WorldWideScience

Sample records for cadmium 105

  1. Cadmium carcinogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Waalkes, Michael P

    2003-12-10

    Cadmium is a heavy metal of considerable environmental and occupational concern. Cadmium compounds are classified as human carcinogens by several regulatory agencies. The most convincing data that cadmium is carcinogenic in humans comes from studies indicating occupational cadmium exposure is associated with lung cancer. Cadmium exposure has also been linked to human prostate and renal cancer, although this linkage is weaker than for lung cancer. Other target sites of cadmium carcinogenesis in humans, such as liver, pancreas and stomach, are considered equivocal. In animals, cadmium effectively induces cancers at multiple sites and by various routes. Cadmium inhalation in rats induces pulmonary adenocarcinomas, in accord with its role in human lung cancer. Cadmium can induce tumors and/or preneoplastic lesions within the rat prostate after ingestion or injection. At relatively high doses, cadmium induces benign testicular tumors in rats, but these appear to be due to early toxic lesions and loss of testicular function, rather than from a specific carcinogenic effect of cadmium. Like many other metals, cadmium salts will induce mesenchymal tumors at the site of subcutaneous (s.c.) or intramuscular (i.m.) injections, but the human relevance of these is dubious. Other targets of cadmium in rodents include the liver, adrenal, pancreas, pituitary, and hematopoietic system. With the exception of testicular tumors in rodents, the mechanisms of cadmium carcinogenesis are poorly defined. Cadmium can cause any number of molecular lesions that would be relevant to oncogenesis in various cellular model systems. Most studies indicate cadmium is poorly mutagenic and probably acts through indirect or epigenetic mechanisms, potentially including aberrant activation of oncogenes and suppression of apoptosis.

  2. Cadmium carcinogenesis

    International Nuclear Information System (INIS)

    Cadmium is a heavy metal of considerable environmental and occupational concern. Cadmium compounds are classified as human carcinogens by several regulatory agencies. The most convincing data that cadmium is carcinogenic in humans comes from studies indicating occupational cadmium exposure is associated with lung cancer. Cadmium exposure has also been linked to human prostate and renal cancer, although this linkage is weaker than for lung cancer. Other target sites of cadmium carcinogenesis in humans, such as liver, pancreas and stomach, are considered equivocal. In animals, cadmium effectively induces cancers at multiple sites and by various routes. Cadmium inhalation in rats induces pulmonary adenocarcinomas, in accord with its role in human lung cancer. Cadmium can induce tumors and/or preneoplastic lesions within the rat prostate after ingestion or injection. At relatively high doses, cadmium induces benign testicular tumors in rats, but these appear to be due to early toxic lesions and loss of testicular function, rather than from a specific carcinogenic effect of cadmium. Like many other metals, cadmium salts will induce mesenchymal tumors at the site of subcutaneous (s.c.) or intramuscular (i.m.) injections, but the human relevance of these is dubious. Other targets of cadmium in rodents include the liver, adrenal, pancreas, pituitary, and hematopoietic system. With the exception of testicular tumors in rodents, the mechanisms of cadmium carcinogenesis are poorly defined. Cadmium can cause any number of molecular lesions that would be relevant to oncogenesis in various cellular model systems. Most studies indicate cadmium is poorly mutagenic and probably acts through indirect or epigenetic mechanisms, potentially including aberrant activation of oncogenes and suppression of apoptosis

  3. GEN 105 Courses/sanptutorial

    OpenAIRE

    ncbdf

    2015-01-01

    GEN 105 Assignment: Reading and Retention GEN 105 Assignment: Elevator Speech GEN 105 CheckPoint: Technological Tools GEN 105 CheckPoint: Distance Learning I GEN 105 CheckPoint: Distance Learning II GEN 105 CheckPoint: Communicating in Forums GEN 105 Week 2 Discussion Questions GEN 105 Week 4 Discussion Questions GEN 105 Week 6 Discussion Questions GEN 105 Week 8 Discussion Questions GEN 105 Assignment: University Library Article Search GEN 105 Chec...

  4. Tripolyphosphates of potassium-cadmium and ammonium-cadmium

    International Nuclear Information System (INIS)

    Formation of barely soluble compounds during interaction of ammonium and potassium tripolyphosphates with cadmium nitrate in aqueous solutions (0.1-2.0 mol% concentration, the temperature 20 deg C), is investigated. KCd2P3O10x7H2O, NH4Cd2P3O10x7H2O crystallohydrates and Cd5(P3O10)2xhH2O (x=10-13) X-ray amorphous salt, that are dissolved in potassium and ammonium tripolyphosphate solution with formation of Cd2+:P3O105-=1:1 and 1:2 complexes, are separated. In K5P3O10-Cd(NO3)2-H2O system Cd2+:P3O105-=1:1 complex is crystallized in a mixture with varied composition amorphous phase

  5. GEN 105 Course tutorial/ indigohelp

    OpenAIRE

    SCD

    2015-01-01

    For more classes visit www.indigohelp.com   GEN 105 Assignment: Reading and Retention GEN 105 Assignment: Elevator Speech GEN 105 CheckPoint: Technological Tools GEN 105 CheckPoint: Distance Learning I GEN 105 CheckPoint: Distance Learning II GEN 105 CheckPoint: Communicating in Forums GEN 105 Week 2 Discussion Questions GEN 105 Week 4 Discussion Questions GEN 105 Week 6 Discussion Questions GEN 105 Week 8 Discussion Questions GEN 105 A...

  6. PHI 105 Course tutorial/ indigohelp

    OpenAIRE

    SAS

    2015-01-01

    For more classes visit www.indigohelp.com   PHI 105 Final Project: Personal Philosophy PowerPoint® Presentation PHI 105 CheckPoint: Pragmatism and Analytic Philosophy PHI 105 Assignment: Ethical Decisions Scenario Analysis PHI 105 CheckPoint: Final Project Preview PHI 105 CheckPoint: Argument and Logic PHI 105 CheckPoint: Final Project Topic PHI 105 WEEK 2 DISCUSSION QUESTION 1 PHI 105 WEEK 2 DISCUSSION QUESTION 2 PHI 105 Assignment: Letter...

  7. Oral cadmium exposure of adults in Germany. 1: Cadmium content of foodstuffs and beverages.

    Science.gov (United States)

    Müller, M; Anke, M; Hartmann, E; Illing-Günther, H

    1996-04-01

    The cadmium contents of 94 and 105 foodstuffs bought in six-fold repetition in 1988 and in nine-fold repetition in 1991, respectively were analysed within the framework of a market-basket study. These foodstuffs were typical of German eating habits. Additionally, 170 samples of drinking water were investigated. The cadmium concentrations of the foodstuffs were comparable with results of recent studies carried out in Europe and North America. Fruit, milk and dairy products, sugar and sugar-rich foodstuffs as well as beverages showed mean cadmium contents cakes and pastries as well as farinaceous products were within the range of 20-40 ng/g. The most important bread, cakes and pastries (wheat and rye bread, toasted bread, rolls) contained 25-35 ng/g. A median cadmium concentration of 0.2 micrograms/l was found in the drinking water. As expected, liver and kidneys showed the highest cadmium levels of 73 and 204 ng/g, respectively on average. PMID:8718751

  8. Adsorption of lead(2) and cadmium(2) ions on the surface of a nitrocellulose membrane modified with denaturated deoxyribonucleic acid

    International Nuclear Information System (INIS)

    The adsorption of the lead(2) and cadmium(2) ions on the surface of the amperometric biosensor on the basis of the nitrocellulose membrane, modified with the denaturated DNA (d-DNA) is studied. It is established that by the combined adsorption of these ions, available in the mixture, the lead(2) ions are bound d-DNA molecules more efficiently in comparison with the cadmium(2) ions. The values of the constant of binding the lead(2) and cadmium(2) ions with the immobilized d-DNA constitute correspondingly (12.0±0.3)x105 M-1 and (0.6±0.2)x105 M-1

  9. The vapour pressures over saturated aqueous solutions of cadmium chloride, cadmium bromide, cadmium iodide, cadmium nitrate, and cadmium sulphate

    Energy Technology Data Exchange (ETDEWEB)

    Apelblat, Alexander [Department of Chemical Engineering, Ben Gurion University of the Negev, P.O. Box 653, Beer Sheva 84105 (Israel)]. E-mail: apelblat@bgu.ac.il; Korin, Eli [Department of Chemical Engineering, Ben Gurion University of the Negev, P.O. Box 653, Beer Sheva 84105 (Israel)

    2007-07-15

    Vapour pressures of water over saturated solutions of cadmium salts (chloride, bromide, iodide, nitrate, and sulphate) were determined over the temperature range 280 K to 322 K and compared with the literature data. The vapour pressures determined were used to obtain the water activities, osmotic coefficients and the molar enthalpies of vaporization in the (cadmium salt + water) systems.

  10. The vapour pressures over saturated aqueous solutions of cadmium chloride, cadmium bromide, cadmium iodide, cadmium nitrate, and cadmium sulphate

    International Nuclear Information System (INIS)

    Vapour pressures of water over saturated solutions of cadmium salts (chloride, bromide, iodide, nitrate, and sulphate) were determined over the temperature range 280 K to 322 K and compared with the literature data. The vapour pressures determined were used to obtain the water activities, osmotic coefficients and the molar enthalpies of vaporization in the (cadmium salt + water) systems

  11. Cadmium status in Egypt

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    It is inferred from these studies that releases of Cd are still increasing and it is recommended that measures must be taken to reduce emissions of cadmium. Any cadmium discharged into the Egyptian environment may move from one compartment to another at varying rates,resulting in an accumulation in compartments such as soils and biota. Such accumulation can be expected to increase with continued emissions,and attention should be given to all sources of cadmium, natural as well as anthropogenic especially in the industrial cities in Egypt. Cadmium present in sewage, as well as industrial effluent (also, other liquid and solid wastes) and sewage sludge will increase levels in soils and is xpected to contribute to dietary levels and body burdens. The current information indicates that such effects may have to be evaluated over long periods of time, possibly as long as 50 - 100 years.

  12. GEN 105 UOP course tutorial/tutorialoutlet

    OpenAIRE

    NARESH 1

    2015-01-01

    For more course tutorials visit www.tutorialoutlet.com     GEN 105 Assignment: Reading and Retention GEN 105 Assignment: Elevator Speech GEN 105 CheckPoint: Technological Tools GEN 105 CheckPoint: Distance Learning I GEN 105 CheckPoint: Distance Learning II GEN 105 CheckPoint: Communicating in Forums GEN 105 Week 2 Discussion Questions GEN 105 Week 4 Discussion Questions GEN 105 Week 6 Discussion Questions GEN 105 Week 8 Discussion...

  13. Kinetic parameters and TL mechanism in cadmium tetra borate phosphor

    Energy Technology Data Exchange (ETDEWEB)

    Annalakshmi, O. [Radiological Safety Division, Materials Physics Division, Indira Gandhi Centre for Atomic Research, Kalpakkam-603102 (India); Jose, M.T., E-mail: mtj@igcar.gov.in [Radiological Safety Division, Materials Physics Division, Indira Gandhi Centre for Atomic Research, Kalpakkam-603102 (India); Sridevi, J. [Central Leather Research Institute, Council of Scientific and Industrial Research, Chennai 600 020, Tamilnadhu (India); Venkatraman, B. [Radiological Safety Division, Materials Physics Division, Indira Gandhi Centre for Atomic Research, Kalpakkam-603102 (India); Amarendra, G. [Materials Physics Division, Indira Gandhi Centre for Atomic Research, Kalpakkam-603102 (India); Mandal, A.B. [Central Leather Research Institute, Council of Scientific and Industrial Research, Chennai 600 020, Tamilnadhu (India)

    2014-03-15

    Polycrystalline powder samples of cadmium tetra borate were synthesized by a simple solid state sintering technique and gamma irradiated sample showed a simple Thermoluminescence (TL) glow peak around 460 K. The TL kinetic parameters of gamma irradiated phosphor were determined by initial rise (IR), isothermal decay (ID), peak shape (PS), variable heating rate (VHR) and glow curve de-convolution method. The kinetic parameters such as activation energy (E), frequency factor (s) and order of kinetics (b) were calculated by IR, ID, PS and VHR methods are in the order of ∼1.05 eV, 10{sup 9}–10{sup 12} s{sup −1} and 1.58, respectively. From the results of TL and PL emission studies carried out on the phosphor revealed that the defect centers related to TL is different from that for PL. EPR measurements were carried out to identify the defect centers formed in cadmium tetra borate phosphor on gamma irradiation. Based on EPR studies the mechanism for TL process in cadmium tetra borate is proposed in this paper -- Highlights: • Polycrystalline powder samples of undoped cadmium tetra borate synthesized. • Cadmium tetra borate phosphor exhibits a dosimetric peak at 458 K. • Kinetic parameters of the trap responsible for TL evaluated. • TL mechanism is proposed from TL to EPR correlation studies.

  14. Kinetic parameters and TL mechanism in cadmium tetra borate phosphor

    International Nuclear Information System (INIS)

    Polycrystalline powder samples of cadmium tetra borate were synthesized by a simple solid state sintering technique and gamma irradiated sample showed a simple Thermoluminescence (TL) glow peak around 460 K. The TL kinetic parameters of gamma irradiated phosphor were determined by initial rise (IR), isothermal decay (ID), peak shape (PS), variable heating rate (VHR) and glow curve de-convolution method. The kinetic parameters such as activation energy (E), frequency factor (s) and order of kinetics (b) were calculated by IR, ID, PS and VHR methods are in the order of ∼1.05 eV, 109–1012 s−1 and 1.58, respectively. From the results of TL and PL emission studies carried out on the phosphor revealed that the defect centers related to TL is different from that for PL. EPR measurements were carried out to identify the defect centers formed in cadmium tetra borate phosphor on gamma irradiation. Based on EPR studies the mechanism for TL process in cadmium tetra borate is proposed in this paper -- Highlights: • Polycrystalline powder samples of undoped cadmium tetra borate synthesized. • Cadmium tetra borate phosphor exhibits a dosimetric peak at 458 K. • Kinetic parameters of the trap responsible for TL evaluated. • TL mechanism is proposed from TL to EPR correlation studies

  15. CIS 105 UOP Course Tutorial/ Tutorialrank

    OpenAIRE

    SINCENK

    2015-01-01

    For more course tutorials visit www.tutorialrank.com Tutorial Purchased: 5 Times, Rating: A   CIS 105 Capstone Discussion Question CIS 105 Assignment: Technology of the Future CIS 105 Assignment: Security Systems CIS 105 CheckPoint: Internet Scavenger Hunt CIS 105 CheckPoint: Computer Comparison CIS 105 CheckPoint: Data Versus Information CIS 105 CheckPoint: Microsoft® Word CIS 105 CheckPoint: Types of Networks CIS 105 CheckPoint: Cyber...

  16. Nephrotoxicity of cadmium & lead.

    Science.gov (United States)

    Gonick, H C

    2008-10-01

    Cadmium and lead are divalent cations with a propensity to settle in the proximal tubule of the nephron, leading to nephrotoxicity. The pathophysiological results, however, tend to diverge. Cadmium in sufficient cumulative dosage leads to the production of the Fanconi syndrome, a generalized proximal tubular reabsorptive defect thought to be related to inhibition of both ATP production and Na-K-ATPase activity. On the other hand, lead accumulation in the proximal tubule leads to hyperuricaemia and gout, presumably by inhibiting uric acid secretion, and diminished glomerular filteration rate (GFR). Fanconi syndrome is seen unusually only in children and experimental animals. Cadmium nephrotoxicity is heralded by increased excretion of beta2-microglobulin, retinol binding protein and alpha1-microglobulin, indicative of decreased proximal tubule function. Beta2-microglobulinuria is not found in lead nephropathy. In lead nephropathy albuminuria is absent or minimal whereas in cadmium nephropathy albuminuria is variable. From the standpoint of pathology, both entities are characterized by tubulointerstitial disease and fibrosis, but only early lead nephropathy is characterized by the presence of proximal tubule nuclear inclusion bodies, due to the combination of lead with a lead binding-protein. PMID:19106433

  17. Maternal Exposure to Cadmium and Manganese Impairs Reproduction and Progeny Fitness in the Sea Urchin Paracentrotus lividus

    OpenAIRE

    Oriana Migliaccio; Immacolata Castellano; Paola Cirino; Giovanna Romano; Anna Palumbo

    2015-01-01

    Metal contamination represents one of the major sources of pollution in marine environments. In this study we investigated the short-term effects of ecologically relevant cadmium and manganese concentrations (10(-6) and 3.6 x 10(-5) M, respectively) on females of the sea urchin Paracentrotus lividus and their progeny, reared in the absence or presence of the metal. Cadmium is a well-known heavy metal, whereas manganese represents a potential emerging contaminant, resulting from an increased p...

  18. Contacting cadmium deposition from spent industrial solutions

    International Nuclear Information System (INIS)

    Cadmium metal deposition from spent industrial solutions by cadmium (2) reduction with dispersed aluminium is studied. The influence of temperature, reagent concentration and the presence of complexing agents on the yield and purity of isolated cadmium metal is examined

  19. CIS 105 UOP COURSES TUTORIAL/UOPHELP

    OpenAIRE

    hubli

    2015-01-01

    For more course tutorials visit www.uophelp.com   CIS 105 Capstone Discussion Question   CIS 105 Assignment: Technology of the Future   CIS 105 Assignment: Security Systems   CIS 105 CheckPoint: Internet Scavenger Hunt   CIS 105 CheckPoint: Computer Comparison   CIS 105 CheckPoint: Data Versus Information   CIS 105 CheckPoint: Microsoft® Word   CIS 105 CheckPoint: Types of Networks ...

  20. Physiological and behavioural responses of Gammarus pulex (Crustacea: Amphipoda) exposed to cadmium

    International Nuclear Information System (INIS)

    The aim of this study was to investigate the effects of cadmium on physiological and behavioural responses in Gammarus pulex. In a first experiment, cadmium LC50s for different times were evaluated in 264 h experiment under continuous mode of exposure (LC5096h = 82.1 μg L-1, LC50120h = 37.1 μg L-1, LC50168h = 21.6 μg L-1, LC50264h = 10.5 μg L-1). In a second experiment, the physiological and behavioural responses of the amphipod exposed to cadmium (0, 7.5 and 15 μg L-1) were investigated under laboratory conditions. The mortality and the whole body cadmium concentration of organisms exposed to cadmium were significantly higher than in controls. Concerning physiological responses, cadmium exposure exerted a significant decrease on osmolality and haemolymph Ca2+ concentration, but not on haemolymph Na+ and Cl- concentrations, whereas the Na+/K+-ATPase activity was significantly increased. Behavioural responses, such as feeding rate, locomotor and ventilatory activities, were significantly reduced in Cd exposed organisms. Mechanism of cadmium action and consequent energetic reallocation in favour of maintenance functions (i.e., osmoregulation) are discussed. The results of this study indicate that osmolality and locomotor activity in G. pulex could be effective ecophysiological/behavioural markers to monitor freshwater ecosystem and to assess the health of organisms

  1. Cadmium in Sweden - environmental risks

    Energy Technology Data Exchange (ETDEWEB)

    Parkman, H.; Iverfeldt, Aa. [Swedish Environmental Research Inst. (Sweden); Borg, H.; Lithner, G. [Stockholm Univ. (Sweden). Inst. for Applied Environmental Research

    1998-03-01

    This report aims at assessing possible effects of cadmium in the Swedish environment. Swedish soils and soft freshwater systems are, due to a generally poor buffering capacity, severely affected by acidification. In addition, the low salinity in the Baltic Sea imply a naturally poor organism structure, with some important organisms living close to their limit of physiological tolerance. Cadmium in soils is mobilized at low pH, and the availability and toxicity of cadmium in marine systems are enhanced at low salinity. The Swedish environment is therefore extra vulnerable to cadmium pollution. The average concentrations of cadmium in the forest mor layers, agricultural soils, and fresh-waters in Sweden are enhanced compared to `back-ground concentrations`, with a general increasing trend from the north to the south-west, indicating strong impact of atmospheric deposition of cadmium originating from the central parts of Europe. In Swedish sea water, total cadmium concentrations, and the fraction of bio-available `free` cadmium, generally increases with decreasing salinity. Decreased emissions of cadmium to the environment have led to decreasing atmospheric deposition during the last decade. The net accumulation of cadmium in the forest mor layer has stopped, and even started to decrease. In northern Sweden, this is due to the decreased deposition, but in southern Sweden the main reason is increased leakage of cadmium from the topsoil as a consequence of acidification. As a result, cadmium in the Swedish environments is undergoing an extended redistribution between different soil compartments, and from the soils to the aquatic systems. 90 refs, 23 figs, 2 tabs. With 3 page summary in Swedish

  2. Cadmium sulfite hexahydrate revisited

    Directory of Open Access Journals (Sweden)

    Sergio Baggio

    2008-07-01

    Full Text Available The present structural revision of the title compound, tetracadmium tetrasulfite hexahydrate, [Cd4(SO34(H2O5]·H2O, is a low-temperature upgrade (T = 100 K and R = 0.017 of the original room-temperature structure reported by Kiers & Vos [Cryst. Struct. Commun. (1978. 7, 399–403; T = 293 K and R = 0.080. The compound is a three-dimensional polymer with four independent cadmium centres, four sulfite anions and six water molecules, five of them coordinated to two cadmium centres and the remaining one an unbound solvent molecule which completes the asymmetric unit. There are two types of cadmium environment: CdO8 (through four chelating sulfite ligands and CdO6 (by way of six monocoordinated ligands. The former groups form planar arrays [parallel to (001 and separated by half a unit cell translation along c], made up of chains running along [110] and [overline{1}10], respectively. These chains are, in turn, interconnected both in an intraplanar as well as in an interplanar fashion by the latter CdO6 polyhedra into a tight three-dimensional framework. There is, in addition, an extensive network of hydrogen bonds, in which all 12 water H atoms act as donors and eight O atoms from all four sulfite groups and two water molecules act as acceptors.

  3. Cadmium in blood and hypertension

    Energy Technology Data Exchange (ETDEWEB)

    Eum, Ki-Do; Lee, Mi-Sun [Department of Environmental Health, Graduate School of Public Health and Institute of Health and Environment, Seoul National University, Seoul (Korea, Republic of); Paek, Domyung [Department of Environmental Health, Graduate School of Public Health and Institute of Health and Environment, Seoul National University, Seoul (Korea, Republic of)], E-mail: paekdm@snu.ac.kr

    2008-12-15

    Objectives:: This study is to examine the effect of cadmium exposure on blood pressure in Korean general population. Methods:: The study population consisted of 958 men and 944 women who participated in the 2005 Korean National Health and Nutrition Examination Survey (KNHANES), in which blood pressure and blood cadmium were measured from each participant. Results:: The mean blood cadmium level was 1.67 {mu}g/L (median level 1.55). The prevalence of hypertension was 26.2%. The blood cadmium level was significantly higher among those subjects with hypertension than those without (mean level 1.77 versus 1.64 {mu}g/dL). After adjusting for covariates, the odds ratio of hypertension comparing the highest to the lowest tertile of cadmium in blood was 1.51 (95% confidence interval 1.13 to 2.05), and a dose-response relationship was observed. Systolic, diastolic, and mean arterial blood pressure were all positively associated with blood cadmium level, and this effect of cadmium on blood pressure was markedly stronger when the kidney function was reduced. Conclusions:: Cadmium exposures at the current level may have increased the blood pressure of Korean general population.

  4. Cadmium in blood and hypertension

    International Nuclear Information System (INIS)

    Objectives:: This study is to examine the effect of cadmium exposure on blood pressure in Korean general population. Methods:: The study population consisted of 958 men and 944 women who participated in the 2005 Korean National Health and Nutrition Examination Survey (KNHANES), in which blood pressure and blood cadmium were measured from each participant. Results:: The mean blood cadmium level was 1.67 μg/L (median level 1.55). The prevalence of hypertension was 26.2%. The blood cadmium level was significantly higher among those subjects with hypertension than those without (mean level 1.77 versus 1.64 μg/dL). After adjusting for covariates, the odds ratio of hypertension comparing the highest to the lowest tertile of cadmium in blood was 1.51 (95% confidence interval 1.13 to 2.05), and a dose-response relationship was observed. Systolic, diastolic, and mean arterial blood pressure were all positively associated with blood cadmium level, and this effect of cadmium on blood pressure was markedly stronger when the kidney function was reduced. Conclusions:: Cadmium exposures at the current level may have increased the blood pressure of Korean general population

  5. Projectbeschrijving Cadmium-informatiepunt (CIP)

    OpenAIRE

    Meijer PJ

    1989-01-01

    To minimize the use of cadmium the Central Government has decided to perform the purchase of products and materials within the Central Government as much as possible within the Draft Cadmium Decree. The activities to achieve this are as far as could be seen at the start of the project in june 1989, mentioned in this report.

  6. 29 CFR 1926.1127 - Cadmium.

    Science.gov (United States)

    2010-07-01

    ... containment of cadmium or materials containing cadmium on the site or location at which construction...) SAFETY AND HEALTH REGULATIONS FOR CONSTRUCTION Toxic and Hazardous Substances § 1926.1127 Cadmium. (a... forms, in all construction work where an employee may potentially be exposed to cadmium....

  7. Cadmium exposure in the Swedish environment

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1998-03-01

    This report gives a thorough description of cadmium in the Swedish environment. It comprises three parts: Cadmium in Sweden - environmental risks;, Cadmium in goods - contribution to environmental exposure;, and Cadmium in fertilizers, soil, crops and foods - the Swedish situation. Separate abstracts have been prepared for all three parts

  8. Cadmium in newborns

    OpenAIRE

    Eklund, Gunilla

    2003-01-01

    Cadmium (Cd) is a well-known nephrotoxic environmental contaminant but there are indications that the developing nervous system might be even more sensitive to Cd than the kidneys in adults. Infants are exposed to Cd from various formulas and infant diets and the gastrointestinal Cd uptake is believed to be higher in newborns than in adults. Cd levels monitored in infant foods ranged between 0.74 and 27.0 µg/kg. Cow's milk formulas had the lowest levels and cereal-based formulas had up to 21 ...

  9. Cadmium sulfite hexahydrate revisited

    OpenAIRE

    Sergio Baggio; Andrés Ibáñez; Ricardo Baggio

    2008-01-01

    The present structural revision of the title compound, tetracadmium tetrasulfite hexahydrate, [Cd4(SO3)4(H2O)5]·H2O, is a low-temperature upgrade (T = 100 K and R = 0.017) of the original room-temperature structure reported by Kiers & Vos [Cryst. Struct. Commun. (1978). 7, 399–403; T = 293 K and R = 0.080). The compound is a three-dimensional polymer with four independent cadmium centres, four sulfite anions and six water molecules, five of them coordinated to two c...

  10. Cadmium and zinc

    International Nuclear Information System (INIS)

    Cadmium and zinc are naturally occurring trace metals that are often considered together because of their close geochemical association and similarities in chemical reactivity. The loss of two electrons from an atom of Cd or Zn imparts to each an electron configuration with completely filled d orbitals; this results in a highly stable 2/sup +/ oxidation state. But Cd and Zn differ greatly in their significance to biological systems. Whereas Zn is an essential nutrient for plants, animals, and humans, Cd is best known for its toxicity to plants and as a causative agent of several disease syndromes in animals and humans

  11. Biomonitoring of cadmium in pig production

    OpenAIRE

    Lindén, Anna

    2002-01-01

    Cadmium is a nephrotoxic metal with increasing levels in arable soils. The non-smoking population is exposed to cadmium mainly from vegetable food, especially cereal products. The major part of pig feed is cereals, and accumulated cadmium in pig kidney could reflect cadmium in the local agricultural environment. In this thesis, the possibility to use pig kidney as a bioindicator of the availability of cadmium in the agricultural environment was evaluated. There were significant correlations b...

  12. 105-C Facility characterization plan

    International Nuclear Information System (INIS)

    This facility characterization plan is a site-specific document that describes how quantification and qualification of the radiological sources and the radioactive contamination in the 105-C Building will be accomplished. Characterization of hazardous materials will be addressed in a separate plan. This plan was developed from review of video tapes, photographs, and records. The purpose of this characterization plan is to provide an efficient and cost-effective method for determining the distribution of radioactive contamination at the 105-C Facility

  13. Cadmium accumulation and subcellular distribution in relation to cadmium chloride induced cytotoxicity in vitro

    International Nuclear Information System (INIS)

    A bovine kidney cell culture system was used to assess what relationship cadmium (Cd) uptake and subcellular distribution had to cadmium chloride induced cytotoxicity. Twenty-four hour incubation with 0.1-10 μM Cd elicited 0-90% cytotoxicity. Fifty percent cytotoxicity was estimated to result from 0.8 μM Cd. A concentration-related Cd accumulation paralleled the cytotoxicity profile. The time-course for Cd accumulation was linear for the first 6 h of exposure and plateaued by 18 h post-exposure. When the degree of cytotoxicity was compared with the cellular Cd burden at 24 h post-treatment a least-squares linear regression analysis (r=0.93) indicated a direct relationship. Subcellular distribution studies indicated greater than 90% Cd recovery from the soluble supernatant (105,000 g) at all levels of cytotoxicity studied. Metallothionein sequestered less than 25% of the cellular Cd. As a result of the correlation of the degree of cytotoxicity with the cellular Cd burden and the independence of subcellular distribution from cytotoxicity, a cumulative mechanism of toxicity for Cd in MDBK cells was suggested. (author)

  14. Potentiometric titration of excess cadmium in cadmium selenide

    International Nuclear Information System (INIS)

    A simple and rapid potentiometric technique for determining excess cadmium in CdSe has been developed. Reaction with AgNO3 is used for sample treatment. Silver, formed in the AgNO3 reaction with excess Cd is determined with the help of KI. When using the given method of analysis the relative standard deviation is equal to 0.08-0.21. The real detection limit of excess cadmium is 9x10-7 g

  15. Cadmium(2) complexes of cytosine

    International Nuclear Information System (INIS)

    Complexes of cadmium(2) with cytosine obtained from aqueous or physiological solutions at room temperature are reported. The complexes were characterized by spectroscopic, conductometric, 1H-NMR, and 13C-NMR measurements and also by thermogravimetry. (Authors)

  16. Discovery of the Cadmium Isotopes

    OpenAIRE

    Amos, S.; Thoennessen, M

    2009-01-01

    Thirty-seven cadmium isotopes have so far been observed; the discovery of these isotopes is discussed. For each isotope a brief summary of the first refereed publication, including the production and identification method, is presented.

  17. Cadmium telluride nuclear radiation detectors

    International Nuclear Information System (INIS)

    The characteristics and performance of undoped high resistivity cadmium telluride detectors are compared to chlorine lifted counters. It is shown, in particular, that Undodep CdTe is in fact aluminium doped and that compensation occurs, as an silicon or germanium, by pair and triplet formation between the group III donor and the doubly charged cadmium vacancy acceptor. Furthermore, in chlorine doped samples, the polarization effect results from the unpaired level at Esub(c)-0,6eV

  18. Speciation of Dissolved Cadmium

    DEFF Research Database (Denmark)

    Holm, Peter Engelund; Andersen, Sjur; Christensen, Thomas Højlund

    1995-01-01

    Equilibrium dialysis and ion exchange methods, as well as computer calculations (GEOCHEM), were applied for speciation of dissolved cadmium (Cd) in test solutions and leachate samples. The leachate samples originated from soil, compost, landfill waste and industrial waste. The ion exchange (IE......) method separates dissolved Cd into free divalent Cd (Cd 2+) and complexed Cd and furthermore separates the latter into the operationally defined forms: labile, slowly labile and stable complexes. The dialysis (ED) method determines high molecular weight Cd complexes (above 1000mol. wt). For both methods...... the reproducibility was good. By combining the results of the GEOCHEM calculations in terms of the inorganic complexes, and the IE results, the fractions of free and inorganically complexed Cd were estimated. The IE and ED results furthermore provided information about the organic complexes. Selected...

  19. Cadmium accumulation and depuration in Anodonta anatina exposed to cadmium chloride or cadmium-EDTA complex

    Energy Technology Data Exchange (ETDEWEB)

    Holwerda, D.A.; Hemelraad, J.; Veenhof, P.R.; Zandee, D.I.

    1988-03-01

    The authors have previously reported on the uptake and distribution of cadmium in unionids, experimentally exposed to cadmium chloride. The purpose of the present investigation was to study the effect of metal chelation on cadmium kinetics, including metal elimination in the post-exposure phase. Generally, chelation of ionic metal by natural substances like humic acids or by synthetic compounds like EDTA decreases its environmental toxicity through a diminished rate of uptake, as compared with the free ion. The influences of metal chelation on bioconcentration and on toxicity do not always run parallel. To their knowledge, there are no data on the effect of chelation on metal kinetics in freshwater clams. Data on rates of cadmium elimination from aquatic invertebrates are highly divergent, but Cd excretion is invariably found to be smaller than uptake.

  20. Characterization of cadmium-resistant bacteria and their application for cadmium bioremediation - 16072

    International Nuclear Information System (INIS)

    insoluble CdS. Interestingly, Cd-resistant bacteria isolated S2500-3, -8, -9,and -20 increased cadmium tolerance of Thai jasmine rice (Kao Hom Mali 105) when grown in the presence of 200 μM CdCl2. These 4 isolates also decreased cadmium concentration accumulation in Kao Hom Mali 105 plant at 61, 9, 6, and 17%, respectively when grown in the presence of 200 μM CdCl2. They were identified by 16S rDNA sequence analysis and classified as Cupriavidus taiwanensis (isolate S2500-3) and Pseudomonas aeruginosa (isolates S2500-8, -9, and -20). (authors)

  1. Sorption profile of cadmium ions onto styrene-divinylbenzene copolymer beads

    International Nuclear Information System (INIS)

    The sorption behavior of cadmium ions from aqueous media was investigated on styrene-divinylbenzene copolymer beads (St-DVB) as an adsorbent. Various physico-chemical parameters were optimized to simulate the best conditions which can be used to decontaminate cadmium ions from aqueous media using St-DVB beads as an adsorbent. Maximum adsorption was observed at 0.001 mol L-1 acid solutions (HNO3, HCl, H2SO4 and HClO4) using 0.2 g of adsorbent for 8.89 x 10-5 mol L-1 of cadmium ions within three minutes equilibration time. The adsorption data followed the Freundlich, Langmuir and Dubinin-Radushkevich (D-R) isotherms over the cadmium concentration range of 8.89 x 10-4 to 8.01 x 10-3 molL-1. The characteristic Freundlich constants, i.e. 1/n=0.243±0.007 and A=1.783 x 10-3±2.069 x 10-5 mol g-1 have been computed for the sorption system. Langmuir isotherm gave a saturated capacity of 0.334±0.0123 mmol g-1. The sorption mean free energy from D-R isotherm was found to be 16.31±0.31 kJ mol-1 indicating chemisorption involving chemical bonding for the adsorption process. The uptake of cadmium increased with the rise in temperature. Thermodynamic parameters, i.e. ΔG, ΔH and ΔS have also been calculated for the system. The sorption process was found to be endothermic. The proposed procedure was applied to remove cadmium from tap water and industrial effluent. (orig.)

  2. Mobiado Professional 105GMT Gold

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    近日一次爆出了旗下新款奢侈品牌手机Professional 105GMT Gold。Mobiado是近几年才崛起的厂商,其品牌主要致力、时尚的设计,在奢侈品牌领域具有良好的口碑。

  3. Zinc-induced protection against cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Early, J.L.; Schnell, R.C.

    1978-02-01

    Pretreatment of male rats with cadmium acetate potentiates the duration of hexobarbital hypnosis and inhibits the rate of hepatic microsomal drug metabolism. Pretreatment of rats with zinc acetate protects against these alterations in drug action elicited by cadmium.

  4. Determination of lead, cadmium and arsenic in infusion tea cultivated in north of Iran

    OpenAIRE

    Shekoohiyan Sakine; Ghoochani Mahboobeh; Mohagheghian Azita; Mahvi Amir Hossein; Yunesian Masoud; Nazmara Shahrokh

    2012-01-01

    Abstract Tea is one of the most common drinks in all over the world. Rapid urbanization and industrialization in recent decades has increased heavy metals in tea and other foods. In this research, heavy metal contents such as lead (Pb), cadmium (Cd) and arsenic (As) were determined in 105 black tea samples cultivated in Guilan and Mazandaran Provinces in north of Iran and their tea infusions. The amount of heavy metals in black tea infusions were analyzed using Inductively Coupled Plasma Atom...

  5. Bioavailability of cadmium from linseed and cocoa

    DEFF Research Database (Denmark)

    Hansen, Max; Sloth, Jens Jørgen; Rasmussen, Rie Romme

    In Denmark and EU the exposure of cadmium from food is at a level that is relatively close to the Tolerable Daily Intake (TDI). This report describes an investigation of the bioavailability of cadmium in selected food items known to contain high levels of cadmium. The purpose was to provide data ...... crushed linseed nor the intake of cocoa and chocolate....

  6. Cadmium purification and quantification using immunochromatography.

    Science.gov (United States)

    Sasaki, Kazuhiro; Yongvongsoontorn, Nunnarpas; Tawarada, Kei; Ohnishi, Yoshikazu; Arakane, Tamami; Kayama, Fujio; Abe, Kaoru; Oguma, Shinichi; Ohmura, Naoya

    2009-06-10

    One of the pathways by which cadmium enters human beings is through the consumption of agricultural products. The monitoring of cadmium has a significant role in the management of cadmium intake. Cadmium purification and quantification using immunochromatography were conducted in this study as an alternative means of cadmium analysis. The samples used in this study were rice, tomato, lettuce, garden pea, Arabidopsis thaliana (a widely used model organism for studying plants), soil, and fertilizer. The cadmium immunochromatography has been produced from the monoclonal antibody Nx2C3, which recognize the chelate form of cadmium, Cd.EDTA. The immunochromatography can be used for quantification of cadmium in a range from 0.01 to 0.1 mg/L at 20% mean coefficient of variance. A chelate column employing quaternary ammonium salts was used for the purification of cadmium from HCl extracts of samples. Recoveries of cadmium were near 100%, and the lowest recovery was 76.6% from rice leaves. The estimated cadmium concentrations from the immunochromatography procedure were evaluated by comparison with the results of instrumental analysis (ICP-AES or ICP-MS). By comparison of HCl extracts analyzed by ICP-MS and column eluates analyzed by immunochromatography of the samples, the estimated cadmium concentrations were closely similar, and their recoveries were from 98 to 116%. PMID:19489614

  7. Mechanisms of cadmium carcinogenesis

    International Nuclear Information System (INIS)

    Cadmium (Cd), a heavy metal of considerable occupational and environmental concern, has been classified as a human carcinogen by the International Agency for Research on Cancer (IARC). The carcinogenic potential of Cd as well as the mechanisms underlying carcinogenesis following exposure to Cd has been studied using in vitro cell culture and in vivo animal models. Exposure of cells to Cd results in their transformation. Administration of Cd in animals results in tumors of multiple organs/tissues. Also, a causal relationship has been noticed between exposure to Cd and the incidence of lung cancer in human. It has been demonstrated that Cd induces cancer by multiple mechanisms and the most important among them are aberrant gene expression, inhibition of DNA damage repair, induction of oxidative stress, and inhibition of apoptosis. The available evidence indicates that, perhaps, oxidative stress plays a central role in Cd carcinogenesis because of its involvement in Cd-induced aberrant gene expression, inhibition of DNA damage repair, and apoptosis.

  8. Cadmium uptake by plants

    Energy Technology Data Exchange (ETDEWEB)

    Haghiri, F.

    1973-01-01

    Absorption of /sup 115m/Cd by soybean (Gylcine max l.) plants via foliar and root systems and translocation into the seed was determined. The uptake of /sup 115m/Cd by soybeans via the root system was more efficient than that of the foliar placement. Growth and Cd concentrations of soybean and wheat (Triticum aestivum l.) tops were influenced by soil-applied Cd. In both crops, the Cd concentration of plant tops increased while yield decreased with increasing levels of applied Cd. Cadmium toxicitiy began to occur in both crops at the lowest level of soil applied Cd (2.5 ppM). With soybean plants, Cd toxicity symptoms resembled fe chlorosis. For wheat plants there were no visual symptoms other than the studied growth. The relative concentration of Cd found in several vegetable crops varied depending on the plant species. The relative Cd concentration in descending order for various vegetables was lettuce (Lactuca sativa l.) > radish top (Raphanus sativus l.) > celery stalk (Apium graveolens l.) > celery leaves greater than or equal to green pepper (Capsicum frutescens l.) > radish roots.

  9. Thin-film cadmium telluride solar cells

    Science.gov (United States)

    Chu, T. L.

    1987-10-01

    Cadmium telluride, with a room-temperature band-gap energy of 1.5 eV, is a promising thin-film photovoltaic material. The major objective of this research has been to demonstrate thin-film CdTe heterojunction solar cells with a total area greater than 1 sq cm and photovoltaic efficiencies of 13 percent or more. Thin-film p-CdTe/CdS/SnO2:F/glass solar cells with an AM1.5 efficiency of 10.5 percent have been reported previously. This report contains results of work done on: (1) the deposition, resistivity control, and characterization of p-CdTe films by the close-spaced sublimation process; (2) the deposition of large-band-gap window materials; (3) the electrical properties of CdS/CdTe heterojunctions; (4) the formation of stable, reproducible, ohmic contacts (such as p-HgTe) to p-CdTe; and (5) the preparation and evaluation of heterojunction solar cells.

  10. Main: PPC105 [AT Atlas

    Lifescience Database Archive (English)

    Full Text Available pment of Advanced Production Technologies for Target Proteins Shigeyuki Yokoyama Systems and Structural Biology Cente...crushing the membrane and remo FBB5|MPA2|MPA6 Protein Expr. Purif. (2006)|J. Biotechnol. (2006)|Prote...PPC105 PPC1 Synthesis of large proteins by human cell-free protein synthesis system Develo...r, Yokohama Institute, RIKEN We have succeeded in synthesizing proteins over 150 kDa by (i)

  11. Nickel cadmium battery expert system

    Science.gov (United States)

    1986-01-01

    The applicability of artificial intelligence methodologies for the automation of energy storage management, in this case, nickel cadmium batteries, is demonstrated. With the Hubble Space Telescope Electrical Power System (HST/EPS) testbed as the application domain, an expert system was developed which incorporates the physical characterization of the EPS, in particular, the nickel cadmium batteries, as well as the human's operational knowledge. The expert system returns not only fault diagnostics but also status and advice along with justifications and explanations in the form of decision support.

  12. Insulin Expression in Rats Exposed to Cadmium

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Objectives To investigate the effects of cadmium exposure on insulin expression in rats. Methods Eighteen adult SD assessed. The levels of cadmium and zinc in pancreas, blood and urine glucose, serum insulin and urine NAG (N-acyetyl-β-glucosaminidase) were determined. The gene expressions of metallothionein (MT) and insulin were also measured,and the oral glucose tolerance tests (OGTT) were carried out. Results The contents of cadmium in pancreas in cadmium-treated rats were higher than that in the control group, which was associated with slight increase of zinc in pancreas.not change significantly after cadmium administration, and the UNAG had no change in Cd-treated group. The gene expression the change of the expression of insulin, MT-Ⅰ and MT-Ⅱ genes. Cadmium can influence the biosynthesis of insulin, but does not induce the release of insulin. The dysfunction of pancreas occurs earlier than that of kidney after administration of cadmium.

  13. 28 CFR 105.24 - Employee's rights.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Employee's rights. 105.24 Section 105.24 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) CRIMINAL HISTORY BACKGROUND CHECKS Private... 28 CFR 16.34....

  14. 34 CFR 300.105 - Assistive technology.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 2 2010-07-01 2010-07-01 false Assistive technology. 300.105 Section 300.105 Education... DISABILITIES State Eligibility Other Fape Requirements § 300.105 Assistive technology. (a) Each public agency must ensure that assistive technology devices or assistive technology services, or both, as those...

  15. 20 CFR 416.105 - Administration.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Administration. 416.105 Section 416.105 Employees' Benefits SOCIAL SECURITY ADMINISTRATION SUPPLEMENTAL SECURITY INCOME FOR THE AGED, BLIND, AND DISABLED Introduction, General Provisions and Definitions § 416.105 Administration. The...

  16. 21 CFR 137.105 - Flour.

    Science.gov (United States)

    2010-04-01

    ... Related Products § 137.105 Flour. (a) Flour, white flour, wheat flour, plain flour, is the food prepared... any natural deficiency of enzymes, malted wheat, malted wheat flour, malted barley flour, or any... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Flour. 137.105 Section 137.105 Food and Drugs...

  17. 24 CFR 51.105 - Exceptions.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Exceptions. 51.105 Section 51.105 Housing and Urban Development Office of the Secretary, Department of Housing and Urban Development ENVIRONMENTAL CRITERIA AND STANDARDS Noise Abatement and Control § 51.105 Exceptions. (a) Flexibility for...

  18. 40 CFR 211.105 - Label format.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Label format. 211.105 Section 211.105 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS PRODUCT NOISE LABELING General Provisions § 211.105 Label format. (a) Unless specified otherwise in other...

  19. 10 CFR 766.105 - Payment procedures.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Payment procedures. 766.105 Section 766.105 Energy DEPARTMENT OF ENERGY URANIUM ENRICHMENT DECONTAMINATION AND DECOMMISSIONING FUND; PROCEDURES FOR SPECIAL ASSESSMENT OF DOMESTIC UTILITIES Procedures for Special Assessment § 766.105 Payment procedures. DOE shall specify payment details and instructions...

  20. 46 CFR 105.45-10 - Smoking.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Smoking. 105.45-10 Section 105.45-10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CARGO AND MISCELLANEOUS VESSELS COMMERCIAL FISHING VESSELS DISPENSING PETROLEUM PRODUCTS Special Operating Requirements § 105.45-10 Smoking. (a) Smoking...

  1. 7 CFR 927.105 - Communications.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 8 2010-01-01 2010-01-01 false Communications. 927.105 Section 927.105 Agriculture... Rules and Regulations Communications § 927.105 Communications. Unless otherwise prescribed in this... reports, applications, submittals, requests, inspection certificates, and communications in...

  2. 49 CFR 236.105 - Electric lock.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Electric lock. 236.105 Section 236.105 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION...: All Systems Inspections and Tests; All Systems § 236.105 Electric lock. Electric lock, except...

  3. 47 CFR 78.105 - Antenna systems.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 4 2010-10-01 2010-10-01 false Antenna systems. 78.105 Section 78.105... SERVICE Technical Regulations § 78.105 Antenna systems. (a) For fixed stations operating in the 12.7-13.2... directional antennas that meet the performance standards indicated in the following table. (i) Stations...

  4. 49 CFR 1572.105 - Immigration status.

    Science.gov (United States)

    2010-10-01

    ... United States under 8 CFR 214.2(b)(4)(i)(E) to conduct business in the United States. (b) Upon expiration... 49 Transportation 9 2010-10-01 2010-10-01 false Immigration status. 1572.105 Section 1572.105... ASSESSMENTS Standards for Security Threat Assessments § 1572.105 Immigration status. (a) An...

  5. 41 CFR 105-74.640 - Employee.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Employee. 105-74.640 Section 105-74.640 Public Contracts and Property Management Federal Property Management Regulations System...-GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Definitions § 105-74.640 Employee....

  6. 48 CFR 53.105 - Computer generation.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Computer generation. 53.105 Section 53.105 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION (CONTINUED) CLAUSES AND FORMS FORMS General 53.105 Computer generation. (a) Agencies may computer-generate...

  7. Cadmium in jamaican bush teas.

    Science.gov (United States)

    Hoo Fung, L A; Rattray, V R; Lalor, G C

    2014-01-01

    Samples of Jamaican plants used as bush teas were collected from households in high soil-cadmium (Cd) areas of central Jamaica and analysed by graphite furnace atomic absorption spectrophotometry for total cadmium and for cadmium extractable with a hot water brew as prepared for human consumption to determine their contribution to dietary cadmium exposure. The concentrations ranged from < 0.03 to 6.85 µg/g for total Cd, between 1 and 15% of which was extracted with a hot water brew. One cup (200 ml) of the teas examined was found to contain < 0.04-1.18 µg of Cd and would contribute 0.1-0.3 µg of Cd to a person's dietary intake. This is significantly below the provisional tolerable weekly intake (PTWI) of 7 µg Cd/kg body weight established by the World Health Organization (WHO). While this suggests that bush tea consumption does not contribute significantly to the PTWI, some of the teas examined exceed the WHO recommendation of less than 0.3 mg/kg Cd for medicinal plants. PMID:25303189

  8. Cadmium detoxification processes in the digestive gland of cephalopods in relation to accumulated cadmium concentrations

    OpenAIRE

    Bustamante, Paco; Cosson, Richard; Gallien, Isabelle; Caurant, Florence; Miramand, Pierre

    2002-01-01

    International audience The high concentrations of cadmium recorded in the digestive gland of cephalopods from various temperate and subpolar waters suggest that these molluscs have developed efficient cadmium detoxification mechanisms. The subcellular distribution of cadmium in the digestive gland cells was investigated in seven cephalopod species from the Bay of Biscay (France) and the Faroe Islands. In most species, cadmium was mainly found in the cytosolic fraction of the digestive glan...

  9. Cadmium content of plants as affected by soil cadmium concentration

    Energy Technology Data Exchange (ETDEWEB)

    Lehoczky, E. [Pannon Univ. of Agricultural Sciences, Keszthely (Hungary); Szabados, I.; Marth, P. [Plant Health and Soil Conservation Station, Higany (Hungary)

    1996-12-31

    Pot experiments were conducted in greenhouse conditions to study the effects of increasing cadmium (Cd) levels on biomass production and Cd contents in corn, (Zea mays L.), garlic (Allium sativum L.), and spinach (Spinacia oleracea L.). Plants were grown in two soil types: Eutric cambisol soil and A gleyic luvisol soil. Spinach proved to be the most sensitive to Cd treatments as its biomass considerably decreased with the increasing Cd levels. Cadmium contents of the three crops increased with increasing levels of Cd applications. Statistical differences were observed in the Cd contents of crops depending on soil type. With the same Cd rates, Cd tissue concentration of test plants grown in the strongly acidic Gleyic luvisol soil were many times higher than that of plants grown in a neutral Eutric cambisol soil. 14 refs., 4 tabs.

  10. Cadmium-induced Cancers in Animals and in Humans

    OpenAIRE

    Huff, James; Lunn, Ruth M.; Waalkes, Michael P.; Tomatis, Lorenzo; Infante, Peter F.

    2007-01-01

    Discovered in the early 1800s, the use of cadmium and various cadmium salts started to become industrially important near the close of the 19th century, rapidly thereafter began to flourish, yet has diminished more recently. Most cadmium used in the United States is a byproduct from the smelting of zinc, lead, or copper ores, and is used to manufacture batteries. Carcinogenic activity of cadmium was discovered first in animals and only subsequently in humans. Cadmium and cadmium compounds hav...

  11. Cadmium Exposure and Pancreatic Cancer in South Louisiana

    OpenAIRE

    Luckett, Brian G.; L. Joseph Su; Rood, Jennifer C.; Elizabeth T. H. Fontham

    2012-01-01

    Cadmium has been hypothesized to be a pancreatic carcinogen. We test the hypothesis that cadmium exposure is a risk factor for pancreatic cancer with a population-based case-control study sampled from a population with persistently high rates of pancreatic cancer (south Louisiana). We tested potential dietary and nondietary sources of cadmium for their association with urinary cadmium concentrations which reflect long-term exposure to cadmium due to the accumulation of cadmium in the kidney c...

  12. Aluminium-based Coatings for Cadmium Replacement

    OpenAIRE

    Cardilli , Emanuele

    2008-01-01

    Cadmium electroplating is widely used in the aerospace industry for the corrosion protection of high strength steels. Cadmium is also used as compatible coating to reduce the galvanic corrosion generated in the assembly of components manufactured with different materials. However, environmental and safety concerns over the high toxicity of cadmium has led to the investigation of suitable replacements. Aluminium coatings are promising coatings for the replacement of electropl...

  13. Zone refining of cadmium and related characterization

    Indian Academy of Sciences (India)

    N R Munirathnam; D S Prasad; Ch Sudheer; J V Rao; T L Prakash

    2005-06-01

    We present the zone refining results of cadmium using horizontal resistive zone refiner under constant flow of moisture free hydrogen gas. The boron impurity in cadmium can be avoided using quartz (GE 214 grade) boat in lieu of high pure graphite boat. The analytical results using inductively coupled plasma optical emission spectrometry (ICPOES) show that majority of the impurities are less than the detection limits. Comparatively, zinc is the most difficult impurity element to remove in cadmium matrix by zone refining.

