x 10-11 to 1.6 x 10-8 M, the other in the range of 1.6 x 10-8 to 1.42 x 10-6 M, with a lower detection limit of 1.6 x 10-11 M. This modified GCE does not suffer from significant interferences by Cu(II), Hg(II), Ag(I), Fe(III), Pb(II), Cr(III), Zn(II), NO3-, Cl-, SO42- ions and EDTA. The response of the electrode remained constant for at least 3 weeks of successive operation. The method presented here provides a new way for the simultaneous separation, enrichment, and electrochemical detection of trace cadmium ion. (author)

  20. European Union Summary Risk Assessment Report - Cadmium Metal and Cadmium Oxide

    OpenAIRE

    2008-01-01

    This report provides a summary, with conclusions, of the risk assessment report of the substances cadmium metal and cadmium oxide that has been prepared by Belgium in the context of Council Regulation (EEC) No. 793/93 on the evaluation and control of existing substances. For detailed information on the risk assessment principles and procedures followed, the underlying data and the literature references, the reader is referred to the comprehensive Final Risk Assessment Report (Final RAR) t...

  1. Effects of bacteria on cadmium bioaccumulation in the cadmium hyperaccumulator plant Beta vulgaris var. cicla L.

    Science.gov (United States)

    Chen, Su; Chao, Lei; Sun, Lina; Sun, Tieheng

    2013-01-01

    To investigate the effects of two cadmium-tolerant bacteria, Staphylococcus pasteuri (S. pasteuri X1) and Agrobacterium tumefaciens (A. tumefaciens X2), on cadmium uptake by the cadmium hyperaccumulator plant Beta vulgaris var. cicla L., a pot experiment with artificially contaminated soil was conducted. The results demonstrated that both cadmium-tolerant bacteria enhanced the dry weight of Beta vulgaris var. cicla L. The total dry weights of plants in the control CK20, S. pasteuri X1 and A. tumefaciens X2 treatments were 0.85, 1.13, and 1.38 g/pot, respectively. Compared with the control CK20 findings, the total dry weight of plants was increased by 32.8 and 61.1% after inoculation with S. pasteuri X1 and A. tumefaciens X2, respectively, indicating that A. tumefaciens X2 more strongly promoted the growth of Beta vulgaris var. cicla L. than S. pasteuri X1. In addition, inoculation with S. pasteuri X1 and A. tumefaciens X2 significantly (p < 0.05) promoted cadmium uptake by plants and improved the bioaccumulation of cadmium by the plants from the soil. Moreover, the inoculation of S. pasteuri X1 and A. tumefaciens X2 effectively facilitated the transfer of cadmium in the soil from the Fe-Mn oxide and residual fractions to the soluble plus exchangeable and weakly specially adsorbed fractions in the rhizosphere soils of plants. The bacterial enhancement of cadmium phytoavailability might provide a potential and promising method to increase the efficiency of phytoextraction. PMID:23488173

  2. Impact of iron status on cadmium uptake in suckling piglets

    International Nuclear Information System (INIS)

    Low iron status is known to increase the uptake of dietary cadmium in both adolescents and adults and there are indications that cadmium is absorbed from the intestine by the two major iron transporters divalent metal transporter 1 (DMT1) and ferroportin 1 (FPN1). In addition, it has been suggested that duodenal metallothionein (MT) may limit the transport of cadmium across the intestinal epithelium. The present investigation was undertaken to examine whether iron status influences cadmium absorption in newborns by applying a model of suckling piglets and the possible roles of duodenal DMT1, FPN1 and MT. An oral cadmium dose (20 μg/kg body weight) was given daily for 6 consecutive days on postnatal days (PNDs) 10-15 to iron-deficient or iron-supplemented piglets. The cadmium dose was chosen to keep the cadmium level at a realistically low but still detectable level, and without inducing any adverse health effects in the piglets. As indicators of cadmium uptake, cadmium levels in blood and kidneys were measured on PND 16 by inductively coupled plasma-mass spectrometry (ICP-MS). Cadmium levels in blood were statistically significantly correlated with cadmium levels in kidneys. The cadmium uptake was not higher in iron-deficient suckling piglets; rather, we detected a higher cadmium uptake in the iron-supplemented ones. The expression and localisation of DMT1, FPN1 and MT were not affected by iron status and could therefore not explain the findings. Our results suggest that there are developmental differences in the handling of both iron and cadmium in newborns as compared to adults

  3. CADMIUM EXPOSURE VIA FOOD CROPS: A CASE STUDY OF INTENSIVE FARMING AREA

    Directory of Open Access Journals (Sweden)

    Raagheni Munisamy

    2013-01-01

    Full Text Available Cadmium (Cd is ubiquitous in environment and may enter food chain through intense application of phosphate fertilizers to agricultural crops. A cross-sectional study was conducted at Kuala Terla and Blue Valley farming villages, Cameron Highlands to determine cadmium concentration in vegetables and soil and to determine the health risks among respondents. A total of 87 respondents were selected based on inclusive and exclusive criteria. A set of pre-tested questionnaires utilized to obtain socio-demographic information and to predict health risks faced by the respondents based on their vegetable ingestion rate. The Average Daily Dose (ADD and Target Hazard Quotient (THQ were determined in this study. Convenient sampling method was employed to obtain 15 paired soil and vegetable samples. Cadmium concentration in the samples was acid digested prior analysis using Flame Atomic Absorption Spectrophotometer (FAAS. The mean ± standard deviation concentrations of Cd in vegetable samples were 0.13±0.082 mg kg-1, within the acceptable range specified by Malaysia Food Regulation 1985 (1 mg kg-1. For sol samples, the mean ± standard deviation concentration of Cd was 2.78±2.83 mg kg-1. Eight out of 11 soil samples exceed the permissible limit of Cd outlined by The Dutch Standard (1 mg kg-1. The findings on THQ demonstrated that all respondents are within the acceptable non-carcinogenic health risk (THQ<1. The results also exhibit that there is no correlation between cadmium in soils and vegetables. There are unlikely potential adverse health impacts arising from Cd through vegetables consumption in this study. Respondents are advised to have a medical check-up in order to determine Cd body burden thus eliminating the risks of acquiring cadmium related diseases.

  4. Half-Lives of 101Rh and 108m Ag

    Science.gov (United States)

    Norman, Eric; Browne, Edgardo; Shugart, Howard

    2014-09-01

    Half-lives of short-lived nuclei can easily be measured by direct counting techniques, whereas those of long-lived naturally-occurring nuclei are usually determined by specific activity measurements. However, half-lives in the range of 1 - 1,000,000 years are notoriously difficult to determine. For example, published values for the half-life of 101Rh range from 3.0 +/- 0.4 years to 10 +/- 1 years, and for 108m Ag published values range from 127 +/- 21 years to 438 +/- 9 years. In order to resolve the issues of what the half-lives of these isotopes actually are, we set up two separate long-term gamma-ray counting experiments. Gamma-ray data were collected in time bins using high-purity Ge detectors and ORTEC PC-based data acquisition systems. We counted in this manner for a period of approximately 5 years for 101Rh and 3 years for 108mAg. In this talk we will describe the details of these experiments and will present the final results for the half-lives of 101Rh and 108mAg determined from these measurements. Half-lives of short-lived nuclei can easily be measured by direct counting techniques, whereas those of long-lived naturally-occurring nuclei are usually determined by specific activity measurements. However, half-lives in the range of 1 - 1,000,000 years are notoriously difficult to determine. For example, published values for the half-life of 101Rh range from 3.0 +/- 0.4 years to 10 +/- 1 years, and for 108m Ag published values range from 127 +/- 21 years to 438 +/- 9 years. In order to resolve the issues of what the half-lives of these isotopes actually are, we set up two separate long-term gamma-ray counting experiments. Gamma-ray data were collected in time bins using high-purity Ge detectors and ORTEC PC-based data acquisition systems. We counted in this manner for a period of approximately 5 years for 101Rh and 3 years for 108mAg. In this talk we will describe the details of these experiments and will present the final results for the half-lives of 101Rh

  5. Accumulation of cadmium by transgenic tobacco

    Czech Academy of Sciences Publication Activity Database

    Macek, Tomáš; Macková, M.; Pavlíková, D.; Száková, J.; Truks, M.; Singh Cundy, A.; Kotrba, P.; Yancey, N.; Scouten, W. H.

    2002-01-01

    Roč. 22, 1/2 (2002), s. 101-106. ISSN 0138-4988 R&D Projects: GA ČR GA526/02/0293 Institutional research plan: CEZ:AV0Z4055905 Keywords : phytoremediation * cadmium Subject RIV: CE - Biochemistry Impact factor: 0.542, year: 2002

  6. Cadmium isotope variations in the Southern Ocean

    NARCIS (Netherlands)

    Xue, Z.; Rehkämper, M.; Horner, T.J.; Abouchami, W.; Middag, R.; van de Flierd, T.; de Baar, H.J.W.

    2013-01-01

    Cadmium concentrations and isotope compositions were determined for 47 seawater samples from the high nutrient low chlorophyll (HNLC) zone of the Atlantic sector of the Southern Ocean. The samples include 13 surface waters from a transect of the Weddell Gyre and 3 depth profiles from the Weddell Sea

  7. Physicochemical properties of a cadmium telluride surface

    International Nuclear Information System (INIS)

    Change of chemical state of cadmium telluride surface is investigated after different treatments (exposure in air, vacuum, gaseous media, γ- and IR-irradiation). The results of these investigations are of great interest for clarifying the nature of active surface of diamond-like semiconductors, the mechanism of its interaction with different media and the possibilities of surface properties regulation

  8. The effect of cadmium on plant metabolism

    Czech Academy of Sciences Publication Activity Database

    Pavlíková, D.; Pavlík, Milan; Vokáč, Karel; Balík, J.; Szaková, J.; Tlustoš, P.

    Budapest : Institute of Materials and Environmental Chemistry, 2006. s. 71. [International Symposium on Trace Element in the Food Chain . 25.05.2006-27.05.2006, Budapest] Institutional research plan: CEZ:AV0Z40550506 Keywords : cadmium * plant metabolism * glutamate kinase Subject RIV: DK - Soil Contamination ; De-contamination incl. Pesticides

  9. The effect of cadmium on plant metabolism

    Czech Academy of Sciences Publication Activity Database

    Pavlíková, D.; Pavlík, Milan; Vokáč, Karel; Staszková, L.; Balík, J.; Szaková, J.; Tlustoš, P.

    Budapest : Institute of Materials and Environmental Chemistry, 2006 - (Szilágyi, M.; Szentmihályi, K.), 256-260 [Trace Elements in the food chain . Budapest (HU), 25.05.2006-27.05.2006] Institutional research plan: CEZ:AV0Z40550506 Keywords : cadmium * plant metabolism * glutamate kinase Subject RIV: DK - Soil Contamination ; De-contamination incl. Pesticides

  10. Structure of nearly degenerate dipole bands in {sup 108}Ag

    Energy Technology Data Exchange (ETDEWEB)

    Sethi, J. [Tata Institute of Fundamental Research, Colaba, Mumbai 400 005 (India); Palit, R., E-mail: palit@tifr.res.in [Tata Institute of Fundamental Research, Colaba, Mumbai 400 005 (India); Saha, S.; Trivedi, T. [Tata Institute of Fundamental Research, Colaba, Mumbai 400 005 (India); Bhat, G.H.; Sheikh, J.A. [Department of Physics, University of Kashmir, Srinagar 190 006 (India); Datta, P. [Ananda Mohan College, Kolkata 700009 (India); Carroll, J.J. [US Army Research Laboratory, Adelphi, MD 20783 (United States); Chattopadhyay, S. [Saha Institute of Nuclear Physics, Kolkata 700064 (India); Donthi, R. [Tata Institute of Fundamental Research, Colaba, Mumbai 400 005 (India); Garg, U. [University of Notre Dame, Notre Dame, IN 46556 (United States); Jadhav, S.; Jain, H.C. [Tata Institute of Fundamental Research, Colaba, Mumbai 400 005 (India); Karamian, S. [Joint Institute for Nuclear Research, Dubna 141980 (Russian Federation); Kumar, S. [University of Delhi, Delhi 110007 (India); Litz, M.S. [US Army Research Laboratory, Adelphi, MD 20783 (United States); Mehta, D. [Panjab University, Chandigarh 160014 (India); Naidu, B.S. [Tata Institute of Fundamental Research, Colaba, Mumbai 400 005 (India); Naik, Z. [Sambalpur University, Sambalpur 143005 (India); Sihotra, S. [Panjab University, Chandigarh 160014 (India); and others

    2013-08-09

    The high spin negative parity states of {sup 108}Ag have been investigated with the {sup 11}B + {sup 100}Mo reaction at 39 MeV beam energy using the INGA facility at TIFR, Mumbai. From the γ–γ coincidence analysis, an excited negative parity band has been established and found to be nearly degenerate with the ground state band. The spin and parity of the levels are assigned using angular correlation and polarization measurements. This pair of degenerate bands in {sup 108}Ag is studied using the recently developed microscopic triaxial projected shell model approach. The observed energy levels and the ratio of the electromagnetic transition probabilities of these bands in this isotope are well reproduced by the present model. Further, it is shown that the partner band has a different quasiparticle structure as compared to the yrast band.

  11. Structure of nearly degenerate dipole bands in 108Ag

    International Nuclear Information System (INIS)

    The high spin negative parity states of 108Ag have been investigated with the 11B + 100Mo reaction at 39 MeV beam energy using the INGA facility at TIFR, Mumbai. From the γ–γ coincidence analysis, an excited negative parity band has been established and found to be nearly degenerate with the ground state band. The spin and parity of the levels are assigned using angular correlation and polarization measurements. This pair of degenerate bands in 108Ag is studied using the recently developed microscopic triaxial projected shell model approach. The observed energy levels and the ratio of the electromagnetic transition probabilities of these bands in this isotope are well reproduced by the present model. Further, it is shown that the partner band has a different quasiparticle structure as compared to the yrast band

  12. Cadmium phytoextraction potential of different Alyssum species

    International Nuclear Information System (INIS)

    Highlights: ► The possibility of using serpentine plants for phytoextraction of Cd was investigated. ► Variation in Cd tolerance, accumulation and translocation in three Alyssum plants with different phenotypes were found. ► Alyssum montanum showed higher Cd tolerance and accumulation than the Ni hyperaccumulator Alyssum bertolonii. ► As for the kinetic parameters of the Cd uptake system, A. montanum presented a low apparent Km value. ► The Vmax values were not significantly different among the plants. - Abstract: This work was planned for providing useful information about the possibility of using serpentine adapted plants for phytoextraction of cadmium, element scarcely represented in such metalliferous environment. To this aim, we investigated variation in cadmium tolerance, accumulation and translocation in three Alyssum plants with different phenotypes: Alyssum bertolonii, that is a serpentine endemic nickel hyperaccumulator, and two populations of Alyssum montanum, one adapted and one not adapted to serpentine soils. Plants were hydroponically cultivated in presence of increasing concentrations of CdSO4 for two weeks. For the metal concentration used in the experiments, the three different Alyssum populations showed variation in cadmium tolerance, accumulation and content. The serpentine adapted population of A. montanum showed statistically higher cadmium tolerance and accumulation than A. bertolonii and the population of A. montanum not adapted to serpentine soil thus deserving to be investigated for phytoextraction purposes. Furthermore, as for the kinetic parameters of the cadmium uptake system, A. montanum serpentine population presented a low apparent Km value, suggesting a high affinity for this metal of its uptake system, whereas the Vmax values were not significantly different among the plants. Present data revealed metallicolous plants are also suitable for the phytoremediation of metals underrepresented in the environment of their initial

  13. Cadmium and Chrome Concentrations in Human Milk

    Directory of Open Access Journals (Sweden)

    Sima Nazarpour

    2014-04-01

    Full Text Available Introduction: Nutrition of children has the highest priority in any program aimed at children's health care. Milk contaminated with various toxic elements can have adverse effects on children's health. This study aimed to determine the concentration of heavy metals including cadmium(Cd and chromium (Cr of breast feeding women’s milk in Varamin. Methods: This is a cross sectional study. In the present study, chromium and cadmium levels in milk of 100 mothers attending clinics in the city of Varamin were measured in four to eight weeks after delivery, using atomic absorption spectrometry. Results: The mean values (±SD of Cd and Cr in human milk were 5±6.9 μg/ml and 3±2.7 μg/ml respectively. Result of Linear regression showed that cadmium levels were higher in breast milk of people living close to the factory or industrial center. Also, the chromium levels were higher in the breast milk of women in cases of: Smoking by spouses, consumption of imported rice, consumption of mineral water, and living close to the factory or an industrial center. Conclusion: This study showed that the relationship of some factors such as living near a factory or an industrial center, smoking by spouse, the type of consumed rice and water, with the level of cadmium and chromium. Cadmium and chromium levels of breast milk in this study were higher than the levels of these elements mentioned in the reviewed articles and international standard. Because some variables, such as living near a factory or an industrial center, smoking by spouse, the type of consumed rice and water can affect the amount of entering elements in breast milk. Actions can be taken to reduce or eliminate these variables in order to decrease the mentioned elements in human milk.

  14. Cadmium phytoextraction potential of different Alyssum species

    Energy Technology Data Exchange (ETDEWEB)

    Barzanti, R., E-mail: rbarzanti@supereva.it [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Colzi, I., E-mail: ilariacolzi@hotmail.it [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Arnetoli, M., E-mail: miluscia@gmail.com [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Gallo, A., E-mail: galloalessia@hotmail.com [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Pignattelli, S., E-mail: sara.pignattelli@gmail.com [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Gabbrielli, R., E-mail: gabbrielli@unifi.it [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Gonnelli, C., E-mail: cristina.gonnelli@unifi.it [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy)

    2011-11-30

    Highlights: Black-Right-Pointing-Pointer The possibility of using serpentine plants for phytoextraction of Cd was investigated. Black-Right-Pointing-Pointer Variation in Cd tolerance, accumulation and translocation in three Alyssum plants with different phenotypes were found. Black-Right-Pointing-Pointer Alyssum montanum showed higher Cd tolerance and accumulation than the Ni hyperaccumulator Alyssum bertolonii. Black-Right-Pointing-Pointer As for the kinetic parameters of the Cd uptake system, A. montanum presented a low apparent K{sub m} value. Black-Right-Pointing-Pointer The V{sub max} values were not significantly different among the plants. - Abstract: This work was planned for providing useful information about the possibility of using serpentine adapted plants for phytoextraction of cadmium, element scarcely represented in such metalliferous environment. To this aim, we investigated variation in cadmium tolerance, accumulation and translocation in three Alyssum plants with different phenotypes: Alyssum bertolonii, that is a serpentine endemic nickel hyperaccumulator, and two populations of Alyssum montanum, one adapted and one not adapted to serpentine soils. Plants were hydroponically cultivated in presence of increasing concentrations of CdSO{sub 4} for two weeks. For the metal concentration used in the experiments, the three different Alyssum populations showed variation in cadmium tolerance, accumulation and content. The serpentine adapted population of A. montanum showed statistically higher cadmium tolerance and accumulation than A. bertolonii and the population of A. montanum not adapted to serpentine soil thus deserving to be investigated for phytoextraction purposes. Furthermore, as for the kinetic parameters of the cadmium uptake system, A. montanum serpentine population presented a low apparent K{sub m} value, suggesting a high affinity for this metal of its uptake system, whereas the V{sub max} values were not significantly different among the

  15. Biological Insights From 108 Schizophrenia-Associated Genetic Loci

    OpenAIRE

    Ripke, Stephan; Neale, Benjamin M.; Corvin, Aiden; Walters, James TR; Farh, Kai-How; Holmans, Peter A; Lee, Phil; Bulik-Sullivan, Brendan; Collier, David A; Huang, Hailiang; Pers, Tune H.; Agartz, Ingrid; Agerbo, Esben; Albus, Margot; Alexander, Madeline

    2014-01-01

    Summary Schizophrenia is a highly heritable disorder. Genetic risk is conferred by a large number of alleles, including common alleles of small effect that might be detected by genome-wide association studies. Here, we report a multi-stage schizophrenia genome-wide association study of up to 36,989 cases and 113,075 controls. We identify 128 independent associations spanning 108 conservatively defined loci that meet genome-wide significance, 83 of which have not been previously reported. Asso...

  16. El medio interestelar alrededor de estrellas Of: HD 108

    Science.gov (United States)

    Cappa, C.; Testori, J. C.

    Hemos analizado la distribución del hidrógeno neutro interestelar en la vecindad de la estrella Of HD 108 en base a perfiles de la línea de 21 cm. Estos datos nos han permitido encontrar una probable burbuja interestelar asociada a la estrella. Comparamos estos resultados con la emisión en otros rangos espectrales y estimamos los principales parámetros físicos de la estructura.

  17. Dicty_cDB: SHD108 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SH (Link to library) SHD108 (Link to dictyBase) - - - Contig-U16371-1 - (Link to Original site) ... Oryzias latipes DNA, clone: ola1-209J09.R, genomic survey ... sequence. 54 0.004 1 DE086252 |DE086252.1 Oryzias ... latipes DNA, clone: ola1-188M19.F, genomic survey ... sequence. 54 0.004 1 DE283369 |DE283369.1 Oryzias ...

  18. 26 CFR 1.338-1 - General principles; status of old target and new target.

    Science.gov (United States)

    2010-04-01

    ... target; (iii) Section 108(e)(5) (relating to the reduction of purchase money debt); (iv) Section 45A...) Anti-abuse rule—(1) In general. The rules of this paragraph (c) apply for purposes of applying the... asset is used primarily in connection with target's activities. Applying the anti-abuse rule of...

  19. Cadmium-induced fetal toxicity in the rat

    International Nuclear Information System (INIS)

    Cadmium, a heavy metal environment contaminant, induces fetal death and placental necrosis in the Wistar rat. This study investigated fetal, maternal, and placental responses to cadmium intoxication. Subcutaneous injection of CdCl2 to dams on day 18 of pregnancy produced a high incidence of fetal death (75%) and placental necrosis. Death in the fetus was produced despite limited fetal accumulations of cadmium. Distribution studies using 109Cd-labeled CdCl2 demonstrated that less than 0.1% of the injected dose was associated with the fetus. To determine if fetuses were sensitive to these low levels of cadmium, direct injections of CdCl2 into fetuses were performed in utero. Direct injections produced fetal accumulations 8-fold greater than those following maternal injections. The 8-fold greater fetal accumulations following direct injection were associated with only a 12% fetal mortality compared to the 75% mortality following maternal injections. The data indicated that the fetal toxicity of cadmium following maternal injections was not the result of direct effects of cadmium on the fetus. In conclusion, cadmium-induced fetal death was not the result of direct effects of cadmium on the fetus but may have been induced by placental cellular injury resulting from high accumulations of cadmium in the placenta. A vascular response to placental injury, leading to decreased utero-placental bood flow and cadmium-induced alterations in trophoblastic function, resulted in fetal death

  20. Cadmium and lead elimination through milk in the ewe

    Energy Technology Data Exchange (ETDEWEB)

    Houpert, P.; Mehennaoui, S.; Federspiel, B.; Milhaud, G. [Equipe associee INRA-ENV Alfort, 94 - Maisons-Alfort (France)

    1997-12-31

    Cadmium and lead are heavy metals widely distributed in industrialized countries, and known for their cumulative properties in continental ecological cycling. The purpose of the experiments was to study lead and cadmium transfer from ewe feed to their milk and meat, in view of protecting human consumers. Ewes were given daily oral administrations of lead, cadmium or associations of lead-cadmium, lead-cadmium-zinc for 52 days. Lead and cadmium were measured in blood, milk and tissues. About 0.1 pc of the total lead and 0.002-0.004 pc of the total cadmium dose was excreted via milk during the lactation, with milk concentrations of about 120 microgram per liter for lead and about 3.5 micro-g./l for cadmium. Sixty days after the last administration, 0.16 pc of the total cadmium dose was retained in liver and 0.09 pc in kidneys. Cadmium and lead concentrations in the muscle remained low

  1. Modelling of Cadmium Transport in Soil-Crop System

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    A model for simulating cadmium transport in a soil-plant system was built using a commercial simu lating program named Powersim on the basis of input-output processes happening in the soil-plant system.Convective and dispersive transport processes of cadmium in soil profile are embedded. Simulations on a daily base have been done up to a total simulating time of 250 years. Results show that applications of sewage sludge and fertilizer at the simulated rates would only cause slight cadmium accumulations in each layer of the soil, and cadmium accumulation would be levelling off, reaching an equilibrium concentrations layer by layer downward after certain time. The time scale to reach an equilibrium concentration varies from 10 years for the top three layers to over 250 years for the bottom layers. Plant cadmium uptake would increase from 52 ug m-2 under initial soil cadmium concentrations to 65 μg m-2 under equilibrium soil cadmium concentrations, which would not exceed the maximum allowable cadmium concentration in wheat grains. Main parameters which influence cadmium accumulation and transport in soil are total cadmium input, rainfall, evaporation, plant uptake and soil properties.

  2. Accumulation of cadmium in livers and kidneys in Greenlanders

    International Nuclear Information System (INIS)

    In the Arctic, the traditional diet exposes its people to a very high intake of cadmium because it is highly concentrated in the liver and kidneys of commonly eaten marine mammals. In one study in Greenland, the cadmium intake was estimated to 182 μg/day/person in the fall and 346 in the spring. To determine whether the cadmium is accumulated in humans, we analyzed autopsy samples of liver and kidneys from 95 ethnic Greenlanders (aged 19-89) who died from a wide range of causes. The cadmium concentration in liver (overall mean 1.97 μg/g wet wt) appeared to be unrelated to any particular age group, whereas the concentrations in the kidneys peaked in Greenlanders between 40 and 50 years of age (peak concentration 22.3 μg/g wet wt). Despite the high cadmium levels in the typical Greenlander diet, we found that the cadmium concentrations in livers and kidneys were comparable to those reported from Denmark, Sweden, Australia and Great Britain. Furthermore, even though the mean cadmium intake from the diet was estimated to be 13-25 times higher in Greenlanders than in Danes, we found similar cadmium levels in the kidneys of both. Seal livers and kidneys are the main source of cadmium in the diet of Greenlanders, but these tissues are not eaten in Denmark. Thus, our results suggest that the accumulation of cadmium from Greenlander's marine diet is very low

  3. Investigation of the influence of cadmium processing on zinc gallium oxide:manganese thin films for photoluminescent and thin film electroluminescent applications

    Science.gov (United States)

    Flynn, Michael John

    Cadmium processing of ZnGa2O4 films provides a new fabrication route for phosphor powders and thin films. It relies on the enhanced diffusion due to the large vacancy concentration left by the sublimation of cadmium. Photoluminescent powders can be made with a single high temperature firing. Thin film devices can be processed at a significantly lower temperature, expanding the range of available substrates. Powders and thin films of ZnGa2O4:Mn were fabricated using starting materials in which between 0% and 50% of the ZnO was substituted by CdO. It was found that the emission spectra of the various compositions was unaffected by the change in composition, peaking at 504 nm, with the colour coordinates x = 0.08 and y = 0.69. The invariance of the emission spectrum is due to the spinel crystal structure exhibited by the compound. However, the maximum PL brightness was obtained from powders in which 10% of the ZnO had been substituted by CdO in the starting materials. The improved brightness is the result of better manganese incorporation which resulted from CdO sublimation during processing. This left a large vacancy concentration which enhanced the diffusion, and hence the manganese incorporation. In the case of thin films sputtered from cadmium processed targets, the composition of the films as deposited closely mirrored that of the target starting materials. The as deposited films were not luminescent and had to be annealed in vacuum in order to activate the manganese. EDX of these films showed that all of the cadmium had sublimed during the anneal. Very long anneal times also resulted in the loss of zinc. The decomposition products were amorphous or nanocrystalline. These films had an identical PL emission to the powders. The loss of cadmium correlated with the onset of bright 254 nm photoluminescence in the films, indicating that cadmium loss aided in the activation of the manganese. This was the result of the enhanced diffusion due to the large vacancy

  4. Cadmium uptake in oyster isognomon alatus under laboratory condition

    International Nuclear Information System (INIS)

    The uptake of cadmium in Flat tree oyster Isognomon alatus was investigated under controlled laboratory conditions for two weeks. Oysters were exposed to 100 μg 1'-1 cadmium and the accumulation of cadmium in the tissues was measured for every two days. Soft tissues of oyster were digested in concentrated acid and cadmium concentrations were determined by using Atomic Absorption Spectrophotometer. The accumulation of cadmium in the soft tissues of oysters was increased during the first six days from 0.73 μg g- 1 to 10.77 μg g'-1, and remaining constant for four days at average level of 10.96 μg g'-1. The Cl concentrations was increased to 32.70 μg g'-1 until the end of experiment. There was no sign of cadmium accumulation approaching saturation for the period of exposure. (author)

  5. Study on electrokinetic remediation of cadmium contaminated soils

    Institute of Scientific and Technical Information of China (English)

    SHI Wen-xin; CUI Chong-wei; YU Shui-li; FENG Wei-ming

    2007-01-01

    Kaolinite from a lead-zinc mining district, which was spiked with cadmium, has been treated by electrokinetics to investigate effects of treatment time and applied voltage gradient. The results showed that the increased test duration had induced a higher removal rate of cadmium. Being treated for 7 days, cadmium was removed from kaolinite dramatically. It was also found that higher removal rate happened when a higher voltage gradient was applied and cadmium accumulated near the cathode because pH increased. Increase of pH near the cathode caused accumulation of cadmium. Moreover, it was observed that cation exchange membrane which was placed between kaolinite and cathode could make pH lower than the initial value and avoid the higher pH near the cathode. As a result, the high concentration accumulation of cadmium near the cathode was avoided.

  6. Assessment and management of risk to wildlife from cadmium

    International Nuclear Information System (INIS)

    Cadmium, a nonessential heavy metal that comes from natural and anthropogenic sources, is a teratogen, carcinogen, and a possible mutagen. Assessment of potential risk from cadmium requires understanding environmental exposure, mainly from ingestion, although there is some local exposure through inhalation. Chronic exposure is more problematic than acute exposure for wildlife. There is evidence for bioaccumulation, particularly in freshwater organisms, but evidence for biomagnification up the food chain is inconsistent; in some bird studies, cadmium levels were higher in species that are higher on the food chain than those that are lower. Some freshwater and marine invertebrates are more adversely affected by cadmium exposure than are birds and mammals. There is very little experimental laboratory research on the effects of cadmium in amphibians, birds and reptiles, and almost no data from studies of wildlife in nature. Managing the risk from cadmium to wildlife involves assessment (including ecological risk assessment), biomonitoring, setting benchmarks of effects, regulations and enforcement, and source reduction

  7. Research and Development of Cadmium Sulphoselenide Red Pigment

    Institute of Scientific and Technical Information of China (English)

    WU Jianfeng; LI Kun; XU Xiaohong; ZHANG Yaxiang; XU Xiaoyang; LAO Xinbin

    2015-01-01

    Cadmium sulphoselenide was synthesized continuous substitution solid solution and the only known pigment to yield bright red color on ceramic decoration. Encapsulated cadmium sulphoselenide pigments could yield abundant hues from yellow to red with high opacity at high temperature. The color generation has a linear function relation with the substitution rate. The encapsulation formation process of zirconium silicate encapsulated cadmium sulphoselenide was shown. Insufifcient encapsulation efifciency and potential hazard to human and environment had limited the industrial application of cadmium sulphoselenide red pigment. Ink-jet printing decoration required ifne size cadmium sulphoselenide red pigment on ceramic decoration. The review mainly focused on the synthesis techniques and industrial application of cadmium sulphoselenide red pigment.

