WorldWideScience

Sample records for cacta-like transposable element

  1. Transposable elements: The enemies within.

    Science.gov (United States)

    Scarfò, Irene; Pellegrino, Elisa; Mereu, Elisabetta; Inghirami, Giorgio; Piva, Roberto

    2016-10-01

    Understanding transformation mechanisms other than genetic aberrations has recently captured the attention of cancer researchers. To date, the role of transposable elements (TEs) in tumor development remains largely undefined. However, an increasing number of studies have reported that loss of epigenetic control causes TE reactivation and consequent oncogenic transcription. Here, we discuss principal examples of TEs-driven oncogenesis. Available data suggest that long terminal repeats and long interspersed nuclear elements play a pivotal role as alternative promoters. These findings provide definitive experimental evidence that repetitive elements are a powerful underestimated force toward oncogenesis and open the possibility to new therapeutic treatments.

  2. Transposable elements and circular DNAs

    KAUST Repository

    Mourier, Tobias

    2016-09-26

    Circular DNAs are extra-chromosomal fragments that become circularized by genomic recombination events. We have recently shown that yeast LTR elements generate circular DNAs through recombination events between their flanking long terminal repeats (LTRs). Similarly, circular DNAs can be generated by recombination between LTRs residing at different genomic loci, in which case the circular DNA will contain the intervening sequence. In yeast, this can result in gene copy number variations when circles contain genes and origins of replication. Here, I speculate on the potential and implications of circular DNAs generated through recombination between human transposable elements.

  3. Transcriptional activity of transposable elements in coelacanth.

    Science.gov (United States)

    Forconi, Mariko; Chalopin, Domitille; Barucca, Marco; Biscotti, Maria Assunta; De Moro, Gianluca; Galiana, Delphine; Gerdol, Marco; Pallavicini, Alberto; Canapa, Adriana; Olmo, Ettore; Volff, Jean-Nicolas

    2014-09-01

    The morphological stasis of coelacanths has long suggested a slow evolutionary rate. General genomic stasis might also imply a decrease of transposable elements activity. To evaluate the potential activity of transposable elements (TEs) in "living fossil" species, transcriptomic data of Latimeria chalumnae and its Indonesian congener Latimeria menadoensis were compared through the RNA-sequencing mapping procedures in three different organs (liver, testis, and muscle). The analysis of coelacanth transcriptomes highlights a significant percentage of transcribed TEs in both species. Major contributors are LINE retrotransposons, especially from the CR1 family. Furthermore, some particular elements such as a LF-SINE and a LINE2 sequences seem to be more expressed than other elements. The amount of TEs expressed in testis suggests possible transposition burst in incoming generations. Moreover, significant amount of TEs in liver and muscle transcriptomes were also observed. Analyses of elements displaying marked organ-specific expression gave us the opportunity to highlight exaptation cases, that is, the recruitment of TEs as new cellular genes, but also to identify a new Latimeria-specific family of Short Interspersed Nuclear Elements called CoeG-SINEs. Overall, transcriptome results do not seem to be in line with a slow-evolving genome with poor TE activity.

  4. Characterization of Transposable Elements in Laccaria bicolor

    Energy Technology Data Exchange (ETDEWEB)

    Labbe, Jessy L [ORNL; Murat, Claude [INRA, Nancy, France; Morin, Emmanuelle [INRA, Nancy, France; Tuskan, Gerald A [ORNL; Le Tacon, F [UMR, France; Martin, Francis [INRA, Nancy, France

    2012-01-01

    Background: The publicly available Laccaria bicolor genome sequence has provided a considerable genomic resource allowing systematic identification of transposable elements (TEs) in this symbiotic ectomycorrhizal fungus. Using a TE-specific annotation pipeline we have characterized and analyzed TEs in the L. bicolor S238N-H82 genome. Methodology/Principal Findings: TEs occupy 24% of the 60 Mb L. bicolor genome and represent 25,787 full-length and partial copies elements distributed within 172 families. The most abundant elements were the Copia-like. TEs are not randomly distributed across the genome, but are tightly nested or clustered. The majority of TEs are ancient except some terminal inverted repeats (TIRS), long terminal repeats (LTRs) and a large retrotransposon derivative (LARD) element. There were three main periods of TEs expansion in L. bicolor; the first from 57 to 10 Mya, the second from 5 to 1 Mya and the most recent from 500,000 years ago until now. LTR retrotransposons are closely related to retrotransposons found in another basidiomycete, Coprinopsis cinerea. Conclusions: This analysis represents an initial characterization of TEs in the L. bicolor genome, contributes to genome assembly and to a greater understanding of the role TEs played in genome organization and evolution, and provides a valuable resource for the ongoing Laccaria Pan-Genome project supported by the U.S.-DOE Joint Genome Institute.

  5. Characteristics of transposable element exonization within human and mouse.

    Directory of Open Access Journals (Sweden)

    Noa Sela

    Full Text Available Insertion of transposed elements within mammalian genes is thought to be an important contributor to mammalian evolution and speciation. Insertion of transposed elements into introns can lead to their activation as alternatively spliced cassette exons, an event called exonization. Elucidation of the evolutionary constraints that have shaped fixation of transposed elements within human and mouse protein coding genes and subsequent exonization is important for understanding of how the exonization process has affected transcriptome and proteome complexities. Here we show that exonization of transposed elements is biased towards the beginning of the coding sequence in both human and mouse genes. Analysis of single nucleotide polymorphisms (SNPs revealed that exonization of transposed elements can be population-specific, implying that exonizations may enhance divergence and lead to speciation. SNP density analysis revealed differences between Alu and other transposed elements. Finally, we identified cases of primate-specific Alu elements that depend on RNA editing for their exonization. These results shed light on TE fixation and the exonization process within human and mouse genes.

  6. Transposable elements and genetic instabilities in crop plants

    Energy Technology Data Exchange (ETDEWEB)

    Burr, B.; Burr, F.

    1981-04-10

    Transposable elements have long been associated with certain unstable loci in maize and have been intensively studied by McClintock and others. It is known that a transposable element can control the expression of the structural genes at the locus where it resides. These controlling elements in maize are now beginning to be studied at the molecular level. Using recombinant molecular probes we have been able to describe the changes induced by the controlling element Ds at the shrunken locus. Ds elements appear to be large and dissimilar insertions into the wild-type locus - two elements actually map within the transcribed region of the gene. Genetic instabilities have been described in other economically important plants but the bases for these phenomena have not been understood. We believe that it is likely that some of these instabilities are the result of transposable element activity much as in the case of maize.

  7. Transposable Elements and Genetic Instabilities in Crop Plants

    Science.gov (United States)

    Burr, B.; Burr, F.

    1981-04-10

    Transposable elements have long been associated with certain unstable loci in maize and have been intensively studied by McClintock and others. It is known that a transposable element can control the expression of the structural genes at the locus where it resides. These controlling elements in maize are now beginning to be studied at the molecular level. Using recombinant molecular probes we have been able to describe the changes induced by the controlling element Ds at the shrunken locus. Ds elements appear to be large and dissimilar insertions into the wild-type locus - two elements actually map within the transcribed region of the gene. Genetic instabilities have been described in other economically important plants but the bases for these phenomena have not been understood. We believe that it is likely that some of these instabilities are the result of transposable element activity much as in the case of maize.

  8. Evolutionary active transposable elements in the genome of the coelacanth.

    Science.gov (United States)

    Chalopin, Domitille; Fan, Shaohua; Simakov, Oleg; Meyer, Axel; Schartl, Manfred; Volff, Jean-Nicolas

    2014-09-01

    The apparent morphological stasis in the lineage of the coelacanth, which has been called a "living fossil" by many, has been suggested to be causally related to a slow evolution of its genome, with strongly reduced activity of transposable elements (TEs). Analysis of the African coelacanth showed that at least 25% of its genome is constituted of transposable elements including retrotransposons, endogenous retroviruses and DNA transposons, with a strong predominance of non-Long Terminal Repeat (non-LTR) retrotransposons. The coelacanth genome has been shaped by four major general bursts of transposition during evolution, with major contributions of LINE1, LINE2, CR1, and Deu non-LTR retrotransposons. Many transposable elements are expressed in different tissues and might be active. The number of TE families in coelacanth, but also in lungfish, is lower than in teleost fish, but is higher than in chicken and human. This observation is in agreement with the hypothesis of a sequential elimination of many TE families in the sarcopterygian lineage during evolution. Taken together, our analysis indicates that the coelacanth contains more TE families than birds and mammals, and that these elements have been active during the evolution of the coelacanth lineage. Hence, at the level of transposable element activity, the coelacanth genome does not appear to evolve particularly slowly.

  9. BLAT-based comparative analysis for transposable elements: BLATCAT.

    Science.gov (United States)

    Lee, Sangbum; Oh, Sumin; Kang, Keunsoo; Han, Kyudong

    2014-01-01

    The availability of several whole genome sequences makes comparative analyses possible. In primate genomes, the priority of transposable elements (TEs) is significantly increased because they account for ~45% of the primate genomes, they can regulate the gene expression level, and they are associated with genomic fluidity in their host genomes. Here, we developed the BLAST-like alignment tool (BLAT) based comparative analysis for transposable elements (BLATCAT) program. The BLATCAT program can compare specific regions of six representative primate genome sequences (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque) on the basis of BLAT and simultaneously carry out RepeatMasker and/or Censor functions, which are widely used Windows-based web-server functions to detect TEs. All results can be stored as a HTML file for manual inspection of a specific locus. BLATCAT will be very convenient and efficient for comparative analyses of TEs in various primate genomes.

  10. BLAT-Based Comparative Analysis for Transposable Elements: BLATCAT

    Directory of Open Access Journals (Sweden)

    Sangbum Lee

    2014-01-01

    Full Text Available The availability of several whole genome sequences makes comparative analyses possible. In primate genomes, the priority of transposable elements (TEs is significantly increased because they account for ~45% of the primate genomes, they can regulate the gene expression level, and they are associated with genomic fluidity in their host genomes. Here, we developed the BLAST-like alignment tool (BLAT based comparative analysis for transposable elements (BLATCAT program. The BLATCAT program can compare specific regions of six representative primate genome sequences (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque on the basis of BLAT and simultaneously carry out RepeatMasker and/or Censor functions, which are widely used Windows-based web-server functions to detect TEs. All results can be stored as a HTML file for manual inspection of a specific locus. BLATCAT will be very convenient and efficient for comparative analyses of TEs in various primate genomes.

  11. Isolation and characterization of a potential transposable element from Wolbachia

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Wolbachia are a group of Rickettsia-like bacteria which parasitize the cells of a wide range of anthropoid. These microorganisms are associated with the reproductive and developmental abnormalities io their hosts. To study the molecular mechanism underlying such phenomena, we analyzed the genomic difference between Wolbachia with different cytoplasmic incompatibility (CI) phenotype using representational difference analysis method. A potential transposable element, which exists in the strong CI-inducing strain wRi, was isolated. This element was designated as Wolbachia insertion sequence element (WISE).

  12. Cooperation is fleeting in the world of transposable elements.

    Directory of Open Access Journals (Sweden)

    Andreas Wagner

    2006-12-01

    Full Text Available Composite transposons are key vehicles for the worldwide spreading of genes that allow bacteria to survive toxic compounds. Composite transposons consist of two smaller transposable elements called insertion sequences (ISs, which flank the genes that permit such survival. Each IS in a composite transposon can either transpose alone, selfishly, or it can transpose cooperatively, jointly with the other IS. Cooperative transposition can enhance an IS's chance of survival, but it also carries the risk of transposon destruction. I use game theory to show that the conditions under which cooperative transposition is an evolutionarily stable strategy (ESS are not biologically realistic. I then analyze the distribution of thousands of ISs in more than 200 bacterial genomes to test the following prediction of the game-theoretical model: if cooperative transposition was an ESS, then the closely spaced ISs that characterize composite transposons should be more abundant in genomes than expected by chance. The data show that this is not the case. Cooperativity can only be maintained in a transitional, far-from-equilibrium state shortly after a selection pressure first arises. This is the case in the spreading of antibiotic resistance, where we are witnessing a fleeting moment in evolution, a moment in which cooperation among selfish DNA molecules has provided a means of survival. Because such cooperation does not pay in the long run, the vehicles of such survival will eventually disappear again. My analysis demonstrates that game theory can help explain behavioral strategies even for mobile DNA.

  13. Evolutionary interaction between W/Y chromosome and transposable elements.

    Science.gov (United States)

    Śliwińska, Ewa B; Martyka, Rafał; Tryjanowski, Piotr

    2016-06-01

    The W/Y chromosome is unique among chromosomes as it does not recombine in its mature form. The main side effect of cessation of recombination is evolutionary instability and degeneration of the W/Y chromosome, or frequent W/Y chromosome turnovers. Another important feature of W/Y chromosome degeneration is transposable element (TEs) accumulation. Transposon accumulation has been confirmed for all W/Y chromosomes that have been sequenced so far. Models of W/Y chromosome instability include the assemblage of deleterious mutations in protein coding genes, but do not include the influence of transposable elements that are accumulated gradually in the non-recombining genome. The multiple roles of genomic TEs, and the interactions between retrotransposons and genome defense proteins are currently being studied intensively. Small RNAs originating from retrotransposon transcripts appear to be, in some cases, the only mediators of W/Y chromosome function. Based on the review of the most recent publications, we present knowledge on W/Y evolution in relation to retrotransposable element accumulation.

  14. Transposable elements and early evolution of sex chromosomes in fish.

    Science.gov (United States)

    Chalopin, Domitille; Volff, Jean-Nicolas; Galiana, Delphine; Anderson, Jennifer L; Schartl, Manfred

    2015-09-01

    In many organisms, the sex chromosome pair can be recognized due to heteromorphy; the Y and W chromosomes have often lost many genes due to the absence of recombination during meiosis and are frequently heterochromatic. Repetitive sequences are found at a high proportion on such heterochromatic sex chromosomes and the evolution and emergence of sex chromosomes has been connected to the dynamics of repeats and transposable elements. With an amazing plasticity of sex determination mechanisms and numerous instances of independent emergence of novel sex chromosomes, fish represent an excellent lineage to investigate the early stages of sex chromosome differentiation, where sex chromosomes often are homomorphic and not heterochromatic. We have analyzed the composition, distribution, and relative age of TEs from available sex chromosome sequences of seven teleost fish. We observed recent bursts of TEs and simple repeat accumulations around young sex determination loci. More strikingly, we detected transposable element (TE) amplifications not only on the sex determination regions of the Y and W sex chromosomes, but also on the corresponding regions of the X and Z chromosomes. In one species, we also clearly demonstrated that the observed TE-rich sex determination locus originated from a TE-poor genomic region, strengthening the link between TE accumulation and emergence of the sex determination locus. Altogether, our results highlight the role of TEs in the initial steps of differentiation and evolution of sex chromosomes.

  15. Transposable elements: from DNA parasites to architects of metazoan evolution.

    Science.gov (United States)

    Piskurek, Oliver; Jackson, Daniel J

    2012-07-12

    One of the most unexpected insights that followed from the completion of the human genome a decade ago was that more than half of our DNA is derived from transposable elements (TEs). Due to advances in high throughput sequencing technologies it is now clear that TEs comprise the largest molecular class within most metazoan genomes. TEs, once categorised as "junk DNA", are now known to influence genomic structure and function by increasing the coding and non-coding genetic repertoire of the host. In this way TEs are key elements that stimulate the evolution of metazoan genomes. This review highlights several lines of TE research including the horizontal transfer of TEs through host-parasite interactions, the vertical maintenance of TEs over long periods of evolutionary time, and the direct role that TEs have played in generating morphological novelty.

  16. Identification and frequency of transposable elements in Eucalyptus

    Directory of Open Access Journals (Sweden)

    Maurício Bacci Jr.

    2005-01-01

    Full Text Available Transposable elements (TE are major components of eukaryotic genomes and involved in cell regulation and organism evolution. We have analyzed 123,889 expressed sequence tags of the Eucalyptus Genome Project database and found 124 sequences representing 76 TE in 9 groups, of which copia, MuDR and FAR1 groups were the most abundant. The low amount of sequences of TE may reflect the high efficiency of repression of these elements, a process that is called TE silencing. Frequency of groups of TE in Eucalyptus libraries which were prepared with different tissues or physiologic conditions from seedlings or adult plants indicated that developing plants experience the expression of a much wider spectrum of TE groups than that seen in adult plants. These are preliminary results that identify the most relevant TE groups involved with Eucalyptus development, which is important for industrial wood production.

  17. Transposable Elements: From DNA Parasites to Architects of Metazoan Evolution

    Directory of Open Access Journals (Sweden)

    Oliver Piskurek

    2012-07-01

    Full Text Available One of the most unexpected insights that followed from the completion of the human genome a decade ago was that more than half of our DNA is derived from transposable elements (TEs. Due to advances in high throughput sequencing technologies it is now clear that TEs comprise the largest molecular class within most metazoan genomes. TEs, once categorised as "junk DNA", are now known to influence genomic structure and function by increasing the coding and non-coding genetic repertoire of the host. In this way TEs are key elements that stimulate the evolution of metazoan genomes. This review highlights several lines of TE research including the horizontal transfer of TEs through host-parasite interactions, the vertical maintenance of TEs over long periods of evolutionary time, and the direct role that TEs have played in generating morphological novelty.

  18. In Silico Methods to Identify Exapted Transposable Element Families.

    Science.gov (United States)

    Ramsay, LeeAnn; Bourque, Guillaume

    2016-01-01

    Transposable elements (TEs) have recently been shown to have many regulatory roles within the genome. In this chapter, we will examine two in silico methods for analyzing TEs and identifying families that may have acquired such functions. The first method will look at how the overrepresentation of a repeat family in a set of genomic features can be discovered. The example situation of OCT4 binding sites originating from LTR7 TE sequences will be used to show how this method could be applied. The second method will describe how to determine if a TE family exhibits a cell type-specific expression pattern. As an example, we will look at the expression of HERV-H, an endogenous retrovirus known to act as an lncRNA in embryonic stem cells. We will use this example to demonstrate how RNA-seq data can be used to compare cell type expression of repeats.

  19. Transposable elements in TDP-43-mediated neurodegenerative disorders.

    Directory of Open Access Journals (Sweden)

    Wanhe Li

    Full Text Available Elevated expression of specific transposable elements (TEs has been observed in several neurodegenerative disorders. TEs also can be active during normal neurogenesis. By mining a series of deep sequencing datasets of protein-RNA interactions and of gene expression profiles, we uncovered extensive binding of TE transcripts to TDP-43, an RNA-binding protein central to amyotrophic lateral sclerosis (ALS and frontotemporal lobar degeneration (FTLD. Second, we find that association between TDP-43 and many of its TE targets is reduced in FTLD patients. Third, we discovered that a large fraction of the TEs to which TDP-43 binds become de-repressed in mouse TDP-43 disease models. We propose the hypothesis that TE mis-regulation contributes to TDP-43 related neurodegenerative diseases.

  20. A blessing in disguise: Transposable elements are more than parasites.

    Science.gov (United States)

    Martin, Antoine; Bendahmane, Abdelhafid

    2010-07-01

    Transposable elements (TEs) are various DNA fragments inserted throughout genomes, which are able to move or duplicate themselves. Recent advances in genomics have placed them back at the center of genome dynamics. One of the emerging observations, especially in plants, is the importance of interactions between TEs and genes to generate or to participate in relevant functions essential for development, adaptation and/or life cycle. A recent publication illustrates the influence of TEs epigenetic control on the expression of a neighboring gene crucial for reproduction. Different reports lately showed that a fundamental mechanism such as imprinting is likely to be closely linked to the dynamics of TEs epigenetic control. Here we discuss and bring together these and others recent findings, to underline that the cis-vicinity or the trans-relation between TEs and genes could bring unexpected but positive outcomes.

  1. Transposable elements and small RNAs: Genomic fuel for species diversity.

    Science.gov (United States)

    Hoffmann, Federico G; McGuire, Liam P; Counterman, Brian A; Ray, David A

    2015-01-01

    While transposable elements (TE) have long been suspected of involvement in species diversification, identifying specific roles has been difficult. We recently found evidence of TE-derived regulatory RNAs in a species-rich family of bats. The TE-derived small RNAs are temporally associated with the burst of species diversification, suggesting that they may have been involved in the processes that led to the diversification. In this commentary, we expand on the ideas that were briefly touched upon in that manuscript. Specifically, we suggest avenues of research that may help to identify the roles that TEs may play in perturbing regulatory pathways. Such research endeavors may serve to inform evolutionary biologists of the ways that TEs have influenced the genomic and taxonomic diversity around us.

  2. [Transposition of the maize transposable element dSpm in transgenic sugar beets].

    Science.gov (United States)

    Kishchenko, E M; Komarnitskiĭ, I K; Kuchuk, N V

    2010-01-01

    Transgenic sugar beet plants carrying maize Spmn/dSpm transposable elements system have been constructed. Heterologous system of maize transposable elements Spm/dSpm was active in transgenic sugar beets that permits transposon-based gene tagging and obtaining of marker-free transgenic sugar beet.

  3. Characterization of Transposable Elements in the Ectomycorrhizal Fungus Laccaria bicolor

    Energy Technology Data Exchange (ETDEWEB)

    Labbe, Jessy L [ORNL; Murat, Claude [INRA, Nancy, France; Morin, Emmanuelle [INRA, Nancy, France; Tuskan, Gerald A [ORNL; Le Tacon, F [UMR, France; Martin, Francis [INRA, Nancy, France

    2012-01-01

    Background: The publicly available Laccaria bicolor genome sequence has provided a considerable genomic resource allowing systematic identification of transposable elements (TEs) in this symbiotic ectomycorrhizal fungus. Using a TEspecific annotation pipeline we have characterized and analyzed TEs in the L. bicolor S238N-H82 genome. Methodology/Principal Findings: TEs occupy 24% of the 60 Mb L. bicolor genome and represent 25,787 full-length and partial copy elements distributed within 171 families. The most abundant elements were the Copia-like. TEs are not randomly distributed across the genome, but are tightly nested or clustered. The majority of TEs exhibits signs of ancient transposition except some intact copies of terminal inverted repeats (TIRS), long terminal repeats (LTRs) and a large retrotransposon derivative (LARD) element. There were three main periods of TE expansion in L. bicolor: the first from 57 to 10 Mya, the second from 5 to 1 Mya and the most recent from 0.5 Mya ago until now. LTR retrotransposons are closely related to retrotransposons found in another basidiomycete, Coprinopsis cinerea. Conclusions: This analysis 1) represents an initial characterization of TEs in the L. bicolor genome, 2) contributes to improve genome annotation and a greater understanding of the role TEs played in genome organization and evolution and 3) provides a valuable resource for future research on the genome evolution within the Laccaria genus.

  4. Transposable element recruitments in the mammalian placenta: impacts and mechanisms.

    Science.gov (United States)

    Emera, Deena; Wagner, Günter P

    2012-07-01

    Transposable elements (TEs) are mobile DNA elements found at high frequency in mammalian genomes. Although these elements are generally perceived as genomic parasites, they have the potential to influence host genome function in many beneficial ways. This article discusses the role TEs have played in the evolution of the placenta and pregnancy in viviparous mammals. Using examples from our own research and the literature, we argue that frequent recruitment of TEs, in particular of retroelements, has facilitated the extreme diversification of tissues at the maternal-fetal interface. We also discuss the mechanisms by which TEs have been recruited for functions during pregnancy. We argue that retroelements are pre-adapted to becoming cis-regulatory elements for host genomes because they need to utilize host regulatory signals for their own life cycle. However, although TEs contain some of the signals necessary for host functions upon insertion, they often require modification before acquiring a biological role in a host tissue. We discuss the process by which one TE was transformed into a promoter for prolactin expression in the endometrium, describing a model for TE domestication called 'epistatic capture'.

  5. Useful parasites: the evolutionary biology and biotechnology applications of transposable elements

    Indian Academy of Sciences (India)

    GEORGI N. BONCHEV

    2016-12-01

    Transposable elements usually comprise the most abundant nongenic fraction of eukaryotic genomes. Because of their capacity to selfreplicate and to induce a wide range of mutations, transposable elements have long been considered as ‘parasitic’ or ‘selfish’. Today, we recognize that the findings about genomic changes affected by transposable elements have considerably altered our view of the ways in which genomes evolve and work. Numerous studies have provided evidences that mobile elements have the potential to act as agents of evolution by increasing, rearranging and diversifying the genetic repertoire of theirhosts. With large-scale sequencing becoming increasingly available, more and more scientists come across transposable element sequences in their data. I will provide examples that transposable elements, although having signatures of ‘selfish’ DNA,play a significant biological role in the maintainance of genome integrity and providing novel regulatoty networks. These features, along with the transpositional and mutagenic capacity to produce a raw genetic diversity, make the genome mobilefraction, a key player in species adaptation and microevolution. The last but not least, transposable elements stand as informative DNA markers that may complement other conventional DNA markers. Altogether, transposable elements represent a promising, but still largely unexplored research niche and deserve to be included into the agenda of molecular ecologists, evolutionary geneticists, conservation biologists and plant breeders.

  6. Useful parasites: the evolutionary biology and biotechnology applications of transposable elements.

    Science.gov (United States)

    Bonchev, Georgi N

    2016-12-01

    Transposable elements usually comprise the most abundant nongenic fraction of eukaryotic genomes. Because of their capacity to selfreplicate and to induce a wide range of mutations, transposable elements have long been considered as 'parasitic' or 'selfish'. Today, we recognize that the findings about genomic changes affected by transposable elements have considerably altered our view of the ways in which genomes evolve and work. Numerous studies have provided evidences that mobile elements have the potential to act as agents of evolution by increasing, rearranging and diversifying the genetic repertoire of their hosts. With large-scale sequencing becoming increasingly available, more and more scientists come across transposable element sequences in their data. I will provide examples that transposable elements, although having signatures of 'selfish' DNA, play a significant biological role in the maintainance of genome integrity and providing novel regulatoty networks. These features, along with the transpositional and mutagenic capacity to produce a raw genetic diversity, make the genome mobile fraction, a key player in species adaptation and microevolution. The last but not least, transposable elements stand as informative DNA markers that may complement other conventional DNA markers. Altogether, transposable elements represent a promising, but still largely unexplored research niche and deserve to be included into the agenda of molecular ecologists, evolutionary geneticists, conservation biologists and plant breeders.

  7. Transposable element influences on gene expression in plants.

    Science.gov (United States)

    Hirsch, Cory D; Springer, Nathan M

    2017-01-01

    Transposable elements (TEs) comprise a major portion of many plant genomes and bursts of TE movements cause novel genomic variation within species. In order to maintain proper gene function, plant genomes have evolved a variety of mechanisms to tolerate the presence of TEs within or near genes. Here, we review our understanding of the interactions between TEs and gene expression in plants by assessing three ways that transposons can influence gene expression. First, there is growing evidence that TE insertions within introns or untranslated regions of genes are often tolerated and have minimal impact on expression level or splicing. However, there are examples in which TE insertions within genes can result in aberrant or novel transcripts. Second, TEs can provide novel alternative promoters, which can lead to new expression patterns or original coding potential of an alternate transcript. Third, TE insertions near genes can influence regulation of gene expression through a variety of mechanisms. For example, TEs may provide novel cis-acting regulatory sites behaving as enhancers or insert within existing enhancers to influence transcript production. Alternatively, TEs may change chromatin modifications in regions near genes, which in turn can influence gene expression levels. Together, the interactions of genes and TEs provide abundant evidence for the role of TEs in changing basic functions within plant genomes beyond acting as latent genomic elements or as simple insertional mutagens. This article is part of a Special Issue entitled: Plant Gene Regulatory Mechanisms and Networks, edited by Dr. Erich Grotewold and Dr. Nathan Springer.

  8. Transposable-element associated small RNAs in Bombyx mori genome.

    Directory of Open Access Journals (Sweden)

    Yimei Cai

    Full Text Available Small RNAs are a group of regulatory RNA molecules that control gene expression at transcriptional or post-transcriptional levels among eukaryotes. The silkworm, Bombyx mori L., genome harbors abundant repetitive sequences derived from families of retrotransposons and transposons, which together constitute almost half of the genome space and provide ample resource for biogenesis of the three major small RNA families. We systematically discovered transposable-element (TE-associated small RNAs in B. mori genome based on a deep RNA-sequencing strategy and the effort yielded 182, 788 and 4,990 TE-associated small RNAs in the miRNA, siRNA and piRNA species, respectively. Our analysis suggested that the three small RNA species preferentially associate with different TEs to create sequence and functional diversity, and we also show evidence that a Bombyx non-LTR retrotransposon, bm1645, alone contributes to the generation of TE-associated small RNAs in a very significant way. The fact that bm1645-associated small RNAs partially overlap with each other implies a possibility that this element may be modulated by different mechanisms to generate different products with diverse functions. Taken together, these discoveries expand the small RNA pool in B. mori genome and lead to new knowledge on the diversity and functional significance of TE-associated small RNAs.

  9. SoyTEdb: a comprehensive database of transposable elements in the soybean genome

    Directory of Open Access Journals (Sweden)

    Zhu Liucun

    2010-02-01

    Full Text Available Abstract Background Transposable elements are the most abundant components of all characterized genomes of higher eukaryotes. It has been documented that these elements not only contribute to the shaping and reshaping of their host genomes, but also play significant roles in regulating gene expression, altering gene function, and creating new genes. Thus, complete identification of transposable elements in sequenced genomes and construction of comprehensive transposable element databases are essential for accurate annotation of genes and other genomic components, for investigation of potential functional interaction between transposable elements and genes, and for study of genome evolution. The recent availability of the soybean genome sequence has provided an unprecedented opportunity for discovery, and structural and functional characterization of transposable elements in this economically important legume crop. Description Using a combination of structure-based and homology-based approaches, a total of 32,552 retrotransposons (Class I and 6,029 DNA transposons (Class II with clear boundaries and insertion sites were structurally annotated and clearly categorized, and a soybean transposable element database, SoyTEdb, was established. These transposable elements have been anchored in and integrated with the soybean physical map and genetic map, and are browsable and visualizable at any scale along the 20 soybean chromosomes, along with predicted genes and other sequence annotations. BLAST search and other infrastracture tools were implemented to facilitate annotation of transposable elements or fragments from soybean and other related legume species. The majority (> 95% of these elements (particularly a few hundred low-copy-number families are first described in this study. Conclusion SoyTEdb provides resources and information related to transposable elements in the soybean genome, representing the most comprehensive and the largest manually

  10. Survey of transposable elements in sugarcane expressed sequence tags (ESTs

    Directory of Open Access Journals (Sweden)

    Rossi Magdalena

    2001-01-01

    Full Text Available The sugarcane expressed sequence tag (SUCEST project has produced a large number of cDNA sequences from several plant tissues submitted or not to different conditions of stress. In this paper we report the result of a search for transposable elements (TEs revealing a surprising amount of expressed TEs homologues. Of the 260,781 sequences grouped in 81,223 fragment assembly program (Phrap clusters, a total of 276 clones showed homology to previously reported TEs using a stringent cut-off value of e-50 or better. Homologous clones to Copia/Ty1 and Gypsy/Ty3 groups of long terminal repeat (LTR retrotransposons were found but no non-LTR retroelements were identified. All major transposon families were represented in sugarcane including Activator (Ac, Mutator (MuDR, Suppressor-mutator (En/Spm and Mariner. In order to compare the TE diversity in grasses genomes, we carried out a search for TEs described in sugarcane related species O.sativa, Z. mays and S. bicolor. We also present preliminary results showing the potential use of TEs insertion pattern polymorphism as molecular markers for cultivar identification.

  11. A DNA fingerprint probe from Mycosphaerella graminicola identifies an active transposable element

    NARCIS (Netherlands)

    Goodwin, S.B.; Cavaletto, J.R.; Waalwijk, C.; Kema, G.H.J.

    2001-01-01

    DNA fingerprinting has been used extensively to characterize populations of Mycosphaerella graminicola, the Septoria tritici blotch pathogen of wheat. The highly polymorphic DNA fingerprints of Mycosphaerella graminicola were assumed to reflect the action of transposable elements. However, there was

  12. Prediction of transposable element derived enhancers using chromatin modification profiles.

    Directory of Open Access Journals (Sweden)

    Ahsan Huda

    Full Text Available Experimentally characterized enhancer regions have previously been shown to display specific patterns of enrichment for several different histone modifications. We modelled these enhancer chromatin profiles in the human genome and used them to guide the search for novel enhancers derived from transposable element (TE sequences. To do this, a computational approach was taken to analyze the genome-wide histone modification landscape characterized by the ENCODE project in two human hematopoietic cell types, GM12878 and K562. We predicted the locations of 2,107 and 1,448 TE-derived enhancers in the GM12878 and K562 cell lines respectively. A vast majority of these putative enhancers are unique to each cell line; only 3.5% of the TE-derived enhancers are shared between the two. We evaluated the functional effect of TE-derived enhancers by associating them with the cell-type specific expression of nearby genes, and found that the number of TE-derived enhancers is strongly positively correlated with the expression of nearby genes in each cell line. Furthermore, genes that are differentially expressed between the two cell lines also possess a divergent number of TE-derived enhancers in their vicinity. As such, genes that are up-regulated in the GM12878 cell line and down-regulated in K562 have significantly more TE-derived enhancers in their vicinity in the GM12878 cell line and vice versa. These data indicate that human TE-derived sequences are likely to be involved in regulating cell-type specific gene expression on a broad scale and suggest that the enhancer activity of TE-derived sequences is mediated by epigenetic regulatory mechanisms.

  13. Epigenetic regulation of transposable element derived human gene promoters.

    Science.gov (United States)

    Huda, Ahsan; Bowen, Nathan J; Conley, Andrew B; Jordan, I King

    2011-04-01

    It was previously thought that epigenetic histone modifications of mammalian transposable elements (TEs) serve primarily to defend the genome against deleterious effects associated with their activity. However, we recently showed that, genome-wide, human TEs can also be epigenetically modified in a manner consistent with their ability to regulate host genes. Here, we explore the ability of TE sequences to epigenetically regulate individual human genes by focusing on the histone modifications of promoter sequences derived from TEs. We found 1520 human genes that initiate transcription from within TE-derived promoter sequences. We evaluated the distributions of eight histone modifications across these TE-promoters, within and between the GM12878 and K562 cell lines, and related their modification status with the cell-type specific expression patterns of the genes that they regulate. TE-derived promoters are significantly enriched for active histone modifications, and depleted for repressive modifications, relative to the genomic background. Active histone modifications of TE-promoters peak at transcription start sites and are positively correlated with increasing expression within cell lines. Furthermore, differential modification of TE-derived promoters between cell lines is significantly correlated with differential gene expression. LTR-retrotransposon derived promoters in particular play a prominent role in mediating cell-type specific gene regulation, and a number of these LTR-promoter genes are implicated in lineage-specific cellular functions. The regulation of human genes mediated by histone modifications targeted to TE-derived promoters is consistent with the ability of TEs to contribute to the epigenomic landscape in a way that provides functional utility to the host genome.

  14. Detection of transposable elements by their compositional bias

    Directory of Open Access Journals (Sweden)

    Anxolabéhère Dominique

    2004-07-01

    Full Text Available Abstract Background Transposable elements (TE are mobile genetic entities present in nearly all genomes. Previous work has shown that TEs tend to have a different nucleotide composition than the host genes, either considering codon usage bias or dinucleotide frequencies. We show here how these compositional differences can be used as a tool for detection and analysis of TE sequences. Results We compared the composition of TE sequences and host gene sequences using probabilistic models of nucleotide sequences. We used hidden Markov models (HMM, which take into account the base composition of the sequences (occurrences of words n nucleotides long, with n ranging here from 1 to 4 and the heterogeneity between coding and non-coding parts of sequences. We analyzed three sets of sequences containing class I TEs, class II TEs and genes respectively in three species: Drosophila melanogaster, Cænorhabditis elegans and Arabidopsis thaliana. Each of these sets had a distinct, homogeneous composition, enabling us to distinguish between the two classes of TE and the genes. However the particular base composition of the TEs differed in the three species studied. Conclusions This approach can be used to detect and annotate TEs in genomic sequences and complements the current homology-based TE detection methods. Furthermore, the HMM method is able to identify the parts of a sequence in which the nucleotide composition resembles that of a coding region of a TE. This is useful for the detailed annotation of TE sequences, which may contain an ancient, highly diverged coding region that is no longer fully functional.

  15. Whole genome resequencing reveals natural target site preferences of transposable elements in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Raquel S Linheiro

    Full Text Available Transposable elements are mobile DNA sequences that integrate into host genomes using diverse mechanisms with varying degrees of target site specificity. While the target site preferences of some engineered transposable elements are well studied, the natural target preferences of most transposable elements are poorly characterized. Using population genomic resequencing data from 166 strains of Drosophila melanogaster, we identified over 8,000 new insertion sites not present in the reference genome sequence that we used to decode the natural target preferences of 22 families of transposable element in this species. We found that terminal inverted repeat transposon and long terminal repeat retrotransposon families present clade-specific target site duplications and target site sequence motifs. Additionally, we found that the sequence motifs at transposable element target sites are always palindromes that extend beyond the target site duplication. Our results demonstrate the utility of population genomics data for high-throughput inference of transposable element targeting preferences in the wild and establish general rules for terminal inverted repeat transposon and long terminal repeat retrotransposon target site selection in eukaryotic genomes.

  16. Novel non-autonomous transposable elements onWchromosome of the silkworm, Bombyx mori

    Indian Academy of Sciences (India)

    Hiroaki Abe; Tsuguru Fujii; Toru Shimada; Kazuei Mita

    2010-09-01

    The sex chromosomes of the silkworm Bombyx mori are designated ZW(XY) for females and ZZ (XX) for males. Numerous long terminal repeat (LTR) and non-LTR retrotransposons, retroposons and DNA transposons have accumulated as strata on the W chromosome. However, there are nucleotide sequences that do not show the characteristics of typical transposable elements on the W chromosome. To analyse these uncharacterized nucleotide sequences on the W chromosome, we used whole-genome shotgun (WGS) data and assembled data that was obtained using male genome DNA. Through these analyses, we found that almost all of these uncharacterized sequences were non-autonomous transposable elements that do not fit into the conventional classification. It is notable that some of these transposable elements contained the Bombyx short interspersed element (Bm1) sequences in the elements. We designated them as secondary-Bm1 transposable elements (SBTEs). Because putative ancestral SBTE nucleotide sequences without Bm1 do not occur in theWGS data, we suggest that the Bm1 sequences of SBTEs are not carried on each element merely as a package but are components of each element. Therefore, we confirmed that SBTEs should be classified as a new group of transposable elements.

  17. Evaluating the protein coding potential of exonized transposable element sequences

    Directory of Open Access Journals (Sweden)

    Borodovsky Mark

    2007-11-01

    Full Text Available Abstract Background Transposable element (TE sequences, once thought to be merely selfish or parasitic members of the genomic community, have been shown to contribute a wide variety of functional sequences to their host genomes. Analysis of complete genome sequences have turned up numerous cases where TE sequences have been incorporated as exons into mRNAs, and it is widely assumed that such 'exonized' TEs encode protein sequences. However, the extent to which TE-derived sequences actually encode proteins is unknown and a matter of some controversy. We have tried to address this outstanding issue from two perspectives: i-by evaluating ascertainment biases related to the search methods used to uncover TE-derived protein coding sequences (CDS and ii-through a probabilistic codon-frequency based analysis of the protein coding potential of TE-derived exons. Results We compared the ability of three classes of sequence similarity search methods to detect TE-derived sequences among data sets of experimentally characterized proteins: 1-a profile-based hidden Markov model (HMM approach, 2-BLAST methods and 3-RepeatMasker. Profile based methods are more sensitive and more selective than the other methods evaluated. However, the application of profile-based search methods to the detection of TE-derived sequences among well-curated experimentally characterized protein data sets did not turn up many more cases than had been previously detected and nowhere near as many cases as recent genome-wide searches have. We observed that the different search methods used were complementary in the sense that they yielded largely non-overlapping sets of hits and differed in their ability to recover known cases of TE-derived CDS. The probabilistic analysis of TE-derived exon sequences indicates that these sequences have low protein coding potential on average. In particular, non-autonomous TEs that do not encode protein sequences, such as Alu elements, are frequently

  18. Evolutionary impact of transposable elements on genomic diversity and lineage-specific innovation in vertebrates.

    Science.gov (United States)

    Warren, Ian A; Naville, Magali; Chalopin, Domitille; Levin, Perrine; Berger, Chloé Suzanne; Galiana, Delphine; Volff, Jean-Nicolas

    2015-09-01

    Since their discovery, a growing body of evidence has emerged demonstrating that transposable elements are important drivers of species diversity. These mobile elements exhibit a great variety in structure, size and mechanisms of transposition, making them important putative actors in organism evolution. The vertebrates represent a highly diverse and successful lineage that has adapted to a wide range of different environments. These animals also possess a rich repertoire of transposable elements, with highly diverse content between lineages and even between species. Here, we review how transposable elements are driving genomic diversity and lineage-specific innovation within vertebrates. We discuss the large differences in TE content between different vertebrate groups and then go on to look at how they affect organisms at a variety of levels: from the structure of chromosomes to their involvement in the regulation of gene expression, as well as in the formation and evolution of non-coding RNAs and protein-coding genes. In the process of doing this, we highlight how transposable elements have been involved in the evolution of some of the key innovations observed within the vertebrate lineage, driving the group's diversity and success.

  19. Survival of Tdc transposable elements of the En/Spm superfamily in the carrot genome.

    Science.gov (United States)

    Itoh, Y; Hasebe, M; Davies, E; Takeda, J; Ozeki, Y

    2003-04-01

    Three subfamilies of the En/Spm-type transposable element of carrot, Tdc A, B, and C, were characterized. It was supposed that the Tdc A subfamily may include autonomous elements which can produce transposases. Tdc B elements are defective, but still generate transcripts containing mutant open reading frame (ORF) sequences for transposases. The single member of the Tdc C group recovered seems to be a pseudogene. The sequences of the transposase ORFs of Tdc A and Tdc B elements are more highly conserved than those of the 5; and 3; untranslated regions and introns, as is found in other structural genes that are subject to selection. These observations indicate that the mutations in the nucleotide sequences of the Tdc elements occurred in the host genome. However, the mutations in the 5; and 3; untranslated regions and introns, which may not be sufficient to prevent transposition, accumulated in autonomous elements, which could transpose and produce copies. When the reproduction rate and the rate of disabling mutations reached an equilibrium, that is, when the birth rate of the transposable elements in the genome equalled the death rate, the population of elements achieved a stationary state in the genome, and could thus survive.

  20. Large-scale mapping of transposable element insertion sites using digital encoding of sample identity.

    Science.gov (United States)

    Gohl, Daryl M; Freifeld, Limor; Silies, Marion; Hwa, Jennifer J; Horowitz, Mark; Clandinin, Thomas R

    2014-03-01

    Determining the genomic locations of transposable elements is a common experimental goal. When mapping large collections of transposon insertions, individualized amplification and sequencing is both time consuming and costly. We describe an approach in which large numbers of insertion lines can be simultaneously mapped in a single DNA sequencing reaction by using digital error-correcting codes to encode line identity in a unique set of barcoded pools.

  1. The sunflower (Helianthus annuus L.) genome reflects a recent history of biased accumulation of transposable elements.

    Science.gov (United States)

    Staton, S Evan; Bakken, Bradley H; Blackman, Benjamin K; Chapman, Mark A; Kane, Nolan C; Tang, Shunxue; Ungerer, Mark C; Knapp, Steven J; Rieseberg, Loren H; Burke, John M

    2012-10-01

    Aside from polyploidy, transposable elements are the major drivers of genome size increases in plants. Thus, understanding the diversity and evolutionary dynamics of transposable elements in sunflower (Helianthus annuus L.), especially given its large genome size (∼3.5 Gb) and the well-documented cases of amplification of certain transposons within the genus, is of considerable importance for understanding the evolutionary history of this emerging model species. By analyzing approximately 25% of the sunflower genome from random sequence reads and assembled bacterial artificial chromosome (BAC) clones, we show that it is composed of over 81% transposable elements, 77% of which are long terminal repeat (LTR) retrotransposons. Moreover, the LTR retrotransposon fraction in BAC clones harboring genes is disproportionately composed of chromodomain-containing Gypsy LTR retrotransposons ('chromoviruses'), and the majority of the intact chromoviruses contain tandem chromodomain duplications. We show that there is a bias in the efficacy of homologous recombination in removing LTR retrotransposon DNA, thereby providing insight into the mechanisms associated with transposable element (TE) composition in the sunflower genome. We also show that the vast majority of observed LTR retrotransposon insertions have likely occurred since the origin of this species, providing further evidence that biased LTR retrotransposon activity has played a major role in shaping the chromatin and DNA landscape of the sunflower genome. Although our findings on LTR retrotransposon age and structure could be influenced by the selection of the BAC clones analyzed, a global analysis of random sequence reads indicates that the evolutionary patterns described herein apply to the sunflower genome as a whole.