  14. Spectrophotometric determination of trace amounts of cadmium and lead with iodide and rhodamine B

    International Nuclear Information System (INIS)

    Highly sensitive spectrophotometric methods have been developed for determination of cadmium and lead, based on the CdI42- or PbI42- anionic complexes with Rhodamine B in the presence of polyvinyl alcohol to form ion-association complexes. The molar absorptivity is 4.2x105 l x mole-1 x cm-1 at 600 nm for cadmium and 5.7x105 l x mole-1 x cm-1 at 610 nm for lead. The complexes have the composition [CdI 42-] x [RhB+]2 and [PbI42-] x [RhB+]2 as established by Job's method of continuous variations and the molar-ratio method. The colour reaction selectivity is fairly good and the method can be applied for direct spectrophotometric determination of cadmium or lead in some pure metals. A species [PbI3-] x [RhB+] can also be formed, and extracted into toluene or a toluene/diethyl ether micture. (Authors)

  15. Bioavailability of cadmium from linseed and cocoa

    OpenAIRE

    Hansen, Max; Rasmussen, Rie Romme; Sloth, Jens Jørgen

    2014-01-01

    The exposure of the European population to cadmium from food is high compared with the tolerable weekly intake of 2.5 μg/kg bodyweight set by EFSA in 2009. Only few studies on the bioavailability of cadmium from different food sources has been performed but this information in very important for the food authorities in order to give correct advises to the population. The aim of this study was to investigate the bioavailability of cadmium from whole linseed, crushed linseed, cocoa and cadmium ...

  16. Lead and cadmium in food

    International Nuclear Information System (INIS)

    The amounts of lead and cadmium produced and processed in these days are considerable. As a result, our environment is increasingly polluted by heavy metals and industrial installations, motor vehicles or incinerating plants appear to be among the main culprits here. Air and water are the media permitting the entry of heavy metals into our natural environment where they accumulate in the soil and then gradually migrate into the plants. Their further transport in the food constitutes the third step in the environmental spread of heavy metals. The consumption of muscle and organ meats, of vegetables, fruits, canned food and drinking water is unavoidably associated with some ingestion of lead and cadmium. The degree to which they are taken up and stored in different tissues is determined by absorption properties and the nutritional state of the organism. Cadmium tends to accumulate in the kidneys, lead is mainly stored in the bones. A continuously increasing uptake finally results in health injuries that range from unspecific complaints to damaged kidneys or bones and disorders of liver function. Children and elderly people are at a particular risk here. The level of food contamination is such that screening for heavy metals must be rigorously carried out once appropriate legal thresholds have been set, which ought to be based on proven detrimental effects of lead and cadmium on our health and also take account of infants and children or any other risk groups, where particular caution must be exercised. It should be pointed out that such thresholds have so far not been determined. (orig./MG)

  17. Historical perspectives on cadmium toxicology

    International Nuclear Information System (INIS)

    The first health effects of cadmium (Cd) were reported already in 1858. Respiratory and gastrointestinal symptoms occurred among persons using Cd-containing polishing agent. The first experimental toxicological studies are from 1919. Bone effects and proteinuria in humans were reported in the 1940's. After World War II, a bone disease with fractures and severe pain, the itai-itai disease, a form of Cd-induced renal osteomalacia, was identified in Japan. Subsequently, the toxicokinetics and toxicodynamics of Cd were described including its binding to the protein metallothionein. International warnings of health risks from Cd-pollution were issued in the 1970's. Reproductive and carcinogenic effects were studied at an early stage, but a quantitative assessment of these effects in humans is still subject to considerable uncertainty. The World Health Organization in its International Program on Chemical Safety, WHO/IPCS (1992) (Cadmium. Environmental Health Criteria Document 134, IPCS. WHO, Geneva, 1-280.) identified renal dysfunction as the critical effect and a crude quantitative evaluation was presented. In the 1990's and 2000 several epidemiological studies have reported adverse health effects, sometimes at low environmental exposures to Cd, in population groups in Japan, China, Europe and USA (reviewed in other contributions to the present volume). The early identification of an important role of metallothionein in cadmium toxicology formed the basis for recent studies using biomarkers of susceptibility to development of Cd-related renal dysfunction such as gene expression of metallothionein in peripheral lymphocytes and autoantibodies against metallothionein in blood plasma. Findings in these studies indicate that very low exposure levels to cadmium may give rise to renal dysfunction among sensitive subgroups of human populations such as persons with diabetes.

  18. Cadmium accumulation by Axonopus compressus (Sw.) P. Beauv and Cyperus rotundas Linn growing in cadmium solution and cadmium-zinc contaminated soil

    OpenAIRE

    Paitip Thiravetyan; Vibol Sao; Woranan Nakbanpote

    2007-01-01

    This research investigated the phyto-remediation potentials of Cyperus rotundas Linn (Nutgrass) and Axonopus compressus (Sw.) P. Beauv (Carpetgrass) for cadmium removal from cadmium solution andcadmium-zinc contaminated soil. Plants growth in the solution showed that cadmium decreased the relative growth rate of both grasses. However, the amount of cadmium accumulated in shoot and root was increasedwith the increase in cadmium concentration and exposure time. Growth in fertile soil mixed with...

  19. Improvement of cadmium phytoremediation after soil inoculation with a cadmium-resistant Micrococcus sp.

    Science.gov (United States)

    Sangthong, Chirawee; Setkit, Kunchaya; Prapagdee, Benjaphorn

    2016-01-01

    Cadmium-resistant Micrococcus sp. TISTR2221, a plant growth-promoting bacterium, has stimulatory effects on the root lengths of Zea mays L. seedlings under toxic cadmium conditions compared to uninoculated seedlings. The performance of Micrococcus sp. TISTR2221 on promoting growth and cadmium accumulation in Z. mays L. was investigated in a pot experiment. The results indicated that Micrococcus sp. TISTR2221significantly promoted the root length, shoot length, and dry biomass of Z. mays L. transplanted in both uncontaminated and cadmium-contaminated soils. Micrococcus sp. TISTR2221 significantly increased cadmium accumulation in the roots and shoots of Z. mays L. compared to uninoculated plants. At the beginning of the planting period, cadmium accumulated mainly in the shoots. With a prolonged duration of cultivation, cadmium content increased in the roots. As expected, little cadmium was found in maize grains. Soil cadmium was significantly reduced with time, and the highest percentage of cadmium removal was found in the bacterial-inoculated Z. mays L. after transplantation for 6 weeks. We conclude that Micrococcus sp. TISTR2221 is a potent bioaugmenting agent, facilitating cadmium phytoextraction in Z. mays L. PMID:26336850

  20. High spin states in the cadmium isotopes excited by (α,xnγ) reactions

    International Nuclear Information System (INIS)

    The cadmium isotopes 109-106-105 and 104 have been studied by means of Pd(α,xnγ) reactions. Their levels schemes have been established thanks to the following on line spectroscopic measurements: excitation functions, direct gamma spectra, gamma-gamma coincidences, angular distributions and half-life determination. The level schemes of the odd-cadmium isotopes are explained in the frame of the 'rotor plus quasi-particle model' using the independant particle wave functions obtained from self-consistent calculations (constrained Hartree-Fock with Skyrme interaction). This formalism does not involve free parameters. The calculated levels are in good agreements with the experimental ones, particularly for the decoupled bands built on the 11/2- unique parity orbitals and the favoured positive parity bands

  1. Oral cadmium chloride intoxication in mice

    DEFF Research Database (Denmark)

    Andersen, O; Nielsen, J B; Svendsen, P

    1988-01-01

    Diethyldithiocarbamate (DDC) is known to alleviate acute toxicity due to injection of cadmium salts. However, when cadmium chloride was administered by the oral route, DDC enhanced rather than alleviated the acute toxicity; both oral and intraperitoneal (i.p.) administration of DDC had this effec...

  2. Cadmium Modulates Biofilm Formation by Staphylococcus epidermidis

    NARCIS (Netherlands)

    Wu, Xueqing; Santos, Regiane R.; Fink-Gremmels, Johanna

    2015-01-01

    The aim of the study was to evaluate the effect of cadmium exposure on Staphylococcus epidermidis (ATCC 35984) biofilm formation. Bacteria were cultured in the absence or presence of different concentrations (0-50 mu M) of cadmium. Biofilm formation and bacterial viability were assessed. Quantitativ

  3. Cadmium Toxicity to Ringed Seals (Phoca hispida)

    DEFF Research Database (Denmark)

    Sonne, Christian; Dietz, R.; Riget, F. F.;

    Cadmium concentrations in kidneys from ringed seals (Phoca hispida) from North West Greenland (Qaanaaq) are high. Concentrations range at level known to induce renal toxic effects (mainly tubulopathy) and demineralisation (osteopenia) of the skeletal system (Fanconi's Syndrome) in humans as well...... the absence of toxic effects of cadmium in ringed seal...

  4. Electrodialytic Removal of Cadmium from Straw Ash

    DEFF Research Database (Denmark)

    Hansen, Henrik; Ottosen, Lisbeth M.; Villumsen, Arne;

    1999-01-01

    A problem with flyash from straw and wood combustion is the high level of heavy metals, especially cadmium. Two electrodialytic remediation experiments were carried out on cadmium polluted flyash from straw combustion. The flyash could be cleaned to 1/3 of its initial level after 24 days of...

  5. Waste management plan for the 105-D and 105-H standing legacy waste remediation project

    International Nuclear Information System (INIS)

    This plan identifies guiding documents for waste management activities and requirements for the removal, staging, characterization, and disposal of standing legacy waste contained in the 105-D and 105-H reactors as authorized by the Remaining Sites Record of Decision

  6. Co-existing structures in 105Ru

    CERN Document Server

    Lalkovski, S; Stefanova, E A; Korichi, A; Petkov, P; Kownacki, J; Kutsarova, T; Minkova, A; Bazzacco, D; Bergstrom, M; Gorgen, A; Herskind, B; Hubel, H; Jansen, A; Kisyov, S; Khoo, T L; Kondev, F G; Lopez-Martens, A; Podolyak, Zs; Schonwasser, G; Yordanov, O

    2014-01-01

    New positive-parity states, having a band-like structure, were observed in 105Ru. The nucleus was produced in induced fission reaction and the prompt gamma-rays, emitted from the fragments, were detected by the EUROBALL III multi-detector array. The partial scheme of excited 105Ru levels is analyzed within the Triaxial-Rotor-plus-Particle approach.

  7. 31 CFR 21.105 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Definitions. 21.105 Section 21.105 Money and Finance: Treasury Office of the Secretary of the Treasury NEW RESTRICTIONS ON LOBBYING General... immediately preceding the date of the submission that initiates agency consideration of such person...

  8. 31 CFR 28.105 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Definitions. 28.105 Section 28.105 Money and Finance: Treasury Office of the Secretary of the Treasury NONDISCRIMINATION ON THE BASIS OF... at nominal consideration, or at consideration reduced for the purpose of assisting the recipient...

  9. 33 CFR 105.120 - Compliance documentation.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Compliance documentation. 105.120... SECURITY MARITIME SECURITY: FACILITIES General § 105.120 Compliance documentation. Each facility owner or... documentation are available at the facility and are made available to the Coast Guard upon request: (a)...

  10. 33 CFR 143.105 - Personnel landings.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Personnel landings. 143.105...) OUTER CONTINENTAL SHELF ACTIVITIES DESIGN AND EQUIPMENT OCS Facilities § 143.105 Personnel landings. (a) Sufficient personnel landings shall be provided on each manned OCS facility to assure safe access and...

  11. 5 CFR 792.105 - Agency responsibilities.

    Science.gov (United States)

    2010-01-01

    ...-term counseling and/or referrals for long-term counseling or treatment. (b) Agencies shall issue... 5 Administrative Personnel 2 2010-01-01 2010-01-01 false Agency responsibilities. 792.105 Section 792.105 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT (CONTINUED) CIVIL SERVICE...

  12. 18 CFR 286.105 - Shortened procedure.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Shortened procedure. 286.105 Section 286.105 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION... facts and applicable law that support the position or positions taken regarding the matters at...

  13. 40 CFR 105.2 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Definitions. 105.2 Section 105.2 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS RECOGNITION AWARDS UNDER... application on behalf of an industrial organization or political subdivision of States. Application means...

  14. 40 CFR 5.105 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Definitions. 5.105 Section 5.105 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GENERAL NONDISCRIMINATION ON THE BASIS OF SEX IN... offers full-time study. Recipient means any State or political subdivision thereof, or...

  15. 40 CFR 105.1 - Background.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Background. 105.1 Section 105.1 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS RECOGNITION AWARDS UNDER... provide official recognition to industrial organizations and political subdivisions of States which...

  16. 28 CFR 105.27 - Miscellaneous provisions.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Miscellaneous provisions. 105.27 Section 105.27 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) CRIMINAL HISTORY BACKGROUND CHECKS... national fingerprint-based criminal history checks of prospective and current private security officers...

  17. 19 CFR 357.105 - Questionnaires.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 3 2010-04-01 2010-04-01 false Questionnaires. 357.105 Section 357.105 Customs... Questionnaires. For reviews conducted under section 106(b)(2), the Secretary normally will send questionnaires to potential producers/suppliers of the product to determine whether it is in short supply....

  18. 50 CFR 648.105 - Possession restrictions.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 8 2010-10-01 2010-10-01 false Possession restrictions. 648.105 Section 648.105 Wildlife and Fisheries FISHERY CONSERVATION AND MANAGEMENT, NATIONAL OCEANIC AND ATMOSPHERIC... November 1 through April 30, unless the vessel possesses a valid summer flounder small-mesh exemption...

  19. 41 CFR 105-71.132 - Equipment.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Equipment. 105-71.132...-Award Requirements/Changes, Property, and Subawards § 105-71.132 Equipment. (a) Title. Subject to the obligations and conditions set forth in this section, title to equipment acquired under a grant or...

  20. 41 CFR 105-72.404 - Equipment.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Equipment. 105-72.404... NON-PROFIT ORGANIZATIONS 72.40-Post-Award Requirements/Property Standards § 105-72.404 Equipment. (a) Title to equipment acquired by a recipient with Federal funds shall vest in the recipient, subject...

  1. 41 CFR 105-8.160 - Communications.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Communications. 105-8.160 Section 105-8.160 Public Contracts and Property Management Federal Property Management Regulations... vision or hearing, can obtain information as to the existence and location of accessible...

  2. 5 CFR 9701.105 - Continuing collaboration.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 3 2010-01-01 2010-01-01 false Continuing collaboration. 9701.105... HUMAN RESOURCES MANAGEMENT SYSTEM General Provisions § 9701.105 Continuing collaboration. (a) In... determine the number of employee representatives to be engaged in the continuing collaboration process....

  3. 33 CFR 105.235 - Communications.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Communications. 105.235 Section... MARITIME SECURITY: FACILITIES Facility Security Requirements § 105.235 Communications. (a) The Facility... conditions at the facility. (b) Communication systems and procedures must allow effective and...

  4. 41 CFR 105-55.002 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Definitions. 105-55.002 Section 105-55.002 Public Contracts and Property Management Federal Property Management Regulations System... corporations. (k) Hearing means a review of the documentary evidence concerning the existence and/or amount...

  5. 41 CFR 105-57.005 - Hearing.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Hearing. 105-57.005 Section 105-57.005 Public Contracts and Property Management Federal Property Management Regulations System... that the issues in dispute cannot be resolved by review of the documentary evidence, for example,...

  6. 41 CFR 105-70.021 - Discovery.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Discovery. 105-70.021 Section 105-70.021 Public Contracts and Property Management Federal Property Management Regulations System..., papers, and other data and documentary evidence. Nothing contained herein shall be interpreted to...

  7. 13 CFR 146.105 - Definitions.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Definitions. 146.105 Section 146.105 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION NEW RESTRICTIONS ON LOBBYING General... intent to influence, any communication to or appearance before an officer or employee or any agency,...

  8. 21 CFR 160.105 - Dried eggs.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Dried eggs. 160.105 Section 160.105 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN... eggs. (a) Dried eggs, dried whole eggs are prepared by drying liquid eggs that conform to §...

  9. 18 CFR 376.105 - Chairman.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Chairman. 376.105 Section 376.105 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT... Law Judges in accordance with the provisions of Title 5, United States Code. (2) The...

  10. 41 CFR 105-70.034 - Evidence.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Evidence. 105-70.034...-IMPLEMENTATION OF THE PROGRAM FRAUD CIVIL REMEDIES ACT OF 1986 § 105-70.034 Evidence. (a) The ALJ shall determine the admissibility of evidence. (b) Except as provided in this part, the ALJ shall not be bound by...

  11. 17 CFR 300.105 - Joint accounts.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Joint accounts. 300.105... A to Part 285 RULES OF THE SECURITIES INVESTOR PROTECTION CORPORATION Accounts of âseparateâ Customers of Sipc Members § 300.105 Joint accounts. (a) A joint account shall be deemed to be a...

  12. Molecular and cellular mechanisms of cadmium carcinogenesis

    International Nuclear Information System (INIS)

    Cadmium is a heavy metal, which is widely used in industry, affecting human health through occupational and environmental exposure. In mammals, it exerts multiple toxic effects and has been classified as a human carcinogen by the International Agency for Research on Cancer. Cadmium affects cell proliferation, differentiation, apoptosis and other cellular activities. Cd2+ does not catalyze Fenton-type reactions because it does not accept or donate electrons under physiological conditions, and it is only weakly genotoxic. Hence, indirect mechanisms are implicated in the carcinogenicity of cadmium. In this review multiple mechanisms are discussed, such as modulation of gene expression and signal transduction, interference with enzymes of the cellular antioxidant system and generation of reactive oxygen species (ROS), inhibition of DNA repair and DNA methylation, role in apoptosis and disruption of E-cadherin-mediated cell-cell adhesion. Cadmium affects both gene transcription and translation. The major mechanisms of gene induction by cadmium known so far are modulation of cellular signal transduction pathways by enhancement of protein phosphorylation and activation of transcription and translation factors. Cadmium interferes with antioxidant defense mechanisms and stimulates the production of reactive oxygen species, which may act as signaling molecules in the induction of gene expression and apoptosis. The inhibition of DNA repair processes by cadmium represents a mechanism by which cadmium enhances the genotoxicity of other agents and may contribute to the tumor initiation by this metal. The disruption of E-cadherin-mediated cell-cell adhesion by cadmium probably further stimulates the development of tumors. It becomes clear that there exist multiple mechanisms which contribute to the carcinogenicity of cadmium, although the relative weights of these contributions are difficult to estimate

  13. Cadmium blood concentrations in relation to nutrition.

    Science.gov (United States)

    Krajcovicová-Kudládková, Marica; Ursínyová, Monika; Masánová, Vlasta; Béderová, Alzbeta; Valachovicová, Martina

    2006-09-01

    Cadmium is a toxic element ubiquitous in the environment, which damages biological systems in various ways. The major source of cadmium exposure is food. High cadmium content in the soil leads to high cadmium concentrations in certain plants such as grains (above all surface layers and germs), oil or non-oil seeds, fruit and vegetables. These food commodities are the crucial components of a vegetarian nutrition. Blood cadmium concentrations were measured in two non-smoking population groups: the vegetarian group (n = 80) and the non-vegetarian (control) group of general population on traditional mixed diet (n = 84). The significantly higher blood cadmium content (1.78 +/- 0.22 vs. 0.45 +/- 0.04 microg/l) was measured in vegetarian group. Healthy risk values > 5 microg/l were found in 6 vegetarians vs. no non-vegetarian. The highest cadmium concentration (3.15 +/- 0.77 microg/l) was measured in vegan subgroup (plant food only, n = 10) and that value decreased with increasing animal food consumption (1.75 +/- 0.36 microg/l, lactovegetarian and lactoovovegetarian subgroup/added dairy products and eggs, n = 41/, 1.34 +/- 0.21 microg/I, semivegetarian subgroup /as a previous subgroup and added white meat, n = 291). Risk vegetarians vs. non-risk vegetarians consume significantly higher amounts of whole grain products, grain sprouts and oil seeds. Blood cadmium content is directly influenced by age (r = 0.32, p vegetarianism (r = 0.5, p Vegetarians have significantly higher plasma concentrations of natural antioxidants. The sufficient antioxidative protection against cadmium induced free radical formation in vegetarians may inhibit the harmful effects of greater cadmium intake from plant food. PMID:17152224

  14. 105-KE basin pilot run relocation

    International Nuclear Information System (INIS)

    The purpose of this document is to present the bases for selecting the exact in-facility location for installation of process equipment to support pilot testing activities in the 105-KE Basin at the United States Department of Energy Hanford Site, in southeastern Washington State. The 105-KE Basin was constructed during the early 1950s, as an integralcomponent of the 105-K East reactor building. Similar basins were provided in all Hanford weapons production reactor buildings to receive fuel elements discharged from the reactors and stage them for rail transport to 200 Area fuel reprocessing plants. The 105-KE reactor began operation in 1955. It was shut down in 1971. However, the 105-KE Basin was reactivated several years later to store spent fuel from the N-Reactor basin and permit its continued operation during outages at the Plutonium Uranium Extraction (PUREX) plant in the 200E Area

  15. Peculiarities of preparation of cadmium isotopes of high enrichment

    International Nuclear Information System (INIS)

    Cascade equipped by gas centrifuges with regard for requirements to structural materials operating with chemically active compounds (dimethylcadmium) was devised for preparation of high-enriched cadmium isotopes. Solutions of such problems as overcoming of isotope memory, compensation of the effect of isotope overlapping, operative analytical accompanying permitted to optimize separation process and to obtain cadmium isotopes of high enrichment degree: cadmium-116 ∼98.9 %, cadmium-114 ∼98.7 %, cadmium-113 ∼93.3 %, cadmium-112 ∼99.1 %, cadmium-110 ∼95.8 %

  16. Response of Saccharomyces cerevisiae to cadmium stress

    Energy Technology Data Exchange (ETDEWEB)

    Moreira, Luciana Mara Costa; Ribeiro, Frederico Haddad; Neves, Maria Jose [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil). Lab. de Radiobiologia], e-mail: luamatu@uol.com.br; Porto, Barbara Abranches Araujo; Amaral, Angela M.; Menezes, Maria Angela B.C. [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Lab. de Ativacao Neutronica], e-mail: menezes@cdtn.br; Rosa, Carlos Augusto [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Dept. de Microbiologia], e-mail: carlrosa@icb.ufmg

    2009-07-01

    The intensification of industrial activity has been greatly contributing with the increase of heavy metals in the environment. Among these heavy metals, cadmium becomes a serious pervasive environmental pollutant. The cadmium is a heavy metal with no biological function, very toxic and carcinogenic at low concentrations. The toxicity of cadmium and several other metals can be mainly attributed to the multiplicity of coordination complexes and clusters that they can form. Some aspects of the cellular response to cadmium were extensively investigated in the yeast Saccharomyces cerevisiae. The primary site of interaction between many toxic metals and microbial cells is the plasma membrane. Plasma-membrane permeabilisation has been reported in a variety of microorganisms following cadmium exposure, and is considered one mechanism of cadmium toxicity in the yeast. In this work, using the yeast strain S. cerevisiae W303-WT, we have investigated the relationships between Cd uptake and release of cellular metal ions (K{sup +} and Na{sup +}) using neutron activation technique. The neutron activation was an easy, rapid and suitable technique for doing these metal determinations on yeast cells; was observed the change in morphology of the strains during the process of Cd accumulation, these alterations were observed by Transmission Electron Microscopy (TEM) and Scanning Electron Microscopy (SEM) during incorporation of cadmium. (author)

  17. Cadmium - a complex environmental problem. Part II. Cadmium in sludges used as fertilizer

    Energy Technology Data Exchange (ETDEWEB)

    Davis, R.D.

    1984-02-15

    Utilisation of sewage sludge as a fertilizer is the most economic disposal route for inland sewage-treatment works. Much of the cadmium in wastewater is concentrated into sludge. It is impracticable to reduce cadmium concentrations in sludge below certain levels. Cadmium is a principal factor limiting the use of sludge on land. Investigations are described which have attempted to identify and to determine the availability of forms of cadmium in soil. There is considerable research interest in cadmium in soil solution which is likely to be directly available for crop uptake. Another area of interest is the apparent disappearance of cadmium from sludge-treated soil. Soil analysis often cannot fully account for the cadmium added in sludge. Apart from the effect of soil conditions, especially pH value, crop uptake varies according to the particular crop examined. Highest concentrations of cadmium occur in tobacco, lettuce, spinach and other leafy vegetables. Using crop uptake data from field trials it is possible to relate potential human dietary intake of cadmium, on which hazard depends, to soil concentrations of cadmium, which can be controlled by regulating applications of sludge. This provides an objective basis for limits for cadmium concentrations in soils receiving sludge. Transfer of cadmium via farm animals to meat and dairy products for human consumption is thought to be minimal, even allowing for some direct ingestion of sludge-treated soil by the animals. Evidence from these and other investigations suggests that a loading rate limit of 5 kg Cd/ha (equivalent to a soil concentration of about 3.5 mg Cd/kg) affords adequate protection to the foodchain where sludge is used on agricultural land.

  18. Tank characterization report for double-shell tank 241-AP-105

    International Nuclear Information System (INIS)

    Double-Shell Tank 241-AP-105 is a radioactive waste tank most recently sampled in March of 1993. Sampling and characterization of the waste in Tank 241-AP-105 contributes toward the fulfillment of Milestone M-44-05 of the Hanford Federal Facility Agreement and Consent Order (Ecology, EPA, and DOE, 1993). Characterization is also needed tot evaluate the waste's fitness for safe processing through an evaporator as part of an overall waste volume reduction program. Tank 241-AP-105, located in the 200 East Area AP Tank Farm, was constructed and went into service in 1986 as a dilute waste receiver tank; Tank 241AP-1 05 was considered as a candidate tank for the Grout Treatment Facility. With the cancellation of the Grout Program, the final disposal of the waste in will be as high- and low-level glass fractions. The tank has an operational capacity of 1,140,000 gallons, and currently contains 821,000 gallons of double-shell slurry feed. The waste is heterogeneous, although distinct layers do not exist. Waste has been removed periodically for processing and concentration through the 242-A Evaporator. The tank is not classified as a Watch List tank and is considered to be sound. There are no Unreviewed Safety Questions associated with Tank 241-AP-105 at this time. The waste in Tank 241-AP-105 exists as an aqueous solution of metallic salts and radionuclides, with limited amounts of organic complexants. The most prevalent soluble analytes include aluminum, potassium, sodium, hydroxide, carbonate, nitrate, and nitrite. The calculated pH is greater than the Resource Conservation and Recovery Act established limit of 12.5 for corrosivity. In addition, cadmium, chromium, and lead concentrations were found at levels greater than their regulatory thresholds. The major radionuclide constituent is 137Cs, while the few organic complexants present include glycolate and oxalate. Approximately 60% of the waste by weight is water

  19. Effect of iron upon cadmium-manganese and cadmium-iron interaction

    International Nuclear Information System (INIS)

    Increase cadmium production has enhanced the potential danger of this toxic metal including its effect upon the metabolism of some essential elements as, for instance, manganese of some essential elements as, for instance, manganese and iron. Relevant data about the cadmium-manganese interaction are rather scanty. Since there are more data of the effect of iron on the metabolism of either of these ions independently. The authors decided to investigate how the presence of iron affected the interaction between cadmium and manganese and how cadmium alone or in combination with the additional iron affected iron transfer and retention in the intestinal wall

  20. 7 CFR 1160.105 - Board.

    Science.gov (United States)

    2010-01-01

    ... and Orders; Milk), DEPARTMENT OF AGRICULTURE FLUID MILK PROMOTION PROGRAM Fluid Milk Promotion Order Definitions § 1160.105 Board. Board means the National Processor Advertising and Promotion Board established... Promotion Board or Board)....

  1. 105-C Building characterization survey data report

    International Nuclear Information System (INIS)

    This report is a compilation of the 105-C Facility Characterization Survey data collected during the period of July 1, 1994, through September 30, 1994. The scope of the report is limited to the characterization of the 105-C Facility and surrounding site. Conclusions and recommendations regarding courses of future action are beyond the scope of this report. The survey data in this report reflects the current conditions and status of the 105-C Building, and is intended to be used in support of future decontamination and decommissioning activities. The survey was organized and implemented to evaluate the four parameters relating to the current condition of the facility. These parameters concern the physical conditions of the 105-C Building from a personnel safety standpoint; the radiological status throughout the building; identification of the hazardous materials located in the building; and identification of subsurface obstacles left in the path of proposed excavations

  2. Market for nickel-cadmium batteries

    Science.gov (United States)

    Putois, F.

    Besides the lead/acid battery market, which has seen a tremendous development linked with the car industry, the alkaline rechargeable battery market has also been expanded for more than twenty years, especially in the field of portable applications with nickel-cadmium batteries. Today, nickel-cadmium batteries have to face newcomers on the market, such as nickel-metal hydride, which is another alkaline couple, and rechargeable lithium batteries; these new battery systems have better performances in some areas. This work illustrates the status of the market for nickel-cadmium batteries and their applications. Also, for two major applications—the cordless tool and the electric vehicles—the competitive situation of nickel-cadmium batteries; facing new systems such as nickel-metal hydride and lithium ion cells are discussed.

  3. External costs of cadmium emissions to soil

    DEFF Research Database (Denmark)

    Pizzol, Massimo; Smart, James C. R.; Thomsen, Marianne

    2014-01-01

    concentration to be calculated for each scenario. Human exposure was determined based on soil-crop bioconcentration factors for cadmium and dietary intake rates of Danish food crops. Updated dose-response functions linking lifetime cadmium intake to the probability of developing cadmium-induced renal disease...... and osteoporosis were applied. These impacts were converted into monetary values by using the EU standard value of a life-year adjusted for quality of life experience. Annualized cost per unit of phosphorus and cadmium are presented, discounted and undiscounted, for comparison. Application of struvite (magnesium...... ammonium phosphate) and mineral fertilizer produced the lowest external health costs, followed by the fertilizer products wastewater sludge and pig manure. The external cost estimates produced in this study could be used to design economic policy instruments to encourage use of cleaner fertilizer products....

  4. Soybean phytoremediation of cadmium polluted agricultural soils

    OpenAIRE

    Mihajlov, Ljupco; Zajkova-Paneva, Vesna; Balabanova, Biljana

    2015-01-01

    Soil pollution with cadmium is a result of the strengthened industrial development, especially in the areas of drilling, exploitation and processing of mineral raw materials. On the territory of the Republic of Macedonia there are several areas with significant higher content of cadmium in the soil, including the vicinity of the mine lead and zinc “Zletovo” near the town of Probištip. Phytoremediation is one of the most convenient techniques for remediation of heavy metals from conta...

  5. Cadmium poisoning. Knowledge of the risk

    International Nuclear Information System (INIS)

    This data sheet provides an up-to-date summary of information on cadmium poisoning. The following points are examined: - the problem of increasing pollution of soil, water and the food chain; - physical and chemical properties, manufacture, industrial applications; - the toxic action of cadmium and its derivatives; - methods and apparatus for taking and analysis samples from the atmosphere and from body fluids; - existing French regulations; - technical control and medical surveillance

  6. Cathodoluminescence of cadmium diphosphide crystals

    International Nuclear Information System (INIS)

    An investigation is made of the cathodoluminescence spectra of CdP2 crystals in the temperature range 6 to 300 K. A pulsing beam of high energy electrons (40 kV) is used in the experiment. The samples investigated are undoped, heat annealed in vacuum or saturated vapours of cadmium, and also doped with As and Bi, elements isoelectronic to phosphorus. The experimental results show that the fine structure present in the higher energywing (2.02 to 2.14 eV) depends on the concentration of the uncontrolled nitrogen impurity in CdP2. Atoms of nitrogen give rise to exciton-impurity complexes, leading to intense narrow peaks in the spectrum of cathodoluminescence. Their location and nature are shown in a table. (author)

  7. Cadmium zinc telluride spectral modeling

    International Nuclear Information System (INIS)

    Cadmium zinc telluride (CZT) detectors are the highest resolution room temperature gamma-ray detectors available for isotopic analysis. As with germanium detectors, accurate isotopic analysis using spectra requires peak deconvolution. The CZT peak shapes are asymmetric, with a long low energy tail. The asymmetry is a result of the physics of the electron/hole transport in the semiconductor. An accurate model of the physics of the electron/hole transport through an electric field will allow the parameterization of the peak shapes as a function of energy. In turn this leads to the ability to perform accurate spectral deconvolution and therefore accurate isotopic analysis. The model and the peak-shape parameterization as a function of energy will be presented

  8. Cadmium leaching from thermal treated and gamma irradiated Mexican aluminosilicates

    International Nuclear Information System (INIS)

    Thermal and radiation effects on the leaching of cadmium from two cadmium exchanged zeolitic tuffs and one clay were determined. The cadmium exchanged aluminosilicates were heated at different temperatures (500, 700, 900 and 1100 oC), and the materials were then treated with NaCl (1 M and 5 M) and HNO3 (0.001 M and 1 M) solutions to determine the leaching behaviour of cadmium from the materials. The stability of cadmium in the materials increased as the heating temperature was increased. Cadmium leaching from gamma irradiated and heated materials at 1100 oC was higher than leaching from non-irradiated samples

  9. Cadmium affects retinogenesis during zebrafish embryonic development

    International Nuclear Information System (INIS)

    Ocular malformations are commonly observed in embryos of aquatic species after exposure to toxicants. Using zebrafish embryos as the model organism, we showed that cadmium exposure from sphere stage (4 hpf) to end of segmentation stage (24 hpf) induced microphthalmia in cadmium-treated embryos. Embryos with eye defects were then assessed for visual abilities. Cadmium-exposed embryos were behaviorally blind, showing hyperpigmentation and loss of camouflage response to light. We investigated the cellular basis of the formation of the small eyes phenotype and the induction of blindness by studying retina development and retinotectal projections. Retinal progenitors were found in cadmium-treated embryos albeit in smaller numbers. The number of retinal ganglion cells (RGC), the first class of retinal cells to differentiate during retinogenesis, was reduced, while photoreceptor cells, the last batch of retinal neurons to differentiate, were absent. Cadmium also affected the propagation of neurons in neurogenic waves. The neurons remained in the ventronasal area and failed to spread across the retina. Drastically reduced RGC axons and disrupted optic stalk showed that the optic nerves did not extend from the retina beyond the chiasm into the tectum. Our data suggested that impairment in neuronal differentiation of the retina, disruption in RGC axon formation and absence of cone photoreceptors were the causes of microphthalmia and visual impairment in cadmium-treated embryos

  10. Positron emission tomography imaging of CD105 expression with {sup 89}Zr-Df-TRC105

    Energy Technology Data Exchange (ETDEWEB)

    Hong, Hao; Yang, Yunan [University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); Severin, Gregory W.; Engle, Jonathan W.; Zhang, Yin; Barnhart, Todd E.; Nickles, Robert J. [University of Wisconsin - Madison, Department of Medical Physics, Madison, WI (United States); Liu, Glenn [University of Wisconsin - Madison, Department of Medicine, Madison, WI (United States); University of Wisconsin Carbone Cancer Center, Madison, WI (United States); Leigh, Bryan R. [TRACON Pharmaceuticals, Inc, San Diego, CA (United States); Cai, Weibo [University of Wisconsin - Madison, Department of Radiology, Madison, WI (United States); University of Wisconsin - Madison, Department of Medical Physics, Madison, WI (United States); University of Wisconsin Carbone Cancer Center, Madison, WI (United States)

    2012-01-15

    High tumor microvessel density correlates with a poor prognosis in multiple solid tumor types. The clinical gold standard for assessing microvessel density is CD105 immunohistochemistry on paraffin-embedded tumor specimens. The goal of this study was to develop an {sup 89}Zr-based PET tracer for noninvasive imaging of CD105 expression. TRC105, a chimeric anti-CD105 monoclonal antibody, was conjugated to p-isothiocyanatobenzyl-desferrioxamine (Df-Bz-NCS) and labeled with {sup 89}Zr. FACS analysis and microscopy studies were performed to compare the CD105 binding affinity of TRC105 and Df-TRC105. PET imaging, biodistribution, blocking, and ex-vivo histology studies were performed on 4T1 murine breast tumor-bearing mice to evaluate the pharmacokinetics and tumor-targeting of {sup 89}Zr-Df-TRC105. Another chimeric antibody, cetuximab, was used as an isotype-matched control. FACS analysis of HUVECs revealed no difference in CD105 binding affinity between TRC105 and Df-TRC105, which was further validated by fluorescence microscopy. {sup 89}Zr labeling was achieved with high yield and specific activity. Serial PET imaging revealed that the 4T1 tumor uptake of {sup 89}Zr-Df-TRC105 was 6.1 {+-} 1.2, 14.3 {+-} 1.2, 12.4 {+-} 1.5, 7.1 {+-} 0.9, and 5.2 {+-} 0.3 %ID/g at 5, 24, 48, 72, and 96 h after injection, respectively (n = 4), higher than all organs starting from 24 h after injection, which provided excellent tumor contrast. Biodistribution data as measured by gamma counting were consistent with the PET findings. Blocking experiments, control studies with {sup 89}Zr-Df-cetuximab, and ex-vivo histology all confirmed the in vivo target specificity of {sup 89}Zr-Df-TRC105. We report here the first successful PET imaging of CD105 expression with {sup 89}Zr as the radiolabel. Rapid, persistent, CD105-specific uptake of {sup 89}Zr-Df-TRC105 in the 4T1 tumor was observed. (orig.)

  11. Dicty_cDB: AFM105 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFM105 (Link to dictyBase) - - - - - (Link to Original site) - - AFM...105Z 742 - - - - Show AFM105 Library AF (Link to library) Clone ID AFM105 (Link to dictyBase) Atlas ID... - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/AF/AFM1-A/AFM...105Q.Seq.d/ Representative seq. ID - (Link to Original site) Representative DNA sequence >AFM...105 (AFM105Q) /CSM/AF/AFM1-A/AFM105Q.Seq.d/ XXXXXXXXXXATCAATATAGTTTATAACTCAACCCAACGTTATGA

  12. On the mechanism of cadmium toxicity: Suppression of mitochondrial respiration by an organic complex of cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Korotkov, S.M.; Rozengart, E.V.; Suvorov, A.A.; Nesterov, V.P.; Khovanskikh, A.E. [Setchenow Institute of Evolutionary Physiology and Biochemistry, St. Petersburg (Russian Federation)

    1994-09-01

    Mitochondria are the main targets of the deleterious effect of cadmium. It was found that 94% of cadmium in mitochondria exists as a soluble complex with low-molecular-weight proteins, i.e., metallothioneins. The remaining 6% of cadmium is bound to protein structures of the mitochondrial matrix and, thereby cause the dysfunction of subcellular organelles in vivo. The mechanism of direct interaction of cadmium with the target protein is unknown; however, it is evident that the incorporation of cadmium into a complex with an organic ligand can significantly affect this process and eventually affect the interaction of cadmium with matrix proteins. It was of interest to compare the effects of an inorganic cadmium salt (hydrated Cd{sup 2+} cation) and an organic complex of cadmium [Cd(II)-1,3-bis-(chlorobenzylidenamino)guanidine, CBG] on rat liver mitochondrial respiration. This complex was earlier shown to display a wide range of biological activities. Particularly, it appeared to be more potent than Cd{sup 2+} in inhibiting monoamine oxidase.

  13. Reviews of the environmental effects of pollutants: IV. Cadmium

    Energy Technology Data Exchange (ETDEWEB)

    Hammons, A.S.; Huff, J.E.; Braunstein, H.M.; Drury, J.S.; Shriner, C.R.; Lewis, E.B.; Whitfield, B.L.; Towill, L.E.

    1978-06-01

    This report is a comprehensive, multidisciplinary review of the health and environmental effects of cadmium and specific cadmium derivatives. More than 500 references are cited. The cadmium body burden in animals and humans results mainly from the diet. In the United States, the normal intake of cadmium for adult humans is estimated at about 50 ..mu..g per day. Tobacco smoke is a significant additional source of cadmium exposure. The kidneys and liver together contain about 50% of the total cadmium body burden. Acute cadmium poisoning is primarily an occupational problem, generally from inhalation of cadmium fumes or dusts. In the general population, incidents of acute poisoning by inhaled or ingested cadmium or its compounds are relatively rare. The kidney is the primary target organ for toxicity from prolonged low-level exposure to cadmium. No causal relationship has been established between cadmium exposure and human cancer, although a possible link between cadmium and prostate cancer has been indicated. Cadmium has been shown to be teratogenic in rats, hamsters, and mice, but no such effects have been proven in humans. Cadmium has been reported to increase the frequency of chromosomal aberrations in cultured Chinese hamster ovary cells and in human peripheral leukocytes. The major concern about environmental cadmium is the potential effects on the general population. There is no substantial evidence of hazard from current levels of cadmium in air, water, or food. However, because cadmium is a cumulative poison and because present intake provides a relatively small safety margin, there are adequate reasons for concern over possible future increases in background levels.

  14. Reviews of the environmental effects of pollutants: IV. Cadmium

    International Nuclear Information System (INIS)

    This report is a comprehensive, multidisciplinary review of the health and environmental effects of cadmium and specific cadmium derivatives. More than 500 references are cited. The cadmium body burden in animals and humans results mainly from the diet. In the United States, the normal intake of cadmium for adult humans is estimated at about 50 μg per day. Tobacco smoke is a significant additional source of cadmium exposure. The kidneys and liver together contain about 50% of the total cadmium body burden. Acute cadmium poisoning is primarily an occupational problem, generally from inhalation of cadmium fumes or dusts. In the general population, incidents of acute poisoning by inhaled or ingested cadmium or its compounds are relatively rare. The kidney is the primary target organ for toxicity from prolonged low-level exposure to cadmium. No causal relationship has been established between cadmium exposure and human cancer, although a possible link between cadmium and prostate cancer has been indicated. Cadmium has been shown to be teratogenic in rats, hamsters, and mice, but no such effects have been proven in humans. Cadmium has been reported to increase the frequency of chromosomal aberrations in cultured Chinese hamster ovary cells and in human peripheral leukocytes. The major concern about environmental cadmium is the potential effects on the general population. There is no substantial evidence of hazard from current levels of cadmium in air, water, or food. However, because cadmium is a cumulative poison and because present intake provides a relatively small safety margin, there are adequate reasons for concern over possible future increases in background levels

  15. Cadmium removal by Lemna minor and Spirodela polyrhiza.

    Science.gov (United States)

    Chaudhuri, Devaleena; Majumder, Arunabha; Misra, Amal K; Bandyopadhyay, Kaushik

    2014-01-01

    The present study investigates the ability of two genus of duckweed (Lemna minor and Spirodela polyrhiza) to phytoremediate cadmium from aqueous solution. Duckweed was exposed to six different cadmium concentrations, such as, 0.5,1.0,1.5, 2.0, 2.5, and 3.0 mg/L and the experiment was continued for 22 days. Water samples were collected periodically for estimation of residual cadmium content in aqueous solution. At the end of treatment period plant samples were collected and accumulated cadmium content was measured. Cadmium toxicity was observed through relative growth factor and changes in chlorophyll content Experimental results showed that Lemna minor and Spirodela polyrhiza were capable of removing 42-78% and 52-75% cadmium from media depending upon initial cadmium concentrations. Cadmium was removed following pseudo second order kinetic model Maximum cadmium accumulation in Lemna minor was 4734.56 mg/kg at 2 mg/L initial cadmium concentration and 7711.00 mg/kg in Spirodela polyrhiza at 3 mg/L initial cadmium concentration at the end of treatment period. Conversely in both cases maximum bioconcentration factor obtained at lowest initial cadmium concentrations, i.e., 0.5 mg/L, were 3295.61 and 4752.00 for Lemna minor and Spirodela polyrhiza respectively. The present study revealed that both Lemna minor and Spirodela polyrhiza was potential cadmium accumulator. PMID:24933906

  16. Effects of cadmium on nickel electrodes in nickel-cadmium cells

    International Nuclear Information System (INIS)

    Nickel cadmium battery cells containing nicel electrodes that are not treated with cadmium during the manufacturing process have a history of performance variability and capacity problems in various cell test programs. In this work cadmium additions to the nickel electrode are examined to determine the effects on the fundamental electrochemical processes occurring at this electrode. The results indicate that cadmium treatments improve recharge efficiency by increasing the potential required for oxygen evolution from the nickel electrode, thus decreasing the overcharge rate at a given voltage and allowing the nickel electrode to attain a higher state of charge. The effects of cadmium treatment become particularly important for stable cell operation at temperatures above 10 C, and for capacity maintenance under conditions of long term, low rate trickle charge

  17. Dicty_cDB: VHP105 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHP105 (Link to dictyBase) - - - Contig-U15792-1 VHP105P (Link to Original site) VHP1...05F 643 VHP105Z 655 VHP105P 1278 - - Show VHP105 Library VH (Link to library) Clone ID VHP1...e URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHP1-A/VHP105Q.Seq.d/ Representative seq. ID VHP1...05P (Link to Original site) Representative DNA sequence >VHP105 (VHP105Q) /CSM/VH/VHP1-A/VHP1...w*s*iitl*c*eivedkkt Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value VHP105 (VHP1

  18. Cadmium exposure induces hematuria in Korean adults

    International Nuclear Information System (INIS)

    Introduction: Toxic heavy metals have adverse effects on human health. However, the risk of hematuria caused by heavy metal exposure has not been evaluated. Methods: Data from 4701 Korean adults were obtained in the Korean National Health and Nutritional Examination Survey (2008–2010). Blood levels of the toxic heavy metals cadmium, lead, and mercury were measured. Hematuria was defined as a result of ≥+1 on a urine dipstick test. The odds ratios (ORs) for hematuria were measured according to the blood heavy metal levels after adjusting for multiple variables. Results: Individuals with blood cadmium levels in the 3rd and 4th quartiles had a greater OR for hematuria than those in the 1st quartile group: 3rd quartile, 1.35 (1.019–1.777; P=0.037); 4th quartile, 1.52 (1.140–2.017; P=0.004). When blood cadmium was considered as a log-transformed continuous variable, the correlation between blood cadmium and hematuria was significant: OR, 1.97 (1.224–3.160; Ptrend=0.005). In contrast, no significant correlations between hematuria and blood lead or mercury were found in the multivariate analyses. Discussion: The present study shows that high cadmium exposure is associated with a risk of hematuria. -- Highlights: • A high level of blood cadmium is associated with a high risk of hematuria. • This correlation is independent of several confounding factors. • Blood levels of lead and mercury are not associated with risk of hematuria. • This is the first study on the correlation between cadmium exposure and hematuria risk

  19. Cadmium exposure induces hematuria in Korean adults

    Energy Technology Data Exchange (ETDEWEB)

    Han, Seung Seok [Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744 (Korea, Republic of); Kim, Myounghee, E-mail: dkkim73@gmail.com [Department of Dental Hygiene, College of Health Science, Eulji University, Gyeonggi-do 461-713 (Korea, Republic of); Lee, Su Mi [Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744 (Korea, Republic of); Lee, Jung Pyo [Department of Internal Medicine, Seoul National University Boramae Medical Center, Seoul 156-707 (Korea, Republic of); Kim, Sejoong [Department of Internal Medicine, Seoul National University Bundang Hospital, Gyeonggi-do 463-707 (Korea, Republic of); Joo, Kwon Wook [Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744 (Korea, Republic of); Lim, Chun Soo [Department of Internal Medicine, Seoul National University Boramae Medical Center, Seoul 156-707 (Korea, Republic of); Kim, Yon Su; Kim, Dong Ki [Department of Internal Medicine, Seoul National University College of Medicine, Seoul 110-744 (Korea, Republic of)

    2013-07-15

    Introduction: Toxic heavy metals have adverse effects on human health. However, the risk of hematuria caused by heavy metal exposure has not been evaluated. Methods: Data from 4701 Korean adults were obtained in the Korean National Health and Nutritional Examination Survey (2008–2010). Blood levels of the toxic heavy metals cadmium, lead, and mercury were measured. Hematuria was defined as a result of ≥+1 on a urine dipstick test. The odds ratios (ORs) for hematuria were measured according to the blood heavy metal levels after adjusting for multiple variables. Results: Individuals with blood cadmium levels in the 3rd and 4th quartiles had a greater OR for hematuria than those in the 1st quartile group: 3rd quartile, 1.35 (1.019–1.777; P=0.037); 4th quartile, 1.52 (1.140–2.017; P=0.004). When blood cadmium was considered as a log-transformed continuous variable, the correlation between blood cadmium and hematuria was significant: OR, 1.97 (1.224–3.160; P{sub trend}=0.005). In contrast, no significant correlations between hematuria and blood lead or mercury were found in the multivariate analyses. Discussion: The present study shows that high cadmium exposure is associated with a risk of hematuria. -- Highlights: • A high level of blood cadmium is associated with a high risk of hematuria. • This correlation is independent of several confounding factors. • Blood levels of lead and mercury are not associated with risk of hematuria. • This is the first study on the correlation between cadmium exposure and hematuria risk.

  20. Copper-cadmium interaction in mice: effects of copper status on retention and distribution of cadmium after cadmium exposure

    International Nuclear Information System (INIS)

    The role of increased dietary copper in altering the accumulation of cadmium and other metals in tissues, was investigated. Female Swiss-Webster mice were pretreated with cadmium or copper in drinking water for three weeks prior to cadmium exposure for an additional nine weeks, with sub groups from each dose level receiving Cu additions to the Cd supplemented water. In Cd pretreated animals, a significant decrease was observed in Cd concentrations in liver and kidney when Cu was added to Cd in drinking water. Cadmium levels in soluble protein fractions of liver of animals administered 5 ppm Cd were approximately three fold greater than that for the same Cd dose when Cu was added. The same was the case for the metallothionein-like protein fraction (MTP) of the liver cytosol. In copper pretreated animals similar trends were noted in that brain, spleen, liver (but not kidney) Cd levels were decreased in animals receiving Cu additions to the Cd dose. Increased binding of Cd to the MTP fraction was observed after both in vivo and in vitro exposure of intestinal mucosal cells to cadmium

  1. High spin spectroscopy of 105Pd

    International Nuclear Information System (INIS)

    The high spin behaviour of nuclei in mass ∼100 region has been studied extensively in recent times. These studies seem to indicate that the lower boundary for the observation of magnetic rotation is the Ag isotopes. On the other hand the upper boundary for chirality seems to be the Rh isotopes as no chiral bands have been found in 105Ag. Thus, it is interesting to study the odd mass isotopes of the intermediate nuclei, namely Pd. In the present communication, we report the high spin structure of 105Pd

  2. On the effect of thallium additions on cadmium amalgam potentials

    International Nuclear Information System (INIS)

    A study has been made of the influence of additives of thallium on potentials of cadmium amalgams with thallium contents of 10, 20, 30, and 40 at.% at 20, 40, 60, and 80 deg C. Additives of thallium have been found to shift the potential of cadmium amalgams towards the range of negative values which indicates an increase in the activity of cadmium. A possibility of calculation of the potential shift for heterogeneous cadmium amalgams on introducing thallium has been shown

  3. 26 CFR 1.105-5 - Accident and health plans.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 2 2010-04-01 2010-04-01 false Accident and health plans. 1.105-5 Section 1.105... (CONTINUED) INCOME TAXES (CONTINUED) Items Specifically Excluded from Gross Income § 1.105-5 Accident and... certain amounts received through accident or health insurance. Section 105(e) provides that for...

  4. 46 CFR 56.50-105 - Low-temperature piping.

    Science.gov (United States)

    2010-10-01

    ... ASTM standards listed in table 56.50-105 are incorporated by reference; see 46 CFR 56.01-2. ... 46 Shipping 2 2010-10-01 2010-10-01 false Low-temperature piping. 56.50-105 Section 56.50-105... APPURTENANCES Design Requirements Pertaining to Specific Systems § 56.50-105 Low-temperature piping. (a) Class...

  5. Dual insulated-gate field-effect transistors with cadmium sulfide active layer and a laminated polymer dielectric

    Science.gov (United States)

    Meth, J. S.; Zane, S. G.; Nunes, G.