  8. Cadmium filtered neutron flux determination. Comparison of activation methods

    International Nuclear Information System (INIS)

    Neutron fluxes under cadmium filters are determined by the cadmium ratio and sandwich activation methods. The thermal neutron flux levels obtained with 7 detectors of different kinds: In, Au, Ag, W, Co, Mn, Zn are compared. The cadmium ratio method was used in locations for which the epithermal and thermal neutron flux ratio are quite different. By irradiating materials under different thicknesses of cadmium it was possible to establish experimental curves from which the flux depression factors for intermediate neutrons may be determined whatever the thickness of the filter used. Whereas the cadmium ratio method can only measure the mean flux above the cadmium cut-off energy the sandwich method enables the flux value to be determined in a narrow band around the resonance energy of each detector used

  9. 30 CFR 206.108 - Does MMS protect information I provide?

    Science.gov (United States)

    2010-07-01

    ... Section 206.108 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR MINERALS REVENUE MANAGEMENT PRODUCT VALUATION Federal Oil § 206.108 Does MMS protect information I provide? Certain... Interior at 43 CFR part 2....

  10. In search of biomonitors for cadmium: cadmium content of wild Swedish fauna during 1973-1976.

    Science.gov (United States)

    Frank, A

    1986-12-01

    Forty-five species of birds and 22 species of mammals of the terrestrial and aquatic fauna, herbivores as well as carnivores, were investigated during the period 1973-1976 for cadmium-accumulating properties in order to find biomonitors for cadmium in the Swedish environment. The herbivores of the terrestrial fauna, birds as well as mammals, are preferred to carnivores, since they demonstrate generally higher renal Cd levels. The moose (Alces alces), roe deer (Capreolus capreolus) and hare (Lepus europeus and Lepus timidus) were found to be suitable as biomonitors because of their common occurrence and uniform geographical distribution. The eider duck (Somateria mollissima), although a short-distance migrating bird whose diet is composed mainly of mussels and crustaceans, and which lives along a great part of the Swedish coastline, is suggested as a biomonitor of cadmium for the aquatic environment. The accumulation rate of cadmium in the kidneys is rapid. Renal levels of cadmium in the parts per million range are reached 10 weeks after hatching. Juvenile birds should be collected for monitoring purposes before leaving their feeding domains at the end of the summer. PMID:3810147

  11. Growth of cadmium oxide whiskers on cadmium sulphide single crystals with copper as growth activator

    International Nuclear Information System (INIS)

    Some results on the growth and morphology of cadmium oxide whiskers, obtained on cadmium sulphide single crystals with copper as a growth activator, are presented in this work. Cadmium oxide whiskers have been obtained on brace 112-bar0 brace faces of cadmium sulphide plates with a copper layer deposited in advance. The whiskers grew during the annealing of the plates in a weak stream of technically pure argon at temperatures 670 to 730 deg C for 15 min to 3.5 h. Details about the procedure have been given elsewhere. The composition and morphology of the whiskers have been studied by an X-ray microanalyser JEOL 35 DDS and a scanning electron microscope JEOL, JSM 35. The optical microscopic observations have shown that after annealing, a gray-black granular layer is formed on the cadmium sulphide single crystals and this layer can easily be separated from the crystal substrate. Under the granular layer the crystal is heavily damaged. The whiskers grow on the granular layer and they are coloured yellow-brown or red-brown. The maximum whisker length attains several hundreds of micrometres and in some cases up to 1 mm or more. (author)

  12. Growth of cadmium oxide whiskers on cadmium sulphide single crystals with copper as growth activator

    Energy Technology Data Exchange (ETDEWEB)

    Koparanova, N.; Simov, S. (Bylgarska Akademiya na Naukite, Sofia. Inst. po Fizika na Tvyrdoto Tyalo); Genchev, D. (Bylgarska Akademiya na Naukite, Sofia. Inst. za Yadrena Izsledvaniya i Yadrena Energetika); Metchenov, G. (Research Inst. of Criminalistics and Criminology, Sofia (Bulgaria))

    1985-02-01

    Some results on the growth and morphology of cadmium oxide whiskers, obtained on cadmium sulphide single crystals with copper as a growth activator, are presented in this work. Cadmium oxide whiskers have been obtained on brace 112-bar0 brace faces of cadmium sulphide plates with a copper layer deposited in advance. The whiskers grew during the annealing of the plates in a weak stream of technically pure argon at temperatures 670 to 730 deg C for 15 min to 3.5 h. Details about the procedure have been given elsewhere. The composition and morphology of the whiskers have been studied by an X-ray microanalyser JEOL 35 DDS and a scanning electron microscope JEOL, JSM 35. The optical microscopic observations have shown that after annealing, a gray-black granular layer is formed on the cadmium sulphide single crystals and this layer can easily be separated from the crystal substrate. Under the granular layer the crystal is heavily damaged. The whiskers grow on the granular layer and they are coloured yellow-brown or red-brown. The maximum whisker length attains several hundreds of micrometres and in some cases up to 1 mm or more.

  13. Oral cadmium exposure of adults in Germany. 1: Cadmium content of foodstuffs and beverages.

    Science.gov (United States)

    Müller, M; Anke, M; Hartmann, E; Illing-Günther, H

    1996-04-01

    The cadmium contents of 94 and 105 foodstuffs bought in six-fold repetition in 1988 and in nine-fold repetition in 1991, respectively were analysed within the framework of a market-basket study. These foodstuffs were typical of German eating habits. Additionally, 170 samples of drinking water were investigated. The cadmium concentrations of the foodstuffs were comparable with results of recent studies carried out in Europe and North America. Fruit, milk and dairy products, sugar and sugar-rich foodstuffs as well as beverages showed mean cadmium contents cakes and pastries as well as farinaceous products were within the range of 20-40 ng/g. The most important bread, cakes and pastries (wheat and rye bread, toasted bread, rolls) contained 25-35 ng/g. A median cadmium concentration of 0.2 micrograms/l was found in the drinking water. As expected, liver and kidneys showed the highest cadmium levels of 73 and 204 ng/g, respectively on average. PMID:8718751

  14. Urinary cadmium and mammographic density in premenopausal women.

    Science.gov (United States)

    Adams, Scott V; Newcomb, Polly A; Shafer, Martin M; Atkinson, Charlotte; Bowles, Erin J Aiello; Newton, Katherine M; Lampe, Johanna W

    2011-08-01

    Mammographic density (MD), a strong marker of breast cancer risk, is influenced by genetic, environmental, and hormonal factors. Cadmium, a persistent and widespread environmental pollutant, has been associated with risk of breast cancer, and laboratory evidence suggests cadmium is a carcinogen in the breast. We investigated the hypothesis that cadmium exposure is associated with higher MD. In a cross-sectional study of MD and urinary cadmium concentration, percentage MD (MD%) and Breast Imaging-Reporting and Data Systems (BI-RADS®) density category were determined from screening mammograms of 190 premenopausal women ages 40-45 years. Women completed a health questionnaire, and the cadmium content of spot urine samples was measured with inductively coupled plasma mass spectrometry and corrected for urine creatinine. Urinary cadmium concentrations are thought to reflect exposure to cadmium during a period of 20-30 years. Multivariable linear regression and logistic regression were used to estimate the strength of association between urinary cadmium and mammographic breast density. Adjusted mean MD% among women in the upper tertile of creatinine-corrected urinary cadmium was 4.6% higher (95% CI: -2.3 to 11.6%) than in women in the lowest cadmium tertile. Each twofold increase in urinary cadmium was associated with higher odds of MD% in the upper tertile (OR: 1.29, 95% CI: 0.82-2.02) or a BI-RADS category rating of "extremely dense" (OR: 1.75, 95% CI: 1.14-2.70). Stronger associations were observed among nulliparous women, and current or former smokers. Exposure to cadmium may be associated with increased breast density in premenopausal women. PMID:21327468

  15. The effects of low environmental cadmium exposure on bone density

    International Nuclear Information System (INIS)

    Recent epidemiological data indicate that low environmental exposure to cadmium, as shown by cadmium body burden (Cd-U), is associated with renal dysfunction as well as an increased risk of cadmium-induced bone disorders. The present study was designed to assess the effects of low environmental cadmium exposure, at the level sufficient to induce kidney damage, on bone metabolism and mineral density (BMD). The project was conducted in the area contaminated with cadmium, nearby a zinc smelter located in the region of Poland where heavy industry prevails. The study population comprised 170 women (mean age=39.7; 18-70 years) and 100 men (mean age=31.9; 18-76 years). Urinary and blood cadmium and the markers of renal tubular dysfunction (β2M-U RBP, NAG), glomerular dysfunction (Alb-U and β2M-S) and bone metabolism markers (BAP-S, CTX-S) as well as forearm BMD, were measured. The results of this study based on simple dose-effect analysis showed the relationship between increasing cadmium concentrations and an increased excretion of renal dysfunction markers and decreasing bone density. However, the results of the multivariate analysis did not indicate the association between exposure to cadmium and decrease in bone density. They showed that the most important factors that have impact on bone density are body weight and age in the female subjects and body weight and calcium excretion in males. Our investigation revealed that the excretion of low molecular weight proteins occurred at a lower level of cadmium exposure than the possible loss of bone mass. It seems that renal tubular markers are the most sensitive and significant indicators of early health effects of cadmium intoxication in the general population. The correlation of urinary cadmium concentration with markers of kidney dysfunction was observed in the absence of significant correlations with bone effects. Our findings did not indicate any effects of environmental cadmium exposure on bone density.

  16. Evaluation of aluminium–based coatings for cadmium replacement

    OpenAIRE

    Chalaftris, George

    2003-01-01

    Cadmium electroplating is widely used in the aerospace industry for the corrosion protection of aircraft components like fasteners manufactured from non corrosion resisting high strength steels. However, environmental and safety concerns over the high toxicity of cadmium and its compounds have led to the investigation of suitable replacements. Alternatives to cadmium should offer effective corrosion protection and have no detrimental effects on the steel substrate. Hydrogen is known to be abs...

  17. Hepatotoxicity of Cadmium and Roles of Mitigating Agents

    Directory of Open Access Journals (Sweden)

    Elias Adikwu

    2013-12-01

    Full Text Available There are increasing reports on cadmium associated hepatotoxicity, due to these reports this study reviewed relevant literature on cadmium associated hepatotoxicity with emphasis on doses, route of administration, salt forms (cadmium compounds and the roles of mitigating agents. Reports have shown that continuous exposure of the liver to cadmium has led to hepatotoxicity. Humans are generally exposed to cadmium by two main routes, inhalation and ingestion. In this study, evaluation of relevant literature showed that irrespective of route of administration and salt forms cadmium hepatotoxicity is dose and time dependent. Cadmium associated hepatotoxicity manifested through impaired functions of hepatic biomarkers (transaminases, enzymatic and non enzymatic antioxidants. Histopathological damage to liver architecture manifested as swelling of hepatocytes, focal necrosis, hepatocytes degeneration, dilatation of ribosomes, damage of membrane-bounded lysosomes, nuclear pyknosis and cytoplasm vacuolization. Deterioration of mitochondrial cristae, deposition of collagen fibrils, hypertrophy of kuffer cells, congestion in central veins and sinusoids, infiltration of mixed inflammatory cells and peripheral hemorrhage also occurred. Hepatotoxic effect of cadmium was mitigated by Vitamin C, Vitamin E, Manganese (11 Chloride, N-acetylcysteine and Selenium. Extracts of plant origin including Solanum tuberosum, Calycopteris floribunda Hibiscus sabdariffa mitigated cadmium induced hepatotoxicity. Chemical substances of animal origin including honey and camel milk were reported to have ameliorated cadmium induced hepatotoxicity. One of the mechanisms of cadmium induced hepatotoxicity is reported to be associated with the up regulation of reactive oxygen species (oxidative stress which caused oxidative damage to lipid contents of membranes and direct liver injury. Conclusion cadmium is dose and time dependently hepatotoxic irrespective of route of administration

  18. Cadmium burden and the risk and phenotype of prostate cancer

    OpenAIRE

    Wu Tony T; Wu Hsi-Chin; Pu Yeong S; Chen Yi-Chun; Lai Ming; Yang Chun Y; Sung Fung-Chang

    2009-01-01

    Abstract Background Studies on the association between prostate cancer and cadmium exposure have yielded conflicting results. This study explored cadmium burden on the risk and phenotype of prostate cancer in men with no evident environmental exposure. Methods Hospital-based 261 prostate cancer cases and 267 controls with benign diseases were recruited from four hospitals in Taiwan. Demographic, dietary and lifestyle data were collected by standardized questionnaires. Blood cadmium (BCd) and ...

  19. Association of Environmental Cadmium Exposure with Pediatric Dental Caries

    OpenAIRE

    Arora, Manish; Weuve, Jennifer Lynn; Schwartz, Joel David; Wright, Robert O.

    2008-01-01

    Background: Although animal experiments have shown that cadmium exposure results in severe dental caries, limited epidemiologic data are available on this issue. Objectives: We aimed to examine the relationship between environmental cadmium exposure and dental caries in children 6–12 years of age. Methods: We analyzed cross-sectional data, including urine cadmium concentrations and counts of decayed or filled tooth surfaces, from the Third National Health and Nutrition Examination Survey. We ...

  20. Assessment of soil contamination. Measuring devices for arsenic, berryllium, lead, cadmium, mercury and selenium. Wirkung von Bodenkontaminationen. Messlatten fuer Arsen, Beryllium, Blei, Cadmium, Quecksilber und Selen

    Energy Technology Data Exchange (ETDEWEB)

    Blumenbach, D.; Kloke, A.; Luehr, H.P.

    1991-12-01

    To assess soil contamination with respect to the suitability of the site concerned, it is essential to obtain knowledge of the relationship between soil contamination levels and the effect of the contaminants on a targets meriting protection (e.g. human beings, plants, soil organisms). In this final report, data obtained from literature on the inorganic pollutants arsenic, lead, cadmium, mercury, selenium and beryllium are compiled, and for selected targets an overview is given of the damage occurring at the various concentration levels studies. The present data, together with information on the envisaged use of the site and on soil properties influencing the pollutant's transport to the protected target, can be used to assess soil quality. Threshold values for use in decision-making cannot be derived directly from the presented data, as such data can only convey a picture of the range of the harmful concentrations given in the literature. (orig.).

  1. studies on the use of organic and inorganic ion exchangers for separation of indium(III) from cadmium(II) using analytical methods

    International Nuclear Information System (INIS)

    Organic and inorganic ion exchangers have many applications not only in the industrial, environmental and the nuclear fields but also in the separation of metal ions. This may be returned to its high measured capacity, high selectivity for some metal ions, low solubility, high chemical radiation stability and easy to use.Indium and cadmium are produced from cyclotron target where the solvent extraction represents an ordinary method for separation of indium and cadmium from its target. In the present work, More than chromatographic columns were successfully used for the separation and recovery of indium(III) and cadmium(II) ions from di-component system in aqueous solution using organic and inorganic ion exchangers. The work was carried out in three main parts;1- In the first part, the commercial resin (Dowex50w-x8) was used for the separation of indium from cadmium. The effect of pH, the weight of resin, and equilibrium time on the sorption process of both metal ions were determined. It was found that the adsorption percentage was more than 99% at pH 4 (as optimum pH value) using batch experiment. The results show that indium was first extracted while cadmium is slightly extracted at this pH value. The recovery of indium and cadmium is about 98% using hydrochloric acid as best eluent. The ion exchange/complexing properties of Dowex50w-x8 resin containing various substituted groups towards indium and cadmium cations were investigated.2- In the second part, Zn(II)polymethacrylates, and poly (acrylamide-acrylic acid), as synthetic organic ion exchangers were prepared by gamma irradiation polymerization technique of the corresponding monomer at 30 kGy. The obtained organic resins were mixed with indium ions to determine its capacity in aqueous solutions using batch experiment.

  2. Extraction-photometric determination of cadmium in meat products

    Energy Technology Data Exchange (ETDEWEB)

    Krylova, A.N.; Malyarova, M.A.; Zhulenko, V.N.

    1986-06-01

    As a result of industrial discharges, burning of solid and liquid fuels, and recycling of metal scrap, cadmium compounds enter the atmosphere and drop into the water and soil causing contamination. In this paper, a method was developed for determining cadmium in meat products. It involves wet ashing the sample, extractive separation of the cadmium as the diethyldithiocarbamate, reextraction, and determination as cadmium dithizonate or as a complex with 2,2'-dipyridyl. The detection limit with dithizone is 0.005 mg/kg and with 2,2'-dipyridyl 0.05 mg/kg. An analysis is shown to take less than 60 minutes.

  3. Effects of Cadmium on BMP Induced Bone Formation

    Institute of Scientific and Technical Information of China (English)

    陈秋生; 徐顺清

    2003-01-01

    To demonstrate the direct effects of cadmium on activities of bone morphogenetic protein (BMP), a complex containing BMP and cadmium chloride (CdCl2) was implanted beneath the abdominal skin of young male Wistar rats. The activity of BMP was studied by observing the histological changes, and measuring the activity of alkaline phosphatase (ALP) and acid phosphatase (ACP) and calcium content of the implants at different time points. Our results showed that during bone formation induced by BMP, cadmium inhibited the activities of osteoblasts and osteoclasts, and slowed the deposition of calcium. It is concluded that cadmium can directly affect biological activities of BMP directly.

  4. Bioremoval of cadmium by lemna minor in different aquatic conditions

    Energy Technology Data Exchange (ETDEWEB)

    Uysal, Yagmur [Dept. of Environmental Engineering, Kahramanmaras Sutcu Imam University, Kahramanmaras (Turkey); Taner, Fadime [Dept. of Environmental Engineering, Mersin University, Mersin (Turkey)

    2010-04-15

    This study was undertaken to determine the cadmium removal efficiency of Lemna minor when it was used for treatment of wastewater having different characteristics, i. e., pH, temperature and cadmium concentration. Plants were cultivated in different pH solutions (4.5-8.0) and temperatures (15-35 C) in the presence of cadmium (0.1-10.0 mg/L) for 168 h. The amount of biomass obtained in the study period, the concentrations of cadmium in the tissues and in the media and net uptake of cadmium by Lemna have been determined for each condition. The percentages of cadmium uptake (PMU) and bioconcentration factors (BCF) were also calculated. The highest accumulation was obtained for the highest cadmium concentration of 10.0 mg Cd/L as 11.668 mg Cd/g at pH 6.0, and as 38.650 mg Cd/g at 35 C and pH 5.0. The cadmium accumulation gradually increased with initial concentration of the medium, but the opposite trend was observed for the PMU. However, the maximum PMU was obtained as 52.2% in the solution with the lowest concentration of 0.1 mg Cd/L. A mathematical model was used to describe the cadmium uptake and the equation obtained was seen to fit the experimental data very well. (Abstract Copyright [2010], Wiley Periodicals, Inc.)

  5. Kinetic studies of cadmium sulfide precipitation from aqueous thiourea solutions

    International Nuclear Information System (INIS)

    Kinetics of cadmium sulfide precipitation by thiourea from aqueous solutions containing ammonia complexes of cadmium(II) under conditions of spontaneous initiation of solid phase within solution volume at temperatures of 298-318 K was studied. It was ascertained that the process activation energy is 77843 J/mol, while the reaction order by initial cadmium complex equals unity. Kinetic equation, which permits control over cadmium sulfide precipitation and preparation of CdS films of desired morphology was derived on the basis of the experimental data

  6. Cadmium elemination from phosphoric acid by ionic flotation

    International Nuclear Information System (INIS)

    The ion flotation process for the recovery of cadmium from wet phosphoric acid (30%P2O5) has been studied. This technique combines a chemical recation between the collector and the cadmium to form a precipitate (sublate) which is carried to the surface of the solution by air bubbles. the resulting foam containing the cadmium may then separated from solution. The influence of parameters such as collector and cadmium concentration as well as iron content have been investigated for the case a synthetic acid (30% P2O5). The result have been applied to the industrial phosphoric acid produced from Djebel Onk's phosphates (Algeria)

  7. Cadmium in milk and mammary gland in rats and mice

    International Nuclear Information System (INIS)

    The purpose of the present investigation was to study the uptake of cadmium in mammary tissue, effects on milk secretion and composition, and lactational transport of cadmium to the sucklings. Cadmium exposure during lactation resulted in retention of cadmium in the mammary tissue in mice and rats. The uptake of cadmium in the mammary tissue was rapid, as shown in lactating mice by whole-body autoradiography 4 h after an intravenous injection of a tracer dose of 109CdCl2. Retention of cadmium in kidneys of suckling pups was observed in the autoradiograms at 7 days after exposure of the dams. Lactating rats were intravenously infused with 109CdCl2 in 0.9% saline via osmotic minipumps from day 3 to day 16 after parturition. The cadmium dose given was 0, 8.8, 62 and 300 μg Cd/kg body wt. per day. Plasma and milk were collected at day 10 and 16 after parturition. Plasma cadmium levels in dams increased from day 10 to day 16. Cadmium levels were higher in milk than in plasma, with milk/plasma ratios varying from 2 to 6. Zinc levels in milk were positively correlated to cadmium levels in milk (r2=0.26; P=0.03). In milk, 109Cd was distributed in fat (46-52%), casein fraction (40-46%), and whey fraction (6-8%). There was a high correlation between cadmium concentrations in pups' kidney and cadmium concentrations in dam's milk (r2=0.98; P 109Cd was bound to metallothionein in mammary tissue. The fraction of radiolabelled cadmium bound to metallothionein increased in a dose-dependent manner in both the liver (88-98%) and mammary tissue (57-80%). The present results indicate a low transfer of cadmium to the suckling pup, which might be due to binding of cadmium to metallothionein in the mammary tissue. However, during the susceptible developmental period even a low cadmium exposure may be of concern. (orig.)

  8. 13 CFR 108.210 - Minimum capital requirements for NMVC Companies.

    Science.gov (United States)

    2010-01-01

    ... NMVC Companies. 108.210 Section 108.210 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION... Company § 108.210 Minimum capital requirements for NMVC Companies. You must have Regulatory Capital of at least $5,000,000 and Leverageable Capital of at least $500,000 to become a NMVC Company....

  9. 13 CFR 108.506 - Safeguarding the NMVC Company's assets/Internal controls.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Safeguarding the NMVC Company's assets/Internal controls. 108.506 Section 108.506 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW MARKETS VENTURE CAPITAL (âNMVCâ) PROGRAM Managing the Operations of a NMVC Company General Requirements § 108.506 Safeguarding the...

  10. 42 CFR 412.108 - Special treatment: Medicare-dependent, small rural hospitals.

    Science.gov (United States)

    2010-10-01

    ... hospitals. 412.108 Section 412.108 Public Health CENTERS FOR MEDICARE & MEDICAID SERVICES, DEPARTMENT OF HEALTH AND HUMAN SERVICES MEDICARE PROGRAM PROSPECTIVE PAYMENT SYSTEMS FOR INPATIENT HOSPITAL SERVICES... § 412.108 Special treatment: Medicare-dependent, small rural hospitals. (a) Criteria for...

  11. 46 CFR 108.441 - Piping and discharge rates for CO2 systems.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Piping and discharge rates for CO2 systems. 108.441... Systems § 108.441 Piping and discharge rates for CO2 systems. (a) The size of branch lines to spaces protected by a CO2 system must meet Table 108.441. (b) Distribution piping within a space must...

  12. 46 CFR 108.133 - Hull superstructure, structural bulkheads, decks, and deckhouses.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Hull superstructure, structural bulkheads, decks, and deckhouses. 108.133 Section 108.133 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Construction and Arrangement Structural Fire Protection § 108.133 Hull...

  13. 46 CFR 108.139 - Boundary bulkheads and decks of a space containing emergency power.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Boundary bulkheads and decks of a space containing emergency power. 108.139 Section 108.139 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Construction and Arrangement Structural Fire Protection § 108.139 Boundary bulkheads and...

  14. 46 CFR 108.135 - Boundary bulkheads, decks of galleys, and combustible material lockers.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Boundary bulkheads, decks of galleys, and combustible material lockers. 108.135 Section 108.135 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Construction and Arrangement Structural Fire Protection § 108.135 Boundary...

  15. 46 CFR 108.137 - Bulkhead and deck separations of accommodation spaces.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Bulkhead and deck separations of accommodation spaces. 108.137 Section 108.137 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Construction and Arrangement Structural Fire Protection § 108.137 Bulkhead and deck separations...

  16. 13 CFR 108.800 - Financings in the form of equity interests.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Financings in the form of equity interests. 108.800 Section 108.800 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW MARKETS...'s Financing of Eligible Small Businesses § 108.800 Financings in the form of equity interests....

  17. 13 CFR 108.710 - Requirement to finance Low-Income Enterprises.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Requirement to finance Low-Income Enterprises. 108.710 Section 108.710 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW MARKETS... Eligibility of A Small Business for Nmvc Financing § 108.710 Requirement to finance Low-Income Enterprises....

  18. 48 CFR 9.108-2 - Relationship with the Internal Revenue Code and Treasury regulations.

    Science.gov (United States)

    2010-10-01

    ... Internal Revenue Code and Treasury regulations. 9.108-2 Section 9.108-2 Federal Acquisition Regulations... Prospective Contractors 9.108-2 Relationship with the Internal Revenue Code and Treasury regulations. (a....C. 395, but also are similarly covered in the Internal Revenue Code at 26 U.S.C. 7874. A...

  19. 13 CFR 108.470 - SBA approval of merger, consolidation, or reorganization of NMVC Company.

    Science.gov (United States)

    2010-01-01

    ... Control Change in Structure of Nmvc Company § 108.470 SBA approval of merger, consolidation, or reorganization of NMVC Company. You may not merge, consolidate, change form of organization (corporation or..., consolidation, or reorganization of NMVC Company. 108.470 Section 108.470 Business Credit and Assistance...

  20. 13 CFR 108.510 - SBA approval of NMVC Company's Investment Adviser/Manager.

    Science.gov (United States)

    2010-01-01

    ... Investment Adviser/Manager. 108.510 Section 108.510 Business Credit and Assistance SMALL BUSINESS... and Compensation § 108.510 SBA approval of NMVC Company's Investment Adviser/Manager. You may employ an Investment Adviser/Manager who will be subject to the supervision of your board of...

  1. 17 CFR 256.108 - Accumulated provision for depreciation and amortization of service company property.

    Science.gov (United States)

    2010-04-01

    ... depreciation and amortization of service company property. 256.108 Section 256.108 Commodity and Securities... Accounts: Assets and Other Debit Accounts § 256.108 Accumulated provision for depreciation and amortization... 403, Depreciation and amortization expense. (b) At the time of retirement of depreciable...

  2. 13 CFR 108.1130 - Leverage fees payable by NMVC Company.

    Science.gov (United States)

    2010-01-01

    ... Company. 108.1130 Section 108.1130 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW MARKETS VENTURE CAPITAL (âNMVCâ) PROGRAM SBA Financial Assistance for NMVC Companies (Leverage) General Information About Obtaining Leverage § 108.1130 Leverage fees payable by NMVC Company. There is no fee for...

  3. 13 CFR 108.1900 - Termination of participation as a NMVC Company.

    Science.gov (United States)

    2010-01-01

    ... NMVC Company. 108.1900 Section 108.1900 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW MARKETS VENTURE CAPITAL (âNMVCâ) PROGRAM Ending Operations as a NMVC Company § 108.1900 Termination of participation as a NMVC Company. You may not terminate your participation as a NMVC...

  4. 13 CFR 108.503 - NMVC Company's adoption of an approved valuation policy.

    Science.gov (United States)

    2010-01-01

    ... approved valuation policy. 108.503 Section 108.503 Business Credit and Assistance SMALL BUSINESS... Requirements § 108.503 NMVC Company's adoption of an approved valuation policy. (a) Valuation guidelines. You must prepare, document and report the valuations of your Loans and Investments in accordance with...

  5. 13 CFR 108.620 - Requirements to obtain information from Portfolio Concerns.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Requirements to obtain information from Portfolio Concerns. 108.620 Section 108.620 Business Credit and Assistance SMALL BUSINESS... requirements of § 108.600 and must be in English. (a) Information for initial Financing decision....

  6. 13 CFR 108.1940 - Procedures for designation of additional Low-Income Geographic Areas

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Procedures for designation of additional Low-Income Geographic Areas 108.1940 Section 108.1940 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW MARKETS VENTURE CAPITAL (âNMVCâ) PROGRAM Miscellaneous § 108.1940 Procedures for designation of additional...

  7. 13 CFR 108.1840 - Computation of NMVC Company's Capital Impairment Percentage.

    Science.gov (United States)

    2010-01-01

    ... Capital Impairment Percentage. 108.1840 Section 108.1840 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW MARKETS VENTURE CAPITAL (âNMVCâ) PROGRAM NMVC Company's Noncompliance With Terms of Leverage Computation of Nmvc Company's Capital Impairment § 108.1840 Computation of NMVC Company's Capital...

  8. 13 CFR 108.585 - Voluntary decrease in NMVC Company's Regulatory Capital.

    Science.gov (United States)

    2010-01-01

    ...'s Regulatory Capital. 108.585 Section 108.585 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW MARKETS VENTURE CAPITAL (âNMVCâ) PROGRAM Managing the Operations of a NMVC Company Voluntary Decrease in Regulatory Capital § 108.585 Voluntary decrease in NMVC Company's Regulatory Capital. You...

  9. Phytoremediation of cadmium contaminated soils by tuberose

    International Nuclear Information System (INIS)

    The potential of three varieties of tuberose (Prajwal, Shringar and Mexican single) for phytoremediation of soil contaminated with cadmium was evaluated by subjecting the plants to five levels of Cd (0, 25, 50, 75 and 100 mg kg-1 soil). Applied Cd did not produce any toxic symptoms in all the three varieties of tuberose except marginal reduction in the photosynthesis rate and total dry weight beyond 50 mg Cd kg-1 soil. The study showed that tuberose possessed the typical ability of Cd hyper accumulator characterized by (1) accumulation of Cd in the shoots of the plant exceeding the critical judging standard i.e., 100 μg g-1 DW and (2) ratio of Cd in the shoots to bulbs >1. It was concluded that tuberose may be an effective accumulator plant for phytoremediation of cadmium polluted soils. (author)

  10. Collective nuclear structure of neutron rich 104-108Mo

    International Nuclear Information System (INIS)

    The recently extended level structure of 104-108Mo isotopes, with g-, γ- and the possible Kπ=4+2γ phonon band structures have been studied in the interacting boson model-1. The unique features of these Mo isotopes with large quadrupole deformation β2, and the γ-soft vibrational band structures as reflected in the γ-g B(E2) ratios have been reproduced. The evidence for the 2γ-phonon bands in 104,106Mo is discussed. (author)

  11. Collective Band Structures in Neutron-Rich 108Mo Nucleus

    Institute of Scientific and Technical Information of China (English)

    DING Huai-Bo; WANG Jian-Guo; XU Qiang; ZHU Sheng-Jiang; J. H. Hamilton; A. V. Ramayya; J. K. Hwang; Y. X. Luo; J. O. Rasmussen; I. Y. Lee; CHE Xing-Lai

    2007-01-01

    High spin states in the neutron-rich 108Mo nucleus are studied by measuring prompt γ-rays following the spontaneous fission of 252Cf with a Gammasphere detector array. The ground-state band is confirmed, and the one-phonon γ-vibrational band is updated with spin up to 12 h. A new collective band with the band head level at 1422.4 keV is suggested as a two-phonon γ-vibrational band. Another new band is proposed as a two-quasi-proton excitation band. Systematic characteristics of the collective bands are discussed.

