WorldWideScience

Sample records for cacta-like transposable element

  1. Transposable elements: The enemies within.

    Science.gov (United States)

    Scarfò, Irene; Pellegrino, Elisa; Mereu, Elisabetta; Inghirami, Giorgio; Piva, Roberto

    2016-10-01

    Understanding transformation mechanisms other than genetic aberrations has recently captured the attention of cancer researchers. To date, the role of transposable elements (TEs) in tumor development remains largely undefined. However, an increasing number of studies have reported that loss of epigenetic control causes TE reactivation and consequent oncogenic transcription. Here, we discuss principal examples of TEs-driven oncogenesis. Available data suggest that long terminal repeats and long interspersed nuclear elements play a pivotal role as alternative promoters. These findings provide definitive experimental evidence that repetitive elements are a powerful underestimated force toward oncogenesis and open the possibility to new therapeutic treatments.

  2. Chromosome rearrangements and transposable elements.

    Science.gov (United States)

    Lonnig, Wolf-Ekkehard; Saedler, Heinz

    2002-01-01

    There has been limited corroboration to date for McClintock's vision of gene regulation by transposable elements (TEs), although her proposition on the origin of species by TE-induced complex chromosome reorganizations in combination with gene mutations, i.e., the involvement of both factors in relatively sudden formations of species in many plant and animal genera, has been more promising. Moreover, resolution is in sight for several seemingly contradictory phenomena such as the endless reshuffling of chromosome structures and gene sequences versus synteny and the constancy of living fossils (or stasis in general). Recent wide-ranging investigations have confirmed and enlarged the number of earlier cases of TE target site selection (hot spots for TE integration), implying preestablished rather than accidental chromosome rearrangements for nonhomologous recombination of host DNA. The possibility of a partly predetermined generation of biodiversity and new species is discussed. The views of several leading transposon experts on the rather abrupt origin of new species have not been synthesized into the macroevolutionary theory of the punctuated equilibrium school of paleontology inferred from thoroughly consistent features of the fossil record. PMID:12429698

  3. Transposable Elements: No More 'Junk DNA'

    OpenAIRE

    Kim, Yun-Ji; Lee, Jungnam; Han, Kyudong

    2012-01-01

    Since the advent of whole-genome sequencing, transposable elements (TEs), just thought to be 'junk' DNA, have been noticed because of their numerous copies in various eukaryotic genomes. Many studies about TEs have been conducted to discover their functions in their host genomes. Based on the results of those studies, it has been generally accepted that they have a function to cause genomic and genetic variations. However, their infinite functions are not fully elucidated. Through various mec...

  4. Transcriptional activity of transposable elements in coelacanth.

    Science.gov (United States)

    Forconi, Mariko; Chalopin, Domitille; Barucca, Marco; Biscotti, Maria Assunta; De Moro, Gianluca; Galiana, Delphine; Gerdol, Marco; Pallavicini, Alberto; Canapa, Adriana; Olmo, Ettore; Volff, Jean-Nicolas

    2014-09-01

    The morphological stasis of coelacanths has long suggested a slow evolutionary rate. General genomic stasis might also imply a decrease of transposable elements activity. To evaluate the potential activity of transposable elements (TEs) in "living fossil" species, transcriptomic data of Latimeria chalumnae and its Indonesian congener Latimeria menadoensis were compared through the RNA-sequencing mapping procedures in three different organs (liver, testis, and muscle). The analysis of coelacanth transcriptomes highlights a significant percentage of transcribed TEs in both species. Major contributors are LINE retrotransposons, especially from the CR1 family. Furthermore, some particular elements such as a LF-SINE and a LINE2 sequences seem to be more expressed than other elements. The amount of TEs expressed in testis suggests possible transposition burst in incoming generations. Moreover, significant amount of TEs in liver and muscle transcriptomes were also observed. Analyses of elements displaying marked organ-specific expression gave us the opportunity to highlight exaptation cases, that is, the recruitment of TEs as new cellular genes, but also to identify a new Latimeria-specific family of Short Interspersed Nuclear Elements called CoeG-SINEs. Overall, transcriptome results do not seem to be in line with a slow-evolving genome with poor TE activity.

  5. PASTEC: an automatic transposable element classification tool.

    Directory of Open Access Journals (Sweden)

    Claire Hoede

    Full Text Available SUMMARY: The classification of transposable elements (TEs is key step towards deciphering their potential impact on the genome. However, this process is often based on manual sequence inspection by TE experts. With the wealth of genomic sequences now available, this task requires automation, making it accessible to most scientists. We propose a new tool, PASTEC, which classifies TEs by searching for structural features and similarities. This tool outperforms currently available software for TE classification. The main innovation of PASTEC is the search for HMM profiles, which is useful for inferring the classification of unknown TE on the basis of conserved functional domains of the proteins. In addition, PASTEC is the only tool providing an exhaustive spectrum of possible classifications to the order level of the Wicker hierarchical TE classification system. It can also automatically classify other repeated elements, such as SSR (Simple Sequence Repeats, rDNA or potential repeated host genes. Finally, the output of this new tool is designed to facilitate manual curation by providing to biologists with all the evidence accumulated for each TE consensus. AVAILABILITY: PASTEC is available as a REPET module or standalone software (http://urgi.versailles.inra.fr/download/repet/REPET_linux-x64-2.2.tar.gz. It requires a Unix-like system. There are two standalone versions: one of which is parallelized (requiring Sun grid Engine or Torque, and the other of which is not.

  6. Transposable elements: powerful facilitators of evolution.

    Science.gov (United States)

    Oliver, Keith R; Greene, Wayne K

    2009-07-01

    Transposable elements (TEs) are powerful facilitators of genome evolution, and hence of phenotypic diversity as they can cause genetic changes of great magnitude and variety. TEs are ubiquitous and extremely ancient, and although harmful to some individuals, they can be very beneficial to lineages. TEs can build, sculpt, and reformat genomes by both active and passive means. Lineages with active TEs or with abundant homogeneous inactive populations of TEs that can act passively by causing ectopic recombination are potentially fecund, adaptable, and taxonate readily. Conversely, taxa deficient in TEs or possessing heterogeneous populations of inactive TEs may be well adapted in their niche, but tend to prolonged stasis and may risk extinction by lacking the capacity to adapt to change, or diversify. Because of recurring intermittent waves of TE infestation, available data indicate a compatibility with punctuated equilibrium, in keeping with widely accepted interpretations of evidence from the fossil record. We propose a general and holistic synthesis on how the presence of TEs within genomes makes them flexible and dynamic, so that genomes themselves are powerful facilitators of their own evolution. PMID:19415638

  7. Transposable element origins of epigenetic gene regulation.

    Science.gov (United States)

    Lisch, Damon; Bennetzen, Jeffrey L

    2011-04-01

    Transposable elements (TEs) are massively abundant and unstable in all plant genomes, but are mostly silent because of epigenetic suppression. Because all known epigenetic pathways act on all TEs, it is likely that the specialized epigenetic regulation of regular host genes (RHGs) was co-opted from this ubiquitous need for the silencing of TEs and viruses. With their internally repetitive and rearranging structures, and the acquisition of fragments of RHGs, the expression of TEs commonly makes antisense RNAs for both TE genes and RHGs. These antisense RNAs, particularly from heterochromatic reservoirs of 'zombie' TEs that are rearranged to form variously internally repetitive structures, may be advantageous because their induction will help rapidly suppress active TEs of the same family. RHG fragments within rapidly rearranging TEs may also provide the raw material for the ongoing generation of miRNA genes. TE gene expression is regulated by both environmental and developmental signals, and insertions can place nearby RHGs under the regulation (both standard and epigenetic) of the TE. The ubiquity of TEs, their frequent preferential association with RHGs, and their ability to be programmed by epigenetic signals all indicate that RGHs have nearly unlimited access to novel regulatory cassettes to assist plant adaptation. PMID:21444239

  8. Transposable elements and G-quadruplexes.

    Science.gov (United States)

    Kejnovsky, Eduard; Tokan, Viktor; Lexa, Matej

    2015-09-01

    A significant part of eukaryotic genomes is formed by transposable elements (TEs) containing not only genes but also regulatory sequences. Some of the regulatory sequences located within TEs can form secondary structures like hairpins or three-stranded (triplex DNA) and four-stranded (quadruplex DNA) conformations. This review focuses on recent evidence showing that G-quadruplex-forming sequences in particular are often present in specific parts of TEs in plants and humans. We discuss the potential role of these structures in the TE life cycle as well as the impact of G-quadruplexes on replication, transcription, translation, chromatin status, and recombination. The aim of this review is to emphasize that TEs may serve as vehicles for the genomic spread of G-quadruplexes. These non-canonical DNA structures and their conformational switches may constitute another regulatory system that, together with small and long non-coding RNA molecules and proteins, contribute to the complex cellular network resulting in the large diversity of eukaryotes. PMID:26403244

  9. Characteristics of transposable element exonization within human and mouse.

    Directory of Open Access Journals (Sweden)

    Noa Sela

    Full Text Available Insertion of transposed elements within mammalian genes is thought to be an important contributor to mammalian evolution and speciation. Insertion of transposed elements into introns can lead to their activation as alternatively spliced cassette exons, an event called exonization. Elucidation of the evolutionary constraints that have shaped fixation of transposed elements within human and mouse protein coding genes and subsequent exonization is important for understanding of how the exonization process has affected transcriptome and proteome complexities. Here we show that exonization of transposed elements is biased towards the beginning of the coding sequence in both human and mouse genes. Analysis of single nucleotide polymorphisms (SNPs revealed that exonization of transposed elements can be population-specific, implying that exonizations may enhance divergence and lead to speciation. SNP density analysis revealed differences between Alu and other transposed elements. Finally, we identified cases of primate-specific Alu elements that depend on RNA editing for their exonization. These results shed light on TE fixation and the exonization process within human and mouse genes.

  10. BLAT-Based Comparative Analysis for Transposable Elements: BLATCAT

    OpenAIRE

    Sangbum Lee; Sumin Oh; Keunsoo Kang; Kyudong Han

    2014-01-01

    The availability of several whole genome sequences makes comparative analyses possible. In primate genomes, the priority of transposable elements (TEs) is significantly increased because they account for ~45% of the primate genomes, they can regulate the gene expression level, and they are associated with genomic fluidity in their host genomes. Here, we developed the BLAST-like alignment tool (BLAT) based comparative analysis for transposable elements (BLATCAT) program. The BLATCAT program ca...

  11. Transposable elements and genetic instabilities in crop plants

    Energy Technology Data Exchange (ETDEWEB)

    Burr, B.; Burr, F.

    1981-04-10

    Transposable elements have long been associated with certain unstable loci in maize and have been intensively studied by McClintock and others. It is known that a transposable element can control the expression of the structural genes at the locus where it resides. These controlling elements in maize are now beginning to be studied at the molecular level. Using recombinant molecular probes we have been able to describe the changes induced by the controlling element Ds at the shrunken locus. Ds elements appear to be large and dissimilar insertions into the wild-type locus - two elements actually map within the transcribed region of the gene. Genetic instabilities have been described in other economically important plants but the bases for these phenomena have not been understood. We believe that it is likely that some of these instabilities are the result of transposable element activity much as in the case of maize.

  12. Evolutionary active transposable elements in the genome of the coelacanth.

    Science.gov (United States)

    Chalopin, Domitille; Fan, Shaohua; Simakov, Oleg; Meyer, Axel; Schartl, Manfred; Volff, Jean-Nicolas

    2014-09-01

    The apparent morphological stasis in the lineage of the coelacanth, which has been called a "living fossil" by many, has been suggested to be causally related to a slow evolution of its genome, with strongly reduced activity of transposable elements (TEs). Analysis of the African coelacanth showed that at least 25% of its genome is constituted of transposable elements including retrotransposons, endogenous retroviruses and DNA transposons, with a strong predominance of non-Long Terminal Repeat (non-LTR) retrotransposons. The coelacanth genome has been shaped by four major general bursts of transposition during evolution, with major contributions of LINE1, LINE2, CR1, and Deu non-LTR retrotransposons. Many transposable elements are expressed in different tissues and might be active. The number of TE families in coelacanth, but also in lungfish, is lower than in teleost fish, but is higher than in chicken and human. This observation is in agreement with the hypothesis of a sequential elimination of many TE families in the sarcopterygian lineage during evolution. Taken together, our analysis indicates that the coelacanth contains more TE families than birds and mammals, and that these elements have been active during the evolution of the coelacanth lineage. Hence, at the level of transposable element activity, the coelacanth genome does not appear to evolve particularly slowly.

  13. Tc1-like transposable elements in plant genomes

    OpenAIRE

    Liu, Yuan; Yang, Guojun

    2014-01-01

    Background The Tc1/mariner superfamily of transposable elements (TEs) is widespread in animal genomes. Mariner-like elements, which bear a DDD triad catalytic motif, have been identified in a wide range of flowering plant species. However, as the founding member of the superfamily, Tc1-like elements that bear a DD34E triad catalytic motif are only known to unikonts (animals, fungi, and Entamoeba). Results Here we report the identification of Tc1-like elements (TLEs) in plant genomes. These el...

  14. P Transposable Elements in Drosophila and other Eukaryotic Organisms.

    Science.gov (United States)

    Majumdar, Sharmistha; Rio, Donald C

    2015-04-01

    P transposable elements were discovered in Drosophila as the causative agents of a syndrome of genetic traits called hybrid dysgenesis. Hybrid dysgenesis exhibits a unique pattern of maternal inheritance linked to the germline-specific small RNA piwi-interacting (piRNA) pathway. The use of P transposable elements as vectors for gene transfer and as genetic tools revolutionized the field of Drosophila molecular genetics. P element transposons have served as a useful model to investigate mechanisms of cut-and-paste transposition in eukaryotes. Biochemical studies have revealed new and unexpected insights into how eukaryotic DNA-based transposons are mobilized. For example, the P element transposase makes unusual 17nt-3' extended double-strand DNA breaks at the transposon termini and uses guanosine triphosphate (GTP) as a cofactor to promote synapsis of the two transposon ends early in the transposition pathway. The N-terminal DNA binding domain of the P element transposase, called a THAP domain, contains a C2CH zinc-coordinating motif and is the founding member of a large family of animal-specific site-specific DNA binding proteins. Over the past decade genome sequencing efforts have revealed the presence of P element-like transposable elements or P element transposase-like genes (called THAP9) in many eukaryotic genomes, including vertebrates, such as primates including humans, zebrafish and Xenopus, as well as the human parasite Trichomonas vaginalis, the sea squirt Ciona, sea urchin and hydra. Surprisingly, the human and zebrafish P element transposase-related THAP9 genes promote transposition of the Drosophila P element transposon DNA in human and Drosophila cells, indicating that the THAP9 genes encode active P element "transposase" proteins. PMID:26104714

  15. BLAT-based comparative analysis for transposable elements: BLATCAT.

    Science.gov (United States)

    Lee, Sangbum; Oh, Sumin; Kang, Keunsoo; Han, Kyudong

    2014-01-01

    The availability of several whole genome sequences makes comparative analyses possible. In primate genomes, the priority of transposable elements (TEs) is significantly increased because they account for ~45% of the primate genomes, they can regulate the gene expression level, and they are associated with genomic fluidity in their host genomes. Here, we developed the BLAST-like alignment tool (BLAT) based comparative analysis for transposable elements (BLATCAT) program. The BLATCAT program can compare specific regions of six representative primate genome sequences (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque) on the basis of BLAT and simultaneously carry out RepeatMasker and/or Censor functions, which are widely used Windows-based web-server functions to detect TEs. All results can be stored as a HTML file for manual inspection of a specific locus. BLATCAT will be very convenient and efficient for comparative analyses of TEs in various primate genomes. PMID:24959585

  16. BLAT-based comparative analysis for transposable elements: BLATCAT.

    Science.gov (United States)

    Lee, Sangbum; Oh, Sumin; Kang, Keunsoo; Han, Kyudong

    2014-01-01

    The availability of several whole genome sequences makes comparative analyses possible. In primate genomes, the priority of transposable elements (TEs) is significantly increased because they account for ~45% of the primate genomes, they can regulate the gene expression level, and they are associated with genomic fluidity in their host genomes. Here, we developed the BLAST-like alignment tool (BLAT) based comparative analysis for transposable elements (BLATCAT) program. The BLATCAT program can compare specific regions of six representative primate genome sequences (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque) on the basis of BLAT and simultaneously carry out RepeatMasker and/or Censor functions, which are widely used Windows-based web-server functions to detect TEs. All results can be stored as a HTML file for manual inspection of a specific locus. BLATCAT will be very convenient and efficient for comparative analyses of TEs in various primate genomes.

  17. BLAT-Based Comparative Analysis for Transposable Elements: BLATCAT

    Directory of Open Access Journals (Sweden)

    Sangbum Lee

    2014-01-01

    Full Text Available The availability of several whole genome sequences makes comparative analyses possible. In primate genomes, the priority of transposable elements (TEs is significantly increased because they account for ~45% of the primate genomes, they can regulate the gene expression level, and they are associated with genomic fluidity in their host genomes. Here, we developed the BLAST-like alignment tool (BLAT based comparative analysis for transposable elements (BLATCAT program. The BLATCAT program can compare specific regions of six representative primate genome sequences (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque on the basis of BLAT and simultaneously carry out RepeatMasker and/or Censor functions, which are widely used Windows-based web-server functions to detect TEs. All results can be stored as a HTML file for manual inspection of a specific locus. BLATCAT will be very convenient and efficient for comparative analyses of TEs in various primate genomes.

  18. Generating and manipulating transgenic animals using transposable elements

    OpenAIRE

    Largaespada David A

    2003-01-01

    Abstract Transposable elements, or transposons, have played a significant role in the history of biological research. They have had a major influence on the structure of genomes during evolution, they can cause mutations, and their study led to the concept of so-called "selfish DNA". In addition, transposons have been manipulated as useful gene transfer vectors. While primarily restricted to use in invertebrates, prokaryotes, and plants, it is now clear that transposon technology and biology ...

  19. Transposable element and genome evolution following hybridization in wild wheats

    OpenAIRE

    Senerchia, Natacha; Parisod, Christian; Kessler, Félix; Felber, François

    2014-01-01

    Genome dynamics is an essential process of eukaryote genome evolution. Hybridization and inter-species gene flow result in new interactions among divergent genomes and may reveal genetic incompatibilities having accumulated after the origin of species. Being highly mutagenic and repressed by various epigenetic mechanisms, transposable elements (TEs) are postulated to play a central role in fuelling genome reorganization following inter-genomic conflicts after hybridization. However, we are st...

  20. Isolation and characterization of a potential transposable element from Wolbachia

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Wolbachia are a group of Rickettsia-like bacteria which parasitize the cells of a wide range of anthropoid. These microorganisms are associated with the reproductive and developmental abnormalities io their hosts. To study the molecular mechanism underlying such phenomena, we analyzed the genomic difference between Wolbachia with different cytoplasmic incompatibility (CI) phenotype using representational difference analysis method. A potential transposable element, which exists in the strong CI-inducing strain wRi, was isolated. This element was designated as Wolbachia insertion sequence element (WISE).

  1. Cooperation is fleeting in the world of transposable elements.

    Directory of Open Access Journals (Sweden)

    Andreas Wagner

    2006-12-01

    Full Text Available Composite transposons are key vehicles for the worldwide spreading of genes that allow bacteria to survive toxic compounds. Composite transposons consist of two smaller transposable elements called insertion sequences (ISs, which flank the genes that permit such survival. Each IS in a composite transposon can either transpose alone, selfishly, or it can transpose cooperatively, jointly with the other IS. Cooperative transposition can enhance an IS's chance of survival, but it also carries the risk of transposon destruction. I use game theory to show that the conditions under which cooperative transposition is an evolutionarily stable strategy (ESS are not biologically realistic. I then analyze the distribution of thousands of ISs in more than 200 bacterial genomes to test the following prediction of the game-theoretical model: if cooperative transposition was an ESS, then the closely spaced ISs that characterize composite transposons should be more abundant in genomes than expected by chance. The data show that this is not the case. Cooperativity can only be maintained in a transitional, far-from-equilibrium state shortly after a selection pressure first arises. This is the case in the spreading of antibiotic resistance, where we are witnessing a fleeting moment in evolution, a moment in which cooperation among selfish DNA molecules has provided a means of survival. Because such cooperation does not pay in the long run, the vehicles of such survival will eventually disappear again. My analysis demonstrates that game theory can help explain behavioral strategies even for mobile DNA.

  2. Evolutionary interaction between W/Y chromosome and transposable elements.

    Science.gov (United States)

    Śliwińska, Ewa B; Martyka, Rafał; Tryjanowski, Piotr

    2016-06-01

    The W/Y chromosome is unique among chromosomes as it does not recombine in its mature form. The main side effect of cessation of recombination is evolutionary instability and degeneration of the W/Y chromosome, or frequent W/Y chromosome turnovers. Another important feature of W/Y chromosome degeneration is transposable element (TEs) accumulation. Transposon accumulation has been confirmed for all W/Y chromosomes that have been sequenced so far. Models of W/Y chromosome instability include the assemblage of deleterious mutations in protein coding genes, but do not include the influence of transposable elements that are accumulated gradually in the non-recombining genome. The multiple roles of genomic TEs, and the interactions between retrotransposons and genome defense proteins are currently being studied intensively. Small RNAs originating from retrotransposon transcripts appear to be, in some cases, the only mediators of W/Y chromosome function. Based on the review of the most recent publications, we present knowledge on W/Y evolution in relation to retrotransposable element accumulation.

  3. DPTEdb, an integrative database of transposable elements in dioecious plants.

    Science.gov (United States)

    Li, Shu-Fen; Zhang, Guo-Jun; Zhang, Xue-Jin; Yuan, Jin-Hong; Deng, Chuan-Liang; Gu, Lian-Feng; Gao, Wu-Jun

    2016-01-01

    Dioecious plants usually harbor 'young' sex chromosomes, providing an opportunity to study the early stages of sex chromosome evolution. Transposable elements (TEs) are mobile DNA elements frequently found in plants and are suggested to play important roles in plant sex chromosome evolution. The genomes of several dioecious plants have been sequenced, offering an opportunity to annotate and mine the TE data. However, comprehensive and unified annotation of TEs in these dioecious plants is still lacking. In this study, we constructed a dioecious plant transposable element database (DPTEdb). DPTEdb is a specific, comprehensive and unified relational database and web interface. We used a combination of de novo, structure-based and homology-based approaches to identify TEs from the genome assemblies of previously published data, as well as our own. The database currently integrates eight dioecious plant species and a total of 31 340 TEs along with classification information. DPTEdb provides user-friendly web interfaces to browse, search and download the TE sequences in the database. Users can also use tools, including BLAST, GetORF, HMMER, Cut sequence and JBrowse, to analyze TE data. Given the role of TEs in plant sex chromosome evolution, the database will contribute to the investigation of TEs in structural, functional and evolutionary dynamics of the genome of dioecious plants. In addition, the database will supplement the research of sex diversification and sex chromosome evolution of dioecious plants.Database URL: http://genedenovoweb.ticp.net:81/DPTEdb/index.php. PMID:27173524

  4. C-GATE - catalogue of genes affected by transposable elements

    Directory of Open Access Journals (Sweden)

    Rebollo Rita

    2012-05-01

    Full Text Available Abstract Background Functional regulatory sequences are present in many transposable element (TE copies, resulting in TEs being frequently exapted by host genes. Today, many examples of TEs impacting host gene expression can be found in the literature and we believe a new catalogue of such exaptations would be useful for the field. Findings We have established the catalogue of genes affected by transposable elements (C-GATE, which can be found at https://sites.google.com/site/tecatalog/. To date, it holds 221 cases of biologically verified TE exaptations and more than 10,000 in silico TE-gene partnerships. C-GATE is interactive and allows users to include missed or new TE exaptation data. C-GATE provides a graphic representation of the entire library, which may be used for future statistical analysis of TE impact on host gene expression. Conclusions We hope C-GATE will be valuable for the TE community but also for others who have realized the role that TEs may have in their research.

  5. Transposable Elements: From DNA Parasites to Architects of Metazoan Evolution

    Directory of Open Access Journals (Sweden)

    Oliver Piskurek

    2012-07-01

    Full Text Available One of the most unexpected insights that followed from the completion of the human genome a decade ago was that more than half of our DNA is derived from transposable elements (TEs. Due to advances in high throughput sequencing technologies it is now clear that TEs comprise the largest molecular class within most metazoan genomes. TEs, once categorised as "junk DNA", are now known to influence genomic structure and function by increasing the coding and non-coding genetic repertoire of the host. In this way TEs are key elements that stimulate the evolution of metazoan genomes. This review highlights several lines of TE research including the horizontal transfer of TEs through host-parasite interactions, the vertical maintenance of TEs over long periods of evolutionary time, and the direct role that TEs have played in generating morphological novelty.

  6. Tc1-like transposable elements in plant genomes

    Science.gov (United States)

    2014-01-01

    Background The Tc1/mariner superfamily of transposable elements (TEs) is widespread in animal genomes. Mariner-like elements, which bear a DDD triad catalytic motif, have been identified in a wide range of flowering plant species. However, as the founding member of the superfamily, Tc1-like elements that bear a DD34E triad catalytic motif are only known to unikonts (animals, fungi, and Entamoeba). Results Here we report the identification of Tc1-like elements (TLEs) in plant genomes. These elements bear the four terminal nucleotides and the characteristic DD34E triad motif of Tc1 element. The two TLE families (PpTc1, PpTc2) identified in the moss (Physcomitrella patens) genome contain highly similar copies. Multiple copies of PpTc1 are actively transcribed and the transcripts encode intact full length transposase coding sequences. TLEs are also found in angiosperm genome sequence databases of rice (Oryza sativa), dwarf birch (Betula nana), cabbage (Brassica rapa), hemp (Cannabis sativa), barley (Hordium valgare), lettuce (Lactuta sativa), poplar (Populus trichocarpa), pear (Pyrus x bretschneideri), and wheat (Triticum urartu). Conclusions This study extends the occurrence of TLEs to the plant phylum. The elements in the moss genome have amplified recently and may still be capable of transposition. The TLEs are also present in angiosperm genomes, but apparently much less abundant than in moss. PMID:24926322

  7. In Silico Methods to Identify Exapted Transposable Element Families.

    Science.gov (United States)

    Ramsay, LeeAnn; Bourque, Guillaume

    2016-01-01

    Transposable elements (TEs) have recently been shown to have many regulatory roles within the genome. In this chapter, we will examine two in silico methods for analyzing TEs and identifying families that may have acquired such functions. The first method will look at how the overrepresentation of a repeat family in a set of genomic features can be discovered. The example situation of OCT4 binding sites originating from LTR7 TE sequences will be used to show how this method could be applied. The second method will describe how to determine if a TE family exhibits a cell type-specific expression pattern. As an example, we will look at the expression of HERV-H, an endogenous retrovirus known to act as an lncRNA in embryonic stem cells. We will use this example to demonstrate how RNA-seq data can be used to compare cell type expression of repeats.

  8. Helicobacter Pylori's plasticity zones are novel transposable elements.

    Directory of Open Access Journals (Sweden)

    Dangeruta Kersulyte

    Full Text Available BACKGROUND: Genes present in only certain strains of a bacterial species can strongly affect cellular phenotypes and evolutionary potentials. One segment that seemed particularly rich in strain-specific genes was found by comparing the first two sequenced Helicobacter pylori genomes (strains 26695 and J99 and was named a "plasticity zone". PRINCIPAL FINDINGS: We studied the nature and evolution of plasticity zones by sequencing them in five more Helicobacter strains, determining their locations in additional strains, and identifying them in recently released genome sequences. They occurred as discrete units, inserted at numerous chromosomal sites, and were usually flanked by direct repeats of 5'AAGAATG, a sequence generally also present in one copy at unoccupied sites in other strains. This showed that plasticity zones are transposable elements, to be called TnPZs. Each full length TnPZ contained a cluster of type IV protein secretion genes (tfs3, a tyrosine recombinase family gene ("xerT", and a large (>or=2800 codon orf encoding a protein with helicase and DNA methylase domains, plus additional orfs with no homology to genes of known function. Several TnPZ types were found that differed in gene arrangement or DNA sequence. Our analysis also indicated that the first-identified plasticity zones (in strains 26695 and J99 are complex mosaics of TnPZ remnants, formed by multiple TnPZ insertions, and spontaneous and transposable element mediated deletions. Tests using laboratory-generated deletions showed that TnPZs are not essential for viability, but identified one TnPZ that contributed quantitatively to bacterial growth during mouse infection and another that affected synthesis of proinflammatory cytokines in cell culture. CONCLUSIONS: We propose that plasticity zone genes are contained in conjugative transposons (TnPZs or remnants of them, that TnPZ insertion is mediated by XerT recombinase, and that some TnPZ genes affect bacterial phenotypes

  9. Transposable element recruitments in the mammalian placenta: impacts and mechanisms.

    Science.gov (United States)

    Emera, Deena; Wagner, Günter P

    2012-07-01

    Transposable elements (TEs) are mobile DNA elements found at high frequency in mammalian genomes. Although these elements are generally perceived as genomic parasites, they have the potential to influence host genome function in many beneficial ways. This article discusses the role TEs have played in the evolution of the placenta and pregnancy in viviparous mammals. Using examples from our own research and the literature, we argue that frequent recruitment of TEs, in particular of retroelements, has facilitated the extreme diversification of tissues at the maternal-fetal interface. We also discuss the mechanisms by which TEs have been recruited for functions during pregnancy. We argue that retroelements are pre-adapted to becoming cis-regulatory elements for host genomes because they need to utilize host regulatory signals for their own life cycle. However, although TEs contain some of the signals necessary for host functions upon insertion, they often require modification before acquiring a biological role in a host tissue. We discuss the process by which one TE was transformed into a promoter for prolactin expression in the endometrium, describing a model for TE domestication called 'epistatic capture'.

  10. Massive contribution of transposable elements to mammalian regulatory sequences.

    Science.gov (United States)

    Rayan, Nirmala Arul; Del Rosario, Ricardo C H; Prabhakar, Shyam

    2016-09-01

    Barbara McClintock discovered the existence of transposable elements (TEs) in the late 1940s and initially proposed that they contributed to the gene regulatory program of higher organisms. This controversial idea gained acceptance only much later in the 1990s, when the first examples of TE-derived promoter sequences were uncovered. It is now known that half of the human genome is recognizably derived from TEs. It is thus important to understand the scope and nature of their contribution to gene regulation. Here, we provide a timeline of major discoveries in this area and discuss how transposons have revolutionized our understanding of mammalian genomes, with a special emphasis on the massive contribution of TEs to primate evolution. Our analysis of primate-specific functional elements supports a simple model for the rate at which new functional elements arise in unique and TE-derived DNA. Finally, we discuss some of the challenges and unresolved questions in the field, which need to be addressed in order to fully characterize the impact of TEs on gene regulation, evolution and disease processes. PMID:27174439

  11. Transposable element dynamics among asymbiotic and ectomycorrhizal Amanita fungi.

    Science.gov (United States)

    Hess, Jaqueline; Skrede, Inger; Wolfe, Benjamin E; LaButti, Kurt; Ohm, Robin A; Grigoriev, Igor V; Pringle, Anne

    2014-07-01

    Transposable elements (TEs) are ubiquitous inhabitants of eukaryotic genomes and their proliferation and dispersal shape genome architectures and diversity. Nevertheless, TE dynamics are often explored for one species at a time and are rarely considered in ecological contexts. Recent work with plant pathogens suggests a link between symbiosis and TE abundance. The genomes of pathogenic fungi appear to house an increased abundance of TEs, and TEs are frequently associated with the genes involved in symbiosis. To investigate whether this pattern is general, and relevant to mutualistic plant-fungal symbioses, we sequenced the genomes of related asymbiotic (AS) and ectomycorrhizal (ECM) Amanita fungi. Using methods developed to interrogate both assembled and unassembled sequences, we characterized and quantified TEs across three AS and three ECM species, including the AS outgroup Volvariella volvacea. The ECM genomes are characterized by abundant numbers of TEs, an especially prominent feature of unassembled sequencing libraries. Increased TE activity in ECM species is also supported by phylogenetic analysis of the three most abundant TE superfamilies; phylogenies revealed many radiations within contemporary ECM species. However, the AS species Amanita thiersii also houses extensive amplifications of elements, highlighting the influence of additional evolutionary parameters on TE abundance. Our analyses provide further evidence for a link between symbiotic associations among plants and fungi, and increased TE activity, while highlighting the importance individual species' natural histories may have in shaping genome architecture. PMID:24923322

  12. Generating and manipulating transgenic animals using transposable elements

    Directory of Open Access Journals (Sweden)

    Largaespada David A

    2003-11-01

    Full Text Available Abstract Transposable elements, or transposons, have played a significant role in the history of biological research. They have had a major influence on the structure of genomes during evolution, they can cause mutations, and their study led to the concept of so-called "selfish DNA". In addition, transposons have been manipulated as useful gene transfer vectors. While primarily restricted to use in invertebrates, prokaryotes, and plants, it is now clear that transposon technology and biology are just as relevant to the study of vertebrate species. Multiple transposons now have been shown to be active in vertebrates and they can be used for germline transgenesis, somatic cell transgenesis/gene therapy, and random germline insertional mutagenesis. The sophistication of these applications and the number of active elements are likely to increase over the next several years. This review covers the vertebrate-active retrotransposons and transposons that have been well studied and adapted for use as gene transfer agents. General considerations and predictions about the future utility of transposon technology are discussed.

  13. Transposable-element associated small RNAs in Bombyx mori genome.

    Directory of Open Access Journals (Sweden)

    Yimei Cai

    Full Text Available Small RNAs are a group of regulatory RNA molecules that control gene expression at transcriptional or post-transcriptional levels among eukaryotes. The silkworm, Bombyx mori L., genome harbors abundant repetitive sequences derived from families of retrotransposons and transposons, which together constitute almost half of the genome space and provide ample resource for biogenesis of the three major small RNA families. We systematically discovered transposable-element (TE-associated small RNAs in B. mori genome based on a deep RNA-sequencing strategy and the effort yielded 182, 788 and 4,990 TE-associated small RNAs in the miRNA, siRNA and piRNA species, respectively. Our analysis suggested that the three small RNA species preferentially associate with different TEs to create sequence and functional diversity, and we also show evidence that a Bombyx non-LTR retrotransposon, bm1645, alone contributes to the generation of TE-associated small RNAs in a very significant way. The fact that bm1645-associated small RNAs partially overlap with each other implies a possibility that this element may be modulated by different mechanisms to generate different products with diverse functions. Taken together, these discoveries expand the small RNA pool in B. mori genome and lead to new knowledge on the diversity and functional significance of TE-associated small RNAs.

  14. Survey of transposable elements in sugarcane expressed sequence tags (ESTs

    Directory of Open Access Journals (Sweden)

    Rossi Magdalena

    2001-01-01

    Full Text Available The sugarcane expressed sequence tag (SUCEST project has produced a large number of cDNA sequences from several plant tissues submitted or not to different conditions of stress. In this paper we report the result of a search for transposable elements (TEs revealing a surprising amount of expressed TEs homologues. Of the 260,781 sequences grouped in 81,223 fragment assembly program (Phrap clusters, a total of 276 clones showed homology to previously reported TEs using a stringent cut-off value of e-50 or better. Homologous clones to Copia/Ty1 and Gypsy/Ty3 groups of long terminal repeat (LTR retrotransposons were found but no non-LTR retroelements were identified. All major transposon families were represented in sugarcane including Activator (Ac, Mutator (MuDR, Suppressor-mutator (En/Spm and Mariner. In order to compare the TE diversity in grasses genomes, we carried out a search for TEs described in sugarcane related species O.sativa, Z. mays and S. bicolor. We also present preliminary results showing the potential use of TEs insertion pattern polymorphism as molecular markers for cultivar identification.

  15. Real-time transposable element activity in individual live cells

    Science.gov (United States)

    Lee, Gloria; Martini, K. Michael

    2016-01-01

    The excision and reintegration of transposable elements (TEs) restructure their host genomes, generating cellular diversity involved in evolution, development, and the etiology of human diseases. Our current knowledge of TE behavior primarily results from bulk techniques that generate time and cell ensemble averages, but cannot capture cell-to-cell variation or local environmental and temporal variability. We have developed an experimental system based on the bacterial TE IS608 that uses fluorescent reporters to directly observe single TE excision events in individual cells in real time. We find that TE activity depends upon the TE’s orientation in the genome and the amount of transposase protein in the cell. We also find that TE activity is highly variable throughout the lifetime of the cell. Upon entering stationary phase, TE activity increases in cells hereditarily predisposed to TE activity. These direct observations demonstrate that real-time live-cell imaging of evolution at the molecular and individual event level is a powerful tool for the exploration of genome plasticity in stressed cells. PMID:27298350

  16. Real-time transposable element activity in individual live cells.

    Science.gov (United States)

    Kim, Neil H; Lee, Gloria; Sherer, Nicholas A; Martini, K Michael; Goldenfeld, Nigel; Kuhlman, Thomas E

    2016-06-28

    The excision and reintegration of transposable elements (TEs) restructure their host genomes, generating cellular diversity involved in evolution, development, and the etiology of human diseases. Our current knowledge of TE behavior primarily results from bulk techniques that generate time and cell ensemble averages, but cannot capture cell-to-cell variation or local environmental and temporal variability. We have developed an experimental system based on the bacterial TE IS608 that uses fluorescent reporters to directly observe single TE excision events in individual cells in real time. We find that TE activity depends upon the TE's orientation in the genome and the amount of transposase protein in the cell. We also find that TE activity is highly variable throughout the lifetime of the cell. Upon entering stationary phase, TE activity increases in cells hereditarily predisposed to TE activity. These direct observations demonstrate that real-time live-cell imaging of evolution at the molecular and individual event level is a powerful tool for the exploration of genome plasticity in stressed cells. PMID:27298350

  17. A DNA fingerprint probe from Mycosphaerella graminicola identifies an active transposable element

    NARCIS (Netherlands)

    Goodwin, S.B.; Cavaletto, J.R.; Waalwijk, C.; Kema, G.H.J.

    2001-01-01

    DNA fingerprinting has been used extensively to characterize populations of Mycosphaerella graminicola, the Septoria tritici blotch pathogen of wheat. The highly polymorphic DNA fingerprints of Mycosphaerella graminicola were assumed to reflect the action of transposable elements. However, there was

  18. Epigenetic regulation of transposable element derived human gene promoters.

    Science.gov (United States)

    Huda, Ahsan; Bowen, Nathan J; Conley, Andrew B; Jordan, I King

    2011-04-01

    It was previously thought that epigenetic histone modifications of mammalian transposable elements (TEs) serve primarily to defend the genome against deleterious effects associated with their activity. However, we recently showed that, genome-wide, human TEs can also be epigenetically modified in a manner consistent with their ability to regulate host genes. Here, we explore the ability of TE sequences to epigenetically regulate individual human genes by focusing on the histone modifications of promoter sequences derived from TEs. We found 1520 human genes that initiate transcription from within TE-derived promoter sequences. We evaluated the distributions of eight histone modifications across these TE-promoters, within and between the GM12878 and K562 cell lines, and related their modification status with the cell-type specific expression patterns of the genes that they regulate. TE-derived promoters are significantly enriched for active histone modifications, and depleted for repressive modifications, relative to the genomic background. Active histone modifications of TE-promoters peak at transcription start sites and are positively correlated with increasing expression within cell lines. Furthermore, differential modification of TE-derived promoters between cell lines is significantly correlated with differential gene expression. LTR-retrotransposon derived promoters in particular play a prominent role in mediating cell-type specific gene regulation, and a number of these LTR-promoter genes are implicated in lineage-specific cellular functions. The regulation of human genes mediated by histone modifications targeted to TE-derived promoters is consistent with the ability of TEs to contribute to the epigenomic landscape in a way that provides functional utility to the host genome.

  19. Detection of transposable elements by their compositional bias

    Directory of Open Access Journals (Sweden)

    Anxolabéhère Dominique

    2004-07-01

    Full Text Available Abstract Background Transposable elements (TE are mobile genetic entities present in nearly all genomes. Previous work has shown that TEs tend to have a different nucleotide composition than the host genes, either considering codon usage bias or dinucleotide frequencies. We show here how these compositional differences can be used as a tool for detection and analysis of TE sequences. Results We compared the composition of TE sequences and host gene sequences using probabilistic models of nucleotide sequences. We used hidden Markov models (HMM, which take into account the base composition of the sequences (occurrences of words n nucleotides long, with n ranging here from 1 to 4 and the heterogeneity between coding and non-coding parts of sequences. We analyzed three sets of sequences containing class I TEs, class II TEs and genes respectively in three species: Drosophila melanogaster, Cænorhabditis elegans and Arabidopsis thaliana. Each of these sets had a distinct, homogeneous composition, enabling us to distinguish between the two classes of TE and the genes. However the particular base composition of the TEs differed in the three species studied. Conclusions This approach can be used to detect and annotate TEs in genomic sequences and complements the current homology-based TE detection methods. Furthermore, the HMM method is able to identify the parts of a sequence in which the nucleotide composition resembles that of a coding region of a TE. This is useful for the detailed annotation of TE sequences, which may contain an ancient, highly diverged coding region that is no longer fully functional.

  20. Prediction of transposable element derived enhancers using chromatin modification profiles.

    Directory of Open Access Journals (Sweden)

    Ahsan Huda

    Full Text Available Experimentally characterized enhancer regions have previously been shown to display specific patterns of enrichment for several different histone modifications. We modelled these enhancer chromatin profiles in the human genome and used them to guide the search for novel enhancers derived from transposable element (TE sequences. To do this, a computational approach was taken to analyze the genome-wide histone modification landscape characterized by the ENCODE project in two human hematopoietic cell types, GM12878 and K562. We predicted the locations of 2,107 and 1,448 TE-derived enhancers in the GM12878 and K562 cell lines respectively. A vast majority of these putative enhancers are unique to each cell line; only 3.5% of the TE-derived enhancers are shared between the two. We evaluated the functional effect of TE-derived enhancers by associating them with the cell-type specific expression of nearby genes, and found that the number of TE-derived enhancers is strongly positively correlated with the expression of nearby genes in each cell line. Furthermore, genes that are differentially expressed between the two cell lines also possess a divergent number of TE-derived enhancers in their vicinity. As such, genes that are up-regulated in the GM12878 cell line and down-regulated in K562 have significantly more TE-derived enhancers in their vicinity in the GM12878 cell line and vice versa. These data indicate that human TE-derived sequences are likely to be involved in regulating cell-type specific gene expression on a broad scale and suggest that the enhancer activity of TE-derived sequences is mediated by epigenetic regulatory mechanisms.

  1. Combined evidence annotation of transposable elements in genome sequences.

    Directory of Open Access Journals (Sweden)

    Hadi Quesneville

    2005-07-01

    Full Text Available Transposable elements (TEs are mobile, repetitive sequences that make up significant fractions of metazoan genomes. Despite their near ubiquity and importance in genome and chromosome biology, most efforts to annotate TEs in genome sequences rely on the results of a single computational program, RepeatMasker. In contrast, recent advances in gene annotation indicate that high-quality gene models can be produced from combining multiple independent sources of computational evidence. To elevate the quality of TE annotations to a level comparable to that of gene models, we have developed a combined evidence-model TE annotation pipeline, analogous to systems used for gene annotation, by integrating results from multiple homology-based and de novo TE identification methods. As proof of principle, we have annotated "TE models" in Drosophila melanogaster Release 4 genomic sequences using the combined computational evidence derived from RepeatMasker, BLASTER, TBLASTX, all-by-all BLASTN, RECON, TE-HMM and the previous Release 3.1 annotation. Our system is designed for use with the Apollo genome annotation tool, allowing automatic results to be curated manually to produce reliable annotations. The euchromatic TE fraction of D. melanogaster is now estimated at 5.3% (cf. 3.86% in Release 3.1, and we found a substantially higher number of TEs (n = 6,013 than previously identified (n = 1,572. Most of the new TEs derive from small fragments of a few hundred nucleotides long and highly abundant families not previously annotated (e.g., INE-1. We also estimated that 518 TE copies (8.6% are inserted into at least one other TE, forming a nest of elements. The pipeline allows rapid and thorough annotation of even the most complex TE models, including highly deleted and/or nested elements such as those often found in heterochromatic sequences. Our pipeline can be easily adapted to other genome sequences, such as those of the D. melanogaster heterochromatin or other

  2. Whole genome resequencing reveals natural target site preferences of transposable elements in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Raquel S Linheiro

    Full Text Available Transposable elements are mobile DNA sequences that integrate into host genomes using diverse mechanisms with varying degrees of target site specificity. While the target site preferences of some engineered transposable elements are well studied, the natural target preferences of most transposable elements are poorly characterized. Using population genomic resequencing data from 166 strains of Drosophila melanogaster, we identified over 8,000 new insertion sites not present in the reference genome sequence that we used to decode the natural target preferences of 22 families of transposable element in this species. We found that terminal inverted repeat transposon and long terminal repeat retrotransposon families present clade-specific target site duplications and target site sequence motifs. Additionally, we found that the sequence motifs at transposable element target sites are always palindromes that extend beyond the target site duplication. Our results demonstrate the utility of population genomics data for high-throughput inference of transposable element targeting preferences in the wild and establish general rules for terminal inverted repeat transposon and long terminal repeat retrotransposon target site selection in eukaryotic genomes.

  3. Novel non-autonomous transposable elements onWchromosome of the silkworm, Bombyx mori

    Indian Academy of Sciences (India)

    Hiroaki Abe; Tsuguru Fujii; Toru Shimada; Kazuei Mita

    2010-09-01

    The sex chromosomes of the silkworm Bombyx mori are designated ZW(XY) for females and ZZ (XX) for males. Numerous long terminal repeat (LTR) and non-LTR retrotransposons, retroposons and DNA transposons have accumulated as strata on the W chromosome. However, there are nucleotide sequences that do not show the characteristics of typical transposable elements on the W chromosome. To analyse these uncharacterized nucleotide sequences on the W chromosome, we used whole-genome shotgun (WGS) data and assembled data that was obtained using male genome DNA. Through these analyses, we found that almost all of these uncharacterized sequences were non-autonomous transposable elements that do not fit into the conventional classification. It is notable that some of these transposable elements contained the Bombyx short interspersed element (Bm1) sequences in the elements. We designated them as secondary-Bm1 transposable elements (SBTEs). Because putative ancestral SBTE nucleotide sequences without Bm1 do not occur in theWGS data, we suggest that the Bm1 sequences of SBTEs are not carried on each element merely as a package but are components of each element. Therefore, we confirmed that SBTEs should be classified as a new group of transposable elements.

  4. Evaluating the protein coding potential of exonized transposable element sequences

    Directory of Open Access Journals (Sweden)

    Borodovsky Mark

    2007-11-01

    Full Text Available Abstract Background Transposable element (TE sequences, once thought to be merely selfish or parasitic members of the genomic community, have been shown to contribute a wide variety of functional sequences to their host genomes. Analysis of complete genome sequences have turned up numerous cases where TE sequences have been incorporated as exons into mRNAs, and it is widely assumed that such 'exonized' TEs encode protein sequences. However, the extent to which TE-derived sequences actually encode proteins is unknown and a matter of some controversy. We have tried to address this outstanding issue from two perspectives: i-by evaluating ascertainment biases related to the search methods used to uncover TE-derived protein coding sequences (CDS and ii-through a probabilistic codon-frequency based analysis of the protein coding potential of TE-derived exons. Results We compared the ability of three classes of sequence similarity search methods to detect TE-derived sequences among data sets of experimentally characterized proteins: 1-a profile-based hidden Markov model (HMM approach, 2-BLAST methods and 3-RepeatMasker. Profile based methods are more sensitive and more selective than the other methods evaluated. However, the application of profile-based search methods to the detection of TE-derived sequences among well-curated experimentally characterized protein data sets did not turn up many more cases than had been previously detected and nowhere near as many cases as recent genome-wide searches have. We observed that the different search methods used were complementary in the sense that they yielded largely non-overlapping sets of hits and differed in their ability to recover known cases of TE-derived CDS. The probabilistic analysis of TE-derived exon sequences indicates that these sequences have low protein coding potential on average. In particular, non-autonomous TEs that do not encode protein sequences, such as Alu elements, are frequently

  5. Cell type-specific termination of transcription by transposable element sequences

    OpenAIRE

    Conley Andrew B; Jordan I

    2012-01-01

    Abstract Background Transposable elements (TEs) encode sequences necessary for their own transposition, including signals required for the termination of transcription. TE sequences within the introns of human genes show an antisense orientation bias, which has been proposed to reflect selection against TE sequences in the sense orientation owing to their ability to terminate the transcription of host gene transcripts. While there is evidence in support of this model for some elements, the ex...

  6. BrassicaTED - a public database for utilization of miniature transposable elements in Brassica species

    OpenAIRE

    Murukarthick, Jayakodi; Sampath, Perumal; Lee, Sang Choon; Choi, Beom-Soon; Senthil, Natesan; Liu, Shengyi; Yang, Tae-Jin

    2014-01-01

    Background MITE, TRIM and SINEs are miniature form transposable elements (mTEs) that are ubiquitous and dispersed throughout entire plant genomes. Tens of thousands of members cause insertion polymorphism at both the inter- and intra- species level. Therefore, mTEs are valuable targets and resources for development of markers that can be utilized for breeding, genetic diversity and genome evolution studies. Taking advantage of the completely sequenced genomes of Brassica rapa and B. oleracea,...

  7. The Holozoan Capsaspora owczarzaki Possesses a Diverse Complement of Active Transposable Element Families

    OpenAIRE

    Carr, Martin; Suga, Hiroshi

    2014-01-01

    Capsaspora owczarzaki, a protistan symbiont of the pulmonate snail Biomphalaria glabrata, is the centre of much interest in evolutionary biology due to its close relationship to Metazoa. The whole genome sequence of this protist has revealed new insights into the ancestral genome composition of Metazoa, in particular with regard to gene families involved in the evolution of multicellularity. The draft genome revealed the presence of 23 families of transposable element, made up from DNA transp...

  8. Genomic deletions and precise removal of transposable elements mediated by short identical DNA segments in primates

    OpenAIRE

    Louie N van de Lagemaat; Gagnier, Liane; Medstrand, Patrik; Mager, Dixie L.

    2005-01-01

    Insertion of transposable elements is a major cause of genomic expansion in eukaryotes. Less is understood, however, about mechanisms underlying contraction of genomes. In this study, we show that retroelements can, in rare cases, be precisely deleted from primate genomes, most likely via recombination between 10- to 20-bp target site duplications (TSDs) flanking the retroelement. The deleted loci are indistinguishable from pre-integration sites, effectively reversing the insertion. Through h...

  9. Transposable elements donate lineage-specific regulatory sequences to host genomes

    OpenAIRE

    Mariño-Ramírez, L; Lewis, K. C.; Landsman, D; Jordan, I K

    2005-01-01

    The evolutionary implications of transposable element (TE) influences on gene regulation are explored here. An historical perspective is presented to underscore the importance of TE influences on gene regulation with respect to both the discovery of TEs and the early conceptualization of their potential impact on host genome evolution. Evidence that points to a role for TEs in host gene regulation is reviewed, and comparisons between genome sequences are used to demonstrate the fact that TEs ...

  10. The industrial melanism mutation in British peppered moths is a transposable element.

    Science.gov (United States)

    Van't Hof, Arjen E; Campagne, Pascal; Rigden, Daniel J; Yung, Carl J; Lingley, Jessica; Quail, Michael A; Hall, Neil; Darby, Alistair C; Saccheri, Ilik J

    2016-06-01

    Discovering the mutational events that fuel adaptation to environmental change remains an important challenge for evolutionary biology. The classroom example of a visible evolutionary response is industrial melanism in the peppered moth (Biston betularia): the replacement, during the Industrial Revolution, of the common pale typica form by a previously unknown black (carbonaria) form, driven by the interaction between bird predation and coal pollution. The carbonaria locus has been coarsely localized to a 200-kilobase region, but the specific identity and nature of the sequence difference controlling the carbonaria-typica polymorphism, and the gene it influences, are unknown. Here we show that the mutation event giving rise to industrial melanism in Britain was the insertion of a large, tandemly repeated, transposable element into the first intron of the gene cortex. Statistical inference based on the distribution of recombined carbonaria haplotypes indicates that this transposition event occurred around 1819, consistent with the historical record. We have begun to dissect the mode of action of the carbonaria transposable element by showing that it increases the abundance of a cortex transcript, the protein product of which plays an important role in cell-cycle regulation, during early wing disc development. Our findings fill a substantial knowledge gap in the iconic example of microevolutionary change, adding a further layer of insight into the mechanism of adaptation in response to natural selection. The discovery that the mutation itself is a transposable element will stimulate further debate about the importance of 'jumping genes' as a source of major phenotypic novelty. PMID:27251284

  11. The industrial melanism mutation in British peppered moths is a transposable element.

    Science.gov (United States)

    Van't Hof, Arjen E; Campagne, Pascal; Rigden, Daniel J; Yung, Carl J; Lingley, Jessica; Quail, Michael A; Hall, Neil; Darby, Alistair C; Saccheri, Ilik J

    2016-06-01

    Discovering the mutational events that fuel adaptation to environmental change remains an important challenge for evolutionary biology. The classroom example of a visible evolutionary response is industrial melanism in the peppered moth (Biston betularia): the replacement, during the Industrial Revolution, of the common pale typica form by a previously unknown black (carbonaria) form, driven by the interaction between bird predation and coal pollution. The carbonaria locus has been coarsely localized to a 200-kilobase region, but the specific identity and nature of the sequence difference controlling the carbonaria-typica polymorphism, and the gene it influences, are unknown. Here we show that the mutation event giving rise to industrial melanism in Britain was the insertion of a large, tandemly repeated, transposable element into the first intron of the gene cortex. Statistical inference based on the distribution of recombined carbonaria haplotypes indicates that this transposition event occurred around 1819, consistent with the historical record. We have begun to dissect the mode of action of the carbonaria transposable element by showing that it increases the abundance of a cortex transcript, the protein product of which plays an important role in cell-cycle regulation, during early wing disc development. Our findings fill a substantial knowledge gap in the iconic example of microevolutionary change, adding a further layer of insight into the mechanism of adaptation in response to natural selection. The discovery that the mutation itself is a transposable element will stimulate further debate about the importance of 'jumping genes' as a source of major phenotypic novelty.

  12. Distribution and insertion numbers of transposable elements in species of the Drosophila saltans group

    Directory of Open Access Journals (Sweden)

    Juliana P. de Castro

    2006-01-01

    Full Text Available Information about the distribution and insertion numbers of many transposable elements is restricted to few species of Drosophila, although these elements are widely distributed throughout the genus. The aim of this work was to describe the distribution and insertion numbers of four retrotransposons (copia, gypsy, micropia, I and four transposons (hobo, mariner, Minos and Bari-1 in the saltans group of Drosophila. Our data shows that, except for mariner, all the other elements are widespread within the saltans group and show variable insertion numbers of up to 24 copies.

  13. Transposable elements in cancer as a by-product of stress-induced evolvability

    DEFF Research Database (Denmark)

    Mourier, Tobias; Nielsen, Lars P.; Hansen, Anders Johannes;

    2014-01-01

    requires the TE activity response to possess an element of specificity and be targeted toward certain parts of the genome. We propose that a similar TE response is present in human cells, and that this stress response may drive the onset of human cancers. As such, TE-driven cancers may be viewed as an......Transposable elements (TEs) are ubiquitous in eukaryotic genomes. Barbara McClintock's famous notion of TEs acting as controlling elements modifying the genetic response of an organism upon exposure to stressful environments has since been solidly supported in a series of model organisms. This...... evolutionary by-product of organisms' abilities to genetically adapt to environmental stress....

  14. Evolutionary Histories of Transposable Elements in the Genome of the Largest Living Marsupial Carnivore, the Tasmanian Devil

    OpenAIRE

    Gallus, Susanne; Hallström, Björn M.; Kumar, Vikas; Dodt, William G; Janke, Axel; Schumann, Gerald G.; Nilsson, Maria A.

    2015-01-01

    The largest living carnivorous marsupial, the Tasmanian devil (Sarcophilus harrisii), is the sole survivor of a lineage originating about 12 Ma. We set out to investigate the spectrum of transposable elements found in the Tasmanian devil genome, the first high-coverage genome of an Australian marsupial. Marsupial genomes have been shown to have the highest amount of transposable elements among vertebrates. We analyzed the horizontally transmitted DNA transposons OC1 and hAT-1_MEu in the Tasma...

  15. Biased exonization of transposed elements in duplicated genes: A lesson from the TIF-IA gene

    Directory of Open Access Journals (Sweden)

    Shomron Noam

    2007-11-01

    Full Text Available Abstract Background Gene duplication and exonization of intronic transposed elements are two mechanisms that enhance genomic diversity. We examined whether there is less selection against exonization of transposed elements in duplicated genes than in single-copy genes. Results Genome-wide analysis of exonization of transposed elements revealed a higher rate of exonization within duplicated genes relative to single-copy genes. The gene for TIF-IA, an RNA polymerase I transcription initiation factor, underwent a humanoid-specific triplication, all three copies of the gene are active transcriptionally, although only one copy retains the ability to generate the TIF-IA protein. Prior to TIF-IA triplication, an Alu element was inserted into the first intron. In one of the non-protein coding copies, this Alu is exonized. We identified a single point mutation leading to exonization in one of the gene duplicates. When this mutation was introduced into the TIF-IA coding copy, exonization was activated and the level of the protein-coding mRNA was reduced substantially. A very low level of exonization was detected in normal human cells. However, this exonization was abundant in most leukemia cell lines evaluated, although the genomic sequence is unchanged in these cancerous cells compared to normal cells. Conclusion The definition of the Alu element within the TIF-IA gene as an exon is restricted to certain types of cancers; the element is not exonized in normal human cells. These results further our understanding of the delicate interplay between gene duplication and alternative splicing and of the molecular evolutionary mechanisms leading to genetic innovations. This implies the existence of purifying selection against exonization in single copy genes, with duplicate genes free from such constrains.

  16. Distribution and conservation of the transposable element gypsy in drosophilid species

    Directory of Open Access Journals (Sweden)

    Fabiana Herédia

    2007-01-01

    Full Text Available In an attempt to understand the dynamics of transposable elements (T'S in the genome of host species, we investigated the distribution, representativeness and conservation of DNA sequences homologous to the Drosophila melanogaster gypsy retrotransposon in 42 drosophilid species. Our results extended the knowledge about the wide distribution of gypsy in the genus Drosophila, including several Neotropical species not previously studied. The gypsy-like sequences showed high divergence compared to the D. melanogaster gypsy element. Furthermore, the conservation of the restriction sites between gypsy sequences from phylogenetically unrelated species pointed to a more complex evolutionary picture, which includes the possibility of the horizontal transfer events already described for this retrotransposon.

  17. Strong phylogenetic inertia on genome size and transposable element content among 26 species of flies.

    Science.gov (United States)

    Sessegolo, Camille; Burlet, Nelly; Haudry, Annabelle

    2016-08-01

    While the evolutionary mechanisms driving eukaryote genome size evolution are still debated, repeated element content appears to be crucial. Here, we reconstructed the phylogeny and identified repeats in the genome of 26 Drosophila exhibiting a twofold variation in genome size. The content in transposable elements (TEs) is highly correlated to genome size evolution among these closely related species. We detected a strong phylogenetic signal on the evolution of both genome size and TE content, and a genome contraction in the Drosophila melanogaster subgroup. PMID:27576524

  18. Interspecies insertion polymorphism analysis reveals recent activity of transposable elements in extant coelacanths.

    Science.gov (United States)

    Naville, Magali; Chalopin, Domitille; Volff, Jean-Nicolas

    2014-01-01

    Coelacanths are lobe-finned fish represented by two extant species, Latimeria chalumnae in South Africa and Comoros and L. menadoensis in Indonesia. Due to their intermediate phylogenetic position between ray-finned fish and tetrapods in the vertebrate lineage, they are of great interest from an evolutionary point of view. In addition, extant specimens look similar to 300 million-year-old fossils; because of their apparent slowly evolving morphology, coelacanths have been often described as « living fossils ». As an underlying cause of such a morphological stasis, several authors have proposed a slow evolution of the coelacanth genome. Accordingly, sequencing of the L. chalumnae genome has revealed a globally low substitution rate for protein-coding regions compared to other vertebrates. However, genome and gene evolution can also be influenced by transposable elements, which form a major and dynamic part of vertebrate genomes through their ability to move, duplicate and recombine. In this work, we have searched for evidence of transposition activity in coelacanth genomes through the comparative analysis of orthologous genomic regions from both Latimeria species. Comparison of 5.7 Mb (0.2%) of the L. chalumnae genome with orthologous Bacterial Artificial Chromosome clones from L. menadoensis allowed the identification of 27 species-specific transposable element insertions, with a strong relative contribution of CR1 non-LTR retrotransposons. Species-specific homologous recombination between the long terminal repeats of a new coelacanth endogenous retrovirus was also detected. Our analysis suggests that transposon activity is responsible for at least 0.6% of genome divergence between both Latimeria species. Taken together, this study demonstrates that coelacanth genomes are not evolutionary inert: they contain recently active transposable elements, which have significantly contributed to post-speciation genome divergence in Latimeria.