    2004-04-01

    We report the fabrication of dual insulated gate thin-film transistors with chemical-bath deposited cadmium sulfide active layers. The cadmium sulfide was deposited from solution onto thermally oxidized silicon wafers to form the first semiconductor-dielectric interface. The terpolymer poly(tetrafluoroethylene-co-vinylidenefluoride-co-propylene) was laminated onto the semiconductor to create the second semiconductor-dielectric interface. This device geometry allows direct comparison of the behavior of the accumulated charge at these two very different interfaces. The mobility values for these devices are in the 0.1-1 cm2/Vs range, while the on/off ratios vary from 102 to 105. The ability to laminate a dielectric to a semiconductor enables new processing routes for large area transistor arrays.

  6. Effect of anions on Toxicity of Cadmium Applied to MIcrobial Biomass in Red Soil

    Institute of Scientific and Technical Information of China (English)

    K.S.KHAN; XIEZHENGMIAO; 等

    1997-01-01

    A laboratory incubation experiment was conducted to elucidat the effects of associated anions on toxicity of cadmium applied to microbial biomass in the red soil. Cadmium was applied at six different levels,i.e.,O(background),5,15,30,60 and 100μg g-1 soil in the form of either cadmium acetate or cadmium chloride. Application of cadmium as cadmium acetate markedly reduced the soil microbial biomass carbon compared to cadmium applied as cadmium chlorde at all the tested levels.Similarly,organic carbon to biomass carbon ration in the soil was markedly increased by increasing the level of the cadmium in the soil as cadmium acetate,while the change wa much smaller in the case of cadmium chloride at the same cadmium levels.The results suggested that due consideration should be given to the source of cadmium while deciding the cadmium levles in experiments.

  7. Cadmium-113m as a biogeochemical tracer for cadmium in Lake Michigan

    International Nuclear Information System (INIS)

    The Lake Michigan watershed has been sampled for 113mCd. This long-lived metastable isotope of cadmium allowed independent evaluation of cadmium distribution in this dynamic ecosystem. 113mCd analysis was not hampered by contamination or loss. These are problems which have plagued stable cadmium measurements. Sensitivity and specificity were necessary concerns. 113mCd has been preconcentrated from large samples in order to obtain sufficient activity for quantification. Specificity for the gross beta activity measured was secured in a rigorous ion exchange decontamination. Confirmation of the suspected 113mCd beta source was checked by reverse tracer analysis and modified Feather analysis range-energy relationships. The 113mCd activities confirm the expected semiconservative behavior for cadmium. This behavior manifests itself in a long residence time for cadmium in Lake Michigan. The inefficiency of outflow removal, the low sedimentation rate and the unquantified sediment resuspension and release of cadmium are factors contributing to this residence time. Steady state concentration of cadmium in Lake Michigan will increase if present input rates persist

  8. 7 CFR 1721.105 - Application documents.

    Science.gov (United States)

    2010-01-01

    .... (3) A 10-year financial forecast of revenues and expenses on a cash basis, by year, for the period of... and Interest § 1721.105 Application documents. (a) Deferments for financial hardship. A Borrower requesting a section 12 deferment because of financial hardship must submit the following: (1) A summary...

  9. 14 CFR 61.105 - Aeronautical knowledge.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 2 2010-01-01 2010-01-01 false Aeronautical knowledge. 61.105 Section 61... Aeronautical knowledge. (a) General. A person who is applying for a private pilot certificate must receive and... knowledge areas of paragraph (b) of this section that apply to the aircraft category and class rating...

  10. Tank 241-U-105 tank characterization plan

    International Nuclear Information System (INIS)

    This document is a plan which serves as the contractual agreement between the Characterization Program, Sampling Operations, Oak Ridge National Laboratory, and PNL tank vapor program. The scope of this plan is to provide guidance for the sampling and analysis of vapor samples from tank 241-U-105

  11. Tank 241-BY-105 tank characterization plan

    International Nuclear Information System (INIS)

    This document is a plan which serves as the contractual agreement between the Characterization Program, Sampling Operations, PNL 325 Analytical Chemistry Laboratory, and WHC 222-S Laboratory. The scope of this plan is to provide guidance for the sampling and analysis of samples for tank 241-BY-105

  12. 39 CFR 601.105 - Business relationships.

    Science.gov (United States)

    2010-07-01

    ... Postal Service UNITED STATES POSTAL SERVICE PROCUREMENT SYSTEM FOR THE U.S. POSTAL SERVICE: INTELLECTUAL PROPERTY RIGHTS OTHER THAN PATENTS PURCHASING OF PROPERTY AND SERVICES § 601.105 Business relationships. (a... from a person or organization, the vice president, Supply Management, or his or her designee,...

  13. 23 CFR 635.105 - Supervising agency.

    Science.gov (United States)

    2010-04-01

    ... employ a consultant to provide construction engineering services, such as inspection or survey work on a... CONSTRUCTION AND MAINTENANCE Contract Procedures § 635.105 Supervising agency. (a) The STD has responsibility for the construction of all Federal-aid projects, and is not relieved of such responsibility...

  14. 24 CFR 200.105 - Mortgagor supervision.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Mortgagor supervision. 200.105... supervision. (a) As long as the Commissioner is the insurer or holder of the mortgage, the Commissioner shall... Regulatory Agreement or other instrument granting the Commissioner supervision of the mortgagor....

  15. 23 CFR 230.105 - Applicability.

    Science.gov (United States)

    2010-04-01

    ... HIGHWAY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION CIVIL RIGHTS EXTERNAL PROGRAMS Equal Employment Opportunity on Federal and Federal-Aid Construction Contracts (Including Supportive Services) § 230.105 Applicability. (a) Federal-aid highway construction projects. This subpart applies to all Federal-aid...

  16. 44 CFR 10.5 - Responsibilities.

    Science.gov (United States)

    2010-10-01

    ... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Responsibilities. 10.5... Responsibilities. (a) The Regional Administrators shall, for each action not categorically excluded from this... impact statements and assign lead agency responsibility when more than one FEMA office or...

  17. 105-KE Basin Pilot Run design plan

    International Nuclear Information System (INIS)

    This document identifies all design deliverables and procedures applicable to the 105-KE Basin Pilot Run. It also establishes a general design strategy, defines interface control requirements, and covers planning for mechanical, electrical, instrument/control system, and equipment installation design

  18. 27 CFR 24.105 - General.

    Science.gov (United States)

    2010-04-01

    ... TREASURY LIQUORS WINE Establishment and Operations Application § 24.105 General. A person desiring to establish a bonded winery, bonded wine cellar or taxpaid wine bottling house shall file an application on TTB F 5120.25, Application to Establish and Operate Wine Premises. Approval of TTB F 5120.25...

  19. LYME CARDITIS - CLINICAL CHARACTERISTICS OF 105 CASES

    NARCIS (Netherlands)

    VANDERLINDE, MR

    1991-01-01

    105 North American and European cases of Lyme carditis, being documented and in part published in the period 1977-1990, are reviewed and compared. The male: female ratio was 3:1, as well in Europe as in the USA. Transient atrioventricular block is the most frequent manifestation of Lyme carditis, wi

  20. 28 CFR 105.22 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... activity; safeguard persons; control access to real property and prevent trespass; or deter criminal... submitted to the appropriate state agency the certification required in § 105.25(g), if its authority to do... duties involve the secure movement of prisoners. (h) Security services means services, whether...

  1. 21 CFR 175.105 - Adhesives.

    Science.gov (United States)

    2010-04-01

    ... § 175.105, see the List of CFR Sections Affected, which appears in the Finding Aids section of the... Chromium potassium sulfate Cobaltous acetate Coconut fatty acid amine salt of tetrachlorophenol For use as... modified with benzoic acid, castor oil, coconut oil, linseed oil, rosin, soybean oil, styrene, and...

  2. Tank 241-TX-105 tank characterization plan

    International Nuclear Information System (INIS)

    This document is a plan which serves as the contractual agreement between the Characterization Program, Sampling Operations, WHC 222-S Laboratory, Oak Ridge National Laboratory, and PNL tank vapor program. The scope of this plan is to provide guidance for the sampling and analysis of vapor samples from tank 241-TX-105

  3. Tank 241-C-105 tank characterization plan

    International Nuclear Information System (INIS)

    This document is a plan which serves as the contractual agreement between the Characterization Program, Sampling Operations, WHC 222-S Laboratory, and PNL 325 Analytical Chemistry Laboratory. The scope of this plan is to provide guidance for the sampling and analysis of samples from tank 241-C-105

  4. CONTROL OF CADMIUM CARBONATE PRECIPITATION INTERFERENCES DURING THE DIALYSIS OF CADMIUM IN HIGH BICARBONATE ALKALINITY AQUATIC-LIFE BIOASSAY WATERS

    Science.gov (United States)

    The precipitation of cadmium carbonate during the dialysis of cadmium in a high bicarbonate alkalinity natural water, was linked to a significant source of error when determining dialyzate cadmium concentrations. The relative standard deviation was reduced by approximately four-f...

  5. Cadmium accumulation by Axonopus compressus (Sw. P. Beauv and Cyperus rotundas Linn growing in cadmium solution and cadmium-zinc contaminated soil

    Directory of Open Access Journals (Sweden)

    Paitip Thiravetyan

    2007-05-01

    Full Text Available This research investigated the phyto-remediation potentials of Cyperus rotundas Linn (Nutgrass and Axonopus compressus (Sw. P. Beauv (Carpetgrass for cadmium removal from cadmium solution andcadmium-zinc contaminated soil. Plants growth in the solution showed that cadmium decreased the relative growth rate of both grasses. However, the amount of cadmium accumulated in shoot and root was increasedwith the increase in cadmium concentration and exposure time. Growth in fertile soil mixed with Cd-contaminated zinc silicate residue (65% Si, 19% Ca, 2% Zn, 1% Mg and 0.03% Cd at the ratio of 50:50 (w/wfor 30 days showed that C. rotundas Linn accumulated cadmium in root and shoot to 2,178 and 1,144 mg kg-1 dry weight, respectively. A. compressus (Sw. P. Beauv accumulated cadmium in root and shoot to 1,965and 669 mg kg-1 dry weight, respectively. Scanning electron microscope connected to energy-dispersive X-ray spectroscopy suggested that the mechanism of cadmium accumulation by both grasses involved thecadmium precipitation in the stable form of cadmium silicate, which indicated that C. rotundas Linn and A. compressus (Sw. P. Beauv could be grown to prevent soil erosion and to remediate cadmium-contaminatedsoil.

  6. ELECTROKINETIC REMEDIATION STUDY FOR CADMIUM CONTAMINATED SOIL

    Directory of Open Access Journals (Sweden)

    P. Bala Ramudu

    2007-09-01

    Full Text Available This paper presents the results of an experimental research undertaken to evaluate different purging solutions to enhance the removal of cadmium from spiked contaminated field soil by electrokinetic remediation. Three experiments were conducted when soil was saturated with deionised water and subsequently deionised water, ammonium citrate and sodium citrate were used as purging solutions at anode end. One experiment was conducted when the soil was saturated with ammonium citrate and itself was used as the purging solution. Results showed that 49% reduction of cadmium concentration was achieved in the case of soil saturated (washed with ammonium citrate as well as purging solution also was ammonium citrate. The soil pH and washing solutions were the most important factors in controlling the removal of cadmium in electrokinetic remediation process.

  7. Bireactor Electronuclear Systems with Liquid Cadmium Valve

    CERN Document Server

    Bznuni, S A; Zhamkochyan, V M; ASosnin, A N; Polanski, A; Khudaverdyan, A H

    2002-01-01

    Three main types of bireactor electronuclear systems are discussed. From the point of view of assuring high level of functional characteristics and safety bireactor electronuclear systems with booster using enriched uranium (20 %) and with a liquid cadmium valve appears to be the most effective. It is shown by means of Monte-Carlo modeling that such operation conditions can be achieved which lead to the destruction of the intermediate cadmium layer making the systems supercritical (k_{eff}>1). One can avoid the problem by using a special design of the liquid cadmium valve. In comparison with other nuclear systems (critical reactors, one-reactor electronuclear systems) cascade electronuclear systems have essential advantages allowing the decrease of the proton beam current by one order of magnitude and providing at same time the necessary level of power generation and neutron flux. Availability of both the thermal and fast cones allows one to transmute not only transuranics but also the fission products - cesi...

  8. Cadmium tungstate ceramics for application as scintillator

    International Nuclear Information System (INIS)

    The aim of the present work is the production of cadmium tungstate scintillator ceramics (CdWO4 - CWO). The route of production employed was the solid state synthesis. Before the calcination, the precursors cadmium oxide and tungsten oxide were homogenized in an agate mortar. Bismuth oxide was used in the production of doped ceramics with 1% in mol of bismuth, in order to improve de efficiency of the scintillators. Since there is a possibility of Cd2+ loss at temperatures above 1000 deg C, ceramics with 1% of cadmium oxide excess were also produced. The crystalline phase was obtained after two calcination, according to X-Ray diffraction results. For the characterization, radioluminescence measurements were performed under β and X-radiation. Images of the surface of the sintered ceramic were registered by Atomic Force Microscopy. The density of ceramics bodies was calculated by the Archimedes' method and compared with the theoretical density (7.99 g/cm3). (author)

  9. Increased cadmium and lead uptake of a cadmium hyperaccumulator tomato by cadmium-resistant bacteria.

    Science.gov (United States)

    He, Lin-Yan; Chen, Zhao-Jin; Ren, Gai-Di; Zhang, Yan-Feng; Qian, Meng; Sheng, Xia-Fang

    2009-07-01

    Two cadmium (Cd)-resistant strains Pseudomonas sp. RJ10 and Bacillus sp. RJ16 were investigated for their effects on the soil Cd and lead (Pb) solubilization and promotion of plant growth and Cd and Pb uptakes of a Cd-hyperaccumulator tomato. In the heavy metal-contaminated inoculated soil, the CaCl(2)-extractable Cd and Pb were increased by 58-104% and 67-93%, respectively, compared to the uninoculation control. The bacteria produced indole acetic acid, siderophore and 1-aminocyclopropane-1-carboxylate deaminase. Root elongation assay conducted on tomato under gnotobiotic conditions demonstrated increase in root elongation of inoculated tomato seedlings compared to the control plants. An increase in Cd and Pb contents of above-ground tissues varied from 92% to 113% and from 73% to 79% in inoculated plants growing in heavy metal-contaminated soil compared to the uninoculation control, respectively. These results show that the bacteria could be exploited for bacteria enhanced-phytoextraction of Cd- and Pb-polluted soils. PMID:19368973

  10. Treatment of cadmium dust with two-stage leaching process

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    The treatment of cadmium dust with a two-stage leaching process was investigated to replace the existing sulphation roast-leaching processes. The process parameters in the first stage leaching were basically similar to the neutralleaching in zinc hydrometallurgy. The effects of process parameters in the second stage leaching on the extraction of zincand cadmium were mainly studied. The experimental results indicated that zinc and cadmium could be efficiently recoveredfrom the cadmium dust by two-stage leaching process. The extraction percentages of zinc and cadmium in two stage leach-ing reached 95% and 88% respectively under the optimum conditions. The total extraction percentage of Zn and Cdreached 94%.

  11. Thermodynamic properties of cadmium in lead amalgam dilute solution

    International Nuclear Information System (INIS)

    Investigation of thermodynamic properties of cadmium dilute solutions in lead amalgam is carried out by means of electromotive force technique within 453-523 K temperature range. Cadmium thermodynamic functions are calculated: activity, activity ratio, Libbs partial energy and its excess value and integral characteristics, respectively. When changing cadmium content from 0.01 up to 0.1 χcd at T=473 K, logarithm of activity ratio does not depend on alloy composition, that is, Heury's law is fulfilled. Increase of cadmium content in amalgam results in the essential reduction of mercury and cadmium reaction

  12. Urinary excretion of cadmium and zinc among persons from Sweden

    Energy Technology Data Exchange (ETDEWEB)

    Elinder, C.G.; Kjellstrom, T.; Linnman, L.; Pershagen, G.

    1978-06-01

    Cadmium and zinc concentrations in the urine of 132 Swedes, including 50 pairs of identical twins, were measured. Atomic absorption spectrophotometry procedures were developed for the analysis. Cadmium concentration increased with age and was higher among smokers than among nonsmokers. Estimated 24-hr excretion of cadmium among nonsmokers increased from about 0.25 to 0.40 ..mu..g in persons from 20 to 70 years old. The 24-hr cadmium excretions among nonsmokers in different age-groups fitted better to total kidney burden than to daily cadmium intake from food. Zinc excretion, on the other hand, decreased after the age of 20.

  13. Screening of a new cadmium hyperaccumulator, Galinsoga parviflora, from winter farmland weeds using the artificially high soil cadmium concentration method.

    Science.gov (United States)

    Lin, Lijin; Jin, Qian; Liu, Yingjie; Ning, Bo; Liao, Ming'an; Luo, Li

    2014-11-01

    A new method, the artificially high soil cadmium (Cd) concentration method, was used to screen for Cd hyperaccumulators among winter farmland weeds. Galinsoga parviflora was the most promising remedial plant among 5 Cd accumulators or hyperaccumulators. In Cd concentration gradient experiments, as soil Cd concentration increased, root and shoot biomass decreased, and their Cd contents increased. In additional concentration gradient experiments, superoxide dismutase and peroxidase activities increased with soil Cd concentrations up to 75 mg kg(-1) , while expression of their isoenzymes strengthened. Catalase (CAT) activity declined and CAT isoenzyme expression weakened at soil Cd concentrations less than 50 mg kg(-1) . The maxima of Cd contents in shoots and roots were 137.63 mg kg(-1) and 105.70 mg kg(-1) , respectively, at 100 mg kg(-1) Cd in soil. The root and shoot bioconcentration factors exceeded 1.0, as did the translocation factor. In a field experiment, total extraction of Cd by shoots was 1.35 mg m(-2) to 1.43 mg m(-2) at soil Cd levels of 2.04 mg kg(-1) to 2.89 mg kg(-1) . Therefore, the artificially high soil Cd concentration method was effective for screening Cd hyperaccumulators. Galinsoga parviflora is a Cd hyperaccumulator that could be used to efficiently remediate Cd-contaminated farmland soil. PMID:25053512

  14. Cadmium telluride quantum dots advances and applications

    CERN Document Server

    Donegan, John

    2013-01-01

    Optical Properties of Bulk and Nanocrystalline Cadmium Telluride, Núñez Fernández and M.I. VasilevskiyAqueous Synthesis of Colloidal CdTe Nanocrystals, V. Lesnyak, N. Gaponik, and A. EychmüllerAssemblies of Thiol-Capped CdTe Nanocrystals, N. GaponikFörster Resonant Energy Transfer in CdTe Nanocrystal Quantum Dot Structures, M. Lunz and A.L. BradleyEmission of CdTe Nanocrystals Coupled to Microcavities, Y.P. Rakovich and J.F. DoneganBiological Applications of Cadmium Telluride Semiconductor Quantum Dots, A. Le Cign

  15. Metallothionein protection of cadmium toxicity

    International Nuclear Information System (INIS)

    The discovery of the cadmium (Cd)-binding protein from horse kidney in 1957 marked the birth of research on this low-molecular weight, cysteine-rich protein called metallothionein (MT) in Cd toxicology. MT plays minimal roles in the gastrointestinal absorption of Cd, but MT plays important roles in Cd retention in tissues and dramatically decreases biliary excretion of Cd. Cd-bound to MT is responsible for Cd accumulation in tissues and the long biological half-life of Cd in the body. Induction of MT protects against acute Cd-induced lethality, as well as acute toxicity to the liver and lung. Intracellular MT also plays important roles in ameliorating Cd toxicity following prolonged exposures, particularly chronic Cd-induced nephrotoxicity, osteotoxicity, and toxicity to the lung, liver, and immune system. There is an association between human and rodent Cd exposure and prostate cancers, especially in the portions where MT is poorly expressed. MT expression in Cd-induced tumors varies depending on the type and the stage of tumor development. For instance, high levels of MT are detected in Cd-induced sarcomas at the injection site, whereas the sarcoma metastases are devoid of MT. The use of MT-transgenic and MT-null mice has greatly helped define the role of MT in Cd toxicology, with the MT-null mice being hypersensitive and MT-transgenic mice resistant to Cd toxicity. Thus, MT is critical for protecting human health from Cd toxicity. There are large individual variations in MT expression, which might in turn predispose some people to Cd toxicity.

  16. Cadmium exposure and pancreatic cancer in south Louisiana.

    Science.gov (United States)

    Luckett, Brian G; Su, L Joseph; Rood, Jennifer C; Fontham, Elizabeth T H

    2012-01-01

    Cadmium has been hypothesized to be a pancreatic carcinogen. We test the hypothesis that cadmium exposure is a risk factor for pancreatic cancer with a population-based case-control study sampled from a population with persistently high rates of pancreatic cancer (south Louisiana). We tested potential dietary and nondietary sources of cadmium for their association with urinary cadmium concentrations which reflect long-term exposure to cadmium due to the accumulation of cadmium in the kidney cortex. Increasing urinary cadmium concentrations were significantly associated with an increasing risk of pancreatic cancer (2nd quartile OR = 3.34, 3rd = 5.58, 4th = 7.70; test for trend P ≤ 0.0001). Potential sources of cadmium exposure, as documented in the scientific literature, found to be statistically significantly associated with increased risk of pancreatic cancer included working as a plumber, pipefitter or welder (OR = 5.88) and high consumption levels of red meat (4th quartile OR = 6.18) and grains (4th quartile OR = 3.38). Current cigarette smoking, at least 80 pack years of smoking, occupational exposure to cadmium and paints, working in a shipyard, and high consumption of grains were found to be statistically significantly associated with increased concentrations of urinary cadmium. This study provides epidemiologic evidence that cadmium is a potential human pancreatic carcinogen. PMID:23319964

  17. Cadmium Exposure and Pancreatic Cancer in South Louisiana

    Directory of Open Access Journals (Sweden)

    Brian G. Luckett

    2012-01-01

    Full Text Available Cadmium has been hypothesized to be a pancreatic carcinogen. We test the hypothesis that cadmium exposure is a risk factor for pancreatic cancer with a population-based case-control study sampled from a population with persistently high rates of pancreatic cancer (south Louisiana. We tested potential dietary and nondietary sources of cadmium for their association with urinary cadmium concentrations which reflect long-term exposure to cadmium due to the accumulation of cadmium in the kidney cortex. Increasing urinary cadmium concentrations were significantly associated with an increasing risk of pancreatic cancer (2nd quartile OR = 3.34, 3rd = 5.58, 4th = 7.70; test for trend P≤0.0001. Potential sources of cadmium exposure, as documented in the scientific literature, found to be statistically significantly associated with increased risk of pancreatic cancer included working as a plumber, pipefitter or welder (OR = 5.88 and high consumption levels of red meat (4th quartile OR = 6.18 and grains (4th quartile OR = 3.38. Current cigarette smoking, at least 80 pack years of smoking, occupational exposure to cadmium and paints, working in a shipyard, and high consumption of grains were found to be statistically significantly associated with increased concentrations of urinary cadmium. This study provides epidemiologic evidence that cadmium is a potential human pancreatic carcinogen.

  18. The Gamow-Teller decay of 105Sn to three-particle states in 105In

    International Nuclear Information System (INIS)

    The EC/β+ decay of 105Sn was reinvestigated by using 58Ni (5 MeV/u) + 50Cr reactions, chemically selective on-line mass separation and γ-ray spectroscopy. The half-life of 105Sn has been determined as 34 ± 1 s. Out of 104 γ transitions ascribed to the 105Sn decay, 89 have been placed in the decay scheme including 52 excited states of 105In. From the EC/β+ feeding of individual states, the distribution of the Gamow-Teller (GT) strength has been derived. It is shown that the main part of the GT strength is associated with the feeding of 105In levels having excitation energies above 3 MeV. This observation can be interpreted as a sign of dominant feeding of three-quasiparticle states in 105In, which correspond to the π(g9/2)-1 νd5/2 shell-model configuration spread over many levels. The sum of the GT strength deduced from the present gamma ray data of BΣ(GT)=1.46 povides a lower limit to the total GT strength. Many weak transitions, mainly from high energy levels, may not have been detected in this study and therefore part of the strength may be missed. An indirect support for this conclusion has been obtained from the analysis of the indium KX-rays intensity. This analysis indicates about 50% contribution of the electron-capture to the beta decay of 105Sn, which is interpreted as a sign of a predominant feeding of the high-energy 105In states with BΣ(GT)≥3. The observed GT distribution and strength will be compared to results obtained from a finite-Fermi-system theory and a large-basis shell-model calculation. The core-polarization and higher-order hindrance factors will be discussed. (orig.)

  19. European Union Summary Risk Assessment Report - Cadmium Metal and Cadmium Oxide

    OpenAIRE

    2008-01-01

    This report provides a summary, with conclusions, of the risk assessment report of the substances cadmium metal and cadmium oxide that has been prepared by Belgium in the context of Council Regulation (EEC) No. 793/93 on the evaluation and control of existing substances. For detailed information on the risk assessment principles and procedures followed, the underlying data and the literature references, the reader is referred to the comprehensive Final Risk Assessment Report (Final RAR) t...

  20. Effects of bacteria on cadmium bioaccumulation in the cadmium hyperaccumulator plant Beta vulgaris var. cicla L.

    Science.gov (United States)

    Chen, Su; Chao, Lei; Sun, Lina; Sun, Tieheng

    2013-01-01

    To investigate the effects of two cadmium-tolerant bacteria, Staphylococcus pasteuri (S. pasteuri X1) and Agrobacterium tumefaciens (A. tumefaciens X2), on cadmium uptake by the cadmium hyperaccumulator plant Beta vulgaris var. cicla L., a pot experiment with artificially contaminated soil was conducted. The results demonstrated that both cadmium-tolerant bacteria enhanced the dry weight of Beta vulgaris var. cicla L. The total dry weights of plants in the control CK20, S. pasteuri X1 and A. tumefaciens X2 treatments were 0.85, 1.13, and 1.38 g/pot, respectively. Compared with the control CK20 findings, the total dry weight of plants was increased by 32.8 and 61.1% after inoculation with S. pasteuri X1 and A. tumefaciens X2, respectively, indicating that A. tumefaciens X2 more strongly promoted the growth of Beta vulgaris var. cicla L. than S. pasteuri X1. In addition, inoculation with S. pasteuri X1 and A. tumefaciens X2 significantly (p < 0.05) promoted cadmium uptake by plants and improved the bioaccumulation of cadmium by the plants from the soil. Moreover, the inoculation of S. pasteuri X1 and A. tumefaciens X2 effectively facilitated the transfer of cadmium in the soil from the Fe-Mn oxide and residual fractions to the soluble plus exchangeable and weakly specially adsorbed fractions in the rhizosphere soils of plants. The bacterial enhancement of cadmium phytoavailability might provide a potential and promising method to increase the efficiency of phytoextraction. PMID:23488173

  1. Influence of Isoflavones on Cadmium-induced Adverse Effects in Vascular Endothelial Cells (ECV 304)

    Institute of Scientific and Technical Information of China (English)

    JUE CHEN; TAI-YI JIN

    2005-01-01

    Objective To study the possible intervention of isoflavones in cytotoxicity induced by cadmium in vascular endothelial cells. Methods An ECV 304 cell line derived from human umbilical vein endothelial cells was adopted. Genistein / daidzein was added prior to or simultaneously with CdCl2, cell viability was determined by MTT assay, and metallothionein mRNA expression was monitored by RT-PCR method. Results Cell viability was higher in isoflavone and CdCl2 co-treated groups than that in CdCl2 treated group, with CdCl2 concentration at 10, 20, 40, and 80 μmol/L, respectively. However this increase was not observed in the group treated with CdCl2 at a concentration of 60 μmol/L. Isoflavones (10-10 mol/L to 10-5 mol/L) were added 24 h before cells were challenged with 80 μmol/L CdCl2 for 24 h or simultaneously with 80 μmol/L CdCl2. Genistein increased cell viability only at 10-5 mol/L, while daidzein caused a dose-dependent increase from 10-10 mol/L to 10-5 mol/L in co-treatment with CdCl2. In pre-treatment, genistein (10-7 to 10-5 mol/L) increased cell viability whereas only 10-5 mol/L of daidzein exerted protection. Apparent protection could be found when the cells were pre-treated with 10-5 mol/L isoflavones for over 12 h, whereas 24 h incubation was required in such a co-treatment, with the exception of daidzein that had a significant protection in only 3 h. Isoflavones (10-6 mol/L) incubated for 3 h to 24 h, increased MT IIA and MT IF mRNA expression, but the induction could not last for more than 24 h. Co-treatment with isoflavones could induce an additional induction of MT IIA mRNA expression in cells exposed to cadmium. However, the additional induction of MT IIA and MT IF mRNA was not seen when pre-treatment was carried out with isoflavones, with the exception of an increase in MT IIA mRNA expression in the daidzein pre-treated group. Conclusion Genistein/daidzein could reverse the cytotoxicity of cadmium either in pre-treatment or in co-treatment. The

  2. Impact of iron status on cadmium uptake in suckling piglets

    International Nuclear Information System (INIS)

    Low iron status is known to increase the uptake of dietary cadmium in both adolescents and adults and there are indications that cadmium is absorbed from the intestine by the two major iron transporters divalent metal transporter 1 (DMT1) and ferroportin 1 (FPN1). In addition, it has been suggested that duodenal metallothionein (MT) may limit the transport of cadmium across the intestinal epithelium. The present investigation was undertaken to examine whether iron status influences cadmium absorption in newborns by applying a model of suckling piglets and the possible roles of duodenal DMT1, FPN1 and MT. An oral cadmium dose (20 μg/kg body weight) was given daily for 6 consecutive days on postnatal days (PNDs) 10-15 to iron-deficient or iron-supplemented piglets. The cadmium dose was chosen to keep the cadmium level at a realistically low but still detectable level, and without inducing any adverse health effects in the piglets. As indicators of cadmium uptake, cadmium levels in blood and kidneys were measured on PND 16 by inductively coupled plasma-mass spectrometry (ICP-MS). Cadmium levels in blood were statistically significantly correlated with cadmium levels in kidneys. The cadmium uptake was not higher in iron-deficient suckling piglets; rather, we detected a higher cadmium uptake in the iron-supplemented ones. The expression and localisation of DMT1, FPN1 and MT were not affected by iron status and could therefore not explain the findings. Our results suggest that there are developmental differences in the handling of both iron and cadmium in newborns as compared to adults

  3. Accumulation of cadmium by transgenic tobacco

    Czech Academy of Sciences Publication Activity Database

    Macek, Tomáš; Macková, M.; Pavlíková, D.; Száková, J.; Truks, M.; Singh Cundy, A.; Kotrba, P.; Yancey, N.; Scouten, W. H.

    2002-01-01

    Roč. 22, 1/2 (2002), s. 101-106. ISSN 0138-4988 R&D Projects: GA ČR GA526/02/0293 Institutional research plan: CEZ:AV0Z4055905 Keywords : phytoremediation * cadmium Subject RIV: CE - Biochemistry Impact factor: 0.542, year: 2002

  4. Cadmium isotope variations in the Southern Ocean

    NARCIS (Netherlands)

    Xue, Z.; Rehkämper, M.; Horner, T.J.; Abouchami, W.; Middag, R.; van de Flierd, T.; de Baar, H.J.W.

    2013-01-01

    Cadmium concentrations and isotope compositions were determined for 47 seawater samples from the high nutrient low chlorophyll (HNLC) zone of the Atlantic sector of the Southern Ocean. The samples include 13 surface waters from a transect of the Weddell Gyre and 3 depth profiles from the Weddell Sea

  5. Physicochemical properties of a cadmium telluride surface

    International Nuclear Information System (INIS)

    Change of chemical state of cadmium telluride surface is investigated after different treatments (exposure in air, vacuum, gaseous media, γ- and IR-irradiation). The results of these investigations are of great interest for clarifying the nature of active surface of diamond-like semiconductors, the mechanism of its interaction with different media and the possibilities of surface properties regulation

  6. The effect of cadmium on plant metabolism

    Czech Academy of Sciences Publication Activity Database

    Pavlíková, D.; Pavlík, Milan; Vokáč, Karel; Balík, J.; Szaková, J.; Tlustoš, P.

    Budapest : Institute of Materials and Environmental Chemistry, 2006. s. 71. [International Symposium on Trace Element in the Food Chain . 25.05.2006-27.05.2006, Budapest] Institutional research plan: CEZ:AV0Z40550506 Keywords : cadmium * plant metabolism * glutamate kinase Subject RIV: DK - Soil Contamination ; De-contamination incl. Pesticides

  7. The effect of cadmium on plant metabolism

    Czech Academy of Sciences Publication Activity Database

    Pavlíková, D.; Pavlík, Milan; Vokáč, Karel; Staszková, L.; Balík, J.; Szaková, J.; Tlustoš, P.

    Budapest : Institute of Materials and Environmental Chemistry, 2006 - (Szilágyi, M.; Szentmihályi, K.), 256-260 [Trace Elements in the food chain . Budapest (HU), 25.05.2006-27.05.2006] Institutional research plan: CEZ:AV0Z40550506 Keywords : cadmium * plant metabolism * glutamate kinase Subject RIV: DK - Soil Contamination ; De-contamination incl. Pesticides

  8. Cadmium phytoextraction potential of different Alyssum species

    International Nuclear Information System (INIS)

    Highlights: ► The possibility of using serpentine plants for phytoextraction of Cd was investigated. ► Variation in Cd tolerance, accumulation and translocation in three Alyssum plants with different phenotypes were found. ► Alyssum montanum showed higher Cd tolerance and accumulation than the Ni hyperaccumulator Alyssum bertolonii. ► As for the kinetic parameters of the Cd uptake system, A. montanum presented a low apparent Km value. ► The Vmax values were not significantly different among the plants. - Abstract: This work was planned for providing useful information about the possibility of using serpentine adapted plants for phytoextraction of cadmium, element scarcely represented in such metalliferous environment. To this aim, we investigated variation in cadmium tolerance, accumulation and translocation in three Alyssum plants with different phenotypes: Alyssum bertolonii, that is a serpentine endemic nickel hyperaccumulator, and two populations of Alyssum montanum, one adapted and one not adapted to serpentine soils. Plants were hydroponically cultivated in presence of increasing concentrations of CdSO4 for two weeks. For the metal concentration used in the experiments, the three different Alyssum populations showed variation in cadmium tolerance, accumulation and content. The serpentine adapted population of A. montanum showed statistically higher cadmium tolerance and accumulation than A. bertolonii and the population of A. montanum not adapted to serpentine soil thus deserving to be investigated for phytoextraction purposes. Furthermore, as for the kinetic parameters of the cadmium uptake system, A. montanum serpentine population presented a low apparent Km value, suggesting a high affinity for this metal of its uptake system, whereas the Vmax values were not significantly different among the plants. Present data revealed metallicolous plants are also suitable for the phytoremediation of metals underrepresented in the environment of their initial

  9. Cadmium and Chrome Concentrations in Human Milk

    Directory of Open Access Journals (Sweden)

    Sima Nazarpour

    2014-04-01

    Full Text Available Introduction: Nutrition of children has the highest priority in any program aimed at children's health care. Milk contaminated with various toxic elements can have adverse effects on children's health. This study aimed to determine the concentration of heavy metals including cadmium(Cd and chromium (Cr of breast feeding women’s milk in Varamin. Methods: This is a cross sectional study. In the present study, chromium and cadmium levels in milk of 100 mothers attending clinics in the city of Varamin were measured in four to eight weeks after delivery, using atomic absorption spectrometry. Results: The mean values (±SD of Cd and Cr in human milk were 5±6.9 μg/ml and 3±2.7 μg/ml respectively. Result of Linear regression showed that cadmium levels were higher in breast milk of people living close to the factory or industrial center. Also, the chromium levels were higher in the breast milk of women in cases of: Smoking by spouses, consumption of imported rice, consumption of mineral water, and living close to the factory or an industrial center. Conclusion: This study showed that the relationship of some factors such as living near a factory or an industrial center, smoking by spouse, the type of consumed rice and water, with the level of cadmium and chromium. Cadmium and chromium levels of breast milk in this study were higher than the levels of these elements mentioned in the reviewed articles and international standard. Because some variables, such as living near a factory or an industrial center, smoking by spouse, the type of consumed rice and water can affect the amount of entering elements in breast milk. Actions can be taken to reduce or eliminate these variables in order to decrease the mentioned elements in human milk.

  10. Cadmium phytoextraction potential of different Alyssum species

    Energy Technology Data Exchange (ETDEWEB)

    Barzanti, R., E-mail: rbarzanti@supereva.it [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Colzi, I., E-mail: ilariacolzi@hotmail.it [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Arnetoli, M., E-mail: miluscia@gmail.com [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Gallo, A., E-mail: galloalessia@hotmail.com [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Pignattelli, S., E-mail: sara.pignattelli@gmail.com [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Gabbrielli, R., E-mail: gabbrielli@unifi.it [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy); Gonnelli, C., E-mail: cristina.gonnelli@unifi.it [Department of Evolutionary Biology, Universita di Firenze, via Micheli 1, 50121 Firenze (Italy)

    2011-11-30

    Highlights: Black-Right-Pointing-Pointer The possibility of using serpentine plants for phytoextraction of Cd was investigated. Black-Right-Pointing-Pointer Variation in Cd tolerance, accumulation and translocation in three Alyssum plants with different phenotypes were found. Black-Right-Pointing-Pointer Alyssum montanum showed higher Cd tolerance and accumulation than the Ni hyperaccumulator Alyssum bertolonii. Black-Right-Pointing-Pointer As for the kinetic parameters of the Cd uptake system, A. montanum presented a low apparent K{sub m} value. Black-Right-Pointing-Pointer The V{sub max} values were not significantly different among the plants. - Abstract: This work was planned for providing useful information about the possibility of using serpentine adapted plants for phytoextraction of cadmium, element scarcely represented in such metalliferous environment. To this aim, we investigated variation in cadmium tolerance, accumulation and translocation in three Alyssum plants with different phenotypes: Alyssum bertolonii, that is a serpentine endemic nickel hyperaccumulator, and two populations of Alyssum montanum, one adapted and one not adapted to serpentine soils. Plants were hydroponically cultivated in presence of increasing concentrations of CdSO{sub 4} for two weeks. For the metal concentration used in the experiments, the three different Alyssum populations showed variation in cadmium tolerance, accumulation and content. The serpentine adapted population of A. montanum showed statistically higher cadmium tolerance and accumulation than A. bertolonii and the population of A. montanum not adapted to serpentine soil thus deserving to be investigated for phytoextraction purposes. Furthermore, as for the kinetic parameters of the cadmium uptake system, A. montanum serpentine population presented a low apparent K{sub m} value, suggesting a high affinity for this metal of its uptake system, whereas the V{sub max} values were not significantly different among the

  11. The characterization of rhodium-105 (105RhCl3) for therapeutic applications

    International Nuclear Information System (INIS)

    Rhodium-105 (105Rh) is one of the radioisotopes that has favourable physical characteristics for therapy, i.e. as β-particles emitter having t1/2 = 35.4 h, Eβ = 247 keV (30%) and 560 keV (70%). In addition to the β - particles, 105Rh also emits γ - rays of 306 keV (5%) and 319 keV (19%). Those energies range are also suitable for imaging during therapeutic applications. The physical and chemical characteristics of 105Rh (105RhCl3) had been studied. It consists of: pH, solution clarity, the radiochemical purity that was determined by paper chromatography and paper electrophoresis techniques, the activity as well as radionuclidic purity that were determined by using multi channel γ-ray spectrometer (MCA), the chemical purity was analyzed by determination the unreacted target (104Ru) concentration using spot test method, and finally the physical and chemical stabilities. The obtained solution of 105RhCl3 having the radiochemical purity of 98.61 ± 0.53% and radionuclidic purity more than 95% (99.78 ± 0.03%). The solution has the pH of 1.5 - 2, clear, with the activity of 35 - 60 mCi, radioactive concentration of 7 - 12 mCi/mL and the concentration of unirradiated 104Ru was less than 50 ppm. Stability evaluation indicated that 105RhCl3 solution was still stable for 6 days at room temperature with the radiochemical purity more than 95%. (author)

  12. Cadmium-induced fetal toxicity in the rat

    International Nuclear Information System (INIS)

    Cadmium, a heavy metal environment contaminant, induces fetal death and placental necrosis in the Wistar rat. This study investigated fetal, maternal, and placental responses to cadmium intoxication. Subcutaneous injection of CdCl2 to dams on day 18 of pregnancy produced a high incidence of fetal death (75%) and placental necrosis. Death in the fetus was produced despite limited fetal accumulations of cadmium. Distribution studies using 109Cd-labeled CdCl2 demonstrated that less than 0.1% of the injected dose was associated with the fetus. To determine if fetuses were sensitive to these low levels of cadmium, direct injections of CdCl2 into fetuses were performed in utero. Direct injections produced fetal accumulations 8-fold greater than those following maternal injections. The 8-fold greater fetal accumulations following direct injection were associated with only a 12% fetal mortality compared to the 75% mortality following maternal injections. The data indicated that the fetal toxicity of cadmium following maternal injections was not the result of direct effects of cadmium on the fetus. In conclusion, cadmium-induced fetal death was not the result of direct effects of cadmium on the fetus but may have been induced by placental cellular injury resulting from high accumulations of cadmium in the placenta. A vascular response to placental injury, leading to decreased utero-placental bood flow and cadmium-induced alterations in trophoblastic function, resulted in fetal death

  13. Cadmium and lead elimination through milk in the ewe

    Energy Technology Data Exchange (ETDEWEB)

    Houpert, P.; Mehennaoui, S.; Federspiel, B.; Milhaud, G. [Equipe associee INRA-ENV Alfort, 94 - Maisons-Alfort (France)

    1997-12-31

    Cadmium and lead are heavy metals widely distributed in industrialized countries, and known for their cumulative properties in continental ecological cycling. The purpose of the experiments was to study lead and cadmium transfer from ewe feed to their milk and meat, in view of protecting human consumers. Ewes were given daily oral administrations of lead, cadmium or associations of lead-cadmium, lead-cadmium-zinc for 52 days. Lead and cadmium were measured in blood, milk and tissues. About 0.1 pc of the total lead and 0.002-0.004 pc of the total cadmium dose was excreted via milk during the lactation, with milk concentrations of about 120 microgram per liter for lead and about 3.5 micro-g./l for cadmium. Sixty days after the last administration, 0.16 pc of the total cadmium dose was retained in liver and 0.09 pc in kidneys. Cadmium and lead concentrations in the muscle remained low

  14. Modelling of Cadmium Transport in Soil-Crop System

    Institute of Scientific and Technical Information of China (English)

    2000-01-01

    A model for simulating cadmium transport in a soil-plant system was built using a commercial simu lating program named Powersim on the basis of input-output processes happening in the soil-plant system.Convective and dispersive transport processes of cadmium in soil profile are embedded. Simulations on a daily base have been done up to a total simulating time of 250 years. Results show that applications of sewage sludge and fertilizer at the simulated rates would only cause slight cadmium accumulations in each layer of the soil, and cadmium accumulation would be levelling off, reaching an equilibrium concentrations layer by layer downward after certain time. The time scale to reach an equilibrium concentration varies from 10 years for the top three layers to over 250 years for the bottom layers. Plant cadmium uptake would increase from 52 ug m-2 under initial soil cadmium concentrations to 65 μg m-2 under equilibrium soil cadmium concentrations, which would not exceed the maximum allowable cadmium concentration in wheat grains. Main parameters which influence cadmium accumulation and transport in soil are total cadmium input, rainfall, evaporation, plant uptake and soil properties.

  15. Accumulation of cadmium in livers and kidneys in Greenlanders

    International Nuclear Information System (INIS)

    In the Arctic, the traditional diet exposes its people to a very high intake of cadmium because it is highly concentrated in the liver and kidneys of commonly eaten marine mammals. In one study in Greenland, the cadmium intake was estimated to 182 μg/day/person in the fall and 346 in the spring. To determine whether the cadmium is accumulated in humans, we analyzed autopsy samples of liver and kidneys from 95 ethnic Greenlanders (aged 19-89) who died from a wide range of causes. The cadmium concentration in liver (overall mean 1.97 μg/g wet wt) appeared to be unrelated to any particular age group, whereas the concentrations in the kidneys peaked in Greenlanders between 40 and 50 years of age (peak concentration 22.3 μg/g wet wt). Despite the high cadmium levels in the typical Greenlander diet, we found that the cadmium concentrations in livers and kidneys were comparable to those reported from Denmark, Sweden, Australia and Great Britain. Furthermore, even though the mean cadmium intake from the diet was estimated to be 13-25 times higher in Greenlanders than in Danes, we found similar cadmium levels in the kidneys of both. Seal livers and kidneys are the main source of cadmium in the diet of Greenlanders, but these tissues are not eaten in Denmark. Thus, our results suggest that the accumulation of cadmium from Greenlander's marine diet is very low

  16. 34 CFR 105.10 - Self-evaluation.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 1 2010-07-01 2010-07-01 false Self-evaluation. 105.10 Section 105.10 Education... DEPARTMENT OF EDUCATION § 105.10 Self-evaluation. (a) The Department shall, within one year of the effective... organizations representing individuals with handicaps to participate in the self-evaluation process...

  17. 41 CFR 105-57.007 - Certification by employer.

    Science.gov (United States)

    2010-07-01

    ... employer. 105-57.007 Section 105-57.007 Public Contracts and Property Management Federal Property... Administration 57-ADMINISTRATION WAGE GARNISHMENT § 105-57.007 Certification by employer. The employer must complete and return the SF 329D (Employer Certification) to GSA within the time frame prescribed in...

  18. 46 CFR 105.25-10 - Cargo pumping installation.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Cargo pumping installation. 105.25-10 Section 105.25-10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CARGO AND MISCELLANEOUS VESSELS... Installed Below Decks § 105.25-10 Cargo pumping installation. (a) Cargo pumps shall not be installed in...

  19. 14 CFR 120.105 - Employees who must be tested.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 3 2010-01-01 2010-01-01 false Employees who must be tested. 120.105 Section 120.105 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION... ALCOHOL TESTING PROGRAM Drug Testing Program Requirements § 120.105 Employees who must be tested....

  20. 42 CFR 56.105 - Accord with health planning.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Accord with health planning. 56.105 Section 56.105... HEALTH SERVICES General Provisions § 56.105 Accord with health planning. A grant may be made under this... appropriate health planning agencies have been met....

  1. 5 CFR 180.105 - Claims not allowed.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Claims not allowed. 180.105 Section 180.105 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS EMPLOYEES' PERSONAL PROPERTY CLAIMS § 180.105 Claims not allowed. (a) A claim is not allowable if: (1) The damage...

  2. 49 CFR 229.105 - Steam generator number.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Steam generator number. 229.105 Section 229.105..., DEPARTMENT OF TRANSPORTATION RAILROAD LOCOMOTIVE SAFETY STANDARDS Safety Requirements Steam Generators § 229.105 Steam generator number. An identification number shall be marked on the steam...

  3. 18 CFR 1300.105 - National origin harassment.

    Science.gov (United States)

    2010-04-01

    ... harassment. 1300.105 Section 1300.105 Conservation of Power and Water Resources TENNESSEE VALLEY AUTHORITY STANDARDS OF CONDUCT FOR EMPLOYEES OF TENNESSEE VALLEY AUTHORITY § 1300.105 National origin harassment. It... national origin harassment. Accordingly, all employees must avoid any action or conduct which could...

  4. 28 CFR 34.105 - Peer review methods.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Peer review methods. 34.105 Section 34.105 Judicial Administration DEPARTMENT OF JUSTICE OJJDP COMPETITION AND PEER REVIEW PROCEDURES Peer Review § 34.105 Peer review methods. (a) For both competitive and noncompetitive applications,...

  5. 41 CFR 105-8.130 - General prohibitions against discrimination.

    Science.gov (United States)

    2010-07-01

    ... against discrimination. 105-8.130 Section 105-8.130 Public Contracts and Property Management Federal... § 105-8.130 General prohibitions against discrimination. (a) No qualified individual with handicaps... otherwise be subjected to discrimination under any program or activity conducted by the agency. (1)...

  6. 36 CFR 1192.105 - Priority seating signs.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Priority seating signs. 1192.105 Section 1192.105 Parks, Forests, and Public Property ARCHITECTURAL AND TRANSPORTATION BARRIERS... Commuter Rail Cars and Systems § 1192.105 Priority seating signs. (a) Each car shall contain sign(s)...

  7. 49 CFR 38.105 - Priority seating signs.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Priority seating signs. 38.105 Section 38.105 Transportation Office of the Secretary of Transportation AMERICANS WITH DISABILITIES ACT (ADA) ACCESSIBILITY SPECIFICATIONS FOR TRANSPORTATION VEHICLES Commuter Rail Cars and Systems § 38.105 Priority seating signs....

  8. 46 CFR 111.105-41 - Battery rooms.

    Science.gov (United States)

    2010-10-01

    ... REQUIREMENTS Hazardous Locations § 111.105-41 Battery rooms. Each electrical installation in a battery room must meet 46 CFR subpart 111.15 and IEEE 45-1998 (incorporated by reference; see 46 CFR 110.10-1). ... 46 Shipping 4 2010-10-01 2010-10-01 false Battery rooms. 111.105-41 Section 111.105-41...

  9. 41 CFR 105-53.130 - Office of the Administrator.

    Science.gov (United States)

    2010-07-01

    ... Administrator. 105-53.130 Section 105-53.130 Public Contracts and Property Management Federal Property... FUNCTIONS Central Offices § 105-53.130 Office of the Administrator. The Administrator of General Services... assigned to the General Services Administration. The Deputy Administrator, who is appointed by...

  10. 41 CFR 105-72.401 - Insurance coverage.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Insurance coverage. 105-72.401 Section 105-72.401 Public Contracts and Property Management Federal Property Management... § 105-72.401 Insurance coverage. Recipients shall, at a minimum, provide the equivalent...

  11. 49 CFR 105.25 - Reviewing public documents.

    Science.gov (United States)

    2010-10-01

    ... information available to you: (i) Appeals under 49 CFR part 107 and PHMSA's decisions issued in response to... 49 Transportation 2 2010-10-01 2010-10-01 false Reviewing public documents. 105.25 Section 105.25... § 105.25 Reviewing public documents. PHMSA is required by statute to make certain documents...

  12. 24 CFR 583.105 - Grants for acquisition and rehabilitation.

    Science.gov (United States)

    2010-04-01

    ... rehabilitation. 583.105 Section 583.105 Housing and Urban Development Regulations Relating to Housing and Urban....105 Grants for acquisition and rehabilitation. (a) Use. HUD will grant funds to recipients to: (1) Pay... supportive services; (2) Pay a portion of the cost of rehabilitation of structures, including...

  13. 18 CFR 381.105 - Method of payment.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Method of payment. 381.105 Section 381.105 Conservation of Power and Water Resources FEDERAL ENERGY REGULATORY COMMISSION, DEPARTMENT OF ENERGY REVISED GENERAL RULES FEES General Provisions § 381.105 Method of payment. Fee...

  14. 46 CFR 111.105-35 - Vessels carrying coal.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Vessels carrying coal. 111.105-35 Section 111.105-35...-GENERAL REQUIREMENTS Hazardous Locations § 111.105-35 Vessels carrying coal. (a) The following are Class II, Division 1, (Zone 10 or Z) locations on a vessel that carries coal: (1) The interior of each...

  15. 40 CFR 133.105 - Treatment equivalent to secondary treatment.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 21 2010-07-01 2010-07-01 false Treatment equivalent to secondary treatment. 133.105 Section 133.105 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) WATER PROGRAMS SECONDARY TREATMENT REGULATION § 133.105 Treatment equivalent to secondary...

  16. 41 CFR 105-60.305-10 - Fee schedule.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Fee schedule. 105-60.305-10 Section 105-60.305-10 Public Contracts and Property Management Federal Property Management..., Orders, Policies, Interpretations, Manuals, and Instructions § 105-60.305-10 Fee schedule. (a) When...

  17. 41 CFR 105-56.005 - Employee response.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Employee response. 105-56.005 Section 105-56.005 Public Contracts and Property Management Federal Property Management... General Services Administration Employees § 105-56.005 Employee response. (a) Voluntary...

  18. 10 CFR 52.105 - Transfer of combined license.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 2 2010-01-01 2010-01-01 false Transfer of combined license. 52.105 Section 52.105 Energy NUCLEAR REGULATORY COMMISSION (CONTINUED) LICENSES, CERTIFICATIONS, AND APPROVALS FOR NUCLEAR POWER PLANTS Combined Licenses § 52.105 Transfer of combined license. A combined license may be transferred...