  12. Study of the level structure of 108Ag

    Directory of Open Access Journals (Sweden)

    Sethi J.

    2014-03-01

    Full Text Available The high spin structure of 108Ag nucleus has been studied using the reaction 11B + 100Mo at 39 MeV with Indian National Gamma Array (INGA at TIFR-BARC accelerator facility. From the two- and higher-fold coincidence analysis of the emitted γ-rays, the level structure of the nucleus is built, with addition of around ∼ 60 new transitions. A new positive parity dipole band has been observed and significant additions have been made in the low spin region. A pair of nearly degenerate, negative parity, dipole bands is established, which is studied using the triaxial projected shell model (TPSM.

  13. Prevention of cadmium bioaccumulation by herbal adaptogens

    OpenAIRE

    K Bharavi; A. Gopala Reddy; G S Rao; Ravi Kumar, P.; D Srinivas Kumar; P Prabhu Prasadini

    2011-01-01

    Objectives : To evaluate the effect of various herbal adaptogens such as shade-dried powders of Withania somnifera, Ocimum sanctum, Asperagus recemosus, Andrographis paniculata, Asphaltum panjabinum (Shilajith), Gymnema sylvestre, Spirulina platensis, and Panex ginseng on cadmium (Cd)-induced oxidative stress and its accumulation in broiler chicken. Materials and Methods : A total of 80 male broiler chicks of day old age were randomly assigned to 10 equal groups. Group 1 birds were fed wi...

  14. ELECTROKINETIC REMEDIATION STUDY FOR CADMIUM CONTAMINATED SOIL

    OpenAIRE

    P. Bala Ramudu; R. P. Tiwari; Srivastava, R. K.

    2007-01-01

    This paper presents the results of an experimental research undertaken to evaluate different purging solutions to enhance the removal of cadmium from spiked contaminated field soil by electrokinetic remediation. Three experiments were conducted when soil was saturated with deionised water and subsequently deionised water, ammonium citrate and sodium citrate were used as purging solutions at anode end. One experiment was conducted when the soil was saturated with ammonium citrate and itself wa...

  15. Electron mobility in mercury cadmium telluride

    Science.gov (United States)

    Patterson, James D.

    1988-01-01

    A previously developed program, which includes all electronic interactions thought to be important, does not correctly predict the value of electron mobility in mercury cadmium telluride particularly near room temperature. Part of the reason for this discrepancy is thought to be the way screening is handled. It seems likely that there are a number of contributors to errors in the calculation. The objective is to survey the calculation, locate reasons for differences between experiment and calculation, and suggest improvements.

  16. Bioaugmentation with cadmium-resistant plant growth-promoting rhizobacteria to assist cadmium phytoextraction by Helianthus annuus.

    Science.gov (United States)

    Prapagdee, Benjaphorn; Chanprasert, Maesinee; Mongkolsuk, Skorn

    2013-07-01

    Micrococcus sp. MU1 and Klebsiella sp. BAM1, the cadmium-resistant plant growth-promoting rhizobacteria (PGPR), produce high levels of indole-3-acetic acid (IAA) during the late stationary phase of their growth. The ability of PGPR to promote root elongation, plant growth and cadmium uptake in sunflowers (Helianthus annuus) was evaluated. Both species of bacteria were able to remove cadmium ions from an aqueous solution and enhanced cadmium mobilization in contaminated soil. Micrococcus sp. and Klebsiella sp. use aminocyclopropane carboxylic acid as a nitrogen source to support their growth, and the minimum inhibitory concentrations of cadmium for Micrococcus sp. and Klebsiella sp. were 1000 and 800mM, respectively. These bacteria promoted root elongation in H. annuus seedlings in both the absence and presence of cadmium compared to uninoculated seedlings. Inoculation with these bacteria was found to increase the root lengths of H. annuus that had been planted in cadmium-contaminated soil. An increase in dry weight was observed for H. annuus inoculated with Micrococcus sp. Moreover, Micrococcus sp. enhanced the accumulation of cadmium in the root and leaf of H. annuus compared to untreated plants. The highest cadmium accumulation in the whole plant was observed when the plants were treated with EDTA following the treatment with Micrococcus sp. In addition, the highest translocation of cadmium from root to the above-ground tissues of H. annuus was found after treatment with Klebsiella sp. in the fourth week after planting. Our results show that plant growth and cadmium accumulation in H. annuus was significantly enhanced by cadmium-resistant PGPRs, and these bacterial inoculants are excellent promoters of phytoextraction for the rehabilitation of heavy metal-polluted environments. PMID:23478127

  17. Bioavailability of cadmium from linseed and cocoa

    DEFF Research Database (Denmark)

    Hansen, Max; Rasmussen, Rie Romme; Sloth, Jens Jørgen

    2014-01-01

    the food authorities in order to give correct advises to the population. The aim of this study was to investigate the bioavailability of cadmium from whole linseed, crushed linseed, cocoa and cadmium chloride in rats. An experiment where 40 rats were divided into 4 groups and a control group and dosed...... with whole linseed, crushed linseed, cocoa and CdCl2 for 3 weeks was performed. Linseed or cocoa made up 10% of the feed (by weight) and was added as a replacement for carbohydrate source. The rats were dosed for 3 weeks and the cadmium content in the rats' kidneys was measured by ICPMS as a biomarker...... which could be measured in the kidney compared to the calculated total intake was as follows: Control 2.0 %, Crushed linseed 0.9 %, whole linseed, 1.5 %, cocoa 0.7 % and CdCl2 4.6 %. Based on this study it could not be concluded that the bioavailability in rats form whole linseed is lower that for...

  18. Soil ecotoxicity assessment using cadmium sensitive plants

    International Nuclear Information System (INIS)

    The crop plants, sorghum and cucumber, can be used as indicator species to assess ecotoxicity of soils contaminated by cadmium. - Four crop plant species (sweet corn, Zea may; wheat, Triticum aestivum; cucumber, Cucumis sativus; and sorghum, Sorghum bicolor) were tested to assess an ecotoxicity in cadmium-amended soils. The measurement endpoints used were seed germination and seedling growth (shoot and root). The presence of cadmium decreased the seedling growth. The medium effective concentration values (EC50) for shoot or root growth were calculated by the Trimmed Spearman-Karber method. Due to the greater accumulation of Cd to the roots, root growth was a more sensitive endpoint than shoot growth. Bioavailability and transport of Cd within plant were related to concentration and species. The ratio of bioaccumulation factor (BAF) in the shoots to the roots indicated high immobilization of Cd in the roots. Seed germination was insensitive to Cd toxicity, and is not recommended for a suitable assay. Among the test plants and test endpoints, root growth of sorghum and cucumber appears to be a good protocol to assess ecotoxicity of soils contaminated by Cd

  19. Soil ecotoxicity assessment using cadmium sensitive plants

    Energy Technology Data Exchange (ETDEWEB)

    An, Youn-Joo

    2004-01-01

    The crop plants, sorghum and cucumber, can be used as indicator species to assess ecotoxicity of soils contaminated by cadmium. - Four crop plant species (sweet corn, Zea may; wheat, Triticum aestivum; cucumber, Cucumis sativus; and sorghum, Sorghum bicolor) were tested to assess an ecotoxicity in cadmium-amended soils. The measurement endpoints used were seed germination and seedling growth (shoot and root). The presence of cadmium decreased the seedling growth. The medium effective concentration values (EC50) for shoot or root growth were calculated by the Trimmed Spearman-Karber method. Due to the greater accumulation of Cd to the roots, root growth was a more sensitive endpoint than shoot growth. Bioavailability and transport of Cd within plant were related to concentration and species. The ratio of bioaccumulation factor (BAF) in the shoots to the roots indicated high immobilization of Cd in the roots. Seed germination was insensitive to Cd toxicity, and is not recommended for a suitable assay. Among the test plants and test endpoints, root growth of sorghum and cucumber appears to be a good protocol to assess ecotoxicity of soils contaminated by Cd.

  20. The cotton MYB108 forms a positive feedback regulation loop with CML11 and participates in the defense response against Verticillium dahliae infection.

    Science.gov (United States)

    Cheng, Huan-Qing; Han, Li-Bo; Yang, Chun-Lin; Wu, Xiao-Min; Zhong, Nai-Qin; Wu, Jia-He; Wang, Fu-Xin; Wang, Hai-Yun; Xia, Gui-Xian

    2016-04-01

    Accumulating evidence indicates that plant MYB transcription factors participate in defense against pathogen attack, but their regulatory targets and related signaling processes remain largely unknown. Here, we identified a defense-related MYB gene (GhMYB108) from upland cotton (Gossypium hirsutum) and characterized its functional mechanism. Expression of GhMYB108 in cotton plants was induced by Verticillium dahliae infection and responded to the application of defense signaling molecules, including salicylic acid, jasmonic acid, and ethylene. Knockdown of GhMYB108 expression led to increased susceptibility of cotton plants to V. dahliae, while ecotopic overexpression of GhMYB108 in Arabidopsis thaliana conferred enhanced tolerance to the pathogen. Further analysis demonstrated that GhMYB108 interacted with the calmodulin-like protein GhCML11, and the two proteins form a positive feedback loop to enhance the transcription of GhCML11 in a calcium-dependent manner. Verticillium dahliae infection stimulated Ca(2+) influx into the cytosol in cotton root cells, but this response was disrupted in both GhCML11-silenced plants and GhMYB108-silenced plants in which expression of several calcium signaling-related genes was down-regulated. Taken together, these results indicate that GhMYB108 acts as a positive regulator in defense against V. dahliae infection by interacting with GhCML11. Furthermore, the data also revealed the important roles and synergetic regulation of MYB transcription factor, Ca(2+), and calmodulin in plant immune responses. PMID:26873979

  1. Use of cadmium in solution in the EL 4 reactor moderator irreversible fixing of cadmium on the metallic surfaces

    International Nuclear Information System (INIS)

    In the framework of research into the poisoning of the EL-4 reactor by cadmium sulphate, measurements have been made by two different methods of the residual amounts of cadmium liable to be fixed irreversibly on the surfaces in contact with the heavy water. A marked influence of the pH has been noticed. The mechanism of the irreversible fixing is compatible with the hypothesis of an ion-exchange in the surface oxide layer. In a sufficiently wide range of pH the cadmium thus fixed causes very little residual poisoning. The stability of the cadmium sulphate solutions is however rather low in the conditions of poisoning. (authors)

  2. Reduction of Cadmium Uptake of Rice Plants Using Soil Amendments in High Cadmium Contaminated Soil: A Pot Experiment

    OpenAIRE

    Dian Siswanto; Parinda Suksabye; Paitip Thiravetyan

    2013-01-01

    The aims of this study were to investigate the effect of agricultural residues on reducing cadmium uptake in rice plants. The rice plants growing on no cadmium/free cadmium soils (N), Cd soils (Cds), and Cd soils each amended with 1% w/w of coir pith (CP), coir pith modified with sodium hydroxide (CPm) and corncob (CC) under high cadmium contaminated soil with an average 145 mg Cd kg-1 soil were investigated. The results showed that the cumulative transpiration of rice grown in various treatm...

  3. Cadmium sulfate complexing with thiourea during preparation of cadmium sulfide films

    International Nuclear Information System (INIS)

    Composition of complexes deposited from cadmium sulfate and thiourea(TU) aqueous solution is studied. Its influence on cadmium sulfide film deposition during solution spraying is ascertained. It is shown that with increase of TU concentration in aqueous solution gradual substitution of TU molecules for the first sphere SO42- ions takes place. As a result CdS deposition from these solutions is initiated when the ratio of CdSO4:TU concentrations is 1:2 and for prepartation of uniform films a five-fold TU excess as a minimum is necessary

  4. STS-108 Mission Highlights Resource Tape. Part 2 of 3

    Science.gov (United States)

    2002-01-01

    This video is a continuation of 'STS-108 Mission Highlights Resource Tape: Part 1 of 3' (Internal ID 2002049331). Flight day four footage continues with a video tour of the International Space Station (ISS). During flight day five, an exterior view of the Multipurpose Logistics Module (MPLM) is seen, followed by the crew unloading the supplies and equipment from the MPLM. Commander Dominic Gorie and Mission Specialist Linda Godwin are seen making preparations for the Extravehicular Activity (EVA) scheduled for the following day. Footage of an exterior view of the ISS is also shown. Flight day six footage includes Godwin and Mission Specialist Daniel Tani suiting up for their EVA and the installation of thermal blankets around the solar array wings of the ISS. Expedition 3 Commander Frank Culbertson is seen working in the ISS laboratory during flight day seven. Views are shown of Saudi Arabia and the Red Sea, the western coast of Australia, Cuba and Florida, and Switzerland and Northern Italy. During flight day eight, the crew is seen stowing objects in the MPLM for return to earth. The video concludes with footage of the treadmill used by the astronauts for physical exercise. Flight days nine through twelve are included in 'STS-108 Mission Highlights Resource Tape: Part 3 of 3' (Internal ID 2002049329).

  5. Removal design report for the 108-F Biological Laboratory

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-09-01

    Most of the 100-F facilities were deactivated with the reactor and have since been demolished. Of the dozen or so reactor-related structures, only the 105-F Reactor Building and the 108-F Biology Laboratory remain standing today. The 108-F Biology Laboratory was intended to be used as a facility for the mixing and addition of chemicals used in the treatment of the reactor cooling water. Shortly after F Reactor began operation, it was determined that the facility was not needed for this purpose. In 1949, the building was converted for use as a biological laboratory. In 1962, the lab was expanded by adding a three-story annex to the original four-story structure. The resulting lab had a floor area of approximately 2,883 m{sup 2} (main building and annex) that operated until 1973. The building contained 47 laboratories, a number of small offices, a conference room, administrative section, lunch and locker rooms, and a heavily shielded, high-energy exposure cell. The purpose of this removal design report is to establish the methods of decontamination and decommissioning and the supporting functions associated with facility removal and disposal.

  6. High rate deposition of thin film cadmium sulphide by pulsed direct current magnetron sputtering

    International Nuclear Information System (INIS)

    Cadmium Sulphide (CdS) is an important n-type semiconductor widely used as a window layer in thin film photovoltaics Copper Indium Selenide, Copper Indium Gallium (di)Selenide, Copper Zinc Tin Sulphide and Cadmium Telluride (CdTe). Cadmium Sulphide has been deposited using a number of techniques but these techniques can be slow (chemical bath deposition and Radio Frequency sputtering) or the uniformity and the control of thickness can be relatively difficult (close space sublimation). In this paper we report on the development of a process using pulsed Direct Current magnetron sputtering which allows nanometre control of thin film thickness using time only. The CdS thin films deposited in this process are highly uniform and smooth. They exhibit the preferred hexagonal structure at room temperature deposition and they have excellent optical properties. Importantly, the process is highly stable despite the use of a semi-insulating magnetron target. Moreover, the process is very fast. The deposition rate using 1.5 kW of power to a 6-inch circular magnetron was measured to be greater than 8 nm/s. This makes the process suitable for industrial deployment. - Highlights: • Pulsed DC magnetron sputtering of CdS • High deposition rate deposition • Uniform, pinhole free films

  7. Correlative characteristic of cadmium in soils of steppe Dnieper region

    Directory of Open Access Journals (Sweden)

    N. M. Tsvetkova

    2015-09-01

    Full Text Available Much attention is paid to searching for methods of establishing environmental standards for objective assessment of admissibility of anthropogenic load on the biosphere. The main pollutants of the environment are xenobiotics; heavy metals such as cadmium occupy hold a special place among them. Cadmium is one of the most dangerous environmental toxic agents, belonging to the 1stclass of hazard. Due to insufficient and fragmented information available on the distribution of cadmium in the city edaphotopes, it’s necessary to conduct additional research, taking into account the properties of soils and the biological characteristics of every element. The paper shows the ratio of cadmium in soils and soil-forming rocks of steppe Dnieper region. Environmental assessment of cadmium content in Dniprodzerzhinsk city soilsis made, and the problem of topsoil contamination of the city as a territory of high anthropogenic load is considered. It is found that the content of cadmium down the profile in natural soil increases. Enrichment of the topsoil with cadmium occurs due to contamination. The value of movable forms content, expressed as a percentage of the total content, varies from 12% to 70%, providing the evidence of the technogenic origin of cadmium in Dniprodzerzhinsk city topsoil. General and proximate correlation analyses of interrelation of soil cadmium and specifically selected characteristics of soil (pH, humus, sulfate ions, dry solid, chloride ions, total alkalinity, hygroscopic moisture were made. It is established that cadmium concentration in the movable forms of natural soils of the steppe Dnieper region depends primarily on pH value. With the increase in pH value, concentration of movable cadmium in soil increases.

  8. Critical review of animal carcinogenesis by cadmium and its inorganic compounds

    International Nuclear Information System (INIS)

    Animal carcinogenic biassays relative to 6 inorganic cadmium substances (cadmium metal, cadmium oxide, cadmium sulfide, cadmium sulfate, cadmium chloride and cadmium acetate) are reviewed (speciation). Critical evaluation of literature data on carcinogenicity has been performed by making reference to E.C. guidelines of good laboratory practice. There are few data on routes relevant for human risk assessment: experiments on inhalation demonstrate lung carcinogenicity of cadmium oxide, cadmium sulfide, cadmium sulfate and cadmium chloride in rats but not in mice nor in hamsters; no carcinogenic effects of cadmium compounds are observed following oral administration. For routes of less or no relevance for human risk assessment, some results are clearly positive: subcutaneous injection induces cancers in situ (various cadmium compounds), testicular tumours (cadmium sulfate and cadmium chloride) and prostatic tumours (cadmium chloride) but such effects are not observed using relevant malignancies in rats. With respect to other no relevant routes (intraperitoneal, intrarenal...) tumours are incidentally produced in situ, but not in remote organs. Numerous studies fail to demonstrate cadmium carcinogenicity, but methodologically acceptable negative ones are very limited in number. Accordingly strain dependent effects and dose effect relationship could not be thoroughly assessed

  9. Naringenin protects against cadmium-induced oxidative renal dysfunction in rats.

    Science.gov (United States)

    Renugadevi, J; Prabu, S Milton

    2009-02-01

    Cadmium (Cd) is an environmental and industrial pollutant that affects various organs in human and experimental animals. Naringenin is a naturally occurring plant bioflavonoid found in citrus fruits, which has been reported to have a wide range of pharmacological properties. A body of evidence has accumulated implicating the free radical generation with subsequent oxidative stress in the biochemical and molecular mechanisms of cadmium toxicity. Since kidney is the critical target organ of chronic Cd toxicity, we carried out this study to investigate the effects of naringenin on Cd-induced toxicity in the kidney of rats. In experimental rats, oral administration of cadmium chloride (5mg/(kgday)) for 4 weeks significantly induced the renal damage which was evident from the increased levels of serum urea, uric acid, creatinine with a significant (pCadmium also significantly decreased the levels of urea, uric acid and creatinine in urine. A markedly increased levels of lipid peroxidation markers (thiobarbituric acid reactive substances and lipid hydroperoxides) and protein carbonyl contents with significant (pcadmium-treated rats. Co-administration of naringenin (25 and 50mg/(kgday)) along with Cd resulted in a reversal of Cd-induced biochemical changes in kidney accompanied by a significant decrease in lipid peroxidation and an increase in the level of renal antioxidant defense system. The histopathological studies in the kidney of rats also showed that naringenin (50mg/(kgday)) markedly reduced the toxicity of Cd and preserved the normal histological architecture of the renal tissue. The present study suggest that the nephroprotective potential of naringenin in Cd toxicity might be due to its antioxidant and metal chelating properties, which could be useful for achieving optimum effects in Cd-induced renal damage. PMID:19063931

  10. Gene expression profiling in rat kidney after intratracheal exposure to cadmium-doped nanoparticles

    International Nuclear Information System (INIS)

    While nephrotoxicity of cadmium is well documented, very limited information exists on renal effects of exposure to cadmium-containing nanomaterials. In this work, “omics” methodologies have been used to assess the action of cadmium-containing silica nanoparticles (Cd-SiNPs) in the kidney of Sprague-Dawley rats exposed intratracheally. Groups of animals received a single dose of Cd-SiNPs (1 mg/rat), CdCl2 (400 μg/rat) or 0.1 ml saline (control). Renal gene expression was evaluated 7 and 30 days post exposure by DNA microarray technology using the Agilent Whole Rat Genome Microarray 4x44K. Gene modulating effects were observed in kidney at both time periods after treatment with Cd-SiNPs. The number of differentially expressed genes being 139 and 153 at the post exposure days 7 and 30, respectively. Renal gene expression changes were also observed in the kidney of CdCl2-treated rats with a total of 253 and 70 probes modulated at 7 and 30 days, respectively. Analysis of renal gene expression profiles at day 7 indicated in both Cd-SiNP and CdCl2 groups downregulation of several cluster genes linked to immune function, oxidative stress, and inflammation processes. Differing from day 7, the majority of cluster gene categories modified by nanoparticles in kidney 30 days after dosing were genes implicated in cell regulation and apoptosis. Modest renal gene expression changes were observed at day 30 in rats treated with CdCl2. These results indicate that kidney may be a susceptible target for subtle long-lasting molecular alterations produced by cadmium nanoparticles locally instilled in the lung.

  11. Comparative genomic analyses identify common molecular pathways modulated upon exposure to low doses of arsenic and cadmium

    Directory of Open Access Journals (Sweden)

    Fry Rebecca C

    2011-04-01

    Full Text Available Abstract Background Exposure to the toxic metals arsenic and cadmium is associated with detrimental health effects including cancers of various organs. While arsenic and cadmium are well known to cause adverse health effects at high doses, the molecular impact resulting from exposure to environmentally relevant doses of these metals remains largely unexplored. Results In this study, we examined the effects of in vitro exposure to either arsenic or cadmium in human TK6 lymphoblastoid cells using genomics and systems level pathway mapping approaches. A total of 167 genes with differential expression were identified following exposure to either metal with surprisingly no overlap between the two. Real-time PCR was used to confirm target gene expression changes. The gene sets were overlaid onto protein-protein interaction maps to identify metal-induced transcriptional networks. Interestingly, both metal-induced networks were significantly enriched for proteins involved in common biological processes such as tumorigenesis, inflammation, and cell signaling. These findings were further supported by gene set enrichment analysis. Conclusions This study is the first to compare the transcriptional responses induced by low dose exposure to cadmium and arsenic in human lymphoblastoid cells. These results highlight that even at low levels of exposure both metals can dramatically influence the expression of important cellular pathways.

  12. Long non-coding RNAs as novel expression signatures modulate DNA damage and repair in cadmium toxicology

    Science.gov (United States)

    Zhou, Zhiheng; Liu, Haibai; Wang, Caixia; Lu, Qian; Huang, Qinhai; Zheng, Chanjiao; Lei, Yixiong

    2015-10-01

    Increasing evidence suggests that long non-coding RNAs (lncRNAs) are involved in a variety of physiological and pathophysiological processes. Our study was to investigate whether lncRNAs as novel expression signatures are able to modulate DNA damage and repair in cadmium(Cd) toxicity. There were aberrant expression profiles of lncRNAs in 35th Cd-induced cells as compared to untreated 16HBE cells. siRNA-mediated knockdown of ENST00000414355 inhibited the growth of DNA-damaged cells and decreased the expressions of DNA-damage related genes (ATM, ATR and ATRIP), while increased the expressions of DNA-repair related genes (DDB1, DDB2, OGG1, ERCC1, MSH2, RAD50, XRCC1 and BARD1). Cadmium increased ENST00000414355 expression in the lung of Cd-exposed rats in a dose-dependent manner. A significant positive correlation was observed between blood ENST00000414355 expression and urinary/blood Cd concentrations, and there were significant correlations of lncRNA-ENST00000414355 expression with the expressions of target genes in the lung of Cd-exposed rats and the blood of Cd exposed workers. These results indicate that some lncRNAs are aberrantly expressed in Cd-treated 16HBE cells. lncRNA-ENST00000414355 may serve as a signature for DNA damage and repair related to the epigenetic mechanisms underlying the cadmium toxicity and become a novel biomarker of cadmium toxicity.

  13. Levels of arsenic, cadmium, lead and mercury in the branchial plate and muscle tissue of mobulid rays

    International Nuclear Information System (INIS)

    Highlights: • Branchial plate and muscle tissue from mobulid rays were analysed for certain metals. • Mean concentrations of cadmium in Mobula japanica were above the EC ML. • Mean inorganic arsenic concentration in Mobula japanica muscle equalled the FSANZ ML. • Mean concentration of lead in Manta alfredi muscle tissue exceeded EC and Codex MLs. • There were significant correlations between the types of tissues for some metals. - Abstract: Mobulid rays are targeted in fisheries for their branchial plates, for use in Chinese medicine. Branchial plate and muscle tissue from Mobula japanica were collected from fish markets in Sri Lanka, and muscle tissue biopsies from Manta alfredi in Australia. These were analysed for arsenic, cadmium, lead and mercury and compared to maximum levels (MLs) set by Food Standards Australia and New Zealand (FSANZ), European Commission (EC) and Codex Alimentarius Commission. The estimated intake for a vulnerable human age group was compared to minimal risk levels set by the Agency for Toxic Substances and Disease Registry. The mean inorganic arsenic concentration in M. japanica muscle was equivalent to the FSANZ ML while cadmium exceeded the EC ML. The mean concentration of lead in M. alfredi muscle tissue exceeded EC and Codex MLs. There were significant positive linear correlations between branchial plate and muscle tissue concentrations for arsenic, cadmium and lead

  14. Cadmium interferes with the degradation of ATF5 via a post-ubiquitination step of the proteasome degradation pathway

    International Nuclear Information System (INIS)

    ATF5 is a member of the CREB/ATF family of transcription factors. In the current study, using a transient transfection system to express FLAG epitope fusion proteins of ATF5, we have shown that CdCl2 or NaAsO3 increases the protein levels of ATF5 in cells, and that cadmium stabilizes the ATF5 protein. Proteasome inhibitors had a similar effect to cadmium on the cellular accumulation of ATF5. Proteasome inhibition led to an increase in ubiquitinated ATF5, while cadmium did not appear to reduce the extent of ATF5 ubiquitination. ATF5 contains a putative nuclear export signal within its N-terminus. We demonstrated that whereas deletion of N-terminal region resulted in a increase of ATF5 levels, this region does not appear to be involved in the ubiquitination of ATF5. These results indicate that ATF5 is targeted for degradation by the ubiquitin-proteasome pathway, and that cadmium slows the rate of ATF5 degradation via a post-ubiquitination mechanism.

  15. Effects of Aluminium Sulfate on Cadmium Accumulation in Rice

    International Nuclear Information System (INIS)

    Full text: Cadmium accumulation in Pathum Thani 1 and Suphan Buri 60 rice cultivars was investigated upon treatment with aluminium sulfate as a precipitant. Rice was grown hydroponically in a medium containing 4 ppm cadmium nitrate with or without 4 ppm aluminium sulfate. Root, stem with leaves and grain samples were collected and analyzed for cadmium content using atomic absorption spectroscopy and inductively coupled plasma atomic emission spectroscopy. Without the addition of aluminium sulfate, Pathum Thani 1 and Suphan Buri 60 accumulated 24.71∫ 3.14 ppm and 34.43 ∫ 4.51 ppm (dry weight of whole plant) of cadmium, respectively. With aluminium sulfate, cadmium accumulation increased to 40.66 ∫ 2.47 ppm and 62.94 ∫ 10.69 ppm, respectively. The addition of aluminium sulfate to the planting medium did not reduce cadmium accumulation but caused the rice to accumulate more cadmium especially in the shoots and grains. This observation might serve as the basis for future research on the management of agricultural areas that are contaminated with cadmium and aluminium

  16. Phytoremediation of cadmium and nickel by Spirodela polyrhiza

    International Nuclear Information System (INIS)

    Heavy metal pollution in surface and groundwater has considerably increased in the last few years. It is essential to have an effective removal mechanism of these toxic metals. Current research includes the need to develop environment friendly and cost effective technologies for removing heavy metals from water. In several studies cadmium and nickel have been considerably removed using phytoremediation. The removal efficiency of cadmium and nickel by Spirodela polyrhiza, common duckweed has been examined in the present study for 3 different concentrations of cadmium (1, 2 and 3 mg/L) and nickel (4, 5 and 6 mg/L). Two sets of experiments for cadmium and nickel were conducted separately. Effect of metal toxicity on Spirodela polyrhiza was evaluated in terms of relative growth factor and cadmium was found to be more toxic than nickel. Under experimental condition BCF value for cadmium removal was more than >1000 in all the 3 concentrations of cadmium. But the BCF value was found to be more than > 1000 only when input nickel concentration was 4 mg/L during phytoremediation process. Experimental results suggest that Spirodela polyrhiza has the potential of accumulating cadmium and nickel from aqueous solution at lower metal concentration. (author)

  17. Cadmium inhibits neurogenesis in zebrafish embryonic brain development

    Energy Technology Data Exchange (ETDEWEB)

    Chow, Elly Suk Hen [Division of Biology, California Institute of Technology, 1200 California Boulevard, Pasadena, CA 91125 (United States); Hui, Michelle Nga Yu; Lin Chunchi [Department of Biology and Chemistry, City University of Hong Kong, 83 Tat Chee Avenue, Kowloon, Hong Kong (China); Cheng Shukhan [Department of Biology and Chemistry, City University of Hong Kong, 83 Tat Chee Avenue, Kowloon, Hong Kong (China)], E-mail: bhcheng@cityu.edu.hk

    2008-05-01

    Cadmium is a non-essential heavy metal found abundantly in the environment. Children of women exposed to cadmium during pregnancy display lower motor and perceptual abilities. High cadmium body burden in children is also related to impaired intelligence and lowered school achievement. However, little is known about the molecular and cellular basis of developmental neurotoxicity in the sensitive early life stages of animals. In this study, we explore neurological deficits caused by cadmium during early embryonic stages in zebrafish by examining regionalization of the neural tube, pattern formation and cell fate determination, commitment of proneural genes and induction of neurogenesis. We show that cadmium-treated embryos developed a smaller head with unclear boundaries between the brain subdivisions, particularly in the mid-hindbrain region. Embryos display normal anterior to posterior regionalization; however, the commitment of neural progenitor cells was affected by cadmium. We observe prominent reductions in the expression of several proneuronal genes including ngn1 in cell clusters, zash1a in the developing optic tectum, and zash1b in the telencephalon and tectum. Cadmium-treated embryos also have fewer differentiated neurons and glia in the facial sensory ganglia as indicated by decreased zn-12 expression. Also, a lower transcription level of neurogenic genes, ngn1 and neuroD, is observed in neurons. Our data suggest that cadmium-induced neurotoxicity can be caused by impaired neurogenesis, resulting in markedly reduced neuronal differentiation and axonogenesis.

  18. Epigenetic Effects of Cadmium [Abstract and Poster 2014

    Science.gov (United States)

    We have reviewed the literature on in vitro and in vivo experiments as well as human studies on cadmium to understand the epigenetic mechanisms involved in cadmium- induced toxicity and carcinogenicity. This presentation will identify gaps in our current understanding and suggest...

