WorldWideScience

Sample records for cacta-like transposable element

  1. Chromosome rearrangements and transposable elements.

    Science.gov (United States)

    Lonnig, Wolf-Ekkehard; Saedler, Heinz

    2002-01-01

    There has been limited corroboration to date for McClintock's vision of gene regulation by transposable elements (TEs), although her proposition on the origin of species by TE-induced complex chromosome reorganizations in combination with gene mutations, i.e., the involvement of both factors in relatively sudden formations of species in many plant and animal genera, has been more promising. Moreover, resolution is in sight for several seemingly contradictory phenomena such as the endless reshuffling of chromosome structures and gene sequences versus synteny and the constancy of living fossils (or stasis in general). Recent wide-ranging investigations have confirmed and enlarged the number of earlier cases of TE target site selection (hot spots for TE integration), implying preestablished rather than accidental chromosome rearrangements for nonhomologous recombination of host DNA. The possibility of a partly predetermined generation of biodiversity and new species is discussed. The views of several leading transposon experts on the rather abrupt origin of new species have not been synthesized into the macroevolutionary theory of the punctuated equilibrium school of paleontology inferred from thoroughly consistent features of the fossil record. PMID:12429698

  2. Transposable Elements: No More 'Junk DNA'

    OpenAIRE

    Kim, Yun-Ji; Lee, Jungnam; Han, Kyudong

    2012-01-01

    Since the advent of whole-genome sequencing, transposable elements (TEs), just thought to be 'junk' DNA, have been noticed because of their numerous copies in various eukaryotic genomes. Many studies about TEs have been conducted to discover their functions in their host genomes. Based on the results of those studies, it has been generally accepted that they have a function to cause genomic and genetic variations. However, their infinite functions are not fully elucidated. Through various mec...

  3. PASTEC: an automatic transposable element classification tool.

    Directory of Open Access Journals (Sweden)

    Claire Hoede

    Full Text Available SUMMARY: The classification of transposable elements (TEs is key step towards deciphering their potential impact on the genome. However, this process is often based on manual sequence inspection by TE experts. With the wealth of genomic sequences now available, this task requires automation, making it accessible to most scientists. We propose a new tool, PASTEC, which classifies TEs by searching for structural features and similarities. This tool outperforms currently available software for TE classification. The main innovation of PASTEC is the search for HMM profiles, which is useful for inferring the classification of unknown TE on the basis of conserved functional domains of the proteins. In addition, PASTEC is the only tool providing an exhaustive spectrum of possible classifications to the order level of the Wicker hierarchical TE classification system. It can also automatically classify other repeated elements, such as SSR (Simple Sequence Repeats, rDNA or potential repeated host genes. Finally, the output of this new tool is designed to facilitate manual curation by providing to biologists with all the evidence accumulated for each TE consensus. AVAILABILITY: PASTEC is available as a REPET module or standalone software (http://urgi.versailles.inra.fr/download/repet/REPET_linux-x64-2.2.tar.gz. It requires a Unix-like system. There are two standalone versions: one of which is parallelized (requiring Sun grid Engine or Torque, and the other of which is not.

  4. Transposable elements: powerful facilitators of evolution.

    Science.gov (United States)

    Oliver, Keith R; Greene, Wayne K

    2009-07-01

    Transposable elements (TEs) are powerful facilitators of genome evolution, and hence of phenotypic diversity as they can cause genetic changes of great magnitude and variety. TEs are ubiquitous and extremely ancient, and although harmful to some individuals, they can be very beneficial to lineages. TEs can build, sculpt, and reformat genomes by both active and passive means. Lineages with active TEs or with abundant homogeneous inactive populations of TEs that can act passively by causing ectopic recombination are potentially fecund, adaptable, and taxonate readily. Conversely, taxa deficient in TEs or possessing heterogeneous populations of inactive TEs may be well adapted in their niche, but tend to prolonged stasis and may risk extinction by lacking the capacity to adapt to change, or diversify. Because of recurring intermittent waves of TE infestation, available data indicate a compatibility with punctuated equilibrium, in keeping with widely accepted interpretations of evidence from the fossil record. We propose a general and holistic synthesis on how the presence of TEs within genomes makes them flexible and dynamic, so that genomes themselves are powerful facilitators of their own evolution. PMID:19415638

  5. Transposable elements and G-quadruplexes.

    Science.gov (United States)

    Kejnovsky, Eduard; Tokan, Viktor; Lexa, Matej

    2015-09-01

    A significant part of eukaryotic genomes is formed by transposable elements (TEs) containing not only genes but also regulatory sequences. Some of the regulatory sequences located within TEs can form secondary structures like hairpins or three-stranded (triplex DNA) and four-stranded (quadruplex DNA) conformations. This review focuses on recent evidence showing that G-quadruplex-forming sequences in particular are often present in specific parts of TEs in plants and humans. We discuss the potential role of these structures in the TE life cycle as well as the impact of G-quadruplexes on replication, transcription, translation, chromatin status, and recombination. The aim of this review is to emphasize that TEs may serve as vehicles for the genomic spread of G-quadruplexes. These non-canonical DNA structures and their conformational switches may constitute another regulatory system that, together with small and long non-coding RNA molecules and proteins, contribute to the complex cellular network resulting in the large diversity of eukaryotes. PMID:26403244

  6. Transposable element origins of epigenetic gene regulation.

    Science.gov (United States)

    Lisch, Damon; Bennetzen, Jeffrey L

    2011-04-01

    Transposable elements (TEs) are massively abundant and unstable in all plant genomes, but are mostly silent because of epigenetic suppression. Because all known epigenetic pathways act on all TEs, it is likely that the specialized epigenetic regulation of regular host genes (RHGs) was co-opted from this ubiquitous need for the silencing of TEs and viruses. With their internally repetitive and rearranging structures, and the acquisition of fragments of RHGs, the expression of TEs commonly makes antisense RNAs for both TE genes and RHGs. These antisense RNAs, particularly from heterochromatic reservoirs of 'zombie' TEs that are rearranged to form variously internally repetitive structures, may be advantageous because their induction will help rapidly suppress active TEs of the same family. RHG fragments within rapidly rearranging TEs may also provide the raw material for the ongoing generation of miRNA genes. TE gene expression is regulated by both environmental and developmental signals, and insertions can place nearby RHGs under the regulation (both standard and epigenetic) of the TE. The ubiquity of TEs, their frequent preferential association with RHGs, and their ability to be programmed by epigenetic signals all indicate that RGHs have nearly unlimited access to novel regulatory cassettes to assist plant adaptation. PMID:21444239

  7. Bursts of transposable elements as an evolutionary driving force

    Czech Academy of Sciences Publication Activity Database

    Belyayev, Alexander

    2014-01-01

    Roč. 27, č. 12 (2014), s. 2573-2584. ISSN 1010-061X Institutional support: RVO:67985939 Keywords : evolution * genome * marginal populations * speciation * transposable elements Subject RIV: EF - Botanics Impact factor: 3.232, year: 2014

  8. Characteristics of transposable element exonization within human and mouse.

    Directory of Open Access Journals (Sweden)

    Noa Sela

    Full Text Available Insertion of transposed elements within mammalian genes is thought to be an important contributor to mammalian evolution and speciation. Insertion of transposed elements into introns can lead to their activation as alternatively spliced cassette exons, an event called exonization. Elucidation of the evolutionary constraints that have shaped fixation of transposed elements within human and mouse protein coding genes and subsequent exonization is important for understanding of how the exonization process has affected transcriptome and proteome complexities. Here we show that exonization of transposed elements is biased towards the beginning of the coding sequence in both human and mouse genes. Analysis of single nucleotide polymorphisms (SNPs revealed that exonization of transposed elements can be population-specific, implying that exonizations may enhance divergence and lead to speciation. SNP density analysis revealed differences between Alu and other transposed elements. Finally, we identified cases of primate-specific Alu elements that depend on RNA editing for their exonization. These results shed light on TE fixation and the exonization process within human and mouse genes.

  9. BLAT-Based Comparative Analysis for Transposable Elements: BLATCAT

    OpenAIRE

    Sangbum Lee; Sumin Oh; Keunsoo Kang; Kyudong Han

    2014-01-01

    The availability of several whole genome sequences makes comparative analyses possible. In primate genomes, the priority of transposable elements (TEs) is significantly increased because they account for ~45% of the primate genomes, they can regulate the gene expression level, and they are associated with genomic fluidity in their host genomes. Here, we developed the BLAST-like alignment tool (BLAT) based comparative analysis for transposable elements (BLATCAT) program. The BLATCAT program ca...

  10. Transposable elements and genetic instabilities in crop plants

    Energy Technology Data Exchange (ETDEWEB)

    Burr, B.; Burr, F.

    1981-04-10

    Transposable elements have long been associated with certain unstable loci in maize and have been intensively studied by McClintock and others. It is known that a transposable element can control the expression of the structural genes at the locus where it resides. These controlling elements in maize are now beginning to be studied at the molecular level. Using recombinant molecular probes we have been able to describe the changes induced by the controlling element Ds at the shrunken locus. Ds elements appear to be large and dissimilar insertions into the wild-type locus - two elements actually map within the transcribed region of the gene. Genetic instabilities have been described in other economically important plants but the bases for these phenomena have not been understood. We believe that it is likely that some of these instabilities are the result of transposable element activity much as in the case of maize.

  11. Mobility of hobo transposable elements in non-drosophilid insects

    International Nuclear Information System (INIS)

    We will describe the development and implementation of assays which permit the mobility of hobo elements injected into developing insects embryos to be detected and examined. These assays have enabled us to classify hobo elements as members of a transposable element family which includes the Ac element of maize and the Tam3 element of snapdragon - two plant transposable elements that have wide host ranges. We will present data that show that hobo also has a wide host range in that it can excise and transpose in a number of non-drosophilid insect species. These results have led us to use hobo as a gene vector in the tephritid, Bactrocera tryoni, and we will discuss the progress of these ongoing experiments. (author)

  12. Transposable Element Targeting by piRNAs in Laurasiatherians with Distinct Transposable Element Histories.

    Science.gov (United States)

    Vandewege, Michael W; Platt, Roy N; Ray, David A; Hoffmann, Federico G

    2016-01-01

    PIWI proteins and PIWI-interacting RNAs (piRNAs) are part of a cellular pathway that has evolved to protect genomes against the proliferation of transposable elements (TEs). PIWIs and piRNAs assemble into complexes that are involved in epigenetic and post-transcriptional repression of TEs. Most of our understanding of the mechanisms of piRNA-mediated TE silencing comes from fruit fly and mouse models. However, even in these well-studied animals it is unclear how piRNA responses relate to variable TE expression and whether the strength of the piRNA response affects TE content over time. Here, we assessed the evolutionary interactions between TE and piRNAs in a statistical framework using three nonmodel laurasiatherian mammals as a study system: dog, horse, and a vesper bat. These three species diverged ∼80 million years ago and have distinct genomic TE contents. By comparing species with distinct TE landscapes, we aimed to identify clear relationships among TE content, expression, and piRNAs. We found that the TE subfamilies that are the most transcribed appear to elicit the strongest "ping-pong" response. This was most evident among long interspersed elements, but the relationships between expression and ping-pong pilRNA (piRNA-like) expression were more complex among SINEs. SINE transcripts were equally abundant in the dog and horse yet new SINE insertions were relatively rare in the horse genome, where we identified a stronger piRNA response. Our analyses suggest that the piRNA response can have a strong impact on the TE composition of a genome. However, our results also suggest that the presence of a robust piRNA response is apparently not sufficient to stop TE mobilization and accumulation. PMID:27060702

  13. Tc1-like transposable elements in plant genomes

    OpenAIRE

    Liu, Yuan; Yang, Guojun

    2014-01-01

    Background The Tc1/mariner superfamily of transposable elements (TEs) is widespread in animal genomes. Mariner-like elements, which bear a DDD triad catalytic motif, have been identified in a wide range of flowering plant species. However, as the founding member of the superfamily, Tc1-like elements that bear a DD34E triad catalytic motif are only known to unikonts (animals, fungi, and Entamoeba). Results Here we report the identification of Tc1-like elements (TLEs) in plant genomes. These el...

  14. P Transposable Elements in Drosophila and other Eukaryotic Organisms.

    Science.gov (United States)

    Majumdar, Sharmistha; Rio, Donald C

    2015-04-01

    P transposable elements were discovered in Drosophila as the causative agents of a syndrome of genetic traits called hybrid dysgenesis. Hybrid dysgenesis exhibits a unique pattern of maternal inheritance linked to the germline-specific small RNA piwi-interacting (piRNA) pathway. The use of P transposable elements as vectors for gene transfer and as genetic tools revolutionized the field of Drosophila molecular genetics. P element transposons have served as a useful model to investigate mechanisms of cut-and-paste transposition in eukaryotes. Biochemical studies have revealed new and unexpected insights into how eukaryotic DNA-based transposons are mobilized. For example, the P element transposase makes unusual 17nt-3' extended double-strand DNA breaks at the transposon termini and uses guanosine triphosphate (GTP) as a cofactor to promote synapsis of the two transposon ends early in the transposition pathway. The N-terminal DNA binding domain of the P element transposase, called a THAP domain, contains a C2CH zinc-coordinating motif and is the founding member of a large family of animal-specific site-specific DNA binding proteins. Over the past decade genome sequencing efforts have revealed the presence of P element-like transposable elements or P element transposase-like genes (called THAP9) in many eukaryotic genomes, including vertebrates, such as primates including humans, zebrafish and Xenopus, as well as the human parasite Trichomonas vaginalis, the sea squirt Ciona, sea urchin and hydra. Surprisingly, the human and zebrafish P element transposase-related THAP9 genes promote transposition of the Drosophila P element transposon DNA in human and Drosophila cells, indicating that the THAP9 genes encode active P element "transposase" proteins. PMID:26104714

  15. BLAT-Based Comparative Analysis for Transposable Elements: BLATCAT

    Directory of Open Access Journals (Sweden)

    Sangbum Lee

    2014-01-01

    Full Text Available The availability of several whole genome sequences makes comparative analyses possible. In primate genomes, the priority of transposable elements (TEs is significantly increased because they account for ~45% of the primate genomes, they can regulate the gene expression level, and they are associated with genomic fluidity in their host genomes. Here, we developed the BLAST-like alignment tool (BLAT based comparative analysis for transposable elements (BLATCAT program. The BLATCAT program can compare specific regions of six representative primate genome sequences (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque on the basis of BLAT and simultaneously carry out RepeatMasker and/or Censor functions, which are widely used Windows-based web-server functions to detect TEs. All results can be stored as a HTML file for manual inspection of a specific locus. BLATCAT will be very convenient and efficient for comparative analyses of TEs in various primate genomes.

  16. BLAT-based comparative analysis for transposable elements: BLATCAT.

    Science.gov (United States)

    Lee, Sangbum; Oh, Sumin; Kang, Keunsoo; Han, Kyudong

    2014-01-01

    The availability of several whole genome sequences makes comparative analyses possible. In primate genomes, the priority of transposable elements (TEs) is significantly increased because they account for ~45% of the primate genomes, they can regulate the gene expression level, and they are associated with genomic fluidity in their host genomes. Here, we developed the BLAST-like alignment tool (BLAT) based comparative analysis for transposable elements (BLATCAT) program. The BLATCAT program can compare specific regions of six representative primate genome sequences (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque) on the basis of BLAT and simultaneously carry out RepeatMasker and/or Censor functions, which are widely used Windows-based web-server functions to detect TEs. All results can be stored as a HTML file for manual inspection of a specific locus. BLATCAT will be very convenient and efficient for comparative analyses of TEs in various primate genomes. PMID:24959585

  17. Transposable element and genome evolution following hybridization in wild wheats

    OpenAIRE

    Senerchia, Natacha; Parisod, Christian; Kessler, Félix; Felber, François

    2014-01-01

    Genome dynamics is an essential process of eukaryote genome evolution. Hybridization and inter-species gene flow result in new interactions among divergent genomes and may reveal genetic incompatibilities having accumulated after the origin of species. Being highly mutagenic and repressed by various epigenetic mechanisms, transposable elements (TEs) are postulated to play a central role in fuelling genome reorganization following inter-genomic conflicts after hybridization. However, we are st...

  18. Generating and manipulating transgenic animals using transposable elements

    OpenAIRE

    Largaespada David A

    2003-01-01

    Abstract Transposable elements, or transposons, have played a significant role in the history of biological research. They have had a major influence on the structure of genomes during evolution, they can cause mutations, and their study led to the concept of so-called "selfish DNA". In addition, transposons have been manipulated as useful gene transfer vectors. While primarily restricted to use in invertebrates, prokaryotes, and plants, it is now clear that transposon technology and biology ...

  19. Isolation and characterization of a potential transposable element from Wolbachia

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Wolbachia are a group of Rickettsia-like bacteria which parasitize the cells of a wide range of anthropoid. These microorganisms are associated with the reproductive and developmental abnormalities io their hosts. To study the molecular mechanism underlying such phenomena, we analyzed the genomic difference between Wolbachia with different cytoplasmic incompatibility (CI) phenotype using representational difference analysis method. A potential transposable element, which exists in the strong CI-inducing strain wRi, was isolated. This element was designated as Wolbachia insertion sequence element (WISE).

  20. Cooperation is fleeting in the world of transposable elements.

    Directory of Open Access Journals (Sweden)

    Andreas Wagner

    2006-12-01

    Full Text Available Composite transposons are key vehicles for the worldwide spreading of genes that allow bacteria to survive toxic compounds. Composite transposons consist of two smaller transposable elements called insertion sequences (ISs, which flank the genes that permit such survival. Each IS in a composite transposon can either transpose alone, selfishly, or it can transpose cooperatively, jointly with the other IS. Cooperative transposition can enhance an IS's chance of survival, but it also carries the risk of transposon destruction. I use game theory to show that the conditions under which cooperative transposition is an evolutionarily stable strategy (ESS are not biologically realistic. I then analyze the distribution of thousands of ISs in more than 200 bacterial genomes to test the following prediction of the game-theoretical model: if cooperative transposition was an ESS, then the closely spaced ISs that characterize composite transposons should be more abundant in genomes than expected by chance. The data show that this is not the case. Cooperativity can only be maintained in a transitional, far-from-equilibrium state shortly after a selection pressure first arises. This is the case in the spreading of antibiotic resistance, where we are witnessing a fleeting moment in evolution, a moment in which cooperation among selfish DNA molecules has provided a means of survival. Because such cooperation does not pay in the long run, the vehicles of such survival will eventually disappear again. My analysis demonstrates that game theory can help explain behavioral strategies even for mobile DNA.

  1. Transcription of Dictyostelium discoideum transposable element DIRS-1.

    OpenAIRE

    Cohen, S M; Cappello, J; Lodish, H F

    1984-01-01

    DIRS-1 is a Dictyostelium discoideum transposable element that contains heat shock promoter sequences in the inverted terminal repeats. We showed that transcription of a 4.5-kilobase polyadenylated RNA initiates at a discrete site within the left-terminal repeat of DIRS-1, downstream from heat shock promoter and TATA box sequences. This RNA represents a full-length transcript of DIRS-1. We describe a cDNA clone that contains the 4.1 kilobases of internal sequence of DIRS-1, a cDNA clone that ...

  2. Sequence of retrovirus provirus resembles that of bacterial transposable elements

    Science.gov (United States)

    Shimotohno, Kunitada; Mizutani, Satoshi; Temin, Howard M.

    1980-06-01

    The nucleotide sequences of the terminal regions of an infectious integrated retrovirus cloned in the modified λ phage cloning vector Charon 4A have been elucidated. There is a 569-base pair direct repeat at both ends of the viral DNA. The cell-virus junctions at each end consist of a 5-base pair direct repeat of cell DNA next to a 3-base pair inverted repeat of viral DNA. This structure resembles that of a transposable element and is consistent with the protovirus hypothesis that retroviruses evolved from the cell genome.

  3. DPTEdb, an integrative database of transposable elements in dioecious plants

    Science.gov (United States)

    Li, Shu-Fen; Zhang, Guo-Jun; Zhang, Xue-Jin; Yuan, Jin-Hong; Deng, Chuan-Liang; Gu, Lian-Feng; Gao, Wu-Jun

    2016-01-01

    Dioecious plants usually harbor ‘young’ sex chromosomes, providing an opportunity to study the early stages of sex chromosome evolution. Transposable elements (TEs) are mobile DNA elements frequently found in plants and are suggested to play important roles in plant sex chromosome evolution. The genomes of several dioecious plants have been sequenced, offering an opportunity to annotate and mine the TE data. However, comprehensive and unified annotation of TEs in these dioecious plants is still lacking. In this study, we constructed a dioecious plant transposable element database (DPTEdb). DPTEdb is a specific, comprehensive and unified relational database and web interface. We used a combination of de novo, structure-based and homology-based approaches to identify TEs from the genome assemblies of previously published data, as well as our own. The database currently integrates eight dioecious plant species and a total of 31 340 TEs along with classification information. DPTEdb provides user-friendly web interfaces to browse, search and download the TE sequences in the database. Users can also use tools, including BLAST, GetORF, HMMER, Cut sequence and JBrowse, to analyze TE data. Given the role of TEs in plant sex chromosome evolution, the database will contribute to the investigation of TEs in structural, functional and evolutionary dynamics of the genome of dioecious plants. In addition, the database will supplement the research of sex diversification and sex chromosome evolution of dioecious plants. Database URL: http://genedenovoweb.ticp.net:81/DPTEdb/index.php PMID:27173524

  4. Evolutionary interaction between W/Y chromosome and transposable elements.

    Science.gov (United States)

    Śliwińska, Ewa B; Martyka, Rafał; Tryjanowski, Piotr

    2016-06-01

    The W/Y chromosome is unique among chromosomes as it does not recombine in its mature form. The main side effect of cessation of recombination is evolutionary instability and degeneration of the W/Y chromosome, or frequent W/Y chromosome turnovers. Another important feature of W/Y chromosome degeneration is transposable element (TEs) accumulation. Transposon accumulation has been confirmed for all W/Y chromosomes that have been sequenced so far. Models of W/Y chromosome instability include the assemblage of deleterious mutations in protein coding genes, but do not include the influence of transposable elements that are accumulated gradually in the non-recombining genome. The multiple roles of genomic TEs, and the interactions between retrotransposons and genome defense proteins are currently being studied intensively. Small RNAs originating from retrotransposon transcripts appear to be, in some cases, the only mediators of W/Y chromosome function. Based on the review of the most recent publications, we present knowledge on W/Y evolution in relation to retrotransposable element accumulation. PMID:27000053

  5. DPTEdb, an integrative database of transposable elements in dioecious plants.

    Science.gov (United States)

    Li, Shu-Fen; Zhang, Guo-Jun; Zhang, Xue-Jin; Yuan, Jin-Hong; Deng, Chuan-Liang; Gu, Lian-Feng; Gao, Wu-Jun

    2016-01-01

    Dioecious plants usually harbor 'young' sex chromosomes, providing an opportunity to study the early stages of sex chromosome evolution. Transposable elements (TEs) are mobile DNA elements frequently found in plants and are suggested to play important roles in plant sex chromosome evolution. The genomes of several dioecious plants have been sequenced, offering an opportunity to annotate and mine the TE data. However, comprehensive and unified annotation of TEs in these dioecious plants is still lacking. In this study, we constructed a dioecious plant transposable element database (DPTEdb). DPTEdb is a specific, comprehensive and unified relational database and web interface. We used a combination of de novo, structure-based and homology-based approaches to identify TEs from the genome assemblies of previously published data, as well as our own. The database currently integrates eight dioecious plant species and a total of 31 340 TEs along with classification information. DPTEdb provides user-friendly web interfaces to browse, search and download the TE sequences in the database. Users can also use tools, including BLAST, GetORF, HMMER, Cut sequence and JBrowse, to analyze TE data. Given the role of TEs in plant sex chromosome evolution, the database will contribute to the investigation of TEs in structural, functional and evolutionary dynamics of the genome of dioecious plants. In addition, the database will supplement the research of sex diversification and sex chromosome evolution of dioecious plants.Database URL: http://genedenovoweb.ticp.net:81/DPTEdb/index.php. PMID:27173524

  6. C-GATE - catalogue of genes affected by transposable elements

    Directory of Open Access Journals (Sweden)

    Rebollo Rita

    2012-05-01

    Full Text Available Abstract Background Functional regulatory sequences are present in many transposable element (TE copies, resulting in TEs being frequently exapted by host genes. Today, many examples of TEs impacting host gene expression can be found in the literature and we believe a new catalogue of such exaptations would be useful for the field. Findings We have established the catalogue of genes affected by transposable elements (C-GATE, which can be found at https://sites.google.com/site/tecatalog/. To date, it holds 221 cases of biologically verified TE exaptations and more than 10,000 in silico TE-gene partnerships. C-GATE is interactive and allows users to include missed or new TE exaptation data. C-GATE provides a graphic representation of the entire library, which may be used for future statistical analysis of TE impact on host gene expression. Conclusions We hope C-GATE will be valuable for the TE community but also for others who have realized the role that TEs may have in their research.

  7. Tc1-like transposable elements in plant genomes

    Science.gov (United States)

    2014-01-01

    Background The Tc1/mariner superfamily of transposable elements (TEs) is widespread in animal genomes. Mariner-like elements, which bear a DDD triad catalytic motif, have been identified in a wide range of flowering plant species. However, as the founding member of the superfamily, Tc1-like elements that bear a DD34E triad catalytic motif are only known to unikonts (animals, fungi, and Entamoeba). Results Here we report the identification of Tc1-like elements (TLEs) in plant genomes. These elements bear the four terminal nucleotides and the characteristic DD34E triad motif of Tc1 element. The two TLE families (PpTc1, PpTc2) identified in the moss (Physcomitrella patens) genome contain highly similar copies. Multiple copies of PpTc1 are actively transcribed and the transcripts encode intact full length transposase coding sequences. TLEs are also found in angiosperm genome sequence databases of rice (Oryza sativa), dwarf birch (Betula nana), cabbage (Brassica rapa), hemp (Cannabis sativa), barley (Hordium valgare), lettuce (Lactuta sativa), poplar (Populus trichocarpa), pear (Pyrus x bretschneideri), and wheat (Triticum urartu). Conclusions This study extends the occurrence of TLEs to the plant phylum. The elements in the moss genome have amplified recently and may still be capable of transposition. The TLEs are also present in angiosperm genomes, but apparently much less abundant than in moss. PMID:24926322

  8. The Intertwining of Transposable Elements and Non-Coding RNAs

    Directory of Open Access Journals (Sweden)

    Nicholas Delihas

    2013-06-01

    Full Text Available Growing evidence shows a close association of transposable elements (TE with non-coding RNAs (ncRNA, and a significant number of small ncRNAs originate from TEs. Further, ncRNAs linked with TE sequences participate in a wide-range of regulatory functions. Alu elements in particular are critical players in gene regulation and molecular pathways. Alu sequences embedded in both long non-coding RNAs (lncRNA and mRNAs form the basis of targeted mRNA decay via short imperfect base-pairing. Imperfect pairing is prominent in most ncRNA/target RNA interactions and found throughout all biological kingdoms. The piRNA-Piwi complex is multifunctional, but plays a major role in protection against invasion by transposons. This is an RNA-based genetic immune system similar to the one found in prokaryotes, the CRISPR system. Thousands of long intergenic non-coding RNAs (lincRNAs are associated with endogenous retrovirus LTR transposable elements in human cells. These TEs can provide regulatory signals for lincRNA genes. A surprisingly large number of long circular ncRNAs have been discovered in human fibroblasts. These serve as “sponges” for miRNAs. Alu sequences, encoded in introns that flank exons are proposed to participate in RNA circularization via Alu/Alu base-pairing. Diseases are increasingly found to have a TE/ncRNA etiology. A single point mutation in a SINE/Alu sequence in a human long non-coding RNA leads to brainstem atrophy and death. On the other hand, genomic clusters of repeat sequences as well as lncRNAs function in epigenetic regulation. Some clusters are unstable, which can lead to formation of diseases such as facioscapulohumeral muscular dystrophy. The future may hold more surprises regarding diseases associated with ncRNAs andTEs.

  9. Massive contribution of transposable elements to mammalian regulatory sequences.

    Science.gov (United States)

    Rayan, Nirmala Arul; Del Rosario, Ricardo C H; Prabhakar, Shyam

    2016-09-01

    Barbara McClintock discovered the existence of transposable elements (TEs) in the late 1940s and initially proposed that they contributed to the gene regulatory program of higher organisms. This controversial idea gained acceptance only much later in the 1990s, when the first examples of TE-derived promoter sequences were uncovered. It is now known that half of the human genome is recognizably derived from TEs. It is thus important to understand the scope and nature of their contribution to gene regulation. Here, we provide a timeline of major discoveries in this area and discuss how transposons have revolutionized our understanding of mammalian genomes, with a special emphasis on the massive contribution of TEs to primate evolution. Our analysis of primate-specific functional elements supports a simple model for the rate at which new functional elements arise in unique and TE-derived DNA. Finally, we discuss some of the challenges and unresolved questions in the field, which need to be addressed in order to fully characterize the impact of TEs on gene regulation, evolution and disease processes. PMID:27174439

  10. Transposable element dynamics among asymbiotic and ectomycorrhizal Amanita fungi.

    Science.gov (United States)

    Hess, Jaqueline; Skrede, Inger; Wolfe, Benjamin E; LaButti, Kurt; Ohm, Robin A; Grigoriev, Igor V; Pringle, Anne

    2014-07-01

    Transposable elements (TEs) are ubiquitous inhabitants of eukaryotic genomes and their proliferation and dispersal shape genome architectures and diversity. Nevertheless, TE dynamics are often explored for one species at a time and are rarely considered in ecological contexts. Recent work with plant pathogens suggests a link between symbiosis and TE abundance. The genomes of pathogenic fungi appear to house an increased abundance of TEs, and TEs are frequently associated with the genes involved in symbiosis. To investigate whether this pattern is general, and relevant to mutualistic plant-fungal symbioses, we sequenced the genomes of related asymbiotic (AS) and ectomycorrhizal (ECM) Amanita fungi. Using methods developed to interrogate both assembled and unassembled sequences, we characterized and quantified TEs across three AS and three ECM species, including the AS outgroup Volvariella volvacea. The ECM genomes are characterized by abundant numbers of TEs, an especially prominent feature of unassembled sequencing libraries. Increased TE activity in ECM species is also supported by phylogenetic analysis of the three most abundant TE superfamilies; phylogenies revealed many radiations within contemporary ECM species. However, the AS species Amanita thiersii also houses extensive amplifications of elements, highlighting the influence of additional evolutionary parameters on TE abundance. Our analyses provide further evidence for a link between symbiotic associations among plants and fungi, and increased TE activity, while highlighting the importance individual species' natural histories may have in shaping genome architecture. PMID:24923322

  11. Generating and manipulating transgenic animals using transposable elements

    Directory of Open Access Journals (Sweden)

    Largaespada David A

    2003-11-01

    Full Text Available Abstract Transposable elements, or transposons, have played a significant role in the history of biological research. They have had a major influence on the structure of genomes during evolution, they can cause mutations, and their study led to the concept of so-called "selfish DNA". In addition, transposons have been manipulated as useful gene transfer vectors. While primarily restricted to use in invertebrates, prokaryotes, and plants, it is now clear that transposon technology and biology are just as relevant to the study of vertebrate species. Multiple transposons now have been shown to be active in vertebrates and they can be used for germline transgenesis, somatic cell transgenesis/gene therapy, and random germline insertional mutagenesis. The sophistication of these applications and the number of active elements are likely to increase over the next several years. This review covers the vertebrate-active retrotransposons and transposons that have been well studied and adapted for use as gene transfer agents. General considerations and predictions about the future utility of transposon technology are discussed.

  12. Physical evidence for a Saccharomyces cerevisiae transposable element which carries the his4C gene.

    OpenAIRE

    de Bruijn, F; Greer, H

    1981-01-01

    A Saccharomyces cerevisiae transposable element which carries the his4C structural gene and which is capable of transposition, excision, and mutator activity is described. Physical evidence is presented for transposition of the his4C deoxyribonucleic acid sequences to a new location in the genome and for precise excision of these transposed deoxyribonucleic acid sequences in spontaneous his4C- segregants.

  13. SoyTEdb: a comprehensive database of transposable elements in the soybean genome

    Directory of Open Access Journals (Sweden)

    Zhu Liucun

    2010-02-01

    Full Text Available Abstract Background Transposable elements are the most abundant components of all characterized genomes of higher eukaryotes. It has been documented that these elements not only contribute to the shaping and reshaping of their host genomes, but also play significant roles in regulating gene expression, altering gene function, and creating new genes. Thus, complete identification of transposable elements in sequenced genomes and construction of comprehensive transposable element databases are essential for accurate annotation of genes and other genomic components, for investigation of potential functional interaction between transposable elements and genes, and for study of genome evolution. The recent availability of the soybean genome sequence has provided an unprecedented opportunity for discovery, and structural and functional characterization of transposable elements in this economically important legume crop. Description Using a combination of structure-based and homology-based approaches, a total of 32,552 retrotransposons (Class I and 6,029 DNA transposons (Class II with clear boundaries and insertion sites were structurally annotated and clearly categorized, and a soybean transposable element database, SoyTEdb, was established. These transposable elements have been anchored in and integrated with the soybean physical map and genetic map, and are browsable and visualizable at any scale along the 20 soybean chromosomes, along with predicted genes and other sequence annotations. BLAST search and other infrastracture tools were implemented to facilitate annotation of transposable elements or fragments from soybean and other related legume species. The majority (> 95% of these elements (particularly a few hundred low-copy-number families are first described in this study. Conclusion SoyTEdb provides resources and information related to transposable elements in the soybean genome, representing the most comprehensive and the largest manually

  14. Differential detection of transposable elements between Saccharum species

    Directory of Open Access Journals (Sweden)

    Marislane Carvalho Paz de Souza

    2013-01-01

    Full Text Available Cultivars of sugarcane (Saccharum are hybrids between species S. officinarum (x = 10, 2n = 8x = 80 and S. spontaneum (x=8,2n=5-16x =40-128. These accessions have 100 to 130 chromosomes, 80-85% of which are derived from S. officinarum, 10-15% from S. spontaneum, and 5-10% are possible recombinants between the two genomes. The aim of this study was to analyze the repetition of DNA sequences in S. officinarum and S. spontaneum. For this purpose, genomic DNA from S. officinarum was digested with restriction enzymes and the fragments cloned. Sixty-eight fragments, approximately 500 bp, were cloned, sequenced and had their identity analyzed in NCBI, and in the rice, maize, and sorghum genome databases using BLAST. Twelve clones containing partial transposable elements, one single-copy control, one DNA repetitive clone control and two genome controls were analyzed by DNA hybridization on membrane, using genomic probes from S. officinarum and S. spontaneum. The hybridization experiment revealed that six TEs had a similar repetitive DNA pattern in the genomes of S. officinarum and S. spontaneum, while six TEs were more abundant in the genome of S. officinarum. We concluded that the species S. officinarum and S. spontaneum have differential accumulation LTR retrotransposon families, suggesting distinct insertion or modification patterns.

  15. Survey of transposable elements in sugarcane expressed sequence tags (ESTs

    Directory of Open Access Journals (Sweden)

    Rossi Magdalena

    2001-01-01

    Full Text Available The sugarcane expressed sequence tag (SUCEST project has produced a large number of cDNA sequences from several plant tissues submitted or not to different conditions of stress. In this paper we report the result of a search for transposable elements (TEs revealing a surprising amount of expressed TEs homologues. Of the 260,781 sequences grouped in 81,223 fragment assembly program (Phrap clusters, a total of 276 clones showed homology to previously reported TEs using a stringent cut-off value of e-50 or better. Homologous clones to Copia/Ty1 and Gypsy/Ty3 groups of long terminal repeat (LTR retrotransposons were found but no non-LTR retroelements were identified. All major transposon families were represented in sugarcane including Activator (Ac, Mutator (MuDR, Suppressor-mutator (En/Spm and Mariner. In order to compare the TE diversity in grasses genomes, we carried out a search for TEs described in sugarcane related species O.sativa, Z. mays and S. bicolor. We also present preliminary results showing the potential use of TEs insertion pattern polymorphism as molecular markers for cultivar identification.

  16. Real-time transposable element activity in individual live cells.

    Science.gov (United States)

    Kim, Neil H; Lee, Gloria; Sherer, Nicholas A; Martini, K Michael; Goldenfeld, Nigel; Kuhlman, Thomas E

    2016-06-28

    The excision and reintegration of transposable elements (TEs) restructure their host genomes, generating cellular diversity involved in evolution, development, and the etiology of human diseases. Our current knowledge of TE behavior primarily results from bulk techniques that generate time and cell ensemble averages, but cannot capture cell-to-cell variation or local environmental and temporal variability. We have developed an experimental system based on the bacterial TE IS608 that uses fluorescent reporters to directly observe single TE excision events in individual cells in real time. We find that TE activity depends upon the TE's orientation in the genome and the amount of transposase protein in the cell. We also find that TE activity is highly variable throughout the lifetime of the cell. Upon entering stationary phase, TE activity increases in cells hereditarily predisposed to TE activity. These direct observations demonstrate that real-time live-cell imaging of evolution at the molecular and individual event level is a powerful tool for the exploration of genome plasticity in stressed cells. PMID:27298350

  17. Real-time transposable element activity in individual live cells

    Science.gov (United States)

    Lee, Gloria; Martini, K. Michael

    2016-01-01

    The excision and reintegration of transposable elements (TEs) restructure their host genomes, generating cellular diversity involved in evolution, development, and the etiology of human diseases. Our current knowledge of TE behavior primarily results from bulk techniques that generate time and cell ensemble averages, but cannot capture cell-to-cell variation or local environmental and temporal variability. We have developed an experimental system based on the bacterial TE IS608 that uses fluorescent reporters to directly observe single TE excision events in individual cells in real time. We find that TE activity depends upon the TE’s orientation in the genome and the amount of transposase protein in the cell. We also find that TE activity is highly variable throughout the lifetime of the cell. Upon entering stationary phase, TE activity increases in cells hereditarily predisposed to TE activity. These direct observations demonstrate that real-time live-cell imaging of evolution at the molecular and individual event level is a powerful tool for the exploration of genome plasticity in stressed cells. PMID:27298350

  18. Epigenetic regulation of transposable element derived human gene promoters.

    Science.gov (United States)

    Huda, Ahsan; Bowen, Nathan J; Conley, Andrew B; Jordan, I King

    2011-04-01

    It was previously thought that epigenetic histone modifications of mammalian transposable elements (TEs) serve primarily to defend the genome against deleterious effects associated with their activity. However, we recently showed that, genome-wide, human TEs can also be epigenetically modified in a manner consistent with their ability to regulate host genes. Here, we explore the ability of TE sequences to epigenetically regulate individual human genes by focusing on the histone modifications of promoter sequences derived from TEs. We found 1520 human genes that initiate transcription from within TE-derived promoter sequences. We evaluated the distributions of eight histone modifications across these TE-promoters, within and between the GM12878 and K562 cell lines, and related their modification status with the cell-type specific expression patterns of the genes that they regulate. TE-derived promoters are significantly enriched for active histone modifications, and depleted for repressive modifications, relative to the genomic background. Active histone modifications of TE-promoters peak at transcription start sites and are positively correlated with increasing expression within cell lines. Furthermore, differential modification of TE-derived promoters between cell lines is significantly correlated with differential gene expression. LTR-retrotransposon derived promoters in particular play a prominent role in mediating cell-type specific gene regulation, and a number of these LTR-promoter genes are implicated in lineage-specific cellular functions. The regulation of human genes mediated by histone modifications targeted to TE-derived promoters is consistent with the ability of TEs to contribute to the epigenomic landscape in a way that provides functional utility to the host genome. PMID:21215797

  19. Prediction of transposable element derived enhancers using chromatin modification profiles.

    Science.gov (United States)

    Huda, Ahsan; Tyagi, Eishita; Mariño-Ramírez, Leonardo; Bowen, Nathan J; Jjingo, Daudi; Jordan, I King

    2011-01-01

    Experimentally characterized enhancer regions have previously been shown to display specific patterns of enrichment for several different histone modifications. We modelled these enhancer chromatin profiles in the human genome and used them to guide the search for novel enhancers derived from transposable element (TE) sequences. To do this, a computational approach was taken to analyze the genome-wide histone modification landscape characterized by the ENCODE project in two human hematopoietic cell types, GM12878 and K562. We predicted the locations of 2,107 and 1,448 TE-derived enhancers in the GM12878 and K562 cell lines respectively. A vast majority of these putative enhancers are unique to each cell line; only 3.5% of the TE-derived enhancers are shared between the two. We evaluated the functional effect of TE-derived enhancers by associating them with the cell-type specific expression of nearby genes, and found that the number of TE-derived enhancers is strongly positively correlated with the expression of nearby genes in each cell line. Furthermore, genes that are differentially expressed between the two cell lines also possess a divergent number of TE-derived enhancers in their vicinity. As such, genes that are up-regulated in the GM12878 cell line and down-regulated in K562 have significantly more TE-derived enhancers in their vicinity in the GM12878 cell line and vice versa. These data indicate that human TE-derived sequences are likely to be involved in regulating cell-type specific gene expression on a broad scale and suggest that the enhancer activity of TE-derived sequences is mediated by epigenetic regulatory mechanisms. PMID:22087331

  20. Prediction of transposable element derived enhancers using chromatin modification profiles.

    Directory of Open Access Journals (Sweden)

    Ahsan Huda

    Full Text Available Experimentally characterized enhancer regions have previously been shown to display specific patterns of enrichment for several different histone modifications. We modelled these enhancer chromatin profiles in the human genome and used them to guide the search for novel enhancers derived from transposable element (TE sequences. To do this, a computational approach was taken to analyze the genome-wide histone modification landscape characterized by the ENCODE project in two human hematopoietic cell types, GM12878 and K562. We predicted the locations of 2,107 and 1,448 TE-derived enhancers in the GM12878 and K562 cell lines respectively. A vast majority of these putative enhancers are unique to each cell line; only 3.5% of the TE-derived enhancers are shared between the two. We evaluated the functional effect of TE-derived enhancers by associating them with the cell-type specific expression of nearby genes, and found that the number of TE-derived enhancers is strongly positively correlated with the expression of nearby genes in each cell line. Furthermore, genes that are differentially expressed between the two cell lines also possess a divergent number of TE-derived enhancers in their vicinity. As such, genes that are up-regulated in the GM12878 cell line and down-regulated in K562 have significantly more TE-derived enhancers in their vicinity in the GM12878 cell line and vice versa. These data indicate that human TE-derived sequences are likely to be involved in regulating cell-type specific gene expression on a broad scale and suggest that the enhancer activity of TE-derived sequences is mediated by epigenetic regulatory mechanisms.

  1. Detection of transposable elements by their compositional bias

    Directory of Open Access Journals (Sweden)

    Anxolabéhère Dominique

    2004-07-01

    Full Text Available Abstract Background Transposable elements (TE are mobile genetic entities present in nearly all genomes. Previous work has shown that TEs tend to have a different nucleotide composition than the host genes, either considering codon usage bias or dinucleotide frequencies. We show here how these compositional differences can be used as a tool for detection and analysis of TE sequences. Results We compared the composition of TE sequences and host gene sequences using probabilistic models of nucleotide sequences. We used hidden Markov models (HMM, which take into account the base composition of the sequences (occurrences of words n nucleotides long, with n ranging here from 1 to 4 and the heterogeneity between coding and non-coding parts of sequences. We analyzed three sets of sequences containing class I TEs, class II TEs and genes respectively in three species: Drosophila melanogaster, Cænorhabditis elegans and Arabidopsis thaliana. Each of these sets had a distinct, homogeneous composition, enabling us to distinguish between the two classes of TE and the genes. However the particular base composition of the TEs differed in the three species studied. Conclusions This approach can be used to detect and annotate TEs in genomic sequences and complements the current homology-based TE detection methods. Furthermore, the HMM method is able to identify the parts of a sequence in which the nucleotide composition resembles that of a coding region of a TE. This is useful for the detailed annotation of TE sequences, which may contain an ancient, highly diverged coding region that is no longer fully functional.

  2. Combined evidence annotation of transposable elements in genome sequences.

    Directory of Open Access Journals (Sweden)

    Hadi Quesneville

    2005-07-01

    Full Text Available Transposable elements (TEs are mobile, repetitive sequences that make up significant fractions of metazoan genomes. Despite their near ubiquity and importance in genome and chromosome biology, most efforts to annotate TEs in genome sequences rely on the results of a single computational program, RepeatMasker. In contrast, recent advances in gene annotation indicate that high-quality gene models can be produced from combining multiple independent sources of computational evidence. To elevate the quality of TE annotations to a level comparable to that of gene models, we have developed a combined evidence-model TE annotation pipeline, analogous to systems used for gene annotation, by integrating results from multiple homology-based and de novo TE identification methods. As proof of principle, we have annotated "TE models" in Drosophila melanogaster Release 4 genomic sequences using the combined computational evidence derived from RepeatMasker, BLASTER, TBLASTX, all-by-all BLASTN, RECON, TE-HMM and the previous Release 3.1 annotation. Our system is designed for use with the Apollo genome annotation tool, allowing automatic results to be curated manually to produce reliable annotations. The euchromatic TE fraction of D. melanogaster is now estimated at 5.3% (cf. 3.86% in Release 3.1, and we found a substantially higher number of TEs (n = 6,013 than previously identified (n = 1,572. Most of the new TEs derive from small fragments of a few hundred nucleotides long and highly abundant families not previously annotated (e.g., INE-1. We also estimated that 518 TE copies (8.6% are inserted into at least one other TE, forming a nest of elements. The pipeline allows rapid and thorough annotation of even the most complex TE models, including highly deleted and/or nested elements such as those often found in heterochromatic sequences. Our pipeline can be easily adapted to other genome sequences, such as those of the D. melanogaster heterochromatin or other

  3. Whole genome resequencing reveals natural target site preferences of transposable elements in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Raquel S Linheiro

    Full Text Available Transposable elements are mobile DNA sequences that integrate into host genomes using diverse mechanisms with varying degrees of target site specificity. While the target site preferences of some engineered transposable elements are well studied, the natural target preferences of most transposable elements are poorly characterized. Using population genomic resequencing data from 166 strains of Drosophila melanogaster, we identified over 8,000 new insertion sites not present in the reference genome sequence that we used to decode the natural target preferences of 22 families of transposable element in this species. We found that terminal inverted repeat transposon and long terminal repeat retrotransposon families present clade-specific target site duplications and target site sequence motifs. Additionally, we found that the sequence motifs at transposable element target sites are always palindromes that extend beyond the target site duplication. Our results demonstrate the utility of population genomics data for high-throughput inference of transposable element targeting preferences in the wild and establish general rules for terminal inverted repeat transposon and long terminal repeat retrotransposon target site selection in eukaryotic genomes.

  4. Novel non-autonomous transposable elements onWchromosome of the silkworm, Bombyx mori

    Indian Academy of Sciences (India)

    Hiroaki Abe; Tsuguru Fujii; Toru Shimada; Kazuei Mita

    2010-09-01

    The sex chromosomes of the silkworm Bombyx mori are designated ZW(XY) for females and ZZ (XX) for males. Numerous long terminal repeat (LTR) and non-LTR retrotransposons, retroposons and DNA transposons have accumulated as strata on the W chromosome. However, there are nucleotide sequences that do not show the characteristics of typical transposable elements on the W chromosome. To analyse these uncharacterized nucleotide sequences on the W chromosome, we used whole-genome shotgun (WGS) data and assembled data that was obtained using male genome DNA. Through these analyses, we found that almost all of these uncharacterized sequences were non-autonomous transposable elements that do not fit into the conventional classification. It is notable that some of these transposable elements contained the Bombyx short interspersed element (Bm1) sequences in the elements. We designated them as secondary-Bm1 transposable elements (SBTEs). Because putative ancestral SBTE nucleotide sequences without Bm1 do not occur in theWGS data, we suggest that the Bm1 sequences of SBTEs are not carried on each element merely as a package but are components of each element. Therefore, we confirmed that SBTEs should be classified as a new group of transposable elements.

  5. The biology and potential for genetic research of transposable elements in filamentous fungi

    Directory of Open Access Journals (Sweden)

    Léia Cecilia de Lima Fávaro

    2005-12-01

    Full Text Available Recently many transposable elements have been identified and characterized in filamentous fungi, especially in species of agricultural, biotechnological and medical interest. Similar to the elements found in other eukaryotes, fungal transposons can be classified as class I elements (retrotransposons that use RNA and reverse transcriptase and class II elements (DNA transposons that use DNA. The changes (transposition and recombination caused by transposons can supply wide-ranging genetic variation, especially for species that do not have a sexual phase. The application of transposable elements to gene isolation and population analysis is an important tool for molecular biology and studies of fungal evolution.

  6. Transposable elements in cancer as a by-product of stress-induced evolvability

    DEFF Research Database (Denmark)

    Mourier, Tobias; Nielsen, Lars P; Hansen, Anders J; Willerslev, Eske

    2014-01-01

    Transposable elements (TEs) are ubiquitous in eukaryotic genomes. Barbara McClintock's famous notion of TEs acting as controlling elements modifying the genetic response of an organism upon exposure to stressful environments has since been solidly supported in a series of model organisms. This...

  7. Zaba: a novel miniature transposable element present in genomes of legume plants

    Czech Academy of Sciences Publication Activity Database

    Macas, Jiří; Neumann, Pavel; Požárková, Dana

    2003-01-01

    Roč. 269, - (2003), s. 624-631. ISSN 1617-4615 R&D Projects: GA ČR GA521/00/0655 Institutional research plan: CEZ:AV0Z5051902 Keywords : DNA * transposable elements * ZABA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.240, year: 2003

  8. Cell type-specific termination of transcription by transposable element sequences

    OpenAIRE

    Conley Andrew B; Jordan I

    2012-01-01

    Abstract Background Transposable elements (TEs) encode sequences necessary for their own transposition, including signals required for the termination of transcription. TE sequences within the introns of human genes show an antisense orientation bias, which has been proposed to reflect selection against TE sequences in the sense orientation owing to their ability to terminate the transcription of host gene transcripts. While there is evidence in support of this model for some elements, the ex...

  9. BrassicaTED - a public database for utilization of miniature transposable elements in Brassica species

    OpenAIRE

    Murukarthick, Jayakodi; Sampath, Perumal; Lee, Sang Choon; Choi, Beom-Soon; Senthil, Natesan; Liu, Shengyi; Yang, Tae-Jin

    2014-01-01

    Background MITE, TRIM and SINEs are miniature form transposable elements (mTEs) that are ubiquitous and dispersed throughout entire plant genomes. Tens of thousands of members cause insertion polymorphism at both the inter- and intra- species level. Therefore, mTEs are valuable targets and resources for development of markers that can be utilized for breeding, genetic diversity and genome evolution studies. Taking advantage of the completely sequenced genomes of Brassica rapa and B. oleracea,...

  10. Sex-dependent differences in transcription of transposable elements in a dioecious plant species

    Czech Academy of Sciences Publication Activity Database

    Čermák, Tomáš; Hobza, Roman; Kubát, Zdeněk; Vyskot, Boris; Kejnovský, Eduard

    Lisbon, 2009. s. 143. [8th Plant Genomics European Meeting. 07.10.2009-10.10.2009, Lisbon] R&D Projects: GA ČR(CZ) GD204/09/H002; GA MŠk(CZ) LC06004; GA ČR(CZ) GA522/09/0083 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : sex chromosomes * Silene * transposable elements Subject RIV: BO - Biophysics

  11. Transposable elements donate lineage-specific regulatory sequences to host genomes

    OpenAIRE

    Mariño-Ramírez, L; Lewis, K. C.; Landsman, D; Jordan, I K

    2005-01-01

    The evolutionary implications of transposable element (TE) influences on gene regulation are explored here. An historical perspective is presented to underscore the importance of TE influences on gene regulation with respect to both the discovery of TEs and the early conceptualization of their potential impact on host genome evolution. Evidence that points to a role for TEs in host gene regulation is reviewed, and comparisons between genome sequences are used to demonstrate the fact that TEs ...

  12. Patterns of Repeat-Induced Point Mutation in Transposable Elements of Basidiomycete Fungi

    OpenAIRE

    Horns, Felix; Petit, Elsa; Yockteng, Roxana; Hood, Michael E.

    2012-01-01

    Transposable elements (TEs) are ubiquitous genomic parasites that have prompted the evolution of genome defense systems that restrict their activity. Repeat-induced point mutation (RIP) is a homology-dependent genome defense that introduces C-to-T transition mutations in duplicated DNA sequences and is thought to control the proliferation of selfish repetitive DNA. Here, we determine the taxonomic distribution of hypermutation patterns indicative of RIP among basidiomycetes. We quantify C-to-...

  13. The Holozoan Capsaspora owczarzaki Possesses a Diverse Complement of Active Transposable Element Families

    OpenAIRE

    Carr, Martin; Suga, Hiroshi

    2014-01-01

    Capsaspora owczarzaki, a protistan symbiont of the pulmonate snail Biomphalaria glabrata, is the centre of much interest in evolutionary biology due to its close relationship to Metazoa. The whole genome sequence of this protist has revealed new insights into the ancestral genome composition of Metazoa, in particular with regard to gene families involved in the evolution of multicellularity. The draft genome revealed the presence of 23 families of transposable element, made up from DNA transp...

  14. Genomic deletions and precise removal of transposable elements mediated by short identical DNA segments in primates

    OpenAIRE

    Louie N van de Lagemaat; Gagnier, Liane; Medstrand, Patrik; Mager, Dixie L.

    2005-01-01

    Insertion of transposable elements is a major cause of genomic expansion in eukaryotes. Less is understood, however, about mechanisms underlying contraction of genomes. In this study, we show that retroelements can, in rare cases, be precisely deleted from primate genomes, most likely via recombination between 10- to 20-bp target site duplications (TSDs) flanking the retroelement. The deleted loci are indistinguishable from pre-integration sites, effectively reversing the insertion. Through h...

  15. Detection transposable elements in Botrytis cinerea in latent infection stage from symptomless apples

    OpenAIRE

    Fernández, Jorge G; Martín A Fernández-Baldo; Claudio Muñoz; Eloy Salinas; Julio Raba; Sanz, María I

    2014-01-01

    Objective: T o detect Botrytis cinerea ( B. cinerea ) latent infections on apples before storage, which is essential for effective control strategies in the fruit postharvest industry. Methods: I n the present study, a polymerase chain reaction detection method, based on primers designed on B. cinerea transposable elements ( boty and flipper ) and intergenic spacer region as internal control, were utilized to reveal the presence of symptomless infections on apple fruits. T ...

  16. The industrial melanism mutation in British peppered moths is a transposable element.

    Science.gov (United States)

    Van't Hof, Arjen E; Campagne, Pascal; Rigden, Daniel J; Yung, Carl J; Lingley, Jessica; Quail, Michael A; Hall, Neil; Darby, Alistair C; Saccheri, Ilik J

    2016-06-01

    Discovering the mutational events that fuel adaptation to environmental change remains an important challenge for evolutionary biology. The classroom example of a visible evolutionary response is industrial melanism in the peppered moth (Biston betularia): the replacement, during the Industrial Revolution, of the common pale typica form by a previously unknown black (carbonaria) form, driven by the interaction between bird predation and coal pollution. The carbonaria locus has been coarsely localized to a 200-kilobase region, but the specific identity and nature of the sequence difference controlling the carbonaria-typica polymorphism, and the gene it influences, are unknown. Here we show that the mutation event giving rise to industrial melanism in Britain was the insertion of a large, tandemly repeated, transposable element into the first intron of the gene cortex. Statistical inference based on the distribution of recombined carbonaria haplotypes indicates that this transposition event occurred around 1819, consistent with the historical record. We have begun to dissect the mode of action of the carbonaria transposable element by showing that it increases the abundance of a cortex transcript, the protein product of which plays an important role in cell-cycle regulation, during early wing disc development. Our findings fill a substantial knowledge gap in the iconic example of microevolutionary change, adding a further layer of insight into the mechanism of adaptation in response to natural selection. The discovery that the mutation itself is a transposable element will stimulate further debate about the importance of 'jumping genes' as a source of major phenotypic novelty. PMID:27251284

  17. Hobo-like transposable elements as non-drosophilid gene vectors

    International Nuclear Information System (INIS)

    Using genetic and physical methods we discovered short-inverted repeat type transposable elements in non-drosophilid insects including, Bactorcera tryoni, Musca domestica, Musca vetustissima and Lucilia cuprina. These elements are related to hobo, Ac and Tam3. The Hermes element from M domestica is 2749 bp in length and has terminal inverted repeats and a transposase coding region very similar to those in hobo. Hermes is functional in M Domestic and can act as a gene vector in this species. When Hermes is introduced into D. melanogaster it is hyperactive, relative to existing vector systems used in this species. Hermes will be useful as a gene vector. (author)

  18. Transposable elements in cancer as a by-product of stress-induced evolvability

    DEFF Research Database (Denmark)

    Mourier, Tobias; Nielsen, Lars P.; Hansen, Anders Johannes;

    2014-01-01

    requires the TE activity response to possess an element of specificity and be targeted toward certain parts of the genome. We propose that a similar TE response is present in human cells, and that this stress response may drive the onset of human cancers. As such, TE-driven cancers may be viewed as an......Transposable elements (TEs) are ubiquitous in eukaryotic genomes. Barbara McClintock's famous notion of TEs acting as controlling elements modifying the genetic response of an organism upon exposure to stressful environments has since been solidly supported in a series of model organisms. This...... evolutionary by-product of organisms' abilities to genetically adapt to environmental stress....

  19. The Tc3 Family of Transposable Genetic Elements in Caenorhabditis Elegans

    OpenAIRE

    Collins, J.; Forbes, E.; Anderson, P

    1989-01-01

    We describe genetic and molecular properties of Tc3, a family of transposable elements in Caenorhabditis elegans. About 15 Tc3 elements are present in the genomes of several different wild-type varieties of C. elegans, but Tc3 transposition and excision are not detected in these strains. Tc3 transposition and excision occur at high frequencies, however, in strain TR679, a mutant identified because of its highly active Tc1 elements. In TR679, Tc3 is responsible for several spontaneous mutation...

  20. Evolutionary Histories of Transposable Elements in the Genome of the Largest Living Marsupial Carnivore, the Tasmanian Devil

    OpenAIRE

    Gallus, Susanne; Hallström, Björn M.; Kumar, Vikas; Dodt, William G; Janke, Axel; Schumann, Gerald G.; Nilsson, Maria A.

    2015-01-01

    The largest living carnivorous marsupial, the Tasmanian devil (Sarcophilus harrisii), is the sole survivor of a lineage originating about 12 Ma. We set out to investigate the spectrum of transposable elements found in the Tasmanian devil genome, the first high-coverage genome of an Australian marsupial. Marsupial genomes have been shown to have the highest amount of transposable elements among vertebrates. We analyzed the horizontally transmitted DNA transposons OC1 and hAT-1_MEu in the Tasma...