  19. Interspecies insertion polymorphism analysis reveals recent activity of transposable elements in extant coelacanths.

    Directory of Open Access Journals (Sweden)

    Magali Naville

    Full Text Available Coelacanths are lobe-finned fish represented by two extant species, Latimeria chalumnae in South Africa and Comoros and L. menadoensis in Indonesia. Due to their intermediate phylogenetic position between ray-finned fish and tetrapods in the vertebrate lineage, they are of great interest from an evolutionary point of view. In addition, extant specimens look similar to 300 million-year-old fossils; because of their apparent slowly evolving morphology, coelacanths have been often described as « living fossils ». As an underlying cause of such a morphological stasis, several authors have proposed a slow evolution of the coelacanth genome. Accordingly, sequencing of the L. chalumnae genome has revealed a globally low substitution rate for protein-coding regions compared to other vertebrates. However, genome and gene evolution can also be influenced by transposable elements, which form a major and dynamic part of vertebrate genomes through their ability to move, duplicate and recombine. In this work, we have searched for evidence of transposition activity in coelacanth genomes through the comparative analysis of orthologous genomic regions from both Latimeria species. Comparison of 5.7 Mb (0.2% of the L. chalumnae genome with orthologous Bacterial Artificial Chromosome clones from L. menadoensis allowed the identification of 27 species-specific transposable element insertions, with a strong relative contribution of CR1 non-LTR retrotransposons. Species-specific homologous recombination between the long terminal repeats of a new coelacanth endogenous retrovirus was also detected. Our analysis suggests that transposon activity is responsible for at least 0.6% of genome divergence between both Latimeria species. Taken together, this study demonstrates that coelacanth genomes are not evolutionary inert: they contain recently active transposable elements, which have significantly contributed to post-speciation genome divergence in Latimeria.

  20. Spontaneous mutators of salmonella typhimurium LT2 generated by insertion of transposable elements.

    OpenAIRE

    Shanabruch, W G; Behlau, I; Walker, G C

    1981-01-01

    Spontaneous mutators of Salmonella typhimurium LT2 were generated by inserting the transposable element Tn5 or Tn10 into the bacterial chromosome. Two mutators mapped at the position of the mutH and mutL loci of S. typhimurium, and two other mutators mapped at positions corresponding to the mutS and uvrD loci of Escherichia coli. A fifth mutator, mutB, did not map at a position corresponding to any of the known mutators of S. typhimurium or E. coli. The mutH,L,S and uvrD alleles increased the...

  1. Germline transformation of Aedes fluviatilis (Diptera:Culicidae) with the piggyBac transposable element.

    Science.gov (United States)

    Rodrigues, Flávia Guimarães; Oliveira, Sabrina Barbosa; Rocha, Bruno Coelho; Moreira, Luciano Andrade

    2006-11-01

    The technique to generate transgenic mosquitoes requires adaptation for each target species because of aspects related to species biology, sensitivity to manipulation and rearing conditions. Here we tested different parameters on the microinjection procedure in order to obtain a transgenic Neotropical mosquito species. By using a transposon-based strategy we were able to successfully transform Aedes fluviatilis (Lutz), which can be used as an avian malaria model. These results demonstrate the usefulness of the piggyBac transposable element as a transformation vector for Neotropical mosquito species and opens up new research frontiers for South American mosquito vectors. PMID:17160283

  2. Germline transformation of Aedes fluviatilis (Diptera:Culicidae with the piggyBac transposable element

    Directory of Open Access Journals (Sweden)

    Flávia Guimarães Rodrigues

    2006-11-01

    Full Text Available The technique to generate transgenic mosquitoes requires adaptation for each target species because of aspects related to species biology, sensitivity to manipulation and rearing conditions. Here we tested different parameters on the microinjection procedure in order to obtain a transgenic Neotropical mosquito species. By using a transposon-based strategy we were able to successfully transform Aedes fluviatilis (Lutz, which can be used as an avian malaria model. These results demonstrate the usefulness of the piggyBac transposable element as a transformation vector for Neotropical mosquito species and opens up new research frontiers for South American mosquito vectors.

  3. Characterization of active miniature inverted-repeat transposable elements in the peanut genome

    OpenAIRE

    Shirasawa, Kenta; Hirakawa, Hideki; Tabata, Satoshi; Hasegawa, Makoto; Kiyoshima, Hiroyuki; Suzuki, Sigeru; Sasamoto, Sigemi; Watanabe, Akiko; Fujishiro, Tsunakazu; Isobe, Sachiko

    2012-01-01

    Miniature inverted-repeat transposable elements (MITEs), some of which are known as active non-autonomous DNA transposons, are found in the genomes of plants and animals. In peanut (Arachis hypogaea), AhMITE1 has been identified in a gene for fatty-acid desaturase, and possessed excision activity. However, the AhMITE1 distribution and frequency of excision have not been determined for the peanut genome. In order to characterize AhMITE1s, their genomic diversity and transposition ability was i...

  4. Abundance, distribution and potential impact of transposable elements in the genome of Mycosphaerella fijiensis

    Directory of Open Access Journals (Sweden)

    Santana Mateus F

    2012-12-01

    Full Text Available Abstract Background Mycosphaerella fijiensis is a ascomycete that causes Black Sigatoka in bananas. Recently, the M. fijiensis genome was sequenced. Repetitive sequences are ubiquitous components of fungal genomes. In most genomic analyses, repetitive sequences are associated with transposable elements (TEs. TEs are dispersed repetitive DNA sequences found in a host genome. These elements have the ability to move from one location to another within the genome, and their insertion can cause a wide spectrum of mutations in their hosts. Some of the deleterious effects of TEs may be due to ectopic recombination among TEs of the same family. In addition, some transposons are physically linked to genes and can control their expression. To prevent possible damage caused by the presence of TEs in the genome, some fungi possess TE-silencing mechanisms, such as RIP (Repeat Induced Point mutation. In this study, the abundance, distribution and potential impact of TEs in the genome of M. fijiensis were investigated. Results A total of 613 LTR-Gypsy and 27 LTR-Copia complete elements of the class I were detected. Among the class II elements, a total of 28 Mariner, five Mutator and one Harbinger complete elements were identified. The results of this study indicate that transposons were and are important ectopic recombination sites. A distribution analysis of a transposable element from each class of the M. fijiensis isolates revealed variable hybridization profiles, indicating the activity of these elements. Several genes encoding proteins involved in important metabolic pathways and with potential correlation to pathogenicity systems were identified upstream and downstream of transposable elements. A comparison of the sequences from different transposon groups suggested the action of the RIP silencing mechanism in the genome of this microorganism. Conclusions The analysis of TEs in M. fijiensis suggests that TEs play an important role in the evolution of

  5. Transposable Elements versus the Fungal Genome: Impact on Whole-Genome Architecture and Transcriptional Profiles.

    Directory of Open Access Journals (Sweden)

    Raúl Castanera

    2016-06-01

    Full Text Available Transposable elements (TEs are exceptional contributors to eukaryotic genome diversity. Their ubiquitous presence impacts the genomes of nearly all species and mediates genome evolution by causing mutations and chromosomal rearrangements and by modulating gene expression. We performed an exhaustive analysis of the TE content in 18 fungal genomes, including strains of the same species and species of the same genera. Our results depicted a scenario of exceptional variability, with species having 0.02 to 29.8% of their genome consisting of transposable elements. A detailed analysis performed on two strains of Pleurotus ostreatus uncovered a genome that is populated mainly by Class I elements, especially LTR-retrotransposons amplified in recent bursts from 0 to 2 million years (My ago. The preferential accumulation of TEs in clusters led to the presence of genomic regions that lacked intra- and inter-specific conservation. In addition, we investigated the effect of TE insertions on the expression of their nearby upstream and downstream genes. Our results showed that an important number of genes under TE influence are significantly repressed, with stronger repression when genes are localized within transposon clusters. Our transcriptional analysis performed in four additional fungal models revealed that this TE-mediated silencing was present only in species with active cytosine methylation machinery. We hypothesize that this phenomenon is related to epigenetic defense mechanisms that are aimed to suppress TE expression and control their proliferation.

  6. Transposable element distribution, abundance and role in genome size variation in the genus Oryza

    Directory of Open Access Journals (Sweden)

    Collura Kristi

    2007-08-01

    Full Text Available Abstract Background The genus Oryza is composed of 10 distinct genome types, 6 diploid and 4 polyploid, and includes the world's most important food crop – rice (Oryza sativa [AA]. Genome size variation in the Oryza is more than 3-fold and ranges from 357 Mbp in Oryza glaberrima [AA] to 1283 Mbp in the polyploid Oryza ridleyi [HHJJ]. Because repetitive elements are known to play a significant role in genome size variation, we constructed random sheared small insert genomic libraries from 12 representative Oryza species and conducted a comprehensive study of the repetitive element composition, distribution and phylogeny in this genus. Particular attention was paid to the role played by the most important classes of transposable elements (Long Terminal Repeats Retrotransposons, Long interspersed Nuclear Elements, helitrons, DNA transposable elements in shaping these genomes and in their contributing to genome size variation. Results We identified the elements primarily responsible for the most strikingly genome size variation in Oryza. We demonstrated how Long Terminal Repeat retrotransposons belonging to the same families have proliferated to very different extents in various species. We also showed that the pool of Long Terminal Repeat Retrotransposons is substantially conserved and ubiquitous throughout the Oryza and so its origin is ancient and its existence predates the speciation events that originated the genus. Finally we described the peculiar behavior of repeats in the species Oryza coarctata [HHKK] whose placement in the Oryza genus is controversial. Conclusion Long Terminal Repeat retrotransposons are the major component of the Oryza genomes analyzed and, along with polyploidization, are the most important contributors to the genome size variation across the Oryza genus. Two families of Ty3-gypsy elements (RIRE2 and Atlantys account for a significant portion of the genome size variations present in the Oryza genus.

  7. Detection transposable elements in Botrytis cinerea in latent infection stage from symptomless apples

    Directory of Open Access Journals (Sweden)

    Jorge G Fernández

    2014-02-01

    Full Text Available Objective: T o detect Botrytis cinerea ( B. cinerea latent infections on apples before storage, which is essential for effective control strategies in the fruit postharvest industry. Methods: I n the present study, a polymerase chain reaction detection method, based on primers designed on B. cinerea transposable elements ( boty and flipper and intergenic spacer region as internal control, were utilized to reveal the presence of symptomless infections on apple fruits. T his molecular method proved to be highly specific and sensitive in detecting latent infections. I t revealed the presence of the pathogen in 83 % of the samples from infected apples with 10 4 conidia/ m L , whereas those infected with 10 6 conidia/m L detected 94 % as compared to the traditional method that revealed the pathogen in 40 % and 66 % of the samples inoculated with 10 4 and 10 6 conidia/m L respectively. F urthermore, the method characterized B. cinerea as subpopulation transposa-type by the presence of the transposable elements boty and flipper Results: T he results obtained from DNA quantification method were compared with enzyme- linked immunosorbent assay and these studies showed good correlation. T herefore our method has important advantages compared with others detection methods for B. cinerea, because the proposed methodology allowed distinguishes between its two subpopulations ( vacuma and transposa and this would allow establish possible appropriate control strategies. Conclusions: F inally, the method can be an interesting alternative for its possible application in the phytosanitary programs of the fruit industry worldwide.

  8. Detection transposable elements in Botrytis cinerea in latent infection stage from symptomless apples

    Institute of Scientific and Technical Information of China (English)

    Jorge G Fernndez; Martn A Fernndez-Baldo; Claudio Muoz; Eloy Salinas; Julio Raba; Mara I Sanz

    2014-01-01

    Objective:To detect Botrytis cinerea (B. cinerea) latent infections on apples before storage, which is essential for effective control strategies in the fruit postharvest industry. Methods:In the present study, a polymerase chain reaction detection method, based on primers designed on B. cinerea transposable elements (boty and flipper) and intergenic spacer region as internal control, were utilized to reveal the presence of symptomless infections on apple fruits. This molecular method proved to be highly specific and sensitive in detecting latent infections. It revealed the presence of the pathogen in 83%of the samples from infected apples with 104 conidia/mL, whereas those infected with 106 conidia/mL detected 94%as compared to the traditional method that revealed the pathogen in 40%and 66%of the samples inoculated with 104 and 106 conidia/mL respectively. Furthermore, the method characterized B. cinerea as subpopulation transposa-type by the presence of the transposable elements boty and flipper Results:The results obtained from DNA quantification method were compared with enzyme-linked immunosorbent assay and these studies showed good correlation. Therefore our method has important advantages compared with others detection methods for B. cinerea, because the proposed methodology allowed distinguishes between its two subpopulations (vacuma and transposa) and this would allow establish possible appropriate control strategies. Conclusions:Finally, the method can be an interesting alternative for its possible application in the phytosanitary programs of the fruit industry worldwide.

  9. detectMITE: A novel approach to detect miniature inverted repeat transposable elements in genomes.

    Science.gov (United States)

    Ye, Congting; Ji, Guoli; Liang, Chun

    2016-01-01

    Miniature inverted repeat transposable elements (MITEs) are prevalent in eukaryotic genomes, including plants and animals. Classified as a type of non-autonomous DNA transposable elements, they play important roles in genome organization and evolution. Comprehensive and accurate genome-wide detection of MITEs in various eukaryotic genomes can improve our understanding of their origins, transposition processes, regulatory mechanisms, and biological relevance with regard to gene structures, expression, and regulation. In this paper, we present a new MATLAB-based program called detectMITE that employs a novel numeric calculation algorithm to replace conventional string matching algorithms in MITE detection, adopts the Lempel-Ziv complexity algorithm to filter out MITE candidates with low complexity, and utilizes the powerful clustering program CD-HIT to cluster similar MITEs into MITE families. Using the rice genome as test data, we found that detectMITE can more accurately, comprehensively, and efficiently detect MITEs on a genome-wide scale than other popular MITE detection tools. Through comparison with the potential MITEs annotated in Repbase, the widely used eukaryotic repeat database, detectMITE has been shown to find known and novel MITEs with a complete structure and full-length copies in the genome. detectMITE is an open source tool (https://sourceforge.net/projects/detectmite). PMID:26795595

  10. Transposable DNA elements and life history traits: II. Transposition of P DNA elements in somatic cells reduces fitness, mating activity, and locomotion of Drosophila melanogaster.

    Science.gov (United States)

    Woodruff, R C; Thompson, J N; Barker, J S; Huai, H

    1999-01-01

    Some transposable DNA elements in higher organisms are active in somatic cells, as well as in germinal cells. What effect does the movement of DNA elements in somatic cells have on life history traits? It has previously been reported that somatically active P and mariner elements in Drosophila induce genetic damage and significantly reduce lifespan. In this study, we report that the movement of P elements in somatic cells also significantly reduces fitness, mating activity, and locomotion of Drosophila melanogaster. If other elements cause similar changes in life history traits, it is doubtful if transposable DNA elements remain active for long in somatic cells in natural populations.

  11. Nezha, a novel active miniature inverted-repeat transposable element in cyanobacteria

    International Nuclear Information System (INIS)

    Miniature inverted-repeat transposable elements (MITEs) were first identified in plants and exerted extensive proliferations throughout eukaryotic and archaeal genomes. But very few MITEs have been characterized in bacteria. We identified a novel MITE, called Nezha, in cyanobacteria Anabaena variabilis ATCC 29413 and Nostoc sp. PCC 7120. Nezha, like most previously known MITEs in other organisms, is small in size, non-coding, carrying TIR and DR signals, and of potential to form a stable RNA secondary structure, and it tends to insert into A+T-rich regions. Recent transpositions of Nezha were observed in A. variabilis ATCC 29413 and Nostoc sp. PCC 7120, respectively. Nezha might have proliferated recently with aid from the transposase encoded by ISNpu3-like elements. A possible horizontal transfer event of Nezha from cyanobacteria to Polaromonas JS666 is also observed

  12. Transposable elements: an abundant and natural source of regulatory sequences for host genes.

    Science.gov (United States)

    Rebollo, Rita; Romanish, Mark T; Mager, Dixie L

    2012-01-01

    The fact that transposable elements (TEs) can influence host gene expression was first recognized more than 50 years ago. However, since that time, TEs have been widely regarded as harmful genetic parasites-selfish elements that are rarely co-opted by the genome to serve a beneficial role. Here, we survey recent findings that relate to TE impact on host genes and remind the reader that TEs, in contrast to other noncoding parts of the genome, are uniquely suited to gene regulatory functions. We review recent studies that demonstrate the role of TEs in establishing and rewiring gene regulatory networks and discuss the overall ubiquity of exaptation. We suggest that although individuals within a population can be harmed by the deleterious effects of new TE insertions, the presence of TE sequences in a genome is of overall benefit to the population. PMID:22905872

  13. Genetic Innovation in Vertebrates: Gypsy Integrase Genes and Other Genes Derived from Transposable Elements

    Directory of Open Access Journals (Sweden)

    Domitille Chalopin

    2012-01-01

    Full Text Available Due to their ability to drive DNA rearrangements and to serve as a source of new coding and regulatory sequences, transposable elements (TEs are considered as powerful evolutionary agents within genomes. In this paper, we review the mechanism of molecular domestication, which corresponds to the formation of new genes derived from TE sequences. Many genes derived from retroelements and DNA transposons have been identified in mammals and other vertebrates, some of them fulfilling essential functions for the development and survival of their host organisms. We will particularly focus on the evolution and expression of Gypsy integrase (GIN genes, which have been formed from ancient event(s of molecular domestication and have evolved differentially in some vertebrate sublineages. What we describe here is probably only the tip of the evolutionary iceberg, and future genome analyses will certainly uncover new TE-derived genes and biological functions driving genetic innovation in vertebrates and other organisms.

  14. A gene family derived from transposable elements during early angiosperm evolution has reproductive fitness benefits in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Zoé Joly-Lopez

    2012-09-01

    Full Text Available The benefits of ever-growing numbers of sequenced eukaryotic genomes will not be fully realized until we learn to decipher vast stretches of noncoding DNA, largely composed of transposable elements. Transposable elements persist through self-replication, but some genes once encoded by transposable elements have, through a process called molecular domestication, evolved new functions that increase fitness. Although they have conferred numerous adaptations, the number of such domesticated transposable element genes remains unknown, so their evolutionary and functional impact cannot be fully assessed. Systematic searches that exploit genomic signatures of natural selection have been employed to identify potential domesticated genes, but their predictions have yet to be experimentally verified. To this end, we investigated a family of domesticated genes called MUSTANG (MUG, identified in a previous bioinformatic search of plant genomes. We show that MUG genes are functional. Mutants of Arabidopsis thaliana MUG genes yield phenotypes with severely reduced plant fitness through decreased plant size, delayed flowering, abnormal development of floral organs, and markedly reduced fertility. MUG genes are present in all flowering plants, but not in any non-flowering plant lineages, such as gymnosperms, suggesting that the molecular domestication of MUG may have been an integral part of early angiosperm evolution. This study shows that systematic searches can be successful at identifying functional genetic elements in noncoding regions and demonstrates how to combine systematic searches with reverse genetics in a fruitful way to decipher eukaryotic genomes.

  15. The ant genomes have been invaded by several types of mariner transposable elements

    Science.gov (United States)

    Lorite, Pedro; Maside, Xulio; Sanllorente, Olivia; Torres, María I.; Periquet, Georges; Palomeque, Teresa

    2012-12-01

    To date, only three types of full-length mariner elements have been described in ants, each one in a different genus of the Myrmicinae subfamily: Sinvmar was isolated from various Solenopsis species, Myrmar from Myrmica ruginodis, and Mboumar from Messor bouvieri. In this study, we report the coexistence of three mariner elements ( Tnigmar- Si, Tnigmar- Mr, and Tnigmar- Mb) in the genome of a single species, Tapinoma nigerrimum (subfamily Dolichoderinae). Molecular evolutionary analyses of the nucleotide sequence data revealed a general agreement between the evolutionary history of most the elements and the ant species that harbour them, and suggest that they are at the vertical inactivation stage of the so-called Mariner Life Cycle. In contrast, significantly reduced levels of synonymous divergence between Mboumar and Tnigmar- Mb and between Myrmar and Botmar (a mariner element isolated from Bombus terrestris), relative to those observed between their hosts, suggest that these elements arrived to the species that host them by horizontal transfer, long after the species' split. The horizontal transfer events for the two pairs of elements could be roughly dated within the last 2 million years and about 14 million years, respectively. As would be expected under this scenario, the coding sequences of the youngest elements, Tnigmar- Mb and Mboumar, are intact and, thus, potentially functional. Each mariner element has a different chromosomal distribution pattern according to their stage within the Mariner Life Cycle. Finally, a new defective transposable element ( Azteca) has also been found inserted into the Tnigmar- Mr sequences showing that the ant genomes have been invaded by at least four different types of mariner elements.

  16. A Gaijin-like miniature inverted repeat transposable element is mobilized in rice during cell differentiation

    Directory of Open Access Journals (Sweden)

    Dong Hai-Tao

    2012-04-01

    Full Text Available Abstract Background Miniature inverted repeat transposable element (MITE is one type of transposable element (TE, which is largely found in eukaryotic genomes and involved in a wide variety of biological events. However, only few MITEs were proved to be currently active and their physiological function remains largely unknown. Results We found that the amplicon discrepancy of a gene locus LOC_Os01g0420 in different rice cultivar genomes was resulted from the existence of a member of Gaijin-like MITEs (mGing. This result indicated that mGing transposition was occurred at this gene locus. By using a modified transposon display (TD analysis, the active transpositions of mGing were detected in rice Jiahua No. 1 genome under three conditions: in seedlings germinated from the seeds received a high dose γ-ray irradiation, in plantlets regenerated from anther-derived calli and from scutellum-derived calli, and were confirmed by PCR validation and sequencing. Sequence analysis revealed that single nucleotide polymorphisms (SNPs or short additional DNA sequences at transposition sites post mGing transposition. It suggested that sequence modification was possibly taken place during mGing transposition. Furthermore, cell re-differentiation experiment showed that active transpositions of both mGing and mPing (another well studied MITE were identified only in regenerated plantlets. Conclusions It is for the first time that mGing active transposition was demonstrated under γ-ray irradiation or in cell re-differentiation process in rice. This newly identified active MITE will provide a foundation for further analysis of the roles of MITEs in biological process.

  17. The majority of primate-specific regulatory sequences are derived from transposable elements.

    Directory of Open Access Journals (Sweden)

    Pierre-Étienne Jacques

    2013-05-01

    Full Text Available Although emerging evidence suggests that transposable elements (TEs have contributed novel regulatory elements to the human genome, their global impact on transcriptional networks remains largely uncharacterized. Here we show that TEs have contributed to the human genome nearly half of its active elements. Using DNase I hypersensitivity data sets from ENCODE in normal, embryonic, and cancer cells, we found that 44% of open chromatin regions were in TEs and that this proportion reached 63% for primate-specific regions. We also showed that distinct subfamilies of endogenous retroviruses (ERVs contributed significantly more accessible regions than expected by chance, with up to 80% of their instances in open chromatin. Based on these results, we further characterized 2,150 TE subfamily-transcription factor pairs that were bound in vivo or enriched for specific binding motifs, and observed that TEs contributing to open chromatin had higher levels of sequence conservation. We also showed that thousands of ERV-derived sequences were activated in a cell type-specific manner, especially in embryonic and cancer cells, and we demonstrated that this activity was associated with cell type-specific expression of neighboring genes. Taken together, these results demonstrate that TEs, and in particular ERVs, have contributed hundreds of thousands of novel regulatory elements to the primate lineage and reshaped the human transcriptional landscape.

  18. Somatic variegation and germinal mutability reflect the position of transposable element dissociation within the maize R gene

    Energy Technology Data Exchange (ETDEWEB)

    Alleman, M.; Kermicle, J.L. (Univ. of Wisconsin, Madison, WI (United States))

    1993-09-01

    The R gene regulates the timing and tissue-specificity of anthocyanin deposition during maize development. The Ac/Ds system of transposable elements was used to induce insertional mutants of the R-sc:124 allele during two cycles of mutagenesis. Of 43 unstable, spotted-aleurone mutants generated, 42 contain inserts of the Ds6 transposable element differing only in the position and orientation of the element. The remaining mutant, r-sc;ml, contained an insert of a Ds element of the approximate size of the Ds1 transposable element. The patterns of somatic variegation of these mutants, resulting from excision of Ds, define a spectrum of phenotypes ranging from sparse to dense variegation. The sparsely variegated mutants produce many germinal revertants and few stable null derivatives. Molecular analysis shows that the sparsely variegated alleles are caused by Ds6 insertions in protein coding regions of R-sc:124 whereas the densely variegated mutants result from insertions in introns or in flanking regions of the gene. The excision rate of Ds6 from R, estimated as the proportion of R genomic DNA restriction fragments lacking the element, was uniform regardless of position, orientation or whether the element was inserted in R-sc:124 or another R allele. The excision rate was greater, however, for the mutable alleles involving the Ds element from r-sc:m1. These data indicate that, although the excision rates are uniform for a given Ds element, the somatic and germinal mutability patterns of alleles associated with that element vary widely and depend primarily on the position of the transposable element within coding or noncoding regions of the gene.

  19. Ancient Transposable Elements Transformed the Uterine Regulatory Landscape and Transcriptome during the Evolution of Mammalian Pregnancy

    Directory of Open Access Journals (Sweden)

    Vincent J. Lynch

    2015-02-01

    Full Text Available A major challenge in biology is determining how evolutionarily novel characters originate; however, mechanistic explanations for the origin of new characters are almost completely unknown. The evolution of pregnancy is an excellent system in which to study the origin of novelties because mammals preserve stages in the transition from egg laying to live birth. To determine the molecular bases of this transition, we characterized the pregnant/gravid uterine transcriptome from tetrapods to trace the evolutionary history of uterine gene expression. We show that thousands of genes evolved endometrial expression during the origins of mammalian pregnancy, including genes that mediate maternal-fetal communication and immunotolerance. Furthermore, thousands of cis-regulatory elements that mediate decidualization and cell-type identity in decidualized stromal cells are derived from ancient mammalian transposable elements (TEs. Our results indicate that one of the defining mammalian novelties evolved from DNA sequences derived from ancient mammalian TEs co-opted into hormone-responsive regulatory elements distributed throughout the genome.

  20. Analysis of transposable elements in the genome of Asparagus officinalis from high coverage sequence data.

    Science.gov (United States)

    Li, Shu-Fen; Gao, Wu-Jun; Zhao, Xin-Peng; Dong, Tian-Yu; Deng, Chuan-Liang; Lu, Long-Dou

    2014-01-01

    Asparagus officinalis is an economically and nutritionally important vegetable crop that is widely cultivated and is used as a model dioecious species to study plant sex determination and sex chromosome evolution. To improve our understanding of its genome composition, especially with respect to transposable elements (TEs), which make up the majority of the genome, we performed Illumina HiSeq2000 sequencing of both male and female asparagus genomes followed by bioinformatics analysis. We generated 17 Gb of sequence (12×coverage) and assembled them into 163,406 scaffolds with a total cumulated length of 400 Mbp, which represent about 30% of asparagus genome. Overall, TEs masked about 53% of the A. officinalis assembly. Majority of the identified TEs belonged to LTR retrotransposons, which constitute about 28% of genomic DNA, with Ty1/copia elements being more diverse and accumulated to higher copy numbers than Ty3/gypsy. Compared with LTR retrotransposons, non-LTR retrotransposons and DNA transposons were relatively rare. In addition, comparison of the abundance of the TE groups between male and female genomes showed that the overall TE composition was highly similar, with only slight differences in the abundance of several TE groups, which is consistent with the relatively recent origin of asparagus sex chromosomes. This study greatly improves our knowledge of the repetitive sequence construction of asparagus, which facilitates the identification of TEs responsible for the early evolution of plant sex chromosomes and is helpful for further studies on this dioecious plant.

  1. Integrated cytogenetics and genomics analysis of transposable elements in the Nile tilapia, Oreochromis niloticus.

    Science.gov (United States)

    Valente, Guilherme; Kocher, Thomas; Eickbush, Thomas; Simões, Rafael P; Martins, Cesar

    2016-06-01

    Integration of cytogenetics and genomics has become essential to a better view of architecture and function of genomes. Although the advances on genomic sequencing have contributed to study genes and genomes, the repetitive DNA fraction of the genome is still enigmatic and poorly understood. Among repeated DNAs, transposable elements (TEs) are major components of eukaryotic chromatin and their investigation has been hindered even after the availability of whole sequenced genomes. The cytogenetic mapping of TEs in chromosomes has proved to be of high value to integrate information from the micro level of nucleotide sequence to a cytological view of chromosomes. Different TEs have been cytogenetically mapped in cichlids; however, neither details about their genomic arrangement nor appropriated copy number are well defined by these approaches. The current study integrates TEs distribution in Nile tilapia Oreochromis niloticus genome based on cytogenetic and genomics/bioinformatics approach. The results showed that some elements are not randomly distributed and that some are genomic dependent on each other. Moreover, we found extensive overlap between genomics and cytogenetics data and that tandem duplication may be the major mechanism responsible for the genomic dynamics of TEs here analyzed. This paper provides insights in the genomic organization of TEs under an integrated view based on cytogenetics and genomics. PMID:26860923

  2. Analysis of transposable elements in the genome of Asparagus officinalis from high coverage sequence data.

    Directory of Open Access Journals (Sweden)

    Shu-Fen Li

    Full Text Available Asparagus officinalis is an economically and nutritionally important vegetable crop that is widely cultivated and is used as a model dioecious species to study plant sex determination and sex chromosome evolution. To improve our understanding of its genome composition, especially with respect to transposable elements (TEs, which make up the majority of the genome, we performed Illumina HiSeq2000 sequencing of both male and female asparagus genomes followed by bioinformatics analysis. We generated 17 Gb of sequence (12×coverage and assembled them into 163,406 scaffolds with a total cumulated length of 400 Mbp, which represent about 30% of asparagus genome. Overall, TEs masked about 53% of the A. officinalis assembly. Majority of the identified TEs belonged to LTR retrotransposons, which constitute about 28% of genomic DNA, with Ty1/copia elements being more diverse and accumulated to higher copy numbers than Ty3/gypsy. Compared with LTR retrotransposons, non-LTR retrotransposons and DNA transposons were relatively rare. In addition, comparison of the abundance of the TE groups between male and female genomes showed that the overall TE composition was highly similar, with only slight differences in the abundance of several TE groups, which is consistent with the relatively recent origin of asparagus sex chromosomes. This study greatly improves our knowledge of the repetitive sequence construction of asparagus, which facilitates the identification of TEs responsible for the early evolution of plant sex chromosomes and is helpful for further studies on this dioecious plant.

  3. Analysis of transposable elements in the genome of Asparagus officinalis from high coverage sequence data.

    Science.gov (United States)

    Li, Shu-Fen; Gao, Wu-Jun; Zhao, Xin-Peng; Dong, Tian-Yu; Deng, Chuan-Liang; Lu, Long-Dou

    2014-01-01

    Asparagus officinalis is an economically and nutritionally important vegetable crop that is widely cultivated and is used as a model dioecious species to study plant sex determination and sex chromosome evolution. To improve our understanding of its genome composition, especially with respect to transposable elements (TEs), which make up the majority of the genome, we performed Illumina HiSeq2000 sequencing of both male and female asparagus genomes followed by bioinformatics analysis. We generated 17 Gb of sequence (12×coverage) and assembled them into 163,406 scaffolds with a total cumulated length of 400 Mbp, which represent about 30% of asparagus genome. Overall, TEs masked about 53% of the A. officinalis assembly. Majority of the identified TEs belonged to LTR retrotransposons, which constitute about 28% of genomic DNA, with Ty1/copia elements being more diverse and accumulated to higher copy numbers than Ty3/gypsy. Compared with LTR retrotransposons, non-LTR retrotransposons and DNA transposons were relatively rare. In addition, comparison of the abundance of the TE groups between male and female genomes showed that the overall TE composition was highly similar, with only slight differences in the abundance of several TE groups, which is consistent with the relatively recent origin of asparagus sex chromosomes. This study greatly improves our knowledge of the repetitive sequence construction of asparagus, which facilitates the identification of TEs responsible for the early evolution of plant sex chromosomes and is helpful for further studies on this dioecious plant. PMID:24810432

  4. Analysis of Transposable Elements in the Genome of Asparagus officinalis from High Coverage Sequence Data

    Science.gov (United States)

    Li, Shu-Fen; Gao, Wu-Jun; Zhao, Xin-Peng; Dong, Tian-Yu; Deng, Chuan-Liang; Lu, Long-Dou

    2014-01-01

    Asparagus officinalis is an economically and nutritionally important vegetable crop that is widely cultivated and is used as a model dioecious species to study plant sex determination and sex chromosome evolution. To improve our understanding of its genome composition, especially with respect to transposable elements (TEs), which make up the majority of the genome, we performed Illumina HiSeq2000 sequencing of both male and female asparagus genomes followed by bioinformatics analysis. We generated 17 Gb of sequence (12×coverage) and assembled them into 163,406 scaffolds with a total cumulated length of 400 Mbp, which represent about 30% of asparagus genome. Overall, TEs masked about 53% of the A. officinalis assembly. Majority of the identified TEs belonged to LTR retrotransposons, which constitute about 28% of genomic DNA, with Ty1/copia elements being more diverse and accumulated to higher copy numbers than Ty3/gypsy. Compared with LTR retrotransposons, non-LTR retrotransposons and DNA transposons were relatively rare. In addition, comparison of the abundance of the TE groups between male and female genomes showed that the overall TE composition was highly similar, with only slight differences in the abundance of several TE groups, which is consistent with the relatively recent origin of asparagus sex chromosomes. This study greatly improves our knowledge of the repetitive sequence construction of asparagus, which facilitates the identification of TEs responsible for the early evolution of plant sex chromosomes and is helpful for further studies on this dioecious plant. PMID:24810432

  5. Active transposable elements recover species boundaries and geographic structure in Madagascan coffee species.

    Science.gov (United States)

    Roncal, Julissa; Guyot, Romain; Hamon, Perla; Crouzillat, Dominique; Rigoreau, Michel; Konan, Olivier N'Guessan; Rakotomalala, Jean-Jacques; Nowak, Michael D; Davis, Aaron P; de Kochko, Alexandre

    2016-02-01

    The completion of the genome assembly for the economically important coffee plant Coffea canephora (Rubiaceae) has allowed the use of bioinformatic tools to identify and characterize a diverse array of transposable elements (TEs), which can be used in evolutionary studies of the genus. An overview of the copy number and location within the C. canephora genome of four TEs is presented. These are tested for their use as molecular markers to unravel the evolutionary history of the Millotii Complex, a group of six wild coffee (Coffea) species native to Madagascar. Two TEs from the Gypsy superfamily successfully recovered some species boundaries and geographic structure among samples, whereas a TE from the Copia superfamily did not. Notably, species occurring in evergreen moist forests of eastern and southeastern Madagascar were divergent with respect to species in other habitats and regions. Our results suggest that the peak of transpositional activity of the Gypsy and Copia TEs occurred, respectively, before and after the speciation events of the tested Madagascan species. We conclude that the utilization of active TEs has considerable potential to unravel the evolutionary history and delimitation of closely related Coffea species. However, the selection of TE needs to be experimentally tested, since each element has its own evolutionary history. Different TEs with similar copy number in a given species can render different dendrograms; thus copy number is not a good selection criterion to attain phylogenetic resolution. PMID:26231981

  6. Enhancer/Suppressor mutator (En/Spm)-like transposable elements of cassava (Manihot esculenta) are transcriptionally inactive.

    Science.gov (United States)

    Gbadegesin, M A; Beeching, J R

    2010-04-13

    Transposable elements contribute to the size, structure, variation, and diversity of the genome and have major effects on gene function. Sequencing projects have revealed the diversity of transposable elements in many organisms and have shown that they constitute a high percentage of the genome. PCR-based techniques using degenerate primers designed from conserved enzyme domains of transposable elements can provide quick and extensive surveys, making study of diversity and abundance and their applications possible in species where full genome sequence data are not yet available. We studied cassava (Manihot esculenta) En/Spm-like transposons (Meens) with regard to genomic distribution, sequence diversity and methylation status. Cassava transposase fragments characteristic of En/Spm-like transposons were isolated, cloned and characterized. Sequence analysis showed that cassava En/Spm-like elements are highly conserved, with overall identity in the range of 68-98%. Southern hybridization supports the presence of multiple copies of En/Spm-like transposons integrated in the genome of all cassava cultivars that we tested. Hybridization patterns of HpaII- and MspI-digested cassava genomic DNA revealed highly methylated sequences. There were no clear differences in hybridization pattern between the cultivars. We did not detect RNA transcripts of Meens by Northern procedures. We examined the possibility of recent transposition activities of the cassava En/Spm-like elements.

  7. The mechanism of ageing: primary role of transposable elements in genome disintegration.

    Science.gov (United States)

    Sturm, Ádám; Ivics, Zoltán; Vellai, Tibor

    2015-05-01

    Understanding the molecular basis of ageing remains a fundamental problem in biology. In multicellular organisms, while the soma undergoes a progressive deterioration over the lifespan, the germ line is essentially immortal as it interconnects the subsequent generations. Genomic instability in somatic cells increases with age, and accumulating evidence indicates that the disintegration of somatic genomes is accompanied by the mobilisation of transposable elements (TEs) that, when mobilised, can be mutagenic by disrupting coding or regulatory sequences. In contrast, TEs are effectively silenced in the germ line by the Piwi-piRNA system. Here, we propose that TE repression transmits the persistent proliferation capacity and the non-ageing phenotype (e.g., preservation of genomic integrity) of the germ line. The Piwi-piRNA pathway also operates in tumorous cells and in somatic cells of certain organisms, including hydras, which likewise exhibit immortality. However, in somatic cells lacking the Piwi-piRNA pathway, gradual chromatin decondensation increasingly allows the mobilisation of TEs as the organism ages. This can explain why the mortality rate rises exponentially throughout the adult life in most animal species, including humans. PMID:25837999

  8. Burgeoning evidence indicates that microRNAs were initially formed from transposable element sequences.

    Science.gov (United States)

    Roberts, Justin T; Cardin, Sara E; Borchert, Glen M

    2014-01-01

    MicroRNAs (miRNAs) constitute a recently discovered class of noncoding RNAs that play key roles in the regulation of gene expression. Despite being only ~20 nucleotides in length, these highly versatile molecules have been shown to play pivotal roles in development, basic cellular metabolism, apoptosis, and disease. While over 24,000 miRNAs have been characterized since they were first isolated in mammals in 2001, the functions of the majority of these miRNAs remain largely undescribed. That said, many now suggest that characterization of the relationships between miRNAs and transposable elements (TEs) can help elucidate miRNA functionality. Strikingly, over 20 publications have now reported the initial formation of thousands of miRNA loci from TE sequences. In this review we chronicle the findings of these reports, discuss the evolution of the field along with future directions, and examine how this information can be used to ascertain insights into miRNA transcriptional regulation and how it can be exploited to facilitate miRNA target prediction. PMID:25054081

  9. Transposable element insertions in long intergenic non-coding RNA genes

    Directory of Open Access Journals (Sweden)

    Sivakumar eKannan

    2015-06-01

    Full Text Available Transposable elements (TE are abundant in mammalian genomes and appear to have contributed to the evolution of their hosts by providing novel regulatory or coding sequences. We analyzed different regions of long intergenic non-coding RNA (lincRNA genes in human and mouse genomes to systematically assess the potential contribution of TEs to the evolution of the structure and regulation of expression of lincRNA genes. Introns of lincRNA genes contain the highest percentage of TE-derived sequences, followed by exons and then promoter regions although the density of TEs is not significantly different between exons and promoters. Higher frequencies of ancient TEs in promoters and exons compared to introns implies that many lincRNA genes emerged before the split of primates and rodents. The content of TE-derived sequences in lincRNA genes is substantially higher than that in protein-coding genes, especially in exons and promoter regions. A significant positive correlation was detected between the content of TEs and evolutionary rate of lincRNAs indicating that inserted TEs are preferentially fixed in fast-evolving lincRNA genes. These results are consistent with the RIDL (Repeat Insertion Domains of LncRNAs hypothesis under which TEs have substantially contributed to the origin, evolution, and in particular functional diversification, of lincRNA genes.

  10. Phylogenetic and Genomic Analyses Resolve the Origin of Important Plant Genes Derived from Transposable Elements.

    Science.gov (United States)

    Joly-Lopez, Zoé; Hoen, Douglas R; Blanchette, Mathieu; Bureau, Thomas E

    2016-08-01

    Once perceived as merely selfish, transposable elements (TEs) are now recognized as potent agents of adaptation. One way TEs contribute to evolution is through TE exaptation, a process whereby TEs, which persist by replicating in the genome, transform into novel host genes, which persist by conferring phenotypic benefits. Known exapted TEs (ETEs) contribute diverse and vital functions, and may facilitate punctuated equilibrium, yet little is known about this process. To better understand TE exaptation, we designed an approach to resolve the phylogenetic context and timing of exaptation events and subsequent patterns of ETE diversification. Starting with known ETEs, we search in diverse genomes for basal ETEs and closely related TEs, carefully curate the numerous candidate sequences, and infer detailed phylogenies. To distinguish TEs from ETEs, we also weigh several key genomic characteristics including repetitiveness, terminal repeats, pseudogenic features, and conserved domains. Applying this approach to the well-characterized plant ETEs MUG and FHY3, we show that each group is paraphyletic and we argue that this pattern demonstrates that each originated in not one but multiple exaptation events. These exaptations and subsequent ETE diversification occurred throughout angiosperm evolution including the crown group expansion, the angiosperm radiation, and the primitive evolution of angiosperms. In addition, we detect evidence of several putative novel ETE families. Our findings support the hypothesis that TE exaptation generates novel genes more frequently than is currently thought, often coinciding with key periods of evolution. PMID:27189548

  11. Report of a chimeric origin of transposable elements in a bovine-coding gene.

    Science.gov (United States)

    Almeida, L M; Amaral, M E J; Silva, I T; Silva, W A; Riggs, P K; Carareto, C M

    2008-02-01

    Despite the wide distribution of transposable elements (TEs) in mammalian genomes, part of their evolutionary significance remains to be discovered. Today there is a substantial amount of evidence showing that TEs are involved in the generation of new exons in different species. In the present study, we searched 22,805 genes and reported the occurrence of TE-cassettes in coding sequences of 542 cow genes using the RepeatMasker program. Despite the significant number (542) of genes with TE insertions in exons only 14 (2.6%) of them were translated into protein, which we characterized as chimeric genes. From these chimeric genes, only the FAST kinase domains 3 (FASTKD3) gene, present on chromosome BTA 20, is a functional gene and showed evidence of the exaptation event. The genome sequence analysis showed that the last exon coding sequence of bovine FASTKD3 is approximately 85% similar to the ART2A retrotransposon sequence. In addition, comparison among FASTKD3 proteins shows that the last exon is very divergent from those of Homo sapiens, Pan troglodytes and Canis familiares. We suggest that the gene structure of bovine FASTKD3 gene could have originated by several ectopic recombinations between TE copies. Additionally, the absence of TE sequences in all other species analyzed suggests that the TE insertion is clade-specific, mainly in the ruminant lineage.

  12. A novel method for identifying polymorphic transposable elements via scanning of high-throughput short reads.

    Science.gov (United States)

    Kang, Houxiang; Zhu, Dan; Lin, Runmao; Opiyo, Stephen Obol; Jiang, Ning; Shiu, Shin-Han; Wang, Guo-Liang

    2016-06-01

    Identification of polymorphic transposable elements (TEs) is important because TE polymorphism creates genetic diversity and influences the function of genes in the host genome. However, de novo scanning of polymorphic TEs remains a challenge. Here, we report a novel computational method, called PTEMD (polymorphic TEs and their movement detection), for de novo discovery of genome-wide polymorphic TEs. PTEMD searches highly identical sequences using reads supported breakpoint evidences. Using PTEMD, we identified 14 polymorphic TE families (905 sequences) in rice blast fungus Magnaporthe oryzae, and 68 (10,618 sequences) in maize. We validated one polymorphic TE family experimentally, MoTE-1; all MoTE-1 family members are located in different genomic loci in the three tested isolates. We found that 57.1% (8 of 14) of the PTEMD-detected polymorphic TE families in M. oryzae are active. Furthermore, our data indicate that there are more polymorphic DNA transposons in maize than their counterparts of retrotransposons despite the fact that retrotransposons occupy largest fraction of genomic mass. We demonstrated that PTEMD is an effective tool for identifying polymorphic TEs in M. oryzae and maize genomes. PTEMD and the genome-wide polymorphic TEs in M. oryzae and maize are publically available at http://www.kanglab.cn/blast/PTEMD_V1.02.htm. PMID:27098848

  13. A Snapshot of Histone Modifications within Transposable Elements in Drosophila Wild Type Strains

    Science.gov (United States)

    Rebollo, Rita; Horard, Béatrice; Begeot, Flora; Delattre, Marion; Gilson, Eric; Vieira, Cristina

    2012-01-01

    Transposable elements (TEs) are a major source of genetic variability in genomes, creating genetic novelty and driving genome evolution. Analysis of sequenced genomes has revealed considerable diversity in TE families, copy number, and localization between different, closely related species. For instance, although the twin species Drosophila melanogaster and D. simulans share the same TE families, they display different amounts of TEs. Furthermore, previous analyses of wild type derived strains of D. simulans have revealed high polymorphism regarding TE copy number within this species. Several factors may influence the diversity and abundance of TEs in a genome, including molecular mechanisms such as epigenetic factors, which could be a source of variation in TE success. In this paper, we present the first analysis of the epigenetic status of four TE families (roo, tirant, 412 and F) in seven wild type strains of D. melanogaster and D. simulans. Our data shows intra- and inter-specific variations in the histone marks that adorn TE copies. Our results demonstrate that the chromatin state of common TEs varies among TE families, between closely related species and also between wild type strains. PMID:22962605

  14. Transposable elements, a treasure trove to decipher epigenetic variation: insights from Arabidopsis and crop epigenomes.

    Science.gov (United States)

    Mirouze, Marie; Vitte, Clémentine

    2014-06-01

    In the past decade, plant biologists and breeders have developed a growing interest in the field of epigenetics, which is defined as the study of heritable changes in gene expression that cannot be explained by changes in the DNA sequence. Epigenetic marks can be responsive to the environment, and evolve faster than genetic changes. Therefore, epigenetic diversity may represent an unexplored resource of natural variation that could be used in plant breeding programmes. On the other hand, crop genomes are largely populated with transposable elements (TEs) that are efficiently targeted by epigenetic marks, and part of the epigenetic diversity observed might be explained by TE polymorphisms. Characterizing the degree to which TEs influence epigenetic variation in crops is therefore a major goal to better use epigenetic variation. To date, epigenetic analyses have been mainly focused on the model plant Arabidopsis thaliana, and have provided clues on epigenome features, components that silence pathways, and effects of silencing impairment. But to what extent can Arabidopsis be used as a model for the epigenomics of crops? In this review, we discuss the similarities and differences between the epigenomes of Arabidopsis and crops. We explore the relationship between TEs and epigenomes, focusing on TE silencing control and escape, and the impact of TE mobility on epigenomic variation. Finally, we provide insights into challenges to tackle, and future directions to take in the route towards using epigenetic diversity in plant breeding programmes. PMID:24744427

  15. Identification and characterization of CACTA transposable elements capturing gene fragments in maize

    Institute of Scientific and Technical Information of China (English)

    LI Qing; LI Lin; DAI JingRui; LI JianSheng; YAN JianBing

    2009-01-01

    Transposable elements (TEs)-mediated gene sequence movement is thought to play an important role in genome expansion and origin of genes with novel functions. In this study, a gene, HGGT, involved in vitamin E synthesis was used in a case study to discover and characterize transposons carrying gene fragments in maize. A total of 69 transposons that are distributed across the 10 chromosomes and have an average length of 3689 bp were identified from the maize sequence database by using the BLAST search algorithm. Three of these carry gene fragments from the progenitor HGGT gene, while the rest (66) contain gene fragments from other cellular genes. Nine of the 69 transposons contain fragments derived from two locations in the genome. By querying the maize Expressed Sequence Tag (EST) da-tabase, we found that at least thirteen out of the 69 TEs had corresponding transcripts. More interest-ingly, two transposons that carry gene fragments from two different chromosomal loci could be ex-pressed as chimeric transcripts.

  16. Mobility properties of the Hermes transposable element in transgenic lines of Aedes aegypti.

    Science.gov (United States)

    Smith, Ryan C; Atkinson, Peter W

    2011-01-01

    The Hermes transposable element has been used to genetically transform a wide range of insect species, including the mosquito, Aedes aegypti, a vector of several important human pathogens. Hermes integrations into the mosquito germline are characterized by the non-canonical integration of the transposon and flanking plasmid and, once integrated, Hermes is stable in the presence of its transposase. In an effort to improve the post-integration mobility of Hermes in the germline of Ae. aegypti, a transgenic helper Mos1 construct expressing Hermes transposase under the control of a testis-specific promoter was crossed to a separate transgenic strain containing a target Hermes transposon. In less than 1% of the approximately 1,500 progeny from jumpstarter lines analyzed, evidence of putative Hermes germline remobilizations were detected. These recovered transposition events occur through an aberrant mechanism and provide insight into the non-canonical cut-and-paste transposition of Hermes in the germ line of Ae. aegypti. PMID:20596755

  17. Transduplication resulted in the incorporation of two protein-coding sequences into the Turmoil-1 transposable element of C. elegans

    Directory of Open Access Journals (Sweden)

    Pupko Tal

    2008-10-01

    Full Text Available Abstract Transposable elements may acquire unrelated gene fragments into their sequences in a process called transduplication. Transduplication of protein-coding genes is common in plants, but is unknown of in animals. Here, we report that the Turmoil-1 transposable element in C. elegans has incorporated two protein-coding sequences into its inverted terminal repeat (ITR sequences. The ITRs of Turmoil-1 contain a conserved RNA recognition motif (RRM that originated from the rsp-2 gene and a fragment from the protein-coding region of the cpg-3 gene. We further report that an open reading frame specific to C. elegans may have been created as a result of a Turmoil-1 insertion. Mutations at the 5' splice site of this open reading frame may have reactivated the transduplicated RRM motif. Reviewers This article was reviewed by Dan Graur and William Martin. For the full reviews, please go to the Reviewers' Reports section.

  18. Microsporidian Genomes Harbor a Diverse Array of Transposable Elements that Demonstrate an Ancestry of Horizontal Exchange with Metazoans

    OpenAIRE

    Parisot, Nicolas; Pelin, Adrian; Gasc , Cyrielle; Polonais, Valérie; Belkorchia, Abdel; Panek, Johan; El Alaoui, Hicham; Biron, David G.; Brasset, Émilie; Vaury, Chantal; Peyret, Pierre; Corradi, Nicolas; Peyretaillade, Éric; LERAT, Emmanuelle

    2014-01-01

    Microsporidian genomes are the leading models to understand the streamlining in response to a pathogenic lifestyle; they are gene-poor and often possess small genomes. In this study, we show a feature of microsporidian genomes that contrasts this pattern of genome reduction. Specifically, genome investigations targeted at Anncaliia algerae, a human pathogen with a genome size of 23 Mb, revealed the presence of a hitherto undetected diversity in transposable elements (TEs). A total of 240 TE f...

  19. Annotation and sequence diversity of transposable elements in common bean (Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    Scott eJackson

    2014-07-01

    Full Text Available Common bean (Phaseolus vulgaris is an important legume crop grown and consumed worldwide. With the availability of the common bean genome sequence, the next challenge is to annotate the genome and characterize functional DNA elements. Transposable elements (TEs are the most abundant component of plant genomes and can dramatically affect genome evolution and genetic variation. Thus, it is pivotal to identify TEs in the common bean genome. In this study, we performed a genome-wide transposon annotation in common bean using a combination of homology and sequence structure-based methods. We developed a 2.12-Mb transposon database which includes 791 representative transposon sequences and is available upon request or from www.phytozome.org. Of note, nearly all transposons in the database are previously unrecognized TEs. More than 5,000 transposon-related expressed sequence tags (ESTs were detected which indicates that some transposons may be transcriptionally active. Two Ty1-copia retrotransposon families were found to encode the envelope-like protein which has rarely been identified in plant genomes. Also, we identified an extra open reading frame (ORF termed ORF2 from 15 Ty3-gypsy families that was located between the ORF encoding the retrotransposase and the 3’LTR. The ORF2 was in opposite transcriptional orientation to retrotransposase. Sequence homology searches and phylogenetic analysis suggested that the ORF2 may have an ancient origin, but its function is not clear. This transposon data provides a useful resource for understanding the genome organization and evolution and may be used to identify active TEs for developing transposon-tagging system in common bean and other related genomes.

  20. Evolutionary genomics of miniature inverted-repeat transposable elements (MITEs) in Brassica.

    Science.gov (United States)

    Nouroz, Faisal; Noreen, Shumaila; Heslop-Harrison, J S

    2015-12-01

    Miniature inverted-repeat transposable elements (MITEs) are truncated derivatives of autonomous DNA transposons, and are dispersed abundantly in most eukaryotic genomes. We aimed to characterize various MITEs families in Brassica in terms of their presence, sequence characteristics and evolutionary activity. Dot plot analyses involving comparison of homoeologous bacterial artificial chromosome (BAC) sequences allowed identification of 15 novel families of mobile MITEs. Of which, 5 were Stowaway-like with TA Target Site Duplications (TSDs), 4 Tourist-like with TAA/TTA TSDs, 5 Mutator-like with 9-10 bp TSDs and 1 novel MITE (BoXMITE1) flanked by 3 bp TSDs. Our data suggested that there are about 30,000 MITE-related sequences in Brassica rapa and B. oleracea genomes. In situ hybridization showed one abundant family was dispersed in the A-genome, while another was located near 45S rDNA sites. PCR analysis using primers flanking sequences of MITE elements detected MITE insertion polymorphisms between and within the three Brassica (AA, BB, CC) genomes, with many insertions being specific to single genomes and others showing evidence of more recent evolutionary insertions. Our BAC sequence comparison strategy enables identification of evolutionarily active MITEs with no prior knowledge of MITE sequences. The details of MITE families reported in Brassica enable their identification, characterization and annotation. Insertion polymorphisms of MITEs and their transposition activity indicated important mechanism of genome evolution and diversification. MITE families derived from known Mariner, Harbinger and Mutator DNA transposons were discovered, as well as some novel structures. The identification of Brassica MITEs will have broad applications in Brassica genomics, breeding, hybridization and phylogeny through their use as DNA markers. PMID:26129767

  1. TEnest: automated chronological annotation and visualization of nested plant transposable elements.

    Science.gov (United States)

    Kronmiller, Brent A; Wise, Roger P

    2008-01-01

    Organisms with a high density of transposable elements (TEs) exhibit nesting, with subsequent repeats found inside previously inserted elements. Nesting splits the sequence structure of TEs and makes annotation of repetitive areas challenging. We present TEnest, a repeat identification and display tool made specifically for highly repetitive genomes. TEnest identifies repetitive sequences and reconstructs separated sections to provide full-length repeats and, for long-terminal repeat (LTR) retrotransposons, calculates age since insertion based on LTR divergence. TEnest provides a chronological insertion display to give an accurate visual representation of TE integration history showing timeline, location, and families of each TE identified, thus creating a framework from which evolutionary comparisons can be made among various regions of the genome. A database of repeats has been developed for maize (Zea mays), rice (Oryza sativa), wheat (Triticum aestivum), and barley (Hordeum vulgare) to illustrate the potential of TEnest software. All currently finished maize bacterial artificial chromosomes totaling 29.3 Mb were analyzed with TEnest to provide a characterization of the repeat insertions. Sixty-seven percent of the maize genome was found to be made up of TEs; of these, 95% are LTR retrotransposons. The rate of solo LTR formation is shown to be dissimilar across retrotransposon families. Phylogenetic analysis of TE families reveals specific events of extreme TE proliferation, which may explain the high quantities of certain TE families found throughout the maize genome. The TEnest software package is available for use on PlantGDB under the tools section (http://www.plantgdb.org/prj/TE_nest/TE_nest.html); the source code is available from (http://wiselab.org).

  2. Transcriptional activity, chromosomal distribution and expression effects of transposable elements in Coffea genomes.

    Directory of Open Access Journals (Sweden)

    Fabrício R Lopes

    Full Text Available Plant genomes are massively invaded by transposable elements (TEs, many of which are located near host genes and can thus impact gene expression. In flowering plants, TE expression can be activated (de-repressed under certain stressful conditions, both biotic and abiotic, as well as by genome stress caused by hybridization. In this study, we examined the effects of these stress agents on TE expression in two diploid species of coffee, Coffea canephora and C. eugenioides, and their allotetraploid hybrid C. arabica. We also explored the relationship of TE repression mechanisms to host gene regulation via the effects of exonized TE sequences. Similar to what has been seen for other plants, overall TE expression levels are low in Coffea plant cultivars, consistent with the existence of effective TE repression mechanisms. TE expression patterns are highly dynamic across the species and conditions assayed here are unrelated to their classification at the level of TE class or family. In contrast to previous results, cell culture conditions per se do not lead to the de-repression of TE expression in C. arabica. Results obtained here indicate that differing plant drought stress levels relate strongly to TE repression mechanisms. TEs tend to be expressed at significantly higher levels in non-irrigated samples for the drought tolerant cultivars but in drought sensitive cultivars the opposite pattern was shown with irrigated samples showing significantly higher TE expression. Thus, TE genome repression mechanisms may be finely tuned to the ideal growth and/or regulatory conditions of the specific plant cultivars in which they are active. Analysis of TE expression levels in cell culture conditions underscored the importance of nonsense-mediated mRNA decay (NMD pathways in the repression of Coffea TEs. These same NMD mechanisms can also regulate plant host gene expression via the repression of genes that bear exonized TE sequences.