  19. Removing cadmium from electroplating wastewater by waste saccharomyces cerevisiae

    Institute of Scientific and Technical Information of China (English)

    DAI Shu-juan; WEI De-zhou; ZHOU Dong-qin; JIA Chun-yun; WANG Yu-juan; LIU Wen-gang

    2008-01-01

    The appropriate condition and scheme of removing cadmium from electroplating wastewater were investigated by adsorption-precipitation method using waste saccharomyces cerevisiae(WSC) as sorbent. Effect factors on biosorption of cadmium in cadmium-containing electroplating wastewater by waste saccharomyces cerevisiae and precipitation process of waste saccharomyces cerevisiae after adsorbing cadmium were studied. The results show that removal rate of cadmium is over 88% after 30 min adsorbing under the condition of cadmium concentration 26 mg/L, the dosage of waste saccharomyces cerevisiae 16.25 g/L, temperature 18 ℃, pH 6.0 and precipitation time 4 h. Biosorption-precipitation method is effective to remove cadmium in cadmium-containing electroplating wastewater by waste saccharomyces cerevisiae. The SEM, infrared spectroscopy and Zeta-potential of the cells show that chemical chelating is the main adsorption form; electrostatic attraction, hydrogen bonding and van der Waals force all function in adsorption process; and ―NH2―,―C=O―,―C=O―NH―,―CH3, ―OH are the main adsorption groups.

  20. Method of making a thin film cadmium telluride solar cell

    International Nuclear Information System (INIS)

    A method for making a photovoltaic cell is described comprising the steps of: (a) depositing a transparent or semi-transparent conductive window layer onto a substrate; (b) depositing a layer of cadmium telluride including phosphorus onto the window layer; (c) depositing a layer of lead telluride onto the layer of cadmium telluride; and (d) depositing a metallic electrode onto the lead telluride layer

  1. Effect of environmental exposure to Cadmium on pregnancy outcome

    Directory of Open Access Journals (Sweden)

    F. Ramezanzadeh

    2010-04-01

    Full Text Available "n "n "nBackgrounds andObjectives:The objective of the present study was to evaluate the potential effect of environmental exposure to toxic metal (cadmium on pregnancy outcome and fetal growth."nMaterials and Methods: 330 normal pregnant women were randomly selected from vali-e-asr hospital, from July 2003 through Feb. 2005. Cadmium was measured in umbilical cord blood and mother whole blood of postpartum women without occupational exposure to metals in Tehran, Iran, using inductively coupled plasma mass spectrometry"nResult: Whole blood cadmium and cord blood cadmium ranged from 0/00 to 6/30 μg/L ,respectivly. in the group higher level of maternal blood cadmium (> 0.40 μg/L 1cm decrease was seen in neonatal birth height. (p = 0.007 There was a significant association between cadmium exposure and birth weight.Mann-whitney test showed that, maternal blood cadmium level, was significantly negatively associated with neonatal birth weight (z = -1.83, P < 0.06."nConclusion: It was concluded that environmental exposure to cadmium significantly reduces neonatal birth height.

  2. Risk of overestimation of urinary cadmium concentrations: interference from molybdenum

    Directory of Open Access Journals (Sweden)

    Cañas A.I.

    2013-04-01

    Full Text Available We show here that the selection of analytical method is critical when measuring low levels of cadmium in human urine. Cadmium is today usually analyzed by Inductively Coupled Plasma Mass Spectrometry (ICP-MS, which has a higher sensitivity than Atomic Absorption Spectroscopy (AAS. ICP-MS cadmium measurements show interference from tin (114Sn and molybdenum oxides, which can result in an overestimation of cadmium levels. The 114Sn interference is stable and can be mathematically corrected. Molybdenum concentrations in urine are variable and different from individual to individual. We have estimated the degree of error which molybdenum interference introduces in the measurement of cadmium in urine by conventional ICP-MS. 268 urine samples from mothers and their children were measured. Removal of the molybdenum oxide interference (DRC-ICP-MS method reduced urinary cadmium concentrations significantly (47.8%. The urinary molybdenum concentration in children was higher than in their mothers, resulting in greater overestimation. Our results clearly show that the DRC method is essential for reliable measurements of urinary cadmium concentrations, particularly in children. Furthermore, care should be taken when comparing Human Biomonitoring data for cadmium in urine and attention should be paid to which analytical method has been used (e.g. AAS and ICP-Ms, and especially if the measurements have been corrected for molybdenum interference.

  3. Electrolytic indium refining from cadmium in glycerine electrolyte

    International Nuclear Information System (INIS)

    The results of investigations directed on development of electrochemical indium cleaning from cadmium in glycerine base electrolyte are presented. Optimal operational conditions, specific consumption of reactants and electric power are determined. Relationship between variation of concentration of cadmium impurity in refined metal and duration of electrolysis is revealed. The method for determination of cleaning time is proposed. Developed process was put into commercial operation

  4. Cadmium and zinc reversibly arrest development of Artemia larvae

    Energy Technology Data Exchange (ETDEWEB)

    Bagshaw, J.C.; Rafiee, P.; Matthews, C.O.; MacRae, T.H.

    1986-08-01

    Despite the widespread distribution of heavy metals such as cadmium and zinc in the environment and their well-known cytotoxicity and embryotoxicity in mammals, comparatively little is known about their effect on aquatic organisms, particularly invertebrates. Post-gastrula and early larval development of the brine shrimp, Artemia, present some useful advantages for studies of developmental aspects of environmental toxicology. Dormant encysted gastrulae, erroneously called brine shrimp eggs, can be obtained commercially and raised in the laboratory under completely defined conditions. Following a period of post-gastrula development within the cyst, pre-nauplius larvae emerge through a crack in the cyst shell. A few hours later, free-swimming nauplius larvae hatch. Cadmium is acutely toxic to both adults and nauplius larvae of Artemia, but the reported LC50s are as high as 10 mM, depending on larval age. In this paper the authors show that pre-nauplius larvae prior to hatching are much more sensitive to cadmium than are hatched nauplius larvae. At 0.1 ..mu..m, cadmium retards development and hatching of larvae; higher concentrations block hatching almost completely and thus are lethal. However, the larvae arrested at the emergence stage survive for 24 hours or more before succumbing to the effects of cadmium, and during this period the potentially lethal effect is reversible if the larvae are placed in cadmium-free medium. The effects of zinc parallel those of cadmium, although zinc is somewhat less toxic than cadmium at equal concentrations.

  5. Cadmium inhibits neurogenesis in zebrafish embryonic brain development

    International Nuclear Information System (INIS)

    Cadmium is a non-essential heavy metal found abundantly in the environment. Children of women exposed to cadmium during pregnancy display lower motor and perceptual abilities. High cadmium body burden in children is also related to impaired intelligence and lowered school achievement. However, little is known about the molecular and cellular basis of developmental neurotoxicity in the sensitive early life stages of animals. In this study, we explore neurological deficits caused by cadmium during early embryonic stages in zebrafish by examining regionalization of the neural tube, pattern formation and cell fate determination, commitment of proneural genes and induction of neurogenesis. We show that cadmium-treated embryos developed a smaller head with unclear boundaries between the brain subdivisions, particularly in the mid-hindbrain region. Embryos display normal anterior to posterior regionalization; however, the commitment of neural progenitor cells was affected by cadmium. We observe prominent reductions in the expression of several proneuronal genes including ngn1 in cell clusters, zash1a in the developing optic tectum, and zash1b in the telencephalon and tectum. Cadmium-treated embryos also have fewer differentiated neurons and glia in the facial sensory ganglia as indicated by decreased zn-12 expression. Also, a lower transcription level of neurogenic genes, ngn1 and neuroD, is observed in neurons. Our data suggest that cadmium-induced neurotoxicity can be caused by impaired neurogenesis, resulting in markedly reduced neuronal differentiation and axonogenesis

  6. Cadmium Removal from Aqueous Solutions by Ground Pine Cone

    Directory of Open Access Journals (Sweden)

    H Izanloo, S Nasseri

    2005-01-01

    Full Text Available A study on the removal of cadmium ions from aqueous solutions by pine cone was conducted in batch conditions. Kinetic data and equilibrium removal isotherms were obtained. The influence of different experimental parameters such as contact time, initial concentration of cadmium, pine cone mass and particle size, and temperature on the kinetics of cadmium removal was studied. Results showed that the main parameters that played an important role in removal phenomenon were initial cadmium concentration, particle size and pine cone mass. The necessary time to reach equilibrium was between 4 and 7 hours based on the initial concentration of cadmium. The capacity of cadmium adsorption at equilibrium increased with the decrease of pine cone particle size. The capacity of cadmium adsorption at equilibrium by pine cone increased with the quantity of pine cone introduced (1–4 g/L. Temperature in the range of 20-30°C showed a restricted effect on the removal kinetics (13.56 mg/g at 20°C and a low capacity of adsorption about 11.48 mg/g at 30°C. The process followed pseudo second-order kinetics. The cadmium uptake of pine cone was quantitatively evaluated using adsorption isotherms. Results indicated that the Langmuir model gave a better fit to the experimental data in comparison with the Freundlich equation.

  7. Concentration of Cadmium in Cacao Beans and its Relationship with Soil Cadmium in Southern Ecuador

    Science.gov (United States)

    The concentration of cadmium (Cd) in cacao (Theobroma cacao, L.) beans above a critical level (0.6 mg kg-1 established by the European Union) has raised concerns of safety in the consumption of cacao-based chocolate (dark chocolate). Currently, little is available regarding Cd concentration in soil,...

  8. Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

    Energy Technology Data Exchange (ETDEWEB)

    Adámik, Matej [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Bažantová, Pavla [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava (Czech Republic); Navrátilová, Lucie; Polášková, Alena [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Pečinka, Petr [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava (Czech Republic); Holaňová, Lucie [Department of Chemical Drugs, Faculty of Pharmacy, University of Veterinary and Pharmaceutical Sciences, Palackého 1/3, 61242 Brno (Czech Republic); Tichý, Vlastimil [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Brázdová, Marie, E-mail: maruska@ibp.cz [Institute of Biophysics, Academy of Science of the Czech Republic, v.v.i., Královopolská 135, 612 65 Brno (Czech Republic); Department of Chemical Drugs, Faculty of Pharmacy, University of Veterinary and Pharmaceutical Sciences, Palackého 1/3, 61242 Brno (Czech Republic)

    2015-01-02

    Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt, which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.

  9. Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

    International Nuclear Information System (INIS)

    Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt, which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed

  10. Cadmium adsorption in montmorillonite as affected by glyphosate

    Institute of Scientific and Technical Information of China (English)

    WANG Yu-jun; ZHOU Dong-mei; LUO Xiao-san; SUN Rui-juan; CHEN Huai-man

    2004-01-01

    Behaviors of soil heavy metals are often affected by coexisting herbicides due to their physical and chemical interaction. Effect of glyphosate, an herbicide containing -PO32- and -COOH groups, on cadmium adsorption in montmorillonite was studied in detail. The results showed that cadmium adsorption quantity in montmorillonite increased with increasing soil solution pH and cadmium concentration as usual, but decreased with glyphosate, which is due to the formation of a low affinity complex of Cd and glyphosate and decreasing solution pH induced by glyphosate addition. When the equilibrium solution pH was below 6.7, glyphosate has little effect on cadmium adsorption, but when the equilibrium solution pH was above 6.7, glyphosate significantly decreased cadmium adsorption quantity in montmorillonite. In addition, the adding order of Cd and glyphosate also influenced Cd adsorption quantity in montmorillonite.

  11. Cadmium sorption and mobility in sludge-amended soil

    International Nuclear Information System (INIS)

    Cadmium sorption was examined in three soils that were unamended, freshly amended, or preconditioned with gamma-irradiated sewage sludge. Metal sorption in the same soils treated with a CaCl2-extract of the sludge was also studied. Cadmium sorption was greatest in the unamended soils, less in soils preconditioned with sludge, and least in the freshly amended soils and sludge-extract-treated soils. The authors attempted to explain the treatment effects on the basis of reduced free metal ion activity, but the explanations were not adequate. Despite the reduction in metal retention effected by various treatments, cadmium mobility was very limited. Short- or long-term leaching studies showed cadmium movement to be limited to 1 or 2 m below the zone of sludge (109Cd) incorporation. Cadmium mobility is expected to be very limited in calcareous soils, regardless of sludge treatments. 24 references, 1 figure, 5 tables

  12. Amorphous tin-cadmium oxide films and the production thereof

    Science.gov (United States)

    Li, Xiaonan; Gessert, Timothy A

    2013-10-29

    A tin-cadmium oxide film having an amorphous structure and a ratio of tin atoms to cadmium atoms of between 1:1 and 3:1. The tin-cadmium oxide film may have an optical band gap of between 2.7 eV and 3.35 eV. The film may also have a charge carrier concentration of between 1.times.10.sup.20 cm.sup.-3 and 2.times.10.sup.20 cm.sup.-3. The tin cadmium oxide film may also exhibit a Hall mobility of between 40 cm.sup.2V.sup.-1 s.sup.-1 and 60 cm.sup.2V.sup.-1 s.sup.-1. Also disclosed is a method of producing an amorphous tin-cadmium oxide film as described and devices using same.

  13. Transient behavior of cadmium in a grassland arthropod food chain

    International Nuclear Information System (INIS)

    Biological assimilation and transport of cadmium were determined for an arthropod food chain in an east Tennessee grassland community. Laboratory experiments demonstrated that there were no significant differences (P greater than 0.05) in assimilation rates (17 percent assimilation per day) or biological half-lives (7 days) of 109Cd either as soluble nitrate or insoluble oxide in crickets under identical conditions. Field experiments demonstrated that primary consumers (crickets) accumulated 109Cd much more rapidly (uptake rate = 0.55 day-1) than did the spider predators (uptake rate = 0.08 day-1). Equilibrium concentrations in crickets were obtained in 9 days (0.04 ppM cadmium), while equilibrium was not reached in spiders during the 30-day study. Food-chain concentration of cadmium did not occur as crickets accumulated levels of cadmium 60 percent of that in their vegetation food sources and spiders accumulated only 70 percent of the cadmium present in the cricket tissues

  14. Synthesis of cadmium chalcogenide nanotubes at room temperature

    KAUST Repository

    Pan, Jun

    2012-10-01

    Cadmium chalcogenide (CdE, E=S, Se, Te) polycrystalline nanotubes have been synthesized from precursor of CdS/cadmium thiolate complex at room temperature. The precursor was hydrothermally synthesized at 180 °C using thioglycolic acid (TGA) and cadmium acetate as starting materials. The transformation from the rod-like precursor of CdS/cadmium thiolate complex to CdS, CdSe and CdTe nanotubes were performed under constant stirring at room temperature in aqueous solution containing S 2-, Se 2- and Te 2-, respectively. The nanotube diameter can be controlled from 150 to 400 nm related to the dimension of templates. The XRD patterns show the cadmium chalcogenide nanotubes all corresponding to face-centered cubic structure. © 2012 Elsevier B.V. All rights reserved.

  15. Effect of pregnancy on cadmium-treated rats

    Energy Technology Data Exchange (ETDEWEB)

    Takizama, Y. (Akita Univ. School of Medicine, Japan); Nakamura, I.; Kurayama, R.; Hirasawa, F.; Kawai, K.

    1982-01-01

    It is well known that itai-itai disease with the osteopathy is broken out among multiparas, 40 years of age and up Japanese residents. In this paper we described an experimental study of effect of pregnancy on cadmium treated rats. Female mature rats were administered drinking water containing 50 and 200 ppm cadmium as CdCl/sub 2/. During 180 days of the experiment, three times of pregnancy were succesful, though slight depression of body weight gain was noticed in the 200 ppm group. The cadmium was accumulated in the kidneys, liver and bone proportionally to the amount of cadmium administered. No significant change was recognized in serum calcium, phosphorus and alkaline phosphatase levels after 180 days. Though cadmium 200 ppm treated rats showed slight histological lesions in the proximal convoluted tubules of the kidney, there appeared to be no osteomalacia including excess formation of osteoid tissue.

  16. Cadmium in the Amazonian Guajara Estuary: Distribution and remobilization

    Energy Technology Data Exchange (ETDEWEB)

    Nascimento, S.F. [Instituto de Quimica, Departamento de Geoquimica, Universidade Federal Fluminense (Brazil)]. E-mail: nascimento@lisa.univ-paris12.fr; Kurzweil, H. [Institut fuer Petrologie, Universitaet Wien (Austria); Wruss, W. [Institut fuer Chemische Technologie anorganischer Stoffe, Technische Univesitaet Wien (Austria); Fenzl, N. [Nucleo de Altos Estudos Amazonicos, Universidade Federal do Para (Brazil)

    2006-03-15

    Extremely high total cadmium concentrations (average about 500 mg/kg) together with very small (average of 1.1 {mu}g/l) dissolved available cadmium have been found in the more acidic deeper layers of the bottom sediments of the Brazilian Amazonian Guajara Estuary. The paper shows that climatic changes and the periodic input of the Atlantic waters into the Estuary appear to have no direct influence on annual average total cadmium concentration, but they affect accumulation, distribution and remobilization of cadmium in different ways during the rainy season (February/March) and the dry season (November/December). Even if only a very small part of the total Cd is available, the concentrations of dissolved Cd in the Estuary are still high enough to cause environmental concern, if compared with concentrations in natural freshwater ecosystems. - Distribution and remobilization of cadmium is affected differently by season.

  17. Effects of diethyldithiocarbamate on the toxicokinetics of cadmium chloride in mice

    DEFF Research Database (Denmark)

    Andersen, O; Nielsen, J B

    1989-01-01

    investigates effects of DDC on the toxicokinetics of cadmium at lower doses of cadmium than those used in previous studies. During single exposure to subtoxic oral doses of cadmium chloride DDC enhanced intestinal cadmium absorption, both after intraperitoneal and oral administration of DDC. In such acute...

  18. Max 2-SAT with up to 108 qubits

    Science.gov (United States)

    Santra, Siddhartha; Quiroz, Gregory; Ver Steeg, Greg; Lidar, Daniel A.

    2014-04-01

    We experimentally study the performance of a programmable quantum annealing processor, the D-Wave One (DW1) with up to 108 qubits, on maximum SAT problem with 2 variables per clause (MAX 2-SAT) problems. We consider ensembles of random problems characterized by a fixed clause density, an external parameter which we tune through its critical value in our experiments. We demonstrate that the DW1 is sensitive to the critical value of the clause density. The DW1 results are verified and compared with akmaxsat, an exact, state-of-the-art algorithm. We study the relative performance of the two solvers and how they correlate in terms of problem hardness. We find that the DW1 performance scales more favorably with problem size and that problem hardness correlation is essentially non-existent. We discuss the relevance and limitations of such a comparison.

  19. Max 2-SAT with up to 108 qubits

    International Nuclear Information System (INIS)

    We experimentally study the performance of a programmable quantum annealing processor, the D-Wave One (DW1) with up to 108 qubits, on maximum SAT problem with 2 variables per clause (MAX 2-SAT) problems. We consider ensembles of random problems characterized by a fixed clause density, an external parameter which we tune through its critical value in our experiments. We demonstrate that the DW1 is sensitive to the critical value of the clause density. The DW1 results are verified and compared with akmaxsat, an exact, state-of-the-art algorithm. We study the relative performance of the two solvers and how they correlate in terms of problem hardness. We find that the DW1 performance scales more favorably with problem size and that problem hardness correlation is essentially non-existent. We discuss the relevance and limitations of such a comparison. (paper)

  20. First observation of excited states in 108Sb

    International Nuclear Information System (INIS)

    A spectroscopic study of 108Sb has been carried out as a part of a larger experiment where in total twenty-nine different residual nuclei were identified. This study gives the first information on excited levels in this nucleus. A low-lying two-quasi-particle multiplet together with some of the higher lying levels are discussed within the framework of the nuclear shell model. A rotational, strongly coupled, band is identified as, most likely, being built on the deformed πg9/2-1xνh11/2 configuration in accordance with total routhian surface calculations. Tentative spins and parities are presented as well as B(M1)/B(E2) ratios for some of the transitions in the strongly coupled band. ((orig.))

  1. Kepler-108: A Mutually Inclined Giant Planet System

    CERN Document Server

    Mills, Sean M

    2016-01-01

    The vast majority of well studied giant-planet systems, including the Solar System, are nearly coplanar which implies dissipation within a primordial gas disk. however, intrinsic instability may lead to planet-planet scattering, which often produces non-coplanar, eccentric orbits. Planet scattering theories have been developed to explain observed high eccentricity systems and also hot Jupiters; thus far their predictions for mutual inclination (I) have barely been tested. Here we characterize a highly mutually-inclined (I ~ 15-60 degrees), moderately eccentric (e >~ 0.1) giant planet system: Kepler-108. This system consists of two approximately Saturn-mass planets with periods of ~49 and ~190 days around a star with a wide (~300AU) binary companion in an orbital configuration inconsistent with a purely disk migration origin.

  2. Wilhelm Tempel and his 10.8-cm Steinheil Telescope

    Science.gov (United States)

    Bianchi, Simone; Gasperini, Antonella; Galli, Daniele; Palla, Francesco; Brenni, Paolo; Giatti, Anna

    2010-03-01

    The German astronomer Ernst Wilhelm Leberecht Tempel (1821-1889) owed most of his successes to a 10.8-cm Steinheil refractor, which he bought in 1858. A lithographer, without an academic foundation, but with a strong passion for astronomy, Tempel had sharp eyesight and a talent for drawing, and he discovered with his telescope many celestial objects, including asteroids, comets (most notably, 9 P/Tempel 1) and the Merope Nebula in the Pleiades. Tempel carried his telescope with him throughout his moves in France and Italy. The telescope is now conserved in Florence, at the Arcetri Astrophysical Observatory, where Tempel was astronomer from 1875 until the end of his life. Using unpublished material from the Arcetri Historical Archive, as well as documents from other archives and published material, we trace the history of the telescope and its use during and after Tempel's life, and describe its recent rediscovery and status.

  3. New compositions of cadmium selenium nanoparticles and dye molecules with cyclodextrin inclusion complexes

    International Nuclear Information System (INIS)

    Spectroscopic properties of new heterogeneous multicolor compositions based on cadmium selenium (CdSe/ZnS) nano crystal and inclusion complexes of dye molecule with cyclodextrin are presented. Spectral fluorescence of proposed compositions investigated in thin films. Signals from multicolor fluorescence of proposing compositions may be combined to definite spectral codes that could be used for tracking or verification of different objects. Calibration bar of signal within spectral codes guarantee high reliability in practical application of proposed multicolor compositions. Express analysis the size of nanoparticles during their synthesis and purification by spectroscopic methods is suggested. Application of Cyclodextrin molecules as target delivery systems is considered. (authors)

  4. Fast-neutron scattering from elemental cadmium

    International Nuclear Information System (INIS)

    Neutron differential-elastic-scattering cross sections of elemental cadmium are measured from approx. = 1.5 to 4.0 MeV at incident-neutron energy intervals of 50 to 200 keV and at 10 to 20 scattering angles distributed between approx. = 20 and 160 degrees. Concurrently, lumped-level neutron inelastic-excitation cross sections are measured. The experimental results are used to deduce parameters of an optical-statistical model that is descriptive of the observables and are compared with corresponding quantities given in ENDF/B-V

  5. Sorption of Cadmium on Na-Bentonite

    International Nuclear Information System (INIS)

    The sorption of Cd radionuclide into Na-bentonite as candidate for buffer material in the radioactive waste disposal system has been performed. Cadmium was used for this study as a model for bivalence elements. Batch experiment was adopted to study sorption isotherm, influence of carbonate and influence of EDTA. In a simple media, pure water, Cd was retained with a high affinity. Two stages Freundlich sorption isotherm was shown, with high coefficient distribution and sorption capacities. It is shown that the presence of carbonate in solution was not affect significantly to the sorption. While the presence of EDTA, decrease the distribution coefficient value. (author)

  6. Sources of cadmium exposure among healthy premenopausal women

    International Nuclear Information System (INIS)

    Background: Cadmium, a persistent and widespread environmental pollutant, has been associated with kidney function impairment and several diseases. Cigarettes are the dominant source of cadmium exposure among smokers; the primary source of cadmium in non-smokers is food. We investigated sources of cadmium exposure in a sample of healthy women. Methods: In a cross-sectional study, 191 premenopausal women completed a health questionnaire and a food frequency questionnaire. The cadmium content of spot urine samples was measured with inductively-coupled plasma mass spectrometry and normalized to urine creatinine content. Multivariable linear regression was used to estimate the strength of association between smoking habits and, among non-smokers, usual foods consumed and urinary cadmium, adjusted for age, race, multivitamin and supplement use, education, estimated total energy intake, and parity. Results: Geometric mean urine creatinine-normalized cadmium concentration (uCd) of women with any history of cigarette smoking was 0.43 μg/g (95% confidence interval (CI): 0.38-0.48 μg/g) and 0.30 μg/g (0.27-0.33 μg/g) among never-smokers, and increased with pack-years of smoking. Analysis of dietary data among women with no reported history of smoking suggested that regular consumption of eggs, hot cereals, organ meats, tofu, vegetable soups, leafy greens, green salad, and yams was associated with uCd. Consumption of tofu products showed the most robust association with uCd; each weekly serving of tofu was associated with a 22% (95% CI: 11-33%) increase in uCd. Thus, uCd was estimated to be 0.11 μg/g (95% CI: 0.06-0.15 μg/g) higher among women who consumed any tofu than among those who consumed none. Conclusions: Cigarette smoking is likely the most important source of cadmium exposure among smokers. Among non-smokers, consumption of specific foods, notably tofu, is associated with increased urine cadmium concentration. - Research highlights: →Urine cadmium, usual

  7. Sources of cadmium exposure among healthy premenopausal women

    Energy Technology Data Exchange (ETDEWEB)

    Adams, Scott V., E-mail: sadams@fhcrc.org [Fred Hutchinson Cancer Research Center, PO Box 19024, M4-B402, Seattle, WA 98109 (United States); Department of Epidemiology, University of Washington, Box 357236, Seattle, WA 98195 (United States); Newcomb, Polly A. [Fred Hutchinson Cancer Research Center, PO Box 19024, M4-B402, Seattle, WA 98109 (United States); Department of Epidemiology, University of Washington, Box 357236, Seattle, WA 98195 (United States); Shafer, Martin M. [Environmental Chemistry and Technology Program, University of Wisconsin and Wisconsin State Laboratory of Hygiene, Madison, WI (United States); Atkinson, Charlotte [Department of Oral and Dental Science, Bristol Dental School, Bristol (United Kingdom); Bowles, Erin J. Aiello [Group Health Research Institute, Seattle, WA (United States); Newton, Katherine M. [Department of Epidemiology, University of Washington, Box 357236, Seattle, WA 98195 (United States); Group Health Research Institute, Seattle, WA (United States); Lampe, Johanna W. [Fred Hutchinson Cancer Research Center, PO Box 19024, M4-B402, Seattle, WA 98109 (United States); Department of Epidemiology, University of Washington, Box 357236, Seattle, WA 98195 (United States)

    2011-04-01

    Background: Cadmium, a persistent and widespread environmental pollutant, has been associated with kidney function impairment and several diseases. Cigarettes are the dominant source of cadmium exposure among smokers; the primary source of cadmium in non-smokers is food. We investigated sources of cadmium exposure in a sample of healthy women. Methods: In a cross-sectional study, 191 premenopausal women completed a health questionnaire and a food frequency questionnaire. The cadmium content of spot urine samples was measured with inductively-coupled plasma mass spectrometry and normalized to urine creatinine content. Multivariable linear regression was used to estimate the strength of association between smoking habits and, among non-smokers, usual foods consumed and urinary cadmium, adjusted for age, race, multivitamin and supplement use, education, estimated total energy intake, and parity. Results: Geometric mean urine creatinine-normalized cadmium concentration (uCd) of women with any history of cigarette smoking was 0.43 {mu}g/g (95% confidence interval (CI): 0.38-0.48 {mu}g/g) and 0.30 {mu}g/g (0.27-0.33 {mu}g/g) among never-smokers, and increased with pack-years of smoking. Analysis of dietary data among women with no reported history of smoking suggested that regular consumption of eggs, hot cereals, organ meats, tofu, vegetable soups, leafy greens, green salad, and yams was associated with uCd. Consumption of tofu products showed the most robust association with uCd; each weekly serving of tofu was associated with a 22% (95% CI: 11-33%) increase in uCd. Thus, uCd was estimated to be 0.11 {mu}g/g (95% CI: 0.06-0.15 {mu}g/g) higher among women who consumed any tofu than among those who consumed none. Conclusions: Cigarette smoking is likely the most important source of cadmium exposure among smokers. Among non-smokers, consumption of specific foods, notably tofu, is associated with increased urine cadmium concentration. - Research highlights: {yields

  8. Modeling cadmium in the feed chain and cattle organs

    Directory of Open Access Journals (Sweden)

    van der Fels-Klerx, I.

    2011-01-01

    Full Text Available The objectives of this study were to estimate cadmium contamination levels in different scenarios related to soil characteristics and assumptions regarding cadmium accumulation in the animal tissues, using quantitative supply chain modeling. The model takes into account soil cadmium levels, soil pH, soil-to-plant transfer, animal consumption patterns, and transfer into animal organs (liver and kidneys. The model was applied to cattle up to the age of six years which were fed roughage (maize and grass and compound feed. Cadmium content in roughage and cadmium intake by cattle were calculated for six different (soil scenarios varying in soil cadmium levels and soil pH. For each of the six scenarios, the carry-over of cadmium from intake into the cattle organs was estimated applying two model assumptions, i.e., linear accumulation and a steady state situation. The results showed that only in the most extreme soil scenario (cadmium level 2.5 mg.kg-1, pH 4.5, cadmium exceeded the EC maximum tolerated level in roughage. Assuming linear accumulation, cadmium levels in organs of cattle up to six years of age, ranged from 0.37-4.03 mg.kg-1 of fresh weight for kidneys and from 0.07 to 0.77 mg.kg-1 of fresh weight for livers. The maximum tolerated levels in one or both organs were exceeded in several scenarios. When considering organ excretion of cadmium, internal cadmium levels in organs were approximately one order of magnitude lower as compared to the results of the linear accumulation model. In this case only in the most extreme soil scenario, the maximum tolerated level in the kidney was exceeded. It was concluded that the difference between the two assumptions (linear model versus a steady state situation to estimate cadmium carry-over in cattle is negligible in the animal's first five years of life, but will become relevant at higher ages. For the current case, the linear approach is a good descriptor for worst case situations. Furthermore, this

  9. Dietary cadmium intake and risk of prostate cancer: a Danish prospective cohort study

    OpenAIRE

    Eriksen, Kirsten T.; Halkjær, Jytte; Jaymie R. Meliker; McElroy, Jane A.; Sørensen, Mette; Tjønneland, Anne; Raaschou-Nielsen, Ole

    2015-01-01

    Background Cadmium is classified as a human lung carcinogen based on evidence from high-exposure occupational settings. Though cadmium has no physiological role, increasing evidence suggests cadmium may mimic steroid hormones. This dual ability of being carcinogenic and hormone-like makes cadmium a concern for hormone-related cancers. Causes of prostate cancer are not clear, but steroid hormones, particularly androgens and probably estrogens, may be involved. Cadmium has been positively assoc...