  1. Strong phylogenetic inertia on genome size and transposable element content among 26 species of flies.

    Science.gov (United States)

    Sessegolo, Camille; Burlet, Nelly; Haudry, Annabelle

    2016-08-01

    While the evolutionary mechanisms driving eukaryote genome size evolution are still debated, repeated element content appears to be crucial. Here, we reconstructed the phylogeny and identified repeats in the genome of 26 Drosophila exhibiting a twofold variation in genome size. The content in transposable elements (TEs) is highly correlated to genome size evolution among these closely related species. We detected a strong phylogenetic signal on the evolution of both genome size and TE content, and a genome contraction in the Drosophila melanogaster subgroup. PMID:27576524

  2. ncRNAclassifier: a tool for detection and classification of transposable element sequences in RNA hairpins

    Directory of Open Access Journals (Sweden)

    Tempel Sébastien

    2012-09-01

    Full Text Available Abstract Background Inverted repeat genes encode precursor RNAs characterized by hairpin structures. These RNA hairpins are then metabolized by biosynthetic pathways to produce functional small RNAs. In eukaryotic genomes, short non-autonomous transposable elements can have similar size and hairpin structures as non-coding precursor RNAs. This resemblance leads to problems annotating small RNAs. Results We mapped all microRNA precursors from miRBASE to several genomes and studied the repetition and dispersion of the corresponding loci. We then searched for repetitive elements overlapping these loci. We developed an automatic method called ncRNAclassifier to classify pre-ncRNAs according to their relationship with transposable elements (TEs. We showed that there is a correlation between the number of scattered occurrences of ncRNA precursor candidates and the presence of TEs. We applied ncRNAclassifier on six chordate genomes and report our findings. Among the 1,426 human and 721 mouse pre-miRNAs of miRBase, we identified 235 and 68 mis-annotated pre-miRNAs respectively corresponding completely to TEs. Conclusions We provide a tool enabling the identification of repetitive elements in precursor ncRNA sequences. ncRNAclassifier is available at http://EvryRNA.ibisc.univ-evry.fr.

  3. Characterization of active miniature inverted-repeat transposable elements in the peanut genome

    OpenAIRE

    Shirasawa, Kenta; Hirakawa, Hideki; Tabata, Satoshi; Hasegawa, Makoto; Kiyoshima, Hiroyuki; Suzuki, Sigeru; Sasamoto, Sigemi; Watanabe, Akiko; Fujishiro, Tsunakazu; Isobe, Sachiko

    2012-01-01

    Miniature inverted-repeat transposable elements (MITEs), some of which are known as active non-autonomous DNA transposons, are found in the genomes of plants and animals. In peanut (Arachis hypogaea), AhMITE1 has been identified in a gene for fatty-acid desaturase, and possessed excision activity. However, the AhMITE1 distribution and frequency of excision have not been determined for the peanut genome. In order to characterize AhMITE1s, their genomic diversity and transposition ability was i...

  4. Germline transformation of Aedes fluviatilis (Diptera:Culicidae) with the piggyBac transposable element.

    Science.gov (United States)

    Rodrigues, Flávia Guimarães; Oliveira, Sabrina Barbosa; Rocha, Bruno Coelho; Moreira, Luciano Andrade

    2006-11-01

    The technique to generate transgenic mosquitoes requires adaptation for each target species because of aspects related to species biology, sensitivity to manipulation and rearing conditions. Here we tested different parameters on the microinjection procedure in order to obtain a transgenic Neotropical mosquito species. By using a transposon-based strategy we were able to successfully transform Aedes fluviatilis (Lutz), which can be used as an avian malaria model. These results demonstrate the usefulness of the piggyBac transposable element as a transformation vector for Neotropical mosquito species and opens up new research frontiers for South American mosquito vectors. PMID:17160283

  5. Germline transformation of Aedes fluviatilis (Diptera:Culicidae with the piggyBac transposable element

    Directory of Open Access Journals (Sweden)

    Flávia Guimarães Rodrigues

    2006-11-01

    Full Text Available The technique to generate transgenic mosquitoes requires adaptation for each target species because of aspects related to species biology, sensitivity to manipulation and rearing conditions. Here we tested different parameters on the microinjection procedure in order to obtain a transgenic Neotropical mosquito species. By using a transposon-based strategy we were able to successfully transform Aedes fluviatilis (Lutz, which can be used as an avian malaria model. These results demonstrate the usefulness of the piggyBac transposable element as a transformation vector for Neotropical mosquito species and opens up new research frontiers for South American mosquito vectors.

  6. Spontaneous mutators of salmonella typhimurium LT2 generated by insertion of transposable elements.

    OpenAIRE

    Shanabruch, W G; Behlau, I; Walker, G C

    1981-01-01

    Spontaneous mutators of Salmonella typhimurium LT2 were generated by inserting the transposable element Tn5 or Tn10 into the bacterial chromosome. Two mutators mapped at the position of the mutH and mutL loci of S. typhimurium, and two other mutators mapped at positions corresponding to the mutS and uvrD loci of Escherichia coli. A fifth mutator, mutB, did not map at a position corresponding to any of the known mutators of S. typhimurium or E. coli. The mutH,L,S and uvrD alleles increased the...

  7. Transposable elements dynamics in taxa with different reproductive strategies or speciation rate

    OpenAIRE

    Ricci, Marco

    2014-01-01

    In recent years the advances in genomics allowed to understand the importance of Transposable Elements (TE) in the evolution of eukaryotic genomes. In this thesis I face two aspects of the TE impact on the in the animal kingdom. The first part is a comparison of the dynamics of the TE dynamics in three species of stick-insects of the Genus Bacillus. I produced three random genomic libraries of 200 Kbps for the three parental species of the taxon: a gonochoric population of Bacillus rossius (f...

  8. Ancestral polymorphism and recent invasion of transposable elements in Drosophila species

    Directory of Open Access Journals (Sweden)

    Dias Elaine

    2012-07-01

    Full Text Available Abstract Background During the evolution of transposable elements, some processes, such as ancestral polymorphisms and horizontal transfer of sequences between species, can produce incongruences in phylogenies. We investigated the evolutionary history of the transposable elements Bari and 412 in the sequenced genomes of the Drosophila melanogaster group and in the sibling species D. melanogaster and D. simulans using traditional phylogenetic and network approaches. Results Maximum likelihood (ML phylogenetic analyses revealed incongruences and unresolved relationships for both the Bari and 412 elements. The DNA transposon Bari within the D. ananassae genome is more closely related to the element of the melanogaster complex than to the sequence in D. erecta, which is inconsistent with the species phylogeny. Divergence analysis and the comparison of the rate of synonymous substitutions per synonymous site of the Bari and host gene sequences explain the incongruence as an ancestral polymorphism that was inherited stochastically by the derived species. Unresolved relationships were observed in the ML phylogeny of both elements involving D. melanogaster, D. simulans and D. sechellia. A network approach was used to attempt to resolve these relationships. The resulting tree suggests recent transfers of both elements between D. melanogaster and D. simulans. The divergence values of the elements between these species support this conclusion. Conclusions We showed that ancestral polymorphism and recent invasion of genomes due to introgression or horizontal transfer between species occurred during the evolutionary history of the Bari and 412 elements in the melanogaster group. These invasions likely occurred in Africa during the Pleistocene, before the worldwide expansion of D. melanogaster and D. simulans.

  9. Genomic patterns associated with paternal/maternal distribution of transposable elements

    Science.gov (United States)

    Jurka, Jerzy

    2003-03-01

    Transposable elements (TEs) are specialized DNA or RNA fragments capable of surviving in intragenomic niches. They are commonly, perhaps unjustifiably referred to as "selfish" or "parasitic" elements. TEs can be divided in two major classes: retroelements and DNA transposons. The former include non-LTR retrotransposons and retrovirus-like elements, using reverse transriptase for their reproduction prior to integration into host DNA. The latter depend mostly on host DNA replication, with possible exception of rolling-circle transposons recently discovered by our team. I will review basic information on TEs, with emphasis on human Alu and L1 retroelements discussed in the context of genomic organization. TEs are non-randomly distributed in chromosomal DNA. In particular, human Alu elements tend to prefer GC-rich regions, whereas L1 accumulate in AT-rich regions. Current explanations of this phenomenon focus on the so called "target effects" and post-insertional selection. However, the proposed models appear to be unsatisfactory and alternative explanations invoking "channeling" to different chromosomal regions will be a major focus of my presentation. Transposable elements (TEs) can be expressed and integrated into host DNA in the male or female germlines, or both. Different models of expression and integration imply different proportions of TEs on sex chromosomes and autosomes. The density of recently retroposed human Alu elements is around three times higher on chromosome Y than on chromosome X, and over two times higher than the average density for all human autosomes. This implies Alu activity in paternal germlines. Analogous inter-chromosomal proportions for other repeat families should determine their compatibility with one of the three basic models describing the inheritance of TEs. Published evidence indicates that maternally and paternally imprinted genes roughly correspond to GC-rich and AT-rich DNA. This may explain the observed chromosomal distribution of

  10. Role of transposable elements in genomic rearrangement, evolution, gene regulation and epigenetics in primates.

    Science.gov (United States)

    Lee, Hee-Eun; Ayarpadikannan, Selvam; Kim, Heui-Soo

    2016-03-23

    The Human Genome Project revealed that almost half of the human genome consists of transposable elements (TEs), which are also abundant in non-human primates. Various studies have confirmed the roles of different TE families in primate evolution. TEs such as endogenous retroviruses (ERVs), long terminal repeats (LTRs), long interspersed nuclear elements (LINEs) and short interspersed nuclear elements (SINEs) all have numerous effects on the primate genome, including genomic rearrangement, regulatory functions and epigenetic mechanisms. This review offers an overview of research on TEs, including our current understanding of their presence in modern primate lineages, their evolutionary origins, and their regulatory and modifying effects on primate as well as human genomes. The information provided here should be useful for the study of primate genomics. PMID:26781081

  11. Detection transposable elements in Botrytis cinerea in latent infection stage from symptomless apples

    Institute of Scientific and Technical Information of China (English)

    Jorge G Fernndez; Martn A Fernndez-Baldo; Claudio Muoz; Eloy Salinas; Julio Raba; Mara I Sanz

    2014-01-01

    Objective:To detect Botrytis cinerea (B. cinerea) latent infections on apples before storage, which is essential for effective control strategies in the fruit postharvest industry. Methods:In the present study, a polymerase chain reaction detection method, based on primers designed on B. cinerea transposable elements (boty and flipper) and intergenic spacer region as internal control, were utilized to reveal the presence of symptomless infections on apple fruits. This molecular method proved to be highly specific and sensitive in detecting latent infections. It revealed the presence of the pathogen in 83%of the samples from infected apples with 104 conidia/mL, whereas those infected with 106 conidia/mL detected 94%as compared to the traditional method that revealed the pathogen in 40%and 66%of the samples inoculated with 104 and 106 conidia/mL respectively. Furthermore, the method characterized B. cinerea as subpopulation transposa-type by the presence of the transposable elements boty and flipper Results:The results obtained from DNA quantification method were compared with enzyme-linked immunosorbent assay and these studies showed good correlation. Therefore our method has important advantages compared with others detection methods for B. cinerea, because the proposed methodology allowed distinguishes between its two subpopulations (vacuma and transposa) and this would allow establish possible appropriate control strategies. Conclusions:Finally, the method can be an interesting alternative for its possible application in the phytosanitary programs of the fruit industry worldwide.

  12. detectMITE: A novel approach to detect miniature inverted repeat transposable elements in genomes.

    Science.gov (United States)

    Ye, Congting; Ji, Guoli; Liang, Chun

    2016-01-01

    Miniature inverted repeat transposable elements (MITEs) are prevalent in eukaryotic genomes, including plants and animals. Classified as a type of non-autonomous DNA transposable elements, they play important roles in genome organization and evolution. Comprehensive and accurate genome-wide detection of MITEs in various eukaryotic genomes can improve our understanding of their origins, transposition processes, regulatory mechanisms, and biological relevance with regard to gene structures, expression, and regulation. In this paper, we present a new MATLAB-based program called detectMITE that employs a novel numeric calculation algorithm to replace conventional string matching algorithms in MITE detection, adopts the Lempel-Ziv complexity algorithm to filter out MITE candidates with low complexity, and utilizes the powerful clustering program CD-HIT to cluster similar MITEs into MITE families. Using the rice genome as test data, we found that detectMITE can more accurately, comprehensively, and efficiently detect MITEs on a genome-wide scale than other popular MITE detection tools. Through comparison with the potential MITEs annotated in Repbase, the widely used eukaryotic repeat database, detectMITE has been shown to find known and novel MITEs with a complete structure and full-length copies in the genome. detectMITE is an open source tool (https://sourceforge.net/projects/detectmite). PMID:26795595

  13. Nezha, a novel active miniature inverted-repeat transposable element in cyanobacteria

    International Nuclear Information System (INIS)

    Miniature inverted-repeat transposable elements (MITEs) were first identified in plants and exerted extensive proliferations throughout eukaryotic and archaeal genomes. But very few MITEs have been characterized in bacteria. We identified a novel MITE, called Nezha, in cyanobacteria Anabaena variabilis ATCC 29413 and Nostoc sp. PCC 7120. Nezha, like most previously known MITEs in other organisms, is small in size, non-coding, carrying TIR and DR signals, and of potential to form a stable RNA secondary structure, and it tends to insert into A+T-rich regions. Recent transpositions of Nezha were observed in A. variabilis ATCC 29413 and Nostoc sp. PCC 7120, respectively. Nezha might have proliferated recently with aid from the transposase encoded by ISNpu3-like elements. A possible horizontal transfer event of Nezha from cyanobacteria to Polaromonas JS666 is also observed

  14. A new approach for annotation of transposable elements using small RNA mapping.

    Science.gov (United States)

    El Baidouri, Moaine; Kim, Kyung Do; Abernathy, Brian; Arikit, Siwaret; Maumus, Florian; Panaud, Olivier; Meyers, Blake C; Jackson, Scott A

    2015-07-27

    Transposable elements (TEs) are mobile genomic DNA sequences found in most organisms. They so densely populate the genomes of many eukaryotic species that they are often the major constituents. With the rapid generation of many plant genome sequencing projects over the past few decades, there is an urgent need for improved TE annotation as a prerequisite for genome-wide studies. Analogous to the use of RNA-seq for gene annotation, we propose a new method for de novo TE annotation that uses as a guide 24 nt-siRNAs that are a part of TE silencing pathways. We use this new approach, called TASR (for Transposon Annotation using Small RNAs), for de novo annotation of TEs in Arabidopsis, rice and soybean and demonstrate that this strategy can be successfully applied for de novo TE annotation in plants.Executable PERL is available for download from: http://tasr-pipeline.sourceforge.net/. PMID:25813049

  15. A gene family derived from transposable elements during early angiosperm evolution has reproductive fitness benefits in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Zoé Joly-Lopez

    2012-09-01

    Full Text Available The benefits of ever-growing numbers of sequenced eukaryotic genomes will not be fully realized until we learn to decipher vast stretches of noncoding DNA, largely composed of transposable elements. Transposable elements persist through self-replication, but some genes once encoded by transposable elements have, through a process called molecular domestication, evolved new functions that increase fitness. Although they have conferred numerous adaptations, the number of such domesticated transposable element genes remains unknown, so their evolutionary and functional impact cannot be fully assessed. Systematic searches that exploit genomic signatures of natural selection have been employed to identify potential domesticated genes, but their predictions have yet to be experimentally verified. To this end, we investigated a family of domesticated genes called MUSTANG (MUG, identified in a previous bioinformatic search of plant genomes. We show that MUG genes are functional. Mutants of Arabidopsis thaliana MUG genes yield phenotypes with severely reduced plant fitness through decreased plant size, delayed flowering, abnormal development of floral organs, and markedly reduced fertility. MUG genes are present in all flowering plants, but not in any non-flowering plant lineages, such as gymnosperms, suggesting that the molecular domestication of MUG may have been an integral part of early angiosperm evolution. This study shows that systematic searches can be successful at identifying functional genetic elements in noncoding regions and demonstrates how to combine systematic searches with reverse genetics in a fruitful way to decipher eukaryotic genomes.

  16. A Gaijin-like miniature inverted repeat transposable element is mobilized in rice during cell differentiation

    Directory of Open Access Journals (Sweden)

    Dong Hai-Tao

    2012-04-01

    Full Text Available Abstract Background Miniature inverted repeat transposable element (MITE is one type of transposable element (TE, which is largely found in eukaryotic genomes and involved in a wide variety of biological events. However, only few MITEs were proved to be currently active and their physiological function remains largely unknown. Results We found that the amplicon discrepancy of a gene locus LOC_Os01g0420 in different rice cultivar genomes was resulted from the existence of a member of Gaijin-like MITEs (mGing. This result indicated that mGing transposition was occurred at this gene locus. By using a modified transposon display (TD analysis, the active transpositions of mGing were detected in rice Jiahua No. 1 genome under three conditions: in seedlings germinated from the seeds received a high dose γ-ray irradiation, in plantlets regenerated from anther-derived calli and from scutellum-derived calli, and were confirmed by PCR validation and sequencing. Sequence analysis revealed that single nucleotide polymorphisms (SNPs or short additional DNA sequences at transposition sites post mGing transposition. It suggested that sequence modification was possibly taken place during mGing transposition. Furthermore, cell re-differentiation experiment showed that active transpositions of both mGing and mPing (another well studied MITE were identified only in regenerated plantlets. Conclusions It is for the first time that mGing active transposition was demonstrated under γ-ray irradiation or in cell re-differentiation process in rice. This newly identified active MITE will provide a foundation for further analysis of the roles of MITEs in biological process.

  17. The ant genomes have been invaded by several types of mariner transposable elements

    Science.gov (United States)

    Lorite, Pedro; Maside, Xulio; Sanllorente, Olivia; Torres, María I.; Periquet, Georges; Palomeque, Teresa

    2012-12-01

    To date, only three types of full-length mariner elements have been described in ants, each one in a different genus of the Myrmicinae subfamily: Sinvmar was isolated from various Solenopsis species, Myrmar from Myrmica ruginodis, and Mboumar from Messor bouvieri. In this study, we report the coexistence of three mariner elements ( Tnigmar- Si, Tnigmar- Mr, and Tnigmar- Mb) in the genome of a single species, Tapinoma nigerrimum (subfamily Dolichoderinae). Molecular evolutionary analyses of the nucleotide sequence data revealed a general agreement between the evolutionary history of most the elements and the ant species that harbour them, and suggest that they are at the vertical inactivation stage of the so-called Mariner Life Cycle. In contrast, significantly reduced levels of synonymous divergence between Mboumar and Tnigmar- Mb and between Myrmar and Botmar (a mariner element isolated from Bombus terrestris), relative to those observed between their hosts, suggest that these elements arrived to the species that host them by horizontal transfer, long after the species' split. The horizontal transfer events for the two pairs of elements could be roughly dated within the last 2 million years and about 14 million years, respectively. As would be expected under this scenario, the coding sequences of the youngest elements, Tnigmar- Mb and Mboumar, are intact and, thus, potentially functional. Each mariner element has a different chromosomal distribution pattern according to their stage within the Mariner Life Cycle. Finally, a new defective transposable element ( Azteca) has also been found inserted into the Tnigmar- Mr sequences showing that the ant genomes have been invaded by at least four different types of mariner elements.

  18. Genotype dependent burst of transposable element expression in crowns of hexaploid wheat (Triticum aestivum L.) during cold acclimation

    Science.gov (United States)

    The expression of 1,613 transposable elements (TEs) represented in the Affymetix Wheat Genome Chip was examined during cold treatment in crowns of 4 hexaploid wheat genotypes that vary in tolerance to cold and in flowering time. The TE expression profiles showed a constant level of expression throug...

  19. Ancient Transposable Elements Transformed the Uterine Regulatory Landscape and Transcriptome during the Evolution of Mammalian Pregnancy

    Directory of Open Access Journals (Sweden)

    Vincent J. Lynch

    2015-02-01

    Full Text Available A major challenge in biology is determining how evolutionarily novel characters originate; however, mechanistic explanations for the origin of new characters are almost completely unknown. The evolution of pregnancy is an excellent system in which to study the origin of novelties because mammals preserve stages in the transition from egg laying to live birth. To determine the molecular bases of this transition, we characterized the pregnant/gravid uterine transcriptome from tetrapods to trace the evolutionary history of uterine gene expression. We show that thousands of genes evolved endometrial expression during the origins of mammalian pregnancy, including genes that mediate maternal-fetal communication and immunotolerance. Furthermore, thousands of cis-regulatory elements that mediate decidualization and cell-type identity in decidualized stromal cells are derived from ancient mammalian transposable elements (TEs. Our results indicate that one of the defining mammalian novelties evolved from DNA sequences derived from ancient mammalian TEs co-opted into hormone-responsive regulatory elements distributed throughout the genome.

  20. Integrated cytogenetics and genomics analysis of transposable elements in the Nile tilapia, Oreochromis niloticus.

    Science.gov (United States)

    Valente, Guilherme; Kocher, Thomas; Eickbush, Thomas; Simões, Rafael P; Martins, Cesar

    2016-06-01

    Integration of cytogenetics and genomics has become essential to a better view of architecture and function of genomes. Although the advances on genomic sequencing have contributed to study genes and genomes, the repetitive DNA fraction of the genome is still enigmatic and poorly understood. Among repeated DNAs, transposable elements (TEs) are major components of eukaryotic chromatin and their investigation has been hindered even after the availability of whole sequenced genomes. The cytogenetic mapping of TEs in chromosomes has proved to be of high value to integrate information from the micro level of nucleotide sequence to a cytological view of chromosomes. Different TEs have been cytogenetically mapped in cichlids; however, neither details about their genomic arrangement nor appropriated copy number are well defined by these approaches. The current study integrates TEs distribution in Nile tilapia Oreochromis niloticus genome based on cytogenetic and genomics/bioinformatics approach. The results showed that some elements are not randomly distributed and that some are genomic dependent on each other. Moreover, we found extensive overlap between genomics and cytogenetics data and that tandem duplication may be the major mechanism responsible for the genomic dynamics of TEs here analyzed. This paper provides insights in the genomic organization of TEs under an integrated view based on cytogenetics and genomics. PMID:26860923

  1. Myriad Triple-Helix-Forming Structures in the Transposable Element RNAs of Plants and Fungi.

    Science.gov (United States)

    Tycowski, Kazimierz T; Shu, Mei-Di; Steitz, Joan A

    2016-05-10

    The ENE (element for nuclear expression) is a cis-acting RNA structure that protects viral or cellular noncoding RNAs (ncRNAs) from nuclear decay through triple-helix formation with the poly(A) tail or 3'-terminal A-rich tract. We expanded the roster of nine known ENEs by bioinformatic identification of ∼200 distinct ENEs that reside in transposable elements (TEs) of numerous non-metazoan and one fish species and in four Dicistrovirus genomes. Despite variation within the ENE core, none of the predicted triple-helical stacks exceeds five base triples. Increased accumulation of reporter transcripts in human cells demonstrated functionality for representative ENEs. Location close to the poly(A) tail argues that ENEs are active in TE transcripts. Their presence in intronless, but not intron-containing, hAT transposase genes supports the idea that TEs acquired ENEs to counteract the RNA-destabilizing effects of intron loss, a potential evolutionary consequence of TE horizontal transfer in organisms that couple RNA silencing to splicing deficits. PMID:27134163

  2. Active transposable elements recover species boundaries and geographic structure in Madagascan coffee species.

    Science.gov (United States)

    Roncal, Julissa; Guyot, Romain; Hamon, Perla; Crouzillat, Dominique; Rigoreau, Michel; Konan, Olivier N'Guessan; Rakotomalala, Jean-Jacques; Nowak, Michael D; Davis, Aaron P; de Kochko, Alexandre

    2016-02-01

    The completion of the genome assembly for the economically important coffee plant Coffea canephora (Rubiaceae) has allowed the use of bioinformatic tools to identify and characterize a diverse array of transposable elements (TEs), which can be used in evolutionary studies of the genus. An overview of the copy number and location within the C. canephora genome of four TEs is presented. These are tested for their use as molecular markers to unravel the evolutionary history of the Millotii Complex, a group of six wild coffee (Coffea) species native to Madagascar. Two TEs from the Gypsy superfamily successfully recovered some species boundaries and geographic structure among samples, whereas a TE from the Copia superfamily did not. Notably, species occurring in evergreen moist forests of eastern and southeastern Madagascar were divergent with respect to species in other habitats and regions. Our results suggest that the peak of transpositional activity of the Gypsy and Copia TEs occurred, respectively, before and after the speciation events of the tested Madagascan species. We conclude that the utilization of active TEs has considerable potential to unravel the evolutionary history and delimitation of closely related Coffea species. However, the selection of TE needs to be experimentally tested, since each element has its own evolutionary history. Different TEs with similar copy number in a given species can render different dendrograms; thus copy number is not a good selection criterion to attain phylogenetic resolution. PMID:26231981

  3. Transposable Elements and Their KRAB-ZFP Controllers Regulate Gene Expression in Adult Tissues.

    Science.gov (United States)

    Ecco, Gabriela; Cassano, Marco; Kauzlaric, Annamaria; Duc, Julien; Coluccio, Andrea; Offner, Sandra; Imbeault, Michaël; Rowe, Helen M; Turelli, Priscilla; Trono, Didier

    2016-03-21

    KRAB-containing zinc finger proteins (KRAB-ZFPs) are early embryonic controllers of transposable elements (TEs), which they repress with their cofactor KAP1 through histone and DNA methylation, a process thought to result in irreversible silencing. Using a target-centered functional screen, we matched murine TEs with their cognate KRAB-ZFP. We found the paralogs ZFP932 and Gm15446 to bind overlapping but distinguishable subsets of ERVK (endogenous retrovirus K), repress these elements in embryonic stem cells, and regulate secondarily the expression of neighboring genes. Most importantly, we uncovered that these KRAB-ZFPs and KAP1 control TEs in adult tissues, in cell culture and in vivo, where they partner up to modulate cellular genes. Therefore, TEs and KRAB-ZFPs establish transcriptional networks that likely regulate not only development but also many physiological events. Given the high degree of species specificity of TEs and KRAB-ZFPs, these results have important implications for understanding the biology of higher vertebrates, including humans. PMID:27003935

  4. Analysis of transposable elements in the genome of Asparagus officinalis from high coverage sequence data.

    Directory of Open Access Journals (Sweden)

    Shu-Fen Li

    Full Text Available Asparagus officinalis is an economically and nutritionally important vegetable crop that is widely cultivated and is used as a model dioecious species to study plant sex determination and sex chromosome evolution. To improve our understanding of its genome composition, especially with respect to transposable elements (TEs, which make up the majority of the genome, we performed Illumina HiSeq2000 sequencing of both male and female asparagus genomes followed by bioinformatics analysis. We generated 17 Gb of sequence (12×coverage and assembled them into 163,406 scaffolds with a total cumulated length of 400 Mbp, which represent about 30% of asparagus genome. Overall, TEs masked about 53% of the A. officinalis assembly. Majority of the identified TEs belonged to LTR retrotransposons, which constitute about 28% of genomic DNA, with Ty1/copia elements being more diverse and accumulated to higher copy numbers than Ty3/gypsy. Compared with LTR retrotransposons, non-LTR retrotransposons and DNA transposons were relatively rare. In addition, comparison of the abundance of the TE groups between male and female genomes showed that the overall TE composition was highly similar, with only slight differences in the abundance of several TE groups, which is consistent with the relatively recent origin of asparagus sex chromosomes. This study greatly improves our knowledge of the repetitive sequence construction of asparagus, which facilitates the identification of TEs responsible for the early evolution of plant sex chromosomes and is helpful for further studies on this dioecious plant.

  5. Analysis of transposable elements in the genome of Asparagus officinalis from high coverage sequence data.

    Science.gov (United States)

    Li, Shu-Fen; Gao, Wu-Jun; Zhao, Xin-Peng; Dong, Tian-Yu; Deng, Chuan-Liang; Lu, Long-Dou

    2014-01-01

    Asparagus officinalis is an economically and nutritionally important vegetable crop that is widely cultivated and is used as a model dioecious species to study plant sex determination and sex chromosome evolution. To improve our understanding of its genome composition, especially with respect to transposable elements (TEs), which make up the majority of the genome, we performed Illumina HiSeq2000 sequencing of both male and female asparagus genomes followed by bioinformatics analysis. We generated 17 Gb of sequence (12×coverage) and assembled them into 163,406 scaffolds with a total cumulated length of 400 Mbp, which represent about 30% of asparagus genome. Overall, TEs masked about 53% of the A. officinalis assembly. Majority of the identified TEs belonged to LTR retrotransposons, which constitute about 28% of genomic DNA, with Ty1/copia elements being more diverse and accumulated to higher copy numbers than Ty3/gypsy. Compared with LTR retrotransposons, non-LTR retrotransposons and DNA transposons were relatively rare. In addition, comparison of the abundance of the TE groups between male and female genomes showed that the overall TE composition was highly similar, with only slight differences in the abundance of several TE groups, which is consistent with the relatively recent origin of asparagus sex chromosomes. This study greatly improves our knowledge of the repetitive sequence construction of asparagus, which facilitates the identification of TEs responsible for the early evolution of plant sex chromosomes and is helpful for further studies on this dioecious plant. PMID:24810432

  6. terMITEs: miniature inverted-repeat transposable elements (MITEs) in the termite genome (Blattodea: Termitoidae).

    Science.gov (United States)

    Luchetti, Andrea

    2015-08-01

    Transposable elements (TEs) are discrete DNA sequences which are able to replicate and jump into different genomic locations. Miniature inverted-repeats TEs (MITEs) are non-autonomous DNA elements whose origin is still poorly understood. Recently, some MITEs were found to contain core repeats that can be arranged in tandem arrays; in some instances, these arrays have even given rise to satellite DNAs in the (peri)centromeric region of the host chromosomes. I report the discovery and analysis of three new MITEs found in the genome of several termite species (hence the name terMITEs) in two different families. For two of the MITEs (terMITE1-Tc1/mariner superfamily; terMITE2-piggyBac superfamily), evidence of past mobility was retrieved. Moreover, these two MITEs contained core repeats, 16 bp and 114 bp long respectively, exhibiting copy number variation. In terMITE2, the tandem duplication appeared associated with element degeneration, in line with a recently proposed evolutionary model on MITEs and the origin of tandem arrays. Concerning their genomic distribution, terMITE1 and terMITE3 appeared more frequently inserted close to coding regions while terMITE2 was mostly associated with TEs. Although MITEs are commonly distributed in coding regions, terMITE2 distribution is in line with that of other insects' piggyBac-related elements and of other small TEs found in termite genomes. This has been explained through insertional preference rather than through selective processes. Data presented here add to the knowledge on the poorly exploited polyneopteran genomes and will provide an interesting framework in which to study TEs' evolution and host's life history traits. PMID:25711308

  7. The mechanism of ageing: primary role of transposable elements in genome disintegration.

    Science.gov (United States)

    Sturm, Ádám; Ivics, Zoltán; Vellai, Tibor

    2015-05-01

    Understanding the molecular basis of ageing remains a fundamental problem in biology. In multicellular organisms, while the soma undergoes a progressive deterioration over the lifespan, the germ line is essentially immortal as it interconnects the subsequent generations. Genomic instability in somatic cells increases with age, and accumulating evidence indicates that the disintegration of somatic genomes is accompanied by the mobilisation of transposable elements (TEs) that, when mobilised, can be mutagenic by disrupting coding or regulatory sequences. In contrast, TEs are effectively silenced in the germ line by the Piwi-piRNA system. Here, we propose that TE repression transmits the persistent proliferation capacity and the non-ageing phenotype (e.g., preservation of genomic integrity) of the germ line. The Piwi-piRNA pathway also operates in tumorous cells and in somatic cells of certain organisms, including hydras, which likewise exhibit immortality. However, in somatic cells lacking the Piwi-piRNA pathway, gradual chromatin decondensation increasingly allows the mobilisation of TEs as the organism ages. This can explain why the mortality rate rises exponentially throughout the adult life in most animal species, including humans. PMID:25837999

  8. Phylogenetic and Genomic Analyses Resolve the Origin of Important Plant Genes Derived from Transposable Elements.

    Science.gov (United States)

    Joly-Lopez, Zoé; Hoen, Douglas R; Blanchette, Mathieu; Bureau, Thomas E

    2016-08-01

    Once perceived as merely selfish, transposable elements (TEs) are now recognized as potent agents of adaptation. One way TEs contribute to evolution is through TE exaptation, a process whereby TEs, which persist by replicating in the genome, transform into novel host genes, which persist by conferring phenotypic benefits. Known exapted TEs (ETEs) contribute diverse and vital functions, and may facilitate punctuated equilibrium, yet little is known about this process. To better understand TE exaptation, we designed an approach to resolve the phylogenetic context and timing of exaptation events and subsequent patterns of ETE diversification. Starting with known ETEs, we search in diverse genomes for basal ETEs and closely related TEs, carefully curate the numerous candidate sequences, and infer detailed phylogenies. To distinguish TEs from ETEs, we also weigh several key genomic characteristics including repetitiveness, terminal repeats, pseudogenic features, and conserved domains. Applying this approach to the well-characterized plant ETEs MUG and FHY3, we show that each group is paraphyletic and we argue that this pattern demonstrates that each originated in not one but multiple exaptation events. These exaptations and subsequent ETE diversification occurred throughout angiosperm evolution including the crown group expansion, the angiosperm radiation, and the primitive evolution of angiosperms. In addition, we detect evidence of several putative novel ETE families. Our findings support the hypothesis that TE exaptation generates novel genes more frequently than is currently thought, often coinciding with key periods of evolution. PMID:27189548

  9. Mobility properties of the Hermes transposable element in transgenic lines of Aedes aegypti.

    Science.gov (United States)

    Smith, Ryan C; Atkinson, Peter W

    2011-01-01

    The Hermes transposable element has been used to genetically transform a wide range of insect species, including the mosquito, Aedes aegypti, a vector of several important human pathogens. Hermes integrations into the mosquito germline are characterized by the non-canonical integration of the transposon and flanking plasmid and, once integrated, Hermes is stable in the presence of its transposase. In an effort to improve the post-integration mobility of Hermes in the germline of Ae. aegypti, a transgenic helper Mos1 construct expressing Hermes transposase under the control of a testis-specific promoter was crossed to a separate transgenic strain containing a target Hermes transposon. In less than 1% of the approximately 1,500 progeny from jumpstarter lines analyzed, evidence of putative Hermes germline remobilizations were detected. These recovered transposition events occur through an aberrant mechanism and provide insight into the non-canonical cut-and-paste transposition of Hermes in the germ line of Ae. aegypti. PMID:20596755

  10. Patterns of repeat-induced point mutation in transposable elements of basidiomycete fungi.

    Science.gov (United States)

    Horns, Felix; Petit, Elsa; Yockteng, Roxana; Hood, Michael E

    2012-01-01

    Transposable elements (TEs) are ubiquitous genomic parasites that have prompted the evolution of genome defense systems that restrict their activity. Repeat-induced point mutation (RIP) is a homology-dependent genome defense that introduces C-to-T transition mutations in duplicated DNA sequences and is thought to control the proliferation of selfish repetitive DNA. Here, we determine the taxonomic distribution of hypermutation patterns indicative of RIP among basidiomycetes. We quantify C-to-T transition mutations in particular di- and trinucleotide target sites for TE-like sequences from nine fungal genomes. We find evidence of RIP-like patterns of hypermutation at TpCpG trinucleotide sites in repetitive sequences from all species of the Pucciniomycotina subphylum of the Basidiomycota, Microbotryum lychnidis-dioicae, Puccinia graminis, Melampsora laricis-populina, and Rhodotorula graminis. In contrast, we do not find evidence for RIP-like hypermutation in four species of the Agaricomycotina and Ustilaginomycotina subphyla of the Basidiomycota. Our results suggest that a RIP-like process and the specific nucleotide context for mutations are conserved within the Pucciniomycotina subphylum. These findings imply that coevolutionary interactions between TEs and a hypermutating genome defense are stable over long evolutionary timescales. PMID:22250128

  11. A Snapshot of Histone Modifications within Transposable Elements in Drosophila Wild Type Strains

    Science.gov (United States)

    Rebollo, Rita; Horard, Béatrice; Begeot, Flora; Delattre, Marion; Gilson, Eric; Vieira, Cristina

    2012-01-01

    Transposable elements (TEs) are a major source of genetic variability in genomes, creating genetic novelty and driving genome evolution. Analysis of sequenced genomes has revealed considerable diversity in TE families, copy number, and localization between different, closely related species. For instance, although the twin species Drosophila melanogaster and D. simulans share the same TE families, they display different amounts of TEs. Furthermore, previous analyses of wild type derived strains of D. simulans have revealed high polymorphism regarding TE copy number within this species. Several factors may influence the diversity and abundance of TEs in a genome, including molecular mechanisms such as epigenetic factors, which could be a source of variation in TE success. In this paper, we present the first analysis of the epigenetic status of four TE families (roo, tirant, 412 and F) in seven wild type strains of D. melanogaster and D. simulans. Our data shows intra- and inter-specific variations in the histone marks that adorn TE copies. Our results demonstrate that the chromatin state of common TEs varies among TE families, between closely related species and also between wild type strains. PMID:22962605

  12. Transposable elements, a treasure trove to decipher epigenetic variation: insights from Arabidopsis and crop epigenomes.

    Science.gov (United States)

    Mirouze, Marie; Vitte, Clémentine

    2014-06-01

    In the past decade, plant biologists and breeders have developed a growing interest in the field of epigenetics, which is defined as the study of heritable changes in gene expression that cannot be explained by changes in the DNA sequence. Epigenetic marks can be responsive to the environment, and evolve faster than genetic changes. Therefore, epigenetic diversity may represent an unexplored resource of natural variation that could be used in plant breeding programmes. On the other hand, crop genomes are largely populated with transposable elements (TEs) that are efficiently targeted by epigenetic marks, and part of the epigenetic diversity observed might be explained by TE polymorphisms. Characterizing the degree to which TEs influence epigenetic variation in crops is therefore a major goal to better use epigenetic variation. To date, epigenetic analyses have been mainly focused on the model plant Arabidopsis thaliana, and have provided clues on epigenome features, components that silence pathways, and effects of silencing impairment. But to what extent can Arabidopsis be used as a model for the epigenomics of crops? In this review, we discuss the similarities and differences between the epigenomes of Arabidopsis and crops. We explore the relationship between TEs and epigenomes, focusing on TE silencing control and escape, and the impact of TE mobility on epigenomic variation. Finally, we provide insights into challenges to tackle, and future directions to take in the route towards using epigenetic diversity in plant breeding programmes. PMID:24744427

  13. Interstrain crosses enhance excision of Tc1 transposable elements in Caenorhabditis elegans.

    Science.gov (United States)

    Mori, I; Moerman, D G; Waterston, R H

    1990-01-01

    We report here an unusual activation of the Tc1 transposable element system in Caenorhabditis elegans. Germline Tc1 activity, as measured by reversion of unc-22::Tc1 alleles, is elevated 50- to 100-fold by certain crosses. For example, unc-22::Tc1 reversion is 1 x 10(-3) in a mut-6 IV strain and less than 1 x 10(-6) in a non-mutator strain, but in the unc-22::Tc1 progeny of a cross between mut-6 hermaphrodites and non-mutator males, reversion is 10(-1). The reciprocal cross does not induce this enhancement of reversion. Results similar to those for mut-6 were obtained using a mut-5 II strain. The mutator hermaphrodite by nonmutator male cross per se is not required for the enhancement of reversion, as mut-5 hermaphrodites x mut-6/+ males also induce unc-22 revertants at an elevated frequency. This reversion enhancement appears to depend on a maternal component inherited from a mutator strain, suggesting that the regulation of Tc1 activity may be complex. PMID:2157953

  14. Identification and characterization of CACTA transposable elements capturing gene fragments in maize

    Institute of Scientific and Technical Information of China (English)

    LI Qing; LI Lin; DAI JingRui; LI JianSheng; YAN JianBing

    2009-01-01

    Transposable elements (TEs)-mediated gene sequence movement is thought to play an important role in genome expansion and origin of genes with novel functions. In this study, a gene, HGGT, involved in vitamin E synthesis was used in a case study to discover and characterize transposons carrying gene fragments in maize. A total of 69 transposons that are distributed across the 10 chromosomes and have an average length of 3689 bp were identified from the maize sequence database by using the BLAST search algorithm. Three of these carry gene fragments from the progenitor HGGT gene, while the rest (66) contain gene fragments from other cellular genes. Nine of the 69 transposons contain fragments derived from two locations in the genome. By querying the maize Expressed Sequence Tag (EST) da-tabase, we found that at least thirteen out of the 69 TEs had corresponding transcripts. More interest-ingly, two transposons that carry gene fragments from two different chromosomal loci could be ex-pressed as chimeric transcripts.

  15. Transduplication resulted in the incorporation of two protein-coding sequences into the Turmoil-1 transposable element of C. elegans

    Directory of Open Access Journals (Sweden)

    Pupko Tal

    2008-10-01

    Full Text Available Abstract Transposable elements may acquire unrelated gene fragments into their sequences in a process called transduplication. Transduplication of protein-coding genes is common in plants, but is unknown of in animals. Here, we report that the Turmoil-1 transposable element in C. elegans has incorporated two protein-coding sequences into its inverted terminal repeat (ITR sequences. The ITRs of Turmoil-1 contain a conserved RNA recognition motif (RRM that originated from the rsp-2 gene and a fragment from the protein-coding region of the cpg-3 gene. We further report that an open reading frame specific to C. elegans may have been created as a result of a Turmoil-1 insertion. Mutations at the 5' splice site of this open reading frame may have reactivated the transduplicated RRM motif. Reviewers This article was reviewed by Dan Graur and William Martin. For the full reviews, please go to the Reviewers' Reports section.

  16. Microsporidian Genomes Harbor a Diverse Array of Transposable Elements that Demonstrate an Ancestry of Horizontal Exchange with Metazoans

    OpenAIRE

    Parisot, Nicolas; Pelin, Adrian; Gasc , Cyrielle; Polonais, Valérie; Belkorchia, Abdel; Panek, Johan; El Alaoui, Hicham; Biron, David G.; Brasset, Émilie; Vaury, Chantal; Peyret, Pierre; Corradi, Nicolas; Peyretaillade, Éric; LERAT, Emmanuelle

    2014-01-01

    Microsporidian genomes are the leading models to understand the streamlining in response to a pathogenic lifestyle; they are gene-poor and often possess small genomes. In this study, we show a feature of microsporidian genomes that contrasts this pattern of genome reduction. Specifically, genome investigations targeted at Anncaliia algerae, a human pathogen with a genome size of 23 Mb, revealed the presence of a hitherto undetected diversity in transposable elements (TEs). A total of 240 TE f...

  17. Evolutionary genomics of miniature inverted-repeat transposable elements (MITEs) in Brassica.

    Science.gov (United States)

    Nouroz, Faisal; Noreen, Shumaila; Heslop-Harrison, J S

    2015-12-01

    Miniature inverted-repeat transposable elements (MITEs) are truncated derivatives of autonomous DNA transposons, and are dispersed abundantly in most eukaryotic genomes. We aimed to characterize various MITEs families in Brassica in terms of their presence, sequence characteristics and evolutionary activity. Dot plot analyses involving comparison of homoeologous bacterial artificial chromosome (BAC) sequences allowed identification of 15 novel families of mobile MITEs. Of which, 5 were Stowaway-like with TA Target Site Duplications (TSDs), 4 Tourist-like with TAA/TTA TSDs, 5 Mutator-like with 9-10 bp TSDs and 1 novel MITE (BoXMITE1) flanked by 3 bp TSDs. Our data suggested that there are about 30,000 MITE-related sequences in Brassica rapa and B. oleracea genomes. In situ hybridization showed one abundant family was dispersed in the A-genome, while another was located near 45S rDNA sites. PCR analysis using primers flanking sequences of MITE elements detected MITE insertion polymorphisms between and within the three Brassica (AA, BB, CC) genomes, with many insertions being specific to single genomes and others showing evidence of more recent evolutionary insertions. Our BAC sequence comparison strategy enables identification of evolutionarily active MITEs with no prior knowledge of MITE sequences. The details of MITE families reported in Brassica enable their identification, characterization and annotation. Insertion polymorphisms of MITEs and their transposition activity indicated important mechanism of genome evolution and diversification. MITE families derived from known Mariner, Harbinger and Mutator DNA transposons were discovered, as well as some novel structures. The identification of Brassica MITEs will have broad applications in Brassica genomics, breeding, hybridization and phylogeny through their use as DNA markers. PMID:26129767

  18. International Congress on Transposable Elements (ICTE 2012 in Saint Malo and the sea of TE stories

    Directory of Open Access Journals (Sweden)

    Ainouche Abdelkader

    2012-10-01

    Full Text Available Abstract An international conference on Transposable Elements (TEs was held 21–24 April 2012 in Saint Malo, France. Organized by the French Transposition Community (GDR Elements Génétiques Mobiles et Génomes, CNRS and the French Society of Genetics (SFG, the conference’s goal was to bring together researchers from around the world who study transposition in diverse organisms using multiple experimental approaches. The meeting drew more than 217 attendees and most contributed through poster presentations (117, invited talks and short talks selected from poster abstracts (48 in total. The talks were organized into four scientific sessions, focused on: impact of TEs on genomes, control of transposition, evolution of TEs and mechanisms of transposition. Here, we present highlights from the talks given during the platform sessions. The conference was sponsored by Alliance pour les sciences de la vie et de la santé (Aviesan, Centre national de la recherche scientifique (CNRS, Institut national de la santé et de la recherche médicale (INSERM, Institut de recherche pour le développement (IRD, Institut national de la recherche agronomique (INRA, Université de Perpignan, Université de Rennes 1, Région Bretagne and Mobile DNA. Chair of the organization committee Jean-Marc Deragon Organizers Abdelkader Ainouche, Mireille Bétermier, Mick Chandler, Richard Cordaux, Gaël Cristofari, Jean-Marc Deragon, Pascale Lesage, Didier Mazel, Olivier Panaud, Hadi Quesneville, Chantal Vaury, Cristina Vieira and Clémentine Vitte

  19. Annotation and sequence diversity of transposable elements in common bean (Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    Scott eJackson

    2014-07-01

    Full Text Available Common bean (Phaseolus vulgaris is an important legume crop grown and consumed worldwide. With the availability of the common bean genome sequence, the next challenge is to annotate the genome and characterize functional DNA elements. Transposable elements (TEs are the most abundant component of plant genomes and can dramatically affect genome evolution and genetic variation. Thus, it is pivotal to identify TEs in the common bean genome. In this study, we performed a genome-wide transposon annotation in common bean using a combination of homology and sequence structure-based methods. We developed a 2.12-Mb transposon database which includes 791 representative transposon sequences and is available upon request or from www.phytozome.org. Of note, nearly all transposons in the database are previously unrecognized TEs. More than 5,000 transposon-related expressed sequence tags (ESTs were detected which indicates that some transposons may be transcriptionally active. Two Ty1-copia retrotransposon families were found to encode the envelope-like protein which has rarely been identified in plant genomes. Also, we identified an extra open reading frame (ORF termed ORF2 from 15 Ty3-gypsy families that was located between the ORF encoding the retrotransposase and the 3’LTR. The ORF2 was in opposite transcriptional orientation to retrotransposase. Sequence homology searches and phylogenetic analysis suggested that the ORF2 may have an ancient origin, but its function is not clear. This transposon data provides a useful resource for understanding the genome organization and evolution and may be used to identify active TEs for developing transposon-tagging system in common bean and other related genomes.

  20. Characterization of active miniature inverted-repeat transposable elements in the peanut genome.

    Science.gov (United States)

    Shirasawa, Kenta; Hirakawa, Hideki; Tabata, Satoshi; Hasegawa, Makoto; Kiyoshima, Hiroyuki; Suzuki, Sigeru; Sasamoto, Sigemi; Watanabe, Akiko; Fujishiro, Tsunakazu; Isobe, Sachiko

    2012-05-01

    Miniature inverted-repeat transposable elements (MITEs), some of which are known as active nonautonomous DNA transposons, are found in the genomes of plants and animals. In peanut (Arachis hypogaea), Ah-MITE1 has been identified in a gene for fatty-acid desaturase, and possessed excision activity. However, the AhMITE1 distribution and frequency of excision have not been determined for the peanut genome. In order to characterize AhMITE1s, their genomic diversity and transposition ability was investigated. Southern blot analysis indicated high AhMITE1 copy number in the genomes of A. hypogaea, A. magna and A. monticola, but not in A. duranensis. A total of 504 AhMITE1s were identified from the MITE-enriched genomic libraries of A. hypogaea. The representative AhMITE1s exhibited a mean length of 205.5 bp and a GC content of 30.1%, with AT-rich, 9 bp target site duplications and 25 bp terminal inverted repeats. PCR analyses were performed using primer pairs designed against both flanking sequences of each AhMITE1. These analyses detected polymorphisms at 169 out of 411 insertional loci in the four peanut lines. In subsequent analyses of 60 gamma-irradiated mutant lines, four Ah-MITE1 excisions showed footprint mutations at the 109 loci tested. This study characterizes AhMITE1s in peanut and discusses their use as DNA markers and mutagens for the genetics, genomics and breeding of peanut and its relatives. PMID:22294450

  1. Transcriptional activity, chromosomal distribution and expression effects of transposable elements in Coffea genomes.

    Directory of Open Access Journals (Sweden)

    Fabrício R Lopes

    Full Text Available Plant genomes are massively invaded by transposable elements (TEs, many of which are located near host genes and can thus impact gene expression. In flowering plants, TE expression can be activated (de-repressed under certain stressful conditions, both biotic and abiotic, as well as by genome stress caused by hybridization. In this study, we examined the effects of these stress agents on TE expression in two diploid species of coffee, Coffea canephora and C. eugenioides, and their allotetraploid hybrid C. arabica. We also explored the relationship of TE repression mechanisms to host gene regulation via the effects of exonized TE sequences. Similar to what has been seen for other plants, overall TE expression levels are low in Coffea plant cultivars, consistent with the existence of effective TE repression mechanisms. TE expression patterns are highly dynamic across the species and conditions assayed here are unrelated to their classification at the level of TE class or family. In contrast to previous results, cell culture conditions per se do not lead to the de-repression of TE expression in C. arabica. Results obtained here indicate that differing plant drought stress levels relate strongly to TE repression mechanisms. TEs tend to be expressed at significantly higher levels in non-irrigated samples for the drought tolerant cultivars but in drought sensitive cultivars the opposite pattern was shown with irrigated samples showing significantly higher TE expression. Thus, TE genome repression mechanisms may be finely tuned to the ideal growth and/or regulatory conditions of the specific plant cultivars in which they are active. Analysis of TE expression levels in cell culture conditions underscored the importance of nonsense-mediated mRNA decay (NMD pathways in the repression of Coffea TEs. These same NMD mechanisms can also regulate plant host gene expression via the repression of genes that bear exonized TE sequences.

  2. A transposable element insertion in APOB causes cholesterol deficiency in Holstein cattle.

    Science.gov (United States)

    Menzi, F; Besuchet-Schmutz, N; Fragnière, M; Hofstetter, S; Jagannathan, V; Mock, T; Raemy, A; Studer, E; Mehinagic, K; Regenscheit, N; Meylan, M; Schmitz-Hsu, F; Drögemüller, C

    2016-04-01

    Cholesterol deficiency, a new autosomal recessive inherited genetic defect in Holstein cattle, has been recently reported to have an influence on the rearing success of calves. The affected animals show unresponsive diarrhea accompanied by hypocholesterolemia and usually die within the first weeks or months of life. Here, we show that whole genome sequencing combined with the knowledge about the pedigree and inbreeding status of a livestock population facilitates the identification of the causative mutation. We resequenced the entire genomes of an affected calf and a healthy partially inbred male carrying one copy of the critical 2.24-Mb chromosome 11 segment in its ancestral state and one copy of the same segment with the cholesterol deficiency mutation. We detected a single structural variant, homozygous in the affected case and heterozygous in the non-affected carrier male. The genetic makeup of this key animal provides extremely strong support for the causality of this mutation. The mutation represents a 1.3kb insertion of a transposable LTR element (ERV2-1) in the coding sequence of the APOB gene, which leads to truncated transcripts and aberrant splicing. This finding was further supported by RNA sequencing of the liver transcriptome of an affected calf. The encoded apolipoprotein B is an essential apolipoprotein on chylomicrons and low-density lipoproteins, and therefore, the mutation represents a loss of function mutation similar to autosomal recessive inherited familial hypobetalipoproteinemia-1 (FHBL1) in humans. Our findings provide a direct gene test to improve selection against this deleterious mutation in Holstein cattle. PMID:26763170

  3. Stem loop sequences specific to transposable element IS605 are found linked to lipoprotein genes in Borrelia plasmids.

    Directory of Open Access Journals (Sweden)

    Nicholas Delihas

    Full Text Available BACKGROUND: Plasmids of Borrelia species are dynamic structures that contain a large number of repetitive genes, gene fragments, and gene fusions. In addition, the transposable element IS605/200 family, as well as degenerate forms of this IS element, are prevalent. In Helicobacter pylori, flanking regions of the IS605 transposase gene contain sequences that fold into identical small stem loops. These function in transposition at the single-stranded DNA level. METHODOLOGY/PRINCIPAL FINDINGS: In work reported here, bioinformatics techniques were used to scan Borrelia plasmid genomes for IS605 transposable element specific stem loop sequences. Two variant stem loop motifs are found in the left and right flanking regions of the transposase gene. Both motifs appear to have dispersed in plasmid genomes and are found "free-standing" and phylogenetically conserved without the associated IS605 transposase gene or the adjacent flanking sequence. Importantly, IS605 specific stem loop sequences are also found at the 3' ends of lipoprotein genes (PFam12 and PFam60, however the left and right sequences appear to develop their own evolutionary patterns. The lipoprotein gene-linked left stem loop sequences maintain the IS605 stem loop motif in orthologs but only at the RNA level. These show mutations whereby variants fold into phylogenetically conserved RNA-type stem loops that contain the wobble non-Watson-Crick G-U base-pairing. The right flanking sequence is associated with the family lipoprotein-1 genes. A comparison of homologs shows that the IS605 stem loop motif rapidly dissipates, but a more elaborate secondary structure appears to develop in its place. CONCLUSIONS/SIGNIFICANCE: Stem loop sequences specific to the transposable element IS605 are present in plasmid regions devoid of a transposase gene and significantly, are found linked to lipoprotein genes in Borrelia plasmids. These sequences are evolutionarily conserved and/or structurally developed in

  4. Benchmarks for transcript assembly and differential gene expression (new isoforms) analysis in the context of transposable elements

    OpenAIRE

    Alaeitabar, Tina; Francillonne, Nicolas; LOAEC, Mikaël; Quesneville, Hadi; Amselem, Joelle

    2015-01-01

    The existence of multiple TSS for a gene is a key event to create diversity and flexibility in the regulation of gene expression under differential conditions (biotic or abiotic). The genomes of most eukaryotes are composed of transposable elements (TEs). TEs are also reported to be carrier of significant signals for the initiation of RNA synthesis and processing. Thus, the presence/absence of TE near the 5’ region of a gene may have a role in creation of new TSS leading to the expression of ...

  5. ReAS: Recovery of ancestral sequences for transposable elements from the unassembled reads of a whole genome shotgun.

    Directory of Open Access Journals (Sweden)

    Ruiqiang Li

    2005-09-01

    Full Text Available We describe an algorithm, ReAS, to recover ancestral sequences for transposable elements (TEs from the unassembled reads of a whole genome shotgun. The main assumptions are that these TEs must exist at high copy numbers across the genome and must not be so old that they are no longer recognizable in comparison to their ancestral sequences. Tested on the japonica rice genome, ReAS was able to reconstruct all of the high copy sequences in the Repbase repository of known TEs, and increase the effectiveness of RepeatMasker in identifying TEs from genome sequences.

  6. DcSto, stowaway-like miniature inverted-repeat transposable elements (MITEs), are abundant and polymorphic in the carrot genome

    Science.gov (United States)

    Transposable elements constitute a large fraction of plant genomes and strongly influence gene and genome evolution. Stowaway elements, a group of MITEs present in high copy number, are preferentially located in the vicinity of coding regions. Stowaway elements are characterized by short length, sim...

  7. A comparative analysis of the amounts and dynamics of transposable elements in natural populations of Drosophila melanogaster and Drosophila simulans

    International Nuclear Information System (INIS)

    Genes are important in defining genetic variability, but they do not constitute the largest component of genomes, which in most organisms contain large amounts of various repeated sequences including transposable elements (TEs), which have been shown to account for most of the genome size. TEs contribute to genetic diversity by their mutational potential as a result of their ability to insert into genes or gene regulator regions, to promote chromosomal rearrangements, and to interfere with gene networks. Also, TEs may be activated by environmental stresses (such as temperature or radiation) that interfere with epigenetic regulation systems, and makes them powerful mutation agents in nature. To understand the relationship between genotype and phenotype, we need to analyze the portions of the genome corresponding to TEs in great detail, and to decipher their relationships with the genes. For this purpose, we carried out comparative analyses of various natural populations of the closely-related species Drosophila melanogaster and Drosophila simulans, which differ with regard to their TE amounts as well as their ecology and population size. - Highlights: ► Transposable elements (TE) are source of genetic novelty and affect genome regulation. ► Environment can affect regulation of TE and thus have an impact on genome. ► Natural populations are natural laboratories to measure the impact of environment.

  8. Evolutionary histories of transposable elements in the genome of the largest living marsupial carnivore, the Tasmanian devil.

    Science.gov (United States)

    Gallus, Susanne; Hallström, Björn M; Kumar, Vikas; Dodt, William G; Janke, Axel; Schumann, Gerald G; Nilsson, Maria A

    2015-05-01

    The largest living carnivorous marsupial, the Tasmanian devil (Sarcophilus harrisii), is the sole survivor of a lineage originating about 12 Ma. We set out to investigate the spectrum of transposable elements found in the Tasmanian devil genome, the first high-coverage genome of an Australian marsupial. Marsupial genomes have been shown to have the highest amount of transposable elements among vertebrates. We analyzed the horizontally transmitted DNA transposons OC1 and hAT-1_MEu in the Tasmanian devil genome. OC1 is present in all carnivorous marsupials, while having a very limited distribution among the remaining Australian marsupial orders. In contrast, hAT-1_MEu is present in all Australian marsupial orders, and has so far only been identified in a few placental mammals. We screened 158 introns for phylogenetically informative retrotransposons in the order Dasyuromorphia, and found that the youngest SINE (Short INterspersed Element), WSINE1, is no longer active in the subfamily Dasyuridae. The lack of detectable WSINE1 activity in this group may be due to a retrotransposon inactivation event approximately 30 Ma. We found that the Tasmanian devil genome contains a relatively low number of continuous full-length LINE-1 (Long INterspersed Element 1, L1) retrotransposons compared with the opossum genome. Furthermore, all L1 elements in the Tasmanian devil appeared to be nonfunctional. Hidden Markov Model approaches suggested that other potential sources of functional reverse transcriptase are absent from the genome. We discuss the issues associated with assembling long, highly similar L1 copies from short read Illumina data and describe how assembly artifacts can potentially lead to erroneous conclusions. PMID:25633377

  9. Losing identity: structural diversity of transposable elements belonging to different classes in the genome of Anopheles gambiae

    Directory of Open Access Journals (Sweden)

    Fernández-Medina Rita D

    2012-06-01

    Full Text Available Abstract Background Transposable elements (TEs, both DNA transposons and retrotransposons, are genetic elements with the main characteristic of being able to mobilize and amplify their own representation within genomes, utilizing different mechanisms of transposition. An almost universal feature of TEs in eukaryotic genomes is their inability to transpose by themselves, mainly as the result of sequence degeneration (by either mutations or deletions. Most of the elements are thus either inactive or non-autonomous. Considering that the bulk of some eukaryotic genomes derive from TEs, they have been conceived as “TE graveyards.” It has been shown that once an element has been inactivated, it progressively accumulates mutations and deletions at neutral rates until completely losing its identity or being lost from the host genome; however, it has also been shown that these “neutral sequences” might serve as raw material for domestication by host genomes. Results We have analyzed the sequence structural variations, nucleotide divergence, and pattern of insertions and deletions of several superfamilies of TEs belonging to both class I (long terminal repeats [LTRs] and non-LTRs [NLTRs] and II in the genome of Anopheles gambiae, aiming at describing the landscape of deterioration of these elements in this particular genome. Our results describe a great diversity in patterns of deterioration, indicating lineage-specific differences including the presence of Solo-LTRs in the LTR lineage, 5′-deleted NLTRs, and several non-autonomous and MITEs in the class II families. Interestingly, we found fragments of NLTRs corresponding to the RT domain, which preserves high identity among them, suggesting a possible remaining genomic role for these domains. Conclusions We show here that the TEs in the An. gambiae genome deteriorate in different ways according to the class to which they belong. This diversity certainly has implications not only at the host

  10. Activation of Tag1 transposable elements in Arabidopsis dedifferentiating cells and their regulation by CHROMOMETHYLASE 3-mediated CHG methylation.