  3. Characterization of active miniature inverted-repeat transposable elements in the peanut genome.

    Science.gov (United States)

    Shirasawa, Kenta; Hirakawa, Hideki; Tabata, Satoshi; Hasegawa, Makoto; Kiyoshima, Hiroyuki; Suzuki, Sigeru; Sasamoto, Sigemi; Watanabe, Akiko; Fujishiro, Tsunakazu; Isobe, Sachiko

    2012-05-01

    Miniature inverted-repeat transposable elements (MITEs), some of which are known as active nonautonomous DNA transposons, are found in the genomes of plants and animals. In peanut (Arachis hypogaea), Ah-MITE1 has been identified in a gene for fatty-acid desaturase, and possessed excision activity. However, the AhMITE1 distribution and frequency of excision have not been determined for the peanut genome. In order to characterize AhMITE1s, their genomic diversity and transposition ability was investigated. Southern blot analysis indicated high AhMITE1 copy number in the genomes of A. hypogaea, A. magna and A. monticola, but not in A. duranensis. A total of 504 AhMITE1s were identified from the MITE-enriched genomic libraries of A. hypogaea. The representative AhMITE1s exhibited a mean length of 205.5 bp and a GC content of 30.1%, with AT-rich, 9 bp target site duplications and 25 bp terminal inverted repeats. PCR analyses were performed using primer pairs designed against both flanking sequences of each AhMITE1. These analyses detected polymorphisms at 169 out of 411 insertional loci in the four peanut lines. In subsequent analyses of 60 gamma-irradiated mutant lines, four Ah-MITE1 excisions showed footprint mutations at the 109 loci tested. This study characterizes AhMITE1s in peanut and discusses their use as DNA markers and mutagens for the genetics, genomics and breeding of peanut and its relatives. PMID:22294450

  4. Paucity of chimeric gene-transposable element transcripts in the Drosophila melanogaster genome

    Directory of Open Access Journals (Sweden)

    Petrov Dmitri A

    2005-11-01

    Full Text Available Abstract Background Recent analysis of the human and mouse genomes has shown that a substantial proportion of protein coding genes and cis-regulatory elements contain transposable element (TE sequences, implicating TE domestication as a mechanism for the origin of genetic novelty. To understand the general role of TE domestication in eukaryotic genome evolution, it is important to assess the acquisition of functional TE sequences by host genomes in a variety of different species, and to understand in greater depth the population dynamics of these mutational events. Results Using an in silico screen for host genes that contain TE sequences, we identified a set of 63 mature "chimeric" transcripts supported by expressed sequence tag (EST evidence in the Drosophila melanogaster genome. We found a paucity of chimeric TEs relative to expectations derived from non-chimeric TEs, indicating that the majority (~80% of TEs that generate chimeric transcripts are deleterious and are not observed in the genome sequence. Using a pooled-PCR strategy to assay the presence of gene-TE chimeras in wild strains, we found that over half of the observed chimeric TE insertions are restricted to the sequenced strain, and ~15% are found at high frequencies in North American D. melanogaster populations. Estimated population frequencies of chimeric TEs did not differ significantly from non-chimeric TEs, suggesting that the distribution of fitness effects for the observed subset of chimeric TEs is indistinguishable from the general set of TEs in the genome sequence. Conclusion In contrast to mammalian genomes, we found that fewer than 1% of Drosophila genes produce mRNAs that include bona fide TE sequences. This observation can be explained by the results of our population genomic analysis, which indicates that most potential chimeric TEs in D. melanogaster are deleterious but that a small proportion may contribute to the evolution of novel gene sequences such as nested or

  5. MicroRNA-Dependent Transcriptional Silencing of Transposable Elements in Drosophila Follicle Cells.

    Science.gov (United States)

    Mugat, Bruno; Akkouche, Abdou; Serrano, Vincent; Armenise, Claudia; Li, Blaise; Brun, Christine; Fulga, Tudor A; Van Vactor, David; Pélisson, Alain; Chambeyron, Séverine

    2015-05-01

    RNA interference-related silencing mechanisms concern very diverse and distinct biological processes, from gene regulation (via the microRNA pathway) to defense against molecular parasites (through the small interfering RNA and the Piwi-interacting RNA pathways). Small non-coding RNAs serve as specificity factors that guide effector proteins to ribonucleic acid targets via base-pairing interactions, to achieve transcriptional or post-transcriptional regulation. Because of the small sequence complementarity required for microRNA-dependent post-transcriptional regulation, thousands of microRNA (miRNA) putative targets have been annotated in Drosophila. In Drosophila somatic ovarian cells, genomic parasites, such as transposable elements (TEs), are transcriptionally repressed by chromatin changes induced by Piwi-interacting RNAs (piRNAs) that prevent them from invading the germinal genome. Here we show, for the first time, that a functional miRNA pathway is required for the piRNA-mediated transcriptional silencing of TEs in this tissue. Global miRNA depletion, caused by tissue- and stage-specific knock down of drosha (involved in miRNA biogenesis), AGO1 or gawky (both responsible for miRNA activity), resulted in loss of TE-derived piRNAs and chromatin-mediated transcriptional de-silencing of TEs. This specific TE de-repression was also observed upon individual titration (by expression of the complementary miRNA sponge) of two miRNAs (miR-14 and miR-34) as well as in a miR-14 loss-of-function mutant background. Interestingly, the miRNA defects differentially affected TE- and 3' UTR-derived piRNAs. To our knowledge, this is the first indication of possible differences in the biogenesis or stability of TE- and 3' UTR-derived piRNAs. This work is one of the examples of detectable phenotypes caused by loss of individual miRNAs in Drosophila and the first genetic evidence that miRNAs have a role in the maintenance of genome stability via piRNA-mediated TE repression.

  6. Stem loop sequences specific to transposable element IS605 are found linked to lipoprotein genes in Borrelia plasmids.

    Directory of Open Access Journals (Sweden)

    Nicholas Delihas

    Full Text Available BACKGROUND: Plasmids of Borrelia species are dynamic structures that contain a large number of repetitive genes, gene fragments, and gene fusions. In addition, the transposable element IS605/200 family, as well as degenerate forms of this IS element, are prevalent. In Helicobacter pylori, flanking regions of the IS605 transposase gene contain sequences that fold into identical small stem loops. These function in transposition at the single-stranded DNA level. METHODOLOGY/PRINCIPAL FINDINGS: In work reported here, bioinformatics techniques were used to scan Borrelia plasmid genomes for IS605 transposable element specific stem loop sequences. Two variant stem loop motifs are found in the left and right flanking regions of the transposase gene. Both motifs appear to have dispersed in plasmid genomes and are found "free-standing" and phylogenetically conserved without the associated IS605 transposase gene or the adjacent flanking sequence. Importantly, IS605 specific stem loop sequences are also found at the 3' ends of lipoprotein genes (PFam12 and PFam60, however the left and right sequences appear to develop their own evolutionary patterns. The lipoprotein gene-linked left stem loop sequences maintain the IS605 stem loop motif in orthologs but only at the RNA level. These show mutations whereby variants fold into phylogenetically conserved RNA-type stem loops that contain the wobble non-Watson-Crick G-U base-pairing. The right flanking sequence is associated with the family lipoprotein-1 genes. A comparison of homologs shows that the IS605 stem loop motif rapidly dissipates, but a more elaborate secondary structure appears to develop in its place. CONCLUSIONS/SIGNIFICANCE: Stem loop sequences specific to the transposable element IS605 are present in plasmid regions devoid of a transposase gene and significantly, are found linked to lipoprotein genes in Borrelia plasmids. These sequences are evolutionarily conserved and/or structurally developed in

  7. Two transposable element insertions are causative mutations for the major domestication gene teosinte branched 1 in modern maize

    Institute of Scientific and Technical Information of China (English)

    Liangliang Zhou; Junya Zhang; Jianbing Yan; Rentao Song

    2011-01-01

    Dear Editor, Transposable elements (TEs) have long been regarded as genomic parasites and occupy a significant portion of eukaryotic genomes because of their massive replication in host genomes.However, at times, TEs can also be domesticated by genes and thereby contribute new regulatory functions to genes [1, 2].Here we show that two TE insertions in a distant upstream region of tbl are the causative mutations in the teosinte branched 1 (tb1)gene that account for the gene's role in the domestication of modem com from its ancestor teosinte.

  8. ReAS: Recovery of ancestral sequences for transposable elements from the unassembled reads of a whole genome shotgun.

    Directory of Open Access Journals (Sweden)

    Ruiqiang Li

    2005-09-01

    Full Text Available We describe an algorithm, ReAS, to recover ancestral sequences for transposable elements (TEs from the unassembled reads of a whole genome shotgun. The main assumptions are that these TEs must exist at high copy numbers across the genome and must not be so old that they are no longer recognizable in comparison to their ancestral sequences. Tested on the japonica rice genome, ReAS was able to reconstruct all of the high copy sequences in the Repbase repository of known TEs, and increase the effectiveness of RepeatMasker in identifying TEs from genome sequences.

  9. DcSto, stowaway-like miniature inverted-repeat transposable elements (MITEs), are abundant and polymorphic in the carrot genome

    Science.gov (United States)

    Transposable elements constitute a large fraction of plant genomes and strongly influence gene and genome evolution. Stowaway elements, a group of MITEs present in high copy number, are preferentially located in the vicinity of coding regions. Stowaway elements are characterized by short length, sim...

  10. A comparative analysis of the amounts and dynamics of transposable elements in natural populations of Drosophila melanogaster and Drosophila simulans

    International Nuclear Information System (INIS)

    Genes are important in defining genetic variability, but they do not constitute the largest component of genomes, which in most organisms contain large amounts of various repeated sequences including transposable elements (TEs), which have been shown to account for most of the genome size. TEs contribute to genetic diversity by their mutational potential as a result of their ability to insert into genes or gene regulator regions, to promote chromosomal rearrangements, and to interfere with gene networks. Also, TEs may be activated by environmental stresses (such as temperature or radiation) that interfere with epigenetic regulation systems, and makes them powerful mutation agents in nature. To understand the relationship between genotype and phenotype, we need to analyze the portions of the genome corresponding to TEs in great detail, and to decipher their relationships with the genes. For this purpose, we carried out comparative analyses of various natural populations of the closely-related species Drosophila melanogaster and Drosophila simulans, which differ with regard to their TE amounts as well as their ecology and population size. - Highlights: ► Transposable elements (TE) are source of genetic novelty and affect genome regulation. ► Environment can affect regulation of TE and thus have an impact on genome. ► Natural populations are natural laboratories to measure the impact of environment.

  11. Losing identity: structural diversity of transposable elements belonging to different classes in the genome of Anopheles gambiae

    Directory of Open Access Journals (Sweden)

    Fernández-Medina Rita D

    2012-06-01

    Full Text Available Abstract Background Transposable elements (TEs, both DNA transposons and retrotransposons, are genetic elements with the main characteristic of being able to mobilize and amplify their own representation within genomes, utilizing different mechanisms of transposition. An almost universal feature of TEs in eukaryotic genomes is their inability to transpose by themselves, mainly as the result of sequence degeneration (by either mutations or deletions. Most of the elements are thus either inactive or non-autonomous. Considering that the bulk of some eukaryotic genomes derive from TEs, they have been conceived as “TE graveyards.” It has been shown that once an element has been inactivated, it progressively accumulates mutations and deletions at neutral rates until completely losing its identity or being lost from the host genome; however, it has also been shown that these “neutral sequences” might serve as raw material for domestication by host genomes. Results We have analyzed the sequence structural variations, nucleotide divergence, and pattern of insertions and deletions of several superfamilies of TEs belonging to both class I (long terminal repeats [LTRs] and non-LTRs [NLTRs] and II in the genome of Anopheles gambiae, aiming at describing the landscape of deterioration of these elements in this particular genome. Our results describe a great diversity in patterns of deterioration, indicating lineage-specific differences including the presence of Solo-LTRs in the LTR lineage, 5′-deleted NLTRs, and several non-autonomous and MITEs in the class II families. Interestingly, we found fragments of NLTRs corresponding to the RT domain, which preserves high identity among them, suggesting a possible remaining genomic role for these domains. Conclusions We show here that the TEs in the An. gambiae genome deteriorate in different ways according to the class to which they belong. This diversity certainly has implications not only at the host

  12. Evolutionary histories of transposable elements in the genome of the largest living marsupial carnivore, the Tasmanian devil.

    Science.gov (United States)

    Gallus, Susanne; Hallström, Björn M; Kumar, Vikas; Dodt, William G; Janke, Axel; Schumann, Gerald G; Nilsson, Maria A

    2015-05-01

    The largest living carnivorous marsupial, the Tasmanian devil (Sarcophilus harrisii), is the sole survivor of a lineage originating about 12 Ma. We set out to investigate the spectrum of transposable elements found in the Tasmanian devil genome, the first high-coverage genome of an Australian marsupial. Marsupial genomes have been shown to have the highest amount of transposable elements among vertebrates. We analyzed the horizontally transmitted DNA transposons OC1 and hAT-1_MEu in the Tasmanian devil genome. OC1 is present in all carnivorous marsupials, while having a very limited distribution among the remaining Australian marsupial orders. In contrast, hAT-1_MEu is present in all Australian marsupial orders, and has so far only been identified in a few placental mammals. We screened 158 introns for phylogenetically informative retrotransposons in the order Dasyuromorphia, and found that the youngest SINE (Short INterspersed Element), WSINE1, is no longer active in the subfamily Dasyuridae. The lack of detectable WSINE1 activity in this group may be due to a retrotransposon inactivation event approximately 30 Ma. We found that the Tasmanian devil genome contains a relatively low number of continuous full-length LINE-1 (Long INterspersed Element 1, L1) retrotransposons compared with the opossum genome. Furthermore, all L1 elements in the Tasmanian devil appeared to be nonfunctional. Hidden Markov Model approaches suggested that other potential sources of functional reverse transcriptase are absent from the genome. We discuss the issues associated with assembling long, highly similar L1 copies from short read Illumina data and describe how assembly artifacts can potentially lead to erroneous conclusions. PMID:25633377

  13. Spontaneous germline excision of Tol1, a DNA-based transposable element naturally occurring in the medaka fish genome.

    Science.gov (United States)

    Watanabe, Kohei; Koga, Hajime; Nakamura, Kodai; Fujita, Akiko; Hattori, Akimasa; Matsuda, Masaru; Koga, Akihiko

    2014-04-01

    DNA-based transposable elements are ubiquitous constituents of eukaryotic genomes. Vertebrates are, however, exceptional in that most of their DNA-based elements appear to be inactivated. The Tol1 element of the medaka fish, Oryzias latipes, is one of the few elements for which copies containing an undamaged gene have been found. Spontaneous transposition of this element in somatic cells has previously been demonstrated, but there is only indirect evidence for its germline transposition. Here, we show direct evidence of spontaneous excision in the germline. Tyrosinase is the key enzyme in melanin biosynthesis. In an albino laboratory strain of medaka fish, which is homozygous for a mutant tyrosinase gene in which a Tol1 copy is inserted, we identified de novo reversion mutations related to melanin pigmentation. The gamete-based reversion rate was as high as 0.4%. The revertant fish carried the tyrosinase gene from which the Tol1 copy had been excised. We previously reported the germline transposition of Tol2, another DNA-based element that is thought to be a recent invader of the medaka fish genome. Tol1 is an ancient resident of the genome. Our results indicate that even an old element can contribute to genetic variation in the host genome as a natural mutator.

  14. Activation of Tag1 transposable elements in Arabidopsis dedifferentiating cells and their regulation by CHROMOMETHYLASE 3-mediated CHG methylation.

    Science.gov (United States)

    Khan, Asif; Yadav, Narendra Singh; Morgenstern, Yaakov; Zemach, Assaf; Grafi, Gideon

    2016-10-01

    Dedifferentiation, that is, the acquisition of stem cell-like state, commonly induced by stress (e.g., protoplasting), is characterized by open chromatin conformation, a chromatin state that could lead to activation of transposable elements (TEs). Here, we studied the activation of the Arabidopsis class II TE Tag1, in which two copies, situated close to each other (near genes) on chromosome 1 are found in Landsberg erecta (Ler) but not in Columbia (Col). We first transformed protoplasts with a construct in which a truncated Tag1 (ΔTag1 non-autonomous) blocks the expression of a reporter gene AtMBD5-GFP and found a relatively high ectopic excision of ΔTag1 accompanied by expression of AtMBD5-GFP in protoplasts derived from Ler compared to Col; further increase was observed in ddm1 (decrease in DNA methylation1) protoplasts (Ler background). Ectopic excision was associated with transcription of the endogenous Tag1 and changes in histone H3 methylation at the promoter region. Focusing on the endogenous Tag1 elements we found low level of excision in Ler protoplasts, which was slightly and strongly enhanced in ddm1 and cmt3 (chromomethylase3) protoplasts, respectively, concomitantly with reduction in Tag1 gene body (GB) CHG methylation and increased Tag1 transcription; strong activation of Tag1 was also observed in cmt3 leaves. Notably, in cmt3, but not in ddm1, Tag1 elements were excised out from their original sites and transposed elsewhere in the genome. Our results suggest that dedifferentiation is associated with Tag1 activation and that CMT3 rather than DDM1 plays a central role in restraining Tag1 activation via inducing GB CHG methylation. PMID:27475038

  15. Efficient transposition of the youngest miniature inverted repeat transposable element family of yellow fever mosquito in yeast.

    Science.gov (United States)

    Fattash, Isam; Lee, Chia-Ni; Mo, Kaiguo; Yang, Guojun

    2015-05-01

    Miniature inverted repeat transposable elements (MITEs) are often the most numerous DNA transposons in plant and animal genomes. The dramatic amplification of MITE families during evolution is puzzling, because the transposase sources for the vast majority of MITE families are unknown. The yellow fever mosquito genome contains > 220-Mb MITE sequences; however, transposition activity has not been demonstrated for any of the MITE families. The Gnome elements are the youngest MITE family in this genome, with at least 116 identical copies. To test whether the putative autonomous element Ozma is capable of mobilizing Gnome and its two sibling MITEs, analyses were performed in a yeast transposition assay system. Whereas the wild-type transposase resulted in very low transposition activity, mutations in the region containing a putative nuclear export signal motif resulted in a dramatic (at least 4160-fold) increase in transposition frequency. We have also demonstrated that each residue of the novel DD37E motif is required for the activity of the Ozma transposase. Footprint sequences left at the donor sites suggest that the transposase may cleave between the second and the third nucleotides from the 5' ends of the elements. The excised elements reinsert specifically at dinucleotide 'TA', ~ 55% of them in yeast genes. The elements described in this article could potentially be useful as genetic tools for genetic manipulation of mosquitoes. PMID:25754725

  16. Genotype-dependent Burst of Transposable Element Expression in Crowns of Hexaploid Wheat (Triticum aestivum L. during Cold Acclimation

    Directory of Open Access Journals (Sweden)

    Debbie Laudencia-Chingcuanco

    2012-01-01

    Full Text Available The expression of 1,613 transposable elements (TEs represented in the Affymetrix Wheat Genome Chip was examined during cold treatment in crowns of four hexaploid wheat genotypes that vary in tolerance to cold and in flowering time. The TE expression profiles showed a constant level of expression throughout the experiment in three of the genotypes. In winter Norstar, the most cold-hardy of the four genotypes, a subset of the TEs showed a burst of expression after vernalization saturation was achieved. About 47% of the TEs were expressed, and both Class I (retrotransposons and Class II (DNA transposons types were well represented. Gypsy and Copia were the most represented among the retrotransposons while CACTA and Mariner were the most represented DNA transposons. The data suggests that the Vrn-A1 region plays a role in the stage-specific induction of TE expression in this genotype.

  17. A genome-wide view of miniature inverted-repeat transposable elements (MITEs) in rice, Oryza sativa ssp. japonica.

    Science.gov (United States)

    Oki, Nobuhiko; Yano, Kentaro; Okumoto, Yutaka; Tsukiyama, Takuji; Teraishi, Masayoshi; Tanisaka, Takatoshi

    2008-08-01

    Transposable elements (TEs) have played important roles in the evolution of genes and genomes of higher eukaryotes. Among the TEs in the rice genome, miniature inverted-repeat transposable elements (MITEs) exist at the highest copy number. Some of MITEs in the rice genome contain poly(A) signals and putative cis-acting regulatory domains. Insertion events of such MITEs may have caused many structural and functional changes of genomes. The genome-wide examination of MITE-derived sequences could elucidate the contribution of MITEs to gene evolution. Here we report on the MITEs in the rice genome that have contributed to the emergence of novel genes and the expansion of the sequence diversity of the genome and mRNAs. Of the MITE-derived sequences, approximately 6000 were found in gene regions (exons and introns) and 67,000 in intergenic regions. In gene regions, most MITEs are located in introns rather than exons. For over 300 protein-coding genes, coding sequences, poly(A) sites, transcription start sites, and splicing sites overlap with MITEs. These sequence alterations via MITE insertions potentially affect the biological functions of gene products. Many MITE insertions also exist in 5'-untranslated regions (UTRs), 3'-UTRs, and in the proximity of genes. Although mutations in these non-protein coding regions do not alter protein sequences, these regions have key roles for gene regulation. Moreover, MITE family sequences (Tourist, Stowaway, and others) are unevenly distributed in introns. Our findings suggest that MITEs may have contributed to expansion of genome diversity by causing alterations not only in gene functions but also in regulation of many genes. PMID:18931457

  18. Genome-wide comparative analysis of 20 miniature inverted-repeat transposable element families in Brassica rapa and B. oleracea.

    Directory of Open Access Journals (Sweden)

    Perumal Sampath

    Full Text Available Miniature inverted-repeat transposable elements (MITEs are ubiquitous, non-autonomous class II transposable elements. Here, we conducted genome-wide comparative analysis of 20 MITE families in B. rapa, B. oleracea, and Arabidopsis thaliana. A total of 5894 and 6026 MITE members belonging to the 20 families were found in the whole genome pseudo-chromosome sequences of B. rapa and B. oleracea, respectively. Meanwhile, only four of the 20 families, comprising 573 members, were identified in the Arabidopsis genome, indicating that most of the families were activated in the Brassica genus after divergence from Arabidopsis. Copy numbers varied from 4 to 1459 for each MITE family, and there was up to 6-fold variation between B. rapa and B. oleracea. In particular, analysis of intact members showed that whereas eleven families were present in similar copy numbers in B. rapa and B. oleracea, nine families showed copy number variation ranging from 2- to 16-fold. Four of those families (BraSto-3, BraTo-3, 4, 5 were more abundant in B. rapa, and the other five (BraSto-1, BraSto-4, BraTo-1, 7 and BraHAT-1 were more abundant in B. oleracea. Overall, 54% and 51% of the MITEs resided in or within 2 kb of a gene in the B. rapa and B. oleracea genomes, respectively. Notably, 92 MITEs were found within the CDS of annotated genes, suggesting that MITEs might play roles in diversification of genes in the recently triplicated Brassica genome. MITE insertion polymorphism (MIP analysis of 289 MITE members showed that 52% and 23% were polymorphic at the inter- and intra-species levels, respectively, indicating that there has been recent MITE activity in the Brassica genome. These recently activated MITE families with abundant MIP will provide useful resources for molecular breeding and identification of novel functional genes arising from MITE insertion.

  19. Large-scale genomic analysis suggests a neutral punctuated dynamics of transposable elements in bacterial genomes.

    Science.gov (United States)

    Iranzo, Jaime; Gómez, Manuel J; López de Saro, Francisco J; Manrubia, Susanna

    2014-06-01

    Insertion sequences (IS) are the simplest and most abundant form of transposable DNA found in bacterial genomes. When present in multiple copies, it is thought that they can promote genomic plasticity and genetic exchange, thus being a major force of evolutionary change. The main processes that determine IS content in genomes are, though, a matter of debate. In this work, we take advantage of the large amount of genomic data currently available and study the abundance distributions of 33 IS families in 1811 bacterial chromosomes. This allows us to test simple models of IS dynamics and estimate their key parameters by means of a maximum likelihood approach. We evaluate the roles played by duplication, lateral gene transfer, deletion and purifying selection. We find that the observed IS abundances are compatible with a neutral scenario where IS proliferation is controlled by deletions instead of purifying selection. Even if there may be some cases driven by selection, neutral behavior dominates over large evolutionary scales. According to this view, IS and hosts tend to coexist in a dynamic equilibrium state for most of the time. Our approach also allows for a detection of recent IS expansions, and supports the hypothesis that rapid expansions constitute transient events-punctuations-during which the state of coexistence of IS and host becomes perturbated. PMID:24967627

  20. Large-scale genomic analysis suggests a neutral punctuated dynamics of transposable elements in bacterial genomes.

    Directory of Open Access Journals (Sweden)

    Jaime Iranzo

    2014-06-01

    Full Text Available Insertion sequences (IS are the simplest and most abundant form of transposable DNA found in bacterial genomes. When present in multiple copies, it is thought that they can promote genomic plasticity and genetic exchange, thus being a major force of evolutionary change. The main processes that determine IS content in genomes are, though, a matter of debate. In this work, we take advantage of the large amount of genomic data currently available and study the abundance distributions of 33 IS families in 1811 bacterial chromosomes. This allows us to test simple models of IS dynamics and estimate their key parameters by means of a maximum likelihood approach. We evaluate the roles played by duplication, lateral gene transfer, deletion and purifying selection. We find that the observed IS abundances are compatible with a neutral scenario where IS proliferation is controlled by deletions instead of purifying selection. Even if there may be some cases driven by selection, neutral behavior dominates over large evolutionary scales. According to this view, IS and hosts tend to coexist in a dynamic equilibrium state for most of the time. Our approach also allows for a detection of recent IS expansions, and supports the hypothesis that rapid expansions constitute transient events-punctuations-during which the state of coexistence of IS and host becomes perturbated.

  1. Heterochromatin and molecular characterization of DsmarMITE transposable element in the beetle Dichotomius schiffleri (Coleoptera: Scarabaeidae).

    Science.gov (United States)

    Xavier, Crislaine; Cabral-de-Mello, Diogo Cavalcanti; de Moura, Rita Cássia

    2014-12-01

    Cytogenetic studies of the Neotropical beetle genus Dichotomius (Scarabaeinae, Coleoptera) have shown dynamism for centromeric constitutive heterochromatin sequences. In the present work we studied the chromosomes and isolated repetitive sequences of Dichotomius schiffleri aiming to contribute to the understanding of coleopteran genome/chromosomal organization. Dichotomius schiffleri presented a conserved karyotype and heterochromatin distribution in comparison to other species of the genus with 2n = 18, biarmed chromosomes, and pericentromeric C-positive blocks. Similarly to heterochromatin distributional patterns, the highly and moderately repetitive DNA fraction (C 0 t-1 DNA) was detected in pericentromeric areas, contrasting with the euchromatic mapping of an isolated TE (named DsmarMITE). After structural analyses, the DsmarMITE was classified as a non-autonomous element of the type miniature inverted-repeat transposable element (MITE) with terminal inverted repeats similar to Mariner elements of insects from different orders. The euchromatic distribution for DsmarMITE indicates that it does not play a part in the dynamics of constitutive heterochromatin sequences.

  2. Characterization of transcriptional activation and inserted-into-gene preference of various transposable elements in the Brassica species.

    Science.gov (United States)

    Gao, Caihua; Xiao, Meili; Jiang, Lingyan; Li, Jiana; Yin, Jiaming; Ren, Xiaodong; Qian, Wei; Oscar, Ortegón; Fu, Donghui; Tang, Zhanglin

    2012-07-01

    Transposable elements (TEs) have attracted increasing attention because of their tremendous contributions to genome reorganization and gene variation through dramatic proliferation and excision via transposition. However, less known are the transcriptional activation of various TEs and the characteristics of TE insertion into genomes at the genome-wide level. In the present study, we focused on TE genes for transposition and gene disruption by insertion of TEs in expression sequences of Brassica, to investigate the transcriptional activation of TEs, the biased insertion of TEs into genes, and their salient characteristics. Long terminal repeat (LTR-retrotransposon) accounted for the majority of these active TE genes (70.8%), suggesting that transposition activation varied with TE type. 6.1% genes were interrupted by LTR-retrotransposons, which indicated their preference for insertion into genes. TEs were preferentially inserted into cellular component-specific genes acted as "binding" elements and involved in metabolic processes. TEs have a biased insertion into some host genes that were involved with important molecular functions and TE genes exhibited spatiotemporal expression. These results suggested that various types of transposons differentially contributed to gene variation and affected gene function.

  3. Transposable elements P and gypsy in natural populations of Drosophila willistoni

    Directory of Open Access Journals (Sweden)

    Adriana Koslovski Sassi

    2005-12-01

    Full Text Available The presence and integrity of the P transposon and the gypsy retrotransposon in the genome of 18 samples of natural Drosophila willistoni populations collected from a large area of South America were Southern blot screened using Drosophila melanogaster probes. The aim of this screening was provide further knowledge-base on the geographical distribution of D. willistoni and to carry out an inter-population analysis of the P and gypsy elements present in the genomes of the populations analyzed. The fragment patterns obtained indicate that both the P and gypsy elements are ancient in the D. willistoni genome, but whereas the gypsy retroelement appears to be invariable and stable the P element varies between populations and appears to still have some capacity for mobilization.

  4. A novel application of ecological analyses to assess transposable element distributions in the genome of the domestic cow, Bos taurus.

    Science.gov (United States)

    Saylor, Brent; Elliott, Tyler A; Linquist, Stefan; Kremer, Stefan C; Gregory, T Ryan; Cottenie, Karl

    2013-09-01

    Transposable elements (TEs) are among the most abundant components of many eukaryotic genomes. Efforts to explain TE abundance, as well as TE diversity among genomes, have led some researchers to draw an analogy between genomic and ecological processes. Adopting this perspective, we conducted an analysis of the cow (Bos taurus) genome using techniques developed by community ecologists to determine whether environmental factors influence community composition. Specifically, each chromosome within the Bos taurus genome was treated as a "linear transect", and a multivariate redundancy analysis (RDA) was used to identify large-scale spatial patterns in TE communities associated with 10 TE families. The position of each TE community on the chromosome accounted for ∼50% of the variation along the chromosome "transect". Multivariate analysis further revealed an effect of gene density on TE communities that is influenced by several other factors in the (genomic) environment, including chromosome length and TE density. The results of this analysis demonstrate that ecological methods can be applied successfully to help answer genomic questions.

  5. Transposable elements in phytopathogenic Verticillium spp.: insights into genome evolution and inter- and intra-specific diversification

    Directory of Open Access Journals (Sweden)

    Amyotte Stefan G

    2012-07-01

    Full Text Available Abstract Background Verticillium dahliae (Vd and Verticillium albo-atrum (Va are cosmopolitan soil fungi causing very disruptive vascular diseases on a wide range of crop plants. To date, no sexual stage has been identified in either microorganism suggesting that somatic mutation is a major force in generating genetic diversity. Whole genome comparative analysis of the recently sequenced strains VdLs.17 and VaMs.102 revealed that non-random insertions of transposable elements (TEs have contributed to the generation of four lineage-specific (LS regions in VdLs.17. Results We present here a detailed analysis of Class I retrotransposons and Class II “cut-and-paste” DNA elements detected in the sequenced Verticillium genomes. We report also of their distribution in other Vd and Va isolates from various geographic origins. In VdLs.17, we identified and characterized 56 complete retrotransposons of the Gypsy-, Copia- and LINE-like types, as well as 34 full-length elements of the “cut-and-paste” superfamilies Tc1/mariner, Activator and Mutator. While Copia and Tc1/mariner were present in multiple identical copies, Activator and Mutator sequences were highly divergent. Most elements comprised complete ORFs, had matching ESTs and showed active transcription in response to stress treatment. Noticeably, we found evidences of repeat-induced point mutation (RIP only in some of the Gypsy retroelements. While Copia-, Gypsy- and Tc1/mariner-like transposons were prominent, a large variation in presence of the other types of mobile elements was detected in the other Verticillium spp. strains surveyed. In particular, neither complete nor defective “cut-and-paste” TEs were found in VaMs.102. Conclusions Copia-, Gypsy- and Tc1/mariner-like transposons are the most wide-spread TEs in the phytopathogens V. dahliae and V. albo-atrum. In VdLs.17, we identified several retroelements and “cut-and-paste” transposons still potentially active. Some of these

  6. Studies on the Mx transposable element system in maize recovered from X-irradiated stocks

    International Nuclear Information System (INIS)

    The unstable mutant bz-x3m arose in a plant subjected to X-irradiation. The element at the bronze locus is non-autonomous and recombination data indicate that an autonomous element is tightly linked. The autonomous element has been designated Mx (mobile element induced by X-rays) and the non-autonomous element, rMx (responder to Mx). Linkage data indicate that a second Mx lies near the end of the short arm of chromosome 9; in one plant, an Mx that is unlinked was deceted. Distinguishing characteristics of bz-x3m are a large window of time in endosperm development during which somatic reversions can arise and a wide range in the frequency at which they occur; these features are heritable. With increasing doses of bz- x3m and Mx, the window expands and the frequency range increases. In kernels containing the bz-x3m allele and the tightly linked Mx, breakage occurs in chromosome 9 distal to the C locus, resulting in breakage-fusion-bridge patterns for endosperm markers that lie proximal to the break. The frequency of breaks and the developmental time at which they occur exhibit the same dosage effect as the somatic reversions of the bz-x3m allele. These observations suggest that an rMx (designated rMxBr) that causes chromosome breakage os positioned distal to the C locus. At the molecular level, the bz-x3m allele is associated with a 0.5 kb increase in fragment size in DNA samples digested with BglII, EcoRI, HindIII and PstI; in germinal revertants, the fragment size returns to that of the progenitor

  7. Transcriptional activation of transposable elements in mouse zygotes is independent of Tet3-mediated 5-methylcytosine oxidation

    Institute of Scientific and Technical Information of China (English)

    Azusa Inoue; Shogo Matoba; Yi Zhang

    2012-01-01

    The methylation state of the paternal genome is rapidly reprogrammed shortly after fertilization.Recent studies have revealed that loss of 5-methylcytosine(5mC)in zygotes correlates with appearance of 5-hydroxymethylcytosine (5hmC),5-formylcytosine(5fC),and 5-carboxylcytosine(5caC).This process is mediated by Tet3 and the 5mC oxidation products generated in zygotes are gradually lost during preimplantation development through a replicationdependent dilution process.Despite these findings,the biological significance of Tet3-mediated oxidation of 5mC to 5hmC/5fC/5caC in zygotes is unknown.DNA methylation plays an important role in silencing gene expression including the repression of transposable elements(TEs).Given that the activation of TEs during preimplantation development correlates with loss of DNA methylation,it is believed that paternal DNA demethylation may have an important role in TE activation.Here we examined this hypothesis and found that Tet3-mediated 5mC oxidation does not have a significant contribution to TE activation.We show that the expression of LINE-1(long interspersed nucleotide element 1)and ERVL(endogenous retroviruses class Ⅲ)are activated from both paternal and maternal genomes in zygotes.Inhibition of 5mC oxidation by siRNA-mediated depletion of Tet3 affected neither TE activation,nor global transcription in zygotes.Thus,our study provides the first evidence demonstrating that activation of both TEs and global transcription in zygotes are independent of Tet3-mediated 5mC oxidation.

  8. Transposable B2 SINE elements can provide mobile RNA polymerase II promoters.

    Science.gov (United States)

    Ferrigno, O; Virolle, T; Djabari, Z; Ortonne, J P; White, R J; Aberdam, D

    2001-05-01

    Short interspersed elements (SINEs) are highly abundant components of mammalian genomes that are propagated by retrotransposition. SINEs are recognized as a causal agent of human disease and must also have had a profound influence in shaping eukaryotic genomes. The B2 SINE family constitutes approximately 0.7% of total mouse genomic DNA (ref. 2) and is also found at low abundance in humans. It resembles the Alu family in several respects, such as its mechanism of propagation. B2 SINEs are derived from tRNA and are transcribed by RNA polymerase (pol) III to generate short transcripts that are not translated. We find here, however, that one B2 SINE also carries an active pol II promoter located outside the tRNA region. Indeed, a B2 element is responsible for the production of a mouse Lama3 transcript. The B2 pol II promoters can be bound and stimulated by the transcription factor USF (for upstream stimulatory factor), as shown by transient transfection experiments. Moreover, this pol II activity does not preclude the pol III transcription necessary for retrotransposition. Dispersal of B2 SINEs by retrotransposition may therefore have provided numerous opportunities for creating regulated pol II transcription at novel genomic sites. This mechanism may have allowed the evolution of new transcription units and new genes. PMID:11326281

  9. Evidence for small RNAs homologous to effector-encoding genes and transposable elements in the oomycete Phytophthora infestans.

    Directory of Open Access Journals (Sweden)

    Ramesh R Vetukuri

    Full Text Available Phytophthora infestans is the oomycete pathogen responsible for the devastating late blight disease on potato and tomato. There is presently an intense research focus on the role(s of effectors in promoting late blight disease development. However, little is known about how they are regulated, or how diversity in their expression may be generated among different isolates. Here we present data from investigation of RNA silencing processes, characterized by non-coding small RNA molecules (sRNA of 19-40 nt. From deep sequencing of sRNAs we have identified sRNAs matching numerous RxLR and Crinkler (CRN effector protein genes in two isolates differing in pathogenicity. Effector gene-derived sRNAs were present in both isolates, but exhibited marked differences in abundance, especially for CRN effectors. Small RNAs in P. infestans grouped into three clear size classes of 21, 25/26 and 32 nt. Small RNAs from all size classes mapped to RxLR effector genes, but notably 21 nt sRNAs were the predominant size class mapping to CRN effector genes. Some effector genes, such as PiAvr3a, to which sRNAs were found, also exhibited differences in transcript accumulation between the two isolates. The P. infestans genome is rich in transposable elements, and the majority of sRNAs of all size classes mapped to these sequences, predominantly to long terminal repeat (LTR retrotransposons. RNA silencing of Dicer and Argonaute genes provided evidence that generation of 21 nt sRNAs is Dicer-dependent, while accumulation of longer sRNAs was impacted by silencing of Argonaute genes. Additionally, we identified six microRNA (miRNA candidates from our sequencing data, their precursor sequences from the genome sequence, and target mRNAs. These miRNA candidates have features characteristic of both plant and metazoan miRNAs.

  10. [The distributional clines in P susceptibility causing by the P family transposable element in Drosophila melanogaster population of China].

    Science.gov (United States)

    Hu, K; Wang, Q M

    1998-01-01

    An extensive survey of the P family transposable element of Drosophila melanogaster in China, from the far west as Xinjiang and Xizang (Tibet) to the east coast, covered all China was provided. Strains, sampling more than 70 localities, which were collected during 1980-1995. In the term of the PM system, the phenotypic property of it was mainly M type, including Taiwan. The molecular test determined, it was M type. There were three localities, the P activity of them were higher as Q type. They are: Dalian Peninsular. Chongming island, near Shanghai and Taizhong of Taiwan. For analyzed geographically, according to the east longitudes, grouped the country to four parts. After comparison, two dividing lines were found: 1. The East longitude of 115 degrees, it was between Area II and Area III, see Fig. 4, separating the coastal from inland. Except the P susceptibility of the northeastern three provinces was little higher, about 30.37%, the most part of the east coastal, the first line, its P susceptibility was very week. Seven strains were 0, fifteen strains were under 10%; its P activity was also low, never beyond 10%. Therefore, it was appeared neutral, its average was 7.23%. That was the major neutral property of the coastal areas. The second line of little increased P susceptibility averaged about 26.67%. Then, there was the third line was, when the line was the more westward, its P susceptibility was higher, up to 87%, closing to the highest score of middlewest part of the country. From the east coast to the west, there were three gradually increased P susceptibility lines pushing forward could be found. The E 115 degrees, it was between the lines of the second and the third. 2. Besides the East Longitude of 115 degrees, there is another natural geographic line shows its potentiality, that is the Tropic of Cancer. It divided the coastal to two parts, the localities at the south of this line, they did not show the coastal characteristic, instead of neutral or very

  11. Transposable elements in a marginal plant population: temporal fluctuations provide new insights into genome evolution of wild diploid wheat

    Directory of Open Access Journals (Sweden)

    Belyayev Alexander

    2010-02-01

    Full Text Available Abstract Background How new forms arise in nature has engaged evolutionary biologists since Darwin's seminal treatise on the origin of species. Transposable elements (TEs may be among the most important internal sources for intraspecific variability. Thus, we aimed to explore the temporal dynamics of several TEs in individual genotypes from a small, marginal population of Aegilops speltoides. A diploid cross-pollinated grass species, it is a wild relative of the various wheat species known for their large genome sizes contributed by an extraordinary number of TEs, particularly long terminal repeat (LTR retrotransposons. The population is characterized by high heteromorphy and possesses a wide spectrum of chromosomal abnormalities including supernumerary chromosomes, heterozygosity for translocations, and variability in the chromosomal position or number of 45S and 5S ribosomal DNA (rDNA sites. We propose that variability on the morphological and chromosomal levels may be linked to variability at the molecular level and particularly in TE proliferation. Results Significant temporal fluctuation in the copy number of TEs was detected when processes that take place in small, marginal populations were simulated. It is known that under critical external conditions, outcrossing plants very often transit to self-pollination. Thus, three morphologically different genotypes with chromosomal aberrations were taken from a wild population of Ae. speltoides, and the dynamics of the TE complex traced through three rounds of selfing. It was discovered that: (i various families of TEs vary tremendously in copy number between individuals from the same population and the selfed progenies; (ii the fluctuations in copy number are TE-family specific; (iii there is a great difference in TE copy number expansion or contraction between gametophytes and sporophytes; and (iv a small percentage of TEs that increase in copy number can actually insert at novel locations and

  12. Excision of transposable elements from the chalcone isomerase and dihydroflavonol 4-reductase genes may contribute to the variegation of the yellow-flowered carnation (Dianthus caryophyllus).

    Science.gov (United States)

    Itoh, Yoshio; Higeta, Daisuke; Suzuki, Akane; Yoshida, Hiroyuki; Ozeki, Yoshihiro

    2002-05-01

    In the "Rhapsody" cultivar of the carnation, which bears white flowers variegated with red flecks and sectors, a transposable element, dTdic1, belonging to the Ac/Ds superfamily, was found within the dihydroflavonol 4-reductase (DFR) gene. The red flecks and sectors of "Rhapsody" may be attributable to a reversion to DFR activity after the excision of dTdic1. The yellow color of the carnation petals is attributed to the synthesis and accumulation of chalcone 2'-glucoside. In several of the carnation cultivars that bear yellow flowers variegated with white flecks and sectors, both the chalcone isomerase (CHI) and DFR genes are disrupted by dTdic1.

  13. FB-NOF is a non-autonomous transposable element, expressed in Drosophila melanogaster and present only in the melanogaster group.

    Science.gov (United States)

    Badal, Martí; Xamena, Noel; Cabré, Oriol

    2013-09-10

    Most foldback elements are defective due to the lack of coding sequences but some are associated with coding sequences and may represent the entire element. This is the case of the NOF sequences found in the FB of Drosophila melanogaster, formerly considered as an autonomous TE and currently proposed as part of the so-called FB-NOF element, the transposon that would be complete and fully functional. NOF is always associated with FB and never seen apart from the FB inverted repeats (IR). This is the reason why the FB-NOF composite element can be considered the complete element. At least one of its ORFs encodes a protein that has always been considered its transposase, but no detailed studies have been carried out to verify this. In this work we test the hypothesis that FB-NOF is an active transposon nowadays. We search for its expression product, obtaining its cDNA, and propose the ORF and the sequence of its potential protein. We found that the NOF protein is not a transposase as it lacks any of the motifs of known transposases and also shows structural homology with hydrolases, therefore FB-NOF cannot belong to the superfamily MuDR/foldback, as up to now it has been classified, and can be considered as a non-autonomous transposable element. The alignment with the published genomes of 12 Drosophila species shows that NOF presence is restricted only to the 6 Drosophila species belonging to the melanogaster group.

  14. Increased Variation in Adh Enzyme Activity in Drosophila Mutation-Accumulation Experiment Is Not Due to Transposable Elements at the Adh Structural Gene

    Science.gov (United States)

    Aquadro, C. F.; Tachida, H.; Langley, C. H.; Harada, K.; Mukai, T.

    1990-01-01

    We present here a molecular analysis of the region surrounding the structural gene encoding alcohol dehydrogenase (Adh) in 47 lines of Drosophila melanogaster that have each accumulated mutations for 300 generations. While these lines show a significant increase in variation of alcohol dehydrogenase enzyme activity compared to control lines, we found no restriction map variation in a 13-kb region including the complete Adh structural gene and roughly 5 kb of both 5' and 3' sequences. Thus, the rapid accumulation of ADH activity variation after 28,200 allele generations does not appear to have been due to the mobilization of transposable elements into or out of the Adh structural gene region. PMID:1963870

  15. Reverted glutathione S-transferase-like genes that influence flower color intensity of carnation (Dianthus caryophyllus L.) originated from excision of a transposable element.

    Science.gov (United States)

    Momose, Masaki; Itoh, Yoshio; Umemoto, Naoyuki; Nakayama, Masayoshi; Ozeki, Yoshihiro

    2013-12-01

    A glutathione S-transferase-like gene, DcGSTF2, is responsible for carnation (Dianthus caryophyllus L.) flower color intensity. Two defective genes, DcGSTF2mu with a nonsense mutation and DcGSTF2-dTac1 containing a transposable element dTac1, have been characterized in detail in this report. dTac1 is an active element that produces reverted functional genes by excision of the element. A pale-pink cultivar 'Daisy' carries both defective genes, whereas a spontaneous deep-colored mutant 'Daisy-VPR' lost the element from DcGSTF2-dTac1. This finding confirmed that dTac1 is active and that the resulting reverted gene, DcGSTF2rev1, missing the element is responsible for this color change. Crosses between the pale-colored cultivar '06-LA' and a deep-colored cultivar 'Spectrum' produced segregating progeny. Only the deep-colored progeny had DcGSTF2rev2 derived from the 'Spectrum' parent, whereas progeny with pale-colored flowers had defective forms from both parents, DcGSTF2mu and DcGSTF2-dTac1. Thus, DcGSTF2rev2 had functional activity and likely originated from excision of dTac1 since there was a footprint sequence at the vacated site of the dTac1 insertion. Characterizing the DcGSTF2 genes in several cultivars revealed that the two functional genes, DcGSTF2rev1 and DcGSTF2rev2, have been used for some time in carnation breeding with the latter in use for more than half a century.

  16. DNA Damage-Induced Transcription of Transposable Elements and Long Non-coding RNAs in Arabidopsis Is Rare and ATM-Dependent.

    Science.gov (United States)

    Wang, Zhenxing; Schwacke, Rainer; Kunze, Reinhard

    2016-08-01

    Induction and mobilization of transposable elements (TEs) following DNA damage or other stresses has been reported in prokaryotes and eukaryotes. Recently it was discovered that eukaryotic TEs are frequently associated with long non-coding RNAs (lncRNAs), many of which are also upregulated by stress. Yet, it is unknown whether DNA damage-induced transcriptional activation of TEs and lncRNAs occurs sporadically or is a synchronized, genome-wide response. Here we investigated the transcriptome of Arabidopsis wild-type (WT) and ataxia telangiectasia mutated (atm) mutant plants 3 h after induction of DNA damage. In WT, expression of 5.2% of the protein-coding genes is ≥2-fold changed, whereas in atm plants, only 2.6% of these genes are regulated, and the response of genes associated with DNA repair, replication, and cell cycle is largely lost. In contrast, only less than 0.6% of TEs and lncRNAs respond to DNA damage in WT plants, and the regulation of ≥95% of them is ATM-dependent. The ATM-downstream factors BRCA1, DRM1, JMJ30, AGO2, and the ATM-independent AGO4 participate in the regulation of individual TEs and lncRNAs. Remarkably, protein-coding genes located adjacent to DNA damage-responsive TEs and lncRNAs are frequently coexpressed, which is consistent with the hypothesis that TEs and lncRNAs located close to genes commonly function as controlling elements. PMID:27150037

  17. Sparse Biclustering of Transposable Data

    OpenAIRE

    Tan, Kean Ming; Witten, Daniela M

    2014-01-01

    We consider the task of simultaneously clustering the rows and columns of a large transposable data matrix. We assume that the matrix elements are normally distributed with a bicluster-specific mean term and a common variance, and perform biclustering by maximizing the corresponding log likelihood. We apply an ℓ1 penalty to the means of the biclusters in order to obtain sparse and interpretable biclusters. Our proposal amounts to a sparse, symmetrized version of k-means clustering. We show th...

  18. The predominantly selfing plant Arabidopsis thaliana experienced a recent reduction in transposable element abundance compared to its outcrossing relative Arabidopsis lyrata

    Directory of Open Access Journals (Sweden)

    de la Chaux Nicole

    2012-02-01

    Full Text Available Abstract Background Transposable elements (TEs are major contributors to genome evolution. One factor that influences their evolutionary dynamics is whether their host reproduces through selfing or through outcrossing. According to the recombinational spreading hypothesis, for instance, TEs can spread more easily in outcrossing species through recombination, and should thus be less abundant in selfing species. We here studied the distribution and evolutionary dynamics of TE families in the predominantly selfing plant Arabidopsis thaliana and its close outcrossing relative Arabidopsis lyrata on a genome-wide scale. We characterized differences in TE abundance between them and asked which, if any, existing hypotheses about TE abundances may explain these differences. Results We identified 1,819 TE families representing all known classes of TEs in both species, and found three times more copies in the outcrossing A. lyrata than in the predominantly selfing A. thaliana, as well as ten times more TE families unique to A. lyrata. On average, elements in A. lyrata are younger than elements in A. thaliana. In particular, A. thaliana shows a marked decrease in element number that occurred during the most recent 10% of the time interval since A. thaliana split from A. lyrata. This most recent period in the evolution of A. thaliana started approximately 500,000 years ago, assuming a splitting time of 5 million years ago, and coincides with the time at which predominant selfing originated. Conclusions Our results indicate that the mating system may be important for determining TE copy number, and that selfing species are likely to have fewer TEs.

  19. Molecular characterization of a mutable pigmentation phenotype and isolation of the first active transposable element from Sorghum bicolor

    OpenAIRE

    Chopra, Surinder; Brendel, Volker; Zhang, Jianbo; John D. Axtell; Peterson, Thomas

    1999-01-01

    Accumulation of red phlobaphene pigments in sorghum grain pericarp is under the control of the Y gene. A mutable allele of Y, designated as y-cs (y-candystripe), produces a variegated pericarp phenotype. Using probes from the maize p1 gene that cross-hybridize with the sorghum Y gene, we isolated the y-cs allele containing a large insertion element. Our results show that the Y gene is a member of the MYB-transcription factor family. The insertion element, named Candystripe1 (Cs1), is present ...

  20. High genetic variation and recombination events in the vicinity of non-autonomous transposable elements from ‘Candidatus Liberibacter asiaticus’

    Institute of Scientific and Technical Information of China (English)

    WANG Xue-feng; CHEN Jiao-yue; TAN Jin; DUAN Suo; DENG Xiao-ling; CHEN Jian-chi; ZHOU Chang-yong

    2015-01-01

    Two miniature inverted-repeat transposable elements (MITEs), MCLas-A and MCLas-B, were recently identiifed from ‘Candidatus Liberibacter asiaticus’ known to be associated with citrus Huanglongbing (HLB, yelow shoot disease). MCLas-A was suggested as an active MITE because of its mobility. The immediate upstream gene of the two MITEs was predicted to be a putative transposase. The goal of this study is to analyze the sequence variation in the upstream putative transposase of MITEs and explore the possible correlation between sequence variation of transposase gene and MITE activity. PCR and sequence analysis showed that 12 sequence types were found in six major amplicon types from 43 representative ‘Ca. L. asiaticus’ isolates from China, the United States and Brazil. Out of the 12 sequence types, three (T4, T5-2, T6) were reported for the ifrst time. Recombination events were found in the two unique sequence types (T5-2 and T6) which were detected in al Brazilian isolates. Notably, no sequence variation or recombination events were detected in the upstream putative transposase gene of MCLas-A, suggesting the conservation of the transposase gene might be closely related with the MITE activity. Phylogenetic analysis demonstrated two wel supported clades including ifve subclades were identiifed, clearly relfecting the geographical origins of isolates, especialy that of Ruili isolates, São Paulo isolates and a few Florida isolates.

  1. Genome-Wide Comparison of Magnaporthe Species Reveals a Host-Specific Pattern of Secretory Proteins and Transposable Elements

    Science.gov (United States)

    Gowda, Malali

    2016-01-01

    Blast disease caused by the Magnaporthe species is a major factor affecting the productivity of rice, wheat and millets. This study was aimed at generating genomic information for rice and non-rice Magnaporthe isolates to understand the extent of genetic variation. We have sequenced the whole genome of the Magnaporthe isolates, infecting rice (leaf and neck), finger millet (leaf and neck), foxtail millet (leaf) and buffel grass (leaf). Rice and finger millet isolates infecting both leaf and neck tissues were sequenced, since the damage and yield loss caused due to neck blast is much higher as compared to leaf blast. The genome-wide comparison was carried out to study the variability in gene content, candidate effectors, repeat element distribution, genes involved in carbohydrate metabolism and SNPs. The analysis of repeat element footprints revealed some genes such as naringenin, 2-oxoglutarate 3-dioxygenase being targeted by Pot2 and Occan, in isolates from different host species. Some repeat insertions were host-specific while other insertions were randomly shared between isolates. The distributions of repeat elements, secretory proteins, CAZymes and SNPs showed significant variation across host-specific lineages of Magnaporthe indicating an independent genome evolution orchestrated by multiple genomic factors. PMID:27658241

  2. Epigenetic mechanisms and associated brain circuits in the regulation of positive emotions: A role for transposable elements.

    Science.gov (United States)

    Gaudi, Simona; Guffanti, Guia; Fallon, James; Macciardi, Fabio

    2016-10-15

    Epigenetic programming and reprogramming are at the heart of cellular differentiation and represent developmental and evolutionary mechanisms in both germline and somatic cell lines. Only about 2% of our genome is composed of protein-coding genes, while the remaining 98%, once considered "junk" DNA, codes for regulatory/epigenetic elements that control how genes are expressed in different tissues and across time from conception to death. While we already know that epigenetic mechanisms are at play in cancer development and in regulating metabolism (cellular and whole body), the role of epigenetics in the developing prenatal and postnatal brain, and in maintaining a proper brain activity throughout the various stages of life, in addition to having played a critical role in human evolution, is a relatively new domain of knowledge. Here we present the current state-of-the-art techniques and results of these studies within the domain of emotions, and then speculate on how genomic and epigenetic mechanisms can modify and potentially alter our emotional (limbic) brain and affect our social interactions. J. Comp. Neurol. 524:2944-2954, 2016. © 2016 Wiley Periodicals, Inc. PMID:27224878

  3. Mapping of a Leishmania major gene/locus that confers pentamidine resistance by deletion and insertion of transposable element

    Directory of Open Access Journals (Sweden)

    Coelho Adriano C.

    2004-01-01

    Full Text Available Pentamidine (PEN is an alternative compound to treat antimony-resistant leishmaniasis patients, which cellular target remains unclear. One approach to the identification of prospective targets is to identify genes able to mediate PEN resistance following overexpression. Starting from a genomic library of transfected parasites bearing a multicopy episomal cosmid vector containing wild-type Leishmania major DNA, we isolated one locus capable to render PEN resistance to wild type cells after DNA transfection. In order to map this Leishmania locus, cosmid insert was deleted by two successive sets of partial digestion with restriction enzymes, followed by transfection into wild type cells, overexpression, induction and functional tests in the presence of PEN. To determine the Leishmania gene related to PEN resistance, nucleotide sequencing experiments were done through insertion of the transposon Mariner element of Drosophila melanogaster (mosK into the deleted insert to work as primer island. Using general molecular techniques, we described here this method that permits a quickly identification of a functional gene facilitating nucleotide sequence experiments from large DNA fragments. Followed experiments revealed the presence of a P-Glycoprotein gene in this locus which role in Leishmania metabolism has now been analyzed.

  4. Development of crop-specific transposable element (SINE) markers for studying gene flow from oilseed rape to wild radish.

    Science.gov (United States)

    Prieto, J L; Pouilly, N; Jenczewski, E; Deragon, J M; Chèvre, A M

    2005-08-01

    The screening of wild populations for evidence of gene flow from a crop to a wild related species requires the unambiguous detection of crop genes within the genome of the wild species, taking into account the intraspecific variability of each species. If the crop and wild relatives share a common ancestor, as is the case for the Brassica crops and their wild relatives (subtribe Brassiceae), the species-specific markers needed to make this unambiguous detection are difficult to identify. In the model oilseed rape (Brassica napus, AACC, 2n = 38)-wild radish (Raphanus raphanistrum, RrRr, 2n = 18) system, we utilized the presence or absence of a short-interspersed element (SINE) at a given locus to develop oilseed rape-specific markers, as SINE insertions are irreversible. By means of sequence-specific amplified polymorphism (SINE-SSAP) reactions, we identified and cloned 67 bands specific to the oilseed rape genome and absent from that of wild radish. Forty-seven PCR-specific markers were developed from three combinations of primers anchored either in (1) the 5'- and 3'-genomic sequences flanking the SINE, (2) the 5'-flanking and SINE internal sequences or (3) the SINE internal and flanking 3'-sequences. Seventeen markers were monomorphic whatever the oilseed rape varieties tested, whereas 30 revealed polymorphism and behaved either as dominant (17) or co-dominant (13) markers. Polymorphic markers were mapped on 19 genomic regions assigned to ten linkage groups. The markers developed will be efficient tools to trace the occurrence and frequency of introgressions of oilseed rape genomic region within wild radish populations. PMID:15942756

  5. The Evolutionary Dynamics of Ribosomal Genes, Histone H3, and Transposable Rex Elements in the Genome of Atlantic Snappers.

    Science.gov (United States)

    Costa, Gideão Wagner Werneck Félix da; Cioffi, Marcelo de Bello; Bertollo, Luiz Antonio Carlos; Molina, Wagner Franco

    2016-03-01

    Lutjanidae is a family of primarily marine and carnivorous fishes distributed in the Atlantic, Indian, and Pacific oceans, with enormous economic and ecological importance. In order to better clarify the conservative chromosomal evolution of Lutjanidae, we analyzed the evolutionary dynamics of 5 repetitive DNA classes in 5 Lutjanus and in 1 Ocyurus species from the Western Atlantic. The ribosomal 18S sites were generally located in a single chromosome pair, except for L. jocu and L. alexandrei where they are found in 2 pairs. In turn, the 5S rDNA sites are unique, terminal and nonsyntenic with the 18S rDNA sites. In 3 species analyzed, H3 hisDNA genes were found in 1 chromosomal pair. However, while L. jocu presented 2 H3 sites, O. chrysurus showed a noteworthy dispersion of this gene in almost all chromosomes of the karyotype. Retrotransposons Rex1 and Rex3 do not exhibit any association with the explosive distribution of H3 sequences in O. chrysurus. The low compartmentalization of Rex elements, in addition to the general nondynamic distribution of ribosomal and H3 genes, corroborate the karyotype conservatism in Lutjanidae species, also at the microstructural level. However, some "disturbing evolutionary waves" can break down this conservative scenario, as evidenced by the massive random dispersion of H3 hisDNA in the genome of O. chrysurus. The implication of the genomic expansion of H3 histone genes and their functionality remain unknown, although suggesting that they have higher evolutionary dynamics than previously thought. PMID:26792596

  6. Changes in DNA methylation and transgenerational mobilization of a transposable element (mPing by the Topoisomerase II inhibitor, Etoposide, in rice

    Directory of Open Access Journals (Sweden)

    Yang Xuejiao

    2012-04-01

    Full Text Available Abstract Background Etoposide (epipodophyllotoxin is a chemical commonly used as an anti-cancer drug which inhibits DNA synthesis by blocking topoisomerase II activity. Previous studies in animal cells have demonstrated that etoposide constitutes a genotoxic stress which may induce genomic instability including mobilization of normally quiescent transposable elements (TEs. However, it remained unknown whether similar genetically mutagenic effects could be imposed by etoposide in plant cells. Also, no information is available with regard to whether the drug may cause a perturbation of epigenetic stability in any organism. Results To investigate whether etoposide could generate genetic and/or epigenetic instability in plant cells, we applied etoposide to germinating seeds of six cultivated rice (Oryza sativa L. genotypes including both subspecies, japonica and indica. Based on the methylation-sensitive gel-blotting results, epigenetic changes in DNA methylation of three TEs (Tos17, Osr23 and Osr36 and two protein-encoding genes (Homeobox and CDPK-related genes were detected in the etoposide-treated plants (S0 generation in four of the six studied japonica cultivars, Nipponbare, RZ1, RZ2, and RZ35, but not in the rest japonica cultivar (Matsumae and the indica cultivar (93-11. DNA methylation changes in the etoposide-treated S0 rice plants were validated by bisulfite sequencing at both of two analyzed loci (Tos17 and Osr36. Transpositional activity was tested for eight TEs endogenous to the rice genome in both the S0 plants and their selfed progenies (S1 and S2 of one of the cultivars, RZ1, which manifested heritable phenotypic variations. Results indicated that no transposition occurred in the etoposide-treated S0 plants for any of the TEs. Nonetheless, a MITE transposon, mPing, showed rampant mobilization in the S1 and S2 progenies descended from the drug-treated S0 plants. Conclusions Our results demonstrate that etoposide imposes a similar

  7. An Immunity-Triggering Effector from the Barley Smut Fungus Ustilago hordei Resides in an Ustilaginaceae-Specific Cluster Bearing Signs of Transposable Element-Assisted Evolution

    KAUST Repository

    Ali, Shawkat

    2014-07-03

    The basidiomycete smut fungus Ustilago hordei was previously shown to comprise isolates that are avirulent on various barley host cultivars. Through genetic crosses we had revealed that a dominant avirulence locus UhAvr1 which triggers immunity in barley cultivar Hannchen harboring resistance gene Ruh1, resided within an 80-kb region. DNA sequence analysis of this genetically delimited region uncovered the presence of 7 candidate secreted effector proteins. Sequence comparison of their coding sequences among virulent and avirulent parental and field isolates could not distinguish UhAvr1 candidates. Systematic deletion and complementation analyses revealed that UhAvr1 is UHOR_10022 which codes for a small effector protein of 171 amino acids with a predicted 19 amino acid signal peptide. Virulence in the parental isolate is caused by the insertion of a fragment of 5.5 kb with similarity to a common U. hordei transposable element (TE), interrupting the promoter of UhAvr1 and thereby changing expression and hence recognition of UhAVR1p. This rearrangement is likely caused by activities of TEs and variation is seen among isolates. Using GFP-chimeric constructs we show that UhAvr1 is induced only in mated dikaryotic hyphae upon sensing and infecting barley coleoptile cells. When infecting Hannchen, UhAVR1p causes local callose deposition and the production of reactive oxygen species and necrosis indicative of the immune response. UhAvr1 does not contribute significantly to overall virulence. UhAvr1 is located in a cluster of ten effectors with several paralogs and over 50% of TEs. This cluster is syntenous with clusters in closely-related U. maydis and Sporisorium reilianum. In these corn-infecting species, these clusters harbor however more and further diversified homologous effector families but very few TEs. This increased variability may have resulted from past selection pressure by resistance genes since U. maydis is not known to trigger immunity in its corn host.