  10. Impairment induced by chronic occupational cadmium exposure during brazing process

    International Nuclear Information System (INIS)

    Cadmium (CD) is considered a metal of the 20th century to which all inhabitants of develop societies are exposed. Long-term occupational and environmental exposure to CD often results in renal dysfunction as the kidney is considered the critical target organ. The aim of this work was to evalutate both resporatory and renal manifestations induced by occupational exposure to CD compounds during brazing process, and suggesting a protocol for prevention and control for CD- induced health effects. This study was conducted on 20 males occupationally exposed workers. They are divided into two groups: Group-1 included (10) exposed smokers and group-2 included (10) exposed non-smokers. Results of both groups were compared with those of 10 healthy age and sex matched non-smokers. All subjects were subjected to detailed history taking and laboratory investigations including blood and urinary CD, liver profile (SGOT, SGPT and alkline phosphates), kindey function tests (blood urea, creatinine and urinary beta2- microglobulin). The level of Cd in the atmosphere of the work plase air was also assessed to detect the degree of exposure as it was about 6 times greater than thesave level (1 mu /m3).(1) This study demonstrated elevation levels of blood CD, urea, creatinine and urinary CD and beta2 -microglobulin for both exposed worker groups than the controls. In additions no appreciable were noted for liver function tests, although the levels fell within normal range

  11. Cellular mechanisms of cadmium-induced toxicity: a review.

    Science.gov (United States)

    Rani, Anju; Kumar, Anuj; Lal, Ankita; Pant, Manu

    2014-08-01

    Cadmium is a widespread toxic pollutant of occupational and environmental concern because of its diverse toxic effects: extremely protracted biological half-life (approximately 20-30 years in humans), low rate of excretion from the body and storage predominantly in soft tissues (primarily, liver and kidneys). It is an extremely toxic element of continuing concern because environmental levels have risen steadily due to continued worldwide anthropogenic mobilization. Cadmium is absorbed in significant quantities from cigarette smoke, food, water and air contamination and is known to have numerous undesirable effects in both humans and animals. Cadmium has a diversity of toxic effects including nephrotoxicity, carcinogenicity, teratogenicity and endocrine and reproductive toxicities. At the cellular level, cadmium affects cell proliferation, differentiation, apoptosis and other cellular activities. Current evidence suggests that exposure to cadmium induces genomic instability through complex and multifactorial mechanisms. Most important seems to be cadmium interaction with DNA repair mechanism, generation of reactive oxygen species and induction of apoptosis. In this article, we have reviewed recent developments and findings on cadmium toxicology. PMID:24117228

  12. Cadmium (II) removal mechanisms in microbial electrolysis cells.

    Science.gov (United States)

    Colantonio, Natalie; Kim, Younggy

    2016-07-01

    Cadmium is a toxic heavy metal, causing serious environmental and human health problems. Conventional methods for removing cadmium from wastewater are expensive and inefficient for low concentrations. Microbial electrolysis cells (MECs) can simultaneously treat wastewater, produce hydrogen gas, and remove heavy metals with low energy requirements. Lab-scale MECs were operated to remove cadmium under various electric conditions: applied voltages of 0.4, 0.6, 0.8, and 1.0V; and a fixed cathode potential of -1.0V vs. Ag/AgCl. Regardless of the electric condition, rapid removal of cadmium was demonstrated (50-67% in 24h); however, cadmium concentration in solution increased after the electric current dropped with depleted organic substrate under applied voltage conditions. For the fixed cathode potential, the electric current was maintained even after substrate depletion and thus cadmium concentration did not increase. These results can be explained by three different removal mechanisms: cathodic reduction; Cd(OH)2 precipitation; and CdCO3 precipitation. When the current decreased with depleted substrates, local pH at the cathode was no longer high due to slowed hydrogen evolution reaction (2H(+)+2e(-)→H2); thus, the precipitated Cd(OH)2 and CdCO3 started dissolving. To prevent their dissolution, sufficient organic substrates should be provided when MECs are used for cadmium removal. PMID:26970043

  13. Mobility, bioavailability, and toxic effects of cadmium in soil samples

    International Nuclear Information System (INIS)

    Total concentration is not a reliable indicator of metal mobility or bioavailability in soils. The physicochemical form determines the behavior of metals in soils and hence the toxicity toward terrestrial biota. The main objectives of this study were the application and comparison of three approaches for the evaluation of cadmium behavior in soil samples. The mobility and bioavailability of cadmium in five selected soil samples were evaluated using equilibrium speciation (Windermere humic aqueous mode (WHAM)), extraction procedures (Milli-Q water, DMSO, and DTPA), and a number of bioassays (Microtox, growth inhibition test, contact toxicity test, and respiration). The mobility, represented by the water-extractable fraction corresponded well with the amount of cadmium in the soil solution, calculate using the WHAM (r2=0.96, P<0.001). The results of the ecotoxicologica evaluation, which represent the bioavailable fraction of cadmium, correlated well with DTPA extractability and also with the concentration of free cadmium ion, which is recognized as the most bioavailable metal form. The results of the WHAM as well as the results of extraction experiments showed a strong binding of cadmium to organic matter and a weak sorption of cadmium to clay minerals

  14. Cadmium cutoff energy for MCNP modeling of dosimetry reactions

    International Nuclear Information System (INIS)

    Reactor pressure vessel neutron fluence calculations are verified by comparing calculated reaction rates of dosimetry foils assumed to be placed in the cavity surrounding the pressure vessel with corresponding experimentally determined dosimetry reaction rates at the same location. The irradiated foils used are bare and cadmium covered. The cadmium-covered foils see a different neutron flux than the uncovered foils. Computer models computing reaction rates for the foils must approximate the effect of the cadmium foil cover. The MCNP code modeling of reactor cavity dosimetry reactions to validate the computed neutron flux hitting the pressure vessel of a pressurized water reactor (PWR) requires the choice of an appropriate cadmium cutoff energy. Since the neutron spectrum is harder in the cavity than in the core, the same cadmium cutoff energy may not be universally applied. The correct cutoff energy for the cavity of a PWR was computed by using MCNP4a and a representative cavity spectrum. Four cadmium-covered foil reactions were analyzed, and the appropriate energy cutoff was determined to be ∼ 0.6 eV for ∼0.5-mm-thick cadmium covers

  15. Bacterial bioremediation of aquatic cadmium 11 of area of Pakistan

    International Nuclear Information System (INIS)

    Cadmium Cd/sup +2/ pollution arises mainly from contamination of minerals used in agriculture and from industrial process. The usual situation is of large volume of soil and H/sub 2/O that are contaminated with low but significant concentration of Cd/sup +2/. Cadmium is one of the most dangerous heavy metal both to human health and aquatic ecosystem. Microorganisms have developed different strategies to regulate uptake and to detoxify heavy metals viz; by different mechanisms i.e. by adsorption to cell surface, by intercellular accumulation, precipitation, biosynthesis of metallothioneins to volatile compounds. Microcosm experiments in chemostat incubated at 20 deg. C showed that Cadmium Contamination does not greatly affect bacterial communities in cultures contaminated with up to 1mg CdI/sup -1/. acterial productivity remains unchanged and Cadmium- resistant strains arise quickly and in great number. The cadmium accumulation by bacteria depend on the bacterial productivity. The free bacteria can accumulate up to 1200 ppm Cadmium Where as the adhering bacteria concentrate up to 6100 ppm. At a steady state, 11-29% Cadmium is removed from the water phase of cultures. This paper includes Cd (II) removal by Bacteria from waste water of Wah Cantonment Pakistan. (author)

  16. Accumulation and distribution of arsenic and cadmium by tea plants

    Institute of Scientific and Technical Information of China (English)

    Yuan-zhi SHI; Jian-yun RUAN; Lifeng MA; Wen-yan HAN; Fang WANG

    2008-01-01

    It is important to research the rules about accumulation and distribution of arsenic and cadmium by tea plants, which will give us some scientific ideas about how to control the contents of arsenic and cadmium in tea. In this study, by field inves- tigation and pot trial, we found that mobility of arsenic and cadmium in tea plants was low. Most arsenic and cadmium absorbed were fixed in feeding roots and only small amount was transported to the above-ground parts. Distribution of arsenic and cadmium, based on their concentrations of unit dry matter, in tea plants grown on un-contaminated soil was in the order: feeding roots>stems≈main roots>old leaves>young leaves. When tea plants were grown on polluted soils simulated by adding salts of these two metals, feeding roots possibly acted as a buffer and defense, and arsenic and cadmium were transported less to the above- ground parts. The concentration of cadmium in soil significantly and negatively correlated with chlorophyll content, photosyn- thetic rate, transpiration rate and biomass production of tea plants.

  17. Cadmium Uptake in Synechococcus aquatilis (Reynaud Strain SY01

    Directory of Open Access Journals (Sweden)

    Ruperto Vallarta Jr.

    1998-12-01

    Full Text Available Cadmium uptake in Synechococcus aquatilis (Reynaud Strain SY01 showed a biphasic behavior, with an initial rapid passive cell wall interaction phase and a later slow intracellular cation uptake process. The cell wall uptake process followed Michaelis-Menten kinetics. The apparent Km of the uptake system was 38.89 µM, a relatively high affinity Km value compared to other metal uptake systems. Fitting of experimental data to the Langmuir and Freundlich adsorption isotherms showed that binding of cadmium to the cell surface was monolayer and/or multilayer, although the monolayer adsorption was more probable, as exemplified by a high correlation coefficient. This could be explained by the presence of a strong primary binding site which was responsible for a monolayer adsorption and a weak secondary binding site which could be responsible for a multilayer adsorption. The uptake process was found to be relatively specific for cadmium. Equimolar amounts (200 µM of cobalt, nickel, magnesium, and copper did not significantly affect cadmium uptake. Synechococcus aquatilis Strain SY01 cells also showed an efflux mechanism for cadmium, although the amount of excluded cadmium was insignificant compared with the amount of adsorbed cadmium in the cell wall.

  18. Blood cadmium concentration and lipid profile in Korean adults

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Kisok, E-mail: kimkisok@kmu.ac.kr [Department of Public Health, Keimyung University, 1000 Shindang-dong, Daegu 704-701 (Korea, Republic of)

    2012-01-15

    Although animal experiments have shown that cadmium exposure induces alterations in lipid profiles, no epidemiological study of this relationship has been performed. The objective of this study was to evaluate the association between blood cadmium concentration and blood lipid levels in Korean adults. A cross-sectional study comprising participants (n=3903) aged 20 years or older from the 2005, 2008, and 2009 Korea National Health and Nutrition Examination Surveys was conducted. Demographic characteristics and dietary intake were obtained from the participants by questionnaire, and cadmium and lipid levels were determined by analysis of blood samples. After adjusting for demographic and dietary factors, blood concentration of cadmium was positively associated with the risk of low high-density lipoprotein cholesterol (HDL-C) in a dose-dependent manner (p for trend <0.001). In addition, the odds ratios (ORs) of a high triglyceride to HDL-C ratio was significantly increased in the high blood cadmium groups [OR=1.36; 95% confidence interval (CI), 1.03-1.79 for fourth quintile and OR=1.41; 95% CI, 1.07-1.86 for fifth quintile] compared with the lowest quintile group. However, high blood cadmium was not associated with a risk of high total cholesterol, high low-density lipoprotein cholesterol, or high triglycerides. These data suggest that an increased cadmium body burden increases the risk of dyslipidemia, mainly due to the increased risk of low HDL-C and the high ratio of triglycerides to HDL-C.

  19. Screening of Amaranth Cultivars (Amaranthus mangostanus L.) for Cadmium Hyperaccumulation

    Institute of Scientific and Technical Information of China (English)

    FAN Hong-li; ZHOU Wei

    2009-01-01

    The potential harm of soil cadmium pollution to ecological environment and human health has been increasingly widely concerned. Phytoremediation, as a kind of new and effective technology, has become an important method for cleaning up cadmium in contaminated sites. The amaranth (Amaranthus mangostanus L.) is widely distributed and has abundant varieties in China, its rapid growth and large biomass can be served as candidate for cadmium hyperaccumulators for phytoremediation. To obtain cadmium hyper-accumulator, Cd uptake in 23 amaranth euitivars from different ecological region was investigated under hydroponic culture condition. Meanwhile, pot experiment was established to probe phytoremediation potentiality of Cd contaminated soil by amaranth. Three treatment (Cd 5, 10, and 25 mg kg-1) were imposed to red soil, yellow brown soil, and vegetable soil. The results showed that under hydroponic culture with Cd 3 mg L-1, the cadmium concentration in the shoots of the cultivar Tianxingmi reached 260 mg kg-1, and its total cadmium uptake was the highest among various cultivars. In the treatment Cd 25 mg kg-1, the cadmium concentration in the shoots of the cultivar Tianxingmi reached 212 mg kg-1, while bioaccumulation factor and shoot purification rate reached 8.50 and 3.8%, respectively. Further, the total biomass and shoot biomass were not decreased significantly under Cd exposure.These results suggested that eultivar Tianxingmi is a typical Cd hyperaccumulator, and can be expected to be used in phytoremediation of Cd contaminated soil.

  20. Selenium protection from cadmium and chromium poisoning

    International Nuclear Information System (INIS)

    The interaction of selenium with cadmium and chromium was studied in 168 chicken-broilers (DWCxWR) divided into four equal groups. Eight-week old control animals received an intravenous dose of /sup 115m/Cd Chloride 370 KBq/Kg (Group I), or 51Cr Chloride 370 KBq/Kg (Group II). The kinetics of these isotopes were studied by scintillation spectrometry (NaI/TI) carried out for whole blood, plasma, plasma proteins, urine, feces and homogenates of all organs at various time intervals. Animals in Groups III and IV received eight subcutaneous doses of sodium selenate (5ug) at 8-week intervals prior to /sup 115m/Cd or 51Cr. The kinetics of these elements were studied as in the previous two groups. It was found that selenium affected those kinetics in two ways: (a) by increasing the excretion of Cd by 11 +/- 3% (P < 0.001) and that of Cr by 7 +/- 1% (P < 0.001); and (b) by favoring redistribution of those elements, with significant (P < 0.001) reductions in liver, endocrine glands and kidney and increases (P < 0.01) in bone. The study suggests that selenium protects the animals' vital organs from environmental pollutants, such as cadmium and chromium

  1. Cadmium determination in Lentinus edodes mushroom species

    Directory of Open Access Journals (Sweden)

    Vera Akiko Maihara

    2012-09-01

    Full Text Available Many studies have drawn attention to the occurrence and concentration of toxic elements found in the fruiting body of mushrooms. Some edible mushroom species are known to accumulate high levels of inorganic contaminants, mainly cadmium, mercury, and lead. There are about 2,000 known edible mushroom species, but only 25 of them are cultivated and used as food. In Brazil, the most marketed and consumed mushroom species are Agaricus bisporus, known as Paris champignon, Lentinus edodes, or Shitake and Pleurotus sp, also called Shimeji or Hiratake. In this study, the concentration of cadmium was determined in Lentinus edodes mushrooms from different cities in São Paulo state and some samples imported from Japan and China. The analyses were performed by graphite furnace atomic absorption spectrometry after HNO3-H2O2 digestion. The results showed a lower concentration of Cd in the mushrooms cultivated in São Paulo (0.0079 to 0.023 mg.kg-1 in natura than that of the mushrooms cultivated abroad (0.125 to 0.212 mg.kg-1 in natura. Although there is no tolerance limit for Cd in mushrooms in Brazil, the results show that Lentinus edodes mushrooms can be safely consumed.

  2. Cadmium minimization in wheat: A critical review.

    Science.gov (United States)

    Rizwan, Muhammad; Ali, Shafaqat; Abbas, Tahir; Zia-Ur-Rehman, Muhammad; Hannan, Fakhir; Keller, Catherine; Al-Wabel, Mohammad I; Ok, Yong Sik

    2016-08-01

    Cadmium (Cd) accumulation in wheat (Triticum aestivum L.) and its subsequent transfer to food chain is a major environmental issue worldwide. Understanding wheat response to Cd stress and its management for aiming to reduce Cd uptake and accumulation in wheat may help to improve wheat growth and grain quality. This paper reviewed the toxic effects, tolerance mechanisms, and management of Cd stress in wheat. It was concluded that Cd decreased germination, growth, mineral nutrients, photosynthesis and grain yield of wheat and plant response to Cd toxicity varies with cultivars, growth conditions and duration of stress applied. Cadmium caused oxidative stress and genotoxicity in wheat plants. Stimulation of antioxidant defense system, osmoregulation, ion homeostasis and over production of signalling molecules are important adaptive strategies of wheat under Cd stress. Exogenous application of plant growth regulators, inorganic amendments, proper fertilization, silicon, and organic, manures and biochar, amendments are commonly used for the reduction of Cd uptake in wheat. Selection of low Cd-accumulating wheat cultivars, crop rotation, soil type, and exogenous application of microbes are among the other agronomic practices successfully employed in reducing Cd uptake by wheat. These management practices could enhance wheat tolerance to Cd stress and reduce the transfer of Cd to the food chain. However, their long-term sustainability in reducing Cd uptake by wheat needs further assessment. PMID:27062345

  3. Alternative materials to cadmium for neutron absorbers in safeguards applications

    International Nuclear Information System (INIS)

    Cadmium is increasingly difficult to use in safeguards applications because of rising cost and increased safety regulations. This work examines the properties of two materials produced by Ceradyne, inc. that present alternatives to cadmium for neutron shielding. The first is an aluminum metal doped with boron and the second is a boron carbide powder, compressed into a ceramic. Both are enriched in the 10B isotope. Two sheets of boron doped aluminum (1.1 mm and 5.2mm thick) and one sheet of boron carbide (8.5mm thick) were provided by Ceradyne for testing. An experiment was designed to test the neutron absorption capabilities of these three sheets against two different thicknesses of cadmium (0.6mm and 1.6mm thick). The thinner piece of aluminum boron alloy (1.1mm) performed as well as the cadmium pieces at absorbing neutrons. The thicker aluminum-boron plate provided more shielding than the cadmium sheets and the boron carbide performed best by a relatively large margin. Monte Carlo N-Particle eXtended (MCNPX) transport code modeling of the experiment was performed to provide validaLed computational tools for predicting the behavior of systems in which these materials may be incorporated as alternatives to cadmium. MCNPX calculations predict that approximately 0.17mm of the boron carbide is equivalent to 0.6mm of cadmium. There are drawbacks to these materials that need to be noted when considering using them as replacements for cadmium. Notably, they may need to be thicker than cadmium, and are not malleable, requiring machining to fit any curved forms.

  4. Effect of titanium addition on fracture toughness behavior of ZL108 alloy

    Institute of Scientific and Technical Information of China (English)

    WENG Yong-gang; LI Zi-jing; LIU Zhi-yong; LIU Wen-cai; WANG Ming-xing; SONG Tian-fu

    2006-01-01

    Two different titanium alloying methods were applied to ZL108 alloy for preparing specimens containing titanium. The specimens were tested on the MTS 810 material test system for studying their behavior of the plane strain fracture toughness KIC. The experimental data were analyzed by the statistical significance tests. The results show that the fracture toughness of the ZL108 alloy containing titanium is superior to that of common ZL108 alloy containing no titanium, but there is no significant difference for different titanium alloying methods. Therefore titanium addition is an effective method for improving the fracture toughness of the alloy ZL108.

  5. Decay properties of nuclei close to Z = 108 and N = 162

    International Nuclear Information System (INIS)

    The goal of the research conducted in the frame of this thesis was to investigate the decay properties of the nuclides 269-271Hs and their daughters using an improved chemical separation and detection system. Shell stabilization was predicted in the region around Z=108 and N=162 in calculations, taking into account possible higher orders of deformations of the nuclei. The nucleus 270Hs with a closed proton and a closed neutron deformed shell, was predicted to be ''deformed doubly magic''. Nuclei around 270Hs can be produced only via fusion reactions at picobarn levels, resulting in a production rates of few atoms per day. Investigating short-lived nuclei using rapid chemical separation and subsequent on-line detection methods provides an independent and alternative means to electromagnetic on-line separators. Chemical separation of Hs in the form of HsO4 provides an excellent tool to study the formation reactions and nuclear structure in this region of the chart of nuclides due to a high overall efficiency and a very high purification factor. The goal was accomplished, as element 108, hassium, was produced in the reaction 248Cm(26Mg,xn)274-xHs and chemically isolated. After gas phase separation of HsO4, 26 genetically linked decay chains have been observed. These were attributed to decays of three different Hs isotopes produced in the 3-5n evaporation channels. The known decay chain of 269Hs, the 5n evaporation product, serves as an anchor point, thus allowing the unambiguous assignment of the observed decay chains to the 5n, 4n, and 3n channels, respectively. Decay properties of five nuclei have been unambiguously established for the first time, including the one for the the doubly-magic nuclide 270Hs. This hassium isotope is the next doubly magic nucleus after the well known 208Pb and the first experimentally observed even-even nucleus on the predicted N=162 neutron shell. The observed decay properties provide strong indications for enhanced nuclear stability in

  6. Cadmium-induced inhibition of photosynthesis and long-term acclimation to cadmium stress in the hyperaccumulator Thlaspi caerulescens.

    Science.gov (United States)

    Küpper, Hendrik; Parameswaran, Aravind; Leitenmaier, Barbara; Trtílek, Martin; Setlík, Ivan

    2007-01-01

    Acclimation of hyperaccumulators to heavy metal-induced stress is crucial for phytoremediation and was investigated using the hyperaccumulator Thlaspi caerulescens and the nonaccumulators T. fendleri and T. ochroleucum. Spatially and spectrally resolved kinetics of in vivo absorbance and fluorescence were measured with a novel fluorescence kinetic microscope. At the beginning of growth on cadmium (Cd), all species suffered from toxicity, but T. caerulescens subsequently recovered completely. During stress, a few mesophyll cells in T. caerulescens became more inhibited and accumulated more Cd than the majority; this heterogeneity disappeared during acclimation. Chlorophyll fluorescence parameters related to photochemistry were more strongly affected by Cd stress than nonphotochemical parameters, and only photochemistry showed acclimation. Cd acclimation in T. caerulescens shows that part of its Cd tolerance is inducible and involves transient physiological heterogeneity as an emergency defence mechanism. Differential effects of Cd stress on photochemical vs nonphotochemical parameters indicate that Cd inhibits the photosynthetic light reactions more than the Calvin-Benson cycle. Differential spectral distribution of Cd effects on photochemical vs nonphotochemical quenching shows that Cd inhibits at least two different targets in/around photosystem II (PSII). Spectrally homogeneous maximal PSII efficiency (F(v)/F(m)) suggests that in healthy T. caerulescens all chlorophylls fluorescing at room temperature are PSII-associated. PMID:17688582

  7. Exposure dose response relationships of the freshwater bivalve Hyridella australis to cadmium spiked sediments

    Energy Technology Data Exchange (ETDEWEB)

    Marasinghe Wadige, Chamani P.M., E-mail: chamani.marasinghe.wadige@canberra.edu.au; Maher, William A.; Taylor, Anne M.; Krikowa, Frank

    2014-07-01

    Highlights: • The exposure–dose–response approach was used to assess cadmium exposure and toxicity. • Accumulated cadmium in H. australis reflected the sediment cadmium exposure. • Spill over of cadmium into the biologically active pool was observed. • Increased cadmium resulted in measurable biological effects. • H. australis has the potential to be a cadmium biomonitor in freshwater environments. - Abstract: To understand how benthic biota may respond to the additive or antagonistic effects of metal mixtures in the environment it is first necessary to examine their responses to the individual metals. In this context, laboratory controlled single metal-spiked sediment toxicity tests are useful to assess this. The exposure–dose–response relationships of Hyridella australis to cadmium-spiked sediments were, therefore, investigated in laboratory microcosms. H. australis was exposed to individual cadmium spiked sediments (<0.05 (control), 4 ± 0.3 (low) and 15 ± 1 (high) μg/g dry mass) for 28 days. Dose was measured as cadmium accumulation in whole soft body and individual tissues at weekly intervals over the exposure period. Dose was further examined as sub-cellular localisation of cadmium in hepatopancreas tissues. The biological responses in terms of enzymatic and cellular biomarkers were measured in hepatopancreas tissues at day 28. H. australis accumulated cadmium from spiked sediments with an 8-fold (low exposure organisms) and 16-fold (high exposure organisms) increase at day 28 compared to control organisms. The accumulated tissue cadmium concentrations reflected the sediment cadmium exposure at day 28. Cadmium accumulation in high exposure organisms was inversely related to the tissue calcium concentrations. Gills of H. australis showed significantly higher cadmium accumulation than the other tissues. Accumulated cadmium in biologically active and biologically detoxified metal pools was not significantly different in cadmium exposed

  8. Cadmium biosorption by baker’s yeast in aqueous suspension

    OpenAIRE

    Tálos Katalin; Pernyeszi Tímea; Majdik Cornelia; Hegedűsova Alzbeta; Páger Csilla

    2012-01-01

    The biosorption of cadmium from artificial aqueous solutions using native baker’s yeast was investigated. The highest metal uptake value was 110 mg g-1 in a suspension of 0.3 g L-1. The effect of pH, initial cadmium concentration, adsorption time and biosorbent dosage on biosorption by baker’s yeast was studied. The maximum biosorption capacity of cadmium by yeast was observed at pH 6.0. The adsorption equilibrium was reached within sixty minutes and the sorption process followed pseudo...

  9. Experience of reprocessing of cadmium sulfide-containing waste materials

    International Nuclear Information System (INIS)

    Technique of cadmium extraction from sulfide-containing wastes using the method of oxidizing leaching was developed and subjected to industrial testing. Reagents containing manganese dioxide - manganese ore or manganese slime of electrolytic shop usually used in zinc production - are advisable to be used as oxidizers. Factors of cadmium extraction into solution appeared to be close to ones, obtained during laboratory investigation. If the yield of leaching residual equals ∼38% and the content of cadmium, being in insoluble form, equals ∼0.40%, metal losses with this residual are equal to 0.37%

  10. Hepatoprotective activity of Moringa oleifera against cadmium toxicity in rats

    OpenAIRE

    Reetu Toppo; Birendra Kumar Roy; Ravuri Halley Gora; Sushma Lalita Baxla; Prabhat Kumar

    2015-01-01

    Aim: The present investigation has been conducted to evaluate the hepatoprotective activity of Moringa oleifera against cadmium-induced toxicity in rats. Materials and Methods: For this study, 18 Wistar albino rats were taken. Control group, Group I rats were given cadmium chloride @ 200 ppm per kg and Group II rats were treated with M. oleifera extract @ 500 mg/kg along with cadmium chloride @ 200 ppm per kg (daily oral for 28 days). On 29th day, animals were slaughtered and various paramete...

  11. Cadmium and hypertension in exposed workers: A meta-analysis

    Directory of Open Access Journals (Sweden)

    Tiziana Caciari

    2013-06-01

    Full Text Available Objectives: In the general population, cadmium seems to be responsible for hypertension, atherosclerosis and an increase in acute coronary events. Therefore, the purpose of this meta-analysis was to analyze controlled studies conducted on cadmium and arterial pressure in occupationally-exposed workers. Materials and Methods: After analyzing all the relevant articles found in the literature, 6 publications were selected. Results: A higher prevalence of hypertension and higher values of systolic and diastolic blood pressure were recorded in the exposed subjects. Conclusions: Cadmium in occupationallyexposed individuals appears to induce an increase in systolic and diastolic blood pressure and an increase in the prevalence of hypertension.

  12. Zinc and cadmium oxidation by cyclopentadienylmolybdenum(tungsten) tricarbonyl chlorides

    International Nuclear Information System (INIS)

    Influence of the nature of organic solvent on reaction rate and yield of zinc and cadmium interaction products with Cp(CO)3 MCl complexes (Cp - cyclopentadiene; M = Mo, W) at temperatures of 283-303 K was studied. Kinetic parameters of zinc and cadmium oxidation by molybdenum complex in the presence of N,N-dimethylformamide were ascertained. Thermodynamic parameters of the oxidant and ligand adsorption on metal surface were determined. It is shown that the use of the complexes studied as metal oxidants permits preparing compounds featuring molybdenum and tunsten bond with zinc and cadmium

  13. Determination of cadmium in aluminium by atomic absorption spectrometry

    International Nuclear Information System (INIS)

    A direct method for the determination of cadmium in elemental aluminium is described. Metal samples are dissolved in diluted hydrochloric acid and cadmium is determined by atomic absorption spectrometry in an air-acetylene flame. Interference by non-specific absorption observed at the analytical wavelength incorrected for by means of a non-absorbing line emitted by the hollow-cathode lamp. Relatively large amounts of arsenic do not interfere. The minimun determinable concentration of cadmium for this procedure is 2-3 ppm, expressed on aluminium basis. (author)

  14. Chromosomal Locus for Cadmium Resistance in Pseudomonas putida Consisting of a Cadmium-Transporting ATPase and a MerR Family Response Regulator

    OpenAIRE

    Lee, Seon-Woo; Glickmann, Eric; Cooksey, Donald A.

    2001-01-01

    Pseudomonads from environmental sources vary widely in their sensitivity to cadmium, but the basis for this resistance is largely uncharactarized. A chromosomal fragment encoding cadmium resistance was cloned from Pseudomonas putida 06909, a rhizosphere bacterium, and sequence analysis revealed two divergently transcribed genes, cadA and cadR. CadA was similar to cadmium-transporting ATPases known mostly from gram-positive bacteria, and to ZntA, a lead-, zinc-, and cadmium-transporting ATPase...

  15. Inclusion free cadmium zinc tellurium and cadmium tellurium crystals and associated growth method

    Science.gov (United States)

    Bolotnikov, Aleskey E.; James, Ralph B.

    2010-07-20

    The present disclosure provides systems and methods for crystal growth of cadmium zinc tellurium (CZT) and cadmium tellurium (CdTe) crystals with an inverted growth reactor chamber. The inverted growth reactor chamber enables growth of single, large, high purity CZT and CdTe crystals that can be used, for example, in X-ray and gamma detection, substrates for infrared detectors, or the like. The inverted growth reactor chamber enables reductions in the presence of Te inclusions, which are recognized as an important limiting factor in using CZT or CdTe as radiation detectors. The inverted growth reactor chamber can be utilized with existing crystal growth techniques such as the Bridgman crystal growth mechanism and the like. In an exemplary embodiment, the inverted growth reactor chamber is a U-shaped ampoule.