  2. The industrial melanism mutation in British peppered moths is a transposable element.

    Science.gov (United States)

    Van't Hof, Arjen E; Campagne, Pascal; Rigden, Daniel J; Yung, Carl J; Lingley, Jessica; Quail, Michael A; Hall, Neil; Darby, Alistair C; Saccheri, Ilik J

    2016-06-01

    Discovering the mutational events that fuel adaptation to environmental change remains an important challenge for evolutionary biology. The classroom example of a visible evolutionary response is industrial melanism in the peppered moth (Biston betularia): the replacement, during the Industrial Revolution, of the common pale typica form by a previously unknown black (carbonaria) form, driven by the interaction between bird predation and coal pollution. The carbonaria locus has been coarsely localized to a 200-kilobase region, but the specific identity and nature of the sequence difference controlling the carbonaria-typica polymorphism, and the gene it influences, are unknown. Here we show that the mutation event giving rise to industrial melanism in Britain was the insertion of a large, tandemly repeated, transposable element into the first intron of the gene cortex. Statistical inference based on the distribution of recombined carbonaria haplotypes indicates that this transposition event occurred around 1819, consistent with the historical record. We have begun to dissect the mode of action of the carbonaria transposable element by showing that it increases the abundance of a cortex transcript, the protein product of which plays an important role in cell-cycle regulation, during early wing disc development. Our findings fill a substantial knowledge gap in the iconic example of microevolutionary change, adding a further layer of insight into the mechanism of adaptation in response to natural selection. The discovery that the mutation itself is a transposable element will stimulate further debate about the importance of 'jumping genes' as a source of major phenotypic novelty.

  3. Distribution and insertion numbers of transposable elements in species of the Drosophila saltans group

    Directory of Open Access Journals (Sweden)

    Juliana P. de Castro

    2006-01-01

    Full Text Available Information about the distribution and insertion numbers of many transposable elements is restricted to few species of Drosophila, although these elements are widely distributed throughout the genus. The aim of this work was to describe the distribution and insertion numbers of four retrotransposons (copia, gypsy, micropia, I and four transposons (hobo, mariner, Minos and Bari-1 in the saltans group of Drosophila. Our data shows that, except for mariner, all the other elements are widespread within the saltans group and show variable insertion numbers of up to 24 copies.

  4. Tourist C transposable elements are closely associated with genes expressed in flowers of rice (Oryza sativa).

    Science.gov (United States)

    Iwamoto, M; Higo, K

    2003-03-01

    Tourist elements comprise a group of transposable elements in plants. One of these elements, Tourist-OsaCatA(a Tourist C element), has been found in the 5; flanking region of a catalase gene, CatA, in rice (Oryza sativa). Using reverse transcriptase-PCR (RT-PCR) analyses of leaves, roots, flowers and developing seeds of rice, we assessed the transcription levels of ten known genes containing Tourist C elements, and of three additional putative genes for which expressed sequence tags (ESTs) including Tourist C elements have been isolated. We found that nine of the ten known genes and two of the three represented by ESTs were expressed in at least one of the organs we analyzed, and all of the genes detected were expressed in flowers, usually in stamens or pistils. We also assessed the expression of the 29 Tourist C-containing hypothetical coding sequences (CDSs) obtained so far by high-throughput genomic sequencing. We found that CDSs of all 11 genes whose transcripts were detectable by RT-PCR were expressed in flowers, especially in stamens or pistils. In contrast, RT-PCR analyses of genes or CDSs associated with other miniature inverted-repeat transposable elements (MITEs), such as Tourist D, Gaijin, Explorer, and Castaway, showed that some of them were expressed only minimally or not at all in flowers. Therefore, compared with other MITEs, Tourist C elements seem to show a strong association with genes that are expressed in the flowers of rice.

  5. Physiological impact of transposable elements encoding DDE transposases in the environmental adaptation of Streptococcus agalactiae.

    Science.gov (United States)

    Fléchard, Maud; Gilot, Philippe

    2014-07-01

    We have referenced and described Streptococcus agalactiae transposable elements encoding DDE transposases. These elements belonged to nine families of insertion sequences (ISs) and to a family of conjugative transposons (TnGBSs). An overview of the physiological impact of the insertion of all these elements is provided. DDE-transposable elements affect S. agalactiae in a number of aspects of its capability to adapt to various environments and modulate the expression of several virulence genes, the scpB-lmB genomic region and the genes involved in capsule expression and haemolysin transport being the targets of several different mobile elements. The referenced mobile elements modify S. agalactiae behaviour by transferring new gene(s) to its genome, by modifying the expression of neighbouring genes at the integration site or by promoting genomic rearrangements. Transposition of some of these elements occurs in vivo, suggesting that by dynamically regulating some adaptation and/or virulence genes, they improve the ability of S. agalactiae to reach different niches within its host and ensure the 'success' of the infectious process.

  6. Biased exonization of transposed elements in duplicated genes: A lesson from the TIF-IA gene

    Directory of Open Access Journals (Sweden)

    Shomron Noam

    2007-11-01

    Full Text Available Abstract Background Gene duplication and exonization of intronic transposed elements are two mechanisms that enhance genomic diversity. We examined whether there is less selection against exonization of transposed elements in duplicated genes than in single-copy genes. Results Genome-wide analysis of exonization of transposed elements revealed a higher rate of exonization within duplicated genes relative to single-copy genes. The gene for TIF-IA, an RNA polymerase I transcription initiation factor, underwent a humanoid-specific triplication, all three copies of the gene are active transcriptionally, although only one copy retains the ability to generate the TIF-IA protein. Prior to TIF-IA triplication, an Alu element was inserted into the first intron. In one of the non-protein coding copies, this Alu is exonized. We identified a single point mutation leading to exonization in one of the gene duplicates. When this mutation was introduced into the TIF-IA coding copy, exonization was activated and the level of the protein-coding mRNA was reduced substantially. A very low level of exonization was detected in normal human cells. However, this exonization was abundant in most leukemia cell lines evaluated, although the genomic sequence is unchanged in these cancerous cells compared to normal cells. Conclusion The definition of the Alu element within the TIF-IA gene as an exon is restricted to certain types of cancers; the element is not exonized in normal human cells. These results further our understanding of the delicate interplay between gene duplication and alternative splicing and of the molecular evolutionary mechanisms leading to genetic innovations. This implies the existence of purifying selection against exonization in single copy genes, with duplicate genes free from such constrains.

  7. Distribution and conservation of the transposable element gypsy in drosophilid species

    Directory of Open Access Journals (Sweden)

    Fabiana Herédia

    2007-01-01

    Full Text Available In an attempt to understand the dynamics of transposable elements (T'S in the genome of host species, we investigated the distribution, representativeness and conservation of DNA sequences homologous to the Drosophila melanogaster gypsy retrotransposon in 42 drosophilid species. Our results extended the knowledge about the wide distribution of gypsy in the genus Drosophila, including several Neotropical species not previously studied. The gypsy-like sequences showed high divergence compared to the D. melanogaster gypsy element. Furthermore, the conservation of the restriction sites between gypsy sequences from phylogenetically unrelated species pointed to a more complex evolutionary picture, which includes the possibility of the horizontal transfer events already described for this retrotransposon.

  8. Transposable element insertion location bias and the dynamics of gene drive in mosquito populations.

    Science.gov (United States)

    Rasgon, J L; Gould, F

    2005-10-01

    Some vector-borne disease control strategies using transgenic mosquitoes require transgene spread to high frequency in populations. Transposable elements (TEs) are DNA sequences that replicate and transpose within the genomes of other organisms and may therefore be represented in the next generation in higher frequencies than predicted by Mendelian segregation. This over-representation has allowed some TEs to spread through natural populations. Transgenes incorporated within a TE sequence are expected to be driven into populations as long as there is a positive balance between fitness costs and over-representation. Models have been used to examine parameters that affect this balance but did not take into account biased insertion of TEs to linked sites in the genome. A simulation model was created to examine the impact of insertion bias on TE spread in mosquito populations. TEs that induce no fitness costs are predicted to increase in frequency over a wide range of parameter values but spread is slower for lower levels of transposition and non-local movement. If TEs are costly, high proportions of local movement can slow or halt spread. To function as a robust transgene drive mechanism a TE should replicate and transpose > 10%/insert/generation, induce < 1% fitness cost/insert, and move preferentially to unlinked sites in the genome.

  9. Interspecies insertion polymorphism analysis reveals recent activity of transposable elements in extant coelacanths.

    Science.gov (United States)

    Naville, Magali; Chalopin, Domitille; Volff, Jean-Nicolas

    2014-01-01

    Coelacanths are lobe-finned fish represented by two extant species, Latimeria chalumnae in South Africa and Comoros and L. menadoensis in Indonesia. Due to their intermediate phylogenetic position between ray-finned fish and tetrapods in the vertebrate lineage, they are of great interest from an evolutionary point of view. In addition, extant specimens look similar to 300 million-year-old fossils; because of their apparent slowly evolving morphology, coelacanths have been often described as « living fossils ». As an underlying cause of such a morphological stasis, several authors have proposed a slow evolution of the coelacanth genome. Accordingly, sequencing of the L. chalumnae genome has revealed a globally low substitution rate for protein-coding regions compared to other vertebrates. However, genome and gene evolution can also be influenced by transposable elements, which form a major and dynamic part of vertebrate genomes through their ability to move, duplicate and recombine. In this work, we have searched for evidence of transposition activity in coelacanth genomes through the comparative analysis of orthologous genomic regions from both Latimeria species. Comparison of 5.7 Mb (0.2%) of the L. chalumnae genome with orthologous Bacterial Artificial Chromosome clones from L. menadoensis allowed the identification of 27 species-specific transposable element insertions, with a strong relative contribution of CR1 non-LTR retrotransposons. Species-specific homologous recombination between the long terminal repeats of a new coelacanth endogenous retrovirus was also detected. Our analysis suggests that transposon activity is responsible for at least 0.6% of genome divergence between both Latimeria species. Taken together, this study demonstrates that coelacanth genomes are not evolutionary inert: they contain recently active transposable elements, which have significantly contributed to post-speciation genome divergence in Latimeria.

  10. Interspecies insertion polymorphism analysis reveals recent activity of transposable elements in extant coelacanths.

    Directory of Open Access Journals (Sweden)

    Magali Naville

    Full Text Available Coelacanths are lobe-finned fish represented by two extant species, Latimeria chalumnae in South Africa and Comoros and L. menadoensis in Indonesia. Due to their intermediate phylogenetic position between ray-finned fish and tetrapods in the vertebrate lineage, they are of great interest from an evolutionary point of view. In addition, extant specimens look similar to 300 million-year-old fossils; because of their apparent slowly evolving morphology, coelacanths have been often described as « living fossils ». As an underlying cause of such a morphological stasis, several authors have proposed a slow evolution of the coelacanth genome. Accordingly, sequencing of the L. chalumnae genome has revealed a globally low substitution rate for protein-coding regions compared to other vertebrates. However, genome and gene evolution can also be influenced by transposable elements, which form a major and dynamic part of vertebrate genomes through their ability to move, duplicate and recombine. In this work, we have searched for evidence of transposition activity in coelacanth genomes through the comparative analysis of orthologous genomic regions from both Latimeria species. Comparison of 5.7 Mb (0.2% of the L. chalumnae genome with orthologous Bacterial Artificial Chromosome clones from L. menadoensis allowed the identification of 27 species-specific transposable element insertions, with a strong relative contribution of CR1 non-LTR retrotransposons. Species-specific homologous recombination between the long terminal repeats of a new coelacanth endogenous retrovirus was also detected. Our analysis suggests that transposon activity is responsible for at least 0.6% of genome divergence between both Latimeria species. Taken together, this study demonstrates that coelacanth genomes are not evolutionary inert: they contain recently active transposable elements, which have significantly contributed to post-speciation genome divergence in Latimeria.

  11. Transposable elements re-wire and fine-tune the transcriptome.

    Directory of Open Access Journals (Sweden)

    Michael Cowley

    Full Text Available What good are transposable elements (TEs? Although their activity can be harmful to host genomes and can cause disease, they nevertheless represent an important source of genetic variation that has helped shape genomes. In this review, we examine the impact of TEs, collectively referred to as the mobilome, on the transcriptome. We explore how TEs-particularly retrotransposons-contribute to transcript diversity and consider their potential significance as a source of small RNAs that regulate host gene transcription. We also discuss a critical role for the mobilome in engineering transcriptional networks, permitting coordinated gene expression, and facilitating the evolution of novel physiological processes.

  12. Germline transformation of Aedes fluviatilis (Diptera:Culicidae) with the piggyBac transposable element.

    Science.gov (United States)

    Rodrigues, Flávia Guimarães; Oliveira, Sabrina Barbosa; Rocha, Bruno Coelho; Moreira, Luciano Andrade

    2006-11-01

    The technique to generate transgenic mosquitoes requires adaptation for each target species because of aspects related to species biology, sensitivity to manipulation and rearing conditions. Here we tested different parameters on the microinjection procedure in order to obtain a transgenic Neotropical mosquito species. By using a transposon-based strategy we were able to successfully transform Aedes fluviatilis (Lutz), which can be used as an avian malaria model. These results demonstrate the usefulness of the piggyBac transposable element as a transformation vector for Neotropical mosquito species and opens up new research frontiers for South American mosquito vectors.

  13. Germline transformation of Aedes fluviatilis (Diptera:Culicidae with the piggyBac transposable element

    Directory of Open Access Journals (Sweden)

    Flávia Guimarães Rodrigues

    2006-11-01

    Full Text Available The technique to generate transgenic mosquitoes requires adaptation for each target species because of aspects related to species biology, sensitivity to manipulation and rearing conditions. Here we tested different parameters on the microinjection procedure in order to obtain a transgenic Neotropical mosquito species. By using a transposon-based strategy we were able to successfully transform Aedes fluviatilis (Lutz, which can be used as an avian malaria model. These results demonstrate the usefulness of the piggyBac transposable element as a transformation vector for Neotropical mosquito species and opens up new research frontiers for South American mosquito vectors.

  14. Transposable Elements versus the Fungal Genome: Impact on Whole-Genome Architecture and Transcriptional Profiles

    Science.gov (United States)

    Castanera, Raúl; López-Varas, Leticia; Borgognone, Alessandra; LaButti, Kurt; Lapidus, Alla; Schmutz, Jeremy; Grimwood, Jane; Pisabarro, Antonio G.; Grigoriev, Igor V.; Ramírez, Lucía

    2016-01-01

    Transposable elements (TEs) are exceptional contributors to eukaryotic genome diversity. Their ubiquitous presence impacts the genomes of nearly all species and mediates genome evolution by causing mutations and chromosomal rearrangements and by modulating gene expression. We performed an exhaustive analysis of the TE content in 18 fungal genomes, including strains of the same species and species of the same genera. Our results depicted a scenario of exceptional variability, with species having 0.02 to 29.8% of their genome consisting of transposable elements. A detailed analysis performed on two strains of Pleurotus ostreatus uncovered a genome that is populated mainly by Class I elements, especially LTR-retrotransposons amplified in recent bursts from 0 to 2 million years (My) ago. The preferential accumulation of TEs in clusters led to the presence of genomic regions that lacked intra- and inter-specific conservation. In addition, we investigated the effect of TE insertions on the expression of their nearby upstream and downstream genes. Our results showed that an important number of genes under TE influence are significantly repressed, with stronger repression when genes are localized within transposon clusters. Our transcriptional analysis performed in four additional fungal models revealed that this TE-mediated silencing was present only in species with active cytosine methylation machinery. We hypothesize that this phenomenon is related to epigenetic defense mechanisms that are aimed to suppress TE expression and control their proliferation. PMID:27294409

  15. Transposable Elements versus the Fungal Genome: Impact on Whole-Genome Architecture and Transcriptional Profiles.

    Directory of Open Access Journals (Sweden)

    Raúl Castanera

    2016-06-01

    Full Text Available Transposable elements (TEs are exceptional contributors to eukaryotic genome diversity. Their ubiquitous presence impacts the genomes of nearly all species and mediates genome evolution by causing mutations and chromosomal rearrangements and by modulating gene expression. We performed an exhaustive analysis of the TE content in 18 fungal genomes, including strains of the same species and species of the same genera. Our results depicted a scenario of exceptional variability, with species having 0.02 to 29.8% of their genome consisting of transposable elements. A detailed analysis performed on two strains of Pleurotus ostreatus uncovered a genome that is populated mainly by Class I elements, especially LTR-retrotransposons amplified in recent bursts from 0 to 2 million years (My ago. The preferential accumulation of TEs in clusters led to the presence of genomic regions that lacked intra- and inter-specific conservation. In addition, we investigated the effect of TE insertions on the expression of their nearby upstream and downstream genes. Our results showed that an important number of genes under TE influence are significantly repressed, with stronger repression when genes are localized within transposon clusters. Our transcriptional analysis performed in four additional fungal models revealed that this TE-mediated silencing was present only in species with active cytosine methylation machinery. We hypothesize that this phenomenon is related to epigenetic defense mechanisms that are aimed to suppress TE expression and control their proliferation.

  16. A novel class of Helitron-related transposable elements in maize contain portions of multiple pseudogenes.

    Science.gov (United States)

    Gupta, Smriti; Gallavotti, Andrea; Stryker, Gabrielle A; Schmidt, Robert J; Lal, Shailesh K

    2005-01-01

    We recently described a maize mutant caused by an insertion of a Helitron type transposable element (Lal, S.K., Giroux, M.J., Brendel, V., Vallejos, E. and Hannah, L.C., 2003, Plant Cell, 15: 381-391). Here we describe another Helitron insertion in the barren stalk1 gene of maize. The termini of a 6525 bp insertion in the proximal promoter region of the mutant reference allele of maize barren stalk1 gene (ba1-ref) shares striking similarity to the Helitron insertion we reported in the Shrunken-2 gene. This insertion is embedded with pseudogenes that differ from the pseudogenes discovered in the mutant Shrunken-2 insertion. Using the common terminal ends of the mutant insertions as a query, we discovered other Helitron insertions in maize BAC clones. Based on the comparison of the insertion site and PCR amplified genomic sequences, these elements inserted between AT dinucleotides. These putative non-autonomous Helitron insertions completely lacked sequences similar to RPA (replication protein A) and DNA Helicases reported in other species. A blastn analysis indicated that both the 5' and 3' termini of Helitrons are repeated in the maize genome. These data provide strong evidence that Helitron type transposable elements are active and may have played an essential role in the evolution and expansion of the maize genome.

  17. Genomic patterns associated with paternal/maternal distribution of transposable elements

    Science.gov (United States)

    Jurka, Jerzy

    2003-03-01

    Transposable elements (TEs) are specialized DNA or RNA fragments capable of surviving in intragenomic niches. They are commonly, perhaps unjustifiably referred to as "selfish" or "parasitic" elements. TEs can be divided in two major classes: retroelements and DNA transposons. The former include non-LTR retrotransposons and retrovirus-like elements, using reverse transriptase for their reproduction prior to integration into host DNA. The latter depend mostly on host DNA replication, with possible exception of rolling-circle transposons recently discovered by our team. I will review basic information on TEs, with emphasis on human Alu and L1 retroelements discussed in the context of genomic organization. TEs are non-randomly distributed in chromosomal DNA. In particular, human Alu elements tend to prefer GC-rich regions, whereas L1 accumulate in AT-rich regions. Current explanations of this phenomenon focus on the so called "target effects" and post-insertional selection. However, the proposed models appear to be unsatisfactory and alternative explanations invoking "channeling" to different chromosomal regions will be a major focus of my presentation. Transposable elements (TEs) can be expressed and integrated into host DNA in the male or female germlines, or both. Different models of expression and integration imply different proportions of TEs on sex chromosomes and autosomes. The density of recently retroposed human Alu elements is around three times higher on chromosome Y than on chromosome X, and over two times higher than the average density for all human autosomes. This implies Alu activity in paternal germlines. Analogous inter-chromosomal proportions for other repeat families should determine their compatibility with one of the three basic models describing the inheritance of TEs. Published evidence indicates that maternally and paternally imprinted genes roughly correspond to GC-rich and AT-rich DNA. This may explain the observed chromosomal distribution of

  18. Transposable element distribution, abundance and role in genome size variation in the genus Oryza

    Directory of Open Access Journals (Sweden)

    Collura Kristi

    2007-08-01

    Full Text Available Abstract Background The genus Oryza is composed of 10 distinct genome types, 6 diploid and 4 polyploid, and includes the world's most important food crop – rice (Oryza sativa [AA]. Genome size variation in the Oryza is more than 3-fold and ranges from 357 Mbp in Oryza glaberrima [AA] to 1283 Mbp in the polyploid Oryza ridleyi [HHJJ]. Because repetitive elements are known to play a significant role in genome size variation, we constructed random sheared small insert genomic libraries from 12 representative Oryza species and conducted a comprehensive study of the repetitive element composition, distribution and phylogeny in this genus. Particular attention was paid to the role played by the most important classes of transposable elements (Long Terminal Repeats Retrotransposons, Long interspersed Nuclear Elements, helitrons, DNA transposable elements in shaping these genomes and in their contributing to genome size variation. Results We identified the elements primarily responsible for the most strikingly genome size variation in Oryza. We demonstrated how Long Terminal Repeat retrotransposons belonging to the same families have proliferated to very different extents in various species. We also showed that the pool of Long Terminal Repeat Retrotransposons is substantially conserved and ubiquitous throughout the Oryza and so its origin is ancient and its existence predates the speciation events that originated the genus. Finally we described the peculiar behavior of repeats in the species Oryza coarctata [HHKK] whose placement in the Oryza genus is controversial. Conclusion Long Terminal Repeat retrotransposons are the major component of the Oryza genomes analyzed and, along with polyploidization, are the most important contributors to the genome size variation across the Oryza genus. Two families of Ty3-gypsy elements (RIRE2 and Atlantys account for a significant portion of the genome size variations present in the Oryza genus.

  19. Characterization of new transposable element sub-families from white clover (Trifolium repens) using PCR amplification.

    Science.gov (United States)

    Becker, Kailey E; Thomas, Mary C; Martini, Samer; Shuipys, Tautvydas; Didorchuk, Volodymyr; Shanker, Rachyl M; Laten, Howard M

    2016-10-01

    Transposable elements (TEs) dominate the landscapes of most plant and animal genomes. Once considered junk DNA and genetic parasites, these interspersed, repetitive DNA elements are now known to play major roles in both genetic and epigenetic processes that sponsor genome variation and regulate gene expression. Knowledge of TE consensus sequences from elements in species whose genomes have not been sequenced is limited, and the individual TEs that are encountered in clones or short-reads rarely represent potentially canonical, let alone, functional representatives. In this study, we queried the Repbase database with eight BAC clones from white clover (Trifolium repens), identified a large number of candidate TEs, and used polymerase chain reaction and Sanger sequencing to create consensus sequences for three new TE families. The results show that TE family consensus sequences can be obtained experimentally in species for which just a single, full-length member of a TE family has been sequenced.

  20. Detection transposable elements in Botrytis cinerea in latent infection stage from symptomless apples

    Directory of Open Access Journals (Sweden)

    Jorge G Fernández

    2014-02-01

    Full Text Available Objective: T o detect Botrytis cinerea ( B. cinerea latent infections on apples before storage, which is essential for effective control strategies in the fruit postharvest industry. Methods: I n the present study, a polymerase chain reaction detection method, based on primers designed on B. cinerea transposable elements ( boty and flipper and intergenic spacer region as internal control, were utilized to reveal the presence of symptomless infections on apple fruits. T his molecular method proved to be highly specific and sensitive in detecting latent infections. I t revealed the presence of the pathogen in 83 % of the samples from infected apples with 10 4 conidia/ m L , whereas those infected with 10 6 conidia/m L detected 94 % as compared to the traditional method that revealed the pathogen in 40 % and 66 % of the samples inoculated with 10 4 and 10 6 conidia/m L respectively. F urthermore, the method characterized B. cinerea as subpopulation transposa-type by the presence of the transposable elements boty and flipper Results: T he results obtained from DNA quantification method were compared with enzyme- linked immunosorbent assay and these studies showed good correlation. T herefore our method has important advantages compared with others detection methods for B. cinerea, because the proposed methodology allowed distinguishes between its two subpopulations ( vacuma and transposa and this would allow establish possible appropriate control strategies. Conclusions: F inally, the method can be an interesting alternative for its possible application in the phytosanitary programs of the fruit industry worldwide.

  1. Detection transposable elements in Botrytis cinerea in latent infection stage from symptomless apples

    Institute of Scientific and Technical Information of China (English)

    Jorge G Fernndez; Martn A Fernndez-Baldo; Claudio Muoz; Eloy Salinas; Julio Raba; Mara I Sanz

    2014-01-01

    Objective:To detect Botrytis cinerea (B. cinerea) latent infections on apples before storage, which is essential for effective control strategies in the fruit postharvest industry. Methods:In the present study, a polymerase chain reaction detection method, based on primers designed on B. cinerea transposable elements (boty and flipper) and intergenic spacer region as internal control, were utilized to reveal the presence of symptomless infections on apple fruits. This molecular method proved to be highly specific and sensitive in detecting latent infections. It revealed the presence of the pathogen in 83%of the samples from infected apples with 104 conidia/mL, whereas those infected with 106 conidia/mL detected 94%as compared to the traditional method that revealed the pathogen in 40%and 66%of the samples inoculated with 104 and 106 conidia/mL respectively. Furthermore, the method characterized B. cinerea as subpopulation transposa-type by the presence of the transposable elements boty and flipper Results:The results obtained from DNA quantification method were compared with enzyme-linked immunosorbent assay and these studies showed good correlation. Therefore our method has important advantages compared with others detection methods for B. cinerea, because the proposed methodology allowed distinguishes between its two subpopulations (vacuma and transposa) and this would allow establish possible appropriate control strategies. Conclusions:Finally, the method can be an interesting alternative for its possible application in the phytosanitary programs of the fruit industry worldwide.

  2. Population genetics and molecular evolution of DNA sequences in transposable elements. I. A simulation framework.

    Science.gov (United States)

    Kijima, T E; Innan, Hideki

    2013-11-01

    A population genetic simulation framework is developed to understand the behavior and molecular evolution of DNA sequences of transposable elements. Our model incorporates random transposition and excision of transposable element (TE) copies, two modes of selection against TEs, and degeneration of transpositional activity by point mutations. We first investigated the relationships between the behavior of the copy number of TEs and these parameters. Our results show that when selection is weak, the genome can maintain a relatively large number of TEs, but most of them are less active. In contrast, with strong selection, the genome can maintain only a limited number of TEs but the proportion of active copies is large. In such a case, there could be substantial fluctuations of the copy number over generations. We also explored how DNA sequences of TEs evolve through the simulations. In general, active copies form clusters around the original sequence, while less active copies have long branches specific to themselves, exhibiting a star-shaped phylogeny. It is demonstrated that the phylogeny of TE sequences could be informative to understand the dynamics of TE evolution.

  3. TEnest 2.0: computational annotation and visualization of nested transposable elements.

    Science.gov (United States)

    Kronmiller, Brent A; Wise, Roger P

    2013-01-01

    Grass genomes harbor a diverse and complex content of repeated sequences. Most of these repeats occur as abundant transposable elements (TEs), which present unique challenges to sequence, assemble, and annotate genomes. Multiple copies of Long Terminal Repeat (LTR) retrotransposons can hinder sequence assembly and also cause problems with gene annotation. TEs can also contain protein-encoding genes, the ancient remnants of which can mislead gene identification software if not correctly masked. Hence, accurate assembly is crucial for gene annotation. We present TEnest v2.0. TEnest computationally annotates and chronologically displays nested transposable elements. Utilizing organism-specific TE databases as a reference for reconstructing degraded TEs to their ancestral state, annotation of repeats is accomplished by iterative sequence alignment. Subsequently, an output consisting of a graphical display of the chronological nesting structure and coordinate positions of all TE insertions is the result. Both linux command line and Web versions of the TEnest software are available at www.wiselab.org and www.plantgdb.org/tool/, respectively.

  4. Transposable DNA elements and life history traits: II. Transposition of P DNA elements in somatic cells reduces fitness, mating activity, and locomotion of Drosophila melanogaster.

    Science.gov (United States)

    Woodruff, R C; Thompson, J N; Barker, J S; Huai, H

    1999-01-01

    Some transposable DNA elements in higher organisms are active in somatic cells, as well as in germinal cells. What effect does the movement of DNA elements in somatic cells have on life history traits? It has previously been reported that somatically active P and mariner elements in Drosophila induce genetic damage and significantly reduce lifespan. In this study, we report that the movement of P elements in somatic cells also significantly reduces fitness, mating activity, and locomotion of Drosophila melanogaster. If other elements cause similar changes in life history traits, it is doubtful if transposable DNA elements remain active for long in somatic cells in natural populations.

  5. A family of transposable elements co-opted into developmental enhancers in the mouse neocortex.

    Science.gov (United States)

    Notwell, James H; Chung, Tisha; Heavner, Whitney; Bejerano, Gill

    2015-03-25

    The neocortex is a mammalian-specific structure that is responsible for higher functions such as cognition, emotion and perception. To gain insight into its evolution and the gene regulatory codes that pattern it, we studied the overlap of its active developmental enhancers with transposable element (TE) families and compared this overlap to uniformly shuffled enhancers. Here we show a striking enrichment of the MER130 repeat family among active enhancers in the mouse dorsal cerebral wall, which gives rise to the neocortex, at embryonic day 14.5. We show that MER130 instances preserve a common code of transcriptional regulatory logic, function as enhancers and are adjacent to critical neocortical genes. MER130, a nonautonomous interspersed TE, originates in the tetrapod or possibly Sarcopterygii ancestor, which far predates the appearance of the neocortex. Our results show that MER130 elements were recruited, likely through their common regulatory logic, as neocortical enhancers.

  6. Characterization of new hAT transposable elements in 12 Drosophila genomes.

    Science.gov (United States)

    de Freitas Ortiz, Mauro; Loreto, Elgion Lucio Silva

    2009-01-01

    In silico searches for sequences homologous to hAT elements in 12 Drosophila genomes have allowed us to identify 37 new hAT elements (8 in D. ananassae, 11 in D. mojavensis, 2 in D. sechellia, 1 in D. simulans, 2 in D. virilis, 3 in D. yakuba, 3 in D. persimilis, 1 in D. grimshawi, 5 in D. willistoni and 1 in D. pseudobscura). The size of these elements varies from 2,359 to 4,962 bp and the terminal inverted repeats (TIRs) show lengths ranging from 10 to 24 bp. Several elements show intact transposase ORFs, suggesting that they are active. Conserved amino acid motifs were identified that correspond to those important for transposase activity. These elements are highly variable and phylogenetic analysis showed that they can be clustered into four different families. Incongruencies were observed between the phylogenies of the transposable elements and those of their hosts, suggesting that horizontal transfer may have occurred between some of the species.

  7. Transposable element proliferation as a possible side effect of endosymbiont manipulations.

    Science.gov (United States)

    Kraaijeveld, Ken; Bast, Jens

    2012-09-01

    The mode of reproduction has been predicted to affect the proliferation of transposable elements (TEs). A population that switches from sexual to asexual reproduction could either accumulate TEs because purifying selection becomes less efficient, or a decrease in TE load because the opportunity for horizontal transmission is reduced. A third possibility is that the mechanism that induces asexual reproduction affects TE dynamics as a side effect. We propose two such mechanisms that might explain recently described patterns of TE abundance in sexual and asexual lineages of the parasitoid wasp Leptopilina clavipes. Asexual reproduction in this species is induced by endosymbiotic Wolbachia bacteria. In order to achieve parthenogenesis in its host, Wolbachia might remove methylation or interfere with Argonaute proteins. Both methylation and Argonaute proteins are known to control TE activity in other species. By interfering with either, Wolbachia might therefore secondarily hamper the control of specific TEs.

  8. Population and clinical genetics of human transposable elements in the (post) genomic era

    Science.gov (United States)

    Rishishwar, Lavanya; Wang, Lu; Clayton, Evan A.; Mariño-Ramírez, Leonardo; McDonald, John F.; Jordan, I. King

    2017-01-01

    ABSTRACT Recent technological developments—in genomics, bioinformatics and high-throughput experimental techniques—are providing opportunities to study ongoing human transposable element (TE) activity at an unprecedented level of detail. It is now possible to characterize genome-wide collections of TE insertion sites for multiple human individuals, within and between populations, and for a variety of tissue types. Comparison of TE insertion site profiles between individuals captures the germline activity of TEs and reveals insertion site variants that segregate as polymorphisms among human populations, whereas comparison among tissue types ascertains somatic TE activity that generates cellular heterogeneity. In this review, we provide an overview of these new technologies and explore their implications for population and clinical genetic studies of human TEs. We cover both recent published results on human TE insertion activity as well as the prospects for future TE studies related to human evolution and health.

  9. Genetic Innovation in Vertebrates: Gypsy Integrase Genes and Other Genes Derived from Transposable Elements

    Directory of Open Access Journals (Sweden)

    Domitille Chalopin

    2012-01-01

    Full Text Available Due to their ability to drive DNA rearrangements and to serve as a source of new coding and regulatory sequences, transposable elements (TEs are considered as powerful evolutionary agents within genomes. In this paper, we review the mechanism of molecular domestication, which corresponds to the formation of new genes derived from TE sequences. Many genes derived from retroelements and DNA transposons have been identified in mammals and other vertebrates, some of them fulfilling essential functions for the development and survival of their host organisms. We will particularly focus on the evolution and expression of Gypsy integrase (GIN genes, which have been formed from ancient event(s of molecular domestication and have evolved differentially in some vertebrate sublineages. What we describe here is probably only the tip of the evolutionary iceberg, and future genome analyses will certainly uncover new TE-derived genes and biological functions driving genetic innovation in vertebrates and other organisms.

  10. A gene family derived from transposable elements during early angiosperm evolution has reproductive fitness benefits in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Zoé Joly-Lopez

    2012-09-01

    Full Text Available The benefits of ever-growing numbers of sequenced eukaryotic genomes will not be fully realized until we learn to decipher vast stretches of noncoding DNA, largely composed of transposable elements. Transposable elements persist through self-replication, but some genes once encoded by transposable elements have, through a process called molecular domestication, evolved new functions that increase fitness. Although they have conferred numerous adaptations, the number of such domesticated transposable element genes remains unknown, so their evolutionary and functional impact cannot be fully assessed. Systematic searches that exploit genomic signatures of natural selection have been employed to identify potential domesticated genes, but their predictions have yet to be experimentally verified. To this end, we investigated a family of domesticated genes called MUSTANG (MUG, identified in a previous bioinformatic search of plant genomes. We show that MUG genes are functional. Mutants of Arabidopsis thaliana MUG genes yield phenotypes with severely reduced plant fitness through decreased plant size, delayed flowering, abnormal development of floral organs, and markedly reduced fertility. MUG genes are present in all flowering plants, but not in any non-flowering plant lineages, such as gymnosperms, suggesting that the molecular domestication of MUG may have been an integral part of early angiosperm evolution. This study shows that systematic searches can be successful at identifying functional genetic elements in noncoding regions and demonstrates how to combine systematic searches with reverse genetics in a fruitful way to decipher eukaryotic genomes.

  11. The majority of primate-specific regulatory sequences are derived from transposable elements.

    Directory of Open Access Journals (Sweden)

    Pierre-Étienne Jacques

    2013-05-01

    Full Text Available Although emerging evidence suggests that transposable elements (TEs have contributed novel regulatory elements to the human genome, their global impact on transcriptional networks remains largely uncharacterized. Here we show that TEs have contributed to the human genome nearly half of its active elements. Using DNase I hypersensitivity data sets from ENCODE in normal, embryonic, and cancer cells, we found that 44% of open chromatin regions were in TEs and that this proportion reached 63% for primate-specific regions. We also showed that distinct subfamilies of endogenous retroviruses (ERVs contributed significantly more accessible regions than expected by chance, with up to 80% of their instances in open chromatin. Based on these results, we further characterized 2,150 TE subfamily-transcription factor pairs that were bound in vivo or enriched for specific binding motifs, and observed that TEs contributing to open chromatin had higher levels of sequence conservation. We also showed that thousands of ERV-derived sequences were activated in a cell type-specific manner, especially in embryonic and cancer cells, and we demonstrated that this activity was associated with cell type-specific expression of neighboring genes. Taken together, these results demonstrate that TEs, and in particular ERVs, have contributed hundreds of thousands of novel regulatory elements to the primate lineage and reshaped the human transcriptional landscape.

  12. Somatic variegation and germinal mutability reflect the position of transposable element dissociation within the maize R gene

    Energy Technology Data Exchange (ETDEWEB)

    Alleman, M.; Kermicle, J.L. (Univ. of Wisconsin, Madison, WI (United States))

    1993-09-01

    The R gene regulates the timing and tissue-specificity of anthocyanin deposition during maize development. The Ac/Ds system of transposable elements was used to induce insertional mutants of the R-sc:124 allele during two cycles of mutagenesis. Of 43 unstable, spotted-aleurone mutants generated, 42 contain inserts of the Ds6 transposable element differing only in the position and orientation of the element. The remaining mutant, r-sc;ml, contained an insert of a Ds element of the approximate size of the Ds1 transposable element. The patterns of somatic variegation of these mutants, resulting from excision of Ds, define a spectrum of phenotypes ranging from sparse to dense variegation. The sparsely variegated mutants produce many germinal revertants and few stable null derivatives. Molecular analysis shows that the sparsely variegated alleles are caused by Ds6 insertions in protein coding regions of R-sc:124 whereas the densely variegated mutants result from insertions in introns or in flanking regions of the gene. The excision rate of Ds6 from R, estimated as the proportion of R genomic DNA restriction fragments lacking the element, was uniform regardless of position, orientation or whether the element was inserted in R-sc:124 or another R allele. The excision rate was greater, however, for the mutable alleles involving the Ds element from r-sc:m1. These data indicate that, although the excision rates are uniform for a given Ds element, the somatic and germinal mutability patterns of alleles associated with that element vary widely and depend primarily on the position of the transposable element within coding or noncoding regions of the gene.

  13. Ancient Transposable Elements Transformed the Uterine Regulatory Landscape and Transcriptome during the Evolution of Mammalian Pregnancy

    Directory of Open Access Journals (Sweden)

    Vincent J. Lynch

    2015-02-01

    Full Text Available A major challenge in biology is determining how evolutionarily novel characters originate; however, mechanistic explanations for the origin of new characters are almost completely unknown. The evolution of pregnancy is an excellent system in which to study the origin of novelties because mammals preserve stages in the transition from egg laying to live birth. To determine the molecular bases of this transition, we characterized the pregnant/gravid uterine transcriptome from tetrapods to trace the evolutionary history of uterine gene expression. We show that thousands of genes evolved endometrial expression during the origins of mammalian pregnancy, including genes that mediate maternal-fetal communication and immunotolerance. Furthermore, thousands of cis-regulatory elements that mediate decidualization and cell-type identity in decidualized stromal cells are derived from ancient mammalian transposable elements (TEs. Our results indicate that one of the defining mammalian novelties evolved from DNA sequences derived from ancient mammalian TEs co-opted into hormone-responsive regulatory elements distributed throughout the genome.

  14. Mobility of the maize transposable element En/Spm in Arabidopsis thaliana.

    Science.gov (United States)

    Cardon, G H; Frey, M; Saedler, H; Gierl, A

    1993-06-01

    The autonomous element En-1 of the maize En/Spm transposable element system is capable of frequent somatic and germinal excision in the heterologous host Arabidopsis thaliana. The pattern of En-homologous transcripts generated in transgenic Arabidopsis resembles En transcription in maize. An excision reporter construct based on NPT-II gene (pKEn2) can be used reliably for the isolation of En-1 germinal revertants by seed germination on kanamycin-containing medium. Re-insertion after germinal excision is apparently frequent. A dSpm receptor element can be efficiently trans-activated in Arabidopsis either by En-1 or by expressing cDNAs of tnpA and tnpD. Excision and re-insertion of En/Spm take place with similar characteristics as in maize. This is the first description of En/Spm transposition in Arabidopsis and the parameters analysed here suggest that transposon tagging with En should be feasible in this species.

  15. The Origin and Evolution of Six Miniature Inverted-Repeat Transposable Elements in Bombyx mori and Rhodnius prolixus

    OpenAIRE

    Zhang, Hua-Hao; Xu, Hong-En; Shen, Yi-Hong; Han, Min-Jin; Zhang, Ze

    2013-01-01

    Miniature inverted-repeat transposable elements (MITEs) are a specific group of nonautonomous DNA transposons, and they are distributed in a wide range of hosts. However, the origin and evolutionary history of MITEs in eukaryotic genomes remain unclear. In this study, six MITEs were identified in the silkworm (Bombyx mori). Five elements are grouped into four known superfamilies of DNA transposons, and one represents a novel class of MITEs. Unexpectedly, six similar MITEs are also present in ...

  16. Myriad Triple-Helix-Forming Structures in the Transposable Element RNAs of Plants and Fungi

    Directory of Open Access Journals (Sweden)

    Kazimierz T. Tycowski

    2016-05-01

    Full Text Available The ENE (element for nuclear expression is a cis-acting RNA structure that protects viral or cellular noncoding RNAs (ncRNAs from nuclear decay through triple-helix formation with the poly(A tail or 3′-terminal A-rich tract. We expanded the roster of nine known ENEs by bioinformatic identification of ∼200 distinct ENEs that reside in transposable elements (TEs of numerous non-metazoan and one fish species and in four Dicistrovirus genomes. Despite variation within the ENE core, none of the predicted triple-helical stacks exceeds five base triples. Increased accumulation of reporter transcripts in human cells demonstrated functionality for representative ENEs. Location close to the poly(A tail argues that ENEs are active in TE transcripts. Their presence in intronless, but not intron-containing, hAT transposase genes supports the idea that TEs acquired ENEs to counteract the RNA-destabilizing effects of intron loss, a potential evolutionary consequence of TE horizontal transfer in organisms that couple RNA silencing to splicing deficits.

  17. Myriad Triple-Helix-Forming Structures in the Transposable Element RNAs of Plants and Fungi.

    Science.gov (United States)

    Tycowski, Kazimierz T; Shu, Mei-Di; Steitz, Joan A

    2016-05-10

    The ENE (element for nuclear expression) is a cis-acting RNA structure that protects viral or cellular noncoding RNAs (ncRNAs) from nuclear decay through triple-helix formation with the poly(A) tail or 3'-terminal A-rich tract. We expanded the roster of nine known ENEs by bioinformatic identification of ∼200 distinct ENEs that reside in transposable elements (TEs) of numerous non-metazoan and one fish species and in four Dicistrovirus genomes. Despite variation within the ENE core, none of the predicted triple-helical stacks exceeds five base triples. Increased accumulation of reporter transcripts in human cells demonstrated functionality for representative ENEs. Location close to the poly(A) tail argues that ENEs are active in TE transcripts. Their presence in intronless, but not intron-containing, hAT transposase genes supports the idea that TEs acquired ENEs to counteract the RNA-destabilizing effects of intron loss, a potential evolutionary consequence of TE horizontal transfer in organisms that couple RNA silencing to splicing deficits.

  18. Integrated cytogenetics and genomics analysis of transposable elements in the Nile tilapia, Oreochromis niloticus.

    Science.gov (United States)

    Valente, Guilherme; Kocher, Thomas; Eickbush, Thomas; Simões, Rafael P; Martins, Cesar

    2016-06-01

    Integration of cytogenetics and genomics has become essential to a better view of architecture and function of genomes. Although the advances on genomic sequencing have contributed to study genes and genomes, the repetitive DNA fraction of the genome is still enigmatic and poorly understood. Among repeated DNAs, transposable elements (TEs) are major components of eukaryotic chromatin and their investigation has been hindered even after the availability of whole sequenced genomes. The cytogenetic mapping of TEs in chromosomes has proved to be of high value to integrate information from the micro level of nucleotide sequence to a cytological view of chromosomes. Different TEs have been cytogenetically mapped in cichlids; however, neither details about their genomic arrangement nor appropriated copy number are well defined by these approaches. The current study integrates TEs distribution in Nile tilapia Oreochromis niloticus genome based on cytogenetic and genomics/bioinformatics approach. The results showed that some elements are not randomly distributed and that some are genomic dependent on each other. Moreover, we found extensive overlap between genomics and cytogenetics data and that tandem duplication may be the major mechanism responsible for the genomic dynamics of TEs here analyzed. This paper provides insights in the genomic organization of TEs under an integrated view based on cytogenetics and genomics.