  19. 41 CFR 105-1.000-50 - Scope of part.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Scope of part. 105-1.000-50 Section 105-1.000-50 Public Contracts and Property Management Federal Property Management Regulations System (Continued) GENERAL SERVICES ADMINISTRATION 1-INTRODUCTION § 105-1.000-50 Scope of...

  20. 46 CFR 105.35-15 - Fire hose.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Fire hose. 105.35-15 Section 105.35-15 Shipping COAST... VESSELS DISPENSING PETROLEUM PRODUCTS Fire Extinguishing Equipment § 105.35-15 Fire hose. (a) One length of fire hose shall be provided for each fire hydrant required. (b) Fire hose may be commercial...

  1. 46 CFR 105.35-5 - Fire pumps.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Fire pumps. 105.35-5 Section 105.35-5 Shipping COAST... VESSELS DISPENSING PETROLEUM PRODUCTS Fire Extinguishing Equipment § 105.35-5 Fire pumps. (a) All vessels shall be provided with a hand operated portable fire pump having a capacity of at least 5 gallons...

  2. 10 CFR 436.105 - Emergency conservation plan.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 3 2010-01-01 2010-01-01 false Emergency conservation plan. 436.105 Section 436.105 Energy DEPARTMENT OF ENERGY ENERGY CONSERVATION FEDERAL ENERGY MANAGEMENT AND PLANNING PROGRAMS Guidelines for General Operations Plans § 436.105 Emergency conservation plan. (a) Each agency...

  3. 33 CFR 105.220 - Drill and exercise requirements.

    Science.gov (United States)

    2010-07-01

    ...) Exercises are a full test of the security program and must include substantial and active participation of.... 105.220 Section 105.220 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY MARITIME SECURITY MARITIME SECURITY: FACILITIES Facility Security Requirements § 105.220 Drill and...

  4. Patterns of gene expression in carp liver after exposure to a mixture of waterborne and dietary cadmium using a custom-made microarray

    International Nuclear Information System (INIS)

    Gene expression changes in carp liver tissue were studied after acute (3 and 24 h) and subchronic (7 and 28 days) exposure to a mixture of waterborne (9, 105 and 480 μg/l) and dietary (9.5, 122 and 144 μg/g) cadmium, using a custom-made microarray. Suppression subtractive hybridization-PCR (SSH-PCR) was applied to isolate a set of 643 liver genes, involved in multiple biological pathways, such as energy metabolism (e.g. glucokinase), immune response (e.g. complement C3) and stress and detoxification (e.g. cytochrome P450 2F2, glutathione-S-transferase pi). These genes were subsequently spotted on glass-slides for the construction of a custom-made microarray. Resulting microarray hybridizations indicated a highly dynamic response to cadmium exposure. At low exposure concentrations (9 μg/l through water and 9.5 μg/g dry weight through food) mostly energy-related genes (e.g. glucokinase, elastase) were influenced, while a general stress response was obvious through induction of several stress-related genes, including hemopexin and cytochrome P450 2F2, at high cadmium concentrations. In addition, fish exposed to the highest cadmium concentrations showed liver damage after 7 days of exposure, as measured by elevated alanine transaminase activity in plasma and increased liver water content (wet-to-dry weight ratio). Moreover, decreased hematocrit and growth were found at the end of the experiment. Altogether this study clearly demonstrated the importance of varying exposure conditions for the characterization of the molecular impact of cadmium and showed that microarray results can provide important information, required to unravel the molecular events and responses related to cadmium exposure

  5. Cadmium uptake in oyster isognomon alatus under laboratory condition

    International Nuclear Information System (INIS)

    The uptake of cadmium in Flat tree oyster Isognomon alatus was investigated under controlled laboratory conditions for two weeks. Oysters were exposed to 100 μg 1'-1 cadmium and the accumulation of cadmium in the tissues was measured for every two days. Soft tissues of oyster were digested in concentrated acid and cadmium concentrations were determined by using Atomic Absorption Spectrophotometer. The accumulation of cadmium in the soft tissues of oysters was increased during the first six days from 0.73 μg g- 1 to 10.77 μg g'-1, and remaining constant for four days at average level of 10.96 μg g'-1. The Cl concentrations was increased to 32.70 μg g'-1 until the end of experiment. There was no sign of cadmium accumulation approaching saturation for the period of exposure. (author)

  6. Study on electrokinetic remediation of cadmium contaminated soils

    Institute of Scientific and Technical Information of China (English)

    SHI Wen-xin; CUI Chong-wei; YU Shui-li; FENG Wei-ming

    2007-01-01

    Kaolinite from a lead-zinc mining district, which was spiked with cadmium, has been treated by electrokinetics to investigate effects of treatment time and applied voltage gradient. The results showed that the increased test duration had induced a higher removal rate of cadmium. Being treated for 7 days, cadmium was removed from kaolinite dramatically. It was also found that higher removal rate happened when a higher voltage gradient was applied and cadmium accumulated near the cathode because pH increased. Increase of pH near the cathode caused accumulation of cadmium. Moreover, it was observed that cation exchange membrane which was placed between kaolinite and cathode could make pH lower than the initial value and avoid the higher pH near the cathode. As a result, the high concentration accumulation of cadmium near the cathode was avoided.

  7. Assessment and management of risk to wildlife from cadmium

    International Nuclear Information System (INIS)

    Cadmium, a nonessential heavy metal that comes from natural and anthropogenic sources, is a teratogen, carcinogen, and a possible mutagen. Assessment of potential risk from cadmium requires understanding environmental exposure, mainly from ingestion, although there is some local exposure through inhalation. Chronic exposure is more problematic than acute exposure for wildlife. There is evidence for bioaccumulation, particularly in freshwater organisms, but evidence for biomagnification up the food chain is inconsistent; in some bird studies, cadmium levels were higher in species that are higher on the food chain than those that are lower. Some freshwater and marine invertebrates are more adversely affected by cadmium exposure than are birds and mammals. There is very little experimental laboratory research on the effects of cadmium in amphibians, birds and reptiles, and almost no data from studies of wildlife in nature. Managing the risk from cadmium to wildlife involves assessment (including ecological risk assessment), biomonitoring, setting benchmarks of effects, regulations and enforcement, and source reduction

  8. Research and Development of Cadmium Sulphoselenide Red Pigment

    Institute of Scientific and Technical Information of China (English)

    WU Jianfeng; LI Kun; XU Xiaohong; ZHANG Yaxiang; XU Xiaoyang; LAO Xinbin

    2015-01-01

    Cadmium sulphoselenide was synthesized continuous substitution solid solution and the only known pigment to yield bright red color on ceramic decoration. Encapsulated cadmium sulphoselenide pigments could yield abundant hues from yellow to red with high opacity at high temperature. The color generation has a linear function relation with the substitution rate. The encapsulation formation process of zirconium silicate encapsulated cadmium sulphoselenide was shown. Insufifcient encapsulation efifciency and potential hazard to human and environment had limited the industrial application of cadmium sulphoselenide red pigment. Ink-jet printing decoration required ifne size cadmium sulphoselenide red pigment on ceramic decoration. The review mainly focused on the synthesis techniques and industrial application of cadmium sulphoselenide red pigment.

  9. Cadmium filtered neutron flux determination. Comparison of activation methods

    International Nuclear Information System (INIS)

    Neutron fluxes under cadmium filters are determined by the cadmium ratio and sandwich activation methods. The thermal neutron flux levels obtained with 7 detectors of different kinds: In, Au, Ag, W, Co, Mn, Zn are compared. The cadmium ratio method was used in locations for which the epithermal and thermal neutron flux ratio are quite different. By irradiating materials under different thicknesses of cadmium it was possible to establish experimental curves from which the flux depression factors for intermediate neutrons may be determined whatever the thickness of the filter used. Whereas the cadmium ratio method can only measure the mean flux above the cadmium cut-off energy the sandwich method enables the flux value to be determined in a narrow band around the resonance energy of each detector used

  10. In search of biomonitors for cadmium: cadmium content of wild Swedish fauna during 1973-1976.

    Science.gov (United States)

    Frank, A

    1986-12-01

    Forty-five species of birds and 22 species of mammals of the terrestrial and aquatic fauna, herbivores as well as carnivores, were investigated during the period 1973-1976 for cadmium-accumulating properties in order to find biomonitors for cadmium in the Swedish environment. The herbivores of the terrestrial fauna, birds as well as mammals, are preferred to carnivores, since they demonstrate generally higher renal Cd levels. The moose (Alces alces), roe deer (Capreolus capreolus) and hare (Lepus europeus and Lepus timidus) were found to be suitable as biomonitors because of their common occurrence and uniform geographical distribution. The eider duck (Somateria mollissima), although a short-distance migrating bird whose diet is composed mainly of mussels and crustaceans, and which lives along a great part of the Swedish coastline, is suggested as a biomonitor of cadmium for the aquatic environment. The accumulation rate of cadmium in the kidneys is rapid. Renal levels of cadmium in the parts per million range are reached 10 weeks after hatching. Juvenile birds should be collected for monitoring purposes before leaving their feeding domains at the end of the summer. PMID:3810147

  11. Growth of cadmium oxide whiskers on cadmium sulphide single crystals with copper as growth activator

    International Nuclear Information System (INIS)

    Some results on the growth and morphology of cadmium oxide whiskers, obtained on cadmium sulphide single crystals with copper as a growth activator, are presented in this work. Cadmium oxide whiskers have been obtained on brace 112-bar0 brace faces of cadmium sulphide plates with a copper layer deposited in advance. The whiskers grew during the annealing of the plates in a weak stream of technically pure argon at temperatures 670 to 730 deg C for 15 min to 3.5 h. Details about the procedure have been given elsewhere. The composition and morphology of the whiskers have been studied by an X-ray microanalyser JEOL 35 DDS and a scanning electron microscope JEOL, JSM 35. The optical microscopic observations have shown that after annealing, a gray-black granular layer is formed on the cadmium sulphide single crystals and this layer can easily be separated from the crystal substrate. Under the granular layer the crystal is heavily damaged. The whiskers grow on the granular layer and they are coloured yellow-brown or red-brown. The maximum whisker length attains several hundreds of micrometres and in some cases up to 1 mm or more. (author)

  12. Growth of cadmium oxide whiskers on cadmium sulphide single crystals with copper as growth activator

    Energy Technology Data Exchange (ETDEWEB)

    Koparanova, N.; Simov, S. (Bylgarska Akademiya na Naukite, Sofia. Inst. po Fizika na Tvyrdoto Tyalo); Genchev, D. (Bylgarska Akademiya na Naukite, Sofia. Inst. za Yadrena Izsledvaniya i Yadrena Energetika); Metchenov, G. (Research Inst. of Criminalistics and Criminology, Sofia (Bulgaria))

    1985-02-01

    Some results on the growth and morphology of cadmium oxide whiskers, obtained on cadmium sulphide single crystals with copper as a growth activator, are presented in this work. Cadmium oxide whiskers have been obtained on brace 112-bar0 brace faces of cadmium sulphide plates with a copper layer deposited in advance. The whiskers grew during the annealing of the plates in a weak stream of technically pure argon at temperatures 670 to 730 deg C for 15 min to 3.5 h. Details about the procedure have been given elsewhere. The composition and morphology of the whiskers have been studied by an X-ray microanalyser JEOL 35 DDS and a scanning electron microscope JEOL, JSM 35. The optical microscopic observations have shown that after annealing, a gray-black granular layer is formed on the cadmium sulphide single crystals and this layer can easily be separated from the crystal substrate. Under the granular layer the crystal is heavily damaged. The whiskers grow on the granular layer and they are coloured yellow-brown or red-brown. The maximum whisker length attains several hundreds of micrometres and in some cases up to 1 mm or more.

  13. Urinary cadmium and mammographic density in premenopausal women.

    Science.gov (United States)

    Adams, Scott V; Newcomb, Polly A; Shafer, Martin M; Atkinson, Charlotte; Bowles, Erin J Aiello; Newton, Katherine M; Lampe, Johanna W

    2011-08-01

    Mammographic density (MD), a strong marker of breast cancer risk, is influenced by genetic, environmental, and hormonal factors. Cadmium, a persistent and widespread environmental pollutant, has been associated with risk of breast cancer, and laboratory evidence suggests cadmium is a carcinogen in the breast. We investigated the hypothesis that cadmium exposure is associated with higher MD. In a cross-sectional study of MD and urinary cadmium concentration, percentage MD (MD%) and Breast Imaging-Reporting and Data Systems (BI-RADS®) density category were determined from screening mammograms of 190 premenopausal women ages 40-45 years. Women completed a health questionnaire, and the cadmium content of spot urine samples was measured with inductively coupled plasma mass spectrometry and corrected for urine creatinine. Urinary cadmium concentrations are thought to reflect exposure to cadmium during a period of 20-30 years. Multivariable linear regression and logistic regression were used to estimate the strength of association between urinary cadmium and mammographic breast density. Adjusted mean MD% among women in the upper tertile of creatinine-corrected urinary cadmium was 4.6% higher (95% CI: -2.3 to 11.6%) than in women in the lowest cadmium tertile. Each twofold increase in urinary cadmium was associated with higher odds of MD% in the upper tertile (OR: 1.29, 95% CI: 0.82-2.02) or a BI-RADS category rating of "extremely dense" (OR: 1.75, 95% CI: 1.14-2.70). Stronger associations were observed among nulliparous women, and current or former smokers. Exposure to cadmium may be associated with increased breast density in premenopausal women. PMID:21327468

  14. The effects of low environmental cadmium exposure on bone density

    International Nuclear Information System (INIS)

    Recent epidemiological data indicate that low environmental exposure to cadmium, as shown by cadmium body burden (Cd-U), is associated with renal dysfunction as well as an increased risk of cadmium-induced bone disorders. The present study was designed to assess the effects of low environmental cadmium exposure, at the level sufficient to induce kidney damage, on bone metabolism and mineral density (BMD). The project was conducted in the area contaminated with cadmium, nearby a zinc smelter located in the region of Poland where heavy industry prevails. The study population comprised 170 women (mean age=39.7; 18-70 years) and 100 men (mean age=31.9; 18-76 years). Urinary and blood cadmium and the markers of renal tubular dysfunction (β2M-U RBP, NAG), glomerular dysfunction (Alb-U and β2M-S) and bone metabolism markers (BAP-S, CTX-S) as well as forearm BMD, were measured. The results of this study based on simple dose-effect analysis showed the relationship between increasing cadmium concentrations and an increased excretion of renal dysfunction markers and decreasing bone density. However, the results of the multivariate analysis did not indicate the association between exposure to cadmium and decrease in bone density. They showed that the most important factors that have impact on bone density are body weight and age in the female subjects and body weight and calcium excretion in males. Our investigation revealed that the excretion of low molecular weight proteins occurred at a lower level of cadmium exposure than the possible loss of bone mass. It seems that renal tubular markers are the most sensitive and significant indicators of early health effects of cadmium intoxication in the general population. The correlation of urinary cadmium concentration with markers of kidney dysfunction was observed in the absence of significant correlations with bone effects. Our findings did not indicate any effects of environmental cadmium exposure on bone density.

  15. Evaluation of aluminium–based coatings for cadmium replacement

    OpenAIRE

    Chalaftris, George

    2003-01-01

    Cadmium electroplating is widely used in the aerospace industry for the corrosion protection of aircraft components like fasteners manufactured from non corrosion resisting high strength steels. However, environmental and safety concerns over the high toxicity of cadmium and its compounds have led to the investigation of suitable replacements. Alternatives to cadmium should offer effective corrosion protection and have no detrimental effects on the steel substrate. Hydrogen is known to be abs...

  16. Hepatotoxicity of Cadmium and Roles of Mitigating Agents

    Directory of Open Access Journals (Sweden)

    Elias Adikwu

    2013-12-01

    Full Text Available There are increasing reports on cadmium associated hepatotoxicity, due to these reports this study reviewed relevant literature on cadmium associated hepatotoxicity with emphasis on doses, route of administration, salt forms (cadmium compounds and the roles of mitigating agents. Reports have shown that continuous exposure of the liver to cadmium has led to hepatotoxicity. Humans are generally exposed to cadmium by two main routes, inhalation and ingestion. In this study, evaluation of relevant literature showed that irrespective of route of administration and salt forms cadmium hepatotoxicity is dose and time dependent. Cadmium associated hepatotoxicity manifested through impaired functions of hepatic biomarkers (transaminases, enzymatic and non enzymatic antioxidants. Histopathological damage to liver architecture manifested as swelling of hepatocytes, focal necrosis, hepatocytes degeneration, dilatation of ribosomes, damage of membrane-bounded lysosomes, nuclear pyknosis and cytoplasm vacuolization. Deterioration of mitochondrial cristae, deposition of collagen fibrils, hypertrophy of kuffer cells, congestion in central veins and sinusoids, infiltration of mixed inflammatory cells and peripheral hemorrhage also occurred. Hepatotoxic effect of cadmium was mitigated by Vitamin C, Vitamin E, Manganese (11 Chloride, N-acetylcysteine and Selenium. Extracts of plant origin including Solanum tuberosum, Calycopteris floribunda Hibiscus sabdariffa mitigated cadmium induced hepatotoxicity. Chemical substances of animal origin including honey and camel milk were reported to have ameliorated cadmium induced hepatotoxicity. One of the mechanisms of cadmium induced hepatotoxicity is reported to be associated with the up regulation of reactive oxygen species (oxidative stress which caused oxidative damage to lipid contents of membranes and direct liver injury. Conclusion cadmium is dose and time dependently hepatotoxic irrespective of route of administration

  17. Cadmium burden and the risk and phenotype of prostate cancer

    OpenAIRE

    Wu Tony T; Wu Hsi-Chin; Pu Yeong S; Chen Yi-Chun; Lai Ming; Yang Chun Y; Sung Fung-Chang

    2009-01-01

    Abstract Background Studies on the association between prostate cancer and cadmium exposure have yielded conflicting results. This study explored cadmium burden on the risk and phenotype of prostate cancer in men with no evident environmental exposure. Methods Hospital-based 261 prostate cancer cases and 267 controls with benign diseases were recruited from four hospitals in Taiwan. Demographic, dietary and lifestyle data were collected by standardized questionnaires. Blood cadmium (BCd) and ...

  18. Association of Environmental Cadmium Exposure with Pediatric Dental Caries

    OpenAIRE

    Arora, Manish; Weuve, Jennifer Lynn; Schwartz, Joel David; Wright, Robert O.

    2008-01-01

    Background: Although animal experiments have shown that cadmium exposure results in severe dental caries, limited epidemiologic data are available on this issue. Objectives: We aimed to examine the relationship between environmental cadmium exposure and dental caries in children 6–12 years of age. Methods: We analyzed cross-sectional data, including urine cadmium concentrations and counts of decayed or filled tooth surfaces, from the Third National Health and Nutrition Examination Survey. We ...

  19. Extraction-photometric determination of cadmium in meat products

    Energy Technology Data Exchange (ETDEWEB)

    Krylova, A.N.; Malyarova, M.A.; Zhulenko, V.N.

    1986-06-01

    As a result of industrial discharges, burning of solid and liquid fuels, and recycling of metal scrap, cadmium compounds enter the atmosphere and drop into the water and soil causing contamination. In this paper, a method was developed for determining cadmium in meat products. It involves wet ashing the sample, extractive separation of the cadmium as the diethyldithiocarbamate, reextraction, and determination as cadmium dithizonate or as a complex with 2,2'-dipyridyl. The detection limit with dithizone is 0.005 mg/kg and with 2,2'-dipyridyl 0.05 mg/kg. An analysis is shown to take less than 60 minutes.

  20. Effects of Cadmium on BMP Induced Bone Formation

    Institute of Scientific and Technical Information of China (English)

    陈秋生; 徐顺清

    2003-01-01

    To demonstrate the direct effects of cadmium on activities of bone morphogenetic protein (BMP), a complex containing BMP and cadmium chloride (CdCl2) was implanted beneath the abdominal skin of young male Wistar rats. The activity of BMP was studied by observing the histological changes, and measuring the activity of alkaline phosphatase (ALP) and acid phosphatase (ACP) and calcium content of the implants at different time points. Our results showed that during bone formation induced by BMP, cadmium inhibited the activities of osteoblasts and osteoclasts, and slowed the deposition of calcium. It is concluded that cadmium can directly affect biological activities of BMP directly.

  1. Bioremoval of cadmium by lemna minor in different aquatic conditions

    Energy Technology Data Exchange (ETDEWEB)

    Uysal, Yagmur [Dept. of Environmental Engineering, Kahramanmaras Sutcu Imam University, Kahramanmaras (Turkey); Taner, Fadime [Dept. of Environmental Engineering, Mersin University, Mersin (Turkey)

    2010-04-15

    This study was undertaken to determine the cadmium removal efficiency of Lemna minor when it was used for treatment of wastewater having different characteristics, i. e., pH, temperature and cadmium concentration. Plants were cultivated in different pH solutions (4.5-8.0) and temperatures (15-35 C) in the presence of cadmium (0.1-10.0 mg/L) for 168 h. The amount of biomass obtained in the study period, the concentrations of cadmium in the tissues and in the media and net uptake of cadmium by Lemna have been determined for each condition. The percentages of cadmium uptake (PMU) and bioconcentration factors (BCF) were also calculated. The highest accumulation was obtained for the highest cadmium concentration of 10.0 mg Cd/L as 11.668 mg Cd/g at pH 6.0, and as 38.650 mg Cd/g at 35 C and pH 5.0. The cadmium accumulation gradually increased with initial concentration of the medium, but the opposite trend was observed for the PMU. However, the maximum PMU was obtained as 52.2% in the solution with the lowest concentration of 0.1 mg Cd/L. A mathematical model was used to describe the cadmium uptake and the equation obtained was seen to fit the experimental data very well. (Abstract Copyright [2010], Wiley Periodicals, Inc.)

  2. Kinetic studies of cadmium sulfide precipitation from aqueous thiourea solutions

    International Nuclear Information System (INIS)

    Kinetics of cadmium sulfide precipitation by thiourea from aqueous solutions containing ammonia complexes of cadmium(II) under conditions of spontaneous initiation of solid phase within solution volume at temperatures of 298-318 K was studied. It was ascertained that the process activation energy is 77843 J/mol, while the reaction order by initial cadmium complex equals unity. Kinetic equation, which permits control over cadmium sulfide precipitation and preparation of CdS films of desired morphology was derived on the basis of the experimental data

  3. Cadmium elemination from phosphoric acid by ionic flotation

    International Nuclear Information System (INIS)

    The ion flotation process for the recovery of cadmium from wet phosphoric acid (30%P2O5) has been studied. This technique combines a chemical recation between the collector and the cadmium to form a precipitate (sublate) which is carried to the surface of the solution by air bubbles. the resulting foam containing the cadmium may then separated from solution. The influence of parameters such as collector and cadmium concentration as well as iron content have been investigated for the case a synthetic acid (30% P2O5). The result have been applied to the industrial phosphoric acid produced from Djebel Onk's phosphates (Algeria)

  4. Cadmium in milk and mammary gland in rats and mice

    International Nuclear Information System (INIS)

    The purpose of the present investigation was to study the uptake of cadmium in mammary tissue, effects on milk secretion and composition, and lactational transport of cadmium to the sucklings. Cadmium exposure during lactation resulted in retention of cadmium in the mammary tissue in mice and rats. The uptake of cadmium in the mammary tissue was rapid, as shown in lactating mice by whole-body autoradiography 4 h after an intravenous injection of a tracer dose of 109CdCl2. Retention of cadmium in kidneys of suckling pups was observed in the autoradiograms at 7 days after exposure of the dams. Lactating rats were intravenously infused with 109CdCl2 in 0.9% saline via osmotic minipumps from day 3 to day 16 after parturition. The cadmium dose given was 0, 8.8, 62 and 300 μg Cd/kg body wt. per day. Plasma and milk were collected at day 10 and 16 after parturition. Plasma cadmium levels in dams increased from day 10 to day 16. Cadmium levels were higher in milk than in plasma, with milk/plasma ratios varying from 2 to 6. Zinc levels in milk were positively correlated to cadmium levels in milk (r2=0.26; P=0.03). In milk, 109Cd was distributed in fat (46-52%), casein fraction (40-46%), and whey fraction (6-8%). There was a high correlation between cadmium concentrations in pups' kidney and cadmium concentrations in dam's milk (r2=0.98; P 109Cd was bound to metallothionein in mammary tissue. The fraction of radiolabelled cadmium bound to metallothionein increased in a dose-dependent manner in both the liver (88-98%) and mammary tissue (57-80%). The present results indicate a low transfer of cadmium to the suckling pup, which might be due to binding of cadmium to metallothionein in the mammary tissue. However, during the susceptible developmental period even a low cadmium exposure may be of concern. (orig.)

  5. Phytoremediation of cadmium contaminated soils by tuberose

    International Nuclear Information System (INIS)

    The potential of three varieties of tuberose (Prajwal, Shringar and Mexican single) for phytoremediation of soil contaminated with cadmium was evaluated by subjecting the plants to five levels of Cd (0, 25, 50, 75 and 100 mg kg-1 soil). Applied Cd did not produce any toxic symptoms in all the three varieties of tuberose except marginal reduction in the photosynthesis rate and total dry weight beyond 50 mg Cd kg-1 soil. The study showed that tuberose possessed the typical ability of Cd hyper accumulator characterized by (1) accumulation of Cd in the shoots of the plant exceeding the critical judging standard i.e., 100 μg g-1 DW and (2) ratio of Cd in the shoots to bulbs >1. It was concluded that tuberose may be an effective accumulator plant for phytoremediation of cadmium polluted soils. (author)

  6. Prevention of cadmium bioaccumulation by herbal adaptogens

    OpenAIRE

    K Bharavi; A. Gopala Reddy; G S Rao; Ravi Kumar, P.; D Srinivas Kumar; P Prabhu Prasadini

    2011-01-01

    Objectives : To evaluate the effect of various herbal adaptogens such as shade-dried powders of Withania somnifera, Ocimum sanctum, Asperagus recemosus, Andrographis paniculata, Asphaltum panjabinum (Shilajith), Gymnema sylvestre, Spirulina platensis, and Panex ginseng on cadmium (Cd)-induced oxidative stress and its accumulation in broiler chicken. Materials and Methods : A total of 80 male broiler chicks of day old age were randomly assigned to 10 equal groups. Group 1 birds were fed wi...

  7. ELECTROKINETIC REMEDIATION STUDY FOR CADMIUM CONTAMINATED SOIL

    OpenAIRE

    P. Bala Ramudu; R. P. Tiwari; Srivastava, R. K.

    2007-01-01

    This paper presents the results of an experimental research undertaken to evaluate different purging solutions to enhance the removal of cadmium from spiked contaminated field soil by electrokinetic remediation. Three experiments were conducted when soil was saturated with deionised water and subsequently deionised water, ammonium citrate and sodium citrate were used as purging solutions at anode end. One experiment was conducted when the soil was saturated with ammonium citrate and itself wa...

  8. Electron mobility in mercury cadmium telluride

    Science.gov (United States)

    Patterson, James D.

    1988-01-01

    A previously developed program, which includes all electronic interactions thought to be important, does not correctly predict the value of electron mobility in mercury cadmium telluride particularly near room temperature. Part of the reason for this discrepancy is thought to be the way screening is handled. It seems likely that there are a number of contributors to errors in the calculation. The objective is to survey the calculation, locate reasons for differences between experiment and calculation, and suggest improvements.

  9. Bioaugmentation with cadmium-resistant plant growth-promoting rhizobacteria to assist cadmium phytoextraction by Helianthus annuus.

    Science.gov (United States)

    Prapagdee, Benjaphorn; Chanprasert, Maesinee; Mongkolsuk, Skorn

    2013-07-01

    Micrococcus sp. MU1 and Klebsiella sp. BAM1, the cadmium-resistant plant growth-promoting rhizobacteria (PGPR), produce high levels of indole-3-acetic acid (IAA) during the late stationary phase of their growth. The ability of PGPR to promote root elongation, plant growth and cadmium uptake in sunflowers (Helianthus annuus) was evaluated. Both species of bacteria were able to remove cadmium ions from an aqueous solution and enhanced cadmium mobilization in contaminated soil. Micrococcus sp. and Klebsiella sp. use aminocyclopropane carboxylic acid as a nitrogen source to support their growth, and the minimum inhibitory concentrations of cadmium for Micrococcus sp. and Klebsiella sp. were 1000 and 800mM, respectively. These bacteria promoted root elongation in H. annuus seedlings in both the absence and presence of cadmium compared to uninoculated seedlings. Inoculation with these bacteria was found to increase the root lengths of H. annuus that had been planted in cadmium-contaminated soil. An increase in dry weight was observed for H. annuus inoculated with Micrococcus sp. Moreover, Micrococcus sp. enhanced the accumulation of cadmium in the root and leaf of H. annuus compared to untreated plants. The highest cadmium accumulation in the whole plant was observed when the plants were treated with EDTA following the treatment with Micrococcus sp. In addition, the highest translocation of cadmium from root to the above-ground tissues of H. annuus was found after treatment with Klebsiella sp. in the fourth week after planting. Our results show that plant growth and cadmium accumulation in H. annuus was significantly enhanced by cadmium-resistant PGPRs, and these bacterial inoculants are excellent promoters of phytoextraction for the rehabilitation of heavy metal-polluted environments. PMID:23478127

  10. 49 CFR 571.105 - Standard No. 105; Hydraulic and electric brake systems.

    Science.gov (United States)

    2010-10-01

    ... word, words or abbreviation, in accordance with the requirements of Standard No. 101 (49 CFR 571.101... of brake fluid as specified in 49 CFR 571.116, e.g., “DOT 3”). The lettering shall be— (a... 49 Transportation 6 2010-10-01 2010-10-01 false Standard No. 105; Hydraulic and electric...

  11. Bioavailability of cadmium from linseed and cocoa

    DEFF Research Database (Denmark)

    Hansen, Max; Rasmussen, Rie Romme; Sloth, Jens Jørgen

    2014-01-01

    the food authorities in order to give correct advises to the population. The aim of this study was to investigate the bioavailability of cadmium from whole linseed, crushed linseed, cocoa and cadmium chloride in rats. An experiment where 40 rats were divided into 4 groups and a control group and dosed...... with whole linseed, crushed linseed, cocoa and CdCl2 for 3 weeks was performed. Linseed or cocoa made up 10% of the feed (by weight) and was added as a replacement for carbohydrate source. The rats were dosed for 3 weeks and the cadmium content in the rats' kidneys was measured by ICPMS as a biomarker...... which could be measured in the kidney compared to the calculated total intake was as follows: Control 2.0 %, Crushed linseed 0.9 %, whole linseed, 1.5 %, cocoa 0.7 % and CdCl2 4.6 %. Based on this study it could not be concluded that the bioavailability in rats form whole linseed is lower that for...

  12. Soil ecotoxicity assessment using cadmium sensitive plants

    International Nuclear Information System (INIS)

    The crop plants, sorghum and cucumber, can be used as indicator species to assess ecotoxicity of soils contaminated by cadmium. - Four crop plant species (sweet corn, Zea may; wheat, Triticum aestivum; cucumber, Cucumis sativus; and sorghum, Sorghum bicolor) were tested to assess an ecotoxicity in cadmium-amended soils. The measurement endpoints used were seed germination and seedling growth (shoot and root). The presence of cadmium decreased the seedling growth. The medium effective concentration values (EC50) for shoot or root growth were calculated by the Trimmed Spearman-Karber method. Due to the greater accumulation of Cd to the roots, root growth was a more sensitive endpoint than shoot growth. Bioavailability and transport of Cd within plant were related to concentration and species. The ratio of bioaccumulation factor (BAF) in the shoots to the roots indicated high immobilization of Cd in the roots. Seed germination was insensitive to Cd toxicity, and is not recommended for a suitable assay. Among the test plants and test endpoints, root growth of sorghum and cucumber appears to be a good protocol to assess ecotoxicity of soils contaminated by Cd

  13. Soil ecotoxicity assessment using cadmium sensitive plants

    Energy Technology Data Exchange (ETDEWEB)

    An, Youn-Joo

    2004-01-01

    The crop plants, sorghum and cucumber, can be used as indicator species to assess ecotoxicity of soils contaminated by cadmium. - Four crop plant species (sweet corn, Zea may; wheat, Triticum aestivum; cucumber, Cucumis sativus; and sorghum, Sorghum bicolor) were tested to assess an ecotoxicity in cadmium-amended soils. The measurement endpoints used were seed germination and seedling growth (shoot and root). The presence of cadmium decreased the seedling growth. The medium effective concentration values (EC50) for shoot or root growth were calculated by the Trimmed Spearman-Karber method. Due to the greater accumulation of Cd to the roots, root growth was a more sensitive endpoint than shoot growth. Bioavailability and transport of Cd within plant were related to concentration and species. The ratio of bioaccumulation factor (BAF) in the shoots to the roots indicated high immobilization of Cd in the roots. Seed germination was insensitive to Cd toxicity, and is not recommended for a suitable assay. Among the test plants and test endpoints, root growth of sorghum and cucumber appears to be a good protocol to assess ecotoxicity of soils contaminated by Cd.

  14. Use of cadmium in solution in the EL 4 reactor moderator irreversible fixing of cadmium on the metallic surfaces

    International Nuclear Information System (INIS)

    In the framework of research into the poisoning of the EL-4 reactor by cadmium sulphate, measurements have been made by two different methods of the residual amounts of cadmium liable to be fixed irreversibly on the surfaces in contact with the heavy water. A marked influence of the pH has been noticed. The mechanism of the irreversible fixing is compatible with the hypothesis of an ion-exchange in the surface oxide layer. In a sufficiently wide range of pH the cadmium thus fixed causes very little residual poisoning. The stability of the cadmium sulphate solutions is however rather low in the conditions of poisoning. (authors)

  15. Reduction of Cadmium Uptake of Rice Plants Using Soil Amendments in High Cadmium Contaminated Soil: A Pot Experiment

    OpenAIRE

    Dian Siswanto; Parinda Suksabye; Paitip Thiravetyan

    2013-01-01

    The aims of this study were to investigate the effect of agricultural residues on reducing cadmium uptake in rice plants. The rice plants growing on no cadmium/free cadmium soils (N), Cd soils (Cds), and Cd soils each amended with 1% w/w of coir pith (CP), coir pith modified with sodium hydroxide (CPm) and corncob (CC) under high cadmium contaminated soil with an average 145 mg Cd kg-1 soil were investigated. The results showed that the cumulative transpiration of rice grown in various treatm...

  16. Cadmium sulfate complexing with thiourea during preparation of cadmium sulfide films

    International Nuclear Information System (INIS)

    Composition of complexes deposited from cadmium sulfate and thiourea(TU) aqueous solution is studied. Its influence on cadmium sulfide film deposition during solution spraying is ascertained. It is shown that with increase of TU concentration in aqueous solution gradual substitution of TU molecules for the first sphere SO42- ions takes place. As a result CdS deposition from these solutions is initiated when the ratio of CdSO4:TU concentrations is 1:2 and for prepartation of uniform films a five-fold TU excess as a minimum is necessary

  17. Correlative characteristic of cadmium in soils of steppe Dnieper region

    Directory of Open Access Journals (Sweden)

    N. M. Tsvetkova

    2015-09-01

    Full Text Available Much attention is paid to searching for methods of establishing environmental standards for objective assessment of admissibility of anthropogenic load on the biosphere. The main pollutants of the environment are xenobiotics; heavy metals such as cadmium occupy hold a special place among them. Cadmium is one of the most dangerous environmental toxic agents, belonging to the 1stclass of hazard. Due to insufficient and fragmented information available on the distribution of cadmium in the city edaphotopes, it’s necessary to conduct additional research, taking into account the properties of soils and the biological characteristics of every element. The paper shows the ratio of cadmium in soils and soil-forming rocks of steppe Dnieper region. Environmental assessment of cadmium content in Dniprodzerzhinsk city soilsis made, and the problem of topsoil contamination of the city as a territory of high anthropogenic load is considered. It is found that the content of cadmium down the profile in natural soil increases. Enrichment of the topsoil with cadmium occurs due to contamination. The value of movable forms content, expressed as a percentage of the total content, varies from 12% to 70%, providing the evidence of the technogenic origin of cadmium in Dniprodzerzhinsk city topsoil. General and proximate correlation analyses of interrelation of soil cadmium and specifically selected characteristics of soil (pH, humus, sulfate ions, dry solid, chloride ions, total alkalinity, hygroscopic moisture were made. It is established that cadmium concentration in the movable forms of natural soils of the steppe Dnieper region depends primarily on pH value. With the increase in pH value, concentration of movable cadmium in soil increases.

  18. Sanitary Risks Connected to the Consumption of Infusion from Senna rotundifolia L. Contaminated with Lead and Cadmium in Cotonou (Benin

    Directory of Open Access Journals (Sweden)

    S. A. Montcho

    2014-01-01

    Full Text Available This study carried out an assessment of sanitary risks connected to the consumption of Senna rotundifolia Linn. contaminated with lead and cadmium. This plant was collected and analyzed by atomic absorption spectrophotometry. The results revealed a contamination of plants from markets of Dantokpa, Vossa, and Godomey with heavy metals. Senna from Vossa was higher in cadmium and lead levels (Pb: 2.733 mg/kg ± 0.356 mg/kg; Cd: 0.58 mg/kg ± 0.044 mg/kg compared to the two other places (Pb: 1.825 mg/kg ± 0.133 mg/kg, Cd: 0.062 mg/kg ± 0.015 mg/kg and Pb: 1.902 mg/kg ± 0.265 mg/kg, Cd: 0.328 mg/kg ± 0.024 mg/kg, respectively, for Dantokpa and Godomey. In terms of risk assessment through the consumption of Senna, the values recorded for lead were nine times higher with children and six times higher with adults than the daily permissive intake (Pb: 3.376 × 10−2 mg/kg/day for children and 2.105 × 10−2 mg/kg/day for adults versus 3.6 × 10−3 mg/kg/day for DPI. With respect to cadmium, there was no significant difference between the recorded values and the DPI (Cd: 1 × 14 10−3 mg/ kg/day for children and Cd: 0.71 × 10−3 mg/ kg/day for adults versus Cd: 1 × 10−3 mg/kg/day for adults. This exposure of the population to lead and cadmium through the consumption of antimalarial healing plants could pose public health problems.

  19. Critical review of animal carcinogenesis by cadmium and its inorganic compounds

    International Nuclear Information System (INIS)

    Animal carcinogenic biassays relative to 6 inorganic cadmium substances (cadmium metal, cadmium oxide, cadmium sulfide, cadmium sulfate, cadmium chloride and cadmium acetate) are reviewed (speciation). Critical evaluation of literature data on carcinogenicity has been performed by making reference to E.C. guidelines of good laboratory practice. There are few data on routes relevant for human risk assessment: experiments on inhalation demonstrate lung carcinogenicity of cadmium oxide, cadmium sulfide, cadmium sulfate and cadmium chloride in rats but not in mice nor in hamsters; no carcinogenic effects of cadmium compounds are observed following oral administration. For routes of less or no relevance for human risk assessment, some results are clearly positive: subcutaneous injection induces cancers in situ (various cadmium compounds), testicular tumours (cadmium sulfate and cadmium chloride) and prostatic tumours (cadmium chloride) but such effects are not observed using relevant malignancies in rats. With respect to other no relevant routes (intraperitoneal, intrarenal...) tumours are incidentally produced in situ, but not in remote organs. Numerous studies fail to demonstrate cadmium carcinogenicity, but methodologically acceptable negative ones are very limited in number. Accordingly strain dependent effects and dose effect relationship could not be thoroughly assessed

  20. Effects of Aluminium Sulfate on Cadmium Accumulation in Rice

    International Nuclear Information System (INIS)

    Full text: Cadmium accumulation in Pathum Thani 1 and Suphan Buri 60 rice cultivars was investigated upon treatment with aluminium sulfate as a precipitant. Rice was grown hydroponically in a medium containing 4 ppm cadmium nitrate with or without 4 ppm aluminium sulfate. Root, stem with leaves and grain samples were collected and analyzed for cadmium content using atomic absorption spectroscopy and inductively coupled plasma atomic emission spectroscopy. Without the addition of aluminium sulfate, Pathum Thani 1 and Suphan Buri 60 accumulated 24.71∫ 3.14 ppm and 34.43 ∫ 4.51 ppm (dry weight of whole plant) of cadmium, respectively. With aluminium sulfate, cadmium accumulation increased to 40.66 ∫ 2.47 ppm and 62.94 ∫ 10.69 ppm, respectively. The addition of aluminium sulfate to the planting medium did not reduce cadmium accumulation but caused the rice to accumulate more cadmium especially in the shoots and grains. This observation might serve as the basis for future research on the management of agricultural areas that are contaminated with cadmium and aluminium

  1. Phytoremediation of cadmium and nickel by Spirodela polyrhiza

    International Nuclear Information System (INIS)

    Heavy metal pollution in surface and groundwater has considerably increased in the last few years. It is essential to have an effective removal mechanism of these toxic metals. Current research includes the need to develop environment friendly and cost effective technologies for removing heavy metals from water. In several studies cadmium and nickel have been considerably removed using phytoremediation. The removal efficiency of cadmium and nickel by Spirodela polyrhiza, common duckweed has been examined in the present study for 3 different concentrations of cadmium (1, 2 and 3 mg/L) and nickel (4, 5 and 6 mg/L). Two sets of experiments for cadmium and nickel were conducted separately. Effect of metal toxicity on Spirodela polyrhiza was evaluated in terms of relative growth factor and cadmium was found to be more toxic than nickel. Under experimental condition BCF value for cadmium removal was more than >1000 in all the 3 concentrations of cadmium. But the BCF value was found to be more than > 1000 only when input nickel concentration was 4 mg/L during phytoremediation process. Experimental results suggest that Spirodela polyrhiza has the potential of accumulating cadmium and nickel from aqueous solution at lower metal concentration. (author)

  2. Cadmium inhibits neurogenesis in zebrafish embryonic brain development

    Energy Technology Data Exchange (ETDEWEB)

    Chow, Elly Suk Hen [Division of Biology, California Institute of Technology, 1200 California Boulevard, Pasadena, CA 91125 (United States); Hui, Michelle Nga Yu; Lin Chunchi [Department of Biology and Chemistry, City University of Hong Kong, 83 Tat Chee Avenue, Kowloon, Hong Kong (China); Cheng Shukhan [Department of Biology and Chemistry, City University of Hong Kong, 83 Tat Chee Avenue, Kowloon, Hong Kong (China)], E-mail: bhcheng@cityu.edu.hk

    2008-05-01

    Cadmium is a non-essential heavy metal found abundantly in the environment. Children of women exposed to cadmium during pregnancy display lower motor and perceptual abilities. High cadmium body burden in children is also related to impaired intelligence and lowered school achievement. However, little is known about the molecular and cellular basis of developmental neurotoxicity in the sensitive early life stages of animals. In this study, we explore neurological deficits caused by cadmium during early embryonic stages in zebrafish by examining regionalization of the neural tube, pattern formation and cell fate determination, commitment of proneural genes and induction of neurogenesis. We show that cadmium-treated embryos developed a smaller head with unclear boundaries between the brain subdivisions, particularly in the mid-hindbrain region. Embryos display normal anterior to posterior regionalization; however, the commitment of neural progenitor cells was affected by cadmium. We observe prominent reductions in the expression of several proneuronal genes including ngn1 in cell clusters, zash1a in the developing optic tectum, and zash1b in the telencephalon and tectum. Cadmium-treated embryos also have fewer differentiated neurons and glia in the facial sensory ganglia as indicated by decreased zn-12 expression. Also, a lower transcription level of neurogenic genes, ngn1 and neuroD, is observed in neurons. Our data suggest that cadmium-induced neurotoxicity can be caused by impaired neurogenesis, resulting in markedly reduced neuronal differentiation and axonogenesis.

  3. Epigenetic Effects of Cadmium [Abstract and Poster 2014

    Science.gov (United States)

    We have reviewed the literature on in vitro and in vivo experiments as well as human studies on cadmium to understand the epigenetic mechanisms involved in cadmium- induced toxicity and carcinogenicity. This presentation will identify gaps in our current understanding and suggest...

  4. Removing cadmium from electroplating wastewater by waste saccharomyces cerevisiae

    Institute of Scientific and Technical Information of China (English)

    DAI Shu-juan; WEI De-zhou; ZHOU Dong-qin; JIA Chun-yun; WANG Yu-juan; LIU Wen-gang

    2008-01-01

    The appropriate condition and scheme of removing cadmium from electroplating wastewater were investigated by adsorption-precipitation method using waste saccharomyces cerevisiae(WSC) as sorbent. Effect factors on biosorption of cadmium in cadmium-containing electroplating wastewater by waste saccharomyces cerevisiae and precipitation process of waste saccharomyces cerevisiae after adsorbing cadmium were studied. The results show that removal rate of cadmium is over 88% after 30 min adsorbing under the condition of cadmium concentration 26 mg/L, the dosage of waste saccharomyces cerevisiae 16.25 g/L, temperature 18 ℃, pH 6.0 and precipitation time 4 h. Biosorption-precipitation method is effective to remove cadmium in cadmium-containing electroplating wastewater by waste saccharomyces cerevisiae. The SEM, infrared spectroscopy and Zeta-potential of the cells show that chemical chelating is the main adsorption form; electrostatic attraction, hydrogen bonding and van der Waals force all function in adsorption process; and ―NH2―,―C=O―,―C=O―NH―,―CH3, ―OH are the main adsorption groups.

  5. Method of making a thin film cadmium telluride solar cell

    International Nuclear Information System (INIS)

    A method for making a photovoltaic cell is described comprising the steps of: (a) depositing a transparent or semi-transparent conductive window layer onto a substrate; (b) depositing a layer of cadmium telluride including phosphorus onto the window layer; (c) depositing a layer of lead telluride onto the layer of cadmium telluride; and (d) depositing a metallic electrode onto the lead telluride layer

  6. Effect of environmental exposure to Cadmium on pregnancy outcome

    Directory of Open Access Journals (Sweden)

    F. Ramezanzadeh

    2010-04-01

    Full Text Available "n "n "nBackgrounds andObjectives:The objective of the present study was to evaluate the potential effect of environmental exposure to toxic metal (cadmium on pregnancy outcome and fetal growth."nMaterials and Methods: 330 normal pregnant women were randomly selected from vali-e-asr hospital, from July 2003 through Feb. 2005. Cadmium was measured in umbilical cord blood and mother whole blood of postpartum women without occupational exposure to metals in Tehran, Iran, using inductively coupled plasma mass spectrometry"nResult: Whole blood cadmium and cord blood cadmium ranged from 0/00 to 6/30 μg/L ,respectivly. in the group higher level of maternal blood cadmium (> 0.40 μg/L 1cm decrease was seen in neonatal birth height. (p = 0.007 There was a significant association between cadmium exposure and birth weight.Mann-whitney test showed that, maternal blood cadmium level, was significantly negatively associated with neonatal birth weight (z = -1.83, P < 0.06."nConclusion: It was concluded that environmental exposure to cadmium significantly reduces neonatal birth height.

  7. Risk of overestimation of urinary cadmium concentrations: interference from molybdenum

    Directory of Open Access Journals (Sweden)

    Cañas A.I.

    2013-04-01

    Full Text Available We show here that the selection of analytical method is critical when measuring low levels of cadmium in human urine. Cadmium is today usually analyzed by Inductively Coupled Plasma Mass Spectrometry (ICP-MS, which has a higher sensitivity than Atomic Absorption Spectroscopy (AAS. ICP-MS cadmium measurements show interference from tin (114Sn and molybdenum oxides, which can result in an overestimation of cadmium levels. The 114Sn interference is stable and can be mathematically corrected. Molybdenum concentrations in urine are variable and different from individual to individual. We have estimated the degree of error which molybdenum interference introduces in the measurement of cadmium in urine by conventional ICP-MS. 268 urine samples from mothers and their children were measured. Removal of the molybdenum oxide interference (DRC-ICP-MS method reduced urinary cadmium concentrations significantly (47.8%. The urinary molybdenum concentration in children was higher than in their mothers, resulting in greater overestimation. Our results clearly show that the DRC method is essential for reliable measurements of urinary cadmium concentrations, particularly in children. Furthermore, care should be taken when comparing Human Biomonitoring data for cadmium in urine and attention should be paid to which analytical method has been used (e.g. AAS and ICP-Ms, and especially if the measurements have been corrected for molybdenum interference.

  8. Electrolytic indium refining from cadmium in glycerine electrolyte

    International Nuclear Information System (INIS)

    The results of investigations directed on development of electrochemical indium cleaning from cadmium in glycerine base electrolyte are presented. Optimal operational conditions, specific consumption of reactants and electric power are determined. Relationship between variation of concentration of cadmium impurity in refined metal and duration of electrolysis is revealed. The method for determination of cleaning time is proposed. Developed process was put into commercial operation

  9. Cadmium and zinc reversibly arrest development of Artemia larvae

    Energy Technology Data Exchange (ETDEWEB)

    Bagshaw, J.C.; Rafiee, P.; Matthews, C.O.; MacRae, T.H.

    1986-08-01

    Despite the widespread distribution of heavy metals such as cadmium and zinc in the environment and their well-known cytotoxicity and embryotoxicity in mammals, comparatively little is known about their effect on aquatic organisms, particularly invertebrates. Post-gastrula and early larval development of the brine shrimp, Artemia, present some useful advantages for studies of developmental aspects of environmental toxicology. Dormant encysted gastrulae, erroneously called brine shrimp eggs, can be obtained commercially and raised in the laboratory under completely defined conditions. Following a period of post-gastrula development within the cyst, pre-nauplius larvae emerge through a crack in the cyst shell. A few hours later, free-swimming nauplius larvae hatch. Cadmium is acutely toxic to both adults and nauplius larvae of Artemia, but the reported LC50s are as high as 10 mM, depending on larval age. In this paper the authors show that pre-nauplius larvae prior to hatching are much more sensitive to cadmium than are hatched nauplius larvae. At 0.1 ..mu..m, cadmium retards development and hatching of larvae; higher concentrations block hatching almost completely and thus are lethal. However, the larvae arrested at the emergence stage survive for 24 hours or more before succumbing to the effects of cadmium, and during this period the potentially lethal effect is reversible if the larvae are placed in cadmium-free medium. The effects of zinc parallel those of cadmium, although zinc is somewhat less toxic than cadmium at equal concentrations.

  10. Cadmium inhibits neurogenesis in zebrafish embryonic brain development

    International Nuclear Information System (INIS)

    Cadmium is a non-essential heavy metal found abundantly in the environment. Children of women exposed to cadmium during pregnancy display lower motor and perceptual abilities. High cadmium body burden in children is also related to impaired intelligence and lowered school achievement. However, little is known about the molecular and cellular basis of developmental neurotoxicity in the sensitive early life stages of animals. In this study, we explore neurological deficits caused by cadmium during early embryonic stages in zebrafish by examining regionalization of the neural tube, pattern formation and cell fate determination, commitment of proneural genes and induction of neurogenesis. We show that cadmium-treated embryos developed a smaller head with unclear boundaries between the brain subdivisions, particularly in the mid-hindbrain region. Embryos display normal anterior to posterior regionalization; however, the commitment of neural progenitor cells was affected by cadmium. We observe prominent reductions in the expression of several proneuronal genes including ngn1 in cell clusters, zash1a in the developing optic tectum, and zash1b in the telencephalon and tectum. Cadmium-treated embryos also have fewer differentiated neurons and glia in the facial sensory ganglia as indicated by decreased zn-12 expression. Also, a lower transcription level of neurogenic genes, ngn1 and neuroD, is observed in neurons. Our data suggest that cadmium-induced neurotoxicity can be caused by impaired neurogenesis, resulting in markedly reduced neuronal differentiation and axonogenesis

  11. Cadmium Removal from Aqueous Solutions by Ground Pine Cone

    Directory of Open Access Journals (Sweden)

    H Izanloo, S Nasseri

    2005-01-01

    Full Text Available A study on the removal of cadmium ions from aqueous solutions by pine cone was conducted in batch conditions. Kinetic data and equilibrium removal isotherms were obtained. The influence of different experimental parameters such as contact time, initial concentration of cadmium, pine cone mass and particle size, and temperature on the kinetics of cadmium removal was studied. Results showed that the main parameters that played an important role in removal phenomenon were initial cadmium concentration, particle size and pine cone mass. The necessary time to reach equilibrium was between 4 and 7 hours based on the initial concentration of cadmium. The capacity of cadmium adsorption at equilibrium increased with the decrease of pine cone particle size. The capacity of cadmium adsorption at equilibrium by pine cone increased with the quantity of pine cone introduced (1–4 g/L. Temperature in the range of 20-30°C showed a restricted effect on the removal kinetics (13.56 mg/g at 20°C and a low capacity of adsorption about 11.48 mg/g at 30°C. The process followed pseudo second-order kinetics. The cadmium uptake of pine cone was quantitatively evaluated using adsorption isotherms. Results indicated that the Langmuir model gave a better fit to the experimental data in comparison with the Freundlich equation.