  8. An immunity-triggering effector from the Barley smut fungus Ustilago hordei resides in an Ustilaginaceae-specific cluster bearing signs of transposable element-assisted evolution.

    Directory of Open Access Journals (Sweden)

    Shawkat Ali

    2014-07-01

    Full Text Available The basidiomycete smut fungus Ustilago hordei was previously shown to comprise isolates that are avirulent on various barley host cultivars. Through genetic crosses we had revealed that a dominant avirulence locus UhAvr1 which triggers immunity in barley cultivar Hannchen harboring resistance gene Ruh1, resided within an 80-kb region. DNA sequence analysis of this genetically delimited region uncovered the presence of 7 candidate secreted effector proteins. Sequence comparison of their coding sequences among virulent and avirulent parental and field isolates could not distinguish UhAvr1 candidates. Systematic deletion and complementation analyses revealed that UhAvr1 is UHOR_10022 which codes for a small effector protein of 171 amino acids with a predicted 19 amino acid signal peptide. Virulence in the parental isolate is caused by the insertion of a fragment of 5.5 kb with similarity to a common U. hordei transposable element (TE, interrupting the promoter of UhAvr1 and thereby changing expression and hence recognition of UhAVR1p. This rearrangement is likely caused by activities of TEs and variation is seen among isolates. Using GFP-chimeric constructs we show that UhAvr1 is induced only in mated dikaryotic hyphae upon sensing and infecting barley coleoptile cells. When infecting Hannchen, UhAVR1p causes local callose deposition and the production of reactive oxygen species and necrosis indicative of the immune response. UhAvr1 does not contribute significantly to overall virulence. UhAvr1 is located in a cluster of ten effectors with several paralogs and over 50% of TEs. This cluster is syntenous with clusters in closely-related U. maydis and Sporisorium reilianum. In these corn-infecting species, these clusters harbor however more and further diversified homologous effector families but very few TEs. This increased variability may have resulted from past selection pressure by resistance genes since U. maydis is not known to trigger immunity

  9. Sparse Biclustering of Transposable Data.

    Science.gov (United States)

    Tan, Kean Ming; Witten, Daniela M

    2014-01-01

    We consider the task of simultaneously clustering the rows and columns of a large transposable data matrix. We assume that the matrix elements are normally distributed with a bicluster-specific mean term and a common variance, and perform biclustering by maximizing the corresponding log likelihood. We apply an ℓ1 penalty to the means of the biclusters in order to obtain sparse and interpretable biclusters. Our proposal amounts to a sparse, symmetrized version of k-means clustering. We show that k-means clustering of the rows and of the columns of a data matrix can be seen as special cases of our proposal, and that a relaxation of our proposal yields the singular value decomposition. In addition, we propose a framework for bi-clustering based on the matrix-variate normal distribution. The performances of our proposals are demonstrated in a simulation study and on a gene expression data set. This article has supplementary material online. PMID:25364221

  10. TamiR1123 originated from a family of miniature inverted-repeat transposable elements (MITE) including one inserted in the Vrn-A1a promoter in wheat.

    Science.gov (United States)

    Yu, Ming; Carver, Brett F; Yan, Liuling

    2014-02-01

    More than half of spring wheat cultivars have a dominant Vrn-A1a allele that has an insertion of a miniature inverted-repeat transposable element (MITE) in its promoter. In this study, we found that the MITE present in the Vrn-A1a gene (MITE_VRN) is a nearly perfect palindrome and it can form highly stable hairpin loops when expressed as RNA. MITE_VRN also possessed sequences of a microRNA in Triticum aestivum (TamiR1123). The P(32) labeled TamiR1123 probe detected two RNA molecules on a small RNA gel blot, one expected for MITE_VRN, and the other expected for TamiR1123. These results demonstrated that MITE_VRN was expressed as RNAs and TamiR1123 was originated from the MITE_VRN family. The isogenic line TDD carrying the dominant Vrn-A1a allele with MITE_VRN showed higher TamiR1123 and Vrn-A1a transcript levels than the isogenic line TDE carrying the recessive vrn-A1a allele without MITE_VRN. TamiR1123 were greatly up-regulated by plant age but slightly down-regulated by low temperature and short days. These findings have pointed to alternative regulatory mechanisms for plant development governed by Vrn-A1a in spring wheat.

  11. Polymorphisms of the nucleolus organizing regions in Loricaria cataphracta (Siluriformes, Loricariidae) of the upper Paraguay River basin indicate an association with transposable elements.

    Science.gov (United States)

    Porto, F E; Gindri, B S; Vieira, M M R; Borin, L A; Portela-Castro, A L B; Martins-Santos, I C

    2014-03-12

    A cytogenetic analysis of Loricaria cataphracta revealed a diploid number of 2n = 64 chromosomes, distributed as 12 metacentric + 8 submetacentric + 2 subtelocentric + 42 acrocentric, with a fundamental number of 86. Analysis of the nucleolus organizing region (NOR) using silver nitrate impregnation and fluorescence in situ hybridization (18S rDNA probe) techniques showed intra-population chromosomal polymorphism that could be classified into five different patterns (I to V), involving four pairs of chromosomes (8, 9, 12, and 13). In pattern I, the NOR was located in pair 12, whereas in pattern II, the NOR was detected in pair 8; these two patterns were characterized as a simple-NOR system. A multiple NOR system was evident in the other patterns (III, IV, and V). In pattern III, the NOR was located in only one of the homologs of pairs 12 and 8, and in patterns IV and V, the NOR was observed in pair 12 and in only one of the homologs of pairs 9 and 13, respectively. In addition, C-band analysis also showed this pattern of variation, and characterized a polymorphism in relation to the constitutive heterochromatin; the composition of this region was GC-rich (positive CMA3) and 4',6-diamidino-2-phenylindole negative. Transposition of NOR sites for mobile elements is suggested to explain this polymorphism.

  12. Structure of the acyl-glucose-dependent anthocyanin 5-O-glucosyltransferase gene in carnations and its disruption by transposable elements in some varieties.

    Science.gov (United States)

    Nishizaki, Yuzo; Matsuba, Yuki; Okamoto, Emi; Okamura, Masachika; Ozeki, Yoshihiro; Sasaki, Nobuhiro

    2011-12-01

    The pink, red and crimson petal colors of carnations (Dianthus caryophyllus) are produced by anthocyanins. The anthocyanins, pelargonidin and cyanidin can be modified by two glucoses at the 3 and 5 positions, and by a single malic acid. Petal color variation can result from failure of such modification, for example, the lack of a glucose at the 5 position is responsible for the color variants of some commercial varieties. With respect to this variation, modification by 5-O-glucosyltransferase plays the most important role in glucosylation at the 5 position. Recently, we identified a novel acyl-glucose-dependent anthocyanin 5-O-glucosyltransferase (AA5GT), that uses acyl-glucoses, but not UDP-glucose, as the glucose donor. Although we showed that loss of AA5GT expression was responsible for loss of glucosylation at the 5 position of anthocyanin in some varieties, the cause of this repression of AA5GT expression could not be determined. Here, we have succeeded in isolating the AA5GT gene and found that it consists of 12 exons and 11 introns. In carnation varieties lacking a glucose at the 5 position, we identified the insertion of two different retrotransposons, Ty1dic1 and Retdic1, into AA5GT. Ty1dic1, which belongs to the class I long terminal repeat (LTR)-retrotransposons of Ty1/copia families, was inserted into exon 10. Retdic1, which includes a long interspersed nuclear element (LINE)-like sequence, was inserted into intron 5. Thus, insertion of either Ty1dic1 or Retdic1 can disrupt AA5GT and result in the lack of glucosylation at the 5 position in anthocyanins.

  13. The characteristics and functions of a miniature inverted-repeat transposable element TaMITE81 in the 5' UTR of TaCHS7BL from Triticum aestivum.

    Science.gov (United States)

    Xi, Xinyuan; Li, Na; Li, Shiming; Chen, Wenjie; Zhang, Bo; Liu, Baolong; Zhang, Huaigang

    2016-10-01

    Miniature inverted-repeat transposable elements (MITEs) are truncated derivatives of autonomous DNA transposons, and are dispersed abundantly in eukaryotic and prokaryotic genomes. In this article, a MITE, TaMITE81, was isolated from the 5' untranslated region (UTR) of TaCHS7BL, chalcone synthase (CHS) catalyzing the first committed step of anthocyanin biosynthesis, in the wheat cultivar 'Opata' with white grain. TaMITE81 was only 81 nucleotides, including a terminal inverted repeat with 39 nucleotides and was flanked by two nucleotides, "TA", target site duplications that were typical features of stowaway-like MITEs. Compared with the wheat cultivar 'Gy115' with purple grain, which is without the insertion, the expression of TaCHS7BL was lower in several organs of 'Opata'. The insertion of TaMITE81 into the 5' UTR of the GUS gene also reduced the transient expression of GUS on the coleoptiles of 'Opata', which means the insertion of TaMITE81 was the reason for the low expression of TaCHS7BL in 'Opata'. But the genotype of TaCHS7BL was not linked to phenotype of grain color in the RILs derived from a cross 'Gy115' and 'Opata'. The TaMITE81 density of the hexaploid variety of T. aestivum was more than 10 times that of diploid relatives, which implies that polyploidization caused the amplification of TaMITE81 homologous sequences. Further research should be conducted on decoding the relationship between TaCHS7BL and other traits relative to anthocyanin biosynthesis in wheat, and discovering the mechanism of TaMITE81 transposon action. PMID:27481288

  14. Transposed intrathoracic stomach: Functional evaluation

    Directory of Open Access Journals (Sweden)

    Vishesh Jain

    2012-01-01

    Full Text Available Background: To study the functional aspects of the transposed stomach in the thoracic cavity and its effects on other organ systems. Patients and Methods: Children who had undergone gastric transposition more than 5 years ago were evaluated for symptoms, anthropometry, anaemia, duodenogastric reflux, pulmonary function, gastric emptying, gastric pH, gastroesophageal reflux and stricture, gastric motility, and gastritis and atrophy on histological examination of gastric mucosa. Results: Ten children were evaluated at a median follow-up of 90.5 months. On evaluation of symptoms, nine children were satisfied with the overall outcome. All patients had their weight and 7 patients had height less than 3 rd percentile for their respective age. Anaemia was present in 7/10 children. On evaluation with hepatobiliary scintigraphy, duodenogastric reflux was present in only 1 patient. Mass contractions of the transposed stomach were present in two thirds of the children. The mean gastric emptying t1/2 was 39.1 minutes. Pulmonary function tests were suggestive of restrictive lung disease in all the patients. Forced vital capacity (FVC and forced expiratory volume in 1 sec (FEV1 were worse in children who underwent transposition or diversion following oesophageal anastomotic leak. Acid secretion was preserved in most patients with episodes of high gastric pH during sleep in nearly half. Mild gastritis was present in all patients where as mild atrophy of the gastric mucosa was observed in only 1child. Helicobacter pylori were positive in 3/ 8 children. Barium swallow demonstrated reflux in 2 children. Conclusions: Most children with transposed stomach remain asymptomatic on follow up. However, subclinical abnormalities are detected on investigations, which need close observation as they can manifest later in life.

  15. Transposed genes in Arabidopsis are often associated with flanking repeats.

    Directory of Open Access Journals (Sweden)

    Margaret R Woodhouse

    2010-05-01

    Full Text Available Much of the eukaryotic genome is known to be mobile, largely due to the movement of transposons and other parasitic elements. Recent work in plants and Drosophila suggests that mobility is also a feature of many nontransposon genes and gene families. Indeed, analysis of the Arabidopsis genome suggested that as many as half of all genes had moved to unlinked positions since Arabidopsis diverged from papaya roughly 72 million years ago, and that these mobile genes tend to fall into distinct gene families. However, the mechanism by which single gene transposition occurred was not deduced. By comparing two closely related species, Arabidopsis thaliana and Arabidopsis lyrata, we sought to determine the nature of gene transposition in Arabidopsis. We found that certain categories of genes are much more likely to have transposed than others, and that many of these transposed genes are flanked by direct repeat sequence that was homologous to sequence within the orthologous target site in A. lyrata and which was predominantly genic in identity. We suggest that intrachromosomal recombination between tandemly duplicated sequences, and subsequent insertion of the circular product, is the predominant mechanism of gene transposition.

  16. Insights into the Transposable Mobilome of Paracoccus spp. (Alphaproteobacteria)

    Science.gov (United States)

    Dziewit, Lukasz; Baj, Jadwiga; Szuplewska, Magdalena; Maj, Anna; Tabin, Mateusz; Czyzkowska, Anna; Skrzypczyk, Grazyna; Adamczuk, Marcin; Sitarek, Tomasz; Stawinski, Piotr; Tudek, Agnieszka; Wanasz, Katarzyna; Wardal, Ewa; Piechucka, Ewa; Bartosik, Dariusz

    2012-01-01

    Several trap plasmids (enabling positive selection of transposition events) were used to identify a pool of functional transposable elements (TEs) residing in bacteria of the genus Paracoccus (Alphaproteobacteria). Complex analysis of 25 strains representing 20 species of this genus led to the capture and characterization of (i) 37 insertion sequences (ISs) representing 9 IS families (IS3, IS5, IS6, IS21, IS66, IS256, IS1182, IS1380 and IS1634), (ii) a composite transposon Tn6097 generated by two copies of the ISPfe2 (IS1634 family) containing two predicted genetic modules, involved in the arginine deiminase pathway and daunorubicin/doxorubicin resistance, (iii) 3 non-composite transposons of the Tn3 family, including Tn5393 carrying streptomycin resistance and (iv) a transposable genomic island TnPpa1 (45 kb). Some of the elements (e.g. Tn5393, Tn6097 and ISs of the IS903 group of the IS5 family) were shown to contain strong promoters able to drive transcription of genes placed downstream of the target site of transposition. Through the application of trap plasmid pCM132TC, containing a promoterless tetracycline resistance reporter gene, we identified five ways in which transposition can supply promoters to transcriptionally silent genes. Besides highlighting the diversity and specific features of several TEs, the analyses performed in this study have provided novel and interesting information on (i) the dynamics of the process of transposition (e.g. the unusually high frequency of transposition of TnPpa1) and (ii) structural changes in DNA mediated by transposition (e.g. the generation of large deletions in the recipient molecule upon transposition of ISPve1 of the IS21 family). We also demonstrated the great potential of TEs and transposition in the generation of diverse phenotypes as well as in the natural amplification and dissemination of genetic information (of adaptative value) by horizontal gene transfer, which is considered the driving force of bacterial

  17. Insights into the transposable mobilome of Paracoccus spp. (Alphaproteobacteria.

    Directory of Open Access Journals (Sweden)

    Lukasz Dziewit

    Full Text Available Several trap plasmids (enabling positive selection of transposition events were used to identify a pool of functional transposable elements (TEs residing in bacteria of the genus Paracoccus (Alphaproteobacteria. Complex analysis of 25 strains representing 20 species of this genus led to the capture and characterization of (i 37 insertion sequences (ISs representing 9 IS families (IS3, IS5, IS6, IS21, IS66, IS256, IS1182, IS1380 and IS1634, (ii a composite transposon Tn6097 generated by two copies of the ISPfe2 (IS1634 family containing two predicted genetic modules, involved in the arginine deiminase pathway and daunorubicin/doxorubicin resistance, (iii 3 non-composite transposons of the Tn3 family, including Tn5393 carrying streptomycin resistance and (iv a transposable genomic island TnPpa1 (45 kb. Some of the elements (e.g. Tn5393, Tn6097 and ISs of the IS903 group of the IS5 family were shown to contain strong promoters able to drive transcription of genes placed downstream of the target site of transposition. Through the application of trap plasmid pCM132TC, containing a promoterless tetracycline resistance reporter gene, we identified five ways in which transposition can supply promoters to transcriptionally silent genes. Besides highlighting the diversity and specific features of several TEs, the analyses performed in this study have provided novel and interesting information on (i the dynamics of the process of transposition (e.g. the unusually high frequency of transposition of TnPpa1 and (ii structural changes in DNA mediated by transposition (e.g. the generation of large deletions in the recipient molecule upon transposition of ISPve1 of the IS21 family. We also demonstrated the great potential of TEs and transposition in the generation of diverse phenotypes as well as in the natural amplification and dissemination of genetic information (of adaptative value by horizontal gene transfer, which is considered the driving force of

  18. Computing partial transposes and related entanglement functions

    CERN Document Server

    Maziero, Jonas

    2016-01-01

    The partial transpose (PT) is an important function for entanglement testing and quantification and also for the study of geometrical aspects of the quantum state space. In this article, considering general bipartite and multipartite discrete systems, explicit formulas ready for the numerical implementation of the PT and of related entanglement functions are presented and the Fortran code produced for that purpose is described. What is more, we obtain an analytical expression for the Hilbert-Schmidt entanglement of two-qudit systems and for the associated closest separable state. In contrast to previous works on this matter, we only use the properties of the PT, not applying Lagrange multipliers.

  19. Computing Partial Transposes and Related Entanglement Functions

    Science.gov (United States)

    Maziero, Jonas

    2016-10-01

    The partial transpose (PT) is an important function for entanglement testing and quantification and also for the study of geometrical aspects of the quantum state space. In this article, considering general bipartite and multipartite discrete systems, explicit formulas ready for the numerical implementation of the PT and of related entanglement functions are presented and the Fortran code produced for that purpose is described. What is more, we obtain an analytical expression for the Hilbert-Schmidt entanglement of two-qudit systems and for the associated closest separable state. In contrast to previous works on this matter, we only use the properties of the PT, not applying Lagrange multipliers.

  20. Structure and properties of the algebra of partially transposed permutation operators

    Energy Technology Data Exchange (ETDEWEB)

    Mozrzymas, Marek [Institute for Theoretical Physics, University of Wrocław, 50-204 Wrocław (Poland); Horodecki, Michał; Studziński, Michał [Institute for Theoretical Physics and Astrophysics, University of Gdańsk, 80-952 Gdańsk (Poland); National Quantum Information Centre of Gdańsk, 81-824 Sopot (Poland)

    2014-03-15

    We consider the structure of algebra of operators, acting in n-fold tensor product space, which are partially transposed on the last term. Using purely algebraical methods we show that this algebra is semi-simple and then, considering its regular representation, we derive basic properties of the algebra. In particular, we describe all irreducible representations of the algebra of partially transposed operators and derive expressions for matrix elements of the representations. It appears that there are two kinds of irreducible representations of the algebra. The first one is strictly connected with the representations of the group S(n − 1) induced by irreducible representations of the group S(n − 2). The second kind is structurally connected with irreducible representations of the group S(n − 1)

  1. A Transposable Partitioning Locus Used To Stabilize Plasmid-Borne Hydrogen Oxidation and Trifolitoxin Production Genes in a Sinorhizobium Strain

    OpenAIRE

    Kent, Angela D.; Wojtasiak, Michelle L.; Robleto, Eduardo A.; Eric W Triplett

    1998-01-01

    Improved nitrogen-fixing inoculum strains for leguminous crops must be able to effectively compete with indigenous strains for nodulation, enhance legume productivity compared to the productivity obtained with indigenous strains, and maintain stable expression of any added genes in the absence of selection pressure. We constructed a transposable element containing the tfx region for expression of increased nodulation competitiveness and the par locus for plasmid stability. The transposon was ...

  2. Strain properties of transposed segment conductors for a transmission cable

    International Nuclear Information System (INIS)

    In order to realize the superconducting cable composed of YBCO tapes, we investigated the optimal design for the cabling parameters, crossed pitch length, tape dimension for YBCO and former diameter, etc., in considering the manufacturing process. In the transposed segment, the repulsive force was applied to the crossed pitch tape, and in the case of the segment with a short crossed pitch length, the crossed pitch tape arched, which we called arching phenomena. However, in winding the transposed segment on the former by a few spiral pitch, arching phenomena did not occur even if crossed pitch length was so short that superconducting property of YBCO tape was deteriorated. In winding process of the transposed segment, a slide of constituent tapes occurred in longitudinal direction and it resulted in slack of the constituent tape. As a result, it became clear that the slack strain could be adjusted in order to avoid deterioration of superconducting property of YBCO tape. In cabling process, transverse and longitudinal bending strains were imposed on the tapes in the transposed segment. Consequently, it was found that transverse bending strain can be calculated with the cabling parameters, i.e. former diameter, spiral pitch and tape thickness, and it seems that longitudinal bending strain can also be calculated as well as transverse bending strain. From these results, we obtained important information to realize the superconducting cable composed of YBCO tapes

  3. A non-autonomous insect piggyBac trasposable element is mobile in tobacco

    Science.gov (United States)

    The piggyBac transposable element, originally isolated from a virus in an insect cell line, is a valuable molecular tool for transgenesis and mutagenesis of invertebrates. For heterologous transgenesis in a variety of mammals, transfer of the piggyBac transposable element from an ectopic plasmid onl...

  4. On biembedding an idempotent Latin square with its transpose

    OpenAIRE

    Donovan, D M; T. S. Griggs; Psomas, C.

    2013-01-01

    Let L be an idempotent Latin square of side n, thought of as a set of ordered triples (i, j, k) where L(i, j) = k. Let I be the set of triples (i, i, i). We consider the problem of biembedding the triples of L - I with the triples of L' - I, where L' is the transpose of L, in an orientable surface. We construct such embeddings for all doubly even values of n.

  5. An Ac transposon system based on maize chromosome 4S for isolating long-distance-transposed Ac tags in the maize genome.

    Science.gov (United States)

    Wang, Fei; Li, Zhaoying; Fan, Jun; Li, Pengfei; Hu, Wei; Wang, Gang; Xu, Zhengkai; Song, Rentao

    2010-12-01

    Transposon tagging is an important tool for gene isolation and functional studies. In maize, several transposon-tagging systems have been developed, mostly using Activator/Dissociation (Ac/Ds) and Mutator systems. Here, we establish another Ac-based transposon system with the donor Ac tightly linked with sugary1 (su1) on maize chromosome 4S. Newly transposed Ac (tr-Acs) were detected based on a negative dosage effect, and long-distance-transposed Ac events were identified and isolated from the donor Ac by a simple backcross scheme. In this study, we identified 208 independent long-distance-transposed Ac lines. Thirty-one flanking sequences of these tr-Acs were isolated and localized in the maize genome. As found in previous studies, the tr-Acs preferentially inserted into genic sequences. The distribution of tr-Acs is not random. In our study, the tr-Acs preferentially transposed into chromosomes 1, 2, 9 and 10. We discuss the preferential distribution of tr-Acs from Ac systems. Our system is complementary to two other Ac-based regional-mutagenesis systems in maize, and the combined use of these systems will achieve an even and high-density distribution of Ac elements throughout the maize genome for functional-genomics studies.

  6. Differences of Skew Schur Functions of Staircases with Transposed Foundations

    CERN Document Server

    Morin, Matthew

    2010-01-01

    We consider the skew diagram $\\Delta_n$, which is the $180^\\circ$ rotation of the staircase diagram $\\delta_n = (n,n-1,n-2,...,2,1)$. We create a staircase with bad foundation by augmenting $\\Delta_n$ with another skew diagram, which we call the \\textit{foundation}. We consider pairs of staircases with bad foundation whose foundations are transposes of one another. Among these pairs, we show that the difference of the corresponding skew Schur functions is Schur-positive in the case when one of the foundations consists of either a one or two row diagram, or a hook diagram.

  7. Moments of the Hilbert-Schmidt probability distributions over determinants of real two-qubit density matrices and of their partial transposes

    CERN Document Server

    Slater, Paul B

    2010-01-01

    The nonnegativity of the determinant of the partial transpose of a two-qubit (4 x 4) density matrix is both a necessary and sufficient condition for its separability. While the determinant is restricted to the interval [0,1/256], the determinant of the partial transpose can range over [-1/16,1/256], with negative values corresponding to entangled states. We report here the exact values of the first nine moments of the probability distribution of the partial transpose over this interval, with respect to the Hilbert-Schmidt (metric volume element) measure on the nine-dimensional convex set of real two-qubit density matrices. Rational functions C_{2 j}(m), yielding the coefficients of the 2j-th power of even polynomials occurring at intermediate steps in our derivation of the m-th moment, emerge. These functions possess poles at finite series of consecutive half-integers (m=-3/2,-1/2,...,(2j-1)/2), and certain (trivial) roots at finite series of consecutive natural numbers (m=0, 1,...). Additionally, the (nontri...

  8. Effects of Un-transposed UHV Transmission Line on Fault Analysis of Power Systems

    Institute of Scientific and Technical Information of China (English)

    WANG Anning; CHEN Qing; ZHOU Zhanping

    2008-01-01

    The conventional fault analysis method based on symmetrical components supposes that the three-phase parameters of un-transposed transmission line are symmetrical in case of fault. The errors caused by the method with the symmetrical distributed parameter circuit model as the equivalent circuit of the un-transposed ultra high voltage (UHV) transmission line were studied under both normal operation and fault, and the corresponding problems arising were pointed out. By contrast with electromagnetic transient and power electronics (EMTPE) simulation results with the asymmetrical distributed parameter circuit model of un-transposed line, it is shown that the conventional method cannot show the existence of negative and zero sequences before fault happening and there are many errors on voltage and current after fault happening which are different with fault types. The error ranges of voltage and current are 2.13%-81.13% and -7.82%-86.15%, respectively.

  9. Translocation junctions in TCF3-PBX1 acute lymphoblastic leukemia/lymphoma cluster near transposable elements

    OpenAIRE

    Rodić, Nemanja; Zampella, John G; Toby C Cornish; Sarah J Wheelan; Burns, Kathleen H.

    2013-01-01

    Background Hematolymphoid neoplasms frequently harbor recurrent genetic abnormalities. Some of the most well recognized lesions are chromosomal translocations, and many of these are known to play pivotal roles in pathogenesis. In lymphoid malignancies, some translocations result from erroneous V(D)J-type events. However, other translocation junctions appear randomly positioned and their underlying mechanisms are not understood. Results We tested the hypothesis that genomic repeats, including ...

  10. Functional identification of gene cluster for the aniline metabolic pathway mediated by transposable element

    Institute of Scientific and Technical Information of China (English)

    LIANG Quanfeng; Takeo Masahiro; LIN Min; CHEN Ming; XU Yuquan; ZHANG Wei; PING Shuzhen; LU Wei; SONG Xianlong; WANG Weiwei; GENG Lizhao

    2005-01-01

    A convenient and widely applicable method has been developed to clone aniline metabolic gene cluster in this study. Three positive recombinant plasmids pDA1, pDB2 and pDB11 were cloned from genomic library of aniline degradation strain AD9. The result of aniline dioxygenase (AD) activity and catechol 2,3-oxygenase (C23O) activity assay showed that pDA1 and pDB11 contain aniline dioxygenase genes and catechol 2,3-dioxygenase genes, respectively. The sequence analysis of the total 24.7-kb region revealed that this region contains 25 ORFs, of which 17 genes involve metabolism of aniline. In the gene cluster, the first five genes (tadQTA1A2B) and the subsequent gene (tadR1) were predicted to encode a multi-component aniline dioxygenase and a LysR-type regulator, respectively, while the others (tadD1C1D2C2EFGIJKL) were expected to encode meta- cleavage pathway enzymes for catechol degradation. The gene cluster was surrounded by two IS1071 sequences.

  11. System-Level Genetic Codes Using a Transposable Element-Like Mechanism with Applications to Cancer

    OpenAIRE

    McGowan, John F.

    2000-01-01

    A system-level genetic code is a hypothetical genetic code that exclusively or preferentially codes systems of interacting coadapted parts. System-level genetic codes differ from part-level genetic codes in which each discrete part is coded independently. In general, a system-level genetic code requires coding discrete interacting parts such as organs or proteins in an interdependent way. Changing a single symbol or "gene" in a system-level genetic code affects two or more parts in a coordina...

  12. An En/Spm based transposable element system for gene isolation in Arabidopsis thaliana.

    NARCIS (Netherlands)

    Aarts, M.G.M.

    1996-01-01

    At the start of the research described in this thesis, the main aim was to develop, study and apply an efficient En/Spm-I/dSpm based transposon tagging system in Arabidopsis thaliana to generate tagged mutants and to provide insights in the possibilities for future applications of such a transposon

  13. Restoration of thumb opposition by transposing the flexsor pollicis brevis muscle: thirteen-year clinical application

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Background To repair late median nerve injury, many methods have been used in the past years. The aim of this study was to review a thirteen-year experience in restoration of thumb opposition by transposing flexor pollicis brevis muscle.Methods From July 1992 to August 2005, 63 patients without thumb opposition because of late median never injury were treated by transposing the flexor pollicis brevis muscle. All the patients had received primary nerve repair after the jnjury. The interval between the injury and the second operation was (1.87±2.31) years (6 months to 4.2 years). The patients were followed up for 3 to 48 [months mean (22.93±2.31) months]. A functional evaluation system designed in 1992 were used to estimate the outcomes of the patients. Results All the patients gained excellent functional results without complications and disabilities during follow-up.Conclusions Restoration of thumb opposition by transposing flexsor pollicis brevis muscle has the following advantages: 1. Operative trauma is minimal; 2. It is not necessary to transpose other tendons; 3. Except for the thumb in opposition, movements of other fingers and the wrist are not restricted postoperatively.

  14. A structured annotation frame for the transposable phages: a new proposed family "Saltoviridae" within the Caudovirales.

    Science.gov (United States)

    Hulo, Chantal; Masson, Patrick; Le Mercier, Philippe; Toussaint, Ariane

    2015-03-01

    Enterobacteriophage Mu is the best studied and paradigm member of the transposable phages. Mu-encoded proteins have been annotated in detail in UniProtKB and linked to a controlled vocabulary describing the various steps involved in the phage lytic and lysogenic cycles. Transposable phages are ubiquitous temperate bacterial viruses with a dsDNA linear genome. Twenty-six of them, that infect α, β and γ-proteobacteria, have been sequenced. Their conserved properties are described. Based on these characteristics, we propose a reorganization of the Caudovirales, to allow for the inclusion of a "Saltoviridae" family and two newly proposed subfamilies, the "Myosaltovirinae" and "Siphosaltovirinae". The latter could temporarily be included in the existing Myoviridae and Siphoviridae families. PMID:25500185

  15. Transposed Markov Matrix as a New Decision Tool of How to Choose among Competing Investment Options in Academic Medicine

    OpenAIRE

    Amnon Sonnenberg

    2009-01-01

    Medical institutions face the challenge of promoting excellence in a variety of competing focus areas, such as grants, publications, income, research, faculty, variety, patient care and teaching. A transposed Markov chain is used analyse the interactions between the various focus areas and their transition towards steady-state. In contradistinction with a regular Markov chain, in the transposed chain used for the present analysis, the sum of inputs (rather than outputs) of each individual sta...

  16. Molecular biology of maize Ac/Ds elements: an overview.

    Science.gov (United States)

    Lazarow, Katina; Doll, My-Linh; Kunze, Reinhard

    2013-01-01

    Maize Activator (Ac) is one of the prototype transposable elements of the hAT transposon superfamily, members of which were identified in plants, fungi, and animals. The autonomous Ac and nonautonomous Dissociation (Ds) elements are mobilized by the single transposase protein encoded by Ac. To date Ac/Ds transposons were shown to be functional in approximately 20 plant species and have become the most widely used transposable elements for gene tagging and functional genomics approaches in plants. In this chapter we review the biology, regulation, and transposition mechanism of Ac/Ds elements in maize and heterologous plants. We discuss the parameters that are known to influence the functionality and transposition efficiency of Ac/Ds transposons and need to be considered when designing Ac transposase expression constructs and Ds elements for application in heterologous plant species.

  17. Orthographic Reading Deficits in Dyslexic Japanese Children: Examining the Transposed-Letter Effect in the Color-Word Stroop Paradigm

    Science.gov (United States)

    Ogawa, Shino; Shibasaki, Masahiro; Isomura, Tomoko; Masataka, Nobuo

    2016-01-01

    In orthographic reading, the transposed-letter effect (TLE) is the perception of a transposed-letter position word such as “cholocate” as the correct word “chocolate.” Although previous studies on dyslexic children using alphabetic languages have reported such orthographic reading deficits, the extent of orthographic reading impairment in dyslexic Japanese children has remained unknown. This study examined the TLE in dyslexic Japanese children using the color-word Stroop paradigm comprising congruent and incongruent Japanese hiragana words with correct and transposed-letter positions. We found that typically developed children exhibited Stroop effects in Japanese hiragana words with both correct and transposed-letter positions, thus indicating the presence of TLE. In contrast, dyslexic children indicated Stroop effects in correct letter positions in Japanese words but not in transposed, which indicated an absence of the TLE. These results suggest that dyslexic Japanese children, similar to dyslexic children using alphabetic languages, may also have a problem with orthographic reading. PMID:27303331

  18. On the structure of the body of states with positive partial transpose

    Energy Technology Data Exchange (ETDEWEB)

    Szarek, Stanislaw J [Case Western Reserve University, Cleveland, OH (United States); Universite Paris VI, Paris (France); Bengtsson, Ingemar [Fysikum, Stockholm University, Stockholm (Sweden); Zyczkowski, Karol [Perimeter Institute, Waterloo, Ontario (Canada); Institute of Physics, Jagiellonian University, Cracow (Poland); Center for Theoretical Physics, Polish Academy of Sciences, Warsaw (Poland)

    2006-02-03

    We show that the convex set of separable mixed states of the 2 x 2 system is a body of a constant height. This fact is used to prove that the probability of finding a random state to be separable equals twice the probability of finding a random boundary state to be separable, provided that the random states are generated uniformly with respect to the Hilbert-Schmidt (Euclidean) measure. An analogous property holds for the set of positive-partial-transpose states for an arbitrary bipartite system. (letter to the editor)

  19. On the structure of the body of states with positive partial transpose

    CERN Document Server

    Szarek, S; Zyczkowski, K; Szarek, Stanislaw; Bengtsson, Ingemar; Zyczkowski, Karol

    2005-01-01

    We show that the convex set of separable mixed states of the 2 x 2 system is a body of constant height. This fact is used to prove that the probability to find a random state to be separable equals 2 times the probability to find a random boundary state to be separable, provided the random states are generated uniformly with respect to the Hilbert-Schmidt (Euclidean) distance. An analogous property holds for the set of positive-partial-transpose states for an arbitrary bipartite system.

  20. LETTER TO THE EDITOR: On the structure of the body of states with positive partial transpose

    Science.gov (United States)

    Szarek, Stanislaw J.; Bengtsson, Ingemar; Zyczkowski, Karol

    2006-02-01

    We show that the convex set of separable mixed states of the 2 × 2 system is a body of a constant height. This fact is used to prove that the probability of finding a random state to be separable equals twice the probability of finding a random boundary state to be separable, provided that the random states are generated uniformly with respect to the Hilbert-Schmidt (Euclidean) measure. An analogous property holds for the set of positive-partial-transpose states for an arbitrary bipartite system.

  1. Behavior of a modified Dissociation element in barley: a tool for genetic studies and for breeding transgenic barley

    Science.gov (United States)

    Maize-derived sequences from the transposable elements Activator (Ac) and Dissociation (Ds) have enabled studies of gene function via transposon tagging. The characteristics of synthetic, transgene-containing Ds elements constructed for some of these studies has demonstrated their ability to resolve...

  2. Substituted-Letter and Transposed-Letter Effects in a Masked Priming Paradigm with French Developing Readers and Dyslexics

    Science.gov (United States)

    Lete, Bernard; Fayol, Michel

    2013-01-01

    The aim of the study was to undertake a behavioral investigation of the development of automatic orthographic processing during reading acquisition in French. Following Castles and colleagues' 2007 study ("Journal of Experimental Child Psychology, 97," 165-182) and their lexical tuning hypothesis framework, substituted-letter and transposed-letter…

  3. Transposed Markov Matrix as a New Decision Tool of How to Choose among Competing Investment Options in Academic Medicine

    Directory of Open Access Journals (Sweden)

    Amnon Sonnenberg

    2009-01-01

    Full Text Available Medical institutions face the challenge of promoting excellence in a variety of competing focus areas, such as grants, publications, income, research, faculty, variety, patient care and teaching. A transposed Markov chain is used analyse the interactions between the various focus areas and their transition towards steady-state. In contradistinction with a regular Markov chain, in the transposed chain used for the present analysis, the sum of inputs (rather than outputs of each individual state is 100%, whereas the outputs are left to assume any possible value. The mathematics of calculating the steady state conditions of a transposed Markov matrix are similar to those of a regular Markov matrix. The analysis shows that a focus area more dependent on other areas is also more likely to lose its investment, whereas largely self-reliant areas will generate the largest return. Full strength of all academic focus areas can be achieved only by investments in all areas. In academic systems with one or several exclusively self-reliant focus areas, only investment in these particular areas will invigorate the system, as all other investments are bound to dissipate over time. The newly developed decision tool of a transposed Markov matrix could be helpful in stochastic modelling of medical phenomena.

  4. Properties and construction of extreme bipartite states having positive partial transpose

    CERN Document Server

    Chen, Lin

    2012-01-01

    We investigate the set E of extreme points of the compact convex set of PPT states (i.e., the states having positive semidefinite partial transpose) of a bipartite MxN quantum system. Let E(M,N,r) denote the subset of E consisting of states of rank r which are supported on MxN. We show that for M,N>2 the sets E(M,N,M+N-2) are nonempty. On the other hand we show that for M,N>3 the sets E(M,N,N+1) are empty. It is known that the set E(M,N,MN) is empty, and we show that also the set E(M,N,MN-1) is empty. We divide the set of all states into the good and the bad states (the definition is too technical to be given here). We show that the good states have many good properties.

  5. Mobile genetic elements in protozoan parasites

    Indian Academy of Sciences (India)

    Sudha Bhattacharya; Abhijeet Bakre; Alok Bhattacharya

    2002-08-01

    Mobile genetic elements, by virtue of their ability to move to new chromosomal locations, are considered important in shaping the evolutionary course of the genome. They are widespread in the biological kingdom. Among the protozoan parasites several types of transposable elements are encountered. The largest variety is seen in the trypanosomatids—Trypanosoma brucei, Trypanosoma cruzi and Crithidia fasciculata. They contain elements that insert site-specifically in the spliced-leader RNA genes, and others that are dispersed in a variety of genomic locations. Giardia lamblia contains three families of transposable elements. Two of these are subtelomeric in location while one is chromosome-internal. Entamoeba histolytica has an abundant retrotransposon dispersed in the genome. Nucleotide sequence analysis of all the elements shows that they are all retrotransposons, and, with the exception of one class of elements in T. cruzi, all of them are non-long-terminal-repeat retrotransposons. Although most copies have accumulated mutations, they can potentially encode reverse transcriptase, endonuclease and nucleic-acid-binding activities. Functionally and phylogenetically they do not belong to a single lineage, showing that retrotransposons were acquired early in the evolution of protozoan parasites. Many of the potentially autonomous elements that encode their own transposition functions have nonautonomous counterparts that probably utilize the functions in trans. In this respect these elements are similar to the mammalian LINEs and SINEs (long and short interspersed DNA elements), showing a common theme in the evolution of retrotransposons. So far there is no report of a DNA transposon in any protozoan parasite. The genome projects that are under way for most of these organisms will help understand the evolution and possible function of these genetic elements.

  6. ReAS: Recovery of ancestral sequences for transposable elements from the unassembled reads of a whole genome shotgun

    DEFF Research Database (Denmark)

    Li, Ruiqiang; Ye, Jia; Li, Songgang;

    2005-01-01

    in comparison to their ancestral sequences. Tested on the japonica rice genome, ReAS was able to reconstruct all of the high copy sequences in the Repbase repository of known TEs, and increase the effectiveness of RepeatMasker in identifying TEs from genome sequences. Udgivelsesdato: 2005-Sep...

  7. Screening of repetitive motifs inside the genome of the flat oyster (Ostrea edulis): Transposable elements and short tandem repeats.

    Science.gov (United States)

    Vera, Manuel; Bello, Xabier; Álvarez-Dios, Jose-Antonio; Pardo, Belen G; Sánchez, Laura; Carlsson, Jens; Carlsson, Jeanette E L; Bartolomé, Carolina; Maside, Xulio; Martinez, Paulino

    2015-12-01

    The flat oyster (Ostrea edulis) is one of the most appreciated molluscs in Europe, but its production has been greatly reduced by the parasite Bonamia ostreae. Here, new generation genomic resources were used to analyse the repetitive fraction of the oyster genome, with the aim of developing molecular markers to face this main oyster production challenge. The resulting oyster database, consists of two sets of 10,318 and 7159 unique contigs (4.8 Mbp and 6.8 Mbp in total length) representing the oyster's genome (WG) and haemocyte transcriptome (HT), respectively. A total of 1083 sequences were identified as TE-derived, which corresponded to 4.0% of WG and 1.1% of HT. They were clustered into 142 homology groups, most of which were assigned to the Penelope order of retrotransposons, and to the Helitron and TIR DNA-transposons. Simple repeats and rRNA pseudogenes, also made a significant contribution to the oyster's genome (0.5% and 0.3% of WG and HT, respectively).The most frequent short tandem repeats identified in WG were tetranucleotide motifs while trinucleotide motifs were in HT. Forty identified microsatellite loci, 20 from each database, were selected for technical validation. Success was much lower among WG than HT microsatellites (15% vs 55%), which could reflect higher variation in anonymous regions interfering with primer annealing. All microsatellites developed adjusted to Hardy-Weinberg proportions and represent a useful tool to support future breeding programmes and to manage genetic resources of natural flat oyster beds.

  8. REACTIVATION POTENTIAL OF EPIGENETICALLY INACTIVE MU TRANSPOSABLE ELEMENTS OF ZEA MAYS L. DECREASES IN SUCCESSIVE GENERATIONS. (R824900)

    Science.gov (United States)

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  9. De novo origin of VCY2 from autosome to Y-transposed amplicon.

    Directory of Open Access Journals (Sweden)

    Peng-Rong Cao

    Full Text Available The formation of new genes is a primary driving force of evolution in all organisms. The de novo evolution of new genes from non-protein-coding genomic regions is emerging as an important additional mechanism for novel gene creation. Y chromosomes underlie sex determination in mammals and contain genes that are required for male-specific functions. In this study, a search was undertaken for Y chromosome de novo genes derived from non-protein-coding sequences. The Y chromosome orphan gene variable charge, Y-linked (VCY2, is an autosome-derived gene that has sequence similarity to large autosomal fragments but lacks an autosomal protein-coding homolog. VCY2 locates in the amplicon containing long DNA fragments that were transposed from autosomes to the Y chromosome before the ape-monkey split. We confirmed that VCY2 cannot be encoded by autosomes due to the presence of multiple disablers that disrupt the open reading frame, such as the absence of start or stop codons and the presence of premature stop codons. Similar observations have been made for homologs in the autosomes of the chimpanzee, gorilla, rhesus macaque, baboon and out-group marmoset, which suggests that there was a non-protein-coding ancestral VCY2 that was common to apes and monkeys that predated the transposition event. Furthermore, while protein-coding orthologs are absent, a putative non-protein-coding VCY2 with conserved disablers was identified in the rhesus macaque Y chromosome male-specific region. This finding implies that VCY2 might have not acquired its protein-coding ability before the ape-monkey split. VCY2 encodes a testis-specific expressed protein and is involved in the pathologic process of male infertility, and the acquisition of this gene might improve male fertility. This is the first evidence that de novo genes can be generated from transposed autosomal non-protein-coding segments, and this evidence provides novel insights into the evolutionary history of the Y

  10. De novo origin of VCY2 from autosome to Y-transposed amplicon.

    Science.gov (United States)

    Cao, Peng-Rong; Wang, Lei; Jiang, Yu-Chao; Yi, Yin-Sha; Qu, Fang; Liu, Tao-Cheng; Lv, Yuan

    2015-01-01

    The formation of new genes is a primary driving force of evolution in all organisms. The de novo evolution of new genes from non-protein-coding genomic regions is emerging as an important additional mechanism for novel gene creation. Y chromosomes underlie sex determination in mammals and contain genes that are required for male-specific functions. In this study, a search was undertaken for Y chromosome de novo genes derived from non-protein-coding sequences. The Y chromosome orphan gene variable charge, Y-linked (VCY)2, is an autosome-derived gene that has sequence similarity to large autosomal fragments but lacks an autosomal protein-coding homolog. VCY2 locates in the amplicon containing long DNA fragments that were transposed from autosomes to the Y chromosome before the ape-monkey split. We confirmed that VCY2 cannot be encoded by autosomes due to the presence of multiple disablers that disrupt the open reading frame, such as the absence of start or stop codons and the presence of premature stop codons. Similar observations have been made for homologs in the autosomes of the chimpanzee, gorilla, rhesus macaque, baboon and out-group marmoset, which suggests that there was a non-protein-coding ancestral VCY2 that was common to apes and monkeys that predated the transposition event. Furthermore, while protein-coding orthologs are absent, a putative non-protein-coding VCY2 with conserved disablers was identified in the rhesus macaque Y chromosome male-specific region. This finding implies that VCY2 might have not acquired its protein-coding ability before the ape-monkey split. VCY2 encodes a testis-specific expressed protein and is involved in the pathologic process of male infertility, and the acquisition of this gene might improve male fertility. This is the first evidence that de novo genes can be generated from transposed autosomal non-protein-coding segments, and this evidence provides novel insights into the evolutionary history of the Y chromosome. PMID

  11. Structure and genomic organization of I elements involved in I-R hybrid dysgenesis in Drosophila melanogaster.

    Science.gov (United States)

    Crozatier, M; Vaury, C; Busseau, I; Pelisson, A; Bucheton, A

    1988-10-11

    I-R hybrid dysgenesis in D. melanogaster is controlled by transposable elements known as I factors which terminate at their 3' ends by an A-rich sequence. Inducer strains contain active I factors. Both reactive and inducer stocks possess defective I elements. We have cloned various I elements from both categories of strains. The I elements having recently transposed in inducer strains have a structure closely related to that of active I factors. However we have isolated one such I element that is truncated at its 5' end. The I elements common to reactive and inducer strains are affected by various rearrangements and many point mutations. They do not appear to be simple derivatives of complete I factors.

  12. Genomic sequence and activity of KS10, a transposable phage of the Burkholderia cepacia complex

    Directory of Open Access Journals (Sweden)

    Shrivastava Savita

    2008-12-01

    Full Text Available Abstract Background The Burkholderia cepacia complex (BCC is a versatile group of Gram negative organisms that can be found throughout the environment in sources such as soil, water, and plants. While BCC bacteria can be involved in beneficial interactions with plants, they are also considered opportunistic pathogens, specifically in patients with cystic fibrosis and chronic granulomatous disease. These organisms also exhibit resistance to many antibiotics, making conventional treatment often unsuccessful. KS10 was isolated as a prophage of B. cenocepacia K56-2, a clinically relevant strain of the BCC. Our objective was to sequence the genome of this phage and also determine if this prophage encoded any virulence determinants. Results KS10 is a 37,635 base pairs (bp transposable phage of the opportunistic pathogen Burkholderia cenocepacia. Genome sequence analysis and annotation of this phage reveals that KS10 shows the closest sequence homology to Mu and BcepMu. KS10 was found to be a prophage in three different strains of B. cenocepacia, including strains K56-2, J2315, and C5424, and seven tested clinical isolates of B. cenocepacia, but no other BCC species. A survey of 23 strains and 20 clinical isolates of the BCC revealed that KS10 is able to form plaques on lawns of B. ambifaria LMG 19467, B. cenocepacia PC184, and B. stabilis LMG 18870. Conclusion KS10 is a novel phage with a genomic organization that differs from most phages in that its capsid genes are not aligned into one module but rather separated by approximately 11 kb, giving evidence of one or more prior genetic rearrangements. There were no potential virulence factors identified in KS10, though many hypothetical proteins were identified with no known function.

  13. Molecular and Functional Analysis of the Mariner Mutator Element Mos1 in Drosophila

    OpenAIRE

    Medhora, M.; Maruyama, K; Hartl, D L

    1991-01-01

    The white-peach allele in Drosophila results from insertion of the transposable element mariner. The particular copy that is inserted in white-peach is an inactive copy referred to as the peach element. The peach element is excised at a high rate in the presence of active copies of mariner located elsewhere in the genome, and the excision of peach in somatic cells is recognized phenotypically by the occurrence of eye-color mosaicism in white-peach flies. Active mariner elements identified by ...

  14. General survey of hAT transposon superfamily with highlight on hobo element in Drosophila.

    Science.gov (United States)

    Ladevèze, Véronique; Chaminade, Nicole; Lemeunier, Françoise; Periquet, Georges; Aulard, Sylvie

    2012-09-01

    The hAT transposons, very abundant in all kingdoms, have a common evolutionary origin probably predating the plant-fungi-animal divergence. In this paper we present their general characteristics. Members of this superfamily belong to Class II transposable elements. hAT elements share transposase, short terminal inverted repeats and eight base-pairs duplication of genomic target. We focus on hAT elements in Drosophila, especially hobo. Its distribution, dynamics and impact on genome restructuring in laboratory strains as well as in natural populations are reported. Finally, the evolutionary history of hAT elements, their domestication and use as transgenic tools are discussed.

  15. The mobile genetic element Alu in the human genome

    Energy Technology Data Exchange (ETDEWEB)

    Novick, G.E. [Florida International Univ., Miami, FL (United States); Batzer, M.A.; Deininger, P.L. [Louisiana State Univ. Medical Center, New Orleans, LA (United States)] [and others

    1996-01-01

    Genetic material has been traditionally envisioned as relatively static with the exception of occasional, often deleterious mutations. The sequence DNA-to-RNA-to-protein represented for many years the central dogma relating gene structure and function. Recently, the field of molecular genetics has provided revolutionary information on the dynamic role of repetitive elements in the function of the genetic material and the evolution of humans and other organisms. Alu sequences represent the largest family of short interspersed repetitive elements (SINEs) in humans, being present in an excess of 500,000 copies per haploid genome. Alu elements, as well as the other repetitive elements, were once considered to be useless. Today, the biology of Alu transposable elements is being widely examined in order to determine the molecular basis of a growing number of identified diseases and to provide new directions in genome mapping and biomedical research. 66 refs., 5 figs.

  16. Genomic Organization of the Drosophila Telomere RetrotransposableElements

    Energy Technology Data Exchange (ETDEWEB)

    George, J.A.; DeBaryshe, P.G.; Traverse, K.L.; Celniker, S. E.; Pardue, M-L.

    2006-10-16

    The emerging sequence of the heterochromatic portion of the Drosophila melanogaster genome, with the most recent update of euchromatic sequence, gives the first genome-wide view of the chromosomal distribution of the telomeric retrotransposons, HeT-A, TART, and Tahre. As expected, these elements are entirely excluded from euchromatin, although sequence fragments of HeT-A and TART 3 untranslated regions are found in nontelomeric heterochromatin on the Y chromosome. The proximal ends of HeT-A/TART arrays appear to be a transition zone because only here do other transposable elements mix in the array. The sharp distinction between the distribution of telomeric elements and that of other transposable elements suggests that chromatin structure is important in telomere element localization. Measurements reported here show (1) D. melanogaster telomeres are very long, in the size range reported for inbred mouse strains (averaging 46 kb per chromosome end in Drosophila stock 2057). As in organisms with telomerase, their length varies depending on genotype. There is also slight under-replication in polytene nuclei. (2) Surprisingly, the relationship between the number of HeT-A and TART elements is not stochastic but is strongly correlated across stocks, supporting the idea that the two elements are interdependent. Although currently assembled portions of the HeT-A/TART arrays are from the most-proximal part of long arrays, {approx}61% of the total HeT-A sequence in these regions consists of intact, potentially active elements with little evidence of sequence decay, making it likely that the content of the telomere arrays turns over more extensively than has been thought.

  17. Transuranium elements

    International Nuclear Information System (INIS)

    In this paper, the authors introduce this volume of historical and research papers on the transuranium elements by reviewing the period of discovery of elements 93 and beyond. Then the authors highlight the research achievements that focus on the unique properties of the 5f elements. Finally, the authors outline the technology and applications of transuranium elements and their radiobiology

  18. A SINE in the genome of the cephalochordate amphioxus is an Alu element

    Directory of Open Access Journals (Sweden)

    2006-04-01

    Full Text Available Transposable elements of about 300 bp, termed “short interspersed nucleotide elements or SINEs are common in eukaryotes. However, Alu elements, SINEs containing restriction sites for the AluI enzyme, have been known only from primates. Here I report the first SINE found in the genome of the cephalochordate, amphioxus. It is an Alu element of 375 bp that does not share substantial identity with any genomic sequences in vertebrates. It was identified because it was located in the FoxD regulatory region in a cosmid derived from one individual, but absent from the two FoxD alleles of BACs from a second individual. However, searches of sequences of BACs and genomic traces from this second individual gave an estimate of 50-100 copies in the amphioxus genome. The finding of an Alu element in amphioxus raises the question of whether Alu elements in amphioxus and primates arose by convergent evolution or by inheritance from a common ancestor. Genome-wide analyses of transposable elements in amphioxus and other chordates such as tunicates, agnathans and cartilaginous fishes could well provide the answer.

  19. Transposing reform pedagogy into new contexts: complex instruction in remote Australia

    Science.gov (United States)

    Sullivan, Peter; Jorgensen, Robyn; Boaler, Jo; Lerman, Steve

    2013-03-01

    This article draws on the outcomes of a 4-year project where complex instruction was used as the basis for a reform in mathematics teaching in remote Aboriginal communities in Australia. The article describes the overall project in terms of the goals and aspirations for learning mathematics among remote Indigenous Australians. Knowing that the approach had been successful in a diverse setting in California, the project team sought to implement and evaluate the possibilities of such reform in a context in which the need for a culturally responsive pedagogy was critical. Elements of complex instruction offered considerable possibilities in aligning with the cultures of the remote communities, but with recognition of the possibility that some elements may not be workable in these contexts. Complex instruction also valued deep knowledge of mathematics rather than a tokenistic, impoverished mathematics. The strategies within complex instruction allowed for mathematical and cultural scaffolding to promote deep learning in mathematics. Such an approach was in line with current reforms in Indigenous education in Australia where there are high expectations of learners in order to break away from the deficit thinking that has permeated much education in remote Australia. The overall intent is to demonstrate what pedagogies are possible within the constraints of the remote context.

  20. An element

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, K.; Iidzima, K.

    1983-03-30

    An anode of a light metal is used in the element, along with an electrolyte which consists of an ether solvent and an ionogenic additive in the form of a salt of dithiocarbamic acid. The element has good discharge characteristics.

  1. Functional Anatomy of Recognition of Chinese Multi-Character Words: Convergent Evidence from Effects of Transposable Nonwords, Lexicality, and Word Frequency.

    Directory of Open Access Journals (Sweden)

    Nan Lin

    Full Text Available This fMRI study aimed to identify the neural mechanisms underlying the recognition of Chinese multi-character words by partialling out the confounding effect of reaction time (RT. For this purpose, a special type of nonword-transposable nonword-was created by reversing the character orders of real words. These nonwords were included in a lexical decision task along with regular (non-transposable nonwords and real words. Through conjunction analysis on the contrasts of transposable nonwords versus regular nonwords and words versus regular nonwords, the confounding effect of RT was eliminated, and the regions involved in word recognition were reliably identified. The word-frequency effect was also examined in emerged regions to further assess their functional roles in word processing. Results showed significant conjunctional effect and positive word-frequency effect in the bilateral inferior parietal lobules and posterior cingulate cortex, whereas only conjunctional effect was found in the anterior cingulate cortex. The roles of these brain regions in recognition of Chinese multi-character words were discussed.

  2. Functional Anatomy of Recognition of Chinese Multi-Character Words: Convergent Evidence from Effects of Transposable Nonwords, Lexicality, and Word Frequency.

    Science.gov (United States)

    Lin, Nan; Yu, Xi; Zhao, Ying; Zhang, Mingxia

    2016-01-01

    This fMRI study aimed to identify the neural mechanisms underlying the recognition of Chinese multi-character words by partialling out the confounding effect of reaction time (RT). For this purpose, a special type of nonword-transposable nonword-was created by reversing the character orders of real words. These nonwords were included in a lexical decision task along with regular (non-transposable) nonwords and real words. Through conjunction analysis on the contrasts of transposable nonwords versus regular nonwords and words versus regular nonwords, the confounding effect of RT was eliminated, and the regions involved in word recognition were reliably identified. The word-frequency effect was also examined in emerged regions to further assess their functional roles in word processing. Results showed significant conjunctional effect and positive word-frequency effect in the bilateral inferior parietal lobules and posterior cingulate cortex, whereas only conjunctional effect was found in the anterior cingulate cortex. The roles of these brain regions in recognition of Chinese multi-character words were discussed. PMID:26901644

  3. Expression of Pseudomonas aeruginosa transposable phages in Pseudomonas putida cells. I. Establishment of lysogeny and lytic growth efficiency

    International Nuclear Information System (INIS)

    Expression of the genomes of Pseudomonas aeruginosa transposable phages (TP) in the cells of a heterologous host, P. putida PpGl, was studied. A high efficiency of TP lytic growth in PpGl cells was obtained both after zygotic induction following RP4::TP plasmid transfer and after thermoinduction of PpGl cells lysogenic for thermoinducible prophage D3112cts15. Characteristic for PpGl cells was a high TP yield (20-25 phage D3112cts15 particles per cell), which was evidence of a high level of TP transposition in cells of this species. The frequency of RP4::TP transfer into PpGl and PA01 cells was equal, but the lysogeny detection rat was somewhat lower in PpGl. Pseudomonas aeruginosa TP can integrate into the PpGl chromosome, producing inducible lysogens. The presence of RP4 is not necessary for the expression of the TP genome in PpGl cells. The D3112cts15 TP may be used for interspecific transduction of plasmids and chromosomal markers

  4. Transuranium elements

    International Nuclear Information System (INIS)

    This paper reports that neutron irradiation of uranium, beginning in 1934, led to the reported discovery of such transuranium elements as eka-rhenium. After a few years of investigation these were correctly identified, in December 1938, as fission products. The first real transuranium elements, with atomic numbers 93 and 94 (neptumiun and plutionium), were discovered in 1940-1941. Plutomiun-239 was shown to be fission-able with slow neutrons, and chemical methods for its separation in quantity were developed. Not until it was recognized that transuranium elements should be part of a 14-member actinide series could elements 95 and 96 (americium and curium) be chemically identified after their nuclear synthesis. This new view was the key to the synthesis and identified after their nuclear synthesis. This new view was the key to the synthesis and identification of the next seven transuranium elements, resulting in the completion of the actinide series at element 103 in 1961. The transactinide elements could, according to the actinide concept, also be correctly placed in the periodic table, and the chemical properties of the first transactinide elements, elements 104 and 105 (rutherfordium and hafnium), confirm this point of view. Transuranium elements through number 109 are now known

  5. Repetitive elements dynamics in cell identity programming, maintenance and disease

    KAUST Repository

    Bodega, Beatrice

    2014-12-01

    The days of \\'junk DNA\\' seem to be over. The rapid progress of genomics technologies has been unveiling unexpected mechanisms by which repetitive DNA and in particular transposable elements (TEs) have evolved, becoming key issues in understanding genome structure and function. Indeed, rather than \\'parasites\\', recent findings strongly suggest that TEs may have a positive function by contributing to tissue specific transcriptional programs, in particular as enhancer-like elements and/or modules for regulation of higher order chromatin structure. Further, it appears that during development and aging genomes experience several waves of TEs activation, and this contributes to individual genome shaping during lifetime. Interestingly, TEs activity is major target of epigenomic regulation. These findings are shedding new light on the genome-phenotype relationship and set the premises to help to explain complex disease manifestation, as consequence of TEs activity deregulation.