  19. Analysis of transposable elements in the genome of Asparagus officinalis from high coverage sequence data.

    Science.gov (United States)

    Li, Shu-Fen; Gao, Wu-Jun; Zhao, Xin-Peng; Dong, Tian-Yu; Deng, Chuan-Liang; Lu, Long-Dou

    2014-01-01

    Asparagus officinalis is an economically and nutritionally important vegetable crop that is widely cultivated and is used as a model dioecious species to study plant sex determination and sex chromosome evolution. To improve our understanding of its genome composition, especially with respect to transposable elements (TEs), which make up the majority of the genome, we performed Illumina HiSeq2000 sequencing of both male and female asparagus genomes followed by bioinformatics analysis. We generated 17 Gb of sequence (12×coverage) and assembled them into 163,406 scaffolds with a total cumulated length of 400 Mbp, which represent about 30% of asparagus genome. Overall, TEs masked about 53% of the A. officinalis assembly. Majority of the identified TEs belonged to LTR retrotransposons, which constitute about 28% of genomic DNA, with Ty1/copia elements being more diverse and accumulated to higher copy numbers than Ty3/gypsy. Compared with LTR retrotransposons, non-LTR retrotransposons and DNA transposons were relatively rare. In addition, comparison of the abundance of the TE groups between male and female genomes showed that the overall TE composition was highly similar, with only slight differences in the abundance of several TE groups, which is consistent with the relatively recent origin of asparagus sex chromosomes. This study greatly improves our knowledge of the repetitive sequence construction of asparagus, which facilitates the identification of TEs responsible for the early evolution of plant sex chromosomes and is helpful for further studies on this dioecious plant.

  20. Spatio-temporal requirements for transposable element piRNA-mediated silencing during Drosophila oogenesis.

    Science.gov (United States)

    Dufourt, Jérémy; Dennis, Cynthia; Boivin, Antoine; Gueguen, Nathalie; Théron, Emmanuelle; Goriaux, Coline; Pouchin, Pierre; Ronsseray, Stéphane; Brasset, Emilie; Vaury, Chantal

    2014-02-01

    During Drosophila oogenesis, transposable element (TE) repression involves the Piwi-interacting RNA (piRNA) pathway which ensures genome integrity for the next generation. We developed a transgenic model to study repression of the Idefix retrotransposon in the germline. Using a candidate gene KD-approach, we identified differences in the spatio-temporal requirements of the piRNA pathway components for piRNA-mediated silencing. Some of them (Aub, Vasa, Spn-E) are necessary in very early stages of oogenesis within the germarium and appear to be less important for efficient TE silencing thereafter. Others (Piwi, Ago3, Mael) are required at all stages of oogenesis. Moreover, during early oogenesis, in the dividing cysts within the germarium, Idefix anti-sense transgenes escape host control, and this is associated with very low piwi expression. Silencing of P-element-based transgenes is also strongly weakened in these cysts. This region, termed the 'Piwiless pocket' or Pilp, may ensure that new TE insertions occur and are transmitted to the next generation, thereby contributing to genome dynamics. In contrast, piRNA-mediated silencing is strong in germline stem cells in which TE mobilization is tightly repressed ensuring the continued production of viable germline cysts.

  1. The genomic proliferation of transposable elements in colonizing populations: Schistosoma mansoni in the new world.

    Science.gov (United States)

    Wijayawardena, Bhagya K; DeWoody, J Andrew; Minchella, Dennis J

    2015-06-01

    Transposable elements (TEs) are mobile genes with an inherent ability to move within and among genomes. Theory predicts that TEs proliferate extensively during physiological stress due to the breakdown of TE repression systems. We tested this hypothesis in Schistosoma mansoni, a widespread trematode parasite that causes the human disease schistosomiasis. According to phylogenetic analysis, S. mansoni invaded the new world during the last 500 years. We hypothesized that new world strains of S. mansoni would have more copies of TEs than old world strains due to the physiological stress associated with invasion of the new world. We quantified the copy number of six TEs (Saci-1, Saci-2 and Saci-3, Perere-1, Merlin-sm1, and SmTRC1) in the genome and the transcriptome of old world and new world strains of S. mansoni, using qPCR relative quantification. As predicted, the genomes of new world parasites contain significantly more copies of class I and class II TEs in both laboratory and field strains. However, such differences are not observed in the transcriptome suggesting that either TE silencing mechanisms have reactivated to control the expression of these elements or the presence of inactive truncated copies of TEs.

  2. An active hAT transposable element causing bud mutation of carnation by insertion into the flavonoid 3'-hydroxylase gene.

    Science.gov (United States)

    Momose, Masaki; Nakayama, Masayoshi; Itoh, Yoshio; Umemoto, Naoyuki; Toguri, Toshihiro; Ozeki, Yoshihiro

    2013-04-01

    The molecular mechanisms underlying spontaneous bud mutations, which provide an important breeding tool in carnation, are poorly understood. Here we describe a new active hAT type transposable element, designated Tdic101, the movement of which caused a bud mutation in carnation that led to a change of flower color from purple to deep pink. The color change was attributed to Tdic101 insertion into the second intron of F3'H, the gene for flavonoid 3'-hydroxylase responsible for purple pigment production. Regions on the deep pink flowers of the mutant can revert to purple, a visible phenotype of, as we show, excision of the transposable element. Sequence analysis revealed that Tdic101 has the characteristics of an autonomous element encoding a transposase. A related, but non-autonomous element dTdic102 was found to move in the genome of the bud mutant as well. Its mobilization might be the result of transposase activities provided by other elements such as Tdic101. In carnation, therefore, the movement of transposable elements plays an important role in the emergence of a bud mutation.

  3. Holliday Junctions Are Associated with Transposable Element Sequences in the Human Genome.

    Science.gov (United States)

    Ladias, Paris; Markopoulos, Georgios; Lazaros, Leandros; Markoula, Sofia; Tzavaras, Theodore; Georgiou, Ioannis

    2016-02-13

    Holliday junctions (HJs) constitute important intermediate structures for many cell functions such as DNA recombination and DNA repair. They derive from a 10-nt degenerate sequence, with a 3-nt core motif. In this study, we explored the human genome whether the HJ degenerate sequence associates with transposable elements (TEs) and mainly with those of the active and inactive ALU, LINE, SVA and HERV families. We identified six different forms of the HJ sequence motif, and we located the genomic coordinates of sequences containing both HJs and TEs. From 2982 total HJs, a significant number of 1319 TE-associated HJs were found, with a median distribution of 1 per 2.4 Mb. The HJs with higher GC content were observed more frequently at the genome. A high percentage of HJs were associated with all main TE families, with specificity for particular active or inactive elements: DNA elements and the retroelements ALUs, LINEs and HERVs up to 41.94%, 72.72%, 42.94% and 84.5%, respectively. Phylogenetic analysis revealed that HJs occur in both active and inactive TEs. Furthermore, the TE-associated HJs were almost exclusively found within a distance less than 1 Mb from human genes, while only 23 were not associated with any genes. This is the first report associating human HJs, with mobile elements. Our data pinpoint that particular HJ forms show preference for specific active retrotransposon families of ALUs and LINEs, suggesting that retrotransposon-incorporated HJs may relocate or replicate in the genome through retrotransposition, contributing to recombination, genome plasticity and DNA repair.

  4. Enhancer/Suppressor mutator (En/Spm)-like transposable elements of cassava (Manihot esculenta) are transcriptionally inactive.

    Science.gov (United States)

    Gbadegesin, M A; Beeching, J R

    2010-04-13

    Transposable elements contribute to the size, structure, variation, and diversity of the genome and have major effects on gene function. Sequencing projects have revealed the diversity of transposable elements in many organisms and have shown that they constitute a high percentage of the genome. PCR-based techniques using degenerate primers designed from conserved enzyme domains of transposable elements can provide quick and extensive surveys, making study of diversity and abundance and their applications possible in species where full genome sequence data are not yet available. We studied cassava (Manihot esculenta) En/Spm-like transposons (Meens) with regard to genomic distribution, sequence diversity and methylation status. Cassava transposase fragments characteristic of En/Spm-like transposons were isolated, cloned and characterized. Sequence analysis showed that cassava En/Spm-like elements are highly conserved, with overall identity in the range of 68-98%. Southern hybridization supports the presence of multiple copies of En/Spm-like transposons integrated in the genome of all cassava cultivars that we tested. Hybridization patterns of HpaII- and MspI-digested cassava genomic DNA revealed highly methylated sequences. There were no clear differences in hybridization pattern between the cultivars. We did not detect RNA transcripts of Meens by Northern procedures. We examined the possibility of recent transposition activities of the cassava En/Spm-like elements.

  5. Identification and characterization of CACTA transposable elements capturing gene fragments in maize

    Institute of Scientific and Technical Information of China (English)

    LI Qing; LI Lin; DAI JingRui; LI JianSheng; YAN JianBing

    2009-01-01

    Transposable elements (TEs)-mediated gene sequence movement is thought to play an important role in genome expansion and origin of genes with novel functions. In this study, a gene, HGGT, involved in vitamin E synthesis was used in a case study to discover and characterize transposons carrying gene fragments in maize. A total of 69 transposons that are distributed across the 10 chromosomes and have an average length of 3689 bp were identified from the maize sequence database by using the BLAST search algorithm. Three of these carry gene fragments from the progenitor HGGT gene, while the rest (66) contain gene fragments from other cellular genes. Nine of the 69 transposons contain fragments derived from two locations in the genome. By querying the maize Expressed Sequence Tag (EST) da-tabase, we found that at least thirteen out of the 69 TEs had corresponding transcripts. More interest-ingly, two transposons that carry gene fragments from two different chromosomal loci could be ex-pressed as chimeric transcripts.

  6. Report of a chimeric origin of transposable elements in a bovine-coding gene.

    Science.gov (United States)

    Almeida, L M; Amaral, M E J; Silva, I T; Silva, W A; Riggs, P K; Carareto, C M

    2008-02-01

    Despite the wide distribution of transposable elements (TEs) in mammalian genomes, part of their evolutionary significance remains to be discovered. Today there is a substantial amount of evidence showing that TEs are involved in the generation of new exons in different species. In the present study, we searched 22,805 genes and reported the occurrence of TE-cassettes in coding sequences of 542 cow genes using the RepeatMasker program. Despite the significant number (542) of genes with TE insertions in exons only 14 (2.6%) of them were translated into protein, which we characterized as chimeric genes. From these chimeric genes, only the FAST kinase domains 3 (FASTKD3) gene, present on chromosome BTA 20, is a functional gene and showed evidence of the exaptation event. The genome sequence analysis showed that the last exon coding sequence of bovine FASTKD3 is approximately 85% similar to the ART2A retrotransposon sequence. In addition, comparison among FASTKD3 proteins shows that the last exon is very divergent from those of Homo sapiens, Pan troglodytes and Canis familiares. We suggest that the gene structure of bovine FASTKD3 gene could have originated by several ectopic recombinations between TE copies. Additionally, the absence of TE sequences in all other species analyzed suggests that the TE insertion is clade-specific, mainly in the ruminant lineage.

  7. Transposable element insertions in long intergenic non-coding RNA genes

    Directory of Open Access Journals (Sweden)

    Sivakumar eKannan

    2015-06-01

    Full Text Available Transposable elements (TE are abundant in mammalian genomes and appear to have contributed to the evolution of their hosts by providing novel regulatory or coding sequences. We analyzed different regions of long intergenic non-coding RNA (lincRNA genes in human and mouse genomes to systematically assess the potential contribution of TEs to the evolution of the structure and regulation of expression of lincRNA genes. Introns of lincRNA genes contain the highest percentage of TE-derived sequences, followed by exons and then promoter regions although the density of TEs is not significantly different between exons and promoters. Higher frequencies of ancient TEs in promoters and exons compared to introns implies that many lincRNA genes emerged before the split of primates and rodents. The content of TE-derived sequences in lincRNA genes is substantially higher than that in protein-coding genes, especially in exons and promoter regions. A significant positive correlation was detected between the content of TEs and evolutionary rate of lincRNAs indicating that inserted TEs are preferentially fixed in fast-evolving lincRNA genes. These results are consistent with the RIDL (Repeat Insertion Domains of LncRNAs hypothesis under which TEs have substantially contributed to the origin, evolution, and in particular functional diversification, of lincRNA genes.

  8. Human population-specific gene expression and transcriptional network modification with polymorphic transposable elements.

    Science.gov (United States)

    Wang, Lu; Rishishwar, Lavanya; Mariño-Ramírez, Leonardo; Jordan, I King

    2016-12-19

    Transposable element (TE) derived sequences are known to contribute to the regulation of the human genome. The majority of known TE-derived regulatory sequences correspond to relatively ancient insertions, which are fixed across human populations. The extent to which human genetic variation caused by recent TE activity leads to regulatory polymorphisms among populations has yet to be thoroughly explored. In this study, we searched for associations between polymorphic TE (polyTE) loci and human gene expression levels using an expression quantitative trait loci (eQTL) approach. We compared locus-specific polyTE insertion genotypes to B cell gene expression levels among 445 individuals from 5 human populations. Numerous human polyTE loci correspond to both cis and trans eQTL, and their regulatory effects are directly related to cell type-specific function in the immune system. PolyTE loci are associated with differences in expression between European and African population groups, and a single polyTE loci is indirectly associated with the expression of numerous genes via the regulation of the B cell-specific transcription factor PAX5 The polyTE-gene expression associations we found indicate that human TE genetic variation can have important phenotypic consequences. Our results reveal that TE-eQTL are involved in population-specific gene regulation as well as transcriptional network modification.

  9. Transduplication resulted in the incorporation of two protein-coding sequences into the Turmoil-1 transposable element of C. elegans

    Directory of Open Access Journals (Sweden)

    Pupko Tal

    2008-10-01

    Full Text Available Abstract Transposable elements may acquire unrelated gene fragments into their sequences in a process called transduplication. Transduplication of protein-coding genes is common in plants, but is unknown of in animals. Here, we report that the Turmoil-1 transposable element in C. elegans has incorporated two protein-coding sequences into its inverted terminal repeat (ITR sequences. The ITRs of Turmoil-1 contain a conserved RNA recognition motif (RRM that originated from the rsp-2 gene and a fragment from the protein-coding region of the cpg-3 gene. We further report that an open reading frame specific to C. elegans may have been created as a result of a Turmoil-1 insertion. Mutations at the 5' splice site of this open reading frame may have reactivated the transduplicated RRM motif. Reviewers This article was reviewed by Dan Graur and William Martin. For the full reviews, please go to the Reviewers' Reports section.

  10. Annotation and sequence diversity of transposable elements in common bean (Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    Scott eJackson

    2014-07-01

    Full Text Available Common bean (Phaseolus vulgaris is an important legume crop grown and consumed worldwide. With the availability of the common bean genome sequence, the next challenge is to annotate the genome and characterize functional DNA elements. Transposable elements (TEs are the most abundant component of plant genomes and can dramatically affect genome evolution and genetic variation. Thus, it is pivotal to identify TEs in the common bean genome. In this study, we performed a genome-wide transposon annotation in common bean using a combination of homology and sequence structure-based methods. We developed a 2.12-Mb transposon database which includes 791 representative transposon sequences and is available upon request or from www.phytozome.org. Of note, nearly all transposons in the database are previously unrecognized TEs. More than 5,000 transposon-related expressed sequence tags (ESTs were detected which indicates that some transposons may be transcriptionally active. Two Ty1-copia retrotransposon families were found to encode the envelope-like protein which has rarely been identified in plant genomes. Also, we identified an extra open reading frame (ORF termed ORF2 from 15 Ty3-gypsy families that was located between the ORF encoding the retrotransposase and the 3’LTR. The ORF2 was in opposite transcriptional orientation to retrotransposase. Sequence homology searches and phylogenetic analysis suggested that the ORF2 may have an ancient origin, but its function is not clear. This transposon data provides a useful resource for understanding the genome organization and evolution and may be used to identify active TEs for developing transposon-tagging system in common bean and other related genomes.

  11. Comparative analysis of transposable elements highlights mobilome diversity and evolution in vertebrates.

    Science.gov (United States)

    Chalopin, Domitille; Naville, Magali; Plard, Floriane; Galiana, Delphine; Volff, Jean-Nicolas

    2015-01-09

    Transposable elements (TEs) are major components of vertebrate genomes, with major roles in genome architecture and evolution. In order to characterize both common patterns and lineage-specific differences in TE content and TE evolution, we have compared the mobilomes of 23 vertebrate genomes, including 10 actinopterygian fish, 11 sarcopterygians, and 2 nonbony vertebrates. We found important variations in TE content (from 6% in the pufferfish tetraodon to 55% in zebrafish), with a more important relative contribution of TEs to genome size in fish than in mammals. Some TE superfamilies were found to be widespread in vertebrates, but most elements showed a more patchy distribution, indicative of multiple events of loss or gain. Interestingly, loss of major TE families was observed during the evolution of the sarcopterygian lineage, with a particularly strong reduction in TE diversity in birds and mammals. Phylogenetic trends in TE composition and activity were detected: Teleost fish genomes are dominated by DNA transposons and contain few ancient TE copies, while mammalian genomes have been predominantly shaped by nonlong terminal repeat retrotransposons, along with the persistence of older sequences. Differences were also found within lineages: The medaka fish genome underwent more recent TE amplification than the related platyfish, as observed for LINE retrotransposons in the mouse compared with the human genome. This study allows the identification of putative cases of horizontal transfer of TEs, and to tentatively infer the composition of the ancestral vertebrate mobilome. Taken together, the results obtained highlight the importance of TEs in the structure and evolution of vertebrate genomes, and demonstrate their major impact on genome diversity both between and within lineages.

  12. TEnest: automated chronological annotation and visualization of nested plant transposable elements.

    Science.gov (United States)

    Kronmiller, Brent A; Wise, Roger P

    2008-01-01

    Organisms with a high density of transposable elements (TEs) exhibit nesting, with subsequent repeats found inside previously inserted elements. Nesting splits the sequence structure of TEs and makes annotation of repetitive areas challenging. We present TEnest, a repeat identification and display tool made specifically for highly repetitive genomes. TEnest identifies repetitive sequences and reconstructs separated sections to provide full-length repeats and, for long-terminal repeat (LTR) retrotransposons, calculates age since insertion based on LTR divergence. TEnest provides a chronological insertion display to give an accurate visual representation of TE integration history showing timeline, location, and families of each TE identified, thus creating a framework from which evolutionary comparisons can be made among various regions of the genome. A database of repeats has been developed for maize (Zea mays), rice (Oryza sativa), wheat (Triticum aestivum), and barley (Hordeum vulgare) to illustrate the potential of TEnest software. All currently finished maize bacterial artificial chromosomes totaling 29.3 Mb were analyzed with TEnest to provide a characterization of the repeat insertions. Sixty-seven percent of the maize genome was found to be made up of TEs; of these, 95% are LTR retrotransposons. The rate of solo LTR formation is shown to be dissimilar across retrotransposon families. Phylogenetic analysis of TE families reveals specific events of extreme TE proliferation, which may explain the high quantities of certain TE families found throughout the maize genome. The TEnest software package is available for use on PlantGDB under the tools section (http://www.plantgdb.org/prj/TE_nest/TE_nest.html); the source code is available from (http://wiselab.org).

  13. Transcriptional rewiring of the sex determining dmrt1 gene duplicate by transposable elements.

    Directory of Open Access Journals (Sweden)

    Amaury Herpin

    2010-02-01

    Full Text Available Control and coordination of eukaryotic gene expression rely on transcriptional and posttranscriptional regulatory networks. Evolutionary innovations and adaptations often require rapid changes of such networks. It has long been hypothesized that transposable elements (TE might contribute to the rewiring of regulatory interactions. More recently it emerged that TEs might bring in ready-to-use transcription factor binding sites to create alterations to the promoters by which they were captured. A process where the gene regulatory architecture is of remarkable plasticity is sex determination. While the more downstream components of the sex determination cascades are evolutionary conserved, the master regulators can switch between groups of organisms even on the interspecies level or between populations. In the medaka fish (Oryzias latipes a duplicated copy of dmrt1, designated dmrt1bY or DMY, on the Y chromosome was shown to be the master regulator of male development, similar to Sry in mammals. We found that the dmrt1bY gene has acquired a new feedback downregulation of its expression. Additionally, the autosomal dmrt1a gene is also able to regulate transcription of its duplicated paralog by binding to a unique target Dmrt1 site nested within the dmrt1bY proximal promoter region. We could trace back this novel regulatory element to a highly conserved sequence within a new type of TE that inserted into the upstream region of dmrt1bY shortly after the duplication event. Our data provide functional evidence for a role of TEs in transcriptional network rewiring for sub- and/or neo-functionalization of duplicated genes. In the particular case of dmrt1bY, this contributed to create new hierarchies of sex-determining genes.

  14. Satellite DNA and Transposable Elements in Seabuckthorn (Hippophae rhamnoides), a Dioecious Plant with Small Y and Large X Chromosomes

    Science.gov (United States)

    Puterova, Janka; Razumova, Olga; Martinek, Tomas; Alexandrov, Oleg; Divashuk, Mikhail; Kubat, Zdenek; Hobza, Roman; Karlov, Gennady

    2017-01-01

    Seabuckthorn (Hippophae rhamnoides) is a dioecious shrub commonly used in the pharmaceutical, cosmetic, and environmental industry as a source of oil, minerals and vitamins. In this study, we analyzed the transposable elements and satellites in its genome. We carried out Illumina DNA sequencing and reconstructed the main repetitive DNA sequences. For data analysis, we developed a new bioinformatics approach for advanced satellite DNA analysis and showed that about 25% of the genome consists of satellite DNA and about 24% is formed of transposable elements, dominated by Ty3/Gypsy and Ty1/Copia LTR retrotransposons. FISH mapping revealed X chromosome-accumulated, Y chromosome-specific or both sex chromosomes-accumulated satellites but most satellites were found on autosomes. Transposable elements were located mostly in the subtelomeres of all chromosomes. The 5S rDNA and 45S rDNA were localized on one autosomal locus each. Although we demonstrated the small size of the Y chromosome of the seabuckthorn and accumulated satellite DNA there, we were unable to estimate the age and extent of the Y chromosome degeneration. Analysis of dioecious relatives such as Shepherdia would shed more light on the evolution of these sex chromosomes. PMID:28057732

  15. Genetic Drift, Not Life History or RNAi, Determine Long-Term Evolution of Transposable Elements.

    Science.gov (United States)

    Szitenberg, Amir; Cha, Soyeon; Opperman, Charles H; Bird, David M; Blaxter, Mark L; Lunt, David H

    2016-10-05

    Transposable elements (TEs) are a major source of genome variation across the branches of life. Although TEs may play an adaptive role in their host's genome, they are more often deleterious, and purifying selection is an important factor controlling their genomic loads. In contrast, life history, mating system, GC content, and RNAi pathways have been suggested to account for the disparity of TE loads in different species. Previous studies of fungal, plant, and animal genomes have reported conflicting results regarding the direction in which these genomic features drive TE evolution. Many of these studies have had limited power, however, because they studied taxonomically narrow systems, comparing only a limited number of phylogenetically independent contrasts, and did not address long-term effects on TE evolution. Here, we test the long-term determinants of TE evolution by comparing 42 nematode genomes spanning over 500 million years of diversification. This analysis includes numerous transitions between life history states, and RNAi pathways, and evaluates if these forces are sufficiently persistent to affect the long-term evolution of TE loads in eukaryotic genomes. Although we demonstrate statistical power to detect selection, we find no evidence that variation in these factors influence genomic TE loads across extended periods of time. In contrast, the effects of genetic drift appear to persist and control TE variation among species. We suggest that variation in the tested factors are largely inconsequential to the large differences in TE content observed between genomes, and only by these large-scale comparisons can we distinguish long-term and persistent effects from transient or random changes.

  16. Scanning of transposable elements and analyzing expression of transposase genes of sweet potato [Ipomoea batatas].

    Directory of Open Access Journals (Sweden)

    Lang Yan

    Full Text Available BACKGROUND: Transposable elements (TEs are the most abundant genomic components in eukaryotes and affect the genome by their replications and movements to generate genetic plasticity. Sweet potato performs asexual reproduction generally and the TEs may be an important genetic factor for genome reorganization. Complete identification of TEs is essential for the study of genome evolution. However, the TEs of sweet potato are still poorly understood because of its complex hexaploid genome and difficulty in genome sequencing. The recent availability of the sweet potato transcriptome databases provides an opportunity for discovering and characterizing the expressed TEs. METHODOLOGY/PRINCIPAL FINDINGS: We first established the integrated-transcriptome database by de novo assembling four published sweet potato transcriptome databases from three cultivars in China. Using sequence-similarity search and analysis, a total of 1,405 TEs including 883 retrotransposons and 522 DNA transposons were predicted and categorized. Depending on mapping sets of RNA-Seq raw short reads to the predicted TEs, we compared the quantities, classifications and expression activities of TEs inter- and intra-cultivars. Moreover, the differential expressions of TEs in seven tissues of Xushu 18 cultivar were analyzed by using Illumina digital gene expression (DGE tag profiling. It was found that 417 TEs were expressed in one or more tissues and 107 in all seven tissues. Furthermore, the copy number of 11 transposase genes was determined to be 1-3 copies in the genome of sweet potato by Real-time PCR-based absolute quantification. CONCLUSIONS/SIGNIFICANCE: Our result provides a new method for TE searching on species with transcriptome sequences while lacking genome information. The searching, identification and expression analysis of TEs will provide useful TE information in sweet potato, which are valuable for the further studies of TE-mediated gene mutation and optimization in

  17. A transposable element insertion in APOB causes cholesterol deficiency in Holstein cattle.

    Science.gov (United States)

    Menzi, F; Besuchet-Schmutz, N; Fragnière, M; Hofstetter, S; Jagannathan, V; Mock, T; Raemy, A; Studer, E; Mehinagic, K; Regenscheit, N; Meylan, M; Schmitz-Hsu, F; Drögemüller, C

    2016-04-01

    Cholesterol deficiency, a new autosomal recessive inherited genetic defect in Holstein cattle, has been recently reported to have an influence on the rearing success of calves. The affected animals show unresponsive diarrhea accompanied by hypocholesterolemia and usually die within the first weeks or months of life. Here, we show that whole genome sequencing combined with the knowledge about the pedigree and inbreeding status of a livestock population facilitates the identification of the causative mutation. We resequenced the entire genomes of an affected calf and a healthy partially inbred male carrying one copy of the critical 2.24-Mb chromosome 11 segment in its ancestral state and one copy of the same segment with the cholesterol deficiency mutation. We detected a single structural variant, homozygous in the affected case and heterozygous in the non-affected carrier male. The genetic makeup of this key animal provides extremely strong support for the causality of this mutation. The mutation represents a 1.3kb insertion of a transposable LTR element (ERV2-1) in the coding sequence of the APOB gene, which leads to truncated transcripts and aberrant splicing. This finding was further supported by RNA sequencing of the liver transcriptome of an affected calf. The encoded apolipoprotein B is an essential apolipoprotein on chylomicrons and low-density lipoproteins, and therefore, the mutation represents a loss of function mutation similar to autosomal recessive inherited familial hypobetalipoproteinemia-1 (FHBL1) in humans. Our findings provide a direct gene test to improve selection against this deleterious mutation in Holstein cattle.

  18. Transposable elements are major contributors to the origin, diversification, and regulation of vertebrate long noncoding RNAs.

    Directory of Open Access Journals (Sweden)

    Aurélie Kapusta

    2013-04-01

    Full Text Available Advances in vertebrate genomics have uncovered thousands of loci encoding long noncoding RNAs (lncRNAs. While progress has been made in elucidating the regulatory functions of lncRNAs, little is known about their origins and evolution. Here we explore the contribution of transposable elements (TEs to the makeup and regulation of lncRNAs in human, mouse, and zebrafish. Surprisingly, TEs occur in more than two thirds of mature lncRNA transcripts and account for a substantial portion of total lncRNA sequence (~30% in human, whereas they seldom occur in protein-coding transcripts. While TEs contribute less to lncRNA exons than expected, several TE families are strongly enriched in lncRNAs. There is also substantial interspecific variation in the coverage and types of TEs embedded in lncRNAs, partially reflecting differences in the TE landscapes of the genomes surveyed. In human, TE sequences in lncRNAs evolve under greater evolutionary constraint than their non-TE sequences, than their intronic TEs, or than random DNA. Consistent with functional constraint, we found that TEs contribute signals essential for the biogenesis of many lncRNAs, including ~30,000 unique sites for transcription initiation, splicing, or polyadenylation in human. In addition, we identified ~35,000 TEs marked as open chromatin located within 10 kb upstream of lncRNA genes. The density of these marks in one cell type correlate with elevated expression of the downstream lncRNA in the same cell type, suggesting that these TEs contribute to cis-regulation. These global trends are recapitulated in several lncRNAs with established functions. Finally a subset of TEs embedded in lncRNAs are subject to RNA editing and predicted to form secondary structures likely important for function. In conclusion, TEs are nearly ubiquitous in lncRNAs and have played an important role in the lineage-specific diversification of vertebrate lncRNA repertoires.

  19. MicroRNA-Dependent Transcriptional Silencing of Transposable Elements in Drosophila Follicle Cells.

    Science.gov (United States)

    Mugat, Bruno; Akkouche, Abdou; Serrano, Vincent; Armenise, Claudia; Li, Blaise; Brun, Christine; Fulga, Tudor A; Van Vactor, David; Pélisson, Alain; Chambeyron, Séverine

    2015-05-01

    RNA interference-related silencing mechanisms concern very diverse and distinct biological processes, from gene regulation (via the microRNA pathway) to defense against molecular parasites (through the small interfering RNA and the Piwi-interacting RNA pathways). Small non-coding RNAs serve as specificity factors that guide effector proteins to ribonucleic acid targets via base-pairing interactions, to achieve transcriptional or post-transcriptional regulation. Because of the small sequence complementarity required for microRNA-dependent post-transcriptional regulation, thousands of microRNA (miRNA) putative targets have been annotated in Drosophila. In Drosophila somatic ovarian cells, genomic parasites, such as transposable elements (TEs), are transcriptionally repressed by chromatin changes induced by Piwi-interacting RNAs (piRNAs) that prevent them from invading the germinal genome. Here we show, for the first time, that a functional miRNA pathway is required for the piRNA-mediated transcriptional silencing of TEs in this tissue. Global miRNA depletion, caused by tissue- and stage-specific knock down of drosha (involved in miRNA biogenesis), AGO1 or gawky (both responsible for miRNA activity), resulted in loss of TE-derived piRNAs and chromatin-mediated transcriptional de-silencing of TEs. This specific TE de-repression was also observed upon individual titration (by expression of the complementary miRNA sponge) of two miRNAs (miR-14 and miR-34) as well as in a miR-14 loss-of-function mutant background. Interestingly, the miRNA defects differentially affected TE- and 3' UTR-derived piRNAs. To our knowledge, this is the first indication of possible differences in the biogenesis or stability of TE- and 3' UTR-derived piRNAs. This work is one of the examples of detectable phenotypes caused by loss of individual miRNAs in Drosophila and the first genetic evidence that miRNAs have a role in the maintenance of genome stability via piRNA-mediated TE repression.

  20. Stem loop sequences specific to transposable element IS605 are found linked to lipoprotein genes in Borrelia plasmids.

    Directory of Open Access Journals (Sweden)

    Nicholas Delihas

    Full Text Available BACKGROUND: Plasmids of Borrelia species are dynamic structures that contain a large number of repetitive genes, gene fragments, and gene fusions. In addition, the transposable element IS605/200 family, as well as degenerate forms of this IS element, are prevalent. In Helicobacter pylori, flanking regions of the IS605 transposase gene contain sequences that fold into identical small stem loops. These function in transposition at the single-stranded DNA level. METHODOLOGY/PRINCIPAL FINDINGS: In work reported here, bioinformatics techniques were used to scan Borrelia plasmid genomes for IS605 transposable element specific stem loop sequences. Two variant stem loop motifs are found in the left and right flanking regions of the transposase gene. Both motifs appear to have dispersed in plasmid genomes and are found "free-standing" and phylogenetically conserved without the associated IS605 transposase gene or the adjacent flanking sequence. Importantly, IS605 specific stem loop sequences are also found at the 3' ends of lipoprotein genes (PFam12 and PFam60, however the left and right sequences appear to develop their own evolutionary patterns. The lipoprotein gene-linked left stem loop sequences maintain the IS605 stem loop motif in orthologs but only at the RNA level. These show mutations whereby variants fold into phylogenetically conserved RNA-type stem loops that contain the wobble non-Watson-Crick G-U base-pairing. The right flanking sequence is associated with the family lipoprotein-1 genes. A comparison of homologs shows that the IS605 stem loop motif rapidly dissipates, but a more elaborate secondary structure appears to develop in its place. CONCLUSIONS/SIGNIFICANCE: Stem loop sequences specific to the transposable element IS605 are present in plasmid regions devoid of a transposase gene and significantly, are found linked to lipoprotein genes in Borrelia plasmids. These sequences are evolutionarily conserved and/or structurally developed in

  1. Losing identity: structural diversity of transposable elements belonging to different classes in the genome of Anopheles gambiae

    Directory of Open Access Journals (Sweden)

    Fernández-Medina Rita D

    2012-06-01

    Full Text Available Abstract Background Transposable elements (TEs, both DNA transposons and retrotransposons, are genetic elements with the main characteristic of being able to mobilize and amplify their own representation within genomes, utilizing different mechanisms of transposition. An almost universal feature of TEs in eukaryotic genomes is their inability to transpose by themselves, mainly as the result of sequence degeneration (by either mutations or deletions. Most of the elements are thus either inactive or non-autonomous. Considering that the bulk of some eukaryotic genomes derive from TEs, they have been conceived as “TE graveyards.” It has been shown that once an element has been inactivated, it progressively accumulates mutations and deletions at neutral rates until completely losing its identity or being lost from the host genome; however, it has also been shown that these “neutral sequences” might serve as raw material for domestication by host genomes. Results We have analyzed the sequence structural variations, nucleotide divergence, and pattern of insertions and deletions of several superfamilies of TEs belonging to both class I (long terminal repeats [LTRs] and non-LTRs [NLTRs] and II in the genome of Anopheles gambiae, aiming at describing the landscape of deterioration of these elements in this particular genome. Our results describe a great diversity in patterns of deterioration, indicating lineage-specific differences including the presence of Solo-LTRs in the LTR lineage, 5′-deleted NLTRs, and several non-autonomous and MITEs in the class II families. Interestingly, we found fragments of NLTRs corresponding to the RT domain, which preserves high identity among them, suggesting a possible remaining genomic role for these domains. Conclusions We show here that the TEs in the An. gambiae genome deteriorate in different ways according to the class to which they belong. This diversity certainly has implications not only at the host

  2. Spontaneous germline excision of Tol1, a DNA-based transposable element naturally occurring in the medaka fish genome.

    Science.gov (United States)

    Watanabe, Kohei; Koga, Hajime; Nakamura, Kodai; Fujita, Akiko; Hattori, Akimasa; Matsuda, Masaru; Koga, Akihiko

    2014-04-01

    DNA-based transposable elements are ubiquitous constituents of eukaryotic genomes. Vertebrates are, however, exceptional in that most of their DNA-based elements appear to be inactivated. The Tol1 element of the medaka fish, Oryzias latipes, is one of the few elements for which copies containing an undamaged gene have been found. Spontaneous transposition of this element in somatic cells has previously been demonstrated, but there is only indirect evidence for its germline transposition. Here, we show direct evidence of spontaneous excision in the germline. Tyrosinase is the key enzyme in melanin biosynthesis. In an albino laboratory strain of medaka fish, which is homozygous for a mutant tyrosinase gene in which a Tol1 copy is inserted, we identified de novo reversion mutations related to melanin pigmentation. The gamete-based reversion rate was as high as 0.4%. The revertant fish carried the tyrosinase gene from which the Tol1 copy had been excised. We previously reported the germline transposition of Tol2, another DNA-based element that is thought to be a recent invader of the medaka fish genome. Tol1 is an ancient resident of the genome. Our results indicate that even an old element can contribute to genetic variation in the host genome as a natural mutator.

  3. Heavy-ion radiation induces both activation of multiple endogenous transposable elements and alterations in DNA methylation in rice

    Science.gov (United States)

    Zhang, Meng; Sun, Yeqing; Li, Xishan; Xiaolin, Cui; Li, Xiang

    2012-07-01

    Space radiation represents a complex environmental condition in which several interacting factors such as electron, neutron, proton, heavy-ion are involved, which may provoke stress responses and jeopardize genome integrity. Given the inherent property of epigenetic modifications to respond to intrinsic aswell as external perturbations, it is conceivable that epigenetic markers like DNA methylation and transposition may undergo alterations in response to space radiation. Cytosine DNA methylation plays important roles in maintaining genome stability and controlling gene expression. A predominant means for Transposable elements (TEs) to cause genetic instability is via their transpositional activation. To find the detailed molecular characterization of the nature of genomic changes induced by space radiation, the seeds of rice were exposed to 0.02, 0.2, 1, 2 and 20 Gy dose of ^{12}C heavy-ion radiation, respectively. We found that extensive alteration in both DNA methylation and gene expression occurred in rice plants after different dose of heavy-ion radiation. Here we shown that heavy-ion radiation has induced transposition of mPing and Tos17 in rice, which belong to distinct classes including the miniature inverted terminal repeat TEs (MITEs) and long-terminal repeat (LTR) retrotransposons, respectively. mPing and Tos17 mobility were found to correlate with cytosine methylation alteration detected by MSAP and genetic variation detected by AFLP. The result showed that at least in some cases transposition of TEs was associated with cytosine demethylation within the elements. Our results implicate that the heavy-ion radiation represents a potent mutagenic agent that can cause genomic instabilities by eliciting transposition of endogenous TEs in rice. Keywords: Heavy-ion radiation, DNA methylation, Transposable elements, mPing, Tos17

  4. Genotype-dependent Burst of Transposable Element Expression in Crowns of Hexaploid Wheat (Triticum aestivum L. during Cold Acclimation

    Directory of Open Access Journals (Sweden)

    Debbie Laudencia-Chingcuanco

    2012-01-01

    Full Text Available The expression of 1,613 transposable elements (TEs represented in the Affymetrix Wheat Genome Chip was examined during cold treatment in crowns of four hexaploid wheat genotypes that vary in tolerance to cold and in flowering time. The TE expression profiles showed a constant level of expression throughout the experiment in three of the genotypes. In winter Norstar, the most cold-hardy of the four genotypes, a subset of the TEs showed a burst of expression after vernalization saturation was achieved. About 47% of the TEs were expressed, and both Class I (retrotransposons and Class II (DNA transposons types were well represented. Gypsy and Copia were the most represented among the retrotransposons while CACTA and Mariner were the most represented DNA transposons. The data suggests that the Vrn-A1 region plays a role in the stage-specific induction of TE expression in this genotype.

  5. Illumina TruSeq synthetic long-reads empower de novo assembly and resolve complex, highly-repetitive transposable elements.

    Science.gov (United States)

    McCoy, Rajiv C; Taylor, Ryan W; Blauwkamp, Timothy A; Kelley, Joanna L; Kertesz, Michael; Pushkarev, Dmitry; Petrov, Dmitri A; Fiston-Lavier, Anna-Sophie

    2014-01-01

    High-throughput DNA sequencing technologies have revolutionized genomic analysis, including the de novo assembly of whole genomes. Nevertheless, assembly of complex genomes remains challenging, in part due to the presence of dispersed repeats which introduce ambiguity during genome reconstruction. Transposable elements (TEs) can be particularly problematic, especially for TE families exhibiting high sequence identity, high copy number, or complex genomic arrangements. While TEs strongly affect genome function and evolution, most current de novo assembly approaches cannot resolve long, identical, and abundant families of TEs. Here, we applied a novel Illumina technology called TruSeq synthetic long-reads, which are generated through highly-parallel library preparation and local assembly of short read data and which achieve lengths of 1.5-18.5 Kbp with an extremely low error rate ([Formula: see text]0.03% per base). To test the utility of this technology, we sequenced and assembled the genome of the model organism Drosophila melanogaster (reference genome strain y; cn, bw, sp) achieving an N50 contig size of 69.7 Kbp and covering 96.9% of the euchromatic chromosome arms of the current reference genome. TruSeq synthetic long-read technology enables placement of individual TE copies in their proper genomic locations as well as accurate reconstruction of TE sequences. We entirely recovered and accurately placed 4,229 (77.8%) of the 5,434 annotated transposable elements with perfect identity to the current reference genome. As TEs are ubiquitous features of genomes of many species, TruSeq synthetic long-reads, and likely other methods that generate long-reads, offer a powerful approach to improve de novo assemblies of whole genomes.

  6. Heterochromatin and molecular characterization of DsmarMITE transposable element in the beetle Dichotomius schiffleri (Coleoptera: Scarabaeidae).

    Science.gov (United States)

    Xavier, Crislaine; Cabral-de-Mello, Diogo Cavalcanti; de Moura, Rita Cássia

    2014-12-01

    Cytogenetic studies of the Neotropical beetle genus Dichotomius (Scarabaeinae, Coleoptera) have shown dynamism for centromeric constitutive heterochromatin sequences. In the present work we studied the chromosomes and isolated repetitive sequences of Dichotomius schiffleri aiming to contribute to the understanding of coleopteran genome/chromosomal organization. Dichotomius schiffleri presented a conserved karyotype and heterochromatin distribution in comparison to other species of the genus with 2n = 18, biarmed chromosomes, and pericentromeric C-positive blocks. Similarly to heterochromatin distributional patterns, the highly and moderately repetitive DNA fraction (C 0 t-1 DNA) was detected in pericentromeric areas, contrasting with the euchromatic mapping of an isolated TE (named DsmarMITE). After structural analyses, the DsmarMITE was classified as a non-autonomous element of the type miniature inverted-repeat transposable element (MITE) with terminal inverted repeats similar to Mariner elements of insects from different orders. The euchromatic distribution for DsmarMITE indicates that it does not play a part in the dynamics of constitutive heterochromatin sequences.

  7. Characterization of transcriptional activation and inserted-into-gene preference of various transposable elements in the Brassica species.

    Science.gov (United States)

    Gao, Caihua; Xiao, Meili; Jiang, Lingyan; Li, Jiana; Yin, Jiaming; Ren, Xiaodong; Qian, Wei; Oscar, Ortegón; Fu, Donghui; Tang, Zhanglin

    2012-07-01

    Transposable elements (TEs) have attracted increasing attention because of their tremendous contributions to genome reorganization and gene variation through dramatic proliferation and excision via transposition. However, less known are the transcriptional activation of various TEs and the characteristics of TE insertion into genomes at the genome-wide level. In the present study, we focused on TE genes for transposition and gene disruption by insertion of TEs in expression sequences of Brassica, to investigate the transcriptional activation of TEs, the biased insertion of TEs into genes, and their salient characteristics. Long terminal repeat (LTR-retrotransposon) accounted for the majority of these active TE genes (70.8%), suggesting that transposition activation varied with TE type. 6.1% genes were interrupted by LTR-retrotransposons, which indicated their preference for insertion into genes. TEs were preferentially inserted into cellular component-specific genes acted as "binding" elements and involved in metabolic processes. TEs have a biased insertion into some host genes that were involved with important molecular functions and TE genes exhibited spatiotemporal expression. These results suggested that various types of transposons differentially contributed to gene variation and affected gene function.