    Science.gov (United States)

    Khan, Asif; Yadav, Narendra Singh; Morgenstern, Yaakov; Zemach, Assaf; Grafi, Gideon

    2016-10-01

    Dedifferentiation, that is, the acquisition of stem cell-like state, commonly induced by stress (e.g., protoplasting), is characterized by open chromatin conformation, a chromatin state that could lead to activation of transposable elements (TEs). Here, we studied the activation of the Arabidopsis class II TE Tag1, in which two copies, situated close to each other (near genes) on chromosome 1 are found in Landsberg erecta (Ler) but not in Columbia (Col). We first transformed protoplasts with a construct in which a truncated Tag1 (ΔTag1 non-autonomous) blocks the expression of a reporter gene AtMBD5-GFP and found a relatively high ectopic excision of ΔTag1 accompanied by expression of AtMBD5-GFP in protoplasts derived from Ler compared to Col; further increase was observed in ddm1 (decrease in DNA methylation1) protoplasts (Ler background). Ectopic excision was associated with transcription of the endogenous Tag1 and changes in histone H3 methylation at the promoter region. Focusing on the endogenous Tag1 elements we found low level of excision in Ler protoplasts, which was slightly and strongly enhanced in ddm1 and cmt3 (chromomethylase3) protoplasts, respectively, concomitantly with reduction in Tag1 gene body (GB) CHG methylation and increased Tag1 transcription; strong activation of Tag1 was also observed in cmt3 leaves. Notably, in cmt3, but not in ddm1, Tag1 elements were excised out from their original sites and transposed elsewhere in the genome. Our results suggest that dedifferentiation is associated with Tag1 activation and that CMT3 rather than DDM1 plays a central role in restraining Tag1 activation via inducing GB CHG methylation. PMID:27475038

  11. Efficient transposition of the youngest miniature inverted repeat transposable element family of yellow fever mosquito in yeast.

    Science.gov (United States)

    Fattash, Isam; Lee, Chia-Ni; Mo, Kaiguo; Yang, Guojun

    2015-05-01

    Miniature inverted repeat transposable elements (MITEs) are often the most numerous DNA transposons in plant and animal genomes. The dramatic amplification of MITE families during evolution is puzzling, because the transposase sources for the vast majority of MITE families are unknown. The yellow fever mosquito genome contains > 220-Mb MITE sequences; however, transposition activity has not been demonstrated for any of the MITE families. The Gnome elements are the youngest MITE family in this genome, with at least 116 identical copies. To test whether the putative autonomous element Ozma is capable of mobilizing Gnome and its two sibling MITEs, analyses were performed in a yeast transposition assay system. Whereas the wild-type transposase resulted in very low transposition activity, mutations in the region containing a putative nuclear export signal motif resulted in a dramatic (at least 4160-fold) increase in transposition frequency. We have also demonstrated that each residue of the novel DD37E motif is required for the activity of the Ozma transposase. Footprint sequences left at the donor sites suggest that the transposase may cleave between the second and the third nucleotides from the 5' ends of the elements. The excised elements reinsert specifically at dinucleotide 'TA', ~ 55% of them in yeast genes. The elements described in this article could potentially be useful as genetic tools for genetic manipulation of mosquitoes. PMID:25754725

  12. Genotype-dependent Burst of Transposable Element Expression in Crowns of Hexaploid Wheat (Triticum aestivum L. during Cold Acclimation

    Directory of Open Access Journals (Sweden)

    Debbie Laudencia-Chingcuanco

    2012-01-01

    Full Text Available The expression of 1,613 transposable elements (TEs represented in the Affymetrix Wheat Genome Chip was examined during cold treatment in crowns of four hexaploid wheat genotypes that vary in tolerance to cold and in flowering time. The TE expression profiles showed a constant level of expression throughout the experiment in three of the genotypes. In winter Norstar, the most cold-hardy of the four genotypes, a subset of the TEs showed a burst of expression after vernalization saturation was achieved. About 47% of the TEs were expressed, and both Class I (retrotransposons and Class II (DNA transposons types were well represented. Gypsy and Copia were the most represented among the retrotransposons while CACTA and Mariner were the most represented DNA transposons. The data suggests that the Vrn-A1 region plays a role in the stage-specific induction of TE expression in this genotype.

  13. Genome-wide comparative analysis of 20 miniature inverted-repeat transposable element families in Brassica rapa and B. oleracea.

    Directory of Open Access Journals (Sweden)

    Perumal Sampath

    Full Text Available Miniature inverted-repeat transposable elements (MITEs are ubiquitous, non-autonomous class II transposable elements. Here, we conducted genome-wide comparative analysis of 20 MITE families in B. rapa, B. oleracea, and Arabidopsis thaliana. A total of 5894 and 6026 MITE members belonging to the 20 families were found in the whole genome pseudo-chromosome sequences of B. rapa and B. oleracea, respectively. Meanwhile, only four of the 20 families, comprising 573 members, were identified in the Arabidopsis genome, indicating that most of the families were activated in the Brassica genus after divergence from Arabidopsis. Copy numbers varied from 4 to 1459 for each MITE family, and there was up to 6-fold variation between B. rapa and B. oleracea. In particular, analysis of intact members showed that whereas eleven families were present in similar copy numbers in B. rapa and B. oleracea, nine families showed copy number variation ranging from 2- to 16-fold. Four of those families (BraSto-3, BraTo-3, 4, 5 were more abundant in B. rapa, and the other five (BraSto-1, BraSto-4, BraTo-1, 7 and BraHAT-1 were more abundant in B. oleracea. Overall, 54% and 51% of the MITEs resided in or within 2 kb of a gene in the B. rapa and B. oleracea genomes, respectively. Notably, 92 MITEs were found within the CDS of annotated genes, suggesting that MITEs might play roles in diversification of genes in the recently triplicated Brassica genome. MITE insertion polymorphism (MIP analysis of 289 MITE members showed that 52% and 23% were polymorphic at the inter- and intra-species levels, respectively, indicating that there has been recent MITE activity in the Brassica genome. These recently activated MITE families with abundant MIP will provide useful resources for molecular breeding and identification of novel functional genes arising from MITE insertion.

  14. Large-scale genomic analysis suggests a neutral punctuated dynamics of transposable elements in bacterial genomes.

    Science.gov (United States)

    Iranzo, Jaime; Gómez, Manuel J; López de Saro, Francisco J; Manrubia, Susanna

    2014-06-01

    Insertion sequences (IS) are the simplest and most abundant form of transposable DNA found in bacterial genomes. When present in multiple copies, it is thought that they can promote genomic plasticity and genetic exchange, thus being a major force of evolutionary change. The main processes that determine IS content in genomes are, though, a matter of debate. In this work, we take advantage of the large amount of genomic data currently available and study the abundance distributions of 33 IS families in 1811 bacterial chromosomes. This allows us to test simple models of IS dynamics and estimate their key parameters by means of a maximum likelihood approach. We evaluate the roles played by duplication, lateral gene transfer, deletion and purifying selection. We find that the observed IS abundances are compatible with a neutral scenario where IS proliferation is controlled by deletions instead of purifying selection. Even if there may be some cases driven by selection, neutral behavior dominates over large evolutionary scales. According to this view, IS and hosts tend to coexist in a dynamic equilibrium state for most of the time. Our approach also allows for a detection of recent IS expansions, and supports the hypothesis that rapid expansions constitute transient events-punctuations-during which the state of coexistence of IS and host becomes perturbated. PMID:24967627

  15. Large-scale genomic analysis suggests a neutral punctuated dynamics of transposable elements in bacterial genomes.

    Directory of Open Access Journals (Sweden)

    Jaime Iranzo

    2014-06-01

    Full Text Available Insertion sequences (IS are the simplest and most abundant form of transposable DNA found in bacterial genomes. When present in multiple copies, it is thought that they can promote genomic plasticity and genetic exchange, thus being a major force of evolutionary change. The main processes that determine IS content in genomes are, though, a matter of debate. In this work, we take advantage of the large amount of genomic data currently available and study the abundance distributions of 33 IS families in 1811 bacterial chromosomes. This allows us to test simple models of IS dynamics and estimate their key parameters by means of a maximum likelihood approach. We evaluate the roles played by duplication, lateral gene transfer, deletion and purifying selection. We find that the observed IS abundances are compatible with a neutral scenario where IS proliferation is controlled by deletions instead of purifying selection. Even if there may be some cases driven by selection, neutral behavior dominates over large evolutionary scales. According to this view, IS and hosts tend to coexist in a dynamic equilibrium state for most of the time. Our approach also allows for a detection of recent IS expansions, and supports the hypothesis that rapid expansions constitute transient events-punctuations-during which the state of coexistence of IS and host becomes perturbated.

  16. PlanTE-MIR DB: a database for transposable element-related microRNAs in plant genomes.

    Science.gov (United States)

    R Lorenzetti, Alan P; A de Antonio, Gabriel Y; Paschoal, Alexandre R; Domingues, Douglas S

    2016-05-01

    Transposable elements (TEs) comprise a major fraction of many plant genomes and are known to drive their organization and evolution. Several studies show that these repetitive elements have a prominent role in shaping noncoding regions of the genome such as microRNA (miRNA) loci, which are components of post-transcriptional regulation mechanisms. Although some studies have reported initial formation of miRNA loci from TE sequences, especially in model plants, the approaches that were used did not employ systems that would allow results to be delivered by a user-friendly database. In this study, we identified 152 precursor miRNAs overlapping TEs in 10 plant species. PlanTE-MIR DB was designed to assemble this data and deliver it to the scientific community interested in miRNA origin, evolution, and regulation pathways. Users can browse the database through a web interface and search for entries using various parameters. This resource is cross-referenced with repetitive element (Repbase Update) and miRNA (miRBase) repositories, where sequences can be checked for further analysis. All data in PlanTE-MIR DB are publicly available for download in several file formats to facilitate their understanding and use. The database is hosted at http://bioinfo-tool.cp.utfpr.edu.br/plantemirdb/ . PMID:26887375

  17. Diversity, abundance, and evolutionary dynamics of Pong-like transposable elements in Triticeae.

    Science.gov (United States)

    Markova, Dragomira N; Mason-Gamer, Roberta J

    2015-12-01

    Pong-like elements are members of the PIF/Harbinger superfamily of DNA transposons that has been described in many plants, animals, and fungi. Most Pong elements contain two open reading frames (ORFs). One encodes a transposase (ORF2) that catalyzes transposition of Pong and related non-autonomous elements, while the function of the second is unknown. Little is known about the evolutionary history of Pong elements in flowering plants. In this work, we present the first comprehensive analysis of the diversity, abundance, and evolution of the Pong-like transposase gene in the genomes of 21 diploid species from the wheat tribe, Triticeae, and we present the first convincing evidence of horizontal transfer of nuclear-encoded Pong elements in any organism. A phylogenetic analysis of nearly 300 Pong sequences based on a conserved region of the transposase domain revealed a complex evolutionary history of Pong elements that can be best explained by ancestral polymorphism, followed by differential evolutionary success of some transposase lineages, and by occasional horizontal transfer between phylogenetically distant genera. In addition, we used transposon display to estimate the abundance of the transposase gene within Triticeae genomes, and our results revealed varying levels of Pong proliferation, with numbers of transposase copies ranging from 22 to 92. Comparisons of Pong transposase abundance to flow cytometry estimates of genome size revealed that larger Triticeae genome size was not correlated with transposase abundance. PMID:26206730

  18. T-lex: a program for fast and accurate assessment of transposable element presence using next-generation sequencing data.

    Science.gov (United States)

    Fiston-Lavier, Anna-Sophie; Carrigan, Matthew; Petrov, Dmitri A; González, Josefa

    2011-03-01

    Transposable elements (TEs) are repetitive DNA sequences that are ubiquitous, extremely abundant and dynamic components of practically all genomes. Much effort has gone into annotation of TE copies in reference genomes. The sequencing cost reduction and the newly available next-generation sequencing (NGS) data from multiple strains within a species offer an unprecedented opportunity to study population genomics of TEs in a range of organisms. Here, we present a computational pipeline (T-lex) that uses NGS data to detect the presence/absence of annotated TE copies. T-lex can use data from a large number of strains and returns estimates of population frequencies of individual TE insertions in a reasonable time. We experimentally validated the accuracy of T-lex detecting presence or absence of 768 previously identified TE copies in two resequenced Drosophila melanogaster strains. Approximately 95% of the TE insertions were detected with 100% sensitivity and 97% specificity. We show that even at low levels of coverage T-lex produces accurate results for TE copies that it can identify reliably but that the rate of 'no data' calls increases as the coverage falls below 15×. T-lex is a broadly applicable and flexible tool that can be used in any genome provided the availability of the reference genome, individual TE copy annotation and NGS data. PMID:21177644

  19. Studies on the Mx transposable element system in maize recovered from X-irradiated stocks

    International Nuclear Information System (INIS)

    The unstable mutant bz-x3m arose in a plant subjected to X-irradiation. The element at the bronze locus is non-autonomous and recombination data indicate that an autonomous element is tightly linked. The autonomous element has been designated Mx (mobile element induced by X-rays) and the non-autonomous element, rMx (responder to Mx). Linkage data indicate that a second Mx lies near the end of the short arm of chromosome 9; in one plant, an Mx that is unlinked was deceted. Distinguishing characteristics of bz-x3m are a large window of time in endosperm development during which somatic reversions can arise and a wide range in the frequency at which they occur; these features are heritable. With increasing doses of bz- x3m and Mx, the window expands and the frequency range increases. In kernels containing the bz-x3m allele and the tightly linked Mx, breakage occurs in chromosome 9 distal to the C locus, resulting in breakage-fusion-bridge patterns for endosperm markers that lie proximal to the break. The frequency of breaks and the developmental time at which they occur exhibit the same dosage effect as the somatic reversions of the bz-x3m allele. These observations suggest that an rMx (designated rMxBr) that causes chromosome breakage os positioned distal to the C locus. At the molecular level, the bz-x3m allele is associated with a 0.5 kb increase in fragment size in DNA samples digested with BglII, EcoRI, HindIII and PstI; in germinal revertants, the fragment size returns to that of the progenitor

  20. Transposable B2 SINE elements can provide mobile RNA polymerase II promoters.

    Science.gov (United States)

    Ferrigno, O; Virolle, T; Djabari, Z; Ortonne, J P; White, R J; Aberdam, D

    2001-05-01

    Short interspersed elements (SINEs) are highly abundant components of mammalian genomes that are propagated by retrotransposition. SINEs are recognized as a causal agent of human disease and must also have had a profound influence in shaping eukaryotic genomes. The B2 SINE family constitutes approximately 0.7% of total mouse genomic DNA (ref. 2) and is also found at low abundance in humans. It resembles the Alu family in several respects, such as its mechanism of propagation. B2 SINEs are derived from tRNA and are transcribed by RNA polymerase (pol) III to generate short transcripts that are not translated. We find here, however, that one B2 SINE also carries an active pol II promoter located outside the tRNA region. Indeed, a B2 element is responsible for the production of a mouse Lama3 transcript. The B2 pol II promoters can be bound and stimulated by the transcription factor USF (for upstream stimulatory factor), as shown by transient transfection experiments. Moreover, this pol II activity does not preclude the pol III transcription necessary for retrotransposition. Dispersal of B2 SINEs by retrotransposition may therefore have provided numerous opportunities for creating regulated pol II transcription at novel genomic sites. This mechanism may have allowed the evolution of new transcription units and new genes. PMID:11326281

  1. Multitasking of the piRNA Silencing Machinery: Targeting Transposable Elements and Foreign Genes in the Bdelloid Rotifer Adineta vaga.

    Science.gov (United States)

    Rodriguez, Fernando; Arkhipova, Irina R

    2016-05-01

    RNA-mediated silencing processes play a key role in silencing of transposable elements, especially in the germ line, where piwi-interacting RNAs (piRNAs) are responsible for suppressing transposon mobility and maintaining genome integrity. We previously reported that the genome of Adineta vaga, the first sequenced representative of the phylum Rotifera (class Bdelloidea), is characterized by massive levels of horizontal gene transfer, by unusually low transposon content, and by highly diversified RNA-mediated silencing machinery. Here, we investigate genome-wide distribution of pi-like small RNAs, which in A. vaga are 25-31 nucleotides in length and have a strong 5'-uridine bias, while lacking ping-pong amplification signatures. In agreement with expectations, 71% of mapped reads corresponded to annotated transposons, with 93% of these reads being in the antisense orientation. Unexpectedly, a significant fraction of piRNAs originate from predicted coding regions corresponding to genes of putatively foreign origin. The distribution of piRNAs across foreign genes is not biased toward 3'-UTRs, instead resembling transposons in uniform distribution pattern throughout the gene body, and in predominantly antisense orientation. We also find that genes with small RNA coverage, including a number of genes of metazoan origin, are characterized by higher occurrence of telomeric repeats in the surrounding genomic regions, and by higher density of transposons in the vicinity, which have the potential to promote antisense transcription. Our findings highlight the complex interplay between RNA-based silencing processes and acquisition of genes at the genome periphery, which can result either in their loss or eventual domestication and integration into the host genome. PMID:27017627

  2. Alternative splicing and co-option of transposable elements: the case of TMPO/LAP2α and ZNF451 in mammals.

    Science.gov (United States)

    Abascal, Federico; Tress, Michael L; Valencia, Alfonso

    2015-07-15

    Transposable elements constitute a large fraction of vertebrate genomes and, during evolution, may be co-opted for new functions. Exonization of transposable elements inserted within or close to host genes is one possible way to generate new genes, and alternative splicing of the new exons may represent an intermediate step in this process. The genes TMPO and ZNF451 are present in all vertebrate lineages. Although they are not evolutionarily related, mammalian TMPO and ZNF451 do have something in common-they both code for splice isoforms that contain LAP2alpha domains. We found that these LAP2alpha domains have sequence similarity to repetitive sequences in non-mammalian genomes, which are in turn related to the first ORF from a DIRS1-like retrotransposon. This retrotransposon domestication happened separately and resulted in proteins that combine retrotransposon and host protein domains. The alternative splicing of the retrotransposed sequence allowed the production of both the new and the untouched original isoforms, which may have contributed to the success of the colonization process. The LAP2alpha-specific isoform of TMPO (LAP2α) has been co-opted for important roles in the cell, whereas the ZNF451 LAP2alpha isoform is evolving under strong purifying selection but remains uncharacterized. PMID:25735770

  3. Sparse Biclustering of Transposable Data

    OpenAIRE

    Tan, Kean Ming; Witten, Daniela M

    2014-01-01

    We consider the task of simultaneously clustering the rows and columns of a large transposable data matrix. We assume that the matrix elements are normally distributed with a bicluster-specific mean term and a common variance, and perform biclustering by maximizing the corresponding log likelihood. We apply an ℓ1 penalty to the means of the biclusters in order to obtain sparse and interpretable biclusters. Our proposal amounts to a sparse, symmetrized version of k-means clustering. We show th...

  4. Partial transpose of permutation matrices

    OpenAIRE

    Hou, Qing-Hu; Mansour, Toufik; Severini, Simone

    2007-01-01

    The partial transpose of a block matrix M is the matrix obtained by transposing the blocks of M independently. We approach the notion of partial transpose from a combinatorial point of view. In this perspective, we solve some basic enumeration problems concerning the partial transpose of permutation matrices. More specifically, we count the number of permutations matrices which are equal to their partial transpose and the number of permutation matrices whose partial transpose is still a permu...

  5. DNA Damage-Induced Transcription of Transposable Elements and Long Non-coding RNAs in Arabidopsis Is Rare and ATM-Dependent.

    Science.gov (United States)

    Wang, Zhenxing; Schwacke, Rainer; Kunze, Reinhard

    2016-08-01

    Induction and mobilization of transposable elements (TEs) following DNA damage or other stresses has been reported in prokaryotes and eukaryotes. Recently it was discovered that eukaryotic TEs are frequently associated with long non-coding RNAs (lncRNAs), many of which are also upregulated by stress. Yet, it is unknown whether DNA damage-induced transcriptional activation of TEs and lncRNAs occurs sporadically or is a synchronized, genome-wide response. Here we investigated the transcriptome of Arabidopsis wild-type (WT) and ataxia telangiectasia mutated (atm) mutant plants 3 h after induction of DNA damage. In WT, expression of 5.2% of the protein-coding genes is ≥2-fold changed, whereas in atm plants, only 2.6% of these genes are regulated, and the response of genes associated with DNA repair, replication, and cell cycle is largely lost. In contrast, only less than 0.6% of TEs and lncRNAs respond to DNA damage in WT plants, and the regulation of ≥95% of them is ATM-dependent. The ATM-downstream factors BRCA1, DRM1, JMJ30, AGO2, and the ATM-independent AGO4 participate in the regulation of individual TEs and lncRNAs. Remarkably, protein-coding genes located adjacent to DNA damage-responsive TEs and lncRNAs are frequently coexpressed, which is consistent with the hypothesis that TEs and lncRNAs located close to genes commonly function as controlling elements. PMID:27150037

  6. Molecular characterization of a mutable pigmentation phenotype and isolation of the first active transposable element from Sorghum bicolor

    OpenAIRE

    Chopra, Surinder; Brendel, Volker; Zhang, Jianbo; John D. Axtell; Peterson, Thomas

    1999-01-01

    Accumulation of red phlobaphene pigments in sorghum grain pericarp is under the control of the Y gene. A mutable allele of Y, designated as y-cs (y-candystripe), produces a variegated pericarp phenotype. Using probes from the maize p1 gene that cross-hybridize with the sorghum Y gene, we isolated the y-cs allele containing a large insertion element. Our results show that the Y gene is a member of the MYB-transcription factor family. The insertion element, named Candystripe1 (Cs1), is present ...

  7. High genetic variation and recombination events in the vicinity of non-autonomous transposable elements from ‘Candidatus Liberibacter asiaticus’

    Institute of Scientific and Technical Information of China (English)

    WANG Xue-feng; CHEN Jiao-yue; TAN Jin; DUAN Suo; DENG Xiao-ling; CHEN Jian-chi; ZHOU Chang-yong

    2015-01-01

    Two miniature inverted-repeat transposable elements (MITEs), MCLas-A and MCLas-B, were recently identiifed from ‘Candidatus Liberibacter asiaticus’ known to be associated with citrus Huanglongbing (HLB, yelow shoot disease). MCLas-A was suggested as an active MITE because of its mobility. The immediate upstream gene of the two MITEs was predicted to be a putative transposase. The goal of this study is to analyze the sequence variation in the upstream putative transposase of MITEs and explore the possible correlation between sequence variation of transposase gene and MITE activity. PCR and sequence analysis showed that 12 sequence types were found in six major amplicon types from 43 representative ‘Ca. L. asiaticus’ isolates from China, the United States and Brazil. Out of the 12 sequence types, three (T4, T5-2, T6) were reported for the ifrst time. Recombination events were found in the two unique sequence types (T5-2 and T6) which were detected in al Brazilian isolates. Notably, no sequence variation or recombination events were detected in the upstream putative transposase gene of MCLas-A, suggesting the conservation of the transposase gene might be closely related with the MITE activity. Phylogenetic analysis demonstrated two wel supported clades including ifve subclades were identiifed, clearly relfecting the geographical origins of isolates, especialy that of Ruili isolates, São Paulo isolates and a few Florida isolates.

  8. Epigenetic mechanisms and associated brain circuits in the regulation of positive emotions: A role for transposable elements.

    Science.gov (United States)

    Gaudi, Simona; Guffanti, Guia; Fallon, James; Macciardi, Fabio

    2016-10-15

    Epigenetic programming and reprogramming are at the heart of cellular differentiation and represent developmental and evolutionary mechanisms in both germline and somatic cell lines. Only about 2% of our genome is composed of protein-coding genes, while the remaining 98%, once considered "junk" DNA, codes for regulatory/epigenetic elements that control how genes are expressed in different tissues and across time from conception to death. While we already know that epigenetic mechanisms are at play in cancer development and in regulating metabolism (cellular and whole body), the role of epigenetics in the developing prenatal and postnatal brain, and in maintaining a proper brain activity throughout the various stages of life, in addition to having played a critical role in human evolution, is a relatively new domain of knowledge. Here we present the current state-of-the-art techniques and results of these studies within the domain of emotions, and then speculate on how genomic and epigenetic mechanisms can modify and potentially alter our emotional (limbic) brain and affect our social interactions. J. Comp. Neurol. 524:2944-2954, 2016. © 2016 Wiley Periodicals, Inc. PMID:27224878

  9. Mapping of a Leishmania major gene/locus that confers pentamidine resistance by deletion and insertion of transposable element

    Directory of Open Access Journals (Sweden)

    Coelho Adriano C.

    2004-01-01

    Full Text Available Pentamidine (PEN is an alternative compound to treat antimony-resistant leishmaniasis patients, which cellular target remains unclear. One approach to the identification of prospective targets is to identify genes able to mediate PEN resistance following overexpression. Starting from a genomic library of transfected parasites bearing a multicopy episomal cosmid vector containing wild-type Leishmania major DNA, we isolated one locus capable to render PEN resistance to wild type cells after DNA transfection. In order to map this Leishmania locus, cosmid insert was deleted by two successive sets of partial digestion with restriction enzymes, followed by transfection into wild type cells, overexpression, induction and functional tests in the presence of PEN. To determine the Leishmania gene related to PEN resistance, nucleotide sequencing experiments were done through insertion of the transposon Mariner element of Drosophila melanogaster (mosK into the deleted insert to work as primer island. Using general molecular techniques, we described here this method that permits a quickly identification of a functional gene facilitating nucleotide sequence experiments from large DNA fragments. Followed experiments revealed the presence of a P-Glycoprotein gene in this locus which role in Leishmania metabolism has now been analyzed.

  10. The Evolutionary Dynamics of Ribosomal Genes, Histone H3, and Transposable Rex Elements in the Genome of Atlantic Snappers.

    Science.gov (United States)

    Costa, Gideão Wagner Werneck Félix da; Cioffi, Marcelo de Bello; Bertollo, Luiz Antonio Carlos; Molina, Wagner Franco

    2016-03-01

    Lutjanidae is a family of primarily marine and carnivorous fishes distributed in the Atlantic, Indian, and Pacific oceans, with enormous economic and ecological importance. In order to better clarify the conservative chromosomal evolution of Lutjanidae, we analyzed the evolutionary dynamics of 5 repetitive DNA classes in 5 Lutjanus and in 1 Ocyurus species from the Western Atlantic. The ribosomal 18S sites were generally located in a single chromosome pair, except for L. jocu and L. alexandrei where they are found in 2 pairs. In turn, the 5S rDNA sites are unique, terminal and nonsyntenic with the 18S rDNA sites. In 3 species analyzed, H3 hisDNA genes were found in 1 chromosomal pair. However, while L. jocu presented 2 H3 sites, O. chrysurus showed a noteworthy dispersion of this gene in almost all chromosomes of the karyotype. Retrotransposons Rex1 and Rex3 do not exhibit any association with the explosive distribution of H3 sequences in O. chrysurus. The low compartmentalization of Rex elements, in addition to the general nondynamic distribution of ribosomal and H3 genes, corroborate the karyotype conservatism in Lutjanidae species, also at the microstructural level. However, some "disturbing evolutionary waves" can break down this conservative scenario, as evidenced by the massive random dispersion of H3 hisDNA in the genome of O. chrysurus. The implication of the genomic expansion of H3 histone genes and their functionality remain unknown, although suggesting that they have higher evolutionary dynamics than previously thought. PMID:26792596

  11. Development of crop-specific transposable element (SINE) markers for studying gene flow from oilseed rape to wild radish.

    Science.gov (United States)

    Prieto, J L; Pouilly, N; Jenczewski, E; Deragon, J M; Chèvre, A M

    2005-08-01

    The screening of wild populations for evidence of gene flow from a crop to a wild related species requires the unambiguous detection of crop genes within the genome of the wild species, taking into account the intraspecific variability of each species. If the crop and wild relatives share a common ancestor, as is the case for the Brassica crops and their wild relatives (subtribe Brassiceae), the species-specific markers needed to make this unambiguous detection are difficult to identify. In the model oilseed rape (Brassica napus, AACC, 2n = 38)-wild radish (Raphanus raphanistrum, RrRr, 2n = 18) system, we utilized the presence or absence of a short-interspersed element (SINE) at a given locus to develop oilseed rape-specific markers, as SINE insertions are irreversible. By means of sequence-specific amplified polymorphism (SINE-SSAP) reactions, we identified and cloned 67 bands specific to the oilseed rape genome and absent from that of wild radish. Forty-seven PCR-specific markers were developed from three combinations of primers anchored either in (1) the 5'- and 3'-genomic sequences flanking the SINE, (2) the 5'-flanking and SINE internal sequences or (3) the SINE internal and flanking 3'-sequences. Seventeen markers were monomorphic whatever the oilseed rape varieties tested, whereas 30 revealed polymorphism and behaved either as dominant (17) or co-dominant (13) markers. Polymorphic markers were mapped on 19 genomic regions assigned to ten linkage groups. The markers developed will be efficient tools to trace the occurrence and frequency of introgressions of oilseed rape genomic region within wild radish populations. PMID:15942756

  12. Changes in DNA methylation and transgenerational mobilization of a transposable element (mPing by the Topoisomerase II inhibitor, Etoposide, in rice

    Directory of Open Access Journals (Sweden)

    Yang Xuejiao

    2012-04-01

    Full Text Available Abstract Background Etoposide (epipodophyllotoxin is a chemical commonly used as an anti-cancer drug which inhibits DNA synthesis by blocking topoisomerase II activity. Previous studies in animal cells have demonstrated that etoposide constitutes a genotoxic stress which may induce genomic instability including mobilization of normally quiescent transposable elements (TEs. However, it remained unknown whether similar genetically mutagenic effects could be imposed by etoposide in plant cells. Also, no information is available with regard to whether the drug may cause a perturbation of epigenetic stability in any organism. Results To investigate whether etoposide could generate genetic and/or epigenetic instability in plant cells, we applied etoposide to germinating seeds of six cultivated rice (Oryza sativa L. genotypes including both subspecies, japonica and indica. Based on the methylation-sensitive gel-blotting results, epigenetic changes in DNA methylation of three TEs (Tos17, Osr23 and Osr36 and two protein-encoding genes (Homeobox and CDPK-related genes were detected in the etoposide-treated plants (S0 generation in four of the six studied japonica cultivars, Nipponbare, RZ1, RZ2, and RZ35, but not in the rest japonica cultivar (Matsumae and the indica cultivar (93-11. DNA methylation changes in the etoposide-treated S0 rice plants were validated by bisulfite sequencing at both of two analyzed loci (Tos17 and Osr36. Transpositional activity was tested for eight TEs endogenous to the rice genome in both the S0 plants and their selfed progenies (S1 and S2 of one of the cultivars, RZ1, which manifested heritable phenotypic variations. Results indicated that no transposition occurred in the etoposide-treated S0 plants for any of the TEs. Nonetheless, a MITE transposon, mPing, showed rampant mobilization in the S1 and S2 progenies descended from the drug-treated S0 plants. Conclusions Our results demonstrate that etoposide imposes a similar

  13. An Immunity-Triggering Effector from the Barley Smut Fungus Ustilago hordei Resides in an Ustilaginaceae-Specific Cluster Bearing Signs of Transposable Element-Assisted Evolution

    KAUST Repository

    Ali, Shawkat

    2014-07-03

    The basidiomycete smut fungus Ustilago hordei was previously shown to comprise isolates that are avirulent on various barley host cultivars. Through genetic crosses we had revealed that a dominant avirulence locus UhAvr1 which triggers immunity in barley cultivar Hannchen harboring resistance gene Ruh1, resided within an 80-kb region. DNA sequence analysis of this genetically delimited region uncovered the presence of 7 candidate secreted effector proteins. Sequence comparison of their coding sequences among virulent and avirulent parental and field isolates could not distinguish UhAvr1 candidates. Systematic deletion and complementation analyses revealed that UhAvr1 is UHOR_10022 which codes for a small effector protein of 171 amino acids with a predicted 19 amino acid signal peptide. Virulence in the parental isolate is caused by the insertion of a fragment of 5.5 kb with similarity to a common U. hordei transposable element (TE), interrupting the promoter of UhAvr1 and thereby changing expression and hence recognition of UhAVR1p. This rearrangement is likely caused by activities of TEs and variation is seen among isolates. Using GFP-chimeric constructs we show that UhAvr1 is induced only in mated dikaryotic hyphae upon sensing and infecting barley coleoptile cells. When infecting Hannchen, UhAVR1p causes local callose deposition and the production of reactive oxygen species and necrosis indicative of the immune response. UhAvr1 does not contribute significantly to overall virulence. UhAvr1 is located in a cluster of ten effectors with several paralogs and over 50% of TEs. This cluster is syntenous with clusters in closely-related U. maydis and Sporisorium reilianum. In these corn-infecting species, these clusters harbor however more and further diversified homologous effector families but very few TEs. This increased variability may have resulted from past selection pressure by resistance genes since U. maydis is not known to trigger immunity in its corn host.

  14. Sparse Biclustering of Transposable Data.

    Science.gov (United States)

    Tan, Kean Ming; Witten, Daniela M

    2014-01-01

    We consider the task of simultaneously clustering the rows and columns of a large transposable data matrix. We assume that the matrix elements are normally distributed with a bicluster-specific mean term and a common variance, and perform biclustering by maximizing the corresponding log likelihood. We apply an ℓ1 penalty to the means of the biclusters in order to obtain sparse and interpretable biclusters. Our proposal amounts to a sparse, symmetrized version of k-means clustering. We show that k-means clustering of the rows and of the columns of a data matrix can be seen as special cases of our proposal, and that a relaxation of our proposal yields the singular value decomposition. In addition, we propose a framework for bi-clustering based on the matrix-variate normal distribution. The performances of our proposals are demonstrated in a simulation study and on a gene expression data set. This article has supplementary material online. PMID:25364221

  15. The characteristics and functions of a miniature inverted-repeat transposable element TaMITE81 in the 5' UTR of TaCHS7BL from Triticum aestivum.

    Science.gov (United States)

    Xi, Xinyuan; Li, Na; Li, Shiming; Chen, Wenjie; Zhang, Bo; Liu, Baolong; Zhang, Huaigang

    2016-10-01

    Miniature inverted-repeat transposable elements (MITEs) are truncated derivatives of autonomous DNA transposons, and are dispersed abundantly in eukaryotic and prokaryotic genomes. In this article, a MITE, TaMITE81, was isolated from the 5' untranslated region (UTR) of TaCHS7BL, chalcone synthase (CHS) catalyzing the first committed step of anthocyanin biosynthesis, in the wheat cultivar 'Opata' with white grain. TaMITE81 was only 81 nucleotides, including a terminal inverted repeat with 39 nucleotides and was flanked by two nucleotides, "TA", target site duplications that were typical features of stowaway-like MITEs. Compared with the wheat cultivar 'Gy115' with purple grain, which is without the insertion, the expression of TaCHS7BL was lower in several organs of 'Opata'. The insertion of TaMITE81 into the 5' UTR of the GUS gene also reduced the transient expression of GUS on the coleoptiles of 'Opata', which means the insertion of TaMITE81 was the reason for the low expression of TaCHS7BL in 'Opata'. But the genotype of TaCHS7BL was not linked to phenotype of grain color in the RILs derived from a cross 'Gy115' and 'Opata'. The TaMITE81 density of the hexaploid variety of T. aestivum was more than 10 times that of diploid relatives, which implies that polyploidization caused the amplification of TaMITE81 homologous sequences. Further research should be conducted on decoding the relationship between TaCHS7BL and other traits relative to anthocyanin biosynthesis in wheat, and discovering the mechanism of TaMITE81 transposon action. PMID:27481288

  16. Transposable elements and G-quadruplexes

    Czech Academy of Sciences Publication Activity Database

    Kejnovský, Eduard; Tokan, Viktor; Lexa, M.

    2015-01-01

    Roč. 23, č. 3 (2015), s. 615-623. ISSN 0967-3849 R&D Projects: GA ČR(CZ) GA15-02891S Institutional support: RVO:68081707 Keywords : TRINUCLEOTIDE REPEAT DNA * LTR RETROTRANSPOSONS * BINDING PROTEIN Subject RIV: BO - Biophysics Impact factor: 2.478, year: 2014

  17. Transposed intrathoracic stomach: Functional evaluation

    Directory of Open Access Journals (Sweden)

    Vishesh Jain

    2012-01-01

    Full Text Available Background: To study the functional aspects of the transposed stomach in the thoracic cavity and its effects on other organ systems. Patients and Methods: Children who had undergone gastric transposition more than 5 years ago were evaluated for symptoms, anthropometry, anaemia, duodenogastric reflux, pulmonary function, gastric emptying, gastric pH, gastroesophageal reflux and stricture, gastric motility, and gastritis and atrophy on histological examination of gastric mucosa. Results: Ten children were evaluated at a median follow-up of 90.5 months. On evaluation of symptoms, nine children were satisfied with the overall outcome. All patients had their weight and 7 patients had height less than 3 rd percentile for their respective age. Anaemia was present in 7/10 children. On evaluation with hepatobiliary scintigraphy, duodenogastric reflux was present in only 1 patient. Mass contractions of the transposed stomach were present in two thirds of the children. The mean gastric emptying t1/2 was 39.1 minutes. Pulmonary function tests were suggestive of restrictive lung disease in all the patients. Forced vital capacity (FVC and forced expiratory volume in 1 sec (FEV1 were worse in children who underwent transposition or diversion following oesophageal anastomotic leak. Acid secretion was preserved in most patients with episodes of high gastric pH during sleep in nearly half. Mild gastritis was present in all patients where as mild atrophy of the gastric mucosa was observed in only 1child. Helicobacter pylori were positive in 3/ 8 children. Barium swallow demonstrated reflux in 2 children. Conclusions: Most children with transposed stomach remain asymptomatic on follow up. However, subclinical abnormalities are detected on investigations, which need close observation as they can manifest later in life.

  18. Disruption of a CAROTENOID CLEAVAGE DIOXYGENASE 4 gene converts flower colour from white to yellow in Brassica species.

    Science.gov (United States)

    Zhang, Bao; Liu, Chao; Wang, Yaqin; Yao, Xuan; Wang, Fang; Wu, Jiangsheng; King, Graham J; Liu, Kede

    2015-06-01

    In Brassica napus, yellow petals had a much higher content of carotenoids than white petals present in a small number of lines, with violaxanthin identified as the major carotenoid compound in yellow petals of rapeseed lines. Using positional cloning we identified a carotenoid cleavage dioxygenase 4 gene, BnaC3.CCD4, responsible for the formation of flower colour, with preferential expression in petals of white-flowered B. napus lines. Insertion of a CACTA-like transposable element 1 (TE1) into the coding region of BnaC3.CCD4 had disrupted its expression in yellow-flowered rapeseed lines. α-Ionone was identified as the major volatile apocarotenoid released from white petals but not from yellow petals. We speculate that BnaC3.CCD4 may use δ- and/or α-carotene as substrates. Four variations, including two CACTA-like TEs (alleles M1 and M4) and two insertion/deletions (INDELs, alleles M2 and M3), were identified in yellow-flowered Brassica oleracea lines. The two CACTA-like TEs were also identified in the coding region of BcaC3.CCD4 in Brassica carinata. However, the two INDELs were not detected in B. napus and B. carinata. We demonstrate that the insertions of TEs in BolC3.CCD4 predated the formation of the two allotetraploids. PMID:25690717

  19. Distribuição do elemento transponível impala em isolados de fusarium oxysporum patogênicos e não-patogênicos ao feijoeiro Distribution of the transposable element impala in Fusarium oxysporum isolates pathogenic and nonpathogenic to common bean

    Directory of Open Access Journals (Sweden)

    Michele G. S. Zanotti

    2005-06-01

    Full Text Available A variabilidade genética de 20 isolados de Fusarium oxysporum, nove não-patogênicos e 11 patogênicos ao feijoeiro (Phaseouls vulgaris, foi determinada com base na distribuição do elemento transponível impala. A presença de impala das subfamílias D e E foi determinada por experimentos de PCR, empregando oligonucleotídeos específicos para cada subfamília. Foi observada a presença de representantes das duas subfamílias na maioria dos isolados, sugerindo, portanto, que impala é um antigo componente do genoma de F. oxysporum f. sp. phaseoli. A hibridização do DNA total de cada isolado, clivado com a enzima EcoRI, com um fragmento do elemento impala da subfamíla E, mostrou uma variação nos padrões de bandas dos isolados não-patogênicos, indicando a possível atividade desses elementos. No entanto, no caso dos isolados patogênicos, foram observados padrões de bandas mais homogêneas e alguns isolados apresentaram o mesmo perfil de bandas, indicando que se trata de cópias de impala que, possivelmente, não são mais capazes de sofrer transposição. Estas cópias inativas são excelentes marcadores genéticos. Um dos isolados patogênicos, Fus4, não apresentou cópias endógenas de impala, o que torna esse isolado um candidato para experimentos de mutagênese insercional usando o vetor pNI160, que possui o elemento impala ativo interrompendo o gene niaD, que codifica a enzima nitrato redutase.The genetic variability of 20 isolates of Fusarium oxysporum, nine nonpathogenic and 11 causing common bean (Phaseouls vulgaris wilt, was analyzed on the basis of the distribution of the transposable element impala. The presence of transposable elements belonging to subfamilies D and E of impala was determined through polymerase chain reaction (PCR using specific primers for each subfamily. The presence of members of the two subfamilies was observed in most of the isolates, suggesting that it is an old component in the F. oxysporum f. sp

  20. Transposed genes in Arabidopsis are often associated with flanking repeats.

    Directory of Open Access Journals (Sweden)

    Margaret R Woodhouse

    2010-05-01

    Full Text Available Much of the eukaryotic genome is known to be mobile, largely due to the movement of transposons and other parasitic elements. Recent work in plants and Drosophila suggests that mobility is also a feature of many nontransposon genes and gene families. Indeed, analysis of the Arabidopsis genome suggested that as many as half of all genes had moved to unlinked positions since Arabidopsis diverged from papaya roughly 72 million years ago, and that these mobile genes tend to fall into distinct gene families. However, the mechanism by which single gene transposition occurred was not deduced. By comparing two closely related species, Arabidopsis thaliana and Arabidopsis lyrata, we sought to determine the nature of gene transposition in Arabidopsis. We found that certain categories of genes are much more likely to have transposed than others, and that many of these transposed genes are flanked by direct repeat sequence that was homologous to sequence within the orthologous target site in A. lyrata and which was predominantly genic in identity. We suggest that intrachromosomal recombination between tandemly duplicated sequences, and subsequent insertion of the circular product, is the predominant mechanism of gene transposition.

  1. Insights into the transposable mobilome of Paracoccus spp. (Alphaproteobacteria.

    Directory of Open Access Journals (Sweden)

    Lukasz Dziewit

    Full Text Available Several trap plasmids (enabling positive selection of transposition events were used to identify a pool of functional transposable elements (TEs residing in bacteria of the genus Paracoccus (Alphaproteobacteria. Complex analysis of 25 strains representing 20 species of this genus led to the capture and characterization of (i 37 insertion sequences (ISs representing 9 IS families (IS3, IS5, IS6, IS21, IS66, IS256, IS1182, IS1380 and IS1634, (ii a composite transposon Tn6097 generated by two copies of the ISPfe2 (IS1634 family containing two predicted genetic modules, involved in the arginine deiminase pathway and daunorubicin/doxorubicin resistance, (iii 3 non-composite transposons of the Tn3 family, including Tn5393 carrying streptomycin resistance and (iv a transposable genomic island TnPpa1 (45 kb. Some of the elements (e.g. Tn5393, Tn6097 and ISs of the IS903 group of the IS5 family were shown to contain strong promoters able to drive transcription of genes placed downstream of the target site of transposition. Through the application of trap plasmid pCM132TC, containing a promoterless tetracycline resistance reporter gene, we identified five ways in which transposition can supply promoters to transcriptionally silent genes. Besides highlighting the diversity and specific features of several TEs, the analyses performed in this study have provided novel and interesting information on (i the dynamics of the process of transposition (e.g. the unusually high frequency of transposition of TnPpa1 and (ii structural changes in DNA mediated by transposition (e.g. the generation of large deletions in the recipient molecule upon transposition of ISPve1 of the IS21 family. We also demonstrated the great potential of TEs and transposition in the generation of diverse phenotypes as well as in the natural amplification and dissemination of genetic information (of adaptative value by horizontal gene transfer, which is considered the driving force of

  2. Computing partial transposes and related entanglement functions

    CERN Document Server

    Maziero, Jonas

    2016-01-01

    The partial transpose (PT) is an important function for entanglement testing and quantification and also for the study of geometrical aspects of the quantum state space. In this article, considering general bipartite and multipartite discrete systems, explicit formulas ready for the numerical implementation of the PT and of related entanglement functions are presented and the Fortran code produced for that purpose is described. What is more, we obtain an analytical expression for the Hilbert-Schmidt entanglement of two-qudit systems and for the associated closest separable state. In contrast to previous works on this matter, we only use the properties of the PT, not applying Lagrange multipliers.

  3. A Transposable Partitioning Locus Used To Stabilize Plasmid-Borne Hydrogen Oxidation and Trifolitoxin Production Genes in a Sinorhizobium Strain

    OpenAIRE

    Kent, Angela D.; Wojtasiak, Michelle L.; Robleto, Eduardo A.; Eric W Triplett

    1998-01-01

    Improved nitrogen-fixing inoculum strains for leguminous crops must be able to effectively compete with indigenous strains for nodulation, enhance legume productivity compared to the productivity obtained with indigenous strains, and maintain stable expression of any added genes in the absence of selection pressure. We constructed a transposable element containing the tfx region for expression of increased nodulation competitiveness and the par locus for plasmid stability. The transposon was ...

  4. Strain properties of transposed segment conductors for a transmission cable

    International Nuclear Information System (INIS)

    In order to realize the superconducting cable composed of YBCO tapes, we investigated the optimal design for the cabling parameters, crossed pitch length, tape dimension for YBCO and former diameter, etc., in considering the manufacturing process. In the transposed segment, the repulsive force was applied to the crossed pitch tape, and in the case of the segment with a short crossed pitch length, the crossed pitch tape arched, which we called arching phenomena. However, in winding the transposed segment on the former by a few spiral pitch, arching phenomena did not occur even if crossed pitch length was so short that superconducting property of YBCO tape was deteriorated. In winding process of the transposed segment, a slide of constituent tapes occurred in longitudinal direction and it resulted in slack of the constituent tape. As a result, it became clear that the slack strain could be adjusted in order to avoid deterioration of superconducting property of YBCO tape. In cabling process, transverse and longitudinal bending strains were imposed on the tapes in the transposed segment. Consequently, it was found that transverse bending strain can be calculated with the cabling parameters, i.e. former diameter, spiral pitch and tape thickness, and it seems that longitudinal bending strain can also be calculated as well as transverse bending strain. From these results, we obtained important information to realize the superconducting cable composed of YBCO tapes

  5. On biembedding an idempotent Latin square with its transpose

    OpenAIRE

    Donovan, D M; T. S. Griggs; Psomas, C.

    2013-01-01

    Let L be an idempotent Latin square of side n, thought of as a set of ordered triples (i, j, k) where L(i, j) = k. Let I be the set of triples (i, i, i). We consider the problem of biembedding the triples of L - I with the triples of L' - I, where L' is the transpose of L, in an orientable surface. We construct such embeddings for all doubly even values of n.

  6. ML(n)BiCGStabt: A ML(n)BiCGStab variant with A-transpose

    OpenAIRE

    Yeung, Man-Chung

    2013-01-01

    The 1980 IDR method plays an important role in the history of Krylov subspace methods. It started the research of transpose-free Krylov subspace methods. In this paper, we make a first attempt to bring back A-transpose to the research area by presenting a new ML(n)BiCGStab variant that involves A-transpose in its implementation. Comparisons of this new algorithm with the existing ML(n)BiCGStab algorithms will be presented.

  7. The hobo transposable element excises and has related elements in tephritid species

    Science.gov (United States)

    Function of the Drosophila melanogaster hobo transposon in tephritid species was tested in transient embryonic excision assays by scientists at the USDA Agricultural Research Service, Center for Medical Agricultural and Veterinary Entomology, Gainesville, Florida. Wild-type and mutant strains of Ana...

  8. Transposing, Transforming and Transcending Tradition in Creative Digital Media

    DEFF Research Database (Denmark)

    Prager, Phillip; Thomas, Maureen; Selsjord, Marianne

    2015-01-01

    storytelling arts combine to create rich, complex, and engaging moving-image based artworks with wide appeal. It examines how dramatist and interactive media artist Maureen Thomas and 3D media artist and conservator Marianne Selsjord deploy creative digital technologies to transpose, transform, and transcend......How can digital media technologies, contemporary theories of creativity, and tradition combine to develop the aesthetics of computer-based art today and in the future? Through contextualised case-studies, this chapter investigates how games, information technologies, and traditional visual and...... pre-page arts and crafts for the digital era, making fresh work for new audiences. Researcher in digital aesthetics, creative cognition, and play behaviour Dr. Phillip Prager examines how such work is conducive to creative insight and worthwhile play, discussing its remediation of some of the...

  9. Moments of the Hilbert-Schmidt probability distributions over determinants of real two-qubit density matrices and of their partial transposes

    CERN Document Server

    Slater, Paul B

    2010-01-01

    The nonnegativity of the determinant of the partial transpose of a two-qubit (4 x 4) density matrix is both a necessary and sufficient condition for its separability. While the determinant is restricted to the interval [0,1/256], the determinant of the partial transpose can range over [-1/16,1/256], with negative values corresponding to entangled states. We report here the exact values of the first nine moments of the probability distribution of the partial transpose over this interval, with respect to the Hilbert-Schmidt (metric volume element) measure on the nine-dimensional convex set of real two-qubit density matrices. Rational functions C_{2 j}(m), yielding the coefficients of the 2j-th power of even polynomials occurring at intermediate steps in our derivation of the m-th moment, emerge. These functions possess poles at finite series of consecutive half-integers (m=-3/2,-1/2,...,(2j-1)/2), and certain (trivial) roots at finite series of consecutive natural numbers (m=0, 1,...). Additionally, the (nontri...

  10. Translocation junctions in TCF3-PBX1 acute lymphoblastic leukemia/lymphoma cluster near transposable elements

    OpenAIRE

    Rodić, Nemanja; Zampella, John G; Toby C Cornish; Sarah J Wheelan; Burns, Kathleen H.

    2013-01-01

    Background Hematolymphoid neoplasms frequently harbor recurrent genetic abnormalities. Some of the most well recognized lesions are chromosomal translocations, and many of these are known to play pivotal roles in pathogenesis. In lymphoid malignancies, some translocations result from erroneous V(D)J-type events. However, other translocation junctions appear randomly positioned and their underlying mechanisms are not understood. Results We tested the hypothesis that genomic repeats, including ...

  11. Transposable Element Junctions in Marker Development and Genomic Characterization of Barley

    Czech Academy of Sciences Publication Activity Database

    Mazaheri, M.; Kianian, P.M.A.; Mergoum, M.; Valentini, G.L.; Seetan, R.; Pirseyedi, S.M.; Kumar, A.; Gu, Y.Q.; Stein, N.; Kubaláková, Marie; Doležel, Jaroslav; Denton, A.M.; Kianian, S.F.

    2014-01-01

    Roč. 7, č. 1 (2014). ISSN 1940-3372 Grant ostatní: GA MŠk(CZ) ED0007/01/01 Institutional support: RVO:61389030 Keywords : CHROMOSOME 3B * BREAD WHEAT * EVOLUTION Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.933, year: 2014

  12. Chromosomal organization and evolutionary history of Mariner transposable elements in Scarabaeinae coleopterans

    OpenAIRE

    Oliveira, Sarah G.; Cabral-de-Mello, Diogo C; Moura, Rita C; Martins, Cesar

    2013-01-01

    Background With the aim to increase the knowledge on the evolution of coleopteran genomes, we investigated through cytogenetics and nucleotide sequence analysis Mariner transposons in three Scarabaeinae species (Coprophanaeus cyanescens, C. ensifer and Diabroctis mimas). Results The cytogenetic mapping revealed an accumulation of Mariner transposon in the pericentromeric repetitive regions characterized as rich in heterochromatin and C 0 t-1 DNA fraction (DNA enriched with high and moderately...

  13. An En/Spm based transposable element system for gene isolation in Arabidopsis thaliana.

    NARCIS (Netherlands)

    Aarts, M.G.M.

    1996-01-01

    At the start of the research described in this thesis, the main aim was to develop, study and apply an efficient En/Spm-I/dSpm based transposon tagging system in Arabidopsis thaliana to generate tagged mutants and to provide insights in the possibilities for future applications of such a transposon

  14. Recombination genes on the Escherichia coli sex factor specific for transposable elements.

    OpenAIRE

    Hopkins, J D; Clements, M B; Liang, T Y; Isberg, R R; Syvanen, M

    1980-01-01

    The Escherichia coli sex factor stimulates precise excision of transposons Tn5 and Tn10 from sites either within the bacterial chromosome or within the factor itself. We have isolated two kinds of mutations that affect this activity. The ferA mutations eliminate the stimulation; the ferB mutations enhance it in the presence of FerA+. We conclude that ferA defines a sex factor gene that stimulates precise excision. The ferB mutations also specifically increase the rate of recombination between...

  15. System-Level Genetic Codes Using a Transposable Element-Like Mechanism with Applications to Cancer

    OpenAIRE

    McGowan, John F.

    2000-01-01

    A system-level genetic code is a hypothetical genetic code that exclusively or preferentially codes systems of interacting coadapted parts. System-level genetic codes differ from part-level genetic codes in which each discrete part is coded independently. In general, a system-level genetic code requires coding discrete interacting parts such as organs or proteins in an interdependent way. Changing a single symbol or "gene" in a system-level genetic code affects two or more parts in a coordina...

  16. Restoration of thumb opposition by transposing the flexsor pollicis brevis muscle: thirteen-year clinical application

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Background To repair late median nerve injury, many methods have been used in the past years. The aim of this study was to review a thirteen-year experience in restoration of thumb opposition by transposing flexor pollicis brevis muscle.Methods From July 1992 to August 2005, 63 patients without thumb opposition because of late median never injury were treated by transposing the flexor pollicis brevis muscle. All the patients had received primary nerve repair after the jnjury. The interval between the injury and the second operation was (1.87±2.31) years (6 months to 4.2 years). The patients were followed up for 3 to 48 [months mean (22.93±2.31) months]. A functional evaluation system designed in 1992 were used to estimate the outcomes of the patients. Results All the patients gained excellent functional results without complications and disabilities during follow-up.Conclusions Restoration of thumb opposition by transposing flexsor pollicis brevis muscle has the following advantages: 1. Operative trauma is minimal; 2. It is not necessary to transpose other tendons; 3. Except for the thumb in opposition, movements of other fingers and the wrist are not restricted postoperatively.

  17. Transpositionally active episomal hAT elements

    Directory of Open Access Journals (Sweden)

    Hice Robert H

    2009-12-01

    Full Text Available Abstract Background hAT elements and V(DJ recombination may have evolved from a common ancestral transposable element system. Extrachromosomal, circular forms of transposable elements (referred to here as episomal forms have been reported yet their biological significance remains unknown. V(DJ signal joints, which resemble episomal transposable elements, have been considered non-recombinogenic products of V(DJ recombination and a safe way to dispose of excised chromosomal sequences. V(DJ signal joints can, however, participate in recombination reactions and the purpose of this study was to determine if hobo and Hermes episomal elements are also recombinogenic. Results Up to 50% of hobo/Hermes episomes contained two intact, inverted-terminal repeats and 86% of these contained from 1-1000 bp of intercalary DNA. Episomal hobo/Hermes elements were recovered from Musca domestica (a natural host of Hermes, Drosophila melanogaster (a natural host of hobo and transgenic Drosophila melanogaster and Aedes aegypti (with autonomous Hermes elements. Episomal Hermes elements were recovered from unfertilized eggs of M. domestica and D. melanogaster demonstrating their potential for extrachromosomal, maternal transmission. Reintegration of episomal Hermes elements was observed in vitro and in vivo and the presence of Hermes episomes resulted in lower rates of canonical Hermes transposition in vivo. Conclusion Episomal hobo/Hermes elements are common products of element excision and can be maternally transmitted. Episomal forms of Hermes are capable of integration and also of influencing the transposition of canonical elements suggesting biological roles for these extrachromosomal elements in element transmission and regulation.

  18. A structured annotation frame for the transposable phages: a new proposed family "Saltoviridae" within the Caudovirales.