  12. Cadmium chronic administration to lactating ewes. Reproductive performance, cadmium tissue accumulation and placental transfer

    Energy Technology Data Exchange (ETDEWEB)

    Floris, B.; Bomboi, G.; Sechi, P.; Marongiu, M. L. [Sassari Univ., Sassari (Italy). Dipt. di Biologia Animale; Pirino, S. [Sassari Univ., Sassari (Italy). Ist. di Patologia Generale, Anatomia Patologica e Clinica Ostetrico-chirurgica Veterinaria

    2000-12-01

    20 lactating ewes were allotted to two groups: 10 subjects received orally 100 mg/day of CdCl{sub 2} for 108 consecutive days, and the remaining 10 acted as control. Reproductive performance in ewes and cadmium tissue accumulation, both in ewes and their lambs, were investigated. The results showed that in ewes: 1) the regular cadmium intestinal intake negatively influences all reproductive parameters; 2) cadmium is particularly accumulated in kidney and liver, bur also in mammary gland, although at distinctly lower level; 3) chronic administration does not increase cadmium placental transfer in lactating pregnant subjects. [Italian] 20 pecore in lattazione sono state suddivise in 2 gruppi: 10 soggetti ricevettero per os 100 mg/giorno di CdCl{sub 2} per 108 giorni consecutivi, e i restanti 10 funsero da controllo. Sono stati studiati i parametri riproduttivi delle pecore e l'accumulo di cadmio nei tessuti, sia delle pecore che dei loro agnelli. I risultati hanno mostrato che negli ovini: 1) il regolare assorbimento intestinale di cadmio influenza negativamente tutti i parametri riproduttivi; 2) il cadmio viene accumulato principalmente nei reni e nel fegato, ma anche dalla ghiandola mammaria, sebbene in misura nettamente inferiore; 3) la somministrazione cronica di cadmio nei soggetti gravidi non incrementa il suo passaggio transplacentare.

  13. Concentration of Cadmium in Cacao Beans and its Relationship with Soil Cadmium in Southern Ecuador

    Science.gov (United States)

    The concentration of cadmium (Cd) in cacao (Theobroma cacao, L.) beans above a critical level (0.6 mg kg-1 established by the European Union) has raised concerns of safety in the consumption of cacao-based chocolate (dark chocolate). Currently, little is available regarding Cd concentration in soil,...

  14. Cadmium adsorption in montmorillonite as affected by glyphosate

    Institute of Scientific and Technical Information of China (English)

    WANG Yu-jun; ZHOU Dong-mei; LUO Xiao-san; SUN Rui-juan; CHEN Huai-man

    2004-01-01

    Behaviors of soil heavy metals are often affected by coexisting herbicides due to their physical and chemical interaction. Effect of glyphosate, an herbicide containing -PO32- and -COOH groups, on cadmium adsorption in montmorillonite was studied in detail. The results showed that cadmium adsorption quantity in montmorillonite increased with increasing soil solution pH and cadmium concentration as usual, but decreased with glyphosate, which is due to the formation of a low affinity complex of Cd and glyphosate and decreasing solution pH induced by glyphosate addition. When the equilibrium solution pH was below 6.7, glyphosate has little effect on cadmium adsorption, but when the equilibrium solution pH was above 6.7, glyphosate significantly decreased cadmium adsorption quantity in montmorillonite. In addition, the adding order of Cd and glyphosate also influenced Cd adsorption quantity in montmorillonite.

  15. Cadmium sorption and mobility in sludge-amended soil

    International Nuclear Information System (INIS)

    Cadmium sorption was examined in three soils that were unamended, freshly amended, or preconditioned with gamma-irradiated sewage sludge. Metal sorption in the same soils treated with a CaCl2-extract of the sludge was also studied. Cadmium sorption was greatest in the unamended soils, less in soils preconditioned with sludge, and least in the freshly amended soils and sludge-extract-treated soils. The authors attempted to explain the treatment effects on the basis of reduced free metal ion activity, but the explanations were not adequate. Despite the reduction in metal retention effected by various treatments, cadmium mobility was very limited. Short- or long-term leaching studies showed cadmium movement to be limited to 1 or 2 m below the zone of sludge (109Cd) incorporation. Cadmium mobility is expected to be very limited in calcareous soils, regardless of sludge treatments. 24 references, 1 figure, 5 tables

  16. Amorphous tin-cadmium oxide films and the production thereof

    Science.gov (United States)

    Li, Xiaonan; Gessert, Timothy A

    2013-10-29

    A tin-cadmium oxide film having an amorphous structure and a ratio of tin atoms to cadmium atoms of between 1:1 and 3:1. The tin-cadmium oxide film may have an optical band gap of between 2.7 eV and 3.35 eV. The film may also have a charge carrier concentration of between 1.times.10.sup.20 cm.sup.-3 and 2.times.10.sup.20 cm.sup.-3. The tin cadmium oxide film may also exhibit a Hall mobility of between 40 cm.sup.2V.sup.-1 s.sup.-1 and 60 cm.sup.2V.sup.-1 s.sup.-1. Also disclosed is a method of producing an amorphous tin-cadmium oxide film as described and devices using same.

  17. Transient behavior of cadmium in a grassland arthropod food chain

    International Nuclear Information System (INIS)

    Biological assimilation and transport of cadmium were determined for an arthropod food chain in an east Tennessee grassland community. Laboratory experiments demonstrated that there were no significant differences (P greater than 0.05) in assimilation rates (17 percent assimilation per day) or biological half-lives (7 days) of 109Cd either as soluble nitrate or insoluble oxide in crickets under identical conditions. Field experiments demonstrated that primary consumers (crickets) accumulated 109Cd much more rapidly (uptake rate = 0.55 day-1) than did the spider predators (uptake rate = 0.08 day-1). Equilibrium concentrations in crickets were obtained in 9 days (0.04 ppM cadmium), while equilibrium was not reached in spiders during the 30-day study. Food-chain concentration of cadmium did not occur as crickets accumulated levels of cadmium 60 percent of that in their vegetation food sources and spiders accumulated only 70 percent of the cadmium present in the cricket tissues

  18. Synthesis of cadmium chalcogenide nanotubes at room temperature

    KAUST Repository

    Pan, Jun

    2012-10-01

    Cadmium chalcogenide (CdE, E=S, Se, Te) polycrystalline nanotubes have been synthesized from precursor of CdS/cadmium thiolate complex at room temperature. The precursor was hydrothermally synthesized at 180 °C using thioglycolic acid (TGA) and cadmium acetate as starting materials. The transformation from the rod-like precursor of CdS/cadmium thiolate complex to CdS, CdSe and CdTe nanotubes were performed under constant stirring at room temperature in aqueous solution containing S 2-, Se 2- and Te 2-, respectively. The nanotube diameter can be controlled from 150 to 400 nm related to the dimension of templates. The XRD patterns show the cadmium chalcogenide nanotubes all corresponding to face-centered cubic structure. © 2012 Elsevier B.V. All rights reserved.

  19. Effect of pregnancy on cadmium-treated rats

    Energy Technology Data Exchange (ETDEWEB)

    Takizama, Y. (Akita Univ. School of Medicine, Japan); Nakamura, I.; Kurayama, R.; Hirasawa, F.; Kawai, K.

    1982-01-01

    It is well known that itai-itai disease with the osteopathy is broken out among multiparas, 40 years of age and up Japanese residents. In this paper we described an experimental study of effect of pregnancy on cadmium treated rats. Female mature rats were administered drinking water containing 50 and 200 ppm cadmium as CdCl/sub 2/. During 180 days of the experiment, three times of pregnancy were succesful, though slight depression of body weight gain was noticed in the 200 ppm group. The cadmium was accumulated in the kidneys, liver and bone proportionally to the amount of cadmium administered. No significant change was recognized in serum calcium, phosphorus and alkaline phosphatase levels after 180 days. Though cadmium 200 ppm treated rats showed slight histological lesions in the proximal convoluted tubules of the kidney, there appeared to be no osteomalacia including excess formation of osteoid tissue.

  20. Cadmium in the Amazonian Guajara Estuary: Distribution and remobilization

    Energy Technology Data Exchange (ETDEWEB)

    Nascimento, S.F. [Instituto de Quimica, Departamento de Geoquimica, Universidade Federal Fluminense (Brazil)]. E-mail: nascimento@lisa.univ-paris12.fr; Kurzweil, H. [Institut fuer Petrologie, Universitaet Wien (Austria); Wruss, W. [Institut fuer Chemische Technologie anorganischer Stoffe, Technische Univesitaet Wien (Austria); Fenzl, N. [Nucleo de Altos Estudos Amazonicos, Universidade Federal do Para (Brazil)

    2006-03-15

    Extremely high total cadmium concentrations (average about 500 mg/kg) together with very small (average of 1.1 {mu}g/l) dissolved available cadmium have been found in the more acidic deeper layers of the bottom sediments of the Brazilian Amazonian Guajara Estuary. The paper shows that climatic changes and the periodic input of the Atlantic waters into the Estuary appear to have no direct influence on annual average total cadmium concentration, but they affect accumulation, distribution and remobilization of cadmium in different ways during the rainy season (February/March) and the dry season (November/December). Even if only a very small part of the total Cd is available, the concentrations of dissolved Cd in the Estuary are still high enough to cause environmental concern, if compared with concentrations in natural freshwater ecosystems. - Distribution and remobilization of cadmium is affected differently by season.

  1. Effects of diethyldithiocarbamate on the toxicokinetics of cadmium chloride in mice

    DEFF Research Database (Denmark)

    Andersen, O; Nielsen, J B

    1989-01-01

    investigates effects of DDC on the toxicokinetics of cadmium at lower doses of cadmium than those used in previous studies. During single exposure to subtoxic oral doses of cadmium chloride DDC enhanced intestinal cadmium absorption, both after intraperitoneal and oral administration of DDC. In such acute...

  2. Fast-neutron scattering from elemental cadmium

    International Nuclear Information System (INIS)

    Neutron differential-elastic-scattering cross sections of elemental cadmium are measured from approx. = 1.5 to 4.0 MeV at incident-neutron energy intervals of 50 to 200 keV and at 10 to 20 scattering angles distributed between approx. = 20 and 160 degrees. Concurrently, lumped-level neutron inelastic-excitation cross sections are measured. The experimental results are used to deduce parameters of an optical-statistical model that is descriptive of the observables and are compared with corresponding quantities given in ENDF/B-V

  3. Sorption of Cadmium on Na-Bentonite

    International Nuclear Information System (INIS)

    The sorption of Cd radionuclide into Na-bentonite as candidate for buffer material in the radioactive waste disposal system has been performed. Cadmium was used for this study as a model for bivalence elements. Batch experiment was adopted to study sorption isotherm, influence of carbonate and influence of EDTA. In a simple media, pure water, Cd was retained with a high affinity. Two stages Freundlich sorption isotherm was shown, with high coefficient distribution and sorption capacities. It is shown that the presence of carbonate in solution was not affect significantly to the sorption. While the presence of EDTA, decrease the distribution coefficient value. (author)

  4. Evidence for chirality in 105Rh

    International Nuclear Information System (INIS)

    Complete text of publication follows. High-spin states in 105Rh were populated by the 96Zr(13C,p3n) reaction at beam energies of 51 and 58 MeV, and studied using the EUROBALL IV γ-ray spectrometer and the DIAMANT charged particle array. A pair of nearly degenerate ΔI = 1 three-quasiparticle bands (bands 4 and 5 in Fig. 1) with the same spins and parity have been observed. Comparison of the experimental results with tilted axis cranking calculations (see Fig. 2) confirms the chiral character of the two bands, while arguments based on the excitation of particles within the πg9/2ν(h11/2)2 configuration of the yrast band and comparison with the previously observed γ band (band 2) exclude the other possible interpretations. This is the first experimental evidence for three-quasiparticle chiral structure in the A∼100 region, and the first simultaneous observation of a γ band and chiral partner bands in one nucleus. The results are published in Ref. 1. (author)

  5. Sources of cadmium exposure among healthy premenopausal women

    International Nuclear Information System (INIS)

    Background: Cadmium, a persistent and widespread environmental pollutant, has been associated with kidney function impairment and several diseases. Cigarettes are the dominant source of cadmium exposure among smokers; the primary source of cadmium in non-smokers is food. We investigated sources of cadmium exposure in a sample of healthy women. Methods: In a cross-sectional study, 191 premenopausal women completed a health questionnaire and a food frequency questionnaire. The cadmium content of spot urine samples was measured with inductively-coupled plasma mass spectrometry and normalized to urine creatinine content. Multivariable linear regression was used to estimate the strength of association between smoking habits and, among non-smokers, usual foods consumed and urinary cadmium, adjusted for age, race, multivitamin and supplement use, education, estimated total energy intake, and parity. Results: Geometric mean urine creatinine-normalized cadmium concentration (uCd) of women with any history of cigarette smoking was 0.43 μg/g (95% confidence interval (CI): 0.38-0.48 μg/g) and 0.30 μg/g (0.27-0.33 μg/g) among never-smokers, and increased with pack-years of smoking. Analysis of dietary data among women with no reported history of smoking suggested that regular consumption of eggs, hot cereals, organ meats, tofu, vegetable soups, leafy greens, green salad, and yams was associated with uCd. Consumption of tofu products showed the most robust association with uCd; each weekly serving of tofu was associated with a 22% (95% CI: 11-33%) increase in uCd. Thus, uCd was estimated to be 0.11 μg/g (95% CI: 0.06-0.15 μg/g) higher among women who consumed any tofu than among those who consumed none. Conclusions: Cigarette smoking is likely the most important source of cadmium exposure among smokers. Among non-smokers, consumption of specific foods, notably tofu, is associated with increased urine cadmium concentration. - Research highlights: →Urine cadmium, usual

  6. Sources of cadmium exposure among healthy premenopausal women

    Energy Technology Data Exchange (ETDEWEB)

    Adams, Scott V., E-mail: sadams@fhcrc.org [Fred Hutchinson Cancer Research Center, PO Box 19024, M4-B402, Seattle, WA 98109 (United States); Department of Epidemiology, University of Washington, Box 357236, Seattle, WA 98195 (United States); Newcomb, Polly A. [Fred Hutchinson Cancer Research Center, PO Box 19024, M4-B402, Seattle, WA 98109 (United States); Department of Epidemiology, University of Washington, Box 357236, Seattle, WA 98195 (United States); Shafer, Martin M. [Environmental Chemistry and Technology Program, University of Wisconsin and Wisconsin State Laboratory of Hygiene, Madison, WI (United States); Atkinson, Charlotte [Department of Oral and Dental Science, Bristol Dental School, Bristol (United Kingdom); Bowles, Erin J. Aiello [Group Health Research Institute, Seattle, WA (United States); Newton, Katherine M. [Department of Epidemiology, University of Washington, Box 357236, Seattle, WA 98195 (United States); Group Health Research Institute, Seattle, WA (United States); Lampe, Johanna W. [Fred Hutchinson Cancer Research Center, PO Box 19024, M4-B402, Seattle, WA 98109 (United States); Department of Epidemiology, University of Washington, Box 357236, Seattle, WA 98195 (United States)

    2011-04-01

    Background: Cadmium, a persistent and widespread environmental pollutant, has been associated with kidney function impairment and several diseases. Cigarettes are the dominant source of cadmium exposure among smokers; the primary source of cadmium in non-smokers is food. We investigated sources of cadmium exposure in a sample of healthy women. Methods: In a cross-sectional study, 191 premenopausal women completed a health questionnaire and a food frequency questionnaire. The cadmium content of spot urine samples was measured with inductively-coupled plasma mass spectrometry and normalized to urine creatinine content. Multivariable linear regression was used to estimate the strength of association between smoking habits and, among non-smokers, usual foods consumed and urinary cadmium, adjusted for age, race, multivitamin and supplement use, education, estimated total energy intake, and parity. Results: Geometric mean urine creatinine-normalized cadmium concentration (uCd) of women with any history of cigarette smoking was 0.43 {mu}g/g (95% confidence interval (CI): 0.38-0.48 {mu}g/g) and 0.30 {mu}g/g (0.27-0.33 {mu}g/g) among never-smokers, and increased with pack-years of smoking. Analysis of dietary data among women with no reported history of smoking suggested that regular consumption of eggs, hot cereals, organ meats, tofu, vegetable soups, leafy greens, green salad, and yams was associated with uCd. Consumption of tofu products showed the most robust association with uCd; each weekly serving of tofu was associated with a 22% (95% CI: 11-33%) increase in uCd. Thus, uCd was estimated to be 0.11 {mu}g/g (95% CI: 0.06-0.15 {mu}g/g) higher among women who consumed any tofu than among those who consumed none. Conclusions: Cigarette smoking is likely the most important source of cadmium exposure among smokers. Among non-smokers, consumption of specific foods, notably tofu, is associated with increased urine cadmium concentration. - Research highlights: {yields

  7. Modeling cadmium in the feed chain and cattle organs

    Directory of Open Access Journals (Sweden)

    van der Fels-Klerx, I.

    2011-01-01

    Full Text Available The objectives of this study were to estimate cadmium contamination levels in different scenarios related to soil characteristics and assumptions regarding cadmium accumulation in the animal tissues, using quantitative supply chain modeling. The model takes into account soil cadmium levels, soil pH, soil-to-plant transfer, animal consumption patterns, and transfer into animal organs (liver and kidneys. The model was applied to cattle up to the age of six years which were fed roughage (maize and grass and compound feed. Cadmium content in roughage and cadmium intake by cattle were calculated for six different (soil scenarios varying in soil cadmium levels and soil pH. For each of the six scenarios, the carry-over of cadmium from intake into the cattle organs was estimated applying two model assumptions, i.e., linear accumulation and a steady state situation. The results showed that only in the most extreme soil scenario (cadmium level 2.5 mg.kg-1, pH 4.5, cadmium exceeded the EC maximum tolerated level in roughage. Assuming linear accumulation, cadmium levels in organs of cattle up to six years of age, ranged from 0.37-4.03 mg.kg-1 of fresh weight for kidneys and from 0.07 to 0.77 mg.kg-1 of fresh weight for livers. The maximum tolerated levels in one or both organs were exceeded in several scenarios. When considering organ excretion of cadmium, internal cadmium levels in organs were approximately one order of magnitude lower as compared to the results of the linear accumulation model. In this case only in the most extreme soil scenario, the maximum tolerated level in the kidney was exceeded. It was concluded that the difference between the two assumptions (linear model versus a steady state situation to estimate cadmium carry-over in cattle is negligible in the animal's first five years of life, but will become relevant at higher ages. For the current case, the linear approach is a good descriptor for worst case situations. Furthermore, this

  8. Dietary cadmium intake and risk of prostate cancer: a Danish prospective cohort study

    OpenAIRE

    Eriksen, Kirsten T.; Halkjær, Jytte; Jaymie R. Meliker; McElroy, Jane A.; Sørensen, Mette; Tjønneland, Anne; Raaschou-Nielsen, Ole

    2015-01-01

    Background Cadmium is classified as a human lung carcinogen based on evidence from high-exposure occupational settings. Though cadmium has no physiological role, increasing evidence suggests cadmium may mimic steroid hormones. This dual ability of being carcinogenic and hormone-like makes cadmium a concern for hormone-related cancers. Causes of prostate cancer are not clear, but steroid hormones, particularly androgens and probably estrogens, may be involved. Cadmium has been positively assoc...

  9. Effects of different annealing atmospheres on the properties of cadmium sulfide thin films

    International Nuclear Information System (INIS)

    Graphical abstract: The effects of different annealing atmospheres (air and sulfur) on the structural, morphological and optical properties of CdS thin films were studied at three different pH values. - Highlights: • Compactness and smoothness of the films were enhanced after sulfur annealing. • Micro-strain values of some films were improved after sulfur annealing. • Dislocation density values of some films were improved after sulfur annealing. • Band gap values of the films were improved after sulfur annealing. - Abstract: Cadmium sulfide (CdS) thin films were prepared on glass substrates by using chemical bath deposition (CBD) technique. The effects of different annealing atmospheres (air and sulfur) on the structural, morphological and optical properties of CdS thin films were studied at three different pH values. Compactness and smoothness of the films (especially for pH 10.5 and 11) enhanced after sulfur annealing. pH value of the precursor solution remarkably affected the roughness, uniformity and particle sizes of the films. Based on the analysis of X-ray diffraction (XRD) patterns of the films, micro-strain and dislocation density values of the sulfur-annealed films (pH 10.5 and 11) were found to be lower than those of air-annealed films. Air-annealed films (pH 10.5, 11 and 11.5) exhibited higher transmittance than sulfur-annealed films in the wavelength region of 550–800 nm. Optical band gap values of the films were found between 2.31 eV and 2.36 eV

  10. Draft Genome Sequence of Rice Isolate Pseudomonas chlororaphis EA105

    OpenAIRE

    McCully, Lucy M.; Bitzer, Adam S.; Spence, Carla A.; Bais, Harsh P.; Silby, Mark W.

    2014-01-01

    Pseudomonas chlororaphis EA105, a strain isolated from rice rhizosphere, has shown antagonistic activities against a rice fungal pathogen, and could be important in defense against rice blast. We report the draft genome sequence of EA105, which is an estimated size of 6.6 Mb.

  11. 15 CFR 2011.105 - Form and applicability of certificate.

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 3 2010-01-01 2010-01-01 false Form and applicability of certificate. 2011.105 Section 2011.105 Commerce and Foreign Trade Regulations Relating to Foreign Trade Agreements OFFICE OF THE UNITED STATES TRADE REPRESENTATIVE ALLOCATION OF TARIFF-RATE QUOTA ON IMPORTED...

  12. 49 CFR 192.105 - Design formula for steel pipe.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 3 2010-10-01 2010-10-01 false Design formula for steel pipe. 192.105 Section 192... NATURAL AND OTHER GAS BY PIPELINE: MINIMUM FEDERAL SAFETY STANDARDS Pipe Design § 192.105 Design formula for steel pipe. (a) The design pressure for steel pipe is determined in accordance with the...

  13. 8 CFR 1003.105 - Notice of Intent to Discipline.

    Science.gov (United States)

    2010-01-01

    ... 8 Aliens and Nationality 1 2010-01-01 2010-01-01 false Notice of Intent to Discipline. 1003.105... and Procedures § 1003.105 Notice of Intent to Discipline. (a) Issuance of Notice to practitioner. (1... subject of the preliminary inquiry a Notice of Intent to Discipline. Service of this notice will be...

  14. 105-B Reactor museum Phase 2 project supplement cost estimate

    International Nuclear Information System (INIS)

    This document serves as a supplement to BHI-0134, 105-B Reactor Museum Feasibility Assessment. The Phase 2 105-B Reactor assessment was performed to provide a basis for identifying and mitigating the hazards in specific areas of the B Reactor facility to support public tours

  15. 28 CFR 105.14 - Risk assessment for candidates.

    Science.gov (United States)

    2010-07-01

    ... or national security as a result of the preliminary risk assessment, the candidate or the Provider... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Risk assessment for candidates. 105.14... CHECKS Aviation Training for Aliens and Other Designated Individuals § 105.14 Risk assessment...

  16. 41 CFR 105-71.141 - Financial reporting.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Financial reporting. 105... GOVERNMENTS 71.14-Post-Award Requirements/Reports, Records, Retention, and Enforcement § 105-71.141 Financial reporting. (a) General. (1) Except as provided in paragraphs (a) (2) and (5) of this section, grantees...

  17. 7 CFR 786.105 - Proof of production.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 7 2010-01-01 2010-01-01 false Proof of production. 786.105 Section 786.105... production. (a) Evidence of production is required to establish the commercial marketing and production history of the dairy operation so that dairy production losses can be computed in accordance with §...

  18. 41 CFR 105-8.150-2 - Methods.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Methods. 105-8.150-2... HANDICAP IN PROGRAMS OR ACTIVITIES CONDUCTED BY GENERAL SERVICES ADMINISTRATION § 105-8.150-2 Methods. (a... construction of new facilities, use of accessible rolling stock, or any other methods that result in making...

  19. 15 CFR 270.105 - Duties of a Team.

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false Duties of a Team. 270.105 Section 270... OF STANDARDS AND TECHNOLOGY, DEPARTMENT OF COMMERCE NATIONAL CONSTRUCTION SAFETY TEAMS NATIONAL CONSTRUCTION SAFETY TEAMS Establishment and Deployment of Teams § 270.105 Duties of a Team. (a) A Team's...

  20. 42 CFR 51c.105 - Accord with health planning.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Accord with health planning. 51c.105 Section 51c... COMMUNITY HEALTH SERVICES General Provisions § 51c.105 Accord with health planning. A grant may be made... approval by the appropriate health planning agencies have been met....

  1. 41 CFR 105-54.203-2 - Active charters file.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Active charters file. 105-54.203-2 Section 105-54.203-2 Public Contracts and Property Management Federal Property Management... charters file. The GSA Committee Management Officer retains each original signed charter in a file...

  2. 41 CFR 105-8.154 - Program accessibility: Exceptions.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Program accessibility: Exceptions. 105-8.154 Section 105-8.154 Public Contracts and Property Management Federal Property Management... any action that it can demonstrate would result in a fundamental alteration in the nature of a...

  3. 14 CFR 105.45 - Use of tandem parachute systems.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 2 2010-01-01 2010-01-01 false Use of tandem parachute systems. 105.45 Section 105.45 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION... completed a tandem instructor course given by the manufacturer of the tandem parachute system used in...

  4. 7 CFR 1437.105 - Determining payments for low yield.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 10 2010-01-01 2010-01-01 false Determining payments for low yield. 1437.105 Section 1437.105 Agriculture Regulations of the Department of Agriculture (Continued) COMMODITY CREDIT CORPORATION, DEPARTMENT OF AGRICULTURE LOANS, PURCHASES, AND OTHER OPERATIONS NONINSURED CROP...

  5. 28 CFR 105.21 - Purpose and authority.

    Science.gov (United States)

    2010-07-01

    ... regulate the exchange of criminal history record information (“CHRI”), as defined in 28 CFR 20.3(d), and... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Purpose and authority. 105.21 Section 105.21 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) CRIMINAL HISTORY BACKGROUND...

  6. 28 CFR 105.25 - Authorized employer's responsibilities.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Authorized employer's responsibilities. 105.25 Section 105.25 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) CRIMINAL HISTORY... obtained; (d) Retaining an employee's written consent to submit his fingerprints for a criminal...

  7. 28 CFR 105.26 - State agency's responsibilities.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false State agency's responsibilities. 105.26 Section 105.26 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) CRIMINAL HISTORY BACKGROUND... responsible for: (1) Determining whether to establish a fee to perform a check of state criminal...

  8. 28 CFR 105.10 - Definitions, purpose, and scope.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Definitions, purpose, and scope. 105.10 Section 105.10 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) CRIMINAL HISTORY BACKGROUND... subject to Federal Aviation Administration (FAA) regulation. Accordingly, these entities, when...

  9. 41 CFR 105-54.308 - Responsibilities of the Administrator.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Responsibilities of the Administrator. 105-54.308 Section 105-54.308 Public Contracts and Property Management Federal Property... of the Administrator. The Administrator must ensure: (a) Compliance with the Federal...

  10. 27 CFR 10.5 - Delegations of the Administrator.

    Science.gov (United States)

    2010-04-01

    ... Administrator's Authorities in 27 CFR Part 10, Commercial Bribery. You may obtain a copy of this order by... Administrator. 10.5 Section 10.5 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU... Administrator. Most of the regulatory authorities of the Administrator contained in this part are delegated...

  11. 31 CFR 0.105 - Deputy Ethics Official.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Deputy Ethics Official. 0.105 Section... EMPLOYEE RULES OF CONDUCT General Provisions Responsibilities § 0.105 Deputy Ethics Official. The Chief Counsel or Legal Counsel for a bureau, or a designee, is the Deputy Ethics Official for that bureau....

  12. 9 CFR 113.105 - Leptospira Hardjo Bacterin.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Leptospira Hardjo Bacterin. 113.105... Inactivated Bacterial Products § 113.105 Leptospira Hardjo Bacterin. Leptospira Hardjo Bacterin shall be produced from a culture of Leptospira hardjo which has been inactivated and is nontoxic. Each serial...

  13. 41 CFR 105-53.147 - Public Buildings Service.

    Science.gov (United States)

    2010-07-01

    ... space is used more effectively and efficiently; providing leadership in the development and maintenance... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Public Buildings Service. 105-53.147 Section 105-53.147 Public Contracts and Property Management Federal Property...

  14. 41 CFR 105-72.602 - Financial reporting.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Financial reporting. 105... § 105-72.602 Financial reporting. (a) The following forms or such other forms as may be approved by OMB... information and the recipient's accounting records are not normally kept on the accrual basis, the...

  15. 41 CFR 105-72.502 - Codes of conduct.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Codes of conduct. 105-72... § 105-72.502 Codes of conduct. The recipient shall maintain written standards of conduct governing the... interest is not substantial or the gift is an unsolicited item of nominal value. The standards of...

  16. 5 CFR 831.105 - Computation of interest.

    Science.gov (United States)

    2010-01-01

    ... 31, 1956, interest is not allowed: (1) When an employee has one year or less of covered service, (2... 5 Administrative Personnel 2 2010-01-01 2010-01-01 false Computation of interest. 831.105 Section... (CONTINUED) RETIREMENT Administration and General Provisions § 831.105 Computation of interest. (a)...

  17. 41 CFR 105-53.134 - Office of Administration.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Office of Administration. 105-53.134 Section 105-53.134 Public Contracts and Property Management Federal Property Management... Associate Administrator for Administration, participates in the executive leadership of the...

  18. 5 CFR 537.105 - Criteria for payment.

    Science.gov (United States)

    2010-01-01

    ....105 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS REPAYMENT OF STUDENT LOANS § 537.105 Criteria for payment. (a) General criteria. Before authorizing student loan... its mission. (c) Current Federal employees. An agency may not authorize student loan...

  19. Solid Phase Characterization of Tank 241-C-105 Grab Samples

    International Nuclear Information System (INIS)

    The solid phase characterization (SPC) of three grab samples from single-shell Tank 241-C-105 (C-105) that were received at the laboratory the week of October 26, 2015, has been completed. The three samples were received and broken down in the 11A hot cells.

  20. 5 CFR 185.105 - Review by the reviewing official.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 1 2010-01-01 2010-01-01 false Review by the reviewing official. 185.105... FRAUD CIVIL REMEDIES § 185.105 Review by the reviewing official. If, based on the report of the investigating official under § 185.104(b), the reviewing official determines that there is adequate evidence...

  1. 19 CFR 200.735-105 - Gifts, entertainment, and favors.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 3 2010-04-01 2010-04-01 false Gifts, entertainment, and favors. 200.735-105...-105 Gifts, entertainment, and favors. (a) Except as provided in paragraph (b) of this section, no employee may solicit or accept, directly or indirectly, any gift, gratuity, favor, entertainment, loan,...

  2. 46 CFR 105.05-2 - Prohibitions regarding petroleum products.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Prohibitions regarding petroleum products. 105.05-2... VESSELS COMMERCIAL FISHING VESSELS DISPENSING PETROLEUM PRODUCTS Application § 105.05-2 Prohibitions regarding petroleum products. (a) Commercial fishing vessels shall not transport Grade A flammable...

  3. 46 CFR 105.10-20 - Pressure vacuum relief valve.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Pressure vacuum relief valve. 105.10-20 Section 105.10-20 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) CARGO AND MISCELLANEOUS VESSELS... Pressure vacuum relief valve. (a) The term pressure vacuum relief valve means any device or assembly of...

  4. 21 CFR 58.105 - Test and control article characterization.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 1 2010-04-01 2010-04-01 false Test and control article characterization. 58.105... GENERAL GOOD LABORATORY PRACTICE FOR NONCLINICAL LABORATORY STUDIES Test and Control Articles § 58.105 Test and control article characterization. (a) The identity, strength, purity, and composition or...

  5. Dicty_cDB: AFJ105 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available AF (Link to library) AFJ105 (Link to dictyBase) - - - Contig-U14985-1 AFJ105P (Link to Original ... _1( BC100108 |pid:none) Rattus norvegicus TAF6 RNA polymer ... 126 2e-27 ( Q62311 ) RecName: Full=Transcriptio ...

  6. 41 CFR 105-72.500 - Purpose of procurement standards.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Purpose of procurement standards. 105-72.500 Section 105-72.500 Public Contracts and Property Management Federal Property... EDUCATION, HOSPITALS, AND OTHER NON-PROFIT ORGANIZATIONS 72.50-Post-Award Requirements/Procurement...

  7. 41 CFR 105-72.506 - Procurement records.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Procurement records. 105-72.506 Section 105-72.506 Public Contracts and Property Management Federal Property Management... EDUCATION, HOSPITALS, AND OTHER NON-PROFIT ORGANIZATIONS 72.50-Post-Award Requirements/Procurement...

  8. 41 CFR 105-72.504 - Procurement procedures.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Procurement procedures. 105-72.504 Section 105-72.504 Public Contracts and Property Management Federal Property Management... EDUCATION, HOSPITALS, AND OTHER NON-PROFIT ORGANIZATIONS 72.50-Post-Award Requirements/Procurement...

  9. 41 CFR 105-74.635 - Drug-free workplace.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Drug-free workplace. 105... Administration 74-GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Definitions § 105-74.635 Drug-free workplace. Drug-free workplace means a site for the performance of work done...

  10. Solid Phase Characterization of Tank 241-C-105 Grab Samples

    Energy Technology Data Exchange (ETDEWEB)

    Ely, T. M. [Washington River Protection Solutions LLC, Richland, WA (United States); LaMothe, M. E. [Washington River Protection Solutions LLC, Richland, WA (United States); Lachut, J. S. [Washington River Protection Solutions LLC, Richland, WA (United States)

    2016-01-11

    The solid phase characterization (SPC) of three grab samples from single-shell Tank 241-C-105 (C-105) that were received at the laboratory the week of October 26, 2015, has been completed. The three samples were received and broken down in the 11A hot cells.

  11. 41 CFR 105-70.019 - Prehearing conferences.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Prehearing conferences. 105-70.019 Section 105-70.019 Public Contracts and Property Management Federal Property Management... party chooses to waive appearance at an oral hearing and to submit only documentary evidence (subject...

  12. 24 CFR 954.105 - Criteria for selection.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Criteria for selection. 954.105... DEVELOPMENT INDIAN HOME PROGRAM Applying for Assistance § 954.105 Criteria for selection. There are four... which the grantee has the administrative staff to carry out the project successfully. (c)...

  13. 49 CFR 219.105 - Railroad's duty to prevent violations.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Railroad's duty to prevent violations. 219.105 Section 219.105 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD... duty to prevent violations. (a) A railroad may not, with actual knowledge, permit an employee to go...

  14. 41 CFR 101-1.105 - Authority for FPMR System.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Authority for FPMR System. 101-1.105 Section 101-1.105 Public Contracts and Property Management Federal Property Management Regulations System FEDERAL PROPERTY MANAGEMENT REGULATIONS GENERAL 1-INTRODUCTION 1.1-Regulation System §...

  15. 40 CFR 300.105 - General organization concepts.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 27 2010-07-01 2010-07-01 false General organization concepts. 300.105... PLAN Responsibility and Organization for Response § 300.105 General organization concepts. (a) Federal....205(c). (d) The basic framework for the response management structure is a system (e.g., a...

  16. 33 CFR 105.250 - Security systems and equipment maintenance.

    Science.gov (United States)

    2010-07-01

    ... maintenance. 105.250 Section 105.250 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND... systems and equipment maintenance. (a) Security systems and equipment must be in good working order and... include procedures for identifying and responding to security system and equipment failures...

  17. 41 CFR 105-68.920 - Civil judgment.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Civil judgment. 105-68... Administration 68-GOVERNMENTWIDE DEBARMENT AND SUSPENSION (NONPROCUREMENT) Definitions § 105-68.920 Civil judgment. Civil judgment means the disposition of a civil action by any court of competent...

  18. Cellular mechanisms of cadmium-induced toxicity: a review.

    Science.gov (United States)

    Rani, Anju; Kumar, Anuj; Lal, Ankita; Pant, Manu

    2014-08-01

    Cadmium is a widespread toxic pollutant of occupational and environmental concern because of its diverse toxic effects: extremely protracted biological half-life (approximately 20-30 years in humans), low rate of excretion from the body and storage predominantly in soft tissues (primarily, liver and kidneys). It is an extremely toxic element of continuing concern because environmental levels have risen steadily due to continued worldwide anthropogenic mobilization. Cadmium is absorbed in significant quantities from cigarette smoke, food, water and air contamination and is known to have numerous undesirable effects in both humans and animals. Cadmium has a diversity of toxic effects including nephrotoxicity, carcinogenicity, teratogenicity and endocrine and reproductive toxicities. At the cellular level, cadmium affects cell proliferation, differentiation, apoptosis and other cellular activities. Current evidence suggests that exposure to cadmium induces genomic instability through complex and multifactorial mechanisms. Most important seems to be cadmium interaction with DNA repair mechanism, generation of reactive oxygen species and induction of apoptosis. In this article, we have reviewed recent developments and findings on cadmium toxicology. PMID:24117228

  19. Cadmium (II) removal mechanisms in microbial electrolysis cells.

    Science.gov (United States)

    Colantonio, Natalie; Kim, Younggy

    2016-07-01

    Cadmium is a toxic heavy metal, causing serious environmental and human health problems. Conventional methods for removing cadmium from wastewater are expensive and inefficient for low concentrations. Microbial electrolysis cells (MECs) can simultaneously treat wastewater, produce hydrogen gas, and remove heavy metals with low energy requirements. Lab-scale MECs were operated to remove cadmium under various electric conditions: applied voltages of 0.4, 0.6, 0.8, and 1.0V; and a fixed cathode potential of -1.0V vs. Ag/AgCl. Regardless of the electric condition, rapid removal of cadmium was demonstrated (50-67% in 24h); however, cadmium concentration in solution increased after the electric current dropped with depleted organic substrate under applied voltage conditions. For the fixed cathode potential, the electric current was maintained even after substrate depletion and thus cadmium concentration did not increase. These results can be explained by three different removal mechanisms: cathodic reduction; Cd(OH)2 precipitation; and CdCO3 precipitation. When the current decreased with depleted substrates, local pH at the cathode was no longer high due to slowed hydrogen evolution reaction (2H(+)+2e(-)→H2); thus, the precipitated Cd(OH)2 and CdCO3 started dissolving. To prevent their dissolution, sufficient organic substrates should be provided when MECs are used for cadmium removal. PMID:26970043

  20. Mobility, bioavailability, and toxic effects of cadmium in soil samples

    International Nuclear Information System (INIS)

    Total concentration is not a reliable indicator of metal mobility or bioavailability in soils. The physicochemical form determines the behavior of metals in soils and hence the toxicity toward terrestrial biota. The main objectives of this study were the application and comparison of three approaches for the evaluation of cadmium behavior in soil samples. The mobility and bioavailability of cadmium in five selected soil samples were evaluated using equilibrium speciation (Windermere humic aqueous mode (WHAM)), extraction procedures (Milli-Q water, DMSO, and DTPA), and a number of bioassays (Microtox, growth inhibition test, contact toxicity test, and respiration). The mobility, represented by the water-extractable fraction corresponded well with the amount of cadmium in the soil solution, calculate using the WHAM (r2=0.96, P<0.001). The results of the ecotoxicologica evaluation, which represent the bioavailable fraction of cadmium, correlated well with DTPA extractability and also with the concentration of free cadmium ion, which is recognized as the most bioavailable metal form. The results of the WHAM as well as the results of extraction experiments showed a strong binding of cadmium to organic matter and a weak sorption of cadmium to clay minerals

  1. Cadmium cutoff energy for MCNP modeling of dosimetry reactions

    International Nuclear Information System (INIS)

    Reactor pressure vessel neutron fluence calculations are verified by comparing calculated reaction rates of dosimetry foils assumed to be placed in the cavity surrounding the pressure vessel with corresponding experimentally determined dosimetry reaction rates at the same location. The irradiated foils used are bare and cadmium covered. The cadmium-covered foils see a different neutron flux than the uncovered foils. Computer models computing reaction rates for the foils must approximate the effect of the cadmium foil cover. The MCNP code modeling of reactor cavity dosimetry reactions to validate the computed neutron flux hitting the pressure vessel of a pressurized water reactor (PWR) requires the choice of an appropriate cadmium cutoff energy. Since the neutron spectrum is harder in the cavity than in the core, the same cadmium cutoff energy may not be universally applied. The correct cutoff energy for the cavity of a PWR was computed by using MCNP4a and a representative cavity spectrum. Four cadmium-covered foil reactions were analyzed, and the appropriate energy cutoff was determined to be ∼ 0.6 eV for ∼0.5-mm-thick cadmium covers

  2. Bacterial bioremediation of aquatic cadmium 11 of area of Pakistan

    International Nuclear Information System (INIS)

    Cadmium Cd/sup +2/ pollution arises mainly from contamination of minerals used in agriculture and from industrial process. The usual situation is of large volume of soil and H/sub 2/O that are contaminated with low but significant concentration of Cd/sup +2/. Cadmium is one of the most dangerous heavy metal both to human health and aquatic ecosystem. Microorganisms have developed different strategies to regulate uptake and to detoxify heavy metals viz; by different mechanisms i.e. by adsorption to cell surface, by intercellular accumulation, precipitation, biosynthesis of metallothioneins to volatile compounds. Microcosm experiments in chemostat incubated at 20 deg. C showed that Cadmium Contamination does not greatly affect bacterial communities in cultures contaminated with up to 1mg CdI/sup -1/. acterial productivity remains unchanged and Cadmium- resistant strains arise quickly and in great number. The cadmium accumulation by bacteria depend on the bacterial productivity. The free bacteria can accumulate up to 1200 ppm Cadmium Where as the adhering bacteria concentrate up to 6100 ppm. At a steady state, 11-29% Cadmium is removed from the water phase of cultures. This paper includes Cd (II) removal by Bacteria from waste water of Wah Cantonment Pakistan. (author)

  3. Accumulation and distribution of arsenic and cadmium by tea plants

    Institute of Scientific and Technical Information of China (English)

    Yuan-zhi SHI; Jian-yun RUAN; Lifeng MA; Wen-yan HAN; Fang WANG

    2008-01-01

    It is important to research the rules about accumulation and distribution of arsenic and cadmium by tea plants, which will give us some scientific ideas about how to control the contents of arsenic and cadmium in tea. In this study, by field inves- tigation and pot trial, we found that mobility of arsenic and cadmium in tea plants was low. Most arsenic and cadmium absorbed were fixed in feeding roots and only small amount was transported to the above-ground parts. Distribution of arsenic and cadmium, based on their concentrations of unit dry matter, in tea plants grown on un-contaminated soil was in the order: feeding roots>stems≈main roots>old leaves>young leaves. When tea plants were grown on polluted soils simulated by adding salts of these two metals, feeding roots possibly acted as a buffer and defense, and arsenic and cadmium were transported less to the above- ground parts. The concentration of cadmium in soil significantly and negatively correlated with chlorophyll content, photosyn- thetic rate, transpiration rate and biomass production of tea plants.

  4. Cadmium Uptake in Synechococcus aquatilis (Reynaud Strain SY01

    Directory of Open Access Journals (Sweden)

    Ruperto Vallarta Jr.

    1998-12-01

    Full Text Available Cadmium uptake in Synechococcus aquatilis (Reynaud Strain SY01 showed a biphasic behavior, with an initial rapid passive cell wall interaction phase and a later slow intracellular cation uptake process. The cell wall uptake process followed Michaelis-Menten kinetics. The apparent Km of the uptake system was 38.89 µM, a relatively high affinity Km value compared to other metal uptake systems. Fitting of experimental data to the Langmuir and Freundlich adsorption isotherms showed that binding of cadmium to the cell surface was monolayer and/or multilayer, although the monolayer adsorption was more probable, as exemplified by a high correlation coefficient. This could be explained by the presence of a strong primary binding site which was responsible for a monolayer adsorption and a weak secondary binding site which could be responsible for a multilayer adsorption. The uptake process was found to be relatively specific for cadmium. Equimolar amounts (200 µM of cobalt, nickel, magnesium, and copper did not significantly affect cadmium uptake. Synechococcus aquatilis Strain SY01 cells also showed an efflux mechanism for cadmium, although the amount of excluded cadmium was insignificant compared with the amount of adsorbed cadmium in the cell wall.

  5. Blood cadmium concentration and lipid profile in Korean adults

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Kisok, E-mail: kimkisok@kmu.ac.kr [Department of Public Health, Keimyung University, 1000 Shindang-dong, Daegu 704-701 (Korea, Republic of)

    2012-01-15

    Although animal experiments have shown that cadmium exposure induces alterations in lipid profiles, no epidemiological study of this relationship has been performed. The objective of this study was to evaluate the association between blood cadmium concentration and blood lipid levels in Korean adults. A cross-sectional study comprising participants (n=3903) aged 20 years or older from the 2005, 2008, and 2009 Korea National Health and Nutrition Examination Surveys was conducted. Demographic characteristics and dietary intake were obtained from the participants by questionnaire, and cadmium and lipid levels were determined by analysis of blood samples. After adjusting for demographic and dietary factors, blood concentration of cadmium was positively associated with the risk of low high-density lipoprotein cholesterol (HDL-C) in a dose-dependent manner (p for trend <0.001). In addition, the odds ratios (ORs) of a high triglyceride to HDL-C ratio was significantly increased in the high blood cadmium groups [OR=1.36; 95% confidence interval (CI), 1.03-1.79 for fourth quintile and OR=1.41; 95% CI, 1.07-1.86 for fifth quintile] compared with the lowest quintile group. However, high blood cadmium was not associated with a risk of high total cholesterol, high low-density lipoprotein cholesterol, or high triglycerides. These data suggest that an increased cadmium body burden increases the risk of dyslipidemia, mainly due to the increased risk of low HDL-C and the high ratio of triglycerides to HDL-C.

  6. Screening of Amaranth Cultivars (Amaranthus mangostanus L.) for Cadmium Hyperaccumulation

    Institute of Scientific and Technical Information of China (English)

    FAN Hong-li; ZHOU Wei

    2009-01-01

    The potential harm of soil cadmium pollution to ecological environment and human health has been increasingly widely concerned. Phytoremediation, as a kind of new and effective technology, has become an important method for cleaning up cadmium in contaminated sites. The amaranth (Amaranthus mangostanus L.) is widely distributed and has abundant varieties in China, its rapid growth and large biomass can be served as candidate for cadmium hyperaccumulators for phytoremediation. To obtain cadmium hyper-accumulator, Cd uptake in 23 amaranth euitivars from different ecological region was investigated under hydroponic culture condition. Meanwhile, pot experiment was established to probe phytoremediation potentiality of Cd contaminated soil by amaranth. Three treatment (Cd 5, 10, and 25 mg kg-1) were imposed to red soil, yellow brown soil, and vegetable soil. The results showed that under hydroponic culture with Cd 3 mg L-1, the cadmium concentration in the shoots of the cultivar Tianxingmi reached 260 mg kg-1, and its total cadmium uptake was the highest among various cultivars. In the treatment Cd 25 mg kg-1, the cadmium concentration in the shoots of the cultivar Tianxingmi reached 212 mg kg-1, while bioaccumulation factor and shoot purification rate reached 8.50 and 3.8%, respectively. Further, the total biomass and shoot biomass were not decreased significantly under Cd exposure.These results suggested that eultivar Tianxingmi is a typical Cd hyperaccumulator, and can be expected to be used in phytoremediation of Cd contaminated soil.

  7. Selenium protection from cadmium and chromium poisoning

    International Nuclear Information System (INIS)

    The interaction of selenium with cadmium and chromium was studied in 168 chicken-broilers (DWCxWR) divided into four equal groups. Eight-week old control animals received an intravenous dose of /sup 115m/Cd Chloride 370 KBq/Kg (Group I), or 51Cr Chloride 370 KBq/Kg (Group II). The kinetics of these isotopes were studied by scintillation spectrometry (NaI/TI) carried out for whole blood, plasma, plasma proteins, urine, feces and homogenates of all organs at various time intervals. Animals in Groups III and IV received eight subcutaneous doses of sodium selenate (5ug) at 8-week intervals prior to /sup 115m/Cd or 51Cr. The kinetics of these elements were studied as in the previous two groups. It was found that selenium affected those kinetics in two ways: (a) by increasing the excretion of Cd by 11 +/- 3% (P < 0.001) and that of Cr by 7 +/- 1% (P < 0.001); and (b) by favoring redistribution of those elements, with significant (P < 0.001) reductions in liver, endocrine glands and kidney and increases (P < 0.01) in bone. The study suggests that selenium protects the animals' vital organs from environmental pollutants, such as cadmium and chromium

  8. Cadmium determination in Lentinus edodes mushroom species

    Directory of Open Access Journals (Sweden)

    Vera Akiko Maihara

    2012-09-01

    Full Text Available Many studies have drawn attention to the occurrence and concentration of toxic elements found in the fruiting body of mushrooms. Some edible mushroom species are known to accumulate high levels of inorganic contaminants, mainly cadmium, mercury, and lead. There are about 2,000 known edible mushroom species, but only 25 of them are cultivated and used as food. In Brazil, the most marketed and consumed mushroom species are Agaricus bisporus, known as Paris champignon, Lentinus edodes, or Shitake and Pleurotus sp, also called Shimeji or Hiratake. In this study, the concentration of cadmium was determined in Lentinus edodes mushrooms from different cities in São Paulo state and some samples imported from Japan and China. The analyses were performed by graphite furnace atomic absorption spectrometry after HNO3-H2O2 digestion. The results showed a lower concentration of Cd in the mushrooms cultivated in São Paulo (0.0079 to 0.023 mg.kg-1 in natura than that of the mushrooms cultivated abroad (0.125 to 0.212 mg.kg-1 in natura. Although there is no tolerance limit for Cd in mushrooms in Brazil, the results show that Lentinus edodes mushrooms can be safely consumed.

  9. Cadmium minimization in wheat: A critical review.

    Science.gov (United States)

    Rizwan, Muhammad; Ali, Shafaqat; Abbas, Tahir; Zia-Ur-Rehman, Muhammad; Hannan, Fakhir; Keller, Catherine; Al-Wabel, Mohammad I; Ok, Yong Sik

    2016-08-01

    Cadmium (Cd) accumulation in wheat (Triticum aestivum L.) and its subsequent transfer to food chain is a major environmental issue worldwide. Understanding wheat response to Cd stress and its management for aiming to reduce Cd uptake and accumulation in wheat may help to improve wheat growth and grain quality. This paper reviewed the toxic effects, tolerance mechanisms, and management of Cd stress in wheat. It was concluded that Cd decreased germination, growth, mineral nutrients, photosynthesis and grain yield of wheat and plant response to Cd toxicity varies with cultivars, growth conditions and duration of stress applied. Cadmium caused oxidative stress and genotoxicity in wheat plants. Stimulation of antioxidant defense system, osmoregulation, ion homeostasis and over production of signalling molecules are important adaptive strategies of wheat under Cd stress. Exogenous application of plant growth regulators, inorganic amendments, proper fertilization, silicon, and organic, manures and biochar, amendments are commonly used for the reduction of Cd uptake in wheat. Selection of low Cd-accumulating wheat cultivars, crop rotation, soil type, and exogenous application of microbes are among the other agronomic practices successfully employed in reducing Cd uptake by wheat. These management practices could enhance wheat tolerance to Cd stress and reduce the transfer of Cd to the food chain. However, their long-term sustainability in reducing Cd uptake by wheat needs further assessment. PMID:27062345

  10. Alternative materials to cadmium for neutron absorbers in safeguards applications

    International Nuclear Information System (INIS)

    Cadmium is increasingly difficult to use in safeguards applications because of rising cost and increased safety regulations. This work examines the properties of two materials produced by Ceradyne, inc. that present alternatives to cadmium for neutron shielding. The first is an aluminum metal doped with boron and the second is a boron carbide powder, compressed into a ceramic. Both are enriched in the 10B isotope. Two sheets of boron doped aluminum (1.1 mm and 5.2mm thick) and one sheet of boron carbide (8.5mm thick) were provided by Ceradyne for testing. An experiment was designed to test the neutron absorption capabilities of these three sheets against two different thicknesses of cadmium (0.6mm and 1.6mm thick). The thinner piece of aluminum boron alloy (1.1mm) performed as well as the cadmium pieces at absorbing neutrons. The thicker aluminum-boron plate provided more shielding than the cadmium sheets and the boron carbide performed best by a relatively large margin. Monte Carlo N-Particle eXtended (MCNPX) transport code modeling of the experiment was performed to provide validaLed computational tools for predicting the behavior of systems in which these materials may be incorporated as alternatives to cadmium. MCNPX calculations predict that approximately 0.17mm of the boron carbide is equivalent to 0.6mm of cadmium. There are drawbacks to these materials that need to be noted when considering using them as replacements for cadmium. Notably, they may need to be thicker than cadmium, and are not malleable, requiring machining to fit any curved forms.