  6. Chompy: an infestation of MITE-like repetitive elements in the crocodilian genome.

    Science.gov (United States)

    Ray, David A; Hedges, Dale J; Herke, Scott W; Fowlkes, Justin D; Barnes, Erin W; LaVie, Daniel K; Goodwin, Lindsey M; Densmore, Llewellyn D; Batzer, Mark A

    2005-12-01

    Interspersed repeats are a major component of most eukaryotic genomes and have an impact on genome size and stability, but the repetitive element landscape of crocodilian genomes has not yet been fully investigated. In this report, we provide the first detailed characterization of an interspersed repeat element in any crocodilian genome. Chompy is a putative miniature inverted-repeat transposable element (MITE) family initially recovered from the genome of Alligator mississippiensis (American alligator) but also present in the genomes of Crocodylus moreletii (Morelet's crocodile) and Gavialis gangeticus (Indian gharial). The element has all of the hallmarks of MITEs including terminal inverted repeats, possible target site duplications, and a tendency to form secondary structures. We estimate the copy number in the alligator genome to be approximately 46,000 copies. As a result of their size and unique properties, Chompy elements may provide a useful source of genomic variation for crocodilian comparative genomics. PMID:16183215

  7. Summary compilation of shell element performance versus formulation.

    Energy Technology Data Exchange (ETDEWEB)

    Heinstein, Martin Wilhelm; Hales, Jason Dean (Idaho National Laboratory, Idaho Falls, ID); Breivik, Nicole L.; Key, Samuel W. (FMA Development, LLC, Great Falls, MT)

    2011-07-01

    This document compares the finite element shell formulations in the Sierra Solid Mechanics code. These are finite elements either currently in the Sierra simulation codes Presto and Adagio, or expected to be added to them in time. The list of elements are divided into traditional two-dimensional, plane stress shell finite elements, and three-dimensional solid finite elements that contain either modifications or additional terms designed to represent the bending stiffness expected to be found in shell formulations. These particular finite elements are formulated for finite deformation and inelastic material response, and, as such, are not based on some of the elegant formulations that can be found in an elastic, infinitesimal finite element setting. Each shell element is subjected to a series of 12 verification and validation test problems. The underlying purpose of the tests here is to identify the quality of both the spatially discrete finite element gradient operator and the spatially discrete finite element divergence operator. If the derivation of the finite element is proper, the discrete divergence operator is the transpose of the discrete gradient operator. An overall summary is provided from which one can rank, at least in an average sense, how well the individual formulations can be expected to perform in applications encountered year in and year out. A letter grade has been assigned albeit sometimes subjectively for each shell element and each test problem result. The number of A's, B's, C's, et cetera assigned have been totaled, and a grade point average (GPA) has been computed, based on a 4.0-system. These grades, combined with a comparison between the test problems and the application problem, can be used to guide an analyst to select the element with the best shell formulation.

  8. Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence

    Energy Technology Data Exchange (ETDEWEB)

    Manning, Viola A.; Pandelova, Iovanna; Dhillon, Braham; Wilhelm, Larry J.; Goodwin, Stephen B.; Berlin, Aaron M.; Figueroa, Melania; Freitag, Michael; Hane, James K.; Henrissat, Bernard; Holman, Wade H.; Kodira, Chinnappa D.; Martin, Joel; Oliver, Richard P.; Robbertse, Barbara; Schackwitz, Wendy; Schwartz, David C.; Spatafora, Joseph W.; Turgeon, B. Gillian; Yandava, Chandri; Young, Sarah; Zhou, Shiguo; Zeng, Qiandong; Grigoriev, Igor V.; Ma, Li-Jun; Ciuffetti, Lynda M.

    2012-08-16

    Pyrenophora tritici-repentis is a necrotrophic fungus causal to the disease tan spot of wheat, whose contribution to crop loss has increased significantly during the last few decades. Pathogenicity by this fungus is attributed to the production of host-selective toxins (HST), which are recognized by their host in a genotype-specific manner. To better understand the mechanisms that have led to the increase in disease incidence related to this pathogen, we sequenced the genomes of three P. tritici-repentis isolates. A pathogenic isolate that produces two known HSTs was used to assemble a reference nuclear genome of approximately 40 Mb composed of 11 chromosomes that encode 12,141 predicted genes. Comparison of the reference genome with those of a pathogenic isolate that produces a third HST, and a nonpathogenic isolate, showed the nonpathogen genome to be more diverged than those of the two pathogens. Examination of gene-coding regions has provided candidate pathogen-specific proteins and revealed gene families that may play a role in a necrotrophic lifestyle. Analysis of transposable elements suggests that their presence in the genome of pathogenic isolates contributes to the creation of novel genes, effector diversification, possible horizontal gene transfer events, identified copy number variation, and the first example of transduplication by DNA transposable elements in fungi. Overall, comparative analysis of these genomes provides evidence that pathogenicity in this species arose through an influx of transposable elements, which created a genetically flexible landscape that can easily respond to environmental changes.

  9. The Ecological Genomics of Fungi: Repeated Elements in Filamentous Fungi with a Focus on Wood-Decay Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Murat, Claude [INRA, Nancy, France; Payen, Thibaut [INRA, Nancy, France; Petitpierre, Denis [INRA, Nancy, France; Labbe, Jessy L [ORNL

    2013-01-01

    In the last decade, the genome of several dozen filamentous fungi have been sequenced. Interestingly, vast diversity in genome size was observed (Fig. 2.1) with 14-fold differences between the 9 Mb of the human pathogenic dandruff fungus (Malassezia globosa; Xu, Saunders, et al., 2007) and the 125 Mb of the ectomycorrhizal black truffle of P rigord (Tuber melanosporum; Martin, Kohler, et al., 2010). Recently, Raffaele and Kamoun (2012) highlighted that the genomes of several lineages of filamentous plant pathogens have been shaped by repeat-driven expansion. Indeed, repeated elements are ubiquitous in all prokaryote and eukaryote genomes; however, their frequencies can vary from just a minor percentage of the genome to more that 60 percent of the genome. Repeated elements can be classified in two major types: satellites DNA and transposable elements. In this chapter, the different types of repeated elements and how these elements can impact genome and gene repertoire will be described. Also, an intriguing link between the transposable elements richness and diversity and the ecological niche will be highlighted.

  10. PELTIER ELEMENTS

    CERN Document Server

    Tani, Laurits

    2015-01-01

    To control Peltier elements, temperature controller was used. I used TEC-1091 that was manufactured my Meerstetter Engineering. To gain control with the temperature controller, software had to be intalled on a controlling PC. There were different modes to control the Peltier: Tempererature controller to control temperature, Static current/voltage to control voltage and current and LIVE ON/OFF to auto-tune the controller respectively to the system. Also, since near the collision pipe there is much radiation, radiation-proof Peltier elements have to be used. To gain the best results, I had to find the most efficient Peltier elements and try to get their cold side to -40 degrees Celsius.

  11. Radiographic element

    International Nuclear Information System (INIS)

    Radiographic elements are disclosed having first and second silver halide emulsion layers comprised of a dispersing medium and radiation-sensitive silver halide grains, and a support interposed between said silver halide emulsion layers capable of transmitting radiation to which said second silver halide emulsion layer is responsive. These elements are characterized in that at least said first silver halide emulsion layer contains tabular silver halide grains and spectral sensitizing dye adsorbed to the surface of the grains. Crossover can be improved in relation to the imaging characteristics. (author)

  12. P elements and MITE relatives in the whole genome sequence of Anopheles gambiae

    Directory of Open Access Journals (Sweden)

    Nouaud Danielle

    2006-08-01

    Full Text Available Abstract Background Miniature Inverted-repeat Terminal Elements (MITEs, which are particular class-II transposable elements (TEs, play an important role in genome evolution, because they have very high copy numbers and display recurrent bursts of transposition. The 5' and 3' subterminal regions of a given MITE family often show a high sequence similarity with the corresponding regions of an autonomous Class-II TE family. However, the sustained presence over a prolonged evolutionary time of MITEs and TE master copies able to promote their mobility has been rarely reported within the same genome, and this raises fascinating evolutionary questions. Results We report here the presence of P transposable elements with related MITE families in the Anopheles gambiae genome. Using a TE annotation pipeline we have identified and analyzed all the P sequences in the sequenced A. gambiae PEST strain genome. More than 0.49% of the genome consists of P elements and derivates. P elements can be divided into 9 different subfamilies, separated by more than 30% of nucleotide divergence. Seven of them present full length copies. Ten MITE families are associated with 6 out of the 9 Psubfamilies. Comparing their intra-element nucleotide diversities and their structures allows us to propose the putative dynamics of their emergence. In particular, one MITE family which has a hybrid structure, with ends each of which is related to a different P-subfamily, suggests a new mechanism for their emergence and their mobility. Conclusion This work contributes to a greater understanding of the relationship between full-length class-II TEs and MITEs, in this case P elements and their derivatives in the genome of A. gambiae. Moreover, it provides the most comprehensive catalogue to date of P-like transposons in this genome and provides convincing yet indirect evidence that some of the subfamilies have been recently active.

  13. S elements: A family of Tc1-like transposons in the genome of Drosophila melanogaster

    Energy Technology Data Exchange (ETDEWEB)

    Merriman, P.J.; Grimes, C.D.; Ambroziak, J. [Univ. of Minnesota, St. Paul, MN (United States)] [and others

    1995-12-01

    The S elements form a diverse family of long-inverted-repeat transposons within the genome of Drosophila melanogaster. These elements very in size and sequence, the longest consisting of 1736 bp with 234-bp inverted terminal repeats. The longest open reading frame in an intact S element could encode a 345-amino acid polypeptide. This polypeptide is homologous to the transposases of the mariner-Tc1 superfamily of transposable elements. S elements are ubiquitous in D. melanogaster populations and also appear to be present in the genomes of two sibling species; however, they seem to be absent from 17 other Drosophila species that were examined. Within D. melanogaster strains, there are, on average, 37.4 cytologically detectable S elements per diploid genome. These elements are scattered throughout the chromosomes, but several sites in both the euchromatin and {beta} heterochromatin are consistently occupied. The discovery of an S-element-insertion mutation and a reversion of this mutation indicates that S elements are at least occasionally mobile in the D. melanogaster genome. These elements seem to insert at an AT dinucleotide within a short palindrome and apparently duplicate that dinucleotide upon insertion. 44 refs., 9 figs., 4 tabs.

  14. Radiographic element

    International Nuclear Information System (INIS)

    Radiographic elements are disclosed comprised of first and second silver halide emulsion layers separated by an interposed support capable of transmitting radiation to which the second image portion is responsive. At least the first imaging portion contains a silver halide emulsion in which thin tubular silver halide grains of intermediate aspect ratios (from 5:1 to 8:1) are present. Spectral sensitizing dye is adsorbed to the surface of the tubular grains. Increased photographic speeds can be realized at comparable levels of crossover. (author)

  15. MaRGEE: Move and Rotate Google Earth Elements

    Science.gov (United States)

    Dordevic, Mladen M.; Whitmeyer, Steven J.

    2015-12-01

    Google Earth is recognized as a highly effective visualization tool for geospatial information. However, there remain serious limitations that have hindered its acceptance as a tool for research and education in the geosciences. One significant limitation is the inability to translate or rotate geometrical elements on the Google Earth virtual globe. Here we present a new JavaScript web application to "Move and Rotate Google Earth Elements" (MaRGEE). MaRGEE includes tools to simplify, translate, and rotate elements, add intermediate steps to a transposition, and batch process multiple transpositions. The transposition algorithm uses spherical geometry calculations, such as the haversine formula, to accurately reposition groups of points, paths, and polygons on the Google Earth globe without distortion. Due to the imminent deprecation of the Google Earth API and browser plugin, MaRGEE uses a Google Maps interface to facilitate and illustrate the transpositions. However, the inherent spatial distortions that result from the Google Maps Web Mercator projection are not apparent once the transposed elements are saved as a KML file and opened in Google Earth. Potential applications of the MaRGEE toolkit include tectonic reconstructions, the movements of glaciers or thrust sheets, and time-based animations of other large- and small-scale geologic processes.

  16. Superheavy elements

    CERN Document Server

    Hofmann, S

    1999-01-01

    The outstanding aim of experimental investigations of heavy nuclei is the exploration of spherical 'SuperHeavy Elements' (SHEs). On the basis of the nuclear shell model, the next double magic shell-closure beyond sup 2 sup 0 sup 8 Pb is predicted at proton numbers between Z=114 and 126 and at neutron number N=184. All experimental efforts aiming at identifying SHEs (Z>=114) were negative so far. A highly sensitive search experiment was performed in November-December 1995 at SHIP. The isotope sup 2 sup 9 sup 0 116 produced by 'radiative capture' was searched for in the course of a 33 days irradiation of a sup 2 sup 0 sup 8 Pb target with sup 8 sup 2 Se projectiles, however, only cross-section limits were measured. Positive results were obtained in experiments searching for elements from 110 to 112 using cold fusion and the 1n evaporation channel. The produced isotopes were unambiguously identified by means of alpha-alpha correlations. Not fission, but alpha emission is the dominant decay mode. The measurement ...

  17. Profile of the mosaic element BTMR1 in the genome of the bumble bee Bombus terrestris (Hymenoptera: Apidae).

    Science.gov (United States)

    Casteret, S; Moiré, N; Aupinel, P; Tasei, J-N; Bigot, Y

    2011-04-01

    Co-evolution involving a mariner transposon, Botmar1 and the other repeats contained in the Bombus terrestris genome was investigated. We found that the 5'-region of Botmar1 forms one of the components of a mosaic element, known as B. terrestris mosaic repeat 1 (BTMR1), which is also composed of inner segments originating from two different retrotransposons and a pseudogene corresponding to an RNA methyltransferase cDNA. The fact that BTMR1 is interspersed within chromosomes and the differences in its abundance in different species indicate that it is very probably a mobile element. Nevertheless, the absences of direct or inverted repeats at its ends and of target site duplication indicate that its mobility is not ensured by a cardinal transposable element, but putatively by a Crypton-like element.

  18. MAR elements and transposons for improved transgene integration and expression.

    Directory of Open Access Journals (Sweden)

    Déborah Ley

    Full Text Available Reliable and long-term expression of transgenes remain significant challenges for gene therapy and biotechnology applications, especially when antibiotic selection procedures are not applicable. In this context, transposons represent attractive gene transfer vectors because of their ability to promote efficient genomic integration in a variety of mammalian cell types. However, expression from genome-integrating vectors may be inhibited by variable gene transcription and/or silencing events. In this study, we assessed whether inclusion of two epigenetic control elements, the human Matrix Attachment Region (MAR 1-68 and X-29, in a piggyBac transposon vector, may lead to more reliable and efficient expression in CHO cells. We found that addition of the MAR 1-68 at the center of the transposon did not interfere with transposition frequency, and transgene expressing cells could be readily detected from the total cell population without antibiotic selection. Inclusion of the MAR led to higher transgene expression per integrated copy, and reliable expression could be obtained from as few as 2-4 genomic copies of the MAR-containing transposon vector. The MAR X-29-containing transposons was found to mediate elevated expression of therapeutic proteins in polyclonal or monoclonal CHO cell populations using a transposable vector devoid of selection gene. Overall, we conclude that MAR and transposable vectors can be used to improve transgene expression from few genomic transposition events, which may be useful when expression from a low number of integrated transgene copies must be obtained and/or when antibiotic selection cannot be applied.

  19. Characterization of irritans mariner-like elements in the olive fruit fly Bactrocera oleae (Diptera: Tephritidae): evolutionary implications

    Science.gov (United States)

    Ben Lazhar-Ajroud, Wafa; Caruso, Aurore; Mezghani, Maha; Bouallegue, Maryem; Tastard, Emmanuelle; Denis, Françoise; Rouault, Jacques-Deric; Makni, Hanem; Capy, Pierre; Chénais, Benoît; Makni, Mohamed; Casse, Nathalie

    2016-08-01

    Genomic variation among species is commonly driven by transposable element (TE) invasion; thus, the pattern of TEs in a genome allows drawing an evolutionary history of the studied species. This paper reports in vitro and in silico detection and characterization of irritans mariner-like elements (MLEs) in the genome and transcriptome of Bactrocera oleae (Rossi) (Diptera: Tephritidae). Eleven irritans MLE sequences have been isolated in vitro using terminal inverted repeats (TIRs) as primers, and 215 have been extracted in silico from the sequenced genome of B. oleae. Additionally, the sequenced genomes of Bactrocera tryoni (Froggatt) and Bactrocera cucurbitae (Diptera: Tephritidae) have been explored to identify irritans MLEs. A total of 129 sequences from B. tryoni have been extracted, while the genome of B. cucurbitae appears probably devoid of irritans MLEs. All detected irritans MLEs are defective due to several mutations and are clustered together in a monophyletic group suggesting a common ancestor. The evolutionary history and dynamics of these TEs are discussed in relation with the phylogenetic distribution of their hosts. The knowledge on the structure, distribution, dynamic, and evolution of irritans MLEs in Bactrocera species contributes to the understanding of both their evolutionary history and the invasion history of their hosts. This could also be the basis for genetic control strategies using transposable elements.

  20. Characterization of irritans mariner-like elements in the olive fruit fly Bactrocera oleae (Diptera: Tephritidae): evolutionary implications.

    Science.gov (United States)

    Ben Lazhar-Ajroud, Wafa; Caruso, Aurore; Mezghani, Maha; Bouallegue, Maryem; Tastard, Emmanuelle; Denis, Françoise; Rouault, Jacques-Deric; Makni, Hanem; Capy, Pierre; Chénais, Benoît; Makni, Mohamed; Casse, Nathalie

    2016-08-01

    Genomic variation among species is commonly driven by transposable element (TE) invasion; thus, the pattern of TEs in a genome allows drawing an evolutionary history of the studied species. This paper reports in vitro and in silico detection and characterization of irritans mariner-like elements (MLEs) in the genome and transcriptome of Bactrocera oleae (Rossi) (Diptera: Tephritidae). Eleven irritans MLE sequences have been isolated in vitro using terminal inverted repeats (TIRs) as primers, and 215 have been extracted in silico from the sequenced genome of B. oleae. Additionally, the sequenced genomes of Bactrocera tryoni (Froggatt) and Bactrocera cucurbitae (Diptera: Tephritidae) have been explored to identify irritans MLEs. A total of 129 sequences from B. tryoni have been extracted, while the genome of B. cucurbitae appears probably devoid of irritans MLEs. All detected irritans MLEs are defective due to several mutations and are clustered together in a monophyletic group suggesting a common ancestor. The evolutionary history and dynamics of these TEs are discussed in relation with the phylogenetic distribution of their hosts. The knowledge on the structure, distribution, dynamic, and evolution of irritans MLEs in Bactrocera species contributes to the understanding of both their evolutionary history and the invasion history of their hosts. This could also be the basis for genetic control strategies using transposable elements. PMID:27392643

  1. Transposon display supports transpositional activity of elements in species of the saltans group of Drosophila

    Indian Academy of Sciences (India)

    Nathalia De Setta; Ana Paula Pimentel Costa; Fabrício Ramon Lopes; Marie-Anne Van Sluys; Cláudia Márcia Aparecida Carareto

    2007-01-01

    Mobilization of two element subfamilies (canonical and O-type) from Drosophila sturtevanti and D. saltans was evaluated for copy number and transposition activity using the transposon display (TD) technique. Pairwise distances between strains regarding the insertion polymorphism profile were estimated. Amplification of the element based on copy number estimates was highly variable among the strains (D. sturtevanti, canonical 20.11, O-type 9.00; D. saltans, canonical 16.4, O-type 12.60 insertions, on average). The larger values obtained by TD compared to our previous data by Southern blotting support the higher sensitivity of TD over Southern analysis for estimating transposable element copy numbers. The higher numbers of the canonical element and the greater divergence in its distribution within the genome of D. sturtevanti (24.8%) compared to the O-type (16.7%), as well as the greater divergence in the distribution of the canonical P element, between the D. sturtevanti (24.8%) and the D. saltans (18.3%) strains, suggest that the canonical element occupies more sites within the D. sturtevanti genome, most probably due to recent transposition activity. These data corroborate the hypothesis that the O-type is the oldest subfamily of elements in the saltans group and suggest that the canonical element is or has been transpositionally active until more recently in D. sturtevanti.

  2. Finite Element Analysis of Electromagnetic Waves in Two-Dimensional Transformed Bianisotropic Media

    CERN Document Server

    Liu, Yan; Guenneau, Sebastien

    2015-01-01

    We analyse wave propagation in two-dimensional bianisotropic media with the Finite Element Method (FEM). We start from the Maxwell-Tellegen's equations in bianisotropic media, and derive some system of coupled Partial Difference Equations (PDEs) for longitudinal electric and magnetic field components. Perfectly Matched Layers (PMLs) are discussed to model such unbounded media. We implement these PDEs and PMLs in a finite element software. We apply transformation optics in order to design some bianisotropic media with interesting functionalities, such as cloaks, concentrators and rotators. We propose a design of metamaterial with concentric layers made of homogeneous media with isotropic permittivity, permeability and magneto-electric parameters that mimic the required effective anisotropic tensors of a bianisotropic cloak in the long wavelength limit (homogenization approach). Our numerical results show that well-known metamaterials can be transposed to bianisotropic media.

  3. Two loci in the genome of transposable phage B39 of Pseudomonas aeruginosa affecting integration. II. Mapping of the pdeX and pdeY loci by restriction and heteroduplex analyses

    International Nuclear Information System (INIS)

    Two loci termed pdeX and pdeY have previously been identified in the genome of transposable phage B39 of Pseudomonas aeruginosa. Both of these loci must operate concomitantly for the normal expression of the phage. In the present study the pdeX (2.85-6.5 kb) and pdeY (6.4-16 kb) loci have been mapped by means of restriction and heteroduplex analysis of hybrid phages possessing the Pde+ and Pde- phenotypes and obtained from the transposable phage B39ts+ x PH132 cross. The EcoRV-sites in genomes of phages D3112, B39, B39ts+ and PH132 have been mapped and the previously undetermined EcoRI-sites in the phage B39 genome have also been mapped. The Kpn1 site in the phage Ph132 genome has been localized

  4. piRNA pathway targets active LINE1 elements to establish the repressive H3K9me3 mark in germ cells.

    Science.gov (United States)

    Pezic, Dubravka; Manakov, Sergei A; Sachidanandam, Ravi; Aravin, Alexei A

    2014-07-01

    Transposable elements (TEs) occupy a large fraction of metazoan genomes and pose a constant threat to genomic integrity. This threat is particularly critical in germ cells, as changes in the genome that are induced by TEs will be transmitted to the next generation. Small noncoding piwi-interacting RNAs (piRNAs) recognize and silence a diverse set of TEs in germ cells. In mice, piRNA-guided transposon repression correlates with establishment of CpG DNA methylation on their sequences, yet the mechanism and the spectrum of genomic targets of piRNA silencing are unknown. Here we show that in addition to DNA methylation, the piRNA pathway is required to maintain a high level of the repressive H3K9me3 histone modification on long interspersed nuclear elements (LINEs) in germ cells. piRNA-dependent chromatin repression targets exclusively full-length elements of actively transposing LINE families, demonstrating the remarkable ability of the piRNA pathway to recognize active elements among the large number of genomic transposon fragments.

  5. Mutator-Like Elements with Multiple Long Terminal Inverted Repeats in Plants

    Directory of Open Access Journals (Sweden)

    Ann A. Ferguson

    2012-01-01

    Full Text Available Mutator-like transposable elements (MULEs are widespread in plants and the majority have long terminal inverted repeats (TIRs, which distinguish them from other DNA transposons. It is known that the long TIRs of Mutator elements harbor transposase binding sites and promoters for transcription, indicating that the TIR sequence is critical for transposition and for expression of sequences between the TIRs. Here, we report the presence of MULEs with multiple TIRs mostly located in tandem. These elements are detected in the genomes of maize, tomato, rice, and Arabidopsis. Some of these elements are present in multiple copies, suggesting their mobility. For those elements that have amplified, sequence conservation was observed for both of the tandem TIRs. For one MULE family carrying a gene fragment, the elements with tandem TIRs are more prevalent than their counterparts with a single TIR. The successful amplification of this particular MULE demonstrates that MULEs with tandem TIRs are functional in both transposition and duplication of gene sequences.

  6. Variable transposition of eight maize activator (ac) elements located on the short arm of chromosome 1.

    Science.gov (United States)

    Sheridan, William F

    2011-09-01

    Eight Activator (Ac) transposable elements mapped to the maize chromosome arm 1S were assessed for Ac transposition rates. For each of the Ac stocks, plants homozygous for the single Ac element and the Ds reporter r1-sc:m3 on chromosome 10 were crossed as females by a homozygous r1-sc:m3 tester color-converted W22 line. The resulting ears produced mostly coarsely spotted kernels and a low frequency of either near-colorless fine-spotted kernels or nonspotted kernels. The relative frequency of these two types of near-colorless kernels differed among the eight Ac stocks. The extent to which increased Ac dosage results in nonspotted kernels may be Ac-specific. Although all of the Ac elements are in near-isogenic inbred W22 lines, they varied to a large extent in their transposition frequency. These differences might possibly result from structural differences among the Ac elements. Because one pair of Ac elements derived from Ac33 on chromosome arm 5S differed about 13-fold in transposition frequency and a second pair of Ac elements derived from Ac12 on chromosome arm 1S differed about 3-fold in transposition frequency, this is not a likely explanation for all eight Ac elements. The data presented here support the notion that the differences in transposition frequency of the eight Ac elements may be a reflection of variability in Ac transcription or accessibility of the transposase to the Ac element, resulting from differences in the chromatin environments wherein the Ac elements are located. This is the first report of variability in transposition rates among different Ac donor lines.

  7. The Ekamanganese elements

    International Nuclear Information System (INIS)

    A recent study tends to revalidate the search for element 43 done in 1925. In ores with properties similar to the hypothetical chemical properties of the missing elements 43 and 75, the unknown elements were concentrated by chemical means. Roentgen-ray spectroscopy was applied in order to observe the characteristic Roentgen L lines for element 75 and K lines for element 43. Element 43 was observed in sperrylith, gadolinit, fergusonit and columbit. The name masurium was proposed. Similarly, element 75 was observed in tantalit, wolframit and platinit. The name rhenium was chosen. (MCB)

  8. Fuel element design handbook

    Energy Technology Data Exchange (ETDEWEB)

    Merckx, K.R.

    1958-09-01

    The economic development of nuclear reactors depends upon the integrated progress in the fields of reactor design, fuel element design, reactor operation, and fuel production and separation. Broad criteria, which restrict the fuel element design, are determined by the mutual consideration of the problems encountered in all the above fields. Hence, no stage of reactor design or operation is independent of the fuel element problem, nor can the fuel element designer disregard the interest of any one field. As an introduction to the fuel element design problem, this chapter describes how the general criteria for a fuel element are determined.

  9. Losing helena: The extinction of a drosophila line-like element

    Science.gov (United States)

    Rebollo, Rita; Lerat, Emmanuelle; Kleine, Liliana Lopez; Biémont, Christian; Vieira, Cristina

    2008-01-01

    Background Transposable elements (TEs) are major players in evolution. We know that they play an essential role in genome size determination, but we still have an incomplete understanding of the processes involved in their amplification and elimination from genomes and populations. Taking advantage of differences in the amount and distribution of the Long Interspersed Nuclear Element (LINE), helena in Drosophila melanogaster and D. simulans, we analyzed the DNA sequences of copies of this element in samples of various natural populations of these two species. Results In situ hybridization experiments revealed that helena is absent from the chromosome arms of D. melanogaster, while it is present in the chromosome arms of D. simulans, which is an unusual feature for a TE in these species. Molecular analyses showed that the helena sequences detected in D. melanogaster were all deleted copies, which diverged from the canonical element. Natural populations of D. simulans have several copies, a few of them full-length, but most of them internally deleted. Conclusion Overall, our data suggest that a mechanism that induces internal deletions in the helena sequences is active in the D. simulans genome. PMID:18377637

  10. Losing helena: The extinction of a drosophila line-like element

    Directory of Open Access Journals (Sweden)

    Biémont Christian

    2008-03-01

    Full Text Available Abstract Background Transposable elements (TEs are major players in evolution. We know that they play an essential role in genome size determination, but we still have an incomplete understanding of the processes involved in their amplification and elimination from genomes and populations. Taking advantage of differences in the amount and distribution of the Long Interspersed Nuclear Element (LINE, helena in Drosophila melanogaster and D. simulans, we analyzed the DNA sequences of copies of this element in samples of various natural populations of these two species. Results In situ hybridization experiments revealed that helena is absent from the chromosome arms of D. melanogaster, while it is present in the chromosome arms of D. simulans, which is an unusual feature for a TE in these species. Molecular analyses showed that the helena sequences detected in D. melanogaster were all deleted copies, which diverged from the canonical element. Natural populations of D. simulans have several copies, a few of them full-length, but most of them internally deleted. Conclusion Overall, our data suggest that a mechanism that induces internal deletions in the helena sequences is active in the D. simulans genome.

  11. The Gypsy Database (GyDB) of mobile genetic elements: release 2.0.

    Science.gov (United States)

    Llorens, Carlos; Futami, Ricardo; Covelli, Laura; Domínguez-Escribá, Laura; Viu, Jose M; Tamarit, Daniel; Aguilar-Rodríguez, Jose; Vicente-Ripolles, Miguel; Fuster, Gonzalo; Bernet, Guillermo P; Maumus, Florian; Munoz-Pomer, Alfonso; Sempere, Jose M; Latorre, Amparo; Moya, Andres

    2011-01-01

    This article introduces the second release of the Gypsy Database of Mobile Genetic Elements (GyDB 2.0): a research project devoted to the evolutionary dynamics of viruses and transposable elements based on their phylogenetic classification (per lineage and protein domain). The Gypsy Database (GyDB) is a long-term project that is continuously progressing, and that owing to the high molecular diversity of mobile elements requires to be completed in several stages. GyDB 2.0 has been powered with a wiki to allow other researchers participate in the project. The current database stage and scope are long terminal repeats (LTR) retroelements and relatives. GyDB 2.0 is an update based on the analysis of Ty3/Gypsy, Retroviridae, Ty1/Copia and Bel/Pao LTR retroelements and the Caulimoviridae pararetroviruses of plants. Among other features, in terms of the aforementioned topics, this update adds: (i) a variety of descriptions and reviews distributed in multiple web pages; (ii) protein-based phylogenies, where phylogenetic levels are assigned to distinct classified elements; (iii) a collection of multiple alignments, lineage-specific hidden Markov models and consensus sequences, called GyDB collection; (iv) updated RefSeq databases and BLAST and HMM servers to facilitate sequence characterization of new LTR retroelement and caulimovirus queries; and (v) a bibliographic server. GyDB 2.0 is available at http://gydb.org. PMID:21036865

  12. The Mechanisms of Host Restriction on LINE-1 Element%宿主限制长散布元件转座活性的机制

    Institute of Scientific and Technical Information of China (English)

    梁志滨; 梁臣; 耿运琪; 乔文涛

    2013-01-01

    Abstract Approximately 45% of the human genome is occupied by transposable elements.Transposable elements have had an important impact on the structure and function of human genomes.Some of these elements are still capable of transposing,and their movements often cause diseases.Long interspersed nuclear element 1 (LINE-1) is the only active autonomous transposon in humans,and it mediates the mobilization of nonautonomous elements.Recently,great progress has been made in understanding the biology of LINE-1.Here,we briefly review the structure of LINE-1,the mechanism of its mobilization,and its impact on human genome and human health.We also highlight the mechanisms that host cell has evolved to control LINE-1 replication.Given the similarity of the life cycle between LINE-1 and retroviruses,the LINE-1 research may also shed new light on the biology of retroviruses.%转座子约占人类基因组的45%,对基因组的结构与功能造成了重大的影响.一部分转座子现在仍然具有活性,它们的转座能引发疾病.长散布元件(long interspersed element-1,LINE-1)是现今在人类基因组中发现的唯一具有活性并能自主转座的转座子,并能介导非自主转座的元件进行转座.近年来,LINE-1的研究有新的突破,本文简述了LINE-1的结构、转座机制及对基因组的影响,重点总结和分析宿主对LINE-1的限制机制.由于LINE-1的生活周期与逆转录病毒有相似之处,也希望能够为宿主抗病毒的研究提供线索.

  13. Element-ary Development.

    Science.gov (United States)

    Schamp, Homer W., Jr.

    1989-01-01

    Describes the historic development of the periodic table from the four-element theory to the Lavoisier's table. Presents a table listing the old and new names of chemicals and the Lavoisier's table of elements. Lists two references. (YP)

  14. Data Element Registry Services

    Data.gov (United States)

    U.S. Environmental Protection Agency — Data Element Registry Services (DERS) is a resource for information about value lists (aka code sets / pick lists), data dictionaries, data elements, and EPA data...

  15. Mobility and generation of mosaic non-autonomous transposons by Tn3-derived inverted-repeat miniature elements (TIMEs.

    Directory of Open Access Journals (Sweden)

    Magdalena Szuplewska

    Full Text Available Functional transposable elements (TEs of several Pseudomonas spp. strains isolated from black shale ore of Lubin mine and from post-flotation tailings of Zelazny Most in Poland, were identified using a positive selection trap plasmid strategy. This approach led to the capture and characterization of (i 13 insertion sequences from 5 IS families (IS3, IS5, ISL3, IS30 and IS1380, (ii isoforms of two Tn3-family transposons--Tn5563a and Tn4662a (the latter contains a toxin-antitoxin system, as well as (iii non-autonomous TEs of diverse structure, ranging in size from 262 to 3892 bp. The non-autonomous elements transposed into AT-rich DNA regions and generated 5- or 6-bp sequence duplications at the target site of transposition. Although these TEs lack a transposase gene, they contain homologous 38-bp-long terminal inverted repeat sequences (IRs, highly conserved in Tn5563a and many other Tn3-family transposons. The simplest elements of this type, designated TIMEs (Tn3 family-derived Inverted-repeat Miniature Elements (262 bp, were identified within two natural plasmids (pZM1P1 and pLM8P2 of Pseudomonas spp. It was demonstrated that TIMEs are able to mobilize segments of plasmid DNA for transposition, which results in the generation of more complex non-autonomous elements, resembling IS-driven composite transposons in structure. Such transposon-like elements may contain different functional genetic modules in their core regions, including plasmid replication systems. Another non-autonomous element "captured" with a trap plasmid was a TIME derivative containing a predicted resolvase gene and a res site typical for many Tn3-family transposons. The identification of a portable site-specific recombination system is another intriguing example confirming the important role of non-autonomous TEs of the TIME family in shuffling genetic information in bacterial genomes. Transposition of such mosaic elements may have a significant impact on diversity and

  16. P elements and the determinants of hybrid dysgenesis have different dynamics of propagation in Drosophila melanogaster populations.

    Science.gov (United States)

    Ignatenko, Olesia M; Zakharenko, Lyudmila P; Dorogova, Natalia V; Fedorova, Svetlana A

    2015-12-01

    Intraspecific hybrid dysgenesis (HD) appears after some strains of D. melanogaster are crossed. The predominant idea is that the movement of transposable P elements causes HD. It is believed that P elements appeared in the D. melanogaster genome in the middle of the last century by horizontal transfer, simultaneously with the appearance of HD determinants. A subsequent simultaneous expansion of HD determinants and P elements occurred. We analyzed the current distribution of HD determinants in natural populations of D. melanogaster and found no evidence of their further spread. However, full-sized P elements were identified in the genomes of all analyzed natural D. melanogaster strains independent of their cytotypes. Thus, the expansion of P elements does not correlate with the expansion of HD determinants. We found that the ovaries of dysgenic females did not contain germ cells despite the equal number of primordial germ cells in early stages in dysgenic and non-dysgenic embryos. We propose that HD does not result from DNA damage caused by P element transposition, but it would be the disruption in the regulation of dysgenic ovarian formation that causes the dysgenic phenotypes.

  17. Bioinformatic analysis of Entamoeba histolytica SINE1 elements

    Directory of Open Access Journals (Sweden)

    Butcher Sarah A

    2010-05-01

    Full Text Available Abstract Background Invasive amoebiasis, caused by infection with the human parasite Entamoeba histolytica remains a major cause of morbidity and mortality in some less-developed countries. Genetically E. histolytica exhibits a number of unusual features including having approximately 20% of its genome comprised of repetitive elements. These include a number of families of SINEs - non-autonomous elements which can, however, move with the help of partner LINEs. In many eukaryotes SINE mobility has had a profound effect on gene expression; in this study we concentrated on one such element - EhSINE1, looking in particular for evidence of recent transposition. Results EhSINE1s were detected in the newly reassembled E. histolytica genome by searching with a Hidden Markov Model developed to encapsulate the key features of this element; 393 were detected. Examination of their sequences revealed that some had an internal structure showing one to four 26-27 nt repeats. Members of the different classes differ in a number of ways and in particular those with two internal repeats show the properties expected of fairly recently transposed SINEs - they are the most homogeneous in length and sequence, they have the longest (i.e. the least decayed target site duplications and are the most likely to show evidence (in a cDNA library of active transcription. Furthermore we were able to identify 15 EhSINE1s (6 pairs and one triplet which appeared to be identical or very nearly so but inserted into different sites in the genome; these provide good evidence that if mobility has now ceased it has only done so very recently. Conclusions Of the many families of repetitive elements present in the genome of E. histolytica we have examined in detail just one - EhSINE1. We have shown that there is evidence for waves of transposition at different points in the past and no evidence that mobility has entirely ceased. There are many aspects of the biology of this parasite which

  18. Rare (Earth Elements [score

    Directory of Open Access Journals (Sweden)

    Camilo Méndez

    2014-12-01

    Full Text Available Rare (Earth Elements is a cycle of works for solo piano. The cycle was inspired by James Dillon’s Book of Elements (Vol. I-V. The complete cycle will consist of 14 pieces; one for each selected rare (earth element. The chosen elements are Neodymium, Erbium, Tellurium, Hafnium, Tantalum, Technetium, Indium, Dysprosium, Lanthanium, Cerium, Europium, Terbium, Yttrium and Darmstadtium. These elements were selected due to their special atomic properties that in many cases make them extremely valuable for the development of new technologies, and also because of their scarcity. To date, only 4 works have been completed Yttrium, Technetium, Indium and Tellurium.

  19. Identification of genetic elements associated with EPSPs gene amplification.

    Directory of Open Access Journals (Sweden)

    Todd A Gaines

    Full Text Available Weed populations can have high genetic plasticity and rapid responses to environmental selection pressures. For example, 100-fold amplification of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS gene evolved in the weed species Amaranthus palmeri to confer resistance to glyphosate, the world's most important herbicide. However, the gene amplification mechanism is unknown. We sequenced the EPSPS gene and genomic regions flanking EPSPS loci in A. palmeri, and searched for mobile genetic elements or repetitive sequences. The EPSPS gene was 10,229 bp, containing 8 exons and 7 introns. The gene amplification likely proceeded through a DNA-mediated mechanism, as introns exist in the amplified gene copies and the entire amplified sequence is at least 30 kb in length. Our data support the presence of two EPSPS loci in susceptible (S A. palmeri, and that only one of these was amplified in glyphosate-resistant (R A. palmeri. The EPSPS gene amplification event likely occurred recently, as no sequence polymorphisms were found within introns of amplified EPSPS copies from R individuals. Sequences with homology to miniature inverted-repeat transposable elements (MITEs were identified next to EPSPS gene copies only in R individuals. Additionally, a putative Activator (Ac transposase and a repetitive sequence region were associated with amplified EPSPS genes. The mechanism controlling this DNA-mediated amplification remains unknown. Further investigation is necessary to determine if the gene amplification may have proceeded via DNA transposon-mediated replication, and/or unequal recombination between different genomic regions resulting in replication of the EPSPS gene.

  20. The synthetic elements

    International Nuclear Information System (INIS)

    Prior to 1940, the heaviest element known was uranium, discovered in 1789. Since that time the elements 93 through 109 have been synthesized and identified and the elements 43, 61, 85, and 87 which were missing form the periodic tables of the 1930's have been discovered. The techniques and problems involved in these discoveries and the placement of the transuranium elements in the periodic table will be discussed. The production and positive identification of elements heavier than Md (Z=101), which have very short half-lives and can only be produced an atom-at-a-time, are very difficult and there have been controversies concerning their discovery. Some of the new methods which have been developed and used in these studies will be described. The prospects for production of still heavier elements will be considered

  1. Translation of LINE-1 DNA elements in vitro and in human cells

    International Nuclear Information System (INIS)

    The LINE-1(L1) family of interspread DNA sequences found throughout the human genome (L1 Homo sapiens, L1Hs) includes active transposable elements. Current models for the mechanism of transposition involve reverse transcription of an RNA intermediate and utilization of element-encoded proteins. The authors report that an antiserum against the polypeptide encoded by the L1Hs 5' open reading frame (ORF1) detects, in human cells, an endogenous ORF1 protein as well as the ORG1 product of an appropriate transfecting recombinant vector. The endogenous polypeptide is most abundant in teratocarcinoma and choriocarcinoma cells, among those cell lines tested; it appears to be a single species of ∼38 kDa. In contrast, RNAs synthesized in vitro from cDNAs representing full-length, polyadenylylated cytoplasmic L1Hs RNA yield, upon in vitro translation, ORF1 products of slightly different sizes. This is consistent with the fact that the various cDNAs are different and represent transcription of different genomic L1Hs elements. In vitro studies additionally suggest that translation of ORF1 is initiated at the first AUG codon. Finally, in no case was an ORF1-ORF2 fusion protein detected

  2. Elements in biological AMS

    International Nuclear Information System (INIS)

    AMS (Accelerator Mass Spectrometry) provides high detection sensitivity for isotopes whose half-lives are between 10 years and 100 million years. 14C is the most developed of such isotopes and is used in tracing natural and anthropogenic organic compounds in the Earth's biosphere. Thirty-three elements in the main periodic table and 17 lanthanides or actinides have long lived isotopes, providing potential tracers for research in elemental biochemistry. Overlap of biologically interesting heavy elements and possible AMS tracers is discussed

  3. Finite element procedures

    CERN Document Server

    Bathe, Klaus-Jürgen

    2015-01-01

    Finite element procedures are now an important and frequently indispensable part of engineering analyses and scientific investigations. This book focuses on finite element procedures that are very useful and are widely employed. Formulations for the linear and nonlinear analyses of solids and structures, fluids, and multiphysics problems are presented, appropriate finite elements are discussed, and solution techniques for the governing finite element equations are given. The book presents general, reliable, and effective procedures that are fundamental and can be expected to be in use for a long time. The given procedures form also the foundations of recent developments in the field.

  4. Quality goals for energy resources - an innovative approach to transposing the EU requirements for energy efficiency and use of renewables to the national level; Energietraegerqualitaetsziele - ein innovativer Ansatz zur Weitergabe der Synergie von Energieeffizienz- und REN-Verpflichtungen

    Energy Technology Data Exchange (ETDEWEB)

    Luhmann, H.J.; Lechtenboehmer, S.; Venjakob, J. [Wuppertal Inst. fuer Klima, Umwelt, Energie GmbH (Germany). Forschungsgruppe 1 - Zukuenftige Energie- und Mobilitaetsstrukturen

    2008-06-15

    One of the main commitments contained in the EU package of 23 January 2008 for the realisation of the so-called 20-20-20 goals is to increase the share of renewable energies in the energy mix. This is to be achieved by means of a EU directive to be transposed into national law. The directive already exists as a draft. Although there is still some discussion about the alternatives of having either an EU-wide uniform system based on the trade in quotas or permits or national promotion systems, ultimately there is likely to be some form of coexistence at the national level of legislation similar to the German Electricity Feed Law on one side and quota-based systems on the other. With this situation in mind the following article explores innovative options for member states given the new legal situation at the EU level.

  5. BSCW Unstructured Mixed Element Grids

    Data.gov (United States)

    National Aeronautics and Space Administration — Corase Grid: Quad Surface Faces= 9360 Tria Surface Faces= 128928 Nodes = 2869187 Total Elements = 9099201 Hex Elements = 0 Pent_5 Elements = 0 Pent_6 Elements =...

  6. Elements of life

    OpenAIRE

    Samuel, J.

    2004-01-01

    A Biography of J.M.W. Turner's life told through the use of the elements. A five screen video installation. This is the Main Screen which was complimented by four video screens to represent each element.Shown at the Community Pharmacy Gallery May 2004.

  7. A dry element

    Energy Technology Data Exchange (ETDEWEB)

    Kimura, T.; Ota, A.

    1983-08-11

    The agglomerate for the element is made from activated charcoal powder, an electrically conducting additive and a neutral electrolyte. The activated charcoal makes up 30 to 50 percent of the weight of the agglomerate. It is a mixture of hydrophobized and unhydrophobized powder in a ratio of 85 to 70 to 15 to 30. The element has high discharge characteristics.

  8. A battery element

    Energy Technology Data Exchange (ETDEWEB)

    Nakai, M.; Koboyasi, S.; Oisi, K.; Okadzaki, R.; Ota, A.

    1983-07-29

    An anode made of an alkaline or an alkaline earth metal and an electrolyte based on an organic solvent are used in the element. A mixture of Mn203 and Mn304 in a 9 to 1 to 3 to 7 ratio serves as the cathode. The element has a stable discharge curve at a nominal voltage of 1.5 volts.

  9. The solar element

    DEFF Research Database (Denmark)

    Kragh, Helge

    2009-01-01

    Apart from hydrogen, helium is the most abundant chemical element in the universe, and yet it was only discovered on the Earth in 1895. Its early history is unique because it encompasses astronomy as well as chemistry, two sciences which the spectroscope brought into contact during the second half...... of the nineteenth century. In the modest form of a yellow spectral line known as D3, 'helium' was sometimes supposed to exist in the Sun's atmosphere, an idea which is traditionally ascribed to J. Norman Lockyer. Did Lockyer discover helium as a solar element? How was the suggestion received by chemists, physicists...... elements might be different. The complex story of how helium became established as both a solar and terrestrial element involves precise observations as well as airy speculations. It is a story that is unique among the discovery histories of the chemical elements....

  10. Discovery of element 112

    Energy Technology Data Exchange (ETDEWEB)

    Hofmann, S. [GSI, Darmstadt (Germany)

    1996-12-31

    The new elements 110, 111, and 112 were synthesized and unambiguously identified in experiments at SHIP. Due to strong shell effects the dominant decay mode is not fission, but emission of alpha particles. Theoretical investigations predict that maximum shell effects should exist in nuclei near proton number 114 and neutron number 184. Measurements give hope that isotopes of element 114 close to the island of spherical Superheavy Elements could be produced by fusion reactions using {sup 118}Pb as target. systematic studies of the reaction cross-sections indicate that transfer of nucleons is the important process to initiate the fusion.

  11. System Elements Heterogeneity

    Directory of Open Access Journals (Sweden)

    Stanislav A. Kuja

    2013-01-01

    Full Text Available The paper deals with the features of the systematic approach development, shows that the systematic approach lacks the definition of system elements divisibility. This fact simplifies the system description. The article shows that, depending on the selection of the criterion of divisibility, different types of elements with different properties are got. Depending on the selection of the criterion of divisibility, the system structure becomes multidimensional. The paper recommends to indicate the criterion of the system divisibility during the systems research. It increases the certainty of the description of a complex system and characterizes the system elements.

  12. Flow Element Models

    DEFF Research Database (Denmark)

    Heiselberg, Per; Nielsen, Peter V.

    Air distribution in ventilated rooms is a flow process that can be divided into different elements such as supply air jets, exhaust flows, thermal plumes, boundary layer flows, infiltration and gravity currents. These flow elements are isolated volumes where the air movement is controlled...... by a restricted number of parameters, and the air movement is fairly independent of the general flow in the enclosure. In many practical situations, the most convenient· method is to design the air distribution system using flow element theory....

  13. Multi-Element Airfoil System

    Science.gov (United States)

    Turner, Travis L. (Inventor); Khorrami, Mehdi R. (Inventor); Lockard, David P. (Inventor); McKenney, Martin J. (Inventor); Atherley, Raymond D. (Inventor); Kidd, Reggie T. (Inventor)

    2014-01-01

    A multi-element airfoil system includes an airfoil element having a leading edge region and a skin element coupled to the airfoil element. A slat deployment system is coupled to the slat and the skin element, and is capable of deploying and retracting the slat and the skin element. The skin element substantially fills the lateral gap formed between the slat and the airfoil element when the slat is deployed. The system further includes an uncoupling device and a sensor to remove the skin element from the gap based on a critical angle-of-attack of the airfoil element. The system can alternatively comprise a trailing edge flap, where a skin element substantially fills the lateral gap between the flap and the trailing edge region of the airfoil element. In each case, the skin element fills a gap between the airfoil element and the deployed flap or slat to reduce airframe noise.

  14. Solar cell element

    Energy Technology Data Exchange (ETDEWEB)

    Nakano, Akihiko; Matsumoto, Hitoshi; Uda, Hiroshi; Komatsu, Yasumitsu; Ikegami, Kiyoharu.

    1989-05-18

    In the existing CdS/CdTe-based solar cell element, nothing is formed except the component effective for generating electromotive force and the components necessary for leading, collecting and extracting the generated electricity, hence even when the element shows deterioration of its performance during its usage, it has been difficult to analyze the above situation. In addition, it has also a defect that its characteristic such as the transfer efficiency in the neighborhood of its glass substrate in connection also with its manufacturing process. In order to solve the above problematical points, this invention proposes, with regard to a CdS-based solar cell element composed by forming a thin film on its substrate, to make a blank space on the above substrate and form thereon a thin film which composes the solar cell element concerned alone or in a piling up manner. 4 figs.

  15. Structural elements design manual

    CERN Document Server

    Draycott, Trevor

    2012-01-01

    Gives clear explanations of the logical design sequence for structural elements. The Structural Engineer says: `The book explains, in simple terms, and with many examples, Code of Practice methods for sizing structural sections in timber, concrete,masonry and steel. It is the combination into one book of section sizing methods in each of these materials that makes this text so useful....Students will find this an essential support text to the Codes of Practice in their study of element sizing'.

  16. Creativity Management Key Elements

    OpenAIRE

    Fuchs Ángeles, Rosa María; Franceso Tonetti, Federico Carlo

    2015-01-01

    Organizations are constantly looking towards innovation. In order to reach it they must foment creativity. This paper analyzes a series of elements considered in the organizational creativity management and proposes a model with the indispensable factors that organizations should consider to reach it. These elements are: culture and organizational environment, strategy, structure, communication, relation with customers, human resources (recruiting, training, job design, compensation, promotio...

  17. New roof element system

    DEFF Research Database (Denmark)

    Ditlev, Jesper; Rudbeck, Claus Christian

    1997-01-01

    The aim of the project has been to develop an element system for warm deck roofs which, from a thermal and economical point of view, can deal with the future demands for heat loss coefficients for low slope roofs.......The aim of the project has been to develop an element system for warm deck roofs which, from a thermal and economical point of view, can deal with the future demands for heat loss coefficients for low slope roofs....

  18. Atoms, molecules & elements

    CERN Document Server

    Graybill, George

    2007-01-01

    Young scientists will be thrilled to explore the invisible world of atoms, molecules and elements. Our resource provides ready-to-use information and activities for remedial students using simplified language and vocabulary. Students will label each part of the atom, learn what compounds are, and explore the patterns in the periodic table of elements to find calcium (Ca), chlorine (Cl), and helium (He) through hands-on activities.

  19. A battery element

    Energy Technology Data Exchange (ETDEWEB)

    Vatanabe, U.; Aoki, K.; Ito, K.; Ogava, K.; Okadzaki, R.

    1983-07-29

    An anode made of a light metal is used in the element, along with an anhydrous liquid electrolyte and a cathode made of CuC12(CFn)x or another material. The current tap of the anode is made from aluminum, gold, silver or another metal of the platinum group and the current tap may be coated with this metal. The thickness of the coating is 0.1 to 1 micrometer. The element has a long storage life.

  20. The Middle Pivot Element Algorithm

    OpenAIRE

    Anchala Kumari; Soubhik Chakraborty

    2012-01-01

    This paper is an improvement over the previous work on New Sorting Algorithm first proposed by Sundararajan and Chakraborty (2007). Here we have taken the pivot element as the middle element of the array. We call this improved version Middle Pivot Element Algorithm (MPA) and it is found that MPA is much faster than the two algorithms RPA (Random Pivot element Algorithm) and FPA (First Pivot element Algorithm) in which the pivot element was selected either randomly or as the first element, res...

  1. Solar energy - design element

    International Nuclear Information System (INIS)

    The main focus of this study is the theoretical examination of the possibilities of applying technological, functional, aesthetic and energy resources in elements of urban design. Designed solutions are treated as part of the overall optimization of architectural elements and urban space, in which technological development enables the use of certain energy potentials of elements of urban design. The paper presents student hypothetical design models of urban architectural elements with integrated photovoltaic modules. The analytical procedure was applied in the analysis of student work in a seminar of the first year of master studies at the Faculty of Architecture. The aim is to improve students' awareness of the need for proper handling of energy and the possibility of integration with other architectural elements. The research and the results have enabled further work on the sustainable development of architectural elements with a focus on the use of solar energy by promoting the modern design approach. Key words: PV module, teaching, solar energy, urban design

  2. Advanced finite element technologies

    CERN Document Server

    Wriggers, Peter

    2016-01-01

    The book presents an overview of the state of research of advanced finite element technologies. Besides the mathematical analysis, the finite element development and their engineering applications are shown to the reader. The authors give a survey of the methods and technologies concerning efficiency, robustness and performance aspects. The book covers the topics of mathematical foundations for variational approaches and the mathematical understanding of the analytical requirements of modern finite element methods. Special attention is paid to finite deformations, adaptive strategies, incompressible, isotropic or anisotropic material behavior and the mathematical and numerical treatment of the well-known locking phenomenon. Beyond that new results for the introduced approaches are presented especially for challenging nonlinear problems.

  3. Computing Heavy Elements

    CERN Document Server

    Schunck, N; Kortelainen, M; McDonnell, J; Moré, J; Nazarewicz, W; Pei, J; Sarich, J; Sheikh, J; Staszczak, A; Stoitsov, M; Wild, S M

    2011-01-01

    Reliable calculations of the structure of heavy elements are crucial to address fundamental science questions such as the origin of the elements in the universe. Applications relevant for energy production, medicine, or national security also rely on theoretical predictions of basic properties of atomic nuclei. Heavy elements are best described within the nuclear density functional theory (DFT) and its various extensions. While relatively mature, DFT has never been implemented in its full power, as it relies on a very large number (~ 10^9-10^12) of expensive calculations (~ day). The advent of leadership-class computers, as well as dedicated large-scale collaborative efforts such as the SciDAC 2 UNEDF project, have dramatically changed the field. This article gives an overview of the various computational challenges related to the nuclear DFT, as well as some of the recent achievements.

  4. Elemental analysis in biotechnology.

    Science.gov (United States)

    Hann, Stephan; Dernovics, Mihaly; Koellensperger, Gunda

    2015-02-01

    This article focuses on analytical strategies integrating atomic spectroscopy in biotechnology. The rationale behind developing such methods is inherently linked to unique features of the key technique in elemental analysis, which is inductively coupled plasma mass spectrometry: (1) the high sensitivity and selectivity of state of the art instrumentation, (2) the possibility of accurate absolute quantification even in complex matrices, (3) the capability of combining elemental detectors with chromatographic separation methods and the versatility of the latter approach, (4) the complementarity of inorganic and organic mass spectrometry, (5) the multi-element capability and finally (6) the capability of isotopic analysis. The article highlights the most recent bio-analytical developments exploiting these methodological advantages and shows the potential in biotechnological applications.

  5. Osteoporosis and trace elements

    DEFF Research Database (Denmark)

    Aaseth, J.; Boivin, G.; Andersen, Ole

    2012-01-01

    More than 200 million people are affected by osteoporosis worldwide, as estimated by 2 million annual hip fractures and other debilitating bone fractures (vertebrae compression and Colles' fractures). Osteoporosis is a multi-factorial disease with potential contributions from genetic, endocrine...... functional, exercise related and nutritional factors. Of particular considerations are calcium (Ca) status, vitamin D, fluoride, magnesium and other trace elements. Several trace elements such as zinc and copper are essential for normal development of the skeleton in humans and animals. Fluoride accumulates...... in new bone and results in a net gain in bone mass, but may be associated with a tissue of poor quality. Aluminum induces impairment of bone formation. Gallium and cadmium suppresses bone turnover. However, exact involvements of the trace elements in osteoporosis have not yet been fully clarified...

  6. An alkaline element

    Energy Technology Data Exchange (ETDEWEB)

    Arita, T.; Murakami, K.; Okha, K.

    1983-04-28

    A cathode with a dual layer active mass is installed in the disk shaped alkaline silver and zinc element. The first layer, which is turned towards the anode, contains 85 parts Ag2O, 5 parts electrolytic MnO2 and 10 parts graphite. The second layer, which contacts the bottom of the element, contains 35 parts Ag2O, 60 parts electrolytic MnO2 and 5 parts graphite. The electrical capacity of the first and second layers is 60 and 40, respectively. The first layer may be discharged with a high current density and the second layer with less current density. The element has high characteristics with comparatively low cost.

  7. Fuel Element Technical Manual

    Energy Technology Data Exchange (ETDEWEB)

    Burley, H.H. [ed.

    1956-08-01

    It is the purpose of the Fuel Element Technical Manual to Provide a single document describing the fabrication processes used in the manufacture of the fuel element as well as the technical bases for these processes. The manual will be instrumental in the indoctrination of personnel new to the field and will provide a single data reference for all personnel involved in the design or manufacture of the fuel element. The material contained in this manual was assembled by members of the Engineering Department and the Manufacturing Department at the Hanford Atomic Products Operation between the dates October, 1955 and June, 1956. Arrangement of the manual. The manual is divided into six parts: Part I--introduction; Part II--technical bases; Part III--process; Part IV--plant and equipment; Part V--process control and improvement; and VI--safety.

  8. Intelligent Elements for ISHM

    Science.gov (United States)

    Schmalzel, John L.; Morris, Jon; Turowski, Mark; Figueroa, Fernando; Oostdyk, Rebecca

    2008-01-01

    There are a number of architecture models for implementing Integrated Systems Health Management (ISHM) capabilities. For example, approaches based on the OSA-CBM and OSA-EAI models, or specific architectures developed in response to local needs. NASA s John C. Stennis Space Center (SSC) has developed one such version of an extensible architecture in support of rocket engine testing that integrates a palette of functions in order to achieve an ISHM capability. Among the functional capabilities that are supported by the framework are: prognostic models, anomaly detection, a data base of supporting health information, root cause analysis, intelligent elements, and integrated awareness. This paper focuses on the role that intelligent elements can play in ISHM architectures. We define an intelligent element as a smart element with sufficient computing capacity to support anomaly detection or other algorithms in support of ISHM functions. A smart element has the capabilities of supporting networked implementations of IEEE 1451.x smart sensor and actuator protocols. The ISHM group at SSC has been actively developing intelligent elements in conjunction with several partners at other Centers, universities, and companies as part of our ISHM approach for better supporting rocket engine testing. We have developed several implementations. Among the key features for these intelligent sensors is support for IEEE 1451.1 and incorporation of a suite of algorithms for determination of sensor health. Regardless of the potential advantages that can be achieved using intelligent sensors, existing large-scale systems are still based on conventional sensors and data acquisition systems. In order to bring the benefits of intelligent sensors to these environments, we have also developed virtual implementations of intelligent sensors.