  8. Trans-activation of an artificial dTam3 transposable element in transgenic tobacco plants

    NARCIS (Netherlands)

    Haring, Michel A.; Teeuwen-de Vroomen, Marianne J.; Nijkamp, H. John J.; Hille, Jacques

    1991-01-01

    In Antirrhinum majus only autonomous Tam3 transposons have been characterized. We investigated whether an artificial dTam3 element, with a deletion in the presumptive transposase coding region, can be trans-activated in tobacco by an activator Tam3 element, which was immobilized by the deletion of o

  9. Post-integration silencing of piggyBac transposable elements in Aedes aegypti.

    Directory of Open Access Journals (Sweden)

    Azhahianambi Palavesam

    Full Text Available The piggyBac transposon, originating in the genome of the Lepidoptera Trichoplusia ni, has a broad host range, making it useful for the development of a number of transposon-based functional genomic technologies including gene vectors, enhancer-, gene- and protein-traps. While capable of being used as a vector for the creation of transgenic insects and insect cell lines, piggyBac has very limited mobility once integrated into the genome of the yellow fever mosquito, Aedes aegypti. A transgenic Aedes aegypti cell line (AagPB8 was created containing three integrated piggyBac elements and the remobilization potential of the elements was tested. The integrated piggyBac elements in AagPB8 were transpositionally silent in the presence of functional transposase, which was shown to be capable of catalyzing the movement of plasmid-borne piggyBac elements in the same cells. The structural integrity of one of the integrated elements along with the quality of element-flanking DNA, which is known to influence transposition rates, were tested in D. melanogaster. The element was found to be structurally intact, capable of transposition and excision in the soma and germ-line of Drosophila melanogaster, and in a DNA sequence context highly conducive to element movement in Drosophila melanogaster. These data show that transpositional silencing of integrated piggyBac elements in the genome of Aedes aegypti appears to be a function of higher scale genome organization or perhaps epigenetic factors, and not due to structural defects or suboptimal integration sites.

  10. Transposable elements P and gypsy in natural populations of Drosophila willistoni

    Directory of Open Access Journals (Sweden)

    Adriana Koslovski Sassi

    2005-12-01

    Full Text Available The presence and integrity of the P transposon and the gypsy retrotransposon in the genome of 18 samples of natural Drosophila willistoni populations collected from a large area of South America were Southern blot screened using Drosophila melanogaster probes. The aim of this screening was provide further knowledge-base on the geographical distribution of D. willistoni and to carry out an inter-population analysis of the P and gypsy elements present in the genomes of the populations analyzed. The fragment patterns obtained indicate that both the P and gypsy elements are ancient in the D. willistoni genome, but whereas the gypsy retroelement appears to be invariable and stable the P element varies between populations and appears to still have some capacity for mobilization.

  11. A novel application of ecological analyses to assess transposable element distributions in the genome of the domestic cow, Bos taurus.

    Science.gov (United States)

    Saylor, Brent; Elliott, Tyler A; Linquist, Stefan; Kremer, Stefan C; Gregory, T Ryan; Cottenie, Karl

    2013-09-01

    Transposable elements (TEs) are among the most abundant components of many eukaryotic genomes. Efforts to explain TE abundance, as well as TE diversity among genomes, have led some researchers to draw an analogy between genomic and ecological processes. Adopting this perspective, we conducted an analysis of the cow (Bos taurus) genome using techniques developed by community ecologists to determine whether environmental factors influence community composition. Specifically, each chromosome within the Bos taurus genome was treated as a "linear transect", and a multivariate redundancy analysis (RDA) was used to identify large-scale spatial patterns in TE communities associated with 10 TE families. The position of each TE community on the chromosome accounted for ∼50% of the variation along the chromosome "transect". Multivariate analysis further revealed an effect of gene density on TE communities that is influenced by several other factors in the (genomic) environment, including chromosome length and TE density. The results of this analysis demonstrate that ecological methods can be applied successfully to help answer genomic questions.

  12. An adaptive transposable element insertion in the regulatory region of the EO gene in the domesticated silkworm, Bombyx mori.

    Science.gov (United States)

    Sun, Wei; Shen, Yi-Hong; Han, Min-Jin; Cao, Yun-Feng; Zhang, Ze

    2014-12-01

    Although there are many studies to show a key role of transposable elements (TEs) in adaptive evolution of higher organisms, little is known about the molecular mechanisms. In this study, we found that a partial TE (Taguchi) inserted in the cis-regulatory region of the silkworm ecdysone oxidase (EO) gene, which encodes a crucial enzyme to reduce the titer of molting hormone (20-hydroxyecdysone, 20E). The TE insertion occurred during domestication of silkworm and the frequency of the TE insertion in the domesticated silkworm (Bombyx mori) is high, 54.24%. The linkage disequilibrium in the TE inserted strains of the domesticated silkworm was elevated. Molecular population genetics analyses suggest that this TE insertion is adaptive for the domesticated silkworm. Luminescent reporter assay shows that the TE inserted in the cis-regulatory region of the EO gene functions as a 20E-induced enhancer of the gene expression. Further, phenotypic bioassay indicates that the silkworm with the TE insertion exhibited more stable developmental phenotype than the silkworm without the TE insertion when suffering from food shortage. Thus, the inserted TE in the cis-regulatory region of the EO gene increased developmental uniformity of silkworm individuals through regulating 20E metabolism, partially explaining transformation of a domestication developmental trait in the domesticated silkworm. Our results emphasize the exceptional role of gene expression regulation in developmental transition of domesticated animals.

  13. Transposable elements in phytopathogenic Verticillium spp.: insights into genome evolution and inter- and intra-specific diversification

    Directory of Open Access Journals (Sweden)

    Amyotte Stefan G

    2012-07-01

    Full Text Available Abstract Background Verticillium dahliae (Vd and Verticillium albo-atrum (Va are cosmopolitan soil fungi causing very disruptive vascular diseases on a wide range of crop plants. To date, no sexual stage has been identified in either microorganism suggesting that somatic mutation is a major force in generating genetic diversity. Whole genome comparative analysis of the recently sequenced strains VdLs.17 and VaMs.102 revealed that non-random insertions of transposable elements (TEs have contributed to the generation of four lineage-specific (LS regions in VdLs.17. Results We present here a detailed analysis of Class I retrotransposons and Class II “cut-and-paste” DNA elements detected in the sequenced Verticillium genomes. We report also of their distribution in other Vd and Va isolates from various geographic origins. In VdLs.17, we identified and characterized 56 complete retrotransposons of the Gypsy-, Copia- and LINE-like types, as well as 34 full-length elements of the “cut-and-paste” superfamilies Tc1/mariner, Activator and Mutator. While Copia and Tc1/mariner were present in multiple identical copies, Activator and Mutator sequences were highly divergent. Most elements comprised complete ORFs, had matching ESTs and showed active transcription in response to stress treatment. Noticeably, we found evidences of repeat-induced point mutation (RIP only in some of the Gypsy retroelements. While Copia-, Gypsy- and Tc1/mariner-like transposons were prominent, a large variation in presence of the other types of mobile elements was detected in the other Verticillium spp. strains surveyed. In particular, neither complete nor defective “cut-and-paste” TEs were found in VaMs.102. Conclusions Copia-, Gypsy- and Tc1/mariner-like transposons are the most wide-spread TEs in the phytopathogens V. dahliae and V. albo-atrum. In VdLs.17, we identified several retroelements and “cut-and-paste” transposons still potentially active. Some of these

  14. Distribution and evolutionary dynamics of Stowaway Miniature Inverted repeat Transposable Elements (MITEs) in grasses.

    Science.gov (United States)

    Minaya, Miguel; Pimentel, Manuel; Mason-Gamer, Roberta; Catalan, Pilar

    2013-07-01

    The occurrence of Stowaway MITEs and their potential footprints in the grasses was assessed within an explicit phylogenetic framework. An organismal tree was used to analyze the distribution and evolutionary dynamics of these elements and their potential excision footprints in the fourth intron of the β-amylase gene and in other introns of several nuclear genes across the Poaceae. Megablast and discontiguous megablast searches in the Entrez nucleotide database were performed for the β-amylase, blz-1, dmc1, nuc, and xly genes MITEs. These elements and their potential footprints were distributed in introns and intergenic spacers of many other nuclear genes throughout the BEP lineages; however, they were absent in the studied PACCMAD lineages. A plausible underlying dynamic of successive acquisitions and deletions of β-amylase Stowaway MITEs in the temperate grasses could be explained by three alternative hypotheses: (i) a single early acquisition of a palindrome element, similar to Tc1-Mariner, in the fourth intron of the β-amylase gene in the ancestor of the Pooideae, followed by multiple independent losses, (ii) multiple independent acquisitions of MITEs in non-related pooid lineages or (iii) different waves of acquisition of MITEs, followed by multiple losses and horizontal transfers in the temperate grasses. This last hypothesis seems to fit best with the evidence found to date.

  15. Global heterochromatic colocalization of transposable elements with minisatellites in the compact genome of the pufferfish Tetraodon nigroviridis.

    Science.gov (United States)

    Fischer, Cécile; Bouneau, Laurence; Coutanceau, Jean-Pierre; Weissenbach, Jean; Volff, Jean-Nicolas; Ozouf-Costaz, Catherine

    2004-07-21

    Because of its unusual high degree of compaction and paucity of repetitive sequences, the genome of the smooth pufferfish Tetraodon nigroviridis is the subject of a well-advanced sequencing project. An astonishing diversity of transposable elements not found in the human and the mouse has been observed in the genome of T. nigroviridis. Due to the difficulty of assembling repeat-rich regions, the whole genome shotgun sequencing approach will probably fail to reveal the general organisation of this compact vertebrate genome. Therefore, in order to gain new insights into the global distribution pattern of repeated DNA in the genome of T. nigroviridis, we have reconstructed partial/complete repetitive sequences from data generated by the genome project and performed double-colour fluorescent in situ hybridization (FISH) analysis for representatives of three major categories of repeated sequences including two minisatellites (ms100 and ms104), two DNA transposons (Tol2 and Buffy1) and two non-long terminal repeat (LTR) retrotransposons (Rex3 and Babar). We show that DNA transposons and retroelements very frequently colocalize with minisatellites and mostly accumulate within heterochromatic regions. These results, which have not been reported so far for the fugu Takifugu rubripes, show that repeated elements are generally excluded from gene-rich regions in T. nigroviridis and underline the extreme degree of compartmentalization of this compact genome. The genome organization of the pufferfish is clearly different from that observed in humans, where repeated sequences make up an important fraction of euchromatic DNA, and is more similar to that observed in the fruit fly Drosophila melanogaster.

  16. Transcriptional activation of transposable elements in mouse zygotes is independent of Tet3-mediated 5-methylcytosine oxidation

    Institute of Scientific and Technical Information of China (English)

    Azusa Inoue; Shogo Matoba; Yi Zhang

    2012-01-01

    The methylation state of the paternal genome is rapidly reprogrammed shortly after fertilization.Recent studies have revealed that loss of 5-methylcytosine(5mC)in zygotes correlates with appearance of 5-hydroxymethylcytosine (5hmC),5-formylcytosine(5fC),and 5-carboxylcytosine(5caC).This process is mediated by Tet3 and the 5mC oxidation products generated in zygotes are gradually lost during preimplantation development through a replicationdependent dilution process.Despite these findings,the biological significance of Tet3-mediated oxidation of 5mC to 5hmC/5fC/5caC in zygotes is unknown.DNA methylation plays an important role in silencing gene expression including the repression of transposable elements(TEs).Given that the activation of TEs during preimplantation development correlates with loss of DNA methylation,it is believed that paternal DNA demethylation may have an important role in TE activation.Here we examined this hypothesis and found that Tet3-mediated 5mC oxidation does not have a significant contribution to TE activation.We show that the expression of LINE-1(long interspersed nucleotide element 1)and ERVL(endogenous retroviruses class Ⅲ)are activated from both paternal and maternal genomes in zygotes.Inhibition of 5mC oxidation by siRNA-mediated depletion of Tet3 affected neither TE activation,nor global transcription in zygotes.Thus,our study provides the first evidence demonstrating that activation of both TEs and global transcription in zygotes are independent of Tet3-mediated 5mC oxidation.

  17. Reverted glutathione S-transferase-like genes that influence flower color intensity of carnation (Dianthus caryophyllus L.) originated from excision of a transposable element

    OpenAIRE

    Momose, Masaki; Itoh, Yoshio; Umemoto, Naoyuki; Nakayama, Masayoshi; Ozeki, Yoshihiro

    2013-01-01

    A glutathione S-transferase-like gene, DcGSTF2, is responsible for carnation (Dianthus caryophyllus L.) flower color intensity. Two defective genes, DcGSTF2mu with a nonsense mutation and DcGSTF2-dTac1 containing a transposable element dTac1, have been characterized in detail in this report. dTac1 is an active element that produces reverted functional genes by excision of the element. A pale-pink cultivar ‘Daisy’ carries both defective genes, whereas a spontaneous deep-colored mutant ‘Daisy-V...

  18. Detection of a novel active transposable element in Caldicellulosiruptor hydrothermalis and a new search for elements in this genus.

    Science.gov (United States)

    Chung, Daehwan; Farkas, Joel; Westpheling, Janet

    2013-05-01

    We show that a previously annotated hypothetical protein is the transposase of a new and active IS element, ISCahy1, widespread in Caldicellulosiruptor species. Transposition generated an 11-bp direct repeat at the insertion site in Caldicellulosiruptor hydrothermalis, suggesting a cut-and-paste mechanism. The discovery of an active insertion sequence in Caldicellulosiruptor species led to a survey of potential IS elements in the genome sequences of eight Caldicellulosiruptor species that identified several new elements, including one novel to this genus.

  19. Phytophthora infestans Argonaute 1 binds microRNA and small RNAs from effector genes and transposable elements.

    Science.gov (United States)

    Åsman, Anna K M; Fogelqvist, Johan; Vetukuri, Ramesh R; Dixelius, Christina

    2016-08-01

    Phytophthora spp. encode large sets of effector proteins and distinct populations of small RNAs (sRNAs). Recent evidence has suggested that pathogen-derived sRNAs can modulate the expression of plant defense genes. Here, we studied the sRNA classes and functions associated with Phytophthora infestans Argonaute (Ago) proteins. sRNAs were co-immunoprecipitated with three PiAgo proteins and deep sequenced. Twenty- to twenty-two-nucleotide (nt) sRNAs were identified as the main interaction partners of PiAgo1 and high enrichment of 24-26-nt sRNAs was seen in the PiAgo4-bound sample. The frequencies and sizes of transposable element (TE)-derived sRNAs in the different PiAgo libraries suggested diversified roles of the PiAgo proteins in the control of different TE classes. We further provide evidence for the involvement of PiAgo1 in the P. infestans microRNA (miRNA) pathway. Protein-coding genes are probably regulated by the shared action of PiAgo1 and PiAgo5, as demonstrated by analysis of differential expression. An abundance of sRNAs from genes encoding host cell death-inducing Crinkler (CRN) effectors was bound to PiAgo1, implicating this protein in the regulation of the expanded CRN gene family. The data suggest that PiAgo1 plays an essential role in gene regulation and that at least two RNA silencing pathways regulate TEs in the plant-pathogenic oomycete P. infestans.

  20. [The distributional clines in P susceptibility causing by the P family transposable element in Drosophila melanogaster population of China].

    Science.gov (United States)

    Hu, K; Wang, Q M

    1998-01-01

    An extensive survey of the P family transposable element of Drosophila melanogaster in China, from the far west as Xinjiang and Xizang (Tibet) to the east coast, covered all China was provided. Strains, sampling more than 70 localities, which were collected during 1980-1995. In the term of the PM system, the phenotypic property of it was mainly M type, including Taiwan. The molecular test determined, it was M type. There were three localities, the P activity of them were higher as Q type. They are: Dalian Peninsular. Chongming island, near Shanghai and Taizhong of Taiwan. For analyzed geographically, according to the east longitudes, grouped the country to four parts. After comparison, two dividing lines were found: 1. The East longitude of 115 degrees, it was between Area II and Area III, see Fig. 4, separating the coastal from inland. Except the P susceptibility of the northeastern three provinces was little higher, about 30.37%, the most part of the east coastal, the first line, its P susceptibility was very week. Seven strains were 0, fifteen strains were under 10%; its P activity was also low, never beyond 10%. Therefore, it was appeared neutral, its average was 7.23%. That was the major neutral property of the coastal areas. The second line of little increased P susceptibility averaged about 26.67%. Then, there was the third line was, when the line was the more westward, its P susceptibility was higher, up to 87%, closing to the highest score of middlewest part of the country. From the east coast to the west, there were three gradually increased P susceptibility lines pushing forward could be found. The E 115 degrees, it was between the lines of the second and the third. 2. Besides the East Longitude of 115 degrees, there is another natural geographic line shows its potentiality, that is the Tropic of Cancer. It divided the coastal to two parts, the localities at the south of this line, they did not show the coastal characteristic, instead of neutral or very

  1. Transposable elements in a marginal plant population: temporal fluctuations provide new insights into genome evolution of wild diploid wheat

    Directory of Open Access Journals (Sweden)

    Belyayev Alexander

    2010-02-01

    Full Text Available Abstract Background How new forms arise in nature has engaged evolutionary biologists since Darwin's seminal treatise on the origin of species. Transposable elements (TEs may be among the most important internal sources for intraspecific variability. Thus, we aimed to explore the temporal dynamics of several TEs in individual genotypes from a small, marginal population of Aegilops speltoides. A diploid cross-pollinated grass species, it is a wild relative of the various wheat species known for their large genome sizes contributed by an extraordinary number of TEs, particularly long terminal repeat (LTR retrotransposons. The population is characterized by high heteromorphy and possesses a wide spectrum of chromosomal abnormalities including supernumerary chromosomes, heterozygosity for translocations, and variability in the chromosomal position or number of 45S and 5S ribosomal DNA (rDNA sites. We propose that variability on the morphological and chromosomal levels may be linked to variability at the molecular level and particularly in TE proliferation. Results Significant temporal fluctuation in the copy number of TEs was detected when processes that take place in small, marginal populations were simulated. It is known that under critical external conditions, outcrossing plants very often transit to self-pollination. Thus, three morphologically different genotypes with chromosomal aberrations were taken from a wild population of Ae. speltoides, and the dynamics of the TE complex traced through three rounds of selfing. It was discovered that: (i various families of TEs vary tremendously in copy number between individuals from the same population and the selfed progenies; (ii the fluctuations in copy number are TE-family specific; (iii there is a great difference in TE copy number expansion or contraction between gametophytes and sporophytes; and (iv a small percentage of TEs that increase in copy number can actually insert at novel locations and

  2. Excision of transposable elements from the chalcone isomerase and dihydroflavonol 4-reductase genes may contribute to the variegation of the yellow-flowered carnation (Dianthus caryophyllus).

    Science.gov (United States)

    Itoh, Yoshio; Higeta, Daisuke; Suzuki, Akane; Yoshida, Hiroyuki; Ozeki, Yoshihiro

    2002-05-01

    In the "Rhapsody" cultivar of the carnation, which bears white flowers variegated with red flecks and sectors, a transposable element, dTdic1, belonging to the Ac/Ds superfamily, was found within the dihydroflavonol 4-reductase (DFR) gene. The red flecks and sectors of "Rhapsody" may be attributable to a reversion to DFR activity after the excision of dTdic1. The yellow color of the carnation petals is attributed to the synthesis and accumulation of chalcone 2'-glucoside. In several of the carnation cultivars that bear yellow flowers variegated with white flecks and sectors, both the chalcone isomerase (CHI) and DFR genes are disrupted by dTdic1.

  3. FB-NOF is a non-autonomous transposable element, expressed in Drosophila melanogaster and present only in the melanogaster group.

    Science.gov (United States)

    Badal, Martí; Xamena, Noel; Cabré, Oriol

    2013-09-10

    Most foldback elements are defective due to the lack of coding sequences but some are associated with coding sequences and may represent the entire element. This is the case of the NOF sequences found in the FB of Drosophila melanogaster, formerly considered as an autonomous TE and currently proposed as part of the so-called FB-NOF element, the transposon that would be complete and fully functional. NOF is always associated with FB and never seen apart from the FB inverted repeats (IR). This is the reason why the FB-NOF composite element can be considered the complete element. At least one of its ORFs encodes a protein that has always been considered its transposase, but no detailed studies have been carried out to verify this. In this work we test the hypothesis that FB-NOF is an active transposon nowadays. We search for its expression product, obtaining its cDNA, and propose the ORF and the sequence of its potential protein. We found that the NOF protein is not a transposase as it lacks any of the motifs of known transposases and also shows structural homology with hydrolases, therefore FB-NOF cannot belong to the superfamily MuDR/foldback, as up to now it has been classified, and can be considered as a non-autonomous transposable element. The alignment with the published genomes of 12 Drosophila species shows that NOF presence is restricted only to the 6 Drosophila species belonging to the melanogaster group.

  4. Increased Variation in Adh Enzyme Activity in Drosophila Mutation-Accumulation Experiment Is Not Due to Transposable Elements at the Adh Structural Gene

    Science.gov (United States)

    Aquadro, C. F.; Tachida, H.; Langley, C. H.; Harada, K.; Mukai, T.

    1990-01-01

    We present here a molecular analysis of the region surrounding the structural gene encoding alcohol dehydrogenase (Adh) in 47 lines of Drosophila melanogaster that have each accumulated mutations for 300 generations. While these lines show a significant increase in variation of alcohol dehydrogenase enzyme activity compared to control lines, we found no restriction map variation in a 13-kb region including the complete Adh structural gene and roughly 5 kb of both 5' and 3' sequences. Thus, the rapid accumulation of ADH activity variation after 28,200 allele generations does not appear to have been due to the mobilization of transposable elements into or out of the Adh structural gene region. PMID:1963870

  5. Cytogenetic mapping of the retroelements Rex1, Rex3 and Rex6 among cichlid fish: new insights on the chromosomal distribution of transposable elements.

    Science.gov (United States)

    Valente, G T; Mazzuchelli, J; Ferreira, I A; Poletto, A B; Fantinatti, B E A; Martins, C

    2011-01-01

    To enhance our understanding of the organization of the genome and chromosome evolution of cichlid fish species, we have isolated and physically mapped onto the chromosomes the transposable elements (TEs) Rex1, Rex3 and Rex6, which are conserved in teleost fish, in the chromosomes of African and South American cichlid species. The physical mapping of different Rex elements showed that they are primarily compartmentalized in the pericentromeric heterochromatic regions, although dispersed or clustered signals in euchromatic regions were also observed. The presence of TEs in heterochromatin can be correlated with their role in the structure and organization of heterochromatic areas (such as centromeres) or with the lower selective pressure that act on these gene-poor regions. The Rex elements were also concentrated in the largest chromosome pair of the Nile tilapia, Oreochromis niloticus. This chromosome pair is supposed to have originated by fusions, demonstrating the possible involvement of TEs with chromosome rearrangements. Besides general patterns of chromosomal distribution, comparative analysis suggests that Rex elements could differ in their chromosomal distribution among different fish groups or species and that intrinsic aspects of the genomes could influence the spread, accumulation or elimination of TEs.

  6. Reverted glutathione S-transferase-like genes that influence flower color intensity of carnation (Dianthus caryophyllus L.) originated from excision of a transposable element.

    Science.gov (United States)

    Momose, Masaki; Itoh, Yoshio; Umemoto, Naoyuki; Nakayama, Masayoshi; Ozeki, Yoshihiro

    2013-12-01

    A glutathione S-transferase-like gene, DcGSTF2, is responsible for carnation (Dianthus caryophyllus L.) flower color intensity. Two defective genes, DcGSTF2mu with a nonsense mutation and DcGSTF2-dTac1 containing a transposable element dTac1, have been characterized in detail in this report. dTac1 is an active element that produces reverted functional genes by excision of the element. A pale-pink cultivar 'Daisy' carries both defective genes, whereas a spontaneous deep-colored mutant 'Daisy-VPR' lost the element from DcGSTF2-dTac1. This finding confirmed that dTac1 is active and that the resulting reverted gene, DcGSTF2rev1, missing the element is responsible for this color change. Crosses between the pale-colored cultivar '06-LA' and a deep-colored cultivar 'Spectrum' produced segregating progeny. Only the deep-colored progeny had DcGSTF2rev2 derived from the 'Spectrum' parent, whereas progeny with pale-colored flowers had defective forms from both parents, DcGSTF2mu and DcGSTF2-dTac1. Thus, DcGSTF2rev2 had functional activity and likely originated from excision of dTac1 since there was a footprint sequence at the vacated site of the dTac1 insertion. Characterizing the DcGSTF2 genes in several cultivars revealed that the two functional genes, DcGSTF2rev1 and DcGSTF2rev2, have been used for some time in carnation breeding with the latter in use for more than half a century.

  7. Small RNA profiling of Xenopus embryos reveals novel miRNAs and a new class of small RNAs derived from intronic transposable elements.

    Science.gov (United States)

    Harding, Joanne L; Horswell, Stuart; Heliot, Claire; Armisen, Javier; Zimmerman, Lyle B; Luscombe, Nicholas M; Miska, Eric A; Hill, Caroline S

    2014-01-01

    Small RNA control of gene expression is critical for developmental processes in vertebrate embryos. To determine the dynamics of small RNA expression and to uncover novel small RNAs in the early vertebrate embryo, we performed high-throughput sequencing of all small RNAs in Xenopus tropicalis embryos at three developmental time points and in dissected halves of gastrula embryos. This analysis allowed us to identify novel microRNAs and we show that microRNA expression is highly dynamic and spatially localized in early embryos. In addition, we have developed a microRNA prediction pipeline and demonstrate that it has the power to predict new miRNAs that are experimentally detectable in frogs, mice, and humans. By combining the small RNA sequencing with mRNA profiling at the different developmental stages, we identify a new class of small noncoding RNAs that we name siteRNAs, which align in clusters to introns of protein-coding genes. We show that siteRNAs are derived from remnants of transposable elements present in the introns. We find that genes containing clusters of siteRNAs are transcriptionally repressed as compared with all genes. Furthermore, we show that this is true for individual genes containing siteRNA clusters, and that these genes are enriched in specific repressive histone modifications. Our data thus suggest a new mechanism of siteRNA-mediated gene silencing in vertebrates, and provide an example of how mobile elements can affect gene regulation.

  8. Quantum states with strong positive partial transpose

    Science.gov (United States)

    Chruściński, Dariusz; Jurkowski, Jacek; Kossakowski, Andrzej

    2008-02-01

    We construct a large class of bipartite M⊗N quantum states which defines a proper subset of states with positive partial transposes (PPTs). Any state from this class has PPT but the positivity of its partial transposition is recognized with respect to canonical factorization of the original density operator. We propose to call elements from this class states with strong positive partial transposes (SPPTs). We conjecture that all SPPT states are separable.

  9. Terminal-repeat retrotransposons with GAG domain in plant genomes: a new testimony on the complex world of transposable elements.

    Science.gov (United States)

    Chaparro, Cristian; Gayraud, Thomas; de Souza, Rogerio Fernandes; Domingues, Douglas Silva; Akaffou, Sélastique; Laforga Vanzela, Andre Luis; Kochko, Alexandre de; Rigoreau, Michel; Crouzillat, Dominique; Hamon, Serge; Hamon, Perla; Guyot, Romain

    2015-01-07

    A novel structure of nonautonomous long terminal repeat (LTR) retrotransposons called terminal repeat with GAG domain (TR-GAG) has been described in plants, both in monocotyledonous, dicotyledonous and basal angiosperm genomes. TR-GAGs are relatively short elements in length (element into the virus-like particle. GAG precursors show similarities with both Copia and Gypsy GAG proteins, suggesting evolutionary relationships of TR-GAG elements with both families. Despite the lack of the enzymatic machinery required for their mobility, strong evidences suggest that TR-GAGs are still active. TR-GAGs represent ubiquitous nonautonomous structures that could be involved in the molecular diversities of plant genomes.

  10. The predominantly selfing plant Arabidopsis thaliana experienced a recent reduction in transposable element abundance compared to its outcrossing relative Arabidopsis lyrata

    Directory of Open Access Journals (Sweden)

    de la Chaux Nicole

    2012-02-01

    Full Text Available Abstract Background Transposable elements (TEs are major contributors to genome evolution. One factor that influences their evolutionary dynamics is whether their host reproduces through selfing or through outcrossing. According to the recombinational spreading hypothesis, for instance, TEs can spread more easily in outcrossing species through recombination, and should thus be less abundant in selfing species. We here studied the distribution and evolutionary dynamics of TE families in the predominantly selfing plant Arabidopsis thaliana and its close outcrossing relative Arabidopsis lyrata on a genome-wide scale. We characterized differences in TE abundance between them and asked which, if any, existing hypotheses about TE abundances may explain these differences. Results We identified 1,819 TE families representing all known classes of TEs in both species, and found three times more copies in the outcrossing A. lyrata than in the predominantly selfing A. thaliana, as well as ten times more TE families unique to A. lyrata. On average, elements in A. lyrata are younger than elements in A. thaliana. In particular, A. thaliana shows a marked decrease in element number that occurred during the most recent 10% of the time interval since A. thaliana split from A. lyrata. This most recent period in the evolution of A. thaliana started approximately 500,000 years ago, assuming a splitting time of 5 million years ago, and coincides with the time at which predominant selfing originated. Conclusions Our results indicate that the mating system may be important for determining TE copy number, and that selfing species are likely to have fewer TEs.

  11. Terminal-Repeat Retrotransposons with GAG Domain in Plant Genomes: A New Testimony on the Complex World of Transposable Elements

    Science.gov (United States)

    Chaparro, Cristian; Gayraud, Thomas; de Souza, Rogerio Fernandes; Domingues, Douglas Silva; Akaffou, Sélastique; Laforga Vanzela, Andre Luis; de Kochko, Alexandre; Rigoreau, Michel; Crouzillat, Dominique; Hamon, Serge; Hamon, Perla; Guyot, Romain

    2015-01-01

    A novel structure of nonautonomous long terminal repeat (LTR) retrotransposons called terminal repeat with GAG domain (TR-GAG) has been described in plants, both in monocotyledonous, dicotyledonous and basal angiosperm genomes. TR-GAGs are relatively short elements in length (<4 kb) showing the typical features of LTR-retrotransposons. However, they carry only one open reading frame coding for the GAG precursor protein involved for instance in transposition, the assembly, and the packaging of the element into the virus-like particle. GAG precursors show similarities with both Copia and Gypsy GAG proteins, suggesting evolutionary relationships of TR-GAG elements with both families. Despite the lack of the enzymatic machinery required for their mobility, strong evidences suggest that TR-GAGs are still active. TR-GAGs represent ubiquitous nonautonomous structures that could be involved in the molecular diversities of plant genomes. PMID:25573958

  12. A transposable element within the Non-canonical telomerase RNA of Arabidopsis thaliana modulates telomerase in response to DNA damage [corrected].

    Directory of Open Access Journals (Sweden)

    Hengyi Xu

    2015-06-01

    Full Text Available Long noncoding RNAs (lncRNAs have emerged as critical factors in many biological processes, but little is known about how their regulatory functions evolved. One of the best-studied lncRNAs is TER, the essential RNA template for telomerase reverse transcriptase. We previously showed that Arabidopsis thaliana harbors three TER isoforms: TER1, TER2 and TER2S. TER1 serves as a canonical telomere template, while TER2 is a novel negative regulator of telomerase activity, induced in response to double-strand breaks (DSBs. TER2 contains a 529 nt intervening sequence that is removed along with 36 nt at the RNA 3' terminus to generate TER2S, an RNA of unknown function. Here we investigate how A. thaliana TER2 acquired its regulatory function. Using data from the 1,001 Arabidopsis genomes project, we report that the intervening sequence within TER2 is derived from a transposable element termed DSB responsive element (DRE. DRE is found in the TER2 loci of most but not all A. thaliana accessions. By analyzing accessions with (TER2 and without DRE (TER2Δ we demonstrate that this element is responsible for many of the unique properties of TER2, including its enhanced binding to TERT and telomerase inhibitory function. We show that DRE destabilizes TER2, and further that TER2 induction by DNA damage reflects increased RNA stability and not increased transcription. DRE-mediated changes in TER2 stability thus provide a rapid and sensitive switch to fine-tune telomerase enzyme activity. Altogether, our data shows that invasion of the TER2 locus by a small transposon converted this lncRNA into a DNA damage sensor that modulates telomerase enzyme activity in response to genome assault.

  13. High genetic variation and recombination events in the vicinity of non-autonomous transposable elements from ‘Candidatus Liberibacter asiaticus’

    Institute of Scientific and Technical Information of China (English)

    WANG Xue-feng; CHEN Jiao-yue; TAN Jin; DUAN Suo; DENG Xiao-ling; CHEN Jian-chi; ZHOU Chang-yong

    2015-01-01

    Two miniature inverted-repeat transposable elements (MITEs), MCLas-A and MCLas-B, were recently identiifed from ‘Candidatus Liberibacter asiaticus’ known to be associated with citrus Huanglongbing (HLB, yelow shoot disease). MCLas-A was suggested as an active MITE because of its mobility. The immediate upstream gene of the two MITEs was predicted to be a putative transposase. The goal of this study is to analyze the sequence variation in the upstream putative transposase of MITEs and explore the possible correlation between sequence variation of transposase gene and MITE activity. PCR and sequence analysis showed that 12 sequence types were found in six major amplicon types from 43 representative ‘Ca. L. asiaticus’ isolates from China, the United States and Brazil. Out of the 12 sequence types, three (T4, T5-2, T6) were reported for the ifrst time. Recombination events were found in the two unique sequence types (T5-2 and T6) which were detected in al Brazilian isolates. Notably, no sequence variation or recombination events were detected in the upstream putative transposase gene of MCLas-A, suggesting the conservation of the transposase gene might be closely related with the MITE activity. Phylogenetic analysis demonstrated two wel supported clades including ifve subclades were identiifed, clearly relfecting the geographical origins of isolates, especialy that of Ruili isolates, São Paulo isolates and a few Florida isolates.

  14. Genome-Wide Comparison of Magnaporthe Species Reveals a Host-Specific Pattern of Secretory Proteins and Transposable Elements

    Science.gov (United States)

    Gowda, Malali

    2016-01-01

    Blast disease caused by the Magnaporthe species is a major factor affecting the productivity of rice, wheat and millets. This study was aimed at generating genomic information for rice and non-rice Magnaporthe isolates to understand the extent of genetic variation. We have sequenced the whole genome of the Magnaporthe isolates, infecting rice (leaf and neck), finger millet (leaf and neck), foxtail millet (leaf) and buffel grass (leaf). Rice and finger millet isolates infecting both leaf and neck tissues were sequenced, since the damage and yield loss caused due to neck blast is much higher as compared to leaf blast. The genome-wide comparison was carried out to study the variability in gene content, candidate effectors, repeat element distribution, genes involved in carbohydrate metabolism and SNPs. The analysis of repeat element footprints revealed some genes such as naringenin, 2-oxoglutarate 3-dioxygenase being targeted by Pot2 and Occan, in isolates from different host species. Some repeat insertions were host-specific while other insertions were randomly shared between isolates. The distributions of repeat elements, secretory proteins, CAZymes and SNPs showed significant variation across host-specific lineages of Magnaporthe indicating an independent genome evolution orchestrated by multiple genomic factors. PMID:27658241

  15. Mapping of a Leishmania major gene/locus that confers pentamidine resistance by deletion and insertion of transposable element

    Directory of Open Access Journals (Sweden)

    Coelho Adriano C.

    2004-01-01

    Full Text Available Pentamidine (PEN is an alternative compound to treat antimony-resistant leishmaniasis patients, which cellular target remains unclear. One approach to the identification of prospective targets is to identify genes able to mediate PEN resistance following overexpression. Starting from a genomic library of transfected parasites bearing a multicopy episomal cosmid vector containing wild-type Leishmania major DNA, we isolated one locus capable to render PEN resistance to wild type cells after DNA transfection. In order to map this Leishmania locus, cosmid insert was deleted by two successive sets of partial digestion with restriction enzymes, followed by transfection into wild type cells, overexpression, induction and functional tests in the presence of PEN. To determine the Leishmania gene related to PEN resistance, nucleotide sequencing experiments were done through insertion of the transposon Mariner element of Drosophila melanogaster (mosK into the deleted insert to work as primer island. Using general molecular techniques, we described here this method that permits a quickly identification of a functional gene facilitating nucleotide sequence experiments from large DNA fragments. Followed experiments revealed the presence of a P-Glycoprotein gene in this locus which role in Leishmania metabolism has now been analyzed.

  16. Differentiation of a Miniature Inverted Transposable Element (MITE) System in Asian Rice Cultivars and Its Inference for a Diphyletic Origin of Two Subspecies of Asian Cultivated Rice

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    In the present study, we report a survey on a Miniature Inverted Transposable Element (MITE) system known as mPing in 102 varieties of Asian cultivated rice (Oryza sativa L.). We found that mPing populations could be generalized into two families, mping-1 and mPing-2, according to their sequence structures. Further analysis showed that these two families of mPing had significant bias in their distribution pattern in two subspecies of rice, namely O. sativa ssp. japonica and indica. O. sativa japonica has a higher proportion of mPing-1 as a general trait, whereas O. sativa indica has a higher proportion of mPing-2. We also examined the mPing system in a doubled haploid (DH) cross-breeding population of jingxi 17 (japonica) and zhaiyeqing 8 (indica) varieties and observed that the mPing system was not tightly linked to major subspecies-determining genes.Furthermore, we checked the mPing system in 28 accessions of Asian common wild rice O. rufipogon and found the mPing system in O. rufipogon. The distribution pattern of the mping system in O. rufipogon indicated a diphyletic origin of the Asian cultivated rice O. sativa species. We did not find the mPing system in another 20 Oryza species. These results substantiated a previous hypothesis that O. rufipogon and O. nivara species were the closest relatives of O. sativa and that the two extant subspecies of O. sativa were evolved independently from corresponding ecotypes of O. rufipogon.

  17. The mosquito Aedes aegypti has a large genome size and high transposable element load but contains a low proportion of transposon-specific piRNAs

    Directory of Open Access Journals (Sweden)

    Arensburger Peter

    2011-12-01

    Full Text Available Abstract Background The piRNA pathway has been shown in model organisms to be involved in silencing of transposons thereby providing genome stability. In D. melanogaster the majority of piRNAs map to these sequences. The medically important mosquito species Aedes aegypti has a large genome size, a high transposon load which includes Miniature Inverted repeat Transposable Elements (MITES and an expansion of the piRNA biogenesis genes. Studies of transgenic lines of Ae. aegypti have indicated that introduced transposons are poorly remobilized and we sought to explore the basis of this. We wished to analyze the piRNA profile of Ae. aegypti and thereby determine if it is responsible for transposon silencing in this mosquito. Results Estimated piRNA sequence diversity was comparable between Ae. aegypti and D. melanogaster, but surprisingly only 19% of mosquito piRNAs mapped to transposons compared to 51% for D. melanogaster. Ae. aegypti piRNA clusters made up a larger percentage of the total genome than those of D. melanogaster but did not contain significantly higher percentages of transposon derived sequences than other regions of the genome. Ae. aegypti contains a number of protein coding genes that may be sources of piRNA biogenesis with two, traffic jam and maelstrom, implicated in this process in model organisms. Several genes of viral origin were also targeted by piRNAs. Examination of six mosquito libraries that had previously been transformed with transposon derived sequence revealed that new piRNA sequences had been generated to the transformed sequences, suggesting that they may have stimulated a transposon inactivation mechanism. Conclusions Ae. aegypti has a large piRNA complement that maps to transposons but primarily gene sequences, including many viral-derived sequences. This, together the more uniform distribution of piRNA clusters throughout its genome, suggest that some aspects of the piRNA system differ between Ae. aegypti and D

  18. An immunity-triggering effector from the Barley smut fungus Ustilago hordei resides in an Ustilaginaceae-specific cluster bearing signs of transposable element-assisted evolution.

    Science.gov (United States)

    Ali, Shawkat; Laurie, John D; Linning, Rob; Cervantes-Chávez, José Antonio; Gaudet, Denis; Bakkeren, Guus

    2014-07-01

    The basidiomycete smut fungus Ustilago hordei was previously shown to comprise isolates that are avirulent on various barley host cultivars. Through genetic crosses we had revealed that a dominant avirulence locus UhAvr1 which triggers immunity in barley cultivar Hannchen harboring resistance gene Ruh1, resided within an 80-kb region. DNA sequence analysis of this genetically delimited region uncovered the presence of 7 candidate secreted effector proteins. Sequence comparison of their coding sequences among virulent and avirulent parental and field isolates could not distinguish UhAvr1 candidates. Systematic deletion and complementation analyses revealed that UhAvr1 is UHOR_10022 which codes for a small effector protein of 171 amino acids with a predicted 19 amino acid signal peptide. Virulence in the parental isolate is caused by the insertion of a fragment of 5.5 kb with similarity to a common U. hordei transposable element (TE), interrupting the promoter of UhAvr1 and thereby changing expression and hence recognition of UhAVR1p. This rearrangement is likely caused by activities of TEs and variation is seen among isolates. Using GFP-chimeric constructs we show that UhAvr1 is induced only in mated dikaryotic hyphae upon sensing and infecting barley coleoptile cells. When infecting Hannchen, UhAVR1p causes local callose deposition and the production of reactive oxygen species and necrosis indicative of the immune response. UhAvr1 does not contribute significantly to overall virulence. UhAvr1 is located in a cluster of ten effectors with several paralogs and over 50% of TEs. This cluster is syntenous with clusters in closely-related U. maydis and Sporisorium reilianum. In these corn-infecting species, these clusters harbor however more and further diversified homologous effector families but very few TEs. This increased variability may have resulted from past selection pressure by resistance genes since U. maydis is not known to trigger immunity in its corn host.

  19. An Immunity-Triggering Effector from the Barley Smut Fungus Ustilago hordei Resides in an Ustilaginaceae-Specific Cluster Bearing Signs of Transposable Element-Assisted Evolution

    KAUST Repository

    Ali, Shawkat

    2014-07-03

    The basidiomycete smut fungus Ustilago hordei was previously shown to comprise isolates that are avirulent on various barley host cultivars. Through genetic crosses we had revealed that a dominant avirulence locus UhAvr1 which triggers immunity in barley cultivar Hannchen harboring resistance gene Ruh1, resided within an 80-kb region. DNA sequence analysis of this genetically delimited region uncovered the presence of 7 candidate secreted effector proteins. Sequence comparison of their coding sequences among virulent and avirulent parental and field isolates could not distinguish UhAvr1 candidates. Systematic deletion and complementation analyses revealed that UhAvr1 is UHOR_10022 which codes for a small effector protein of 171 amino acids with a predicted 19 amino acid signal peptide. Virulence in the parental isolate is caused by the insertion of a fragment of 5.5 kb with similarity to a common U. hordei transposable element (TE), interrupting the promoter of UhAvr1 and thereby changing expression and hence recognition of UhAVR1p. This rearrangement is likely caused by activities of TEs and variation is seen among isolates. Using GFP-chimeric constructs we show that UhAvr1 is induced only in mated dikaryotic hyphae upon sensing and infecting barley coleoptile cells. When infecting Hannchen, UhAVR1p causes local callose deposition and the production of reactive oxygen species and necrosis indicative of the immune response. UhAvr1 does not contribute significantly to overall virulence. UhAvr1 is located in a cluster of ten effectors with several paralogs and over 50% of TEs. This cluster is syntenous with clusters in closely-related U. maydis and Sporisorium reilianum. In these corn-infecting species, these clusters harbor however more and further diversified homologous effector families but very few TEs. This increased variability may have resulted from past selection pressure by resistance genes since U. maydis is not known to trigger immunity in its corn host.