  11. Cadmium inhibits acid secretion in stimulated frog gastric mucosa

    International Nuclear Information System (INIS)

    Cadmium, a toxic environmental pollutant, affects the function of different organs such as lungs, liver and kidney. Less is known about its toxic effects on the gastric mucosa. The aim of this study was to investigate the mechanisms by which cadmium impacts on the physiology of gastric mucosa. To this end, intact amphibian mucosae were mounted in Ussing chambers and the rate of acid secretion, short circuit current (Isc), transepithelial potential (Vt) and resistance (Rt) were recorded in the continuous presence of cadmium. Addition of cadmium (20 μM to 1 mM) on the serosal but not luminal side of the mucosae resulted in inhibition of acid secretion and increase in NPPB-sensitive, chloride-dependent short circuit current. Remarkably, cadmium exerted its effects only on histamine-stimulated tissues. Experiments with TPEN, a cell-permeant chelator for heavy metals, showed that cadmium acts from the intracellular side of the acid secreting cells. Furthermore, cadmium-induced inhibition of acid secretion and increase in Isc cannot be explained by an action on: 1) H2 histamine receptor, 2) Ca2+ signalling 3) adenylyl cyclase or 4) carbonic anhydrase. Conversely, cadmium was ineffective in the presence of the H+/K+-ATPase blocker omeprazole suggesting that the two compounds likely act on the same target. Our findings suggest that cadmium affects the functionality of histamine-stimulated gastric mucosa by inhibiting the H+/K+-ATPase from the intracellular side. These data shed new light on the toxic effect of this dangerous environmental pollutant and may result in new avenues for therapeutic intervention in acute and chronic intoxication.

  12. Exposure dose response relationships of the freshwater bivalve Hyridella australis to cadmium spiked sediments

    Energy Technology Data Exchange (ETDEWEB)

    Marasinghe Wadige, Chamani P.M., E-mail: chamani.marasinghe.wadige@canberra.edu.au; Maher, William A.; Taylor, Anne M.; Krikowa, Frank

    2014-07-01

    Highlights: • The exposure–dose–response approach was used to assess cadmium exposure and toxicity. • Accumulated cadmium in H. australis reflected the sediment cadmium exposure. • Spill over of cadmium into the biologically active pool was observed. • Increased cadmium resulted in measurable biological effects. • H. australis has the potential to be a cadmium biomonitor in freshwater environments. - Abstract: To understand how benthic biota may respond to the additive or antagonistic effects of metal mixtures in the environment it is first necessary to examine their responses to the individual metals. In this context, laboratory controlled single metal-spiked sediment toxicity tests are useful to assess this. The exposure–dose–response relationships of Hyridella australis to cadmium-spiked sediments were, therefore, investigated in laboratory microcosms. H. australis was exposed to individual cadmium spiked sediments (<0.05 (control), 4 ± 0.3 (low) and 15 ± 1 (high) μg/g dry mass) for 28 days. Dose was measured as cadmium accumulation in whole soft body and individual tissues at weekly intervals over the exposure period. Dose was further examined as sub-cellular localisation of cadmium in hepatopancreas tissues. The biological responses in terms of enzymatic and cellular biomarkers were measured in hepatopancreas tissues at day 28. H. australis accumulated cadmium from spiked sediments with an 8-fold (low exposure organisms) and 16-fold (high exposure organisms) increase at day 28 compared to control organisms. The accumulated tissue cadmium concentrations reflected the sediment cadmium exposure at day 28. Cadmium accumulation in high exposure organisms was inversely related to the tissue calcium concentrations. Gills of H. australis showed significantly higher cadmium accumulation than the other tissues. Accumulated cadmium in biologically active and biologically detoxified metal pools was not significantly different in cadmium exposed

  13. Cadmium biosorption by baker’s yeast in aqueous suspension

    OpenAIRE

    Tálos Katalin; Pernyeszi Tímea; Majdik Cornelia; Hegedűsova Alzbeta; Páger Csilla

    2012-01-01

    The biosorption of cadmium from artificial aqueous solutions using native baker’s yeast was investigated. The highest metal uptake value was 110 mg g-1 in a suspension of 0.3 g L-1. The effect of pH, initial cadmium concentration, adsorption time and biosorbent dosage on biosorption by baker’s yeast was studied. The maximum biosorption capacity of cadmium by yeast was observed at pH 6.0. The adsorption equilibrium was reached within sixty minutes and the sorption process followed pseudo...

  14. Experience of reprocessing of cadmium sulfide-containing waste materials

    International Nuclear Information System (INIS)

    Technique of cadmium extraction from sulfide-containing wastes using the method of oxidizing leaching was developed and subjected to industrial testing. Reagents containing manganese dioxide - manganese ore or manganese slime of electrolytic shop usually used in zinc production - are advisable to be used as oxidizers. Factors of cadmium extraction into solution appeared to be close to ones, obtained during laboratory investigation. If the yield of leaching residual equals ∼38% and the content of cadmium, being in insoluble form, equals ∼0.40%, metal losses with this residual are equal to 0.37%

  15. Hepatoprotective activity of Moringa oleifera against cadmium toxicity in rats

    OpenAIRE

    Reetu Toppo; Birendra Kumar Roy; Ravuri Halley Gora; Sushma Lalita Baxla; Prabhat Kumar

    2015-01-01

    Aim: The present investigation has been conducted to evaluate the hepatoprotective activity of Moringa oleifera against cadmium-induced toxicity in rats. Materials and Methods: For this study, 18 Wistar albino rats were taken. Control group, Group I rats were given cadmium chloride @ 200 ppm per kg and Group II rats were treated with M. oleifera extract @ 500 mg/kg along with cadmium chloride @ 200 ppm per kg (daily oral for 28 days). On 29th day, animals were slaughtered and various paramete...

  16. Cadmium and hypertension in exposed workers: A meta-analysis

    Directory of Open Access Journals (Sweden)

    Tiziana Caciari

    2013-06-01

    Full Text Available Objectives: In the general population, cadmium seems to be responsible for hypertension, atherosclerosis and an increase in acute coronary events. Therefore, the purpose of this meta-analysis was to analyze controlled studies conducted on cadmium and arterial pressure in occupationally-exposed workers. Materials and Methods: After analyzing all the relevant articles found in the literature, 6 publications were selected. Results: A higher prevalence of hypertension and higher values of systolic and diastolic blood pressure were recorded in the exposed subjects. Conclusions: Cadmium in occupationallyexposed individuals appears to induce an increase in systolic and diastolic blood pressure and an increase in the prevalence of hypertension.

  17. Zinc and cadmium oxidation by cyclopentadienylmolybdenum(tungsten) tricarbonyl chlorides

    International Nuclear Information System (INIS)

    Influence of the nature of organic solvent on reaction rate and yield of zinc and cadmium interaction products with Cp(CO)3 MCl complexes (Cp - cyclopentadiene; M = Mo, W) at temperatures of 283-303 K was studied. Kinetic parameters of zinc and cadmium oxidation by molybdenum complex in the presence of N,N-dimethylformamide were ascertained. Thermodynamic parameters of the oxidant and ligand adsorption on metal surface were determined. It is shown that the use of the complexes studied as metal oxidants permits preparing compounds featuring molybdenum and tunsten bond with zinc and cadmium

  18. Determination of cadmium in aluminium by atomic absorption spectrometry

    International Nuclear Information System (INIS)

    A direct method for the determination of cadmium in elemental aluminium is described. Metal samples are dissolved in diluted hydrochloric acid and cadmium is determined by atomic absorption spectrometry in an air-acetylene flame. Interference by non-specific absorption observed at the analytical wavelength incorrected for by means of a non-absorbing line emitted by the hollow-cathode lamp. Relatively large amounts of arsenic do not interfere. The minimun determinable concentration of cadmium for this procedure is 2-3 ppm, expressed on aluminium basis. (author)

  19. Chromosomal Locus for Cadmium Resistance in Pseudomonas putida Consisting of a Cadmium-Transporting ATPase and a MerR Family Response Regulator

    OpenAIRE

    Lee, Seon-Woo; Glickmann, Eric; Cooksey, Donald A.

    2001-01-01

    Pseudomonads from environmental sources vary widely in their sensitivity to cadmium, but the basis for this resistance is largely uncharactarized. A chromosomal fragment encoding cadmium resistance was cloned from Pseudomonas putida 06909, a rhizosphere bacterium, and sequence analysis revealed two divergently transcribed genes, cadA and cadR. CadA was similar to cadmium-transporting ATPases known mostly from gram-positive bacteria, and to ZntA, a lead-, zinc-, and cadmium-transporting ATPase...

  20. Inclusion free cadmium zinc tellurium and cadmium tellurium crystals and associated growth method

    Science.gov (United States)

    Bolotnikov, Aleskey E.; James, Ralph B.

    2010-07-20

    The present disclosure provides systems and methods for crystal growth of cadmium zinc tellurium (CZT) and cadmium tellurium (CdTe) crystals with an inverted growth reactor chamber. The inverted growth reactor chamber enables growth of single, large, high purity CZT and CdTe crystals that can be used, for example, in X-ray and gamma detection, substrates for infrared detectors, or the like. The inverted growth reactor chamber enables reductions in the presence of Te inclusions, which are recognized as an important limiting factor in using CZT or CdTe as radiation detectors. The inverted growth reactor chamber can be utilized with existing crystal growth techniques such as the Bridgman crystal growth mechanism and the like. In an exemplary embodiment, the inverted growth reactor chamber is a U-shaped ampoule.

  1. Enhanced diode performance in cadmium telluride–silicon nanowire heterostructures

    International Nuclear Information System (INIS)

    Highlights: • Vertically well oriented Si nanowire arrays on Si wafer were synthesized. • Semiconductor CdTe thin film/Si nanowire devices were successfully fabricated. • Optoelectronic properties of the fabricated devices were investigated. • Enhanced electrical and diode properties for the devices were observed. • The devices exhibited strong photosensitivity in near infrared region. - Abstract: We report on the structural and optoelectronic characteristics and photodetection properties of cadmium telluride (CdTe) thin film/silicon (Si) nanowire heterojunction diodes. A simple and cost-effective metal-assisted etching (MAE) method is applied to fabricate vertically oriented Si nanowires on n-type single crystalline Si wafer. Following the nanowire synthesis, CdTe thin films are directly deposited onto the Si nanowire arrays through RF magnetron sputtering. A comparative study of X-ray diffraction (XRD) and Raman spectroscopy shows the improved crystallinity of the CdTe thin films deposited onto the Si nanowires. The fabricated nanowire based heterojunction devices exhibit remarkable diode characteristics, enhanced optoelectronic properties and photosensitivity in comparison to the planar reference device. The electrical measurements revealed that the diodes have a well-defined rectifying behavior with a superior rectification ratio of 105 at ±5 V and a relatively small ideality factor of n = 1.9 with lower reverse leakage current and series resistance at room temperature in dark condition. Moreover, an open circuit voltage of 120 mV is also observed under illumination. Based on spectral photoresponsivity measurements, the nanowire based device exhibits a distinct responsivity (0.35–0.5 A W−1) and high detectivity (6 × 1012−9 × 1012 cm Hz1/2 W−1) in near-infrared wavelength region. The enhanced device performance and photosensitivity is believed to be due to three-dimensional nature of the interface between the CdTe thin film and the Si

  2. Cadmium transport and tolerance in rice: perspectives for reducing grain cadmium accumulation

    OpenAIRE

    Uraguchi, Shimpei; Fujiwara, Toru

    2012-01-01

    Cadmium (Cd) is a toxic heavy metal which harms human health. In Japan, a major source of human Cd-intake is rice grains and contamination of paddy soils by Cd and accumulation of Cd in rice grains are the serious agricultural issues. There also exist Cd contamination of rice and its toxicity in several populations in countries including China and Thailand. Understanding the Cd transport mechanisms in rice can be a basis for regulating rice Cd transport and accumulation by molecular engineeri...

  3. Fractionation of Stable Cadmium Isotopes in the Cadmium Tolerant Ricinus communis and Hyperaccumulator Solanum nigrum

    OpenAIRE

    Rongfei Wei; Qingjun Guo; Hanjie Wen; Congqiang Liu; Junxing Yang; Marc Peters; Jian Hu; Guangxu Zhu; Hanzhi Zhang; Liyan Tian; Xiaokun Han; Jie Ma; Chuanwei Zhu; Yingxin Wan

    2016-01-01

    Cadmium (Cd) isotopes provide new insights into Cd uptake, transport and storage mechanisms in plants. Therefore, the present study adopted the Cd-tolerant Ricinus communis and Cd-hyperaccumulator Solanum nigrum, which were cultured under controlled conditions in a nutrient solution with variable Cd supply, to test the isotopic fractionation of Cd during plant uptake. The Cd isotope compositions of nutrient solutions and organs of the plants were measured by multiple collector inductively cou...

  4. Engineering study: 105KE to 105KW Basin fuel and sludge transfer. Final report

    International Nuclear Information System (INIS)

    In the last five years, there have been three periods at the 105KE fuel storage basin (KE Basin) where the reported drawdown test rates were in excess of 25 gph. Drawdown rates in excess of this amount have been used during past operations as the primary indicators of leaks in the basin. The latest leak occurred in March, 1993. The reported water loss from the KE Basin was estimated at 25 gph. This engineering study was performed to identify and recommend the most feasible and practical method of transferring canisters of irradiated fuel and basin sludge from the KE Basin to the 105KW fuel storage basin (KW Basin). Six alternatives were identified during the performance of this study as possible methods for transferring the fuel and sludge from the KE Basin to the KW Basin. These methods were then assessed with regard to operations, safety, radiation exposure, packaging, environmental concerns, waste management, cost, and schedule; and the most feasible and practical methods of transfer were identified. The methods examined in detail in this study were based on shipment without cooling water except where noted: Transfer by rail using the previously used transfer system and water cooling; Transfer by rail using the previously used transfer system (without water cooling); Transfer by truck using the K Area fuel transfer cask (K Area cask); Transfer by truck using a DOE shipping cask; Transfer by truck using a commercial shipping cask; and Transfer by truck using a new fuel shipping cask

  5. Electrochemical removal of cadmium from bio-ash; Elektrokemisk fjernelse af cadmium fra bioasker

    Energy Technology Data Exchange (ETDEWEB)

    Juul Pedersen, Anne; Ottosen, Lisbeth M.; Simonsen, Peter; Christensen, Terkel C.

    2004-07-01

    The potential of using the method electrodialytic remediation for removal of cadmium from bioashes has been investigated. Five different types of fly ash from biomass combustion were included in the study: 1) A straw combustion fly ash from grate-firing at Avedoere power plant. 2) A fly ash from co-firing of wood and fuel oil at Avedoere power plant. 3) A suspended, grain size fractionated straw fly ash, obtained from PSO project FU 2201, fine and coarse size fraction. The ash was originally produced at Avedoere power plant. 4) A straw pellet fly ash from dust-firing at Amager power plant. Thr five ashes were characterised, and a series of preliminary elekctrodialytic remediation experiments were conducted on each ash. In spite a significant differences between the five ashes with respect to parameters such as pH and content of cadmium, all ashes showed promising remediation potential. For all ashes cadmium concentrations below the regulatory limits for recycling were reached in one or more of the preliminary remediation experiements. The best results were obtained with the suspended straw ash from PSO FU 2201, whereas the results with the wood chips ash, due to a high initial pH value, were less sucessful, meaning that the remediation process was progressing more slowly. (BA)

  6. Comparative effects of three dithiocarbamates on tissue distribution and excretion of cadmium in mice

    International Nuclear Information System (INIS)

    The effects of sodium N-benzyl-D-glucamine dithiocarbamate (BGD), sodium N-p-hydroxymethylbenzyl-D-glucamine dithiocarbamate (HBGD), and sodium N-p-carboxybenzyl-D-glucamine dithiocarbamate (CBGD), which were newly synthesized, on the distribution and excretion of cadmium were compared in mice exposed to cadmium. Mice were injected with 109CdCl2 (1 mg Cd/kg and 74 KBq of 109Cd/one animal) and 30 min or 24 h later, they were injected with the dithiocarbamates (400 mumols/kg). At 30 min after treatment with cadmium, these chelating agents significantly enhanced the biliary excretion of cadmium, and HBGD and CBGD significantly increased the urinary excretion of the metal. At 24 h after cadmium injection, BGD and HBGD significantly increased the biliary excretion of cadmium and HBGD was the most effective on the biliary excretion of the metal. These chelating agents were effective in mobilizing cadmium from the liver and kidney at 30 min after cadmium treatment. HBGD showed the largest effectiveness on the depression of cadmium contents in the liver and kidney. At 24 h after cadmium treatment, only HBGD among these chelating agents significantly reduced the cadmium contents in the liver and kidney. These results show that the injection of HBGD at both 30 min and 24 h after cadmium treatment can much more effectively mobilize cadmium from the body mainly through the bile without redistribution of cadmium to other tissues, such as brain, testes, and heart, than injection of BGD and CBGD

  7. A Study of Growth of Cadmium Oxide Nano structure

    International Nuclear Information System (INIS)

    Cadmium oxide nano structure were synthesized by solid-vapor deposition without catalyst. Cadmium Oxide powder was heated to 1320 K in a tube furnace, and the resultant vapor was carried to the silicon substrate zone by an argon flow. Field electron scanning electron microscopy revealed that the product was dendrite-like petals of Cadmium Oxide nano structure. The grown nano structure had random orientations and a grain size of 30 nm. Photoluminescence spectroscopy was conducted to investigate the optical properties of the nano structures. The red-shift direct band gap energy of Cadmium Oxide nano structure was at 548 nm (2.26 eV), whereas that of CdO bulk was at 491 nm (2.5 eV). (author)

  8. Electrodialytic removal of cadmium from straw combustion fly ash

    DEFF Research Database (Denmark)

    Hansen, Henrik K.; Ottosen, Lisbeth M.; Villumsen, Arne

    2004-01-01

    Fly ash from straw combustion contains valuable nutrients when returned to agricultural soils. In many instances, however, this fly ash may contain heavy metals, such as cadmium, at levels which often exceed the limits given by the Danish legislation. Thus before utilizing the nutrients, cadmium...... must be removed from these ashes. The use of an electrodialytic remediation method to remove cadmium from fly ash arising from straw combustion and containing 11.2 mg Cd kg$+-1$/ DM (dry matter) was accessed. After 36 days of remediation at a constant current density of 5.6 mA cm$+-2$/ more than 97% of...... the cadmium had been removed from around 150 g ash on a dry basis. $CPY 2004 Society of Chemical Industry....

  9. Effect of gamma radiation on cadmium telluride surface properties

    International Nuclear Information System (INIS)

    The effect of γ-irradiation on the surface properties of cadmium telluride is studied. The possibility of oriented modification of surface properties for increasing the adsorption activity and obtaining the materials, suited for the sensor transducer production, is shown

  10. Studies on cadmium accumulation by some selected floating macrophytes.

    Science.gov (United States)

    Shuvaeva, Olga V; Belchenko, Ludmila A; Romanova, Tamara E

    2013-01-01

    The results of investigation of the process of cadmium accumulation by floating plants of Eichhornia crassipes and Pistia stratiotes are discussed. The main specialty of this study is that it puts more emphasis on the mechanism of penetration of pollutant within the plant and its fate during accumulation act. As a result it was shown that at the first stage of cadmium uptake the sorption of the metal on the surface of the roots due to the presence of carboxylic groups takes place. At the root of the plant cadmium mainly localized in the cortex and rhizodermis, then the pollutant penetrates into the tissues of the stem according to its translocation factor. It has been also assumed that flavonoids perform an intermediate role in the accumulation of cadmium by the plant, taking part in the transport and combat an oxidative stress. PMID:23819290

  11. Soil biogeochemistry, plant physiology and phytoremediation of cadmium contaminated soils

    Science.gov (United States)

    Cadmium (Cd) loading in soil and the environment has been accelerated worldwide due to enhanced industrialization and intensified agricultural production, particularly in the developing countries. Soil Cd pollution, resulting from both anthropogenic and geogenic sources, has posed an increasing chal...

  12. Ion exchange of Cobalt and Cadmium in Zeolite X

    International Nuclear Information System (INIS)

    The growing development in the industry has an important contribution to the environmental damage, where the natural effluents are each day more contaminated by toxic elements, such as: mercury, chromium, lead and cadmium. So as to separate such elements it has sorbent must have enough stability, and have a sharp capacity of sorption. In this work it was studied the sorption behavior of cobalt and on the other hand, cadmium in aqueous solutions, which along with sodic form of the Zeolite X, undergoes a phenomenon of ionic interchange. Such interchange was verify to different concentration of cadmium, cobalt and hydronium ion. The content of cobalt and sodium in the interchanged samples was detected through the neutronic activation analysis. The results disclose a higher selectivity for cadmium than cobalt. (Author)

  13. EFFECTS OF CADMIUM ON THE REPRODUCTIVE AXIS OF JAPANESE MEDAKA

    Science.gov (United States)

    Cadmium (Cd) is a ubquitous element and a significant inorganic pollutant that has previously been found to bioaccumulate in reproductive organs of fish and disrupt important endocrine processes, especially those involved in synthesis, release and metabolism of hormones. Clearly,...

  14. Surfactant Mediated Cadmium Determination with Dithizone in Aqueous Solution

    OpenAIRE

    Ismael, Fouad Jawad

    2014-01-01

    ABSTRACT: Cadmium is a toxic and hazardous trace metal that has become a serious environmental pollutant since industrialization and intensive farming began in late 19th century. Although there are many established wet-chemical and instrumental methods for qualitative and quantitative determination of cadmium, most involve the formation of the Cd-dithizone complex in the presence of the highly toxic potassium cyanide which is then extracted into carcinogenic chlorinated organic solvents such ...

  15. Ecotoxicity and genotoxicity of cadmium in different marine trophic levels.

    Science.gov (United States)

    Pavlaki, Maria D; Araújo, Mário J; Cardoso, Diogo N; Silva, Ana Rita R; Cruz, Andreia; Mendo, Sónia; Soares, Amadeu M V M; Calado, Ricardo; Loureiro, Susana

    2016-08-01

    Cadmium ecotoxicity and genotoxicity was assessed in three representative species of different trophic levels of marine ecosystems - the calanoid copepod Acartia tonsa, the decapod shrimp, Palaemon varians and the pleuronectiform fish Solea senegalensis. Ecotoxicity endpoints assessed in this study were adult survival, hatching success and larval development ratio (LDR) for A. tonsa, survival of the first larval stage (zoea I) and post-larvae of P. varians, egg and larvae survival, as well as the presence of malformations in the larval stage of S. senegalensis. In vivo genotoxicity was assessed on adult A. tonsa, the larval and postlarval stage of P. varians and newly hatched larvae of S. senegalensis using the comet assay. Results showed that the highest sensitivity to cadmium is displayed by A. tonsa, with the most sensitive endpoint being the LDR of nauplii to copepodites. Sole eggs displayed the highest tolerance to cadmium compared to the other endpoints evaluated for all tested species. Recorded cadmium toxicity was (by increasing order): S. senegalensis eggs < P. varians post-larvae < P. varians zoea I < S. senegalensis larvae < A. tonsa eggs < A. tonsa LDR. DNA damage to all species exposed to cadmium increased with increasing concentrations. Overall, understanding cadmium chemical speciation is paramount to reliably evaluate the effects of this metal in marine ecosystems. Cadmium is genotoxic to all three species tested and therefore may differentially impact individuals and populations of marine taxa. As A. tonsa was the most sensitive species and occupies a lower trophic level, it is likely that cadmium contamination may trigger bottom-up cascading effects in marine trophic interactions. PMID:27203468

  16. Study on Systemic Separation of Palladium, Silver, Cadmium and Tin

    Institute of Scientific and Technical Information of China (English)

    YU; Zhen-hua; HUANG; Kun

    2013-01-01

    To accurately measure the yields of palladium,silver,cadmium and tin that generated from the fission of plutonium,radiochemical method is needed because there is much interference in using directγ-spectroscopy measurements.Usually,we want to get as much as possible the experiment data from one target,so it is required systemic separation of palladium,silver,cadmium and tin.Considering the

  17. Cadmium and hypertension in exposed workers: A meta-analysis

    OpenAIRE

    Tiziana Caciari; Angela Sancini; Mario Fioravanti; Teodorico Casale; Lucio Montuori; Maria Fiaschetti; Maria Pia Schifano; Giorgia Andreozzi; Nadia Nardone; Gianfranco Tomei; Manuela Ciarrocca; Maria Valeria Rosati; Francesco Tomei

    2013-01-01

    Objectives: In the general population, cadmium seems to be responsible for hypertension, atherosclerosis and an increase in acute coronary events. Therefore, the purpose of this meta-analysis was to analyze controlled studies conducted on cadmium and arterial pressure in occupationally-exposed workers. Materials and Methods: After analyzing all the relevant articles found in the literature, 6 publications were selected. Results: A higher prevalence of hypertension and higher values of systoli...

  18. Association between blood cadmium levels and malnutrition in peritoneal dialysis

    OpenAIRE

    Hsu, Ching-Wei; Lin, Ja-Liang; Lin-Tan, Dan-Tzu; Huang, Wen-Hung; Chen, Kuan-Hsing; Yen, Tzung-Hai

    2014-01-01

    Background Malnutrition is associated with an increased risk of cardiovascular death and may cause protein-energy wasting in individuals with chronic kidney disease. A previous study demonstrated that blood cadmium levels (BCLs) were associated with malnutrition in maintenance hemodialysis (MHD) patients. However, the correlation between cadmium exposure and malnutrition remains unclear in chronic peritoneal dialysis (CPD) patients. This study examined the possible adverse effects of environm...

  19. Avalanche multiplication of electrons and holes in cadmium telluride

    CERN Document Server

    Demich, N V

    2001-01-01

    Determination of the ratio of the coefficients of the electrons and holes of the diode structures impact ionization is carried out with the purpose of optimizing the parameters of the avalanche diodes from the cadmium telluride. It is shown experimentally, that the process of the impact ionization in the cadmium telluride is stimulated by holes. The ratio of the coefficients of the holes and electrons impact ionization constitutes approx = 30-40

  20. Elektrokemisk fjernelse af cadmium fra bioasker

    DEFF Research Database (Denmark)

    Pedersen, Anne Juul; Ottosen, Lisbeth M.; Simonsen, Peter;

    Hosliggende rapport formidler resultaterne fra PSO-projektet: ”Elektrokemisk fjernelse af cadmium fra bioasker” (PSO-F&U 3206), finansieret af Elkraft System og Energi E2 A/S. Projektet blev gennemført i perioden 01.05.2003 – 30.06.2004, og partnerne var Energi E2 A/S, BYG-DTU og Krüger A/S, med ...... igangværende PSO FU 2201 ”Opgradering af restprodukter” (”Askepot”), og det skulle derfor også undersøges, om den elektrodialytiske rensningsproces evt. kunne kombineres med den vaskeproces, der benyttes til rensning af aske i FU 2201....

  1. Cadmium substituted high permeability lithium ferrite

    Indian Academy of Sciences (India)

    S S Bellad; S C Watawe; A M Shaikh; B K Chougule

    2000-04-01

    Polycrystalline Li0.5–/2 Cd Fe2.5–/2O4 ferrites where = 0, 0.1, 0.2, 0.3, 0.4, 0.5 and 0.6 were prepared by a double sintering ceramic technique and characterized by X-ray diffraction and scanning electron microscopy (SEM). The lattice parameter is found to increase monotonically with the cadmium content. It is explained in terms of the sizes of component ions. The grain size of the samples increases up to = 0.3 and then it decreases for higher values of . A similar trend is observed in the variation of Ms with Cd2+ content. The initial permeability () is however found to increase continuously with . The increase in is attributed to decrease of anisotropy constant K1 and higher grain size of the samples.

  2. Flotation of cadmium-loaded biomass.

    Science.gov (United States)

    Matis, K A; Zouboulis, A I

    1994-07-01

    Biosorption of heavy metal ions such as Cd(2+) by dead biomass has been recognized as a potential alternative to existing removal technologies applied to wastewater treatment. Two bacterial strains were studied in the laboratory, streptomyces griseus and S. clavuligerus, an industrial by-product. Both washed and unwashed samples were examined. Foam flotation proposed in this work as the separation state following biosorption. Effective biomass separation was conducted in the presence of a frother, ethanol. The pH of the solution was a crucial parameter for flotation and also for metal binding. Other basic parameters of flotation examined were the initial cadmium concentration in the dilute aqueous solution and the quantity of biomass used. A study of zeta-potential measurements of the actinomycetes was carried out under the conditions used in the separation; surface tension was also measured. These provided useful information on the process. PMID:18618752

  3. Synthesis and Electroluminescence Characterization of Cadmium Complex

    Directory of Open Access Journals (Sweden)

    Rahulkumar

    2011-01-01

    Full Text Available We have synthesized and characterized a new electroluminescence material,Cadmium [(2-(2-hydroxyphenylbenzoxazole(8-hydoxyquinoline] Cd(HPBq. The absorption spectra of this material show maxima at 378 nm. It may be attributed due to π° – π* transition. The photoluminescence showed peak at 520 nm. TGA data of the material shows stability up to 370 °C .Organic light emitting diode have been fabricated with this material and the fundamental structures of the device is ITO/α-NPD/ Cd(HPBq/BCP/Alq3/LiF/Al exhibited a luminescence peak at 550 nm. The maximum luminescence of the device was 295 cd/m2 with current density of 6687 A/m2 at 20 V. The maximum current efficiency of OLED was 1.01 cd/A at 17 V and power efficiency was 1.01 lm/w at 17 V.

  4. Soil Cadmium Regulates Antioxidases in Sorghum

    Institute of Scientific and Technical Information of China (English)

    LIU Da-lin; ZHANG Shu-pan; CHEN Zheng; QIU Wei-wei

    2010-01-01

    The regulatory mechanism of soil cadmium(Cd)on antioxidases in sorghum was studied using 3 sorghum species viz.,sweet sorghum[Sorghum bicolor(L.)]Moench.cv.Hunnigreen,sorghum hybrid sudangrass(Sorghum bicolor × S.sudanense,cv.Everlush)and sudangrass[Sorghum sudanense(Piper)Stapf cv.Xinjiang].The results showed that low concentrations of Cd2+(≤10 mg kg-1)induced the activities of 4 antioxidases in leaves of the 3 species of sorghum,but high Cd2+concentrations(≥50 mg kg-1)significantly reduced the activities of all the four antioxidases.The glutathione(GSH)contents in leaves of the 3 species of sorghum correlated positively with the Cd2+concentrations.The maximum antioxidase activities were observed at the elongation stage of sorghum during the whole growth period.

  5. Cadmium in goods - contribution to environmental exposure

    Energy Technology Data Exchange (ETDEWEB)

    Bergbaeck, B.; Jonsson, Arne [Kalmar Univ. (Sweden). Dept. of Natural Science

    1998-03-01

    The total amount of Cd used in Sweden since 1940 is approximately 5000 tonnes, including alloys, fertilizers and impurities in zinc. The stock of Cd in goods in the Swedish anthroposphere is dominated by NiCd-batteries. However, when one considers the degree of exposure to corrosion, Cd stabilizers are dominant. Emissions of Cd from industrial plants and other point sources have been historically important. However, these point source emissions must be seen in relation to the increasingly significant fugitive `consumption emissions`, from the use and/or end-use of various goods. In this study, methods of reconstructing the flows of cadmium (Cd) and estimating the emissions over time are discussed. This is done through studies of the development of production, technology, trade and the longevity of metals in Swedish society. This last part in the chain will form the `consumption emissions` calculated from emission factors giving the proportion of the cadmium content in goods that eventually will reach the environment. The main accumulation of metals in the anthroposphere occurs in urban areas where the influx of metals is greatest. Urban areas probably represent `hot spots` as far as this type of environmental impact is concerned. Extreme Cd concentrations in surface sediments in central Stockholm indicate an ongoing release of Cd from the anthroposphere. The sources are so far unknown, i.e. this Cd flow to the biosphere cannot be explained in terms of deposition or emissions from point sources. Approximately 40 tonnes of Cd in goods are exposed to corrosion in varying degrees. This stock is dominated by Cd in stabilizers and pigments, and as impurities in Zn 15 refs, 2 figs, 8 tabs

  6. Adsorption mechanism of copper and cadmium onto defatted waste biomass.

    Science.gov (United States)

    Ogata, Fumihiko; Tominaga, Hisato; Yabutani, Hitoshi; Kawasaki, Naohito

    2011-01-01

    In this study, the amount of copper or cadmium adsorbed using waste biomass (i.e., coffee grounds (CG) and rice bran (RB)) was investigated. The amount of crude protein in defatted CG (D-CG) or RB (D-RB) was greater than that in CG or RB, respectively. The amount of copper or cadmium adsorbed using CG was greater than that using RB. Additionally, the amount of copper or cadmium adsorbed was not affected by the presence of fat in CG. Adsorption data was fitted to the Freundlich equation, and the correlation coefficients were in the range of 0.794-0.991. The main adsorption mechanism was thought to be monolayer adsorption onto the surface of the waste biomass. The adsorption rate data was fitted to the pseudo-second-order model, and the correlation coefficient average was in the range of 0.891-0.945. This result showed that the rate-limiting step may be chemisorption. Moreover, the amount of copper or cadmium desorbed from CG or RB using 0.01 mol/L or 1.00 mol/L HNO(3) was investigated. Desorption with 0.01 mol/L HNO(3) resulted in the recovery of 86-97% of the copper and cadmium, indicating that copper or cadmium that was adsorbed using waste biomass was recoverable. PMID:21701100

  7. Tantalum-cadmium film coatings: Preparation, phase composition, and structure

    Science.gov (United States)

    Tuleushev, Yu. Zh.; Volodin, V. N.; Zhakanbaev, E. A.

    2015-01-01

    Ion-plasma sputtering and codeposition of ultrafine Ta and Cd particles were used for the first time to prepare solid solutions, namely, alloys with up to 66.2 at % Cd in the form of coatings; the fact of such a production confirms the thermal-fluctuation melting and coalescence of small particles. When the coatings are formed by tantalum and cadmium nanolayers, the mutual dissolution of the components takes place, which is accompanied by the formation of solid solutions of one metal in the other. When the cadmium concentration is above 44 at %, the β-Ta tetragonal lattice transforms into the α-Ta body-centered cubic lattice. Beginning from 74.4 at % Cd, a hexagonal structure typical of cadmium is formed, and tantalum is present in the coatings in the form of amorphous phase. The formation of β-Ta- and Cd-based interstitial and α-Ta-based substitute solid solutions is stated. At 700°C, cadmium evaporates from Ta-based solid solutions, and porous tantalum is formed. The evaporation of cadmium from coatings, which consist of the mixture of tantalum solid solution in cadmium and amorphous tantalum, leads to the formation of tantalum characterized by a highly developed surface. The prepared Ta-based materials assume the technological application of the results of the investigation.

  8. Effects of Cadmium on Some Physiological Characteristics of Eucalyptus occidentalis

    Directory of Open Access Journals (Sweden)

    A. Shariat

    2010-10-01

    Full Text Available Heavy metals including cadmium produced as a result of urban, industrial and agricultural activities lead to the water pollution. Also, considering the growing need for silviculture in Iran, it is necessary to conduct a comprehensive research on fast growing and evergreen species of Eucalyptus and their role in heavy metals' absorption. To achieve this goal, Eucalyptus occidentalis seedlings were grown in pots containing silica and irrigated with a mixture of nutrient solution and cadmium chloride in 5, 10 and 15 m M for 10 months. Root and leaf samples were harvested and the amount of cadmium in stem, root and leaf organs was measured. Also, some morphological and physiological characteristics were determined including soluble sugar and praline. The analysis indicated that the cadmium concentrations of 15 mM treatment in the root, leaf and stem were 585, 142 and 87 mg/kg D.W., respectively. Proline content increased with the increase of Cadmium concentration while the content of pigments decreased. The result of this research shows that eucalypt has the potential of cadmium accumulation without any serious damage to its growth. Therefore, the plant can be used to decrease the environmental pollutions.

  9. Trichosporon jirovecii-mediated synthesis of cadmium sulfide nanoparticles.

    Science.gov (United States)

    El-Baz, Ashraf Farag; Sorour, Noha Mohamed; Shetaia, Youssria Mohamed

    2016-05-01

    Cadmium sulphide is one of the most promising materials for solar cells and of great interest due to its useful applications in photonics and electronics, thus the development of bio-mediated synthesis of cadmium sulphide nanoparticles (CdS NPs) is one of the essential areas in nanoparticles. The present study demonstrates for the first time the eco-friendly biosynthesis of CdS NPs using the yeast Trichosporon jirovecii. The biosynthesis of CdS NPs were confirmed by UV-Vis spectrum and characterized by X-ray diffraction assay and electron microscopy. Scanning and transmission electron microscope analyses shows the formation of spherical CdS NPs with a size range of about 6-15 nm with a mean Cd:S molar ratio of 1.0:0.98. T. jirovecii produced hydrogen sulfide on cysteine containing medium confirmed by positive cysteine-desulfhydrase activity and the colony color turned yellow on 0.1 mM cadmium containing medium. T. jirovecii tolerance to cadmium was increased by the UV treatment and three 0.6 mM cadmium tolerant mutants were generated upon the UV radiation treatment. The overall results indicated that T. jirovecii could tolerate cadmium toxicity by its conversion into CdS NPs on cysteine containing medium using cysteine-desulfhydrase as a defense response mechanism. PMID:26467054

  10. Determination of cadmium in bovine tissue by spectrophotometry of atomic absorption

    International Nuclear Information System (INIS)

    The present work utilized the suggested method by Food Safety and Inspection Service (FSIS) for the analysis of cadmium in animal tissue, it was adapted by the Toxicology's Laboratory of MAG, where the project was organized. This method consist of a burning of sample and the instrumental analysis by means of the atomic absorption's technique. In the study there were determined parameters of carrying out of the analytical methodology, it was getting the following values: linearity : 0,020 -1,0 mg/L; homogeneity of the model: homoscedastic; limit of detection (LD) : 0,0049 mg/kg (4,9 μg/Kg); limit of quantification (LC): 0,016 μg/L (16 mg/kg); sensibility of calibration: 0,243 A * L/gm; analytical sensibility: 105 L/mg; instrumental repetitively: < 4,3%; repetitively of gauges < 3,5%; reproducibility of methodology: 13,4% (expressed like variation's coefficient); truthfulness: 86,5%; selectivity and specificity: there isn't interferences of matrix, chemical or of ionization when the wavelength utilized is of 228,8 nm. It was made an study to determinate the present cadmium's quantities in three tissues of bovine origin; of an total of 20 animals there were gotten the following averages: muscles: 37,5 μg/kg, liver: 93,7 μg/kg and kidney: 253,4 μg/kg. Additionally, it was determined the correlation that exist among the contents of the metal and other variations, like sex, approximate age, as well as the stock sort: dairy or meat, where there were observed significant differences to a level of confidence of 95%, among the contents of Cadmium in muscle of meat stock and the dairy stock, being major the accumulation to the meat stock and the dairy stock, this like a difference of the other variations where didn't find a significant difference. Besides, it was determined, the metal's accumulation in two different kidney's zones: medullar and cortical, being significantly major in the last one, with a correlation of 99,5%. (Author)

  11. Risk Assessment of Non-Carcinogenic Heavy Metals (Barium, Cadmium, and Lead in Hair Color in Markets of Tehran

    Directory of Open Access Journals (Sweden)

    F Khalili

    2016-06-01

    Full Text Available Background and Objectives: Chemical hair color are one of the most widely used cosmetics. The presence of heavy metals in these products can affect the health of consumers. Unlike other cosmetics, no study has been conducted on the heavy metal levels in the synthetic chemical hair colors. This study determined the concentration of heavy metals in these products and the risk assessment of non-carcinogenic effects by these elements were calculated. Material and Method: 32 samples of chemical hair color from eight brands (3 local and 5 imported ones and four most used colors were collected from the markets in Tehran. The concentration of cadmium, lead, and barium was determined using ICP-MS. The information required to assess exposure risk was gathered through  a questionnaire distributed among citizens of Tehran. The assessment of exposure was conducted using Mont Carlo method and  non-carcinogenic risk was determined using the index of Hazard Quotient. . Results: Barium concentration measured was 0.86 mg/kg and concentrations of Cadmium and Lead were 0.45 and 185.34 µg/kg respectively. Among the elements, Pb with Hazard Quotient equals to 7.46×10-4 had the most risk and cadmium with Hazard Quotient equals to 3.57×10-5 had the lowest risk. Moreover, the Iranian brand and blond had the highest risk among the samples. Conclusion: Based on the index of Hazard Quotient, heavy metals in the studied samples had no risk for consumers of these products.

  12. A rapid and sensitive assay for determination of doxycycline using thioglycolic acid-capped cadmium telluride quantum dots

    Science.gov (United States)

    Tashkhourian, Javad; Absalan, Ghodratollah; Jafari, Marzieh; Zare, Saber

    2016-01-01

    A rapid, simple and inexpensive spectrofluorimetric sensor for determination of doxycycline based on its interaction with thioglycolic acid-capped cadmium telluride quantum dots (TGA/CdTe QDs) has been developed. Under the optimum experimental conditions, the sensor exhibited a fast response time of doxycycline could quench the fluorescence of TGA/CdTe QDs via electron transfer from the QDs to doxycycline through a dynamic quenching mechanism. The sensor permitted determination of doxycycline in a concentration range of 1.9 × 10-6-6.1 × 10-5 mol L-1 with a detection limit of 1.1 × 10-7 mol L-1. The sensor was applied for determination of doxycycline in honey and human serum samples.

  13. A new and highly selective turn-on fluorescent sensor with fast response time for the monitoring of cadmium ions in cosmetic, and health product samples.

    Science.gov (United States)

    Khani, Rouhollah; Ghiamati, Ebrahim; Boroujerdi, Ramin; Rezaeifard, Abdolreza; Zaryabi, Mohadeseh Hosseinpour

    2016-06-15

    Cadmium (Cd) which is an extremely toxic could be found in many products like plastics, fossil fuel combustion, cosmetics, water resources, and wastewaters. It is capable of causing serious environmental and health problems such as lung, prostate, renal cancers and the other disorders. So, the development of a sensor to continually monitor cadmium is considerably demanding. Tetrakis(4-nitrophenyl)porphyrin, T(4-NO2-P)P, was synthesized and used as a new and highly selective fluorescent probe for monitoring cadmium ions in the "turn-on" mode. There was a linear relationship between fluorescence intensity and the concentration of Cd(II) in the range of 1.0×10(-6) to 1.0×10(-5)molL(-1) with a detection limit of 0.276μM. To examine the most important parameters involved and their interactions in the sensor optimization procedure, a four-factor central composite design (CCD) combined with response surface modeling (RSM) was implemented. The practical applicability of the developed sensor was investigated using real cosmetic, and personal care samples. PMID:27045784

  14. Cadmium toxicity to ringed seals (Phoca hispida): an epidemiological study of possible cadmium-induced nephropathy and osteodystrophy in ringed seals (Phoca hispida) from Qaanaaq in Northwest Greenland

    DEFF Research Database (Denmark)

    Sonne-Hansen, C; Dietz, R; Leifsson, P S;

    2002-01-01

    the skeleton nor to the cadmium concentrations. Furthermore, the degree of mineralisation of the skeleton was not correlated with the cadmium concentration, age or sex. It can therefore be concluded that despite high levels of cadmium, none of the ringed seals showed any signs of cadmium......-induced nephropathy or osteodystrophy. This might be explained by the composition of the ringed seals diet, which contains high levels of vitamin D, calcium, phosphorus, zinc, selenium and protein. These elements are all likely to counteract cadmium-induced damage. It is speculated that ringed seal are not...

  15. C-105 heel pit removed and C-105 dome cut paves way for new retrieval technology

    Energy Technology Data Exchange (ETDEWEB)

    Mackey, Thomas C.; Sutey, Michael J.

    2013-06-10

    For just the second time, crews have cut a hole in the top of an active radioactive waste storage tank at Hanford. Workers began cutting a 55-inch hole in the top of Tank C-105 last Tuesday night on graveyard shift, completing the cut early Wednesday. The hole will allow for installation of the Mobile Arm Retrieval System (MARS) Vacuum into the tank. The cut was made through 17 inches of concrete and rebar using the newly developed rotary-core cutting system, which uses a laser-guided steel canister with teeth on the bottom to drill a round hole into the tank dome. The project was completed safely and successfully in a high-rad area without contamination or significant dose to workers.

  16. 48 CFR 48.105 - Relationship to other incentives.

    Science.gov (United States)

    2010-10-01

    ... CONTRACT MANAGEMENT VALUE ENGINEERING Policies and Procedures 48.105 Relationship to other incentives. Contractors should be offered the fullest possible range of motivation, yet the benefits of an accepted...

  17. 46 CFR 105.20-3 - Cargo tanks.

    Science.gov (United States)

    2010-10-01

    ... VESSELS DISPENSING PETROLEUM PRODUCTS Specific Requirements-Cargo Tanks § 105.20-3 Cargo tanks. (a... subjected, except that in no case shall the thickness of the shell or head be less than that specified...

  18. 40 CFR 92.105 - General equipment specifications.

    Science.gov (United States)

    2010-07-01

    ... (CONTINUED) CONTROL OF AIR POLLUTION FROM LOCOMOTIVES AND LOCOMOTIVE ENGINES Test Procedures § 92.105 General... devices; (iii) The temperature of the sample within the water trap(s); (iv) Temperature measurements...

  19. 18 CFR 401.105 - Indexes of certain records.

    Science.gov (United States)

    2010-04-01

    ... ADMINISTRATIVE MANUAL RULES OF PRACTICE AND PROCEDURE Public Access to Records and Information § 401.105 Indexes... Federal Register or official minutes of Commission meetings. (3) Administrative staff manuals...

  20. 33 CFR 136.105 - General requirements for a claim.

    Science.gov (United States)

    2010-07-01

    ... PROCEDURES; DESIGNATION OF SOURCE; AND ADVERTISEMENT General Procedure § 136.105 General requirements for a... basis for such identity or belief. (4) A general description of the nature and extent of the impact...

  1. The Role of Exopolymers in Protection of Ralstonia sp., a Cadmium-resistant Bacterium, from Cadmium Toxicity

    OpenAIRE

    Anchulee Watcharamusik; Benjaphorn Prapagdee

    2008-01-01

    Production of exopolymers is one of heavy metal resistance mechanisms in bacteria. Ralstonia sp. TAK1, a cadmium-resistant bacterium, was isolated from a high cadmium (Cd) contaminated soil at the zinc mine, Tak province, Thailand. The bacterium was cultivated in LB broth and its growth was monitored. The yields of exopolymers were measured by the phenol-sulfuric method at different growth phases. The levels of Cd resistance were quantitatively determined by survival cell assay. The highest a...

  2. Influence of pressure on the synthesis of cadmium sulfide by combustion of complex compound of cadmium nitrate with thiosemicarbazide

    International Nuclear Information System (INIS)

    A method of cadmium sulfide synthesis based on combustion of high-energy content complex of cadmium nitrate and thiosemicarbazide has been suggested. The combustion has been carried out in nitrogen under gas pressure varying from 0.1 to 2.0 MPa. It is shown that the complex may serve as a precursor for obtaining sulfide materials with regulated morphology and dispersivity under combustion conditions

  3. Study on complex formation of cadmium (II) ions, 9. Formation constants on cadmium (II) complexes with dicarboxylic acids

    Energy Technology Data Exchange (ETDEWEB)

    Matsui, Haruo (Government Industrial Research Inst., Nagoya (Japan))

    1984-03-01

    Formation constants of cadmium (11) complexes with dicarboxylic acids such as oxalic, malonic, methylmalonic, succinic, and glutaric acids were determined in aqueous solutions containing 3 mol.dm/sup -3/ LiClO/sub 4/ as a constant ionic medium at 25/sup 0/C by potentiometric titrations. It was reported in the previous works that cadmium (11)- aspartic acid complexes contained two chelate rings. However, a problem remained whether the second chelate ring could be formed by six membered-ring containing -O-Cd-N- bond or by seven membered-ring containing -O-Cd-O- bond. The results of the present work suggested that it would be formed by a six membered ring. Cadmium (11) ions were coordinated with a carboxylic group of the dicarboxylic acids studied, and formed no chelate ring within the complexes. The white precipitate appeared in the solution containing cadmium (11) ion and oxalic acid, in the pH range below 3.0, therefore, the chelate formation was not ascertained in this case. The formation constants, log ..beta..sub(pr)= log((Cdsub(p)Lsub(r)sup((2p-2r)+))/((Cd/sup 2 +/)sup(p)(L/sup 2 -/)sup(r))), of the complexes were: log ..beta../sub 11/ = 1.98, log ..beta../sub 12/ = 3.05 for cadmium (11)-malonic acid; log ..beta../sub 11/ = 2.28, log ..beta../sub 12/ = 3.06 for cadmium (11)-methylmalonic acid; log ..beta../sub 11/ = 1.78, log ..beta../sub 12/ = 3.08 for cadmium (11)-succinic acid; log ..beta../sub 11/ = 1.85, log ..beta../sub 12/ = 3.28 for cadmium (11)-glutaric acid complexes.

  4. An analysis of Lehman Brothers bankruptcy and Repo 105 transactions

    OpenAIRE

    Charles Hines; Jerry Kreuze; Sheldon Langsam

    2011-01-01

    Purpose – The purpose of this paper is to investigate the bankruptcy of Lehman Brothers, with particular focus on its use of Repo 105 transactions. Design/methodology/approach – The use of the Lehman's bankruptcy report produced in part by Anton R. Valukas was used as a basis to explain how Lehman maintained acceptable leverage ratios through the use of Repo 105 transactions to paint a better picture of its financial position than actually existed. Findings – The study concludes that Lehman's...

  5. Oxidative stress and DNA damage induced by cadmium in the human keratinocyte HaCaT cell line: Role of glutathione in the resistance to cadmium

    International Nuclear Information System (INIS)

    Cadmium affects the cellular homeostasis and generates damage via complex mechanisms involving interactions with other metals and oxidative stress induction. In this work we used a human keratinocyte cell line (HaCaT) as a model to study the oxidative damage induced by cadmium to cellular macromolecules, its effect on the antioxidant systems and the role of glutathione in cell protection toward cadmium toxicity. The cells were incubated for 24 and 48 h with cadmium (3, 15, 50 and 100 μM). High doses of cadmium were required to induce a cytotoxicity: 100 μM lead to 30% mortality after 24 h and 50% after 48 h. The oxidation of lipids and proteins and the DNA damage, respectively, assessed by thiobarbituric acid reactants determination, thiol group measurement and comet assay, were observed for 50-100 μM cadmium. The cytotoxic effects were strongly correlated to the cellular cadmium content. The glutathione peroxidase and the catalase activities were decreased, while the glutathione reductase activity and the glutathione concentration were increased after cadmium treatment. The superoxide dismutases activities were unchanged. A depletion in glutathione prior to cadmium exposure increased the cytotoxic effects and provoked DNA damage. Our results suggested that the hydroxyl radical could be the major compound involved in the oxidative stress generated by cadmium and that glutathione could play a major role in the protection of HaCaT cells from cytotoxicity but mostly from DNA damage induced by cadmium

  6. Correlations of urinary cadmium with hypertension and diabetes in persons living in cadmium-contaminated villages in northwestern Thailand: A population study

    International Nuclear Information System (INIS)

    Risk for hypertension and diabetes has not been conclusively found to be a result of cadmium exposure. A population-based study was conducted in 2009 to examine the correlations of urinary cadmium, a good biomarker of long-term cadmium exposure, with hypertension and diabetes in persons aged 35 years and older who lived in the 12 cadmium-contaminated rural villages in northwestern Thailand. A total of 5273 persons were interviewed and screened for urinary cadmium, hypertension, and diabetes. The geometric mean level of urinary cadmium for women (2.4±2.3 μg/g creatinine) was significantly greater than that for men (2.0±2.2 μg/g creatinine). Hypertension was presented in 29.8% of the study population and diabetes was detected in 6.6%. The prevalence of hypertension significantly increased from 25.0% among persons in the lowest tertile of urinary cadmium to 35.0% in the highest tertile. In women, the rate of hypertension significantly increased with increasing urinary cadmium levels in both ever and never smokers, after adjusting for age, alcohol consumption, body mass index, and diabetes. In men, such association was less significantly found in never smokers. The study revealed no significant association between urinary cadmium and diabetes in either gender. Our study supports the hypothesis that environmental exposure to cadmium may increase the risk of hypertension. Risk for diabetes in relation to cadmium exposure remains uncertain in this exposed population.