  9. Elements of linear space

    CERN Document Server

    Amir-Moez, A R; Sneddon, I N

    1962-01-01

    Elements of Linear Space is a detailed treatment of the elements of linear spaces, including real spaces with no more than three dimensions and complex n-dimensional spaces. The geometry of conic sections and quadric surfaces is considered, along with algebraic structures, especially vector spaces and transformations. Problems drawn from various branches of geometry are given.Comprised of 12 chapters, this volume begins with an introduction to real Euclidean space, followed by a discussion on linear transformations and matrices. The addition and multiplication of transformations and matrices a

  10. Finite elements and approximation

    CERN Document Server

    Zienkiewicz, O C

    2006-01-01

    A powerful tool for the approximate solution of differential equations, the finite element is extensively used in industry and research. This book offers students of engineering and physics a comprehensive view of the principles involved, with numerous illustrative examples and exercises.Starting with continuum boundary value problems and the need for numerical discretization, the text examines finite difference methods, weighted residual methods in the context of continuous trial functions, and piecewise defined trial functions and the finite element method. Additional topics include higher o

  11. Finite element analysis

    CERN Document Server

    2010-01-01

    Finite element analysis is an engineering method for the numerical analysis of complex structures. This book provides a bird's eye view on this very broad matter through 27 original and innovative research studies exhibiting various investigation directions. Through its chapters the reader will have access to works related to Biomedical Engineering, Materials Engineering, Process Analysis and Civil Engineering. The text is addressed not only to researchers, but also to professional engineers, engineering lecturers and students seeking to gain a better understanding of where Finite Element Analysis stands today.

  12. Rocket propulsion elements

    CERN Document Server

    Sutton, George P

    2011-01-01

    The definitive text on rocket propulsion-now revised to reflect advancements in the field For sixty years, Sutton's Rocket Propulsion Elements has been regarded as the single most authoritative sourcebook on rocket propulsion technology. As with the previous edition, coauthored with Oscar Biblarz, the Eighth Edition of Rocket Propulsion Elements offers a thorough introduction to basic principles of rocket propulsion for guided missiles, space flight, or satellite flight. It describes the physical mechanisms and designs for various types of rockets' and provides an unders

  13. An alkaline element

    Energy Technology Data Exchange (ETDEWEB)

    Obi, F.

    1983-09-29

    A current tap pressed into the anode is installed in the central part of the top of the element. There is an internal top made of plastic under the top. There is a projection in the center of the top with an opening, through which the current tap is passed. The edge of the plastic top serves as an insulation lining between the metallic top and the body, which serves as the current tap for the cathode. A separator is placed between the anode and the cathode. Electrolyte leaks are prevented in the slotted disk elements.

  14. The protist Trichomonas vaginalis harbors multiple lineages of transcriptionally active Mutator-like elements

    Directory of Open Access Journals (Sweden)

    Pereira Gonçalo AG

    2009-07-01

    Full Text Available Abstract Background For three decades the Mutator system was thought to be exclusive of plants, until the first homolog representatives were characterized in fungi and in early-diverging amoebas earlier in this decade. Results Here, we describe and characterize four families of Mutator-like elements in a new eukaryotic group, the Parabasalids. These Trichomonas vaginalis Mutator- like elements, or TvMULEs, are active in T. vaginalis and patchily distributed among 12 trichomonad species and isolates. Despite their relatively distinctive amino acid composition, the inclusion of the repeats TvMULE1, TvMULE2, TvMULE3 and TvMULE4 into the Mutator superfamily is justified by sequence, structural and phylogenetic analyses. In addition, we identified three new TvMULE-related sequences in the genome sequence of Candida albicans. While TvMULE1 is a member of the MuDR clade, predominantly from plants, the other three TvMULEs, together with the C. albicans elements, represent a new and quite distinct Mutator lineage, which we named TvCaMULEs. The finding of TvMULE1 sequence inserted into other putative repeat suggests the occurrence a novel TE family not yet described. Conclusion These findings expand the taxonomic distribution and the range of functional motif of MULEs among eukaryotes. The characterization of the dynamics of TvMULEs and other transposons in this organism is of particular interest because it is atypical for an asexual species to have such an extreme level of TE activity; this genetic landscape makes an interesting case study for causes and consequences of such activity. Finally, the extreme repetitiveness of the T. vaginalis genome and the remarkable degree of sequence identity within its repeat families highlights this species as an ideal system to characterize new transposable elements.

  15. Development of a versatile XRF scanner for the elemental imaging of paintworks

    Energy Technology Data Exchange (ETDEWEB)

    Ravaud, E.; Pichon, L.; Laval, E.; Eveno, M. [Centre de recherche et de restauration des musees de France, C2RMF, Paris (France); Gonzalez, V.; Calligaro, T. [Centre de recherche et de restauration des musees de France, C2RMF, Paris (France); PSL Research University, Chimie ParisTech-CNRS, Institut de Recherche Chimie Paris, UMR8247, Paris (France)

    2016-01-15

    Scanning XRF is a powerful elemental imaging technique introduced at the synchrotron that has recently been transposed to laboratory. The growing interest in this technique stems from its ability to collect images reflecting pigment distribution within large areas on artworks by means of their elemental signature. In that sense, scanning XRF appears highly complementary to standard imaging techniques (Visible, UV, IR photography and X-ray radiography). The versatile XRF scanner presented here has been designed and built at the C2RMF in response to specific constraints: transportability, cost-effectiveness and ability to scan large areas within a single working day. The instrument is based on a standard X-ray generator with sub-millimetre collimated beam and a SDD-based spectrometer to collected X-ray spectra. The instrument head is scanned in front of the painting by means of motorised movements to cover an area up to 300 x 300 mm{sup 2} with a resolution of 0.5 mm (600 x 600 pixels). The 15-kg head is mounted on a stable photo stand for rapid positioning on paintworks and maintains a free side-access for safety; it can also be attached to a lighter tripod for field measurements. Alignment is achieved with a laser pointer and a micro-camera. With a scanning speed of 5 mm/s and 0.1 s/point, elemental maps are collected in 10 h, i.e. a working day. The X-ray spectra of all pixels are rapidly processed using an open source program to derive elemental maps. To illustrate the capabilities of this instrument, this contribution presents the results obtained on the Belle Ferronniere painted by Leonardo da Vinci (1452-1519) and conserved in the Musee du Louvre, prior to its restoration at the C2RMF. (orig.)

  16. Development of a versatile XRF scanner for the elemental imaging of paintworks

    Science.gov (United States)

    Ravaud, E.; Pichon, L.; Laval, E.; Gonzalez, V.; Eveno, M.; Calligaro, T.

    2016-01-01

    Scanning XRF is a powerful elemental imaging technique introduced at the synchrotron that has recently been transposed to laboratory. The growing interest in this technique stems from its ability to collect images reflecting pigment distribution within large areas on artworks by means of their elemental signature. In that sense, scanning XRF appears highly complementary to standard imaging techniques (Visible, UV, IR photography and X-ray radiography). The versatile XRF scanner presented here has been designed and built at the C2RMF in response to specific constraints: transportability, cost-effectiveness and ability to scan large areas within a single working day. The instrument is based on a standard X-ray generator with sub-millimetre collimated beam and a SDD-based spectrometer to collected X-ray spectra. The instrument head is scanned in front of the painting by means of motorised movements to cover an area up to 300 × 300 mm2 with a resolution of 0.5 mm (600 × 600 pixels). The 15-kg head is mounted on a stable photo stand for rapid positioning on paintworks and maintains a free side-access for safety; it can also be attached to a lighter tripod for field measurements. Alignment is achieved with a laser pointer and a micro-camera. With a scanning speed of 5 mm/s and 0.1 s/point, elemental maps are collected in 10 h, i.e. a working day. The X-ray spectra of all pixels are rapidly processed using an open source program to derive elemental maps. To illustrate the capabilities of this instrument, this contribution presents the results obtained on the Belle Ferronnière painted by Leonardo da Vinci (1452-1519) and conserved in the Musée du Louvre, prior to its restoration at the C2RMF.

  17. Development of a versatile XRF scanner for the elemental imaging of paintworks

    International Nuclear Information System (INIS)

    Scanning XRF is a powerful elemental imaging technique introduced at the synchrotron that has recently been transposed to laboratory. The growing interest in this technique stems from its ability to collect images reflecting pigment distribution within large areas on artworks by means of their elemental signature. In that sense, scanning XRF appears highly complementary to standard imaging techniques (Visible, UV, IR photography and X-ray radiography). The versatile XRF scanner presented here has been designed and built at the C2RMF in response to specific constraints: transportability, cost-effectiveness and ability to scan large areas within a single working day. The instrument is based on a standard X-ray generator with sub-millimetre collimated beam and a SDD-based spectrometer to collected X-ray spectra. The instrument head is scanned in front of the painting by means of motorised movements to cover an area up to 300 x 300 mm2 with a resolution of 0.5 mm (600 x 600 pixels). The 15-kg head is mounted on a stable photo stand for rapid positioning on paintworks and maintains a free side-access for safety; it can also be attached to a lighter tripod for field measurements. Alignment is achieved with a laser pointer and a micro-camera. With a scanning speed of 5 mm/s and 0.1 s/point, elemental maps are collected in 10 h, i.e. a working day. The X-ray spectra of all pixels are rapidly processed using an open source program to derive elemental maps. To illustrate the capabilities of this instrument, this contribution presents the results obtained on the Belle Ferronniere painted by Leonardo da Vinci (1452-1519) and conserved in the Musee du Louvre, prior to its restoration at the C2RMF. (orig.)

  18. Beam transport elements

    CERN Multimedia

    1965-01-01

    Two of the beam transport elements for the slow ejection system. On the left, a quadrupole 1.2 m long with a 5 cm aperture, capable of producing a gradient of 5000 gauss. On the right, a 1 m bending magnet with a 4 cm gap; its field is 20 000 gauss.

  19. NEUTRONIC REACTOR FUEL ELEMENT

    Science.gov (United States)

    Picklesimer, M.L.; Thurber, W.C.

    1961-01-01

    A chemically nonreactive fuel composition for incorporation in aluminum- clad, plate type fuel elements for neutronic reactors is described. The composition comprises a mixture of aluminum and uranium carbide particles, the uranium carbide particles containing at least 80 wt.% UC/sub 2/.

  20. Inside finite elements

    CERN Document Server

    Weiser, Martin

    2016-01-01

    All relevant implementation aspects of finite element methods are discussed in this book. The focus is on algorithms and data structures as well as on their concrete implementation. Theory is covered as far as it gives insight into the construction of algorithms. Throughout the exercises a complete FE-solver for scalar 2D problems will be implemented in Matlab/Octave.

  1. Elemental Chem Lab

    Science.gov (United States)

    Franco Mariscal, Antonio Joaquin

    2008-01-01

    This educative material uses the symbols of 45 elements to spell the names of 32 types of laboratory equipment usually found in chemical labs. This teaching material has been divided into three puzzles according to the type of the laboratory equipment: (i) glassware as reaction vessels or containers; (ii) glassware for measuring, addition or…

  2. Movies and Literary Elements.

    Science.gov (United States)

    Keller, Rodney D.

    1987-01-01

    Recommends using movie clips to stimulate students' interest in reading a novel as well as to teach elements of fiction such as plot, character, setting, symbol, irony, and theme. Describes each clip and provides study questions. Includes a listing of movies made from books. (NH)

  3. Cytogenetic variation of repetitive DNA elements in Hoplias malabaricus (Characiformes - Erythrinidae) from white, black and clear water rivers of the Amazon basin.

    Science.gov (United States)

    Santos, Fabíola Araújo Dos; Marques, Diego Ferreira; Terencio, Maria Leandra; Feldberg, Eliana; Rodrigues, Luís Reginaldo R

    2016-03-01

    Hoplias malabaricus is a common fish species occurring in white, black and clear water rivers of the Amazon basin. Its large distribution across distinct aquatic environments can pose stressful conditions for dispersal and creates possibilities for the emergence of local adaptive profiles. We investigated the chromosomal localization of repetitive DNA markers (constitutive heterochromatin, rDNA and the transposable element REX-3) in populations from the Amazonas river (white water), the Negro river (black water) and the Tapajós river (clear water), in order to address the variation/association of cytogenomic features and environmental conditions. We found a conserved karyotypic macrostructure with a diploid number of 40 chromosomes (20 metacentrics + 20 submetacentrics) in all the samples. Heteromorphism in pair 14 was detected as evidence for the initial differentiation of an XX/XY system. Minor differences detected in the amount of repetitive DNA markers are interpreted as possible signatures of local adaptations to distinct aquatic environments.

  4. FLOW INJECTION ANALYSIS SYSTEM COUPLED WITH ICP-EOS FOR DETERMINATION OF SOME METALLIC ELEMENTS IN DRINKING WATER

    Directory of Open Access Journals (Sweden)

    Cristina Dinu

    2009-06-01

    Full Text Available The European Drinking Water Directive (98/83/EC, transposed in Romanian Legislation as Low 458/2002, amended by Low 311/2004, imposes the limit of concentration for metallic elements in water intended for human consumption. The toxic metals arsenic and selenium are among these elements and the limit value is 10 μg/L. In the paper there are presented the working conditions for determination of As and Se from drinking water using modern techniques based on the fl ow injection-hydride generation with the inductively coupled plasma atomic emission spectrometry (FIAS-ICP-EOS. The analyses were performed on Optima 5300 DV Perkin Elmer equipment with FIAS 400 Flow Injection System, Perkin Elmer type. For the hydride generation two types of solution were used: 10% (v/v HCl as a carrier solution and 0.2 % NaBH4 in 0.05%NaOH solution as a reducing agent [1]. The treatment step of the samples and standard solutions consisted in reducing with mixed solutions of KI and ascorbic acid in acidic condition (HCl for As and only with HCl and high temperature for Se [2,3]. The paper contains the characteristic parameters of the methods, such as: low detection limit, quantifi cation limit, repeatability, precision, recovery, which were evaluated using Certifi ed Reference Materials for each element.

  5. The Foldback-like element Galileo belongs to the P superfamily of DNA transposons and is widespread within the Drosophila genus.

    Science.gov (United States)

    Marzo, Mar; Puig, Marta; Ruiz, Alfredo

    2008-02-26

    Galileo is the only transposable element (TE) known to have generated natural chromosomal inversions in the genus Drosophila. It was discovered in Drosophila buzzatii and classified as a Foldback-like element because of its long, internally repetitive, terminal inverted repeats (TIRs) and lack of coding capacity. Here, we characterized a seemingly complete copy of Galileo from the D. buzzatii genome. It is 5,406 bp long, possesses 1,229-bp TIRs, and encodes a 912-aa transposase similar to those of the Drosophila melanogaster 1360 (Hoppel) and P elements. We also searched the recently available genome sequences of 12 Drosophila species for elements similar to Dbuz\\Galileo by using bioinformatic tools. Galileo was found in six species (ananassae, willistoni, peudoobscura, persimilis, virilis, and mojavensis) from the two main lineages within the Drosophila genus. Our observations place Galileo within the P superfamily of cut-and-paste transposons and extend considerably its phylogenetic distribution. The interspecific distribution of Galileo indicates an ancient presence in the genus, but the phylogenetic tree built with the transposase amino acid sequences contrasts significantly with that of the species, indicating lineage sorting and/or horizontal transfer events. Our results also suggest that Foldback-like elements such as Galileo may evolve from DNA-based transposon ancestors by loss of the transposase gene and disproportionate elongation of TIRs.

  6. Production of transuranium elements

    International Nuclear Information System (INIS)

    The Radiochemical Engineering Development Center (REDC) has the programmatic responsibility for the Department of Energy's Transuranium Element Program. Principle elements from the program are einsteinium, berkelium, and fermium. Targets containing curium oxide mixed with aluminum powder are fabricated by the REDC and irradiated in the Oak Ridge National Laboratory (ORNL) High Flux Isotope Reactor. Following an irradiation period of 6-12 months, targets are returned to the REDC for chemical processing. Processing operations consists of aluminum dejacketing in a caustic-nitrate solution, filtration, acid dissolution, solvent extraction, anion exchange, and finally a cation exchange to recover the actinides. The processing operations take place in heavily shielded hot cell facilities and all operations are carried out remotely. The chemistry for the separations has been well established over the 26-yr. operating life of the facility

  7. ELEMENTS OF MARKETING

    OpenAIRE

    Ramakrishna Mohan Rao Munaga

    2014-01-01

    The marketing thinking starts with customer’s needs. Today the customer is on the driver’s seat. It is also because of the change in the demand supply equation. Now the demand is less than supply just reverse to the past times situation. Today each marketer wants to retain and satisfy the customer because of the intense competition. The marketing elements are Needs, Wants, Demands, Products, Value, Exchange, Transaction and Relationship, Market, Marketers.

  8. Quantum theory elements

    CERN Document Server

    Bates, David Robert

    1962-01-01

    Quantum Theory: A Treatise in Three Volumes, I: Elements focuses on the principles, methodologies, and approaches involved in quantum theory, including quantum mechanics, linear combinations, collisions, and transitions. The selection first elaborates on the fundamental principles of quantum mechanics, exactly soluble bound state problems, and continuum. Discussions focus on delta function normalization, spherically symmetric potentials, rectangular potential wells, harmonic oscillators, spherically symmetrical potentials, Coulomb potential, axiomatic basis, consequences of first three postula

  9. Nuclear reactor fuel elements

    International Nuclear Information System (INIS)

    A nuclear reactor fuel element comprising a column of vibration compacted fuel which is retained in consolidated condition by a thimble shaped plug. The plug is wedged into gripping engagement with the wall of the sheath by a wedge. The wedge material has a lower coefficient of expansion than the sheath material so that at reactor operating temperature the retainer can relax sufficient to accommodate thermal expansion of the column of fuel. (author)

  10. Nuclear fuel element

    Science.gov (United States)

    Meadowcroft, Ronald Ross; Bain, Alastair Stewart

    1977-01-01

    A nuclear fuel element wherein a tubular cladding of zirconium or a zirconium alloy has a fission gas plenum chamber which is held against collapse by the loops of a spacer in the form of a tube which has been deformed inwardly at three equally spaced, circumferential positions to provide three loops. A heat resistant disc of, say, graphite separates nuclear fuel pellets within the cladding from the plenum chamber. The spacer is of zirconium or a zirconium alloy.

  11. A sealing element

    Energy Technology Data Exchange (ETDEWEB)

    Obi, F.; Takada, K.

    1983-09-22

    A sealing lining made of a mixture of polyethylene or polypropylene with an additive which prevents destruction of the lining is used in the element. The content of the additive in the mixture is 10 to 30 percent by mass. The additive basically consists of polyethylene. Carboxyl groups are introduced into the polymer as an anion and sodium, potassium and molybdenum are introduced as the cation.

  12. The transuranium elements

    International Nuclear Information System (INIS)

    In this paper Seaborg's actinide hypothesis is traced from its beginnings to the present. The wealth of spectroscopic and magnetic data accumulated over the years leads to conclusions about the electronic structure of the actinides. These investigations include spectroscopic studies of gaseous atoms and ions, as well as of solutions and compounds, and magnetic susceptibility and electron spin resonance studies of metals, alloys, and compounds. Both experimental and theoretical studies have resulted in accurate values for spin-orbit coupling and crystal-field parameters for 5f electrons, for example, which can be compared with values characteristic of 4f electrons. For instance, the somewhat greater spatial extent of 5f versus 4f wave functions gives rise to 5f orbital participation in the bonding of actinide element organometallic compounds and leads to an extensive and intricate organometallic chemistry for this group of elements. The rich chemistry of Np and Pu provides new insights into electronic structure and the unique nature of 5f electrons yields exciting findings in the exploration of the chemistry of the actinide elements

  13. Helium the disappearing element

    CERN Document Server

    Sears, Wheeler M

    2015-01-01

    The subject of the book is helium, the element, and its use in myriad applications including MRI machines, particle accelerators, space telescopes, and of course balloons and blimps. It was at the birth of our Universe, or the Big Bang, where the majority of cosmic helium was created; and stellar helium production continues. Although helium is the second most abundant element in the Universe, it is actually quite rare here on Earth and only exists because of radioactive elements deep within the Earth. This book includes a detailed history of the discovery of helium, of the commercial industry built around it, how the helium we actually encounter is produced within the Earth, and the state of the helium industry today. The gas that most people associate with birthday party balloons is running out. “Who cares?” you might ask. Well, without helium, MRI machines could not function, rockets could not go into space, particle accelerators such as those used by CERN could not operate, fiber optic cables would not...

  14. The transuranium elements: From neptunium and plutonium to element 112

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, D.C. [California Univ., Berkeley, CA (United States)]|[Lawrence Livermore National Lab., CA (United States)

    1996-07-26

    Beginning in the 1930`s, both chemists and physicists became interested in synthesizing new artificial elements. The first transuranium element, Np, was synthesized in 1940. Over the past six decades, 20 transuranium elements have been produced. A review of the synthesis is given. The procedure of naming the heavy elements is also discussed. It appears feasible to produce elements 113 and 114. With the Berkeley Gas-filled Separator, it should be possible to reach the superheavy elements in the region of the spherical Z=114 shell, but with fewer neutrons than the N=184 spherical shell. 57 refs, 6 figs.

  15. Distribution of Genes and Repetitive Elements in the Diabrotica virgifera virgifera Genome Estimated Using BAC Sequencing

    Directory of Open Access Journals (Sweden)

    Brad S. Coates

    2012-01-01

    Full Text Available Feeding damage caused by the western corn rootworm, Diabrotica virgifera virgifera, is destructive to corn plants in North America and Europe where control remains challenging due to evolution of resistance to chemical and transgenic toxins. A BAC library, DvvBAC1, containing 109,486 clones with 104±34.5 kb inserts was created, which has an ~4.56X genome coverage based upon a 2.58 Gb (2.80 pg flow cytometry-estimated haploid genome size. Paired end sequencing of 1037 BAC inserts produced 1.17 Mb of data (~0.05% genome coverage and indicated ~9.4 and 16.0% of reads encode, respectively, endogenous genes and transposable elements (TEs. Sequencing genes within BAC full inserts demonstrated that TE densities are high within intergenic and intron regions and contribute to the increased gene size. Comparison of homologous genome regions cloned within different BAC clones indicated that TE movement may cause haplotype variation within the inbred strain. The data presented here indicate that the D. virgifera virgifera genome is large in size and contains a high proportion of repetitive sequence. These BAC sequencing methods that are applicable for characterization of genomes prior to sequencing may likely be valuable resources for genome annotation as well as scaffolding.

  16. Identification and chromosome mapping of repetitive elements in the Astyanax scabripinnis (Teleostei: Characidae) species complex.

    Science.gov (United States)

    Barbosa, Patrícia; de Oliveira, Luiz Antonio; Pucci, Marcela Baer; Santos, Mateus Henrique; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo; Nogaroto, Viviane; de Almeida, Mara Cristina; Artoni, Roberto Ferreira

    2015-02-01

    Most part of the eukaryotic genome is composed of repeated sequences or multiple copies of DNA, which were considered as "junk DNA", and may be associated to the heterochromatin. In this study, three populations of Astyanax aff. scabripinnis from Brazilian rivers of Guaratinguetá and Pindamonhangaba (São Paulo) and a population from Maringá (Paraná) were analyzed concerning the localization of the nucleolar organizer regions (Ag-NORs), the As51 satellite DNA, the 18S ribosomal DNA (rDNA), and the 5S rDNA. Repeated sequences were also isolated and identified by the Cot - 1 method, which indicated similarity (90%) with the LINE UnaL2 retrotransposon. The fluorescence in situ hybridization (FISH) showed the retrotransposon dispersed and more concentrated markers in centromeric and telomeric chromosomal regions. These sequences were co-localized and interspaced with 18S and 5S rDNA and As51, confirmed by fiber-FISH essay. The B chromosome found in these populations pointed to a conspicuous hybridization with LINE probe, which is also co-located in As51 sequences. The NORs were active at unique sites of a homologous pair in the three populations. There were no evidences that transposable elements and repetitive DNA had influence in the transcriptional regulation of ribosomal genes in our analyses.

  17. Method of securing filter elements

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Erik P.; Haslam, Jeffery L.; Mitchell, Mark A.

    2016-10-04

    A filter securing system including a filter unit body housing; at least one tubular filter element positioned in the filter unit body housing, the tubular filter element having a closed top and an open bottom; a dimple in either the filter unit body housing or the top of the tubular filter element; and a socket in either the filter unit body housing or the top of the tubular filter element that receives the dimple in either the filter unit body housing or the top of the tubular filter element to secure the tubular filter element to the filter unit body housing.

  18. Elements of analytical dynamics

    CERN Document Server

    Kurth, Rudolph; Stark, M

    1976-01-01

    Elements of Analytical Dynamics deals with dynamics, which studies the relationship between motion of material bodies and the forces acting on them. This book is a compilation of lectures given by the author at the Georgia and Institute of Technology and formed a part of a course in Topological Dynamics. The book begins by discussing the notions of space and time and their basic properties. It then discusses the Hamilton-Jacobi theory and Hamilton's principle and first integrals. The text concludes with a discussion on Jacobi's geometric interpretation of conservative systems. This book will

  19. Analytical elements of mechanics

    CERN Document Server

    Kane, Thomas R

    2013-01-01

    Analytical Elements of Mechanics, Volume 1, is the first of two volumes intended for use in courses in classical mechanics. The books aim to provide students and teachers with a text consistent in content and format with the author's ideas regarding the subject matter and teaching of mechanics, and to disseminate these ideas. The book opens with a detailed exposition of vector algebra, and no prior knowledge of this subject is required. This is followed by a chapter on the topic of mass centers, which is presented as a logical extension of concepts introduced in connection with centroids. A

  20. Elements of probability theory

    CERN Document Server

    Rumshiskii, L Z

    1965-01-01

    Elements of Probability Theory presents the methods of the theory of probability. This book is divided into seven chapters that discuss the general rule for the multiplication of probabilities, the fundamental properties of the subject matter, and the classical definition of probability. The introductory chapters deal with the functions of random variables; continuous random variables; numerical characteristics of probability distributions; center of the probability distribution of a random variable; definition of the law of large numbers; stability of the sample mean and the method of moments

  1. [Healthcare marketing elements].

    Science.gov (United States)

    Ameri, Cinzia; Fiorini, Fulvio

    2014-01-01

    Marketing puts its foundation on a few key concepts: need-demand, product-service, satisfaction, exchange, market, or business structure manufacturing / supply. The combination of these elements allows you to build an effective marketing strategy. Crucial in this respect is to remember the Porter matrix, which shows that for a correct analysis of the relevant market is necessary to refer to the "five forces at play", ie: customers, competitors, new entrants and substitutes threat. Another key lever for proper marketing oriented approach is the continuous and constant monitoring of the application, anticipating their dissatisfactions.

  2. [Healthcare marketing elements].

    Science.gov (United States)

    Ameri, Cinzia; Fiorini, Fulvio

    2014-01-01

    Marketing puts its foundation on a few key concepts: need-demand, product-service, satisfaction, exchange, market, or business structure manufacturing / supply. The combination of these elements allows you to build an effective marketing strategy. Crucial in this respect is to remember the Porter matrix, which shows that for a correct analysis of the relevant market is necessary to refer to the "five forces at play", ie: customers, competitors, new entrants and substitutes threat. Another key lever for proper marketing oriented approach is the continuous and constant monitoring of the application, anticipating their dissatisfactions. PMID:24777920

  3. Elements of energy conversion

    CERN Document Server

    Russell, Charles R

    2013-01-01

    Elements of Energy Conversion brings together scattered information on the subject of energy conversion and presents it in terms of the fundamental thermodynamics that apply to energy conversion by any process. Emphasis is given to the development of the theory of heat engines because these are and will remain most important power sources. Descriptive material is then presented to provide elementary information on all important energy conversion devices. The book contains 10 chapters and opens with a discussion of forms of energy, energy sources and storage, and energy conversion. This is foll

  4. Extractability of risk elements and nutrition elements from ash

    OpenAIRE

    Hrma, Jiří

    2012-01-01

    The thesis „Extractability of risk elements and nutrition elements from ash“ studies the determination of physicochemical properties of ash and compares the mobility of heavy metals and nutrition elements in various samples. The aim of the study was to determine the extractability of heavy metals and nutrition elements from biomass ash and their chemical speciation using sequential extraction procedure based upon Tessier which was modified for given matrix. The results permit to classify m...

  5. Ring-laser gyroscope system using dispersive element(s)

    Science.gov (United States)

    Smith, David D. (Inventor)

    2010-01-01

    A ring-laser gyroscope system includes a ring-laser gyroscope (RLG) and at least one dispersive element optically coupled to the RLG's ring-shaped optical path. Each dispersive element has a resonant frequency that is approximately equal to the RLG's lasing frequency. A group index of refraction defined collectively by the dispersive element(s) has (i) a real portion that is greater than zero and less than one, and (ii) an imaginary portion that is less than zero.

  6. Fundamental Atomtronic Circuit Elements

    Science.gov (United States)

    Lee, Jeffrey; McIlvain, Brian; Lobb, Christopher; Hill, Wendell T., III

    2012-06-01

    Recent experiments with neutral superfluid gases have shown that it is possible to create atomtronic circuits analogous to existing superconducting circuits. The goals of these experiments are to create complex systems such as Josephson junctions. In addition, there are theoretical models for active atomtronic components analogous to diodes, transistors and oscillators. In order for any of these devices to function, an understanding of the more fundamental atomtronic elements is needed. Here we describe the first experimental realization of these more fundamental elements. We have created an atomtronic capacitor that is discharged through a resistance and inductance. We will discuss a theoretical description of the system that allows us to determine values for the capacitance, resistance and inductance. The resistance is shown to be analogous to the Sharvin resistance, and the inductance analogous to kinetic inductance in electronics. This atomtronic circuit is implemented with a thermal sample of laser cooled rubidium atoms. The atoms are confined using what we call free-space atom chips, a novel optical dipole trap produced using a generalized phase-contrast imaging technique. We will also discuss progress toward implementing this atomtronic system in a degenerate Bose gas.

  7. NIH Common Data Elements Repository

    Data.gov (United States)

    U.S. Department of Health & Human Services — The NIH Common Data Elements (CDE) Repository has been designed to provide access to structured human and machine-readable definitions of data elements that have...

  8. A new large-DNA-fragment delivery system based on integrase activity from an integrative and conjugative element.

    Science.gov (United States)

    Miyazaki, Ryo; van der Meer, Jan Roelof

    2013-07-01

    During the past few decades, numerous plasmid vectors have been developed for cloning, gene expression analysis, and genetic engineering. Cloning procedures typically rely on PCR amplification, DNA fragment restriction digestion, recovery, and ligation, but increasingly, procedures are being developed to assemble large synthetic DNAs. In this study, we developed a new gene delivery system using the integrase activity of an integrative and conjugative element (ICE). The advantage of the integrase-based delivery is that it can stably introduce a large DNA fragment (at least 75 kb) into one or more specific sites (the gene for glycine-accepting tRNA) on a target chromosome. Integrase recombination activity in Escherichia coli is kept low by using a synthetic hybrid promoter, which, however, is unleashed in the final target host, forcing the integration of the construct. Upon integration, the system is again silenced. Two variants with different genetic features were produced, one in the form of a cloning vector in E. coli and the other as a mini-transposable element by which large DNA constructs assembled in E. coli can be tagged with the integrase gene. We confirmed that the system could successfully introduce cosmid and bacterial artificial chromosome (BAC) DNAs from E. coli into the chromosome of Pseudomonas putida in a site-specific manner. The integrase delivery system works in concert with existing vector systems and could thus be a powerful tool for synthetic constructions of new metabolic pathways in a variety of host bacteria. PMID:23686268

  9. Trace element emissions from coal

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2012-09-15

    Trace elements are emitted during coal combustion. The quantity, in general, depends on the physical and chemical properties of the element itself, the concentration of the element in the coal, the combustion conditions and the type of particulate control device used, and its collection efficiency as a function of particle size. Some trace elements become concentrated in certain particle streams following combustion such as bottom ash, fly ash, and flue gas particulate matter, while others do not. Various classification schemes have been developed to describe this partitioning behaviour. These classification schemes generally distinguish between: Class 1: elements that are approximately equally concentrated in the fly ash and bottom ash, or show little or no fine particle enrichment, examples include Mn, Be, Co and Cr; Class 2: elements that are enriched in the fly ash relative to bottom ash, or show increasing enrichment with decreasing particle size, examples include As, Cd, Pb and Sb; Class 3: elements which are emitted in the gas phase (primarily Hg (not discussed in this review), and in some cases, Se). Control of class 1 trace elements is directly related to control of total particulate matter emissions, while control of the class 2 elements depends on collection of fine particulates. Due to the variability in particulate control device efficiencies, emission rates of these elements can vary substantially. The volatility of class 3 elements means that particulate controls have only a limited impact on the emissions of these elements.

  10. Accelerator vacuum system elements

    International Nuclear Information System (INIS)

    Some elements of vacuum systems are investigated. Considerable attention has been given to the investigation into peculiarities in pumping out of a ionoguide for transportation of an accelerated charged particles beam the spread of which often attains a considerable length. The number of pumps over the ionoguide length is experimentally determined. It is shown that as a result of ionoguide warm-up the pumping out time is considerably reduced maximum permissible pressure is decreased by two orders and lesser rate of pump pumping out is required. The investigations have shown that when operating the ionoguide there is no necessity in setting up seals between the ionoguide and magnetodischarged pump. The causes of the phenomenon in which the pressure near the pump is greater than in the end of the ionoguide, are impurities carried in by the pump into the ionoguide volume and the pumping out capacity of the pressure converter

  11. Finite element modelling

    International Nuclear Information System (INIS)

    The Finite Element Method (FEM) is a numerical technique for finding approximate solutions to boundary value problems. While FEM is commonly used to solve solid mechanics equations, it can be applied to a large range of BVPs from many different fields. FEM has been used for reactor fuels modelling for many years. It is most often used for fuel performance modelling at the pellet and pin scale, however, it has also been used to investigate properties of the fuel material, such as thermal conductivity and fission gas release. Recently, the United Stated Department Nuclear Energy Advanced Modelling and Simulation Program has begun using FEM as the basis of the MOOSE-BISON-MARMOT Project that is developing a multi-dimensional, multi-physics fuel performance capability that is massively parallel and will use multi-scale material models to provide a truly predictive modelling capability. (authors)

  12. Heavy-element research

    International Nuclear Information System (INIS)

    The status is reported of studies on the solid-state chemistry of the actinides and lanthanides, spectroscopy of actinide compounds, and dynamic chemical description of actinide elements in solution. Phase studies were done on Rb2UO4, K2UO4, Li2UO4, and Es2U2O7. The lithium neptunate (VI) system was investigated and the existence of Li2NpO4 was established. In oxidation-reduction studies it was shown that Am(III) can be electrolytically oxidized to Am(IV) in strong H3PO4, but Cf(III) and Pr(III) do not oxidize. The low-temperature absorption spectrum of thin films of NpBr3 was investigated. (U.S.)

  13. Nuclear reactor fuel element

    International Nuclear Information System (INIS)

    The grid-shaped spacer for PWR fuel elements consists of flat, upright metal bars at right angles to the fuel rods. In one corner of a grid mesh it has a spring with two end parts for the fuel rod. The cut-outs for the end parts start from an end edge of the metal bar parallel to the fuel rods. The transverse metal bar is one of four outer metal bars. Both end parts of the spring have an extension parallel to this outer metal arm, which grips a grid mesh adjacent to this grid mesh at the side in one corner of the spacer and forms an end part of a spring for the fuel rod there on the inside of the outer metal bar. (HP)

  14. The fantastic four.. elements

    Science.gov (United States)

    Marsili, Antonella; D'Addezio, Giuliana; Rubbia, Giuliana; Ramieri, Caterina; Todaro, Riccardo; Scipilliti, Francesca; Tosto, Eleonora

    2015-04-01

    With a "Sunday between territory and music to 'National Institute of Geophysics and Volcanology," October 12, 2014 the headquarters of INGV Roma kicked off the activities of the second edition of the Week of Planet Earth. The laboratory of scientific outreach and museum activities together with volunteers of the National Civil Service have organized the whole day dedicated to the dissemination of earth sciences, involving adults and children. Especially for primary school children a laboratory was made involving three amusing activities all aimed at inspiring respect for the Earth: a theatrical representation called "The Fantastic 4... elements", a behavioral game and a nursery rhyme reading. The theater as a means of communication of science is an innovative and creative way to introduce children to important scientific concepts. The use of this methodology and simple language favoring the emotional involvement of the child facilitating learning. The main character is a child, chosen to facilitate the identification of the spectators with the protagonist, that through a fantastic journey discovers the importance of the four elements of our planet: earth, fire, air and water. As a second step, volunteers involved children in reading a nursery rhyme "the ABC to become a Friend of the Earth" inviting them to protect and respect the environment and its resources. Finally, the behavioral game gave indications about behaviors to adopt to safeguard the planet. Volunteers introduced a billboard divided into two colors, green to indicate the right behaviors and red for the wrong ones. Each child, after reading a card with indication on the behavior to adopt, had to decide if they were correct or not with respect to the environment safeguard. After listening to the children's answer, the volunteer gave the correct explanation about the appropriate behavior to adopt. At the end of the activities, each child received a certificate as "a friend of Planet Earth".

  15. Novel high-performance element in the electromagnetic finite-element method--node-edge element

    Institute of Scientific and Technical Information of China (English)

    Sheng Xinqing; Peng Zhen

    2008-01-01

    It is known in the computational electromagnetics (CEM) that the node element has a relative well-conditioned matrix,but suffers from the spurious solution problem; whereas the edge element has no spurious solutions,but usually produces an ill-conditioned matrix.Particularly,when the mesh is over dense,the iterative solution of the matrix equation from edge element converges very slowly.Based on the node element and edge element,a node-edge element is presented,which has no spurious solutions and better-conditioned matrix.Numerical experiments demonstrate that the proposed node-edge element is more efficient than now-widely used edge element.

  16. An element by element spectral element method for elastic wave modeling

    Institute of Scientific and Technical Information of China (English)

    LIN Weijun; WANG Xiuming; ZHANG Hailan

    2006-01-01

    The spectral element method which combines the advantages of spectral method with those of finite element method,provides an efficient tool in simulating elastic wave equation in complex medium. Based on weak form of elastodynamic equations, mathematical formulations for Legendre spectral element method are presented. The wave field on an element is discretized using high-order Lagrange interpolation, and integration over the element is accomplished based upon the Gauss-Lobatto-Legendre integration rule. This results in a diagonal mass matrix which leads to a greatly simplified algorithm. In addition, the element by element technique is introduced in our method to reduce the memory sizes and improve the computation efficiency. Finally, some numerical examples are presented to demonstrate the spectral accuracy and the efficiency. Because of combinations of the finite element scheme and spectral algorithms, this method can be used for complex models, including free surface boundaries and strong heterogeneity.

  17. The Chemistry of Superheavy Elements

    CERN Document Server

    Schädel, M

    2003-01-01

    The chemistry of transactinide or superheavy elements has reached element 108. Preparations are under way to leap to element 112 and beyond. The current status of this atom-at-a-time chemical research and its future perspectives are reviewed from an experimental point of view together with some of the interesting results from n -rich nuclides near and at the N=162 neutron shell. Experimental techniques and important results enlightening typical chemical properties of elements 104 through 108 are presented in an exemplary way. From the results of these experiments it is justified to place these elements in the Periodic Table of the Elements in to groups 4 through 8, respectively. However, mainly due to the influence of relativistic effects, it is no longer possible to deduce detailed chemical properties of these superheavy elements simply from this position.

  18. Site-selected insertional mutagenesis of tomato with maize Ac and Ds elements.

    Science.gov (United States)

    Cooley, M B; Goldsbrough, A P; Still, D W; Yoder, J I

    1996-08-27

    Site-selected insertion (SSI) is a PCR-based technique which uses primers located within the transposon and a target gene for detection of transposon insertions into cloned genes. We screened tomato plants bearing single or multiple copies of maize Ac or Ds transposable elements for somatic insertions at one close-range target and two long-range targets. Eight close-range Ds insertions near the right border of the T-DNA were recovered. Sequence analysis showed a precise junction between the transposon and the target for all insertions. Two insertions in separate plants occurred at the same site, but others appeared dispersed in the region of the right T-DNA border with no target specificity. However, insertions showed a preference for one orientation of the transposon. Use of plants with multiple Ac (HiAc) or Ds (HiDs) elements allowed detection of somatic insertions at two single-copy genes, PG (polygalacturonase) and DFR (dihydroflavonol 4-reductase). Certain HiDs plants showed much higher rates of insertion into PG than others. Insertions in PG and DFR were found throughout the gene regions monitored and, with the exception of one insertion in PG, the junctions between transposon and target were exact. SSI analysis of progeny from the HiDs parents revealed that in some cases the tendency to incur high levels of somatic insertions in PG was inherited. Inheritance of this character is an indication that SSI could be used to direct a search for germinal PG insertions in tomato. PMID:8804392

  19. Chemistry of the superheavy elements.

    Science.gov (United States)

    Schädel, Matthias

    2015-03-13

    The quest for superheavy elements (SHEs) is driven by the desire to find and explore one of the extreme limits of existence of matter. These elements exist solely due to their nuclear shell stabilization. All 15 presently 'known' SHEs (11 are officially 'discovered' and named) up to element 118 are short-lived and are man-made atom-at-a-time in heavy ion induced nuclear reactions. They are identical to the transactinide elements located in the seventh period of the periodic table beginning with rutherfordium (element 104), dubnium (element 105) and seaborgium (element 106) in groups 4, 5 and 6, respectively. Their chemical properties are often surprising and unexpected from simple extrapolations. After hassium (element 108), chemistry has now reached copernicium (element 112) and flerovium (element 114). For the later ones, the focus is on questions of their metallic or possibly noble gas-like character originating from interplay of most pronounced relativistic effects and electron-shell effects. SHEs provide unique opportunities to get insights into the influence of strong relativistic effects on the atomic electrons and to probe 'relativistically' influenced chemical properties and the architecture of the periodic table at its farthest reach. In addition, they establish a test bench to challenge the validity and predictive power of modern fully relativistic quantum chemical models. PMID:25666065

  20. I element distribution in mitotic heterochromatin of Drosophila melanogaster reactive strains: identification of a specific site which is correlated with the reactivity levels.

    Science.gov (United States)

    Dimitri, P; Bucheton, A

    2005-01-01

    The I factor is a Drosophila melanogaster LINE-like element that efficiently transposes in the genetic system of I-R hybrid dysgenesis. It has been suggested that some of the I-related sequences located in the heterochromatin of D. melanogaster are involved in the regulation of I factor activity. In this work we have performed fluorescent in situ hybridization (FISH) mapping of I element sequences in mitotic heterochromatin of nine differentially reactive D. melanogaster strains. The results of our analysis showed that a single hybridization site mapping to region h28 of the distal heterochromatin of the X chromosome is present in three strains with low or intermediate levels of reactivity, while it is undetectable in six highly reactive strains. Together, these observations suggest a negative correlation between I sequences located at h28 and the level of reactivity. To this regard, it is intriguing that flamenco and COM, two loci that regulate the activity of D. melanogaster endogenous retroviruses also map to the distal heterochromatin of the X chromosome. Our data represent the first experimental evidence in favour of a silencing effect exerted by naturally occurring I element sequences located in pericentromeric heterochromatin. PMID:16093668

  1. Transuranium organometallic elements

    International Nuclear Information System (INIS)

    This paper reports that neptunium and plutonium metal react cleanly with 1.5 equiv of I2 in aprotic ligating solvents, L, to give the triiodide complexes as tetrasolvates, AnI3L4 [An is Np, L is tetrahydrofuran (THF) (1); An is Pu, L is THF (2a), pyridine (Py) (2b), and dimethyl sulfoxide (DMSO) (2c)]. These complexes are convenient precursors to both new and existing transuranium compounds. Reaction of the triiodide complexes 1 and 2a in hexane with 3 equiv of sodium bis(trimethylsilyl)amide provides the volatile, solvate-free tris (silylamide) complexes, An[N(SiMe3)2]3 (An is Np, 3; An is Pu, 4). Hexan solutions of 3 and 4 react rapidly with 3 equiv of HO-2,6-(t-C4H9)2C6H3 to give the aryloxide complexes An[O-26-(t-C4H9)2C6H3]3 (An is Np 5; An is Pu, 6). Preliminary investigations indicate that complexes 5 and 6 react with lithium bis(trimethylsilyl)methanide, Li[CH(SiMe3)2], in hexane to give the alkyl complexes An[CH(SiME3)2]3 (An is Np, 7; An is PU, 8). Plutonium triiodide complex 2a readily reacts with LiC5H5 to give the known (n5-C5H5)3Pu(THF). The homoleptic silylamide, aryloxide, and alkyl complexes are the first reported examples for transuranium elements

  2. Matrix elements of unstable states

    CERN Document Server

    Bernard, V; Meißner, U -G; Rusetsky, A

    2012-01-01

    Using the language of non-relativistic effective Lagrangians, we formulate a systematic framework for the calculation of resonance matrix elements in lattice QCD. The generalization of the L\\"uscher-Lellouch formula for these matrix elements is derived. We further discuss in detail the procedure of the analytic continuation of the resonance matrix elements into the complex energy plane and investigate the infinite-volume limit.

  3. EDGE-ORIENTED HEXAGONAL ELEMENTS

    Institute of Scientific and Technical Information of China (English)

    Chao Yang; Jiachang Sun

    2007-01-01

    In this paper, two new nonconforming hexagonal elements are presented, which are based on the trilinear function space Q(3)1 and are edge-oriented, analogical to the case of the rotated Q1 quadrilateral element. A priori error estimates are given to show that the new elements achieve first-order accuracy in the energy norm and second-order accuracy in the L2 norm. This theoretical result is confirmed by the numerical tests.

  4. Photoshop Elements 10 For Dummies

    CERN Document Server

    Obermeier, Barbara

    2011-01-01

    Perfect your photos and images with this "focused" guide to the latest version of Photoshop Elements For most of us, the professional-level Photoshop is overkill for our needs. Amateur photographers and photo enthusiasts turn to Photoshop Elements for a powerful but simpler way to edit and retouch their snapshots. Photoshop Elements 10 For Dummies, fully updated and revised for the latest release of this software product, helps you navigate Elements to create, edit, fix, share, and organize the high-quality images you desire. Full color pages bring the techniques to life and make taking great

  5. Trace element emissions. Literature review

    International Nuclear Information System (INIS)

    Application of fossil fuels by various utilities results in the emission of trace elements to air, water and solid waste streams. Elements present in coal are released as particles or as vapours during coal combustion or gasification. Owing to the increased consumption of coal, especially for power generation, huge quantities of potentially hazardous trace elements are released into the atmosphere every year. It is necessary to evaluate the emissions of each trace element from coal-fired combustion or gasification systems, and their effects on the environment. Present research interests should be aimed at determining the sources, concentrations, and environmental impact of trace elements related with energy generation and relevant control technologies. Two of the emerging advanced coal gasification technologies, such as integrated gasification combined cycle (IGCC) and integrated gasification fuel cell (IGFC) are presently experiencing potential difficulties due to trace element emissions. In order to control the levels of these contaminants within regulatory limits and to ensure the efficient operation of fuel cells, it is necessary to determine the type and quantity of trace elements emitted from coal gasification-based systems as a function of system, operating conditions, and type of coal. The partitioning of the trace elements is influenced by the gasification conditions. In general, the following gasification conditions are expected to influence the distribution of trace elements between various product streams. (a) reducing and oxidizing environments (b) gas phase composition, pressure and temperature. The present report was aimed at finding and identifying gaps existing in the literature on the trace element transformations during gasification. Also included in the report is the modelling of relevant transformation mechanisms of the trace elements during gasification as a function of coal type and process conditions. 7 figs., 6 tabs., 69 refs

  6. Design transposal workshop: visualising through the gyre

    OpenAIRE

    Dimitrijevic, Katarina

    2015-01-01

    The workshop's primary objective is to visualize the future possibilities for ocean plastic de-pollution, using plastic disposal to co-create a 3D gyre installation. It will incorporate joyful activism, trash aesthetics and craft making.The workshop will be a participatory platform, facilitating rather than dictating. It proposes that a changing relation to disposal is a changing relation to oneself. The future aim of this ongoing design research is to co-create new discard values and induce ...

  7. Repetitive elements in parasitic protozoa

    OpenAIRE

    Clayton Christine

    2010-01-01

    Abstract A recent paper published in BMC Genomics suggests that retrotransposition may be active in the human gut parasite Entamoeba histolytica. This adds to our knowledge of the various types of repetitive elements in parasitic protists and the potential influence of such elements on pathogenicity. See research article http://www.biomedcentral.com/1471-2164/11/321

  8. Clean Elements in Abelian Rings

    Indian Academy of Sciences (India)

    Angelina Y M Chin

    2009-04-01

    Let be a ring with identity. An element in is said to be clean if it is the sum of a unit and an idempotent. is said to be clean if all of its elements are clean. If every idempotent in is central, then is said to be abelian. In this paper we obtain some conditions equivalent to being clean in an abelian ring.

  9. Solution of Finite Element Equations

    DEFF Research Database (Denmark)

    Krenk, Steen

    An important step in solving any problem by the finite element method is the solution of the global equations. Numerical solution of linear equations is a subject covered in most courses in numerical analysis. However, the equations encountered in most finite element applications have some special...

  10. Fuel element for nuclear reactor

    International Nuclear Information System (INIS)

    In order to avoid a can box or an adjacent fuel element sitting on the spacer of a fuel element in the corner during assembly, the top and bottom edges of the outer bars of the spacers are provided with deflector bars, which have projections projecting beyond the outside of the outer bars. (orig.)

  11. Repetitive elements in parasitic protozoa

    Directory of Open Access Journals (Sweden)

    Clayton Christine

    2010-05-01

    Full Text Available Abstract A recent paper published in BMC Genomics suggests that retrotransposition may be active in the human gut parasite Entamoeba histolytica. This adds to our knowledge of the various types of repetitive elements in parasitic protists and the potential influence of such elements on pathogenicity. See research article http://www.biomedcentral.com/1471-2164/11/321

  12. Subsidence modelling with analytic elements.

    NARCIS (Netherlands)

    Fokker, P.A.; Orlic, B.

    2000-01-01

    The method of Analytic Elements has been extended to enable elasticity calculations, to evaluate subsidence at the surface as resulting from extraction of oil or gas. Validation has been achieved by comparison with more limited analytical methods and with a comprehensive finite-element simulator. Th

  13. Stabilized Finite Elements with Matlab

    OpenAIRE

    Asensio, M. I.; A. Russo

    2002-01-01

    The purpose of this note is to explain the MATLAB code developed to solve an advection diffusion-reaction problem, with different Finite Element Methods: Standard Galerkin [7], Streamline Upwind/ Petrov-Galerkin (SUPG) [6], Unsual Stabilized [8, 9] and Residual-Free Bubbles [3, 4, 5], for both linear (P1) (see [1]) and quadratic (P2) (see [2]) triangular finite elements.

  14. Massively Parallel Finite Element Programming

    KAUST Repository

    Heister, Timo

    2010-01-01

    Today\\'s large finite element simulations require parallel algorithms to scale on clusters with thousands or tens of thousands of processor cores. We present data structures and algorithms to take advantage of the power of high performance computers in generic finite element codes. Existing generic finite element libraries often restrict the parallelization to parallel linear algebra routines. This is a limiting factor when solving on more than a few hundreds of cores. We describe routines for distributed storage of all major components coupled with efficient, scalable algorithms. We give an overview of our effort to enable the modern and generic finite element library deal.II to take advantage of the power of large clusters. In particular, we describe the construction of a distributed mesh and develop algorithms to fully parallelize the finite element calculation. Numerical results demonstrate good scalability. © 2010 Springer-Verlag.

  15. Chemical elements distribution in cells

    Science.gov (United States)

    Ortega, R.

    2005-04-01

    Analysing, imaging and understanding the cellular chemistry, from macromolecules to monoatomic elements, is probably a major challenge for the scientific community after the conclusion of the genome project. In order to probe the distribution of elements in cells, especially the so-called inorganic elements, it is necessary to apply microanalytical techniques with sub-micrometer resolution and high chemical sensitivity. This paper presents the current status of chemical element imaging inside cells, and a comparison of the different analytical techniques available: nuclear microprobe, electron microprobe and electron energy loss spectroscopy, synchrotron radiation microprobe, secondary ion mass spectrometry and fluorescence microscopy methods. Examples of intracellular chemical elements distributions relevant to cancer pharmacology, medical imaging, metal carcinogenesis and neuropathology studies obtained by nuclear microprobe and other microanalytical techniques are presented.

  16. Second order tensor finite element

    Science.gov (United States)

    Oden, J. Tinsley; Fly, J.; Berry, C.; Tworzydlo, W.; Vadaketh, S.; Bass, J.

    1990-01-01

    The results of a research and software development effort are presented for the finite element modeling of the static and dynamic behavior of anisotropic materials, with emphasis on single crystal alloys. Various versions of two dimensional and three dimensional hybrid finite elements were implemented and compared with displacement-based elements. Both static and dynamic cases are considered. The hybrid elements developed in the project were incorporated into the SPAR finite element code. In an extension of the first phase of the project, optimization of experimental tests for anisotropic materials was addressed. In particular, the problem of calculating material properties from tensile tests and of calculating stresses from strain measurements were considered. For both cases, numerical procedures and software for the optimization of strain gauge and material axes orientation were developed.

  17. Deep investigation of Arabidopsis thaliana junk DNA reveals a continuum between repetitive elements and genomic dark matter.

    Science.gov (United States)

    Maumus, Florian; Quesneville, Hadi

    2014-01-01

    Eukaryotic genomes contain highly variable amounts of DNA with no apparent function. This so-called junk DNA is composed of two components: repeated and repeat-derived sequences (together referred to as the repeatome), and non-annotated sequences also known as genomic dark matter. Because of their high duplication rates as compared to other genomic features, transposable elements are predominant contributors to the repeatome and the products of their decay is thought to be a major source of genomic dark matter. Determining the origin and composition of junk DNA is thus important to help understanding genome evolution as well as host biology. In this study, we have used a combination of tools enabling to show that the repeatome from the small and reducing A. thaliana genome is significantly larger than previously thought. Furthermore, we present the concepts and results from a series of innovative approaches suggesting that a significant amount of the A. thaliana dark matter is of repetitive origin. As a tentative standard for the community, we propose a deep compendium annotation of the A. thaliana repeatome that may help addressing farther genome evolution as well as transcriptional and epigenetic regulation in this model plant.

  18. quadratic spline finite element method

    Directory of Open Access Journals (Sweden)

    A. R. Bahadir

    2002-01-01

    Full Text Available The problem of heat transfer in a Positive Temperature Coefficient (PTC thermistor, which may form one element of an electric circuit, is solved numerically by a finite element method. The approach used is based on Galerkin finite element using quadratic splines as shape functions. The resulting system of ordinary differential equations is solved by the finite difference method. Comparison is made with numerical and analytical solutions and the accuracy of the computed solutions indicates that the method is well suited for the solution of the PTC thermistor problem.

  19. Increased burnup of fuel elements

    International Nuclear Information System (INIS)

    The specialists' group for fuel elements of the Kerntechnische Gesellschaft e.V. held a meeting on ''Increased Burnup of Fuel Elements'' on 9th and 10th of November 1982 at the GKSS Research Center Geesthacht. Most papers dealt with the problems of burnup increase of fuel elements for light water reactors with respect to fuel manufacturing, power plant operation and reprocessing. Review papers were given on the burnup limits for high temperature gas cooled reactors and sodium fast breeder reactors. The meeting ended with a presentation of the technical equipment of the hot laboratory of the GKSS and the programs which are in progress there. (orig.)

  20. Photoshop Elements 9 Digital Classroom

    CERN Document Server

    Team, AGI Creative

    2011-01-01

    Learn Photoshop Elements at your own pace with this unique book-and-DVD training packagePhotoshop Elements is the leading image-editing software, and this personal training course uses a full-color book plus video tutorials on the DVD to teach you how to use all its features. Each of the 13 lessons is presented with step-by-step instructions and includes lesson files and a video explanation of the concepts. You can learn from leading instructors, and do it at your own pace.Photoshop Elements provides professional quality image-editing tools at an affordable price; this book-and-DVD package off

  1. Spacer for a fuel element

    International Nuclear Information System (INIS)

    Spacers for fuel pins arranged to form congish fuel elements can be shaped as plates with openings in accordance with the fuel pin grid. Such a plate that covers the cross section of a fuel element consists according to the invention of at least two parts that are offset in the fuel element's longitudinal direction and joint hinge-like in at least one grid position. Thus, one has smaller parts that are easier to work on with due accuracy. The invention is designed in particular for breeder reactors and high-conversion reactors. (orig.)

  2. Repetitive genome elements in a European corn borer, Ostrinia nubilalis, bacterial artificial chromosome library were indicated by bacterial artificial chromosome end sequencing and development of sequence tag site markers: implications for lepidopteran genomic research.

    Science.gov (United States)

    Coates, Brad S; Sumerford, Douglas V; Hellmich, Richard L; Lewis, Leslie C

    2009-01-01

    The European corn borer, Ostrinia nubilalis, is a serious pest of food, fiber, and biofuel crops in Europe, North America, and Asia and a model system for insect olfaction and speciation. A bacterial artificial chromosome library constructed for O. nubilalis contains 36 864 clones with an estimated average insert size of >or=120 kb and genome coverage of 8.8-fold. Screening OnB1 clones comprising approximately 2.76 genome equivalents determined the physical position of 24 sequence tag site markers, including markers linked to ecologically important and Bacillus thuringiensis toxin resistance traits. OnB1 bacterial artificial chromosome end sequence reads (GenBank dbGSS accessions ET217010 to ET217273) showed homology to annotated genes or expressed sequence tags and identified repetitive genome elements, O. nubilalis miniature subterminal inverted repeat transposable elements (OnMITE01 and OnMITE02), and ezi-like long interspersed nuclear elements. Mobility of OnMITE01 was demonstrated by the presence or absence in O. nubilalis of introns at two different loci. A (GTCT)n tetranucleotide repeat at the 5' ends of OnMITE01 and OnMITE02 are evidence for transposon-mediated movement of lepidopteran microsatellite loci. The number of repetitive elements in lepidopteran genomes will affect genome assembly and marker development. Single-locus sequence tag site markers described here have downstream application for integration within linkage maps and comparative genomic studies. PMID:19132072

  3. Repetitive genome elements in a European corn borer, Ostrinia nubilalis, bacterial artificial chromosome library were indicated by bacterial artificial chromosome end sequencing and development of sequence tag site markers: implications for lepidopteran genomic research.

    Science.gov (United States)

    Coates, Brad S; Sumerford, Douglas V; Hellmich, Richard L; Lewis, Leslie C

    2009-01-01

    The European corn borer, Ostrinia nubilalis, is a serious pest of food, fiber, and biofuel crops in Europe, North America, and Asia and a model system for insect olfaction and speciation. A bacterial artificial chromosome library constructed for O. nubilalis contains 36 864 clones with an estimated average insert size of >or=120 kb and genome coverage of 8.8-fold. Screening OnB1 clones comprising approximately 2.76 genome equivalents determined the physical position of 24 sequence tag site markers, including markers linked to ecologically important and Bacillus thuringiensis toxin resistance traits. OnB1 bacterial artificial chromosome end sequence reads (GenBank dbGSS accessions ET217010 to ET217273) showed homology to annotated genes or expressed sequence tags and identified repetitive genome elements, O. nubilalis miniature subterminal inverted repeat transposable elements (OnMITE01 and OnMITE02), and ezi-like long interspersed nuclear elements. Mobility of OnMITE01 was demonstrated by the presence or absence in O. nubilalis of introns at two different loci. A (GTCT)n tetranucleotide repeat at the 5' ends of OnMITE01 and OnMITE02 are evidence for transposon-mediated movement of lepidopteran microsatellite loci. The number of repetitive elements in lepidopteran genomes will affect genome assembly and marker development. Single-locus sequence tag site markers described here have downstream application for integration within linkage maps and comparative genomic studies.