    Science.gov (United States)

    Hulo, Chantal; Masson, Patrick; Le Mercier, Philippe; Toussaint, Ariane

    2015-03-01

    Enterobacteriophage Mu is the best studied and paradigm member of the transposable phages. Mu-encoded proteins have been annotated in detail in UniProtKB and linked to a controlled vocabulary describing the various steps involved in the phage lytic and lysogenic cycles. Transposable phages are ubiquitous temperate bacterial viruses with a dsDNA linear genome. Twenty-six of them, that infect α, β and γ-proteobacteria, have been sequenced. Their conserved properties are described. Based on these characteristics, we propose a reorganization of the Caudovirales, to allow for the inclusion of a "Saltoviridae" family and two newly proposed subfamilies, the "Myosaltovirinae" and "Siphosaltovirinae". The latter could temporarily be included in the existing Myoviridae and Siphoviridae families. PMID:25500185

  19. Transposed-letter priming effects in reading aloud words and nonwords.

    Science.gov (United States)

    Mousikou, Petroula; Kinoshita, Sachiko; Wu, Simon; Norris, Dennis

    2015-10-01

    A masked nonword prime generated by transposing adjacent inner letters in a word (e.g., jugde) facilitates the recognition of the target word (JUDGE) more than a prime in which the relevant letters are replaced by different letters (e.g., junpe). This transposed-letter (TL) priming effect has been widely interpreted as evidence that the coding of letter position is flexible, rather than precise. Although the TL priming effect has been extensively investigated in the domain of visual word recognition using the lexical decision task, very few studies have investigated this empirical phenomenon in reading aloud. In the present study, we investigated TL priming effects in reading aloud words and nonwords and found that these effects are of equal magnitude for the two types of items. We take this result as support for the view that the TL priming effect arises from noisy perception of letter order within the prime prior to the mapping of orthography to phonology. PMID:25665798

  20. Periodontal Effects of a Transposed Versus a Conventional Flap in Mandibular Third Molar Extractions.

    Science.gov (United States)

    Laurito, Domenica; Lollobrigida, Marco; Graziani, Filippo; Guerra, Fabrizio; Vestri, Annarita; De Biase, Alberto

    2016-05-01

    The aim of this study was to compare a transposed with a repositioned flap by assessing the periodontal effects on the second molar and primary healing after extraction of partially impacted lower third molars. A total of 24 patients requiring partially impacted mandibular wisdom tooth removal were enrolled in the study. The test group (n = 12) underwent a transposed flap procedure, whereas the control group (n = 12) underwent a repositioned flap procedure. Plaque index, probing depth, bleeding on probing, and width of keratinized tissue were recorded the day of surgery (T1) and after 60 days (T4). Wound dehiscence was assessed on the mesio-distal and bucco-lingual directions at days 2 (T2), 7 (T3), and T4. No significant differences have been observed in the periodontal parameters between the groups at T1 and T4 (P > 0.05). Similarly, no difference was found at T2, T3, and T4 in wound dehiscence incidence (P > 0.05). To date, no data exists on the use of transposed flaps in third molar surgery; thus a comparison of results cannot be done. Further studies with larger population are needed to investigate the potential advantages of this type of flap. PMID:27054424

  1. Phase transitions for random states and a semi-circle law for the partial transpose

    CERN Document Server

    Aubrun, Guillaume; Ye, Deping

    2011-01-01

    For a system of N identical particles in a random pure state, there is a threshold k_0 = k_0(N) ~ N/5 such that two subsystems of k particles each typically share entanglement if k > k_0, and typically do not share entanglement if k k_1. Since, for a given state of the entire system, the induced state of a subsystem is given by the partial trace, the above facts can be rephrased as properties of random induced states. An important step in the analysis depends on identifying the asymptotic spectral density of the partial transposes of such random induced states, a result which is interesting in its own right.

  2. Behavior of a modified Dissociation element in barley: a tool for genetic studies and for breeding transgenic barley

    Science.gov (United States)

    Maize-derived sequences from the transposable elements Activator (Ac) and Dissociation (Ds) have enabled studies of gene function via transposon tagging. The characteristics of synthetic, transgene-containing Ds elements constructed for some of these studies has demonstrated their ability to resolve...

  3. Substituted-Letter and Transposed-Letter Effects in a Masked Priming Paradigm with French Developing Readers and Dyslexics

    Science.gov (United States)

    Lete, Bernard; Fayol, Michel

    2013-01-01

    The aim of the study was to undertake a behavioral investigation of the development of automatic orthographic processing during reading acquisition in French. Following Castles and colleagues' 2007 study ("Journal of Experimental Child Psychology, 97," 165-182) and their lexical tuning hypothesis framework, substituted-letter and transposed-letter…

  4. Insulation design of HTS transformer with the use of continuous transposed conductor

    International Nuclear Information System (INIS)

    Important key technologies of a high-temperature superconducting (HTS) transformer may include the HTS wire technology, cooling, AC loss reduction, large current technology, and cryogenic temperature insulation. Among them, the cryogenic temperature insulation technology will be specifically a core technology for ensuring reliability for the smaller size, stability, economic efficiency of a HTS transformer. In this paper, we have simulated a HTS transformer applied with continuous transposed conductor, which has been studied as a way of reducing AC loss. Also, we analyzed the insulation composition and considered various characteristics of insulation breakdown in liquid nitrogen. Insulation design was realized in a way of calculating breakdown voltage of 0.1% with Weibull statistical treatment of the obtained experimental results and calculating insulation distance meeting basic impulse insulation level (BIL) 750 kV, a target voltage.

  5. Novel porcine repetitive elements

    Directory of Open Access Journals (Sweden)

    Nonneman Dan J

    2006-12-01

    Full Text Available Abstract Background Repetitive elements comprise ~45% of mammalian genomes and are increasingly known to impact genomic function by contributing to the genomic architecture, by direct regulation of gene expression and by affecting genomic size, diversity and evolution. The ubiquity and increasingly understood importance of repetitive elements contribute to the need to identify and annotate them. We set out to identify previously uncharacterized repetitive DNA in the porcine genome. Once found, we characterized the prevalence of these repeats in other mammals. Results We discovered 27 repetitive elements in 220 BACs covering 1% of the porcine genome (Comparative Vertebrate Sequencing Initiative; CVSI. These repeats varied in length from 55 to 1059 nucleotides. To estimate copy numbers, we went to an independent source of data, the BAC-end sequences (Wellcome Trust Sanger Institute, covering approximately 15% of the porcine genome. Copy numbers in BAC-ends were less than one hundred for 6 repeat elements, between 100 and 1000 for 16 and between 1,000 and 10,000 for 5. Several of the repeat elements were found in the bovine genome and we have identified two with orthologous sites, indicating that these elements were present in their common ancestor. None of the repeat elements were found in primate, rodent or dog genomes. We were unable to identify any of the replication machinery common to active transposable elements in these newly identified repeats. Conclusion The presence of both orthologous and non-orthologous sites indicates that some sites existed prior to speciation and some were generated later. The identification of low to moderate copy number repetitive DNA that is specific to artiodactyls will be critical in the assembly of livestock genomes and studies of comparative genomics.

  6. Mouse endogenous retroviral long terminal repeat (LTR) elements and environmental carcinogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Yang, W.K.; Ch' ang, L-Y; Myer, F.E.; Yang, M.D.; Koh, C.K.

    1988-01-01

    For the past several years, the working hypothesis of this laboratory has been that chromosomal retrovirus-related gene elements play important roles in gene-rearrangement and gene-activation events of carcinogenesis and mutagenesis induced by environmental agents. This working hypothesis is based on the concept of transposable genes as well as the recent understanding of retroviruses (RNA tumor viruses) in relation to the carcinogenesis problem. Activation of transposable gene elements has been discussed from the viewpoint of unprogrammed genomic changes in response to unanticipated genomic shocks. This view was used in considering the possibility of transposable gene elements involved in genetic changes of cancer formation in the animal. In this regard, this concept is similar to the perspectives of RNA tumor viruses, the oncogene-virogene hypothesis, and the provirus hypothesis because retroviruses replicate through DNA forms that carry long terminal repeat (LTR) sequences resembling the insertion sequences (or the IS elements) of prokaryotic transposons. The finding of oncogene myc activation in avian leukosis virus-induced leukemogenesis and proviral insertion in the mouse dilute locus mutation have also pointed to the functional similarity between retroviruses and transposable genes.

  7. A major invasion of transposable elements accounts for the large size of the Blumeria graminis f.sp. tritici genome

    Czech Academy of Sciences Publication Activity Database

    Parlange, Z.; Oberhaensli, S.; Breen, J.; Platzer, M.; Taudien, S.; Šimková, Hana; Wicker, T.; Doležel, Jaroslav; Keller, B.

    2011-01-01

    Roč. 11, č. 4 (2011), s. 671-677. ISSN 1438-793X R&D Projects: GA MŠk ED0007/01/01 Institutional research plan: CEZ:AV0Z50380511 Keywords : Blumeria graminis * BAC library * BAC-end sequences Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.842, year: 2011

  8. ReAS: Recovery of ancestral sequences for transposable elements from the unassembled reads of a whole genome shotgun

    DEFF Research Database (Denmark)

    Li, Ruiqiang; Ye, Jia; Li, Songgang;

    2005-01-01

    in comparison to their ancestral sequences. Tested on the japonica rice genome, ReAS was able to reconstruct all of the high copy sequences in the Repbase repository of known TEs, and increase the effectiveness of RepeatMasker in identifying TEs from genome sequences. Udgivelsesdato: 2005-Sep...

  9. Transposition patterns of unlinked transposed Ds elements from two T-DNA loci on tomato chromosomes 7 and 8

    Czech Academy of Sciences Publication Activity Database

    Bříza, Jindřich; Niedermeierová, Hana; Pavingerová, Daniela; Thomas, C. M.; Klimyuk, V. I.; Jones, J. D. G.

    2002-01-01

    Roč. 266, - (2002), s. 882-890. ISSN 1617-4615 R&D Projects: GA ČR GA521/96/0724 Keywords : tomato chromosomes * gene manipulation Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.522, year: 2002

  10. REACTIVATION POTENTIAL OF EPIGENETICALLY INACTIVE MU TRANSPOSABLE ELEMENTS OF ZEA MAYS L. DECREASES IN SUCCESSIVE GENERATIONS. (R824900)

    Science.gov (United States)

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  11. De novo origin of VCY2 from autosome to Y-transposed amplicon.

    Directory of Open Access Journals (Sweden)

    Peng-Rong Cao

    Full Text Available The formation of new genes is a primary driving force of evolution in all organisms. The de novo evolution of new genes from non-protein-coding genomic regions is emerging as an important additional mechanism for novel gene creation. Y chromosomes underlie sex determination in mammals and contain genes that are required for male-specific functions. In this study, a search was undertaken for Y chromosome de novo genes derived from non-protein-coding sequences. The Y chromosome orphan gene variable charge, Y-linked (VCY2, is an autosome-derived gene that has sequence similarity to large autosomal fragments but lacks an autosomal protein-coding homolog. VCY2 locates in the amplicon containing long DNA fragments that were transposed from autosomes to the Y chromosome before the ape-monkey split. We confirmed that VCY2 cannot be encoded by autosomes due to the presence of multiple disablers that disrupt the open reading frame, such as the absence of start or stop codons and the presence of premature stop codons. Similar observations have been made for homologs in the autosomes of the chimpanzee, gorilla, rhesus macaque, baboon and out-group marmoset, which suggests that there was a non-protein-coding ancestral VCY2 that was common to apes and monkeys that predated the transposition event. Furthermore, while protein-coding orthologs are absent, a putative non-protein-coding VCY2 with conserved disablers was identified in the rhesus macaque Y chromosome male-specific region. This finding implies that VCY2 might have not acquired its protein-coding ability before the ape-monkey split. VCY2 encodes a testis-specific expressed protein and is involved in the pathologic process of male infertility, and the acquisition of this gene might improve male fertility. This is the first evidence that de novo genes can be generated from transposed autosomal non-protein-coding segments, and this evidence provides novel insights into the evolutionary history of the Y

  12. De novo origin of VCY2 from autosome to Y-transposed amplicon.

    Science.gov (United States)

    Cao, Peng-Rong; Wang, Lei; Jiang, Yu-Chao; Yi, Yin-Sha; Qu, Fang; Liu, Tao-Cheng; Lv, Yuan

    2015-01-01

    The formation of new genes is a primary driving force of evolution in all organisms. The de novo evolution of new genes from non-protein-coding genomic regions is emerging as an important additional mechanism for novel gene creation. Y chromosomes underlie sex determination in mammals and contain genes that are required for male-specific functions. In this study, a search was undertaken for Y chromosome de novo genes derived from non-protein-coding sequences. The Y chromosome orphan gene variable charge, Y-linked (VCY)2, is an autosome-derived gene that has sequence similarity to large autosomal fragments but lacks an autosomal protein-coding homolog. VCY2 locates in the amplicon containing long DNA fragments that were transposed from autosomes to the Y chromosome before the ape-monkey split. We confirmed that VCY2 cannot be encoded by autosomes due to the presence of multiple disablers that disrupt the open reading frame, such as the absence of start or stop codons and the presence of premature stop codons. Similar observations have been made for homologs in the autosomes of the chimpanzee, gorilla, rhesus macaque, baboon and out-group marmoset, which suggests that there was a non-protein-coding ancestral VCY2 that was common to apes and monkeys that predated the transposition event. Furthermore, while protein-coding orthologs are absent, a putative non-protein-coding VCY2 with conserved disablers was identified in the rhesus macaque Y chromosome male-specific region. This finding implies that VCY2 might have not acquired its protein-coding ability before the ape-monkey split. VCY2 encodes a testis-specific expressed protein and is involved in the pathologic process of male infertility, and the acquisition of this gene might improve male fertility. This is the first evidence that de novo genes can be generated from transposed autosomal non-protein-coding segments, and this evidence provides novel insights into the evolutionary history of the Y chromosome. PMID

  13. Mobile genetic elements in protozoan parasites

    Indian Academy of Sciences (India)

    Sudha Bhattacharya; Abhijeet Bakre; Alok Bhattacharya

    2002-08-01

    Mobile genetic elements, by virtue of their ability to move to new chromosomal locations, are considered important in shaping the evolutionary course of the genome. They are widespread in the biological kingdom. Among the protozoan parasites several types of transposable elements are encountered. The largest variety is seen in the trypanosomatids—Trypanosoma brucei, Trypanosoma cruzi and Crithidia fasciculata. They contain elements that insert site-specifically in the spliced-leader RNA genes, and others that are dispersed in a variety of genomic locations. Giardia lamblia contains three families of transposable elements. Two of these are subtelomeric in location while one is chromosome-internal. Entamoeba histolytica has an abundant retrotransposon dispersed in the genome. Nucleotide sequence analysis of all the elements shows that they are all retrotransposons, and, with the exception of one class of elements in T. cruzi, all of them are non-long-terminal-repeat retrotransposons. Although most copies have accumulated mutations, they can potentially encode reverse transcriptase, endonuclease and nucleic-acid-binding activities. Functionally and phylogenetically they do not belong to a single lineage, showing that retrotransposons were acquired early in the evolution of protozoan parasites. Many of the potentially autonomous elements that encode their own transposition functions have nonautonomous counterparts that probably utilize the functions in trans. In this respect these elements are similar to the mammalian LINEs and SINEs (long and short interspersed DNA elements), showing a common theme in the evolution of retrotransposons. So far there is no report of a DNA transposon in any protozoan parasite. The genome projects that are under way for most of these organisms will help understand the evolution and possible function of these genetic elements.

  14. Assessment of transposed ovarian movement. How much of a safety margin should be added during pelvic radiotherapy?

    International Nuclear Information System (INIS)

    The purpose of this study was to analyze transposed ovarian movement. Data from 27 patients who underwent ovarian transposition after surgical treatment for uterine cancer were retrospectively analyzed. Computed tomography (CT) images including transposed ovaries were superimposed on other CT images acquired at different times, and were matched on bony structures. Differences in ovarian position between the CT images were measured. The planning organ at risk volume (PRV) margins were calculated from the formula of the 90% reference intervals (RIs) and the 95% RI, which were defined as mean ± 1.65 standard deviation (SD) and mean ± 1.96 SD, respectively. The 90% RI in the cranial, caudal, anterior, posterior, left and right directions were 1.5, 1.5, 1.4, 1.0, 1.7 and 0.9 cm, respectively. The 95% RI in the corresponding directions were 1.5, 2.0, 1.7, 1.2, 1.9 and 1.2 cm, respectively. These data suggest that bilateral ovaries need a PRV margin of ∼2 cm in all directions. The present study suggests that a transposed ovary needs the same PRV margin as a normal ovary (∼2 cm). Even after transposition, ovaries should be kept away from the radiation field to take into consideration the degree of ovarian movement. (author)

  15. Genomic sequence and activity of KS10, a transposable phage of the Burkholderia cepacia complex

    Directory of Open Access Journals (Sweden)

    Shrivastava Savita

    2008-12-01

    Full Text Available Abstract Background The Burkholderia cepacia complex (BCC is a versatile group of Gram negative organisms that can be found throughout the environment in sources such as soil, water, and plants. While BCC bacteria can be involved in beneficial interactions with plants, they are also considered opportunistic pathogens, specifically in patients with cystic fibrosis and chronic granulomatous disease. These organisms also exhibit resistance to many antibiotics, making conventional treatment often unsuccessful. KS10 was isolated as a prophage of B. cenocepacia K56-2, a clinically relevant strain of the BCC. Our objective was to sequence the genome of this phage and also determine if this prophage encoded any virulence determinants. Results KS10 is a 37,635 base pairs (bp transposable phage of the opportunistic pathogen Burkholderia cenocepacia. Genome sequence analysis and annotation of this phage reveals that KS10 shows the closest sequence homology to Mu and BcepMu. KS10 was found to be a prophage in three different strains of B. cenocepacia, including strains K56-2, J2315, and C5424, and seven tested clinical isolates of B. cenocepacia, but no other BCC species. A survey of 23 strains and 20 clinical isolates of the BCC revealed that KS10 is able to form plaques on lawns of B. ambifaria LMG 19467, B. cenocepacia PC184, and B. stabilis LMG 18870. Conclusion KS10 is a novel phage with a genomic organization that differs from most phages in that its capsid genes are not aligned into one module but rather separated by approximately 11 kb, giving evidence of one or more prior genetic rearrangements. There were no potential virulence factors identified in KS10, though many hypothetical proteins were identified with no known function.

  16. General survey of hAT transposon superfamily with highlight on hobo element in Drosophila.

    Science.gov (United States)

    Ladevèze, Véronique; Chaminade, Nicole; Lemeunier, Françoise; Periquet, Georges; Aulard, Sylvie

    2012-09-01

    The hAT transposons, very abundant in all kingdoms, have a common evolutionary origin probably predating the plant-fungi-animal divergence. In this paper we present their general characteristics. Members of this superfamily belong to Class II transposable elements. hAT elements share transposase, short terminal inverted repeats and eight base-pairs duplication of genomic target. We focus on hAT elements in Drosophila, especially hobo. Its distribution, dynamics and impact on genome restructuring in laboratory strains as well as in natural populations are reported. Finally, the evolutionary history of hAT elements, their domestication and use as transgenic tools are discussed. PMID:23111927

  17. Molecular and Functional Analysis of the Mariner Mutator Element Mos1 in Drosophila

    OpenAIRE

    Medhora, M.; Maruyama, K; Hartl, D L

    1991-01-01

    The white-peach allele in Drosophila results from insertion of the transposable element mariner. The particular copy that is inserted in white-peach is an inactive copy referred to as the peach element. The peach element is excised at a high rate in the presence of active copies of mariner located elsewhere in the genome, and the excision of peach in somatic cells is recognized phenotypically by the occurrence of eye-color mosaicism in white-peach flies. Active mariner elements identified by ...

  18. Impact of ploidy level on the distribution of Pokey element insertions in the Daphnia pulex complex

    OpenAIRE

    Vergilino, Roland; Eagle, Shannon HC; Crease, Teresa J; Dufresne, France

    2014-01-01

    Background Transposable elements (TEs) play a major role in genome evolution. Their capacity to move and/or multiply in the genome of their host may have profound impacts on phenotypes and dramatic consequences on genome structure. The population dynamics and distribution of TEs are influenced by their mode of transposition, the availability of niches in host genomes, and host population dynamics. Theories predict an increase in the number of TE insertions following hybridization or polyploid...

  19. Differential expression of a retrotransposable element, Rex6, in Colossoma macropomum fish from different Amazonian environments

    OpenAIRE

    Barbosa, Cassiane Martins; Mareco, Edson Assunção; Silva, Maeli Dal Pai; Martins, Cesar; Alves-Costa, Fernanda Antunes

    2014-01-01

    Transposable elements (TEs) are DNA sequences that have the ability to move and replicate within the genomes. TEs can be classified according to their intermediates of transposition, RNA (retrotransposons) or DNA. In some aquatic organisms, it has been observed that environmental factors such as pH, temperature and pollution may stimulate differential transcription and mobilization of retrotransposons. In light of this information, the present study sought to evaluate the expression of Rex6 T...

  20. Genome wide survey, discovery and evolution of repetitive elements in three Entamoeba species

    Directory of Open Access Journals (Sweden)

    Wortman Jennifer

    2008-12-01

    Full Text Available Abstract Background Identification and mapping of repetitive elements is a key step for accurate gene prediction and overall structural annotation of genomes. During the assembly and annotation of three highly repetitive amoeba genomes, Entamoeba histolytica, Entamoeba dispar, and Entamoeba invadens, we performed comparative sequence analysis to identify and map all class I and class II transposable elements in their sequences. Results Here, we report the identification of two novel Entamoeba-specific repeats: ERE1 and ERE2; ERE1 is spread across the three genomes and associated with different repeats in a species-specific manner, while ERE2 is unique to E. histolytica. We also report the identification of two novel subfamilies of LINE and SINE retrotransposons in E. dispar and provide evidence for how the different LINE and SINE subfamilies evolved in these species. Additionally, we found a putative transposase-coding gene in E. histolytica and E. dispar related to the mariner transposon Hydargos from E. invadens. The distribution of transposable elements in these genomes is markedly skewed with a tendency of forming clusters. More than 70% of the three genomes have a repeat density below their corresponding average value indicating that transposable elements are not evenly distributed. We show that repeats and repeat-clusters are found at syntenic break points between E. histolytica and E. dispar and hence, could work as recombination hot spots promoting genome rearrangements. Conclusion The mapping of all transposable elements found in these parasites shows that repeat coverage is up to three times higher than previously reported. LINE, ERE1 and mariner elements were present in the common ancestor to the three Entamoeba species while ERE2 was likely acquired by E. histolytica after its separation from E. dispar. We demonstrate that E. histolytica and E. dispar share their entire repertoire of LINE and SINE retrotransposons and that Eh_SINE3

  1. Genomic Organization of the Drosophila Telomere RetrotransposableElements

    Energy Technology Data Exchange (ETDEWEB)

    George, J.A.; DeBaryshe, P.G.; Traverse, K.L.; Celniker, S. E.; Pardue, M-L.

    2006-10-16

    The emerging sequence of the heterochromatic portion of the Drosophila melanogaster genome, with the most recent update of euchromatic sequence, gives the first genome-wide view of the chromosomal distribution of the telomeric retrotransposons, HeT-A, TART, and Tahre. As expected, these elements are entirely excluded from euchromatin, although sequence fragments of HeT-A and TART 3 untranslated regions are found in nontelomeric heterochromatin on the Y chromosome. The proximal ends of HeT-A/TART arrays appear to be a transition zone because only here do other transposable elements mix in the array. The sharp distinction between the distribution of telomeric elements and that of other transposable elements suggests that chromatin structure is important in telomere element localization. Measurements reported here show (1) D. melanogaster telomeres are very long, in the size range reported for inbred mouse strains (averaging 46 kb per chromosome end in Drosophila stock 2057). As in organisms with telomerase, their length varies depending on genotype. There is also slight under-replication in polytene nuclei. (2) Surprisingly, the relationship between the number of HeT-A and TART elements is not stochastic but is strongly correlated across stocks, supporting the idea that the two elements are interdependent. Although currently assembled portions of the HeT-A/TART arrays are from the most-proximal part of long arrays, {approx}61% of the total HeT-A sequence in these regions consists of intact, potentially active elements with little evidence of sequence decay, making it likely that the content of the telomere arrays turns over more extensively than has been thought.

  2. Transposing reform pedagogy into new contexts: complex instruction in remote Australia

    Science.gov (United States)

    Sullivan, Peter; Jorgensen, Robyn; Boaler, Jo; Lerman, Steve

    2013-03-01

    This article draws on the outcomes of a 4-year project where complex instruction was used as the basis for a reform in mathematics teaching in remote Aboriginal communities in Australia. The article describes the overall project in terms of the goals and aspirations for learning mathematics among remote Indigenous Australians. Knowing that the approach had been successful in a diverse setting in California, the project team sought to implement and evaluate the possibilities of such reform in a context in which the need for a culturally responsive pedagogy was critical. Elements of complex instruction offered considerable possibilities in aligning with the cultures of the remote communities, but with recognition of the possibility that some elements may not be workable in these contexts. Complex instruction also valued deep knowledge of mathematics rather than a tokenistic, impoverished mathematics. The strategies within complex instruction allowed for mathematical and cultural scaffolding to promote deep learning in mathematics. Such an approach was in line with current reforms in Indigenous education in Australia where there are high expectations of learners in order to break away from the deficit thinking that has permeated much education in remote Australia. The overall intent is to demonstrate what pedagogies are possible within the constraints of the remote context.

  3. A SINE in the genome of the cephalochordate amphioxus is an Alu element

    Directory of Open Access Journals (Sweden)

    2006-04-01

    Full Text Available Transposable elements of about 300 bp, termed “short interspersed nucleotide elements or SINEs are common in eukaryotes. However, Alu elements, SINEs containing restriction sites for the AluI enzyme, have been known only from primates. Here I report the first SINE found in the genome of the cephalochordate, amphioxus. It is an Alu element of 375 bp that does not share substantial identity with any genomic sequences in vertebrates. It was identified because it was located in the FoxD regulatory region in a cosmid derived from one individual, but absent from the two FoxD alleles of BACs from a second individual. However, searches of sequences of BACs and genomic traces from this second individual gave an estimate of 50-100 copies in the amphioxus genome. The finding of an Alu element in amphioxus raises the question of whether Alu elements in amphioxus and primates arose by convergent evolution or by inheritance from a common ancestor. Genome-wide analyses of transposable elements in amphioxus and other chordates such as tunicates, agnathans and cartilaginous fishes could well provide the answer.

  4. Functional Anatomy of Recognition of Chinese Multi-Character Words: Convergent Evidence from Effects of Transposable Nonwords, Lexicality, and Word Frequency.

    Directory of Open Access Journals (Sweden)

    Nan Lin

    Full Text Available This fMRI study aimed to identify the neural mechanisms underlying the recognition of Chinese multi-character words by partialling out the confounding effect of reaction time (RT. For this purpose, a special type of nonword-transposable nonword-was created by reversing the character orders of real words. These nonwords were included in a lexical decision task along with regular (non-transposable nonwords and real words. Through conjunction analysis on the contrasts of transposable nonwords versus regular nonwords and words versus regular nonwords, the confounding effect of RT was eliminated, and the regions involved in word recognition were reliably identified. The word-frequency effect was also examined in emerged regions to further assess their functional roles in word processing. Results showed significant conjunctional effect and positive word-frequency effect in the bilateral inferior parietal lobules and posterior cingulate cortex, whereas only conjunctional effect was found in the anterior cingulate cortex. The roles of these brain regions in recognition of Chinese multi-character words were discussed.

  5. Functional Anatomy of Recognition of Chinese Multi-Character Words: Convergent Evidence from Effects of Transposable Nonwords, Lexicality, and Word Frequency.

    Science.gov (United States)

    Lin, Nan; Yu, Xi; Zhao, Ying; Zhang, Mingxia

    2016-01-01

    This fMRI study aimed to identify the neural mechanisms underlying the recognition of Chinese multi-character words by partialling out the confounding effect of reaction time (RT). For this purpose, a special type of nonword-transposable nonword-was created by reversing the character orders of real words. These nonwords were included in a lexical decision task along with regular (non-transposable) nonwords and real words. Through conjunction analysis on the contrasts of transposable nonwords versus regular nonwords and words versus regular nonwords, the confounding effect of RT was eliminated, and the regions involved in word recognition were reliably identified. The word-frequency effect was also examined in emerged regions to further assess their functional roles in word processing. Results showed significant conjunctional effect and positive word-frequency effect in the bilateral inferior parietal lobules and posterior cingulate cortex, whereas only conjunctional effect was found in the anterior cingulate cortex. The roles of these brain regions in recognition of Chinese multi-character words were discussed. PMID:26901644

  6. Expression of Pseudomonas aeruginosa transposable phages in Pseudomonas putida cells. I. Establishment of lysogeny and lytic growth efficiency

    International Nuclear Information System (INIS)

    Expression of the genomes of Pseudomonas aeruginosa transposable phages (TP) in the cells of a heterologous host, P. putida PpGl, was studied. A high efficiency of TP lytic growth in PpGl cells was obtained both after zygotic induction following RP4::TP plasmid transfer and after thermoinduction of PpGl cells lysogenic for thermoinducible prophage D3112cts15. Characteristic for PpGl cells was a high TP yield (20-25 phage D3112cts15 particles per cell), which was evidence of a high level of TP transposition in cells of this species. The frequency of RP4::TP transfer into PpGl and PA01 cells was equal, but the lysogeny detection rat was somewhat lower in PpGl. Pseudomonas aeruginosa TP can integrate into the PpGl chromosome, producing inducible lysogens. The presence of RP4 is not necessary for the expression of the TP genome in PpGl cells. The D3112cts15 TP may be used for interspecific transduction of plasmids and chromosomal markers

  7. Transuranium elements

    International Nuclear Information System (INIS)

    In this paper, the authors introduce this volume of historical and research papers on the transuranium elements by reviewing the period of discovery of elements 93 and beyond. Then the authors highlight the research achievements that focus on the unique properties of the 5f elements. Finally, the authors outline the technology and applications of transuranium elements and their radiobiology

  8. Contrasting Patterns of Transposable Element and Satellite Distribution on Sex Chromosomes (XY1Y2) in the Dioecious Plant Rumex acetosa

    Czech Academy of Sciences Publication Activity Database

    Šteflová, Pavlína; Tokan, Viktor; Vogel, Ivan; Lexa, M.; Macas, Jiří; Novák, Petr; Hobza, Roman; Vyskot, Boris; Kejnovský, Eduard

    2013-01-01

    Roč. 5, č. 4 (2013), s. 769-782. ISSN 1759-6653 R&D Projects: GA ČR(CZ) GAP305/10/0930; GA ČR(CZ) GAP501/10/0102; GA ČR(CZ) GAP501/12/2220 Grant ostatní: GA MŠk(CZ) ED1.1.00/02.0068 Institutional research plan: CEZ:AV0Z50040702 Institutional support: RVO:68081707 ; RVO:60077344 Keywords : Y-CHROMOSOME * REPETITIVE SEQUENCES * SILENE-LATIFOLIA Subject RIV: BO - Biophysics; EB - Genetics ; Molecular Biology (BC-A) Impact factor: 4.532, year: 2013

  9. An Immunity-Triggering Effector from the Barley Smut Fungus Ustilago hordei Resides in an Ustilaginaceae-Specific Cluster Bearing Signs of Transposable Element-Assisted Evolution

    OpenAIRE

    Brefort, Thomas; Tanaka, Shigeyuki; Neidig, Nina; Doehlemann, Gunther; Vincon, Volker; Kahmann, Regine

    2014-01-01

    In the genome of the biotrophic plant pathogen Ustilago maydis, many of the genes coding for secreted protein effectors modulating virulence are arranged in gene clusters. The vast majority of these genes encode novel proteins whose expression is coupled to plant colonization. The largest of these gene clusters, cluster 19A, encodes 24 secreted effectors. Deletion of the entire cluster results in severe attenuation of virulence. Here we present the functional analysis of this genomic region. ...

  10. Repetitive elements dynamics in cell identity programming, maintenance and disease

    KAUST Repository

    Bodega, Beatrice

    2014-12-01

    The days of \\'junk DNA\\' seem to be over. The rapid progress of genomics technologies has been unveiling unexpected mechanisms by which repetitive DNA and in particular transposable elements (TEs) have evolved, becoming key issues in understanding genome structure and function. Indeed, rather than \\'parasites\\', recent findings strongly suggest that TEs may have a positive function by contributing to tissue specific transcriptional programs, in particular as enhancer-like elements and/or modules for regulation of higher order chromatin structure. Further, it appears that during development and aging genomes experience several waves of TEs activation, and this contributes to individual genome shaping during lifetime. Interestingly, TEs activity is major target of epigenomic regulation. These findings are shedding new light on the genome-phenotype relationship and set the premises to help to explain complex disease manifestation, as consequence of TEs activity deregulation.

  11. Chompy: an infestation of MITE-like repetitive elements in the crocodilian genome.

    Science.gov (United States)

    Ray, David A; Hedges, Dale J; Herke, Scott W; Fowlkes, Justin D; Barnes, Erin W; LaVie, Daniel K; Goodwin, Lindsey M; Densmore, Llewellyn D; Batzer, Mark A

    2005-12-01

    Interspersed repeats are a major component of most eukaryotic genomes and have an impact on genome size and stability, but the repetitive element landscape of crocodilian genomes has not yet been fully investigated. In this report, we provide the first detailed characterization of an interspersed repeat element in any crocodilian genome. Chompy is a putative miniature inverted-repeat transposable element (MITE) family initially recovered from the genome of Alligator mississippiensis (American alligator) but also present in the genomes of Crocodylus moreletii (Morelet's crocodile) and Gavialis gangeticus (Indian gharial). The element has all of the hallmarks of MITEs including terminal inverted repeats, possible target site duplications, and a tendency to form secondary structures. We estimate the copy number in the alligator genome to be approximately 46,000 copies. As a result of their size and unique properties, Chompy elements may provide a useful source of genomic variation for crocodilian comparative genomics. PMID:16183215

  12. Transuranium elements

    International Nuclear Information System (INIS)

    This paper reports that neutron irradiation of uranium, beginning in 1934, led to the reported discovery of such transuranium elements as eka-rhenium. After a few years of investigation these were correctly identified, in December 1938, as fission products. The first real transuranium elements, with atomic numbers 93 and 94 (neptumiun and plutionium), were discovered in 1940-1941. Plutomiun-239 was shown to be fission-able with slow neutrons, and chemical methods for its separation in quantity were developed. Not until it was recognized that transuranium elements should be part of a 14-member actinide series could elements 95 and 96 (americium and curium) be chemically identified after their nuclear synthesis. This new view was the key to the synthesis and identified after their nuclear synthesis. This new view was the key to the synthesis and identification of the next seven transuranium elements, resulting in the completion of the actinide series at element 103 in 1961. The transactinide elements could, according to the actinide concept, also be correctly placed in the periodic table, and the chemical properties of the first transactinide elements, elements 104 and 105 (rutherfordium and hafnium), confirm this point of view. Transuranium elements through number 109 are now known

  13. Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence

    Energy Technology Data Exchange (ETDEWEB)

    Manning, Viola A.; Pandelova, Iovanna; Dhillon, Braham; Wilhelm, Larry J.; Goodwin, Stephen B.; Berlin, Aaron M.; Figueroa, Melania; Freitag, Michael; Hane, James K.; Henrissat, Bernard; Holman, Wade H.; Kodira, Chinnappa D.; Martin, Joel; Oliver, Richard P.; Robbertse, Barbara; Schackwitz, Wendy; Schwartz, David C.; Spatafora, Joseph W.; Turgeon, B. Gillian; Yandava, Chandri; Young, Sarah; Zhou, Shiguo; Zeng, Qiandong; Grigoriev, Igor V.; Ma, Li-Jun; Ciuffetti, Lynda M.

    2012-08-16

    Pyrenophora tritici-repentis is a necrotrophic fungus causal to the disease tan spot of wheat, whose contribution to crop loss has increased significantly during the last few decades. Pathogenicity by this fungus is attributed to the production of host-selective toxins (HST), which are recognized by their host in a genotype-specific manner. To better understand the mechanisms that have led to the increase in disease incidence related to this pathogen, we sequenced the genomes of three P. tritici-repentis isolates. A pathogenic isolate that produces two known HSTs was used to assemble a reference nuclear genome of approximately 40 Mb composed of 11 chromosomes that encode 12,141 predicted genes. Comparison of the reference genome with those of a pathogenic isolate that produces a third HST, and a nonpathogenic isolate, showed the nonpathogen genome to be more diverged than those of the two pathogens. Examination of gene-coding regions has provided candidate pathogen-specific proteins and revealed gene families that may play a role in a necrotrophic lifestyle. Analysis of transposable elements suggests that their presence in the genome of pathogenic isolates contributes to the creation of novel genes, effector diversification, possible horizontal gene transfer events, identified copy number variation, and the first example of transduplication by DNA transposable elements in fungi. Overall, comparative analysis of these genomes provides evidence that pathogenicity in this species arose through an influx of transposable elements, which created a genetically flexible landscape that can easily respond to environmental changes.

  14. Summary compilation of shell element performance versus formulation.

    Energy Technology Data Exchange (ETDEWEB)

    Heinstein, Martin Wilhelm; Hales, Jason Dean (Idaho National Laboratory, Idaho Falls, ID); Breivik, Nicole L.; Key, Samuel W. (FMA Development, LLC, Great Falls, MT)

    2011-07-01

    This document compares the finite element shell formulations in the Sierra Solid Mechanics code. These are finite elements either currently in the Sierra simulation codes Presto and Adagio, or expected to be added to them in time. The list of elements are divided into traditional two-dimensional, plane stress shell finite elements, and three-dimensional solid finite elements that contain either modifications or additional terms designed to represent the bending stiffness expected to be found in shell formulations. These particular finite elements are formulated for finite deformation and inelastic material response, and, as such, are not based on some of the elegant formulations that can be found in an elastic, infinitesimal finite element setting. Each shell element is subjected to a series of 12 verification and validation test problems. The underlying purpose of the tests here is to identify the quality of both the spatially discrete finite element gradient operator and the spatially discrete finite element divergence operator. If the derivation of the finite element is proper, the discrete divergence operator is the transpose of the discrete gradient operator. An overall summary is provided from which one can rank, at least in an average sense, how well the individual formulations can be expected to perform in applications encountered year in and year out. A letter grade has been assigned albeit sometimes subjectively for each shell element and each test problem result. The number of A's, B's, C's, et cetera assigned have been totaled, and a grade point average (GPA) has been computed, based on a 4.0-system. These grades, combined with a comparison between the test problems and the application problem, can be used to guide an analyst to select the element with the best shell formulation.

  15. The Ecological Genomics of Fungi: Repeated Elements in Filamentous Fungi with a Focus on Wood-Decay Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Murat, Claude [INRA, Nancy, France; Payen, Thibaut [INRA, Nancy, France; Petitpierre, Denis [INRA, Nancy, France; Labbe, Jessy L [ORNL

    2013-01-01

    In the last decade, the genome of several dozen filamentous fungi have been sequenced. Interestingly, vast diversity in genome size was observed (Fig. 2.1) with 14-fold differences between the 9 Mb of the human pathogenic dandruff fungus (Malassezia globosa; Xu, Saunders, et al., 2007) and the 125 Mb of the ectomycorrhizal black truffle of P rigord (Tuber melanosporum; Martin, Kohler, et al., 2010). Recently, Raffaele and Kamoun (2012) highlighted that the genomes of several lineages of filamentous plant pathogens have been shaped by repeat-driven expansion. Indeed, repeated elements are ubiquitous in all prokaryote and eukaryote genomes; however, their frequencies can vary from just a minor percentage of the genome to more that 60 percent of the genome. Repeated elements can be classified in two major types: satellites DNA and transposable elements. In this chapter, the different types of repeated elements and how these elements can impact genome and gene repertoire will be described. Also, an intriguing link between the transposable elements richness and diversity and the ecological niche will be highlighted.

  16. PELTIER ELEMENTS

    CERN Document Server

    Tani, Laurits

    2015-01-01

    To control Peltier elements, temperature controller was used. I used TEC-1091 that was manufactured my Meerstetter Engineering. To gain control with the temperature controller, software had to be intalled on a controlling PC. There were different modes to control the Peltier: Tempererature controller to control temperature, Static current/voltage to control voltage and current and LIVE ON/OFF to auto-tune the controller respectively to the system. Also, since near the collision pipe there is much radiation, radiation-proof Peltier elements have to be used. To gain the best results, I had to find the most efficient Peltier elements and try to get their cold side to -40 degrees Celsius.

  17. Radiographic element

    International Nuclear Information System (INIS)

    Radiographic elements are disclosed having first and second silver halide emulsion layers comprised of a dispersing medium and radiation-sensitive silver halide grains, and a support interposed between said silver halide emulsion layers capable of transmitting radiation to which said second silver halide emulsion layer is responsive. These elements are characterized in that at least said first silver halide emulsion layer contains tabular silver halide grains and spectral sensitizing dye adsorbed to the surface of the grains. Crossover can be improved in relation to the imaging characteristics. (author)

  18. Radiographic element

    International Nuclear Information System (INIS)

    Radiographic elements are disclosed comprised of first and second silver halide emulsion layers separated by an interposed support capable of transmitting radiation to which the second image portion is responsive. At least the first imaging portion contains a silver halide emulsion in which thin tubular silver halide grains of intermediate aspect ratios (from 5:1 to 8:1) are present. Spectral sensitizing dye is adsorbed to the surface of the tubular grains. Increased photographic speeds can be realized at comparable levels of crossover. (author)

  19. Superheavy elements

    CERN Document Server

    Hofmann, S

    1999-01-01

    The outstanding aim of experimental investigations of heavy nuclei is the exploration of spherical 'SuperHeavy Elements' (SHEs). On the basis of the nuclear shell model, the next double magic shell-closure beyond sup 2 sup 0 sup 8 Pb is predicted at proton numbers between Z=114 and 126 and at neutron number N=184. All experimental efforts aiming at identifying SHEs (Z>=114) were negative so far. A highly sensitive search experiment was performed in November-December 1995 at SHIP. The isotope sup 2 sup 9 sup 0 116 produced by 'radiative capture' was searched for in the course of a 33 days irradiation of a sup 2 sup 0 sup 8 Pb target with sup 8 sup 2 Se projectiles, however, only cross-section limits were measured. Positive results were obtained in experiments searching for elements from 110 to 112 using cold fusion and the 1n evaporation channel. The produced isotopes were unambiguously identified by means of alpha-alpha correlations. Not fission, but alpha emission is the dominant decay mode. The measurement ...

  20. MAR elements and transposons for improved transgene integration and expression.

    Directory of Open Access Journals (Sweden)

    Déborah Ley

    Full Text Available Reliable and long-term expression of transgenes remain significant challenges for gene therapy and biotechnology applications, especially when antibiotic selection procedures are not applicable. In this context, transposons represent attractive gene transfer vectors because of their ability to promote efficient genomic integration in a variety of mammalian cell types. However, expression from genome-integrating vectors may be inhibited by variable gene transcription and/or silencing events. In this study, we assessed whether inclusion of two epigenetic control elements, the human Matrix Attachment Region (MAR 1-68 and X-29, in a piggyBac transposon vector, may lead to more reliable and efficient expression in CHO cells. We found that addition of the MAR 1-68 at the center of the transposon did not interfere with transposition frequency, and transgene expressing cells could be readily detected from the total cell population without antibiotic selection. Inclusion of the MAR led to higher transgene expression per integrated copy, and reliable expression could be obtained from as few as 2-4 genomic copies of the MAR-containing transposon vector. The MAR X-29-containing transposons was found to mediate elevated expression of therapeutic proteins in polyclonal or monoclonal CHO cell populations using a transposable vector devoid of selection gene. Overall, we conclude that MAR and transposable vectors can be used to improve transgene expression from few genomic transposition events, which may be useful when expression from a low number of integrated transgene copies must be obtained and/or when antibiotic selection cannot be applied.

  1. Characterization of new IS elements and studies of their dispersion in two subspecies of Leifsonia xyli

    Directory of Open Access Journals (Sweden)

    Monteiro-Vitorello Claudia B

    2008-07-01

    Full Text Available Abstract Background Leifsonia xyli is a xylem-inhabiting bacterial species comprised of two subspecies: L. xyli subsp. xyli (Lxx and L. xyli subsp. cynodontis (Lxc. Lxx is the causal agent of ratoon stunting disease in sugarcane commercial fields and Lxc colonizes the xylem of several grasses causing either mild or no symptoms of disease. The completely sequenced genome of Lxx provided insights into its biology and pathogenicity. Since IS elements are largely reported as an important source of bacterial genome diversification and nothing is known about their role in chromosome architecture of L. xyli, a comparative analysis of Lxc and Lxx elements was performed. Results Sample sequencing of Lxc genome and comparative analysis with Lxx complete DNA sequence revealed a variable number of IS transposable elements acting upon genomic diversity. A detailed characterization of Lxc IS elements and a comparative review with IS elements of Lxx are presented. Each genome showed a unique set of elements although related to same IS families when considering features such as similarity among transposases, inverted and direct repeats, and element size. Most of the Lxc and Lxx IS families assigned were reported to maintain transposition at low levels using translation regulatory mechanisms, consistent with our in silico analysis. Some of the IS elements were found associated with rearrangements and specific regions of each genome. Differences were also found in the effect of IS elements upon insertion, although none of the elements were preferentially associated with gene disruption. A survey of transposases among genomes of Actinobacteria showed no correlation between phylogenetic relatedness and distribution of IS families. By using Southern hybridization, we suggested that diversification of Lxc isolates is also mediated by insertion sequences in probably recent events. Conclusion Collectively our data indicate that transposable elements are involved in

  2. Characterization of irritans mariner-like elements in the olive fruit fly Bactrocera oleae (Diptera: Tephritidae): evolutionary implications

    Science.gov (United States)

    Ben Lazhar-Ajroud, Wafa; Caruso, Aurore; Mezghani, Maha; Bouallegue, Maryem; Tastard, Emmanuelle; Denis, Françoise; Rouault, Jacques-Deric; Makni, Hanem; Capy, Pierre; Chénais, Benoît; Makni, Mohamed; Casse, Nathalie

    2016-08-01

    Genomic variation among species is commonly driven by transposable element (TE) invasion; thus, the pattern of TEs in a genome allows drawing an evolutionary history of the studied species. This paper reports in vitro and in silico detection and characterization of irritans mariner-like elements (MLEs) in the genome and transcriptome of Bactrocera oleae (Rossi) (Diptera: Tephritidae). Eleven irritans MLE sequences have been isolated in vitro using terminal inverted repeats (TIRs) as primers, and 215 have been extracted in silico from the sequenced genome of B. oleae. Additionally, the sequenced genomes of Bactrocera tryoni (Froggatt) and Bactrocera cucurbitae (Diptera: Tephritidae) have been explored to identify irritans MLEs. A total of 129 sequences from B. tryoni have been extracted, while the genome of B. cucurbitae appears probably devoid of irritans MLEs. All detected irritans MLEs are defective due to several mutations and are clustered together in a monophyletic group suggesting a common ancestor. The evolutionary history and dynamics of these TEs are discussed in relation with the phylogenetic distribution of their hosts. The knowledge on the structure, distribution, dynamic, and evolution of irritans MLEs in Bactrocera species contributes to the understanding of both their evolutionary history and the invasion history of their hosts. This could also be the basis for genetic control strategies using transposable elements.

  3. Characterization of irritans mariner-like elements in the olive fruit fly Bactrocera oleae (Diptera: Tephritidae): evolutionary implications.

    Science.gov (United States)

    Ben Lazhar-Ajroud, Wafa; Caruso, Aurore; Mezghani, Maha; Bouallegue, Maryem; Tastard, Emmanuelle; Denis, Françoise; Rouault, Jacques-Deric; Makni, Hanem; Capy, Pierre; Chénais, Benoît; Makni, Mohamed; Casse, Nathalie

    2016-08-01

    Genomic variation among species is commonly driven by transposable element (TE) invasion; thus, the pattern of TEs in a genome allows drawing an evolutionary history of the studied species. This paper reports in vitro and in silico detection and characterization of irritans mariner-like elements (MLEs) in the genome and transcriptome of Bactrocera oleae (Rossi) (Diptera: Tephritidae). Eleven irritans MLE sequences have been isolated in vitro using terminal inverted repeats (TIRs) as primers, and 215 have been extracted in silico from the sequenced genome of B. oleae. Additionally, the sequenced genomes of Bactrocera tryoni (Froggatt) and Bactrocera cucurbitae (Diptera: Tephritidae) have been explored to identify irritans MLEs. A total of 129 sequences from B. tryoni have been extracted, while the genome of B. cucurbitae appears probably devoid of irritans MLEs. All detected irritans MLEs are defective due to several mutations and are clustered together in a monophyletic group suggesting a common ancestor. The evolutionary history and dynamics of these TEs are discussed in relation with the phylogenetic distribution of their hosts. The knowledge on the structure, distribution, dynamic, and evolution of irritans MLEs in Bactrocera species contributes to the understanding of both their evolutionary history and the invasion history of their hosts. This could also be the basis for genetic control strategies using transposable elements. PMID:27392643

  4. Two loci in the genome of transposable phage B39 of Pseudomonas aeruginosa affecting integration. II. Mapping of the pdeX and pdeY loci by restriction and heteroduplex analyses

    International Nuclear Information System (INIS)

    Two loci termed pdeX and pdeY have previously been identified in the genome of transposable phage B39 of Pseudomonas aeruginosa. Both of these loci must operate concomitantly for the normal expression of the phage. In the present study the pdeX (2.85-6.5 kb) and pdeY (6.4-16 kb) loci have been mapped by means of restriction and heteroduplex analysis of hybrid phages possessing the Pde+ and Pde- phenotypes and obtained from the transposable phage B39ts+ x PH132 cross. The EcoRV-sites in genomes of phages D3112, B39, B39ts+ and PH132 have been mapped and the previously undetermined EcoRI-sites in the phage B39 genome have also been mapped. The Kpn1 site in the phage Ph132 genome has been localized

  5. Transposon display supports transpositional activity of elements in species of the saltans group of Drosophila

    Indian Academy of Sciences (India)

    Nathalia De Setta; Ana Paula Pimentel Costa; Fabrício Ramon Lopes; Marie-Anne Van Sluys; Cláudia Márcia Aparecida Carareto

    2007-01-01

    Mobilization of two element subfamilies (canonical and O-type) from Drosophila sturtevanti and D. saltans was evaluated for copy number and transposition activity using the transposon display (TD) technique. Pairwise distances between strains regarding the insertion polymorphism profile were estimated. Amplification of the element based on copy number estimates was highly variable among the strains (D. sturtevanti, canonical 20.11, O-type 9.00; D. saltans, canonical 16.4, O-type 12.60 insertions, on average). The larger values obtained by TD compared to our previous data by Southern blotting support the higher sensitivity of TD over Southern analysis for estimating transposable element copy numbers. The higher numbers of the canonical element and the greater divergence in its distribution within the genome of D. sturtevanti (24.8%) compared to the O-type (16.7%), as well as the greater divergence in the distribution of the canonical P element, between the D. sturtevanti (24.8%) and the D. saltans (18.3%) strains, suggest that the canonical element occupies more sites within the D. sturtevanti genome, most probably due to recent transposition activity. These data corroborate the hypothesis that the O-type is the oldest subfamily of elements in the saltans group and suggest that the canonical element is or has been transpositionally active until more recently in D. sturtevanti.

  6. Finite Element Analysis of Electromagnetic Waves in Two-Dimensional Transformed Bianisotropic Media

    CERN Document Server

    Liu, Yan; Guenneau, Sebastien

    2015-01-01

    We analyse wave propagation in two-dimensional bianisotropic media with the Finite Element Method (FEM). We start from the Maxwell-Tellegen's equations in bianisotropic media, and derive some system of coupled Partial Difference Equations (PDEs) for longitudinal electric and magnetic field components. Perfectly Matched Layers (PMLs) are discussed to model such unbounded media. We implement these PDEs and PMLs in a finite element software. We apply transformation optics in order to design some bianisotropic media with interesting functionalities, such as cloaks, concentrators and rotators. We propose a design of metamaterial with concentric layers made of homogeneous media with isotropic permittivity, permeability and magneto-electric parameters that mimic the required effective anisotropic tensors of a bianisotropic cloak in the long wavelength limit (homogenization approach). Our numerical results show that well-known metamaterials can be transposed to bianisotropic media.

  7. Heavy elements (I). From transuranium elements to superheavy elements

    International Nuclear Information System (INIS)

    History of the synthesis and discovery of heavy elements starting from 93 is reviewed. This article describes the story of thrilling competition for the discovery of new elements with increasing difficulties as the atomic number increases, beginning the 93 element, neptunium. Particularly, competition between USA and USSR has lasted from 102 to 106 element and was unsettled until a new aspect was developed in relation with the superheavy elements theoretically predicted. Here, the search of naturally occurring superheavy elements is briefly explained as an introduction to the present and future perspectives of the research on the superheavy elements which is appearing in the succeeding article. (author)

  8. Discrete Element Modeling

    Energy Technology Data Exchange (ETDEWEB)

    Morris, J; Johnson, S

    2007-12-03

    The Distinct Element Method (also frequently referred to as the Discrete Element Method) (DEM) is a Lagrangian numerical technique where the computational domain consists of discrete solid elements which interact via compliant contacts. This can be contrasted with Finite Element Methods where the computational domain is assumed to represent a continuum (although many modern implementations of the FEM can accommodate some Distinct Element capabilities). Often the terms Discrete Element Method and Distinct Element Method are used interchangeably in the literature, although Cundall and Hart (1992) suggested that Discrete Element Methods should be a more inclusive term covering Distinct Element Methods, Displacement Discontinuity Analysis and Modal Methods. In this work, DEM specifically refers to the Distinct Element Method, where the discrete elements interact via compliant contacts, in contrast with Displacement Discontinuity Analysis where the contacts are rigid and all compliance is taken up by the adjacent intact material.

  9. P-Element repression in Drosophila melanogaster by variegating clusters of P-lacZ-white transgenes.

    Science.gov (United States)

    Ronsseray, S; Boivin, A; Anxolabéhère, D

    2001-12-01

    In Drosophila, clusters of P transgenes (P-lac-w) display a variegating phenotype for the w marker. In addition, X-ray-induced rearrangements of chromosomes bearing such clusters may lead to enhancement of the variegated phenotype. Since P-lacZ transgenes in subtelomeric heterochromatin have some P-element repression abilities, we tested whether P-lac-w clusters also have the capacity to repress P-element activity in the germline. One cluster (T-1), located on a rearranged chromosome (T2;3) and derived from a line bearing a variegating tandem array of seven P-lac-w elements, partially represses the dysgenic sterility (GD sterility) induced by P elements. This cluster also strongly represses in trans the expression of P-lacZ elements in the germline. This latter suppression shows a maternal effect. Finally, the combination of variegating P-lac-w clusters and a single P-lacZ reporter inserted in subtelomeric heterochromatic sequences at the X chromosome telomere (cytological site 1A) leads to strong repression of dysgenic sterility. These results show that repression of P-induced dysgenic sterility can be elicited in the absence of P elements encoding a polypeptide repressor and that a transgene cluster can repress the expression of a single homologous transgene at a nonallelic position. Implications for models of transposable element silencing are discussed. PMID:11779802

  10. The Ekamanganese elements

    International Nuclear Information System (INIS)

    A recent study tends to revalidate the search for element 43 done in 1925. In ores with properties similar to the hypothetical chemical properties of the missing elements 43 and 75, the unknown elements were concentrated by chemical means. Roentgen-ray spectroscopy was applied in order to observe the characteristic Roentgen L lines for element 75 and K lines for element 43. Element 43 was observed in sperrylith, gadolinit, fergusonit and columbit. The name masurium was proposed. Similarly, element 75 was observed in tantalit, wolframit and platinit. The name rhenium was chosen. (MCB)

  11. Losing helena: The extinction of a drosophila line-like element

    Science.gov (United States)

    Rebollo, Rita; Lerat, Emmanuelle; Kleine, Liliana Lopez; Biémont, Christian; Vieira, Cristina

    2008-01-01

    Background Transposable elements (TEs) are major players in evolution. We know that they play an essential role in genome size determination, but we still have an incomplete understanding of the processes involved in their amplification and elimination from genomes and populations. Taking advantage of differences in the amount and distribution of the Long Interspersed Nuclear Element (LINE), helena in Drosophila melanogaster and D. simulans, we analyzed the DNA sequences of copies of this element in samples of various natural populations of these two species. Results In situ hybridization experiments revealed that helena is absent from the chromosome arms of D. melanogaster, while it is present in the chromosome arms of D. simulans, which is an unusual feature for a TE in these species. Molecular analyses showed that the helena sequences detected in D. melanogaster were all deleted copies, which diverged from the canonical element. Natural populations of D. simulans have several copies, a few of them full-length, but most of them internally deleted. Conclusion Overall, our data suggest that a mechanism that induces internal deletions in the helena sequences is active in the D. simulans genome. PMID:18377637

  12. Losing helena: The extinction of a drosophila line-like element

    Directory of Open Access Journals (Sweden)

    Biémont Christian

    2008-03-01

    Full Text Available Abstract Background Transposable elements (TEs are major players in evolution. We know that they play an essential role in genome size determination, but we still have an incomplete understanding of the processes involved in their amplification and elimination from genomes and populations. Taking advantage of differences in the amount and distribution of the Long Interspersed Nuclear Element (LINE, helena in Drosophila melanogaster and D. simulans, we analyzed the DNA sequences of copies of this element in samples of various natural populations of these two species. Results In situ hybridization experiments revealed that helena is absent from the chromosome arms of D. melanogaster, while it is present in the chromosome arms of D. simulans, which is an unusual feature for a TE in these species. Molecular analyses showed that the helena sequences detected in D. melanogaster were all deleted copies, which diverged from the canonical element. Natural populations of D. simulans have several copies, a few of them full-length, but most of them internally deleted. Conclusion Overall, our data suggest that a mechanism that induces internal deletions in the helena sequences is active in the D. simulans genome.

  13. The Gypsy Database (GyDB) of mobile genetic elements: release 2.0.

    Science.gov (United States)

    Llorens, Carlos; Futami, Ricardo; Covelli, Laura; Domínguez-Escribá, Laura; Viu, Jose M; Tamarit, Daniel; Aguilar-Rodríguez, Jose; Vicente-Ripolles, Miguel; Fuster, Gonzalo; Bernet, Guillermo P; Maumus, Florian; Munoz-Pomer, Alfonso; Sempere, Jose M; Latorre, Amparo; Moya, Andres

    2011-01-01

    This article introduces the second release of the Gypsy Database of Mobile Genetic Elements (GyDB 2.0): a research project devoted to the evolutionary dynamics of viruses and transposable elements based on their phylogenetic classification (per lineage and protein domain). The Gypsy Database (GyDB) is a long-term project that is continuously progressing, and that owing to the high molecular diversity of mobile elements requires to be completed in several stages. GyDB 2.0 has been powered with a wiki to allow other researchers participate in the project. The current database stage and scope are long terminal repeats (LTR) retroelements and relatives. GyDB 2.0 is an update based on the analysis of Ty3/Gypsy, Retroviridae, Ty1/Copia and Bel/Pao LTR retroelements and the Caulimoviridae pararetroviruses of plants. Among other features, in terms of the aforementioned topics, this update adds: (i) a variety of descriptions and reviews distributed in multiple web pages; (ii) protein-based phylogenies, where phylogenetic levels are assigned to distinct classified elements; (iii) a collection of multiple alignments, lineage-specific hidden Markov models and consensus sequences, called GyDB collection; (iv) updated RefSeq databases and BLAST and HMM servers to facilitate sequence characterization of new LTR retroelement and caulimovirus queries; and (v) a bibliographic server. GyDB 2.0 is available at http://gydb.org. PMID:21036865

  14. Fuel element design handbook

    Energy Technology Data Exchange (ETDEWEB)

    Merckx, K.R.