  7. Effects of Soil pH,Texture,Moisture,Organic Matter and Cadmium Content on Cadmium Diffusion Coefficient

    Institute of Scientific and Technical Information of China (English)

    WUQI-TANG; J.L.MOREL; 等

    1994-01-01

    The supply of cadmium from soil to plant roots mainly depends on the diffusion prooess.This work was conducted to study the effects of some soil properties on cadmium diffusion coefficient (D) in soil. Measurements were made using the Shofield and Graham-Bryce's isotopic labelling method.Cadmium diffusion coefficients varied from 10-7to 10-9 cms2-1.Higher values were observed in acid sandy soils and lower values in calcareous clay soils.Liming an acid soil resulted in a substantial decrease of D.Addition of cadmium as nitrate salt generally increased D,while addition of sewage sludge and organic matter resulted in a significant decrease of cadmium diffusion.The rhizospheric activity also induced a moderate reduction in D.The relationships between D(10-9cms2-1)on the on hand and soil pH.moisture(Mc,g kg-1) ,organic matter(OM,g kg-1),clay(Cy,gkg-1)and cadmium content(Cd,mgkg-1) on the other were obtained by the multiple regression:D=182.1-29.91pH+0.210Mc-0.303OM+0.011Cy+1.64Cd(R2=0.859,n=22).

  8. Effects of cadmium accumulation from suspended sediments and phytoplankton on the Oyster Saccostrea glomerata

    International Nuclear Information System (INIS)

    Highlights: • Saccostrea glomerata accumulated cadmium from sediments and phytoplankton. • Effects were similar for both pathways. • Antioxidant capacity, lipid peroxidation and lysosomal destabilisation were affected. • Clear exposure–dose–response relationships were demonstrated. - Abstract: Metals are accumulated by filter feeding organisms via water, ingestion of suspended sediments or food. The uptake pathway can affect metal toxicity. Saccostrea glomerata were exposed to cadmium through cadmium-spiked suspended sediments (19 and 93 μg/g dry mass) and cadmium-enriched phytoplankton (1.6–3 μg/g dry mass) and cadmium uptake and effects measured. Oysters accumulated appreciable amounts of cadmium from both low and high cadmium spiked suspended sediment treatments (5.9 ± 0.4 μg/g and 23 ± 2 μg/g respectively compared to controls 0.97 ± 0.05 μg/g dry mass). Only a small amount of cadmium was accumulated by ingestion of cadmium-enriched phytoplankton (1.9 ± 0.1 μg/g compared to controls 1.2 ± 0.1 μg/g). In the cadmium spiked suspended sediment experiments, most cadmium was desorbed from sediments and cadmium concentrations in S. glomerata were significantly related to dissolved cadmium concentrations (4–21 μg/L) in the overlying water. In the phytoplankton feeding experiment cadmium concentrations in overlying water were <0.01 μg/L. In both exposure experiments, cadmium-exposed oysters showed a significant reduction in total antioxidant capacity and significantly increased lipid peroxidation and percentage of destabilised lysosomes. Destabilised lysosomes in the suspended sediments experiments also resulted from stress of exposure to the suspended sediments. The study demonstrated that exposure to cadmium via suspended sediments and to low concentrations of cadmium through the ingestion of phytoplankton, can cause sublethal stress to S. glomerata

  9. Effects of cadmium accumulation from suspended sediments and phytoplankton on the Oyster Saccostrea glomerata

    Energy Technology Data Exchange (ETDEWEB)

    Schmitz, Helena A.; Maher, William A., E-mail: bill.maher@canberra.edu.au; Taylor, Anne M.; Krikowa, Frank

    2015-03-15

    Highlights: • Saccostrea glomerata accumulated cadmium from sediments and phytoplankton. • Effects were similar for both pathways. • Antioxidant capacity, lipid peroxidation and lysosomal destabilisation were affected. • Clear exposure–dose–response relationships were demonstrated. - Abstract: Metals are accumulated by filter feeding organisms via water, ingestion of suspended sediments or food. The uptake pathway can affect metal toxicity. Saccostrea glomerata were exposed to cadmium through cadmium-spiked suspended sediments (19 and 93 μg/g dry mass) and cadmium-enriched phytoplankton (1.6–3 μg/g dry mass) and cadmium uptake and effects measured. Oysters accumulated appreciable amounts of cadmium from both low and high cadmium spiked suspended sediment treatments (5.9 ± 0.4 μg/g and 23 ± 2 μg/g respectively compared to controls 0.97 ± 0.05 μg/g dry mass). Only a small amount of cadmium was accumulated by ingestion of cadmium-enriched phytoplankton (1.9 ± 0.1 μg/g compared to controls 1.2 ± 0.1 μg/g). In the cadmium spiked suspended sediment experiments, most cadmium was desorbed from sediments and cadmium concentrations in S. glomerata were significantly related to dissolved cadmium concentrations (4–21 μg/L) in the overlying water. In the phytoplankton feeding experiment cadmium concentrations in overlying water were <0.01 μg/L. In both exposure experiments, cadmium-exposed oysters showed a significant reduction in total antioxidant capacity and significantly increased lipid peroxidation and percentage of destabilised lysosomes. Destabilised lysosomes in the suspended sediments experiments also resulted from stress of exposure to the suspended sediments. The study demonstrated that exposure to cadmium via suspended sediments and to low concentrations of cadmium through the ingestion of phytoplankton, can cause sublethal stress to S. glomerata.

  10. Cadmium: A toxin and a nutrient for marine phytoplankton. Doctoral thesis

    Energy Technology Data Exchange (ETDEWEB)

    Lee, J.G.

    1995-06-01

    Although cadmium is known to be very toxic, it exhibits nutrient-like vertical concentration profiles in the open ocean. Cadmium enhances the growth of the marine diatom Thalassiosira weissflogii, a chlorophyte and some prymnesiophytes at inorganic zinc and cadmium concentrations typical of surface seawater. Detailed studies of T. weissflogii show that cadmium is also regulated like a nutrient over a wide range of external inorganic cadmium (5-500pM) and inorganic zinc (2-16pM) concentrations. The cellular cadmium concentration is maintained at relatively constant levels both through uptake and, at high inorganic cadmium concentrations (5nM), export of cadmium, most likely complexed to the metal-binding polypeptide phytochelatin. Cadmium may play an essential role in carbon uptake under conditions of zinc limitation. The same low level of inorganic cadmium that enhances the growth of T. weissflogii restores the activity of carbonic anhydrase, thought to be the key enzyme limiting growth at low zinc. Cadmium coelutes with a least one of the multiple isoforms of carbonic anhydrase produced by T. weissfiogii and covaries with activity of this isoform. The substitution of cadmium for zinc in carbonic anhydrase links the geochemical cycle of cadmium to those of zinc and carbon.

  11. Removal Action Workplan for the 105-DR and 105-F Building Interim Safe Storage Projects and Ancillary Buildings

    International Nuclear Information System (INIS)

    This document is the removal action workplan (RAW) for the 105-DR and 105-F Reactor Buildings and ancillary facilities. These buildings and facilities are located in the 100-D/DR and 100-F Areas of the Hanford Site in Benton County, Washington, which is owned and operated by the U.S. Department of Energy (DOE). The 100 Areas (including 100-D/DR and 100-F Areas) of the Hanford Site were placed on the U.S. Environmental Protection Agency's (EPA) National Priorities List under the Comprehensive Environmental Response, Compensation,and Liability Act of 1980 (CERCLA). DOE has determined that hazardous substances in the 105-DR and 105-F Reactor Buildings and four ancillary facilities present a potential threat to human health or the environment DOE has also determined that a non-time critical removal action is warranted at these facilities

  12. Removal Action Work Plan for 105-DR and 105-F Building Interim Safe Storage Projects and Ancillary Buildings

    International Nuclear Information System (INIS)

    This document contains the removal action work plan for the 105-DR and 105-F Reactor buildings and ancillary facilities. These buildings and facilities are located in the 100-D/DR and 100-F Areas of the Hanford Site, which is owned and operated by the US Department of Energy (DOE), in Benton County, Washington. The 100 Areas (including the 100-D/DR and 100-F Areas) of the Hanford Site were placed on the US Environmental Protection Agency's (EPA's) National Priorities List under the ''Comprehensive Environmental Response, Compensation, and Liability Act of 1980'' (CERCLA). The DOE has determined that hazardous substances in the 105-DR and 105-F Reactor buildings and four ancillary facilities present a potential threat to human health or the environment. The DOE has also determined that a non-time critical removal action is warranted at these facilities. Alternatives for conducting a non-time critical removal action were evaluated in the ''Engineering Evaluation/Cost Analysis for the 105-DR and 105-F Reactor Facilities and Ancillary Facilities'' (DOE-RL 1998a). The engineering evaluation/cost analysis (EE/CA) resulted in the recommendation to decontaminate and demolish the contaminated reactor buildings (except for the reactor blocks) and the ancillary facilities and to construct a safe storage enclosure (SSE) over the reactor blocks. The recommendation was approved in an action memorandum (Ecology et al. 1998) signed by the Washington State Department of Ecology (Ecology), EPA, and DOE. The DOE is the agency responsible for implementing the removal actions in the 105-D/DR and 105-F Areas. Ecology is the lead regulatory agency for facilities in the 100-D/DR Area, and EPA is the lead regulatory agency for facilities in the 100-F Area. The term ''lead regulator agency'' hereinafter, refers to these authorities. This removal action work plan supports implementation of the non-time critical removal action

  13. Predictors of urinary cadmium levels in adult females

    International Nuclear Information System (INIS)

    Ubiquitous exposure to low levels of cadmium has raised concern about adverse health effects. The aim of this study was to identify characteristics of non-occupationally exposed adult females that correlated with creatinine-adjusted urinary cadmium levels. In our population-based study, trained interviewers collected information from 254 female Wisconsin residents aged 20-69 years on tobacco use, limited dietary consumption patterns, reproductive history, demographics, and residential history. Participants provided spot-urine specimens collected at home. Urine cadmium concentrations were quantified using inductively-coupled plasma mass spectrometry and creatinine levels were also determined. Least square means and 95% confidence intervals for the natural log of the creatinine-adjusted urinary cadmium levels were calculated for each characteristic using multivariate analysis of variance adjusting for age and smoking status. Results were calculated on the log scale and then transformed to the original scale by taking the exponent of each of the values. We observed statistically significant increasing creatinine-adjusted urinary cadmium mean levels relative to smoking status, older age, parity, lower body surface area, mineral zinc supplement consumption, and high income. We did not observe a difference relative to consumption of organ meats, crustaceans, alcohol, multivitamins, multiminerals or homegrown vegetables, age of menopause, menarche of participant or oldest daughter, menopausal status or urban-rural residential location. Approximately 40% of the variance in creatinine-adjusted urinary cadmium levels in adult women was explained by several characteristics. Similar to other studies, age and smoking were the strongest determinants of creatinine-adjusted urinary cadmium concentration

  14. CONCENTRATION OF CADMIUM IN MEAT AND SELECTED MEATS PRODUCTS

    Directory of Open Access Journals (Sweden)

    Anetta Lukáčová

    2015-02-01

    Full Text Available The cadmium concentrations depend on the environmental conditions and food production methods. The monitoring of cadmium concentration in meat is important for human health. The concentrations of cadmium in meat and meat products collected from central Slovakia, in the central Europe region and from different countries of West Europe were assessed using by AA spectrometer with graphite furnace (PerkinElmer AAnalyst 80, MA, USA. Within starting materials we detected the highest values of cadmium in beef from foreign production (0.1101 ppm, followed by pork from foreign production (0.0901 ppm in Lovecka salama and pork thigh (0.0523 ppm in selected ham. In Lovecka salami we were found the highest concentration of cadmium in final samples from foreign starting materials, followed by homogenized samples from foreign starting materials, final samples from domestic starting materials and homogenized samples from domestic starting materials (0.3728, 0.3549, 0.2387, 0.2112 ppm, respectively. The highest concentration of cadmium in selected ham were found in final products from foreign starting materials, homogenized samples from foreign starting materials, final products from domestic starting materials and homogenized samples from domestic starting materials (0.1453, 0.1382,0.0810, 0.0734 ppm, respectively. The obtained results suggested that the concentrations of cadmium are higher in homogenized samples and final products in Lovecka salami and selected ham in comparison with to starting materials. Technological process of meat processing can create a potential source of heavy metals in final products.

  15. Predictors of urinary cadmium levels in adult females

    Energy Technology Data Exchange (ETDEWEB)

    McElroy, Jane A. [University of Wisconsin Paul P. Carbone Comprehensive Cancer Center, 610 Walnut Street, 370 WARF, Madison, WI 53726 (United States)]. E-mail: jamcelroy@wisc.edu; Shafer, Martin M. [University of Wisconsin, Environmental Chemistry and Technology Program, 600 N Park Street, Madison, WI 53706 (United States); Hampton, John M. [University of Wisconsin Paul P. Carbone Comprehensive Cancer Center, 610 Walnut Street, 370 WARF, Madison, WI 53726 (United States); Newcomb, Polly A. [University of Wisconsin Paul P. Carbone Comprehensive Cancer Center, 610 Walnut Street, 370 WARF, Madison, WI 53726 (United States); Fred Hutchinson Cancer Research Center, Cancer Prevention Program, 1100 Fairview Ave N, M4-B402 PO Box 19024, Seattle, WA 98109 (United States)

    2007-09-01

    Ubiquitous exposure to low levels of cadmium has raised concern about adverse health effects. The aim of this study was to identify characteristics of non-occupationally exposed adult females that correlated with creatinine-adjusted urinary cadmium levels. In our population-based study, trained interviewers collected information from 254 female Wisconsin residents aged 20-69 years on tobacco use, limited dietary consumption patterns, reproductive history, demographics, and residential history. Participants provided spot-urine specimens collected at home. Urine cadmium concentrations were quantified using inductively-coupled plasma mass spectrometry and creatinine levels were also determined. Least square means and 95% confidence intervals for the natural log of the creatinine-adjusted urinary cadmium levels were calculated for each characteristic using multivariate analysis of variance adjusting for age and smoking status. Results were calculated on the log scale and then transformed to the original scale by taking the exponent of each of the values. We observed statistically significant increasing creatinine-adjusted urinary cadmium mean levels relative to smoking status, older age, parity, lower body surface area, mineral zinc supplement consumption, and high income. We did not observe a difference relative to consumption of organ meats, crustaceans, alcohol, multivitamins, multiminerals or homegrown vegetables, age of menopause, menarche of participant or oldest daughter, menopausal status or urban-rural residential location. Approximately 40% of the variance in creatinine-adjusted urinary cadmium levels in adult women was explained by several characteristics. Similar to other studies, age and smoking were the strongest determinants of creatinine-adjusted urinary cadmium concentration.

  16. Cadmium, ATPase-P, yeast. From transport to toxicity

    International Nuclear Information System (INIS)

    Two projects has been developed during my PhD. One consisting in the functional study of CadA, the Cd2+-ATPase from Listeria monocytogenes, the other one was focused on the toxicity of cadmium and the associated response of the yeast Saccharomyces cerevisiae. This two studies used a a phenotype of sensitivity to cadmium induced by CadA expression in yeast. This phenotype was used as a screening tool to identify essential amino acids of Cd transport by CadA and to study cadmium toxicity and the corresponding yeast cellular response. CadA actively transports Cd using ATP hydrolysis as energy source. Directed mutagenesis of the membranous polar, sulphur and charged amino-acids revealed that Cd transport pathway implied four transmembrane segments (Tm) and more precisely the cysteine C354, C356 and proline P355 of the CPC motif located in Tm6, aspartate D692 in Tm8, glutamate E164 in Tm4 and methionine M149 in Tm5. From our studies, 2 Cd ions would be translocated for each hydrolysis ATP. Expression of CadA in the yeast Saccharomyces cerevisiae induces an hypersensitivity to Cd. A wild type cell can grow up to 100 μm cadmium whereas CadA expressing yeast cannot grow with 1 μm cadmium in the culture medium. This cadmium sensitivity was due to the localisation of CadA in the endoplasmic reticulum membrane. Transport of cadmium in this compartment produces an accumulation of mis-folded proteins that induces the Unfolded Protein Response (UPR). As UPR also occurs in a wild type yeast exposed to low Cd concentration, one can point out endoplasmic reticulum as a extremely sensitive cellular compartment. UPR also appears as an early response to Cd as it happens far before any visible signs of toxicity. (author)

  17. Blood cadmium concentration and lipid profile in Korean adults

    International Nuclear Information System (INIS)

    Although animal experiments have shown that cadmium exposure induces alterations in lipid profiles, no epidemiological study of this relationship has been performed. The objective of this study was to evaluate the association between blood cadmium concentration and blood lipid levels in Korean adults. A cross-sectional study comprising participants (n=3903) aged 20 years or older from the 2005, 2008, and 2009 Korea National Health and Nutrition Examination Surveys was conducted. Demographic characteristics and dietary intake were obtained from the participants by questionnaire, and cadmium and lipid levels were determined by analysis of blood samples. After adjusting for demographic and dietary factors, blood concentration of cadmium was positively associated with the risk of low high-density lipoprotein cholesterol (HDL-C) in a dose-dependent manner (p for trend <0.001). In addition, the odds ratios (ORs) of a high triglyceride to HDL-C ratio was significantly increased in the high blood cadmium groups [OR=1.36; 95% confidence interval (CI), 1.03–1.79 for fourth quintile and OR=1.41; 95% CI, 1.07–1.86 for fifth quintile] compared with the lowest quintile group. However, high blood cadmium was not associated with a risk of high total cholesterol, high low-density lipoprotein cholesterol, or high triglycerides. These data suggest that an increased cadmium body burden increases the risk of dyslipidemia, mainly due to the increased risk of low HDL-C and the high ratio of triglycerides to HDL-C.

  18. Cadmium(II) complex formation with glutathione.

    Science.gov (United States)

    Mah, Vicky; Jalilehvand, Farideh

    2010-03-01

    Complex formation between heavy metal ions and glutathione (GSH) is considered as the initial step in many detoxification processes in living organisms. In this study the structure and coordination between the cadmium(II) ion and GSH were investigated in aqueous solutions (pH 7.5 and 11.0) and in the solid state, using a combination of spectroscopic techniques. The similarity of the Cd K-edge and L(3)-edge X-ray absorption spectra of the solid compound [Cd(GS)(GSH)]ClO(4).3H(2)O, precipitating at pH 3.0, with the previously studied cysteine compound {Cd(HCys)(2).H(2)O}(2).H(3)O(+).ClO(4) (-) corresponds to Cd(S-GS)(3)O (dominating) and Cd(S-GS)(4) four-coordination within oligomeric complexes with mean bond distances of 2.51 +/- 0.02 A for Cd-S and 2.24 +/- 0.04 A for Cd-O. For cadmium(II) solutions (C (Cd(II)) approximately 0.05 M) at pH 7.5 with moderate excess of GSH (C (GSH)/C (Cd(II)) = 3.0-5.0), a mix of Cd(S-GS)(3)O (dominating) and Cd(S-GS)(4) species is consistent with the broad (113)Cd NMR resonances in the range 632-658 ppm. In alkaline solutions (pH 11.0 and C (GSH)/C (Cd(II)) = 2.0 or 3.0), two distinct peaks at 322 and 674 ppm are obtained. The first peak indicates six-coordinated mononuclear and dinuclear complexes with CdS(2)N(2)(N/O)(2) and CdSN(3)O(2) coordination in fast exchange, whereas the second corresponds to Cd(S-GS)(4) sites. At high ligand excess the tetrathiolate complex, Cd(S-GS)(4), characterized by a sharp delta((113)Cd) NMR signal at 677 ppm, predominates. The average Cd-S distance, obtained from the X-ray absorption spectra, varied within a narrow range, 2.49-2.53 A, for all solutions (pH 7.5 and 11.0) regardless of the coordination geometry. PMID:20035360

  19. Cadmium Impairs p53 Activity in HepG2 Cells

    OpenAIRE

    Urani, C.; Melchioretto, P.; M. Fabbri; Bowe, G.; Maserati, E.; Gribaldo, L.

    2014-01-01

    Cadmium and cadmium compounds are contaminants of the environment, food, and drinking water and are important constituents of cigarette smoke. Cd exposure has also been associated with airborne particulate CdO and with Cd-containing quantum dots in medical therapy. Adverse cadmium effects reported in the literature have stimulated during recent years an ongoing discussion to better elucidate cadmium outcomes at cell and molecular level. The present work is designed to gain an insight into the...

  20. An Evaluation of Biofield Treatment on Thermal, Physical and Structural Properties of Cadmium Powder

    OpenAIRE

    Mahendra Kumar Trivedi

    2015-01-01

    Cadmium is widely utilized in nickel-cadmium batteries, stabilizers, and coating applications due to its versatile physico-chemical properties. The aim of present study was to evaluate the impact of biofield treatment on atomic, thermal, and physical properties of cadmium powder. The cadmium powder was divided into two groups, one group as control and another group as treated. The treated group received Mr. Trivedi’s biofield treatment. Control and treated samples were characterized usi...

  1. Nrf2 activation prevents cadmium-induced acute liver injury

    International Nuclear Information System (INIS)

    Oxidative stress plays an important role in cadmium-induced liver injury. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that up-regulates cytoprotective genes in response to oxidative stress. To investigate the role of Nrf2 in cadmium-induced hepatotoxicity, Nrf2-null mice, wild-type mice, kelch-like ECH-associated protein 1-knockdown (Keap1-KD) mice with enhanced Nrf2, and Keap1-hepatocyte knockout (Keap1-HKO) mice with maximum Nrf2 activation were treated with cadmium chloride (3.5 mg Cd/kg, i.p.). Blood and liver samples were collected 8 h thereafter. Cadmium increased serum alanine aminotransferase (ALT) and lactate dehydrogenase (LDH) activities, and caused extensive hepatic hemorrhage and necrosis in the Nrf2-null mice. In contrast, Nrf2-enhanced mice had lower serum ALT and LDH activities and less morphological alternations in the livers than wild-type mice. H2DCFDA (2′,7′-dichlorodihydrofluoresein diacetate) staining of primary hepatocytes isolated from the four genotypes of mice indicated that oxidative stress was higher in Nrf2-null cells, and lower in Nrf2-enhanced cells than in wild-type cells. To further investigate the mechanism of the protective effect of Nrf2, mRNA of metallothionein (MT) and other cytoprotective genes were determined. Cadmium markedly induced MT-1 and MT-2 in livers of all four genotypes of mice. In contrast, genes involved in glutathione synthesis and reducing reactive oxygen species, including glutamate-cysteine ligase (Gclc), glutathione peroxidase-2 (Gpx2), and sulfiredoxin-1 (Srxn-1) were only induced in Nrf2-enhanced mice, but not in Nrf2-null mice. In conclusion, the present study shows that Nrf2 activation prevents cadmium-induced oxidative stress and liver injury through induction of genes involved in antioxidant defense rather than genes that scavenge Cd. -- Highlights: ► Cadmium caused extensive hepatic hemorrhage and necrosis in Nrf2-null mice. ► Keap1-KD and Keap1-HKO mice were

  2. Nrf2 activation prevents cadmium-induced acute liver injury

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Kai C. [Department of Pharmacology, Toxicology, and Therapeutics, University of Kansas Medical Center, Kansas City, KS (United States); Liu, Jie J. [Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS (United States); Klaassen, Curtis D., E-mail: cklaasse@kumc.edu [Department of Internal Medicine, University of Kansas Medical Center, Kansas City, KS (United States)

    2012-08-15

    Oxidative stress plays an important role in cadmium-induced liver injury. Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor that up-regulates cytoprotective genes in response to oxidative stress. To investigate the role of Nrf2 in cadmium-induced hepatotoxicity, Nrf2-null mice, wild-type mice, kelch-like ECH-associated protein 1-knockdown (Keap1-KD) mice with enhanced Nrf2, and Keap1-hepatocyte knockout (Keap1-HKO) mice with maximum Nrf2 activation were treated with cadmium chloride (3.5 mg Cd/kg, i.p.). Blood and liver samples were collected 8 h thereafter. Cadmium increased serum alanine aminotransferase (ALT) and lactate dehydrogenase (LDH) activities, and caused extensive hepatic hemorrhage and necrosis in the Nrf2-null mice. In contrast, Nrf2-enhanced mice had lower serum ALT and LDH activities and less morphological alternations in the livers than wild-type mice. H{sub 2}DCFDA (2′,7′-dichlorodihydrofluoresein diacetate) staining of primary hepatocytes isolated from the four genotypes of mice indicated that oxidative stress was higher in Nrf2-null cells, and lower in Nrf2-enhanced cells than in wild-type cells. To further investigate the mechanism of the protective effect of Nrf2, mRNA of metallothionein (MT) and other cytoprotective genes were determined. Cadmium markedly induced MT-1 and MT-2 in livers of all four genotypes of mice. In contrast, genes involved in glutathione synthesis and reducing reactive oxygen species, including glutamate-cysteine ligase (Gclc), glutathione peroxidase-2 (Gpx2), and sulfiredoxin-1 (Srxn-1) were only induced in Nrf2-enhanced mice, but not in Nrf2-null mice. In conclusion, the present study shows that Nrf2 activation prevents cadmium-induced oxidative stress and liver injury through induction of genes involved in antioxidant defense rather than genes that scavenge Cd. -- Highlights: ► Cadmium caused extensive hepatic hemorrhage and necrosis in Nrf2-null mice. ► Keap1-KD and Keap1-HKO mice

  3. Subcellular Localization of Cadmium in Chlorella vulgaris Beijerinck Strain Bt-09

    Directory of Open Access Journals (Sweden)

    P.B. Lintongan

    2004-06-01

    Full Text Available Growth response curves of Chlorella vulgaris Beijerinck strain Bt-09 to sublethal concentrations of cadmium were evaluated. The growth responses of this microalgal isolate was determined through analysis of chlorophyll a levels. Cadmium was effectively taken up by the cells as determined by Flame Atomic Absorption Spectrophotometry (F-AAS. Subcellular fractionation was undertaken to locate sites that accumulate cadmium.

  4. ASSESSMENT OF CADMIUM EXPOSURE AND TOXICITY RISK IN AN AMERICAN VEGETARIAN POPULATION

    Science.gov (United States)

    It has been postulated that nonvegetarians may be exposed to less cadmium than vegetarians because of the cadmium-poor meat in their diet. This study attempts to test this possibility by measuring the cadmium exposure and accumulation in a population subgroup that includes many v...

  5. 40 CFR 415.640 - Applicability; description of the cadmium pigments and salts production subcategory.

    Science.gov (United States)

    2010-07-01

    ... cadmium pigments and salts production subcategory. 415.640 Section 415.640 Protection of Environment... POINT SOURCE CATEGORY Cadmium Pigments and Salts Production Subcategory § 415.640 Applicability; description of the cadmium pigments and salts production subcategory. The provisions of this subpart...

  6. Highly sensitive detection of urinary cadmium to assess personal exposure

    International Nuclear Information System (INIS)

    Highlights: ► An electrochemical sensor capable of detecting cadmium at parts-per-billion levels in urine. ► A novel fabrication method for Boron-Doped Diamond (BDD) ultramicroelectrode (UME) arrays. ► Unique combination of BDD UME arrays and a differential pulse voltammetry algorithm. ► High sensitivity, high reproducibility, and very low noise levels. ► Opportunity for portable operation to assess on-site personal exposure. -- Abstract: A series of Boron-Doped Diamond (BDD) ultramicroelectrode arrays were fabricated and investigated for their performance as electrochemical sensors to detect trace level metals such as cadmium. The steady-state diffusion behavior of these sensors was validated using cyclic voltammetry followed by electrochemical detection of cadmium in water and in human urine to demonstrate high sensitivity (>200 μA ppb−1 cm−2) and low background current (<4 nA). When an array of ultramicroelectrodes was positioned with optimal spacing, these BDD sensors showed a sigmoidal diffusion behavior. They also demonstrated high accuracy with linear dose dependence for quantification of cadmium in a certified reference river water sample from the U.S. National Institute of Standards and Technology (NIST) as well as in a human urine sample spiked with 0.25–1 ppb cadmium

  7. Effect of Cadmium Chloride on Metallothionein Levels in Carp

    Directory of Open Access Journals (Sweden)

    Jana Kovarova

    2009-06-01

    Full Text Available Due to anthropogenic activities, heavy metals still represent a threat for various trophic levels. If aquatic animals are exposed to heavy metals, we can obviously observe considerable toxicity. It is well known that organisms treated with heavy metals synthesize low molecular mass compounds rich in cysteine. In this work the effects of cadmium chloride (2.5, 5, 7.5, 10 and 12.5 mg/L on common carp (Cyprinus carpio was investigated. We determined cadmium content in tissue of muscle, liver and kidney by atomic absorption spectrometry with electrothermal atomization and content of metallothionein (MT in the same tissues by the Brdicka reaction. Electrochemical methods can be considered as suitable and sensitive tools for MT determination in carp tissues. Results of our study showed a gradually enhancing of cadmium content in muscle with time and dose of cadmium chloride in water. MT levels in liver reached both high levels (above 130 ng/g in fish exposed to 2.5, 5 and 7.5 mg/L and low level (to 50 ng/g in fish exposed to 10 and 12.5 mg/L of cadmium chloride. This finding confirms that the synthesis of metallothioneins and binding capacity of these proteins is restricted.

  8. Cadmium sorption characteristics of phosphorylated sago starch-extraction residue

    International Nuclear Information System (INIS)

    The residue produced by the extraction of sago starch is usually discarded as a waste material. In this study, we phosphorylated the sago starch-extraction residue with phosphoryl chloride and used the phosphorylated residue to remove cadmium from wastewater. The phosphoric ester functionality in the phosphorylated residue was evaluated by means of infrared microspectrometry and solid-state NMR. The dependence of the cadmium sorption behavior on pH, contact time, and electrolyte concentration and the maximum sorption capacity of the phosphorylated residue were also studied. The cadmium sorption varied with pH and electrolyte concentration, and the maximum sorption capacity was 25.2 mg g-1, which is almost half the capacity of commercially available weakly acidic cation exchange resins. The phosphorylated residue could be reused several times, although cadmium sorption gradually decreased as the number of sorption-desorption cycles increased. The phosphorylated residue sorbed cadmium rapidly, which is expected to be favorable for the continuous operation in a column.

  9. Lead and cadmium in indoor air and the urban environment

    International Nuclear Information System (INIS)

    The present study was conducted to find potential terrestrial biomonitors for heavy metals in indoor air in an urban environment. TSP, PM10, and PM2.5 were collected in three retirement facilities in the urban area of Vienna. In addition, particulate matter and soil, vegetation, and isopods (Porcellio scaber L.) were collected in the adjacent garden areas. Aerosols were sampled with a low-volume air sampler. The sampled materials were wet ashed and total lead and cadmium contents were determined. Water-soluble heavy metal concentrations were measured in aqueous extracts from air exposed filters, soil, and vegetation. Lead and cadmium were analyzed by graphite furnace AAS. Lead contents in the vegetation were inferred from water-soluble lead in soils. Lead in isopods generally reflected the contents in vegetation. Cadmium in plants probably derived from soil solutions as well as from atmospheric input. Isopods reflected the total cadmium contents in soils. Particulate matter was dominated by PM2.5, both with respect to mass concentrations and to heavy metal contents. The indoor aerosol was found to be influenced by human activity, indoor sources, and outdoor particles. Relationships between indoor airborne heavy metals and the contents in vegetation (lead and cadmium: positive) and isopods (lead: negative) were identified to have the potential for biomonitoring indoor air quality. - Urban vegetation and isopods are potential indicators for indoor aerial heavy metals

  10. Production and radiochemical separation of rhodium-105 for radiopharmaceutical applications

    International Nuclear Information System (INIS)

    Production of no carrier added 105Rh by thermal neutron irradiation of natural Ru target and its radiochemical separation to obtain radionuclidically and radiochemically pure species is described. Irradiation planning, post irradiation chemical separation of 105Rh from ruthenium and iridium radionuclidic contaminants are discussed in detail. 100 mg of natural Ru was irradiated in a thermal neutron flux of 3 x 1013 neutrons/cm2/s for 7 days. Irradiated target was dissolved in a mixture of KIO4 and KOH in presence of water. Solvent extraction with CCl4 was used for removal of 97Ru and 103Ru, whereas solvent extraction with TBP was used for the removal of traces of 192Ir impurity. Different radiochemical separation techniques were tested for the recovery of 105Rh and its final purification from the accompanying radionuclidic impurities. The salts associated with the product were subsequently removed by fractional precipitation and by cation exchange chromatography. The radionuclidic purity of the 105Rh separated was estimated by gamma ray spectrometry; no radionuclidic contamination was observed. The radiochemical purity of the 105RhCl3 was ascertained by paper chromatography and paper electrophoresis. (orig.)

  11. Collinear laser spectroscopy of atomic cadmium

    CERN Document Server

    Frömmgen, Nadja; Bissell, Mark L; Bieroń, Jacek; Blaum, Klaus; Cheal, Bradley; Flanagan, Kieran; Fritzsche, Stephan; Geppert, Christopher; Hammen, Michael; Kowalska, Magdalena; Kreim, Kim; Krieger, Andreas; Neugart, Rainer; Neyens, Gerda; Rajabali, Mustafa M; Nörtershäuser, Wilfried; Papuga, Jasna; Yordanov, Deyan T

    2015-01-01

    Hyperfine structure $A$ and $B$ factors of the atomic $5s\\,5p\\,\\; ^3\\rm{P}_2 \\rightarrow 5s\\,6s\\,\\; ^3\\rm{S}_1$ transition are determined from collinear laser spectroscopy data of $^{107-123}$Cd and $^{111m-123m}$Cd. Nuclear magnetic moments and electric quadrupole moments are extracted using reference dipole moments and calculated electric field gradients, respectively. The hyperfine structure anomaly for isotopes with $s_{1/2}$ and $d_{5/2}$ nuclear ground states and isomeric $h_{11/2}$ states is evaluated and a linear relationship is observed for all nuclear states except $s_{1/2}$. This corresponds to the Moskowitz-Lombardi rule that was established in the mercury region of the nuclear chart but in the case of cadmium the slope is distinctively smaller than for mercury. In total four atomic and ionic levels were analyzed and all of them exhibit a similar behaviour. The electric field gradient for the atomic $5s\\,5p\\,\\; ^3\\mathrm{P}_2$ level is derived from multi-configuration Dirac-Hartree-Fock calculatio...

  12. Cadmium & its adverse effects on human health.

    Science.gov (United States)

    Bernard, A

    2008-10-01

    Cadmium (Cd), a by-product of zinc production, is one of the most toxic elements to which man can be exposed at work or in the environment. Once absorbed, Cd is efficiently retained in the human body, in which it accumulates throughout life. Cd is primarily toxic to the kidney, especially to the proximal tubular cells, the main site of accumulation. Cd can also cause bone demineralization, either through direct bone damage or indirectly as a result of renal dysfunction. In the industry, excessive exposures to airborne Cd may impair lung function and increase the risk of lung cancer. All these effects have been described in populations with relatively high exposures to Cd in the industrial or in heavily polluted environments. Recent studies, however, suggest that the chronic low environmental exposure to Cd now prevailing in industrialized countries can adversely affect the kidneys and bones of the general population. These studies show consistent associations between various renal and bone biomarkers and the urinary excretion of Cd used to assess Cd body burden. The public health impact of these findings are still unknown. Further research is needed to ascertain that these associations are truly causal and not secondary to parallel changes in Cd metabolism and in the bone or kidney function occurring because of ageing or diseases unrelated to Cd exposure. PMID:19106447

  13. Scanning tunneling microscope study of cadmium telluride

    International Nuclear Information System (INIS)

    Layered samples of cadmium telluride grown epitaxially on gallium arsenide substrates have been investigated by means of scanning tunneling microscopy (STM). The surface geometric and electronic structures are both of interest. Techniques were developed to remove the native oxide by etching, or to create a fresh surface by cleaving, and to protect them from oxidation by employing mineral or paraffin oil media. STM studies were conducted within the protective medium. These techniques were adapted and tested for both etched and cleaved samples of Si, CdTe and HgTe. The current-voltage characteristics of the CdTe surface were investigated during dynamic changes of the tunnel current and barrier height while the probe-to-sample separation (gap) was static. Recorded values are shown for current versus bias for several constant gap values. A range of bias values has been employed to test a possible solution for the problem of interference between the contributions from geometric and electronic structure factors

  14. Cadmium uptake by rat red blood cells

    International Nuclear Information System (INIS)

    Rat red blood cells were employed to study the uptake of cadmium (109Cd). Suspensions of red blood cells were exposed to Cd concentrations (both bound and free) observed following in vivo Cd administration. Cd uptake was biphasic with an initial rapid phase (0C was one-fourth of that at 370C. The metabolic inhibitors: sodium fluoride (1mM), potassium cyanide (1mM) and carbonyl cyanide-m-chlorophenyl hydrazone (2μM) and the Na+-K+-ATPase inhibitor, ouabain (1mM) did not reduce Cd (50μM) uptake into red blood cells. This suggests that the uptake of Cd into red blood cells was not an active process. Incubation of Cd (10μM) with an equimolar concentration of Zn did not alter uptake of Cd into red blood cells, but at 5 and 10 times higher concentrations of Zn, Cd uptake was enhanced 5-fold. Mercury at one-tenth and equimolar concentrations of Cd increased Cd uptake by red blood cells 2-fold. N-Ethylmaleimide (0.5-5mM), which irreversibly inactivates membrane sulfhydryl groups, decreased Cd uptake. The data indicate that Cd uptake into rat red blood cells occurs by passive transport and that alterations of sulfhydryls of red blood cell membrane may modulate the process. (author)

  15. Cadmium in insects after ash fertilization

    Institute of Scientific and Technical Information of China (English)

    Martin Lodenius; Jussi Josefsson; Kari Heli(o)vaara; Esa Tulisalo; Matti Nummelin

    2009-01-01

    Ash fertilization of forests returns nutrients to forest ecosystems and has a positive effect on soil pH.but it also may elevate Cd concentrations of forest biota.Cadmium concentrations of some forest insects(Formica ants.carabids and Coleopteran larvac from decaying wood)were investigated in southern Finland where two plots were fertilized with wood ash,while two other plots represented anfertilized control plots.In ants,mean Cd concentration was 3.6±1.4 mg/kg.with nest workers having significantly higher concen-trations than workers trapped in pitfall traps.Concentrations at fertilized and unfertilized plots were similar.In carabid beetles,the average Cd concentration of Carabus glabratus was 0.44±0.36 mg/kg.with no significant difference between control plots and fertilized plots.In another carabid beetle,Pterostichus niger,mean Cd concentration was higher at fertilized plots compared to control plots.We conclude that the variation of Cd concentra-tions in the insects studied is more efficiently controlled by species-specific differences than fertilization history of the forest floor.

  16. Effect of elevated CO2 concentration on photosynthetic characteristics of hyperaccumulator Sedum alfredii under cadmium stress

    Institute of Scientific and Technical Information of China (English)

    Tingqiang Li; Qi Tao; Zhenzhen Di; Fan Lu; Xiaoe Yang

    2015-01-01

    The combined effects of elevated CO2 and cadmi-um (Cd) on photosynthetic rate, chlorophyl fluorescence and Cd accumulation in hyperaccumulator Sedum alfredi Hance were investigated to predict plant growth under Cd stress with rising atmospheric CO2 concentration. Both pot and hydroponic experiments were conducted and the plants were grown under ambient (350 mL L?1) or elevated (800 mL L?1) CO2. Elevated CO2 significantly (P<0.05) increased Pn (105%–149%), Pnmax (38.8%–63.0%) and AQY (20.0%–34.8%) of S. alfredii in al the Cd treatments, but reduced chlorophyl concentra-tion, dark respiration and photorespiration. After 10 days growth in medium with 50 mM Cd under elevated CO2, PSII activities were significantly enhanced (P<0.05) with Pm, Fv/Fm, F(II) and qP increased by 66.1%, 7.5%, 19.5% and 16.4%, respectively, as compared with ambient-grown plants. Total Cd uptake in shoot of S. alfredi grown under elevated CO2 was increased by 44.1%–48.5%, which was positively correlated with the increase in Pn. These results indicate that elevated CO2 promoted the growth of S. alfredi due to increased photosynthetic carbon uptake rate and photosynthetic light-use efficiency, and showed great potential to improve the phytoextraction of Cd by S. alfredi .

  17. Effect of elevated CO2 concentration on photosynthetic characteristics of hyperaccumulator Sedum alfredii under cadmium stress.

    Science.gov (United States)

    Li, Tingqiang; Tao, Qi; Di, Zhenzhen; Lu, Fan; Yang, Xiaoe

    2015-07-01

    The combined effects of elevated CO2 and cadmium (Cd) on photosynthetic rate, chlorophyll fluorescence and Cd accumulation in hyperaccumulator Sedum alfredii Hance were investigated to predict plant growth under Cd stress with rising atmospheric CO2 concentration. Both pot and hydroponic experiments were conducted and the plants were grown under ambient (350 µL L(-1)) or elevated (800 µL L(-1)) CO2 . Elevated CO2 significantly (P < 0.05) increased Pn (105%-149%), Pnmax (38.8%-63.0%) and AQY (20.0%-34.8%) of S. alfredii in all the Cd treatments, but reduced chlorophyll concentration, dark respiration and photorespiration. After 10 days growth in medium with 50 µM Cd under elevated CO2 , PSII activities were significantly enhanced (P < 0.05) with Pm, Fv/Fm, Φ(II) and qP increased by 66.1%, 7.5%, 19.5% and 16.4%, respectively, as compared with ambient-grown plants. Total Cd uptake in shoot of S. alfredii grown under elevated CO2 was increased by 44.1%-48.5%, which was positively correlated with the increase in Pn. These results indicate that elevated CO2 promoted the growth of S. alfredii due to increased photosynthetic carbon uptake rate and photosynthetic light-use efficiency, and showed great potential to improve the phytoextraction of Cd by S. alfredii. PMID:25370532

  18. Rhodium-105 Bombesin Analogs for Prostate Cancer Radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Silvia S. Jurisson, PhD

    2005-12-31

    Over the period of this grant (11/01/2001 to 12/31/2005), the consistent and reproducible production of Rh-105, synthesis and evaluation of three new chelate systems based on hydroxymethyl phosphines, development of a new non-hydroxymethyl phosphine N{sub 2}P{sub 2} chelate system, conjugation of two of the chelates to the bombesin peptide analog BBN[7-14]NH{sub 2}, evaluation of the bombesin conjugates and their Rh-105 complexes for stability, cell binding affinity, and in vivo biodistribution in normal mice has been developed. The BBN analogs bind to GRP receptors that are overexpressed on PC-3 prostate tumor cells. A dedicated glove box is used for the separation and isolation of {sup 105}Rh from the target ({sup 104}Ru). All tubing/connections/valves from the point of the Cl{sub 2} tank are made of Teflon to minimize/eliminate the introduction of any metal into the process (e.g., iron from stainless steel corrosion). The separation of {sup 105}Rh produced from the enriched {sup 104}Ru target involves oxidation of the enriched {sup 104}Ru metal target to ruthenium tetroxide with chlorine gas and sodium hydroxide solution to generate hypochlorite in situ. The RuO4 is removed by distillation and the {sup 105}Rh remaining in the reaction vial is converted into {sup 105}Rh-chloride by acidification with hydrochloric acid and heating. The {sup 105}Rh production process has become reproducible over the past year to consistently make 10-30 mCi of {sup 105}Rh from 1-3 mg of an enriched (99.21%) {sup 104}Ru target. The process itself involves irradiation of the enriched {sup 104}Ru target in the core of the reactor (University of Missouri Research Reactor (MURR)) for one week to yield 16-40 mCi of {sup 105}Rh. The irradiated target is processed to separate the Rh-105 in high specific activity from the {sup 104}Ru target. The irradiated target is dissolved in NaOH (2M, 3 mL) by bubbling Cl{sub 2} gas through the solution (generating NaOCl in situ) to generate RuO{sub 4

  19. Renal and blood pressure effects from environmental cadmium exposure in Thai children

    International Nuclear Information System (INIS)

    Very few studies have shown renal and blood pressure effects from environmental cadmium exposure in children. This population study examined associations between urinary cadmium excretion, a good biomarker of long-term cadmium exposure, and renal dysfunctions and blood pressure in environmentally exposed Thai children. Renal functions including urinary excretion of β2-microglobulin, calcium (early renal effects), and total protein (late renal effect), and blood pressure were measured in 594 primary school children. Of the children studied, 19.0% had urinary cadmium ≥1 μg/g creatinine. The prevalence of urinary cadmium ≥1 μg/g creatinine was significantly higher in girls and in those consuming rice grown in cadmium-contaminated areas. The geometric mean levels of urinary β2-microglobulin, calcium, and total protein significantly increased with increasing tertiles of urinary cadmium. The analysis did not show increased blood pressure with increasing tertiles of urinary cadmium. After adjusting for age, sex, and blood lead levels, the analysis showed significant positive associations between urinary cadmium and urinary β2-microglobulin and urinary calcium, but not urinary total protein nor blood pressure. Our findings provide evidence that environmental cadmium exposure can affect renal functions in children. A follow-up study is essential to assess the clinical significance and progress of renal effects in these children. - Highlights: • Few studies show renal effects from environmental cadmium exposure in children. • We report renal and blood pressure effects from cadmium exposure in Thai children. • Urinary β2-microglobulin and calcium increased with increasing urinary cadmium. • The study found no association between urinary cadmium levels and blood pressure. • Environmental cadmium exposure can affect renal functions in children

  20. Renal and blood pressure effects from environmental cadmium exposure in Thai children

    Energy Technology Data Exchange (ETDEWEB)

    Swaddiwudhipong, Witaya, E-mail: swaddi@hotmail.com [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Mahasakpan, Pranee [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Jeekeeree, Wanpen [Department of Medical Technology, Mae Sot General Hospital, Tak 63110 (Thailand); Funkhiew, Thippawan [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand); Sanjum, Rungaroon; Apiwatpaiboon, Thitikarn [Department of Medical Technology, Mae Sot General Hospital, Tak 63110 (Thailand); Phopueng, Ittipol [Department of Community and Social Medicine, Mae Sot General Hospital, Tak 63110 (Thailand)

    2015-01-15

    Very few studies have shown renal and blood pressure effects from environmental cadmium exposure in children. This population study examined associations between urinary cadmium excretion, a good biomarker of long-term cadmium exposure, and renal dysfunctions and blood pressure in environmentally exposed Thai children. Renal functions including urinary excretion of β{sub 2}-microglobulin, calcium (early renal effects), and total protein (late renal effect), and blood pressure were measured in 594 primary school children. Of the children studied, 19.0% had urinary cadmium ≥1 μg/g creatinine. The prevalence of urinary cadmium ≥1 μg/g creatinine was significantly higher in girls and in those consuming rice grown in cadmium-contaminated areas. The geometric mean levels of urinary β{sub 2}-microglobulin, calcium, and total protein significantly increased with increasing tertiles of urinary cadmium. The analysis did not show increased blood pressure with increasing tertiles of urinary cadmium. After adjusting for age, sex, and blood lead levels, the analysis showed significant positive associations between urinary cadmium and urinary β{sub 2}-microglobulin and urinary calcium, but not urinary total protein nor blood pressure. Our findings provide evidence that environmental cadmium exposure can affect renal functions in children. A follow-up study is essential to assess the clinical significance and progress of renal effects in these children. - Highlights: • Few studies show renal effects from environmental cadmium exposure in children. • We report renal and blood pressure effects from cadmium exposure in Thai children. • Urinary β{sub 2}-microglobulin and calcium increased with increasing urinary cadmium. • The study found no association between urinary cadmium levels and blood pressure. • Environmental cadmium exposure can affect renal functions in children.

  1. Biosorption of Cadmium by Fungal Biomass of Aspergillus niger

    Institute of Scientific and Technical Information of China (English)

    QI YANG; JIAN-LONG WANG; ZHI XING

    2005-01-01

    Objective To investigate the removal of cadmium from aqueous solution by waste fungal biomass of Aspergillus niger, originated from citric acid fermentation industry. Methods Batch adsorption test was used to study the biosorption equilibrium and isotherm. The Cd2+ concentration was measured with atomic adsorption spectrophotometer (AAS) HITACHI 180-80. Results The biosorption achieved equilibrium within 30 min. The adsorption isotherm could be described by Freundlich adsorption model, and the constants KF and 1/n were determined to be 2.07 and 0.18, respectively, and the correlation efficiency was 0.97. The optimal pH for Cd adsorption was 6.0. The cadmium-laden biomass could be effectively regenerated using 0.1 N HCl. Conclusion The waste biomass of Aspergillus niger, a by-product of fermentation industry, is a potential biosorbent for the removal of cadmium from aqueous solution.

  2. Analysis Of The Underpotential Deposition Of Cadmium On Copper

    Directory of Open Access Journals (Sweden)

    Kowalik R.

    2015-09-01

    Full Text Available In this study the process of deposition of cadmium on polycrystalline copper electrode in sulfate solution was investigated. The process of underpotential and bulk deposition was analyzed by classical electrochemical method: cyclic voltammetry(CV, anodic stripping voltammetry(ASV and electrochemical quartz crystal microbalance(EQCM. The obtained results were compared with electrochemical impedance spectroscopy(EIS measurements. CV, EQCM and EIS results suggest that the UPD of cadmium starts below potential −0.4 V vs Ag/AgCl. Additionally the stripping analysis indicates the formation of cadmium monolayer with different density of deposited atoms depending on the applied potential. The transition from UPD to bulk deposition occurs below potential −0,7 V.

  3. Effects of macromolecular chelators on intestinal cadmium absorption in mice

    Energy Technology Data Exchange (ETDEWEB)

    Andersen, O.; Nielsen, J.B.; Bulman, R.A.

    1989-01-01

    Suppression of absorption by macromolecular chelators have been sucessful with several metals. In this paper a series of immobilized chelators ranging from DTPA to S-containing soft bases have been synthetized and investigated for ability to suppress intestinal uptake of /sup 109/Cd/sup 2+/ in mice. Dextran-O-ethyl-mercaptan, xanthates derived from polysaccharides and polyvinyl alcohol, dithiocarbamates of polyethylene imine and aminoethyl cellulose, and DTPA immobilized on aminopropyl silica were all ineffective. DTPA immobilized on aminoethyl cellulose even enhanced the intestinal uptake. The macromolecular chelators were without extensive effect on organ distribution of absorbed cadmium, except for dithiocarbamate immobilized on polyethylene imine, which enhanced the deposition of cadmium in several organs including the brain. Although the results are discouragign, they indicate that desing and synthesis of immobilized vicinal dithio compounds may represent an avenue for development of non-absorbable chelators with high affinity for cadmium.