  4. Essential Elements of Geologic Reports.

    Science.gov (United States)

    Webb, Elmer James

    1988-01-01

    Described is a report outline for geologic reports. Essential elements include title; abstract; introduction; stratigraphy; petrography; geochemistry; petrology; geophysics; structural geology; geologic history; modeling; economics; conclusions; and recommendations. (Author/CW)

  5. Finite element methods for engineers

    CERN Document Server

    Fenner, Roger T

    2013-01-01

    This book is intended as a textbook providing a deliberately simple introduction to finite element methods in a way that should be readily understandable to engineers, both students and practising professionals. Only the very simplest elements are considered, mainly two dimensional three-noded “constant strain triangles”, with simple linear variation of the relevant variables. Chapters of the book deal with structural problems (beams), classification of a broad range of engineering into harmonic and biharmonic types, finite element analysis of harmonic problems, and finite element analysis of biharmonic problems (plane stress and plane strain). Full Fortran programs are listed and explained in detail, and a range of practical problems solved in the text. Despite being somewhat unfashionable for general programming purposes, the Fortran language remains very widely used in engineering. The programs listed, which were originally developed for use on mainframe computers, have been thoroughly updated for use ...

  6. Environmental research on actinide elements

    International Nuclear Information System (INIS)

    The papers synthesize the results of research sponsored by DOE's Office of Health and Environmental Research on the behavior of transuranic and actinide elements in the environment. Separate abstracts have been prepared for the 21 individual papers

  7. In situ trace element microanalysis

    Science.gov (United States)

    Burnett, D. S.; Woolum, D. S.

    1983-01-01

    The use of particle-track-radiography and X-ray- fluorescence techniques in the in situ measurement of trace (less than 1000 ppm) elements in single mineral phases of polished sections is surveyed, and examples of their application to ordinary, carbonaceous and enstatite chondrites are provided. Radiographic methods surveyed include fission-track radiography (for U, Th, and Pu-244), alpha radiography using nuclear reactions (for Li and B), alpha autoradiography (for Bi and Pb), and beta autoradiography (for several elements in synthetic or biological samples). Two X-ray-fluorescence methods are compared: (1) photon-induced X-ray emission (PIXE), and (2) the potential use of synchrotron radiation. The latter is shown to allow much greater sensitivity than current PIXE technology and a much broader range of elements than particle-track radiography: the ppm analysis of 10-micron grains for all elements heavier than Na. These advantages are seen as balancing the high cost of accelerator use.

  8. Naturalistic Elements in The Egg

    Institute of Scientific and Technical Information of China (English)

    惠菲菲

    2013-01-01

    The purpose of the study is to analyze the naturalistic elements in The Egg, which is taken from the collection of short stories, The Triumph of the Egg. The study states the ideology and technique of naturalism and then exams how naturalistic ele-ments are revealed in the fiction. Then it comes to the conclusion that the family is defeated by the egg and the life of human be-ings is under control of complicated forces from both inside and outside.

  9. Nuclear reactor fuel element splitter

    International Nuclear Information System (INIS)

    A method and apparatus are disclosed for removing nuclear fuel from a clad fuel element. The fuel element is power driven past laser beams which simultaneously cut the cladding lengthwise into at least two longitudinal pieces. The axially cut lengths of cladding are then separated, causing the nuclear fuel contained therein to drop into a receptacle for later disposition. The cut lengths of cladding comprise nuclear waste which is disposed of in a suitable manner. 6 claims, 10 drawing figures

  10. Elemental mercury exposure: peripheral neurotoxicity.

    OpenAIRE

    Levine, S P; Cavender, G D; Langolf, G D; Albers, J W

    1982-01-01

    Nerve conduction tests were performed on the right ulnar nerve of factory workers exposed to elemental mercury vapour. Time integrated urine mercury indices were used to measure the degree of exposure. Workers with prolonged distal latencies had significantly higher urine mercury concentrations when compared with those with normal latencies. Significant correlations between increasing urine mercury concentrations and prolonged motor and sensory distal latencies were established. Elemental mer...

  11. PROPOSAL OF NEW OPTICAL ELEMENTS

    Directory of Open Access Journals (Sweden)

    Goce Chadzitaskos

    2013-10-01

    Full Text Available A overview of our patented proposals of new optical elements is presented. The elements are suitable for laser pulse analysis, telescopy, X-ray microscopy and X-ray telescopy. They are based on the interference properties of light: a special grating for a double slit pattern, parabolic strip imaging for a telescope, and Bragg’s condition for X-ray scattering on a slice of a single crystal for X-raymicroscopy and X-ray telescopy.

  12. First identification of Tn916-like element in industrial strains of Lactobacillus vini that spread the tet-M resistance gene.

    Science.gov (United States)

    Mendonça, Allyson Andrade; de Lucena, Brigida Thais Luckwu; de Morais, Márcia Maria Camargo; de Morais, Marcos Antonio

    2016-02-01

    The open process used to ferment sugar cane juice or molasses to produce ethanol fuel is prone to contamination by bacterial cells of different species, in particular Lactobacilli. The situation can be exacerbated by the emergence of resistant cells to industrial antibiotics that are normally used to combat this contamination. In this work, two Lactobacillus vini isolates from ethanol distilleries were identified and found to be resistant to doxycycline, a tetracycline derivative, although sensitive to other antibiotics tested. The identification of these isolates was confirmed by sequencing the pheS gene and their clonal origin was shown by PCR-fingerprinting analysis. Moreover, the isolates were shown to carry the transposable element Tn916 that harboured the tet-M gene. Furthermore, conjugation experiments showed that both isolates were capable of transferring this element, and as a result, the tet-M gene, to Enterococcus faecalis reference strain. Finally, the identification of tetracycline resistance in the same distilleries in other Lactobacilli, suggested that inter-species transfer of antibiotic resistance may be occurring in the industrial environment, and thus impairing the efficiency of the antibiotic treatment and causing serious health concerns. PMID:26722009

  13. Resistance determinants and mobile genetic elements of an NDM-1-encoding Klebsiella pneumoniae strain.

    Directory of Open Access Journals (Sweden)

    Corey M Hudson

    Full Text Available Multidrug-resistant Enterobacteriaceae are emerging as a serious infectious disease challenge. These strains can accumulate many antibiotic resistance genes though horizontal transfer of genetic elements, those for β-lactamases being of particular concern. Some β-lactamases are active on a broad spectrum of β-lactams including the last-resort carbapenems. The gene for the broad-spectrum and carbapenem-active metallo-β-lactamase NDM-1 is rapidly spreading. We present the complete genome of Klebsiella pneumoniae ATCC BAA-2146, the first U.S. isolate found to encode NDM-1, and describe its repertoire of antibiotic-resistance genes and mutations, including genes for eight β-lactamases and 15 additional antibiotic-resistance enzymes. To elucidate the evolution of this rich repertoire, the mobile elements of the genome were characterized, including four plasmids with varying degrees of conservation and mosaicism and eleven chromosomal genomic islands. One island was identified by a novel phylogenomic approach, that further indicated the cps-lps polysaccharide synthesis locus, where operon translocation and fusion was noted. Unique plasmid segments and mosaic junctions were identified. Plasmid-borne blaCTX-M-15 was transposed recently to the chromosome by ISEcp1. None of the eleven full copies of IS26, the most frequent IS element in the genome, had the expected 8-bp direct repeat of the integration target sequence, suggesting that each copy underwent homologous recombination subsequent to its last transposition event. Comparative analysis likewise indicates IS26 as a frequent recombinational junction between plasmid ancestors, and also indicates a resolvase site. In one novel use of high-throughput sequencing, homologously recombinant subpopulations of the bacterial culture were detected. In a second novel use, circular transposition intermediates were detected for the novel insertion sequence ISKpn21 of the ISNCY family, suggesting that it uses

  14. Marine oligotrophy and element biogeochemistry

    International Nuclear Information System (INIS)

    A biogeochemical model has been developed that explains the inverse and non-linear relationship between Po-210 concentration in zooplankton and their biomass, under oligotrophic conditions in French Polynesia. This study identified other elements with comparable accumulatory behaviours to Po-210 in phytoplankton, seston and zooplankton, that are proposed to be critical to its enhanced environmental levels under oligotrophy. Field investigation in the Gulf of Papua showed that four of these a priori identified elements viz Cd, Co, Pb and Mn, as well as Cr and Ni, showed elevated water concentrations with reduced biological productivity, results that are consistent with those previously obtained for Po-210 and the proposed explanatory model. These findings point to the enhanced susceptibility of oligotrophic systems to contamination from particle-reactive elements. (author)

  15. Mechanical Analogies of Fractional Elements

    Institute of Scientific and Technical Information of China (English)

    HU Kai-Xin; ZHU Ke-Qin

    2009-01-01

    A Fractional element model describes a special kind of viscoelastic material.Its stress is proportional to the fractional-order derivative of strain. Physically the mechanical analogies of fractional elements can be represented by spring-dashpot fractal networks. We introduce a constitutive operator in the constitutive equations of viscoelastic materials.To derive constitutive operators for spring-dashpot fractal networks, we use Heaviside operational calculus, which provides explicit answers not otherwise obtainable simply.Then the series-parallel formulas for the constitutive operator are derived. Using these formulas, a constitutive equation of fractional element with 1/2-order derivative is obtained.Finally we find the way to derive the constitutive equations with other fractional-order derivatives and their mechanical analogies.

  16. An external drag measuring element

    Science.gov (United States)

    Ringel, Mordechai; Levin, Daniel; Seginer, Arnan

    The accurate measurement of the axial-force component acting on small wind-tunnel models has traditionally made use of integral string balances, which eliminated many accuracy problems, such as friction and hysteresis, but also introduced interactions between the various force and moment sensing elements due to nonlinear elastic phenomena. The reduction of these interactions usually calls for complicated designs, expensive manufacturing, hard-to-handle calibration processes, and cumbersome data reduction programs. An approach is presented that is based on an external axial-force-measuring element and avoids the ill-conditioned design problems of integral balances. Other difficulties that are encountered, such as friction, misalignment, and relative motion between metric elements are considered, and their solution is examined. Calibration and test results show that the new approach duplicates and surpasses the results of much more complicated and expensive integral balances.

  17. The age of the elements

    International Nuclear Information System (INIS)

    The paper is devoted to nuclear cosmochronology. The age of the Universe is estimated with the aid of radioactive nuclear-nuclear chronometers (NC). For calculations it is required that the proportion in which the appropriate pair of NC is at present ('relative abundance') and the proportion for the moment of their formation ('relative production') should be known. A short description is given of production of elements in the process of star evolution. The 'relative production' is calculated theoretically. The relative abundance is determined from experiments, mainly from meteorites. Recentl Lunar rocks have been also coming into use. The following elements are chosen as pairs of chronometers: Th-232/U-238; U-235/U-238; Pu-244/Th-232; J-129/J-127. Using this method the authors have determined the age of elements from 7 to 15 billion years, the best estimate being approximately 10 billion years. This age is quite in an agreement with calculations made by other methods

  18. Elements to diminish radioactive accidents

    International Nuclear Information System (INIS)

    In this work it is presented an application of the cause-effect diagram method or Ichikawa method identifying the elements that allow to diminish accidents when the radioactive materials are transported. It is considered the transport of hazardous materials which include radioactive materials in the period: December 1996 until March 1997. Among the identified elements by this method it is possible to mention: the road type, the radioactive source protection, the grade driver responsibility and the preparation that the OEP has in the radioactive material management. It is showed the differences found between the country inner roads and the Mexico City area. (Author)

  19. Multiphoton spectroscopy in heavy elements

    Energy Technology Data Exchange (ETDEWEB)

    Solarz, R.W.; Paisner, J.A.; Worden, E.F.

    1977-05-03

    Some recently discovered regularities in the spectra of heavy elements which are also applicable to the analysis of the spectra of lighter atoms are described. It is pointed out that stepwise resonant multiphoton methods are irreplaceable tools in the study of high lying states in a complex atomic system. Systematic applications of these methods has permitted regularities to be observed which also hold for the lighter elements. It is noted that greatly increased understanding of the excited state structure of heavy atoms is not possible. 8 references. (JFP)

  20. FINITE ELEMENT ANALYSIS OF STRUCTURES

    Directory of Open Access Journals (Sweden)

    PECINGINA OLIMPIA-MIOARA

    2015-05-01

    Full Text Available The application of finite element method is analytical when solutions can not be applied for deeper study analyzes static, dynamic or other types of requirements in different points of the structures .In practice it is necessary to know the behavior of the structure or certain parts components of the machine under the influence of certain factors static and dynamic . The application of finite element in the optimization of components leads to economic growth , to increase reliability and durability organs studied, thus the machine itself.

  1. Organic chemistry of elemental phosphorus

    Energy Technology Data Exchange (ETDEWEB)

    Milyukov, V A; Budnikova, Yulia H; Sinyashin, Oleg G [A.E. Arbuzov Institute of Organic and Physical Chemistry, Kazan Scientific Centre of the Russian Academy of Sciences, Kazan (Russian Federation)

    2005-09-30

    The principal achievements and the modern trends in the development of the chemistry of elemental phosphorus are analysed, described systematically and generalised. The possibilities and advantages of the preparation of organophosphorus compounds directly from white phosphorus are demonstrated. Attention is focused on the activation and transformation of elemental phosphorus in the coordination sphere of transition metal complexes. The mechanisms of the reactions of white phosphorus with nucleophilic and electrophilic reagents are discussed. Electrochemical approaches to the synthesis of organic phosphorus derivatives based on white phosphorus are considered.

  2. Finite elements of nonlinear continua

    CERN Document Server

    Oden, J T

    2000-01-01

    Geared toward undergraduate and graduate students, this text extends applications of the finite element method from linear problems in elastic structures to a broad class of practical, nonlinear problems in continuum mechanics. It treats both theory and applications from a general and unifying point of view.The text reviews the thermomechanical principles of continuous media and the properties of the finite element method, and then brings them together to produce discrete physical models of nonlinear continua. The mathematical properties of these models are analyzed, along with the numerical s

  3. Staggered weak matrix element miscellany

    International Nuclear Information System (INIS)

    I report on work, done with Rajan Gupta and Greg Kilcup, using staggered fermions to study weak matrix elements in quenched QCD. I give an update on the ΔI = 1/2 rule on matrix elements relevant for ε'. I show results of a study of the dependence of BK on non-leading terms in the chiral expansion. I present our results for BK from quenched calculation at β = 6.4 on 323 x 48 lattices, based on ensemble of 12 configurations. 15 refs., 5 figs

  4. Elements of spatial data quality

    CERN Document Server

    Guptill, SC

    1995-01-01

    Elements of Spatial Data Quality outlines the need and suggests potential categories for the content of a comprehensive statement of data quality that must be imbedded in the metadata that accompanies the transfer of a digital spatial data file or is available in a separate metadata catalog. Members of the International Cartographic Association's Commission on Spatial Data Quality have identified seven elements of data quality: positional accuracy, attribute accuracy, completeness, logical consistency, lineage, semantic accuracy and temporal information. In the book the authors describe: compo

  5. A high temperature fuel element

    Energy Technology Data Exchange (ETDEWEB)

    Sekido, A.; Nakai, M.; Ninomiya, Y.

    1982-12-21

    A solid electrolyte which conducts electricity with heating by oxygen ions and operates at a temperature of 1,000C is used in the element. The cathode, besides the ionic conductivity in oxygen, has an electron conductivity. The anode has electron conductivity. Substances such as Bi203, into which oxides of alkaline earth metals are added, are used for making the cathode. The electrolyte consists of ZrO2 and Y2O3, to which CaO is added. WC, to which an H2 type fuel is fed, serves as the anode. The element has a long service life.

  6. A 3D pyramid spline element

    Institute of Scientific and Technical Information of China (English)

    Juan Chen; Chong-Jun Li; Wan-Ji Chen

    2011-01-01

    In this paper,a 13-node pyramid spline element is derived by using the tetrahedron volume coordinates and the B-net method,which achieves the second order completeness in Cartesian coordinates.Some appropriate examples were employed to evaluate the performance of the proposed element.The numerical results show that the spline element has much better performance compared with the isoparametric serendipity element Q20 and its degenerate pyramid element P13 especially when mesh is distorted,and it is comparable to the Lagrange element Q27.It has been demonstrated that the spline finite element method is an efficient tool for developing high accuracy elements.

  7. Nuclear fuel elements design, fabrication and performance

    CERN Document Server

    Frost, Brian R T

    1982-01-01

    Nuclear Fuel Elements: Design, Fabrication and Performance is concerned with the design, fabrication, and performance of nuclear fuel elements, with emphasis on fast reactor fuel elements. Topics range from fuel types and the irradiation behavior of fuels to cladding and duct materials, fuel element design and modeling, fuel element performance testing and qualification, and the performance of water reactor fuels. Fast reactor fuel elements, research and test reactor fuel elements, and unconventional fuel elements are also covered. This volume consists of 12 chapters and begins with an overvie

  8. Dynamic and Transient Infinite Elements

    CERN Document Server

    Zhao, Chongbin

    2009-01-01

    Intends to provide the theory and the application of dynamic and transient infinite elements for simulating the far fields of infinite domains involved in many of scientific and engineering problems, based on the author's own work over the years. This title is suitable for computational geoscientists, geotechnical engineers, and civil engineers.

  9. Compact Fuel Element Environment Test

    Science.gov (United States)

    Bradley, D. E.; Mireles, O. R.; Hickman, R. R.; Broadway, J. W.

    2012-01-01

    Deep space missions with large payloads require high specific impulse (I(sub sp)) and relatively high thrust to achieve mission goals in reasonable time frames. Conventional, storable propellants produce average I(sub sp). Nuclear thermal rockets (NTRs) capable of high I(sub sp) thrust have been proposed. NTR employs heat produced by fission reaction to heat and therefore accelerate hydrogen, which is then forced through a rocket nozzle providing thrust. Fuel element temperatures are very high (up to 3,000 K) and hydrogen is highly reactive with most materials at high temperatures. Data covering the effects of high-temperature hydrogen exposure on fuel elements are limited. The primary concern is the mechanical failure of fuel elements that employ high melting point metals, ceramics, or a combination (cermet) as a structural matrix into which the nuclear fuel is distributed. It is not necessary to include fissile material in test samples intended to explore high-temperature hydrogen exposure of the structural support matrices. A small-scale test bed designed to heat fuel element samples via noncontact radio frequency heating and expose samples to hydrogen for typical mission durations has been developed to assist in optimal material and manufacturing process selection without employing fissile material. This Technical Memorandum details the test bed design and results of testing conducted to date.

  10. Treatment of incorporated transuranium elements

    International Nuclear Information System (INIS)

    The text of this report and its tables and figures provide basic information on the decorporation of transuranium elements as well as an insight into the more general principles, trends and interactions. The detailed tables and the exhaustive list of important references should enable the reader to make his own conclusions in a minimum of time

  11. Experimental search for superheavy elements

    International Nuclear Information System (INIS)

    This work reports on the experimental search for superheavy elements (SHE). Two types of approaches for SHE production are studied i.e. '' cold '' fusion mechanism and massive transfer mechanism. First mechanism was studied in normal and inverse kinematics, by using Wien filter at the GANIL facility. The production of SHE elements with Z 106 and 108 is reported while negative results on the synthesis of SHE elements with Z 114 and 118 was received. The other approach i.e. reactions induced by heavy ion projectiles (e.g. 172Yb, 197Au) on fissile target nuclei (e.g. 238U, 232Th) at near Coulomb barrier incident energies was studied by using superconducting solenoid installed Texas A(and)M University. Preliminary results for the reaction 197Au(7.5 MeV/u) - 232Th are presented where three cases of the possible candidates for SHE elements were found. A dedicated detection setup for such studies is discussed and the detailed data analysis is presented. Detection of alpha and spontaneous fission radioactive decays is used to unambiguously identify the atomic number of SHE. Special statistical analysis for a very low detected number of α decays is applied to check consistency of the αradioactive chains. (author)

  12. Environmental research on actinide elements

    Energy Technology Data Exchange (ETDEWEB)

    Pinder, J.E. III; Alberts, J.J.; McLeod, K.W.; Schreckhise, R.G. (eds.)

    1987-08-01

    The papers synthesize the results of research sponsored by DOE's Office of Health and Environmental Research on the behavior of transuranic and actinide elements in the environment. Separate abstracts have been prepared for the 21 individual papers. (ACR)

  13. Spectral element simulation of ultrafiltration

    DEFF Research Database (Denmark)

    Hansen, M.; Barker, Vincent A.; Hassager, Ole

    1998-01-01

    A spectral element method for simulating stationary 2-D ultrafiltration is presented. The mathematical model is comprised of the Navier-Stokes equations for the velocity field of the fluid and a transport equation for the concentration of the solute. In addition to the presence of the velocity...

  14. Main Elements for Upscaling Recreation

    DEFF Research Database (Denmark)

    Zandersen, Marianne; Termansen, Mette

    2012-01-01

    This report provides information on the main elements used to scale up modelled local visitor flow data to regional level based on recreational de-mand models. These models are described in Report #1. This report also provides information on data sources such as spatial data (e.g. land cov......-timated value per site for car-borne visits....

  15. An improved optimal elemental method for updating finite element models

    Institute of Scientific and Technical Information of China (English)

    Duan Zhongdong(段忠东); Spencer B.F.; Yan Guirong(闫桂荣); Ou Jinping(欧进萍)

    2004-01-01

    The optimal matrix method and optimal elemental method used to update finite element models may not provide accurate results. This situation occurs when the test modal model is incomplete, as is often the case in practice. An improved optimal elemental method is presented that defines a new objective function, and as a byproduct, circumvents the need for mass normalized modal shapes, which are also not readily available in practice. To solve the group of nonlinear equations created by the improved optimal method, the Lagrange multiplier method and Matlab function fmincon are employed. To deal with actual complex structures,the float-encoding genetic algorithm (FGA) is introduced to enhance the capability of the improved method. Two examples, a 7-degree of freedom (DOF) mass-spring system and a 53-DOF planar frame, respectively, are updated using the improved method.Thc example results demonstrate the advantages of the improved method over existing optimal methods, and show that the genetic algorithm is an effective way to update the models used for actual complex structures.

  16. The Transuranium Elements - Present Status: Nobel Lecture

    Science.gov (United States)

    Seaborg, G. T.

    1951-12-12

    The discovery of the transuranium elements and the work done on them up to the present time are reviewed. The properties of these elements, their relationship to other elements, their place in the periodic table, and the possibility of production and identification of other transuranium elements are discussed briefly.

  17. An Improved Triangular Element With Drilling Rotations

    DEFF Research Database (Denmark)

    Damkilde, Lars; Grønne, Mikael

    2002-01-01

    A new plane element with rotational degrees in the corner nodes is presented. The element has 12 degrees of freedom and the only difference from the well-known Linear Strain Triangular (LST) element is that the displacements perpendicular to the element sides in the mid-side nodes are replaced by...... rotations in the corner nodes. Compared to Allman's plane element which was the first succesfull implementation of drilling rotations the proposed element has extra displacements in the mid-side nodes parallel to the element sides. The performance should therefore be better and closer to the LST...

  18. Automation of finite element methods

    CERN Document Server

    Korelc, Jože

    2016-01-01

    New finite elements are needed as well in research as in industry environments for the development of virtual prediction techniques. The design and implementation of novel finite elements for specific purposes is a tedious and time consuming task, especially for nonlinear formulations. The automation of this process can help to speed up this process considerably since the generation of the final computer code can be accelerated by order of several magnitudes. This book provides the reader with the required knowledge needed to employ modern automatic tools like AceGen within solid mechanics in a successful way. It covers the range from the theoretical background, algorithmic treatments to many different applications. The book is written for advanced students in the engineering field and for researchers in educational and industrial environments.

  19. Selective Smoothed Finite Element Method

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The paper examines three selective schemes for the smoothed finite element method (SFEM) which was formulated by incorporating a cell-wise strain smoothing operation into the standard compatible finite element method (FEM). These selective SFEM schemes were formulated based on three selective integration FEM schemes with similar properties found between the number of smoothing cells in the SFEM and the number of Gaussian integration points in the FEM. Both scheme 1 and scheme 2 are free of nearly incompressible locking, but scheme 2 is more general and gives better results than scheme 1. In addition, scheme 2 can be applied to anisotropic and nonlinear situations, while scheme 1 can only be applied to isotropic and linear situations. Scheme 3 is free of shear locking. This scheme can be applied to plate and shell problems. Results of the numerical study show that the selective SFEM schemes give more accurate results than the FEM schemes.

  20. Gelivity Effects on Construction Elements

    Directory of Open Access Journals (Sweden)

    Bogdan Rujanu

    2009-01-01

    Full Text Available Complex nature of environment effects on concrete structures has imposed an improvement of material characteristics, an adequate design, accurate execution and inspection, maintenance and prevention of deterioration risks. Large complexity of concrete elements deterioration processes, it is determined by the relation between adopted structural conceptions, exposing climatic conditions, concrete composition, quality of execution processes, but also due to synergetic action of destructive agents. When water freezes in a porous material, like cement stone, raise its volume about 9%, and can lead to concrete cleavage, when pores are saturated with water. Using deicers on concrete surface for melting of ice or snow, cause a thermal shock. Temperature difference between the surface and the core of concrete leads to interior stress and deformation state, capable to influence cracking of concrete layer from the surface of element. Prevention of damages and their amplification needs inspection, maintenance and overhauling of structures.

  1. Composite oxygen ion transport element

    Science.gov (United States)

    Chen, Jack C.; Besecker, Charles J.; Chen, Hancun; Robinson, Earil T.

    2007-06-12

    A composite oxygen ion transport element that has a layered structure formed by a dense layer to transport oxygen ions and electrons and a porous support layer to provide mechanical support. The dense layer can be formed of a mixture of a mixed conductor, an ionic conductor, and a metal. The porous support layer can be fabricated from an oxide dispersion strengthened metal, a metal-reinforced intermetallic alloy, a boron-doped Mo.sub.5Si.sub.3-based intermetallic alloy or combinations thereof. The support layer can be provided with a network of non-interconnected pores and each of said pores communicates between opposite surfaces of said support layer. Such a support layer can be advantageously employed to reduce diffusion resistance in any type of element, including those using a different material makeup than that outlined above.

  2. Trace-elements and tectonics

    International Nuclear Information System (INIS)

    Trends of the past twenty years in geochemical investigation of trace elements are reflected in studies of the partial melting of mantle and also the differentiation of magma. Substantial improvements have been made in accuracy, sensitivity and convenience of trace elements analysis, mainly through improved techniques and equipment for neutron activation analysis. Models for genesis of the zonal arrangement in island arc volcanic rocks as products of partial melting and fractional crystallization have been developed. We also applied these results to discuss the tectonic development of island arcs. Dating of geological materials is on universal concern to earth scientists working on various problems. In many research situations the use of a combination of dating method and paleomagnetism or geochemistry provides the greatest tectonic results for crustal materials, such as rotation of microcontinent and cooling history of rock body. (author)

  3. DOLFIN: Automated Finite Element Computing

    CERN Document Server

    Logg, Anders; 10.1145/1731022.1731030

    2011-01-01

    We describe here a library aimed at automating the solution of partial differential equations using the finite element method. By employing novel techniques for automated code generation, the library combines a high level of expressiveness with efficient computation. Finite element variational forms may be expressed in near mathematical notation, from which low-level code is automatically generated, compiled and seamlessly integrated with efficient implementations of computational meshes and high-performance linear algebra. Easy-to-use object-oriented interfaces to the library are provided in the form of a C++ library and a Python module. This paper discusses the mathematical abstractions and methods used in the design of the library and its implementation. A number of examples are presented to demonstrate the use of the library in application code.

  4. CONSTRAINED QUADRILATERAL NONCONFORMING ROTATED Q1 ELEMENT

    Institute of Scientific and Technical Information of China (English)

    Jun Hu; Zhong-ci Shi

    2005-01-01

    In this paper, we define a new nonconforming quadrilateral finite element based on the nonconforming rotated Q1 element by enforcing a constraint on each element, which has only three degrees of freedom. We investigate the consistency, approximation, superclose property, discrete Green's function and superconvergence of this element. Moreover, we propose a new postprocessing technique and apply it to this element. It is proved that the postprocessed discrete solution is superconvergent under a mild assumption on the mesh.

  5. Backfire antennas with dipole elements

    DEFF Research Database (Denmark)

    Nielsen, Erik Dragø; Pontoppidan, Knud

    1970-01-01

    A method is set up for a theoretical investigation of arbitrary backfire antennas based upon dipole structures. The mutual impedance between the dipole elements of the antenna is taken into account, and the field radiated due to a surface wave reflector of finite extent is determined by calculating...... the surface current distribution on the reflector plate. Numerical results obtained for Yagi backfire antennas and short-backfire antennas using this theory are compared with experimental results....

  6. Elements of Bayesian experimental design

    Energy Technology Data Exchange (ETDEWEB)

    Sivia, D.S. [Rutherford Appleton Lab., Oxon (United Kingdom)

    1997-09-01

    We consider some elements of the Bayesian approach that are important for optimal experimental design. While the underlying principles used are very general, and are explained in detail in a recent tutorial text, they are applied here to the specific case of characterising the inferential value of different resolution peakshapes. This particular issue was considered earlier by Silver, Sivia and Pynn (1989, 1990a, 1990b), and the following presentation confirms and extends the conclusions of their analysis.

  7. Synthesis of super heavy elements

    International Nuclear Information System (INIS)

    An era of study and synthesis of superheavy elements began with the prediction of the existence of an island of stability of long lived superheavy elements in the vicinity Z = 126, N = 184 by Myers and Swiatecki in 1966. Within coulomb and proximity potential model, we have studied cluster emission from all even-even nuclei from 270118 to 318118. Fission decay half lives for these isotopes are calculated by the model proposed by Ren et al. The range of isotopes in which α-decay shall occur for the element Z=118 is found out using the difference in α-decay half life and fission decay half life as a criterion. This range is also the one in which isotopes can exist without getting spontaneously fissioned. Making use of the concepts of quantum mechanical fragmentation theory and the information that is gathered from our work, about the range of isotopes where synthesis of Z = 118 is probable, sets of reactions, according to order of possibility, for the production of all isotopes in the range have been elucidated. Along with that the involved fusion barrier and ground state Q-value also are shown

  8. Inorganic elements in sugar samples

    Energy Technology Data Exchange (ETDEWEB)

    Salles, Paulo M.B. de; Campos, Tarcisio P.R. de, E-mail: pauladesalles@yahoo.com.br, E-mail: tprcampos@pq.cnpq.br [Universidade Federal de Minas Gerais (DEN/UFMG), Belo Horizonte, MG (Brazil). Departamento de Engenharia Nuclear; Menezes, Maria Angela de B.C., E-mail: menezes@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)

    2013-07-01

    Sugar is considered a safe food ingredient; however, it can be contaminated by organic elements since its planting until its production process. Thus, this study aims at checking the presence of inorganic elements in samples of crystal, refined and brown sugar available for consumption in Brazil. The applied technique was neutron activation analysis, the k{sub 0} method, using the TRIGA MARK - IPR-R1 reactor located at CDTN/CNEN, in Belo Horizonte. It was identified the presence of elements such as, Au, Br, Co, Cr, Hf, K, Na, Sb, Sc and Zn in the samples of crystal/refined sugar and the presence of As, Au, Br, Ca, Co, Cr, Cs, Fe, Hf, K, Na, Sb, Sc, Sm, Sr, Th and Zn in the brown sugar samples. The applied technique was appropriate to this study because it was not necessary to put the samples in solution, essential condition in order to apply other techniques, avoiding contaminations and sample losses, besides allowing a multi elementary detection in different sugar samples. (author)

  9. Elemental composition of cosmic ray

    International Nuclear Information System (INIS)

    The report first summarizes some data that have been obtained so far from observation of isotopes and elements in cosmic rays in the low energy region. Then, objectives of studies planned to be carried out with Astromag are outlined and the number of incident particles expected to be measured by baloon observation is estimated. Heavy elements with atomic numbers of greater than 30 are considered to be formed through neutron absorption reactions by the s- or r-process. Observations show that products of the r-process is abundant in cosmic ray sources. The escape length depends on energy. In relation to this, it has been reported that the ratios Ar-Fe and Ca-Fe increase above 200 GeV-n while such a tendency is not observed for K, Sc, Ti or V. Thus, no satisfactory models are available at present which can fully explain the changes in the escape length. The ratio 3He-4He in the range of 5 - 10 GeV-n is inconsistent with the general theory that interprets the escape length of heavy elements. Some models, including the supermetallicity model and Wolf Rayet theory, have been proposed to explain unusual ratios of isotopes in cosmic rays, but more measurements are required to verify them. It is expected that Astromag can serve to make observations that can clarify these points. (Nogami, K.)

  10. The UNCLE finite element scheme

    International Nuclear Information System (INIS)

    A completely general finite element scheme, implemented in the UKAEA Reactor Group is outlined. UNCLE is not a complete, self-contained program. It is a framework of routines that provide the common services required by all general purpose finite element programs, whether for heat transfer, stress analysis or any other linear (or piece-wise linear) problem. These services are: input of mesh, geometry, loads (etc) and material data: matrix and load vector calculation and assembly (including handling of standard boundary conditions); solution of global matrix (elimination and conjugate gradient methods); output (printed and graphical) of initial geometry, displacements, stresses, final geometry etc; facilities for iteration for non-linear problems and time integration; mass matrix reduction, dynamic analysis of reduced problem and expansion of displacements to full problem. The framework is written to handle 1, 2, 3 or more dimensions equally efficiently. To produce a general purpose program for a particular range of applications it is only necessary to provide a set of element subroutines specialised to the application (heat transfer, framework analysis, continuum stress analysis etc)

  11. Adobe Photoshop Elements 10 unleash the hidden performance of Elements

    CERN Document Server

    Galer, Mark

    2011-01-01

    Master the most powerful photo editing tools and techniques that Elements has to offer! Using step-by-step projects, Mark Galer will have you creating stunning images in no time at all. Whether you want to create impressive, seamless montages, optimize your photos for perfect print quality, or simply enhance your images for maximum impact, Maximum Performance will give you the skills and know-how you need to create professional quality results. Featured projects teach you how to work with multilayered 16 bit/channel files, as well as convert to black and white using Adobe Camera Raw, create

  12. Peridynamic Multiscale Finite Element Methods

    Energy Technology Data Exchange (ETDEWEB)

    Costa, Timothy [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Bond, Stephen D. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Littlewood, David John [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Moore, Stan Gerald [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2015-12-01

    The problem of computing quantum-accurate design-scale solutions to mechanics problems is rich with applications and serves as the background to modern multiscale science research. The prob- lem can be broken into component problems comprised of communicating across adjacent scales, which when strung together create a pipeline for information to travel from quantum scales to design scales. Traditionally, this involves connections between a) quantum electronic structure calculations and molecular dynamics and between b) molecular dynamics and local partial differ- ential equation models at the design scale. The second step, b), is particularly challenging since the appropriate scales of molecular dynamic and local partial differential equation models do not overlap. The peridynamic model for continuum mechanics provides an advantage in this endeavor, as the basic equations of peridynamics are valid at a wide range of scales limiting from the classical partial differential equation models valid at the design scale to the scale of molecular dynamics. In this work we focus on the development of multiscale finite element methods for the peridynamic model, in an effort to create a mathematically consistent channel for microscale information to travel from the upper limits of the molecular dynamics scale to the design scale. In particular, we first develop a Nonlocal Multiscale Finite Element Method which solves the peridynamic model at multiple scales to include microscale information at the coarse-scale. We then consider a method that solves a fine-scale peridynamic model to build element-support basis functions for a coarse- scale local partial differential equation model, called the Mixed Locality Multiscale Finite Element Method. Given decades of research and development into finite element codes for the local partial differential equation models of continuum mechanics there is a strong desire to couple local and nonlocal models to leverage the speed and state of the

  13. Finite element analysis of elasto-plastic plate bending problems using transition rectangular plate elements

    Institute of Scientific and Technical Information of China (English)

    Bahattin Kanber; O.Yavuz Bozkurt

    2006-01-01

    In this work,the finite element analysis of the elasto-plastic plate bending problems is carried out using transition rectangular plate elements.The shape functions of the transition plate elements are derived based on a practical rule.The transition plate elements are all quadrilateral and can be used to obtain efficient finite element models using minimum number of elements.The mesh convergence rates of the models including the transition elements are compared with the regular element models.To verify the developed elements,simple tests are demonstrated and various elasto-plastic problems are solved.Their results are compared with ANSYS results.

  14. Implementing wavelet transform with SAW elements

    Institute of Scientific and Technical Information of China (English)

    LU; Wenke(卢文科); ZHU; Changchun(朱长纯); LIU; Junhua(刘君华); LIU; Qinghong(刘清洪)

    2003-01-01

    In the design of the finger-overlap envelope according to the envelope of wavelet function, it is concluded that the pulse-response function of the interdigital transducer (IDT) for surface acoustic wave (SAW) is identical to the wavelet function. SAW type of the wavelet-transform element is manufactured. A new method of using two wavelet-transform elements to manufacture the reconstruction element of the wavelet transform is proposed. The sources of the element error are analyzed, and the methods for reducing the error are put forward. SAW type of the wavelet transformation element and its reconstruction element have the following three characteristics: (i) the implementing methods of the wavelet transform element and its reconstruction element are simple, and free of complicated mathematical algorithms of the wavelet transform; (ii) because one of SAW element is fast, the response velocities of SAW type of the wavelet transform element and its reconstruction element are also fast; (iii) the costs of the wavelet transform element and its reconstruction element are low, so the elements may be manufactured in a large quantity.

  15. Calculation of binary phase diagrams between the actinide elements, rare earth elements, and transition metal elements

    International Nuclear Information System (INIS)

    Attempts were made to apply the Kaufman method of calculating binary phase diagrams to the calculation of binary phase diagrams between the rare earths, actinides, and the refractory transition metals. Difficulties were encountered in applying the method to the rare earths and actinides, and modifications were necessary to provide accurate representation of known diagrams. To calculate the interaction parameters for rare earth-rare earth diagrams, it was necessary to use the atomic volumes for each of the phases: liquid, body-centered cubic, hexagonal close-packed, and face-centered cubic. Determination of the atomic volumes of each of these phases for each element is discussed in detail. In some cases, empirical means were necessary. Results are presented on the calculation of rare earth-rare earth, rare earth-actinide, and actinide-actinide diagrams. For rare earth-refractory transition metal diagrams and actinide-refractory transition metal diagrams, empirical means were required to develop values for the enthalpy of vaporization for rare earth elements and values for the constant (C) required when intermediate phases are present. Results of using the values determined for each element are presented

  16. Super-Light Prefabricated Deck Element Integrated in Traditional Concrete Prefabricated Element Construction

    DEFF Research Database (Denmark)

    Christensen, Jacob Ellehauge; Hertz, Kristian Dahl

    the super-light slab element are element size, which have greatly reduced the total number of elements the pedestrian bridges consist of. The application also demonstrated the ability to control the path that the forces will take in the element. The deck elements are for example fully prepared at the...

  17. Fluidic Elements based on Coanda Effect

    Directory of Open Access Journals (Sweden)

    Constantin OLIVOTTO

    2010-12-01

    Full Text Available This paper contains first some definitions and classifications regarding the fluidic elements. Thegeneral current status is presented, nominating the main specific elements based on the Coanda effect developedspecially in Romania. In particularly the development of an original bistable element using industrial compressedair at industrial pressure supply is presented. The function of this element is based on the controlled attachmentof the main jet at a curved wall through the Coanda effect. The methods used for particular calculation andexperiments are nominated. The main application of these elements was to develop a specific execution element:a fluidic step–by-step motor based on the Coanda effect.

  18. Formulations of a hydromechanical interface element

    Institute of Scientific and Technical Information of China (English)

    Zhong-Zhi Fu; Si-Hong Liu

    2011-01-01

    A hydromechanical interface element is proposed for the consideration of the hydraulic-mechanical coupling effect along the interface.The fully coupled governing equations and the relevant finite element formulations are derived in detail for the interface element.All the involved matrices are of the same form as those of a solid element,which makes the incorporation of the model into a finite element program straightforward.Three examples are then numerically simulated using the interface element.Reasonable results confirm the correctness of the proposed model and motivate its application in hydromechanical contact problems in the future.

  19. Nuclear reactor fuel element. Kernreaktorbrennelement

    Energy Technology Data Exchange (ETDEWEB)

    Lippert, H.J.

    1985-03-28

    The fuel element box for a BWR is situated with a corner bolt on the inside in one corner of its top on the top side of the top plate. This corner bolt is screwed down with a bolt with a corner part which is provided with leaf springs outside on two sides, where the bolt has a smaller diameter and an expansion shank. The bolt is held captive to the bolt head on the top and the holder on the bottom of the corner part. The holder is a locknut. If the expansion forces are too great, the bolt can only break at the expansion shank.

  20. Transportation of irradiated fuel elements

    International Nuclear Information System (INIS)

    The report falls under the headings: introduction (explaining the special interest of the London Borough of Brent, as forming part of the route for transportation of irradiated fuel elements); nuclear power (with special reference to transport of spent fuel and radioactive wastes); the flask aspect (design, safety regulations, criticisms, tests, etc.); the accident aspect (working manual for rail staff, train formation, responsibility, postulated accident situations); the emergency arrangements aspect; the monitoring aspect (health and safety reports); legislation; contingency plans; radiation - relevant background information. (U.K.)

  1. Elements of partial differential equations

    CERN Document Server

    Sneddon, Ian N

    2006-01-01

    Geared toward students of applied rather than pure mathematics, this volume introduces elements of partial differential equations. Its focus is primarily upon finding solutions to particular equations rather than general theory.Topics include ordinary differential equations in more than two variables, partial differential equations of the first and second orders, Laplace's equation, the wave equation, and the diffusion equation. A helpful Appendix offers information on systems of surfaces, and solutions to the odd-numbered problems appear at the end of the book. Readers pursuing independent st

  2. Elements of abstract harmonic analysis

    CERN Document Server

    Bachman, George

    2013-01-01

    Elements of Abstract Harmonic Analysis provides an introduction to the fundamental concepts and basic theorems of abstract harmonic analysis. In order to give a reasonably complete and self-contained introduction to the subject, most of the proofs have been presented in great detail thereby making the development understandable to a very wide audience. Exercises have been supplied at the end of each chapter. Some of these are meant to extend the theory slightly while others should serve to test the reader's understanding of the material presented. The first chapter and part of the second give

  3. Basic Elements of Knowledge Management

    Directory of Open Access Journals (Sweden)

    Marcin W. Staniewski

    2007-10-01

    Full Text Available The article is a review of basic knowledge management terminology. It presents such a description as: knowledge resources levels (data, information, knowledge, and wisdom, knowledge sources (internal, external, and knowledge typology (implicit, tacit or individual, social. Moreover the article characterizes knowledge management process, knowledge management system and main knowledge management strategies (codification, personalization. At the end of the article there is mentioned the knowledge creating process (the concept of knowledge creation spiral and the role of Intelligence Technology (IT and organizational culture as main elements supporting knowledge management implementation in organizations.

  4. METHODOLOGICAL ELEMENTS OF SITUATIONAL ANALYSIS

    Directory of Open Access Journals (Sweden)

    Tetyana KOVALCHUK

    2016-07-01

    Full Text Available The article deals with the investigation of theoretical and methodological principles of situational analysis. The necessity of situational analysis is proved in modern conditions. The notion “situational analysis” is determined. We have concluded that situational analysis is a continuous system study which purpose is to identify dangerous situation signs, to evaluate comprehensively such signs influenced by a system of objective and subjective factors, to search for motivated targeted actions used to eliminate adverse effects of the exposure of the system to the situation now and in the future and to develop the managerial actions needed to bring the system back to norm. It is developed a methodological approach to the situational analysis, its goal is substantiated, proved the expediency of diagnostic, evaluative and searching functions in the process of situational analysis. The basic methodological elements of the situational analysis are grounded. The substantiation of the principal methodological elements of system analysis will enable the analyst to develop adaptive methods able to take into account the peculiar features of a unique object which is a situation that has emerged in a complex system, to diagnose such situation and subject it to system and in-depth analysis, to identify risks opportunities, to make timely management decisions as required by a particular period.

  5. Mars Surface Tunnel Element Concept

    Science.gov (United States)

    Rucker, Michelle A.; Mary, Natalie; Howe, A. Scott; Jeffries, Sharon

    2016-01-01

    How Mars surface crews get into their ascent vehicle has profound implications for Mars surface architecture. To meet planetary protection protocols, the architecture has get Intravehicular Activity (IVA)-suited crew into a Mars Ascent Vehicle (MAV) without having to step outside into the Mars environment. Pushing EVA suit don/doff and EVA operations to an element that remains on the surface also helps to minimize MAV cabin volume, which in turn can reduce MAV cabin mass. Because the MAV will require at least seven kilograms of propellant to ascend each kilogram of cabin mass, minimal MAV mass is desired. For architectures involving more than one surface element-such as an ascent vehicle and a pressurized rover or surface habitat-a retractable tunnel is an attractive solution. Beyond addressing the immediate MAV access issue, a reusable tunnel may be useful for other surface applications once its primary mission is complete. A National Aeronautics and Space Administration (NASA) team is studying the optimal balance between surface tunnel functionality, mass, and stowed volume as part of the Evolvable Mars Campaign (EMC). The "Minimum Functional Tunnel" is a conceptual design that performs a single function. Having established this baseline configuration, the next step is to trade design options, evaluate other applications, and explore alternative solutions.

  6. Analysis of composite structural elements

    Directory of Open Access Journals (Sweden)

    A. Baier

    2010-12-01

    Full Text Available Purpose: The themes of the study are composite structural components. For this purpose have been designed and built several research positions.Design/methodology/approach: Using different structural materials to build new device components requires multiple tests of the components. Research posts were designed in the advanced graphical program CAx Siemens NX 7.5. Analysed samples were made from the glass fibre, aramid and carbon of various weights. Due to the specific use of composite materials it focuses on the elements in the form of plates and flat bars. For the examination of experimental strain gauge technique was used bead, the force sensor and displacement sensor. The experimental methods were compared with computer simulation using the FEM.Findings: The aim of this study was to determine the basic material constants and a comparison of the experimental method and the method of computer simulation.Research limitations/implications: Change the number of layers and how to connect the laminate with the steel plate changes mechanical properties of the structural component.Practical implications: The ultimate result will be knowledge on the different forms of laminates, such as material properties, the stresses in all layers, strain and comparing the results obtained by two methods.Originality/value: The expected outcome of the study will be the composition and method of joining composite laminate with a steel plate to the possible application in the repair and construction of structural elements of freight wagons.

  7. Light element opacities from ATOMIC

    Science.gov (United States)

    Colgan, J.; Kilcrease, D. P.; Magee, N. H.; Armstrong, G. S. J.; Abdallah, J.; Sherrill, M. E.; Fontes, C. J.; Zhang, H. L.; Hakel, P.

    2013-06-01

    We present new calculations of local-thermodynamic-equilibrium (LTE) light element opacities from the Los Alamos ATOMIC code. ATOMIC is a multi-purpose code that can generate LTE or non-LTE quantities of interest at various levels of approximation. A program of work is currently underway to compute new LTE opacity data for all elements H through Zn. New opacity tables for H through Ne are complete, and a new Fe opacity table will be available soon. Our calculations, which include fine-structure detail, represent a systematic improvement over previous Los Alamos opacity calculations using the LEDCOP legacy code. Our opacity calculations incorporate atomic structure data computed from the CATS code, which is based on Cowan's atomic structure codes, and photoionization cross section data computed from the Los Alamos ionization code GIPPER. We make use of a new equation-of-state (EOS) model based on the chemical picture. ATOMIC incorporates some physics packages from LEDCOP and also includes additional physical processes, such as improved free-free cross sections and additional scattering mechanisms. In this report, we briefly discuss the physics improvements included in our new opacity calculations and present comparisons of our new opacities with other work for C, O, and Fe at selected conditions.

  8. Fuel elements of thermionic converters

    Energy Technology Data Exchange (ETDEWEB)

    Hunter, R.L. [ed.] [Sandia National Labs., Albuquerque, NM (United States). Environmental Systems Assessment Dept.; Gontar, A.S.; Nelidov, M.V.; Nikolaev, Yu.V.; Schulepov, L.N. [RI SIA Lutch, Podolsk (Russian Federation)

    1997-01-01

    Work on thermionic nuclear power systems has been performed in Russia within the framework of the TOPAZ reactor program since the early 1960s. In the TOPAZ in-core thermionic convertor reactor design, the fuel element`s cladding is also the thermionic convertor`s emitter. Deformation of the emitter can lead to short-circuiting and is the primary cause of premature TRC failure. Such deformation can be the result of fuel swelling, thermocycling, or increased unilateral pressure on the emitter due to the release of gaseous fission products. Much of the work on TRCs has concentrated on preventing or mitigating emitter deformation by improving the following materials and structures: nuclear fuel; emitter materials; electrical insulators; moderator and reflector materials; and gas-exhaust device. In addition, considerable effort has been directed toward the development of experimental techniques that accurately mimic operational conditions and toward the creation of analytical and numerical models that allow operational conditions and behavior to be predicted without the expense and time demands of in-pile tests. New and modified materials and structures for the cores of thermionic NPSs and new fabrication processes for the materials have ensured the possibility of creating thermionic NPSs for a wide range of powers, from tens to several hundreds of kilowatts, with life spans of 5 to 10 years.

  9. Apparatus for locating defective nuclear fuel elements

    International Nuclear Information System (INIS)

    An ultrasonic search unit for locating defective fuel elements within a fuel assembly used in a water cooled nuclear reactor is presented. The unit is capable of freely traversing the restricted spaces between the fuel elements

  10. Natural wetland emissions of methylated trace elements

    NARCIS (Netherlands)

    Vriens, B.; Lenz, M.; Charlet, L.; Berg, M.; Winkel, L.H.E.

    2014-01-01

    Natural wetlands are well known for their significant methane emissions. However, trace element emissions via biomethylation and subsequent volatilization from pristine wetlands are virtually unstudied, even though wetlands constitute large reservoirs for trace elements. Here we show that the averag

  11. Dow Introduces "Human Element" to China

    Institute of Scientific and Technical Information of China (English)

    Jenny Du

    2007-01-01

    @@ Recently, the DOW Chemical Company of the United States introduced the "Human Element" to China. The "Human Element" series campaignwas launched in North America and Europe respectively from 2006 and the Q2 of 2007.

  12. Analysis of phage Mu DNA transposition by whole-genome Escherichia coli tiling arrays reveals a complex relationship to distribution of target selection protein B, transcription and chromosome architectural elements

    Indian Academy of Sciences (India)

    Jun Ge; Zheng Lou; Hong Cui; Lei Shang; Rasika M Harshey

    2011-09-01

    Of all known transposable elements, phage Mu exhibits the highest transposition efficiency and the lowest target specificity. In vitro, MuB protein is responsible for target choice. In this work, we provide a comprehensive assessment of the genome-wide distribution of MuB and its relationship to Mu target selection using high-resolution Escherichia coli tiling DNA arrays. We have also assessed how MuB binding and Mu transposition are influenced by chromosome-organizing elements such as AT-rich DNA signatures, or the binding of the nucleoid-associated protein Fis, or processes such as transcription. The results confirm and extend previous biochemical and lower resolution in vivo data. Despite the generally random nature of Mu transposition and MuB binding, there were hot and cold insertion sites and MuB binding sites in the genome, and differences between the hottest and coldest sites were large. The new data also suggest that MuB distribution and subsequent Mu integration is responsive to DNA sequences that contribute to the structural organization of the chromosome.

  13. Natural wetland emissions of methylated trace elements

    Science.gov (United States)

    Vriens, Bas; Lenz, Markus; Charlet, Laurent; Berg, Michael; Winkel, Lenny H. E.

    2014-01-01

    Natural wetlands are well known for their significant methane emissions. However, trace element emissions via biomethylation and subsequent volatilization from pristine wetlands are virtually unstudied, even though wetlands constitute large reservoirs for trace elements. Here we show that the average volatile fluxes of selenium (health-relevant trace elements will increase with global warming. We suggest that biomethylation and volatilization in wetlands play a crucial role in the mobilization and global biogeochemical cycling of trace elements.

  14. Flux-conserving finite element methods

    OpenAIRE

    Zhang, Shangyou; Zhang, Zhimin; Zou, Qingsong

    2012-01-01

    We analyze the flux conservation property of the finite element method. It is shown that the finite element solution does approximate the flux locally in the optimal order, i.e., the same order as that of the nodal interpolation operator. We propose two methods, post-processing the finite element solutions locally. The new solutions, remaining as optimal-order solutions, are flux-conserving elementwise. In one of our methods, the processed solution also satisfies the original finite element e...

  15. Continuous finite element methods for Hamiltonian systems

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    By applying the continuous finite element methods of ordinary differential equations, the linear element methods are proved having second-order pseudo-symplectic scheme and the quadratic element methods are proved having third-order pseudosymplectic scheme respectively for general Hamiltonian systems, and they both keep energy conservative. The finite element methods are proved to be symplectic as well as energy conservative for linear Hamiltonian systems. The numerical results are in agreement with theory.

  16. Light elements in oceanic and ophiolitic serpentinities

    OpenAIRE

    Vils, Flurin Andri; Katz, Angelika

    2009-01-01

    Despite the key importance of altered oceanic mantle as a repository and carrier of light elements (B, Li, and Be) to depth, its inventory of these elements has hardly been explored and quantified. In order to constrain the systematics and budgets of these elements in the oceanic lithosphere, this thesis has studied samples of highly serpentinized peridotites from the mid-Atlantic ridge (ODP Leg 209) and progressively metamorphosed alpine ophiolites (Totalp, Platta and Malenco). Light element...

  17. ELEMENT FUNCTIONS OF DISCRETE OPERATOR DIFFERENCE METHOD

    Institute of Scientific and Technical Information of China (English)

    田中旭; 唐立民; 刘正兴

    2002-01-01

    The discrete scheme called discrete operator difference for differential equations was given. Several difference elements for plate bending problems and plane problems were given. By investigating these elements, the ability of the discrete forms expressing to the element functions was talked about. In discrete operator difference method, the displacements of the elements can be reproduced exactly in the discrete forms whether the displacements are conforming or not. According to this point, discrete operator difference method is a method with good performance.

  18. Data Element Dictionary: Facilities. Preliminary Draft.

    Science.gov (United States)

    Thomas, Charles R.

    The draft includes--(1) comments on file structure, (2) descriptions of dictionary organization and format, (3) alphabetical lists of elements, and (4) facilities related elements in dictionary form. The data element definitions in this draft are compatible with the Higher Education Facilities Classification and Inventory Procedures Manual, which…

  19. Main: ELEMENT1GMLBC3 [PLACE

    Lifescience Database Archive (English)

    Full Text Available ELEMENT1GMLBC3 S000319 7-Sep-2000 (last modified) seki Element 1 found in the promo...ter of soybean (G.m.) leghaemoglobin lbc3 gene; Binding site of nuclear extract from soybean nodules; Locate...Element 2 share a common motif; See S000320; nodule; leghaemoglobin; lbc3; root; Soybean (Glycine max) GATATATTAATATTTTATTTTATA ...

  20. Elements from chlorine to calcium nuclear reactions

    CERN Document Server

    Kunz, Wunibald

    1968-01-01

    Nuclear Tables: Part II Nuclear Reactions, Volume 3: The Elements from Chlorine to Calcium contains tabulations of the nuclear reaction values of elements chlorine, argon, potassium, and calcium. These tabulations provide the calculated Q-values of the elements and their isotopes. This book will be of value to general chemistry researchers.

  1. Downhole elemental analysis with LIBS

    Science.gov (United States)

    Moreschini, P.; Zacny, K.; Rickman, D.

    2011-12-01

    In this paper we discuss a novel instrument, currently under development at Honeybee Robotics with SBIR funding from NASA. The device is designed to characterize elemental composition as a function of depth in non-terrestrial geological formations. The instrument consists of a miniaturized LIBS analyzer integrated in a 2" diameter drill string. While the drill provides subsurface access, the LIBS analyzer provides information on the elemental composition of the borehole wall. This instrument has a variety of space applications ranging from exploration of the Moon for which it was originally designed, to Mars, as well as a variety of terrestrial applications. Subsurface analysis is usually performed by sample acquisition through a drill or excavator, followed by sample preparation and subsequent sample presentation to an instrument or suite of instruments. An alternative approach consisting in bringing a miniaturized version of the instrument to the sample has many advantages over the traditional methodology, as it allows faster response, reduced probability of cross-contamination and a simplification in the sampling mechanisms. LIBS functions by focusing a high energy laser on a material inducing a plasma consisting of a small fraction of the material under analysis. Optical emission from the plasma, analyzed by a spectrometer, can be used to determine elemental composition. A triangulation sensor located in the sensor head determines the distance of the sensor from the borehole wall. An actuator modifies the position of the sensor accordingly, in order to compensate for changes due to the profile of the borehole walls. This is necessary because LIBS measurements are negatively affected by changes in the relative position of the focus of the laser with respect to the position of the sample (commonly referred to as the "lens to sample distance"). Profiling the borehole is done by adjusting the position of the sensor with a vertical stage; a second actuator at the

  2. Elements of algebraic coding systems

    CERN Document Server

    Cardoso da Rocha, Jr, Valdemar

    2014-01-01

    Elements of Algebraic Coding Systems is an introductory textto algebraic coding theory. In the first chapter, you'll gain insideknowledge of coding fundamentals, which is essential for a deeperunderstanding of state-of-the-art coding systems.This book is a quick reference for those who are unfamiliar withthis topic, as well as for use with specific applications such as cryptographyand communication. Linear error-correcting block codesthrough elementary principles span eleven chapters of the text.Cyclic codes, some finite field algebra, Goppa codes, algebraic decodingalgorithms, and applications in public-key cryptography andsecret-key cryptography are discussed, including problems and solutionsat the end of each chapter. Three appendices cover the Gilbertbound and some related derivations, a derivation of the Mac-Williams' identities based on the probability of undetected error,and two important tools for algebraic decoding-namely, the finitefield Fourier transform and the Euclidean algorithm for polynomials.