  16. Biological Insights From 108 Schizophrenia-Associated Genetic Loci

    Science.gov (United States)

    Ripke, Stephan; Neale, Benjamin M; Corvin, Aiden; Walters, James TR; Farh, Kai-How; Holmans, Peter A; Lee, Phil; Bulik-Sullivan, Brendan; Collier, David A; Huang, Hailiang; Pers, Tune H; Agartz, Ingrid; Agerbo, Esben; Albus, Margot; Alexander, Madeline; Amin, Farooq; Bacanu, Silviu A; Begemann, Martin; Belliveau, Richard A; Bene, Judit; Bergen, Sarah E; Bevilacqua, Elizabeth; Bigdeli, Tim B; Black, Donald W; Bruggeman, Richard; Buccola, Nancy G; Buckner, Randy L; Byerley, William; Cahn, Wiepke; Cai, Guiqing; Campion, Dominique; Cantor, Rita M; Carr, Vaughan J; Carrera, Noa; Catts, Stanley V; Chambert, Kimberley D; Chan, Raymond CK; Chan, Ronald YL; Chen, Eric YH; Cheng, Wei; Cheung, Eric FC; Chong, Siow Ann; Cloninger, C Robert; Cohen, David; Cohen, Nadine; Cormican, Paul; Craddock, Nick; Crowley, James J; Curtis, David; Davidson, Michael; Davis, Kenneth L; Degenhardt, Franziska; Del Favero, Jurgen; Demontis, Ditte; Dikeos, Dimitris; Dinan, Timothy; Djurovic, Srdjan; Donohoe, Gary; Drapeau, Elodie; Duan, Jubao; Dudbridge, Frank; Durmishi, Naser; Eichhammer, Peter; Eriksson, Johan; Escott-Price, Valentina; Essioux, Laurent; Fanous, Ayman H; Farrell, Martilias S; Frank, Josef; Franke, Lude; Freedman, Robert; Freimer, Nelson B; Friedl, Marion; Friedman, Joseph I; Fromer, Menachem; Genovese, Giulio; Georgieva, Lyudmila; Giegling, Ina; Giusti-Rodríguez, Paola; Godard, Stephanie; Goldstein, Jacqueline I; Golimbet, Vera; Gopal, Srihari; Gratten, Jacob; de Haan, Lieuwe; Hammer, Christian; Hamshere, Marian L; Hansen, Mark; Hansen, Thomas; Haroutunian, Vahram; Hartmann, Annette M; Henskens, Frans A; Herms, Stefan; Hirschhorn, Joel N; Hoffmann, Per; Hofman, Andrea; Hollegaard, Mads V; Hougaard, David M; Ikeda, Masashi; Joa, Inge; Julià, Antonio; Kahn, René S; Kalaydjieva, Luba; Karachanak-Yankova, Sena; Karjalainen, Juha; Kavanagh, David; Keller, Matthew C; Kennedy, James L; Khrunin, Andrey; Kim, Yunjung; Klovins, Janis; Knowles, James A; Konte, Bettina; Kucinskas, Vaidutis; Kucinskiene, Zita Ausrele; Kuzelova-Ptackova, Hana; Kähler, Anna K; Laurent, Claudine; Lee, Jimmy; Lee, S Hong; Legge, Sophie E; Lerer, Bernard; Li, Miaoxin; Li, Tao; Liang, Kung-Yee; Lieberman, Jeffrey; Limborska, Svetlana; Loughland, Carmel M; Lubinski, Jan; Lönnqvist, Jouko; Macek, Milan; Magnusson, Patrik KE; Maher, Brion S; Maier, Wolfgang; Mallet, Jacques; Marsal, Sara; Mattheisen, Manuel; Mattingsdal, Morten; McCarley, Robert W; McDonald, Colm; McIntosh, Andrew M; Meier, Sandra; Meijer, Carin J; Melegh, Bela; Melle, Ingrid; Mesholam-Gately, Raquelle I; Metspalu, Andres; Michie, Patricia T; Milani, Lili; Milanova, Vihra; Mokrab, Younes; Morris, Derek W; Mors, Ole; Murphy, Kieran C; Murray, Robin M; Myin-Germeys, Inez; Müller-Myhsok, Bertram; Nelis, Mari; Nenadic, Igor; Nertney, Deborah A; Nestadt, Gerald; Nicodemus, Kristin K; Nikitina-Zake, Liene; Nisenbaum, Laura; Nordin, Annelie; O’Callaghan, Eadbhard; O’Dushlaine, Colm; O’Neill, F Anthony; Oh, Sang-Yun; Olincy, Ann; Olsen, Line; Van Os, Jim; Pantelis, Christos; Papadimitriou, George N; Papiol, Sergi; Parkhomenko, Elena; Pato, Michele T; Paunio, Tiina; Pejovic-Milovancevic, Milica; Perkins, Diana O; Pietiläinen, Olli; Pimm, Jonathan; Pocklington, Andrew J; Powell, John; Price, Alkes; Pulver, Ann E; Purcell, Shaun M; Quested, Digby; Rasmussen, Henrik B; Reichenberg, Abraham; Reimers, Mark A; Richards, Alexander L; Roffman, Joshua L; Roussos, Panos; Ruderfer, Douglas M; Salomaa, Veikko; Sanders, Alan R; Schall, Ulrich; Schubert, Christian R; Schulze, Thomas G; Schwab, Sibylle G; Scolnick, Edward M; Scott, Rodney J; Seidman, Larry J; Shi, Jianxin; Sigurdsson, Engilbert; Silagadze, Teimuraz; Silverman, Jeremy M; Sim, Kang; Slominsky, Petr; Smoller, Jordan W; So, Hon-Cheong; Spencer, Chris C A; Stahl, Eli A; Stefansson, Hreinn; Steinberg, Stacy; Stogmann, Elisabeth; Straub, Richard E; Strengman, Eric; Strohmaier, Jana; Stroup, T Scott; Subramaniam, Mythily; Suvisaari, Jaana; Svrakic, Dragan M; Szatkiewicz, Jin P; Söderman, Erik; Thirumalai, Srinivas; Toncheva, Draga; Tosato, Sarah; Veijola, Juha; Waddington, John; Walsh, Dermot; Wang, Dai; Wang, Qiang; Webb, Bradley T; Weiser, Mark; Wildenauer, Dieter B; Williams, Nigel M; Williams, Stephanie; Witt, Stephanie H; Wolen, Aaron R; Wong, Emily HM; Wormley, Brandon K; Xi, Hualin Simon; Zai, Clement C; Zheng, Xuebin; Zimprich, Fritz; Wray, Naomi R; Stefansson, Kari; Visscher, Peter M; Adolfsson, Rolf; Andreassen, Ole A; Blackwood, Douglas HR; Bramon, Elvira; Buxbaum, Joseph D; Børglum, Anders D; Cichon, Sven; Darvasi, Ariel; Domenici, Enrico; Ehrenreich, Hannelore; Esko, Tõnu; Gejman, Pablo V; Gill, Michael; Gurling, Hugh; Hultman, Christina M; Iwata, Nakao; Jablensky, Assen V; Jönsson, Erik G; Kendler, Kenneth S; Kirov, George; Knight, Jo; Lencz, Todd; Levinson, Douglas F; Li, Qingqin S; Liu, Jianjun; Malhotra, Anil K; McCarroll, Steven A; McQuillin, Andrew; Moran, Jennifer L; Mortensen, Preben B; Mowry, Bryan J; Nöthen, Markus M; Ophoff, Roel A; Owen, Michael J; Palotie, Aarno; Pato, Carlos N; Petryshen, Tracey L; Posthuma, Danielle; Rietschel, Marcella; Riley, Brien P; Rujescu, Dan; Sham, Pak C; Sklar, Pamela; St Clair, David; Weinberger, Daniel R; Wendland, Jens R; Werge, Thomas; Daly, Mark J; Sullivan, Patrick F; O’Donovan, Michael C

    2014-01-01

    Summary Schizophrenia is a highly heritable disorder. Genetic risk is conferred by a large number of alleles, including common alleles of small effect that might be detected by genome-wide association studies. Here, we report a multi-stage schizophrenia genome-wide association study of up to 36,989 cases and 113,075 controls. We identify 128 independent associations spanning 108 conservatively defined loci that meet genome-wide significance, 83 of which have not been previously reported. Associations were enriched among genes expressed in brain providing biological plausibility for the findings. Many findings have the potential to provide entirely novel insights into aetiology, but associations at DRD2 and multiple genes involved in glutamatergic neurotransmission highlight molecules of known and potential therapeutic relevance to schizophrenia, and are consistent with leading pathophysiological hypotheses. Independent of genes expressed in brain, associations were enriched among genes expressed in tissues that play important roles in immunity, providing support for the hypothesized link between the immune system and schizophrenia. PMID:25056061

  17. Shell Model Description of $^{102-108}$Sn Isotopes

    CERN Document Server

    Trivedi, T; Negi, D; Mehrotra, I

    2012-01-01

    We have performed shell model calculations for neutron deficient even $^{102-108}$Sn and odd $^{103-107}$Sn isotopes in $sdg_{7/2}h_{11/2}$ model space using two different interactions. The first set of interaction is due to Brown {\\it et al.} and second is due to Hoska {\\it et al}. The calculations have been performed using doubly magic $^{100}$Sn as core and valence neutrons are distributed over the single particle orbits 1$g_{7/2}$, 2$d_{5/2}$, 2$d_{3/2}$, 3$s_{1/2}$ and 1$h_{11/2}$. In more recent experimental work for $^{101}$Sn [Phys. Rev. Lett. {\\bf 105} (2010) 162502], the g.s. is predicted as 5/2$^+$ with excited 7/2$^+$ at 172 keV. We have also performed another two set of calculations by taking difference in single particle energies of 2$d_{5/2}$ and 1$g_{7/2}$ orbitals by 172 keV. The present state-of-the-art shell model calculations predicts fair agreements with the experimental data. These calculations serve as a test of nuclear shell model in the region far from stability for unstable Sn isotop...

  18. Collective bands in 104,106,108Mo

    International Nuclear Information System (INIS)

    We have used our analysis of γ-γ-γ data (5.7 x 1011 triples and higher folds) taken with Gammasphere from prompt γ rays emitted in the spontaneous fission of 252Cf to study the collective bands in 104,106,108Mo. The one-phonon and two-phonon γ-vibrational bands and known two-quasiparticle bands in neutron-rich 104,106Mo were extended to higher spins. The one-and two-phonon γ-vibrational bands have remarkably close energies for transitions from the same spin states and identical moments of inertia. Several new bands are observed and are proposed as quasiparticle bands in 104,106Mo, along with the first β-type vibrational band in 106Mo. The quasiparticle bands have essentially constant moments of inertia near the rigid-body value that indicate blocking of the pairing interaction. Candidates for chiral doublet bands in 106Mo are strong. These are the first reported chiral vibrational bands in an even-even nucleus

  19. Cadmium transport and tolerance in rice: perspectives for reducing grain cadmium accumulation

    OpenAIRE

    Uraguchi, Shimpei; Fujiwara, Toru

    2012-01-01

    Cadmium (Cd) is a toxic heavy metal which harms human health. In Japan, a major source of human Cd-intake is rice grains and contamination of paddy soils by Cd and accumulation of Cd in rice grains are the serious agricultural issues. There also exist Cd contamination of rice and its toxicity in several populations in countries including China and Thailand. Understanding the Cd transport mechanisms in rice can be a basis for regulating rice Cd transport and accumulation by molecular engineeri...

  20. Fractionation of Stable Cadmium Isotopes in the Cadmium Tolerant Ricinus communis and Hyperaccumulator Solanum nigrum

    OpenAIRE

    Rongfei Wei; Qingjun Guo; Hanjie Wen; Congqiang Liu; Junxing Yang; Marc Peters; Jian Hu; Guangxu Zhu; Hanzhi Zhang; Liyan Tian; Xiaokun Han; Jie Ma; Chuanwei Zhu; Yingxin Wan

    2016-01-01

    Cadmium (Cd) isotopes provide new insights into Cd uptake, transport and storage mechanisms in plants. Therefore, the present study adopted the Cd-tolerant Ricinus communis and Cd-hyperaccumulator Solanum nigrum, which were cultured under controlled conditions in a nutrient solution with variable Cd supply, to test the isotopic fractionation of Cd during plant uptake. The Cd isotope compositions of nutrient solutions and organs of the plants were measured by multiple collector inductively cou...

  1. Electrochemical removal of cadmium from bio-ash; Elektrokemisk fjernelse af cadmium fra bioasker

    Energy Technology Data Exchange (ETDEWEB)

    Juul Pedersen, Anne; Ottosen, Lisbeth M.; Simonsen, Peter; Christensen, Terkel C.

    2004-07-01

    The potential of using the method electrodialytic remediation for removal of cadmium from bioashes has been investigated. Five different types of fly ash from biomass combustion were included in the study: 1) A straw combustion fly ash from grate-firing at Avedoere power plant. 2) A fly ash from co-firing of wood and fuel oil at Avedoere power plant. 3) A suspended, grain size fractionated straw fly ash, obtained from PSO project FU 2201, fine and coarse size fraction. The ash was originally produced at Avedoere power plant. 4) A straw pellet fly ash from dust-firing at Amager power plant. Thr five ashes were characterised, and a series of preliminary elekctrodialytic remediation experiments were conducted on each ash. In spite a significant differences between the five ashes with respect to parameters such as pH and content of cadmium, all ashes showed promising remediation potential. For all ashes cadmium concentrations below the regulatory limits for recycling were reached in one or more of the preliminary remediation experiements. The best results were obtained with the suspended straw ash from PSO FU 2201, whereas the results with the wood chips ash, due to a high initial pH value, were less sucessful, meaning that the remediation process was progressing more slowly. (BA)

  2. Comparative effects of three dithiocarbamates on tissue distribution and excretion of cadmium in mice

    International Nuclear Information System (INIS)

    The effects of sodium N-benzyl-D-glucamine dithiocarbamate (BGD), sodium N-p-hydroxymethylbenzyl-D-glucamine dithiocarbamate (HBGD), and sodium N-p-carboxybenzyl-D-glucamine dithiocarbamate (CBGD), which were newly synthesized, on the distribution and excretion of cadmium were compared in mice exposed to cadmium. Mice were injected with 109CdCl2 (1 mg Cd/kg and 74 KBq of 109Cd/one animal) and 30 min or 24 h later, they were injected with the dithiocarbamates (400 mumols/kg). At 30 min after treatment with cadmium, these chelating agents significantly enhanced the biliary excretion of cadmium, and HBGD and CBGD significantly increased the urinary excretion of the metal. At 24 h after cadmium injection, BGD and HBGD significantly increased the biliary excretion of cadmium and HBGD was the most effective on the biliary excretion of the metal. These chelating agents were effective in mobilizing cadmium from the liver and kidney at 30 min after cadmium treatment. HBGD showed the largest effectiveness on the depression of cadmium contents in the liver and kidney. At 24 h after cadmium treatment, only HBGD among these chelating agents significantly reduced the cadmium contents in the liver and kidney. These results show that the injection of HBGD at both 30 min and 24 h after cadmium treatment can much more effectively mobilize cadmium from the body mainly through the bile without redistribution of cadmium to other tissues, such as brain, testes, and heart, than injection of BGD and CBGD

  3. X-ray crystallographic characterization of an adenine-cadmium (II) complex, di-. mu. -adeninium-di-. mu. -aquo-tetrakis(nitrato-0,0')dicadmium(II) dinitrate, containing a cationic nuclei acid base as a bidentate ligand

    Energy Technology Data Exchange (ETDEWEB)

    Wei, C.H.; Jacobson, K.B.

    1981-02-01

    The reaction of the monosodium salt of adenosine-5'-monophosphoric acid with cadmium nitrate in the presence of nitric acid has resulted in the formation of a binuclear cadmium complex of adenine, ((C/sub 5/H/sub 6/N/sub 5/)Cd(NO/sub 3/)/sub 2/.H/sub 2/O)/sub 2/(NO/sub 3/)/sub 2/. The crystal structure of this complex has been characterized by single-crystal x-ray analysis based on counter data collected with an automated diffractometer. The crystals contain one centrosymmetric dimer in a reduced triclinic cell of symmetry P anti 1 and of dimensions a = 7.595 (2) A, b = 9.539 (5) A, c = 10.527 (5) A, ..cap alpha.. = 101.37 (3)/sup 0/, ..beta.. = 108.69 (3)/sup 0/, and ..gamma.. = 107.42 (3)/sup 0/.

  4. A Study of Growth of Cadmium Oxide Nano structure

    International Nuclear Information System (INIS)

    Cadmium oxide nano structure were synthesized by solid-vapor deposition without catalyst. Cadmium Oxide powder was heated to 1320 K in a tube furnace, and the resultant vapor was carried to the silicon substrate zone by an argon flow. Field electron scanning electron microscopy revealed that the product was dendrite-like petals of Cadmium Oxide nano structure. The grown nano structure had random orientations and a grain size of 30 nm. Photoluminescence spectroscopy was conducted to investigate the optical properties of the nano structures. The red-shift direct band gap energy of Cadmium Oxide nano structure was at 548 nm (2.26 eV), whereas that of CdO bulk was at 491 nm (2.5 eV). (author)

  5. Electrodialytic removal of cadmium from straw combustion fly ash

    DEFF Research Database (Denmark)

    Hansen, Henrik K.; Ottosen, Lisbeth M.; Villumsen, Arne

    2004-01-01

    Fly ash from straw combustion contains valuable nutrients when returned to agricultural soils. In many instances, however, this fly ash may contain heavy metals, such as cadmium, at levels which often exceed the limits given by the Danish legislation. Thus before utilizing the nutrients, cadmium...... must be removed from these ashes. The use of an electrodialytic remediation method to remove cadmium from fly ash arising from straw combustion and containing 11.2 mg Cd kg$+-1$/ DM (dry matter) was accessed. After 36 days of remediation at a constant current density of 5.6 mA cm$+-2$/ more than 97% of...... the cadmium had been removed from around 150 g ash on a dry basis. $CPY 2004 Society of Chemical Industry....

  6. Effect of gamma radiation on cadmium telluride surface properties

    International Nuclear Information System (INIS)

    The effect of γ-irradiation on the surface properties of cadmium telluride is studied. The possibility of oriented modification of surface properties for increasing the adsorption activity and obtaining the materials, suited for the sensor transducer production, is shown

  7. Studies on cadmium accumulation by some selected floating macrophytes.

    Science.gov (United States)

    Shuvaeva, Olga V; Belchenko, Ludmila A; Romanova, Tamara E

    2013-01-01

    The results of investigation of the process of cadmium accumulation by floating plants of Eichhornia crassipes and Pistia stratiotes are discussed. The main specialty of this study is that it puts more emphasis on the mechanism of penetration of pollutant within the plant and its fate during accumulation act. As a result it was shown that at the first stage of cadmium uptake the sorption of the metal on the surface of the roots due to the presence of carboxylic groups takes place. At the root of the plant cadmium mainly localized in the cortex and rhizodermis, then the pollutant penetrates into the tissues of the stem according to its translocation factor. It has been also assumed that flavonoids perform an intermediate role in the accumulation of cadmium by the plant, taking part in the transport and combat an oxidative stress. PMID:23819290

  8. Soil biogeochemistry, plant physiology and phytoremediation of cadmium contaminated soils

    Science.gov (United States)

    Cadmium (Cd) loading in soil and the environment has been accelerated worldwide due to enhanced industrialization and intensified agricultural production, particularly in the developing countries. Soil Cd pollution, resulting from both anthropogenic and geogenic sources, has posed an increasing chal...

  9. Ion exchange of Cobalt and Cadmium in Zeolite X

    International Nuclear Information System (INIS)

    The growing development in the industry has an important contribution to the environmental damage, where the natural effluents are each day more contaminated by toxic elements, such as: mercury, chromium, lead and cadmium. So as to separate such elements it has sorbent must have enough stability, and have a sharp capacity of sorption. In this work it was studied the sorption behavior of cobalt and on the other hand, cadmium in aqueous solutions, which along with sodic form of the Zeolite X, undergoes a phenomenon of ionic interchange. Such interchange was verify to different concentration of cadmium, cobalt and hydronium ion. The content of cobalt and sodium in the interchanged samples was detected through the neutronic activation analysis. The results disclose a higher selectivity for cadmium than cobalt. (Author)

  10. EFFECTS OF CADMIUM ON THE REPRODUCTIVE AXIS OF JAPANESE MEDAKA

    Science.gov (United States)

    Cadmium (Cd) is a ubquitous element and a significant inorganic pollutant that has previously been found to bioaccumulate in reproductive organs of fish and disrupt important endocrine processes, especially those involved in synthesis, release and metabolism of hormones. Clearly,...

  11. 47 CFR 78.108 - Minimum path lengths for fixed links.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 4 2010-10-01 2010-10-01 false Minimum path lengths for fixed links. 78.108... CABLE TELEVISION RELAY SERVICE Technical Regulations § 78.108 Minimum path lengths for fixed links. (a...) Minimum path length (km) 12,200 to 13,250 5 Above 17,700 N/A (b) For paths shorter than those specified...

  12. 46 CFR 108.205 - Wash spaces; toilet spaces; and shower spaces.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Wash spaces; toilet spaces; and shower spaces. 108.205... DRILLING UNITS DESIGN AND EQUIPMENT Construction and Arrangement Accommodation Spaces § 108.205 Wash spaces... toilet, washing, or shower space that is accessible only from one single or double occupancy...

  13. 13 CFR 108.520 - Management Expenses of a NMVC Company.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Management Expenses of a NMVC Company. 108.520 Section 108.520 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW MARKETS VENTURE CAPITAL (âNMVCâ) PROGRAM Managing the Operations of a NMVC Company Management and...

  14. 13 CFR 108.140 - SBA approval of initial Management Expenses.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false SBA approval of initial Management Expenses. 108.140 Section 108.140 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW MARKETS... SBA approval of initial Management Expenses. A NMVC Company must have its Management Expenses...

  15. 46 CFR 108.155 - Restrictions on means of escape utilized.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Restrictions on means of escape utilized. 108.155 Section 108.155 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE... means of escape utilized. A required means of escape may not be a vertical ladder or deck...

  16. 13 CFR 108.650 - Requirement to report portfolio valuations to SBA.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Requirement to report portfolio valuations to SBA. 108.650 Section 108.650 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW MARKETS VENTURE CAPITAL (âNMVCâ) PROGRAM Recordkeeping, Reporting, and Examination Requirements for NMVC Companies Reporting Requirements...

  17. 50 CFR 216.108 - Requirements for monitoring and reporting under incidental harassment authorizations for Arctic...

    Science.gov (United States)

    2010-10-01

    ... under incidental harassment authorizations for Arctic waters. 216.108 Section 216.108 Wildlife and... for monitoring and reporting under incidental harassment authorizations for Arctic waters. (a) Holders of an incidental harassment authorization in Arctic waters and their employees, agents, and...

  18. Collective dipole motion in highly excited (272)Hs (Z=108) nuclei

    NARCIS (Netherlands)

    Tveter, TS; Gaardhoje, JJ; Maj, A; Ramsay, T; Atac, A; Bacelar, J; Bracco, A; Buda, A; Camera, F; Herskind, B; Korten, W; Krolas, W; Menthe, A; Million, B; Nifenecker, H; Pignanelli, M; Pinston, JA; vanderPloeg, H; Schussler, F; Sletten, G

    1996-01-01

    The heavy nucleus (272)(108)Hs (Z = 108) and its evaporation daughters were produced using the reaction Th-232(Ar-40, gamma xn) with beam energies 10.5 and 15.0 MeV/A. The giant dipole resonance gamma radiation from the hot composite system prior to fission has been isolated using a differential met

  19. 13 CFR 108.2005 - Contents of plan submitted by SSBICs.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Contents of plan submitted by SSBICs. 108.2005 Section 108.2005 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW... objectives of the NMVC program. It must include: (1) An estimate of the social, economic, and...

  20. 5 CFR 537.108 - Loss of eligibility for student loan repayment benefits.

    Science.gov (United States)

    2010-01-01

    ... equivalent) or higher, as described in 5 CFR 430.208(d). An employee loses eligibility for student loan... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Loss of eligibility for student loan repayment benefits. 537.108 Section 537.108 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT...

  1. 48 CFR 49.108-5 - Recognition of judgments and arbitration awards.

    Science.gov (United States)

    2010-10-01

    ... and arbitration awards. 49.108-5 Section 49.108-5 Federal Acquisition Regulations System FEDERAL... judgments and arbitration awards. (a) When a subcontractor obtains a final judgment against a prime... arbitration under any applicable law or contract provision, the TCO shall recognize the arbitration award...

  2. 13 CFR 124.108 - What other eligibility requirements apply for individuals or businesses?

    Science.gov (United States)

    2010-01-01

    ... crime involving business integrity. (5) If, during the processing of an application, SBA determines that... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false What other eligibility requirements apply for individuals or businesses? 124.108 Section 124.108 Business Credit and Assistance...

  3. 30 CFR 291.108 - How do I pay the processing fee?

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false How do I pay the processing fee? 291.108 Section 291.108 Mineral Resources MINERALS MANAGEMENT SERVICE, DEPARTMENT OF THE INTERIOR APPEALS OPEN AND... the processing fee? (a) You must pay the processing fee electronically through Pay.Gov. The...

  4. 41 CFR 101-1.108 - Agency implementation and supplementation of FPMR.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Agency implementation and supplementation of FPMR. 101-1.108 Section 101-1.108 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS GENERAL 1-INTRODUCTION...

  5. Surfactant Mediated Cadmium Determination with Dithizone in Aqueous Solution

    OpenAIRE

    Ismael, Fouad Jawad

    2014-01-01

    ABSTRACT: Cadmium is a toxic and hazardous trace metal that has become a serious environmental pollutant since industrialization and intensive farming began in late 19th century. Although there are many established wet-chemical and instrumental methods for qualitative and quantitative determination of cadmium, most involve the formation of the Cd-dithizone complex in the presence of the highly toxic potassium cyanide which is then extracted into carcinogenic chlorinated organic solvents such ...

  6. Ecotoxicity and genotoxicity of cadmium in different marine trophic levels.

    Science.gov (United States)

    Pavlaki, Maria D; Araújo, Mário J; Cardoso, Diogo N; Silva, Ana Rita R; Cruz, Andreia; Mendo, Sónia; Soares, Amadeu M V M; Calado, Ricardo; Loureiro, Susana

    2016-08-01

    Cadmium ecotoxicity and genotoxicity was assessed in three representative species of different trophic levels of marine ecosystems - the calanoid copepod Acartia tonsa, the decapod shrimp, Palaemon varians and the pleuronectiform fish Solea senegalensis. Ecotoxicity endpoints assessed in this study were adult survival, hatching success and larval development ratio (LDR) for A. tonsa, survival of the first larval stage (zoea I) and post-larvae of P. varians, egg and larvae survival, as well as the presence of malformations in the larval stage of S. senegalensis. In vivo genotoxicity was assessed on adult A. tonsa, the larval and postlarval stage of P. varians and newly hatched larvae of S. senegalensis using the comet assay. Results showed that the highest sensitivity to cadmium is displayed by A. tonsa, with the most sensitive endpoint being the LDR of nauplii to copepodites. Sole eggs displayed the highest tolerance to cadmium compared to the other endpoints evaluated for all tested species. Recorded cadmium toxicity was (by increasing order): S. senegalensis eggs < P. varians post-larvae < P. varians zoea I < S. senegalensis larvae < A. tonsa eggs < A. tonsa LDR. DNA damage to all species exposed to cadmium increased with increasing concentrations. Overall, understanding cadmium chemical speciation is paramount to reliably evaluate the effects of this metal in marine ecosystems. Cadmium is genotoxic to all three species tested and therefore may differentially impact individuals and populations of marine taxa. As A. tonsa was the most sensitive species and occupies a lower trophic level, it is likely that cadmium contamination may trigger bottom-up cascading effects in marine trophic interactions. PMID:27203468

  7. Cadmium and hypertension in exposed workers: A meta-analysis

    OpenAIRE

    Tiziana Caciari; Angela Sancini; Mario Fioravanti; Teodorico Casale; Lucio Montuori; Maria Fiaschetti; Maria Pia Schifano; Giorgia Andreozzi; Nadia Nardone; Gianfranco Tomei; Manuela Ciarrocca; Maria Valeria Rosati; Francesco Tomei

    2013-01-01

    Objectives: In the general population, cadmium seems to be responsible for hypertension, atherosclerosis and an increase in acute coronary events. Therefore, the purpose of this meta-analysis was to analyze controlled studies conducted on cadmium and arterial pressure in occupationally-exposed workers. Materials and Methods: After analyzing all the relevant articles found in the literature, 6 publications were selected. Results: A higher prevalence of hypertension and higher values of systoli...

  8. Association between blood cadmium levels and malnutrition in peritoneal dialysis

    OpenAIRE

    Hsu, Ching-Wei; Lin, Ja-Liang; Lin-Tan, Dan-Tzu; Huang, Wen-Hung; Chen, Kuan-Hsing; Yen, Tzung-Hai

    2014-01-01

    Background Malnutrition is associated with an increased risk of cardiovascular death and may cause protein-energy wasting in individuals with chronic kidney disease. A previous study demonstrated that blood cadmium levels (BCLs) were associated with malnutrition in maintenance hemodialysis (MHD) patients. However, the correlation between cadmium exposure and malnutrition remains unclear in chronic peritoneal dialysis (CPD) patients. This study examined the possible adverse effects of environm...

  9. Avalanche multiplication of electrons and holes in cadmium telluride

    CERN Document Server

    Demich, N V

    2001-01-01

    Determination of the ratio of the coefficients of the electrons and holes of the diode structures impact ionization is carried out with the purpose of optimizing the parameters of the avalanche diodes from the cadmium telluride. It is shown experimentally, that the process of the impact ionization in the cadmium telluride is stimulated by holes. The ratio of the coefficients of the holes and electrons impact ionization constitutes approx = 30-40

  10. Elektrokemisk fjernelse af cadmium fra bioasker

    DEFF Research Database (Denmark)

    Pedersen, Anne Juul; Ottosen, Lisbeth M.; Simonsen, Peter;

    Hosliggende rapport formidler resultaterne fra PSO-projektet: ”Elektrokemisk fjernelse af cadmium fra bioasker” (PSO-F&U 3206), finansieret af Elkraft System og Energi E2 A/S. Projektet blev gennemført i perioden 01.05.2003 – 30.06.2004, og partnerne var Energi E2 A/S, BYG-DTU og Krüger A/S, med ...... igangværende PSO FU 2201 ”Opgradering af restprodukter” (”Askepot”), og det skulle derfor også undersøges, om den elektrodialytiske rensningsproces evt. kunne kombineres med den vaskeproces, der benyttes til rensning af aske i FU 2201....

  11. Cadmium substituted high permeability lithium ferrite

    Indian Academy of Sciences (India)

    S S Bellad; S C Watawe; A M Shaikh; B K Chougule

    2000-04-01

    Polycrystalline Li0.5–/2 Cd Fe2.5–/2O4 ferrites where = 0, 0.1, 0.2, 0.3, 0.4, 0.5 and 0.6 were prepared by a double sintering ceramic technique and characterized by X-ray diffraction and scanning electron microscopy (SEM). The lattice parameter is found to increase monotonically with the cadmium content. It is explained in terms of the sizes of component ions. The grain size of the samples increases up to = 0.3 and then it decreases for higher values of . A similar trend is observed in the variation of Ms with Cd2+ content. The initial permeability () is however found to increase continuously with . The increase in is attributed to decrease of anisotropy constant K1 and higher grain size of the samples.

  12. Flotation of cadmium-loaded biomass.

    Science.gov (United States)

    Matis, K A; Zouboulis, A I

    1994-07-01

    Biosorption of heavy metal ions such as Cd(2+) by dead biomass has been recognized as a potential alternative to existing removal technologies applied to wastewater treatment. Two bacterial strains were studied in the laboratory, streptomyces griseus and S. clavuligerus, an industrial by-product. Both washed and unwashed samples were examined. Foam flotation proposed in this work as the separation state following biosorption. Effective biomass separation was conducted in the presence of a frother, ethanol. The pH of the solution was a crucial parameter for flotation and also for metal binding. Other basic parameters of flotation examined were the initial cadmium concentration in the dilute aqueous solution and the quantity of biomass used. A study of zeta-potential measurements of the actinomycetes was carried out under the conditions used in the separation; surface tension was also measured. These provided useful information on the process. PMID:18618752

  13. Synthesis and Electroluminescence Characterization of Cadmium Complex

    Directory of Open Access Journals (Sweden)

    Rahulkumar

    2011-01-01

    Full Text Available We have synthesized and characterized a new electroluminescence material,Cadmium [(2-(2-hydroxyphenylbenzoxazole(8-hydoxyquinoline] Cd(HPBq. The absorption spectra of this material show maxima at 378 nm. It may be attributed due to π° – π* transition. The photoluminescence showed peak at 520 nm. TGA data of the material shows stability up to 370 °C .Organic light emitting diode have been fabricated with this material and the fundamental structures of the device is ITO/α-NPD/ Cd(HPBq/BCP/Alq3/LiF/Al exhibited a luminescence peak at 550 nm. The maximum luminescence of the device was 295 cd/m2 with current density of 6687 A/m2 at 20 V. The maximum current efficiency of OLED was 1.01 cd/A at 17 V and power efficiency was 1.01 lm/w at 17 V.