  4. Cadmium-induced oxidative stress in potato tuber

    Directory of Open Access Journals (Sweden)

    Andrzej Stroiński

    2014-02-01

    Full Text Available Short-term treatment of tuber discs of potato (Solanum tuberosum L. with cadmium chloride elevated the concentration of active oxygen species (.O-2, H202 and activated the antioxidative system. Two cultivars, Bintje and Bzura, susceptible and tolerant, respectively, to cadmium were examined. In more tolerant, control tissues the activity of ascorbic acid peroxidase (AAP and catalase (CAT was higher than in the sensitive ones. During first hours of stress, the inhibition of superoxide dismutase (SOD, CAT and AAP was observed and it comes from inactivation of enzymes by cadmium ions. A subsequent activity increase of the enzymes aroused earlier in tolerant tissues. It seems therefore, that tolerant tissues possess a more efficient antioxidative system.

  5. Thermal decomposition of thiourea coordination compounds of cadmium

    International Nuclear Information System (INIS)

    Thermal decomposition processes of cadmium thiourea complexes of the composition [Cd(thio)2A2] and [Cd(thio)4]B2 (A = CH3COO, I, Br, Cl, 1/2SO4; B = NO3, F, 1/2SO4; thio = thiourea) were studied using the methods of IR spectroscopy, X-ray phase and thermal analyses. It was ascertained that cadmium sulfide is the final product of pyrolysis for all the complexes studied, while the composition of the rest products is largely determined by nature of acidoligand A or second sphere anion B. Parameters of thermal stability of cadmium complexes, effective activation energies of their decomposition process were determined, pyrolysis mechanism being suggested

  6. Antifungal activity of nicotine and its cadmium complex

    International Nuclear Information System (INIS)

    Nicotine and its metal complex; Cd(II)-nicotine were isolated from leaves of Nicotiana tabacum using various metal ions by the reported techniques and studied for their antifungal activities against fourteen different species of fungi. For comparative study, pure sample of nicotine and metal salt used for complexation; cadmium(II) iodide was also subjected to antifungal tests with the same species of fungus under similar conditions. Results indicated that nicotine is quite effective against the rare pathogenic and Non pathogenic fungi but comparatively less effective against Pathogenic fungi. Nicotine was found to be completely ineffective against the selected species of Occasional pathogenic fungi. Cadmium(II) iodide effectively inhibited Pathogenic and Non pathogenic fungi whereas relatively ineffective against the Occasional pathogenic and Rare pathogenic fungi. On the other hand, Cadmium(II) nicotine complex inhibited all the selected species of fungi except Fusarium solani. (author)

  7. Study on removal of cadmium by hybrid liquid membrane process

    International Nuclear Information System (INIS)

    Removal of cadmium as a hazardous heavy metal is studied by applying a new design of hybrid cell for liquid membrane process. Tri-iso-octyl amine (TIOA) is used as the carrier in the organic phase. The concentration of cadmium in the samples is measured by atomic absorption spectroscopy. The effect of various parameters including type of supporting membrane, pH of feed and stripping phases, initial concentration of cadmium, carrier concentration, solvent nature, and also organic film resistance on mass transfer rate and removal efficiency are studied. The effect of temperature on mass transfer flux is studied by proposing a prediction model. The optimum carrier concentration is found to be about 0.05 M. The appropriate values of pH for feed and stripping phases are about 3 and 13, respectively.

  8. Lead and Cadmium Content of Korbal Rice in Northern Iran

    Directory of Open Access Journals (Sweden)

    A Bakhtiarian

    2001-09-01

    Full Text Available Every year the entrance of factory wastes such as Shiraz Petrochemical Complex, Marvdasht sugar cube factory, and Charmineh factory, and other industrial units into the Kor and Sivand rivers and also the entrance of the Marvdasht and Zarghan city sewer system wastes into the Kor river and the use of their water in the cultivation of the rice has caused a significant increase in the lead and cadmium content of the grains of rice. To study the effect of the Kor river's pollution on the lead and cadmium content of the Korbal rice samples. The results of the study show that the lead and cadmium content of the grains of rice, 57 samples of 6 different types of rice were prepared in 19 different stations in Korbal region and also 18 samples of 6 different types of rice, cultivated with unpolluted water, were prepared in the National Institute of Rice Research (Gilan. A comparison of the pollution level of the Korbal and Gilan rice samples shows a significant difference and indicates the significant effect of the pollution of the river on the lead and cadmium content of the Korbal rice samples. The results of the study show that the lead and cadmium content of the hybrid, prolific, and late rice sample types were greater than that of unprolific and early types, such that the amount of these two elements were highest in the Hassani type (the lead content was 0.9625 ppm and the cadmium content was 0.0793 ppm, whereas the Gasroddashti type which blooms earlier and is long seeded has the lowest amount of these two elements.

  9. Cadmium effects and accumulation in cultures of Prorocentrum micans (dinophyta)

    Science.gov (United States)

    Kayser, H.; Sperling, K.-R.

    1980-03-01

    Effects and accumulation of cadmium were studied in unialgal 10-1 batch-culture experiments with the dinoflagellate Prorocentrum micans Ehrenberg. Tests were made using sterile filtered North Sea water enriched with nitrate and phosphate only in order to avoid disturbances by complex formation. Cadmium was added to the cultures in amounts of 100 to 0.13 µg l-1. In one series it was added at the start of the experiments and in a second one after a growth period of 1 week. Addition of only 1.2 µg Cd l-1 reduces multiplication rates and maximum cell densities of the algae. Not until 0.4 µg Cd-1 does growth correspond to that of the controls. Cadmium concentrations were measured, after filtration, in the culture medium and in the biomass by means of flameless AAS. The cadmium content in algae increased from 2.7 µg g-1 (dry weight) in controls to 500 µg g-1 (dry weight) in media containing 100 µg Cd l-1. Uptake occurred rapidly during the first few days of the experiments, slowed down somewhat during exponential growth stage, and increased during decay of the cultures. Cadmium content of culture media remained nearly constant (Series 1) or decreased only slowly during experimental time (Series 2). The highest concentration factor was measured in the controls. It decreased with increasing metal concentration in the medium and increased with experimental time. Structural modifications of the cells were visible after Lugol fixation only, indicating brittleness of the cell walls. P. micans has shown to be extremely sensitive to cadmium and to accumulate this metal.

  10. Cadmium effects and accumulation in cultures of Prorocentrum micans (Dinophyta)

    Energy Technology Data Exchange (ETDEWEB)

    Kayser, H.; Sperling, K.R.

    1980-01-01

    Effects and accumulation of cadmium were studied in 10-l batch-culture experiments with the dinoflagellate Prorocentrum micans Ehrenberg. Tests were made using sterile filtered North Sea water enriched with nitrate and phosphate only in order to avoid disturbances by complex formation. Cadmium was added to the cultures in amounts of 100 to 0.13 ..mu..g l/sup -1/. In one series it was added at the start of the experiments and in a second one after a growth period of 1 week. Addition of only 1.2 ..mu..g Cd l/sup -1/ reduces multiplication rates and maximum cell densities of the algae. Not until 0.4 ..mu..g Cd l/sup -1/ does growth correspond to that of the controls. Cadmium concentrations were measured, after filtration, in the culture medium and the biomass by means of flameless AAS. The cadmium content in algae increased from 2.7 ..mu..g g/sup -1/ (dry weight) in controls to 500 ..mu..g g/sup -1/ (dry weight) in media containing 100 ..mu..g Cd l/sup -1/. Uptake occurred rapidly during the first few days of the experiments, slowed down somewhat during exponential growth stage, and increased during decay of the cultures. Cadmium content of culture media remained nearly constant or decreased only slowly during experimental time. The highest concentration factor was measured in the controls. It decreased with increasing metal concentration in the medium and increased with experimental time. Structural modifications of the cells were visible after Lugol fixation only, indicating brittleness of the cell walls. P. micans has shown to be extremely sensitive to cadmium and to accumulate this metal.

  11. Solution and solid state characterization of a cadmium octaazacryptand complex

    Energy Technology Data Exchange (ETDEWEB)

    Thompson, J.A.; Barr, M.E.; Ford, D.K. [Los Alamos National Laboratory, NM (United States)] [and others

    1996-03-27

    The constant for cadmium binding by octaazacryptand L = N(CH{sub 2}CH{sub 2}NHCH{sub 2}CH{sub 2}NHCH{sub 2}CH{sub 2}){sub 3}N was determined by potentiometry; log {Beta}{sub ML}=18.3(1). Calculation of pM values (pM = -log [M]) show that L has the highest reported binding affinity for cadmium relative to other [2.2.2]polyoxa-polyaza cryptates. Two cadmium cryptate complexes, [CdL](BF{sub 4}){sub 2} (1a) and [CdL](OAc){sub 2}{center_dot}2H{sub 2}O (1b), were synthesized by metalation of the free cryptand. The molecular structures of compounds 1a and 1b were determined by X-ray diffraction. The cadmium ions in both complexes are eight-coordinate and display similar coordination geometries but different ligand conformations, designated as parallel and oblique. The cadmium coordination sphere is best described as a bicapped octahedron. Through 2D NMR experiments the authors have found that the Cd is in a symmetric environment and the conformation of the ligand in solution is consistent with the parallel conformation observed in one of the solid state structures. The {sup 113}Cd NMR shift of this eight-coordinate amine complex is 75 ppm relative to 0.1 M aqueous Cd(ClO{sub 4}){sub 2}, which correlates with shifts observed for other [2.2.2] cadmium polyoxa-polyaza cryptates.

  12. THE CADMIUM INTAKE OF SELECTED LEGUMES IN MODEL CONDITIONS

    Directory of Open Access Journals (Sweden)

    Pavol Trebichalský

    2012-12-01

    Full Text Available The work is to evaluate the extent of risk transfer of heavy metals from soil burdensome to their different levels of consumption of selected parts of the crop. The goal to be achieved in conditions of simulated vegetation pot experiments. To implement the experiment, we used the agricultural soil of land site Výčapy - Opatovce. The experiments use two types of leguminous plants: Faba beans (Faba vulgaris M., a variety MERLIN lentil dishes (Lens esculentum variety NELKA. In one experimental tank was weighed 5 kg of soil mixed with 1 kg of silica sand, and the bottom of the container we put a small drainage layer of gravel. Within each container, we applied the calculated dose of the basic fertilizer, as well as various amounts of soluble salts of cadmium observed. Crops are harvested when fully ripe and the  wet mineralization of plant samples was determined by heavy metals AAS method for device VARIAN 240FS. Significant ratio of cadmium is in the aboveground biomass of the legumes. Lentils take into aboveground biomass much more cadmium than  faba beans. The cadmium content in the first two variants is significantly lower than in the next two in both crops. We may conclude that the faba beans, and lentils to accumulate an increased amount of cadmium in soil in a relatively large amount of seeds. Although it is clear that Faba bean received cadmium content was compared with more lentils. Due to the significant accumulation of Cd by plants lentils and excessive production of the aboveground biomass is potentially usable lens as fytoremediation crop recovery for metalic polluted soils.doi:10.5219/221

  13. Effect of pH on cadmium biosorption by coconut copra meal

    International Nuclear Information System (INIS)

    Biosorption of cadmium ion by coconut copra meal, an agricultural waste product was investigated as a function of initial solution pH and initial cadmium concentration. Pseudo-second-order kinetic analyses were performed to determine the rate constant of biosorption, the equilibrium capacity, and initial biosorption rate. Cadmium biosorption by copra meal was found to be dependent on the initial solution pH and initial cadmium concentration. Ion exchange occurred in the initial biosorption period. In addition, mathematical relationships were drawn to relate the change in the solution hydrogen ion concentration with equilibrium biosorption capacity, initial cadmium concentration, and equilibrium biosorption capacity

  14. Zinc-Nickel Codeposition in Sulfate Solution Combined Effect of Cadmium and Boric Acid

    Directory of Open Access Journals (Sweden)

    Y. Addi

    2011-01-01

    Full Text Available The combined effect of cadmium and boric acid on the electrodeposition of zinc-nickel from a sulfate has been investigated. The presence of cadmium ion decreases zinc in the deposit. In solution, cadmium inhibits the zinc ion deposition and suppresses it when deposition potential value is more negative than −1.2 V. Low concentration of CdSO4 reduces the anomalous nature of Zn-Ni deposit. Boric acid decreases current density and shifts potential discharge of nickel and hydrogen to more negative potential. The combination of boric acid and cadmium increases the percentage of nickel in the deposit. Boric acid and cadmium.

  15. Contribution of an Auxin to the Uptake of Nickel and Cadmium in Maize Seedlings

    Institute of Scientific and Technical Information of China (English)

    GUO DONG-SHENG; XI YU-YING; WANG AI-YING; ZHANG JUN; YUAN XIAO-YING

    1999-01-01

    Maize seedlings were cultured in nickel or cadmium contaminated sand treated with α-naphthylacetic acid (NAA). The effects of NAA on nickel and cadmium uptake in roots, shoots, and subcellular fractions (cell wall, nuclei and remained parts of seedling cells) were determined. The data showed growth promotion when NAA was applied at low concentrations and inhibition at high concentrations. Uptake of nickel and cadmium content increased concurrently in roots and shoots. In the subcellular fraction, nickel and cadmium was greatest in the cell wall. The changes in growth had greatest correlation with nickel and cadmium content in the subcellular fraction.

  16. Kinetics of biosorption of cadmium on Baker's yeast.

    Science.gov (United States)

    Vasudevan, Padma; Padmavathy, V; Dhingra, S C

    2003-09-01

    In the present study the kinetics of biosorption of cadmium(II) ions by deactivated protonated yeast converted to sodium form was investigated for different initial concentrations of the metal ion (10-100 ppm) and different sorbent dosages (0.1-2.0 g) at a pH of 6.5. The adsorption process occurred in four distinct steps and the rates for these steps decreased sequentially. The rate of cadmium uptake in each case was pseudo-second-order with respect to metal ion concentration. The amount sorbed at equilibrium was found to be directly proportional to the initial metal ion concentration divided by the sorbent mass. PMID:12798119

  17. Reactivity of the cadmium ion in concentrated phosphoric acid solutions.

    Science.gov (United States)

    De Gyves, J; Gonzales, J; Louis, C; Bessiere, J

    1989-07-01

    The solvation transfer coefficients which characterize the changes of ion reactivity with phosphoric acid concentration have been calculated for cadmium from the constants of the successive chloride complexes, and for silver and diethyldithiophosphate from potentiometric measurements. They evidence the strong desolvation of the cadmium species in concentrated phosphoric acid media, causing a remarkable increase of its reactivity. They allow the results of liquid-liquid extraction, precipitation and flotation reactions to be correctly interpreted and their changes to be foreseen when the reagents are modified. PMID:18964794

  18. Spectroscopic study of cadmium (II) complexes with heterocyclic dithiocarbamate ligands

    Energy Technology Data Exchange (ETDEWEB)

    Garcia-Fontan, S. (Departamento de Quimica Pura y Aplicada, Universidad de Vigo (Spain)); Rodriguez-Seoane, P. (Departamento de Quimica Pura y Aplicada, Universidad de Vigo (Spain)); Casas, J.S. (Departamento de Quimica Inorganica, Universidad de Santiago de Compostela (Spain)); Sordo, J. (Departamento de Quimica Inorganica, Universidad de Santiago de Compostela (Spain)); Jones, M.M. (Department of Chemistry and Center in Molecular Toxicology, Vanderbilt University, Nashville, TN (United States))

    1993-09-15

    Cadmium(II) dithiocarbamates Cd(dtc)[sub 2] (dtc=4-carboxamidopiperidine-1-carbodithioate, morpholine-1-carbodithioate or 4-(2-hydroxyethyl)piperazine-1-carbodithioate) and Cd(dtc)[sub 2].H[sub 2]O (dtc=4-hydroxypiperidine-1-carbodithioate)[r brace] have been prepared and characterized by thermal analysis and IR and NMR ([sup 13]C, [sup 113]Cd) spectrometry. Two of these ligands have previously been shown capable of removing cadmium from its aged in vivo storage sites. The use of solid state [sup 13]C NMR measurements to establish the coordination mode of the dithiocarbomate ligands is also examined and the difficulties which arise are discussed. (orig.)

  19. Distribution regularities lead and cadmium in soils of northern landscapes

    Science.gov (United States)

    Lodygin, Evgeny; Beznosikov, Vasily

    2013-04-01

    The background concentrations of lead and cadmium in soils of the southern part of the Komi Republic have been studied. It is found that the content of lead and cadmium in the soils of accumulative landscapes (depressions, floodplains) is generally higher than that in the soils of eluvial (interfluves) landscapes. Background (unpolluted) soils of the southern districts (Syktyvdinsk, Kortkeross, Sysola, Koigorod, and Priluzskii) of the Komi Republic were studied; their total area reaches 58 100 km2. Acid-soluble forms of metals (Pb, Cd) were determined according to a metrologically tested method with the use of an atomic emission spectrometer with inductively coupled argon plasma (Spectro Ciros, Germany). The lead concentrations in the A0A1 horizon of the studied soils vary from 6.5 to 40.0 mg/kg. The maximum lead concentrations exceed the minimum lead concentration by six times. Sandy soils have a considerably lower content of lead in comparison with loamy soils. The lead content in the profiles of loamy soils is higher than that in the parent material. Relatively low lead concentrations are typical of the podzols with a coarse texture and a high mobility of lead. The lead content in the soils is weakly correlated with the carbon content (r = 0.55), and the clay (environment is due to industrial emissions. The uppermost (0-5 cm) soil horizons are enriched with cadmium under the impact of biological factors, and its concentrations in the humus horizons reaches 0.19-0.50 mg/kg in the southern part of the Komi Republic. Accumulative landscapes have maximum cadmium concentrations; eluvial landscapes are depleted of cadmium due to its removal with solid and liquid runoff. The distribution of cadmium in the soil profiles is relatively even with an insignificant maximum in the humus horizons. Illuvial horizons represent a geochemical barrier on the path of cadmium migration down the soil profile. The cadmium content in the studied soils is weakly correlated with the

  20. Synthesis and characterization of cadmium doped lead–borate glasses

    Indian Academy of Sciences (India)

    A A Alemi; H Sedghi; A R Mirmohseni; V Golsanamlu

    2006-02-01

    Cadmium doped lead–borate glasses were prepared from the melts in appropriate proportions of PbO2, H3BO3 and (15–40 mol%) CdO mixture in the temperature range 700–950°C. The infrared spectra of the glasses in the range 400–4000 cm-1 show their structures. No boroxol ring formation was observed in the structure of these glasses. Furthermore, doped cadmium atoms were not seen in tetrahedral coordination. But the conversion of three-fold to four-fold coordination of boron atoms in the structure of glasses was observed.

  1. Cadmium resistance from Staphylococcus aureus plasmid pI258 cadA gene results from a cadmium-efflux ATPase.

    OpenAIRE

    Nucifora, G; Chu, L; Misra, T K; Silver, S

    1989-01-01

    Cadmium resistance specified by the cadA determinant of Staphylococcus aureus plasmid pI258 results from the functioning of a cadmium-efflux system. In the nucleotide sequence of the DNA fragment containing the cadA determinant, two open reading frames were identified. The larger one, corresponding to a predicted polypeptide of 727 amino acid residues, is necessary and sufficient for expression of cadmium resistance. Comparison of the CadA amino acid sequence with known protein sequences sugg...

  2. Biosorption of cadmium by endophytic fungus (EF) Microsphaeropsis sp. LSE10 isolated from cadmium hyperaccumulator Solanum nigrum L.

    Science.gov (United States)

    Xiao, Xiao; Luo, Shenglian; Zeng, Guangming; Wei, Wanzhi; Wan, Yong; Chen, Liang; Guo, Hanjun; Cao, Zhe; Yang, Lixia; Chen, Jueliang; Xi, Qiang

    2010-03-01

    A novel technology to obtain highly efficient biosorbent from the endophytes of a hyperaccumulator is reported. This technology is more convenient than the traditional method of obtaining biosorbents by experimentally screening many types of biomass by trial and error. Using this technology, endophytic fungus (EF) LSE10 was isolated from the cadmium hyperaccumulator Solanum nigrum L. It was identified as Microsphaeropsis sp. When cultured in vitro, the biomass yield of this EF was more than twice that of none-endophytic fungus (NEF) Rhizopus cohnii. Subsequently, it was used as a biosorbent for biosorption of cadmium from the aqueous solution. The results showed that the maximum biosorption capacity was 247.5mg/g (2.2 mmol/g) which was much higher than those of other adsorbents, including biosorbents and activated carbon. Carboxyl, amino, sulphonate and hydroxyl groups on EF LSE10 surface were responsible for the biosorption of cadmium. PMID:19854641

  3. Concentration of cadmium in cacao beans and its relationship with soil cadmium in southern Ecuador.

    Science.gov (United States)

    Chavez, E; He, Z L; Stoffella, P J; Mylavarapu, R S; Li, Y C; Moyano, B; Baligar, V C

    2015-11-15

    Cadmium (Cd) content in cacao beans above a critical level (0.6 mg kg(-1)) has raised concerns in the consumption of cacao-based chocolate. Little is available regarding Cd concentration in soil and cacao in Ecuador. The aim of this study was to determine the status of Cd in both, soils and cacao plants, in southern Ecuador. Soil samples were collected from 19 farms at 0-5, 5-15, 15-30, and 30-50 cm depths, whereas plant samples were taken from four nearby trees. Total recoverable and extractable Cd were measured at the different soil depths. Total recoverable Cd ranged from 0.88 to 2.45 and 0.06 to 2.59, averaged 1.54 and 0.85 mg kg(-1), respectively in the surface and subsurface soils whereas the corresponding values for M3-extractable Cd were 0.08 to 1.27 and 0.02 to 0.33 with mean values of 0.40 and 0.10 mg kg(-1). Surface soil in all sampling sites had total recoverable Cd above the USEPA critical level for agricultural soils (0.43 mg kg(-1)), indicating that Cd pollution occurs. Since both total recoverable and M3-extractable Cd significantly decreased depth wise, anthropogenic activities are more likely the source of contamination. Cadmium in cacao tissues decreased in the order of beans>shell>leaves. Cadmium content in cacao beans ranged from 0.02 to 3.00, averaged 0.94 mg kg(-1), and 12 out of 19 sites had bean Cd content above the critical level. Bean Cd concentration was highly correlated with M3- or HCl-extractable Cd at both the 0-5 and 5-15 cm depths (r=0.80 and 0.82 for M3, and r=0.78 and 0.82 for HCl; Pcacao beans and M3- or HCl-extractable Cd are suitable methods for predicting available Cd in the studied soils. PMID:26172587

  4. Concentration of cadmium in cacao beans and its relationship with soil cadmium in southern Ecuador

    International Nuclear Information System (INIS)

    Cadmium (Cd) content in cacao beans above a critical level (0.6 mg kg−1) has raised concerns in the consumption of cacao-based chocolate. Little is available regarding Cd concentration in soil and cacao in Ecuador. The aim of this study was to determine the status of Cd in both, soils and cacao plants, in southern Ecuador. Soil samples were collected from 19 farms at 0–5, 5–15, 15–30, and 30–50 cm depths, whereas plant samples were taken from four nearby trees. Total recoverable and extractable Cd were measured at the different soil depths. Total recoverable Cd ranged from 0.88 to 2.45 and 0.06 to 2.59, averaged 1.54 and 0.85 mg kg−1, respectively in the surface and subsurface soils whereas the corresponding values for M3-extractable Cd were 0.08 to 1.27 and 0.02 to 0.33 with mean values of 0.40 and 0.10 mg kg−1. Surface soil in all sampling sites had total recoverable Cd above the USEPA critical level for agricultural soils (0.43 mg kg−1), indicating that Cd pollution occurs. Since both total recoverable and M3-extractable Cd significantly decreased depth wise, anthropogenic activities are more likely the source of contamination. Cadmium in cacao tissues decreased in the order of beans > shell > > leaves. Cadmium content in cacao beans ranged from 0.02 to 3.00, averaged 0.94 mg kg−1, and 12 out of 19 sites had bean Cd content above the critical level. Bean Cd concentration was highly correlated with M3- or HCl-extractable Cd at both the 0–5 and 5–15 cm depths (r = 0.80 and 0.82 for M3, and r = 0.78 and 0.82 for HCl; P < 0.01). These results indicate that accumulation of Cd in surface layers results in excessive Cd in cacao beans and M3- or HCl-extractable Cd are suitable methods for predicting available Cd in the studied soils. - Highlights: • > 60% of the studied sites had a Cd content in cacao beans above the critical level. • Bean Cd concentration was closely correlated with available Cd in soil. • Soil Cd contamination is likely

  5. Concentration of cadmium in cacao beans and its relationship with soil cadmium in southern Ecuador

    Energy Technology Data Exchange (ETDEWEB)

    Chavez, E. [University of Florida, Institute of Food and Agricultural Science, Indian River Research and Education Center, Fort Pierce, FL 34945 (United States); Escuela Superior Politecnica del Litoral, Centro de Investigaciones Biotecnologicas del Ecuador, Guayaquil, Guayas (Ecuador); He, Z.L., E-mail: zhe@ufl.edu [University of Florida, Institute of Food and Agricultural Science, Indian River Research and Education Center, Fort Pierce, FL 34945 (United States); Stoffella, P.J. [University of Florida, Institute of Food and Agricultural Science, Indian River Research and Education Center, Fort Pierce, FL 34945 (United States); Mylavarapu, R.S. [University of Florida, Institute of Food and Agricultural Science, Soil and Water Science Department, Gainesville, FL 33611 (United States); Li, Y.C. [University of Florida, Institute of Food and Agricultural Science, Tropical Research and Education Center, Homestead, FL 33031 (United States); Moyano, B. [Escuela Superior Politecnica del Litoral, Centro de Investigaciones Biotecnologicas del Ecuador, Guayaquil, Guayas (Ecuador); Baligar, V.C. [United State Department of Agriculture, ARS, Beltsville, MD 20705 (United States)

    2015-11-15

    Cadmium (Cd) content in cacao beans above a critical level (0.6 mg kg{sup −1}) has raised concerns in the consumption of cacao-based chocolate. Little is available regarding Cd concentration in soil and cacao in Ecuador. The aim of this study was to determine the status of Cd in both, soils and cacao plants, in southern Ecuador. Soil samples were collected from 19 farms at 0–5, 5–15, 15–30, and 30–50 cm depths, whereas plant samples were taken from four nearby trees. Total recoverable and extractable Cd were measured at the different soil depths. Total recoverable Cd ranged from 0.88 to 2.45 and 0.06 to 2.59, averaged 1.54 and 0.85 mg kg{sup −1}, respectively in the surface and subsurface soils whereas the corresponding values for M3-extractable Cd were 0.08 to 1.27 and 0.02 to 0.33 with mean values of 0.40 and 0.10 mg kg{sup −1}. Surface soil in all sampling sites had total recoverable Cd above the USEPA critical level for agricultural soils (0.43 mg kg{sup −1}), indicating that Cd pollution occurs. Since both total recoverable and M3-extractable Cd significantly decreased depth wise, anthropogenic activities are more likely the source of contamination. Cadmium in cacao tissues decreased in the order of beans > shell > > leaves. Cadmium content in cacao beans ranged from 0.02 to 3.00, averaged 0.94 mg kg{sup −1}, and 12 out of 19 sites had bean Cd content above the critical level. Bean Cd concentration was highly correlated with M3- or HCl-extractable Cd at both the 0–5 and 5–15 cm depths (r = 0.80 and 0.82 for M3, and r = 0.78 and 0.82 for HCl; P < 0.01). These results indicate that accumulation of Cd in surface layers results in excessive Cd in cacao beans and M3- or HCl-extractable Cd are suitable methods for predicting available Cd in the studied soils. - Highlights: • > 60% of the studied sites had a Cd content in cacao beans above the critical level. • Bean Cd concentration was closely correlated with available Cd in soil. • Soil

  6. Cadmium potentiates toxicity of cypermethrin in zebrafish.

    Science.gov (United States)

    Yang, Ye; Ye, Xiaoqing; He, Buyuan; Liu, Jing

    2016-02-01

    Co-occurrence of pesticides such as synthetic pyrethroids and metals in aquatic ecosystems raises concerns over their combined ecological effects. Cypermethrin, 1 of the top 5 synthetic pyrethroids in use, has been extensively detected in surface water. Cadmium (Cd) has been recognized as 1 of the most toxic metals and is a common contaminant in the aquatic system. However, little information is available regarding their joint toxicity. In the present study, combined toxicity of cypermethrin and Cd and the underlying mechanisms were investigated. Zebrafish embryos and adults were exposed to the individual contaminant or binary mixtures. Co-exposure to cypermethrin and Cd produced synergistic effects on the occurrence of crooked body, pericardial edema, and noninflation of swim bladder. The addition of Cd significantly potentiated cypermethrin-induced spasms and caused more oxidative stress in zebrafish larvae. Cypermethrin-mediated induction of transcription levels and catalytic activities of cytochrome P450 (CYP) enzyme were significantly down-regulated by Cd in both zebrafish larvae and adults. Chemical analytical data showed that in vitro elimination of cypermethrin by CYP1A1 was inhibited by Cd. The addition of Cd caused an elevation of in vivo cypermethrin residue levels in the mixture-exposed adult zebrafish. These results suggest that the enhanced toxicity of cypermethrin in the presence of Cd results from the inhibitory effects of Cd on CYP-mediated biotransformation of this pesticide. The authors' findings provide a deeper understanding of the mechanistic basis accounting for the joint toxicity of cypermethrin and Cd. PMID:26267556

  7. Potentiation of cadmium nephrotoxicity by acetaminophen

    Energy Technology Data Exchange (ETDEWEB)

    Bernard, A.M.; Russis, R. de; Ouled Amor, A.; Lauwerys, R.R.

    1988-10-01

    The possible interactions between acetaminophen and cadmium (Cd) on the kidney were investigated in female Sprague-Dawley rats. Acetaminophen was administered in the food at an average dose of 900 mg/kg and Cd in drinking water at the concentration of 200 ppm. The treatment with acetaminophen and Cd lasted 2 and 10 months, respectively. No interaction between Cd and acetaminophen was observed during the period of their concomitant administration: the increase in albuminuria caused by Cd and acetaminophen was additive, while the tubular impairment caused by acetaminophen (increased ..beta../sub 2/-microglobulinuria and decreased kidney concentrating ability) was not exacerbated by Cd. None of these treatments affected the glomerular filtration rate. Four months after the end of acetaminophen treatment, the renal changes had almost completely disappeared in the rats which had received the analgesic alone. Those continously exposed to Cd had developed slight tubular damage, as evidenced by an increased urinary excretion of ..beta../sub 2/-microglobulin and ..beta..-N-acetylglucosaminidase. By contrast, rats pretreated with acetaminophen for 2 months and exposed to Cd showed a marked increase in urinary excretion of albumin and ..beta../sub 2/-microglobulin, suggesting an interaction between both treatments. At the end of the study, only the interaction with ..beta../sub 2/-microglobulin excretion was still evident; that with the urinary excretion of ..beta..-N-acetylglucosaminidase and albumin having been masked by the chronic progessive nephrosis affecting most animals at that stage. As acetaminophen had no effect on the renal accumulation of Cd, it may be concluded that pretreatment with this analygesic at a dose causing slight tubular dysfunction renders rat kidney more sensitive to the nephrotoxic action of Cd. This observation may be of clinical relevance for population groups occupationally or environmentally exposed to Cd.

  8. Thin-film cadmium telluride photovoltaics: ES and H issues, solutions, and perspectives

    International Nuclear Information System (INIS)

    Photovoltaics (PV) is a growing business worldwide, with new technologies evolving towards potentially large-volume production. PV use produces no emissions, thus offsetting many potential environmental problems. However, the new PV technologies also bring unfamiliar environment, safety, and health (ES and H) challenges that require innovative solutions. This is a summary of the issues, solutions, and perspectives associated with the use of cadmium in one of the new and important PV technologies: thin-film, cadmium telluride (CdTe) PV, which is being developed and commercialized by several companies including Solar Cells Inc. (Toledo, Ohio), BP Solar (Fairfield, California), and Matsushita (Japan). The principal ES and H issue for thin-film cadmium telluride PV is the potential introduction of cadmium--a toxic heavy metal--into the air or water. The amount of cadmium in thin-film PV, however, is quite small--one nickel cadmium flashlight battery has about as much cadmium (7 g) as a square meter of PV module using current technology--and a typical cordless power tool will have 5--10 batteries. CdTe modules are also very well sealed, limiting the chance of release. Nonetheless, minimizing the amount of cadmium in cadmium telluride modules and preventing the introduction of that cadmium into the environment is a top priority for National Renewable Energy Laboratory researchers and cadmium telluride PV manufacturers

  9. Reduced cadmium-induced cytotoxicity in cultured liver cells following 5-azacytidine pretreatment

    Energy Technology Data Exchange (ETDEWEB)

    Waalkes, M.P.; Wilson, M.J.; Poirier, L.A.

    1985-11-01

    Recent work indicated that administration of the pyrimidine analog 5-azacytidine (AZA), either to cells in culture or to rats, results in an enhancement of expression of the metallothionein (MT) gene. Since MT is thought to play a central role in the detoxification of cadmium, the present study was designed to assess the effect of AZA pretreatment on cadmium cytotoxicity. Cultured rat liver cells in log phase of growth were first exposed to AZA (8 microM). Forty-eight hours later, cadmium was added. A modest increase in MT amounts over control was detected after AZA treatment alone. Cadmium alone resulted in a 10-fold increase in MT concentrations. The combination of AZA pretreatment followed by cadmium exposure caused a 23-fold increase in MT concentrations over control. Treatment with the DNA synthesis inhibitor hydroxyurea (HU) eliminated the enhancing effect of AZA pretreatment on cadmium induction of MT, indicating that cell division is required. AZA-pretreated cells were also harvested and incubated in suspension with cadmium for 0 to 90 min. AZA-pretreated cells showed marked reductions in cadmium-induced cytotoxicity as reflected by reduced intracellular potassium loss, glutamic-oxaloacetic transaminase loss, and lipid peroxidation following cadmium exposure. Results suggest that AZA pretreatment induces tolerance to cadmium cytotoxicity which appears to be due to an increased capacity to synthesize MT rather than high quantities of preexisting MT at the time of cadmium exposure.

  10. Reduced cadmium-induced cytotoxicity in cultured liver cells following 5-azacytidine pretreatment

    International Nuclear Information System (INIS)

    Recent work indicated that administration of the pyrimidine analog 5-azacytidine (AZA), either to cells in culture or to rats, results in an enhancement of expression of the metallothionein (MT) gene. Since MT is thought to play a central role in the detoxification of cadmium, the present study was designed to assess the effect of AZA pretreatment on cadmium cytotoxicity. Cultured rat liver cells in log phase of growth were first exposed to AZA (8 microM). Forty-eight hours later, cadmium was added. A modest increase in MT amounts over control was detected after AZA treatment alone. Cadmium alone resulted in a 10-fold increase in MT concentrations. The combination of AZA pretreatment followed by cadmium exposure caused a 23-fold increase in MT concentrations over control. Treatment with the DNA synthesis inhibitor hydroxyurea (HU) eliminated the enhancing effect of AZA pretreatment on cadmium induction of MT, indicating that cell division is required. AZA-pretreated cells were also harvested and incubated in suspension with cadmium for 0 to 90 min. AZA-pretreated cells showed marked reductions in cadmium-induced cytotoxicity as reflected by reduced intracellular potassium loss, glutamic-oxaloacetic transaminase loss, and lipid peroxidation following cadmium exposure. Results suggest that AZA pretreatment induces tolerance to cadmium cytotoxicity which appears to be due to an increased capacity to synthesize MT rather than high quantities of preexisting MT at the time of cadmium exposure

  11. A Study on the Fabrication of Uranium-Cadmium Alloy and its Distillation Behavior

    International Nuclear Information System (INIS)

    The pyrometallurgical nuclear fuel recycle process, called pyroprocessing, has been known as a promising nuclear fuel recycling technology. Pyroprocessing technology is crucial to advanced nuclear systems due to increased nuclear proliferation resistance and economic efficiency. The basic concept of pyroprocessing is group actinide recovery, which enhances the nuclear proliferation resistance significantly. One of the key steps in pyroprocessing is 'electrowinning' which recovers group actinides with lanthanide from the spent nuclear fuels. In this study, a vertical cadmium distiller was manufactured. The evaporation rate of pure cadmium in vertical cadmium distiller varied from 12.3 to 40.8 g/cm2/h within a temperature range of 773 ∼ 923 K and pressure below 0.01 torr. Uranium - cadmium alloy was fabricated by electrolysis using liquid cadmium cathode in a high purity argon atmosphere glove box. The distillation behavior of pure cadmium and cadmium in uranium - cadmium alloy was investigated. The distillation behavior of cadmium from this study could be used to develop an actinide recovery process from a liquid cadmium cathode in a cadmium distiller

  12. [Physiological response and bioaccumulation of Panax notoginseng to cadmium under hydroponic].

    Science.gov (United States)

    Li, Zi-wei; Yang, Ye; Cui, Xiu-ming; Liao, Pei-ran; Ge, Jin; Wang, Cheng-xiao; Yang, Xiao-yan; Liu, Da-hui

    2015-08-01

    The physiological response and bioaccumulation of 2-year-old Panax notoginseng to cadmium stress was investigated under a hydroponic experiment with different cadmium concentrations (0, 2.5, 5, 10 μmol · L(-1)). Result showed that low concentration (2.5 μmol · L(-1)) of cadmium could stimulate the activities of SOD, POD, APX in P. notoginseng, while high concentration (10 μmol · L(-1)) treatment made activities of antioxidant enzyme descended obviously. But, no matter how high the concentration of cadmium was, the activities of CAT were inhibited. The Pn, Tr, Gs in P. notoginseng decreased gradually with the increase of cadmium concentration, however Ci showed a trend from rise to decline. The enrichment coefficients of different parts in P. notoginseng ranked in the order of hair root > root > rhizome > leaf > stem, and all enrichment coefficients decreased with the increase of concentration of cadmium treatments; while the cadmium content in different parts of P. notoginseng and the transport coefficients rose. To sum up, cadmium could affect antioxidant enzyme system and photosynthetic system of P. notoginseng; P. notoginseng had the ability of cadmium enrichment, so we should plant it in suitable place reduce for reducing the absorption of cadmium; and choose medicinal parts properly to lessen cadmium intake. PMID:26677685

  13. Alleviation of adverse impact of cadmium stress in sunflower (helianthus annuus l.) by arbuscular mycorrhizal fungi

    International Nuclear Information System (INIS)

    Sunflower (Helianthus annuus L.) is an important ornamental plant and good source of vegetable oil, widely accepted as potential promising plant for phytoremediation. A pot experiment was conducted to evaluate the impact of cadmium on the growth and some biochemical attributes of sunflower and role of arbuscular mycorrhizal fungi (AMF) in assuaging the cadmium stress induced changes. Cadmium treatment reduced growth, chlorophyll contents and cell membrane stability. AMF inoculated plants showed increased growth, chlorophyll contents and cell membrane stability and also mitigated changes caused due to cadmium. Cadmium caused increase in lipid peroxidation, and hydrogen peroxide production. An increase in antioxidant enzyme activity was observed due to cadmium treatment which was further enhanced by inoculation of AMF. Increase in proline and total phenols due to cadmium stress was obvious. Cadmium stressed plants showed enhanced fatty acid content. AMF inoculated plants showed higher activities of acid and alkaline phosphatases which were reduced by cadmium stress. However palmitoleic acid (C16:1), oleic (C18:1), linoleic (C18:2) and linolenic acid (C18:3) reduced in cadmium treated plants and the negative impact of cadmium was mitigated by AMF. (author)

  14. Dissolution ad uptake of cadmium from dental gold solder alloy implants

    International Nuclear Information System (INIS)

    Pure metallic cadmium was irradiated by means of thermal neutrons. The irradiated cadmium (115Cd) was placed in bags of gold foil and the bags were implanted subcutaneously in the neck region of mice. Two and 3 d respectively after implantation the mice were killed, the bags removed and the animals subjected to whole-body autoradiography. The autoradiograms revealed an uptake of 115Cd in liver and kidney. In another experiment specimens of a cadmium-containing dental gold solder alloy, a cadmium-free dental casting gold alloy and soldered assemblies made of these two alloys were implanted subcutaneously in the neck region of mice. The animals were killed after 6 months; cadmium analysis showed significant increases in the cadmium concentration in liver and kidney of those mice which had been given implants of gold solder alloy. The study clearly shows that due to electrochemical corrosion cadmium can be released from implants and accumulated in the kidneys and the liver. (author)

  15. Ecological toxicity of reactive X-3B red dye and cadmium acting on wheat (Triticum aestivum)

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Ecological toxicity of reactive X-3B red dye and cadmium in both their single form and their combined form on wheat was studied using the experimental method of seed and root exposure. The single-factor exposure indicated that the inhibitory rate of wheat root elongation was significantly increased with the increase in the concentration of the dye in the cultural solution, although seed germination of wheat was not sensitive to the dye. The toxicity of cadmium was greatly higher than that of the dye, but low concentration cadmium (< 40 mg/L) could promote the germination of wheat seed. Interactive effects of the dye and cadmium on wheat were complicated. There was no significant correlation between the inhibitory rate of seed germination and the concentrations of the dye and cadmium. Low concentration cadmium could strengthen the toxicity of the dye acting on root elongation. On the contrary, high concentration cadmium could weaken the toxicity of the dye acting on root elongation.

  16. Cadmium causes delayed effects on renal function in the offspring of cadmium-contaminated pregnant female rats.

    Science.gov (United States)

    Jacquillet, G; Barbier, O; Rubera, I; Tauc, M; Borderie, A; Namorado, M C; Martin, D; Sierra, G; Reyes, J L; Poujeol, P; Cougnon, M

    2007-11-01

    In the adult rat, chronic cadmium intoxication induces nephropathy with Fanconi-like features. This result raises the question of whether intoxication of pregnant rats has any deleterious effects on renal function in their offspring. To test this hypothesis, we measured the renal function of 2- to 60-day-old postnatal offspring from female rats administered cadmium chloride by the oral route (0.5 mg.kg(-1).day(-1)) throughout their entire gestation. Investigations of rat offspring from contaminated pregnant rats showed the presence of cadmium in the kidney at gestational day 20. After birth, the cadmium kidney concentration increased from postnatal day 2 to day 60 (PND2 to PND60), presumably because of 1) milk contamination and 2) neonatal liver cadmium content release. Although the renal parameters (glomerular filtration, U/P inulin, and urinary excretion rate) were not significantly affected until PND45, renal failure appeared at PND60, as demonstrated by a dramatic decrease of the glomerular filtration rate associated with increased excretion of the main ions. In parallel, an immunofluorescence study of tight-junction protein expression of PND60 offspring from contaminated rats showed a disorganization of the tight-junction proteins claudin-2 and claudin-5, specifically expressed in the proximal tubule and glomerulus, respectively. In contrast, expression of a distal claudin protein, claudin-3, was not affected. In conclusion, in utero exposure of cadmium leads to toxic renal effects in adult offspring. These results suggest that contamination of pregnant rats is a serious and critical hazard for renal function of their offspring. PMID:17686954

  17. 27 CFR 22.105 - Hospitals, blood banks, and sanitariums.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Hospitals, blood banks... Tax-Free Alcohol § 22.105 Hospitals, blood banks, and sanitariums. (a) Tax-free alcohol withdrawn for use by hospitals, blood banks, and sanitariums shall be used exclusively for medicinal,...

  18. Notice of construction for the 105 KE encapsulation activity

    International Nuclear Information System (INIS)

    This is a Notice of Construction for the 105-KE Basin Fuel Encapsulation Activity. This Notice of Construction is being submitted to the State of Washington Department of Health pursuant to the Washington Administrative Code, 246-247, ''Radiation Protection--Air Emissions,'' as amended. The encapsulation activity will consist of all of the activities described in Section 1.3 as necessary to complete encapsulation of the fuel elements and sludge contained in the 105-KE Basin. The encapsulation activity will be carried out on the 105-KE Basin floor under a minimum of 3 m (10 ft) of water. The encapsulation activity.includes emptying irradiated fuel elements from the existing canisters stored in the 105-KE Basin, packaging.these fuel elements in new canisters, packaging sludge from previous fuel inventories and the current inventory in new canisters, capping these canisters of fuel elements and sludge, and returning the new canisters to the storage racks in the basin. The empty canisters will be cleaned and crushed underwater. Packaging and disposal of the crushed canisters will take place above the water

  19. 41 CFR 105-57.010 - Financial hardship.

    Science.gov (United States)

    2010-07-01

    ... Regulations System (Continued) GENERAL SERVICES ADMINISTRATION Regional Offices-General Services Administration 57-ADMINISTRATION WAGE GARNISHMENT § 105-57.010 Financial hardship. (a) A debtor whose wages are... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Financial hardship....

  20. 41 CFR 105-55.009 - Aggressive agency collection activity.

    Science.gov (United States)

    2010-07-01

    ... to collect the debt or terminate collection action. See 31 CFR 285.12 (Transfer of Debts to Treasury... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Aggressive agency... Administration 55-COLLECTION OF CLAIMS OWED THE UNITED STATES § 105-55.009 Aggressive agency collection...

  1. 48 CFR 49.105-3 - Termination case file.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Termination case file. 49... MANAGEMENT TERMINATION OF CONTRACTS General Principles 49.105-3 Termination case file. The TCO responsible for negotiating the final settlement shall establish a separate case file for each termination....

  2. 41 CFR 105-72.505 - Cost and price analysis.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Cost and price analysis... EDUCATION, HOSPITALS, AND OTHER NON-PROFIT ORGANIZATIONS 72.50-Post-Award Requirements/Procurement Standards § 105-72.505 Cost and price analysis. Some form of cost or price analysis shall be made and...

  3. Simultaneous integral/rxte observations of grs 1915+105

    Directory of Open Access Journals (Sweden)

    j. Rodriguez

    2004-01-01

    Full Text Available Presentamos los primeros resultados de observaciones INTEGRAL y RXTE simult aneas del microcuasar GRS 1915+105. Nos enfocamos en el an alisis de la unica observaci on altamente variable, mostrando que pudimos haber observado una nueva clase de variabilidad. Luego estudiamos la dependencia energ etica de una QPO con base en nuestras observaciones regulares.

  4. 28 CFR 35.105 - Self-evaluation.

    Science.gov (United States)

    2010-07-01

    ... of any such services, policies, and practices is required, the public entity shall proceed to make... Judicial Administration DEPARTMENT OF JUSTICE NONDISCRIMINATION ON THE BASIS OF DISABILITY IN STATE AND LOCAL GOVERNMENT SERVICES General § 35.105 Self-evaluation. (a) A public entity shall, within one...

  5. 41 CFR 105-56.029 - Offset amount.

    Science.gov (United States)

    2010-07-01

    ... Administration 56-SALARY OFFSET FOR INDEBTEDNESS OF FEDERAL EMPLOYEES TO THE UNITED STATES Centralized Salary Offset (CSO) Procedures-GSA as Paying Agency § 105-56.029 Offset amount. (a) The minimum dollar amount of salary offset under this subpart is $100. (b) The amount offset from a salary payment under this...

  6. 41 CFR 105-56.019 - Offset amount.

    Science.gov (United States)

    2010-07-01

    ... Administration 56-SALARY OFFSET FOR INDEBTEDNESS OF FEDERAL EMPLOYEES TO THE UNITED STATES Centralized Salary Offset (CSO) Procedures-GSA as Creditor Agency § 105-56.019 Offset amount. (a) The minimum dollar amount referred for offset under this subpart is $100. (b) The amount offset from a salary payment under...

  7. 7 CFR 28.105 - Practical forms of cotton standards.

    Science.gov (United States)

    2010-01-01

    ... hours of 9 a.m. and 4 p.m., by the Administrator or by an officer or agent of the Department authorized....105 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE COMMODITY STANDARDS AND STANDARD...

  8. 33 CFR 105.415 - Amendment and audit.

    Science.gov (United States)

    2010-07-01

    ... SECURITY MARITIME SECURITY: FACILITIES Facility Security Plan (FSP) § 105.415 Amendment and audit. (a... security measures being audited. (5) If the results of an audit require amendment of either the FSA or FSP... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Amendment and audit....

  9. 41 CFR 105-50.202-3 - Training.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Training. 105-50.202-3....202-3 Training. (a) This training consists of the type which GSA is authorized by law to conduct for Federal personnel and others or which is similar to such training. (b) Descriptions of the...

  10. 24 CFR 886.105 - Content of application; Disclosure.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 4 2010-04-01 2010-04-01 false Content of application; Disclosure... Additional Assistance Program for Projects With HUD-Insured and HUD-Held Mortgages § 886.105 Content of... Housing Marketing Plan on a HUD-prescribed form. To be eligible to become an owner of housing...

  11. Acute Flaccid Paralysis Associated with Novel Enterovirus C105

    OpenAIRE

    Horner, Liana M.; Poulter, Melinda D.; Brenton, J. Nicholas; Turner, Ronald B.

    2015-01-01

    An outbreak of acute flaccid paralysis among children in the United States during summer 2014 was tentatively associated with enterovirus D68 infection. This syndrome in a child in fall 2014 was associated with enterovirus C105 infection. The presence of this virus strain in North America may pose a diagnostic challenge.

  12. 40 CFR 280.105 - Local government financial test.

    Science.gov (United States)

    2010-07-01

    ... intergovernmental transfers (dollars)______ c. Local Revenues (dollars)______ 4. Debt Service a. Interest and fiscal... identical to the wording specified in 40 CFR part 280.105(c) as such regulations were constituted on the... services, investment earnings, sales (property, publications, etc.), intergovernmental revenues...

  13. 41 CFR 105-53.143 - Information Resources Management Service.

    Science.gov (United States)

    2010-07-01

    ... chapter 201, Federal Information Resources Management Regulation (FIRMR), and 48 CFR chapters 1 and 5... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Information Resources... FUNCTIONS Central Offices § 105-53.143 Information Resources Management Service. (a) Creation and...

  14. 2 CFR 1.105 - Organization and subtitle content.

    Science.gov (United States)

    2010-01-01

    ... Introduction to Title 2 of the CFR § 1.105 Organization and subtitle content. (a) This title is organized into... the OMB guidance in the CFR does not change its nature—it is guidance and not regulation. (c) Each... 2 Grants and Agreements 1 2010-01-01 2010-01-01 false Organization and subtitle content....

  15. 50 CFR 14.105 - Consignment to carrier.

    Science.gov (United States)

    2010-10-01

    ... Wild Mammals and Birds to the United States § 14.105 Consignment to carrier. (a) No carrier shall accept any live wild mammal or bird for transport to the United States that has not been examined within... attendant. (c) A sick or injured wild mammal or bird shall be permitted transport to the United States...

  16. 48 CFR 32.105 - Uses of contract financing.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Uses of contract financing... CONTRACTING REQUIREMENTS CONTRACT FINANCING Non-Commercial Item Purchase Financing 32.105 Uses of contract financing. (a) Contract financing methods covered in this part are intended to be self-liquidating...

  17. 105 GHz Notch Filter Design for Collective Thomson Scattering

    DEFF Research Database (Denmark)

    Furtula, Vedran; Michelsen, Poul; Leipold, Frank; Johansen, T.; Korsholm, Søren Bang; Meo, Fernando; Moseev, Dmitry; Nielsen, Stefan Kragh; Salewski, Mirko; Stejner Pedersen, Morten

    2011-01-01

    A millimeter-wave notch filter with 105-GHz center frequency, >20-GHz passband coverage, and 1-GHz rejection bandwidth has been constructed. The design is based on a fundamental rectangular waveguide with cylindrical cavities coupled by narrow iris gaps, i.e., small elongated holes of negligible...

  18. 33 CFR 183.105 - Quantity of flotation required.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Quantity of flotation required... (CONTINUED) BOATING SAFETY BOATS AND ASSOCIATED EQUIPMENT Flotation Requirements for Inboard Boats, Inboard/Outdrive Boats, and Airboats § 183.105 Quantity of flotation required. (a) Each boat must have...

  19. 41 CFR 105-53.133 - Information Security Oversight Office.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Information Security... FUNCTIONS Central Offices § 105-53.133 Information Security Oversight Office. (a) Creation and authority. The Information Security Oversight Office (ISOO), headed by the Director of ISOO, who is appointed...

  20. 5 CFR 2635.105 - Supplemental agency regulations.

    Science.gov (United States)

    2010-01-01

    ... ETHICAL CONDUCT FOR EMPLOYEES OF THE EXECUTIVE BRANCH General Provisions § 2635.105 Supplemental agency... included in the agency's standards of conduct regulations issued pursuant to Executive Order 11222 and the... agency in title 5 of the Code of Federal Regulations. Supplemental agency regulations issued under...