  20. Transcription of the rat testis-specific Rtdpoz-T1 and -T2 retrogenes during embryo development: co-transcription and frequent exonisation of transposable element sequences

    Directory of Open Access Journals (Sweden)

    Chang Che-Ming

    2009-07-01

    Full Text Available Abstract Background Retrotransposition is an important evolutionary force for the creation of new and potentially functional intronless genes which are collectively called retrogenes. Many retrogenes are expressed in the testis and the gene products have been shown to actively participate in spermatogenesis and other unique functions of the male germline. We have previously reported a cluster of retrogenes in the rat genome that encode putative TRAF- and POZ-domain proteins. Two of the genes, Rtdpoz-T1 and -T2 (abbreviated as T1 and T2, have further been shown to be expressed specifically in the rat testis. Results We show here that the T1 and T2 genes are also expressed in the rat embryo up to days 16–17 of development when the genes are silenced until being re-activated in the adult testis. On database interrogation, we find that some T1/T2 exons are chromosomally duplicated as cassettes of 2 or 3 exons consistent with retro-duplication. The embryonic T1/T2 transcripts, characterised by RT-PCR-cloning and rapid amplification of cDNA ends, are further found to have acquired one or more noncoding exons in the 5'-untranslated region (5'-UTR. Most importantly, the T1/T2 locus is embedded within a dense field of relics of transposable element (TE derived mainly from LINE1 and ERV sequences, and the TE sequences are frequently exonised through alternative splicing to form the 5'-UTR sequences of the T1/T2 transcripts. In a case of T1 transcript, the 3'-end is extended into and terminated within an L1 sequence. Since the two genes share a common exon 1 and are, therefore, regulated by a single promoter, a T2-to-T1 co-transcription model is proposed. We further demonstrate that the exonised 5'-UTR TE sequences could lead to the creation of upstream open reading frames resulting in translational repression. Conclusion Exonisation of TE sequences is a frequent event in the transcription of retrogenes during embryonic development and in the testis and

  1. Changes in DNA methylation and transgenerational mobilization of a transposable element (mPing by the Topoisomerase II inhibitor, Etoposide, in rice

    Directory of Open Access Journals (Sweden)

    Yang Xuejiao

    2012-04-01

    Full Text Available Abstract Background Etoposide (epipodophyllotoxin is a chemical commonly used as an anti-cancer drug which inhibits DNA synthesis by blocking topoisomerase II activity. Previous studies in animal cells have demonstrated that etoposide constitutes a genotoxic stress which may induce genomic instability including mobilization of normally quiescent transposable elements (TEs. However, it remained unknown whether similar genetically mutagenic effects could be imposed by etoposide in plant cells. Also, no information is available with regard to whether the drug may cause a perturbation of epigenetic stability in any organism. Results To investigate whether etoposide could generate genetic and/or epigenetic instability in plant cells, we applied etoposide to germinating seeds of six cultivated rice (Oryza sativa L. genotypes including both subspecies, japonica and indica. Based on the methylation-sensitive gel-blotting results, epigenetic changes in DNA methylation of three TEs (Tos17, Osr23 and Osr36 and two protein-encoding genes (Homeobox and CDPK-related genes were detected in the etoposide-treated plants (S0 generation in four of the six studied japonica cultivars, Nipponbare, RZ1, RZ2, and RZ35, but not in the rest japonica cultivar (Matsumae and the indica cultivar (93-11. DNA methylation changes in the etoposide-treated S0 rice plants were validated by bisulfite sequencing at both of two analyzed loci (Tos17 and Osr36. Transpositional activity was tested for eight TEs endogenous to the rice genome in both the S0 plants and their selfed progenies (S1 and S2 of one of the cultivars, RZ1, which manifested heritable phenotypic variations. Results indicated that no transposition occurred in the etoposide-treated S0 plants for any of the TEs. Nonetheless, a MITE transposon, mPing, showed rampant mobilization in the S1 and S2 progenies descended from the drug-treated S0 plants. Conclusions Our results demonstrate that etoposide imposes a similar

  2. An immunity-triggering effector from the Barley smut fungus Ustilago hordei resides in an Ustilaginaceae-specific cluster bearing signs of transposable element-assisted evolution.

    Directory of Open Access Journals (Sweden)

    Shawkat Ali

    2014-07-01

    Full Text Available The basidiomycete smut fungus Ustilago hordei was previously shown to comprise isolates that are avirulent on various barley host cultivars. Through genetic crosses we had revealed that a dominant avirulence locus UhAvr1 which triggers immunity in barley cultivar Hannchen harboring resistance gene Ruh1, resided within an 80-kb region. DNA sequence analysis of this genetically delimited region uncovered the presence of 7 candidate secreted effector proteins. Sequence comparison of their coding sequences among virulent and avirulent parental and field isolates could not distinguish UhAvr1 candidates. Systematic deletion and complementation analyses revealed that UhAvr1 is UHOR_10022 which codes for a small effector protein of 171 amino acids with a predicted 19 amino acid signal peptide. Virulence in the parental isolate is caused by the insertion of a fragment of 5.5 kb with similarity to a common U. hordei transposable element (TE, interrupting the promoter of UhAvr1 and thereby changing expression and hence recognition of UhAVR1p. This rearrangement is likely caused by activities of TEs and variation is seen among isolates. Using GFP-chimeric constructs we show that UhAvr1 is induced only in mated dikaryotic hyphae upon sensing and infecting barley coleoptile cells. When infecting Hannchen, UhAVR1p causes local callose deposition and the production of reactive oxygen species and necrosis indicative of the immune response. UhAvr1 does not contribute significantly to overall virulence. UhAvr1 is located in a cluster of ten effectors with several paralogs and over 50% of TEs. This cluster is syntenous with clusters in closely-related U. maydis and Sporisorium reilianum. In these corn-infecting species, these clusters harbor however more and further diversified homologous effector families but very few TEs. This increased variability may have resulted from past selection pressure by resistance genes since U. maydis is not known to trigger immunity

  3. A Study of Fractality and Long-Range Order in the Distribution of Transposable Elements in Eukaryotic Genomes Using the Scaling Properties of Block Entropy and Box-Counting

    Directory of Open Access Journals (Sweden)

    Labrini Athanasopoulou

    2014-03-01

    Full Text Available Repeats or Transposable Elements (TEs are highly repeated sequence stretches, present in virtually all eukaryotic genomes. We explore the distribution of representative TEs from all major classes in entire chromosomes across various organisms. We employ two complementary approaches, the scaling of block entropy and box-counting. Both converge to the conclusion that well-developed fractality is typical of small genomes while in large genomes it appears sporadically and in some cases is rudimentary. The human genome is particularly prone to develop this pattern, as TE chromosomal distributions therein are often highly clustered and inhomogeneous. Comparing with previous works, where occurrence of power-law-like size distributions in inter-repeat distances is studied, we conclude that fractality in entire chromosomes is a more stringent (thus less often encountered condition. We have formulated a simple evolutionary scenario for the genomic dynamics of TEs, which may account for their fractal distribution in real genomes. The observed fractality and long-range properties of TE genomic distributions have probably contributed to the formation of the “fractal globule”, a model for the confined chromatin organization of the eukaryotic nucleus proposed on the basis of experimental evidence.

  4. TamiR1123 originated from a family of miniature inverted-repeat transposable elements (MITE) including one inserted in the Vrn-A1a promoter in wheat.

    Science.gov (United States)

    Yu, Ming; Carver, Brett F; Yan, Liuling

    2014-02-01

    More than half of spring wheat cultivars have a dominant Vrn-A1a allele that has an insertion of a miniature inverted-repeat transposable element (MITE) in its promoter. In this study, we found that the MITE present in the Vrn-A1a gene (MITE_VRN) is a nearly perfect palindrome and it can form highly stable hairpin loops when expressed as RNA. MITE_VRN also possessed sequences of a microRNA in Triticum aestivum (TamiR1123). The P(32) labeled TamiR1123 probe detected two RNA molecules on a small RNA gel blot, one expected for MITE_VRN, and the other expected for TamiR1123. These results demonstrated that MITE_VRN was expressed as RNAs and TamiR1123 was originated from the MITE_VRN family. The isogenic line TDD carrying the dominant Vrn-A1a allele with MITE_VRN showed higher TamiR1123 and Vrn-A1a transcript levels than the isogenic line TDE carrying the recessive vrn-A1a allele without MITE_VRN. TamiR1123 were greatly up-regulated by plant age but slightly down-regulated by low temperature and short days. These findings have pointed to alternative regulatory mechanisms for plant development governed by Vrn-A1a in spring wheat.

  5. Polymorphisms of the nucleolus organizing regions in Loricaria cataphracta (Siluriformes, Loricariidae) of the upper Paraguay River basin indicate an association with transposable elements.

    Science.gov (United States)

    Porto, F E; Gindri, B S; Vieira, M M R; Borin, L A; Portela-Castro, A L B; Martins-Santos, I C

    2014-03-12

    A cytogenetic analysis of Loricaria cataphracta revealed a diploid number of 2n = 64 chromosomes, distributed as 12 metacentric + 8 submetacentric + 2 subtelocentric + 42 acrocentric, with a fundamental number of 86. Analysis of the nucleolus organizing region (NOR) using silver nitrate impregnation and fluorescence in situ hybridization (18S rDNA probe) techniques showed intra-population chromosomal polymorphism that could be classified into five different patterns (I to V), involving four pairs of chromosomes (8, 9, 12, and 13). In pattern I, the NOR was located in pair 12, whereas in pattern II, the NOR was detected in pair 8; these two patterns were characterized as a simple-NOR system. A multiple NOR system was evident in the other patterns (III, IV, and V). In pattern III, the NOR was located in only one of the homologs of pairs 12 and 8, and in patterns IV and V, the NOR was observed in pair 12 and in only one of the homologs of pairs 9 and 13, respectively. In addition, C-band analysis also showed this pattern of variation, and characterized a polymorphism in relation to the constitutive heterochromatin; the composition of this region was GC-rich (positive CMA3) and 4',6-diamidino-2-phenylindole negative. Transposition of NOR sites for mobile elements is suggested to explain this polymorphism.

  6. Structure of the acyl-glucose-dependent anthocyanin 5-O-glucosyltransferase gene in carnations and its disruption by transposable elements in some varieties.

    Science.gov (United States)

    Nishizaki, Yuzo; Matsuba, Yuki; Okamoto, Emi; Okamura, Masachika; Ozeki, Yoshihiro; Sasaki, Nobuhiro

    2011-12-01

    The pink, red and crimson petal colors of carnations (Dianthus caryophyllus) are produced by anthocyanins. The anthocyanins, pelargonidin and cyanidin can be modified by two glucoses at the 3 and 5 positions, and by a single malic acid. Petal color variation can result from failure of such modification, for example, the lack of a glucose at the 5 position is responsible for the color variants of some commercial varieties. With respect to this variation, modification by 5-O-glucosyltransferase plays the most important role in glucosylation at the 5 position. Recently, we identified a novel acyl-glucose-dependent anthocyanin 5-O-glucosyltransferase (AA5GT), that uses acyl-glucoses, but not UDP-glucose, as the glucose donor. Although we showed that loss of AA5GT expression was responsible for loss of glucosylation at the 5 position of anthocyanin in some varieties, the cause of this repression of AA5GT expression could not be determined. Here, we have succeeded in isolating the AA5GT gene and found that it consists of 12 exons and 11 introns. In carnation varieties lacking a glucose at the 5 position, we identified the insertion of two different retrotransposons, Ty1dic1 and Retdic1, into AA5GT. Ty1dic1, which belongs to the class I long terminal repeat (LTR)-retrotransposons of Ty1/copia families, was inserted into exon 10. Retdic1, which includes a long interspersed nuclear element (LINE)-like sequence, was inserted into intron 5. Thus, insertion of either Ty1dic1 or Retdic1 can disrupt AA5GT and result in the lack of glucosylation at the 5 position in anthocyanins.

  7. Mammary Cancer and Activation of Transposable Elements

    Science.gov (United States)

    2015-03-01

    derived adipo- cytes and ADS-derived induced pluripotent stem cells (ADS-iPSCs) (19) and primary mouse ES cells to isolated sperm and oocytes (20). We...Mesendoderm 2353 765 051 59 5 92% H9-IMR90 5875 7 669 782 605 58 91% oocyte - ES cell (mouse) 4727 1 204 883 334 25 93% sperm - ES cell (mouse) 4580 4 364 748...engineered mouse model in which a specific mammary cell population is fluorescently marked upon initial transcriptional activation of the SV40 large T

  8. Mammary Cancer and Activation of Transposable Elements

    Science.gov (United States)

    2012-09-01

    SV40Tag is transcriptionally activated during pregnancy and lactation , and the mice are predisposed to develop mammary cancer after 3 pregnancies...and lactations . Using this model, populations of marked cells can be collected for integrated analysis of gene expression, promoter usage, and DNA...completed over the first 6 months on the job . Training included mouse husbandry and colony management, mammary cell isolations in preparation for

  9. The structure of the transposable genetic element ISBsu2 from the cryptic plasmid p1516 of a soil Bacillus subtilis strain and the presence of homologues of this element in the chromosomes of various Bacillus subtilis strains

    NARCIS (Netherlands)

    Holsappel, S; Gagarina, EY; Poluektova, EU; Nezametdinova, VZ; Gel'fand, MS; Prozorov, AA; Bron, S

    2003-01-01

    A cryptic plasmid from a soil strain of Bacillus subtilis was found to contain a sequence having features of an IS element. Homologous sequences were also found in the chromosome of this strain and in the chromosomes of some other B. subtilis strains.

  10. Transpose symmetry of the Jones matrix and topological phases.

    Science.gov (United States)

    Bhandari, Rajendra

    2008-04-15

    The transmission Jones matrix of an arbitrary stack of reciprocal plane-parallel plates that has been turned through 180 degrees about an axis in the plane of the stack is, in an appropriate basis, the transpose of the transmission matrix of the unturned slab with a change in the sign of the off-diagonal elements. We prove this convention-free result for the case where reflection at the interfaces can be ignored and use it to devise an experimental scheme to separate isotropic and topological phase changes in a reciprocal optical medium.

  11. Transposed genes in Arabidopsis are often associated with flanking repeats.

    Directory of Open Access Journals (Sweden)

    Margaret R Woodhouse

    2010-05-01

    Full Text Available Much of the eukaryotic genome is known to be mobile, largely due to the movement of transposons and other parasitic elements. Recent work in plants and Drosophila suggests that mobility is also a feature of many nontransposon genes and gene families. Indeed, analysis of the Arabidopsis genome suggested that as many as half of all genes had moved to unlinked positions since Arabidopsis diverged from papaya roughly 72 million years ago, and that these mobile genes tend to fall into distinct gene families. However, the mechanism by which single gene transposition occurred was not deduced. By comparing two closely related species, Arabidopsis thaliana and Arabidopsis lyrata, we sought to determine the nature of gene transposition in Arabidopsis. We found that certain categories of genes are much more likely to have transposed than others, and that many of these transposed genes are flanked by direct repeat sequence that was homologous to sequence within the orthologous target site in A. lyrata and which was predominantly genic in identity. We suggest that intrachromosomal recombination between tandemly duplicated sequences, and subsequent insertion of the circular product, is the predominant mechanism of gene transposition.

  12. On circulant states with positive partial transpose

    OpenAIRE

    Chruściński, Dariusz; Kossakowski, Andrzej

    2007-01-01

    We construct a large class of quantum "d x d" states which are positive under partial transposition (so called PPT states). The construction is based on certain direct sum decomposition of the total Hilbert space displaying characteristic circular structure - that is way we call them circulant states. It turns out that partial transposition maps any such decomposition into another one and hence both original density matrix and its partially transposed partner share similar cyclic properties. ...

  13. Insights into the Transposable Mobilome of Paracoccus spp. (Alphaproteobacteria)

    Science.gov (United States)

    Dziewit, Lukasz; Baj, Jadwiga; Szuplewska, Magdalena; Maj, Anna; Tabin, Mateusz; Czyzkowska, Anna; Skrzypczyk, Grazyna; Adamczuk, Marcin; Sitarek, Tomasz; Stawinski, Piotr; Tudek, Agnieszka; Wanasz, Katarzyna; Wardal, Ewa; Piechucka, Ewa; Bartosik, Dariusz

    2012-01-01

    Several trap plasmids (enabling positive selection of transposition events) were used to identify a pool of functional transposable elements (TEs) residing in bacteria of the genus Paracoccus (Alphaproteobacteria). Complex analysis of 25 strains representing 20 species of this genus led to the capture and characterization of (i) 37 insertion sequences (ISs) representing 9 IS families (IS3, IS5, IS6, IS21, IS66, IS256, IS1182, IS1380 and IS1634), (ii) a composite transposon Tn6097 generated by two copies of the ISPfe2 (IS1634 family) containing two predicted genetic modules, involved in the arginine deiminase pathway and daunorubicin/doxorubicin resistance, (iii) 3 non-composite transposons of the Tn3 family, including Tn5393 carrying streptomycin resistance and (iv) a transposable genomic island TnPpa1 (45 kb). Some of the elements (e.g. Tn5393, Tn6097 and ISs of the IS903 group of the IS5 family) were shown to contain strong promoters able to drive transcription of genes placed downstream of the target site of transposition. Through the application of trap plasmid pCM132TC, containing a promoterless tetracycline resistance reporter gene, we identified five ways in which transposition can supply promoters to transcriptionally silent genes. Besides highlighting the diversity and specific features of several TEs, the analyses performed in this study have provided novel and interesting information on (i) the dynamics of the process of transposition (e.g. the unusually high frequency of transposition of TnPpa1) and (ii) structural changes in DNA mediated by transposition (e.g. the generation of large deletions in the recipient molecule upon transposition of ISPve1 of the IS21 family). We also demonstrated the great potential of TEs and transposition in the generation of diverse phenotypes as well as in the natural amplification and dissemination of genetic information (of adaptative value) by horizontal gene transfer, which is considered the driving force of bacterial

  14. Insights into the transposable mobilome of Paracoccus spp. (Alphaproteobacteria.

    Directory of Open Access Journals (Sweden)

    Lukasz Dziewit

    Full Text Available Several trap plasmids (enabling positive selection of transposition events were used to identify a pool of functional transposable elements (TEs residing in bacteria of the genus Paracoccus (Alphaproteobacteria. Complex analysis of 25 strains representing 20 species of this genus led to the capture and characterization of (i 37 insertion sequences (ISs representing 9 IS families (IS3, IS5, IS6, IS21, IS66, IS256, IS1182, IS1380 and IS1634, (ii a composite transposon Tn6097 generated by two copies of the ISPfe2 (IS1634 family containing two predicted genetic modules, involved in the arginine deiminase pathway and daunorubicin/doxorubicin resistance, (iii 3 non-composite transposons of the Tn3 family, including Tn5393 carrying streptomycin resistance and (iv a transposable genomic island TnPpa1 (45 kb. Some of the elements (e.g. Tn5393, Tn6097 and ISs of the IS903 group of the IS5 family were shown to contain strong promoters able to drive transcription of genes placed downstream of the target site of transposition. Through the application of trap plasmid pCM132TC, containing a promoterless tetracycline resistance reporter gene, we identified five ways in which transposition can supply promoters to transcriptionally silent genes. Besides highlighting the diversity and specific features of several TEs, the analyses performed in this study have provided novel and interesting information on (i the dynamics of the process of transposition (e.g. the unusually high frequency of transposition of TnPpa1 and (ii structural changes in DNA mediated by transposition (e.g. the generation of large deletions in the recipient molecule upon transposition of ISPve1 of the IS21 family. We also demonstrated the great potential of TEs and transposition in the generation of diverse phenotypes as well as in the natural amplification and dissemination of genetic information (of adaptative value by horizontal gene transfer, which is considered the driving force of

  15. Computing partial transposes and related entanglement functions

    CERN Document Server

    Maziero, Jonas

    2016-01-01

    The partial transpose (PT) is an important function for entanglement testing and quantification and also for the study of geometrical aspects of the quantum state space. In this article, considering general bipartite and multipartite discrete systems, explicit formulas ready for the numerical implementation of the PT and of related entanglement functions are presented and the Fortran code produced for that purpose is described. What is more, we obtain an analytical expression for the Hilbert-Schmidt entanglement of two-qudit systems and for the associated closest separable state. In contrast to previous works on this matter, we only use the properties of the PT, not applying Lagrange multipliers.

  16. Circulant states with positive partial transpose

    Science.gov (United States)

    Chruściński, Dariusz; Kossakowski, Andrzej

    2007-09-01

    We construct a large class of quantum d⊗d states which are positive under partial transposition (so called PPT states). The construction is based on certain direct sum decomposition of the total Hilbert space displaying characteristic circular structure—that is why we call them circulant states. It turns out that partial transposition maps any such decomposition into another one and hence both original density matrix and its partially transposed partner share similar cyclic properties. This class contains many well-known examples of PPT states from the literature and gives rise to a huge family of completely new states.

  17. Transposed Paternò-Büchi Reaction.

    Science.gov (United States)

    Kumarasamy, Elango; Raghunathan, Ramya; Kandappa, Sunil Kumar; Sreenithya, A; Jockusch, Steffen; Sunoj, Raghavan B; Sivaguru, J

    2017-01-18

    A complementary strategy of utilizing ππ* excited state of alkene instead of nπ* excited state of the carbonyl chromophore in a "transposed Paternò-Büchi" reaction is evaluated with atropisomeric enamides as the model system. Based on photophysical investigations, the nature of excited states and the reactive pathway was deciphered leading to atropselective reaction. This new concept of switching of excited-state configuration should pave the way to control the stereochemical course of photoreaction due to the orbital approaches required for photochemical reactivity.

  18. Computing Partial Transposes and Related Entanglement Functions

    Science.gov (United States)

    Maziero, Jonas

    2016-10-01

    The partial transpose (PT) is an important function for entanglement testing and quantification and also for the study of geometrical aspects of the quantum state space. In this article, considering general bipartite and multipartite discrete systems, explicit formulas ready for the numerical implementation of the PT and of related entanglement functions are presented and the Fortran code produced for that purpose is described. What is more, we obtain an analytical expression for the Hilbert-Schmidt entanglement of two-qudit systems and for the associated closest separable state. In contrast to previous works on this matter, we only use the properties of the PT, not applying Lagrange multipliers.

  19. Transposed-Letter and Laterality Effects in Lexical Decision

    Science.gov (United States)

    Perea, Manuel; Fraga, Isabel

    2006-01-01

    Two divided visual field lexical decision experiments were conducted to examine the role of the cerebral hemispheres in transposed-letter similarity effects. In Experiment 1, we created two types of nonwords: nonadjacent transposed-letter nonwords ("TRADEGIA"; the base word was "TRAGEDIA," the Spanish for "TRAGEDY") and two-letter different…

  20. Structure and properties of the algebra of partially transposed permutation operators

    Energy Technology Data Exchange (ETDEWEB)

    Mozrzymas, Marek [Institute for Theoretical Physics, University of Wrocław, 50-204 Wrocław (Poland); Horodecki, Michał; Studziński, Michał [Institute for Theoretical Physics and Astrophysics, University of Gdańsk, 80-952 Gdańsk (Poland); National Quantum Information Centre of Gdańsk, 81-824 Sopot (Poland)

    2014-03-15

    We consider the structure of algebra of operators, acting in n-fold tensor product space, which are partially transposed on the last term. Using purely algebraical methods we show that this algebra is semi-simple and then, considering its regular representation, we derive basic properties of the algebra. In particular, we describe all irreducible representations of the algebra of partially transposed operators and derive expressions for matrix elements of the representations. It appears that there are two kinds of irreducible representations of the algebra. The first one is strictly connected with the representations of the group S(n − 1) induced by irreducible representations of the group S(n − 2). The second kind is structurally connected with irreducible representations of the group S(n − 1)

  1. Analysis of energetically biased transcripts of viruses and transposable elements

    Directory of Open Access Journals (Sweden)

    Rodrigo Secolin

    2012-01-01

    Full Text Available RNA interference (RNAi is a natural endogenous process by which double-stranded RNA molecules trigger potent and specific gene silencing in eukaryotic cells and is characterized by target RNA cleavage. In mammals, small interfering RNAs (siRNAs are the trigger molecules of choice and constitute a new class of RNA-based antiviral agents. In an efficient RNAi response, the antisense strand of siRNAs must enter the RNA-induced silencing complex (RISC in a process mediated by thermodynamic features. In this report, we hypothesize that silent mutations capable of inverting thermodynamic properties can promote resistance to siRNAs. Extensive computational analyses were used to assess whether continuous selective pressure that promotes such mutations could lead to the emergence of viral strains completely resistant to RNAi (i.e., prone to transfer only the sense strands to RISC. Based on our findings, we propose that, although synonymous mutations may produce functional resistance, this strategy cannot be systematically adopted by viruses since the longest RNAi-refractory sequence is only 10 nt long. This finding also suggests that all mRNAs display fluctuating thermodynamic landscapes and that, in terms of thermodynamic features, RNAi is a very efficient antiviral system since there will always be sites susceptible to siRNAs.

  2. Unwrapping ADMM: Efficient Distributed Computing via Transpose Reduction

    Science.gov (United States)

    2016-05-11

    Unwrapping ADMM: Efficient Distributed Computing via Transpose Reduction Thomas Goldstein Gavin Taylor Kawika Barabin Kent Sayre University of...of yk+1 is computed with either an analytical solution, or using a simple 1-dimensional lookup table of solutions. Thomas Goldstein, Gavin Taylor ... Taylor , Kawika Barabin, Kent Sayre On the other hand, transpose reduction removes the ma- trix D from the objective function and corresponds to (4

  3. Parallel matrix transpose algorithms on distributed memory concurrent computers

    Energy Technology Data Exchange (ETDEWEB)

    Choi, J.; Walker, D.W. [Oak Ridge National Lab., TN (United States); Dongarra, J.J. [Oak Ridge National Lab., TN (United States)]|[Univ. of Tennessee, Knoxville, TN (United States). Dept. of Computer Science

    1993-10-01

    This paper describes parallel matrix transpose algorithms on distributed memory concurrent processors. It is assumed that the matrix is distributed over a P x Q processor template with a block scattered data distribution. P, Q, and the block size can be arbitrary, so the algorithms have wide applicability. The communication schemes of the algorithms are determined by the greatest common divisor (GCD) of P and Q. If P and Q are relatively prime, the matrix transpose algorithm involves complete exchange communication. If P and Q are not relatively prime, processors are divided into GCD groups and the communication operations are overlapped for different groups of processors. Processors transpose GCD wrapped diagonal blocks simultaneously, and the matrix can be transposed with LCM/GCD steps, where LCM is the least common multiple of P and Q. The algorithms make use of non-blocking, point-to-point communication between processors. The use of nonblocking communication allows a processor to overlap the messages that it sends to different processors, thereby avoiding unnecessary synchronization. Combined with the matrix multiplication routine, C = A{center_dot}B, the algorithms are used to compute parallel multiplications of transposed matrices, C = A{sup T}{center_dot}B{sup T}, in the PUMMA package. Details of the parallel implementation of the algorithms are given, and results are presented for runs on the Intel Touchstone Delta computer.

  4. Transposed-Letter Priming across Inflectional Morpheme Boundaries

    Science.gov (United States)

    Zargar, Ehsan Shafiee; Witzel, Naoko

    2017-01-01

    This study reports findings from two experiments testing whether a transposed-letter (TL) priming effect can be obtained when the transposition occurs across morphological boundaries. Previous studies have primarily tested derivationally complex words or compound words, but have not examined a more rule-based and productive morphological…

  5. An Ac transposon system based on maize chromosome 4S for isolating long-distance-transposed Ac tags in the maize genome.

    Science.gov (United States)

    Wang, Fei; Li, Zhaoying; Fan, Jun; Li, Pengfei; Hu, Wei; Wang, Gang; Xu, Zhengkai; Song, Rentao

    2010-12-01

    Transposon tagging is an important tool for gene isolation and functional studies. In maize, several transposon-tagging systems have been developed, mostly using Activator/Dissociation (Ac/Ds) and Mutator systems. Here, we establish another Ac-based transposon system with the donor Ac tightly linked with sugary1 (su1) on maize chromosome 4S. Newly transposed Ac (tr-Acs) were detected based on a negative dosage effect, and long-distance-transposed Ac events were identified and isolated from the donor Ac by a simple backcross scheme. In this study, we identified 208 independent long-distance-transposed Ac lines. Thirty-one flanking sequences of these tr-Acs were isolated and localized in the maize genome. As found in previous studies, the tr-Acs preferentially inserted into genic sequences. The distribution of tr-Acs is not random. In our study, the tr-Acs preferentially transposed into chromosomes 1, 2, 9 and 10. We discuss the preferential distribution of tr-Acs from Ac systems. Our system is complementary to two other Ac-based regional-mutagenesis systems in maize, and the combined use of these systems will achieve an even and high-density distribution of Ac elements throughout the maize genome for functional-genomics studies.

  6. Differences of Skew Schur Functions of Staircases with Transposed Foundations

    CERN Document Server

    Morin, Matthew

    2010-01-01

    We consider the skew diagram $\\Delta_n$, which is the $180^\\circ$ rotation of the staircase diagram $\\delta_n = (n,n-1,n-2,...,2,1)$. We create a staircase with bad foundation by augmenting $\\Delta_n$ with another skew diagram, which we call the \\textit{foundation}. We consider pairs of staircases with bad foundation whose foundations are transposes of one another. Among these pairs, we show that the difference of the corresponding skew Schur functions is Schur-positive in the case when one of the foundations consists of either a one or two row diagram, or a hook diagram.

  7. Transposing, Transforming and Transcending Tradition in Creative Digital Media

    DEFF Research Database (Denmark)

    Prager, Phillip; Thomas, Maureen; Selsjord, Marianne

    2015-01-01

    How can digital media technologies, contemporary theories of creativity, and tradition combine to develop the aesthetics of computer-based art today and in the future? Through contextualised case-studies, this chapter investigates how games, information technologies, and traditional visual...... and storytelling arts combine to create rich, complex, and engaging moving-image based artworks with wide appeal. It examines how dramatist and interactive media artist Maureen Thomas and 3D media artist and conservator Marianne Selsjord deploy creative digital technologies to transpose, transform, and transcend...... of the aspirations and approaches of 20th-century avant-garde artists, revealing these as a potent source of conceptual riches for the digital media creators of today and tomorrow....

  8. A novel transposable Mu-like prophage in Bacillus alcalophilus CGMCC 1.3604(ATCC 27647)

    Institute of Scientific and Technical Information of China (English)

    Junjie; Yang; Yimeng; Kong; Xuan; Li; Sheng; Yang

    2015-01-01

    <正>Dear Editor,Transposable phages,which are reproduced by transposition(Harshey,2012;Taylor,1963),have been widely applied in the field of biotechnology to manipulate operon/gene fusions,in vivo cloning,randomion mutagenesis,and integration of DNA into bacterial genomes(Abalakina et al.,2008;Akhverdyan et al.,2011).One of the best-studied transposable phages is

  9. Multi-particle entanglement under asymptotic positive partial transpose preserving operations

    OpenAIRE

    Ishizaka, S; Plenio, M. B.

    2005-01-01

    We demonstrate that even under positive partial transpose preserving operations in an asymptotic setting GHZ and W states are not reversibly interconvertible. We investigate the structure of minimal reversible entanglement generating set (MREGS) for tri-partite states under positive partial transpose (ppt) preserving operations. We demonstrate that the set consisting of W and EPR states alone cannot be an MREGS. In this context we prove the surprising result that the relative entropy of entan...

  10. TRANSPOSABLE REGULARIZED COVARIANCE MODELS WITH AN APPLICATION TO MISSING DATA IMPUTATION.

    Science.gov (United States)

    Allen, Genevera I; Tibshirani, Robert

    2010-06-01

    Missing data estimation is an important challenge with high-dimensional data arranged in the form of a matrix. Typically this data matrix is transposable, meaning that either the rows, columns or both can be treated as features. To model transposable data, we present a modification of the matrix-variate normal, the mean-restricted matrix-variate normal, in which the rows and columns each have a separate mean vector and covariance matrix. By placing additive penalties on the inverse covariance matrices of the rows and columns, these so called transposable regularized covariance models allow for maximum likelihood estimation of the mean and non-singular covariance matrices. Using these models, we formulate EM-type algorithms for missing data imputation in both the multivariate and transposable frameworks. We present theoretical results exploiting the structure of our transposable models that allow these models and imputation methods to be applied to high-dimensional data. Simulations and results on microarray data and the Netflix data show that these imputation techniques often outperform existing methods and offer a greater degree of flexibility.

  11. Effects of Un-transposed UHV Transmission Line on Fault Analysis of Power Systems

    Institute of Scientific and Technical Information of China (English)

    WANG Anning; CHEN Qing; ZHOU Zhanping

    2008-01-01

    The conventional fault analysis method based on symmetrical components supposes that the three-phase parameters of un-transposed transmission line are symmetrical in case of fault. The errors caused by the method with the symmetrical distributed parameter circuit model as the equivalent circuit of the un-transposed ultra high voltage (UHV) transmission line were studied under both normal operation and fault, and the corresponding problems arising were pointed out. By contrast with electromagnetic transient and power electronics (EMTPE) simulation results with the asymmetrical distributed parameter circuit model of un-transposed line, it is shown that the conventional method cannot show the existence of negative and zero sequences before fault happening and there are many errors on voltage and current after fault happening which are different with fault types. The error ranges of voltage and current are 2.13%-81.13% and -7.82%-86.15%, respectively.

  12. A tiger mouse and relatives. Variants caused by an activated transposable element?

    Science.gov (United States)

    Wallace, M E; Nash, H R

    1984-01-01

    In a laboratory-bred population of wild Peruvian house mice, one male had an excessive rate of non-pairing of the X and Y chromosomes. After crossing him with laboratory stock mice, a mouse of very unusual phenotype appeared from a yellow (AyA) mother. He was yellow with black dorsal stripes; hence Tiger. He was mated to many females, and inbred F2 and F3 generations were raised. There were no more tiger phenotypes, but his F1 contained an excess of black-and-tans over yellows, showing him to be a gonosomic mosaic Ayat/atat; the homozygous cell line probably arose from the heterozygous one. The mitotic karyotype was normal. Some of Tiger's mates were of known allozyme types and their progeny were scored. The allozyme segregations were normal, except at the Es-3 locus (esterase-3), for which Tiger was typed as homozygous. Several unusual events among Tiger's close relatives included a mutation to an unstable pattern mutant, three probable translocations, and several cases of somatic defect. All unusual mice derived from Tiger's yellow mother, whose genome was one-quarter Peruvian. Yellow is associated with an ecotropic murine leukemia virus. The Peru genome is characterized by a high occurrence of mutation and aberrant karyotypes. It is suggested that something from the Peru genome in Tiger's mother caused instability of the DNA sequence associated with yellow, with related disturbance at different locations thereafter. The nature of this instability, and of the Peru genome, is discussed.

  13. Regulation of Metastasis and DNA Damage Resistance Pathways by Transposable Elements

    Science.gov (United States)

    2014-10-01

    Discovery Conference in Philadelphia. Philadelphia, PA. Sept. 2012 Interplay Between Chromatin Responses to DNA Double Strand Breaks and Transcription ...pathways. We have recently reported the phenomenon of Double Strand Break Induced Silencing in Cis (DISC), a process that relies on ATM and histone H2A... double - strand breaks (DSBs). Similar mechanisms of DSB silencing were involved in suppression of TEs following DNA damage, inspiring the hypothesis

  14. Functional identification of gene cluster for the aniline metabolic pathway mediated by transposable element

    Institute of Scientific and Technical Information of China (English)

    LIANG Quanfeng; Takeo Masahiro; LIN Min; CHEN Ming; XU Yuquan; ZHANG Wei; PING Shuzhen; LU Wei; SONG Xianlong; WANG Weiwei; GENG Lizhao

    2005-01-01

    A convenient and widely applicable method has been developed to clone aniline metabolic gene cluster in this study. Three positive recombinant plasmids pDA1, pDB2 and pDB11 were cloned from genomic library of aniline degradation strain AD9. The result of aniline dioxygenase (AD) activity and catechol 2,3-oxygenase (C23O) activity assay showed that pDA1 and pDB11 contain aniline dioxygenase genes and catechol 2,3-dioxygenase genes, respectively. The sequence analysis of the total 24.7-kb region revealed that this region contains 25 ORFs, of which 17 genes involve metabolism of aniline. In the gene cluster, the first five genes (tadQTA1A2B) and the subsequent gene (tadR1) were predicted to encode a multi-component aniline dioxygenase and a LysR-type regulator, respectively, while the others (tadD1C1D2C2EFGIJKL) were expected to encode meta- cleavage pathway enzymes for catechol degradation. The gene cluster was surrounded by two IS1071 sequences.

  15. An En/Spm based transposable element system for gene isolation in Arabidopsis thaliana.

    NARCIS (Netherlands)

    Aarts, M.G.M.

    1996-01-01

    At the start of the research described in this thesis, the main aim was to develop, study and apply an efficient En/Spm-I/dSpm based transposon tagging system in Arabidopsis thaliana to generate tagged mutants and to provide insights in the possibilities for future applications of such a transposon

  16. Repetitive elements, architects of genomic variation in Verticillium

    Science.gov (United States)

    Vascular wilt pathogens in the genus Verticillium show considerable variation with respect to their host ranges, genomic organization, and the variety and number of transposable elements (TEs) that they carry. These families of TE sequences were first documented in the wide host range, plant pathog...

  17. Molecular biology of maize Ac/Ds elements: an overview.

    Science.gov (United States)

    Lazarow, Katina; Doll, My-Linh; Kunze, Reinhard

    2013-01-01

    Maize Activator (Ac) is one of the prototype transposable elements of the hAT transposon superfamily, members of which were identified in plants, fungi, and animals. The autonomous Ac and nonautonomous Dissociation (Ds) elements are mobilized by the single transposase protein encoded by Ac. To date Ac/Ds transposons were shown to be functional in approximately 20 plant species and have become the most widely used transposable elements for gene tagging and functional genomics approaches in plants. In this chapter we review the biology, regulation, and transposition mechanism of Ac/Ds elements in maize and heterologous plants. We discuss the parameters that are known to influence the functionality and transposition efficiency of Ac/Ds transposons and need to be considered when designing Ac transposase expression constructs and Ds elements for application in heterologous plant species.

  18. Orthographic Reading Deficits in Dyslexic Japanese Children: Examining the Transposed-Letter Effect in the Color-Word Stroop Paradigm

    Science.gov (United States)

    Ogawa, Shino; Shibasaki, Masahiro; Isomura, Tomoko; Masataka, Nobuo

    2016-01-01

    In orthographic reading, the transposed-letter effect (TLE) is the perception of a transposed-letter position word such as “cholocate” as the correct word “chocolate.” Although previous studies on dyslexic children using alphabetic languages have reported such orthographic reading deficits, the extent of orthographic reading impairment in dyslexic Japanese children has remained unknown. This study examined the TLE in dyslexic Japanese children using the color-word Stroop paradigm comprising congruent and incongruent Japanese hiragana words with correct and transposed-letter positions. We found that typically developed children exhibited Stroop effects in Japanese hiragana words with both correct and transposed-letter positions, thus indicating the presence of TLE. In contrast, dyslexic children indicated Stroop effects in correct letter positions in Japanese words but not in transposed, which indicated an absence of the TLE. These results suggest that dyslexic Japanese children, similar to dyslexic children using alphabetic languages, may also have a problem with orthographic reading. PMID:27303331

  19. On the structure of the body of states with positive partial transpose

    Energy Technology Data Exchange (ETDEWEB)

    Szarek, Stanislaw J [Case Western Reserve University, Cleveland, OH (United States); Universite Paris VI, Paris (France); Bengtsson, Ingemar [Fysikum, Stockholm University, Stockholm (Sweden); Zyczkowski, Karol [Perimeter Institute, Waterloo, Ontario (Canada); Institute of Physics, Jagiellonian University, Cracow (Poland); Center for Theoretical Physics, Polish Academy of Sciences, Warsaw (Poland)

    2006-02-03

    We show that the convex set of separable mixed states of the 2 x 2 system is a body of a constant height. This fact is used to prove that the probability of finding a random state to be separable equals twice the probability of finding a random boundary state to be separable, provided that the random states are generated uniformly with respect to the Hilbert-Schmidt (Euclidean) measure. An analogous property holds for the set of positive-partial-transpose states for an arbitrary bipartite system. (letter to the editor)

  20. On the structure of the body of states with positive partial transpose

    CERN Document Server

    Szarek, S; Zyczkowski, K; Szarek, Stanislaw; Bengtsson, Ingemar; Zyczkowski, Karol

    2005-01-01

    We show that the convex set of separable mixed states of the 2 x 2 system is a body of constant height. This fact is used to prove that the probability to find a random state to be separable equals 2 times the probability to find a random boundary state to be separable, provided the random states are generated uniformly with respect to the Hilbert-Schmidt (Euclidean) distance. An analogous property holds for the set of positive-partial-transpose states for an arbitrary bipartite system.

  1. LETTER TO THE EDITOR: On the structure of the body of states with positive partial transpose

    Science.gov (United States)

    Szarek, Stanislaw J.; Bengtsson, Ingemar; Zyczkowski, Karol

    2006-02-01

    We show that the convex set of separable mixed states of the 2 × 2 system is a body of a constant height. This fact is used to prove that the probability of finding a random state to be separable equals twice the probability of finding a random boundary state to be separable, provided that the random states are generated uniformly with respect to the Hilbert-Schmidt (Euclidean) measure. An analogous property holds for the set of positive-partial-transpose states for an arbitrary bipartite system.

  2. Novel porcine repetitive elements

    Directory of Open Access Journals (Sweden)

    Nonneman Dan J

    2006-12-01

    Full Text Available Abstract Background Repetitive elements comprise ~45% of mammalian genomes and are increasingly known to impact genomic function by contributing to the genomic architecture, by direct regulation of gene expression and by affecting genomic size, diversity and evolution. The ubiquity and increasingly understood importance of repetitive elements contribute to the need to identify and annotate them. We set out to identify previously uncharacterized repetitive DNA in the porcine genome. Once found, we characterized the prevalence of these repeats in other mammals. Results We discovered 27 repetitive elements in 220 BACs covering 1% of the porcine genome (Comparative Vertebrate Sequencing Initiative; CVSI. These repeats varied in length from 55 to 1059 nucleotides. To estimate copy numbers, we went to an independent source of data, the BAC-end sequences (Wellcome Trust Sanger Institute, covering approximately 15% of the porcine genome. Copy numbers in BAC-ends were less than one hundred for 6 repeat elements, between 100 and 1000 for 16 and between 1,000 and 10,000 for 5. Several of the repeat elements were found in the bovine genome and we have identified two with orthologous sites, indicating that these elements were present in their common ancestor. None of the repeat elements were found in primate, rodent or dog genomes. We were unable to identify any of the replication machinery common to active transposable elements in these newly identified repeats. Conclusion The presence of both orthologous and non-orthologous sites indicates that some sites existed prior to speciation and some were generated later. The identification of low to moderate copy number repetitive DNA that is specific to artiodactyls will be critical in the assembly of livestock genomes and studies of comparative genomics.

  3. Properties and construction of extreme bipartite states having positive partial transpose

    CERN Document Server

    Chen, Lin

    2012-01-01

    We investigate the set E of extreme points of the compact convex set of PPT states (i.e., the states having positive semidefinite partial transpose) of a bipartite MxN quantum system. Let E(M,N,r) denote the subset of E consisting of states of rank r which are supported on MxN. We show that for M,N>2 the sets E(M,N,M+N-2) are nonempty. On the other hand we show that for M,N>3 the sets E(M,N,N+1) are empty. It is known that the set E(M,N,MN) is empty, and we show that also the set E(M,N,MN-1) is empty. We divide the set of all states into the good and the bad states (the definition is too technical to be given here). We show that the good states have many good properties.

  4. Mouse endogenous retroviral long terminal repeat (LTR) elements and environmental carcinogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Yang, W.K.; Ch' ang, L-Y; Myer, F.E.; Yang, M.D.; Koh, C.K.

    1988-01-01

    For the past several years, the working hypothesis of this laboratory has been that chromosomal retrovirus-related gene elements play important roles in gene-rearrangement and gene-activation events of carcinogenesis and mutagenesis induced by environmental agents. This working hypothesis is based on the concept of transposable genes as well as the recent understanding of retroviruses (RNA tumor viruses) in relation to the carcinogenesis problem. Activation of transposable gene elements has been discussed from the viewpoint of unprogrammed genomic changes in response to unanticipated genomic shocks. This view was used in considering the possibility of transposable gene elements involved in genetic changes of cancer formation in the animal. In this regard, this concept is similar to the perspectives of RNA tumor viruses, the oncogene-virogene hypothesis, and the provirus hypothesis because retroviruses replicate through DNA forms that carry long terminal repeat (LTR) sequences resembling the insertion sequences (or the IS elements) of prokaryotic transposons. The finding of oncogene myc activation in avian leukosis virus-induced leukemogenesis and proviral insertion in the mouse dilute locus mutation have also pointed to the functional similarity between retroviruses and transposable genes.