  3. Analysis of“Microtonal Transposed Pentatonic Mode System”in SONG Mingzhu’s Chamber Music Work Two Pieces of String’s Rhyme%宋名筑室内乐《弦韵两首》中“微分音移位五声性调式体系”的运用兼及技法分析

    Institute of Scientific and Technical Information of China (English)

    陈国威; 何莲子

    2014-01-01

    The per-set“Microtonal Transposed Pentatonic Mode System”in SONG Mingzhu ’s Chamber Music Work Two Pieces of String’s Rhyme (for Zheng,Piano and String Quartet)is a successful attempt of individualized musical language and stylistic breakthrough. My paper takes Two Pieces of String’s Rhyme as an example,and an-alyzes the theoretical construction,harmonic sonority,multiple performance method,timber combination,and modern contrapuntal technique of“Microtonal Transposed Pentatonic Mode System.”%改革开放以来,中国的现代音乐逐渐走向成熟。作曲家们在吸收前人创作经验的基础上,不拘一格,不断创新,在追求表达富于个性鲜明特征,彰显本土音乐文化,体现多元音乐文化体征的同时,实现作曲家自身音乐语言与风格的突破。四川音乐学院作曲系宋名筑教授创作的室内乐《弦韵两首》(为古筝、钢琴和弦乐四重奏而作)运用设定的“微分音移位五声性调式体系”作曲法,正是其为实现自身个性化音乐语言和风格突破所作的成功尝试。而这一体系的设定,对中国现代音乐创作是具有一定指导启发意义的。文章从微分音移位五声性音材料的理论构建、和声音响、多重演奏法与音色搭配、现代复调技法、数控节奏等角度,解析“微分音移位五声性调式体系”在《弦韵两首》中的运用规律与创作构想。

  4. Logical elements in living cells.

    Science.gov (United States)

    Kremen, A

    1984-11-01

    Recognition processes with enhanced accuracy (as performed by structures like enzymes or ribosomes) are investigated using elementary ideas of statistical mechanics and related concepts of thermodynamics. The analysis starts from a formal definition of recognition and provides a correspondence with appropriate physical properties of the macromolecular logical elements. Transitions of the recognizing system between different modifications are a necessary feature of a more exacting recognition process. Rearrangement steps provide the process with higher accuracy by performing two physical operations: (1) rearranging the phase space of the system so that the "correct" states be better separated from the "wrong" states and the probability of occupation of the "correct" states be enhanced, (2) directing the process toward the more favourable modifications thus formed. Both operations are related to changes in the physical properties of the recognizing system. These changes can be expressed as differences of macromolecular Gibbs energy levels; if ligand binding or release participate in a step, directivity of the step depends also on the actual chemical potentials of the ligands in solution. The two operations just mentioned resemble two basic operations known to be necessary in electronic digital networks: directivity of control and signal standardization. An analysis of the entire reaction catalysed by a macromolecular logical element takes into account the requirements imposed by the logical functions as well as the need that the chemical potential of the product be not restricted to very low values. To satisfy these conditions, the reaction must be supported by a so-called non-specific reaction, usually implemented by the cleavage reaction of a nucleoside triphosphate. PMID:6513567

  5. A New Geochemical Classification of Elements

    Institute of Scientific and Technical Information of China (English)

    Qi Changmou; L. Lynn Chyi

    2001-01-01

    The geochemical classification proposed by Goldschmidt was based on meteoritic analysis and elemental partition in blast furnace. There are many surprises when applied to the discussion of natural occurrences. A modified classification of elements based on basic chemical properties and their occurrences. A modified classification of elements based on basic chemical properties and their occurrences in nature is, therefore, proposed for students learning geochemistry and geologists working in the field. Elements are classified into six groups including lithophile, oxyphile, siderophile, chalcophile, biophile, and atmophile elements. Five terms are taken from Goldshcmidt's original classification. Oxyphile is a new term.

  6. Spectral-element agglomerate coarsening in AMGe

    Energy Technology Data Exchange (ETDEWEB)

    Vassilevski, P S

    2000-12-06

    In this talk the authors present a highly accurate coarsening algorithm for constructing coarse finite element spaces to be used in algebraic multigrid methods designed for finite element problems on generally unstructured meshes. The new algorithm relies on removing certain percentage of the high oscillating components from the spectrum of local stiffness matrices corresponding to element agglomerations. By doing so, one is guaranteed that the hierarchical complement finite element subspace gives rise to a well conditioned matrix. The coarsening consists of an agglomeration step and of computing a few minimal eigenvectors of the corresponding assembled agglomerate stiffness matrix. The method requires access to the individual element matrices. Based on the topological agglomeration algorithms they employed one is able to define coarse elements and coarse element matrices thus allowing for recursive use of the same algorithm. Some numerical illustration for elliptic problems is also given.

  7. 利用果蝇转座子作载体构建土垢分枝杆菌变异基因文库的研究%ESTABLISHMENT OF MYCOBACTERIUM SMEGMATISB MUTAGENESIS LIBRARY WITH DROSOPHILA MAURITIANA MARINER ELEMENT VECTOR

    Institute of Scientific and Technical Information of China (English)

    刘克义; 于进芝

    2004-01-01

    目的利用果蝇mariner转座子作为载体构建土垢分枝杆菌随机变异基因文库以筛选影响脂肪酸代谢的基因. 方法将果蝇转座子mos1的末端反向重复序列置于卡那霉素抗性基因两侧,并将此种基因插入到M272B载体,用此载体转化土垢分枝杆菌,用Southern blot验证外源基因的插入.将变异的基因克隆在不同碳源的培养基上培养,筛选只在软脂酸上生长的菌落. 结果初筛了468个菌落,有5个不能在软脂酸上生长,其中2个在ICL基因上发生变异,3个在PCKA基因上发生变异.ICL为乙醛酸旁路所必须,PCKA编码糖异生的关键酶. 结论研究证明该转座子载体用于基因变异有效,变异筛选分枝杆菌中与脂肪酸代谢的基因可行.%Objective Use the Drosophila mauritiana mariner transposable element as a vector to construct Mycobacterium smegmatis random mutagenesis library in order to screen transposon mutants that affect the metabolism of fatty acids. Methods A transposon mutagenesis vector was constructed, which contains the Tn903 kanamycin resistance (KanR) gene flanked by the 5′ and 3′ inverted repeats of the D. mauritiana transposable element Mos1. M. smegmatis was transformed with the vector. The ability of transposon to integrate within the chromosome was identified using southern strategy. M. smegmatis transposon mutants were pooled and screened using different carbon sources. The clones could not grow on palmitate were selected. Results From initial screen of 468 colonies, we isolated one insertion in the isocitrate lyase gene, required for the glyoxalate shunt, and three independent insertions in the phosphoenolpyruvate carboxykinase gene, required for gluconeogenesis. Conclusion These results demonstrate the utility of this transposon mutagenesis vector, as well as the ability of our mutagenesis screen to identify mutations that affect the metabolism of fatty acids by mycobacterium.

  8. Osmolality of Elemental and Semi-Elemental Formulas Supplemented with Nonprotein Energy Supplements

    OpenAIRE

    Pereira-da-Silva, L; Pitta-Grós Dias, M; Virella, D; Serelha, M.

    2008-01-01

    Elemental and semi-elemental formulas are used to feed infants with short bowel syndrome, who may not be able to tolerate feeds of more than 310 mOsm kg(-1). The present study aimed to measure the osmolality of elemental and semi-elemental formulas at different concentrations, with and without the addition of nonprotein energy supplements.

  9. Functional Metamirrors Using Bianisotropic Elements

    Science.gov (United States)

    Asadchy, V. S.; Ra'di, Y.; Vehmas, J.; Tretyakov, S. A.

    2015-03-01

    Conventional mirrors obey the simple reflection law that a plane wave is reflected as a plane wave, at the same angle. To engineer spatial distributions of fields reflected from a mirror, one can either shape the reflector or position some phase-correcting elements on top of a mirror surface. Here we show, both theoretically and experimentally, that full-power reflection with general control over the reflected wave phase is possible with a single-layer array of deeply subwavelength inclusions. These proposed artificial surfaces, metamirrors, provide various functions of shaped or nonuniform reflectors without utilizing any mirror. This can be achieved only if the forward and backward scattering of the inclusions in the array can be engineered independently, and we prove that it is possible using electrically and magnetically polarizable inclusions. The proposed subwavelength inclusions possess desired reflecting properties at the operational frequency band, while at other frequencies the array is practically transparent. The metamirror concept leads to a variety of applications over the entire electromagnetic spectrum, such as optically transparent focusing antennas for satellites, multifrequency reflector antennas for radio astronomy, low-profile conformal antennas for telecommunications, and nanoreflectarray antennas for integrated optics.

  10. Trace Element Management in Rice

    Directory of Open Access Journals (Sweden)

    Abin Sebastian

    2015-08-01

    Full Text Available Trace elements (TEs are vital for the operation of metabolic pathways that promote growth and structural integrity. Paddy soils are often prone to TE limitation due to intensive cultivation and irrigation practices. Apart from this, rice paddies are potentially contaminated with transition metals such as Cd, which are often referred to as toxic TEs. Deficiency of TEs in the soil not only delays plant growth but also causes exposure of plant roots to toxic TEs. Fine-tuning of nutrient cycling in the rice field is a practical solution to cope with TEs deficiency. Adjustment of soil physicochemical properties, biological process such as microbial activities, and fertilization helps to control TEs mobilization in soil. Modifications in root architecture, metal transporters activity, and physiological processes are also promising approaches to enhance TEs accumulation in grains. Through genetic manipulation, these modifications help to increase TE mining capacity of rice plants as well as transport and trafficking of TEs into the grains. The present review summarizes that regulation of TE mobilization in soil, and the genetic improvement of TE acquisition traits help to boost essential TE content in rice grain.

  11. Finite element coiled cochlea model

    Science.gov (United States)

    Isailovic, Velibor; Nikolic, Milica; Milosevic, Zarko; Saveljic, Igor; Nikolic, Dalibor; Radovic, Milos; Filipović, Nenad

    2015-12-01

    Cochlea is important part of the hearing system, and thanks to special structure converts external sound waves into neural impulses which go to the brain. Shape of the cochlea is like snail, so geometry of the cochlea model is complex. The simplified cochlea coiled model was developed using finite element method inside SIFEM FP7 project. Software application is created on the way that user can prescribe set of the parameters for spiral cochlea, as well as material properties and boundary conditions to the model. Several mathematical models were tested. The acoustic wave equation for describing fluid in the cochlea chambers - scala vestibuli and scala timpani, and Newtonian dynamics for describing vibrations of the basilar membrane are used. The mechanical behavior of the coiled cochlea was analyzed and the third chamber, scala media, was not modeled because it does not have a significant impact on the mechanical vibrations of the basilar membrane. The obtained results are in good agreement with experimental measurements. Future work is needed for more realistic geometry model. Coiled model of the cochlea was created and results are compared with initial simplified coiled model of the cochlea.

  12. Interstitial Functionalization in elemental Si

    Science.gov (United States)

    Kiefer, Boris; Fohtung, Edwin

    Societies in the 21st century will face many challenges. Materials science and materials design will be essential to address and master some if not all of these challenges. Semiconductors are among the most important technological material classes. Properties such as electrical transport are strongly affected by defects and a central goal continues to be the reduction of defect densities as much as possible in these compounds. Here we present results of interstitial Fe doping in elemental Si using first-principles DFT calculations. The preliminary results show that Fe will only occupy octahedral interstitial sites. The analysis of the electronic structure shows that the compounds are ferromagnetic and that a bandgap opens as interstitial Fe concentrations decrease, with a possible intermittent semi-metallic phase. The formation energy for interstitial Fe is unfavorable, as expected, by ~1.5 eV but becomes favorable as the chemical potential of Fe increases. Therefore, we expect that biasing the system with an external electrical field will lead to the formation of these materials. Thus, our results show that interstitial defects can be beneficial for the design of functionalities that differ significantly from those of the host material.

  13. A NOVEL ELLIPSOIDAL ACOUSTIC INFINITE ELEMENT

    Institute of Scientific and Technical Information of China (English)

    YANG Rui-liang; WANG Hong-zhen

    2005-01-01

    A novel ellipsoidal acoustic infinite element is proposed. It is based a new pressure representation, which can describe and solve the ellipsoidal acoustic field more exactly. The shape functions of this novel acoustic infinite element are similar .to the Burnett's method, while the weight functions are defined as the product of the complex conjugates of the shaped functions and an additional weighting factor. The code of this method is cheap to generate as for 1-D element because only 1-D integral needs to be numerical. Coupling with the standard finite element, this method provides a capability for very efficiently modeling acoustic fields surrounding structures of virtually any practical shape. This novel method was deduced in brief and the conclusion was kept in detail. To test the feasibility of this novel method efficiently, in the examples the infinite elements were considered, excluding the finite elements relative. This novel ellipsoidal acoustic infinite element can deduce the analytic solution of an oscillating sphere. The example of a prolate spheroid shows that the novel infinite element is superior to the boundary element and other acoustic infinite elements. Analytical and numerical results of these examples show that this novel method is feasible.

  14. Stable isotopes for heavy element production

    CERN Document Server

    Lommel, B; Hofmann, S; Kindler, B; Klemm, J; Steiner, J; Tinschert, K

    2003-01-01

    The synthesis of heavy elements and the search for new superheavy elements is one of the exciting fields in modern nuclear physics and chemistry. Heavy elements are produced by heavy-ion fusion reactions. Necessary prerequisites are intense heavy-ion beams from pure isotopic material and thin isotopically enriched targets. At GSI the elements from 107 to 112 were produced using targets of Pb and Bi and beams of the most neutron rich isotopes of Cr, Fe, Ni, and Zn. Experimental set-up consisting of target wheel, velocity filter SHIP (Separator for Heavy Ion Reaction Products), and detector system is presented. Status of the ion source techniques for delivering intense and stable beams for this kind of experiment is shortly described. The manufacturing and properties of various source - target combinations used for the synthesis of the elements by now are discussed in detail as well as the possibilities for extending the experiments into the region of superheavy elements.

  15. Automated Fuel Element Closure Welding System

    International Nuclear Information System (INIS)

    The Automated Fuel Element Closure Welding System is a robotic device that will load and weld top end plugs onto nuclear fuel elements in a highly radioactive and inert gas environment. The system was developed at Argonne National Laboratory-West as part of the Fuel Cycle Demonstration. The welding system performs four main functions, it (1) injects a small amount of a xenon/krypton gas mixture into specific fuel elements, and (2) loads tiny end plugs into the tops of fuel element jackets, and (3) welds the end plugs to the element jackets, and (4) performs a dimensional inspection of the pre- and post-welded fuel elements. The system components are modular to facilitate remote replacement of failed parts. The entire system can be operated remotely in manual, semi-automatic, or fully automatic modes using a computer control system. The welding system is currently undergoing software testing and functional checkout

  16. Spacer for supporting fuel element boxes

    International Nuclear Information System (INIS)

    A spacer plate unit arranged externally on each side and at a predetermined level of a polygonal fuel element box for mutually supporting, with respect to one another, a plurality of the fuel element boxes forming a fuel element bundle, is formed of a first and a second spacer plate part each having the same length and the same width and being constituted of unlike first and second materials, respectively. The first and second spacer plate parts of the several spacer plate units situated at the predetermined level are arranged in an alternating continuous series when viewed in the peripheral direction of the fuel element box, so that any two spacer plate units belonging to face-to-face oriented sides of two adjoining fuel element boxes in the fuel element bundle define interfaces of unlike materials

  17. Completely normal elements in finite abelian extensions

    CERN Document Server

    Koo, Ja Kung

    2011-01-01

    We give a completely normal element in the maximal real subfield of a cyclotomic field over the field of rational numbers, which is different from that of Okada. This result is a consequence of the criterion for a normal element developed in [Normal bases of ray class fields over imaginary quadratic fields, Math. Zeit.]. Furthermore, we find a completely normal element in certain extension of modular function fields in terms of a quotient of the modular discriminant function.

  18. DETERMINATION OF IMPURITY ELEMENTS IN ALUMINIUM

    Institute of Scientific and Technical Information of China (English)

    侯小琳; 张永保

    1994-01-01

    Twenty five impurity elements in aluminium applied as reactor material are determined.Titanium and nickel are determined with epithermal neutron activation analysis(NAA),magnesium and silicon by inductance coupling plasma emission spectra(ICP),other elements by thermal NAA.The fission coefficient of uranium is given by an experiment,the interferences of uranium to Ce,Nd,Mo,Zr,La,Sm are subtracted.The detection limits of these methods to all of impurity elements in aluminium are calculated.

  19. Integrating Environmentally Responsive Elements in Buildings

    OpenAIRE

    Heiselberg, Per; Andresen, Inger; Perino, Marco; van der Aa, Ad

    2006-01-01

    Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie with technologies that promote the integration of responsive building elements and building services in integrated building concepts. In order to address some of these issues an international research effort, IE...

  20. The elements of life and medicines.

    Science.gov (United States)

    Chellan, Prinessa; Sadler, Peter J

    2015-03-13

    Which elements are essential for human life? Here we make an element-by-element journey through the periodic table and attempt to assess whether elements are essential or not, and if they are, whether there is a relevant code for them in the human genome. There are many difficulties such as the human biochemistry of several so-called essential elements is not well understood, and it is not clear how we should classify elements that are involved in the destruction of invading microorganisms, or elements which are essential for microorganisms with which we live in symbiosis. In general, genes do not code for the elements themselves, but for specific chemical species, i.e. for the element, its oxidation state, type and number of coordinated ligands, and the coordination geometry. Today, the biological periodic table is in a position somewhat similar to Mendeleev's chemical periodic table of 1869: there are gaps and we need to do more research to fill them. The periodic table also offers potential for novel therapeutic and diagnostic agents, based on not only essential elements, but also non-essential elements, and on radionuclides. Although the potential for inorganic chemistry in medicine was realized more than 2000 years ago, this area of research is still in its infancy. Future advances in the design of inorganic drugs require more knowledge of their mechanism of action, including target sites and metabolism. Temporal speciation of elements in their biological environments at the atomic level is a major challenge, for which new methods are urgently needed. PMID:25666066

  1. Anisotropic damping of Timoshenko beam elements

    DEFF Research Database (Denmark)

    Hansen, M.H.

    2001-01-01

    for ¤flapwise¤, ¤edgewise¤ and ¤torsional¤ vibrations. The structural damping forces acting on the beam element are modeled by viscous damping described by an element damping matrix. The composition of this matrix is basedon the element mass and stiffness matrices. It is shown how the coefficients for the mass...... and stiffness contributions can be calibrated to give the desired modal damping in the complete model of a blade....

  2. Benchmarking the QUAD4/TRIA3 element

    Science.gov (United States)

    Pitrof, Stephen M.; Venkayya, Vipperla B.

    1993-09-01

    The QUAD4 and TRIA3 elements are the primary plate/shell elements in NASTRAN. These elements enable the user to analyze thin plate/shell structures for membrane, bending and shear phenomena. They are also very new elements in the NASTRAN library. These elements are extremely versatile and constitute a substantially enhanced analysis capability in NASTRAN. However, with the versatility comes the burden of understanding a myriad of modeling implications and their effect on accuracy and analysis quality. The validity of many aspects of these elements were established through a series of benchmark problem results and comparison with those available in the literature and obtained from other programs like MSC/NASTRAN and CSAR/NASTRAN. Never-the-less such a comparison is never complete because of the new and creative use of these elements in complex modeling situations. One of the important features of QUAD4 and TRIA3 elements is the offset capability which allows the midsurface of the plate to be noncoincident with the surface of the grid points. None of the previous elements, with the exception of bar (beam), has this capability. The offset capability played a crucial role in the design of QUAD4 and TRIA3 elements. It allowed modeling layered composites, laminated plates and sandwich plates with the metal and composite face sheets. Even though the basic implementation of the offset capability is found to be sound in the previous applications, there is some uncertainty in relatively simple applications. The main purpose of this paper is to test the integrity of the offset capability and provide guidelines for its effective use. For the purpose of simplicity, references in this paper to the QUAD4 element will also include the TRIA3 element.

  3. Noncoding Elements: Evolution and Epigenetic Regulation

    KAUST Repository

    Seridi, Loqmane

    2016-03-09

    When the human genome project was completed, it revealed a surprising result. 98% of the genome did not code for protein of which more than 50% are repeats— later known as ”Junk DNA”. However, comparative genomics unveiled that many noncoding elements are evolutionarily constrained; thus luckily to have a role in genome stability and regulation. Though, their exact functions remained largely unknown. Several large international consortia such as the Functional Annotation of Mammalian Genomes (FANTOM) and the Encyclopedia of DNA Elements (ENCODE) were set to understand the structure and the regulation of the genome. Specifically, these endeavors aim to measure and reveal the transcribed components and functional elements of the genome. One of the most the striking findings of these efforts is that most of the genome is transcribed, including non-conserved noncoding elements and repeat elements. Specifically, we investigated the evolution and epigenetic properties of noncoding elements. 1. We compared genomes of evolutionarily distant species and showed the ubiquity of constrained noncoding elements in metazoa. 2. By integrating multi-omic data (such as transcriptome, nucleosome profiling, histone modifications), I conducted a comprehensive analysis of epigenetic properties (chromatin states) of conserved noncoding elements in insects. We showed that those elements have distinct and protective sequence features, undergo dynamic epigenetic regulation, and appear to be associated with the structural components of the chromatin, replication origins, and nuclear matrix. 3. I focused on the relationship between enhancers and repetitive elements. Using Cap Analysis of Gene Expression (CAGE) and RNASeq, I compiled a full catalog of active enhancers (a class of noncoding elements) during myogenesis of human primary cells of healthy donors and donors affected by Duchenne muscular dystrophy (DMD). Comparing the two time-courses, a significant change in the epigenetic

  4. Superheavy Elements Challenge Experimental and Theoretical Chemistry

    CERN Document Server

    Zvára, I

    2003-01-01

    When reflecting on the story of superheavy elements, the an experimenter, acknowledges the role, which the predictions of nuclear and chemical theories have played in ongoing studies. Today, the problems of major interest for experimental chemistry are the studies of elements 112 and 114 including their chemical identification. Advanced quantum chemistry calculations of atoms and molecules would be of much help. First experiments with element 112 evidence that the metal is much more volatile and inert than mercury.

  5. Domain decomposition methods for mortar finite elements

    Energy Technology Data Exchange (ETDEWEB)

    Widlund, O.

    1996-12-31

    In the last few years, domain decomposition methods, previously developed and tested for standard finite element methods and elliptic problems, have been extended and modified to work for mortar and other nonconforming finite element methods. A survey will be given of work carried out jointly with Yves Achdou, Mario Casarin, Maksymilian Dryja and Yvon Maday. Results on the p- and h-p-version finite elements will also be discussed.

  6. Multi-element analysis of wines

    OpenAIRE

    Ivanova, Violeta

    2014-01-01

    The knowledge of the element composition in wine is very important from toxicological point of view, since it could contains harmful elements, such as Pb, As and Cd, and from nutritional point of view, since wine contains essential elements for the human organism, such as Ca, Cr, Co, K, Se and Zn [1]. The presence of metals (i.e. Al, Zn, Cu, Fe, Pb) in wine is important for efficient alcoholic fermentation and for its sensorial characteristics (flavor, aroma, freshness). The element compositi...

  7. Photoshop Elements 8 After the Shoot

    CERN Document Server

    Fitzgerald, Mark

    2010-01-01

    A handy, full-color reference for using Photoshop Elements 8 while on the go. Photoshop Elements combines an easy-to-use set of features and enhancements with image editing power in an affordable program. The newest version—Photoshop Elements 8—features more online integration with products like the new Flash-based Web galleries. Featuring a convenient trim size that goes where you go, this portable guide is essential reading for Elements users and especially suited if you are a mobile user who wants to edit and post your digital photographs while on the go.: Serves as a portable reference for

  8. Quadrature representation of finite element variational forms

    DEFF Research Database (Denmark)

    Ølgaard, Kristian Breum; Wells, Garth N.

    2012-01-01

    This chapter addresses the conventional run-time quadrature approach for the numerical integration of local element tensors associated with finite element variational forms, and in particular automated optimizations that can be performed to reduce the number of floating point operations. An alter......This chapter addresses the conventional run-time quadrature approach for the numerical integration of local element tensors associated with finite element variational forms, and in particular automated optimizations that can be performed to reduce the number of floating point operations...

  9. Laser emission spectrography of rare earth elements

    International Nuclear Information System (INIS)

    Emission spectrography of rare earth elements in several matrixes is studied by using a Q-switched ruby laser as an exciting source for macro analysis. The emission intensities of rare earth elements are considerably affected by the matrixes. The emission intensities of rare earth elements are most intense in sodium chloride matrix, but fairly suppressed in sodium sulfate matrix. Scandium, yttrium, europium, and ytterbium, in sodium chloride matrix are detected down to concentrations of ppm order with one laser shot. The emission intensities of rare earth elements in refractory oxides, such as aluminum oxide or rate earth oxides, are about two orders of magnitude less than those in sodium chloride matrix. (auth.)

  10. A first course in finite elements

    CERN Document Server

    Fish, Jacob

    2007-01-01

    Developed from the authors, combined total of 50 years undergraduate and graduate teaching experience, this book presents the finite element method formulated as a general-purpose numerical procedure for solving engineering problems governed by partial differential equations.  Focusing on the formulation and application of the finite element method through the integration of finite element theory, code development, and software application, the book is both introductory and self-contained, as well as being a hands-on experience for any student. This authoritative text on Finite Elements:Adopts

  11. Gamma spectrometry of TRIGA fuel elements

    International Nuclear Information System (INIS)

    The burnupt of 19 TRIGA fuel elements was determined by gamma spectrometry using a special fuel element holder developed and constructed at the Atom Institute, Vienna. The investigated fuel element is kept in a horizontal position about 4 m below the reactor pool water surface. A collimator tube extends to the reactor platform where an intrinsic Ge-detector is located. With this system each fuel element was investigated at eight equidistant points along its active zone and the Cs 137 activity was evaluated. (orig.)

  12. EDITORIAL: King of the elements? King of the elements?

    Science.gov (United States)

    Demming, Anna

    2010-07-01

    Throughout the history of science, carbon-based research has played a defining role in the development of a range of fundamental and technological fields. It was used in Avagadro's definition of the mole in the early 18th century, it provides the 'backbone' of molecules in organic compounds, and in the environmental debate currently raging in the press and international government discussions, the 'carbon footprint' has become the metric of our species' impact on our planet. Also in nanotechnology, with the discovery of various wonder materials, carbon is once again asserting its claim as king of the elements. Until the 1980s the only known forms of carbon were diamond, graphite and amorphous carbon, as in soot or charcoal. In 1985 Robert Curl, Harold Kroto and Richard Smalley reported the existence of fullerenes, spherical structures comprising hexagonal carbon rings [1], work for which they won the Nobel Prize for Chemistry in 1996 [2]. The discovery of fullerenes was followed in 1991 by Sumio Ijima with the discovery of rolled graphite sheets, the carbon nanotube [3]. The discovery of these novel carbon nanostructures inspired researchers in a range of fields, largely as a result of the extraordinary capacity for investigations of these structures to reveal ever more intriguing properties. One of the fascinating properties attributed to carbon nanotubes is their phenomenal strength, with a Young's modulus of single walled carbon nanotubes approaching a terapascal [4]. Ingenious methods of harnessing this strength have since been developed, including bucky paper, a term used to refer to a mat of randomly self-entangled carbon nanotubes. Steven Crannford and Markus Buehler have recently reported a novel computational technique for probing the mechanical properties of these structures and show that the Young's modulus of bucky paper can be tuned by manipulation of the carbon nanotube type and density [5]. The electrical properties of carbon nanotubes, which depend

  13. Retrotransposition of long interspersed nucleotide element-1 is associated with colitis but not tumors in a murine colitic cancer model.

    Directory of Open Access Journals (Sweden)

    Takeshi Otsubo

    Full Text Available Long interspersed element-1 (L1 is a transposable element that can move within the genome, potentially leading to genome diversity and modified gene function. Although L1 activity in somatic cells is normally suppressed through DNA methylation, some L1s are activated in tumors including colorectal carcinoma. However, how L1-retrotransposition (L1-RTP is involved in gastrointestinal disorders remains to be elucidated. We hypothesized that L1-RTP in somatic cells might contribute to colitis-associated cancer (CAC. To address this, we employed an experimental model of CAC using transgenic L1-reporter mice carrying a human L1-EGFP reporter gene. Mice were subjected to repeated cycles of colitis induced by administration of dextran sodium sulfate (DSS in drinking water with injection of carcinogen azoxymethane (AOM. L1-RTP levels were measured by a quantitative polymerase chain reaction targeting the newly inserted reporter EGFP in various tissues and cell types, including samples obtained by laser microdissection and cell sorting with flow cytometry. DNA methylation levels of the human L1 promoter were analyzed by bisulfite pyrosequencing. AOM+DSS-treated mice exhibited significantly higher levels of L1-RTP in whole colon tissue during the acute phase of colitis when compared with control naïve mice. L1-RTP levels in whole colon tissue were positively correlated with the histological severity of colitis and degree of neutrophil infiltration into the lamina propria (LP, but not with tumor development in the colon. L1-RTP was enriched in LP mesenchymal cells rather than epithelial cells (ECs, myeloid, or lymphoid cells. DNA methylation levels of the human L1 promoter region showed a negative correlation with L1-RTP levels. L1-RTP was absent from most tumors found in 22-week-old mice. In conclusion, we demonstrated that L1-RTP was induced in the mouse CAC mucosa in accordance with the acute inflammatory response; however, retrotransposition appears

  14. INCOMES AND EXPENSES DEFINE ELEMENTS OF THE BUDGETARY ACCOUNTING OF PUBLIC INSTITUTIONS ACCOUNTING

    OpenAIRE

    Iuliana Cenar

    2008-01-01

    The process of reforming accounting has been transposed to the level ofpublic institutions for nearly 3 years. It was an audacious attempt by Cutting out theheavy legacy of the past, limited to income earned and expenses paid. The next stageof reform is sedimentation, decanting, and the formulation of strategies accountingfor supreme desideratum achievement of accounting - the image faithful. In thisprocess should be involved both theory and practice of accounting. It is why weconsidered appr...

  15. Photosynthetic system as a biological functional element

    International Nuclear Information System (INIS)

    Photosynthetic apparatus of high plants and photosynthetic bacteria is essentially autonomic system in terms of genetics and structural -functional properties located in specific medium, a bio-membrane. Processes of light absorption and exciton migration in light harvesting antenna, separation and further transfer of charges in reaction centers have specific features, which may be used for application of these objects as key elements in construction of future biological functional elements. Progress in study and genetic modification of photosynthetic membranes achieved during the last decade opens great prospects in development biological functional elements and systems. The main characteristics of photosynthetic system for these purposes are: (i) energy conversion processes in the first light phase of the photosynthesis have very short periods, up to picoseconds, which indicates possibility of creation of ultrafast functional elements on their basis; (ii) characteristics sizes of photosynthetic units, 10-100 nm, and possibility to arrange regularly disposed elements in relevant membranes could be prospective point for creation of nano structures and on their basis relevant biologic functional elements; (iii) elements based on modified photosynthetic apparatus and bio-membranes might be efficiently created by methods of gene engineering and manipulation, that open huge opportunities for development of read biological functional systems. In the paper structural-functional properties and characteristics of high plants and purple photosynthetic bacteria, which may be useful for creation of future biological functional elements are considered. (author)

  16. Elemental composition of human and animal milk

    International Nuclear Information System (INIS)

    A review is presented of the elemental composition of human and animal milk with special reference to trace elements determined through nuclear techniques, particularly neutron activation analysis (NAA). In the joint IAEA/WHO research project, 16 of the 24 elements under investigation have been analysed by NAA with the aid of advanced research nuclear reactors. Literature data are discussed and tabulated in 50 separate tables (one for each element) mainly for the period after 1950. Each table uses a standard format comprising 10 columns indicating (1) source of milk (e.g. human or animal), (2) status of the milk (colostrum, transitional or mature), (3) country of origin, (4) year of data publication, (5) mean concentration, (6) range of single values or standard deviation of the mean, (7) number of samples analysed, (8) analytical technique employed, (9) literature source of the data, and (10) relevant remarks, if any. The most abundant data refer to the minor elements Ca, Cl, K, Mg, N, Na, P and S and to the trace elements Cu, Fe and Zn. Fewer data are available for Cd, Hg, I, Mn, Pb and Se. For the remaining elements, including such biologically important trace elements as As, Co, Cr, F, Mo, Ni, Si and Sn, very few reliable data so far appear to exist

  17. Unconscious emotional effects of packaging design elements

    DEFF Research Database (Denmark)

    Liao, Lewis; Corsi, Armando; Lockshin, Larry;

    This research investigates consumers’ unconscious emotional responses to packaging elements such as image, colour and font. The intensity and valence of the emotional response, in reaction to these packaging elements, is established by the use of skin conductance tests and facial electromyography...... response to packaging....

  18. Protein export elements from Lactococcus lactis

    NARCIS (Netherlands)

    Perez-Martinez, Gaspar; Kok, Jan; Venema, Gerhardus; Dijl, Jan Maarten van; Smith, Hilda; Bron, Sierd

    1992-01-01

    Broad-host-range plasmids carrying α-amylase or β-lactamase reporter genes lacking a signal sequence were used to select export elements from Lactococcus lactis chromosomal DNA that could function as signal sequences. Fragments containing such elements were identified by their ability to direct the

  19. 40 CFR 721.10068 - Elemental mercury.

    Science.gov (United States)

    2010-07-01

    ... Substances § 721.10068 Elemental mercury. (a) Definitions. The definitions in § 721.3 apply to this section. In addition, the following definition applies: Motor vehicle has the meaning found at 40 CFR 85.1703... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Elemental mercury. 721.10068...

  20. An elemental microanalysis of mouse ileum tissue

    International Nuclear Information System (INIS)

    A scanning proton microprobe has been used for a preliminary investigation of the cellular distribution of heavy metals and other elements in mouse ileum tissue. In order to study the cellular and elemental morphology of a villus the spatial distributions of the yields of characteristic X-rays are compared to a photomicrograph of the irradiated tissue and to a stained adjacent tissue section

  1. Trace Elements in Human Tooth Enamel

    International Nuclear Information System (INIS)

    The trace elements are considered to play a role in the resistance of teeth to dental caries. The exact mechanism by which they act has not yet been fully established. Estimations of trace elements have been undertaken in sound human teeth. By means of activation analysis it has been possible to determine trace element concentrations in different layers of enamel in the same tooth. The concentrations of the following elements have been determined: arsenic, antimony, copper, zinc, manganese, mercury, molybdenum and vanadium. The distribution of trace elements in enamel varies from those with a narrow range, such as manganese, to those with a broad range, such as antimony. The elements present in the broad range are considered to be non-essential and their presence is thought to result from a chance incorporation into the enamel. Those in the narrow range appear to be essential trace elements and are present in amounts which do not vary unduly from other body tissues. Only manganese and zinc were found in higher concentrations in the surface layer of enamel compared with the inner layers. The importance of the concentration of trace elements on this surface layer of enamel is emphasized as this layer is the site of the first attack by the carious process. (author)

  2. Enhanced patch test of finite element methods

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    Theoretically, the constant stress patch test is not rigorous. Also, either the patch test of non-zero constant shear for Mindlin plate problem or non-zero strain gradient curvature of the microstructures cannot be performed. To improve the theory of the patch test, in this paper, based on the variational principle with relaxed continuity requirement of nonconforming element for homogeneous differential equations, the author proposed the individual element condition for passing the patch test and the convergence condition of the element: besides passing the patch test, the element function should include the rigid body modes and constant strain modes and satisfy the weak continuity condition, and no extra zero energy modes occur. Moreover, the author further established a variational principle with relaxed continuity requirement of nonconforming element for inhomogeneous differential equations, the enhanced patch test condition and the individual element condition. To assure the convergence of the element that should pass the enhanced patch test, the element function should include the rigid body modes and non-zero strain modes which satisfied the equilibrium equations, and no spurious zero energy modes occur and should satisfy new weak continuity condition. The theory of the enhanced patch test proposed in this paper can be applied to both homogeneous and inhomogeneous differential equations. Based on this theory, the patch test of the non-zero constant shear stress for Mindlin plate and the C0-1 patch test of the non-zero constant curvature for the couple stress/strain gradient theory were established.

  3. Finite-Element Composite-Analysis Program

    Science.gov (United States)

    Bowles, David E.

    1990-01-01

    Finite Element Composite Analysis Program, FECAP, special-purpose finite-element program for analyzing behavior of composite material with microcomputer. Procedure leads to set of linear simultaneous equations relating unknown nodal displacement to applied loads. Written in HP BASIC 3.0.

  4. Finite-Element Software for Conceptual Design

    DEFF Research Database (Denmark)

    Lindemann, J.; Sandberg, G.; Damkilde, Lars

    2010-01-01

    and research. Forcepad is an effort to provide a conceptual design and teaching tool in a finite-element software package. Forcepad is a two-dimensional finite-element application based on the same conceptual model as image editing applications such as Adobe Photoshop or Microsoft Paint. Instead of using...

  5. Elements of Inclusion: Findings from the Field

    Science.gov (United States)

    McMaster, Christopher

    2014-01-01

    The Ministry of Education has set the target of 100% of New Zealand schools to be "mostly" inclusive by 2014. But what are the essential elements of inclusion? This paper explores essential core elements that allow inclusion to flourish. Based on an extensive time in the field as part of a year-long doctoral research project, these…

  6. MODERATOR ELEMENTS FOR UNIFORM POWER NUCLEAR REACTOR

    Science.gov (United States)

    Balent, R.

    1963-03-12

    This patent describes a method of obtaining a flatter flux and more uniform power generation across the core of a nuclear reactor. The method comprises using moderator elements having differing moderating strength. The elements have an increasing amount of the better moderating material as a function of radial and/or axial distance from the reactor core center. (AEC)

  7. Non-linear finite element modeling

    DEFF Research Database (Denmark)

    Mikkelsen, Lars Pilgaard

    The note is written for courses in "Non-linear finite element method". The note has been used by the author teaching non-linear finite element modeling at Civil Engineering at Aalborg University, Computational Mechanics at Aalborg University Esbjerg, Structural Engineering at the University...

  8. Reference: ELEMENT1GMLBC3 [PLACE

    Lifescience Database Archive (English)

    Full Text Available ELEMENT1GMLBC3 Jensen EO, Marcker KA, Schell J, de Bruijn J Interaction of a nodule... specific, trans-acting factor with distinct DNA elements in the soybean leghaemoglobin lbc3 5' upstream region EMBO J 7:1265-1271 (1988) ...

  9. Reference: ELEMENT2GMLBC3 [PLACE

    Lifescience Database Archive (English)

    Full Text Available ELEMENT2GMLBC3 Jensen EO, Marcker KA, Schell J, de Bruijn J Interaction of a nodule... specific, trans-acting factor with distinct DNA elements in the soybean leghaemoglobin lbc3 5' upstream region EMBO J 7:1265-1271 (1988) ...

  10. Solar cycle variation of network magnetic elements

    Science.gov (United States)

    Wang, J. X.; Jin, C. L.

    With the unique database from Michelson Doppler Imager aboard the Solar and Heliospheric Observatory in an interval embodying solar cycle 23, the cyclic behavior of solar small-scale magnetic elements is studied. More than 13 million solar network magnetic elements are selected, and the following results are discussed. (1) With increasing flux per element, the number variation of the network elements shows a three-fold scenario: no-correlation, anti-correlation, and correlation with sunspots, respectively. The anti-correlated elements cover flux range of (2.9 - 32.0)× 10^{18} Mx, and occupy 77.2% of total network elements. (2) The latitude distribution of the correlated elements follows the sunspot butterfly diagram in the solar cycle but has wider latitude distribution than sunspots. Furthermore, the anti-correlated elements also show much broad latitude distribution, but a moderate migration toward equator during the solar maximum which was clearly out of phase with sunspots. These results shed new light in understanding anti-correlated variations of small-scale solar activity, e.g., X-ray coronal bright points, and the origin of the Sun's small-scale magnetism.

  11. Just-in-time elements and benefits

    CERN Document Server

    García-Alcaraz, Jorge Luis

    2016-01-01

    This book reports the elements required for implementing Just in Time (JIT) technique in companies. The main reasons for low implementation processes and the main benefits from the successful implementation of them are highlighted in this book. Structural equation models are presented to help identify the essential elements in JIT.

  12. Trace element metabolism in man and animals

    International Nuclear Information System (INIS)

    Uptake, distribution, storage, excretion of different trace elements and resulting disturbances are investigated in blood and organs in animal experiments and in human diagnostics with the aid of radioisotopes. Apart from this, untritional disturbances are mentioned. Finally, future aspects of physiological trace element examinations are listed. (AJ) 891 AJ

  13. 47 CFR 97.505 - Element credit.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 5 2010-10-01 2010-10-01 false Element credit. 97.505 Section 97.505... SERVICE Qualifying Examination Systems § 97.505 Element credit. (a) The administering VEs must give credit.... (b) No examination credit, except as herein provided, shall be allowed on the basis of holding...

  14. Elemental Etymology: What's in a Name?

    Science.gov (United States)

    Ball, David W.

    1985-01-01

    Examines the origin of the names (or etymologies) of the chemical elements. Includes tables listing elements: (1) with names of obscure origin; (2) named for colors; (3) named after real or mythical people; (4) named after places; (5) named after heavenly bodies; and (6) having names of miscellaneous origin. (JN)

  15. Rare Earth Elements Distribution in Beryl

    International Nuclear Information System (INIS)

    Laser ablation method is applied to a double focusing inductively coupled plasma mass spectrometer to determine the rare earth element distribution in some selected beryl samples. White, green and blue beryl samples are selected from the Egyptian eastern desert. Distributions of chondrite- normalized plot for the rare earth element in the selected beryl samples are investigated

  16. A method for making an alkaline element

    Energy Technology Data Exchange (ETDEWEB)

    Obi, F.; Takada, K.

    1983-05-11

    A mixture of asphalt with polybutene is applied to the contacting surfaces of the body top and the hermetically sealing stuffing. After assembly the element is heated to a temperature which exceeds the softening point of the mixture. The edge of the body is rolled in. The element has high reliability.

  17. An Improved Linear Tetrahedral Element for Plasticity

    Energy Technology Data Exchange (ETDEWEB)

    Puso, M

    2005-04-25

    A stabilized, nodally integrated linear tetrahedral is formulated and analyzed. It is well known that linear tetrahedral elements perform poorly in problems with plasticity, nearly incompressible materials, and acute bending. For a variety of reasons, linear tetrahedral elements are preferable to quadratic tetrahedral elements in most nonlinear problems. Whereas, mixed methods work well for linear hexahedral elements, they don't for linear tetrahedrals. On the other hand, automatic mesh generation is typically not feasible for building many 3D hexahedral meshes. A stabilized, nodally integrated linear tetrahedral is developed and shown to perform very well in problems with plasticity, nearly incompressible materials and acute bending. Furthermore, the formulation is analytically and numerically shown to be stable and optimally convergent. The element is demonstrated to perform well in several standard linear and nonlinear benchmarks.

  18. International experience in conditioning spent fuel elements

    International Nuclear Information System (INIS)

    The purpose of this report is to compile and present in a clear form international experience (USA, Canada, Sweden, FRG, UK, Japan, Switzerland) gained to date in conditioning spent fuel elements. The term conditioning is here taken to mean the handling and packaging of spent fuel elements for short- or long-term storage or final disposal. Plants of a varying nature fall within this scope, both in terms of the type of fuel element treated and the plant purpose eg. experimental or production plant. Emphasis is given to plants which bear some similarity to the concept developed in Germany for direct disposal of spent fuel elements. Worldwide, however, relatively few conditioning plants are in existence or have been conceived. Hence additional plants have been included where aspects of the experience gained are also of relevance eg. plants developed for the consolidation of spent fuel elements. (orig./HP)

  19. Transuranic element behavior in soils and plants

    International Nuclear Information System (INIS)

    The principal objective of this study is to define soil, plant, and foliar interaction processes that influence the availability of transuranic elements to agricultural plants and animals as a basis for improved modeling and dose-assessment. Major areas of emphasis are: (1) soil and soil-microbial processes that influence the concentration and form of transuranic elements in soil solutions and availability to the plant root with time; (2) deposition and plant interception of airborne submicronic particles containing transuranic elements and their susceptibility to leaching; (3) plant processes that influence transport across plant root membrane and foliar surfaces, as well as the form and sites of deposition of transuranic elements in mature plants; and (4) the integrated effect of soil and plant processes on transuranic element availability to, and form in, animals that consume plants

  20. Finite element modelling of perturbed stellar systems

    CERN Document Server

    Jalali, Mir Abbas

    2010-01-01

    I formulate a general finite element method (FEM) for self-gravitating stellar systems. I split the configuration space to finite elements, and express the potential and density functions over each element in terms of their nodal values and suitable interpolating functions. General expressions are then introduced for the Hamiltonian and phase space distribution functions of the stars that visit a given element. Using the weighted residual form of Poisson's equation, I derive the Galerkin projection of the perturbed collisionless Boltzmann equation, and assemble the global evolutionary equations of nodal distribution functions. The FEM is highly adaptable to all kinds of potential and density profiles, and it can deal with density clumps and initially non-axisymmetric systems. I use ring elements of non-uniform widths, choose linear and quadratic interpolation functions in the radial direction, and apply the FEM to the stability analysis of the cutout Mestel disc. I also integrate the forced evolutionary equat...

  1. Rolling Element Bearing Stiffness Matrix Determination (Presentation)

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Y.; Parker, R.

    2014-01-01

    Current theoretical bearing models differ in their stiffness estimates because of different model assumptions. In this study, a finite element/contact mechanics model is developed for rolling element bearings with the focus of obtaining accurate bearing stiffness for a wide range of bearing types and parameters. A combined surface integral and finite element method is used to solve for the contact mechanics between the rolling elements and races. This model captures the time-dependent characteristics of the bearing contact due to the orbital motion of the rolling elements. A numerical method is developed to determine the full bearing stiffness matrix corresponding to two radial, one axial, and two angular coordinates; the rotation about the shaft axis is free by design. This proposed stiffness determination method is validated against experiments in the literature and compared to existing analytical models and widely used advanced computational methods. The fully-populated stiffness matrix demonstrates the coupling between bearing radial, axial, and tilting bearing deflections.

  2. Spectral element methods: Algorithms and architectures

    Science.gov (United States)

    Fischer, Paul; Ronquist, Einar M.; Dewey, Daniel; Patera, Anthony T.

    1988-01-01

    Spectral element methods are high-order weighted residual techniques for partial differential equations that combine the geometric flexibility of finite element methods with the rapid convergence of spectral techniques. Spectral element methods are described for the simulation of incompressible fluid flows, with special emphasis on implementation of spectral element techniques on medium-grained parallel processors. Two parallel architectures are considered: the first, a commercially available message-passing hypercube system; the second, a developmental reconfigurable architecture based on Geometry-Defining Processors. High parallel efficiency is obtained in hypercube spectral element computations, indicating that load balancing and communication issues can be successfully addressed by a high-order technique/medium-grained processor algorithm-architecture coupling.

  3. Spectral element methods - Algorithms and architectures

    Science.gov (United States)

    Fischer, Paul; Ronquist, Einar M.; Dewey, Daniel; Patera, Anthony T.

    1988-01-01

    Spectral element methods are high-order weighted residual techniques for partial differential equations that combine the geometric flexibility of finite element methods with the rapid convergence of spectral techniques. Spectral element methods are described for the simulation of incompressible fluid flows, with special emphasis on implementation of spectral element techniques on medium-grained parallel processors. Two parallel architectures are considered; the first, a commercially available message-passing hypercube system; the second, a developmental reconfigurable architecture based on Geometry-Defining Processors. High parallel efficiency is obtained in hypercube spectral element computations, indicating that load balancing and communication issues can be successfully addressed by a high-order technique/medium-grained processor algorithm-architecture coupling.

  4. Writing analytic element programs in Python.

    Science.gov (United States)

    Bakker, Mark; Kelson, Victor A

    2009-01-01

    The analytic element method is a mesh-free approach for modeling ground water flow at both the local and the regional scale. With the advent of the Python object-oriented programming language, it has become relatively easy to write analytic element programs. In this article, an introduction is given of the basic principles of the analytic element method and of the Python programming language. A simple, yet flexible, object-oriented design is presented for analytic element codes using multiple inheritance. New types of analytic elements may be added without the need for any changes in the existing part of the code. The presented code may be used to model flow to wells (with either a specified discharge or drawdown) and streams (with a specified head). The code may be extended by any hydrogeologist with a healthy appetite for writing computer code to solve more complicated ground water flow problems.

  5. Writing analytic element programs in Python.

    Science.gov (United States)

    Bakker, Mark; Kelson, Victor A

    2009-01-01

    The analytic element method is a mesh-free approach for modeling ground water flow at both the local and the regional scale. With the advent of the Python object-oriented programming language, it has become relatively easy to write analytic element programs. In this article, an introduction is given of the basic principles of the analytic element method and of the Python programming language. A simple, yet flexible, object-oriented design is presented for analytic element codes using multiple inheritance. New types of analytic elements may be added without the need for any changes in the existing part of the code. The presented code may be used to model flow to wells (with either a specified discharge or drawdown) and streams (with a specified head). The code may be extended by any hydrogeologist with a healthy appetite for writing computer code to solve more complicated ground water flow problems. PMID:19473273

  6. Effects of thirty elements on bone metabolism.

    Science.gov (United States)

    Dermience, Michael; Lognay, Georges; Mathieu, Françoise; Goyens, Philippe

    2015-10-01

    The human skeleton, made of 206 bones, plays vital roles including supporting the body, protecting organs, enabling movement, and storing minerals. Bones are made of organic structures, intimately connected with an inorganic matrix produced by bone cells. Many elements are ubiquitous in our environment, and many impact bone metabolism. Most elements have antagonistic actions depending on concentration. Indeed, some elements are essential, others are deleterious, and many can be both. Several pathways mediate effects of element deficiencies or excesses on bone metabolism. This paper aims to identify all elements that impact bone health and explore the mechanisms by which they act. To date, this is the first time that the effects of thirty minerals on bone metabolism have been summarized. PMID:26302917

  7. Element spots in HgMn stars

    CERN Document Server

    Korhonen, Heidi

    2013-01-01

    A fraction of late B-type stars, the so-called HgMn stars, exhibit enhanced absorption lines of certain chemical elements, notably Hg and Mn, combined with an underabundance of He. For about a decade now the elements with anomalously high abundances in HgMn stars are known to be distributed inhomogeneously over the stellar surface. Temporal evolution of these elemental spots have been reported in a few HgMn stars, first secular evolution of the mercury spots in alpha And, and recently also a fast evolution of yttrium and strontium spots in HD 11753. The fast evolution of spots in HD 11753 is combined with a slower change in the overall abundance of the affected elements. In this paper I review what is known of elemental spots in HgMn stars and their secular and fast temporal evolution.

  8. Multi-Element Lean Direct Injection Combustor Single Element Demonstration Project

    Data.gov (United States)

    National Aeronautics and Space Administration — We propose to demonstrate the feasibility in a single element of a Multi-Element Lean Direct Injection, ME-LDI, Combustion concept. The concept will have the...

  9. Burnup measurements of leader fuel elements

    International Nuclear Information System (INIS)

    Some time ago the CCHEN authorities decided to produce a set of 50 low enrichment fuel elements. These elements were produced in the PEC (Fuel Elements Plant), located at CCHEN offices in Lo Aguirre. These new fuel elements have basically the same geometrical characteristics of previous ones, which were British and made with raw material from the U.S. The principal differences between our fuel elements and the British ones is the density of fissile material, U-235, which was increased to compensate the reduction in enrichment. Last year, the Fuel Elements Plant (PEC) delivered the shipment's first four (4) fuel elements, called leaders, to the RECH1. A test element was delivered too, and the complete set was introduced into the reactor's nucleus, following the normal routine, but performing a special follow-up on their behavior inside the nucleus. This experimental element has only one outside fuel plate, and the remaining (15) structural plates are aluminum. In order to study the burnup, the test element was taken out of the nucleus, in mid- November 1999, and left to decay until June 2000, when it was moved to the laboratory (High Activity Cell), to start the burnup measurements, with a gamma spectroscopy system. This work aims to show the results of these measurements and in addition to meet the following objectives: (a) Visual test of the plate's general condition; (b) Sipping test of fission products; (c) Study of burn-up distribution in the plate; (d) Check and improve the calculus algorithm; (e) Comparison of the results obtained from the spectroscopy with the ones from neutron calculus

  10. PRECONDITIONING HIGHER ORDER FINITE ELEMENT SYSTEMS BY ALGEBRAIC MULTIGRID METHOD OF LINEAR ELEMENTS

    Institute of Scientific and Technical Information of China (English)

    Yun-qing Huang; Shi Shu; Xi-jun Yu

    2006-01-01

    We present and analyze a robust preconditioned conjugate gradient method for the higher order Lagrangian finite element systems of a class of elliptic problems. An auxiliary linear element stiffness matrix is chosen to be the preconditioner for higher order finite elements. Then an algebraic multigrid method of linear finite element is applied for solving the preconditioner. The optimal condition number which is independent of the mesh size is obtained. Numerical experiments confirm the efficiency of the algorithm.

  11. Analysis of bender element test interpretation using the discrete element method

    NARCIS (Netherlands)

    O’Donovan, J.; O’Sullivan, C.; Marketos, G.; Muir Wood, D.

    2015-01-01

    While bender element testing is now well-established as a laboratory technique to determine soil stiffness, a robust technique to interpret the data remains elusive. A discrete element method (DEM) model of a face-centred cubic packing of uniform spheres was created to simulate bender element tests

  12. Mortar Upwind Finite Volume Element Method with Crouzeix-Raviart Element for Parabolic Convection Diffusion Problems

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    In this paper, we study the semi-discrete mortar upwind finite volume element method with the Crouzeix-Raviart element for the parabolic convection diffusion problems.It is proved that the semi-discrete mortar upwind finite volume element approximations derived are convergent in the H1- and L2-norms.

  13. Stabilized tetrahedral elements for crystal plasticity finite element analysis overcoming volumetric locking

    Science.gov (United States)

    Cheng, Jiahao; Shahba, Ahmad; Ghosh, Somnath

    2016-05-01

    Image-based CPFE modeling involves computer generation of virtual polycrystalline microstructures from experimental data, followed by discretization into finite element meshes. Discretization is commonly accomplished using three-dimensional four-node tetrahedral or TET4 elements, which conform to the complex geometries. It has been commonly observed that TET4 elements suffer from severe volumetric locking when simulating deformation of incompressible or nearly incompressible materials. This paper develops and examines three locking-free stabilized finite element formulations in the context of crystal plasticity finite element analysis. They include a node-based uniform strain (NUS) element, a locally integrated B-bar (LIB) based element and a F-bar patch (FP) based element. All three formulations are based on the partitioning of TET4 element meshes and integrating over patches to obtain favorable incompressibility constraint ratios without adding large degrees of freedom. The results show that NUS formulation introduces unstable spurious energy modes, while the LIB and FP elements stabilize the solutions and are preferred for reliable CPFE analysis. The FP element is found to be computationally efficient over the LIB element.

  14. Streptococcus gallolyticus subsp. gallolyticus from human and animal origins: genetic diversity, antimicrobial susceptibility, and characterization of a vancomycin-resistant calf isolate carrying a vanA-Tn1546-like element.

    Science.gov (United States)

    Romero-Hernández, Beatriz; Tedim, Ana P; Sánchez-Herrero, José Francisco; Librado, Pablo; Rozas, Julio; Muñoz, Gloria; Baquero, Fernando; Cantón, Rafael; Del Campo, Rosa

    2015-04-01

    The aim of this work was to characterize the antibiotic susceptibility and genetic diversity of 41 Streptococcus gallolyticus subsp. gallolyticus isolates: 18 isolates obtained from animals and 23 human clinical isolates. Antibiotic susceptibility was determined by the semiautomatic Wider system and genetic diversity by pulsed-field gel electrophoresis (PFGE) with SmaI. Animal isolates grouped separately in the PFGE analysis, but no statistical differences in antimicrobial resistance were found between the two groups. The LMG 17956 sequence type 28 (ST28) strain recovered from the feces of a calf exhibited high levels of resistance to vancomycin and teicoplanin (MIC, ≥256 mg/liter). Its glycopeptide resistance mechanism was characterized by Southern blot hybridization and a primer-walking strategy, and finally its genome, determined by whole-genome sequencing, was compared with four closely related S. gallolyticus subsp. gallolyticus genomes. Hybridization experiments demonstrated that a Tn1546-like element was integrated into the bacterial chromosome. In agreement with this finding, whole-genome sequencing confirmed a partial deletion of the vanY-vanZ region and partial duplication of the vanH gene. The comparative genomic analyses revealed that the LMG 17956 ST28 strain had acquired an unusually high number of transposable elements and had experienced extensive chromosomal rearrangements, as well as gene gain and loss events. In conclusion, S. gallolyticus subsp. gallolyticus isolates from animals seem to belong to lineages separate from those infecting humans. In addition, we report a glycopeptide-resistant isolate from a calf carrying a Tn1546-like element integrated into its chromosome.

  15. Genome-wide identification of enhancer elements.

    Science.gov (United States)

    Tulin, Sarah; Barsi, Julius C; Bocconcelli, Carlo; Smith, Joel

    2016-01-01

    We present a prospective genome-wide regulatory element database for the sea urchin embryo and the modified chromosome capture-related methodology used to create it. The method we developed is termed GRIP-seq for genome-wide regulatory element immunoprecipitation and combines features of chromosome conformation capture, chromatin immunoprecipitation, and paired-end next-generation sequencing with molecular steps that enrich for active cis-regulatory elements associated with basal transcriptional machinery. The first GRIP-seq database, available to the community, comes from S. purpuratus 24 hpf embryos and takes advantage of the extremely well-characterized cis-regulatory elements in this system for validation. In addition, using the GRIP-seq database, we identify and experimentally validate a novel, intronic cis-regulatory element at the onecut locus. We find GRIP-seq signal sensitively identifies active cis-regulatory elements with a high signal-to-noise ratio for both distal and intronic elements. This promising GRIP-seq protocol has the potential to address a rate-limiting step in resolving comprehensive, predictive network models in all systems.

  16. The dynamic stiffness matrix of two-dimensional elements: application to Kirchhoff's plate continuous elements

    Science.gov (United States)

    Casimir, J. B.; Kevorkian, S.; Vinh, T.

    2005-10-01

    This paper describes a procedure for building the dynamic stiffness matrix of two-dimensional elements with free edge boundary conditions. The dynamic stiffness matrix is the basis of the continuous element method. Then, the formulation is used to build a Kirchhoff rectangular plate element. Gorman's method of boundary condition decomposition and Levy's series are used to obtain the strong solution of the elementary problem. A symbolic computation software partially performs the construction of the dynamic stiffness matrix from this solution. The performances of the element are evaluated from comparisons with harmonic responses of plates obtained by the finite element method.

  17. APPLICATION OF SUB-ELEMENT AND MICRO-ELEMENT IN BEM WITH ROLLER BEARING LOAD

    Institute of Scientific and Technical Information of China (English)

    Shu Xuedao; Xing Xidong

    2004-01-01

    Aiming at the discontinuous traction on contact elements of roller bearing, new concepts of sub- and micro-element are put forward. In the sub-element and micro-element, traction influence coefficient has been modified, which is calculated by the former boundary element method (BEM) with roller bearing load. Hence, three-dimensional distribution of load on roller bearing is calculated accurately. In practice, it has been proved that this method has higher calculation accuracy. An effective numerical method is offered for analyzing load characteristics of roller bearing to improve service longevity of roller bearing and operation efficiency of rolling mill.

  18. Finite Dynamic Elements and Modal Analysis

    Directory of Open Access Journals (Sweden)

    N.J. Fergusson

    1993-01-01

    Full Text Available A general modal analysis scheme is derived for forced response that makes use of high accuracy modes computed by the dynamic element method. The new procedure differs from the usual modal analysis in that the modes are obtained from a power series expansion for the dynamic stiffness matrix that includes an extra dynamic correction term in addition to the static stiffness matrix and the consistent mass matrix based on static displacement. A cantilevered beam example is used to demonstrate the relative accuracies of the dynamic element and the traditional finite element methods.

  19. Use of SCC in Prefabricated Concrete Elements

    DEFF Research Database (Denmark)

    Thrane, Lars Nyholm; Lauritsen, Ib

    2004-01-01

    This paper presents observations made on the use of self-compacting concrete for pre-cast elements at Byggebjerg Beton A/S during the last 3 years. The elements include L- and sandwich elements and are mainly produced for agriculture purposes. In general, the flow properties and air content are...... concrete to achieve a good surface quality with a limited number of blowholes. For horizontal castings it is important to keep the concrete flowing to avoid casting joints. Blocking is avoided by using the right type of spacers and a maximum size aggregate of 8mm. However, if the concrete has to flow over...

  20. MRT fuel element inspection at Dounreay

    Energy Technology Data Exchange (ETDEWEB)

    Gibson, J.

    1997-08-01

    To ensure that their production and inspection processes are performed in an acceptable manner, ie. auditable and traceable, the MTR Fuel Element Fabrication Plant at Dounreay operates to a documented quality system. This quality system, together with the fuel element manufacturing and inspection operations, has been independently certified to ISO9002-1987, EN29002-1987 and BS5750:Pt2:1987 by Lloyd`s Register Quality Assurance Limited (LRQA). This certification also provides dual accreditation to the relevant German, Dutch and Australian certification bodies. This paper briefly describes the quality system, together with the various inspection stages involved in the manufacture of MTR fuel elements at Dounreay.