    1958-09-01

    The economic development of nuclear reactors depends upon the integrated progress in the fields of reactor design, fuel element design, reactor operation, and fuel production and separation. Broad criteria, which restrict the fuel element design, are determined by the mutual consideration of the problems encountered in all the above fields. Hence, no stage of reactor design or operation is independent of the fuel element problem, nor can the fuel element designer disregard the interest of any one field. As an introduction to the fuel element design problem, this chapter describes how the general criteria for a fuel element are determined.

  15. Data Element Registry Services

    Data.gov (United States)

    U.S. Environmental Protection Agency — Data Element Registry Services (DERS) is a resource for information about value lists (aka code sets / pick lists), data dictionaries, data elements, and EPA data...

  16. Quality goals for energy resources - an innovative approach to transposing the EU requirements for energy efficiency and use of renewables to the national level; Energietraegerqualitaetsziele - ein innovativer Ansatz zur Weitergabe der Synergie von Energieeffizienz- und REN-Verpflichtungen

    Energy Technology Data Exchange (ETDEWEB)

    Luhmann, H.J.; Lechtenboehmer, S.; Venjakob, J. [Wuppertal Inst. fuer Klima, Umwelt, Energie GmbH (Germany). Forschungsgruppe 1 - Zukuenftige Energie- und Mobilitaetsstrukturen

    2008-06-15

    One of the main commitments contained in the EU package of 23 January 2008 for the realisation of the so-called 20-20-20 goals is to increase the share of renewable energies in the energy mix. This is to be achieved by means of a EU directive to be transposed into national law. The directive already exists as a draft. Although there is still some discussion about the alternatives of having either an EU-wide uniform system based on the trade in quotas or permits or national promotion systems, ultimately there is likely to be some form of coexistence at the national level of legislation similar to the German Electricity Feed Law on one side and quota-based systems on the other. With this situation in mind the following article explores innovative options for member states given the new legal situation at the EU level.

  17. Rare (Earth Elements [score

    Directory of Open Access Journals (Sweden)

    Camilo Méndez

    2014-12-01

    Full Text Available Rare (Earth Elements is a cycle of works for solo piano. The cycle was inspired by James Dillon’s Book of Elements (Vol. I-V. The complete cycle will consist of 14 pieces; one for each selected rare (earth element. The chosen elements are Neodymium, Erbium, Tellurium, Hafnium, Tantalum, Technetium, Indium, Dysprosium, Lanthanium, Cerium, Europium, Terbium, Yttrium and Darmstadtium. These elements were selected due to their special atomic properties that in many cases make them extremely valuable for the development of new technologies, and also because of their scarcity. To date, only 4 works have been completed Yttrium, Technetium, Indium and Tellurium.

  18. Translation of LINE-1 DNA elements in vitro and in human cells

    International Nuclear Information System (INIS)

    The LINE-1(L1) family of interspread DNA sequences found throughout the human genome (L1 Homo sapiens, L1Hs) includes active transposable elements. Current models for the mechanism of transposition involve reverse transcription of an RNA intermediate and utilization of element-encoded proteins. The authors report that an antiserum against the polypeptide encoded by the L1Hs 5' open reading frame (ORF1) detects, in human cells, an endogenous ORF1 protein as well as the ORG1 product of an appropriate transfecting recombinant vector. The endogenous polypeptide is most abundant in teratocarcinoma and choriocarcinoma cells, among those cell lines tested; it appears to be a single species of ∼38 kDa. In contrast, RNAs synthesized in vitro from cDNAs representing full-length, polyadenylylated cytoplasmic L1Hs RNA yield, upon in vitro translation, ORF1 products of slightly different sizes. This is consistent with the fact that the various cDNAs are different and represent transcription of different genomic L1Hs elements. In vitro studies additionally suggest that translation of ORF1 is initiated at the first AUG codon. Finally, in no case was an ORF1-ORF2 fusion protein detected

  19. Translation of LINE-1 DNA elements in vitro and in human cells

    Energy Technology Data Exchange (ETDEWEB)

    Leibold, D.M.; Swergold, G.D.; Thayer, R.E.; Singer, M.F.; Fanning, T.G. (National Cancer Inst., Bethesda, MD (USA)); Dombroski, B.A. (Johns Hopkins Univ., Baltimore, MD (USA))

    1990-09-01

    The LINE-1(L1) family of interspread DNA sequences found throughout the human genome (L1 Homo sapiens, L1Hs) includes active transposable elements. Current models for the mechanism of transposition involve reverse transcription of an RNA intermediate and utilization of element-encoded proteins. The authors report that an antiserum against the polypeptide encoded by the L1Hs 5{prime} open reading frame (ORF1) detects, in human cells, an endogenous ORF1 protein as well as the ORG1 product of an appropriate transfecting recombinant vector. The endogenous polypeptide is most abundant in teratocarcinoma and choriocarcinoma cells, among those cell lines tested; it appears to be a single species of {approx}38 kDa. In contrast, RNAs synthesized in vitro from cDNAs representing full-length, polyadenylylated cytoplasmic L1Hs RNA yield, upon in vitro translation, ORF1 products of slightly different sizes. This is consistent with the fact that the various cDNAs are different and represent transcription of different genomic L1Hs elements. In vitro studies additionally suggest that translation of ORF1 is initiated at the first AUG codon. Finally, in no case was an ORF1-ORF2 fusion protein detected.

  20. Properties of elements

    International Nuclear Information System (INIS)

    An element, in its chemical definition, is a common entity to the different variants of a simple substance and to the combinations of this substance with others. The place of an element in the periodic system is indicated by its atomic number (number of protons of the nucleus). The isotopes of a same element differ by the number of neutrons. Ninety-three elements exist naturally and 20 others have been produced artificially. This article presents the main properties of the elements summarized in tables: general properties (atomic number, name, symbol, atomic mass, electronic structure, first ionization energy, electronic affinity, oxidation number, density, fusion and boiling temperatures), the atomic and metallic radii, the electronegativity, the atomic mass and period of the main radionuclides, the historical discovery of the elements and their relative abundance on the Earth. (J.S.)

  1. The synthetic elements

    International Nuclear Information System (INIS)

    Prior to 1940, the heaviest element known was uranium, discovered in 1789. Since that time the elements 93 through 109 have been synthesized and identified and the elements 43, 61, 85, and 87 which were missing form the periodic tables of the 1930's have been discovered. The techniques and problems involved in these discoveries and the placement of the transuranium elements in the periodic table will be discussed. The production and positive identification of elements heavier than Md (Z=101), which have very short half-lives and can only be produced an atom-at-a-time, are very difficult and there have been controversies concerning their discovery. Some of the new methods which have been developed and used in these studies will be described. The prospects for production of still heavier elements will be considered

  2. The solar element

    DEFF Research Database (Denmark)

    Kragh, Helge

    2009-01-01

    of the nineteenth century. In the modest form of a yellow spectral line known as D3, 'helium' was sometimes supposed to exist in the Sun's atmosphere, an idea which is traditionally ascribed to J. Norman Lockyer. Did Lockyer discover helium as a solar element? How was the suggestion received by chemists, physicists...... and astronomers in the period until the spring of 1895, when William Ramsay serendipitously found the gas in uranium minerals? The hypothetical element helium was fairly well known, yet Ramsay's discovery owed little or nothing to Lockyer's solar element. Indeed, for a brief while it was thought that the two...... elements might be different. The complex story of how helium became established as both a solar and terrestrial element involves precise observations as well as airy speculations. It is a story that is unique among the discovery histories of the chemical elements....

  3. The synthetic elements

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, D.C.

    1990-05-01

    Prior to 1940, the heaviest element known was uranium, discovered in 1789. Since that time the elements 93 through 109 have been synthesized and identified and the elements 43, 61, 85, and 87 which were missing form the periodic tables of the 1930's have been discovered. The techniques and problems involved in these discoveries and the placement of the transuranium elements in the periodic table will be discussed. The production and positive identification of elements heavier than Md (Z=101), which have very short half-lives and can only be produced an atom-at-a-time, are very difficult and there have been controversies concerning their discovery. Some of the new methods which have been developed and used in these studies will be described. The prospects for production of still heavier elements will be considered.

  4. Element Level Semantic Matching

    OpenAIRE

    Giunchiglia, Fausto; Yatskevich, Mikalai

    2004-01-01

    We think of Match as an operator which takes two graph-like structures and produces a mapping between semantically related nodes. The matching process is essentially divided into two steps: element level and structure level. Element level matchers consider only labels of nodes, while structure level matchers start from this information to consider the full graph. In this paper we present various element level semantic matchers, and discuss their implementation within the S-Match system. The m...

  5. Elements in biological AMS

    International Nuclear Information System (INIS)

    AMS (Accelerator Mass Spectrometry) provides high detection sensitivity for isotopes whose half-lives are between 10 years and 100 million years. 14C is the most developed of such isotopes and is used in tracing natural and anthropogenic organic compounds in the Earth's biosphere. Thirty-three elements in the main periodic table and 17 lanthanides or actinides have long lived isotopes, providing potential tracers for research in elemental biochemistry. Overlap of biologically interesting heavy elements and possible AMS tracers is discussed

  6. Chemistry of superheavy elements

    Energy Technology Data Exchange (ETDEWEB)

    Schaedel, M. [Japan Atomic Energy Agency, Tokai, Ibaraki (Japan). Advanced Science Research Center; GSI Helmholtz Center for Heavy Ion Research, Darmstadt (Germany)

    2012-07-01

    The chemistry of superheavy elements - or transactinides from their position in the Periodic Table - is summarized. After giving an overview over historical developments, nuclear aspects about synthesis of neutron-rich isotopes of these elements, produced in hot-fusion reactions, and their nuclear decay properties are briefly mentioned. Specific requirements to cope with the one-atom-at-a-time situation in automated chemical separations and recent developments in aqueous-phase and gas-phase chemistry are presented. Exciting, current developments, first applications, and future prospects of chemical separations behind physical recoil separators ('pre-separator') are discussed in detail. The status of our current knowledge about the chemistry of rutherfordium (Rf, element 104), dubnium (Db, element 105), seaborgium (Sg, element 106), bohrium (Bh, element 107), hassium (Hs, element 108), copernicium (Cn, element 112), and element 114 is discussed from an experimental point of view. Recent results are emphasized and compared with empirical extrapolations and with fully-relativistic theoretical calculations, especially also under the aspect of the architecture of the Periodic Table. (orig.)

  7. Chemistry of superheavy elements

    International Nuclear Information System (INIS)

    The chemistry of superheavy elements - or transactinides from their position in the Periodic Table - is summarized. After giving an overview over historical developments, nuclear aspects about synthesis of neutron-rich isotopes of these elements, produced in hot-fusion reactions, and their nuclear decay properties are briefly mentioned. Specific requirements to cope with the one-atom-at-a-time situation in automated chemical separations and recent developments in aqueous-phase and gas-phase chemistry are presented. Exciting, current developments, first applications, and future prospects of chemical separations behind physical recoil separators ('pre-separator') are discussed in detail. The status of our current knowledge about the chemistry of rutherfordium (Rf, element 104), dubnium (Db, element 105), seaborgium (Sg, element 106), bohrium (Bh, element 107), hassium (Hs, element 108), copernicium (Cn, element 112), and element 114 is discussed from an experimental point of view. Recent results are emphasized and compared with empirical extrapolations and with fully-relativistic theoretical calculations, especially also under the aspect of the architecture of the Periodic Table. (orig.)

  8. Stochastic finite element method with simple random elements

    OpenAIRE

    Starkloff, Hans-Jörg

    2008-01-01

    We propose a variant of the stochastic finite element method, where the random elements occuring in the problem formulation are approximated by simple random elements, i.e. random elements with only a finite number of possible values.

  9. BSCW Unstructured Mixed Element Grids

    Data.gov (United States)

    National Aeronautics and Space Administration — Corase Grid: Quad Surface Faces= 9360 Tria Surface Faces= 128928 Nodes = 2869187 Total Elements = 9099201 Hex Elements = 0 Pent_5 Elements = 0 Pent_6 Elements =...

  10. Main: -300ELEMENT [PLACE

    Lifescience Database Archive (English)

    Full Text Available -300ELEMENT S000122 11-May-2006 (last modified) kehi Present upstream of the promoter from the B ... liadin, and low molecular weight glutenin genes of wheat ; See S000001 -300CORE; See S000002 -300MOTIF; -300 ... element; hordein; gliadin; glutenin; seed; wheat ... (Triticum aestivum) TGHAAARK ...

  11. Proceedings of transuranium elements

    International Nuclear Information System (INIS)

    The identification of the first synthetic elements was established by chemical evidence. Conclusive proof of the synthesis of the first artificial element, technetium, was published in 1937 by Perrier and Segre. An essential aspect of their achievement was the prediction of the chemical properties of element 43, which had been missing from the periodic table and which was expected to have properties similar to those of manganese and rhenium. The discovery of other artificial elements, astatine and francium, was facilitated in 1939-1940 by the prediction of their chemical properties. A little more than 50 years ago, in the spring of 1940, Edwin McMillan and Philip Abelson synthesized element 93, neptunium, and confirmed its uniqueness by chemical means. On August 30, 1940, Glenn Seaborg, Arthur Wahl, and the late Joseph Kennedy began their neutron irradiations of uranium nitrate hexahydrate. A few months later they synthesized element 94, later named plutonium, by observing the alpha particles emitted from uranium oxide targets that had been bombarded with deuterons. Shortly thereafter they proved that is was the second transuranium element by establishing its unique oxidation-reduction behavior. The symposium honored the scientists and engineers whose vision and dedication led to the discovery of the transuranium elements and to the understanding of the influence of 5f electrons on their electronic structure and bonding. This volume represents a record of papers presented at the symposium

  12. Elements of life

    OpenAIRE

    Samuel, J.

    2004-01-01

    A Biography of J.M.W. Turner's life told through the use of the elements. A five screen video installation. This is the Main Screen which was complimented by four video screens to represent each element.Shown at the Community Pharmacy Gallery May 2004.

  13. The Elements of Empathy.

    Science.gov (United States)

    Iannotti, Ronald J.

    When assessing the influence of empathy on prosocial motivation, analyzing empathy alone would lead to a misunderstanding. We must also assess other elements of the situation, such as the altruist's coping skills and situational constraints. In a similar manner empathy itself should be conceptualized as a process with many elements. One way to…

  14. Flow Element Models

    DEFF Research Database (Denmark)

    Heiselberg, Per; Nielsen, Peter V.

    Air distribution in ventilated rooms is a flow process that can be divided into different elements such as supply air jets, exhaust flows, thermal plumes, boundary layer flows, infiltration and gravity currents. These flow elements are isolated volumes where the air movement is controlled by a re...... restricted number of parameters, and the air movement is fairly independent of the general flow in the enclosure. In many practical situations, the most convenient· method is to design the air distribution system using flow element theory.......Air distribution in ventilated rooms is a flow process that can be divided into different elements such as supply air jets, exhaust flows, thermal plumes, boundary layer flows, infiltration and gravity currents. These flow elements are isolated volumes where the air movement is controlled by a...

  15. NUCLEAR REACTOR FUEL ELEMENT

    Science.gov (United States)

    Wheelock, C.W.; Baumeister, E.B.

    1961-09-01

    A reactor fuel element utilizing fissionable fuel materials in plate form is described. This fuel element consists of bundles of fuel-bearing plates. The bundles are stacked inside of a tube which forms the shell of the fuel element. The plates each have longitudinal fins running parallel to the direction of coolant flow, and interspersed among and parallel to the fins are ribs which position the plates relative to each other and to the fuel element shell. The plate bundles are held together by thin bands or wires. The ex tended surface increases the heat transfer capabilities of a fuel element by a factor of 3 or more over those of a simple flat plate.

  16. Monolithic freeform element

    Science.gov (United States)

    Kiontke, Sven R.

    2015-09-01

    For 10 years there has been the asphere as one of the new products to be accepted by the market. All parts of the chain design, production and measurement needed to learn how to treat the asphere and what it is helpful for. The aspheric optical element now is established and accepted as an equal optical element between other as a fast growing part of all the optical elements. Now we are focusing onto the next new element with a lot of potential, the optical freeform surface. Manufacturing results will be shown for fully tolerance optic including manufacturing, setup and optics configurations including measurement setup. The element itself is a monolith consisting of several optical surfaces that have to be aligned properly to each other. The freeform surface is measured for surface form tolerance (irregularity, slope, Zernike, PV).

  17. Radiation-induced changes in DNA methylation of repetitive elements in the mouse heart.

    Science.gov (United States)

    Koturbash, Igor; Miousse, Isabelle R; Sridharan, Vijayalakshmi; Nzabarushimana, Etienne; Skinner, Charles M; Melnyk, Stepan B; Pavliv, Oleksandra; Hauer-Jensen, Martin; Nelson, Gregory A; Boerma, Marjan

    2016-05-01

    DNA methylation is a key epigenetic mechanism, needed for proper control over the expression of genetic information and silencing of repetitive elements. Exposure to ionizing radiation, aside from its strong genotoxic potential, may also affect the methylation of DNA, within the repetitive elements, in particular. In this study, we exposed C57BL/6J male mice to low absorbed mean doses of two types of space radiation-proton (0.1Gy, 150MeV, dose rate 0.53±0.08Gy/min), and heavy iron ions ((56)Fe) (0.5Gy, 600MeV/n, dose rate 0.38±0.06Gy/min). Radiation-induced changes in cardiac DNA methylation associated with repetitive elements were detected. Specifically, modest hypomethylation of retrotransposon LINE-1 was observed at day 7 after irradiation with either protons or (56)Fe. This was followed by LINE-1, and other retrotransposons, ERV2 and SINE B1, as well as major satellite DNA hypermethylation at day 90 after irradiation with (56)Fe. These changes in DNA methylation were accompanied by alterations in the expression of DNA methylation machinery and affected the one-carbon metabolism pathway. Furthermore, loss of transposable elements expression was detected in the cardiac tissue at the 90-day time-point, paralleled by substantial accumulation of mRNA transcripts, associated with major satellites. Given that the one-carbon metabolism pathway can be modulated by dietary modifications, these findings suggest a potential strategy for the mitigation and, possibly, prevention of the negative effects exerted by ionizing radiation on the cardiovascular system. Additionally, we show that the methylation status and expression of repetitive elements may serve as early biomarkers of exposure to space radiation. PMID:26963372

  18. The heaviest elements

    International Nuclear Information System (INIS)

    How long does an atom need to ''exist before it's possible to do any meaningful chemistry on it? Is it possible to learn anything at all about the reactions of an element for which no more than a few dozen atoms have ever existed simultaneously? These are some of the questions colleagues in a few laboratories worldwide attempt to answer as they investigate the chemistry of the heaviest elements--elements produced one atom at a time in accelerators by bombarding radioactive targets with high-intensity beams of heavy ions. All of these elements spontaneously decay; the most stable of them have half-lives of only a few minutes, some that are less stable exist for only milliseconds. So far, no chemical studies have been performed on elements whose longest lived isotopes last only milliseconds because the difficulties of doing chemistry on this time scale under highly radioactive conditions are enormous. Over the past 10 years, however, nuclear chemists have developed new techniques or adapted existing ones to begin to probe the chemical properties of those very heavy elements that have half-lives in the range of seconds to minutes. Although the classic experiments are now nearly 40 years old, they are worth describing, as they were the first of their kind and illustrate many of the techniques that are still used and essential in studying these very short-lived, radioactive elements

  19. System Elements Heterogeneity

    Directory of Open Access Journals (Sweden)

    Stanislav A. Kuja

    2013-01-01

    Full Text Available The paper deals with the features of the systematic approach development, shows that the systematic approach lacks the definition of system elements divisibility. This fact simplifies the system description. The article shows that, depending on the selection of the criterion of divisibility, different types of elements with different properties are got. Depending on the selection of the criterion of divisibility, the system structure becomes multidimensional. The paper recommends to indicate the criterion of the system divisibility during the systems research. It increases the certainty of the description of a complex system and characterizes the system elements.

  20. Unraveling the evolutionary scenario of the hobo element in populations of Drosophila melanogaster and D. simulans in South America using the TPE repeats as markers

    Directory of Open Access Journals (Sweden)

    Geovani T. Ragagnin

    2016-03-01

    Full Text Available Abstract Transposable elements (TEs are nucleotide sequences found in most studied genomes. These elements are highly diversified and have a large variation in nucleotide structure and mechanisms of transposition. hobo is a member of class II, belonging to hAT superfamily, described inDrosophila melanogaster, and it presents in its Open Reading Frame, a repetitive region encoding the amino acids threonine-proline-glutamic acid (TPE, which shows variability in the number of repeats in some regions of the world. Due to this variability some evolutionary scenarios of the hobo element are discussed, such as the scenario of the invasion of hobo element in populations ofD. melanogaster. In the present study, we investigated 22 DNA sequences of D. melanogaster and seven sequences ofD. simulans, both from South America, to check the number of repetitions of TPE, in order to clarify the evolutionary scenario of thehobo element in these populations. Our results showed a monomorphism in populations of both species in South America, with only three TPE repeats. Hence, we discuss and propose an evolutionary scenario of the invasion of the hobo element in populations of D. melanogaster and D. simulans.

  1. Multi-Element Airfoil System

    Science.gov (United States)

    Turner, Travis L. (Inventor); Khorrami, Mehdi R. (Inventor); Lockard, David P. (Inventor); McKenney, Martin J. (Inventor); Atherley, Raymond D. (Inventor); Kidd, Reggie T. (Inventor)

    2014-01-01

    A multi-element airfoil system includes an airfoil element having a leading edge region and a skin element coupled to the airfoil element. A slat deployment system is coupled to the slat and the skin element, and is capable of deploying and retracting the slat and the skin element. The skin element substantially fills the lateral gap formed between the slat and the airfoil element when the slat is deployed. The system further includes an uncoupling device and a sensor to remove the skin element from the gap based on a critical angle-of-attack of the airfoil element. The system can alternatively comprise a trailing edge flap, where a skin element substantially fills the lateral gap between the flap and the trailing edge region of the airfoil element. In each case, the skin element fills a gap between the airfoil element and the deployed flap or slat to reduce airframe noise.

  2. Nuclear reactor fuel elements

    International Nuclear Information System (INIS)

    An improved nuclear power reactor fuel element is described which consists of fuel rods, rod guide tubes and an end plate. The system allows direct access to an end of each fuel rod for inspection purposes. (U.K.)

  3. Solar cell element

    Energy Technology Data Exchange (ETDEWEB)

    Nakano, Akihiko; Matsumoto, Hitoshi; Uda, Hiroshi; Komatsu, Yasumitsu; Ikegami, Kiyoharu.

    1989-05-18

    In the existing CdS/CdTe-based solar cell element, nothing is formed except the component effective for generating electromotive force and the components necessary for leading, collecting and extracting the generated electricity, hence even when the element shows deterioration of its performance during its usage, it has been difficult to analyze the above situation. In addition, it has also a defect that its characteristic such as the transfer efficiency in the neighborhood of its glass substrate in connection also with its manufacturing process. In order to solve the above problematical points, this invention proposes, with regard to a CdS-based solar cell element composed by forming a thin film on its substrate, to make a blank space on the above substrate and form thereon a thin film which composes the solar cell element concerned alone or in a piling up manner. 4 figs.

  4. Nuclear reactor fuel element

    International Nuclear Information System (INIS)

    The fuel element for a BWR known from the patent application DE 2824265 is developed so that the screw only breaks on the expansion shank with reduced diameter if the expansion forces are too great. (HP)

  5. Structural elements design manual

    CERN Document Server

    Draycott, Trevor

    2012-01-01

    Gives clear explanations of the logical design sequence for structural elements. The Structural Engineer says: `The book explains, in simple terms, and with many examples, Code of Practice methods for sizing structural sections in timber, concrete,masonry and steel. It is the combination into one book of section sizing methods in each of these materials that makes this text so useful....Students will find this an essential support text to the Codes of Practice in their study of element sizing'.

  6. Distant elements of surprise

    International Nuclear Information System (INIS)

    The fortuitous alignment of a quasar and a distant galaxy has enabled astronomers to unravel the origin and evolution of chemical elements. Cosmologists and fossil hunters have more in common than it might first appear. Palaeontologists analyse fossil records of the last 3.5 billion years to track the evolution of life on Earth. Motivated by a similar curiosity, astronomers are searching for chemical elements in stars and cosmic gas to understand the origin of the chemistry of the universe, and how it has developed since the Big Bang. The basic theoretical framework of the universe's chemistry has been in place for half a century. The lightest elements - hydrogen and helium, along with trace amounts of deuterium and lithium - were created within a few minutes of the Big Bang. All of the other elements were assembled at much later times by the fusion of hydrogen and helium nuclei in the interior of stars. Some of these elements were dispersed through space in the violent supernova explosions with which some stars end their lives. They were then condensed into subsequent generations of stars, and into the planets that formed around them. Some of these elements were eventually incorporated into organic structures and became essential for life on Earth. This cosmic cycle continues to the present day. The closest region of active star formation is the Orion nebula, which is visible to anyone who looks up at the sky on a clear winter's night. But the details of the cycle are still far from clear. For example, we do not know when most of the elements were produced in the universe as a whole, or which stars were responsible for producing which elements. In order to unravel the path of chemical evolution we have to shift our attention to much further away than the Orion nebula. (U.K.)

  7. Creativity Management Key Elements

    OpenAIRE

    Fuchs Ángeles, Rosa María; Franceso Tonetti, Federico Carlo

    2015-01-01

    Organizations are constantly looking towards innovation. In order to reach it they must foment creativity. This paper analyzes a series of elements considered in the organizational creativity management and proposes a model with the indispensable factors that organizations should consider to reach it. These elements are: culture and organizational environment, strategy, structure, communication, relation with customers, human resources (recruiting, training, job design, compensation, promotio...

  8. New roof element system

    DEFF Research Database (Denmark)

    Ditlev, Jesper; Rudbeck, Claus Christian

    1997-01-01

    The aim of the project has been to develop an element system for warm deck roofs which, from a thermal and economical point of view, can deal with the future demands for heat loss coefficients for low slope roofs.......The aim of the project has been to develop an element system for warm deck roofs which, from a thermal and economical point of view, can deal with the future demands for heat loss coefficients for low slope roofs....

  9. Atoms, molecules & elements

    CERN Document Server

    Graybill, George

    2007-01-01

    Young scientists will be thrilled to explore the invisible world of atoms, molecules and elements. Our resource provides ready-to-use information and activities for remedial students using simplified language and vocabulary. Students will label each part of the atom, learn what compounds are, and explore the patterns in the periodic table of elements to find calcium (Ca), chlorine (Cl), and helium (He) through hands-on activities.

  10. Creating superheavy elements

    International Nuclear Information System (INIS)

    During the past 20 years physicists around the world have been engaged in the task of producing superheavy elements. At the Institute for Heavy-Ion Research in Darmstadt the authors have met with some success, synthesizing the nuclei of elements 107, 108 and 109. These nuclei lie beyond the 106-proton threshold that marked the limits of previous techniques for creating and identifying heavy elements. Experimental mass measurements, followed up by theory, show that the new elements owe their stability to the microscopic arrangement of their protons and neutrons rather than the macroscopic properties that stabilize lighter nuclei. On the other hand the authors have met with problems that have thus far prevented them from reaching the goals set in the late 1960's, when elements up to 114 seemed within reach. Working to overcome obstacles to further progress, however, has deepened our understanding of nuclear structure and of the dynamics of fusion reactions between nuclei. Nucleosynthesis has come a long way from the earliest years when elements not found in nature were created in nuclear reactors. Physicists have employed ever-heavier projectiles to bombard target atoms; the latest development is cold fusion, which masses and bombardment energies are carefully chosen to minimize the excitation of newly formed nuclei. In the course of their work early ideas about how to synthesize superheavy elements have almost all turned out to be wrong: the nuclei of the elements that can be synthesized are deformed and not, as postulated in 1966, spherical. In the fusion process they use stable, naturally plentiful spherical nuclei and medium-weight projectiles, not, as expected earlier, the heaviest radioactive man-made nuclei and correspondingly light projectiles. Fusion must take place at the lowest possible bombardment energy, and not, as believed earlier, with excess impact energy to assist the process by brute force

  11. The Middle Pivot Element Algorithm

    OpenAIRE

    Anchala Kumari; Soubhik Chakraborty

    2012-01-01

    This paper is an improvement over the previous work on New Sorting Algorithm first proposed by Sundararajan and Chakraborty (2007). Here we have taken the pivot element as the middle element of the array. We call this improved version Middle Pivot Element Algorithm (MPA) and it is found that MPA is much faster than the two algorithms RPA (Random Pivot element Algorithm) and FPA (First Pivot element Algorithm) in which the pivot element was selected either randomly or as the first element, res...

  12. Solar energy - design element

    International Nuclear Information System (INIS)

    The main focus of this study is the theoretical examination of the possibilities of applying technological, functional, aesthetic and energy resources in elements of urban design. Designed solutions are treated as part of the overall optimization of architectural elements and urban space, in which technological development enables the use of certain energy potentials of elements of urban design. The paper presents student hypothetical design models of urban architectural elements with integrated photovoltaic modules. The analytical procedure was applied in the analysis of student work in a seminar of the first year of master studies at the Faculty of Architecture. The aim is to improve students' awareness of the need for proper handling of energy and the possibility of integration with other architectural elements. The research and the results have enabled further work on the sustainable development of architectural elements with a focus on the use of solar energy by promoting the modern design approach. Key words: PV module, teaching, solar energy, urban design

  13. New elements - approaching ?

    Science.gov (United States)

    Hofmann, S.

    1998-06-01

    The search for new elements is part of the broader field of investigations of nuclei at the limits of stability. In two series of experiments at SHIP, six new elements 0034-4885/61/6/002/img2 were synthesized via fusion reactions using 1n-deexcitation channels and lead or bismuth targets. The isotopes were unambiguously identified by means of 0034-4885/61/6/002/img3 correlations. Alpha decay, not fission, is the dominant decay mode. The collected decay data establish a means of comparison with theoretical data. This aids in the selection of appropriate models that describe the properties of known nuclei. Predictions based on these models are useful in the preparation of the next generation of experiments. Cross sections decrease by two orders of magnitude from bohrium (Z = 107) to element 112, for which a cross section of 1 pb was measured. The development of intense beam currents and sensitive detection methods is essential for the production and identification of still heavier elements and new isotopes of already known elements, as well as the measurement of small 0034-4885/61/6/002/img4-, 0034-4885/61/6/002/img5- and fission-branching ratios. An equally sensitive set-up is needed for the measurement of excitation functions at low cross sections. Based on our results, it is likely that the production of isotopes of element 114 close to the island of spherical superheavy elements (SHEs) could be achieved by fusion reactions using 0034-4885/61/6/002/img6 targets. Systematic studies of the reaction cross sections indicate that the transfer of nucleons is an important process for the initiation of fusion. The data allow for the fixing of a narrow energy window for the production of SHEs using 1n-emission channels. The likelihood of broadening the energy window by investigation of radiative capture reactions, use of neutron deficient projectile isotopes and use of actinide targets is discussed.

  14. Cytogenetic variation of repetitive DNA elements in Hoplias malabaricus (Characiformes - Erythrinidae from white, black and clear water rivers of the Amazon basin

    Directory of Open Access Journals (Sweden)

    Fabíola Araújo dos Santos

    2016-03-01

    Full Text Available Abstract Hoplias malabaricus is a common fish species occurring in white, black and clear water rivers of the Amazon basin. Its large distribution across distinct aquatic environments can pose stressful conditions for dispersal and creates possibilities for the emergence of local adaptive profiles. We investigated the chromosomal localization of repetitive DNA markers (constitutive heterochromatin, rDNA and the transposable element REX-3 in populations from the Amazonas river (white water, the Negro river (black water and the Tapajós river (clear water, in order to address the variation/association of cytogenomic features and environmental conditions. We found a conserved karyotypic macrostructure with a diploid number of 40 chromosomes (20 metacentrics + 20 submetacentrics in all the samples. Heteromorphism in pair 14 was detected as evidence for the initial differentiation of an XX/XY system. Minor differences detected in the amount of repetitive DNA markers are interpreted as possible signatures of local adaptations to distinct aquatic environments.

  15. Cytogenetic variation of repetitive DNA elements in Hoplias malabaricus (Characiformes - Erythrinidae) from white, black and clear water rivers of the Amazon basin.

    Science.gov (United States)

    Santos, Fabíola Araújo Dos; Marques, Diego Ferreira; Terencio, Maria Leandra; Feldberg, Eliana; Rodrigues, Luís Reginaldo R

    2016-03-01

    Hoplias malabaricus is a common fish species occurring in white, black and clear water rivers of the Amazon basin. Its large distribution across distinct aquatic environments can pose stressful conditions for dispersal and creates possibilities for the emergence of local adaptive profiles. We investigated the chromosomal localization of repetitive DNA markers (constitutive heterochromatin, rDNA and the transposable element REX-3) in populations from the Amazonas river (white water), the Negro river (black water) and the Tapajós river (clear water), in order to address the variation/association of cytogenomic features and environmental conditions. We found a conserved karyotypic macrostructure with a diploid number of 40 chromosomes (20 metacentrics + 20 submetacentrics) in all the samples. Heteromorphism in pair 14 was detected as evidence for the initial differentiation of an XX/XY system. Minor differences detected in the amount of repetitive DNA markers are interpreted as possible signatures of local adaptations to distinct aquatic environments. PMID:27007897

  16. Development of a versatile XRF scanner for the elemental imaging of paintworks

    Energy Technology Data Exchange (ETDEWEB)

    Ravaud, E.; Pichon, L.; Laval, E.; Eveno, M. [Centre de recherche et de restauration des musees de France, C2RMF, Paris (France); Gonzalez, V.; Calligaro, T. [Centre de recherche et de restauration des musees de France, C2RMF, Paris (France); PSL Research University, Chimie ParisTech-CNRS, Institut de Recherche Chimie Paris, UMR8247, Paris (France)

    2016-01-15

    Scanning XRF is a powerful elemental imaging technique introduced at the synchrotron that has recently been transposed to laboratory. The growing interest in this technique stems from its ability to collect images reflecting pigment distribution within large areas on artworks by means of their elemental signature. In that sense, scanning XRF appears highly complementary to standard imaging techniques (Visible, UV, IR photography and X-ray radiography). The versatile XRF scanner presented here has been designed and built at the C2RMF in response to specific constraints: transportability, cost-effectiveness and ability to scan large areas within a single working day. The instrument is based on a standard X-ray generator with sub-millimetre collimated beam and a SDD-based spectrometer to collected X-ray spectra. The instrument head is scanned in front of the painting by means of motorised movements to cover an area up to 300 x 300 mm{sup 2} with a resolution of 0.5 mm (600 x 600 pixels). The 15-kg head is mounted on a stable photo stand for rapid positioning on paintworks and maintains a free side-access for safety; it can also be attached to a lighter tripod for field measurements. Alignment is achieved with a laser pointer and a micro-camera. With a scanning speed of 5 mm/s and 0.1 s/point, elemental maps are collected in 10 h, i.e. a working day. The X-ray spectra of all pixels are rapidly processed using an open source program to derive elemental maps. To illustrate the capabilities of this instrument, this contribution presents the results obtained on the Belle Ferronniere painted by Leonardo da Vinci (1452-1519) and conserved in the Musee du Louvre, prior to its restoration at the C2RMF. (orig.)

  17. Development of a versatile XRF scanner for the elemental imaging of paintworks

    International Nuclear Information System (INIS)

    Scanning XRF is a powerful elemental imaging technique introduced at the synchrotron that has recently been transposed to laboratory. The growing interest in this technique stems from its ability to collect images reflecting pigment distribution within large areas on artworks by means of their elemental signature. In that sense, scanning XRF appears highly complementary to standard imaging techniques (Visible, UV, IR photography and X-ray radiography). The versatile XRF scanner presented here has been designed and built at the C2RMF in response to specific constraints: transportability, cost-effectiveness and ability to scan large areas within a single working day. The instrument is based on a standard X-ray generator with sub-millimetre collimated beam and a SDD-based spectrometer to collected X-ray spectra. The instrument head is scanned in front of the painting by means of motorised movements to cover an area up to 300 x 300 mm2 with a resolution of 0.5 mm (600 x 600 pixels). The 15-kg head is mounted on a stable photo stand for rapid positioning on paintworks and maintains a free side-access for safety; it can also be attached to a lighter tripod for field measurements. Alignment is achieved with a laser pointer and a micro-camera. With a scanning speed of 5 mm/s and 0.1 s/point, elemental maps are collected in 10 h, i.e. a working day. The X-ray spectra of all pixels are rapidly processed using an open source program to derive elemental maps. To illustrate the capabilities of this instrument, this contribution presents the results obtained on the Belle Ferronniere painted by Leonardo da Vinci (1452-1519) and conserved in the Musee du Louvre, prior to its restoration at the C2RMF. (orig.)

  18. Development of a versatile XRF scanner for the elemental imaging of paintworks

    Science.gov (United States)

    Ravaud, E.; Pichon, L.; Laval, E.; Gonzalez, V.; Eveno, M.; Calligaro, T.

    2016-01-01

    Scanning XRF is a powerful elemental imaging technique introduced at the synchrotron that has recently been transposed to laboratory. The growing interest in this technique stems from its ability to collect images reflecting pigment distribution within large areas on artworks by means of their elemental signature. In that sense, scanning XRF appears highly complementary to standard imaging techniques (Visible, UV, IR photography and X-ray radiography). The versatile XRF scanner presented here has been designed and built at the C2RMF in response to specific constraints: transportability, cost-effectiveness and ability to scan large areas within a single working day. The instrument is based on a standard X-ray generator with sub-millimetre collimated beam and a SDD-based spectrometer to collected X-ray spectra. The instrument head is scanned in front of the painting by means of motorised movements to cover an area up to 300 × 300 mm2 with a resolution of 0.5 mm (600 × 600 pixels). The 15-kg head is mounted on a stable photo stand for rapid positioning on paintworks and maintains a free side-access for safety; it can also be attached to a lighter tripod for field measurements. Alignment is achieved with a laser pointer and a micro-camera. With a scanning speed of 5 mm/s and 0.1 s/point, elemental maps are collected in 10 h, i.e. a working day. The X-ray spectra of all pixels are rapidly processed using an open source program to derive elemental maps. To illustrate the capabilities of this instrument, this contribution presents the results obtained on the Belle Ferronnière painted by Leonardo da Vinci (1452-1519) and conserved in the Musée du Louvre, prior to its restoration at the C2RMF.

  19. The protist Trichomonas vaginalis harbors multiple lineages of transcriptionally active Mutator-like elements

    Directory of Open Access Journals (Sweden)

    Pereira Gonçalo AG

    2009-07-01

    Full Text Available Abstract Background For three decades the Mutator system was thought to be exclusive of plants, until the first homolog representatives were characterized in fungi and in early-diverging amoebas earlier in this decade. Results Here, we describe and characterize four families of Mutator-like elements in a new eukaryotic group, the Parabasalids. These Trichomonas vaginalis Mutator- like elements, or TvMULEs, are active in T. vaginalis and patchily distributed among 12 trichomonad species and isolates. Despite their relatively distinctive amino acid composition, the inclusion of the repeats TvMULE1, TvMULE2, TvMULE3 and TvMULE4 into the Mutator superfamily is justified by sequence, structural and phylogenetic analyses. In addition, we identified three new TvMULE-related sequences in the genome sequence of Candida albicans. While TvMULE1 is a member of the MuDR clade, predominantly from plants, the other three TvMULEs, together with the C. albicans elements, represent a new and quite distinct Mutator lineage, which we named TvCaMULEs. The finding of TvMULE1 sequence inserted into other putative repeat suggests the occurrence a novel TE family not yet described. Conclusion These findings expand the taxonomic distribution and the range of functional motif of MULEs among eukaryotes. The characterization of the dynamics of TvMULEs and other transposons in this organism is of particular interest because it is atypical for an asexual species to have such an extreme level of TE activity; this genetic landscape makes an interesting case study for causes and consequences of such activity. Finally, the extreme repetitiveness of the T. vaginalis genome and the remarkable degree of sequence identity within its repeat families highlights this species as an ideal system to characterize new transposable elements.

  20. FLOW INJECTION ANALYSIS SYSTEM COUPLED WITH ICP-EOS FOR DETERMINATION OF SOME METALLIC ELEMENTS IN DRINKING WATER

    Directory of Open Access Journals (Sweden)

    Cristina Dinu

    2009-06-01

    Full Text Available The European Drinking Water Directive (98/83/EC, transposed in Romanian Legislation as Low 458/2002, amended by Low 311/2004, imposes the limit of concentration for metallic elements in water intended for human consumption. The toxic metals arsenic and selenium are among these elements and the limit value is 10 μg/L. In the paper there are presented the working conditions for determination of As and Se from drinking water using modern techniques based on the fl ow injection-hydride generation with the inductively coupled plasma atomic emission spectrometry (FIAS-ICP-EOS. The analyses were performed on Optima 5300 DV Perkin Elmer equipment with FIAS 400 Flow Injection System, Perkin Elmer type. For the hydride generation two types of solution were used: 10% (v/v HCl as a carrier solution and 0.2 % NaBH4 in 0.05%NaOH solution as a reducing agent [1]. The treatment step of the samples and standard solutions consisted in reducing with mixed solutions of KI and ascorbic acid in acidic condition (HCl for As and only with HCl and high temperature for Se [2,3]. The paper contains the characteristic parameters of the methods, such as: low detection limit, quantifi cation limit, repeatability, precision, recovery, which were evaluated using Certifi ed Reference Materials for each element.

  1. Probabilistic boundary element method

    Science.gov (United States)

    Cruse, T. A.; Raveendra, S. T.

    1989-01-01

    The purpose of the Probabilistic Structural Analysis Method (PSAM) project is to develop structural analysis capabilities for the design analysis of advanced space propulsion system hardware. The boundary element method (BEM) is used as the basis of the Probabilistic Advanced Analysis Methods (PADAM) which is discussed. The probabilistic BEM code (PBEM) is used to obtain the structural response and sensitivity results to a set of random variables. As such, PBEM performs analogous to other structural analysis codes such as finite elements in the PSAM system. For linear problems, unlike the finite element method (FEM), the BEM governing equations are written at the boundary of the body only, thus, the method eliminates the need to model the volume of the body. However, for general body force problems, a direct condensation of the governing equations to the boundary of the body is not possible and therefore volume modeling is generally required.

  2. Computing Heavy Elements

    CERN Document Server

    Schunck, N; Kortelainen, M; McDonnell, J; Moré, J; Nazarewicz, W; Pei, J; Sarich, J; Sheikh, J; Staszczak, A; Stoitsov, M; Wild, S M

    2011-01-01

    Reliable calculations of the structure of heavy elements are crucial to address fundamental science questions such as the origin of the elements in the universe. Applications relevant for energy production, medicine, or national security also rely on theoretical predictions of basic properties of atomic nuclei. Heavy elements are best described within the nuclear density functional theory (DFT) and its various extensions. While relatively mature, DFT has never been implemented in its full power, as it relies on a very large number (~ 10^9-10^12) of expensive calculations (~ day). The advent of leadership-class computers, as well as dedicated large-scale collaborative efforts such as the SciDAC 2 UNEDF project, have dramatically changed the field. This article gives an overview of the various computational challenges related to the nuclear DFT, as well as some of the recent achievements.

  3. Fuel Element Technical Manual

    Energy Technology Data Exchange (ETDEWEB)

    Burley, H.H. [ed.

    1956-08-01

    It is the purpose of the Fuel Element Technical Manual to Provide a single document describing the fabrication processes used in the manufacture of the fuel element as well as the technical bases for these processes. The manual will be instrumental in the indoctrination of personnel new to the field and will provide a single data reference for all personnel involved in the design or manufacture of the fuel element. The material contained in this manual was assembled by members of the Engineering Department and the Manufacturing Department at the Hanford Atomic Products Operation between the dates October, 1955 and June, 1956. Arrangement of the manual. The manual is divided into six parts: Part I--introduction; Part II--technical bases; Part III--process; Part IV--plant and equipment; Part V--process control and improvement; and VI--safety.

  4. Advanced finite element technologies

    CERN Document Server

    Wriggers, Peter

    2016-01-01

    The book presents an overview of the state of research of advanced finite element technologies. Besides the mathematical analysis, the finite element development and their engineering applications are shown to the reader. The authors give a survey of the methods and technologies concerning efficiency, robustness and performance aspects. The book covers the topics of mathematical foundations for variational approaches and the mathematical understanding of the analytical requirements of modern finite element methods. Special attention is paid to finite deformations, adaptive strategies, incompressible, isotropic or anisotropic material behavior and the mathematical and numerical treatment of the well-known locking phenomenon. Beyond that new results for the introduced approaches are presented especially for challenging nonlinear problems.

  5. Finite element analysis

    CERN Document Server

    2010-01-01

    Finite element analysis is an engineering method for the numerical analysis of complex structures. This book provides a bird's eye view on this very broad matter through 27 original and innovative research studies exhibiting various investigation directions. Through its chapters the reader will have access to works related to Biomedical Engineering, Materials Engineering, Process Analysis and Civil Engineering. The text is addressed not only to researchers, but also to professional engineers, engineering lecturers and students seeking to gain a better understanding of where Finite Element Analysis stands today.

  6. Osteoporosis and trace elements

    DEFF Research Database (Denmark)

    Aaseth, J.; Boivin, G.; Andersen, Ole

    2012-01-01

    functional, exercise related and nutritional factors. Of particular considerations are calcium (Ca) status, vitamin D, fluoride, magnesium and other trace elements. Several trace elements such as zinc and copper are essential for normal development of the skeleton in humans and animals. Fluoride accumulates....... Numerous investigators have evaluated the role of medications and supplementations with minerals and trace substances to reverse the progression of this disease. Although bisphosphonates are still the drugs of choice, low-dosed fluoride and strontium salts have shown promise for the future....

  7. Bibliography on transuranium elements

    International Nuclear Information System (INIS)

    A selective bibliography of prominent publications on transuranium elements is compiled. Heading papers, symposia proceedings and the textbooks are included in the bibliography. The bibliography is arranged under the headings: (1)Books, Symposia Proceedings, Reviews etc., (2)Discovery, (3)Weighable Isolation, (4)Metal Preparation, (5)Nuclear Properties, (6)Plutonium as Reactor Fuel, (7)Fuel Reprocessing, (8)Solid State Chemistry, Thermochemistry and Spectroscopy, (9)Radiation Safety, (10)Applications, and (11)Some Typical Indian Papers. Total number of references cited are 298. The bibliography, though selective, will serve as a starting point for comprehensive literature search on transuranium elements. (author)

  8. Rocket propulsion elements

    CERN Document Server

    Sutton, George P

    2011-01-01

    The definitive text on rocket propulsion-now revised to reflect advancements in the field For sixty years, Sutton's Rocket Propulsion Elements has been regarded as the single most authoritative sourcebook on rocket propulsion technology. As with the previous edition, coauthored with Oscar Biblarz, the Eighth Edition of Rocket Propulsion Elements offers a thorough introduction to basic principles of rocket propulsion for guided missiles, space flight, or satellite flight. It describes the physical mechanisms and designs for various types of rockets' and provides an unders

  9. Finite elements and approximation

    CERN Document Server

    Zienkiewicz, O C

    2006-01-01

    A powerful tool for the approximate solution of differential equations, the finite element is extensively used in industry and research. This book offers students of engineering and physics a comprehensive view of the principles involved, with numerous illustrative examples and exercises.Starting with continuum boundary value problems and the need for numerical discretization, the text examines finite difference methods, weighted residual methods in the context of continuous trial functions, and piecewise defined trial functions and the finite element method. Additional topics include higher o

  10. Elements of linear space

    CERN Document Server

    Amir-Moez, A R; Sneddon, I N

    1962-01-01

    Elements of Linear Space is a detailed treatment of the elements of linear spaces, including real spaces with no more than three dimensions and complex n-dimensional spaces. The geometry of conic sections and quadric surfaces is considered, along with algebraic structures, especially vector spaces and transformations. Problems drawn from various branches of geometry are given.Comprised of 12 chapters, this volume begins with an introduction to real Euclidean space, followed by a discussion on linear transformations and matrices. The addition and multiplication of transformations and matrices a

  11. TABLE OF RADIOACTIVE ELEMENTS.

    Energy Technology Data Exchange (ETDEWEB)

    HOLDEN,N.E.

    2001-06-29

    For those chemical elements which have no stable nuclides with a terrestrial isotopic composition, the data on radioactive half-lives and relative atomic masses for the nuclides of interest and importance have been evaluated and the recommended values and uncertainties are listed.

  12. TABLE OF RADIOACTIVE ELEMENTS

    International Nuclear Information System (INIS)

    For those chemical elements which have no stable nuclides with a terrestrial isotopic composition, the data on radioactive half-lives and relative atomic masses for the nuclides of interest and importance have been evaluated and the recommended values and uncertainties are listed

  13. Inside finite elements

    CERN Document Server

    Weiser, Martin

    2016-01-01

    All relevant implementation aspects of finite element methods are discussed in this book. The focus is on algorithms and data structures as well as on their concrete implementation. Theory is covered as far as it gives insight into the construction of algorithms. Throughout the exercises a complete FE-solver for scalar 2D problems will be implemented in Matlab/Octave.

  14. Differential expression of a retrotransposable element, Rex6, in Colossoma macropomum fish from different Amazonian environments.

    Science.gov (United States)

    Barbosa, Cassiane Martins; Mareco, Edson Assunção; Silva, Maeli Dal Pai; Martins, Cesar; Alves-Costa, Fernanda Antunes

    2014-01-01

    Transposable elements (TEs) are DNA sequences that have the ability to move and replicate within the genomes. TEs can be classified according to their intermediates of transposition, RNA (retrotransposons) or DNA. In some aquatic organisms, it has been observed that environmental factors such as pH, temperature and pollution may stimulate differential transcription and mobilization of retrotransposons. In light of this information, the present study sought to evaluate the expression of Rex6 TE transcripts in Colossoma macropomum, which is a very commercially exploited fish in Brazil. In order to establish a comparative analysis using real-time PCR, the samples were collected from Amazonian rivers with different physical and chemical characteristics (distinguished by clear water and black water). Quantitative RT-PCR analyses revealed a differential pattern of expression between tissues collected from different types of water (clear and black waters). When it came to the hepatic and muscle tissues sampled, the levels of Rex6 transcripts were significantly different between the two Amazonian water types. These results suggest that environmental conditions operate differently in the regulation of Rex6 transcription in C. macropomum, results which have implications in the reshaping of the genome against environmental variations. PMID:25089227

  15. Distribution of Genes and Repetitive Elements in the Diabrotica virgifera virgifera Genome Estimated Using BAC Sequencing

    Directory of Open Access Journals (Sweden)

    Brad S. Coates

    2012-01-01

    Full Text Available Feeding damage caused by the western corn rootworm, Diabrotica virgifera virgifera, is destructive to corn plants in North America and Europe where control remains challenging due to evolution of resistance to chemical and transgenic toxins. A BAC library, DvvBAC1, containing 109,486 clones with 104±34.5 kb inserts was created, which has an ~4.56X genome coverage based upon a 2.58 Gb (2.80 pg flow cytometry-estimated haploid genome size. Paired end sequencing of 1037 BAC inserts produced 1.17 Mb of data (~0.05% genome coverage and indicated ~9.4 and 16.0% of reads encode, respectively, endogenous genes and transposable elements (TEs. Sequencing genes within BAC full inserts demonstrated that TE densities are high within intergenic and intron regions and contribute to the increased gene size. Comparison of homologous genome regions cloned within different BAC clones indicated that TE movement may cause haplotype variation within the inbred strain. The data presented here indicate that the D. virgifera virgifera genome is large in size and contains a high proportion of repetitive sequence. These BAC sequencing methods that are applicable for characterization of genomes prior to sequencing may likely be valuable resources for genome annotation as well as scaffolding.

  16. Periodic table of elements

    International Nuclear Information System (INIS)

    Following a recommendation by the International Union for Pure and Applied Chemistry (IUPAC), the groups of the periodic table shall be numbered from 1 to 18, instead of I to VIII as before. The recommendations has been approved of by the Committee on Nomenclature of the American Chemical Society. The new system abandons the distinction between main groups (a) and auxiliary groups (b), which in the past frequently has been the reason for misunderstandings between European and American chemists, due to different handling. The publishing house VCH Verlagsgesellschaft recently produced a new periodic table that shows the old and the new numbering system together at a glance, so that chemists will have time to get familiar with the new system. In addition the new periodic table represents an extensive data compilation arranged by elements. The front page lists the chemical properties of elements, the back page their physical properties. (orig./EF)

  17. Production of transuranium elements

    International Nuclear Information System (INIS)

    The Radiochemical Engineering Development Center (REDC) has the programmatic responsibility for the Department of Energy's Transuranium Element Program. Principle elements from the program are einsteinium, berkelium, and fermium. Targets containing curium oxide mixed with aluminum powder are fabricated by the REDC and irradiated in the Oak Ridge National Laboratory (ORNL) High Flux Isotope Reactor. Following an irradiation period of 6-12 months, targets are returned to the REDC for chemical processing. Processing operations consists of aluminum dejacketing in a caustic-nitrate solution, filtration, acid dissolution, solvent extraction, anion exchange, and finally a cation exchange to recover the actinides. The processing operations take place in heavily shielded hot cell facilities and all operations are carried out remotely. The chemistry for the separations has been well established over the 26-yr. operating life of the facility

  18. Origin of light elements

    International Nuclear Information System (INIS)

    A brief review on the state of the problem of occurrence of light elements, physics of shearing reactions and nucleosynthesis, caused by the observed fluxes of galactic cosmic rays is presented. Special attention is paid to 7Li nucleosynthesis, revealing interesting aspects of star physics, the problem of the effect of low-energy cosmic ray flux, strongly modulated by solar wind and solar magnetic activity, nucleosynthesis in red giants, explosions of novae and early stages of the Universe evolution which are of particular interest among them. The conclusion is made, that light elements Li, Be and B present a unique instrument for the analysis of cosmologic problems, as well as for the comprehension of the physics of cosmic rays and chemical evolution of galaxies

  19. ELEMENTS OF MARKETING

    OpenAIRE

    Ramakrishna Mohan Rao Munaga

    2014-01-01

    The marketing thinking starts with customer’s needs. Today the customer is on the driver’s seat. It is also because of the change in the demand supply equation. Now the demand is less than supply just reverse to the past times situation. Today each marketer wants to retain and satisfy the customer because of the intense competition. The marketing elements are Needs, Wants, Demands, Products, Value, Exchange, Transaction and Relationship, Market, Marketers.

  20. Nuclear reactor fuel elements

    International Nuclear Information System (INIS)

    A nuclear reactor fuel element comprising a column of vibration compacted fuel which is retained in consolidated condition by a thimble shaped plug. The plug is wedged into gripping engagement with the wall of the sheath by a wedge. The wedge material has a lower coefficient of expansion than the sheath material so that at reactor operating temperature the retainer can relax sufficient to accommodate thermal expansion of the column of fuel. (author)

  1. Finite elements in fluids

    International Nuclear Information System (INIS)

    This book discusses the topics in the general field of finite element analysis of flow problems and describes the major advances over the last two years and introduces new powerful methods for high-speed and free-surface flows, and discusses applications. The contents include: General Topics, Computational and Mathematical Aspects. High-speed and Transonic flows. Hydraulics, Viscous Flow, Boundary-Layers, MHD. Free Surface Flow. Index

  2. Elements of quantum information

    International Nuclear Information System (INIS)

    Elements of Quantum Information introduces the reader to the fascinating field of quantum information processing, which lives on the interface between computer science, physics, mathematics, and engineering. This interdisciplinary branch of science thrives on the use of quantum mechanics as a resource for high potential modern applications. With its wide coverage of experiments, applications, and specialized topics - all written by renowned experts - Elements of Quantum Information provides and indispensable, up-to-date account of the state of the art of this rapidly advancing field and takes the reader straight up to the frontiers of current research. The articles have first appeared as a special issue of the journal 'Fortschritte der Physik / Progress of Physics'. Since then, they have been carefully updated. The book will be an inspiring source of information and insight for anyone researching and specializing in experiments and theory of quantum information. Topics addressed in Elements of Quantum Information include - Cavity Quantum Electrodynamics - Segmented Paul Traps - Cold Atoms and Bose-Einstein Condensates in Microtraps, Optical Lattices, and on Atom Chips - Rydberg Gases - Factorization of Numbers with Physical Systems - Entanglement of Continuous Variables - NMR and Solid State Quantum Computation - Quantum Algorithms and Quantum Machines - Complexity Theory - Quantum Crytography. (orig.)

  3. Helium the disappearing element

    CERN Document Server

    Sears, Wheeler M

    2015-01-01

    The subject of the book is helium, the element, and its use in myriad applications including MRI machines, particle accelerators, space telescopes, and of course balloons and blimps. It was at the birth of our Universe, or the Big Bang, where the majority of cosmic helium was created; and stellar helium production continues. Although helium is the second most abundant element in the Universe, it is actually quite rare here on Earth and only exists because of radioactive elements deep within the Earth. This book includes a detailed history of the discovery of helium, of the commercial industry built around it, how the helium we actually encounter is produced within the Earth, and the state of the helium industry today. The gas that most people associate with birthday party balloons is running out. “Who cares?” you might ask. Well, without helium, MRI machines could not function, rockets could not go into space, particle accelerators such as those used by CERN could not operate, fiber optic cables would not...

  4. The transuranium elements

    International Nuclear Information System (INIS)

    In this paper Seaborg's actinide hypothesis is traced from its beginnings to the present. The wealth of spectroscopic and magnetic data accumulated over the years leads to conclusions about the electronic structure of the actinides. These investigations include spectroscopic studies of gaseous atoms and ions, as well as of solutions and compounds, and magnetic susceptibility and electron spin resonance studies of metals, alloys, and compounds. Both experimental and theoretical studies have resulted in accurate values for spin-orbit coupling and crystal-field parameters for 5f electrons, for example, which can be compared with values characteristic of 4f electrons. For instance, the somewhat greater spatial extent of 5f versus 4f wave functions gives rise to 5f orbital participation in the bonding of actinide element organometallic compounds and leads to an extensive and intricate organometallic chemistry for this group of elements. The rich chemistry of Np and Pu provides new insights into electronic structure and the unique nature of 5f electrons yields exciting findings in the exploration of the chemistry of the actinide elements

  5. The transuranium elements: From neptunium and plutonium to element 112

    International Nuclear Information System (INIS)

    Beginning in the 1930's, both chemists and physicists became interested in synthesizing new artificial elements. The first transuranium element, Np, was synthesized in 1940. Over the past six decades, 20 transuranium elements have been produced. A review of the synthesis is given. The procedure of naming the heavy elements is also discussed. It appears feasible to produce elements 113 and 114. With the Berkeley Gas-filled Separator, it should be possible to reach the superheavy elements in the region of the spherical Z=114 shell, but with fewer neutrons than the N=184 spherical shell. 57 refs, 6 figs

  6. The transuranium elements: From neptunium and plutonium to element 112

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, D.C. [California Univ., Berkeley, CA (United States)]|[Lawrence Livermore National Lab., CA (United States)

    1996-07-26

    Beginning in the 1930`s, both chemists and physicists became interested in synthesizing new artificial elements. The first transuranium element, Np, was synthesized in 1940. Over the past six decades, 20 transuranium elements have been produced. A review of the synthesis is given. The procedure of naming the heavy elements is also discussed. It appears feasible to produce elements 113 and 114. With the Berkeley Gas-filled Separator, it should be possible to reach the superheavy elements in the region of the spherical Z=114 shell, but with fewer neutrons than the N=184 spherical shell. 57 refs, 6 figs.