  14. Soil Cadmium Regulates Antioxidases in Sorghum

    Institute of Scientific and Technical Information of China (English)

    LIU Da-lin; ZHANG Shu-pan; CHEN Zheng; QIU Wei-wei

    2010-01-01

    The regulatory mechanism of soil cadmium(Cd)on antioxidases in sorghum was studied using 3 sorghum species viz.,sweet sorghum[Sorghum bicolor(L.)]Moench.cv.Hunnigreen,sorghum hybrid sudangrass(Sorghum bicolor × S.sudanense,cv.Everlush)and sudangrass[Sorghum sudanense(Piper)Stapf cv.Xinjiang].The results showed that low concentrations of Cd2+(≤10 mg kg-1)induced the activities of 4 antioxidases in leaves of the 3 species of sorghum,but high Cd2+concentrations(≥50 mg kg-1)significantly reduced the activities of all the four antioxidases.The glutathione(GSH)contents in leaves of the 3 species of sorghum correlated positively with the Cd2+concentrations.The maximum antioxidase activities were observed at the elongation stage of sorghum during the whole growth period.

  15. Cadmium in goods - contribution to environmental exposure

    Energy Technology Data Exchange (ETDEWEB)

    Bergbaeck, B.; Jonsson, Arne [Kalmar Univ. (Sweden). Dept. of Natural Science

    1998-03-01

    The total amount of Cd used in Sweden since 1940 is approximately 5000 tonnes, including alloys, fertilizers and impurities in zinc. The stock of Cd in goods in the Swedish anthroposphere is dominated by NiCd-batteries. However, when one considers the degree of exposure to corrosion, Cd stabilizers are dominant. Emissions of Cd from industrial plants and other point sources have been historically important. However, these point source emissions must be seen in relation to the increasingly significant fugitive `consumption emissions`, from the use and/or end-use of various goods. In this study, methods of reconstructing the flows of cadmium (Cd) and estimating the emissions over time are discussed. This is done through studies of the development of production, technology, trade and the longevity of metals in Swedish society. This last part in the chain will form the `consumption emissions` calculated from emission factors giving the proportion of the cadmium content in goods that eventually will reach the environment. The main accumulation of metals in the anthroposphere occurs in urban areas where the influx of metals is greatest. Urban areas probably represent `hot spots` as far as this type of environmental impact is concerned. Extreme Cd concentrations in surface sediments in central Stockholm indicate an ongoing release of Cd from the anthroposphere. The sources are so far unknown, i.e. this Cd flow to the biosphere cannot be explained in terms of deposition or emissions from point sources. Approximately 40 tonnes of Cd in goods are exposed to corrosion in varying degrees. This stock is dominated by Cd in stabilizers and pigments, and as impurities in Zn 15 refs, 2 figs, 8 tabs

  16. Structural evolution in the neutron-rich nuclei 106Zr and 108Zr

    CERN Document Server

    Sumikama, T; Watanabe, H; Nishimura, S; Miyashita, Y; Yamaguchi, K; Sugimoto, K; Chiba, J; Li, Z; Baba, H; Berryman, J S; Blasi, N; Bracco, A; Camera, F; Doornenbal, P; Go, S; Hashimoto, T; Hayakawa, S; Hinke, C; Ideguchi, E; Isobe, T; Ito, Y; Jenkins, D G; Kawada, Y; Kobayashi, N; Kondo, Y; Krücken, R; Kubono, S; Lorusso, G; Nakano, T; Kurata-Nishimura, M; Odahara, A; Ong, H J; Ota, S; Podolyák, Zs; Sakurai, H; Scheit, H; Steiger, K; Steppenbeck, D; Takano, S; Takashima, A; Tajiri, K; Teranishi, T; Wakabayashi, Y; Walker, P M; Wieland, O; Yamaguchi, H

    2011-01-01

    The low-lying states in 106Zr and 108Zr have been investigated by means of {\\beta}-{\\gamma} and isomer spectroscopy at the RI beam factory, respectively. A new isomer with a half-life of 620\\pm150 ns has been identified in 108Zr. For the sequence of even-even Zr isotopes, the excitation energies of the first 2+ states reach a minimum at N = 64 and gradually increase as the neutron number increases up to N = 68, suggesting a deformed sub-shell closure at N = 64. The deformed ground state of 108Zr indicates that a spherical sub-shell gap predicted at N = 70 is not large enough to change the ground state of 108Zr to the spherical shape. The possibility of a tetrahedral shape isomer in 108Zr is also discussed.

  17. Adsorption mechanism of copper and cadmium onto defatted waste biomass.

    Science.gov (United States)

    Ogata, Fumihiko; Tominaga, Hisato; Yabutani, Hitoshi; Kawasaki, Naohito

    2011-01-01

    In this study, the amount of copper or cadmium adsorbed using waste biomass (i.e., coffee grounds (CG) and rice bran (RB)) was investigated. The amount of crude protein in defatted CG (D-CG) or RB (D-RB) was greater than that in CG or RB, respectively. The amount of copper or cadmium adsorbed using CG was greater than that using RB. Additionally, the amount of copper or cadmium adsorbed was not affected by the presence of fat in CG. Adsorption data was fitted to the Freundlich equation, and the correlation coefficients were in the range of 0.794-0.991. The main adsorption mechanism was thought to be monolayer adsorption onto the surface of the waste biomass. The adsorption rate data was fitted to the pseudo-second-order model, and the correlation coefficient average was in the range of 0.891-0.945. This result showed that the rate-limiting step may be chemisorption. Moreover, the amount of copper or cadmium desorbed from CG or RB using 0.01 mol/L or 1.00 mol/L HNO(3) was investigated. Desorption with 0.01 mol/L HNO(3) resulted in the recovery of 86-97% of the copper and cadmium, indicating that copper or cadmium that was adsorbed using waste biomass was recoverable. PMID:21701100

  18. Tantalum-cadmium film coatings: Preparation, phase composition, and structure

    Science.gov (United States)

    Tuleushev, Yu. Zh.; Volodin, V. N.; Zhakanbaev, E. A.

    2015-01-01

    Ion-plasma sputtering and codeposition of ultrafine Ta and Cd particles were used for the first time to prepare solid solutions, namely, alloys with up to 66.2 at % Cd in the form of coatings; the fact of such a production confirms the thermal-fluctuation melting and coalescence of small particles. When the coatings are formed by tantalum and cadmium nanolayers, the mutual dissolution of the components takes place, which is accompanied by the formation of solid solutions of one metal in the other. When the cadmium concentration is above 44 at %, the β-Ta tetragonal lattice transforms into the α-Ta body-centered cubic lattice. Beginning from 74.4 at % Cd, a hexagonal structure typical of cadmium is formed, and tantalum is present in the coatings in the form of amorphous phase. The formation of β-Ta- and Cd-based interstitial and α-Ta-based substitute solid solutions is stated. At 700°C, cadmium evaporates from Ta-based solid solutions, and porous tantalum is formed. The evaporation of cadmium from coatings, which consist of the mixture of tantalum solid solution in cadmium and amorphous tantalum, leads to the formation of tantalum characterized by a highly developed surface. The prepared Ta-based materials assume the technological application of the results of the investigation.

  19. Effects of Cadmium on Some Physiological Characteristics of Eucalyptus occidentalis

    Directory of Open Access Journals (Sweden)

    A. Shariat

    2010-10-01

    Full Text Available Heavy metals including cadmium produced as a result of urban, industrial and agricultural activities lead to the water pollution. Also, considering the growing need for silviculture in Iran, it is necessary to conduct a comprehensive research on fast growing and evergreen species of Eucalyptus and their role in heavy metals' absorption. To achieve this goal, Eucalyptus occidentalis seedlings were grown in pots containing silica and irrigated with a mixture of nutrient solution and cadmium chloride in 5, 10 and 15 m M for 10 months. Root and leaf samples were harvested and the amount of cadmium in stem, root and leaf organs was measured. Also, some morphological and physiological characteristics were determined including soluble sugar and praline. The analysis indicated that the cadmium concentrations of 15 mM treatment in the root, leaf and stem were 585, 142 and 87 mg/kg D.W., respectively. Proline content increased with the increase of Cadmium concentration while the content of pigments decreased. The result of this research shows that eucalypt has the potential of cadmium accumulation without any serious damage to its growth. Therefore, the plant can be used to decrease the environmental pollutions.

  20. Trichosporon jirovecii-mediated synthesis of cadmium sulfide nanoparticles.

    Science.gov (United States)

    El-Baz, Ashraf Farag; Sorour, Noha Mohamed; Shetaia, Youssria Mohamed

    2016-05-01

    Cadmium sulphide is one of the most promising materials for solar cells and of great interest due to its useful applications in photonics and electronics, thus the development of bio-mediated synthesis of cadmium sulphide nanoparticles (CdS NPs) is one of the essential areas in nanoparticles. The present study demonstrates for the first time the eco-friendly biosynthesis of CdS NPs using the yeast Trichosporon jirovecii. The biosynthesis of CdS NPs were confirmed by UV-Vis spectrum and characterized by X-ray diffraction assay and electron microscopy. Scanning and transmission electron microscope analyses shows the formation of spherical CdS NPs with a size range of about 6-15 nm with a mean Cd:S molar ratio of 1.0:0.98. T. jirovecii produced hydrogen sulfide on cysteine containing medium confirmed by positive cysteine-desulfhydrase activity and the colony color turned yellow on 0.1 mM cadmium containing medium. T. jirovecii tolerance to cadmium was increased by the UV treatment and three 0.6 mM cadmium tolerant mutants were generated upon the UV radiation treatment. The overall results indicated that T. jirovecii could tolerate cadmium toxicity by its conversion into CdS NPs on cysteine containing medium using cysteine-desulfhydrase as a defense response mechanism. PMID:26467054

  1. CERN: Fixed target targets

    International Nuclear Information System (INIS)

    Full text: While the immediate priority of CERN's research programme is to exploit to the full the world's largest accelerator, the LEP electron-positron collider and its concomitant LEP200 energy upgrade (January, page 1), CERN is also mindful of its long tradition of diversified research. Away from LEP and preparations for the LHC proton-proton collider to be built above LEP in the same 27-kilometre tunnel, CERN is also preparing for a new generation of heavy ion experiments using a new source, providing heavier ions (April 1992, page 8), with first physics expected next year. CERN's smallest accelerator, the LEAR Low Energy Antiproton Ring continues to cover a wide range of research topics, and saw a record number of hours of operation in 1992. The new ISOLDE on-line isotope separator was inaugurated last year (July, page 5) and physics is already underway. The remaining effort concentrates around fixed target experiments at the SPS synchrotron, which formed the main thrust of CERN's research during the late 1970s. With the SPS and LEAR now approaching middle age, their research future was extensively studied last year. Broadly, a vigorous SPS programme looks assured until at least the end of 1995. Decisions for the longer term future of the West Experimental Area of the SPS will have to take into account the heavy demand for test beams from work towards experiments at big colliders, both at CERN and elsewhere. The North Experimental Area is the scene of larger experiments with longer lead times. Several more years of LEAR exploitation are already in the pipeline, but for the longer term, the ambitious Superlear project for a superconducting ring (January 1992, page 7) did not catch on. Neutrino physics has a long tradition at CERN, and this continues with the preparations for two major projects, the Chorus and Nomad experiments (November 1991, page 7), to start next year in the West Area. Delicate neutrino oscillation effects could become

  2. Cadmium toxicity to ringed seals (Phoca hispida): an epidemiological study of possible cadmium-induced nephropathy and osteodystrophy in ringed seals (Phoca hispida) from Qaanaaq in Northwest Greenland

    DEFF Research Database (Denmark)

    Sonne-Hansen, C; Dietz, R; Leifsson, P S;

    2002-01-01

    the skeleton nor to the cadmium concentrations. Furthermore, the degree of mineralisation of the skeleton was not correlated with the cadmium concentration, age or sex. It can therefore be concluded that despite high levels of cadmium, none of the ringed seals showed any signs of cadmium......-induced nephropathy or osteodystrophy. This might be explained by the composition of the ringed seals diet, which contains high levels of vitamin D, calcium, phosphorus, zinc, selenium and protein. These elements are all likely to counteract cadmium-induced damage. It is speculated that ringed seal are not...

  3. The Role of Exopolymers in Protection of Ralstonia sp., a Cadmium-resistant Bacterium, from Cadmium Toxicity

    OpenAIRE

    Anchulee Watcharamusik; Benjaphorn Prapagdee

    2008-01-01

    Production of exopolymers is one of heavy metal resistance mechanisms in bacteria. Ralstonia sp. TAK1, a cadmium-resistant bacterium, was isolated from a high cadmium (Cd) contaminated soil at the zinc mine, Tak province, Thailand. The bacterium was cultivated in LB broth and its growth was monitored. The yields of exopolymers were measured by the phenol-sulfuric method at different growth phases. The levels of Cd resistance were quantitatively determined by survival cell assay. The highest a...

  4. Influence of pressure on the synthesis of cadmium sulfide by combustion of complex compound of cadmium nitrate with thiosemicarbazide

    International Nuclear Information System (INIS)

    A method of cadmium sulfide synthesis based on combustion of high-energy content complex of cadmium nitrate and thiosemicarbazide has been suggested. The combustion has been carried out in nitrogen under gas pressure varying from 0.1 to 2.0 MPa. It is shown that the complex may serve as a precursor for obtaining sulfide materials with regulated morphology and dispersivity under combustion conditions

  5. Study on complex formation of cadmium (II) ions, 9. Formation constants on cadmium (II) complexes with dicarboxylic acids

    Energy Technology Data Exchange (ETDEWEB)

    Matsui, Haruo (Government Industrial Research Inst., Nagoya (Japan))

    1984-03-01

    Formation constants of cadmium (11) complexes with dicarboxylic acids such as oxalic, malonic, methylmalonic, succinic, and glutaric acids were determined in aqueous solutions containing 3 mol.dm/sup -3/ LiClO/sub 4/ as a constant ionic medium at 25/sup 0/C by potentiometric titrations. It was reported in the previous works that cadmium (11)- aspartic acid complexes contained two chelate rings. However, a problem remained whether the second chelate ring could be formed by six membered-ring containing -O-Cd-N- bond or by seven membered-ring containing -O-Cd-O- bond. The results of the present work suggested that it would be formed by a six membered ring. Cadmium (11) ions were coordinated with a carboxylic group of the dicarboxylic acids studied, and formed no chelate ring within the complexes. The white precipitate appeared in the solution containing cadmium (11) ion and oxalic acid, in the pH range below 3.0, therefore, the chelate formation was not ascertained in this case. The formation constants, log ..beta..sub(pr)= log((Cdsub(p)Lsub(r)sup((2p-2r)+))/((Cd/sup 2 +/)sup(p)(L/sup 2 -/)sup(r))), of the complexes were: log ..beta../sub 11/ = 1.98, log ..beta../sub 12/ = 3.05 for cadmium (11)-malonic acid; log ..beta../sub 11/ = 2.28, log ..beta../sub 12/ = 3.06 for cadmium (11)-methylmalonic acid; log ..beta../sub 11/ = 1.78, log ..beta../sub 12/ = 3.08 for cadmium (11)-succinic acid; log ..beta../sub 11/ = 1.85, log ..beta../sub 12/ = 3.28 for cadmium (11)-glutaric acid complexes.

  6. Sputter target

    Science.gov (United States)

    Gates, Willard G.; Hale, Gerald J.

    1980-01-01

    The disclosure relates to an improved sputter target for use in the deposition of hard coatings. An exemplary target is given wherein titanium diboride is brazed to a tantalum backing plate using a gold-palladium-nickel braze alloy.

  7. Investigation of lead and cadmium in counterfeit cigarettes seized in the United States.

    Science.gov (United States)

    He, Yi; von Lampe, Klaus; Wood, Laura; Kurti, Marin

    2015-07-01

    Information of toxic elements such as lead (Pb) and cadmium (Cd) in counterfeit cigarettes offers insight on the potential public health impact of consuming counterfeit cigarettes and the technology used by counterfeiters in the illicit cigarette trade. In this study, the concentration of Pb and Cd in twenty-three packs of counterfeit cigarettes seized in the US by various law enforcement agencies were evaluated and compared with their genuine equivalents using microwave digestion followed by inductively coupled plasma - mass spectrometry (ICP-MS) analysis. Both Pb and Cd concentration in counterfeit cigarettes were markedly higher than those in their genuine equivalents, and exhibited greater sample to sample variability. The average Pb and Cd mass fraction values in counterfeit cigarettes were (5.13 ± 2.50) mg/kg (n = 23) and (5.13 ± 1.95) mg/kg (n = 23) respectively, compared with (0.59 ± 0.08) mg/kg (n = 9) and (1.08 ± 0.08) mg/kg (n = 9) respectively in the genuine equivalents. Results suggest that counterfeit cigarettes may impose higher risks to public health. Studying these toxic elements could provide important information regarding the illicit trade, including the level of organization among counterfeiters, who broker between availability of supplies and consumer demand for a cheaper product that is assumed to be genuine. PMID:25862957

  8. Design considerations for II–VI multi-gate transistors: the case of cadmium sulfide

    International Nuclear Information System (INIS)

    In this paper, we report a feasibility study of MuGFETs (multi-gate field effect transistors) devices using solution-based cadmium sulfide films as the semiconductor. The simulations were carried out using the commercially available ATLAS simulator. Experimental parameters for CdS were extracted from planar thin film transistors fabricated using photolithography methods. Several critical design parameters for MuGFETs devices were studied, including fin width, fin high, channel length, and CdS carrier concentration. Short-channel effects can be reasonably controlled by reducing either fin height or width. It is shown that is possible to fabricate devices that operate in depletion or enhancement mode by controlling the device structure. ION/IOFF ratio was in the range 108–1010, subthreshold slope was closely related to the geometry of the MuGFET. We also observed that as the CdS carrier concentration decreases, the on-voltage shifts to positive values. Optimized MuGFETs simulated in enhancement mode show excellent subthreshold slope, and ION/IOFF ratio ∼1010. This study demonstrates that CdS can be used to fabricate enhanced mode/depletion mode devices using solution-based semiconductors. Furthermore, all processing is kept at temperatures below 100 °C, which demonstrates that these devices can be used in flexible substrates. (paper)

  9. The influence of long-term cadmium exposure on phonotaxis in male Pelophylax nigromaculata.

    Science.gov (United States)

    Huang, Min-Yi; Duan, Ren-Yan; Ji, Xiang

    2015-01-01

    Cadmium (Cd) is a common industrial and agricultural heavy metal found in the natural environment that disrupts the endocrine systems of vertebrates. Amphibians are particularly vulnerable to endocrine disruptors because of their aquatic habitats and permeable skin. Endocrine disruptors are known to negatively affect amphibian acoustic behavior, but whether and how the ubiquitous pollutant Cd impacts this crucial amphibian signaling system remains unknown. Male black-spotted frogs (Pelophylax nigromaculata) show phonotactic responses to female receptive calls by emitting advertisement calls and moving towards females during the mating season, essential for reproductive success. To study whether long-term (60 d) exposure to low Cd concentrations (10(-8), 10(-7) and 10(-6) M) affects male phonotaxis, we recorded male responses to female calls following Cd exposure during the breeding season. We found that Cd adversely affected advertisement call characteristics (call latency, call duration and call rate), the proportion of individuals that responded and the time to first movement of the male. These results indicate that long-term exposure to Cd at environmentally relevant concentrations alters phonotaxis in male P. nigromaculata. PMID:25192651

  10. Oxidative stress and DNA damage induced by cadmium in the human keratinocyte HaCaT cell line: Role of glutathione in the resistance to cadmium

    International Nuclear Information System (INIS)

    Cadmium affects the cellular homeostasis and generates damage via complex mechanisms involving interactions with other metals and oxidative stress induction. In this work we used a human keratinocyte cell line (HaCaT) as a model to study the oxidative damage induced by cadmium to cellular macromolecules, its effect on the antioxidant systems and the role of glutathione in cell protection toward cadmium toxicity. The cells were incubated for 24 and 48 h with cadmium (3, 15, 50 and 100 μM). High doses of cadmium were required to induce a cytotoxicity: 100 μM lead to 30% mortality after 24 h and 50% after 48 h. The oxidation of lipids and proteins and the DNA damage, respectively, assessed by thiobarbituric acid reactants determination, thiol group measurement and comet assay, were observed for 50-100 μM cadmium. The cytotoxic effects were strongly correlated to the cellular cadmium content. The glutathione peroxidase and the catalase activities were decreased, while the glutathione reductase activity and the glutathione concentration were increased after cadmium treatment. The superoxide dismutases activities were unchanged. A depletion in glutathione prior to cadmium exposure increased the cytotoxic effects and provoked DNA damage. Our results suggested that the hydroxyl radical could be the major compound involved in the oxidative stress generated by cadmium and that glutathione could play a major role in the protection of HaCaT cells from cytotoxicity but mostly from DNA damage induced by cadmium

  11. Correlations of urinary cadmium with hypertension and diabetes in persons living in cadmium-contaminated villages in northwestern Thailand: A population study

    International Nuclear Information System (INIS)

    Risk for hypertension and diabetes has not been conclusively found to be a result of cadmium exposure. A population-based study was conducted in 2009 to examine the correlations of urinary cadmium, a good biomarker of long-term cadmium exposure, with hypertension and diabetes in persons aged 35 years and older who lived in the 12 cadmium-contaminated rural villages in northwestern Thailand. A total of 5273 persons were interviewed and screened for urinary cadmium, hypertension, and diabetes. The geometric mean level of urinary cadmium for women (2.4±2.3 μg/g creatinine) was significantly greater than that for men (2.0±2.2 μg/g creatinine). Hypertension was presented in 29.8% of the study population and diabetes was detected in 6.6%. The prevalence of hypertension significantly increased from 25.0% among persons in the lowest tertile of urinary cadmium to 35.0% in the highest tertile. In women, the rate of hypertension significantly increased with increasing urinary cadmium levels in both ever and never smokers, after adjusting for age, alcohol consumption, body mass index, and diabetes. In men, such association was less significantly found in never smokers. The study revealed no significant association between urinary cadmium and diabetes in either gender. Our study supports the hypothesis that environmental exposure to cadmium may increase the risk of hypertension. Risk for diabetes in relation to cadmium exposure remains uncertain in this exposed population.

  12. Effects of Soil pH,Texture,Moisture,Organic Matter and Cadmium Content on Cadmium Diffusion Coefficient

    Institute of Scientific and Technical Information of China (English)

    WUQI-TANG; J.L.MOREL; 等

    1994-01-01

    The supply of cadmium from soil to plant roots mainly depends on the diffusion prooess.This work was conducted to study the effects of some soil properties on cadmium diffusion coefficient (D) in soil. Measurements were made using the Shofield and Graham-Bryce's isotopic labelling method.Cadmium diffusion coefficients varied from 10-7to 10-9 cms2-1.Higher values were observed in acid sandy soils and lower values in calcareous clay soils.Liming an acid soil resulted in a substantial decrease of D.Addition of cadmium as nitrate salt generally increased D,while addition of sewage sludge and organic matter resulted in a significant decrease of cadmium diffusion.The rhizospheric activity also induced a moderate reduction in D.The relationships between D(10-9cms2-1)on the on hand and soil pH.moisture(Mc,g kg-1) ,organic matter(OM,g kg-1),clay(Cy,gkg-1)and cadmium content(Cd,mgkg-1) on the other were obtained by the multiple regression:D=182.1-29.91pH+0.210Mc-0.303OM+0.011Cy+1.64Cd(R2=0.859,n=22).

  13. Effects of cadmium accumulation from suspended sediments and phytoplankton on the Oyster Saccostrea glomerata

    International Nuclear Information System (INIS)

    Highlights: • Saccostrea glomerata accumulated cadmium from sediments and phytoplankton. • Effects were similar for both pathways. • Antioxidant capacity, lipid peroxidation and lysosomal destabilisation were affected. • Clear exposure–dose–response relationships were demonstrated. - Abstract: Metals are accumulated by filter feeding organisms via water, ingestion of suspended sediments or food. The uptake pathway can affect metal toxicity. Saccostrea glomerata were exposed to cadmium through cadmium-spiked suspended sediments (19 and 93 μg/g dry mass) and cadmium-enriched phytoplankton (1.6–3 μg/g dry mass) and cadmium uptake and effects measured. Oysters accumulated appreciable amounts of cadmium from both low and high cadmium spiked suspended sediment treatments (5.9 ± 0.4 μg/g and 23 ± 2 μg/g respectively compared to controls 0.97 ± 0.05 μg/g dry mass). Only a small amount of cadmium was accumulated by ingestion of cadmium-enriched phytoplankton (1.9 ± 0.1 μg/g compared to controls 1.2 ± 0.1 μg/g). In the cadmium spiked suspended sediment experiments, most cadmium was desorbed from sediments and cadmium concentrations in S. glomerata were significantly related to dissolved cadmium concentrations (4–21 μg/L) in the overlying water. In the phytoplankton feeding experiment cadmium concentrations in overlying water were <0.01 μg/L. In both exposure experiments, cadmium-exposed oysters showed a significant reduction in total antioxidant capacity and significantly increased lipid peroxidation and percentage of destabilised lysosomes. Destabilised lysosomes in the suspended sediments experiments also resulted from stress of exposure to the suspended sediments. The study demonstrated that exposure to cadmium via suspended sediments and to low concentrations of cadmium through the ingestion of phytoplankton, can cause sublethal stress to S. glomerata

  14. Effects of cadmium accumulation from suspended sediments and phytoplankton on the Oyster Saccostrea glomerata

    Energy Technology Data Exchange (ETDEWEB)

    Schmitz, Helena A.; Maher, William A., E-mail: bill.maher@canberra.edu.au; Taylor, Anne M.; Krikowa, Frank

    2015-03-15

    Highlights: • Saccostrea glomerata accumulated cadmium from sediments and phytoplankton. • Effects were similar for both pathways. • Antioxidant capacity, lipid peroxidation and lysosomal destabilisation were affected. • Clear exposure–dose–response relationships were demonstrated. - Abstract: Metals are accumulated by filter feeding organisms via water, ingestion of suspended sediments or food. The uptake pathway can affect metal toxicity. Saccostrea glomerata were exposed to cadmium through cadmium-spiked suspended sediments (19 and 93 μg/g dry mass) and cadmium-enriched phytoplankton (1.6–3 μg/g dry mass) and cadmium uptake and effects measured. Oysters accumulated appreciable amounts of cadmium from both low and high cadmium spiked suspended sediment treatments (5.9 ± 0.4 μg/g and 23 ± 2 μg/g respectively compared to controls 0.97 ± 0.05 μg/g dry mass). Only a small amount of cadmium was accumulated by ingestion of cadmium-enriched phytoplankton (1.9 ± 0.1 μg/g compared to controls 1.2 ± 0.1 μg/g). In the cadmium spiked suspended sediment experiments, most cadmium was desorbed from sediments and cadmium concentrations in S. glomerata were significantly related to dissolved cadmium concentrations (4–21 μg/L) in the overlying water. In the phytoplankton feeding experiment cadmium concentrations in overlying water were <0.01 μg/L. In both exposure experiments, cadmium-exposed oysters showed a significant reduction in total antioxidant capacity and significantly increased lipid peroxidation and percentage of destabilised lysosomes. Destabilised lysosomes in the suspended sediments experiments also resulted from stress of exposure to the suspended sediments. The study demonstrated that exposure to cadmium via suspended sediments and to low concentrations of cadmium through the ingestion of phytoplankton, can cause sublethal stress to S. glomerata.

  15. Cadmium: A toxin and a nutrient for marine phytoplankton. Doctoral thesis

    Energy Technology Data Exchange (ETDEWEB)

    Lee, J.G.

    1995-06-01

    Although cadmium is known to be very toxic, it exhibits nutrient-like vertical concentration profiles in the open ocean. Cadmium enhances the growth of the marine diatom Thalassiosira weissflogii, a chlorophyte and some prymnesiophytes at inorganic zinc and cadmium concentrations typical of surface seawater. Detailed studies of T. weissflogii show that cadmium is also regulated like a nutrient over a wide range of external inorganic cadmium (5-500pM) and inorganic zinc (2-16pM) concentrations. The cellular cadmium concentration is maintained at relatively constant levels both through uptake and, at high inorganic cadmium concentrations (5nM), export of cadmium, most likely complexed to the metal-binding polypeptide phytochelatin. Cadmium may play an essential role in carbon uptake under conditions of zinc limitation. The same low level of inorganic cadmium that enhances the growth of T. weissflogii restores the activity of carbonic anhydrase, thought to be the key enzyme limiting growth at low zinc. Cadmium coelutes with a least one of the multiple isoforms of carbonic anhydrase produced by T. weissfiogii and covaries with activity of this isoform. The substitution of cadmium for zinc in carbonic anhydrase links the geochemical cycle of cadmium to those of zinc and carbon.

  16. High-spin studies near 100Sn with NORDBALL: new results on 102In, 104In and 108Sb

    International Nuclear Information System (INIS)

    The NORDBALL detector array has been used in a γ-ray spectroscopic study of neutron deficient nuclei close to 100Sn. A beam of 270 MeV 58Ni ions was used to bombard a target of 54Fe. Reaction channel separation was achieved with a 4π charged particle Si-ball together with a 1π neutron detector wall. Altogether 29 final nuclei were identified and excited states were observed for the first time in 8 of them. The weakest identified channel was 100Cd which represented 4.10-3 % of the observed total yield. Level schemes of 102In, 104In and 108Sb constructed from γ-γ-particle-coincidence and γ-γ-angular correlation analyses are presented. The observed structures are discussed in the framework of the nuclear shell-model. In 108Sb also a deformed, strongly coupled, level sequence is observed. This deformed structure is interpreted as built on a πg-19/2xνh11/2 configuration in agreement with TRS calculations. (orig.)

  17. Systematic investigation of the giant monopole resonance with 108.5 MeV 3He through the periodic table

    International Nuclear Information System (INIS)

    Inelastic spectra of 108.5 MeV 3He projectiles have been measured at very forward angles including zero degree, using an improved experimental set up to remove slit scattering. Targets were 12C, 27Al, 40Ca, 56Fe, sup(58,60)Ni, sup(66,68)Zn, 89Y, 90Zr, sup(92,96,100)Mo, 108Pd, 107Ag, sup(110,116)Cd, 115In, sup(116,120,124)Sn, 140Ce, sup(144,150,152)Sm, 169Tm, 175Lu, 181Ta, 197Au and 208Pb. A giant monopole resonance is observed above the giant quadrupole resonance in nuclei of mass A >= 60. The excitation energy deviates from the 80 A sup(-1/3) law with decreasing A. For smaller masses, no monopole strength is found separated from the quadrupole strength, unless largely fractionnated and at a lower excitation energy. Preliminary DWBA analysis and percentages of the energy weighted sum rule are presented. Compression moduli are derived. (author)

  18. Cadmium-induced apoptosis and necrosis in human osteoblasts: role of caspases and mitogen-activated protein kinases pathways.