  5. Mobile genetic elements in protozoan parasites

    Indian Academy of Sciences (India)

    Sudha Bhattacharya; Abhijeet Bakre; Alok Bhattacharya

    2002-08-01

    Mobile genetic elements, by virtue of their ability to move to new chromosomal locations, are considered important in shaping the evolutionary course of the genome. They are widespread in the biological kingdom. Among the protozoan parasites several types of transposable elements are encountered. The largest variety is seen in the trypanosomatids—Trypanosoma brucei, Trypanosoma cruzi and Crithidia fasciculata. They contain elements that insert site-specifically in the spliced-leader RNA genes, and others that are dispersed in a variety of genomic locations. Giardia lamblia contains three families of transposable elements. Two of these are subtelomeric in location while one is chromosome-internal. Entamoeba histolytica has an abundant retrotransposon dispersed in the genome. Nucleotide sequence analysis of all the elements shows that they are all retrotransposons, and, with the exception of one class of elements in T. cruzi, all of them are non-long-terminal-repeat retrotransposons. Although most copies have accumulated mutations, they can potentially encode reverse transcriptase, endonuclease and nucleic-acid-binding activities. Functionally and phylogenetically they do not belong to a single lineage, showing that retrotransposons were acquired early in the evolution of protozoan parasites. Many of the potentially autonomous elements that encode their own transposition functions have nonautonomous counterparts that probably utilize the functions in trans. In this respect these elements are similar to the mammalian LINEs and SINEs (long and short interspersed DNA elements), showing a common theme in the evolution of retrotransposons. So far there is no report of a DNA transposon in any protozoan parasite. The genome projects that are under way for most of these organisms will help understand the evolution and possible function of these genetic elements.

  6. REACTIVATION POTENTIAL OF EPIGENETICALLY INACTIVE MU TRANSPOSABLE ELEMENTS OF ZEA MAYS L. DECREASES IN SUCCESSIVE GENERATIONS. (R824900)

    Science.gov (United States)

    The perspectives, information and conclusions conveyed in research project abstracts, progress reports, final reports, journal abstracts and journal publications convey the viewpoints of the principal investigator and may not represent the views and policies of ORD and EPA. Concl...

  7. Screening of repetitive motifs inside the genome of the flat oyster (Ostrea edulis): Transposable elements and short tandem repeats.

    Science.gov (United States)

    Vera, Manuel; Bello, Xabier; Álvarez-Dios, Jose-Antonio; Pardo, Belen G; Sánchez, Laura; Carlsson, Jens; Carlsson, Jeanette E L; Bartolomé, Carolina; Maside, Xulio; Martinez, Paulino

    2015-12-01

    The flat oyster (Ostrea edulis) is one of the most appreciated molluscs in Europe, but its production has been greatly reduced by the parasite Bonamia ostreae. Here, new generation genomic resources were used to analyse the repetitive fraction of the oyster genome, with the aim of developing molecular markers to face this main oyster production challenge. The resulting oyster database, consists of two sets of 10,318 and 7159 unique contigs (4.8 Mbp and 6.8 Mbp in total length) representing the oyster's genome (WG) and haemocyte transcriptome (HT), respectively. A total of 1083 sequences were identified as TE-derived, which corresponded to 4.0% of WG and 1.1% of HT. They were clustered into 142 homology groups, most of which were assigned to the Penelope order of retrotransposons, and to the Helitron and TIR DNA-transposons. Simple repeats and rRNA pseudogenes, also made a significant contribution to the oyster's genome (0.5% and 0.3% of WG and HT, respectively).The most frequent short tandem repeats identified in WG were tetranucleotide motifs while trinucleotide motifs were in HT. Forty identified microsatellite loci, 20 from each database, were selected for technical validation. Success was much lower among WG than HT microsatellites (15% vs 55%), which could reflect higher variation in anonymous regions interfering with primer annealing. All microsatellites developed adjusted to Hardy-Weinberg proportions and represent a useful tool to support future breeding programmes and to manage genetic resources of natural flat oyster beds.

  8. Genetic mapping of Ty elements in Saccharomyces cerevisiae.

    OpenAIRE

    Klein, H L; Petes, T. D.

    1984-01-01

    We used transformation to insert a selectable marker at various sites in the Saccharomyces cerevisiae genome occupied by the transposable element Ty. The vector CV9 contains the LEU2+ gene and a portion of the repeated element Ty1-17. Transformation with this plasmid resulted in integration of the vector via a reciprocal exchange using homology at the LEU2 locus or at the various Ty elements that are dispersed throughout the S. cerevisiae genome. These transformants were used to map genetical...

  9. Structure and genomic organization of I elements involved in I-R hybrid dysgenesis in Drosophila melanogaster.

    Science.gov (United States)

    Crozatier, M; Vaury, C; Busseau, I; Pelisson, A; Bucheton, A

    1988-10-11

    I-R hybrid dysgenesis in D. melanogaster is controlled by transposable elements known as I factors which terminate at their 3' ends by an A-rich sequence. Inducer strains contain active I factors. Both reactive and inducer stocks possess defective I elements. We have cloned various I elements from both categories of strains. The I elements having recently transposed in inducer strains have a structure closely related to that of active I factors. However we have isolated one such I element that is truncated at its 5' end. The I elements common to reactive and inducer strains are affected by various rearrangements and many point mutations. They do not appear to be simple derivatives of complete I factors.

  10. Spec Rekindled-A Simple Torque Correction Mechanics for Transposed Teeth in Conjunction with Pre-adjusted Edgewise Appliance System.

    Science.gov (United States)

    Singh, Harpreet; Maurya, Raj Kumar; Thakkar, Surbhi

    2016-12-01

    Complete transposition of teeth is a rather rare phenomenon. After correction of transposed and malaligned lateral incisor and canine, attainment of appropriate individual antagonistic tooth torque is indispensable, which many orthodontists consider to be a herculean task. Here, a novel method is proposed which demonstrates the use of Spec reverse torquing auxillary as an effective adjunctive aid in conjunction with pre-adjusted edgewise brackets.

  11. Spec Rekindled-A Simple Torque Correction Mechanics for Transposed Teeth in Conjunction with Pre-adjusted Edgewise Appliance System

    Science.gov (United States)

    Singh, Harpreet; Thakkar, Surbhi

    2016-01-01

    Complete transposition of teeth is a rather rare phenomenon. After correction of transposed and malaligned lateral incisor and canine, attainment of appropriate individual antagonistic tooth torque is indispensable, which many orthodontists consider to be a herculean task. Here, a novel method is proposed which demonstrates the use of Spec reverse torquing auxillary as an effective adjunctive aid in conjunction with pre-adjusted edgewise brackets. PMID:28209017

  12. Genomic sequence and activity of KS10, a transposable phage of the Burkholderia cepacia complex

    Directory of Open Access Journals (Sweden)

    Shrivastava Savita

    2008-12-01

    Full Text Available Abstract Background The Burkholderia cepacia complex (BCC is a versatile group of Gram negative organisms that can be found throughout the environment in sources such as soil, water, and plants. While BCC bacteria can be involved in beneficial interactions with plants, they are also considered opportunistic pathogens, specifically in patients with cystic fibrosis and chronic granulomatous disease. These organisms also exhibit resistance to many antibiotics, making conventional treatment often unsuccessful. KS10 was isolated as a prophage of B. cenocepacia K56-2, a clinically relevant strain of the BCC. Our objective was to sequence the genome of this phage and also determine if this prophage encoded any virulence determinants. Results KS10 is a 37,635 base pairs (bp transposable phage of the opportunistic pathogen Burkholderia cenocepacia. Genome sequence analysis and annotation of this phage reveals that KS10 shows the closest sequence homology to Mu and BcepMu. KS10 was found to be a prophage in three different strains of B. cenocepacia, including strains K56-2, J2315, and C5424, and seven tested clinical isolates of B. cenocepacia, but no other BCC species. A survey of 23 strains and 20 clinical isolates of the BCC revealed that KS10 is able to form plaques on lawns of B. ambifaria LMG 19467, B. cenocepacia PC184, and B. stabilis LMG 18870. Conclusion KS10 is a novel phage with a genomic organization that differs from most phages in that its capsid genes are not aligned into one module but rather separated by approximately 11 kb, giving evidence of one or more prior genetic rearrangements. There were no potential virulence factors identified in KS10, though many hypothetical proteins were identified with no known function.

  13. New mariner elements in Anastrepha species (Diptera: Tephritidae).

    Science.gov (United States)

    Marcon, Helena S; Domingues, D S; Coscrato, V E; Selivon, D; Perondini, A L P; Marion, C L

    2011-10-01

    Mariner-like elements (MLE) are members from class II of transposable elements also known as DNA transposons. These elements have a wide distribution among different groups of organisms, including insects, which can be explained by horizontal and vertical gene-transfer. MLE families have been described in tephritid flies and other genera. During screening for Wolbachia bacteria in fruit flies of the genus Anastrepha, we discovered two sequences related to mariner-like elements. Based on these sequences, we designed primers that allowed us to isolate and characterize two new mariner-like elements (Anmar1 and Anmar2) in Anastrepha flies. These elements, which belong to the mellifera and rosa subfamilies have a low nucleotide diversity, and are probably inactive and acquired by vertical transfer. This is the first report of mariner-like transposons in flies found in South America.

  14. General survey of hAT transposon superfamily with highlight on hobo element in Drosophila.

    Science.gov (United States)

    Ladevèze, Véronique; Chaminade, Nicole; Lemeunier, Françoise; Periquet, Georges; Aulard, Sylvie

    2012-09-01

    The hAT transposons, very abundant in all kingdoms, have a common evolutionary origin probably predating the plant-fungi-animal divergence. In this paper we present their general characteristics. Members of this superfamily belong to Class II transposable elements. hAT elements share transposase, short terminal inverted repeats and eight base-pairs duplication of genomic target. We focus on hAT elements in Drosophila, especially hobo. Its distribution, dynamics and impact on genome restructuring in laboratory strains as well as in natural populations are reported. Finally, the evolutionary history of hAT elements, their domestication and use as transgenic tools are discussed.

  15. Prokaryotic homologs of Argonaute proteins are predicted to function as key components of a novel system of defense against mobile genetic elements

    NARCIS (Netherlands)

    Makarova, K.S.; Wolf, Y.I.; Oost, van der J.; Koonin, E.V.

    2009-01-01

    ABSTRACT: BACKGROUND: In eukaryotes, RNA interference (RNAi) is a major mechanism of defense against viruses and transposable elements as well of regulating translation of endogenous mRNAs. The RNAi systems recognize the target RNA molecules via small guide RNAs that are completely or partially comp

  16. The mobile genetic element Alu in the human genome

    Energy Technology Data Exchange (ETDEWEB)

    Novick, G.E. [Florida International Univ., Miami, FL (United States); Batzer, M.A.; Deininger, P.L. [Louisiana State Univ. Medical Center, New Orleans, LA (United States)] [and others

    1996-01-01

    Genetic material has been traditionally envisioned as relatively static with the exception of occasional, often deleterious mutations. The sequence DNA-to-RNA-to-protein represented for many years the central dogma relating gene structure and function. Recently, the field of molecular genetics has provided revolutionary information on the dynamic role of repetitive elements in the function of the genetic material and the evolution of humans and other organisms. Alu sequences represent the largest family of short interspersed repetitive elements (SINEs) in humans, being present in an excess of 500,000 copies per haploid genome. Alu elements, as well as the other repetitive elements, were once considered to be useless. Today, the biology of Alu transposable elements is being widely examined in order to determine the molecular basis of a growing number of identified diseases and to provide new directions in genome mapping and biomedical research. 66 refs., 5 figs.

  17. There is no direct generalization of positive partial transpose criterion to the three-by-three case

    Science.gov (United States)

    Skowronek, Łukasz

    2016-11-01

    We show that there cannot exist a straightforward generalization of the famous positive partial transpose criterion to three-by-three systems. We call straightforward generalizations that use a finite set of positive maps and arbitrary local rotations of the tested two-partite state. In particular, we show that a family of extreme positive maps discussed in a paper by Ha and Kye [Open Syst. Inf. Dyn. 18, 323-337 (2011)], cannot be replaced by a finite set of witnesses in the task of entanglement detection in three-by-three systems. In a more mathematically elegant parlance, our result says that the convex cone of positive maps of the set of three-dimensional matrices into itself is not finitely generated as a mapping cone.

  18. Genomic Organization of the Drosophila Telomere RetrotransposableElements

    Energy Technology Data Exchange (ETDEWEB)

    George, J.A.; DeBaryshe, P.G.; Traverse, K.L.; Celniker, S. E.; Pardue, M-L.

    2006-10-16

    The emerging sequence of the heterochromatic portion of the Drosophila melanogaster genome, with the most recent update of euchromatic sequence, gives the first genome-wide view of the chromosomal distribution of the telomeric retrotransposons, HeT-A, TART, and Tahre. As expected, these elements are entirely excluded from euchromatin, although sequence fragments of HeT-A and TART 3 untranslated regions are found in nontelomeric heterochromatin on the Y chromosome. The proximal ends of HeT-A/TART arrays appear to be a transition zone because only here do other transposable elements mix in the array. The sharp distinction between the distribution of telomeric elements and that of other transposable elements suggests that chromatin structure is important in telomere element localization. Measurements reported here show (1) D. melanogaster telomeres are very long, in the size range reported for inbred mouse strains (averaging 46 kb per chromosome end in Drosophila stock 2057). As in organisms with telomerase, their length varies depending on genotype. There is also slight under-replication in polytene nuclei. (2) Surprisingly, the relationship between the number of HeT-A and TART elements is not stochastic but is strongly correlated across stocks, supporting the idea that the two elements are interdependent. Although currently assembled portions of the HeT-A/TART arrays are from the most-proximal part of long arrays, {approx}61% of the total HeT-A sequence in these regions consists of intact, potentially active elements with little evidence of sequence decay, making it likely that the content of the telomere arrays turns over more extensively than has been thought.

  19. New Drosophila P-like elements and reclassification of Drosophila P-elements subfamilies.

    Science.gov (United States)

    Loreto, Elgion L S; Zambra, Francis M B; Ortiz, Mauro F; Robe, Lizandra J

    2012-07-01

    Genomic searches for P-like transposable elements were performed (1) in silico in the 12 available Drosophila genomes and (2) by PCR using degenerate primers in 21 Neotropical Drosophila species. In silico searches revealed P-like sequences only in Drosophila persimilis and Drosophila willistoni. Sixteen new P-like elements were obtained by PCR. These sequences were added to sequences of previously described P-like elements, and a phylogenetic analysis was performed. The subfamilies of P-elements described in the literature (Canonical, M, O, T, and K) were included in the reconstructed tree, and all were monophyletic. However, we suggest that some subfamilies can be enlarged, other subdivided, and some new subfamilies may be proposed, totalizing eleven subfamilies, most of which contain new P-like sequences. Our analyses support the monophyly of P-like elements in Drosophilidae. We suggest that, once these elements need host-specific factors to be mobilizable, the horizontal transfer (HT) of P-like elements may be inhibited among more distant taxa. Nevertheless, HT among Drosophilidae species appears to be a common phenomenon.

  20. Transposing reform pedagogy into new contexts: complex instruction in remote Australia

    Science.gov (United States)

    Sullivan, Peter; Jorgensen, Robyn; Boaler, Jo; Lerman, Steve

    2013-03-01

    This article draws on the outcomes of a 4-year project where complex instruction was used as the basis for a reform in mathematics teaching in remote Aboriginal communities in Australia. The article describes the overall project in terms of the goals and aspirations for learning mathematics among remote Indigenous Australians. Knowing that the approach had been successful in a diverse setting in California, the project team sought to implement and evaluate the possibilities of such reform in a context in which the need for a culturally responsive pedagogy was critical. Elements of complex instruction offered considerable possibilities in aligning with the cultures of the remote communities, but with recognition of the possibility that some elements may not be workable in these contexts. Complex instruction also valued deep knowledge of mathematics rather than a tokenistic, impoverished mathematics. The strategies within complex instruction allowed for mathematical and cultural scaffolding to promote deep learning in mathematics. Such an approach was in line with current reforms in Indigenous education in Australia where there are high expectations of learners in order to break away from the deficit thinking that has permeated much education in remote Australia. The overall intent is to demonstrate what pedagogies are possible within the constraints of the remote context.

  1. An element

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, K.; Iidzima, K.

    1983-03-30

    An anode of a light metal is used in the element, along with an electrolyte which consists of an ether solvent and an ionogenic additive in the form of a salt of dithiocarbamic acid. The element has good discharge characteristics.

  2. Identification of the Angel-related elements in cyprinid fishes and their phylogenetic implications

    Institute of Scientific and Technical Information of China (English)

    WANG Li; HE Shunping; CHEN Yiyu

    2007-01-01

    Angel-related element belongs to the family of miniature inverted-repeat transposable elements (MITEs). In this paper we report the identification of an Angel- related element in the series Leuciscini of cyprinid fishes, which is located in the second intron of the growth hormone (GH) gene. We have also found that this element is absent in orthologous locus in the series Barbini of cyprinid fishes, that provides new evidence for the monophyly of the series Leuciscini. The insertion of Angel-related element into the GH gene might take place in the common ancestor of the series Leuciscini after its divergence from the series Barbini. The high sequence divergence and relatively broad species distribution of Angel-related elements implies that they might be ancient transposons which appeared about 26 million years ago.

  3. Repetitive elements dynamics in cell identity programming, maintenance and disease

    KAUST Repository

    Bodega, Beatrice

    2014-12-01

    The days of \\'junk DNA\\' seem to be over. The rapid progress of genomics technologies has been unveiling unexpected mechanisms by which repetitive DNA and in particular transposable elements (TEs) have evolved, becoming key issues in understanding genome structure and function. Indeed, rather than \\'parasites\\', recent findings strongly suggest that TEs may have a positive function by contributing to tissue specific transcriptional programs, in particular as enhancer-like elements and/or modules for regulation of higher order chromatin structure. Further, it appears that during development and aging genomes experience several waves of TEs activation, and this contributes to individual genome shaping during lifetime. Interestingly, TEs activity is major target of epigenomic regulation. These findings are shedding new light on the genome-phenotype relationship and set the premises to help to explain complex disease manifestation, as consequence of TEs activity deregulation.

  4. Pilot Sequencing of Onion Genomic DNA Reveals Fragments of Transposable Elements, Low Gene Densities, and Significant Gene Enrichment After Methyl Filtration

    Science.gov (United States)

    Onion (Allium cepa) is a diploid (2n=2x=16) monocot with one of the largest nuclear genomes among cultivated plants, over 6 and 16 times that of maize and rice, respectively. In this study, we sequenced onion BACs to estimate gene densities and investigate the nature and distribution of repetitive ...

  5. Genome comparison of barley and maize smut fungi reveals targeted loss of RNA silencing components and species-specific presence of transposable elements.

    Science.gov (United States)

    Laurie, John D; Ali, Shawkat; Linning, Rob; Mannhaupt, Gertrud; Wong, Philip; Güldener, Ulrich; Münsterkötter, Martin; Moore, Richard; Kahmann, Regine; Bakkeren, Guus; Schirawski, Jan

    2012-05-01

    Ustilago hordei is a biotrophic parasite of barley (Hordeum vulgare). After seedling infection, the fungus persists in the plant until head emergence when fungal spores develop and are released from sori formed at kernel positions. The 26.1-Mb U. hordei genome contains 7113 protein encoding genes with high synteny to the smaller genomes of the related, maize-infecting smut fungi Ustilago maydis and Sporisorium reilianum but has a larger repeat content that affected genome evolution at important loci, including mating-type and effector loci. The U. hordei genome encodes components involved in RNA interference and heterochromatin formation, normally involved in genome defense, that are lacking in the U. maydis genome due to clean excision events. These excision events were possibly a result of former presence of repetitive DNA and of an efficient homologous recombination system in U. maydis. We found evidence of repeat-induced point mutations in the genome of U. hordei, indicating that smut fungi use different strategies to counteract the deleterious effects of repetitive DNA. The complement of U. hordei effector genes is comparable to the other two smuts but reveals differences in family expansion and clustering. The availability of the genome sequence will facilitate the identification of genes responsible for virulence and evolution of smut fungi on their respective hosts.

  6. Genome Comparison of Barley and Maize Smut Fungi Reveals Targeted Loss of RNA Silencing Components and Species-Specific Presence of Transposable Elements[W

    Science.gov (United States)

    Laurie, John D.; Ali, Shawkat; Linning, Rob; Mannhaupt, Gertrud; Wong, Philip; Güldener, Ulrich; Münsterkötter, Martin; Moore, Richard; Kahmann, Regine; Bakkeren, Guus; Schirawski, Jan

    2012-01-01

    Ustilago hordei is a biotrophic parasite of barley (Hordeum vulgare). After seedling infection, the fungus persists in the plant until head emergence when fungal spores develop and are released from sori formed at kernel positions. The 26.1-Mb U. hordei genome contains 7113 protein encoding genes with high synteny to the smaller genomes of the related, maize-infecting smut fungi Ustilago maydis and Sporisorium reilianum but has a larger repeat content that affected genome evolution at important loci, including mating-type and effector loci. The U. hordei genome encodes components involved in RNA interference and heterochromatin formation, normally involved in genome defense, that are lacking in the U. maydis genome due to clean excision events. These excision events were possibly a result of former presence of repetitive DNA and of an efficient homologous recombination system in U. maydis. We found evidence of repeat-induced point mutations in the genome of U. hordei, indicating that smut fungi use different strategies to counteract the deleterious effects of repetitive DNA. The complement of U. hordei effector genes is comparable to the other two smuts but reveals differences in family expansion and clustering. The availability of the genome sequence will facilitate the identification of genes responsible for virulence and evolution of smut fungi on their respective hosts. PMID:22623492

  7. A novel multiplexed, probe-based quantitative PCR assay for the soybean root-rot pathogen Phytophthora sojae utilizes its transposable element

    Science.gov (United States)

    The soybean aphid, Aphis glycines Matsumura, is the most important insect pest posing a threat to soybean, Glycine max (L.) Merr., grain production in the United States. Soybean cultivars with resistance are currently being deployed to aid in management of the pest. Temperature has been reported to ...

  8. Toxic Elements

    DEFF Research Database (Denmark)

    Hajeb, Parvaneh; Shakibazadeh, Shahram; Sloth, Jens Jørgen

    2016-01-01

    Food is considered the main source of toxic element (arsenic, cadmium, lead, and mercury) exposure to humans, and they can cause major public health effects. In this chapter, we discuss the most important sources for toxic element in food and the foodstuffs which are significant contributors to h...

  9. Summary compilation of shell element performance versus formulation.

    Energy Technology Data Exchange (ETDEWEB)

    Heinstein, Martin Wilhelm; Hales, Jason Dean (Idaho National Laboratory, Idaho Falls, ID); Breivik, Nicole L.; Key, Samuel W. (FMA Development, LLC, Great Falls, MT)

    2011-07-01

    This document compares the finite element shell formulations in the Sierra Solid Mechanics code. These are finite elements either currently in the Sierra simulation codes Presto and Adagio, or expected to be added to them in time. The list of elements are divided into traditional two-dimensional, plane stress shell finite elements, and three-dimensional solid finite elements that contain either modifications or additional terms designed to represent the bending stiffness expected to be found in shell formulations. These particular finite elements are formulated for finite deformation and inelastic material response, and, as such, are not based on some of the elegant formulations that can be found in an elastic, infinitesimal finite element setting. Each shell element is subjected to a series of 12 verification and validation test problems. The underlying purpose of the tests here is to identify the quality of both the spatially discrete finite element gradient operator and the spatially discrete finite element divergence operator. If the derivation of the finite element is proper, the discrete divergence operator is the transpose of the discrete gradient operator. An overall summary is provided from which one can rank, at least in an average sense, how well the individual formulations can be expected to perform in applications encountered year in and year out. A letter grade has been assigned albeit sometimes subjectively for each shell element and each test problem result. The number of A's, B's, C's, et cetera assigned have been totaled, and a grade point average (GPA) has been computed, based on a 4.0-system. These grades, combined with a comparison between the test problems and the application problem, can be used to guide an analyst to select the element with the best shell formulation.

  10. Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence

    Energy Technology Data Exchange (ETDEWEB)

    Manning, Viola A.; Pandelova, Iovanna; Dhillon, Braham; Wilhelm, Larry J.; Goodwin, Stephen B.; Berlin, Aaron M.; Figueroa, Melania; Freitag, Michael; Hane, James K.; Henrissat, Bernard; Holman, Wade H.; Kodira, Chinnappa D.; Martin, Joel; Oliver, Richard P.; Robbertse, Barbara; Schackwitz, Wendy; Schwartz, David C.; Spatafora, Joseph W.; Turgeon, B. Gillian; Yandava, Chandri; Young, Sarah; Zhou, Shiguo; Zeng, Qiandong; Grigoriev, Igor V.; Ma, Li-Jun; Ciuffetti, Lynda M.

    2012-08-16

    Pyrenophora tritici-repentis is a necrotrophic fungus causal to the disease tan spot of wheat, whose contribution to crop loss has increased significantly during the last few decades. Pathogenicity by this fungus is attributed to the production of host-selective toxins (HST), which are recognized by their host in a genotype-specific manner. To better understand the mechanisms that have led to the increase in disease incidence related to this pathogen, we sequenced the genomes of three P. tritici-repentis isolates. A pathogenic isolate that produces two known HSTs was used to assemble a reference nuclear genome of approximately 40 Mb composed of 11 chromosomes that encode 12,141 predicted genes. Comparison of the reference genome with those of a pathogenic isolate that produces a third HST, and a nonpathogenic isolate, showed the nonpathogen genome to be more diverged than those of the two pathogens. Examination of gene-coding regions has provided candidate pathogen-specific proteins and revealed gene families that may play a role in a necrotrophic lifestyle. Analysis of transposable elements suggests that their presence in the genome of pathogenic isolates contributes to the creation of novel genes, effector diversification, possible horizontal gene transfer events, identified copy number variation, and the first example of transduplication by DNA transposable elements in fungi. Overall, comparative analysis of these genomes provides evidence that pathogenicity in this species arose through an influx of transposable elements, which created a genetically flexible landscape that can easily respond to environmental changes.

  11. La démarche RAROC utilisée en banque est-elle transposable à l’assurance-vie ?

    OpenAIRE

    Jean-Noël Ory

    2002-01-01

    L’objet de cet article est de dresser une tentative d’adaptation de la méthodologie RAROC (risk adjusted return on capital), utilisée en banque, au domaine de l’assurance-vie. Après avoir rappelé que la nécessité de constituer des fonds propres économiques est similaire pour une banque et pour une compagnie d’assurance-vie, nous rappelons la logique de construction de l’indicateur RAROC. Dans un deuxième temps, nous essayons de transposer cette logique à l’assurance-vie, en étudiant quels ser...

  12. The Ecological Genomics of Fungi: Repeated Elements in Filamentous Fungi with a Focus on Wood-Decay Fungi

    Energy Technology Data Exchange (ETDEWEB)

    Murat, Claude [INRA, Nancy, France; Payen, Thibaut [INRA, Nancy, France; Petitpierre, Denis [INRA, Nancy, France; Labbe, Jessy L [ORNL

    2013-01-01

    In the last decade, the genome of several dozen filamentous fungi have been sequenced. Interestingly, vast diversity in genome size was observed (Fig. 2.1) with 14-fold differences between the 9 Mb of the human pathogenic dandruff fungus (Malassezia globosa; Xu, Saunders, et al., 2007) and the 125 Mb of the ectomycorrhizal black truffle of P rigord (Tuber melanosporum; Martin, Kohler, et al., 2010). Recently, Raffaele and Kamoun (2012) highlighted that the genomes of several lineages of filamentous plant pathogens have been shaped by repeat-driven expansion. Indeed, repeated elements are ubiquitous in all prokaryote and eukaryote genomes; however, their frequencies can vary from just a minor percentage of the genome to more that 60 percent of the genome. Repeated elements can be classified in two major types: satellites DNA and transposable elements. In this chapter, the different types of repeated elements and how these elements can impact genome and gene repertoire will be described. Also, an intriguing link between the transposable elements richness and diversity and the ecological niche will be highlighted.

  13. Identification of Two Transposon-like Elements in Rice Wx Gene

    Institute of Scientific and Technical Information of China (English)

    王宗阳; 郑靠琴; 高继平; 王小全; 吴敏; 张景六; 洪孟民

    1994-01-01

    Rice Wx genes have been cloned and sequenced from Oryza saliva subsp. japonica (Wx-R-jp) and subsp. indica (Wx-R-id) and wild rice Oryza saliva L. f. spontanea (Wx-R-sp). Comparison of the nucleotide sequences of these three Wx genes indicates that Wx-R-jp and Wx-R-id genes contain two types of transposon-like elements, designated by RTL-1 and RTL-2. in the region of their two introns and 5’ upstream, RTL-1 shares sequence homology with valine tRNA molecules, and contains an internal promoter of RNA polymerase Ⅲ. RTL-2 forms a stem-loop structure. Both RTL-1 and RTL-2 are flanked by direct repetitive sequences. Compared with the elements that have been known transposable, RTL-1 resembles the short interspersed-repeated DNA elements (SINEs) and RTL-2 is similar to the fold-back (FB) element of trahsposon of Drosophila.

  14. PELTIER ELEMENTS

    CERN Document Server

    Tani, Laurits

    2015-01-01

    To control Peltier elements, temperature controller was used. I used TEC-1091 that was manufactured my Meerstetter Engineering. To gain control with the temperature controller, software had to be intalled on a controlling PC. There were different modes to control the Peltier: Tempererature controller to control temperature, Static current/voltage to control voltage and current and LIVE ON/OFF to auto-tune the controller respectively to the system. Also, since near the collision pipe there is much radiation, radiation-proof Peltier elements have to be used. To gain the best results, I had to find the most efficient Peltier elements and try to get their cold side to -40 degrees Celsius.

  15. Element Research.

    Science.gov (United States)

    Herald, Christine

    2001-01-01

    Describes a research assignment for 8th grade students on the elements of the periodic table. Students use web-based resources and a chemistry handbook to gather information, construct concept maps, and present the findings to the full class using the mode of their choice: a humorous story, a slideshow or gameboard, a brochure, a song, or skit.…

  16. P elements and MITE relatives in the whole genome sequence of Anopheles gambiae

    Directory of Open Access Journals (Sweden)

    Nouaud Danielle

    2006-08-01

    Full Text Available Abstract Background Miniature Inverted-repeat Terminal Elements (MITEs, which are particular class-II transposable elements (TEs, play an important role in genome evolution, because they have very high copy numbers and display recurrent bursts of transposition. The 5' and 3' subterminal regions of a given MITE family often show a high sequence similarity with the corresponding regions of an autonomous Class-II TE family. However, the sustained presence over a prolonged evolutionary time of MITEs and TE master copies able to promote their mobility has been rarely reported within the same genome, and this raises fascinating evolutionary questions. Results We report here the presence of P transposable elements with related MITE families in the Anopheles gambiae genome. Using a TE annotation pipeline we have identified and analyzed all the P sequences in the sequenced A. gambiae PEST strain genome. More than 0.49% of the genome consists of P elements and derivates. P elements can be divided into 9 different subfamilies, separated by more than 30% of nucleotide divergence. Seven of them present full length copies. Ten MITE families are associated with 6 out of the 9 Psubfamilies. Comparing their intra-element nucleotide diversities and their structures allows us to propose the putative dynamics of their emergence. In particular, one MITE family which has a hybrid structure, with ends each of which is related to a different P-subfamily, suggests a new mechanism for their emergence and their mobility. Conclusion This work contributes to a greater understanding of the relationship between full-length class-II TEs and MITEs, in this case P elements and their derivatives in the genome of A. gambiae. Moreover, it provides the most comprehensive catalogue to date of P-like transposons in this genome and provides convincing yet indirect evidence that some of the subfamilies have been recently active.

  17. The transposability of the Mediterranean-type diet in non-Mediterranean regions: application to the physician/allied health team.

    Science.gov (United States)

    Speed, C

    2004-12-01

    Studies are consistently declaring that the Mediterranean-type diet is transposable to non-Mediterranean regions. The nutritional end points of Med-type eating appear to be achievable through foods from a variety of traditions and appear to support predetermined expectations surrounding food preparation, choice, taste and sensory appeal. The broad emphasis on minimally processed plants and their products (vegetables, fruit, legumes, wholegrains, nuts, seeds and oils); low fat dairy, fish, less emphasis on animal products and removal of partially hydrogenated fats has piqued the attention of health professionals who are interested in arresting the incidence of chronic disease. The theoretical underpinnings of Med-type eating have driven new understandings in dietary guidelines, which is especially timely as well-marketed fad diets loom large on the current health horizon.

  18. Identification of misexpressed genetic elements in hybrids between Drosophila-related species

    Science.gov (United States)

    Lopez-Maestre, Hélène; Carnelossi, Elias A. G.; Lacroix, Vincent; Burlet, Nelly; Mugat, Bruno; Chambeyron, Séverine; Carareto, Claudia M. A.; Vieira, Cristina

    2017-01-01

    Crosses between close species can lead to genomic disorders, often considered to be the cause of hybrid incompatibility, one of the initial steps in the speciation process. How these incompatibilities are established and what are their causes remain unclear. To understand the initiation of hybrid incompatibility, we performed reciprocal crosses between two species of Drosophila (D. mojavensis and D. arizonae) that diverged less than 1 Mya. We performed a genome-wide transcriptomic analysis on ovaries from parental lines and on hybrids from reciprocal crosses. Using an innovative procedure of co-assembling transcriptomes, we show that parental lines differ in the expression of their genes and transposable elements. Reciprocal hybrids presented specific gene categories and few transposable element families misexpressed relative to the parental lines. Because TEs are mainly silenced by piwi-interacting RNAs (piRNAs), we hypothesize that in hybrids the deregulation of specific TE families is due to the absence of such small RNAs. Small RNA sequencing confirmed our hypothesis and we therefore propose that TEs can indeed be major players of genome differentiation and be implicated in the first steps of genomic incompatibilities through small RNA regulation. PMID:28091568

  19. MaRGEE: Move and Rotate Google Earth Elements

    Science.gov (United States)

    Dordevic, Mladen M.; Whitmeyer, Steven J.

    2015-12-01

    Google Earth is recognized as a highly effective visualization tool for geospatial information. However, there remain serious limitations that have hindered its acceptance as a tool for research and education in the geosciences. One significant limitation is the inability to translate or rotate geometrical elements on the Google Earth virtual globe. Here we present a new JavaScript web application to "Move and Rotate Google Earth Elements" (MaRGEE). MaRGEE includes tools to simplify, translate, and rotate elements, add intermediate steps to a transposition, and batch process multiple transpositions. The transposition algorithm uses spherical geometry calculations, such as the haversine formula, to accurately reposition groups of points, paths, and polygons on the Google Earth globe without distortion. Due to the imminent deprecation of the Google Earth API and browser plugin, MaRGEE uses a Google Maps interface to facilitate and illustrate the transpositions. However, the inherent spatial distortions that result from the Google Maps Web Mercator projection are not apparent once the transposed elements are saved as a KML file and opened in Google Earth. Potential applications of the MaRGEE toolkit include tectonic reconstructions, the movements of glaciers or thrust sheets, and time-based animations of other large- and small-scale geologic processes.

  20. Evolutionary origin of Rosaceae-specific active non-autonomous hAT elements and their contribution to gene regulation and genomic structural variation.

    Science.gov (United States)

    Wang, Lu; Peng, Qian; Zhao, Jianbo; Ren, Fei; Zhou, Hui; Wang, Wei; Liao, Liao; Owiti, Albert; Jiang, Quan; Han, Yuepeng

    2016-05-01

    Transposable elements account for approximately 30 % of the Prunus genome; however, their evolutionary origin and functionality remain largely unclear. In this study, we identified a hAT transposon family, termed Moshan, in Prunus. The Moshan elements consist of three types, aMoshan, tMoshan, and mMoshan. The aMoshan and tMoshan types contain intact or truncated transposase genes, respectively, while the mMoshan type is miniature inverted-repeat transposable element (MITE). The Moshan transposons are unique to Rosaceae, and the copy numbers of different Moshan types are significantly correlated. Sequence homology analysis reveals that the mMoshan MITEs are direct deletion derivatives of the tMoshan progenitors, and one kind of mMoshan containing a MuDR-derived fragment were amplified predominately in the peach genome. The mMoshan sequences contain cis-regulatory elements that can enhance gene expression up to 100-fold. The mMoshan MITEs can serve as potential sources of micro and long noncoding RNAs. Whole-genome re-sequencing analysis indicates that mMoshan elements are highly active, and an insertion into S-haplotype-specific F-box gene was reported to cause the breakdown of self-incompatibility in sour cherry. Taken together, all these results suggest that the mMoshan elements play important roles in regulating gene expression and driving genomic structural variation in Prunus.

  1. Profile of the mosaic element BTMR1 in the genome of the bumble bee Bombus terrestris (Hymenoptera: Apidae).

    Science.gov (United States)

    Casteret, S; Moiré, N; Aupinel, P; Tasei, J-N; Bigot, Y

    2011-04-01

    Co-evolution involving a mariner transposon, Botmar1 and the other repeats contained in the Bombus terrestris genome was investigated. We found that the 5'-region of Botmar1 forms one of the components of a mosaic element, known as B. terrestris mosaic repeat 1 (BTMR1), which is also composed of inner segments originating from two different retrotransposons and a pseudogene corresponding to an RNA methyltransferase cDNA. The fact that BTMR1 is interspersed within chromosomes and the differences in its abundance in different species indicate that it is very probably a mobile element. Nevertheless, the absences of direct or inverted repeats at its ends and of target site duplication indicate that its mobility is not ensured by a cardinal transposable element, but putatively by a Crypton-like element.

  2. Characterization of new IS elements and studies of their dispersion in two subspecies of Leifsonia xyli

    Directory of Open Access Journals (Sweden)

    Monteiro-Vitorello Claudia B

    2008-07-01

    Full Text Available Abstract Background Leifsonia xyli is a xylem-inhabiting bacterial species comprised of two subspecies: L. xyli subsp. xyli (Lxx and L. xyli subsp. cynodontis (Lxc. Lxx is the causal agent of ratoon stunting disease in sugarcane commercial fields and Lxc colonizes the xylem of several grasses causing either mild or no symptoms of disease. The completely sequenced genome of Lxx provided insights into its biology and pathogenicity. Since IS elements are largely reported as an important source of bacterial genome diversification and nothing is known about their role in chromosome architecture of L. xyli, a comparative analysis of Lxc and Lxx elements was performed. Results Sample sequencing of Lxc genome and comparative analysis with Lxx complete DNA sequence revealed a variable number of IS transposable elements acting upon genomic diversity. A detailed characterization of Lxc IS elements and a comparative review with IS elements of Lxx are presented. Each genome showed a unique set of elements although related to same IS families when considering features such as similarity among transposases, inverted and direct repeats, and element size. Most of the Lxc and Lxx IS families assigned were reported to maintain transposition at low levels using translation regulatory mechanisms, consistent with our in silico analysis. Some of the IS elements were found associated with rearrangements and specific regions of each genome. Differences were also found in the effect of IS elements upon insertion, although none of the elements were preferentially associated with gene disruption. A survey of transposases among genomes of Actinobacteria showed no correlation between phylogenetic relatedness and distribution of IS families. By using Southern hybridization, we suggested that diversification of Lxc isolates is also mediated by insertion sequences in probably recent events. Conclusion Collectively our data indicate that transposable elements are involved in

  3. MAR elements and transposons for improved transgene integration and expression.

    Science.gov (United States)

    Ley, Déborah; Harraghy, Niamh; Le Fourn, Valérie; Bire, Solenne; Girod, Pierre-Alain; Regamey, Alexandre; Rouleux-Bonnin, Florence; Bigot, Yves; Mermod, Nicolas

    2013-01-01

    Reliable and long-term expression of transgenes remain significant challenges for gene therapy and biotechnology applications, especially when antibiotic selection procedures are not applicable. In this context, transposons represent attractive gene transfer vectors because of their ability to promote efficient genomic integration in a variety of mammalian cell types. However, expression from genome-integrating vectors may be inhibited by variable gene transcription and/or silencing events. In this study, we assessed whether inclusion of two epigenetic control elements, the human Matrix Attachment Region (MAR) 1-68 and X-29, in a piggyBac transposon vector, may lead to more reliable and efficient expression in CHO cells. We found that addition of the MAR 1-68 at the center of the transposon did not interfere with transposition frequency, and transgene expressing cells could be readily detected from the total cell population without antibiotic selection. Inclusion of the MAR led to higher transgene expression per integrated copy, and reliable expression could be obtained from as few as 2-4 genomic copies of the MAR-containing transposon vector. The MAR X-29-containing transposons was found to mediate elevated expression of therapeutic proteins in polyclonal or monoclonal CHO cell populations using a transposable vector devoid of selection gene. Overall, we conclude that MAR and transposable vectors can be used to improve transgene expression from few genomic transposition events, which may be useful when expression from a low number of integrated transgene copies must be obtained and/or when antibiotic selection cannot be applied.

  4. MAR elements and transposons for improved transgene integration and expression.

    Directory of Open Access Journals (Sweden)

    Déborah Ley

    Full Text Available Reliable and long-term expression of transgenes remain significant challenges for gene therapy and biotechnology applications, especially when antibiotic selection procedures are not applicable. In this context, transposons represent attractive gene transfer vectors because of their ability to promote efficient genomic integration in a variety of mammalian cell types. However, expression from genome-integrating vectors may be inhibited by variable gene transcription and/or silencing events. In this study, we assessed whether inclusion of two epigenetic control elements, the human Matrix Attachment Region (MAR 1-68 and X-29, in a piggyBac transposon vector, may lead to more reliable and efficient expression in CHO cells. We found that addition of the MAR 1-68 at the center of the transposon did not interfere with transposition frequency, and transgene expressing cells could be readily detected from the total cell population without antibiotic selection. Inclusion of the MAR led to higher transgene expression per integrated copy, and reliable expression could be obtained from as few as 2-4 genomic copies of the MAR-containing transposon vector. The MAR X-29-containing transposons was found to mediate elevated expression of therapeutic proteins in polyclonal or monoclonal CHO cell populations using a transposable vector devoid of selection gene. Overall, we conclude that MAR and transposable vectors can be used to improve transgene expression from few genomic transposition events, which may be useful when expression from a low number of integrated transgene copies must be obtained and/or when antibiotic selection cannot be applied.

  5. Characterization of irritans mariner-like elements in the olive fruit fly Bactrocera oleae (Diptera: Tephritidae): evolutionary implications

    Science.gov (United States)

    Ben Lazhar-Ajroud, Wafa; Caruso, Aurore; Mezghani, Maha; Bouallegue, Maryem; Tastard, Emmanuelle; Denis, Françoise; Rouault, Jacques-Deric; Makni, Hanem; Capy, Pierre; Chénais, Benoît; Makni, Mohamed; Casse, Nathalie

    2016-08-01

    Genomic variation among species is commonly driven by transposable element (TE) invasion; thus, the pattern of TEs in a genome allows drawing an evolutionary history of the studied species. This paper reports in vitro and in silico detection and characterization of irritans mariner-like elements (MLEs) in the genome and transcriptome of Bactrocera oleae (Rossi) (Diptera: Tephritidae). Eleven irritans MLE sequences have been isolated in vitro using terminal inverted repeats (TIRs) as primers, and 215 have been extracted in silico from the sequenced genome of B. oleae. Additionally, the sequenced genomes of Bactrocera tryoni (Froggatt) and Bactrocera cucurbitae (Diptera: Tephritidae) have been explored to identify irritans MLEs. A total of 129 sequences from B. tryoni have been extracted, while the genome of B. cucurbitae appears probably devoid of irritans MLEs. All detected irritans MLEs are defective due to several mutations and are clustered together in a monophyletic group suggesting a common ancestor. The evolutionary history and dynamics of these TEs are discussed in relation with the phylogenetic distribution of their hosts. The knowledge on the structure, distribution, dynamic, and evolution of irritans MLEs in Bactrocera species contributes to the understanding of both their evolutionary history and the invasion history of their hosts. This could also be the basis for genetic control strategies using transposable elements.