  7. A new large-DNA-fragment delivery system based on integrase activity from an integrative and conjugative element.

    Science.gov (United States)

    Miyazaki, Ryo; van der Meer, Jan Roelof

    2013-07-01

    During the past few decades, numerous plasmid vectors have been developed for cloning, gene expression analysis, and genetic engineering. Cloning procedures typically rely on PCR amplification, DNA fragment restriction digestion, recovery, and ligation, but increasingly, procedures are being developed to assemble large synthetic DNAs. In this study, we developed a new gene delivery system using the integrase activity of an integrative and conjugative element (ICE). The advantage of the integrase-based delivery is that it can stably introduce a large DNA fragment (at least 75 kb) into one or more specific sites (the gene for glycine-accepting tRNA) on a target chromosome. Integrase recombination activity in Escherichia coli is kept low by using a synthetic hybrid promoter, which, however, is unleashed in the final target host, forcing the integration of the construct. Upon integration, the system is again silenced. Two variants with different genetic features were produced, one in the form of a cloning vector in E. coli and the other as a mini-transposable element by which large DNA constructs assembled in E. coli can be tagged with the integrase gene. We confirmed that the system could successfully introduce cosmid and bacterial artificial chromosome (BAC) DNAs from E. coli into the chromosome of Pseudomonas putida in a site-specific manner. The integrase delivery system works in concert with existing vector systems and could thus be a powerful tool for synthetic constructions of new metabolic pathways in a variety of host bacteria. PMID:23686268

  8. [Healthcare marketing elements].

    Science.gov (United States)

    Ameri, Cinzia; Fiorini, Fulvio

    2014-01-01

    Marketing puts its foundation on a few key concepts: need-demand, product-service, satisfaction, exchange, market, or business structure manufacturing / supply. The combination of these elements allows you to build an effective marketing strategy. Crucial in this respect is to remember the Porter matrix, which shows that for a correct analysis of the relevant market is necessary to refer to the "five forces at play", ie: customers, competitors, new entrants and substitutes threat. Another key lever for proper marketing oriented approach is the continuous and constant monitoring of the application, anticipating their dissatisfactions. PMID:24777920

  9. Elements of probability theory

    CERN Document Server

    Rumshiskii, L Z

    1965-01-01

    Elements of Probability Theory presents the methods of the theory of probability. This book is divided into seven chapters that discuss the general rule for the multiplication of probabilities, the fundamental properties of the subject matter, and the classical definition of probability. The introductory chapters deal with the functions of random variables; continuous random variables; numerical characteristics of probability distributions; center of the probability distribution of a random variable; definition of the law of large numbers; stability of the sample mean and the method of moments

  10. Primordial heavy element production

    CERN Document Server

    Rauscher, T

    2015-01-01

    A number of possible mechanisms have been suggested to generate density inhomogeneities in the early Universe which could survive until the onset of primordial nucleosynthesis and generate neutron-rich regions. In this work we are not concerned with how the inhomogeneities were generated but we want to focus on the effect of such inhomogeneities on primordial nucleosynthesis. One of the proposed signatures of inhomogeneity, the synthesis of very heavy elements by neutron capture in a primordial r-process, was analyzed for varying baryon to photon ratios $\\eta$ and fluctuation length scales $L$.

  11. Elements of analytical dynamics

    CERN Document Server

    Kurth, Rudolph; Stark, M

    1976-01-01

    Elements of Analytical Dynamics deals with dynamics, which studies the relationship between motion of material bodies and the forces acting on them. This book is a compilation of lectures given by the author at the Georgia and Institute of Technology and formed a part of a course in Topological Dynamics. The book begins by discussing the notions of space and time and their basic properties. It then discusses the Hamilton-Jacobi theory and Hamilton's principle and first integrals. The text concludes with a discussion on Jacobi's geometric interpretation of conservative systems. This book will

  12. Elements of energy conversion

    CERN Document Server

    Russell, Charles R

    2013-01-01

    Elements of Energy Conversion brings together scattered information on the subject of energy conversion and presents it in terms of the fundamental thermodynamics that apply to energy conversion by any process. Emphasis is given to the development of the theory of heat engines because these are and will remain most important power sources. Descriptive material is then presented to provide elementary information on all important energy conversion devices. The book contains 10 chapters and opens with a discussion of forms of energy, energy sources and storage, and energy conversion. This is foll

  13. Nuclear fuel element cladding

    International Nuclear Information System (INIS)

    Composite cladding for a nuclear fuel element containing fuel pellets is formed with a zirconium metal barrier layer bonded to the inside surface of a zirconium alloy tube. The composite tube is sized by a cold working tube reduction process and is heat treated after final reduction to provide complete recrystallization of the zirconium metal barrier layer and a fine-grained microstructure. The zirconium alloy tube is stress-relieved but is not fully recrystallized. The crystallographic structure of the zirconium metal barrier layer may be improved by compressive deformation such as shot-peening. (author)

  14. Nuclear fuel element

    International Nuclear Information System (INIS)

    Purpose: To reduce the probability of stress corrosion cracks in a zirconium alloy fuel can even when tensile stresses are resulted to the fuel can. Constitution: Sintered nuclear fuel pellets composed of uranium dioxide or a solid solution of gadolinium as a burnable poison in uranium dioxide are charged in a tightly sealed zirconium alloy fuel can. The nuclear fuel pellets for the nuclear fuel element are heat-treated in a gas mixture of carbon dioxide and carbon monoxide. Further, a charging gas containing a mixture of carbon dioxide and carbon monoxide is charged within a zirconium alloy fuel can packed with the nuclear fuel pellets and tightly sealed. (Aizawa, K.)

  15. Radiolabelled Cellular Blood Elements

    International Nuclear Information System (INIS)

    This volume contains the abstracts of the 5th International Symposion on Radiolabelling of Cellular Blood Elements to be held in Vienna, Austria, September 10-14, 1989. The Meeting is the fifth in a series of meetings designed to discuss the basics and clinical application of radiolabelling techniques. In these days, beside the search for new labelling agents and extending the knowledge in clinical use, the use of monoclonal antibodies is a big new challenge. All reviewed contributions that have been accepted for presentation are contained in this volume. (authors) 58 of them are of INIS scope

  16. Analytical elements of mechanics

    CERN Document Server

    Kane, Thomas R

    2013-01-01

    Analytical Elements of Mechanics, Volume 1, is the first of two volumes intended for use in courses in classical mechanics. The books aim to provide students and teachers with a text consistent in content and format with the author's ideas regarding the subject matter and teaching of mechanics, and to disseminate these ideas. The book opens with a detailed exposition of vector algebra, and no prior knowledge of this subject is required. This is followed by a chapter on the topic of mass centers, which is presented as a logical extension of concepts introduced in connection with centroids. A

  17. Nuclear reactor fuel element

    International Nuclear Information System (INIS)

    The fuel element box for a BWR is situated with a corner bolt on the inside in one corner of its top on the top side of the top plate. This corner bolt is screwed down with a bolt with a corner part which is provided with leaf springs outside on two sides, where the bolt has a smaller diameter and an expansion shank. The bolt is held captive to the bolt head on the top and the holder on the bottom of the corner part. The holder is a locknut. If the expansion forces are too great, the bolt can only break at the expansion shank. (HP)

  18. Extractability of risk elements and nutrition elements from ash

    OpenAIRE

    Hrma, Jiří

    2012-01-01

    The thesis „Extractability of risk elements and nutrition elements from ash“ studies the determination of physicochemical properties of ash and compares the mobility of heavy metals and nutrition elements in various samples. The aim of the study was to determine the extractability of heavy metals and nutrition elements from biomass ash and their chemical speciation using sequential extraction procedure based upon Tessier which was modified for given matrix. The results permit to classify m...

  19. Fundamental Atomtronic Circuit Elements

    Science.gov (United States)

    Lee, Jeffrey; McIlvain, Brian; Lobb, Christopher; Hill, Wendell T., III

    2012-06-01

    Recent experiments with neutral superfluid gases have shown that it is possible to create atomtronic circuits analogous to existing superconducting circuits. The goals of these experiments are to create complex systems such as Josephson junctions. In addition, there are theoretical models for active atomtronic components analogous to diodes, transistors and oscillators. In order for any of these devices to function, an understanding of the more fundamental atomtronic elements is needed. Here we describe the first experimental realization of these more fundamental elements. We have created an atomtronic capacitor that is discharged through a resistance and inductance. We will discuss a theoretical description of the system that allows us to determine values for the capacitance, resistance and inductance. The resistance is shown to be analogous to the Sharvin resistance, and the inductance analogous to kinetic inductance in electronics. This atomtronic circuit is implemented with a thermal sample of laser cooled rubidium atoms. The atoms are confined using what we call free-space atom chips, a novel optical dipole trap produced using a generalized phase-contrast imaging technique. We will also discuss progress toward implementing this atomtronic system in a degenerate Bose gas.

  20. NIH Common Data Elements Repository

    Data.gov (United States)

    U.S. Department of Health & Human Services — The NIH Common Data Elements (CDE) Repository has been designed to provide access to structured human and machine-readable definitions of data elements that have...

  1. News from the 'superheavy elements'

    International Nuclear Information System (INIS)

    The search of some groups of scientists after superheavy elements in nature (minerals, meteorites) is shortly outlined, and the main facts suggesting the existence of at least some of these elements are stated. However, it is also pointed out that the problem of superheavy elements still leaves much room for speculations. (RB)

  2. Analog elements for transuranic chemistries

    International Nuclear Information System (INIS)

    A chemical extraction technique for estimating the biologically available fraction of nonessential trace elements in soils has been developed. This procedure has been used in evaluating the uptake of naturally occurring transuranic analog elements from soils into several foodstuffs. The availability of the natural elements has been compared with the availability of their analog transuranics which have been derived from global fallout

  3. Chemistry of the transactinide elements

    International Nuclear Information System (INIS)

    The synthesis and decay of the elements 104, 105 and 106 are described as well as the chemistry of the elements in the gaseous and liquid phase. The electron configurations of the ground state of the elements 105 and higher are described, as well as further chemical properties. (SR)

  4. Trace element emissions from coal

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2012-09-15

    Trace elements are emitted during coal combustion. The quantity, in general, depends on the physical and chemical properties of the element itself, the concentration of the element in the coal, the combustion conditions and the type of particulate control device used, and its collection efficiency as a function of particle size. Some trace elements become concentrated in certain particle streams following combustion such as bottom ash, fly ash, and flue gas particulate matter, while others do not. Various classification schemes have been developed to describe this partitioning behaviour. These classification schemes generally distinguish between: Class 1: elements that are approximately equally concentrated in the fly ash and bottom ash, or show little or no fine particle enrichment, examples include Mn, Be, Co and Cr; Class 2: elements that are enriched in the fly ash relative to bottom ash, or show increasing enrichment with decreasing particle size, examples include As, Cd, Pb and Sb; Class 3: elements which are emitted in the gas phase (primarily Hg (not discussed in this review), and in some cases, Se). Control of class 1 trace elements is directly related to control of total particulate matter emissions, while control of the class 2 elements depends on collection of fine particulates. Due to the variability in particulate control device efficiencies, emission rates of these elements can vary substantially. The volatility of class 3 elements means that particulate controls have only a limited impact on the emissions of these elements.

  5. Accelerator vacuum system elements

    International Nuclear Information System (INIS)

    Some elements of vacuum systems are investigated. Considerable attention has been given to the investigation into peculiarities in pumping out of a ionoguide for transportation of an accelerated charged particles beam the spread of which often attains a considerable length. The number of pumps over the ionoguide length is experimentally determined. It is shown that as a result of ionoguide warm-up the pumping out time is considerably reduced maximum permissible pressure is decreased by two orders and lesser rate of pump pumping out is required. The investigations have shown that when operating the ionoguide there is no necessity in setting up seals between the ionoguide and magnetodischarged pump. The causes of the phenomenon in which the pressure near the pump is greater than in the end of the ionoguide, are impurities carried in by the pump into the ionoguide volume and the pumping out capacity of the pressure converter

  6. Finite element modelling

    International Nuclear Information System (INIS)

    The Finite Element Method (FEM) is a numerical technique for finding approximate solutions to boundary value problems. While FEM is commonly used to solve solid mechanics equations, it can be applied to a large range of BVPs from many different fields. FEM has been used for reactor fuels modelling for many years. It is most often used for fuel performance modelling at the pellet and pin scale, however, it has also been used to investigate properties of the fuel material, such as thermal conductivity and fission gas release. Recently, the United Stated Department Nuclear Energy Advanced Modelling and Simulation Program has begun using FEM as the basis of the MOOSE-BISON-MARMOT Project that is developing a multi-dimensional, multi-physics fuel performance capability that is massively parallel and will use multi-scale material models to provide a truly predictive modelling capability. (authors)

  7. Heavy-element research

    International Nuclear Information System (INIS)

    The status is reported of studies on the solid-state chemistry of the actinides and lanthanides, spectroscopy of actinide compounds, and dynamic chemical description of actinide elements in solution. Phase studies were done on Rb2UO4, K2UO4, Li2UO4, and Es2U2O7. The lithium neptunate (VI) system was investigated and the existence of Li2NpO4 was established. In oxidation-reduction studies it was shown that Am(III) can be electrolytically oxidized to Am(IV) in strong H3PO4, but Cf(III) and Pr(III) do not oxidize. The low-temperature absorption spectrum of thin films of NpBr3 was investigated. (U.S.)

  8. Nuclear reactor fuel element

    International Nuclear Information System (INIS)

    The grid-shaped spacer for PWR fuel elements consists of flat, upright metal bars at right angles to the fuel rods. In one corner of a grid mesh it has a spring with two end parts for the fuel rod. The cut-outs for the end parts start from an end edge of the metal bar parallel to the fuel rods. The transverse metal bar is one of four outer metal bars. Both end parts of the spring have an extension parallel to this outer metal arm, which grips a grid mesh adjacent to this grid mesh at the side in one corner of the spacer and forms an end part of a spring for the fuel rod there on the inside of the outer metal bar. (HP)

  9. Burnable neutron absorber element

    International Nuclear Information System (INIS)

    A burnable thermal neutron absorber element is described comprising: a zirconium alloy elongated tubular container having an inside diameter surface; hydrogen diffusion barrier means for limiting hydrogen diffusion from within the container into the zirconium alloy; a boron-containing burnable thermal neutron absorber material sealed within the zirconium alloy elongated container, the boron-containing burnable absorber material being in a particle form, the particles of absorber material being coated with a diffusion barrier material; zirconium hydride sealed within the zirconium alloy elongated container, the zirconium hydride being in a partially hydrided condition and having a H to Zr ratio on an atomic basis in the range of about 1.0 to about 1.8; the burnable thermal neutron absorber material and the zirconium hydride distributed along the length of the zirconium alloy elongated container; and the zirconium hydride acts as a neutron moderator thereby enhancing the neutron capture efficiency of the burnable thermal neutron absorber

  10. Burnable neutron absorber element

    Energy Technology Data Exchange (ETDEWEB)

    Ferrari, H.M.

    1988-06-14

    A burnable thermal neutron absorber element is described comprising: a zirconium alloy elongated tubular container having an inside diameter surface; hydrogen diffusion barrier means for limiting hydrogen diffusion from within the container into the zirconium alloy; a boron-containing burnable thermal neutron absorber material sealed within the zirconium alloy elongated container, the boron-containing burnable absorber material being in a particle form, the particles of absorber material being coated with a diffusion barrier material; zirconium hydride sealed within the zirconium alloy elongated container, the zirconium hydride being in a partially hydrided condition and having a H to Zr ratio on an atomic basis in the range of about 1.0 to about 1.8; the burnable thermal neutron absorber material and the zirconium hydride distributed along the length of the zirconium alloy elongated container; and the zirconium hydride acts as a neutron moderator thereby enhancing the neutron capture efficiency of the burnable thermal neutron absorber.

  11. The fantastic four.. elements

    Science.gov (United States)

    Marsili, Antonella; D'Addezio, Giuliana; Rubbia, Giuliana; Ramieri, Caterina; Todaro, Riccardo; Scipilliti, Francesca; Tosto, Eleonora

    2015-04-01

    With a "Sunday between territory and music to 'National Institute of Geophysics and Volcanology," October 12, 2014 the headquarters of INGV Roma kicked off the activities of the second edition of the Week of Planet Earth. The laboratory of scientific outreach and museum activities together with volunteers of the National Civil Service have organized the whole day dedicated to the dissemination of earth sciences, involving adults and children. Especially for primary school children a laboratory was made involving three amusing activities all aimed at inspiring respect for the Earth: a theatrical representation called "The Fantastic 4... elements", a behavioral game and a nursery rhyme reading. The theater as a means of communication of science is an innovative and creative way to introduce children to important scientific concepts. The use of this methodology and simple language favoring the emotional involvement of the child facilitating learning. The main character is a child, chosen to facilitate the identification of the spectators with the protagonist, that through a fantastic journey discovers the importance of the four elements of our planet: earth, fire, air and water. As a second step, volunteers involved children in reading a nursery rhyme "the ABC to become a Friend of the Earth" inviting them to protect and respect the environment and its resources. Finally, the behavioral game gave indications about behaviors to adopt to safeguard the planet. Volunteers introduced a billboard divided into two colors, green to indicate the right behaviors and red for the wrong ones. Each child, after reading a card with indication on the behavior to adopt, had to decide if they were correct or not with respect to the environment safeguard. After listening to the children's answer, the volunteer gave the correct explanation about the appropriate behavior to adopt. At the end of the activities, each child received a certificate as "a friend of Planet Earth".

  12. Design transposal workshop: visualising through the gyre

    OpenAIRE

    Dimitrijevic, Katarina

    2015-01-01

    The workshop's primary objective is to visualize the future possibilities for ocean plastic de-pollution, using plastic disposal to co-create a 3D gyre installation. It will incorporate joyful activism, trash aesthetics and craft making.The workshop will be a participatory platform, facilitating rather than dictating. It proposes that a changing relation to disposal is a changing relation to oneself. The future aim of this ongoing design research is to co-create new discard values and induce ...

  13. Novel high-performance element in the electromagnetic finite-element method--node-edge element

    Institute of Scientific and Technical Information of China (English)

    Sheng Xinqing; Peng Zhen

    2008-01-01

    It is known in the computational electromagnetics (CEM) that the node element has a relative well-conditioned matrix,but suffers from the spurious solution problem; whereas the edge element has no spurious solutions,but usually produces an ill-conditioned matrix.Particularly,when the mesh is over dense,the iterative solution of the matrix equation from edge element converges very slowly.Based on the node element and edge element,a node-edge element is presented,which has no spurious solutions and better-conditioned matrix.Numerical experiments demonstrate that the proposed node-edge element is more efficient than now-widely used edge element.

  14. An element by element spectral element method for elastic wave modeling

    Institute of Scientific and Technical Information of China (English)

    LIN Weijun; WANG Xiuming; ZHANG Hailan

    2006-01-01

    The spectral element method which combines the advantages of spectral method with those of finite element method,provides an efficient tool in simulating elastic wave equation in complex medium. Based on weak form of elastodynamic equations, mathematical formulations for Legendre spectral element method are presented. The wave field on an element is discretized using high-order Lagrange interpolation, and integration over the element is accomplished based upon the Gauss-Lobatto-Legendre integration rule. This results in a diagonal mass matrix which leads to a greatly simplified algorithm. In addition, the element by element technique is introduced in our method to reduce the memory sizes and improve the computation efficiency. Finally, some numerical examples are presented to demonstrate the spectral accuracy and the efficiency. Because of combinations of the finite element scheme and spectral algorithms, this method can be used for complex models, including free surface boundaries and strong heterogeneity.

  15. Transposition burst of mariner-like elements in the sequenced genome of Rhodnius prolixus.

    Science.gov (United States)

    Fernández-Medina, R D; Granzotto, A; Ribeiro, J M; Carareto, C M A

    2016-02-01

    Transposable elements (TEs) are widespread in insect's genomes. However, there are wide differences in the proportion of the total DNA content occupied by these repetitive sequences in different species. We have analyzed the TEs present in R. prolixus (vector of the Chagas disease) and showed that 3.0% of this genome is occupied by Class II TEs, belonging mainly to the Tc1-mariner superfamily (1.65%) and MITEs (1.84%). Interestingly, most of this genomic content is due to the expansion of two subfamilies belonging to: irritans himar, a well characterized subfamily of mariners, and prolixus1, one of the two novel subfamilies here described. The high amount of sequences in these subfamilies suggests that bursts of transposition occurred during the life cycle of this family. In an attempt to characterize these elements, we performed an in silico analysis of the sequences corresponding to the DDD/E domain of the transposase gene. We performed an evolutionary analysis including network and Bayesian coalescent-based methods in order to infer the dynamics of the amplification, as well as to estimate the time of the bursts identified in these subfamilies. Given our data, we hypothesized that the TE expansions occurred around the time of speciation of R. prolixus around 1.4 mya. This suggestion lays on the "Transposon Model" of TE evolution, in which the members of a TE population that are replicative active are present at multiple loci in the genome, but their replicative potential varies, and of the "Life Cycle Model" that states that when present-day TEs have been involved in amplification bursts, they share an ancestral copy that dates back to this initial amplification. PMID:26363296

  16. Site-selected insertional mutagenesis of tomato with maize Ac and Ds elements.

    Science.gov (United States)

    Cooley, M B; Goldsbrough, A P; Still, D W; Yoder, J I

    1996-08-27

    Site-selected insertion (SSI) is a PCR-based technique which uses primers located within the transposon and a target gene for detection of transposon insertions into cloned genes. We screened tomato plants bearing single or multiple copies of maize Ac or Ds transposable elements for somatic insertions at one close-range target and two long-range targets. Eight close-range Ds insertions near the right border of the T-DNA were recovered. Sequence analysis showed a precise junction between the transposon and the target for all insertions. Two insertions in separate plants occurred at the same site, but others appeared dispersed in the region of the right T-DNA border with no target specificity. However, insertions showed a preference for one orientation of the transposon. Use of plants with multiple Ac (HiAc) or Ds (HiDs) elements allowed detection of somatic insertions at two single-copy genes, PG (polygalacturonase) and DFR (dihydroflavonol 4-reductase). Certain HiDs plants showed much higher rates of insertion into PG than others. Insertions in PG and DFR were found throughout the gene regions monitored and, with the exception of one insertion in PG, the junctions between transposon and target were exact. SSI analysis of progeny from the HiDs parents revealed that in some cases the tendency to incur high levels of somatic insertions in PG was inherited. Inheritance of this character is an indication that SSI could be used to direct a search for germinal PG insertions in tomato. PMID:8804392

  17. Chemical characterization of element 112.

    Science.gov (United States)

    Eichler, R; Aksenov, N V; Belozerov, A V; Bozhikov, G A; Chepigin, V I; Dmitriev, S N; Dressler, R; Gäggeler, H W; Gorshkov, V A; Haenssler, F; Itkis, M G; Laube, A; Lebedev, V Ya; Malyshev, O N; Oganessian, Yu Ts; Petrushkin, O V; Piguet, D; Rasmussen, P; Shishkin, S V; Shutov, A V; Svirikhin, A I; Tereshatov, E E; Vostokin, G K; Wegrzecki, M; Yeremin, A V

    2007-05-01

    The heaviest elements to have been chemically characterized are seaborgium (element 106), bohrium (element 107) and hassium (element 108). All three behave according to their respective positions in groups 6, 7 and 8 of the periodic table, which arranges elements according to their outermost electrons and hence their chemical properties. However, the chemical characterization results are not trivial: relativistic effects on the electronic structure of the heaviest elements can strongly influence chemical properties. The next heavy element targeted for chemical characterization is element 112; its closed-shell electronic structure with a filled outer s orbital suggests that it may be particularly susceptible to strong deviations from the chemical property trends expected within group 12. Indeed, first experiments concluded that element 112 does not behave like its lighter homologue mercury. However, the production and identification methods used cast doubt on the validity of this result. Here we report a more reliable chemical characterization of element 112, involving the production of two atoms of (283)112 through the alpha decay of the short-lived (287)114 (which itself forms in the nuclear fusion reaction of 48Ca with 242Pu) and the adsorption of the two atoms on a gold surface. By directly comparing the adsorption characteristics of (283)112 to that of mercury and the noble gas radon, we find that element 112 is very volatile and, unlike radon, reveals a metallic interaction with the gold surface. These adsorption characteristics establish element 112 as a typical element of group 12, and its successful production unambiguously establishes the approach to the island of stability of superheavy elements through 48Ca-induced nuclear fusion reactions with actinides. PMID:17476264

  18. Chemical characterization of element 112

    Science.gov (United States)

    Eichler, R.; Aksenov, N. V.; Belozerov, A. V.; Bozhikov, G. A.; Chepigin, V. I.; Dmitriev, S. N.; Dressler, R.; Gäggeler, H. W.; Gorshkov, V. A.; Haenssler, F.; Itkis, M. G.; Laube, A.; Lebedev, V. Ya.; Malyshev, O. N.; Oganessian, Yu. Ts.; Petrushkin, O. V.; Piguet, D.; Rasmussen, P.; Shishkin, S. V.; Shutov, A. V.; Svirikhin, A. I.; Tereshatov, E. E.; Vostokin, G. K.; Wegrzecki, M.; Yeremin, A. V.

    2007-05-01

    The heaviest elements to have been chemically characterized are seaborgium (element 106), bohrium (element 107) and hassium (element 108). All three behave according to their respective positions in groups 6, 7 and 8 of the periodic table, which arranges elements according to their outermost electrons and hence their chemical properties. However, the chemical characterization results are not trivial: relativistic effects on the electronic structure of the heaviest elements can strongly influence chemical properties. The next heavy element targeted for chemical characterization is element 112; its closed-shell electronic structure with a filled outer s orbital suggests that it may be particularly susceptible to strong deviations from the chemical property trends expected within group 12. Indeed, first experiments concluded that element 112 does not behave like its lighter homologue mercury. However, the production and identification methods used cast doubt on the validity of this result. Here we report a more reliable chemical characterization of element 112, involving the production of two atoms of 283112 through the alpha decay of the short-lived 287114 (which itself forms in the nuclear fusion reaction of 48Ca with 242Pu) and the adsorption of the two atoms on a gold surface. By directly comparing the adsorption characteristics of 283112 to that of mercury and the noble gas radon, we find that element 112 is very volatile and, unlike radon, reveals a metallic interaction with the gold surface. These adsorption characteristics establish element 112 as a typical element of group 12, and its successful production unambiguously establishes the approach to the island of stability of superheavy elements through 48Ca-induced nuclear fusion reactions with actinides.

  19. I element distribution in mitotic heterochromatin of Drosophila melanogaster reactive strains: identification of a specific site which is correlated with the reactivity levels.

    Science.gov (United States)

    Dimitri, P; Bucheton, A

    2005-01-01

    The I factor is a Drosophila melanogaster LINE-like element that efficiently transposes in the genetic system of I-R hybrid dysgenesis. It has been suggested that some of the I-related sequences located in the heterochromatin of D. melanogaster are involved in the regulation of I factor activity. In this work we have performed fluorescent in situ hybridization (FISH) mapping of I element sequences in mitotic heterochromatin of nine differentially reactive D. melanogaster strains. The results of our analysis showed that a single hybridization site mapping to region h28 of the distal heterochromatin of the X chromosome is present in three strains with low or intermediate levels of reactivity, while it is undetectable in six highly reactive strains. Together, these observations suggest a negative correlation between I sequences located at h28 and the level of reactivity. To this regard, it is intriguing that flamenco and COM, two loci that regulate the activity of D. melanogaster endogenous retroviruses also map to the distal heterochromatin of the X chromosome. Our data represent the first experimental evidence in favour of a silencing effect exerted by naturally occurring I element sequences located in pericentromeric heterochromatin. PMID:16093668

  20. Portable element analysis unit

    International Nuclear Information System (INIS)

    A field portable X-ray fluorescent spectrometer is described, including a multichannel analyzer and a plurality of interchangeable sensor heads. Each sensor head includes a shutter which, when open, permits one of several radiation sources to irradiate the material to be analyzed. The returned radiation is detected by a corresponding detector which provides corresponding data in response. When the shutter is open, the multichannel analyzer utilizes the detector data to accumulate an energy spectrum of the material being analyzed, and displays the spectrum on a display screen. A cursor control allows the operator to move a cursor along the displayed spectrum. The symbol of the element having its major spectral peak at the position identified by the cursor, is automatically displayed on another display screen. Memory is provided for storing a number of reference spectra which may be displayed on the first screen along with the acquired spectrum for comparison purposes. The memory also stores previously acquired spectra for later analyses. To permit quantitative chemical analysis of materials in the field, the analyzer also includes other operational features such as normalization, window control and ratio and concentration determination

  1. Chemistry of the superheavy elements.

    Science.gov (United States)

    Schädel, Matthias

    2015-03-13

    The quest for superheavy elements (SHEs) is driven by the desire to find and explore one of the extreme limits of existence of matter. These elements exist solely due to their nuclear shell stabilization. All 15 presently 'known' SHEs (11 are officially 'discovered' and named) up to element 118 are short-lived and are man-made atom-at-a-time in heavy ion induced nuclear reactions. They are identical to the transactinide elements located in the seventh period of the periodic table beginning with rutherfordium (element 104), dubnium (element 105) and seaborgium (element 106) in groups 4, 5 and 6, respectively. Their chemical properties are often surprising and unexpected from simple extrapolations. After hassium (element 108), chemistry has now reached copernicium (element 112) and flerovium (element 114). For the later ones, the focus is on questions of their metallic or possibly noble gas-like character originating from interplay of most pronounced relativistic effects and electron-shell effects. SHEs provide unique opportunities to get insights into the influence of strong relativistic effects on the atomic electrons and to probe 'relativistically' influenced chemical properties and the architecture of the periodic table at its farthest reach. In addition, they establish a test bench to challenge the validity and predictive power of modern fully relativistic quantum chemical models. PMID:25666065

  2. Transuranium organometallic elements

    International Nuclear Information System (INIS)

    This paper reports that neptunium and plutonium metal react cleanly with 1.5 equiv of I2 in aprotic ligating solvents, L, to give the triiodide complexes as tetrasolvates, AnI3L4 [An is Np, L is tetrahydrofuran (THF) (1); An is Pu, L is THF (2a), pyridine (Py) (2b), and dimethyl sulfoxide (DMSO) (2c)]. These complexes are convenient precursors to both new and existing transuranium compounds. Reaction of the triiodide complexes 1 and 2a in hexane with 3 equiv of sodium bis(trimethylsilyl)amide provides the volatile, solvate-free tris (silylamide) complexes, An[N(SiMe3)2]3 (An is Np, 3; An is Pu, 4). Hexan solutions of 3 and 4 react rapidly with 3 equiv of HO-2,6-(t-C4H9)2C6H3 to give the aryloxide complexes An[O-26-(t-C4H9)2C6H3]3 (An is Np 5; An is Pu, 6). Preliminary investigations indicate that complexes 5 and 6 react with lithium bis(trimethylsilyl)methanide, Li[CH(SiMe3)2], in hexane to give the alkyl complexes An[CH(SiME3)2]3 (An is Np, 7; An is PU, 8). Plutonium triiodide complex 2a readily reacts with LiC5H5 to give the known (n5-C5H5)3Pu(THF). The homoleptic silylamide, aryloxide, and alkyl complexes are the first reported examples for transuranium elements

  3. EDGE-ORIENTED HEXAGONAL ELEMENTS

    Institute of Scientific and Technical Information of China (English)

    Chao Yang; Jiachang Sun

    2007-01-01

    In this paper, two new nonconforming hexagonal elements are presented, which are based on the trilinear function space Q(3)1 and are edge-oriented, analogical to the case of the rotated Q1 quadrilateral element. A priori error estimates are given to show that the new elements achieve first-order accuracy in the energy norm and second-order accuracy in the L2 norm. This theoretical result is confirmed by the numerical tests.

  4. Electronic structure of superheavy elements

    International Nuclear Information System (INIS)

    The electronic structure of superheavy elements, from element 121 to 131, studied using the relativistic density-functional theory with quantum electrodynamical corrections (Berit interaction) by MacDonald and Vosko, is reported. These corrections give rise to a modification to previous results, and the g electron is found to appear from element 126. Since a recent study on molecular systems has clarified the surprising accuracy of the density-functional approach in evaluating the relative energy difference of ground and excited states, a further study of the electronic configuration of heavy elements using the relativistic density-functional theory and the further improvement of the theory are both awaited. (author)

  5. Finite Element Method: An Overview

    Directory of Open Access Journals (Sweden)

    Vishal JAGOTA

    2013-02-01

    Full Text Available The finite element method (FEM is a numerical analysis technique for obtaining approximate solutions to a wide variety of engineering problems. A finite element model of a problem gives a piecewise approximation to the governing equations. The basic premise of the FEM is that a solution region can be analytically modeled or approximated by replacing it with an assemblage of discrete elements (discretization. Since these elements can be put together in a variety of ways, they can be used to represent exceedingly complex shapes.

  6. Photoshop Elements 10 For Dummies

    CERN Document Server

    Obermeier, Barbara

    2011-01-01

    Perfect your photos and images with this "focused" guide to the latest version of Photoshop Elements For most of us, the professional-level Photoshop is overkill for our needs. Amateur photographers and photo enthusiasts turn to Photoshop Elements for a powerful but simpler way to edit and retouch their snapshots. Photoshop Elements 10 For Dummies, fully updated and revised for the latest release of this software product, helps you navigate Elements to create, edit, fix, share, and organize the high-quality images you desire. Full color pages bring the techniques to life and make taking great

  7. Trace element emissions. Literature review

    International Nuclear Information System (INIS)

    Application of fossil fuels by various utilities results in the emission of trace elements to air, water and solid waste streams. Elements present in coal are released as particles or as vapours during coal combustion or gasification. Owing to the increased consumption of coal, especially for power generation, huge quantities of potentially hazardous trace elements are released into the atmosphere every year. It is necessary to evaluate the emissions of each trace element from coal-fired combustion or gasification systems, and their effects on the environment. Present research interests should be aimed at determining the sources, concentrations, and environmental impact of trace elements related with energy generation and relevant control technologies. Two of the emerging advanced coal gasification technologies, such as integrated gasification combined cycle (IGCC) and integrated gasification fuel cell (IGFC) are presently experiencing potential difficulties due to trace element emissions. In order to control the levels of these contaminants within regulatory limits and to ensure the efficient operation of fuel cells, it is necessary to determine the type and quantity of trace elements emitted from coal gasification-based systems as a function of system, operating conditions, and type of coal. The partitioning of the trace elements is influenced by the gasification conditions. In general, the following gasification conditions are expected to influence the distribution of trace elements between various product streams. (a) reducing and oxidizing environments (b) gas phase composition, pressure and temperature. The present report was aimed at finding and identifying gaps existing in the literature on the trace element transformations during gasification. Also included in the report is the modelling of relevant transformation mechanisms of the trace elements during gasification as a function of coal type and process conditions. 7 figs., 6 tabs., 69 refs

  8. Repetitive elements in parasitic protozoa

    OpenAIRE

    Clayton Christine

    2010-01-01

    Abstract A recent paper published in BMC Genomics suggests that retrotransposition may be active in the human gut parasite Entamoeba histolytica. This adds to our knowledge of the various types of repetitive elements in parasitic protists and the potential influence of such elements on pathogenicity. See research article http://www.biomedcentral.com/1471-2164/11/321

  9. Fuel element for nuclear reactor

    International Nuclear Information System (INIS)

    In order to avoid a can box or an adjacent fuel element sitting on the spacer of a fuel element in the corner during assembly, the top and bottom edges of the outer bars of the spacers are provided with deflector bars, which have projections projecting beyond the outside of the outer bars. (orig.)

  10. Clean Elements in Abelian Rings

    Indian Academy of Sciences (India)

    Angelina Y M Chin

    2009-04-01

    Let be a ring with identity. An element in is said to be clean if it is the sum of a unit and an idempotent. is said to be clean if all of its elements are clean. If every idempotent in is central, then is said to be abelian. In this paper we obtain some conditions equivalent to being clean in an abelian ring.

  11. Stabilized Finite Elements with Matlab

    OpenAIRE

    Asensio, M. I.; A. Russo

    2002-01-01

    The purpose of this note is to explain the MATLAB code developed to solve an advection diffusion-reaction problem, with different Finite Element Methods: Standard Galerkin [7], Streamline Upwind/ Petrov-Galerkin (SUPG) [6], Unsual Stabilized [8, 9] and Residual-Free Bubbles [3, 4, 5], for both linear (P1) (see [1]) and quadratic (P2) (see [2]) triangular finite elements.

  12. Rack for nuclear fuel elements

    International Nuclear Information System (INIS)

    Disclosed is a rack for storing spent nuclear fuel elements in which a plurality of aligned rows of upright enclosures of generally square cross-sectional areas contain vertically disposed spent fuel elements. Each fuel element is supported at the lower end thereof by a respective support that rests on the floor of the spent fuel pool for a nuclear power plant. An open rack frame is employed as an upright support for the enclosures containing the spent fuel elements. Legs at the lower corners of the frame rest on the floor of the pool to support the frame. In one exemplary embodiment, the support for the fuel element is in the form of a base on which a fuel element rests and the base is supported by legs. In another exemplary embodiment, each fuel element is supported on the pool floor by a self-adjusting support in the form of a base on which a fuel element rests and the base rests on a ball or swivel joint for self-alignment. The lower four corners of the frame are supported by legs adjustable in height for leveling the frame. Each adjustable frame leg is in the form of a base resting on the pool floor and the base supports a threaded post. The threaded post adjustably engages a threaded column on which rests the lower end of the frame. 16 claims, 14 figures

  13. Solution of Finite Element Equations

    DEFF Research Database (Denmark)

    Krenk, Steen

    An important step in solving any problem by the finite element method is the solution of the global equations. Numerical solution of linear equations is a subject covered in most courses in numerical analysis. However, the equations encountered in most finite element applications have some special...

  14. Repetitive elements in parasitic protozoa

    Directory of Open Access Journals (Sweden)

    Clayton Christine

    2010-05-01

    Full Text Available Abstract A recent paper published in BMC Genomics suggests that retrotransposition may be active in the human gut parasite Entamoeba histolytica. This adds to our knowledge of the various types of repetitive elements in parasitic protists and the potential influence of such elements on pathogenicity. See research article http://www.biomedcentral.com/1471-2164/11/321

  15. Trace element speciation in man

    International Nuclear Information System (INIS)

    The toxicological properties associated with an element depend upon its chemical form since this will dictate the metabolic pathway that the compound follows in the body. The speciation of the element is determinant for its physiological behaviour in a living system. The complicated interactions of the different forms of trace elements in human metabolism were reviewed and the species present were categorised into seven groups. The complexity of the tasks involved in a study of trace element speciation in man was illustrated and many of the pitfalls were identified together with an example of the detective approach that must be followed to elucidate the intricacies of the associations between trace elements and biomolecular moieties

  16. Massively Parallel Finite Element Programming

    KAUST Repository

    Heister, Timo

    2010-01-01

    Today\\'s large finite element simulations require parallel algorithms to scale on clusters with thousands or tens of thousands of processor cores. We present data structures and algorithms to take advantage of the power of high performance computers in generic finite element codes. Existing generic finite element libraries often restrict the parallelization to parallel linear algebra routines. This is a limiting factor when solving on more than a few hundreds of cores. We describe routines for distributed storage of all major components coupled with efficient, scalable algorithms. We give an overview of our effort to enable the modern and generic finite element library deal.II to take advantage of the power of large clusters. In particular, we describe the construction of a distributed mesh and develop algorithms to fully parallelize the finite element calculation. Numerical results demonstrate good scalability. © 2010 Springer-Verlag.

  17. Repetitive genome elements in a European corn borer, Ostrinia nubilalis, bacterial artificial chromosome library were indicated by bacterial artificial chromosome end sequencing and development of sequence tag site markers: implications for lepidopteran genomic research.

    Science.gov (United States)

    Coates, Brad S; Sumerford, Douglas V; Hellmich, Richard L; Lewis, Leslie C

    2009-01-01

    The European corn borer, Ostrinia nubilalis, is a serious pest of food, fiber, and biofuel crops in Europe, North America, and Asia and a model system for insect olfaction and speciation. A bacterial artificial chromosome library constructed for O. nubilalis contains 36 864 clones with an estimated average insert size of >or=120 kb and genome coverage of 8.8-fold. Screening OnB1 clones comprising approximately 2.76 genome equivalents determined the physical position of 24 sequence tag site markers, including markers linked to ecologically important and Bacillus thuringiensis toxin resistance traits. OnB1 bacterial artificial chromosome end sequence reads (GenBank dbGSS accessions ET217010 to ET217273) showed homology to annotated genes or expressed sequence tags and identified repetitive genome elements, O. nubilalis miniature subterminal inverted repeat transposable elements (OnMITE01 and OnMITE02), and ezi-like long interspersed nuclear elements. Mobility of OnMITE01 was demonstrated by the presence or absence in O. nubilalis of introns at two different loci. A (GTCT)n tetranucleotide repeat at the 5' ends of OnMITE01 and OnMITE02 are evidence for transposon-mediated movement of lepidopteran microsatellite loci. The number of repetitive elements in lepidopteran genomes will affect genome assembly and marker development. Single-locus sequence tag site markers described here have downstream application for integration within linkage maps and comparative genomic studies. PMID:19132072

  18. Chemistry of the heaviest elements

    International Nuclear Information System (INIS)

    Studies of the chemical properties of the elements at the uppermost end of the periodic table are discussed. Some historical perspective is given, but major emphasis is on recent studies. Isotopes of these elements are short-lived and, therefore, must be studied near the site of production. They must be produced with charged-particle beams at accelerators rather than via neutron capture. The use of radioactive heavy actinide targets is often required and the number of atoms produced is so small that any chemistry to be performed must be done on an ''atom-at-a-time'' basis. Furthermore, a knowledge of their nuclear properties is required in order to identify and detect them. To date, both gas and aqueous phase properties of elements as heavy as element 104 (rutherfordium) and element 105 (hahnium) have been investigated, even though their longest-lived known isotopes have half-lives of only 65 and 35 seconds, respectively. The experimental results show that their chemical properties cannot be simply extrapolated from the known properties of their lighter homologs in the periodic table, emphasizing the importance of obtaining additional experimental information for the heaviest elements to compare with predictions and help assess the influence of relativistic effects. The feasibility of the extension of chemical studies to still heavier elements is also discussed. (orig.)

  19. Higher-Order Finite Element Modeling with Curvilinear Elements

    Czech Academy of Sciences Publication Activity Database

    Karban, P.; Mach, F.; Doležel, Ivo

    Gliwice : Silesian University of Technology, 2011, s. 5-6. ISBN 978-83-85940-33-3. [INTERNATIONAL CONFERENCE ON FUNDAMENTALS OF ELECTROTECHNICS AND CIRCUIT THEORY /34./. Ustroň (PL), 18.05.2011-21.05.2011] R&D Projects: GA ČR(CZ) GAP102/11/0498 Institutional research plan: CEZ:AV0Z20570509 Keywords : automatic adaptivity * higher-order finite element method * curvilinear elements Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering

  20. First identification of Tn916-like element in industrial strains of Lactobacillus vini that spread the tet-M resistance gene.

    Science.gov (United States)

    Mendonça, Allyson Andrade; de Lucena, Brigida Thais Luckwu; de Morais, Márcia Maria Camargo; de Morais, Marcos Antonio

    2016-02-01

    The open process used to ferment sugar cane juice or molasses to produce ethanol fuel is prone to contamination by bacterial cells of different species, in particular Lactobacilli. The situation can be exacerbated by the emergence of resistant cells to industrial antibiotics that are normally used to combat this contamination. In this work, two Lactobacillus vini isolates from ethanol distilleries were identified and found to be resistant to doxycycline, a tetracycline derivative, although sensitive to other antibiotics tested. The identification of these isolates was confirmed by sequencing the pheS gene and their clonal origin was shown by PCR-fingerprinting analysis. Moreover, the isolates were shown to carry the transposable element Tn916 that harboured the tet-M gene. Furthermore, conjugation experiments showed that both isolates were capable of transferring this element, and as a result, the tet-M gene, to Enterococcus faecalis reference strain. Finally, the identification of tetracycline resistance in the same distilleries in other Lactobacilli, suggested that inter-species transfer of antibiotic resistance may be occurring in the industrial environment, and thus impairing the efficiency of the antibiotic treatment and causing serious health concerns. PMID:26722009

  1. Increased burnup of fuel elements

    International Nuclear Information System (INIS)

    The specialists' group for fuel elements of the Kerntechnische Gesellschaft e.V. held a meeting on ''Increased Burnup of Fuel Elements'' on 9th and 10th of November 1982 at the GKSS Research Center Geesthacht. Most papers dealt with the problems of burnup increase of fuel elements for light water reactors with respect to fuel manufacturing, power plant operation and reprocessing. Review papers were given on the burnup limits for high temperature gas cooled reactors and sodium fast breeder reactors. The meeting ended with a presentation of the technical equipment of the hot laboratory of the GKSS and the programs which are in progress there. (orig.)

  2. Packing element of a packer

    Energy Technology Data Exchange (ETDEWEB)

    Safin, V.A.

    1982-01-01

    The packing element of a packer is proposed which consists of an elastic core and outer layer made of plastic sealing material. It is distinguished by the fact that in order to facilitate removal of the packing element from the site of installation, the outer layer has a sublayer made of polymer material which is chemically inactive in relationship to the material of the core, for example polytetrafluoroethylene. The element is also distinguished by the fact that the outer layer together with the sublayer is attached to the core through a nonhardening and nondrying glue composition, for example, based on rubber, rosin, lanolin, vaseline oil and zinc oxide.

  3. Spacer for a fuel element

    International Nuclear Information System (INIS)

    Spacers for fuel pins arranged to form congish fuel elements can be shaped as plates with openings in accordance with the fuel pin grid. Such a plate that covers the cross section of a fuel element consists according to the invention of at least two parts that are offset in the fuel element's longitudinal direction and joint hinge-like in at least one grid position. Thus, one has smaller parts that are easier to work on with due accuracy. The invention is designed in particular for breeder reactors and high-conversion reactors. (orig.)

  4. Finite element computational fluid mechanics

    Science.gov (United States)

    Baker, A. J.

    1983-01-01

    Finite element analysis as applied to the broad spectrum of computational fluid mechanics is analyzed. The finite element solution methodology is derived, developed, and applied directly to the differential equation systems governing classes of problems in fluid mechanics. The heat conduction equation is used to reveal the essence and elegance of finite element theory, including higher order accuracy and convergence. The algorithm is extended to the pervasive nonlinearity of the Navier-Stokes equations. A specific fluid mechanics problem class is analyzed with an even mix of theory and applications, including turbulence closure and the solution of turbulent flows.

  5. Photoshop Elements 9 Digital Classroom

    CERN Document Server

    Team, AGI Creative

    2011-01-01

    Learn Photoshop Elements at your own pace with this unique book-and-DVD training packagePhotoshop Elements is the leading image-editing software, and this personal training course uses a full-color book plus video tutorials on the DVD to teach you how to use all its features. Each of the 13 lessons is presented with step-by-step instructions and includes lesson files and a video explanation of the concepts. You can learn from leading instructors, and do it at your own pace.Photoshop Elements provides professional quality image-editing tools at an affordable price; this book-and-DVD package off

  6. Essential Elements of Geologic Reports.

    Science.gov (United States)

    Webb, Elmer James

    1988-01-01

    Described is a report outline for geologic reports. Essential elements include title; abstract; introduction; stratigraphy; petrography; geochemistry; petrology; geophysics; structural geology; geologic history; modeling; economics; conclusions; and recommendations. (Author/CW)

  7. Finite element methods for engineers

    CERN Document Server

    Fenner, Roger T

    2013-01-01

    This book is intended as a textbook providing a deliberately simple introduction to finite element methods in a way that should be readily understandable to engineers, both students and practising professionals. Only the very simplest elements are considered, mainly two dimensional three-noded “constant strain triangles”, with simple linear variation of the relevant variables. Chapters of the book deal with structural problems (beams), classification of a broad range of engineering into harmonic and biharmonic types, finite element analysis of harmonic problems, and finite element analysis of biharmonic problems (plane stress and plane strain). Full Fortran programs are listed and explained in detail, and a range of practical problems solved in the text. Despite being somewhat unfashionable for general programming purposes, the Fortran language remains very widely used in engineering. The programs listed, which were originally developed for use on mainframe computers, have been thoroughly updated for use ...

  8. Environmental research on actinide elements

    International Nuclear Information System (INIS)

    The papers synthesize the results of research sponsored by DOE's Office of Health and Environmental Research on the behavior of transuranic and actinide elements in the environment. Separate abstracts have been prepared for the 21 individual papers

  9. In situ trace element microanalysis

    Science.gov (United States)

    Burnett, D. S.; Woolum, D. S.

    1983-01-01

    The use of particle-track-radiography and X-ray- fluorescence techniques in the in situ measurement of trace (less than 1000 ppm) elements in single mineral phases of polished sections is surveyed, and examples of their application to ordinary, carbonaceous and enstatite chondrites are provided. Radiographic methods surveyed include fission-track radiography (for U, Th, and Pu-244), alpha radiography using nuclear reactions (for Li and B), alpha autoradiography (for Bi and Pb), and beta autoradiography (for several elements in synthetic or biological samples). Two X-ray-fluorescence methods are compared: (1) photon-induced X-ray emission (PIXE), and (2) the potential use of synchrotron radiation. The latter is shown to allow much greater sensitivity than current PIXE technology and a much broader range of elements than particle-track radiography: the ppm analysis of 10-micron grains for all elements heavier than Na. These advantages are seen as balancing the high cost of accelerator use.

  10. Elemental ABAREX -- a user's manual

    International Nuclear Information System (INIS)

    ELEMENTAL ABAREX is an extended version of the spherical optical-statistical model code ABAREX, designed for the interpretation of neutron interactions with elemental targets consisting of up to ten isotopes. The contributions from each of the isotopes of the element are explicitly dealt with, and combined for comparison with the elemental observables. Calculations and statistical fitting of experimental data are considered. The code is written in FORTRAN-77 and arranged for use on the IBM-compatible personal computer (PC), but it should operate effectively on a number of other systems, particularly VAX/VMS and IBM work stations. Effort is taken to make the code user friendly. With this document a reasonably skilled individual should become fluent with the use of the code in a brief period of time

  11. Web engineering security: essential elements

    OpenAIRE

    Glisson, W.B.; Welland, R.

    2007-01-01

    Security is an elusive target in today’s high-speed and extremely complex, Web enabled, information rich business environment. This paper presents the idea that there are essential, basic organizational elements that need to be identified, defined and addressed before examining security aspects of a Web Engineering Development process. These elements are derived from empirical evidence based on a Web survey and supporting literature. This paper makes two contributions. The first contribution ...

  12. Elemental mercury exposure: peripheral neurotoxicity.

    OpenAIRE

    Levine, S P; Cavender, G D; Langolf, G D; Albers, J W

    1982-01-01

    Nerve conduction tests were performed on the right ulnar nerve of factory workers exposed to elemental mercury vapour. Time integrated urine mercury indices were used to measure the degree of exposure. Workers with prolonged distal latencies had significantly higher urine mercury concentrations when compared with those with normal latencies. Significant correlations between increasing urine mercury concentrations and prolonged motor and sensory distal latencies were established. Elemental mer...

  13. Nuclear reactor fuel element splitter

    International Nuclear Information System (INIS)

    A method and apparatus are disclosed for removing nuclear fuel from a clad fuel element. The fuel element is power driven past laser beams which simultaneously cut the cladding lengthwise into at least two longitudinal pieces. The axially cut lengths of cladding are then separated, causing the nuclear fuel contained therein to drop into a receptacle for later disposition. The cut lengths of cladding comprise nuclear waste which is disposed of in a suitable manner. 6 claims, 10 drawing figures

  14. Organisms and Elements. Survey Paper

    International Nuclear Information System (INIS)

    An attempt is made in this paper to fit the subject matter of the Symposium within a general biological framework. With this in view the following points are considered. Living organisms are autonomously functioning complex units, whose basic structures are macromolecules (proteins, lipids, carbohydrates, nucleic acids) composed of only a few elements (C, H, O, N, S, P). However, the study of the life processes has increasingly shown that a considerable number of additional elements are of importance for many vital functions. Depending on differences in their ability to synthesize complex molecules, the organisms must continuously assimilate a greater or smaller variety of molecular and elemental constituents from their environments. Thus a complex network comprising many energy, food, and element chains exists in the biosphere. Living organisms are distributed among a variety of biotopes which differ greatly from each other (sea, brackish water, freshwater, land, air). Their basic food and energy requirements in these environments are reflected in their primary structures and ways of life (e. g. sessility, mobility). Furthermore, in many organisms, special external and internal pumps and other homeostatic mechanisms (hormones) exist which serve a special purpose in relation to particular elements in their environments. In those organisms which have, in the past, migrated from one main biotope to another, such a factor in their origin and development may be betrayed by their elemental compositions. Living organisms, therefore, form a unity with their non-living milieu. They are the living part of the elemental pool at the surface of this planet. A careful study of the elements present in the organisms - not just a descriptive study but rather a physiological one - is of fundamental importance for biology. (author)

  15. PROPOSAL OF NEW OPTICAL ELEMENTS

    Directory of Open Access Journals (Sweden)

    Goce Chadzitaskos

    2013-10-01

    Full Text Available A overview of our patented proposals of new optical elements is presented. The elements are suitable for laser pulse analysis, telescopy, X-ray microscopy and X-ray telescopy. They are based on the interference properties of light: a special grating for a double slit pattern, parabolic strip imaging for a telescope, and Bragg’s condition for X-ray scattering on a slice of a single crystal for X-raymicroscopy and X-ray telescopy.

  16. Sortable elements and Cambrian lattices

    OpenAIRE

    Reading, Nathan

    2005-01-01

    We show that the Coxeter-sortable elements in a finite Coxeter group W are the minimal congruence-class representatives of a lattice congruence of the weak order on W. We identify this congruence as the Cambrian congruence on W, so that the Cambrian lattice is the weak order on Coxeter-sortable elements. These results exhibit W-Catalan combinatorics arising in the context of the lattice theory of the weak order on W.

  17. Chemistry of the transactinide elements

    International Nuclear Information System (INIS)

    The experimentally known chemical properties of the transactinide elements 104 and 105, and the experimental techniques used to study these properties on an atom-at-a-time base, are reviewed. The production of transactinides in heavy ion reactions and the specific aspects of chemical separations with single atoms is briefly discussed. The chemical properties of the first two transactinide elements are compared with the lighter element homologs in group 4 and 5 of the Periodic Table and with the expected behaviour obtained from most recent atomic and molecular calculations which take the increasingly strong relativistic effect into account. Elements 104 and 105 behave as transactinide elements and, in general, exhibit properties characteristic of their position in group 4 and 5 of the Periodic Table. However, surprising deviations of the chemical properties from expectations based on simple extrapolations have been observed. It is shown that the chemical properties of the heaviest elements cannot reliably be predicted by simple extrapolations. Prospects to extend our chemical knowledge at the top end of the Periodic Table are discussed. (orig.)

  18. ANSYS duplicate finite-element checker routine

    Science.gov (United States)

    Ortega, R.

    1995-01-01

    An ANSYS finite-element code routine to check for duplicated elements within the volume of a three-dimensional (3D) finite-element mesh was developed. The routine developed is used for checking floating elements within a mesh, identically duplicated elements, and intersecting elements with a common face. A space shuttle main engine alternate turbopump development high pressure oxidizer turbopump finite-element model check using the developed subroutine is discussed. Finally, recommendations are provided for duplicate element checking of 3D finite-element models.

  19. New elements - approaching Z=114

    International Nuclear Information System (INIS)

    The search for new elements is part of the broader field of investigations of nuclei at the limits of stability. In two series of experiments at SHIP, six new elements (Z=107-112) were synthesized via fusion reactions using 1n-deexcitation channels and lead or bismuth targets. The isotopes were unambiguously identified by means of α-α correlations. Not fission, but alpha decay is the dominant decay mode. The collected decay data establish a means of comparison with theoretical data. This aids in the selection of appropriate models that describe the properties of known nuclei. Predictions based on these models are useful in the preparation of the next generation of experiments. Cross-sections decrease by two orders of magnitude from bohrium (Z=107) to element 112, for which a cross-section of 1 pb was measured. The development of intense beam currents and sensitive detection methods is essential for the production and identification of still heavier elements and new isotopes of already known elements, as well as the measurement of small α-, β- and fission-branching ratios. An equally sensitive set-up is needed for the measurement of excitation functions at low cross-sections. Based on our results, it is likely that the production of isotopes of element 114 close to the island of spherical super heavy elements (SHE) could be achieved by fusion reactions using 208Pb targets. Systematic studies of the reaction cross-sections indicate that the transfer of nucleons is an important process for the initiation of fusion. The data allow for the fixing of a narrow energy window for the production of SHE using 1n-emission channels. (orig.)

  20. New elements - approaching Z=114

    Energy Technology Data Exchange (ETDEWEB)

    Hofmann, S.

    1998-03-01

    The search for new elements is part of the broader field of investigations of nuclei at the limits of stability. In two series of experiments at SHIP, six new elements (Z=107-112) were synthesized via fusion reactions using 1n-deexcitation channels and lead or bismuth targets. The isotopes were unambiguously identified by means of {alpha}-{alpha} correlations. Not fission, but alpha decay is the dominant decay mode. The collected decay data establish a means of comparison with theoretical data. This aids in the selection of appropriate models that describe the properties of known nuclei. Predictions based on these models are useful in the preparation of the next generation of experiments. Cross-sections decrease by two orders of magnitude from bohrium (Z=107) to element 112, for which a cross-section of 1 pb was measured. The development of intense beam currents and sensitive detection methods is essential for the production and identification of still heavier elements and new isotopes of already known elements, as well as the measurement of small {alpha}-, {beta}- and fission-branching ratios. An equally sensitive set-up is needed for the measurement of excitation functions at low cross-sections. Based on our results, it is likely that the production of isotopes of element 114 close to the island of spherical super heavy elements (SHE) could be achieved by fusion reactions using {sup 208}Pb targets. Systematic studies of the reaction cross-sections indicate that the transfer of nucleons is an important process for the initiation of fusion. The data allow for the fixing of a narrow energy window for the production of SHE using 1n-emission channels. (orig.)