    Science.gov (United States)

    Brama, M; Politi, L; Santini, P; Migliaccio, S; Scandurra, R

    2012-02-01

    Cadmium is a widespread environmental pollutant which induces severe toxic alterations, including osteomalacia and osteoporosis, likely by estrogen receptor-dependent mechanisms. Indeed, cadmium has been described to act as an endocrine disruptor and its toxicity is exerted both in vivo and in vitro through induction of apoptosis and/or necrosis by not fully clarified intracellular mechanism(s) of action. Aim of the present study was to further investigate the molecular mechanism by which cadmium might alter homeostasis of estrogen target cells, such as osteoblast homeostasis, inducing cell apoptosis and/or necrosis. Human osteoblastic cells (hFOB 1.19) in culture were used as an in vitro model to characterize the intracellular mechanisms induced by this heavy metal. Cells were incubated in the presence/ absence of 10-50 μM cadmium chloride at different times and DNA fragmentation and activation of procaspases- 8 and -3 were induced upon CdCl(2) treatment triggering apoptotic and necrotic pathways. Addition of caspase-8 and -3 inhibitors (Z-IETD-FMK and Z-DQMD-FMK) partially blocked these effects. No activation of procaspase-9 was observed. To determine the role of mitogen-activated protein kinases (MAPK) in these events, we investigated c-jun N-terminal kinase (JNK), p38 and extracellular signal-regulated protein kinase (ERK1/2) phosphorylation which were activated by 10 μM CdCl(2). Chemical inhibitors of JNK, p38, and ERK1/2, SP600125, SB202190, and PD98059, significantly reduced the phosphorylation of the kinases and blunted apoptosis. In contrast, caspase inhibitors did not reduce the cadmium-induced MAPK phosphorylation, suggesting an independent activation of these pathways. In conclusion, at least 2 pathways appear activated by cadmium in osteoblasts: a direct induction of caspase-8 followed by activation of caspase-3 and an indirect induction by phosphorylation of ERK1/2, p38, and JNK MAPK triggering activation of caspase-8 and -3. PMID:21697648

  19. Cadmium assessment on the intertidal water margins from the Óbidos Lagoon (western coast of Portugal

    Directory of Open Access Journals (Sweden)

    Marcia S.S. Santos

    2014-04-01

    Full Text Available The Óbidos Lagoon is the largest shallow coastal lagoon in Portugal. Like any other brackish water system, it has been potentially exposed to different sources of contamination (e.g. livestock farming, domestic and industrial sewage. Trace metals are persistent elements present in the water and sediments in their elemental and organic/inorganic forms. In fact, Cadmium is extremely pollutant due to its great solubility in water and high toxicity for organisms. Also, it is classified as a priority substance according to the European Union Water Frame directive. In this context, a seasonal environmental monitoring program was implemented in the intertidal water margins of the Óbidos Lagoon to assess the presence of Cadmium. In 2009 and 2010, eight sampling stations (S distributed on the shores of the Óbidos Lagoon were chosen and water and sediments were seasonally collected. In all samples, cadmium concentrations were analyzed by Atomic Absorption Spectrometry, with Graphite Furnace Technique. Cadmium dissolved in the water samples was only detected during summer months, with the highest values in the Barrosa’s arm (S3: 0.35 mg/l in 2009, and at the station further downstream (S1: 0.19 mg/l in 2010. In the suspended fraction of the water samples the trace metal was detectable in all seasons, with the maximum concentration at the Barrosa’s arm (S4: 1.04 mg/l in the winter of 2010. Cadmium was not detectable in the sediments during the summers and was sporadically present in the autumn and in the winter of 2009. The highest concentration in the sediments was observed at the Barrosa´s arm (S4: 140.78 mg/kg in the spring of 2010. As a whole, cadmium contamination appears to be mostly focused on the inner areas of the lagoon, at the Barrosa´s arm, but a clear seasonal pattern of variation was not detectable. These results allow a better understanding of the environmental quality of this ecosystem and may assist in the definition of coastal

  20. Role of oxidative stress in cadmium toxicity and carcinogenesis

    International Nuclear Information System (INIS)

    Cadmium (Cd) is a toxic metal, targeting the lung, liver, kidney, and testes following acute intoxication, and causing nephrotoxicity, immunotoxicity, osteotoxicity and tumors after prolonged exposures. Reactive oxygen species (ROS) are often implicated in Cd toxicology. This minireview focused on direct evidence for the generation of free radicals in intact animals following acute Cd overload and discussed the association of ROS in chronic Cd toxicity and carcinogenesis. Cd-generated superoxide anion, hydrogen peroxide, and hydroxyl radicals in vivo have been detected by the electron spin resonance spectra, which are often accompanied by activation of redox sensitive transcription factors (e.g., NF-κB, AP-1 and Nrf2) and alteration of ROS-related gene expression. It is generally agreed upon that oxidative stress plays important roles in acute Cd poisoning. However, following long-term Cd exposure at environmentally-relevant low levels, direct evidence for oxidative stress is often obscure. Alterations in ROS-related gene expression during chronic exposures are also less significant compared to acute Cd poisoning. This is probably due to induced adaptation mechanisms (e.g., metallothionein and glutathione) following chronic Cd exposures, which in turn diminish Cd-induced oxidative stress. In chronic Cd-transformed cells, less ROS signals are detected with fluorescence probes. Acquired apoptotic tolerance renders damaged cells to proliferate with inherent oxidative DNA lesions, potentially leading to tumorigenesis. Thus, ROS are generated following acute Cd overload and play important roles in tissue damage. Adaptation to chronic Cd exposure reduces ROS production, but acquired Cd tolerance with aberrant gene expression plays important roles in chronic Cd toxicity and carcinogenesis.

  1. Predictors of urinary cadmium levels in adult females

    International Nuclear Information System (INIS)

    Ubiquitous exposure to low levels of cadmium has raised concern about adverse health effects. The aim of this study was to identify characteristics of non-occupationally exposed adult females that correlated with creatinine-adjusted urinary cadmium levels. In our population-based study, trained interviewers collected information from 254 female Wisconsin residents aged 20-69 years on tobacco use, limited dietary consumption patterns, reproductive history, demographics, and residential history. Participants provided spot-urine specimens collected at home. Urine cadmium concentrations were quantified using inductively-coupled plasma mass spectrometry and creatinine levels were also determined. Least square means and 95% confidence intervals for the natural log of the creatinine-adjusted urinary cadmium levels were calculated for each characteristic using multivariate analysis of variance adjusting for age and smoking status. Results were calculated on the log scale and then transformed to the original scale by taking the exponent of each of the values. We observed statistically significant increasing creatinine-adjusted urinary cadmium mean levels relative to smoking status, older age, parity, lower body surface area, mineral zinc supplement consumption, and high income. We did not observe a difference relative to consumption of organ meats, crustaceans, alcohol, multivitamins, multiminerals or homegrown vegetables, age of menopause, menarche of participant or oldest daughter, menopausal status or urban-rural residential location. Approximately 40% of the variance in creatinine-adjusted urinary cadmium levels in adult women was explained by several characteristics. Similar to other studies, age and smoking were the strongest determinants of creatinine-adjusted urinary cadmium concentration

  2. CONCENTRATION OF CADMIUM IN MEAT AND SELECTED MEATS PRODUCTS

    Directory of Open Access Journals (Sweden)

    Anetta Lukáčová

    2015-02-01

    Full Text Available The cadmium concentrations depend on the environmental conditions and food production methods. The monitoring of cadmium concentration in meat is important for human health. The concentrations of cadmium in meat and meat products collected from central Slovakia, in the central Europe region and from different countries of West Europe were assessed using by AA spectrometer with graphite furnace (PerkinElmer AAnalyst 80, MA, USA. Within starting materials we detected the highest values of cadmium in beef from foreign production (0.1101 ppm, followed by pork from foreign production (0.0901 ppm in Lovecka salama and pork thigh (0.0523 ppm in selected ham. In Lovecka salami we were found the highest concentration of cadmium in final samples from foreign starting materials, followed by homogenized samples from foreign starting materials, final samples from domestic starting materials and homogenized samples from domestic starting materials (0.3728, 0.3549, 0.2387, 0.2112 ppm, respectively. The highest concentration of cadmium in selected ham were found in final products from foreign starting materials, homogenized samples from foreign starting materials, final products from domestic starting materials and homogenized samples from domestic starting materials (0.1453, 0.1382,0.0810, 0.0734 ppm, respectively. The obtained results suggested that the concentrations of cadmium are higher in homogenized samples and final products in Lovecka salami and selected ham in comparison with to starting materials. Technological process of meat processing can create a potential source of heavy metals in final products.

  3. Predictors of urinary cadmium levels in adult females

    Energy Technology Data Exchange (ETDEWEB)

    McElroy, Jane A. [University of Wisconsin Paul P. Carbone Comprehensive Cancer Center, 610 Walnut Street, 370 WARF, Madison, WI 53726 (United States)]. E-mail: jamcelroy@wisc.edu; Shafer, Martin M. [University of Wisconsin, Environmental Chemistry and Technology Program, 600 N Park Street, Madison, WI 53706 (United States); Hampton, John M. [University of Wisconsin Paul P. Carbone Comprehensive Cancer Center, 610 Walnut Street, 370 WARF, Madison, WI 53726 (United States); Newcomb, Polly A. [University of Wisconsin Paul P. Carbone Comprehensive Cancer Center, 610 Walnut Street, 370 WARF, Madison, WI 53726 (United States); Fred Hutchinson Cancer Research Center, Cancer Prevention Program, 1100 Fairview Ave N, M4-B402 PO Box 19024, Seattle, WA 98109 (United States)

    2007-09-01

    Ubiquitous exposure to low levels of cadmium has raised concern about adverse health effects. The aim of this study was to identify characteristics of non-occupationally exposed adult females that correlated with creatinine-adjusted urinary cadmium levels. In our population-based study, trained interviewers collected information from 254 female Wisconsin residents aged 20-69 years on tobacco use, limited dietary consumption patterns, reproductive history, demographics, and residential history. Participants provided spot-urine specimens collected at home. Urine cadmium concentrations were quantified using inductively-coupled plasma mass spectrometry and creatinine levels were also determined. Least square means and 95% confidence intervals for the natural log of the creatinine-adjusted urinary cadmium levels were calculated for each characteristic using multivariate analysis of variance adjusting for age and smoking status. Results were calculated on the log scale and then transformed to the original scale by taking the exponent of each of the values. We observed statistically significant increasing creatinine-adjusted urinary cadmium mean levels relative to smoking status, older age, parity, lower body surface area, mineral zinc supplement consumption, and high income. We did not observe a difference relative to consumption of organ meats, crustaceans, alcohol, multivitamins, multiminerals or homegrown vegetables, age of menopause, menarche of participant or oldest daughter, menopausal status or urban-rural residential location. Approximately 40% of the variance in creatinine-adjusted urinary cadmium levels in adult women was explained by several characteristics. Similar to other studies, age and smoking were the strongest determinants of creatinine-adjusted urinary cadmium concentration.

  4. Cadmium, ATPase-P, yeast. From transport to toxicity

    International Nuclear Information System (INIS)

    Two projects has been developed during my PhD. One consisting in the functional study of CadA, the Cd2+-ATPase from Listeria monocytogenes, the other one was focused on the toxicity of cadmium and the associated response of the yeast Saccharomyces cerevisiae. This two studies used a a phenotype of sensitivity to cadmium induced by CadA expression in yeast. This phenotype was used as a screening tool to identify essential amino acids of Cd transport by CadA and to study cadmium toxicity and the corresponding yeast cellular response. CadA actively transports Cd using ATP hydrolysis as energy source. Directed mutagenesis of the membranous polar, sulphur and charged amino-acids revealed that Cd transport pathway implied four transmembrane segments (Tm) and more precisely the cysteine C354, C356 and proline P355 of the CPC motif located in Tm6, aspartate D692 in Tm8, glutamate E164 in Tm4 and methionine M149 in Tm5. From our studies, 2 Cd ions would be translocated for each hydrolysis ATP. Expression of CadA in the yeast Saccharomyces cerevisiae induces an hypersensitivity to Cd. A wild type cell can grow up to 100 μm cadmium whereas CadA expressing yeast cannot grow with 1 μm cadmium in the culture medium. This cadmium sensitivity was due to the localisation of CadA in the endoplasmic reticulum membrane. Transport of cadmium in this compartment produces an accumulation of mis-folded proteins that induces the Unfolded Protein Response (UPR). As UPR also occurs in a wild type yeast exposed to low Cd concentration, one can point out endoplasmic reticulum as a extremely sensitive cellular compartment. UPR also appears as an early response to Cd as it happens far before any visible signs of toxicity. (author)

  5. Blood cadmium concentration and lipid profile in Korean adults

    International Nuclear Information System (INIS)

    Although animal experiments have shown that cadmium exposure induces alterations in lipid profiles, no epidemiological study of this relationship has been performed. The objective of this study was to evaluate the association between blood cadmium concentration and blood lipid levels in Korean adults. A cross-sectional study comprising participants (n=3903) aged 20 years or older from the 2005, 2008, and 2009 Korea National Health and Nutrition Examination Surveys was conducted. Demographic characteristics and dietary intake were obtained from the participants by questionnaire, and cadmium and lipid levels were determined by analysis of blood samples. After adjusting for demographic and dietary factors, blood concentration of cadmium was positively associated with the risk of low high-density lipoprotein cholesterol (HDL-C) in a dose-dependent manner (p for trend <0.001). In addition, the odds ratios (ORs) of a high triglyceride to HDL-C ratio was significantly increased in the high blood cadmium groups [OR=1.36; 95% confidence interval (CI), 1.03–1.79 for fourth quintile and OR=1.41; 95% CI, 1.07–1.86 for fifth quintile] compared with the lowest quintile group. However, high blood cadmium was not associated with a risk of high total cholesterol, high low-density lipoprotein cholesterol, or high triglycerides. These data suggest that an increased cadmium body burden increases the risk of dyslipidemia, mainly due to the increased risk of low HDL-C and the high ratio of triglycerides to HDL-C.

  6. The plant decapeptide OSIP108 prevents copper-induced toxicity in various models for Wilson disease

    International Nuclear Information System (INIS)

    Background: Wilson disease (WD) is caused by accumulation of excess copper (Cu) due to a mutation in the gene encoding the liver Cu transporter ATP7B, and is characterized by acute liver failure or cirrhosis and neuronal cell death. We investigated the effect of OSIP108, a plant derived decapeptide that prevents Cu-induced apoptosis in yeast and human cells, on Cu-induced toxicity in various mammalian in vitro models relevant for WD and in a Cu-toxicity zebrafish larvae model applicable to WD. Methods: The effect of OSIP108 was evaluated on viability of various cell lines in the presence of excess Cu, on liver morphology of a Cu-treated zebrafish larvae strain that expresses a fluorescent reporter in hepatocytes, and on oxidative stress levels in wild type AB zebrafish larvae. Results: OSIP108 increased not only viability of Cu-treated CHO cells transgenically expressing ATP7B and the common WD-causing mutant ATP7BH1069Q, but also viability of Cu-treated human glioblastoma U87 cells. Aberrancies in liver morphology of Cu-treated zebrafish larvae were observed, which were further confirmed as Cu-induced hepatotoxicity by liver histology. Injections of OSIP108 into Cu-treated zebrafish larvae significantly increased the amount of larvae with normal liver morphology and decreased Cu-induced production of reactive oxygen species. Conclusions: OSIP108 prevents Cu-induced toxicity in in vitro models and in a Cu-toxicity zebrafish larvae model applicable to WD. General significance: All the above data indicate the potential of OSIP108 as a drug lead for further development as a novel WD treatment. - Highlights: • Wilson disease (WD) is characterized by accumulation of toxic copper (Cu). • OSIP108 increases viability of Cu-treated cellular models applicable to WD. • OSIP108 injections preserve liver morphology of Cu-treated zebrafish larvae. • OSIP108 injections into zebrafish larvae abrogates Cu-induced oxidative stress

  7. 108 años de espera para alcanzar la gloria del olimpismo = Waiting 108 years to achieve the glory of the olympics

    Directory of Open Access Journals (Sweden)

    Douglas Crispín Castellanos

    2013-04-01

    Full Text Available En el presente artículo se trata de realizar un breve resumen de la participación de los deportistas de Isla de la Juventud (Cuba, en los Juegos Olímpicos Modernos y los 108 años que tuvieron que esperar para lograr al fin una medalla de oro por uno de sus ciudadanos.---------------------------------------------------------------This article is a brief summary exclusively of the evolution of athletes from the Isla de la Juventud (Cuba, in the Modern Olympic Games and the 108 years who had to wait to finally get a gold medal by one of its citizens.

  8. Target capture and target ghosts

    Science.gov (United States)

    Auerbach, Steven P.

    1996-05-01

    Optimal detection methods for small targets rely on whitened matched filters, which convolve the measured data with the signal model, and whiten the result with the noise covariance. In real-world implementations of such filters, the noise covariance must be estimated from the data, and the resulting covariance estimate may be corrupted by presence of the target. The resulting loss in SNR is called 'target capture'. Target capture is often thought to be a problem only for bright targets. This presentation shows that target capture also arises for dim targets, leading to an SNR loss which is independent of target strength and depends on the averaging method used to estimate the noise covariance. This loss is due to a 'coherent beat' between the true noise and that portion of the estimated noise covariance due to the target. This beat leads to 'ghost targets', which diminish the target SNR by producing a negative target ghost at the target's position. A quantitative estimate of this effect will be given, and shown to agree with numerical results. The effect of averaging on SNR is also discussed for data scenes with synthetic injected targets, in cases where the noise covariance is estimated using 'no target' data. For these cases, it is shown that the so-called 'optimal' filter, which uses the true noise covariance, is actually worse than a 'sub-optimal' filter which estimates the noise from scene. This apparent contradiction is resolved by showing that the optimal filter is best if the same filter is used for many scenes, but is outperformed by a filter adapted to a specific scene.

  9. Cadmium(II) complex formation with glutathione.

    Science.gov (United States)

    Mah, Vicky; Jalilehvand, Farideh

    2010-03-01

    Complex formation between heavy metal ions and glutathione (GSH) is considered as the initial step in many detoxification processes in living organisms. In this study the structure and coordination between the cadmium(II) ion and GSH were investigated in aqueous solutions (pH 7.5 and 11.0) and in the solid state, using a combination of spectroscopic techniques. The similarity of the Cd K-edge and L(3)-edge X-ray absorption spectra of the solid compound [Cd(GS)(GSH)]ClO(4).3H(2)O, precipitating at pH 3.0, with the previously studied cysteine compound {Cd(HCys)(2).H(2)O}(2).H(3)O(+).ClO(4) (-) corresponds to Cd(S-GS)(3)O (dominating) and Cd(S-GS)(4) four-coordination within oligomeric complexes with mean bond distances of 2.51 +/- 0.02 A for Cd-S and 2.24 +/- 0.04 A for Cd-O. For cadmium(II) solutions (C (Cd(II)) approximately 0.05 M) at pH 7.5 with moderate excess of GSH (C (GSH)/C (Cd(II)) = 3.0-5.0), a mix of Cd(S-GS)(3)O (dominating) and Cd(S-GS)(4) species is consistent with the broad (113)Cd NMR resonances in the range 632-658 ppm. In alkaline solutions (pH 11.0 and C (GSH)/C (Cd(II)) = 2.0 or 3.0), two distinct peaks at 322 and 674 ppm are obtained. The first peak indicates six-coordinated mononuclear and dinuclear complexes with CdS(2)N(2)(N/O)(2) and CdSN(3)O(2) coordination in fast exchange, whereas the second corresponds to Cd(S-GS)(4) sites. At high ligand excess the tetrathiolate complex, Cd(S-GS)(4), characterized by a sharp delta((113)Cd) NMR signal at 677 ppm, predominates. The average Cd-S distance, obtained from the X-ray absorption spectra, varied within a narrow range, 2.49-2.53 A, for all solutions (pH 7.5 and 11.0) regardless of the coordination geometry. PMID:20035360

  10. Cadmium Impairs p53 Activity in HepG2 Cells

    OpenAIRE

    Urani, C.; Melchioretto, P.; M. Fabbri; Bowe, G.; Maserati, E.; Gribaldo, L.

    2014-01-01

    Cadmium and cadmium compounds are contaminants of the environment, food, and drinking water and are important constituents of cigarette smoke. Cd exposure has also been associated with airborne particulate CdO and with Cd-containing quantum dots in medical therapy. Adverse cadmium effects reported in the literature have stimulated during recent years an ongoing discussion to better elucidate cadmium outcomes at cell and molecular level. The present work is designed to gain an insight into the...

  11. An Evaluation of Biofield Treatment on Thermal, Physical and Structural Properties of Cadmium Powder

    OpenAIRE

    Mahendra Kumar Trivedi

    2015-01-01

    Cadmium is widely utilized in nickel-cadmium batteries, stabilizers, and coating applications due to its versatile physico-chemical properties. The aim of present study was to evaluate the impact of biofield treatment on atomic, thermal, and physical properties of cadmium powder. The cadmium powder was divided into two groups, one group as control and another group as treated. The treated group received Mr. Trivedi’s biofield treatment. Control and treated samples were characterized usi...

  12. Cadmium localization and quantification in the plant Arabidopsis thaliana using micro-PIXE

    Science.gov (United States)

    Ager, F. J.; Ynsa, M. D.; Domínguez-Solís, J. R.; Gotor, C.; Respaldiza, M. A.; Romero, L. C.

    2002-04-01

    Remediation of metal-contaminated soils and waters poses a challenging problem due to its implications in the environment and the human health. The use of metal-accumulating plants to remove toxic metals, including Cd, from soil and aqueous streams has been proposed as a possible solution to this problem. The process of using plants for environmental restoration is termed phytoremediation. Cd is a particularly favourable target metal for this technology because it is readily transported and accumulated in the shoots of several plant species. This paper investigates the sites of metal localization within Arabidopsis thaliana leaves, when plants are grown in a cadmium-rich environment, by making use of nuclear microscopy techniques. Micro-PIXE, RBS and SEM analyses were performed on the scanning proton microprobe at the CNA in Seville (Spain), showing that cadmium is sequestered within the trichomes on the leaf surface. Additionally, regular PIXE analyses were performed on samples prepared by an acid digestion method in order to assess the metal accumulation of such plants.

  13. Cadmium localization and quantification in the plant Arabidopsis thaliana using micro-PIXE

    International Nuclear Information System (INIS)

    Remediation of metal-contaminated soils and waters poses a challenging problem due to its implications in the environment and the human health. The use of metal-accumulating plants to remove toxic metals, including Cd, from soil and aqueous streams has been proposed as a possible solution to this problem. The process of using plants for environmental restoration is termed phytoremediation. Cd is a particularly favourable target metal for this technology because it is readily transported and accumulated in the shoots of several plant species. This paper investigates the sites of metal localization within Arabidopsis thaliana leaves, when plants are grown in a cadmium-rich environment, by making use of nuclear microscopy techniques. Micro-PIXE, RBS and SEM analyses were performed on the scanning proton microprobe at the CNA in Seville (Spain), showing that cadmium is sequestered within the trichomes on the leaf surface. Additionally, regular PIXE analyses were performed on samples prepared by an acid digestion method in order to assess the metal accumulation of such plants

  14. Nrf2 activation prevents cadmium-induced acute liver injury

    International Nuclear Information System (INIS)

    Oxidative stress plays an important role in cadmium-induced liver injury. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that up-regulates cytoprotective genes in response to oxidative stress. To investigate the role of Nrf2 in cadmium-induced hepatotoxicity, Nrf2-null mice, wild-type mice, kelch-like ECH-associated protein 1-knockdown (Keap1-KD) mice with enhanced Nrf2, and Keap1-hepatocyte knockout (Keap1-HKO) mice with maximum Nrf2 activation were treated with cadmium chloride (3.5 mg Cd/kg, i.p.). Blood and liver samples were collected 8 h thereafter. Cadmium increased serum alanine aminotransferase (ALT) and lactate dehydrogenase (LDH) activities, and caused extensive hepatic hemorrhage and necrosis in the Nrf2-null mice. In contrast, Nrf2-enhanced mice had lower serum ALT and LDH activities and less morphological alternations in the livers than wild-type mice. H2DCFDA (2′,7′-dichlorodihydrofluoresein diacetate) staining of primary hepatocytes isolated from the four genotypes of mice indicated that oxidative stress was higher in Nrf2-null cells, and lower in Nrf2-enhanced cells than in wild-type cells. To further investigate the mechanism of the protective effect of Nrf2, mRNA of metallothionein (MT) and other cytoprotective genes were determined. Cadmium markedly induced MT-1 and MT-2 in livers of all four genotypes of mice. In contrast, genes involved in glutathione synthesis and reducing reactive oxygen species, including glutamate-cysteine ligase (Gclc), glutathione peroxidase-2 (Gpx2), and sulfiredoxin-1 (Srxn-1) were only induced in Nrf2-enhanced mice, but not in Nrf2-null mice. In conclusion, the present study shows that Nrf2 activation prevents cadmium-induced oxidative stress and liver injury through induction of genes involved in antioxidant defense rather than genes that scavenge Cd. -- Highlights: ► Cadmium caused extensive hepatic hemorrhage and necrosis in Nrf2-null mice. ► Keap1-KD and Keap1-HKO mice were

  15. Nrf2 activation prevents cadmium-induced acute liver injury

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Kai C. [Department of Pharmacology, Toxicology, and Therapeutics, University of Kansas Medical Center, Kansas City, KS (United States); Liu, Jie J. [Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS (United States); Klaassen, Curtis D., E-mail: cklaasse@kumc.edu [Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS (United States)

    2012-08-15

    Oxidative stress plays an important role in cadmium-induced liver injury. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that up-regulates cytoprotective genes in response to oxidative stress. To investigate the role of Nrf2 in cadmium-induced hepatotoxicity, Nrf2-null mice, wild-type mice, kelch-like ECH-associated protein 1-knockdown (Keap1-KD) mice with enhanced Nrf2, and Keap1-hepatocyte knockout (Keap1-HKO) mice with maximum Nrf2 activation were treated with cadmium chloride (3.5 mg Cd/kg, i.p.). Blood and liver samples were collected 8 h thereafter. Cadmium increased serum alanine aminotransferase (ALT) and lactate dehydrogenase (LDH) activities, and caused extensive hepatic hemorrhage and necrosis in the Nrf2-null mice. In contrast, Nrf2-enhanced mice had lower serum ALT and LDH activities and less morphological alternations in the livers than wild-type mice. H{sub 2}DCFDA (2′,7′-dichlorodihydrofluoresein diacetate) staining of primary hepatocytes isolated from the four genotypes of mice indicated that oxidative stress was higher in Nrf2-null cells, and lower in Nrf2-enhanced cells than in wild-type cells. To further investigate the mechanism of the protective effect of Nrf2, mRNA of metallothionein (MT) and other cytoprotective genes were determined. Cadmium markedly induced MT-1 and MT-2 in livers of all four genotypes of mice. In contrast, genes involved in glutathione synthesis and reducing reactive oxygen species, including glutamate-cysteine ligase (Gclc), glutathione peroxidase-2 (Gpx2), and sulfiredoxin-1 (Srxn-1) were only induced in Nrf2-enhanced mice, but not in Nrf2-null mice. In conclusion, the present study shows that Nrf2 activation prevents cadmium-induced oxidative stress and liver injury through induction of genes involved in antioxidant defense rather than genes that scavenge Cd. -- Highlights: ► Cadmium caused extensive hepatic hemorrhage and necrosis in Nrf2-null mice. ► Keap1-KD and Keap1-HKO mice

  16. Assessment of radio modulatory potential of emblica against radiation and cadmium induced biochemical changes in kidney of Swiss albino mice

    International Nuclear Information System (INIS)

    Ionizing radiation Induces cellular damage through direct ionization of DNA and other cellular targets and indirectly via reactive oxygen species which may include effects from epigenetic changes. It has been known since ancient times that Cadmium is virtually toxic to every organ of body including renal system. Radioprotectors are compounds that are designed to reduce the damage in normal tissue caused by radiation and cadmium. Emblica officinalis extract has been shown to possess high antioxidative, anticancer, lipid lowering, antisclerotic, hepatoprotective and anti-HIV potential. It is highly nutritious and important dietary source of vitamin. Emblica contains a polyphenols, especially tannins and other phenolic compounds. Considering antioxidant properties of Emblica, the aim of this study was to access the efficacy of Emblica in reducing radiation and cadmium induced changes in mouse kidney. For this purpose four male mice were randomly assigned into six treatment groups. The mice in the treatment groups II to VII treated respectively with cadmium chloride, radiation (7.0 Gy) combined treatment and drug treated groups. All biochemical parameters of the control groups were compared with the respective experimental groups. An increase in the value of total proteins, glycogen, acid phosphatase, alkaline phosphatase activity and RNA was observed up to day-14 in the non drug treated group and day 7 in the Emblica treated groups. Thereafter value declined up to day-28 without reaching to normal. Whereas the value of cholesterol and DNA showed a decreasing trend up to day-14 in non drug treated groups and day-7 in Emblica treated groups. The biochemical findings indicated the drug treated section of the kidney showed slightly/no degenerative changes. The treated groups demonstrating the ability of Emblica to inhibit oxidative stress thus preventing renal injury. (author)

  17. Subcellular Localization of Cadmium in Chlorella vulgaris Beijerinck Strain Bt-09

    Directory of Open Access Journals (Sweden)

    P.B. Lintongan

    2004-06-01

    Full Text Available Growth response curves of Chlorella vulgaris Beijerinck strain Bt-09 to sublethal concentrations of cadmium were evaluated. The growth responses of this microalgal isolate was determined through analysis of chlorophyll a levels. Cadmium was effectively taken up by the cells as determined by Flame Atomic Absorption Spectrophotometry (F-AAS. Subcellular fractionation was undertaken to locate sites that accumulate cadmium.

  18. ASSESSMENT OF CADMIUM EXPOSURE AND TOXICITY RISK IN AN AMERICAN VEGETARIAN POPULATION

    Science.gov (United States)

    It has been postulated that nonvegetarians may be exposed to less cadmium than vegetarians because of the cadmium-poor meat in their diet. This study attempts to test this possibility by measuring the cadmium exposure and accumulation in a population subgroup that includes many v...

  19. 40 CFR 415.640 - Applicability; description of the cadmium pigments and salts production subcategory.

    Science.gov (United States)

    2010-07-01

    ... cadmium pigments and salts production subcategory. 415.640 Section 415.640 Protection of Environment... POINT SOURCE CATEGORY Cadmium Pigments and Salts Production Subcategory § 415.640 Applicability; description of the cadmium pigments and salts production subcategory. The provisions of this subpart...

  20. Budding yeast cDNA sequencing project: Y108_J23_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y108_J23_F.ab1 Y108_J23_F.ab1 - - Show Y108_J23_F.ab1 Seqid Y108_J23_F.ab1 Link to SGD Y108_J23_ ... GAGTGTAAACGACGGCCATAACTTATTTAAT ACGACTCACTATAGGGAATTCC TTAAGATTTTAGGGATGCTGTGGAAAAG GCTCTTAAACAGACTAACGGAA ... ATGCAGAATTTGCTGCATCC CTCC TTTT CC AATGAGCAACCACTGATATTGTGATCGGCCTCTACTTATG ... CTGTTAATATATAATATGCA TAGTTGTATTTGTGCCTCAATGTGCGCCATTCC TGTGTTGGACAAAGCCG CAAGGGCCAAGGCAAGATCC CAGTTTGAAAACG ... ACCCCCGGCCGCTAGAT GCTCC CTTTAGTGACGGTAAATTGCATCC GCACTGACAAGATACTTTGAC GAGTT ...