  6. Transposon display supports transpositional activity of elements in species of the saltans group of Drosophila

    Indian Academy of Sciences (India)

    Nathalia De Setta; Ana Paula Pimentel Costa; Fabrício Ramon Lopes; Marie-Anne Van Sluys; Cláudia Márcia Aparecida Carareto

    2007-01-01

    Mobilization of two element subfamilies (canonical and O-type) from Drosophila sturtevanti and D. saltans was evaluated for copy number and transposition activity using the transposon display (TD) technique. Pairwise distances between strains regarding the insertion polymorphism profile were estimated. Amplification of the element based on copy number estimates was highly variable among the strains (D. sturtevanti, canonical 20.11, O-type 9.00; D. saltans, canonical 16.4, O-type 12.60 insertions, on average). The larger values obtained by TD compared to our previous data by Southern blotting support the higher sensitivity of TD over Southern analysis for estimating transposable element copy numbers. The higher numbers of the canonical element and the greater divergence in its distribution within the genome of D. sturtevanti (24.8%) compared to the O-type (16.7%), as well as the greater divergence in the distribution of the canonical P element, between the D. sturtevanti (24.8%) and the D. saltans (18.3%) strains, suggest that the canonical element occupies more sites within the D. sturtevanti genome, most probably due to recent transposition activity. These data corroborate the hypothesis that the O-type is the oldest subfamily of elements in the saltans group and suggest that the canonical element is or has been transpositionally active until more recently in D. sturtevanti.

  7. Mobile DNA Elements: The Seeds of Organic Complexity on Earth.

    Science.gov (United States)

    Habibi, Laleh; Pedram, Mehrdad; AmirPhirozy, Akbar; Bonyadi, Khadijeh

    2015-10-01

    Mobile DNA or transposable elements (TEs) are genomic sequences capable of moving themselves independently into different parts of the genome. Viral invasion of eukaryotic genomes is assumed to be the main source of TEs. Selfish transposition of these elements could be a serious threat to the host cell, as they can insert themselves into the middle of coding genes and/or induce genomic instability. In response, through millions of years of evolution, cells have come up with various mechanisms such as genomic imprinting, DNA methylation, heterochromatin formation, and RNA interference to deactivate them. Interestingly, these processes have also greatly contributed to important cellular functions involved in cell differentiation, development, and differential gene expression. Propagation of TE copies during the course of evolution have resulted in increasing the genome size and providing proper space and flexibility in shaping the genome by creating new genes and establishing essential cellular structures such as heterochromatin, centromere, and telomeres. Yet, these elements are mostly labeled for playing a role in pathogenesis of human diseases. Here, we attempt to introduce TEs as factors necessary for making us human rather than just selfish sequences or obligatory guests invading our DNA.

  8. piRNA pathway targets active LINE1 elements to establish the repressive H3K9me3 mark in germ cells.

    Science.gov (United States)

    Pezic, Dubravka; Manakov, Sergei A; Sachidanandam, Ravi; Aravin, Alexei A

    2014-07-01

    Transposable elements (TEs) occupy a large fraction of metazoan genomes and pose a constant threat to genomic integrity. This threat is particularly critical in germ cells, as changes in the genome that are induced by TEs will be transmitted to the next generation. Small noncoding piwi-interacting RNAs (piRNAs) recognize and silence a diverse set of TEs in germ cells. In mice, piRNA-guided transposon repression correlates with establishment of CpG DNA methylation on their sequences, yet the mechanism and the spectrum of genomic targets of piRNA silencing are unknown. Here we show that in addition to DNA methylation, the piRNA pathway is required to maintain a high level of the repressive H3K9me3 histone modification on long interspersed nuclear elements (LINEs) in germ cells. piRNA-dependent chromatin repression targets exclusively full-length elements of actively transposing LINE families, demonstrating the remarkable ability of the piRNA pathway to recognize active elements among the large number of genomic transposon fragments.

  9. Discrete Element Modeling

    Energy Technology Data Exchange (ETDEWEB)

    Morris, J; Johnson, S

    2007-12-03

    The Distinct Element Method (also frequently referred to as the Discrete Element Method) (DEM) is a Lagrangian numerical technique where the computational domain consists of discrete solid elements which interact via compliant contacts. This can be contrasted with Finite Element Methods where the computational domain is assumed to represent a continuum (although many modern implementations of the FEM can accommodate some Distinct Element capabilities). Often the terms Discrete Element Method and Distinct Element Method are used interchangeably in the literature, although Cundall and Hart (1992) suggested that Discrete Element Methods should be a more inclusive term covering Distinct Element Methods, Displacement Discontinuity Analysis and Modal Methods. In this work, DEM specifically refers to the Distinct Element Method, where the discrete elements interact via compliant contacts, in contrast with Displacement Discontinuity Analysis where the contacts are rigid and all compliance is taken up by the adjacent intact material.

  10. Variable transposition of eight maize activator (ac) elements located on the short arm of chromosome 1.

    Science.gov (United States)

    Sheridan, William F

    2011-09-01

    Eight Activator (Ac) transposable elements mapped to the maize chromosome arm 1S were assessed for Ac transposition rates. For each of the Ac stocks, plants homozygous for the single Ac element and the Ds reporter r1-sc:m3 on chromosome 10 were crossed as females by a homozygous r1-sc:m3 tester color-converted W22 line. The resulting ears produced mostly coarsely spotted kernels and a low frequency of either near-colorless fine-spotted kernels or nonspotted kernels. The relative frequency of these two types of near-colorless kernels differed among the eight Ac stocks. The extent to which increased Ac dosage results in nonspotted kernels may be Ac-specific. Although all of the Ac elements are in near-isogenic inbred W22 lines, they varied to a large extent in their transposition frequency. These differences might possibly result from structural differences among the Ac elements. Because one pair of Ac elements derived from Ac33 on chromosome arm 5S differed about 13-fold in transposition frequency and a second pair of Ac elements derived from Ac12 on chromosome arm 1S differed about 3-fold in transposition frequency, this is not a likely explanation for all eight Ac elements. The data presented here support the notion that the differences in transposition frequency of the eight Ac elements may be a reflection of variability in Ac transcription or accessibility of the transposase to the Ac element, resulting from differences in the chromatin environments wherein the Ac elements are located. This is the first report of variability in transposition rates among different Ac donor lines.

  11. A conserved nuclear element with a role in mammalian gene regulation.

    Science.gov (United States)

    Donnelly, S R; Hawkins, T E; Moss, S E

    1999-09-01

    Mammalian genomes contain numerous fragments of DNA that are derived from inactivated transposable elements. The accumulation and persistence of these elements is generally attributed to transposase activity rather than through possession or acquisition of a function of value to the host genome. Here we describe such a repetitive element, named ALF (forannexin VILINE-2fragment), comprising 130 bp of DNA derived from a LINE-2 sequence, which functions as a potent T-cell-specific silencer. The expansion of the DNA database arising as a result of the human genome sequencing project enabled us to identify ALF in, or close to, several well characterized genes including those for annexin VI, interleukin-4 and protein kinase C-beta. A systematic analysis of the entire LINE-2 sequence revealed that ALF, and not other regions of the LINE-2 sequence, was especially highly represented in the human genome. Acquisition of a function by this repetitive element may explain its abundance. These data show that a conserved fragment of an interspersed nuclear element has the potential to modulate gene expression, a discovery that has broad implications for the way in which we view so-called 'junk' DNA and our understanding of eukaryotic gene regulation.

  12. The Gypsy Database (GyDB) of mobile genetic elements: release 2.0.

    Science.gov (United States)

    Llorens, Carlos; Futami, Ricardo; Covelli, Laura; Domínguez-Escribá, Laura; Viu, Jose M; Tamarit, Daniel; Aguilar-Rodríguez, Jose; Vicente-Ripolles, Miguel; Fuster, Gonzalo; Bernet, Guillermo P; Maumus, Florian; Munoz-Pomer, Alfonso; Sempere, Jose M; Latorre, Amparo; Moya, Andres

    2011-01-01

    This article introduces the second release of the Gypsy Database of Mobile Genetic Elements (GyDB 2.0): a research project devoted to the evolutionary dynamics of viruses and transposable elements based on their phylogenetic classification (per lineage and protein domain). The Gypsy Database (GyDB) is a long-term project that is continuously progressing, and that owing to the high molecular diversity of mobile elements requires to be completed in several stages. GyDB 2.0 has been powered with a wiki to allow other researchers participate in the project. The current database stage and scope are long terminal repeats (LTR) retroelements and relatives. GyDB 2.0 is an update based on the analysis of Ty3/Gypsy, Retroviridae, Ty1/Copia and Bel/Pao LTR retroelements and the Caulimoviridae pararetroviruses of plants. Among other features, in terms of the aforementioned topics, this update adds: (i) a variety of descriptions and reviews distributed in multiple web pages; (ii) protein-based phylogenies, where phylogenetic levels are assigned to distinct classified elements; (iii) a collection of multiple alignments, lineage-specific hidden Markov models and consensus sequences, called GyDB collection; (iv) updated RefSeq databases and BLAST and HMM servers to facilitate sequence characterization of new LTR retroelement and caulimovirus queries; and (v) a bibliographic server. GyDB 2.0 is available at http://gydb.org.

  13. Data Element Registry Services

    Data.gov (United States)

    U.S. Environmental Protection Agency — Data Element Registry Services (DERS) is a resource for information about value lists (aka code sets / pick lists), data dictionaries, data elements, and EPA data...

  14. On Element SDD Approximability

    CERN Document Server

    Avron, Haim; Toledo, Sivan

    2009-01-01

    This short communication shows that in some cases scalar elliptic finite element matrices cannot be approximated well by an SDD matrix. We also give a theoretical analysis of a simple heuristic method for approximating an element by an SDD matrix.

  15. Element-ary Development.

    Science.gov (United States)

    Schamp, Homer W., Jr.

    1989-01-01

    Describes the historic development of the periodic table from the four-element theory to the Lavoisier's table. Presents a table listing the old and new names of chemicals and the Lavoisier's table of elements. Lists two references. (YP)

  16. The Mechanisms of Host Restriction on LINE-1 Element%宿主限制长散布元件转座活性的机制

    Institute of Scientific and Technical Information of China (English)

    梁志滨; 梁臣; 耿运琪; 乔文涛

    2013-01-01

    Abstract Approximately 45% of the human genome is occupied by transposable elements.Transposable elements have had an important impact on the structure and function of human genomes.Some of these elements are still capable of transposing,and their movements often cause diseases.Long interspersed nuclear element 1 (LINE-1) is the only active autonomous transposon in humans,and it mediates the mobilization of nonautonomous elements.Recently,great progress has been made in understanding the biology of LINE-1.Here,we briefly review the structure of LINE-1,the mechanism of its mobilization,and its impact on human genome and human health.We also highlight the mechanisms that host cell has evolved to control LINE-1 replication.Given the similarity of the life cycle between LINE-1 and retroviruses,the LINE-1 research may also shed new light on the biology of retroviruses.%转座子约占人类基因组的45%,对基因组的结构与功能造成了重大的影响.一部分转座子现在仍然具有活性,它们的转座能引发疾病.长散布元件(long interspersed element-1,LINE-1)是现今在人类基因组中发现的唯一具有活性并能自主转座的转座子,并能介导非自主转座的元件进行转座.近年来,LINE-1的研究有新的突破,本文简述了LINE-1的结构、转座机制及对基因组的影响,重点总结和分析宿主对LINE-1的限制机制.由于LINE-1的生活周期与逆转录病毒有相似之处,也希望能够为宿主抗病毒的研究提供线索.

  17. Mobility and generation of mosaic non-autonomous transposons by Tn3-derived inverted-repeat miniature elements (TIMEs.

    Directory of Open Access Journals (Sweden)

    Magdalena Szuplewska

    Full Text Available Functional transposable elements (TEs of several Pseudomonas spp. strains isolated from black shale ore of Lubin mine and from post-flotation tailings of Zelazny Most in Poland, were identified using a positive selection trap plasmid strategy. This approach led to the capture and characterization of (i 13 insertion sequences from 5 IS families (IS3, IS5, ISL3, IS30 and IS1380, (ii isoforms of two Tn3-family transposons--Tn5563a and Tn4662a (the latter contains a toxin-antitoxin system, as well as (iii non-autonomous TEs of diverse structure, ranging in size from 262 to 3892 bp. The non-autonomous elements transposed into AT-rich DNA regions and generated 5- or 6-bp sequence duplications at the target site of transposition. Although these TEs lack a transposase gene, they contain homologous 38-bp-long terminal inverted repeat sequences (IRs, highly conserved in Tn5563a and many other Tn3-family transposons. The simplest elements of this type, designated TIMEs (Tn3 family-derived Inverted-repeat Miniature Elements (262 bp, were identified within two natural plasmids (pZM1P1 and pLM8P2 of Pseudomonas spp. It was demonstrated that TIMEs are able to mobilize segments of plasmid DNA for transposition, which results in the generation of more complex non-autonomous elements, resembling IS-driven composite transposons in structure. Such transposon-like elements may contain different functional genetic modules in their core regions, including plasmid replication systems. Another non-autonomous element "captured" with a trap plasmid was a TIME derivative containing a predicted resolvase gene and a res site typical for many Tn3-family transposons. The identification of a portable site-specific recombination system is another intriguing example confirming the important role of non-autonomous TEs of the TIME family in shuffling genetic information in bacterial genomes. Transposition of such mosaic elements may have a significant impact on diversity and

  18. P elements and the determinants of hybrid dysgenesis have different dynamics of propagation in Drosophila melanogaster populations.

    Science.gov (United States)

    Ignatenko, Olesia M; Zakharenko, Lyudmila P; Dorogova, Natalia V; Fedorova, Svetlana A

    2015-12-01

    Intraspecific hybrid dysgenesis (HD) appears after some strains of D. melanogaster are crossed. The predominant idea is that the movement of transposable P elements causes HD. It is believed that P elements appeared in the D. melanogaster genome in the middle of the last century by horizontal transfer, simultaneously with the appearance of HD determinants. A subsequent simultaneous expansion of HD determinants and P elements occurred. We analyzed the current distribution of HD determinants in natural populations of D. melanogaster and found no evidence of their further spread. However, full-sized P elements were identified in the genomes of all analyzed natural D. melanogaster strains independent of their cytotypes. Thus, the expansion of P elements does not correlate with the expansion of HD determinants. We found that the ovaries of dysgenic females did not contain germ cells despite the equal number of primordial germ cells in early stages in dysgenic and non-dysgenic embryos. We propose that HD does not result from DNA damage caused by P element transposition, but it would be the disruption in the regulation of dysgenic ovarian formation that causes the dysgenic phenotypes.

  19. Rare (Earth Elements [score

    Directory of Open Access Journals (Sweden)

    Camilo Méndez

    2014-12-01

    Full Text Available Rare (Earth Elements is a cycle of works for solo piano. The cycle was inspired by James Dillon’s Book of Elements (Vol. I-V. The complete cycle will consist of 14 pieces; one for each selected rare (earth element. The chosen elements are Neodymium, Erbium, Tellurium, Hafnium, Tantalum, Technetium, Indium, Dysprosium, Lanthanium, Cerium, Europium, Terbium, Yttrium and Darmstadtium. These elements were selected due to their special atomic properties that in many cases make them extremely valuable for the development of new technologies, and also because of their scarcity. To date, only 4 works have been completed Yttrium, Technetium, Indium and Tellurium.

  20. Musikalske elementer i musikaler

    OpenAIRE

    Jensen, Linnea Reitan

    2014-01-01

    Denne masteroppgaven undersøker hvordan musikalske elementer kan bli brukt i musikaler for å påvirke den dramaturgiske helheten. Gjennom både musikalsk og dramaturgisk analyse viser jeg hvordan elementer i musikk kan ha innvirkning på forestillingens dramaturgi. In this master thesis I am aiming to examine the musical elements used in the songs in musicals. Music is an important element in the musical, and therefore I want to look at how some musical elements can contribute to the musical'...

  1. Bioinformatic analysis of Entamoeba histolytica SINE1 elements

    Directory of Open Access Journals (Sweden)

    Butcher Sarah A

    2010-05-01

    Full Text Available Abstract Background Invasive amoebiasis, caused by infection with the human parasite Entamoeba histolytica remains a major cause of morbidity and mortality in some less-developed countries. Genetically E. histolytica exhibits a number of unusual features including having approximately 20% of its genome comprised of repetitive elements. These include a number of families of SINEs - non-autonomous elements which can, however, move with the help of partner LINEs. In many eukaryotes SINE mobility has had a profound effect on gene expression; in this study we concentrated on one such element - EhSINE1, looking in particular for evidence of recent transposition. Results EhSINE1s were detected in the newly reassembled E. histolytica genome by searching with a Hidden Markov Model developed to encapsulate the key features of this element; 393 were detected. Examination of their sequences revealed that some had an internal structure showing one to four 26-27 nt repeats. Members of the different classes differ in a number of ways and in particular those with two internal repeats show the properties expected of fairly recently transposed SINEs - they are the most homogeneous in length and sequence, they have the longest (i.e. the least decayed target site duplications and are the most likely to show evidence (in a cDNA library of active transcription. Furthermore we were able to identify 15 EhSINE1s (6 pairs and one triplet which appeared to be identical or very nearly so but inserted into different sites in the genome; these provide good evidence that if mobility has now ceased it has only done so very recently. Conclusions Of the many families of repetitive elements present in the genome of E. histolytica we have examined in detail just one - EhSINE1. We have shown that there is evidence for waves of transposition at different points in the past and no evidence that mobility has entirely ceased. There are many aspects of the biology of this parasite which

  2. Identification of genetic elements associated with EPSPs gene amplification.

    Directory of Open Access Journals (Sweden)

    Todd A Gaines

    Full Text Available Weed populations can have high genetic plasticity and rapid responses to environmental selection pressures. For example, 100-fold amplification of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS gene evolved in the weed species Amaranthus palmeri to confer resistance to glyphosate, the world's most important herbicide. However, the gene amplification mechanism is unknown. We sequenced the EPSPS gene and genomic regions flanking EPSPS loci in A. palmeri, and searched for mobile genetic elements or repetitive sequences. The EPSPS gene was 10,229 bp, containing 8 exons and 7 introns. The gene amplification likely proceeded through a DNA-mediated mechanism, as introns exist in the amplified gene copies and the entire amplified sequence is at least 30 kb in length. Our data support the presence of two EPSPS loci in susceptible (S A. palmeri, and that only one of these was amplified in glyphosate-resistant (R A. palmeri. The EPSPS gene amplification event likely occurred recently, as no sequence polymorphisms were found within introns of amplified EPSPS copies from R individuals. Sequences with homology to miniature inverted-repeat transposable elements (MITEs were identified next to EPSPS gene copies only in R individuals. Additionally, a putative Activator (Ac transposase and a repetitive sequence region were associated with amplified EPSPS genes. The mechanism controlling this DNA-mediated amplification remains unknown. Further investigation is necessary to determine if the gene amplification may have proceeded via DNA transposon-mediated replication, and/or unequal recombination between different genomic regions resulting in replication of the EPSPS gene.

  3. Monitoring Long Interspersed Nuclear Element 1 Expression During Mouse Embryonic Stem Cell Differentiation.

    Science.gov (United States)

    Bodak, Maxime; Ciaudo, Constance

    2016-01-01

    Long Interspersed Elements-1 (LINE-1 or L1) are a class of transposable elements which account for almost 19 % of the mouse genome. This represents around 600,000 L1 fragments, among which it is estimated that 3000 intact copies still remain capable to retrotranspose and to generate deleterious mutation by insertion into genomic coding region. In differentiated cells, full length L1 are transcriptionally repressed by DNA methylation. However at the blastocyst stage, L1 elements are subject to a demethylation wave and able to be expressed and to be inserted into new genomic locations. Mouse Embryonic Stem Cells (mESCs) are pluripotent stem cells derived from the inner cell mass of blastocysts. Mouse ESCs can be maintained undifferentiated under controlled culture conditions or induced into the three primary germ layers, therefore they represent a suitable model to follow mechanisms involved in L1 repression during the process of differentiation of mESCs. This protocol presents how to maintain culture of undifferentiated mESCs, induce their differentiation, and monitor L1 expression at the transcriptional and translational levels. L1 transcriptional levels are assessed by real-time qRT-PCR performed on total RNA extracts using specific L1 primers and translation levels are measured by Western blot analysis of L1 protein ORF1 using a specific L1 antibody.

  4. Finite element procedures

    CERN Document Server

    Bathe, Klaus-Jürgen

    2015-01-01

    Finite element procedures are now an important and frequently indispensable part of engineering analyses and scientific investigations. This book focuses on finite element procedures that are very useful and are widely employed. Formulations for the linear and nonlinear analyses of solids and structures, fluids, and multiphysics problems are presented, appropriate finite elements are discussed, and solution techniques for the governing finite element equations are given. The book presents general, reliable, and effective procedures that are fundamental and can be expected to be in use for a long time. The given procedures form also the foundations of recent developments in the field.

  5. Neutral Theory Predicts the Relative Abundance and Diversity of Genetic Elements in a Broad Array of Eukaryotic Genomes

    Science.gov (United States)

    Serra, François; Becher, Verónica; Dopazo, Hernán

    2013-01-01

    It is universally true in ecological communities, terrestrial or aquatic, temperate or tropical, that some species are very abundant, others are moderately common, and the majority are rare. Likewise, eukaryotic genomes also contain classes or “species” of genetic elements that vary greatly in abundance: DNA transposons, retrotransposons, satellite sequences, simple repeats and their less abundant functional sequences such as RNA or genes. Are the patterns of relative species abundance and diversity similar among ecological communities and genomes? Previous dynamical models of genomic diversity have focused on the selective forces shaping the abundance and diversity of transposable elements (TEs). However, ideally, models of genome dynamics should consider not only TEs, but also the diversity of all genetic classes or “species” populating eukaryotic genomes. Here, in an analysis of the diversity and abundance of genetic elements in >500 eukaryotic chromosomes, we show that the patterns are consistent with a neutral hypothesis of genome assembly in virtually all chromosomes tested. The distributions of relative abundance of genetic elements are quite precisely predicted by the dynamics of an ecological model for which the principle of functional equivalence is the main assumption. We hypothesize that at large temporal scales an overarching neutral or nearly neutral process governs the evolution of abundance and diversity of genetic elements in eukaryotic genomes. PMID:23798991

  6. Main: -300ELEMENT [PLACE

    Lifescience Database Archive (English)

    Full Text Available -300ELEMENT S000122 11-May-2006 (last modified) kehi Present upstream of the promot...er from the B-hordein gene of barley and the alpha-gliadin, gamma-gliadin, and low molecular weight glutenin... genes of wheat; See S000001 -300CORE; See S000002 -300MOTIF; -300 element; hordein; gliadin; glutenin; seed; wheat (Triticum aestivum) TGHAAARK ...

  7. A dry element

    Energy Technology Data Exchange (ETDEWEB)

    Kimura, T.; Ota, A.

    1983-08-11

    The agglomerate for the element is made from activated charcoal powder, an electrically conducting additive and a neutral electrolyte. The activated charcoal makes up 30 to 50 percent of the weight of the agglomerate. It is a mixture of hydrophobized and unhydrophobized powder in a ratio of 85 to 70 to 15 to 30. The element has high discharge characteristics.

  8. A battery element

    Energy Technology Data Exchange (ETDEWEB)

    Nakai, M.; Koboyasi, S.; Oisi, K.; Okadzaki, R.; Ota, A.

    1983-07-29

    An anode made of an alkaline or an alkaline earth metal and an electrolyte based on an organic solvent are used in the element. A mixture of Mn203 and Mn304 in a 9 to 1 to 3 to 7 ratio serves as the cathode. The element has a stable discharge curve at a nominal voltage of 1.5 volts.

  9. Enrichment analysis of Alu elements with different spatial chromatin proximity in the human genome.

    Science.gov (United States)

    Gu, Zhuoya; Jin, Ke; Crabbe, M James C; Zhang, Yang; Liu, Xiaolin; Huang, Yanyan; Hua, Mengyi; Nan, Peng; Zhang, Zhaolei; Zhong, Yang

    2016-04-01

    Transposable elements (TEs) have no longer been totally considered as "junk DNA" for quite a time since the continual discoveries of their multifunctional roles in eukaryote genomes. As one of the most important and abundant TEs that still active in human genome, Alu, a SINE family, has demonstrated its indispensable regulatory functions at sequence level, but its spatial roles are still unclear. Technologies based on 3C (chromosome conformation capture) have revealed the mysterious three-dimensional structure of chromatin, and make it possible to study the distal chromatin interaction in the genome. To find the role TE playing in distal regulation in human genome, we compiled the new released Hi-C data, TE annotation, histone marker annotations, and the genome-wide methylation data to operate correlation analysis, and found that the density of Alu elements showed a strong positive correlation with the level of chromatin interactions (hESC: r = 0.9, P elements like enhancers and promoters (Enhancer: hESC: r = 0.997, P = 2.3 × 10(-4); IMR90: r = 0.934, P = 2 × 10(-2); Promoter: hESC: r = 0.995, P = 3.8 × 10(-4); IMR90: r = 0.996, P = 3.2 × 10(-4)). Further investigation involving GC content and methylation status showed the GC content of Alu covered sequences shared a similar pattern with that of the overall sequence, suggesting that Alu elements also function as the GC nucleotide and CpG site provider. In all, our results suggest that the Alu elements may act as an alternative parameter to evaluate the Hi-C data, which is confirmed by the correlation analysis of Alu elements and histone markers. Moreover, the GC-rich Alu sequence can bring high GC content and methylation flexibility to the regions with more distal chromatin contact, regulating the transcription of tissue-specific genes.

  10. Quality goals for energy resources - an innovative approach to transposing the EU requirements for energy efficiency and use of renewables to the national level; Energietraegerqualitaetsziele - ein innovativer Ansatz zur Weitergabe der Synergie von Energieeffizienz- und REN-Verpflichtungen

    Energy Technology Data Exchange (ETDEWEB)

    Luhmann, H.J.; Lechtenboehmer, S.; Venjakob, J. [Wuppertal Inst. fuer Klima, Umwelt, Energie GmbH (Germany). Forschungsgruppe 1 - Zukuenftige Energie- und Mobilitaetsstrukturen

    2008-06-15

    One of the main commitments contained in the EU package of 23 January 2008 for the realisation of the so-called 20-20-20 goals is to increase the share of renewable energies in the energy mix. This is to be achieved by means of a EU directive to be transposed into national law. The directive already exists as a draft. Although there is still some discussion about the alternatives of having either an EU-wide uniform system based on the trade in quotas or permits or national promotion systems, ultimately there is likely to be some form of coexistence at the national level of legislation similar to the German Electricity Feed Law on one side and quota-based systems on the other. With this situation in mind the following article explores innovative options for member states given the new legal situation at the EU level.

  11. The solar element

    DEFF Research Database (Denmark)

    Kragh, Helge

    2009-01-01

    Apart from hydrogen, helium is the most abundant chemical element in the universe, and yet it was only discovered on the Earth in 1895. Its early history is unique because it encompasses astronomy as well as chemistry, two sciences which the spectroscope brought into contact during the second half...... of the nineteenth century. In the modest form of a yellow spectral line known as D3, 'helium' was sometimes supposed to exist in the Sun's atmosphere, an idea which is traditionally ascribed to J. Norman Lockyer. Did Lockyer discover helium as a solar element? How was the suggestion received by chemists, physicists...... elements might be different. The complex story of how helium became established as both a solar and terrestrial element involves precise observations as well as airy speculations. It is a story that is unique among the discovery histories of the chemical elements....

  12. Flow Element Models

    DEFF Research Database (Denmark)

    Heiselberg, Per; Nielsen, Peter V.

    Air distribution in ventilated rooms is a flow process that can be divided into different elements such as supply air jets, exhaust flows, thermal plumes, boundary layer flows, infiltration and gravity currents. These flow elements are isolated volumes where the air movement is controlled...... by a restricted number of parameters, and the air movement is fairly independent of the general flow in the enclosure. In many practical situations, the most convenient· method is to design the air distribution system using flow element theory....

  13. Finite element mesh generation

    CERN Document Server

    Lo, Daniel SH

    2014-01-01

    Highlights the Progression of Meshing Technologies and Their ApplicationsFinite Element Mesh Generation provides a concise and comprehensive guide to the application of finite element mesh generation over 2D domains, curved surfaces, and 3D space. Organised according to the geometry and dimension of the problem domains, it develops from the basic meshing algorithms to the most advanced schemes to deal with problems with specific requirements such as boundary conformity, adaptive and anisotropic elements, shape qualities, and mesh optimization. It sets out the fundamentals of popular techniques

  14. Discovery of element 112

    Energy Technology Data Exchange (ETDEWEB)

    Hofmann, S. [GSI, Darmstadt (Germany)

    1996-12-31

    The new elements 110, 111, and 112 were synthesized and unambiguously identified in experiments at SHIP. Due to strong shell effects the dominant decay mode is not fission, but emission of alpha particles. Theoretical investigations predict that maximum shell effects should exist in nuclei near proton number 114 and neutron number 184. Measurements give hope that isotopes of element 114 close to the island of spherical Superheavy Elements could be produced by fusion reactions using {sup 118}Pb as target. systematic studies of the reaction cross-sections indicate that transfer of nucleons is the important process to initiate the fusion.

  15. New functionalities in abundant element oxides: ubiquitous element strategy.

    Science.gov (United States)

    Hosono, Hideo; Hayashi, Katsuro; Kamiya, Toshio; Atou, Toshiyuki; Susaki, Tomofumi

    2011-06-01

    While most ceramics are composed of ubiquitous elements (the ten most abundant elements within the Earth's crust), many advanced materials are based on rare elements. A 'rare-element crisis' is approaching owing to the imbalance between the limited supply of rare elements and the increasing demand. Therefore, we propose a 'ubiquitous element strategy' for materials research, which aims to apply abundant elements in a variety of innovative applications. Creation of innovative oxide materials and devices based on conventional ceramics is one specific challenge. This review describes the concept of ubiquitous element strategy and gives some highlights of our recent research on the synthesis of electronic, thermionic and structural materials using ubiquitous elements.

  16. New roof element system

    DEFF Research Database (Denmark)

    Ditlev, Jesper; Rudbeck, Claus Christian

    1997-01-01

    The aim of the project has been to develop an element system for warm deck roofs which, from a thermal and economical point of view, can deal with the future demands for heat loss coefficients for low slope roofs.......The aim of the project has been to develop an element system for warm deck roofs which, from a thermal and economical point of view, can deal with the future demands for heat loss coefficients for low slope roofs....

  17. Structural elements design manual

    CERN Document Server

    Draycott, Trevor

    2012-01-01

    Gives clear explanations of the logical design sequence for structural elements. The Structural Engineer says: `The book explains, in simple terms, and with many examples, Code of Practice methods for sizing structural sections in timber, concrete,masonry and steel. It is the combination into one book of section sizing methods in each of these materials that makes this text so useful....Students will find this an essential support text to the Codes of Practice in their study of element sizing'.

  18. A battery element

    Energy Technology Data Exchange (ETDEWEB)

    Vatanabe, U.; Aoki, K.; Ito, K.; Ogava, K.; Okadzaki, R.

    1983-07-29

    An anode made of a light metal is used in the element, along with an anhydrous liquid electrolyte and a cathode made of CuC12(CFn)x or another material. The current tap of the anode is made from aluminum, gold, silver or another metal of the platinum group and the current tap may be coated with this metal. The thickness of the coating is 0.1 to 1 micrometer. The element has a long storage life.

  19. Atoms, molecules & elements

    CERN Document Server

    Graybill, George

    2007-01-01

    Young scientists will be thrilled to explore the invisible world of atoms, molecules and elements. Our resource provides ready-to-use information and activities for remedial students using simplified language and vocabulary. Students will label each part of the atom, learn what compounds are, and explore the patterns in the periodic table of elements to find calcium (Ca), chlorine (Cl), and helium (He) through hands-on activities.

  20. Trace elements in dialysis.

    Science.gov (United States)

    Filler, Guido; Felder, Sarah

    2014-08-01

    In end-stage chronic kidney disease (CKD), pediatric nephrologists must consider the homeostasis of the multiple water-soluble ions that are influenced by renal replacement therapy (RRT). While certain ions such as potassium and calcium are closely monitored, little is known about the handling of trace elements in pediatric dialysis. RRT may lead to accumulation of toxic trace elements, either due to insufficient elimination or due to contamination, or to excessive removal of essential trace elements. However, trace elements are not routinely monitored in dialysis patients and no mechanism for these deficits or toxicities has been established. This review summarizes the handling of trace elements, with particular attention to pediatric data. The best data describe lead and indicate that there is a higher prevalence of elevated lead (Pb, atomic number 82) levels in children on RRT when compared to adults. Lead is particularly toxic in neurodevelopment and lead levels should therefore be monitored. Monitoring of zinc (Zn, atomic number 30) and selenium (Se, atomic number 34) may be indicated in the monitoring of all pediatric dialysis patients to reduce morbidity from deficiency. Prospective studies evaluating the impact of abnormal trace elements and the possible therapeutic value of intervention are required.

  1. Radiation-induced changes in DNA methylation of repetitive elements in the mouse heart.

    Science.gov (United States)

    Koturbash, Igor; Miousse, Isabelle R; Sridharan, Vijayalakshmi; Nzabarushimana, Etienne; Skinner, Charles M; Melnyk, Stepan B; Pavliv, Oleksandra; Hauer-Jensen, Martin; Nelson, Gregory A; Boerma, Marjan

    2016-05-01

    DNA methylation is a key epigenetic mechanism, needed for proper control over the expression of genetic information and silencing of repetitive elements. Exposure to ionizing radiation, aside from its strong genotoxic potential, may also affect the methylation of DNA, within the repetitive elements, in particular. In this study, we exposed C57BL/6J male mice to low absorbed mean doses of two types of space radiation-proton (0.1 Gy, 150 MeV, dose rate 0.53 ± 0.08 Gy/min), and heavy iron ions ((56)Fe) (0.5 Gy, 600 MeV/n, dose rate 0.38 ± 0.06 Gy/min). Radiation-induced changes in cardiac DNA methylation associated with repetitive elements were detected. Specifically, modest hypomethylation of retrotransposon LINE-1 was observed at day 7 after irradiation with either protons or (56)Fe. This was followed by LINE-1, and other retrotransposons, ERV2 and SINE B1, as well as major satellite DNA hypermethylation at day 90 after irradiation with (56)Fe. These changes in DNA methylation were accompanied by alterations in the expression of DNA methylation machinery and affected the one-carbon metabolism pathway. Furthermore, loss of transposable elements expression was detected in the cardiac tissue at the 90-day time-point, paralleled by substantial accumulation of mRNA transcripts, associated with major satellites. Given that the one-carbon metabolism pathway can be modulated by dietary modifications, these findings suggest a potential strategy for the mitigation and, possibly, prevention of the negative effects exerted by ionizing radiation on the cardiovascular system. Additionally, we show that the methylation status and expression of repetitive elements may serve as early biomarkers of exposure to space radiation.

  2. Simulation of the cabling process for Rutherford cables: An advanced finite element model

    Science.gov (United States)

    Cabanes, J.; Garlasche, M.; Bordini, B.; Dallocchio, A.

    2016-12-01

    In all existing large particle accelerators (Tevatron, HERA, RHIC, LHC) the main superconducting magnets are based on Rutherford cables, which are characterized by having: strands fully transposed with respect to the magnetic field, a significant compaction that assures a large engineering critical current density and a geometry that allows efficient winding of the coils. The Nb3Sn magnets developed in the framework of the HL-LHC project for improving the luminosity of the Large Hadron Collider (LHC) are also based on Rutherford cables. Due to the characteristics of Nb3Sn wires, the cabling process has become a crucial step in the magnet manufacturing. During cabling the wires experience large plastic deformations that strongly modify the geometrical dimensions of the sub-elements constituting the superconducting strand. These deformations are particularly severe on the cable edges and can result in a significant reduction of the cable critical current as well as of the Residual Resistivity Ratio (RRR) of the stabilizing copper. In order to understand the main parameters that rule the cabling process and their impact on the cable performance, CERN has developed a 3D Finite Element (FE) model based on the LS-Dyna® software that simulates the whole cabling process. In the paper the model is presented together with a comparison between experimental and numerical results for a copper cable produced at CERN.

  3. Retrotransposon long interspersed nucleotide element-1 (LINE-1) is activated during salamander limb regeneration.

    Science.gov (United States)

    Zhu, Wei; Kuo, Dwight; Nathanson, Jason; Satoh, Akira; Pao, Gerald M; Yeo, Gene W; Bryant, Susan V; Voss, S Randal; Gardiner, David M; Hunter, Tony

    2012-09-01

    Salamanders possess an extraordinary capacity for tissue and organ regeneration when compared to mammals. In our effort to characterize the unique transcriptional fingerprint emerging during the early phase of salamander limb regeneration, we identified transcriptional activation of some germline-specific genes within the Mexican axolotl (Ambystoma mexicanum) that is indicative of cellular reprogramming of differentiated cells into a germline-like state. In this work, we focus on one of these genes, the long interspersed nucleotide element-1 (LINE-1) retrotransposon, which is usually active in germ cells and silent in most of the somatic tissues in other organisms. LINE-1 was found to be dramatically upregulated during regeneration. In addition, higher genomic LINE-1 content was also detected in the limb regenerate when compared to that before amputation indicating that LINE-1 retrotransposition is indeed active during regeneration. Active LINE-1 retrotransposition has been suggested to have a potentially deleterious impact on genomic integrity. Silencing of activated LINE-1 by small RNAs has been reported to be part of the machinery aiming to maintain genomic integrity. Indeed, we were able to identify putative LINE-1-related piRNAs in the limb blastema. Transposable element-related piRNAs have been identified frequently in the germline in other organisms. Thus, we present here a scenario in which a unique germline-like state is established during axolotl limb regeneration, and the re-activation of LINE-1 may serve as a marker for cellular dedifferentiation in the early-stage of limb regeneration.

  4. Unraveling the evolutionary scenario of the hobo element in populations of Drosophila melanogaster and D. simulans in South America using the TPE repeats as markers

    Directory of Open Access Journals (Sweden)

    Geovani T. Ragagnin

    2016-03-01

    Full Text Available Abstract Transposable elements (TEs are nucleotide sequences found in most studied genomes. These elements are highly diversified and have a large variation in nucleotide structure and mechanisms of transposition. hobo is a member of class II, belonging to hAT superfamily, described inDrosophila melanogaster, and it presents in its Open Reading Frame, a repetitive region encoding the amino acids threonine-proline-glutamic acid (TPE, which shows variability in the number of repeats in some regions of the world. Due to this variability some evolutionary scenarios of the hobo element are discussed, such as the scenario of the invasion of hobo element in populations ofD. melanogaster. In the present study, we investigated 22 DNA sequences of D. melanogaster and seven sequences ofD. simulans, both from South America, to check the number of repetitions of TPE, in order to clarify the evolutionary scenario of thehobo element in these populations. Our results showed a monomorphism in populations of both species in South America, with only three TPE repeats. Hence, we discuss and propose an evolutionary scenario of the invasion of the hobo element in populations of D. melanogaster and D. simulans.

  5. Elemental analysis in biotechnology.

    Science.gov (United States)

    Hann, Stephan; Dernovics, Mihaly; Koellensperger, Gunda

    2015-02-01

    This article focuses on analytical strategies integrating atomic spectroscopy in biotechnology. The rationale behind developing such methods is inherently linked to unique features of the key technique in elemental analysis, which is inductively coupled plasma mass spectrometry: (1) the high sensitivity and selectivity of state of the art instrumentation, (2) the possibility of accurate absolute quantification even in complex matrices, (3) the capability of combining elemental detectors with chromatographic separation methods and the versatility of the latter approach, (4) the complementarity of inorganic and organic mass spectrometry, (5) the multi-element capability and finally (6) the capability of isotopic analysis. The article highlights the most recent bio-analytical developments exploiting these methodological advantages and shows the potential in biotechnological applications.

  6. Advanced finite element technologies

    CERN Document Server

    Wriggers, Peter

    2016-01-01

    The book presents an overview of the state of research of advanced finite element technologies. Besides the mathematical analysis, the finite element development and their engineering applications are shown to the reader. The authors give a survey of the methods and technologies concerning efficiency, robustness and performance aspects. The book covers the topics of mathematical foundations for variational approaches and the mathematical understanding of the analytical requirements of modern finite element methods. Special attention is paid to finite deformations, adaptive strategies, incompressible, isotropic or anisotropic material behavior and the mathematical and numerical treatment of the well-known locking phenomenon. Beyond that new results for the introduced approaches are presented especially for challenging nonlinear problems.

  7. Fuel Element Technical Manual

    Energy Technology Data Exchange (ETDEWEB)

    Burley, H.H. [ed.

    1956-08-01

    It is the purpose of the Fuel Element Technical Manual to Provide a single document describing the fabrication processes used in the manufacture of the fuel element as well as the technical bases for these processes. The manual will be instrumental in the indoctrination of personnel new to the field and will provide a single data reference for all personnel involved in the design or manufacture of the fuel element. The material contained in this manual was assembled by members of the Engineering Department and the Manufacturing Department at the Hanford Atomic Products Operation between the dates October, 1955 and June, 1956. Arrangement of the manual. The manual is divided into six parts: Part I--introduction; Part II--technical bases; Part III--process; Part IV--plant and equipment; Part V--process control and improvement; and VI--safety.

  8. Creativity Management Key Elements

    Directory of Open Access Journals (Sweden)

    Rosa María Fuchs Ángeles

    2015-09-01

    Full Text Available Organizations are constantly looking towards innovation. In order to reach it they must foment creativity. This paper analyzes a series of elements considered in the organizational creativity management and proposes a model with the indispensable factors that organizations should consider to reach it. These elements are: culture and organizational environment, strategy, structure, communication, relation with customers, human resources (recruiting, training, job design, compensation, promotion, and performance evaluation, long term orientation and the organizational life cycle. Having the analysis of those elements as a basis, the indispensable pillars on management creativity are identified. The proposed model is based on 5 pillars: the alignment between strategic, culture and organizational structure, called by the authors 'Holy Trinity'; intern publicity; customer’s voice; recognition and a look towards future. Finally, the case of an innovative Peruvian enterprise is presented from the model’s perspective and the study conclusions.

  9. An alkaline element

    Energy Technology Data Exchange (ETDEWEB)

    Arita, T.; Murakami, K.; Okha, K.

    1983-04-28

    A cathode with a dual layer active mass is installed in the disk shaped alkaline silver and zinc element. The first layer, which is turned towards the anode, contains 85 parts Ag2O, 5 parts electrolytic MnO2 and 10 parts graphite. The second layer, which contacts the bottom of the element, contains 35 parts Ag2O, 60 parts electrolytic MnO2 and 5 parts graphite. The electrical capacity of the first and second layers is 60 and 40, respectively. The first layer may be discharged with a high current density and the second layer with less current density. The element has high characteristics with comparatively low cost.

  10. Intelligent Elements for ISHM

    Science.gov (United States)

    Schmalzel, John L.; Morris, Jon; Turowski, Mark; Figueroa, Fernando; Oostdyk, Rebecca

    2008-01-01

    There are a number of architecture models for implementing Integrated Systems Health Management (ISHM) capabilities. For example, approaches based on the OSA-CBM and OSA-EAI models, or specific architectures developed in response to local needs. NASA s John C. Stennis Space Center (SSC) has developed one such version of an extensible architecture in support of rocket engine testing that integrates a palette of functions in order to achieve an ISHM capability. Among the functional capabilities that are supported by the framework are: prognostic models, anomaly detection, a data base of supporting health information, root cause analysis, intelligent elements, and integrated awareness. This paper focuses on the role that intelligent elements can play in ISHM architectures. We define an intelligent element as a smart element with sufficient computing capacity to support anomaly detection or other algorithms in support of ISHM functions. A smart element has the capabilities of supporting networked implementations of IEEE 1451.x smart sensor and actuator protocols. The ISHM group at SSC has been actively developing intelligent elements in conjunction with several partners at other Centers, universities, and companies as part of our ISHM approach for better supporting rocket engine testing. We have developed several implementations. Among the key features for these intelligent sensors is support for IEEE 1451.1 and incorporation of a suite of algorithms for determination of sensor health. Regardless of the potential advantages that can be achieved using intelligent sensors, existing large-scale systems are still based on conventional sensors and data acquisition systems. In order to bring the benefits of intelligent sensors to these environments, we have also developed virtual implementations of intelligent sensors.