  1. New elements - approaching Z = 114

    International Nuclear Information System (INIS)

    The search for new elements is part of the broader field of investigations of nuclei at the limits of stability. In two series of experiments at SHIP, six new elements (Z = 107-112) were synthesized via fusion reactions using 1n-deexcitation channels and lead or bismuth targets. The isotopes were unambiguously identified by means of α-α correlations. Alpha decay, not fission, is the dominant decay mode. The collected decay data establish a means of comparison with theoretical data. This aids in the selection of appropriate models that describe the properties of known nuclei. Predictions based on these models are useful in the preparation of the next generation of experiments. Cross sections decrease by two orders of magnitude from bohrium (Z = 107) to element 112, for which a cross section of 1 pb was measured. The development of intense beam currents and sensitive detection methods is essential for the production and identification of still heavier elements and new isotopes of already known elements, as well as the measurement of small α-, β- and fission-branching ratios. An equally sensitive set-up is needed for the measurement of excitation functions at low cross sections. Based on our results, it is likely that the production of isotopes of element 114 close to the island of spherical superheavy elements (SHEs) could be achieved by fusion reactions using 208Pb targets. Systematic studies of the reaction cross sections indicate that the transfer of nucleons is an important process for the initiation of fusion. The data allow for the fixing of a narrow energy window for the production of SHEs using 1n-emission channels. The likelihood of broadening the energy window by investigation of radiative capture reactions, use of neutron deficient projectile isotopes and use of actinide targets is discussed. (author)

  2. Brain trace elements and aging

    International Nuclear Information System (INIS)

    Degenerative mechanisms involved in the aging process of the brain are to a certain extent counteracted by repair mechanisms. In both degenerative and recovery processes, trace elements are involved. The present study focused on the role of two minor (i.e., K and Ca) and six trace elements (i.e., Mn, Fe, Cu, Zn, Se and Rb) in the aging process. The elements were determined by PIXE in cerebral cortex and white matter, basal ganglia, brainstem and cerebellar cortex of 18 postmortem human brains, from persons without a history of neurologic or psychiatric disease who deceased between the age of 7 and 79. This age range allowed us to study the relationship between elemental concentrations and age. The most prominent findings were a concentration decrease for K and Rb and a concentration increase for the elements Ca, Fe, Zn and Se. The study supports recent findings that Ca and Fe are involved in brain degenerative processes initiated by oxygen free radicals, whereas Zn and Se are involved in immunological reactions counteracting the aging process

  3. Novel RSFQ elements and devices

    International Nuclear Information System (INIS)

    A new generation of the Josephson digital circuits - Rapid Single Flux Quantum (RSFQ) devices - have been introduced and experimentally investigated. The information in RSFQ-logic is carried by Single magnetic Flux Quanta (SFQ). The basic principle of operation of RSFQ elements lies in controlling SFQ in complex structures of Josephson junction arrays. DC powered RSFQ elements differ radically from latching family by much higher clock frequency up to 100 GHz. New RSFQ elements, which are necessary for practical application have been designed, fabricated and experimentally investigated. All refractory Nb-AlOx-Nb overdamped junctions (βc≤1, jc∼103A/cm2) have been successfully employed for fabrication of RSFQ microcircuits. Four-bit Flash type Analog to Digital converter (ADC) has been suggested, designed and tested. The DC/SFQ converter of information from potential into SFQ form as well as comparators and SFQ/DC converters for asynchronous readout were implemented. The RSFQ version of Flash type ADC surpasses traditional latching one for the next reasons: 1) DC powering; 2) asynchronous readout; 3) readout elements are allocated outside of comparator; 4) internal frequency of elements is higher than 50GHz. Latching logic to RSFQ converter has been fabricated, tested and used for DC/SFQ input current level stabilization. (orig.)

  4. Spectral element simulation of ultrafiltration

    DEFF Research Database (Denmark)

    Hansen, M.; Barker, Vincent A.; Hassager, Ole

    1998-01-01

    vector in the transport equation, the system is coupled by the dependency of the fluid viscosity on the solute concentration and by a concentration-dependent boundary condition for the Navier-Stokes equations at the membrane surface. The spectral element discretization yields a nonlinear algebraic system......A spectral element method for simulating stationary 2-D ultrafiltration is presented. The mathematical model is comprised of the Navier-Stokes equations for the velocity field of the fluid and a transport equation for the concentration of the solute. In addition to the presence of the velocity....... The performance of the spectral element code when applied to several ultrafiltration problems is reported. (C) 1998 Elsevier Science Ltd. All rights reserved....

  5. Element profiles of mouse hair

    International Nuclear Information System (INIS)

    Element profile patterns of growth and nongrowth phase hair were obtained for the C57L/J male mouse using a proton microprobe. Growth phase hair profiles of Cl, S, K and P show that these elements are concentrating in regions of higher pigmentation. Calcium is restricted to the medulla region in the hair shaft. For nongrowth phase hair, the profiles of Cl and S are essentially unchanged, whereas K and P are depleted in the hair shaft and are concentrating in the cornified root sheath. The element patterns found for the nongrowth phase profiles of mouse hair show striking similarities to previously reported patterns for growth profiles of human hair. (author) 10 refs.; 4 figs

  6. Mechanical Analogies of Fractional Elements

    Institute of Scientific and Technical Information of China (English)

    HU Kai-Xin; ZHU Ke-Qin

    2009-01-01

    A Fractional element model describes a special kind of viscoelastic material.Its stress is proportional to the fractional-order derivative of strain. Physically the mechanical analogies of fractional elements can be represented by spring-dashpot fractal networks. We introduce a constitutive operator in the constitutive equations of viscoelastic materials.To derive constitutive operators for spring-dashpot fractal networks, we use Heaviside operational calculus, which provides explicit answers not otherwise obtainable simply.Then the series-parallel formulas for the constitutive operator are derived. Using these formulas, a constitutive equation of fractional element with 1/2-order derivative is obtained.Finally we find the way to derive the constitutive equations with other fractional-order derivatives and their mechanical analogies.

  7. An external drag measuring element

    Science.gov (United States)

    Ringel, Mordechai; Levin, Daniel; Seginer, Arnan

    The accurate measurement of the axial-force component acting on small wind-tunnel models has traditionally made use of integral string balances, which eliminated many accuracy problems, such as friction and hysteresis, but also introduced interactions between the various force and moment sensing elements due to nonlinear elastic phenomena. The reduction of these interactions usually calls for complicated designs, expensive manufacturing, hard-to-handle calibration processes, and cumbersome data reduction programs. An approach is presented that is based on an external axial-force-measuring element and avoids the ill-conditioned design problems of integral balances. Other difficulties that are encountered, such as friction, misalignment, and relative motion between metric elements are considered, and their solution is examined. Calibration and test results show that the new approach duplicates and surpasses the results of much more complicated and expensive integral balances.

  8. The age of the elements

    International Nuclear Information System (INIS)

    The paper is devoted to nuclear cosmochronology. The age of the Universe is estimated with the aid of radioactive nuclear-nuclear chronometers (NC). For calculations it is required that the proportion in which the appropriate pair of NC is at present ('relative abundance') and the proportion for the moment of their formation ('relative production') should be known. A short description is given of production of elements in the process of star evolution. The 'relative production' is calculated theoretically. The relative abundance is determined from experiments, mainly from meteorites. Recentl Lunar rocks have been also coming into use. The following elements are chosen as pairs of chronometers: Th-232/U-238; U-235/U-238; Pu-244/Th-232; J-129/J-127. Using this method the authors have determined the age of elements from 7 to 15 billion years, the best estimate being approximately 10 billion years. This age is quite in an agreement with calculations made by other methods

  9. Regeneration method for filter element

    International Nuclear Information System (INIS)

    The outer surface of a filter element used for treating exhaust gases from an incinerator is divided into a plurality of zones. A back-washing for the filter is conducted in a container by using pressurized air in a state of leaving a certain zone unsealed. Then, the unsealed zone is displaced and back-washing is applied in the same manner. With such procedures, clogged materials which could not be removed by the existent method of simultaneously back-washing the entire filter element can certainly be removed. Further, according to the present invention, the clogged materials removed from the filter element are not discharged to the outside, but prevented from flowing out of the system. (T.M.)

  10. Trace element analysis in flour

    International Nuclear Information System (INIS)

    Trace elements in five kinds of flour which were made in Japan, America and Canada, have been measured by means of in-air PIXE. Twelve kinds of trace elements were detected, such as Cl, K, Ca, Sc, Cr, Mn, Fe, Co, Ni, Cu, Zn and Br. The concentration of these elements varied depending on the place where they were made. In order to check the target preparation procedure, two types of sample preparation have been used, such as wet ashing by nitric acid in a microwave oven and making a paste by an internal standard solution. Comparisons of the results of both samples ensures that bromine was not lost during micro-wave oven heating. Analytic fitting of PIXE spectra by a personal computer and a commercial application software was successfully used. (author)

  11. Marine oligotrophy and element biogeochemistry

    International Nuclear Information System (INIS)

    A biogeochemical model has been developed that explains the inverse and non-linear relationship between Po-210 concentration in zooplankton and their biomass, under oligotrophic conditions in French Polynesia. This study identified other elements with comparable accumulatory behaviours to Po-210 in phytoplankton, seston and zooplankton, that are proposed to be critical to its enhanced environmental levels under oligotrophy. Field investigation in the Gulf of Papua showed that four of these a priori identified elements viz Cd, Co, Pb and Mn, as well as Cr and Ni, showed elevated water concentrations with reduced biological productivity, results that are consistent with those previously obtained for Po-210 and the proposed explanatory model. These findings point to the enhanced susceptibility of oligotrophic systems to contamination from particle-reactive elements. (author)

  12. New elements - approaching Z = 114

    Energy Technology Data Exchange (ETDEWEB)

    Hofmann, S. [Gesellschaft fuer Schwerionenforschung (GSI), Darmstadt (Germany)

    1998-06-01

    The search for new elements is part of the broader field of investigations of nuclei at the limits of stability. In two series of experiments at SHIP, six new elements (Z = 107-112) were synthesized via fusion reactions using 1n-deexcitation channels and lead or bismuth targets. The isotopes were unambiguously identified by means of {alpha}-{alpha} correlations. Alpha decay, not fission, is the dominant decay mode. The collected decay data establish a means of comparison with theoretical data. This aids in the selection of appropriate models that describe the properties of known nuclei. Predictions based on these models are useful in the preparation of the next generation of experiments. Cross sections decrease by two orders of magnitude from bohrium (Z = 107) to element 112, for which a cross section of 1 pb was measured. The development of intense beam currents and sensitive detection methods is essential for the production and identification of still heavierelements and new isotopes of already known elements, as well as the measurement of small {alpha}-, {beta}- and fission-branching ratios. An equally sensitive set-up is needed for the measurement of excitation functions at low cross sections. Based on our results, it is likely that the production of isotopes of element 114 close to the island of spherical superheavy elements (SHEs) could be achieved by fusion reactions using {sup 208}Pb targets. Systematic studies of the reaction cross sections indicate that the transfer of nucleons is an important process for the initiation of fusion. The data allow for the fixing of a narrow energy window for the production of SHEs using 1n-emission channels. The likelihood of broadening the energy window by investigation of radiative capture reactions, use of neutron deficient projectile isotopes and use of actinide targets is discussed. (author)

  13. Elements to diminish radioactive accidents

    International Nuclear Information System (INIS)

    In this work it is presented an application of the cause-effect diagram method or Ichikawa method identifying the elements that allow to diminish accidents when the radioactive materials are transported. It is considered the transport of hazardous materials which include radioactive materials in the period: December 1996 until March 1997. Among the identified elements by this method it is possible to mention: the road type, the radioactive source protection, the grade driver responsibility and the preparation that the OEP has in the radioactive material management. It is showed the differences found between the country inner roads and the Mexico City area. (Author)

  14. Multiphoton spectroscopy in heavy elements

    Energy Technology Data Exchange (ETDEWEB)

    Solarz, R.W.; Paisner, J.A.; Worden, E.F.

    1977-05-03

    Some recently discovered regularities in the spectra of heavy elements which are also applicable to the analysis of the spectra of lighter atoms are described. It is pointed out that stepwise resonant multiphoton methods are irreplaceable tools in the study of high lying states in a complex atomic system. Systematic applications of these methods has permitted regularities to be observed which also hold for the lighter elements. It is noted that greatly increased understanding of the excited state structure of heavy atoms is not possible. 8 references. (JFP)

  15. Elements of spatial data quality

    CERN Document Server

    Guptill, SC

    1995-01-01

    Elements of Spatial Data Quality outlines the need and suggests potential categories for the content of a comprehensive statement of data quality that must be imbedded in the metadata that accompanies the transfer of a digital spatial data file or is available in a separate metadata catalog. Members of the International Cartographic Association's Commission on Spatial Data Quality have identified seven elements of data quality: positional accuracy, attribute accuracy, completeness, logical consistency, lineage, semantic accuracy and temporal information. In the book the authors describe: compo

  16. Elemental mercury exposure: peripheral neurotoxicity

    Energy Technology Data Exchange (ETDEWEB)

    Levine, S.P.; Cavender, G.D.; Langolf, G.D.; Albers, J.W.

    1982-05-01

    Nerve conduction tests were performed on the right ulnar nerve of factory workers exposed to elemental mercury vapour. Time integrated urine mercury indices were used to measure the degree of exposure. Workers with prolonged distal latencies had significantly higher urine mercury concentrations when compared with those with normal latencies. Significant correlations between increasing urine mercury concentrations and prolonged motor and sensory distal latencies were established. Elemental mercury can affect both motor and sensory peripheral nerve conduction and the degree of involvement may be related to time-integrated urine mercury concentrations.

  17. Staggered weak matrix element miscellany

    International Nuclear Information System (INIS)

    I report on work, done with Rajan Gupta and Greg Kilcup, using staggered fermions to study weak matrix elements in quenched QCD. I give an update on the ΔI = 1/2 rule on matrix elements relevant for ε'. I show results of a study of the dependence of BK on non-leading terms in the chiral expansion. I present our results for BK from quenched calculation at β = 6.4 on 323 x 48 lattices, based on ensemble of 12 configurations. 15 refs., 5 figs

  18. Finite elements of nonlinear continua

    CERN Document Server

    Oden, J T

    2000-01-01

    Geared toward undergraduate and graduate students, this text extends applications of the finite element method from linear problems in elastic structures to a broad class of practical, nonlinear problems in continuum mechanics. It treats both theory and applications from a general and unifying point of view.The text reviews the thermomechanical principles of continuous media and the properties of the finite element method, and then brings them together to produce discrete physical models of nonlinear continua. The mathematical properties of these models are analyzed, along with the numerical s

  19. Nuclear fuel elements design, fabrication and performance

    CERN Document Server

    Frost, Brian R T

    1982-01-01

    Nuclear Fuel Elements: Design, Fabrication and Performance is concerned with the design, fabrication, and performance of nuclear fuel elements, with emphasis on fast reactor fuel elements. Topics range from fuel types and the irradiation behavior of fuels to cladding and duct materials, fuel element design and modeling, fuel element performance testing and qualification, and the performance of water reactor fuels. Fast reactor fuel elements, research and test reactor fuel elements, and unconventional fuel elements are also covered. This volume consists of 12 chapters and begins with an overvie

  20. Fuel element database: developer handbook

    International Nuclear Information System (INIS)

    The fuel elements database which was developed for Atomic Institute of the Austrian Universities is described. The software uses standards like HTML, PHP and SQL. For the standard installation freely available software packages such as MySQL database or the PHP interpreter from Apache Software Foundation and Java Script were used. (nevyjel)

  1. New elements produced at GSI

    Science.gov (United States)

    Hofmann, Sigurd

    1998-12-01

    In two series of experiments at SHIP, six new elements (Z=107-112) were synthesized via fusion reactions using lead or bismuth targets and 1n-deexcitation channels. The isotopes were unambiguously identified by means of α-α correlations. Not fission, but alpha decay is the dominant decay mode. Cross-sections decrease by two orders of magnitude from bohrium (Z=107) to element 112, for which a cross-section of 1 pb was measured. Based on our results, it is likely that the production of isotopes of element 114 close to the island of spherical SuperHeavy Elements (SHE) could be achieved by fusion reactions using 208Pb targets. Systematic studies of the reaction cross-sections indicate that the transfer of nucleons is an important process for the initiation of fusion. The data allow for the fixing of a narrow energy window for the production of SHE using 1n-emission channels. The likelihood of broadening the energy window by investigation of radiative capture reactions, use of neutron deficient projectile isotopes and use of actinide targets is discussed.

  2. New elements produced at GSI

    International Nuclear Information System (INIS)

    In two series of experiments at SHIP, six new elements (Z=107-112) were synthesized via fusion reactions using lead or bismuth targets and 1n-deexcitation channels. The isotopes were unambiguously identified by means of α-α correlations. Not fission, but alpha decay is the dominant decay mode. Cross-sections decrease by two orders of magnitude from bohrium (Z=107) to element 112, for which a cross-section of 1 pb was measured. Based on our results, it is likely that the production of isotopes of element 114 close to the island of spherical SuperHeavy Elements (SHE) could be achieved by fusion reactions using 208Pb targets. Systematic studies of the reaction cross-sections indicate that the transfer of nucleons is an important process for the initiation of fusion. The data allow for the fixing of a narrow energy window for the production of SHE using 1n-emission channels. The likelihood of broadening the energy window by investigation of radiative capture reactions, use of neutron deficient projectile isotopes and use of actinide targets is discussed

  3. Compact Fuel Element Environment Test

    Science.gov (United States)

    Bradley, D. E.; Mireles, O. R.; Hickman, R. R.; Broadway, J. W.

    2012-01-01

    Deep space missions with large payloads require high specific impulse (I(sub sp)) and relatively high thrust to achieve mission goals in reasonable time frames. Conventional, storable propellants produce average I(sub sp). Nuclear thermal rockets (NTRs) capable of high I(sub sp) thrust have been proposed. NTR employs heat produced by fission reaction to heat and therefore accelerate hydrogen, which is then forced through a rocket nozzle providing thrust. Fuel element temperatures are very high (up to 3,000 K) and hydrogen is highly reactive with most materials at high temperatures. Data covering the effects of high-temperature hydrogen exposure on fuel elements are limited. The primary concern is the mechanical failure of fuel elements that employ high melting point metals, ceramics, or a combination (cermet) as a structural matrix into which the nuclear fuel is distributed. It is not necessary to include fissile material in test samples intended to explore high-temperature hydrogen exposure of the structural support matrices. A small-scale test bed designed to heat fuel element samples via noncontact radio frequency heating and expose samples to hydrogen for typical mission durations has been developed to assist in optimal material and manufacturing process selection without employing fissile material. This Technical Memorandum details the test bed design and results of testing conducted to date.

  4. Environmental research on actinide elements

    Energy Technology Data Exchange (ETDEWEB)

    Pinder, J.E. III; Alberts, J.J.; McLeod, K.W.; Schreckhise, R.G. (eds.)

    1987-08-01

    The papers synthesize the results of research sponsored by DOE's Office of Health and Environmental Research on the behavior of transuranic and actinide elements in the environment. Separate abstracts have been prepared for the 21 individual papers. (ACR)

  5. Treatment of incorporated transuranium elements

    International Nuclear Information System (INIS)

    The text of this report and its tables and figures provide basic information on the decorporation of transuranium elements as well as an insight into the more general principles, trends and interactions. The detailed tables and the exhaustive list of important references should enable the reader to make his own conclusions in a minimum of time

  6. Key Elements of Social Innovation

    OpenAIRE

    Allyson Hewitt

    2008-01-01

    This article describes four key elements of social innovation: i) social technology; ii) innovation intermediaries; iii) people who drive innovation; and iv) openness. By taking experiences from social technology and examining the impact of "open everything", this article posits the value of innovation intermediaries as critical enablers of success in the emergent field of social innovation.

  7. Dynamic and Transient Infinite Elements

    CERN Document Server

    Zhao, Chongbin

    2009-01-01

    Intends to provide the theory and the application of dynamic and transient infinite elements for simulating the far fields of infinite domains involved in many of scientific and engineering problems, based on the author's own work over the years. This title is suitable for computational geoscientists, geotechnical engineers, and civil engineers.

  8. Elements Of Epistemic Crypto Logic

    OpenAIRE

    2014-01-01

    The talk presents an extension of DEL (dynamic epistemic logic) intended for model checking of cryptographic protocols. Key elements are a feasible epistemic representation of knowledge of large integers, using register models, and exchange of such knowledge over a network. I will demonstrate how the approach can be used for model checking Diffie-Helman key exchange and similar protocols.

  9. Experimental search for superheavy elements

    International Nuclear Information System (INIS)

    This work reports on the experimental search for superheavy elements (SHE). Two types of approaches for SHE production are studied i.e. '' cold '' fusion mechanism and massive transfer mechanism. First mechanism was studied in normal and inverse kinematics, by using Wien filter at the GANIL facility. The production of SHE elements with Z 106 and 108 is reported while negative results on the synthesis of SHE elements with Z 114 and 118 was received. The other approach i.e. reactions induced by heavy ion projectiles (e.g. 172Yb, 197Au) on fissile target nuclei (e.g. 238U, 232Th) at near Coulomb barrier incident energies was studied by using superconducting solenoid installed Texas A(and)M University. Preliminary results for the reaction 197Au(7.5 MeV/u) - 232Th are presented where three cases of the possible candidates for SHE elements were found. A dedicated detection setup for such studies is discussed and the detailed data analysis is presented. Detection of alpha and spontaneous fission radioactive decays is used to unambiguously identify the atomic number of SHE. Special statistical analysis for a very low detected number of α decays is applied to check consistency of the αradioactive chains. (author)

  10. Superheavy element flerovium (element 114) is a volatile metal.

    Science.gov (United States)

    Yakushev, Alexander; Gates, Jacklyn M; Türler, Andreas; Schädel, Matthias; Düllmann, Christoph E; Ackermann, Dieter; Andersson, Lise-Lotte; Block, Michael; Brüchle, Willy; Dvorak, Jan; Eberhardt, Klaus; Essel, Hans G; Even, Julia; Forsberg, Ulrika; Gorshkov, Alexander; Graeger, Reimar; Gregorich, Kenneth E; Hartmann, Willi; Herzberg, Rolf-Dietmar; Hessberger, Fritz P; Hild, Daniel; Hübner, Annett; Jäger, Egon; Khuyagbaatar, Jadambaa; Kindler, Birgit; Kratz, Jens V; Krier, Jörg; Kurz, Nikolaus; Lommel, Bettina; Niewisch, Lorenz J; Nitsche, Heino; Omtvedt, Jon Petter; Parr, Edward; Qin, Zhi; Rudolph, Dirk; Runke, Jörg; Schausten, Brigitta; Schimpf, Erwin; Semchenkov, Andrey; Steiner, Jutta; Thörle-Pospiech, Petra; Uusitalo, Juha; Wegrzecki, Maciej; Wiehl, Norbert

    2014-02-01

    The electron shell structure of superheavy elements, i.e., elements with atomic number Z ≥ 104, is influenced by strong relativistic effects caused by the high Z. Early atomic calculations on element 112 (copernicium, Cn) and element 114 (flerovium, Fl) having closed and quasi-closed electron shell configurations of 6d(10)7s(2) and 6d(10)7s(2)7p1/2(2), respectively, predicted them to be noble-gas-like due to very strong relativistic effects on the 7s and 7p1/2 valence orbitals. Recent fully relativistic calculations studying Cn and Fl in different environments suggest them to be less reactive compared to their lighter homologues in the groups, but still exhibiting a metallic character. Experimental gas-solid chromatography studies on Cn have, indeed, revealed a metal-metal bond formation with Au. In contrast to this, for Fl, the formation of a weak bond upon physisorption on a Au surface was inferred from first experiments. Here, we report on a gas-solid chromatography study of the adsorption of Fl on a Au surface. Fl was produced in the nuclear fusion reaction (244)Pu((48)Ca, 3-4n)(288,289)Fl and was isolated in-flight from the primary (48)Ca beam in a physical recoil separator. The adsorption behavior of Fl, its nuclear α-decay product Cn, their lighter homologues in groups 14 and 12, i.e., Pb and Hg, and the noble gas Rn were studied simultaneously by isothermal gas chromatography and thermochromatography. Two Fl atoms were detected. They adsorbed on a Au surface at room temperature in the first, isothermal part, but not as readily as Pb and Hg. The observed adsorption behavior of Fl points to a higher inertness compared to its nearest homologue in the group, Pb. However, the measured lower limit for the adsorption enthalpy of Fl on a Au surface points to the formation of a metal-metal bond of Fl with Au. Fl is the least reactive element in the group, but still a metal. PMID:24456007

  11. An Improved Triangular Element With Drilling Rotations

    DEFF Research Database (Denmark)

    Damkilde, Lars; Grønne, Mikael

    2002-01-01

    A new plane element with rotational degrees in the corner nodes is presented. The element has 12 degrees of freedom and the only difference from the well-known Linear Strain Triangular (LST) element is that the displacements perpendicular to the element sides in the mid-side nodes are replaced by...... rotations in the corner nodes. Compared to Allman's plane element which was the first succesfull implementation of drilling rotations the proposed element has extra displacements in the mid-side nodes parallel to the element sides. The performance should therefore be better and closer to the LST...

  12. Fermilab Booster Correction Elements upgrade

    International Nuclear Information System (INIS)

    The Fermilab Booster Correction Element Power Supply System is being upgraded to provide significant improvements in performance and versatility. At the same time these improvements will compliment raising the Booster injection energy from 200 MeV to 400 MeV and will allow increased range of adjustment to tune, chromaticity, closed orbit and harmonic corrections. All correction elements will be capable of ramping to give dynamic orbit, tune and chromaticity control throughout the acceleration cycle. The power supplies are commercial switch mode current sources capable of operating in all four current-voltage quadrants. External secondary feedback loops on the amplifiers have extended the small signal bandwidth to 3 kHz and allow current ramps in excess of 1000 A/sec. Implementation and present status of the upgrade project is described in this paper. (author) 4 refs., 2 figs., 1 tab

  13. Elemental composition of charcoal sorbants

    International Nuclear Information System (INIS)

    Despite the widespread use of charcoal sorbants in the collection of vapor phase chemicals and trace atmospheric gases, the charcoal's initial elemental composition is frequently not well characterized. This information is important in predicting possible reactions of collected chemicals within the charcoal matrix, the production of artifacts, and the possible sample loss during sampling. Also, it is critical in choosing the proper analytical technique for chemical measurement. For example, the authors have recently found that instrumental neutron activation analysis cannot be applied to measure mercury concentrations in oil bottom ashes, which are similar to some charcoals, due to the analytical interference of high levels of rare earth elements in these matrices. It is therefore vital to have at least a general knowledge of the major constituents of the sampling media for proper sampling and the selection of suitable analytical techniques

  14. Composite oxygen ion transport element

    Science.gov (United States)

    Chen, Jack C.; Besecker, Charles J.; Chen, Hancun; Robinson, Earil T.

    2007-06-12

    A composite oxygen ion transport element that has a layered structure formed by a dense layer to transport oxygen ions and electrons and a porous support layer to provide mechanical support. The dense layer can be formed of a mixture of a mixed conductor, an ionic conductor, and a metal. The porous support layer can be fabricated from an oxide dispersion strengthened metal, a metal-reinforced intermetallic alloy, a boron-doped Mo.sub.5Si.sub.3-based intermetallic alloy or combinations thereof. The support layer can be provided with a network of non-interconnected pores and each of said pores communicates between opposite surfaces of said support layer. Such a support layer can be advantageously employed to reduce diffusion resistance in any type of element, including those using a different material makeup than that outlined above.

  15. Chemistry of the transactinide elements

    International Nuclear Information System (INIS)

    Synthesis and decay of elements in the upper end of periodic table (z=104 to 111) are described. In view of very short half-life of about 1 s, the production of the transactinide isotopes and their transport to the separation and detection chamber are to be necessarily carried out employing fast and reliable techniques. Advances in microchemical separation techniques such as OLGA-II, HEVI, ARCA-II and SISAK, coupled to sensitive detection methods enable the detection of these heavier transactinide elements at atomic level. Their position in the periodic table and similarities, if any, with the corresponding lighter homologs are discussed based on their predicted and observed chemical behaviour. (author). 70 refs., 15 figs

  16. Trace-elements and tectonics

    International Nuclear Information System (INIS)

    Trends of the past twenty years in geochemical investigation of trace elements are reflected in studies of the partial melting of mantle and also the differentiation of magma. Substantial improvements have been made in accuracy, sensitivity and convenience of trace elements analysis, mainly through improved techniques and equipment for neutron activation analysis. Models for genesis of the zonal arrangement in island arc volcanic rocks as products of partial melting and fractional crystallization have been developed. We also applied these results to discuss the tectonic development of island arcs. Dating of geological materials is on universal concern to earth scientists working on various problems. In many research situations the use of a combination of dating method and paleomagnetism or geochemistry provides the greatest tectonic results for crustal materials, such as rotation of microcontinent and cooling history of rock body. (author)

  17. Automation of finite element methods

    CERN Document Server

    Korelc, Jože

    2016-01-01

    New finite elements are needed as well in research as in industry environments for the development of virtual prediction techniques. The design and implementation of novel finite elements for specific purposes is a tedious and time consuming task, especially for nonlinear formulations. The automation of this process can help to speed up this process considerably since the generation of the final computer code can be accelerated by order of several magnitudes. This book provides the reader with the required knowledge needed to employ modern automatic tools like AceGen within solid mechanics in a successful way. It covers the range from the theoretical background, algorithmic treatments to many different applications. The book is written for advanced students in the engineering field and for researchers in educational and industrial environments.

  18. Gelivity Effects on Construction Elements

    Directory of Open Access Journals (Sweden)

    Bogdan Rujanu

    2009-01-01

    Full Text Available Complex nature of environment effects on concrete structures has imposed an improvement of material characteristics, an adequate design, accurate execution and inspection, maintenance and prevention of deterioration risks. Large complexity of concrete elements deterioration processes, it is determined by the relation between adopted structural conceptions, exposing climatic conditions, concrete composition, quality of execution processes, but also due to synergetic action of destructive agents. When water freezes in a porous material, like cement stone, raise its volume about 9%, and can lead to concrete cleavage, when pores are saturated with water. Using deicers on concrete surface for melting of ice or snow, cause a thermal shock. Temperature difference between the surface and the core of concrete leads to interior stress and deformation state, capable to influence cracking of concrete layer from the surface of element. Prevention of damages and their amplification needs inspection, maintenance and overhauling of structures.

  19. Backfire antennas with dipole elements

    DEFF Research Database (Denmark)

    Nielsen, Erik Dragø; Pontoppidan, Knud

    1970-01-01

    A method is set up for a theoretical investigation of arbitrary backfire antennas based upon dipole structures. The mutual impedance between the dipole elements of the antenna is taken into account, and the field radiated due to a surface wave reflector of finite extent is determined by calculating...... the surface current distribution on the reflector plate. Numerical results obtained for Yagi backfire antennas and short-backfire antennas using this theory are compared with experimental results....

  20. Elements of Bayesian experimental design

    Energy Technology Data Exchange (ETDEWEB)

    Sivia, D.S. [Rutherford Appleton Lab., Oxon (United Kingdom)

    1997-09-01

    We consider some elements of the Bayesian approach that are important for optimal experimental design. While the underlying principles used are very general, and are explained in detail in a recent tutorial text, they are applied here to the specific case of characterising the inferential value of different resolution peakshapes. This particular issue was considered earlier by Silver, Sivia and Pynn (1989, 1990a, 1990b), and the following presentation confirms and extends the conclusions of their analysis.

  1. Trace Element Management in Rice

    OpenAIRE

    Abin Sebastian; Majeti Narasimha Vara Prasad

    2015-01-01

    Trace elements (TEs) are vital for the operation of metabolic pathways that promote growth and structural integrity. Paddy soils are often prone to TE limitation due to intensive cultivation and irrigation practices. Apart from this, rice paddies are potentially contaminated with transition metals such as Cd, which are often referred to as toxic TEs. Deficiency of TEs in the soil not only delays plant growth but also causes exposure of plant roots to toxic TEs. Fine-tuning of nutrient cycling...

  2. CONSTRAINED QUADRILATERAL NONCONFORMING ROTATED Q1 ELEMENT

    Institute of Scientific and Technical Information of China (English)

    Jun Hu; Zhong-ci Shi

    2005-01-01

    In this paper, we define a new nonconforming quadrilateral finite element based on the nonconforming rotated Q1 element by enforcing a constraint on each element, which has only three degrees of freedom. We investigate the consistency, approximation, superclose property, discrete Green's function and superconvergence of this element. Moreover, we propose a new postprocessing technique and apply it to this element. It is proved that the postprocessed discrete solution is superconvergent under a mild assumption on the mesh.

  3. Synthesis of super heavy elements

    International Nuclear Information System (INIS)

    An era of study and synthesis of superheavy elements began with the prediction of the existence of an island of stability of long lived superheavy elements in the vicinity Z = 126, N = 184 by Myers and Swiatecki in 1966. Within coulomb and proximity potential model, we have studied cluster emission from all even-even nuclei from 270118 to 318118. Fission decay half lives for these isotopes are calculated by the model proposed by Ren et al. The range of isotopes in which α-decay shall occur for the element Z=118 is found out using the difference in α-decay half life and fission decay half life as a criterion. This range is also the one in which isotopes can exist without getting spontaneously fissioned. Making use of the concepts of quantum mechanical fragmentation theory and the information that is gathered from our work, about the range of isotopes where synthesis of Z = 118 is probable, sets of reactions, according to order of possibility, for the production of all isotopes in the range have been elucidated. Along with that the involved fusion barrier and ground state Q-value also are shown

  4. Inorganic elements in sugar samples

    International Nuclear Information System (INIS)

    Sugar is considered a safe food ingredient; however, it can be contaminated by organic elements since its planting until its production process. Thus, this study aims at checking the presence of inorganic elements in samples of crystal, refined and brown sugar available for consumption in Brazil. The applied technique was neutron activation analysis, the k0 method, using the TRIGA MARK - IPR-R1 reactor located at CDTN/CNEN, in Belo Horizonte. It was identified the presence of elements such as, Au, Br, Co, Cr, Hf, K, Na, Sb, Sc and Zn in the samples of crystal/refined sugar and the presence of As, Au, Br, Ca, Co, Cr, Cs, Fe, Hf, K, Na, Sb, Sc, Sm, Sr, Th and Zn in the brown sugar samples. The applied technique was appropriate to this study because it was not necessary to put the samples in solution, essential condition in order to apply other techniques, avoiding contaminations and sample losses, besides allowing a multi elementary detection in different sugar samples. (author)

  5. Elemental composition of cosmic ray

    International Nuclear Information System (INIS)

    The report first summarizes some data that have been obtained so far from observation of isotopes and elements in cosmic rays in the low energy region. Then, objectives of studies planned to be carried out with Astromag are outlined and the number of incident particles expected to be measured by baloon observation is estimated. Heavy elements with atomic numbers of greater than 30 are considered to be formed through neutron absorption reactions by the s- or r-process. Observations show that products of the r-process is abundant in cosmic ray sources. The escape length depends on energy. In relation to this, it has been reported that the ratios Ar-Fe and Ca-Fe increase above 200 GeV-n while such a tendency is not observed for K, Sc, Ti or V. Thus, no satisfactory models are available at present which can fully explain the changes in the escape length. The ratio 3He-4He in the range of 5 - 10 GeV-n is inconsistent with the general theory that interprets the escape length of heavy elements. Some models, including the supermetallicity model and Wolf Rayet theory, have been proposed to explain unusual ratios of isotopes in cosmic rays, but more measurements are required to verify them. It is expected that Astromag can serve to make observations that can clarify these points. (Nogami, K.)

  6. The UNCLE finite element scheme

    International Nuclear Information System (INIS)

    A completely general finite element scheme, implemented in the UKAEA Reactor Group is outlined. UNCLE is not a complete, self-contained program. It is a framework of routines that provide the common services required by all general purpose finite element programs, whether for heat transfer, stress analysis or any other linear (or piece-wise linear) problem. These services are: input of mesh, geometry, loads (etc) and material data: matrix and load vector calculation and assembly (including handling of standard boundary conditions); solution of global matrix (elimination and conjugate gradient methods); output (printed and graphical) of initial geometry, displacements, stresses, final geometry etc; facilities for iteration for non-linear problems and time integration; mass matrix reduction, dynamic analysis of reduced problem and expansion of displacements to full problem. The framework is written to handle 1, 2, 3 or more dimensions equally efficiently. To produce a general purpose program for a particular range of applications it is only necessary to provide a set of element subroutines specialised to the application (heat transfer, framework analysis, continuum stress analysis etc)

  7. Inorganic elements in sugar samples

    Energy Technology Data Exchange (ETDEWEB)

    Salles, Paulo M.B. de; Campos, Tarcisio P.R. de, E-mail: pauladesalles@yahoo.com.br, E-mail: tprcampos@pq.cnpq.br [Universidade Federal de Minas Gerais (DEN/UFMG), Belo Horizonte, MG (Brazil). Departamento de Engenharia Nuclear; Menezes, Maria Angela de B.C., E-mail: menezes@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)

    2013-07-01

    Sugar is considered a safe food ingredient; however, it can be contaminated by organic elements since its planting until its production process. Thus, this study aims at checking the presence of inorganic elements in samples of crystal, refined and brown sugar available for consumption in Brazil. The applied technique was neutron activation analysis, the k{sub 0} method, using the TRIGA MARK - IPR-R1 reactor located at CDTN/CNEN, in Belo Horizonte. It was identified the presence of elements such as, Au, Br, Co, Cr, Hf, K, Na, Sb, Sc and Zn in the samples of crystal/refined sugar and the presence of As, Au, Br, Ca, Co, Cr, Cs, Fe, Hf, K, Na, Sb, Sc, Sm, Sr, Th and Zn in the brown sugar samples. The applied technique was appropriate to this study because it was not necessary to put the samples in solution, essential condition in order to apply other techniques, avoiding contaminations and sample losses, besides allowing a multi elementary detection in different sugar samples. (author)

  8. The Synthesis of Superheavy Elements

    International Nuclear Information System (INIS)

    The elements with the atomic numbers 107-112 have been synthesized and unambiguously identified at the velocity filter SHIP at GSI. The technique allowing for this successful experimental program is the combination of the detection of correlations between evaporation residues and subsequent a-decays with a powerful separator. Systematic investigations, the construction of decay chain networks and mass measurements are some of the possible approaches to study the decay chains tentatively attributed to the isotopes of the elements 114 and 116 at Dubna, which are, in contrast to those observed at GSI, not connected to α-decays of known isotopes. The sensitivity limit of the set-up at GSI has reached the 1pb level. For systematic investigation in this region of extremely low cross section and to synthesize nuclei of higher Z this limit has to be pushed to even lower values. An extensive development program is pursued at SHIP in order to reach at least an order of magnitude lower cross sections. Apart from target cooling and separator development a super conducting CW linear accelerator is studied to reach this goal. To design a successful experimental program for the possible discovery of new elements the nuclear structure of the heaviest nuclei has to be understood as well as the reaction mechanism which leads to their production in heavy ion reactions. We have initiated series of systematic studies for both subjects

  9. Analysis of“Microtonal Transposed Pentatonic Mode System”in SONG Mingzhu’s Chamber Music Work Two Pieces of String’s Rhyme%宋名筑室内乐《弦韵两首》中“微分音移位五声性调式体系”的运用兼及技法分析

    Institute of Scientific and Technical Information of China (English)

    陈国威; 何莲子

    2014-01-01

    The per-set“Microtonal Transposed Pentatonic Mode System”in SONG Mingzhu ’s Chamber Music Work Two Pieces of String’s Rhyme (for Zheng,Piano and String Quartet)is a successful attempt of individualized musical language and stylistic breakthrough. My paper takes Two Pieces of String’s Rhyme as an example,and an-alyzes the theoretical construction,harmonic sonority,multiple performance method,timber combination,and modern contrapuntal technique of“Microtonal Transposed Pentatonic Mode System.”%改革开放以来,中国的现代音乐逐渐走向成熟。作曲家们在吸收前人创作经验的基础上,不拘一格,不断创新,在追求表达富于个性鲜明特征,彰显本土音乐文化,体现多元音乐文化体征的同时,实现作曲家自身音乐语言与风格的突破。四川音乐学院作曲系宋名筑教授创作的室内乐《弦韵两首》(为古筝、钢琴和弦乐四重奏而作)运用设定的“微分音移位五声性调式体系”作曲法,正是其为实现自身个性化音乐语言和风格突破所作的成功尝试。而这一体系的设定,对中国现代音乐创作是具有一定指导启发意义的。文章从微分音移位五声性音材料的理论构建、和声音响、多重演奏法与音色搭配、现代复调技法、数控节奏等角度,解析“微分音移位五声性调式体系”在《弦韵两首》中的运用规律与创作构想。

  10. Adobe Photoshop Elements 10 unleash the hidden performance of Elements

    CERN Document Server

    Galer, Mark

    2011-01-01

    Master the most powerful photo editing tools and techniques that Elements has to offer! Using step-by-step projects, Mark Galer will have you creating stunning images in no time at all. Whether you want to create impressive, seamless montages, optimize your photos for perfect print quality, or simply enhance your images for maximum impact, Maximum Performance will give you the skills and know-how you need to create professional quality results. Featured projects teach you how to work with multilayered 16 bit/channel files, as well as convert to black and white using Adobe Camera Raw, create

  11. Peridynamic Multiscale Finite Element Methods

    Energy Technology Data Exchange (ETDEWEB)

    Costa, Timothy [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Bond, Stephen D. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Littlewood, David John [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Moore, Stan Gerald [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2015-12-01

    The problem of computing quantum-accurate design-scale solutions to mechanics problems is rich with applications and serves as the background to modern multiscale science research. The prob- lem can be broken into component problems comprised of communicating across adjacent scales, which when strung together create a pipeline for information to travel from quantum scales to design scales. Traditionally, this involves connections between a) quantum electronic structure calculations and molecular dynamics and between b) molecular dynamics and local partial differ- ential equation models at the design scale. The second step, b), is particularly challenging since the appropriate scales of molecular dynamic and local partial differential equation models do not overlap. The peridynamic model for continuum mechanics provides an advantage in this endeavor, as the basic equations of peridynamics are valid at a wide range of scales limiting from the classical partial differential equation models valid at the design scale to the scale of molecular dynamics. In this work we focus on the development of multiscale finite element methods for the peridynamic model, in an effort to create a mathematically consistent channel for microscale information to travel from the upper limits of the molecular dynamics scale to the design scale. In particular, we first develop a Nonlocal Multiscale Finite Element Method which solves the peridynamic model at multiple scales to include microscale information at the coarse-scale. We then consider a method that solves a fine-scale peridynamic model to build element-support basis functions for a coarse- scale local partial differential equation model, called the Mixed Locality Multiscale Finite Element Method. Given decades of research and development into finite element codes for the local partial differential equation models of continuum mechanics there is a strong desire to couple local and nonlocal models to leverage the speed and state of the

  12. Element-by-element and implicit-explicit finite element formulations for computational fluid dynamics

    Science.gov (United States)

    Tezduyar, T. E.; Liou, J.

    1988-01-01

    Preconditioner algorithms to reduce the computational effort in FEM analyses of large-scale fluid-dynamics problems are presented. A general model problem is constructed on the basis of the convection-diffusion equation and the two-dimensional vorticity/stream-function formulation of the Navier-Stokes equations; this problem is then analyzed using element-by-element, implicit-explicit, and adaptive implicit-explicit approximation schemes. Numerical results for the two-dimensional advection and rigid-body rotation of a cosine hill, flow past a circular cylinder, and driven cavity flow are presented in extensive graphs and shown to be in good agreement with those obtained using implicit methods.

  13. Major and trace elements in human tears

    International Nuclear Information System (INIS)

    Major elements in tears were determined by ion chromatography. The concentrations of major elements in tears (Cl, Na, K) are in the range from 600 to 4000 ppm. Minor elements in tears (Ca and Mg) were analyzed using ICP-MS and their concentration range is 10 to 80 ppm. All trace elements in tears have concentrations below the ppm range. Two techniques were applied for the determination of trace elements in tears (GFAAS and ICP-MS). The time-dependence of the concentrations of major and minor elements in tears was studied. The concentrations of major elements in tears hardly change with passage of time. However, the concentrations of minor elements (Ca, Mg, Rb) vary with time but in inconsistent manner. Some correlations are found between the concentrations of major elements (Cl and Na, Cl and Na+K) No correlations were observed between K and either Cl or Na. (author)

  14. Calculation of binary phase diagrams between the actinide elements, rare earth elements, and transition metal elements

    International Nuclear Information System (INIS)

    Attempts were made to apply the Kaufman method of calculating binary phase diagrams to the calculation of binary phase diagrams between the rare earths, actinides, and the refractory transition metals. Difficulties were encountered in applying the method to the rare earths and actinides, and modifications were necessary to provide accurate representation of known diagrams. To calculate the interaction parameters for rare earth-rare earth diagrams, it was necessary to use the atomic volumes for each of the phases: liquid, body-centered cubic, hexagonal close-packed, and face-centered cubic. Determination of the atomic volumes of each of these phases for each element is discussed in detail. In some cases, empirical means were necessary. Results are presented on the calculation of rare earth-rare earth, rare earth-actinide, and actinide-actinide diagrams. For rare earth-refractory transition metal diagrams and actinide-refractory transition metal diagrams, empirical means were required to develop values for the enthalpy of vaporization for rare earth elements and values for the constant (C) required when intermediate phases are present. Results of using the values determined for each element are presented

  15. Implementing wavelet transform with SAW elements

    Institute of Scientific and Technical Information of China (English)

    LU; Wenke(卢文科); ZHU; Changchun(朱长纯); LIU; Junhua(刘君华); LIU; Qinghong(刘清洪)

    2003-01-01

    In the design of the finger-overlap envelope according to the envelope of wavelet function, it is concluded that the pulse-response function of the interdigital transducer (IDT) for surface acoustic wave (SAW) is identical to the wavelet function. SAW type of the wavelet-transform element is manufactured. A new method of using two wavelet-transform elements to manufacture the reconstruction element of the wavelet transform is proposed. The sources of the element error are analyzed, and the methods for reducing the error are put forward. SAW type of the wavelet transformation element and its reconstruction element have the following three characteristics: (i) the implementing methods of the wavelet transform element and its reconstruction element are simple, and free of complicated mathematical algorithms of the wavelet transform; (ii) because one of SAW element is fast, the response velocities of SAW type of the wavelet transform element and its reconstruction element are also fast; (iii) the costs of the wavelet transform element and its reconstruction element are low, so the elements may be manufactured in a large quantity.

  16. Super-Light Prefabricated Deck Element Integrated in Traditional Concrete Prefabricated Element Construction

    DEFF Research Database (Denmark)

    Christensen, Jacob Ellehauge; Hertz, Kristian Dahl

    the super-light slab element are element size, which have greatly reduced the total number of elements the pedestrian bridges consist of. The application also demonstrated the ability to control the path that the forces will take in the element. The deck elements are for example fully prepared at the...

  17. Analysis of phage Mu DNA transposition by whole-genome Escherichia coli tiling arrays reveals a complex relationship to distribution of target selection protein B, transcription and chromosome architectural elements

    Indian Academy of Sciences (India)

    Jun Ge; Zheng Lou; Hong Cui; Lei Shang; Rasika M Harshey

    2011-09-01

    Of all known transposable elements, phage Mu exhibits the highest transposition efficiency and the lowest target specificity. In vitro, MuB protein is responsible for target choice. In this work, we provide a comprehensive assessment of the genome-wide distribution of MuB and its relationship to Mu target selection using high-resolution Escherichia coli tiling DNA arrays. We have also assessed how MuB binding and Mu transposition are influenced by chromosome-organizing elements such as AT-rich DNA signatures, or the binding of the nucleoid-associated protein Fis, or processes such as transcription. The results confirm and extend previous biochemical and lower resolution in vivo data. Despite the generally random nature of Mu transposition and MuB binding, there were hot and cold insertion sites and MuB binding sites in the genome, and differences between the hottest and coldest sites were large. The new data also suggest that MuB distribution and subsequent Mu integration is responsive to DNA sequences that contribute to the structural organization of the chromosome.

  18. Duration judgements over multiple elements

    Directory of Open Access Journals (Sweden)

    InciAyhan

    2012-11-01

    Full Text Available We investigated the limits of the number of events observers can simultaneously time. For single targets occurring in one of eight positions sensitivity to duration was improved for spatially pre-cued items as compared to post-cued items indicating that exogenous driven attention can improve duration discrimination. Sensitivity to duration for pre-cued items was also marginally better for single items as compared to eight items indicating that even after the allocation of focal attention, distracter items can interfere with the encoding of duration. For an eight item array discrimination was worse for post-cued locations as compared to pre-cued locations indicating both that attention can improve duration discrimination performance and that it was not possible to access a perfect memory trace of the duration of eight elements. The interference from the distracters in the pre-cued eight item array may reflect some mandatory averaging of target and distracter events. To further explore duration averaging we asked subjects to explicitly compare average durations of multiple item arrays against a single item standard duration. Duration discrimination thresholds were significantly lower for single elements as compared to multiple elements, showing that averaging, either automatically or intentionally, impairs duration discrimination. There was no set size effect. Performance was the same for averages of two and eight items, but performance with even an average of two items was worse than for one item. This was also true for sequential presentation indicating poor performance was not due to limits on the division of attention across items. Rather performance appears to be limited by an inability to remember or aggregate duration information from two or more items. Although it is possible to manipulate perceived duration locally, there appears to be no perceptual mechanisms for aggregating local durations across space.

  19. Fluidic Elements based on Coanda Effect

    Directory of Open Access Journals (Sweden)

    Constantin OLIVOTTO

    2010-12-01

    Full Text Available This paper contains first some definitions and classifications regarding the fluidic elements. Thegeneral current status is presented, nominating the main specific elements based on the Coanda effect developedspecially in Romania. In particularly the development of an original bistable element using industrial compressedair at industrial pressure supply is presented. The function of this element is based on the controlled attachmentof the main jet at a curved wall through the Coanda effect. The methods used for particular calculation andexperiments are nominated. The main application of these elements was to develop a specific execution element:a fluidic step–by-step motor based on the Coanda effect.

  20. The elements of life and medicines

    OpenAIRE

    Chellan, Prinessa; Sadler, Peter J.

    2015-01-01

    Which elements are essential for human life? Here we make an element-by-element journey through the periodic table and attempt to assess whether elements are essential or not, and if they are, whether there is a relevant code for them in the human genome. There are many difficulties such as the human biochemistry of several so-called essential elements is not well understood, and it is not clear how we should classify elements that are involved in the destruction of invading microorganisms, o...

  1. Gas phase chemistry studies of superheavy elements

    International Nuclear Information System (INIS)

    The present status of the chemical properties investigation for superheavy elements was described in this paper. The synthesis of superheavy elements and the experimental techniques used in studies on the gas phase chemistry of superheavy elements were briefly introduced. The current experimental studies about the gas-chromatography of Rf, Db, Sg, Bh, Hs and element 112 were discussed in detail. Finally, the development of synthesis of superheavy elements and the study on gas phase chemical properties of superheavy elements in China were prospected. (authors)

  2. Formulations of a hydromechanical interface element

    Institute of Scientific and Technical Information of China (English)

    Zhong-Zhi Fu; Si-Hong Liu

    2011-01-01

    A hydromechanical interface element is proposed for the consideration of the hydraulic-mechanical coupling effect along the interface.The fully coupled governing equations and the relevant finite element formulations are derived in detail for the interface element.All the involved matrices are of the same form as those of a solid element,which makes the incorporation of the model into a finite element program straightforward.Three examples are then numerically simulated using the interface element.Reasonable results confirm the correctness of the proposed model and motivate its application in hydromechanical contact problems in the future.

  3. Main Elements for Upscaling Recreation

    DEFF Research Database (Denmark)

    Zandersen, Marianne; Termansen, Mette

    2012-01-01

    This report provides information on the main elements used to scale up modelled local visitor flow data to regional level based on recreational de-mand models. These models are described in Report #1. This report also provides information on data sources such as spatial data (e.g. land cov......-er/land use information), demographic information. The report is accom-pagnied with a spatial database for the regional case of forest recreation in Northern Zealand, Denmark. The spatial database contains forest polygons; forest attribute; estimation of total annual number of visits per site; and es...

  4. Elements of partial differential equations

    CERN Document Server

    Sneddon, Ian N

    2006-01-01

    Geared toward students of applied rather than pure mathematics, this volume introduces elements of partial differential equations. Its focus is primarily upon finding solutions to particular equations rather than general theory.Topics include ordinary differential equations in more than two variables, partial differential equations of the first and second orders, Laplace's equation, the wave equation, and the diffusion equation. A helpful Appendix offers information on systems of surfaces, and solutions to the odd-numbered problems appear at the end of the book. Readers pursuing independent st

  5. Transportation of irradiated fuel elements

    International Nuclear Information System (INIS)

    The report falls under the headings: introduction (explaining the special interest of the London Borough of Brent, as forming part of the route for transportation of irradiated fuel elements); nuclear power (with special reference to transport of spent fuel and radioactive wastes); the flask aspect (design, safety regulations, criticisms, tests, etc.); the accident aspect (working manual for rail staff, train formation, responsibility, postulated accident situations); the emergency arrangements aspect; the monitoring aspect (health and safety reports); legislation; contingency plans; radiation - relevant background information. (U.K.)

  6. Elements of abstract harmonic analysis

    CERN Document Server

    Bachman, George

    2013-01-01

    Elements of Abstract Harmonic Analysis provides an introduction to the fundamental concepts and basic theorems of abstract harmonic analysis. In order to give a reasonably complete and self-contained introduction to the subject, most of the proofs have been presented in great detail thereby making the development understandable to a very wide audience. Exercises have been supplied at the end of each chapter. Some of these are meant to extend the theory slightly while others should serve to test the reader's understanding of the material presented. The first chapter and part of the second give

  7. Basic Elements of Knowledge Management

    Directory of Open Access Journals (Sweden)

    Marcin W. Staniewski

    2007-10-01

    Full Text Available The article is a review of basic knowledge management terminology. It presents such a description as: knowledge resources levels (data, information, knowledge, and wisdom, knowledge sources (internal, external, and knowledge typology (implicit, tacit or individual, social. Moreover the article characterizes knowledge management process, knowledge management system and main knowledge management strategies (codification, personalization. At the end of the article there is mentioned the knowledge creating process (the concept of knowledge creation spiral and the role of Intelligence Technology (IT and organizational culture as main elements supporting knowledge management implementation in organizations.

  8. Mars Surface Tunnel Element Concept

    Science.gov (United States)

    Rucker, Michelle A.; Mary, Natalie; Howe, A. Scott; Jeffries, Sharon

    2016-01-01

    How Mars surface crews get into their ascent vehicle has profound implications for Mars surface architecture. To meet planetary protection protocols, the architecture has get Intravehicular Activity (IVA)-suited crew into a Mars Ascent Vehicle (MAV) without having to step outside into the Mars environment. Pushing EVA suit don/doff and EVA operations to an element that remains on the surface also helps to minimize MAV cabin volume, which in turn can reduce MAV cabin mass. Because the MAV will require at least seven kilograms of propellant to ascend each kilogram of cabin mass, minimal MAV mass is desired. For architectures involving more than one surface element-such as an ascent vehicle and a pressurized rover or surface habitat-a retractable tunnel is an attractive solution. Beyond addressing the immediate MAV access issue, a reusable tunnel may be useful for other surface applications once its primary mission is complete. A National Aeronautics and Space Administration (NASA) team is studying the optimal balance between surface tunnel functionality, mass, and stowed volume as part of the Evolvable Mars Campaign (EMC). The "Minimum Functional Tunnel" is a conceptual design that performs a single function. Having established this baseline configuration, the next step is to trade design options, evaluate other applications, and explore alternative solutions.

  9. Fuel elements of thermionic converters

    Energy Technology Data Exchange (ETDEWEB)

    Hunter, R.L. [ed.] [Sandia National Labs., Albuquerque, NM (United States). Environmental Systems Assessment Dept.; Gontar, A.S.; Nelidov, M.V.; Nikolaev, Yu.V.; Schulepov, L.N. [RI SIA Lutch, Podolsk (Russian Federation)

    1997-01-01

    Work on thermionic nuclear power systems has been performed in Russia within the framework of the TOPAZ reactor program since the early 1960s. In the TOPAZ in-core thermionic convertor reactor design, the fuel element`s cladding is also the thermionic convertor`s emitter. Deformation of the emitter can lead to short-circuiting and is the primary cause of premature TRC failure. Such deformation can be the result of fuel swelling, thermocycling, or increased unilateral pressure on the emitter due to the release of gaseous fission products. Much of the work on TRCs has concentrated on preventing or mitigating emitter deformation by improving the following materials and structures: nuclear fuel; emitter materials; electrical insulators; moderator and reflector materials; and gas-exhaust device. In addition, considerable effort has been directed toward the development of experimental techniques that accurately mimic operational conditions and toward the creation of analytical and numerical models that allow operational conditions and behavior to be predicted without the expense and time demands of in-pile tests. New and modified materials and structures for the cores of thermionic NPSs and new fabrication processes for the materials have ensured the possibility of creating thermionic NPSs for a wide range of powers, from tens to several hundreds of kilowatts, with life spans of 5 to 10 years.

  10. A coupling procedure for modeling acoustic problems using finite elements and boundary elements

    OpenAIRE

    Coyette, J.; Vanderborck, G.; Steichen, W.

    1994-01-01

    Finite element (FEM) and boundary element (BEM) methods have been used for a long time for the numerical simulation of acoustic problems. The development presented in this paper deals with a general procedure for coupling acoustic finite elements with acoustic boundary elements in order to solve efficiently acoustic problems involving non homogeneous fluids. Emphasis is made on problems where finite elements are used for a confined (bounded) fluid while boundary elements are selected for an e...

  11. Apparatus for locating defective nuclear fuel elements

    International Nuclear Information System (INIS)

    An ultrasonic search unit for locating defective fuel elements within a fuel assembly used in a water cooled nuclear reactor is presented. The unit is capable of freely traversing the restricted spaces between the fuel elements

  12. Natural wetland emissions of methylated trace elements

    NARCIS (Netherlands)

    Vriens, B.; Lenz, M.; Charlet, L.; Berg, M.; Winkel, L.H.E.

    2014-01-01

    Natural wetlands are well known for their significant methane emissions. However, trace element emissions via biomethylation and subsequent volatilization from pristine wetlands are virtually unstudied, even though wetlands constitute large reservoirs for trace elements. Here we show that the averag

  13. Admixture elements as indicators of fluorite genesis

    International Nuclear Information System (INIS)

    Present book is devoted to comparative analysis of abundance and distribution of admixture elements in fluorite-mineral. The data on composition and content of admixture elements in fluorite was generalized. The hydrothermal deposits were characterized on mineral types.

  14. Dow Introduces "Human Element" to China

    Institute of Scientific and Technical Information of China (English)

    Jenny Du

    2007-01-01

    @@ Recently, the DOW Chemical Company of the United States introduced the "Human Element" to China. The "Human Element" series campaignwas launched in North America and Europe respectively from 2006 and the Q2 of 2007.

  15. Indication for a volatile element 114

    International Nuclear Information System (INIS)

    Recently, the chemical investigation of element 112 revealed a highly volatile, noble metallic behaviour, as expected for the last group 12 member of the periodic table. The observed volatility and chemical inertness were ascribed to the growing influence of relativistic effects on the chemical properties of the heaviest elements with increasing nuclear charge. Here, we report for the first time on gas phase chemical experiments aiming at a determination of element 114 properties. This element was investigated using its isotopes 287114 and 288114 produced in the nuclear fusion reactions of 48Ca with 242Pu and 244Pu, respectively. Identification of three atoms of element 114 in thermochromatography experiments and their deposition pattern on a gold surface indicates that this element is at least as volatile as simultaneously investigated elements Hg, At, and element 112. This behaviour is rather unexpected for a typical metal of group 14. (orig.)

  16. 利用果蝇转座子作载体构建土垢分枝杆菌变异基因文库的研究%ESTABLISHMENT OF MYCOBACTERIUM SMEGMATISB MUTAGENESIS LIBRARY WITH DROSOPHILA MAURITIANA MARINER ELEMENT VECTOR

    Institute of Scientific and Technical Information of China (English)

    刘克义; 于进芝

    2004-01-01

    目的利用果蝇mariner转座子作为载体构建土垢分枝杆菌随机变异基因文库以筛选影响脂肪酸代谢的基因. 方法将果蝇转座子mos1的末端反向重复序列置于卡那霉素抗性基因两侧,并将此种基因插入到M272B载体,用此载体转化土垢分枝杆菌,用Southern blot验证外源基因的插入.将变异的基因克隆在不同碳源的培养基上培养,筛选只在软脂酸上生长的菌落. 结果初筛了468个菌落,有5个不能在软脂酸上生长,其中2个在ICL基因上发生变异,3个在PCKA基因上发生变异.ICL为乙醛酸旁路所必须,PCKA编码糖异生的关键酶. 结论研究证明该转座子载体用于基因变异有效,变异筛选分枝杆菌中与脂肪酸代谢的基因可行.%Objective Use the Drosophila mauritiana mariner transposable element as a vector to construct Mycobacterium smegmatis random mutagenesis library in order to screen transposon mutants that affect the metabolism of fatty acids. Methods A transposon mutagenesis vector was constructed, which contains the Tn903 kanamycin resistance (KanR) gene flanked by the 5′ and 3′ inverted repeats of the D. mauritiana transposable element Mos1. M. smegmatis was transformed with the vector. The ability of transposon to integrate within the chromosome was identified using southern strategy. M. smegmatis transposon mutants were pooled and screened using different carbon sources. The clones could not grow on palmitate were selected. Results From initial screen of 468 colonies, we isolated one insertion in the isocitrate lyase gene, required for the glyoxalate shunt, and three independent insertions in the phosphoenolpyruvate carboxykinase gene, required for gluconeogenesis. Conclusion These results demonstrate the utility of this transposon mutagenesis vector, as well as the ability of our mutagenesis screen to identify mutations that affect the metabolism of fatty acids by mycobacterium.

  17. Continuous finite element methods for Hamiltonian systems

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    By applying the continuous finite element methods of ordinary differential equations, the linear element methods are proved having second-order pseudo-symplectic scheme and the quadratic element methods are proved having third-order pseudosymplectic scheme respectively for general Hamiltonian systems, and they both keep energy conservative. The finite element methods are proved to be symplectic as well as energy conservative for linear Hamiltonian systems. The numerical results are in agreement with theory.

  18. Light elements in oceanic and ophiolitic serpentinities

    OpenAIRE

    Vils, Flurin Andri; Katz, Angelika

    2009-01-01

    Despite the key importance of altered oceanic mantle as a repository and carrier of light elements (B, Li, and Be) to depth, its inventory of these elements has hardly been explored and quantified. In order to constrain the systematics and budgets of these elements in the oceanic lithosphere, this thesis has studied samples of highly serpentinized peridotites from the mid-Atlantic ridge (ODP Leg 209) and progressively metamorphosed alpine ophiolites (Totalp, Platta and Malenco). Light element...

  19. ELEMENT FUNCTIONS OF DISCRETE OPERATOR DIFFERENCE METHOD

    Institute of Scientific and Technical Information of China (English)

    田中旭; 唐立民; 刘正兴

    2002-01-01

    The discrete scheme called discrete operator difference for differential equations was given. Several difference elements for plate bending problems and plane problems were given. By investigating these elements, the ability of the discrete forms expressing to the element functions was talked about. In discrete operator difference method, the displacements of the elements can be reproduced exactly in the discrete forms whether the displacements are conforming or not. According to this point, discrete operator difference method is a method with good performance.

  20. Solid finite elements through three decades

    OpenAIRE

    Venkatesh, DN; Shrinivasa, U

    1994-01-01

    conventionally, solid finite elements have been looked upon as just generalizations of two-dimensional finite elements. In this article we trace their development starting from the days of their inception. Keeping in tune with our perceptions on developing finite elements, without taking recourse to any extra variational techniques, we discuss a few of the techniques which have been applied to solid finite elements. Finally we critically examine our own work on formulating solid finite elemen...

  1. Fluidic Elements based on Coanda Effect

    OpenAIRE

    Constantin OLIVOTTO

    2010-01-01

    This paper contains first some definitions and classifications regarding the fluidic elements. Thegeneral current status is presented, nominating the main specific elements based on the Coanda effect developedspecially in Romania. In particularly the development of an original bistable element using industrial compressedair at industrial pressure supply is presented. The function of this element is based on the controlled attachmentof the main jet at a curved wall through the Coanda effect. T...

  2. Flux-conserving finite element methods

    OpenAIRE

    Zhang, Shangyou; Zhang, Zhimin; Zou, Qingsong

    2012-01-01

    We analyze the flux conservation property of the finite element method. It is shown that the finite element solution does approximate the flux locally in the optimal order, i.e., the same order as that of the nodal interpolation operator. We propose two methods, post-processing the finite element solutions locally. The new solutions, remaining as optimal-order solutions, are flux-conserving elementwise. In one of our methods, the processed solution also satisfies the original finite element e...

  3. Modelling optimization involving different types of elements in finite element analysis

    International Nuclear Information System (INIS)

    Finite elements are used to express the mechanical behaviour of a structure in finite element analysis. Therefore, the selection of the elements determines the quality of the analysis. The aim of this paper is to compare and contrast 1D element, 2D element, and 3D element used in finite element analysis. A simple case study was carried out on a standard W460x74 I-beam. The I-beam was modelled and analyzed statically with 1D elements, 2D elements and 3D elements. The results for the three separate finite element models were compared in terms of stresses, deformation and displacement of the I-beam. All three finite element models yield satisfactory results with acceptable errors. The advantages and limitations of these elements are discussed. 1D elements offer simplicity although lacking in their ability to model complicated geometry. 2D elements and 3D elements provide more detail yet sophisticated results which require more time and computer memory in the modelling process. It is also found that the choice of element in finite element analysis is influence by a few factors such as the geometry of the structure, desired analysis results, and the capability of the computer

  4. Downhole Elemental Analysis with LIBS

    Science.gov (United States)

    Moreschini, Paolo; Zacny, Kris; Rickman, Doug

    2011-01-01

    In this paper we discuss a novel instrument, currently under development at Honeybee Robotics with SBIR funding from NASA. The device is designed to characterize elemental composition as a function of depth in non-terrestrial geological formations. The instrument consists of a miniaturized laser-induced breakdown spectrometer (LIBS) analyzer integrated in a 2" diameter drill string. While the drill provides subsurface access, the LIBS analyzer provides information on the elemental composition of the borehole wall. This instrument has a variety of space applications ranging from exploration of the Moon for which it was originally designed, to Mars, as well as a variety of terrestrial applications. Subsurface analysis is usually performed by sample acquisition through a drill or excavator, followed by sample preparation and subsequent sample presentation to an instrument or suite of instruments. An alternative approach consisting in bringing a miniaturized version of the instrument to the sample has many advantages over the traditional methodology, as it allows faster response, reduced probability of cross-contamination and a simplification in the sampling mechanisms. LIBS functions by focusing a high energy laser on a material inducing a plasma consisting of a small fraction of the material under analysis. Optical emission from the plasma, analyzed by a spectrometer, can be used to determine elemental composition. A triangulation sensor located in the sensor head determines the distance of the sensor from the borehole wall. An actuator modifies the position of the sensor accordingly, in order to compensate for changes due to the profile of the borehole walls. This is necessary because LIBS measurements are negatively affected by changes in the relative position of the focus of the laser with respect to the position of the sample (commonly referred to as the "lens to sample distance"). Profiling the borehole is done by adjusting the position of the sensor with a

  5. Downhole elemental analysis with LIBS

    Science.gov (United States)

    Moreschini, P.; Zacny, K.; Rickman, D.

    2011-12-01

    In this paper we discuss a novel instrument, currently under development at Honeybee Robotics with SBIR funding from NASA. The device is designed to characterize elemental composition as a function of depth in non-terrestrial geological formations. The instrument consists of a miniaturized LIBS analyzer integrated in a 2" diameter drill string. While the drill provides subsurface access, the LIBS analyzer provides information on the elemental composition of the borehole wall. This instrument has a variety of space applications ranging from exploration of the Moon for which it was originally designed, to Mars, as well as a variety of terrestrial applications. Subsurface analysis is usually performed by sample acquisition through a drill or excavator, followed by sample preparation and subsequent sample presentation to an instrument or suite of instruments. An alternative approach consisting in bringing a miniaturized version of the instrument to the sample has many advantages over the traditional methodology, as it allows faster response, reduced probability of cross-contamination and a simplification in the sampling mechanisms. LIBS functions by focusing a high energy laser on a material inducing a plasma consisting of a small fraction of the material under analysis. Optical emission from the plasma, analyzed by a spectrometer, can be used to determine elemental composition. A triangulation sensor located in the sensor head determines the distance of the sensor from the borehole wall. An actuator modifies the position of the sensor accordingly, in order to compensate for changes due to the profile of the borehole walls. This is necessary because LIBS measurements are negatively affected by changes in the relative position of the focus of the laser with respect to the position of the sample (commonly referred to as the "lens to sample distance"). Profiling the borehole is done by adjusting the position of the sensor with a vertical stage; a second actuator at the

  6. Deformation Expression for Elements of Algebra

    OpenAIRE

    Omori, H.; Y. Maeda; Miyazaki, N.; Yoshioka, A.

    2011-01-01

    The purpose of this paper is to give a notion of deformation of expressions for elements of algebra. Deformation quantization (cf.[BF]) deforms the commutative world to a non-commutative world. However, this involves deformation of expression of elements of algebras even from a commutative world to another commutative world. This is indeed a deformation of expressions for elements of algebra.

  7. Tool Releases Optical Elements From Spring Brackets

    Science.gov (United States)

    Gum, J. S.

    1984-01-01

    Threaded hooks retract bracket arms holding element. Tool uses three hooks with threaded shanks mounted in ring-shaped holder to pull on tabs to release optical element. One person can easily insert or remove optical element (such as prism or lens) from spring holder or bracket with minimal risk of damage.

  8. Superheavy elements: existence, classification and experiment

    OpenAIRE

    Kostyghin, V. A.; Vaschenko, V. M.; Loza, Ye. A.

    2012-01-01

    This paper proposes spatial periodic table developed based on classic electron shell structure model. The periodic table determines location and chemical properties of superheavy elements. 14 new long-living superheavy elements found by Proton-21 laboratory and one long-living superheavy element found by A.Marinov were identified.

  9. Main: ELEMENT1GMLBC3 [PLACE

    Lifescience Database Archive (English)

    Full Text Available ELEMENT1GMLBC3 S000319 7-Sep-2000 (last modified) seki Element 1 found in the promo...ter of soybean (G.m.) leghaemoglobin lbc3 gene; Binding site of nuclear extract from soybean nodules; Locate...Element 2 share a common motif; See S000320; nodule; leghaemoglobin; lbc3; root; Soybean (Glycine max) GATATATTAATATTTTATTTTATA ...

  10. Climbing elements in finite coxeter groups

    OpenAIRE

    Brady, Thomas; Kenny, Aisling; Watt, And Colum

    2010-01-01

    We define the notion of a climbing element in a finite real reflection group relative to a total order on the reflection set and we characterise these elements in the case where the total order arises from a bipartite Coxeter element.

  11. Element Cycles: An Environmental Chemistry Board Game

    Science.gov (United States)

    Pippins, Tracy; Anderson, Cody M.; Poindexter, Eric F.; Sultemeier, S. Whitney; Schultz, Linda D.

    2011-01-01

    "Element Cycles" is an activity designed to reinforce correlation of essential elements and their different forms in the ecosystem. Students are assigned essential elements to research as homework, then share results, and construct game boards with four ecosphere sections: geosphere (earth), hydrosphere (water), atmosphere (air), and biosphere…

  12. Heavy element production and limits to fusion

    International Nuclear Information System (INIS)

    The recent experiments on the synthesis of the heaviest elements led to the discovery of a region of nuclei of an unexpected high ground-state stability. The experimental results on our synthesis of new elements will be discussed as well as our new insights as their ground-state properties. The prospects to proceed to new elements will be outlined. (orig.)

  13. Determination of toxic elements in Malaysian foodstuffs

    International Nuclear Information System (INIS)

    This project is concentrating on the analysis of toxic elements content in seafoods including fishes, mussel, squid and prawn. Samples were collected from various places throughout Malay Peninsular. Samples were prepared according to RCA research protocol - nuclear techniques for toxic element in foodstuffs. Techniques used for elemental analysis were neutron activation analysis (instrumental and radiochemical) and anodic stripping voltametry. (author). 9 refs, 9 tabs

  14. Elements from chlorine to calcium nuclear reactions

    CERN Document Server

    Kunz, Wunibald

    1968-01-01

    Nuclear Tables: Part II Nuclear Reactions, Volume 3: The Elements from Chlorine to Calcium contains tabulations of the nuclear reaction values of elements chlorine, argon, potassium, and calcium. These tabulations provide the calculated Q-values of the elements and their isotopes. This book will be of value to general chemistry researchers.

  15. Elements of a Spatial Web

    DEFF Research Database (Denmark)

    Jensen, Christian S.

    2010-01-01

    Driven by factors such as the increasingly mobile use of the web and the proliferation of geo-positioning technologies, the web is rapidly acquiring a spatial aspect. Specifically, content and users are being geo-tagged, and services are being developed that exploit these tags. The research...... community is hard at work inventing means of efficiently supporting new spatial query functionality. Points of interest with a web presence, called spatial web objects, have a location as well as a textual description. Spatio-textual queries return such objects that are near a location argument and are...... relevant to a text argument. An important element in enabling such queries is to be able to rank spatial web objects. Another is to be able to determine the relevance of an object to a query. Yet another is to enable the efficient processing of such queries. The talk covers recent results on spatial web...

  16. Logical elements in living cells.

    Science.gov (United States)

    Kremen, A

    1984-11-01

    Recognition processes with enhanced accuracy (as performed by structures like enzymes or ribosomes) are investigated using elementary ideas of statistical mechanics and related concepts of thermodynamics. The analysis starts from a formal definition of recognition and provides a correspondence with appropriate physical properties of the macromolecular logical elements. Transitions of the recognizing system between different modifications are a necessary feature of a more exacting recognition process. Rearrangement steps provide the process with higher accuracy by performing two physical operations: (1) rearranging the phase space of the system so that the "correct" states be better separated from the "wrong" states and the probability of occupation of the "correct" states be enhanced, (2) directing the process toward the more favourable modifications thus formed. Both operations are related to changes in the physical properties of the recognizing system. These changes can be expressed as differences of macromolecular Gibbs energy levels; if ligand binding or release participate in a step, directivity of the step depends also on the actual chemical potentials of the ligands in solution. The two operations just mentioned resemble two basic operations known to be necessary in electronic digital networks: directivity of control and signal standardization. An analysis of the entire reaction catalysed by a macromolecular logical element takes into account the requirements imposed by the logical functions as well as the need that the chemical potential of the product be not restricted to very low values. To satisfy these conditions, the reaction must be supported by a so-called non-specific reaction, usually implemented by the cleavage reaction of a nucleoside triphosphate. PMID:6513567

  17. Trace Element Analysis of Selenium

    International Nuclear Information System (INIS)

    The present thesis divided into four chapters as follows:Chapter (1):This chapter contains an introduction on different oxidation states of organic and inorganic species for selenium in environmental and biological samples, the process for separation of selenium from these samples and the importance of selenium as a component for these samples. Also gives notes about the techniques which are used in the elemental analysis for selenium species and the detection limits for selenium in these techniques, selenium species in human body and the importance of these species in protecting the body from the different types of cancer and the sources of selenium in environmental samples (soil and water) and distribution levels of selenium in these samples.Chapter (2):This chapter is divided into two parts :The first part deals with the sample collection process for environmental samples (underground water, soil) and the wet digestion ( microwave digestion ) process of soil samples. It also contains the theory of work of the closed microwave digestion system.The second part contains detailed information concerning the theoretical considerations of the used analytical techniques. These techniques include Hydride generation - Atomic Absorption Spectrometer (HG-AAS), Inductively Coupled Plasma Mass Spectrometer (ICP-MS) and Neutron Activation Analysis (NAA).Chapter (3): This chapter includes the methods of sampling, sample preparation, and sample digesition. The measures of quality assurance are disscused in this chapter. It describes in details the closed microwave digestion technique and the analytical methods used in this study which are present in Central Laboratory for Elemental and Isotopic Analysis (CLEIA) and the Egypt Second Research Reactor (ETRR-2). The described techniques are Atomic Absorption Spectrometer (AAS 6 vario, Analytical Jena GmbH, Germany), JMS-PLASMAX2 Mass Spectrometer (ICP-MS) and the Egypt Second Research Reactor (NAA).

  18. Trace elements and cutaneous cancer

    International Nuclear Information System (INIS)

    The mineral macro- and micro-elements are playing essential biological roles. Some are co-factors of enzymes or act as organizers of the molecular structures of the cell or have an important role in ionic transport while some could be even beneficial as anti-tumor agents. Their concentration in the organism is closely linked to the long-term dietary intake, the environmental exposure, (e.g. cumulative exposure to chemicals from industrial sources could increase the incidence of skin cancer) and the health profile of the concerned subject. The research objective consisted in the examination of the content levels of some micro- and macro-elements found in the tumor tissue of patients having skin cancer disease, namely basal cell carcinoma (BCC), squamous cell carcinoma (SCC), malignant melanoma (MM), as well as benign tumor nevi. The analytical method of proton induced X-ray emission (PIXE) was used. The skin samples were collected from 22 cancer patients, aged 32-88 years, 11 males and 11 females. Controls were health skin samples (histopathological diagnosis) from patients having skin cancer. The samples were freeze-dried and then mineralized for PIXE analysis, using nitric acid at 1200 deg C temperature. The internal standard (Yttrium) technique was used for quantitative determination. Thin targets were measured in vacuum using a 3 MeV proton beam delivered by the Van de Graaff Tandem accelerator of the Institute for Physics and Nuclear Engineering in Bucharest - Magurele. A collimated beam (of 3 mm diameter) bombarded the target oriented at an angle of 45 angle with respect to the beam direction. The beam current entering the scattering chamber was maintained at several nAs. The samples were typically irradiated for a collected charge of 10 μC. The emitted X-rays have been detected by a Canberra Ge(HP) detector with energy resolution of 180 eV / 5.9 keV placed perpendicularly to the beam direction. Data manipulation and storage were performed with a Canberra S

  19. Multigroup finite element-boundary element method for neutron diffusion

    International Nuclear Information System (INIS)

    Full text: The finite element method (FEM) is an efficient method used for the solution of partial differential equations (PDE's) of engineering physics due to its symmetric, sparse and positive-definite coefficient matrix. FEM has been successfully applied for the solution of multigroup neutron transport and diffusion equations since 1970's. The boundary element method (BEM), on the other hand, is a newer method and is unique among the numerical methods used for the solution of PDE's with its property of confining the unknowns only to the boundaries of homogeneous regions, thus, greatly reducing matrix dimensions. The first application of BEM to the neutron diffusion equation (NDE) dates back to 1985 and many researchers are currently working in this area. Although BEM is known to have the desirable property of being an internal-mesh free method, this advantage is lost in some of its application to the NDE due to the existence of fission source volume integrals in fissionable regions unless domain-decomposition methods are used. To exploit the favorable properties of both FEM and BEM, a hybrid FE/BE method has been recently proposed for reflected systems treated by one or two-group diffusion theories in a recent paper co-authored by the first author. In this work, the hybrid FE/BE method for reflected systems is generalized to multigroup diffusion theory. The core is treated by FEM to preserve the high accuracy of FEM in such neutron-producing regions. Using a boundary integral equation formerly proposed by the second author, BEM, is utilized for the discretization of the reflector, thus, eliminating the internal mesh completely for this nonfissionable region. The multigroup FE/BE method has been implemented in our recently developed FORTRAN program. The program is validated by comparison of the calculated effective multiplication factor and the group fluxes with their analytical counterparts for a two-group reflected system. Comparison of these results and

  20. Gas chromatographic studies of the heaviest elements

    International Nuclear Information System (INIS)

    Recent experiments are reviewed which used on-line isothermal gas chromatography techniques for studying chemical properties of transactinide elements. Elements 106 (Sg) and 107(Bh) could assigned to groups 6 and 7 of the Periodic Table. The chemical characterization of elements 108 (Hs) and 112 has been prepared. A first attempt to chemically identify element 112 has been unsuccessful. Nevertheless, the chemical isolation of transactinide elements with Z>107 appears feasible. It could also serve to confirm the discovery of SHE decaying to nuclides which have previously been unknown

  1. A New Geochemical Classification of Elements

    Institute of Scientific and Technical Information of China (English)

    Qi Changmou; L. Lynn Chyi

    2001-01-01

    The geochemical classification proposed by Goldschmidt was based on meteoritic analysis and elemental partition in blast furnace. There are many surprises when applied to the discussion of natural occurrences. A modified classification of elements based on basic chemical properties and their occurrences. A modified classification of elements based on basic chemical properties and their occurrences in nature is, therefore, proposed for students learning geochemistry and geologists working in the field. Elements are classified into six groups including lithophile, oxyphile, siderophile, chalcophile, biophile, and atmophile elements. Five terms are taken from Goldshcmidt's original classification. Oxyphile is a new term.

  2. Chemical characterization of bohrium (element 107)

    Science.gov (United States)

    Eichler; Bruchle; Dressler; Dullmann; Eichler; Gaggeler; Gregorich; Hoffman; Hubener; Jost; Kirbach; Laue; Lavanchy; Nitsche; Patin; Piguet; Schadel; Shaughnessy; Strellis; Taut; Tobler; Tsyganov; Turler; Vahle; Wilk; Yakushev

    2000-09-01

    The arrangement of the chemical elements in the periodic table highlights resemblances in chemical properties, which reflect the elements' electronic structure. For the heaviest elements, however, deviations in the periodicity of chemical properties are expected: electrons in orbitals with a high probability density near the nucleus are accelerated by the large nuclear charges to relativistic velocities, which increase their binding energies and cause orbital contraction. This leads to more efficient screening of the nuclear charge and corresponding destabilization of the outer d and f orbitals: it is these changes that can give rise to unexpected chemical properties. The synthesis of increasingly heavy elements, now including that of elements 114, 116 and 118, allows the investigation of this effect, provided sufficiently long-lived isotopes for chemical characterization are available. In the case of elements 104 and 105, for example, relativistic effects interrupt characteristic trends in the chemical properties of the elements constituting the corresponding columns of the periodic table, whereas element 106 behaves in accordance with the expected periodicity. Here we report the chemical separation and characterization of six atoms of element 107 (bohrium, Bh), in the form of its oxychloride. We find that this compound is less volatile than the oxychlorides of the lighter elements of group VII, thus confirming relativistic calculations that predict the behaviour of bohrium, like that of element 106, to coincide with that expected on the basis of its position in the periodic table. PMID:10993071

  3. Chemical characterization of bohrium (element 107)

    Science.gov (United States)

    Eichler, R.; Brüchle, W.; Dressler, R.; Düllmann, Ch. E.; Eichler, B.; Gäggeler, H. W.; Gregorich, K. E.; Hoffman, D. C.; Hübener, S.; Jost, D. T.; Kirbach, U. W.; Laue, C. A.; Lavanchy, V. M.; Nitsche, H.; Patin, J. B.; Piguet, D.; Schädel, M.; Shaughnessy, D. A.; Strellis, D. A.; Taut, S.; Tobler, L.; Tsyganov, Y. S.; Türler, A.; Vahle, A.; WiIk, P. A.; Yakushev, A. B.

    2000-09-01

    The arrangement of the chemical elements in the periodic table highlights resemblances in chemical properties, which reflect the elements' electronic structure. For the heaviest elements, however, deviations in the periodicity of chemical properties are expected: electrons in orbitals with a high probability density near the nucleus are accelerated by the large nuclear charges to relativistic velocities, which increase their binding energies and cause orbital contraction. This leads to more efficient screening of the nuclear charge and corresponding destabilization of the outer d and f orbitals: it is these changes that can give rise to unexpected chemical properties. The synthesis of increasingly heavy elements, now including that of elements 114, 116 and 118, allows the investigation of this effect, provided sufficiently long-lived isotopes for chemical characterization are available. In the case of elements 104 and 105, for example, relativistic effects interrupt characteristic trends in the chemical properties of the elements constituting the corresponding columns of the periodic table, whereas element 106 behaves in accordance with the expected periodicity. Here we report the chemical separation and characterization of six atoms of element 107 (bohrium, Bh), in the form of its oxychloride. We find that this compound is less volatile than the oxychlorides of the lighter elements of group VII, thus confirming relativistic calculations that predict the behaviour of bohrium, like that of element 106, to coincide with that expected on the basis of its position in the periodic table.

  4. Superheavy element chemistry. Achievements and perspectives

    International Nuclear Information System (INIS)

    Superheavy elements have been synthesized and chemically characterized one-atom-at-a-time up to element 108. Presently, the quest for element 112 is one of the hottest topics in this field. The transactinide elements 104 to 108 are members of group 4 to 8 of the Periodic Table and element 112 belongs into group 12. Chemical properties of some of these elements, like elements 104 and 105, show stunning deviations from simple extrapolations within their respective group while others exhibit great similarities with their lighter homologues elements. First experiments to investigate seaborgium (Sg, element 106) in aqueous solution were performed. Again, in large international collaborations at the GSI, several gas-phase chemistry experiments were performed with hassium (Hs, element 108). Recently, the highly efficient and very clean separation of Hs was applied for nuclear studies of various Hs nuclides investigating their cross section and their nuclear decay properties in the region of the doubly-magic 270Hs (Z=108, N=162). To overcome certain limitations of the presently used on-line chemical separations the new TransActinide Separation and Chemistry Apparatus (TASCA) - with a gas-filled recoil separator as a front-end tool - was designed and built at the GSI in a collaborative effort. Presently in its commissioning phase, TASCA shall be a key instrument for a big leap into quantitatively and qualitatively new experiments in the region of superheavy elements. (author)

  5. Synthesis of superheavy elements by cold fusion

    Energy Technology Data Exchange (ETDEWEB)

    Hofmann, S. [GSI Helmholtzzentrum fuer Schwerionenforschung GmbH, Darmstadt (Germany); Frankfurt Univ. (Germany). Inst. fuer Kernphysik

    2011-07-01

    The new elements from Z = 107 to 112 were synthesized in cold fusion reactions based on targets of lead and bismuth. The principle physical concepts are presented which led to the application of this reaction type in search experiments for new elements. Described are the technical developments from early mechanical devices to experiments with recoil separators. An overview is given of present experiments which use cold fusion for systematic studies and synthesis of new isotopes. Perspectives are also presented for the application of cold fusion reactions in synthesis of elements beyond element 113, the so far heaviest element produced in a cold fusion reaction. Further, the transition of hot fusion to cold fusion is pointed out, which occurs in reactions for synthesis of elements near Z = 126 using actinide targets and beams of neutron rich isotopes of elements from iron to germanium. (orig.)

  6. Synthesis of superheavy elements by cold fusion

    International Nuclear Information System (INIS)

    The new elements from Z = 107 to 112 were synthesized in cold fusion reactions based on targets of lead and bismuth. The principle physical concepts are presented which led to the application of this reaction type in search experiments for new elements. Described are the technical developments from early mechanical devices to experiments with recoil separators. An overview is given of present experiments which use cold fusion for systematic studies and synthesis of new isotopes. Perspectives are also presented for the application of cold fusion reactions in synthesis of elements beyond element 113, the so far heaviest element produced in a cold fusion reaction. Further, the transition of hot fusion to cold fusion is pointed out, which occurs in reactions for synthesis of elements near Z = 126 using actinide targets and beams of neutron rich isotopes of elements from iron to germanium. (orig.)

  7. Pump element for a tube pump

    DEFF Research Database (Denmark)

    2011-01-01

    The invention relates to a tube pump comprising a tube and a pump element inserted in the tube, where the pump element comprises a rod element and a first and a second non-return valve member positioned a distance apart on the rod element. The valve members are oriented in the same direction...... portion acts to alternately close and open the valve members thereby generating a fluid flow through the tube. The invention further relates to a pump element comprising at least two non-return valve members connected by a rod element, and for insertion in an at least partly flexible tube in such tube...... pump as mentioned above, thereby acting to generate a fluid flow through the tube upon repeated deformation of the tube between the two valve members. The pump element may comprise a connecting part for coupling to another tube and may comprise a sealing part establishing a fluid tight connection to a...

  8. Osmolality of Elemental and Semi-Elemental Formulas Supplemented with Nonprotein Energy Supplements

    OpenAIRE

    Pereira-da-Silva, L; Pitta-Grós Dias, M; Virella, D; Serelha, M.

    2008-01-01

    Elemental and semi-elemental formulas are used to feed infants with short bowel syndrome, who may not be able to tolerate feeds of more than 310 mOsm kg(-1). The present study aimed to measure the osmolality of elemental and semi-elemental formulas at different concentrations, with and without the addition of nonprotein energy supplements.

  9. Development of polygon elements based on the scaled boundary finite element method

    International Nuclear Information System (INIS)

    We aim to extend the scaled boundary finite element method to construct conforming polygon elements. The development of the polygonal finite element is highly anticipated in computational mechanics as greater flexibility and accuracy can be achieved using these elements. The scaled boundary polygonal finite element will enable new developments in mesh generation, better accuracy from a higher order approximation and better transition elements in finite element meshes. Polygon elements of arbitrary number of edges and order have been developed successfully. The edges of an element are discretised with line elements. The displacement solution of the scaled boundary finite element method is used in the development of shape functions. They are shown to be smooth and continuous within the element, and satisfy compatibility and completeness requirements. Furthermore, eigenvalue decomposition has been used to depict element modes and outcomes indicate the ability of the scaled boundary polygonal element to express rigid body and constant strain modes. Numerical tests are presented; the patch test is passed and constant strain modes verified. Accuracy and convergence of the method are also presented and the performance of the scaled boundary polygonal finite element is verified on Cook's swept panel problem. Results show that the scaled boundary polygonal finite element method outperforms a traditional mesh and accuracy and convergence are achieved from fewer nodes. The proposed method is also shown to be truly flexible, and applies to arbitrary n-gons formed of irregular and non-convex polygons.

  10. Micro fuel elements and fuel elements studies with the use of pre-irradiation

    International Nuclear Information System (INIS)

    The ampoule and loop canal designs for irradiation of HTGR fuel elements and methods of investigation of their radiation stability are described. The results are presented on the measurement of fission product yield from fuel elements during irradiation. Irradiation main parameters are in agreement with HTGR operating conditions. The results of metallographic investigations of the micro fuel elements irradiated are given. The processes taking place in fuel elements and microfuel elements during irradiation are discussed

  11. Efficiency analysis of betavoltaic elements

    Science.gov (United States)

    Sachenko, A. V.; Shkrebtii, A. I.; Korkishko, R. M.; Kostylyov, V. P.; Kulish, M. R.; Sokolovskyi, I. O.

    2015-09-01

    The conversion of energy of electrons produced by a radioactive β-source into electricity in a Si and SiC p-n junctions is modeled. The features of the generation function that describes the electron-hole pair production by an electron flux and the emergence of a "dead layer" are discussed. The collection efficiency Q that describes the rate of electron-hole pair production by incident beta particles, is calculated taking into account the presence of the dead layer. It is shown that in the case of high-grade Si p-n junctions, the collection efficiency of electron-hole pairs created by a high-energy electrons flux (such as, e.g., Pm-147 beta flux) is close or equal to unity in a wide range of electron energies. For SiC p-n junctions, Q is near unity only for electrons with relatively low energies of about 5 keV (produced, e.g., by a tritium source) and decreases rapidly with further increase of electron energy. The conditions, under which the influence of the dead layer on the collection efficiency is negligible, are determined. The open-circuit voltage is calculated for realistic values of the minority carriers' diffusion coefficients and lifetimes in Si and SiC p-n junctions, irradiated by a high-energy electrons flux. Our calculations allow to estimate the attainable efficiency of betavoltaic elements.

  12. Fuel elements of thermionic converters

    International Nuclear Information System (INIS)

    Work on thermionic nuclear power systems has been performed in Russia within the framework of the TOPAZ reactor program since the early 1960s. In the TOPAZ in-core thermionic convertor reactor design, the fuel element's cladding is also the thermionic convertor's emitter. Deformation of the emitter can lead to short-circuiting and is the primary cause of premature TRC failure. Such deformation can be the result of fuel swelling, thermocycling, or increased unilateral pressure on the emitter due to the release of gaseous fission products. Much of the work on TRCs has concentrated on preventing or mitigating emitter deformation by improving the following materials and structures: nuclear fuel; emitter materials; electrical insulators; moderator and reflector materials; and gas-exhaust device. In addition, considerable effort has been directed toward the development of experimental techniques that accurately mimic operational conditions and toward the creation of analytical and numerical models that allow operational conditions and behavior to be predicted without the expense and time demands of in-pile tests. New and modified materials and structures for the cores of thermionic NPSs and new fabrication processes for the materials have ensured the possibility of creating thermionic NPSs for a wide range of powers, from tens to several hundreds of kilowatts, with life spans of 5 to 10 years

  13. Dynamic heater for display elements

    Science.gov (United States)

    Dehmlow, Brian P.; Bishop, Gary D.; Steffensmeier, Martin J.; Sampica, James D.; Skarohlid, Mark C.

    1997-07-01

    Liquid crystal display (LCD) deliver optimal performance when the entire display surface is isothermal and at a controllable temperature. This condition creates uniform electro-optical properties within the liquid crystal layer. This paper describes a dynamic, multicontact heater system that actively compensates for uneven heat loads, thereby creating the desired isothermal condition. The heater system includes a uniform resistive sheet, with multiple electrical contacts around the perimeter. A switch network connects each heater contact to a power supply, ground potential, or a high impedance. A microprocessor monitors the display temperature, and detects non-uniformity, and selectively applies heat to cold areas of the display. The dynamic heater system employs a variety of heating patterns to create the desired isothermal condition.Heating patterns vary in duration, power applied, and location on the display face. The microprocessor control loop can also detect and isolate faulty drive elements, and compensate for non- uniformity in the heater itself. The heater prevents stress- induced delaminations, mechanical distortions, and stress- induced birefringence in optical components. Test results indicate that a dynamic heater can be beneficial in the thermal design of LCD products.

  14. Functional Metamirrors Using Bianisotropic Elements

    Science.gov (United States)

    Asadchy, V. S.; Ra'di, Y.; Vehmas, J.; Tretyakov, S. A.

    2015-03-01

    Conventional mirrors obey the simple reflection law that a plane wave is reflected as a plane wave, at the same angle. To engineer spatial distributions of fields reflected from a mirror, one can either shape the reflector or position some phase-correcting elements on top of a mirror surface. Here we show, both theoretically and experimentally, that full-power reflection with general control over the reflected wave phase is possible with a single-layer array of deeply subwavelength inclusions. These proposed artificial surfaces, metamirrors, provide various functions of shaped or nonuniform reflectors without utilizing any mirror. This can be achieved only if the forward and backward scattering of the inclusions in the array can be engineered independently, and we prove that it is possible using electrically and magnetically polarizable inclusions. The proposed subwavelength inclusions possess desired reflecting properties at the operational frequency band, while at other frequencies the array is practically transparent. The metamirror concept leads to a variety of applications over the entire electromagnetic spectrum, such as optically transparent focusing antennas for satellites, multifrequency reflector antennas for radio astronomy, low-profile conformal antennas for telecommunications, and nanoreflectarray antennas for integrated optics.

  15. Designing Rolling-Element Bearings

    Science.gov (United States)

    Moore, James D., Jr.

    2007-01-01

    Bearing Analysis Tool (BAT) is a computer program for designing rolling-element bearings for cryogenic turbomachines. BAT provides a graphical user interface (GUI) that guides the entry of data to develop mathematical models of bearings. The GUI breaks model data into logical subsets that are entered through logic-driven input screens. The software generates a threedimensional graphical model of a bearing as the data are entered. Most dataentry errors become immediately obvious in the graphical model. BAT provides for storage of all the data on a shaft/bearing system, enabling the creation of a library of proven designs. Data from the library can be transferred to subsequent projects by use of simple cut-and-paste routines. BAT includes a library of temperature- dependent cryogenic bearing-material properties for use in the mathematical models. BAT implements algorithms that (1) enable the user to select combinations of design and/or operating-condition parameters, and then (2) automatically optimize the design by performing trade studies over all of the parameter combinations. This feature enables optimization over a large trade space in a fraction of the time taken when using prior bearingmodel software.

  16. Mars Surface Tunnel Element Concept

    Science.gov (United States)

    Rucker, Michelle A.; Jefferies, Sharon; Howe, A. Scott; Howard, Robert; Mary, Natalie; Watson, Judith; Lewis, Ruthan

    2016-01-01

    When the first human visitors on Mars prepare to return to Earth, they will have to comply with stringent planetary protection requirements. Apollo Program experience warns that opening an EVA hatch directly to the surface will bring dust into the ascent vehicle. To prevent inadvertent return of potential Martian contaminants to Earth, careful consideration must be given to the way in which crew ingress their Mars Ascent Vehicle (MAV). For architectures involving more than one surface element-such as an ascent vehicle and a pressurized rover or surface habitat-a retractable tunnel that eliminates extravehicular activity (EVA) ingress is an attractive solution. Beyond addressing the immediate MAV access issue, a reusable tunnel may be useful for other surface applications, such as rover to habitat transfer, once its primary mission is complete. A National Aeronautics and Space Administration (NASA) team is studying the optimal balance between surface tunnel functionality, mass, and stowed volume as part of the Evolvable Mars Campaign (EMC). The study team began by identifying the minimum set of functional requirements needed for the tunnel to perform its primary mission, as this would presumably be the simplest design, with the lowest mass and volume. This Minimum Functional Tunnel then becomes a baseline against which various tunnel design concepts and potential alternatives can be traded, and aids in assessing the mass penalty of increased functionality. Preliminary analysis indicates that the mass of a single-mission tunnel is about 237 kg, not including mass growth allowance.

  17. Functions over RDF Language Elements

    Science.gov (United States)

    Schandl, Bernhard

    RDF data are usually accessed using one of two methods: either, graphs are rendered in forms perceivable by human users (e.g., in tabular or in graphical form), which are difficult to handle for large data sets. Alternatively, query languages like SPARQL provide means to express information needs in structured form; hence they are targeted towards developers and experts. Inspired by the concept of spreadsheet tools, where users can perform relatively complex calculations by splitting formulas and values across multiple cells, we have investigated mechanisms that allow us to access RDF graphs in a more intuitive and manageable, yet formally grounded manner. In this paper, we make three contributions towards this direction. First, we present RDFunctions, an algebra that consists of mappings between sets of RDF language elements (URIs, blank nodes, and literals) under consideration of the triples contained in a background graph. Second, we define a syntax for expressing RDFunctions, which can be edited, parsed and evaluated. Third, we discuss Tripcel, an implementation of RDFunctions using a spreadsheet metaphor. Using this tool, users can easily edit and execute function expressions and perform analysis tasks on the data stored in an RDF graph.

  18. Nuclear fuel element and container

    International Nuclear Information System (INIS)

    The invention is based on the discovery that a substantial reduction in metal embrittlement or stress corrosion cracking from fuel pellet-cladding interaction can be achieved by the use of a copper layer or liner in proximity to the nuclear fuel, and an intermediate zirconium oxide barrier layer between the copper layer and the zirconium cladding substrate. The intermediate zirconia layer is a good copper diffusion barrier; also, if the zirconium cladding surface is modified prior to oxidation, copper can be deposited by electroless plating. A nuclear fuel element is described which comprises a central core of fuel material and an elongated container using the system outlined above. The method for making the container is again described. It comprises roughening or etching the surface of the zirconium or zirconium alloy container, oxidizing the resulting container, activating the oxidized surface to allow for the metallic coating of such surfaces by electroless deposition and further coating the activated-oxidized surface of the zirconium or zirconium alloy container with copper, iron or nickel or an alloy thereof. (U.K.)

  19. Finite element coiled cochlea model

    Science.gov (United States)

    Isailovic, Velibor; Nikolic, Milica; Milosevic, Zarko; Saveljic, Igor; Nikolic, Dalibor; Radovic, Milos; Filipović, Nenad

    2015-12-01

    Cochlea is important part of the hearing system, and thanks to special structure converts external sound waves into neural impulses which go to the brain. Shape of the cochlea is like snail, so geometry of the cochlea model is complex. The simplified cochlea coiled model was developed using finite element method inside SIFEM FP7 project. Software application is created on the way that user can prescribe set of the parameters for spiral cochlea, as well as material properties and boundary conditions to the model. Several mathematical models were tested. The acoustic wave equation for describing fluid in the cochlea chambers - scala vestibuli and scala timpani, and Newtonian dynamics for describing vibrations of the basilar membrane are used. The mechanical behavior of the coiled cochlea was analyzed and the third chamber, scala media, was not modeled because it does not have a significant impact on the mechanical vibrations of the basilar membrane. The obtained results are in good agreement with experimental measurements. Future work is needed for more realistic geometry model. Coiled model of the cochlea was created and results are compared with initial simplified coiled model of the cochlea.

  20. Trace Element Management in Rice

    Directory of Open Access Journals (Sweden)

    Abin Sebastian

    2015-08-01

    Full Text Available Trace elements (TEs are vital for the operation of metabolic pathways that promote growth and structural integrity. Paddy soils are often prone to TE limitation due to intensive cultivation and irrigation practices. Apart from this, rice paddies are potentially contaminated with transition metals such as Cd, which are often referred to as toxic TEs. Deficiency of TEs in the soil not only delays plant growth but also causes exposure of plant roots to toxic TEs. Fine-tuning of nutrient cycling in the rice field is a practical solution to cope with TEs deficiency. Adjustment of soil physicochemical properties, biological process such as microbial activities, and fertilization helps to control TEs mobilization in soil. Modifications in root architecture, metal transporters activity, and physiological processes are also promising approaches to enhance TEs accumulation in grains. Through genetic manipulation, these modifications help to increase TE mining capacity of rice plants as well as transport and trafficking of TEs into the grains. The present review summarizes that regulation of TE mobilization in soil, and the genetic improvement of TE acquisition traits help to boost essential TE content in rice grain.

  1. INCOMES AND EXPENSES DEFINE ELEMENTS OF THE BUDGETARY ACCOUNTING OF PUBLIC INSTITUTIONS ACCOUNTING

    OpenAIRE

    Iuliana Cenar

    2008-01-01

    The process of reforming accounting has been transposed to the level ofpublic institutions for nearly 3 years. It was an audacious attempt by Cutting out theheavy legacy of the past, limited to income earned and expenses paid. The next stageof reform is sedimentation, decanting, and the formulation of strategies accountingfor supreme desideratum achievement of accounting - the image faithful. In thisprocess should be involved both theory and practice of accounting. It is why weconsidered appr...

  2. Beryllium reflector elements for PARR-1

    International Nuclear Information System (INIS)

    The LEU fuel of PARR-1 was designed for a discharge burnup of 35% of initial /sup 235/U loading. Recently some of the fuel elements have been discharged from the PARR-1 core after attaining the burnup closed to the design value. These fuel elements were discharged due to diminished excess reactivity although they were physically intact. After satisfactory performance of these fuel elements there has been a desire to explore the possibility of enhancing the discharge burnup by boosting up the core reactivity. Use of better reflector elements is one of the methods to obtain this goal. In this report properties of various reflector elements have been compared and it is found that use of Beryllium metal reflector elements may be a promising choice for this purpose. (author)

  3. Spacer for supporting fuel element boxes

    International Nuclear Information System (INIS)

    A spacer plate unit arranged externally on each side and at a predetermined level of a polygonal fuel element box for mutually supporting, with respect to one another, a plurality of the fuel element boxes forming a fuel element bundle, is formed of a first and a second spacer plate part each having the same length and the same width and being constituted of unlike first and second materials, respectively. The first and second spacer plate parts of the several spacer plate units situated at the predetermined level are arranged in an alternating continuous series when viewed in the peripheral direction of the fuel element box, so that any two spacer plate units belonging to face-to-face oriented sides of two adjoining fuel element boxes in the fuel element bundle define interfaces of unlike materials

  4. Stable isotopes for heavy element production

    CERN Document Server

    Lommel, B; Hofmann, S; Kindler, B; Klemm, J; Steiner, J; Tinschert, K

    2003-01-01

    The synthesis of heavy elements and the search for new superheavy elements is one of the exciting fields in modern nuclear physics and chemistry. Heavy elements are produced by heavy-ion fusion reactions. Necessary prerequisites are intense heavy-ion beams from pure isotopic material and thin isotopically enriched targets. At GSI the elements from 107 to 112 were produced using targets of Pb and Bi and beams of the most neutron rich isotopes of Cr, Fe, Ni, and Zn. Experimental set-up consisting of target wheel, velocity filter SHIP (Separator for Heavy Ion Reaction Products), and detector system is presented. Status of the ion source techniques for delivering intense and stable beams for this kind of experiment is shortly described. The manufacturing and properties of various source - target combinations used for the synthesis of the elements by now are discussed in detail as well as the possibilities for extending the experiments into the region of superheavy elements.

  5. Automated Fuel Element Closure Welding System

    International Nuclear Information System (INIS)

    The Automated Fuel Element Closure Welding System is a robotic device that will load and weld top end plugs onto nuclear fuel elements in a highly radioactive and inert gas environment. The system was developed at Argonne National Laboratory-West as part of the Fuel Cycle Demonstration. The welding system performs four main functions, it (1) injects a small amount of a xenon/krypton gas mixture into specific fuel elements, and (2) loads tiny end plugs into the tops of fuel element jackets, and (3) welds the end plugs to the element jackets, and (4) performs a dimensional inspection of the pre- and post-welded fuel elements. The system components are modular to facilitate remote replacement of failed parts. The entire system can be operated remotely in manual, semi-automatic, or fully automatic modes using a computer control system. The welding system is currently undergoing software testing and functional checkout

  6. Retrotransposition of long interspersed nucleotide element-1 is associated with colitis but not tumors in a murine colitic cancer model.

    Directory of Open Access Journals (Sweden)

    Takeshi Otsubo

    Full Text Available Long interspersed element-1 (L1 is a transposable element that can move within the genome, potentially leading to genome diversity and modified gene function. Although L1 activity in somatic cells is normally suppressed through DNA methylation, some L1s are activated in tumors including colorectal carcinoma. However, how L1-retrotransposition (L1-RTP is involved in gastrointestinal disorders remains to be elucidated. We hypothesized that L1-RTP in somatic cells might contribute to colitis-associated cancer (CAC. To address this, we employed an experimental model of CAC using transgenic L1-reporter mice carrying a human L1-EGFP reporter gene. Mice were subjected to repeated cycles of colitis induced by administration of dextran sodium sulfate (DSS in drinking water with injection of carcinogen azoxymethane (AOM. L1-RTP levels were measured by a quantitative polymerase chain reaction targeting the newly inserted reporter EGFP in various tissues and cell types, including samples obtained by laser microdissection and cell sorting with flow cytometry. DNA methylation levels of the human L1 promoter were analyzed by bisulfite pyrosequencing. AOM+DSS-treated mice exhibited significantly higher levels of L1-RTP in whole colon tissue during the acute phase of colitis when compared with control naïve mice. L1-RTP levels in whole colon tissue were positively correlated with the histological severity of colitis and degree of neutrophil infiltration into the lamina propria (LP, but not with tumor development in the colon. L1-RTP was enriched in LP mesenchymal cells rather than epithelial cells (ECs, myeloid, or lymphoid cells. DNA methylation levels of the human L1 promoter region showed a negative correlation with L1-RTP levels. L1-RTP was absent from most tumors found in 22-week-old mice. In conclusion, we demonstrated that L1-RTP was induced in the mouse CAC mucosa in accordance with the acute inflammatory response; however, retrotransposition appears

  7. Benchmarking the QUAD4/TRIA3 element

    Science.gov (United States)

    Pitrof, Stephen M.; Venkayya, Vipperla B.

    1993-01-01

    The QUAD4 and TRIA3 elements are the primary plate/shell elements in NASTRAN. These elements enable the user to analyze thin plate/shell structures for membrane, bending and shear phenomena. They are also very new elements in the NASTRAN library. These elements are extremely versatile and constitute a substantially enhanced analysis capability in NASTRAN. However, with the versatility comes the burden of understanding a myriad of modeling implications and their effect on accuracy and analysis quality. The validity of many aspects of these elements were established through a series of benchmark problem results and comparison with those available in the literature and obtained from other programs like MSC/NASTRAN and CSAR/NASTRAN. Never-the-less such a comparison is never complete because of the new and creative use of these elements in complex modeling situations. One of the important features of QUAD4 and TRIA3 elements is the offset capability which allows the midsurface of the plate to be noncoincident with the surface of the grid points. None of the previous elements, with the exception of bar (beam), has this capability. The offset capability played a crucial role in the design of QUAD4 and TRIA3 elements. It allowed modeling layered composites, laminated plates and sandwich plates with the metal and composite face sheets. Even though the basic implementation of the offset capability is found to be sound in the previous applications, there is some uncertainty in relatively simple applications. The main purpose of this paper is to test the integrity of the offset capability and provide guidelines for its effective use. For the purpose of simplicity, references in this paper to the QUAD4 element will also include the TRIA3 element.

  8. Integrating Environmentally Responsive Elements in Buildings

    OpenAIRE

    Heiselberg, Per; Andresen, Inger; Perino, Marco; van der Aa, Ad

    2006-01-01

    Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie with technologies that promote the integration of responsive building elements and building services in integrated building concepts. In order to address some of these issues an international research effort, IE...

  9. Domain decomposition methods for mortar finite elements

    Energy Technology Data Exchange (ETDEWEB)

    Widlund, O.

    1996-12-31

    In the last few years, domain decomposition methods, previously developed and tested for standard finite element methods and elliptic problems, have been extended and modified to work for mortar and other nonconforming finite element methods. A survey will be given of work carried out jointly with Yves Achdou, Mario Casarin, Maksymilian Dryja and Yvon Maday. Results on the p- and h-p-version finite elements will also be discussed.

  10. Rotationally invariant distortion resistant finite-elements.

    OpenAIRE

    Cowan, T.; Coombs, W.M.

    2014-01-01

    The predictive capability of conventional iso-parametric finite-elements deteriorates with mesh distortion. In the case of geometrically non-linear analysis, changes in geometry causing severe distortion can result in negative Jacobian mapping between the local and global systems resulting in numerical breakdown. This paper presents a finite-element formulation that is resistant to irregular mesh geometries and large element distortions whilst remaining invariant to rigid body motion. The pre...

  11. All Spin Nano-magnetic State Elements

    OpenAIRE

    Manipatruni, Sasikanth; Nikonov, Dmitri E.; Young, Ian A.

    2012-01-01

    We propose an all spin state element to enable all spin state machines using spin currents and nanomagnets. We demonstrate via numerical simulations the operation of a state element a critical building block for synchronous, sequential logic computation. The numerical models encompass Landau-Lifshitz-Gilbert (LLG) nanomagnet dynamics with stochastic models and vector spin-transport in metallic magnetic and non-magnetic channels. Combined with all spin combinatorial logic, the state elements c...

  12. Benchmarking the QUAD4/TRIA3 element

    Science.gov (United States)

    Pitrof, Stephen M.; Venkayya, Vipperla B.

    1993-09-01

    The QUAD4 and TRIA3 elements are the primary plate/shell elements in NASTRAN. These elements enable the user to analyze thin plate/shell structures for membrane, bending and shear phenomena. They are also very new elements in the NASTRAN library. These elements are extremely versatile and constitute a substantially enhanced analysis capability in NASTRAN. However, with the versatility comes the burden of understanding a myriad of modeling implications and their effect on accuracy and analysis quality. The validity of many aspects of these elements were established through a series of benchmark problem results and comparison with those available in the literature and obtained from other programs like MSC/NASTRAN and CSAR/NASTRAN. Never-the-less such a comparison is never complete because of the new and creative use of these elements in complex modeling situations. One of the important features of QUAD4 and TRIA3 elements is the offset capability which allows the midsurface of the plate to be noncoincident with the surface of the grid points. None of the previous elements, with the exception of bar (beam), has this capability. The offset capability played a crucial role in the design of QUAD4 and TRIA3 elements. It allowed modeling layered composites, laminated plates and sandwich plates with the metal and composite face sheets. Even though the basic implementation of the offset capability is found to be sound in the previous applications, there is some uncertainty in relatively simple applications. The main purpose of this paper is to test the integrity of the offset capability and provide guidelines for its effective use. For the purpose of simplicity, references in this paper to the QUAD4 element will also include the TRIA3 element.

  13. Completely normal elements in finite abelian extensions

    CERN Document Server

    Koo, Ja Kung

    2011-01-01

    We give a completely normal element in the maximal real subfield of a cyclotomic field over the field of rational numbers, which is different from that of Okada. This result is a consequence of the criterion for a normal element developed in [Normal bases of ray class fields over imaginary quadratic fields, Math. Zeit.]. Furthermore, we find a completely normal element in certain extension of modular function fields in terms of a quotient of the modular discriminant function.

  14. Superheavy Elements Challenge Experimental and Theoretical Chemistry

    International Nuclear Information System (INIS)

    When reflecting on the story of superheavy elements, the author, an experimenter, acknowledges the role, which the predictions of nuclear and chemical theories have played in ongoing studies. Today, the problems of major interest for experimental chemistry are the studies of elements 112 and 114 including their chemical identification. Advanced quantum chemistry calculations of atoms and molecules would be of much help. First experiments with element 112 evidence that the metal is much more volatile and inert than mercury. (author)

  15. The elements of life and medicines.

    Science.gov (United States)

    Chellan, Prinessa; Sadler, Peter J

    2015-03-13

    Which elements are essential for human life? Here we make an element-by-element journey through the periodic table and attempt to assess whether elements are essential or not, and if they are, whether there is a relevant code for them in the human genome. There are many difficulties such as the human biochemistry of several so-called essential elements is not well understood, and it is not clear how we should classify elements that are involved in the destruction of invading microorganisms, or elements which are essential for microorganisms with which we live in symbiosis. In general, genes do not code for the elements themselves, but for specific chemical species, i.e. for the element, its oxidation state, type and number of coordinated ligands, and the coordination geometry. Today, the biological periodic table is in a position somewhat similar to Mendeleev's chemical periodic table of 1869: there are gaps and we need to do more research to fill them. The periodic table also offers potential for novel therapeutic and diagnostic agents, based on not only essential elements, but also non-essential elements, and on radionuclides. Although the potential for inorganic chemistry in medicine was realized more than 2000 years ago, this area of research is still in its infancy. Future advances in the design of inorganic drugs require more knowledge of their mechanism of action, including target sites and metabolism. Temporal speciation of elements in their biological environments at the atomic level is a major challenge, for which new methods are urgently needed. PMID:25666066

  16. Superheavy Elements Challenge Experimental and Theoretical Chemistry

    CERN Document Server

    Zvára, I

    2003-01-01

    When reflecting on the story of superheavy elements, the an experimenter, acknowledges the role, which the predictions of nuclear and chemical theories have played in ongoing studies. Today, the problems of major interest for experimental chemistry are the studies of elements 112 and 114 including their chemical identification. Advanced quantum chemistry calculations of atoms and molecules would be of much help. First experiments with element 112 evidence that the metal is much more volatile and inert than mercury.

  17. Noncoding Elements: Evolution and Epigenetic Regulation

    KAUST Repository

    Seridi, Loqmane

    2016-03-09

    When the human genome project was completed, it revealed a surprising result. 98% of the genome did not code for protein of which more than 50% are repeats— later known as ”Junk DNA”. However, comparative genomics unveiled that many noncoding elements are evolutionarily constrained; thus luckily to have a role in genome stability and regulation. Though, their exact functions remained largely unknown. Several large international consortia such as the Functional Annotation of Mammalian Genomes (FANTOM) and the Encyclopedia of DNA Elements (ENCODE) were set to understand the structure and the regulation of the genome. Specifically, these endeavors aim to measure and reveal the transcribed components and functional elements of the genome. One of the most the striking findings of these efforts is that most of the genome is transcribed, including non-conserved noncoding elements and repeat elements. Specifically, we investigated the evolution and epigenetic properties of noncoding elements. 1. We compared genomes of evolutionarily distant species and showed the ubiquity of constrained noncoding elements in metazoa. 2. By integrating multi-omic data (such as transcriptome, nucleosome profiling, histone modifications), I conducted a comprehensive analysis of epigenetic properties (chromatin states) of conserved noncoding elements in insects. We showed that those elements have distinct and protective sequence features, undergo dynamic epigenetic regulation, and appear to be associated with the structural components of the chromatin, replication origins, and nuclear matrix. 3. I focused on the relationship between enhancers and repetitive elements. Using Cap Analysis of Gene Expression (CAGE) and RNASeq, I compiled a full catalog of active enhancers (a class of noncoding elements) during myogenesis of human primary cells of healthy donors and donors affected by Duchenne muscular dystrophy (DMD). Comparing the two time-courses, a significant change in the epigenetic

  18. Generalizations of the primitive element theorem

    Directory of Open Access Journals (Sweden)

    Panagiotis Nikolopoulos

    1991-09-01

    Full Text Available In this paper we generalize the primitive element theorem to the generation of separable algebras over fields and rings. We prove that any finitely generated separable algebra over an infinite field is generated by two elements and if the algebra is commutative it can be generated by one element. We then derive similar results for finitely generated separable algebras over semilocal rings.

  19. All-spin nanomagnetic state elements

    Science.gov (United States)

    Manipatruni, Sasikanth; Nikonov, Dmitri E.; Young, Ian A.

    2013-08-01

    We propose an all-spin state element using spin currents and nanomagnets to enable all-spin state machines for digital computing. We demonstrate via numerical simulations the operation of the state element, a critical building block for synchronous, sequential logic computation. The numerical models encompass Landau-Lifshitz-Gilbert nanomagnet dynamics with stochastic models and vector spin-transport in metallic magnetic and non-magnetic channels. Combined with all-spin combinatorial logic, the state elements can enable synchronous and asynchronous computing elements.

  20. Spectral analysis method for detecting an element

    Science.gov (United States)

    Blackwood, Larry G [Idaho Falls, ID; Edwards, Andrew J [Idaho Falls, ID; Jewell, James K [Idaho Falls, ID; Reber, Edward L [Idaho Falls, ID; Seabury, Edward H [Idaho Falls, ID

    2008-02-12

    A method for detecting an element is described and which includes the steps of providing a gamma-ray spectrum which has a region of interest which corresponds with a small amount of an element to be detected; providing nonparametric assumptions about a shape of the gamma-ray spectrum in the region of interest, and which would indicate the presence of the element to be detected; and applying a statistical test to the shape of the gamma-ray spectrum based upon the nonparametric assumptions to detect the small amount of the element to be detected.