  11. Finite elements and approximation

    CERN Document Server

    Zienkiewicz, O C

    2006-01-01

    A powerful tool for the approximate solution of differential equations, the finite element is extensively used in industry and research. This book offers students of engineering and physics a comprehensive view of the principles involved, with numerous illustrative examples and exercises.Starting with continuum boundary value problems and the need for numerical discretization, the text examines finite difference methods, weighted residual methods in the context of continuous trial functions, and piecewise defined trial functions and the finite element method. Additional topics include higher o

  12. Elements of linear space

    CERN Document Server

    Amir-Moez, A R; Sneddon, I N

    1962-01-01

    Elements of Linear Space is a detailed treatment of the elements of linear spaces, including real spaces with no more than three dimensions and complex n-dimensional spaces. The geometry of conic sections and quadric surfaces is considered, along with algebraic structures, especially vector spaces and transformations. Problems drawn from various branches of geometry are given.Comprised of 12 chapters, this volume begins with an introduction to real Euclidean space, followed by a discussion on linear transformations and matrices. The addition and multiplication of transformations and matrices a

  13. Annihilators of nilpotent elements

    Directory of Open Access Journals (Sweden)

    Abraham A. Klein

    2005-01-01

    Full Text Available Let x be a nilpotent element of an infinite ring R (not necessarily with 1. We prove that A(x—the two-sided annihilator of x—has a large intersection with any infinite ideal I of R in the sense that card(A(x∩I=cardI. In particular, cardA(x=cardR; and this is applied to prove that if N is the set of nilpotent elements of R and R≠N, then card(R\\N≥cardN.

  14. Finite element analysis

    CERN Document Server

    2010-01-01

    Finite element analysis is an engineering method for the numerical analysis of complex structures. This book provides a bird's eye view on this very broad matter through 27 original and innovative research studies exhibiting various investigation directions. Through its chapters the reader will have access to works related to Biomedical Engineering, Materials Engineering, Process Analysis and Civil Engineering. The text is addressed not only to researchers, but also to professional engineers, engineering lecturers and students seeking to gain a better understanding of where Finite Element Analysis stands today.

  15. Elements of social security

    DEFF Research Database (Denmark)

    Hansen, Hans

    (Alte Länder). This is the 9th and last edition of the publication,covering income levels and rules for social security and personal taxation for 1999. Basis for the projections to 1999 income levels is the 1998 data (in some cases 1999 data)for OECD's Taxing Wages as reported by national experts.......Elements of Social Security is a comparative study of important elements of the social security systems in Denmark (DK), Sweden (S), Finland (FIN), Austria (A), Germany (D), the Netherlands (NL), Great Britain (GB) and Canada (CAN). It should be emphasized that Germany is the former West Germany...

  16. Rocket propulsion elements

    CERN Document Server

    Sutton, George P

    2011-01-01

    The definitive text on rocket propulsion-now revised to reflect advancements in the field For sixty years, Sutton's Rocket Propulsion Elements has been regarded as the single most authoritative sourcebook on rocket propulsion technology. As with the previous edition, coauthored with Oscar Biblarz, the Eighth Edition of Rocket Propulsion Elements offers a thorough introduction to basic principles of rocket propulsion for guided missiles, space flight, or satellite flight. It describes the physical mechanisms and designs for various types of rockets' and provides an unders

  17. Archaeal extrachromosomal genetic elements

    DEFF Research Database (Denmark)

    Wang, Haina; Peng, Nan; Shah, Shiraz Ali

    2015-01-01

    SUMMARY: Research on archaeal extrachromosomal genetic elements (ECEs) has progressed rapidly in the past decade. To date, over 60 archaeal viruses and 60 plasmids have been isolated. These archaeal viruses exhibit an exceptional diversity in morphology, with a wide array of shapes, such as spind......SUMMARY: Research on archaeal extrachromosomal genetic elements (ECEs) has progressed rapidly in the past decade. To date, over 60 archaeal viruses and 60 plasmids have been isolated. These archaeal viruses exhibit an exceptional diversity in morphology, with a wide array of shapes...

  18. An alkaline element

    Energy Technology Data Exchange (ETDEWEB)

    Obi, F.

    1983-09-29

    A current tap pressed into the anode is installed in the central part of the top of the element. There is an internal top made of plastic under the top. There is a projection in the center of the top with an opening, through which the current tap is passed. The edge of the plastic top serves as an insulation lining between the metallic top and the body, which serves as the current tap for the cathode. A separator is placed between the anode and the cathode. Electrolyte leaks are prevented in the slotted disk elements.

  19. Development of a versatile XRF scanner for the elemental imaging of paintworks

    Science.gov (United States)

    Ravaud, E.; Pichon, L.; Laval, E.; Gonzalez, V.; Eveno, M.; Calligaro, T.

    2016-01-01

    Scanning XRF is a powerful elemental imaging technique introduced at the synchrotron that has recently been transposed to laboratory. The growing interest in this technique stems from its ability to collect images reflecting pigment distribution within large areas on artworks by means of their elemental signature. In that sense, scanning XRF appears highly complementary to standard imaging techniques (Visible, UV, IR photography and X-ray radiography). The versatile XRF scanner presented here has been designed and built at the C2RMF in response to specific constraints: transportability, cost-effectiveness and ability to scan large areas within a single working day. The instrument is based on a standard X-ray generator with sub-millimetre collimated beam and a SDD-based spectrometer to collected X-ray spectra. The instrument head is scanned in front of the painting by means of motorised movements to cover an area up to 300 × 300 mm2 with a resolution of 0.5 mm (600 × 600 pixels). The 15-kg head is mounted on a stable photo stand for rapid positioning on paintworks and maintains a free side-access for safety; it can also be attached to a lighter tripod for field measurements. Alignment is achieved with a laser pointer and a micro-camera. With a scanning speed of 5 mm/s and 0.1 s/point, elemental maps are collected in 10 h, i.e. a working day. The X-ray spectra of all pixels are rapidly processed using an open source program to derive elemental maps. To illustrate the capabilities of this instrument, this contribution presents the results obtained on the Belle Ferronnière painted by Leonardo da Vinci (1452-1519) and conserved in the Musée du Louvre, prior to its restoration at the C2RMF.

  20. Development of a versatile XRF scanner for the elemental imaging of paintworks

    Energy Technology Data Exchange (ETDEWEB)

    Ravaud, E.; Pichon, L.; Laval, E.; Eveno, M. [Centre de recherche et de restauration des musees de France, C2RMF, Paris (France); Gonzalez, V.; Calligaro, T. [Centre de recherche et de restauration des musees de France, C2RMF, Paris (France); PSL Research University, Chimie ParisTech-CNRS, Institut de Recherche Chimie Paris, UMR8247, Paris (France)

    2016-01-15

    Scanning XRF is a powerful elemental imaging technique introduced at the synchrotron that has recently been transposed to laboratory. The growing interest in this technique stems from its ability to collect images reflecting pigment distribution within large areas on artworks by means of their elemental signature. In that sense, scanning XRF appears highly complementary to standard imaging techniques (Visible, UV, IR photography and X-ray radiography). The versatile XRF scanner presented here has been designed and built at the C2RMF in response to specific constraints: transportability, cost-effectiveness and ability to scan large areas within a single working day. The instrument is based on a standard X-ray generator with sub-millimetre collimated beam and a SDD-based spectrometer to collected X-ray spectra. The instrument head is scanned in front of the painting by means of motorised movements to cover an area up to 300 x 300 mm{sup 2} with a resolution of 0.5 mm (600 x 600 pixels). The 15-kg head is mounted on a stable photo stand for rapid positioning on paintworks and maintains a free side-access for safety; it can also be attached to a lighter tripod for field measurements. Alignment is achieved with a laser pointer and a micro-camera. With a scanning speed of 5 mm/s and 0.1 s/point, elemental maps are collected in 10 h, i.e. a working day. The X-ray spectra of all pixels are rapidly processed using an open source program to derive elemental maps. To illustrate the capabilities of this instrument, this contribution presents the results obtained on the Belle Ferronniere painted by Leonardo da Vinci (1452-1519) and conserved in the Musee du Louvre, prior to its restoration at the C2RMF. (orig.)

  1. The protist Trichomonas vaginalis harbors multiple lineages of transcriptionally active Mutator-like elements

    Directory of Open Access Journals (Sweden)

    Pereira Gonçalo AG

    2009-07-01

    Full Text Available Abstract Background For three decades the Mutator system was thought to be exclusive of plants, until the first homolog representatives were characterized in fungi and in early-diverging amoebas earlier in this decade. Results Here, we describe and characterize four families of Mutator-like elements in a new eukaryotic group, the Parabasalids. These Trichomonas vaginalis Mutator- like elements, or TvMULEs, are active in T. vaginalis and patchily distributed among 12 trichomonad species and isolates. Despite their relatively distinctive amino acid composition, the inclusion of the repeats TvMULE1, TvMULE2, TvMULE3 and TvMULE4 into the Mutator superfamily is justified by sequence, structural and phylogenetic analyses. In addition, we identified three new TvMULE-related sequences in the genome sequence of Candida albicans. While TvMULE1 is a member of the MuDR clade, predominantly from plants, the other three TvMULEs, together with the C. albicans elements, represent a new and quite distinct Mutator lineage, which we named TvCaMULEs. The finding of TvMULE1 sequence inserted into other putative repeat suggests the occurrence a novel TE family not yet described. Conclusion These findings expand the taxonomic distribution and the range of functional motif of MULEs among eukaryotes. The characterization of the dynamics of TvMULEs and other transposons in this organism is of particular interest because it is atypical for an asexual species to have such an extreme level of TE activity; this genetic landscape makes an interesting case study for causes and consequences of such activity. Finally, the extreme repetitiveness of the T. vaginalis genome and the remarkable degree of sequence identity within its repeat families highlights this species as an ideal system to characterize new transposable elements.

  2. A bioinformatics search pipeline, RNA2DSearch, identifies RNA localization elements in Drosophila retrotransposons.

    Science.gov (United States)

    Hamilton, Russell S; Hartswood, Eve; Vendra, Georgia; Jones, Cheryl; Van De Bor, Veronique; Finnegan, David; Davis, Ilan

    2009-02-01

    mRNA localization is a widespread mode of delivering proteins to their site of function. The embryonic axes in Drosophila are determined in the oocyte, through Dynein-dependent transport of gurken/TGF-alpha mRNA, containing a small localization signal that assigns its destination. A signal with a similar secondary structure, but lacking significant sequence similarity, is present in the I factor retrotransposon mRNA, also transported by Dynein. It is currently unclear whether other mRNAs exist that are localized to the same site using similar signals. Moreover, searches for other genes containing similar elements have not been possible due to a lack of suitable bioinformatics methods for searches of secondary structure elements and the difficulty of experimentally testing all the possible candidates. We have developed a bioinformatics approach for searching across the genome for small RNA elements that are similar to the secondary structures of particular localization signals. We have uncovered 48 candidates, of which we were able to test 22 for their localization potential using injection assays for Dynein mediated RNA localization. We found that G2 and Jockey transposons each contain a gurken/I factor-like RNA stem-loop required for Dynein-dependent localization to the anterior and dorso-anterior corner of the oocyte. We conclude that I factor, G2, and Jockey are members of a "family" of transposable elements sharing a gurken-like mRNA localization signal and Dynein-dependent mechanism of transport. The bioinformatics pipeline we have developed will have broader utility in fields where small RNA signals play important roles.

  3. It is elemental

    DEFF Research Database (Denmark)

    Delgado-Baquerizo, Manuel; Reich, Peter B.; Khachane, Amit N.

    2017-01-01

    It is well established that resource quantity and elemental stoichiometry play major roles in shaping below and aboveground plant biodiversity, but their importance for shaping microbial diversity in soil remains unclear. Here, we used statistical modeling on a regional database covering 179 loca...

  4. Elemental Chem Lab

    Science.gov (United States)

    Franco Mariscal, Antonio Joaquin

    2008-01-01

    This educative material uses the symbols of 45 elements to spell the names of 32 types of laboratory equipment usually found in chemical labs. This teaching material has been divided into three puzzles according to the type of the laboratory equipment: (i) glassware as reaction vessels or containers; (ii) glassware for measuring, addition or…

  5. Reference: -300ELEMENT [PLACE

    Lifescience Database Archive (English)

    Full Text Available -300ELEMENT Kreis M, Williamson MS, Forde J, Schmitz D, Clark J, Buxton B, Pywell J..., Marris C, Henderson J, Harris N, Shewry PR, Forde BG, Miflin BJ Differential gene expression in the developing barley endosperm. Philos Trans R Soc Lond B314:355-365 (1986) ...

  6. Beam transport elements

    CERN Multimedia

    1965-01-01

    Two of the beam transport elements for the slow ejection system. On the left, a quadrupole 1.2 m long with a 5 cm aperture, capable of producing a gradient of 5000 gauss. On the right, a 1 m bending magnet with a 4 cm gap; its field is 20 000 gauss.

  7. Light element ceramics

    OpenAIRE

    Rao, KJ; Varma, KBR; Raju, AR

    1988-01-01

    An overview of a few structually important light element ceramics is presented. Included in the overview are silicon nitide, sialon, aluminium nitride, boron carbide and silicon carbide. Methods of preparation, characterization and industrial applications of these ceramics are summarized. Mechanical properties, industrial production techniques and principal uses of these ceramics are emphasized.

  8. Water, the intangible element

    NARCIS (Netherlands)

    Schotting, R.J.

    2009-01-01

    Water is the key to life. No living creature can survive without water. Too much water or polluted water are serious threats to mankind. Managing this intangible element is complex, not only in wet deltaic regions but also in the (semi-)arid regions of the world. Combined efforts of the hydro(geo)lo

  9. CEDS Addresses: Rubric Elements

    Science.gov (United States)

    US Department of Education, 2015

    2015-01-01

    Common Education Data Standards (CEDS) Version 4 introduced a common data vocabulary for defining rubrics in a data system. The CEDS elements support digital representations of both holistic and analytic rubrics. This document shares examples of holistic and analytic project rubrics, available CEDS Connections, and a logical model showing the…

  10. Movies and Literary Elements.

    Science.gov (United States)

    Keller, Rodney D.

    1987-01-01

    Recommends using movie clips to stimulate students' interest in reading a novel as well as to teach elements of fiction such as plot, character, setting, symbol, irony, and theme. Describes each clip and provides study questions. Includes a listing of movies made from books. (NH)

  11. Inside finite elements

    CERN Document Server

    Weiser, Martin

    2016-01-01

    All relevant implementation aspects of finite element methods are discussed in this book. The focus is on algorithms and data structures as well as on their concrete implementation. Theory is covered as far as it gives insight into the construction of algorithms. Throughout the exercises a complete FE-solver for scalar 2D problems will be implemented in Matlab/Octave.

  12. Cytogenetic variation of repetitive DNA elements in Hoplias malabaricus (Characiformes - Erythrinidae) from white, black and clear water rivers of the Amazon basin.

    Science.gov (United States)

    Santos, Fabíola Araújo Dos; Marques, Diego Ferreira; Terencio, Maria Leandra; Feldberg, Eliana; Rodrigues, Luís Reginaldo R

    2016-03-01

    Hoplias malabaricus is a common fish species occurring in white, black and clear water rivers of the Amazon basin. Its large distribution across distinct aquatic environments can pose stressful conditions for dispersal and creates possibilities for the emergence of local adaptive profiles. We investigated the chromosomal localization of repetitive DNA markers (constitutive heterochromatin, rDNA and the transposable element REX-3) in populations from the Amazonas river (white water), the Negro river (black water) and the Tapajós river (clear water), in order to address the variation/association of cytogenomic features and environmental conditions. We found a conserved karyotypic macrostructure with a diploid number of 40 chromosomes (20 metacentrics + 20 submetacentrics) in all the samples. Heteromorphism in pair 14 was detected as evidence for the initial differentiation of an XX/XY system. Minor differences detected in the amount of repetitive DNA markers are interpreted as possible signatures of local adaptations to distinct aquatic environments.

  13. FLOW INJECTION ANALYSIS SYSTEM COUPLED WITH ICP-EOS FOR DETERMINATION OF SOME METALLIC ELEMENTS IN DRINKING WATER

    Directory of Open Access Journals (Sweden)

    Cristina Dinu

    2009-06-01

    Full Text Available The European Drinking Water Directive (98/83/EC, transposed in Romanian Legislation as Low 458/2002, amended by Low 311/2004, imposes the limit of concentration for metallic elements in water intended for human consumption. The toxic metals arsenic and selenium are among these elements and the limit value is 10 μg/L. In the paper there are presented the working conditions for determination of As and Se from drinking water using modern techniques based on the fl ow injection-hydride generation with the inductively coupled plasma atomic emission spectrometry (FIAS-ICP-EOS. The analyses were performed on Optima 5300 DV Perkin Elmer equipment with FIAS 400 Flow Injection System, Perkin Elmer type. For the hydride generation two types of solution were used: 10% (v/v HCl as a carrier solution and 0.2 % NaBH4 in 0.05%NaOH solution as a reducing agent [1]. The treatment step of the samples and standard solutions consisted in reducing with mixed solutions of KI and ascorbic acid in acidic condition (HCl for As and only with HCl and high temperature for Se [2,3]. The paper contains the characteristic parameters of the methods, such as: low detection limit, quantifi cation limit, repeatability, precision, recovery, which were evaluated using Certifi ed Reference Materials for each element.

  14. Occurrence and abundance of a mariner-like element in freshwater and terrestrial planarians (Platyhelminthes, Tricladida from southern Brazil

    Directory of Open Access Journals (Sweden)

    Fernanda Sperb

    2009-01-01

    Full Text Available Transposable elements are DNA sequences present in all the large phylogenetic groups, both capable of changing position within the genome and constituting a significant part of eukaryotic genomes. The mariner family of transposons is one of the few which occurs in a wide variety of taxonomic groups, including freshwater planarians. Nevertheless, so far only five planarian species have been reported to carry mariner-like elements (MLEs, although several different species have been investigated. Regarding the number of copies of MLEs, Girardia tigrina is the only planarian species in which this has been evaluated, with an estimation of 8,000 copies of the element per haploid genome. Preliminary results obtained in our laboratory demonstrated that MLE is found in a large number of different species of planarians, including terrestrial. With this in mind, the aim was to evaluate the occurrence and estimate the number of MLE copies in different planarian species collected in south Brazil. Twenty-eight individuals from 15 planarian species were analyzed. By using PCR and the hybridization of nucleic acids, it was found that MLE was present in all the analyzed species, the number of copies being high, probably over 10³ per haploid genome.

  15. Element-topology-independent preconditioners for parallel finite element computations

    Science.gov (United States)

    Park, K. C.; Alexander, Scott

    1992-01-01

    A family of preconditioners for the solution of finite element equations are presented, which are element-topology independent and thus can be applicable to element order-free parallel computations. A key feature of the present preconditioners is the repeated use of element connectivity matrices and their left and right inverses. The properties and performance of the present preconditioners are demonstrated via beam and two-dimensional finite element matrices for implicit time integration computations.

  16. The Foldback-like element Galileo belongs to the P superfamily of DNA transposons and is widespread within the Drosophila genus.

    Science.gov (United States)

    Marzo, Mar; Puig, Marta; Ruiz, Alfredo

    2008-02-26

    Galileo is the only transposable element (TE) known to have generated natural chromosomal inversions in the genus Drosophila. It was discovered in Drosophila buzzatii and classified as a Foldback-like element because of its long, internally repetitive, terminal inverted repeats (TIRs) and lack of coding capacity. Here, we characterized a seemingly complete copy of Galileo from the D. buzzatii genome. It is 5,406 bp long, possesses 1,229-bp TIRs, and encodes a 912-aa transposase similar to those of the Drosophila melanogaster 1360 (Hoppel) and P elements. We also searched the recently available genome sequences of 12 Drosophila species for elements similar to Dbuz\\Galileo by using bioinformatic tools. Galileo was found in six species (ananassae, willistoni, peudoobscura, persimilis, virilis, and mojavensis) from the two main lineages within the Drosophila genus. Our observations place Galileo within the P superfamily of cut-and-paste transposons and extend considerably its phylogenetic distribution. The interspecific distribution of Galileo indicates an ancient presence in the genus, but the phylogenetic tree built with the transposase amino acid sequences contrasts significantly with that of the species, indicating lineage sorting and/or horizontal transfer events. Our results also suggest that Foldback-like elements such as Galileo may evolve from DNA-based transposon ancestors by loss of the transposase gene and disproportionate elongation of TIRs.

  17. Elements of quantum optics

    CERN Document Server

    Meystre, Pierre

    2007-01-01

    Elements of Quantum Optics gives a self-contained and broad coverage of the basic elements necessary to understand and carry out research in laser physics and quantum optics, including a review of basic quantum mechanics and pedagogical introductions to system-reservoir interactions and to second quantization. The text reveals the close connection between many seemingly unrelated topics, such as probe absorption, four-wave mixing, optical instabilities, resonance fluorescence and squeezing. It also comprises discussions of cavity quantum electrodynamics and atom optics. The 4th edition includes a new chapter on quantum entanglement and quantum information, as well as added discussions of the quantum beam splitter, electromagnetically induced transparency, slow light, and the input-output formalism needed to understand many problems in quantum optics. It also provides an expanded treatment of the minimum-coupling Hamiltonian and a simple derivation of the Gross-Pitaevskii equation, an important gateway to rese...

  18. Nuclear fuel element

    Science.gov (United States)

    Meadowcroft, Ronald Ross; Bain, Alastair Stewart

    1977-01-01

    A nuclear fuel element wherein a tubular cladding of zirconium or a zirconium alloy has a fission gas plenum chamber which is held against collapse by the loops of a spacer in the form of a tube which has been deformed inwardly at three equally spaced, circumferential positions to provide three loops. A heat resistant disc of, say, graphite separates nuclear fuel pellets within the cladding from the plenum chamber. The spacer is of zirconium or a zirconium alloy.

  19. Quantum theory elements

    CERN Document Server

    Bates, David Robert

    1962-01-01

    Quantum Theory: A Treatise in Three Volumes, I: Elements focuses on the principles, methodologies, and approaches involved in quantum theory, including quantum mechanics, linear combinations, collisions, and transitions. The selection first elaborates on the fundamental principles of quantum mechanics, exactly soluble bound state problems, and continuum. Discussions focus on delta function normalization, spherically symmetric potentials, rectangular potential wells, harmonic oscillators, spherically symmetrical potentials, Coulomb potential, axiomatic basis, consequences of first three postula

  20. A sealing element

    Energy Technology Data Exchange (ETDEWEB)

    Obi, F.; Takada, K.

    1983-09-22

    A sealing lining made of a mixture of polyethylene or polypropylene with an additive which prevents destruction of the lining is used in the element. The content of the additive in the mixture is 10 to 30 percent by mass. The additive basically consists of polyethylene. Carboxyl groups are introduced into the polymer as an anion and sodium, potassium and molybdenum are introduced as the cation.

  1. Helium the disappearing element

    CERN Document Server

    Sears, Wheeler M

    2015-01-01

    The subject of the book is helium, the element, and its use in myriad applications including MRI machines, particle accelerators, space telescopes, and of course balloons and blimps. It was at the birth of our Universe, or the Big Bang, where the majority of cosmic helium was created; and stellar helium production continues. Although helium is the second most abundant element in the Universe, it is actually quite rare here on Earth and only exists because of radioactive elements deep within the Earth. This book includes a detailed history of the discovery of helium, of the commercial industry built around it, how the helium we actually encounter is produced within the Earth, and the state of the helium industry today. The gas that most people associate with birthday party balloons is running out. “Who cares?” you might ask. Well, without helium, MRI machines could not function, rockets could not go into space, particle accelerators such as those used by CERN could not operate, fiber optic cables would not...

  2. New Aperture Partitioning Element

    Science.gov (United States)

    Griffin, S.; Calef, B.; Williams, S.

    Postprocessing in an optical system can be aided by adding an optical element to partition the pupil into a number of segments. When imaging through the atmosphere, the recorded data are blurred by temperature-induced variations in the index of refraction along the line of sight. Using speckle imaging techniques developed in the astronomy community, this blurring can be corrected to some degree. The effectiveness of these techniques is diminished by redundant baselines in the pupil. Partitioning the pupil reduces the degree of baseline redundancy, and therefore improves the quality of images that can be obtained from the system. It is possible to implement the described approach on an optical system with a segmented primary mirror, but not very practical. This is because most optical systems do not have segmented primary mirrors, and those that do have relatively low bandwidth positioning of segments due to their large mass and inertia. It is much more practical to position an active aperture partitioning element at an aft optics pupil of the optical system. This paper describes the design, implementation and testing of a new aperture partitioning element that is completely reflective and reconfigurable. The device uses four independent, annular segments that can be positioned with a high degree of accuracy without impacting optical wavefront of each segment. This mirror has been produced and is currently deployed and working on the 3.6 m telescope.

  3. Molecular characterization of mariner-like elements in emerald ash borer, Agrilus planipennis (Coleoptera, Polyphaga).

    Science.gov (United States)

    Rivera-Vega, L; Mittapalli, O

    2010-08-01

    Emerald ash borer (EAB, Agrilus planipennis), an exotic invasive pest, has killed millions of ash trees (Fraxinus spp.) in North America and continues to threaten the very survival of the entire Fraxinus genus. Despite its high-impact status, to date very little knowledge exists for this devastating insect pest at the molecular level. Mariner-like elements (MLEs) are transposable elements, which are ubiquitous in occurrence in insects and other invertebrates. Because of their low specificity and broad host range, they can be used for epitope-tagging, gene mapping, and in vitro mutagenesis. The majority of the known MLEs are inactive due to in-frame shifts and stop codons within the open reading frame (ORF). We report on the cloning and characterization of two MLEs in A. planipennis genome (Apmar1 and Apmar2). Southern analysis indicated a very high copy number for Apmar1 and a moderate copy number for Apmar2. Phylogenetic analysis revealed that both elements belong to the irritans subfamily. Based on the high copy number for Apmar1, the full-length sequence was obtained using degenerate primers designed to the inverted terminal repeat (ITR) sequences of irritans MLEs. The recovered nucleotide sequence for Apmar1 consisted of 1,292 bases with perfect ITRs, and an ORF of 1,050 bases encoding a putative transposase of 349 amino acids. The deduced amino acid sequence of Apmar1 contained the conserved regions of mariner transposases including WVPHEL and YSPDLAP, and the D,D(34)D motif. Both Apmar1 and Apmar2 could represent useful genetic tools and provide insights on EAB adaptation.

  4. Transpositional behaviour of the Ds element in the Ac/Ds system in rice

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Insertional mutagenesis based on maize Activator/Dissociator (Ac/Ds) transposons is becoming a major approach used to produce a saturated mutant collection in rice. In this research, Ds-T-DNA transformed homozygotes were crossed with Ac-T-DNA transformed homozygotes in order to establish an Ac/Ds transposon system in rice. The successive investigation of Ds transposition from F1 to F5 generations indicated that the frequencies of germinal transposition increased over successive generations and reached 54.2% in F3 generation. The Ds transposition pattern revealed that a Ds transposition induced an approximately 170-bp deletion of T-DNA sequence and another Ds transposition carried a 272-bp T-DNA sequence. Using thermal asymmetric interlaced PCR (TAIL-PCR), some flanking sequences of the Ds element were amplified. Analyses of 17 Ds-flanking sequences showed that five Ds were inserted into gene regions. The Ds could transpose not only to the linked sites but also to the unlinked sites. The frequency of inter-chromosomal transposition of Ds was 33.3%.

  5. Insertion polymorphisms of mobile genetic elements in sexual and asexual populations of Daphnia pulex.

    Science.gov (United States)

    Jiang, Xiaoqian; Tang, Haixu; Ye, Zhiqiang; Lynch, Michael

    2017-01-04

    Transposable elements (TEs) constitute a substantial portion of many eukaryotic genomes, and can in principle contribute to evolutionary innovation as well as genomic deterioration. Daphnia pulex serves as a useful model for studying TE dynamics as a potential cause and/or consequence of asexuality. We analyzed insertion polymorphisms of TEs in 20 sexual and 20 asexual isolates of D. pulex across North American from their available whole-genome sequencing data. Our results show that the total fraction of the derived sequences of TEs is not substantially different between asexual and sexual D. pulex isolates. However, in general, sexual clones contain fewer fixed TE insertions but more total insertion polymorphisms than asexual clones, supporting the hypothesis that sexual reproduction facilitates the spread and elimination of TEs. We identified 9 asexual-specific fixed TE insertions, 8 LTR retrotransposons and 1 DNA transposon. By comparison, no sexual-specific fixed TE insertions were observed in our analysis. Furthermore, except 1 TE insertion located on a contig from chromosome 7, the other 8 asexual-specific insertion sites are located on contigs from chromosome 9 that is known to be associated with obligate asexuality in D. pulex. We found that all 9 asexual-specific fixed TE insertions can also be detected in some D. pulicaria isolates, indicating that a substantial number of TE insertions in asexual D. pulex have been directly inherited from D. pulicaria during the origin of obligate asexuals.

  6. Insertion Polymorphisms of Mobile Genetic Elements in Sexual and Asexual Populations of Daphnia pulex

    Science.gov (United States)

    Ye, Zhiqiang; Lynch, Michael

    2017-01-01

    Transposable elements (TEs) constitute a substantial portion of many eukaryotic genomes, and can in principle contribute to evolutionary innovation as well as genomic deterioration. Daphnia pulex serves as a useful model for studying TE dynamics as a potential cause and/or consequence of asexuality. We analyzed insertion polymorphisms of TEs in 20 sexual and 20 asexual isolates of D. pulex across North American from their available whole-genome sequencing data. Our results show that the total fraction of the derived sequences of TEs is not substantially different between asexual and sexual D. pulex isolates. However, in general, sexual clones contain fewer fixed TE insertions but more total insertion polymorphisms than asexual clones, supporting the hypothesis that sexual reproduction facilitates the spread and elimination of TEs. We identified nine asexual-specific fixed TE insertions, eight long terminal repeat retrotransposons, and one DNA transposon. By comparison, no sexual-specific fixed TE insertions were observed in our analysis. Furthermore, except one TE insertion located on a contig from chromosome 7, the other eight asexual-specific insertion sites are located on contigs from chromosome 9 that is known to be associated with obligate asexuality in D. pulex. We found that all nine asexual-specific fixed TE insertions can also be detected in some Daphnia pulicaria isolates, indicating that a substantial number of TE insertions in asexual D. pulex have been directly inherited from D. pulicaria during the origin of obligate asexuals. PMID:28057730

  7. Identification and chromosome mapping of repetitive elements in the Astyanax scabripinnis (Teleostei: Characidae) species complex.

    Science.gov (United States)

    Barbosa, Patrícia; de Oliveira, Luiz Antonio; Pucci, Marcela Baer; Santos, Mateus Henrique; Moreira-Filho, Orlando; Vicari, Marcelo Ricardo; Nogaroto, Viviane; de Almeida, Mara Cristina; Artoni, Roberto Ferreira

    2015-02-01

    Most part of the eukaryotic genome is composed of repeated sequences or multiple copies of DNA, which were considered as "junk DNA", and may be associated to the heterochromatin. In this study, three populations of Astyanax aff. scabripinnis from Brazilian rivers of Guaratinguetá and Pindamonhangaba (São Paulo) and a population from Maringá (Paraná) were analyzed concerning the localization of the nucleolar organizer regions (Ag-NORs), the As51 satellite DNA, the 18S ribosomal DNA (rDNA), and the 5S rDNA. Repeated sequences were also isolated and identified by the Cot - 1 method, which indicated similarity (90%) with the LINE UnaL2 retrotransposon. The fluorescence in situ hybridization (FISH) showed the retrotransposon dispersed and more concentrated markers in centromeric and telomeric chromosomal regions. These sequences were co-localized and interspaced with 18S and 5S rDNA and As51, confirmed by fiber-FISH essay. The B chromosome found in these populations pointed to a conspicuous hybridization with LINE probe, which is also co-located in As51 sequences. The NORs were active at unique sites of a homologous pair in the three populations. There were no evidences that transposable elements and repetitive DNA had influence in the transcriptional regulation of ribosomal genes in our analyses.

  8. Distribution of Genes and Repetitive Elements in the Diabrotica virgifera virgifera Genome Estimated Using BAC Sequencing

    Directory of Open Access Journals (Sweden)

    Brad S. Coates

    2012-01-01

    Full Text Available Feeding damage caused by the western corn rootworm, Diabrotica virgifera virgifera, is destructive to corn plants in North America and Europe where control remains challenging due to evolution of resistance to chemical and transgenic toxins. A BAC library, DvvBAC1, containing 109,486 clones with 104±34.5 kb inserts was created, which has an ~4.56X genome coverage based upon a 2.58 Gb (2.80 pg flow cytometry-estimated haploid genome size. Paired end sequencing of 1037 BAC inserts produced 1.17 Mb of data (~0.05% genome coverage and indicated ~9.4 and 16.0% of reads encode, respectively, endogenous genes and transposable elements (TEs. Sequencing genes within BAC full inserts demonstrated that TE densities are high within intergenic and intron regions and contribute to the increased gene size. Comparison of homologous genome regions cloned within different BAC clones indicated that TE movement may cause haplotype variation within the inbred strain. The data presented here indicate that the D. virgifera virgifera genome is large in size and contains a high proportion of repetitive sequence. These BAC sequencing methods that are applicable for characterization of genomes prior to sequencing may likely be valuable resources for genome annotation as well as scaffolding.

  9. Method of securing filter elements

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Erik P.; Haslam, Jeffery L.; Mitchell, Mark A.

    2016-10-04

    A filter securing system including a filter unit body housing; at least one tubular filter element positioned in the filter unit body housing, the tubular filter element having a closed top and an open bottom; a dimple in either the filter unit body housing or the top of the tubular filter element; and a socket in either the filter unit body housing or the top of the tubular filter element that receives the dimple in either the filter unit body housing or the top of the tubular filter element to secure the tubular filter element to the filter unit body housing.

  10. Elements of energy conversion

    CERN Document Server

    Russell, Charles R

    2013-01-01

    Elements of Energy Conversion brings together scattered information on the subject of energy conversion and presents it in terms of the fundamental thermodynamics that apply to energy conversion by any process. Emphasis is given to the development of the theory of heat engines because these are and will remain most important power sources. Descriptive material is then presented to provide elementary information on all important energy conversion devices. The book contains 10 chapters and opens with a discussion of forms of energy, energy sources and storage, and energy conversion. This is foll

  11. [Healthcare marketing elements].

    Science.gov (United States)

    Ameri, Cinzia; Fiorini, Fulvio

    2014-01-01

    Marketing puts its foundation on a few key concepts: need-demand, product-service, satisfaction, exchange, market, or business structure manufacturing / supply. The combination of these elements allows you to build an effective marketing strategy. Crucial in this respect is to remember the Porter matrix, which shows that for a correct analysis of the relevant market is necessary to refer to the "five forces at play", ie: customers, competitors, new entrants and substitutes threat. Another key lever for proper marketing oriented approach is the continuous and constant monitoring of the application, anticipating their dissatisfactions.

  12. Elements of analytical dynamics

    CERN Document Server

    Kurth, Rudolph; Stark, M

    1976-01-01

    Elements of Analytical Dynamics deals with dynamics, which studies the relationship between motion of material bodies and the forces acting on them. This book is a compilation of lectures given by the author at the Georgia and Institute of Technology and formed a part of a course in Topological Dynamics. The book begins by discussing the notions of space and time and their basic properties. It then discusses the Hamilton-Jacobi theory and Hamilton's principle and first integrals. The text concludes with a discussion on Jacobi's geometric interpretation of conservative systems. This book will

  13. Analytical elements of mechanics

    CERN Document Server

    Kane, Thomas R

    2013-01-01

    Analytical Elements of Mechanics, Volume 1, is the first of two volumes intended for use in courses in classical mechanics. The books aim to provide students and teachers with a text consistent in content and format with the author's ideas regarding the subject matter and teaching of mechanics, and to disseminate these ideas. The book opens with a detailed exposition of vector algebra, and no prior knowledge of this subject is required. This is followed by a chapter on the topic of mass centers, which is presented as a logical extension of concepts introduced in connection with centroids. A

  14. Elements of probability theory

    CERN Document Server

    Rumshiskii, L Z

    1965-01-01

    Elements of Probability Theory presents the methods of the theory of probability. This book is divided into seven chapters that discuss the general rule for the multiplication of probabilities, the fundamental properties of the subject matter, and the classical definition of probability. The introductory chapters deal with the functions of random variables; continuous random variables; numerical characteristics of probability distributions; center of the probability distribution of a random variable; definition of the law of large numbers; stability of the sample mean and the method of moments

  15. Elements of real analysis

    CERN Document Server

    Sprecher, David A

    2010-01-01

    This classic text in introductory analysis delineates and explores the intermediate steps between the basics of calculus and the ultimate stage of mathematics: abstraction and generalization.Since many abstractions and generalizations originate with the real line, the author has made it the unifying theme of the text, constructing the real number system from the point of view of a Cauchy sequence (a step which Dr. Sprecher feels is essential to learn what the real number system is).The material covered in Elements of Real Analysis should be accessible to those who have completed a course in

  16. Osteoporosis and trace elements

    DEFF Research Database (Denmark)

    Aaseth, J.; Boivin, G.; Andersen, Ole

    2012-01-01

    More than 200 million people are affected by osteoporosis worldwide, as estimated by 2 million annual hip fractures and other debilitating bone fractures (vertebrae compression and Colles' fractures). Osteoporosis is a multi-factorial disease with potential contributions from genetic, endocrine...... in new bone and results in a net gain in bone mass, but may be associated with a tissue of poor quality. Aluminum induces impairment of bone formation. Gallium and cadmium suppresses bone turnover. However, exact involvements of the trace elements in osteoporosis have not yet been fully clarified...

  17. Elements of Architecture

    DEFF Research Database (Denmark)

    Elements of Architecture explores new ways of engaging architecture in archaeology. It conceives of architecture both as the physical evidence of past societies and as existing beyond the physical environment, considering how people in the past have not just dwelled in buildings but have existed...... and affective impacts, of these material remains. The contributions in this volume investigate the way time, performance and movement, both physically and emotionally, are central aspects of understanding architectural assemblages. It is a book about the constellations of people, places and things that emerge...

  18. Ring-laser gyroscope system using dispersive element(s)

    Science.gov (United States)

    Smith, David D. (Inventor)

    2010-01-01

    A ring-laser gyroscope system includes a ring-laser gyroscope (RLG) and at least one dispersive element optically coupled to the RLG's ring-shaped optical path. Each dispersive element has a resonant frequency that is approximately equal to the RLG's lasing frequency. A group index of refraction defined collectively by the dispersive element(s) has (i) a real portion that is greater than zero and less than one, and (ii) an imaginary portion that is less than zero.

  19. An efficient rectangular plate element

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    A new 12-parameter rectangular plate element is presented by useof the double set parameter method. The error in the energy norm is of order O(h2), one order higher than the commonly used Adini nonconforming element.

  20. NIH Common Data Elements Repository

    Data.gov (United States)

    U.S. Department of Health & Human Services — The NIH Common Data Elements (CDE) Repository has been designed to provide access to structured human and machine-readable definitions of data elements that have...

  1. Trace element emissions from coal

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2012-09-15

    Trace elements are emitted during coal combustion. The quantity, in general, depends on the physical and chemical properties of the element itself, the concentration of the element in the coal, the combustion conditions and the type of particulate control device used, and its collection efficiency as a function of particle size. Some trace elements become concentrated in certain particle streams following combustion such as bottom ash, fly ash, and flue gas particulate matter, while others do not. Various classification schemes have been developed to describe this partitioning behaviour. These classification schemes generally distinguish between: Class 1: elements that are approximately equally concentrated in the fly ash and bottom ash, or show little or no fine particle enrichment, examples include Mn, Be, Co and Cr; Class 2: elements that are enriched in the fly ash relative to bottom ash, or show increasing enrichment with decreasing particle size, examples include As, Cd, Pb and Sb; Class 3: elements which are emitted in the gas phase (primarily Hg (not discussed in this review), and in some cases, Se). Control of class 1 trace elements is directly related to control of total particulate matter emissions, while control of the class 2 elements depends on collection of fine particulates. Due to the variability in particulate control device efficiencies, emission rates of these elements can vary substantially. The volatility of class 3 elements means that particulate controls have only a limited impact on the emissions of these elements.

  2. COLOR- SENSITIZED SOLAR ELEMENTS

    Directory of Open Access Journals (Sweden)

    Gish R. A.

    2016-05-01

    Full Text Available Photovoltaic devices are a promising solution to the energy crisis, because they generate electricity directly from sunlight, without producing CO2. While color-sensitized batteries are the most studied element, mainly due to its low cost and high efficiency solar energy conversion into electricity. Until recently, the color-sensitized solar cells performance was less than 1%, however, the use of titanium dioxide as the anode material have greatly raised their efficiency. The advantages of titanium dioxide is primarily in the low cost, but its use provides high light capture efficiency, with external quantum efficiency (efficiency incident photon - charge, usually in the range of 60-90% using nanocrystal forms in comparison with

  3. Ucla, escuela elemental

    Directory of Open Access Journals (Sweden)

    Neutra, Richard J.

    1962-03-01

    Full Text Available La Escuela Elemental de Preparación de la Universidad de California, en Los Angeles, está dedicada a la educación e investigación y preparación del profesorado de la infancia. Se ha construido en un paraje maravilloso, de frondosa vegetación, frente a un terreno bastante quebrado, circunstancia que presta mayor encanto al conjunto, construido con gran pericia y adaptación al paisaje a base de una dominante horizontalidad, con materiales sencillos (ladrillos, hierro y madera y gran comunicación con la naturaleza mediante grandes cristaleras correderas que ensanchan las clases y las suplementan hacia el jardín de acuerdo con las nuevas normas y prácticas docentes.

  4. The fantastic four.. elements

    Science.gov (United States)

    Marsili, Antonella; D'Addezio, Giuliana; Rubbia, Giuliana; Ramieri, Caterina; Todaro, Riccardo; Scipilliti, Francesca; Tosto, Eleonora

    2015-04-01

    With a "Sunday between territory and music to 'National Institute of Geophysics and Volcanology," October 12, 2014 the headquarters of INGV Roma kicked off the activities of the second edition of the Week of Planet Earth. The laboratory of scientific outreach and museum activities together with volunteers of the National Civil Service have organized the whole day dedicated to the dissemination of earth sciences, involving adults and children. Especially for primary school children a laboratory was made involving three amusing activities all aimed at inspiring respect for the Earth: a theatrical representation called "The Fantastic 4... elements", a behavioral game and a nursery rhyme reading. The theater as a means of communication of science is an innovative and creative way to introduce children to important scientific concepts. The use of this methodology and simple language favoring the emotional involvement of the child facilitating learning. The main character is a child, chosen to facilitate the identification of the spectators with the protagonist, that through a fantastic journey discovers the importance of the four elements of our planet: earth, fire, air and water. As a second step, volunteers involved children in reading a nursery rhyme "the ABC to become a Friend of the Earth" inviting them to protect and respect the environment and its resources. Finally, the behavioral game gave indications about behaviors to adopt to safeguard the planet. Volunteers introduced a billboard divided into two colors, green to indicate the right behaviors and red for the wrong ones. Each child, after reading a card with indication on the behavior to adopt, had to decide if they were correct or not with respect to the environment safeguard. After listening to the children's answer, the volunteer gave the correct explanation about the appropriate behavior to adopt. At the end of the activities, each child received a certificate as "a friend of Planet Earth".

  5. Novel high-performance element in the electromagnetic finite-element method--node-edge element

    Institute of Scientific and Technical Information of China (English)

    Sheng Xinqing; Peng Zhen

    2008-01-01

    It is known in the computational electromagnetics (CEM) that the node element has a relative well-conditioned matrix,but suffers from the spurious solution problem; whereas the edge element has no spurious solutions,but usually produces an ill-conditioned matrix.Particularly,when the mesh is over dense,the iterative solution of the matrix equation from edge element converges very slowly.Based on the node element and edge element,a node-edge element is presented,which has no spurious solutions and better-conditioned matrix.Numerical experiments demonstrate that the proposed node-edge element is more efficient than now-widely used edge element.

  6. An element by element spectral element method for elastic wave modeling

    Institute of Scientific and Technical Information of China (English)

    LIN Weijun; WANG Xiuming; ZHANG Hailan

    2006-01-01

    The spectral element method which combines the advantages of spectral method with those of finite element method,provides an efficient tool in simulating elastic wave equation in complex medium. Based on weak form of elastodynamic equations, mathematical formulations for Legendre spectral element method are presented. The wave field on an element is discretized using high-order Lagrange interpolation, and integration over the element is accomplished based upon the Gauss-Lobatto-Legendre integration rule. This results in a diagonal mass matrix which leads to a greatly simplified algorithm. In addition, the element by element technique is introduced in our method to reduce the memory sizes and improve the computation efficiency. Finally, some numerical examples are presented to demonstrate the spectral accuracy and the efficiency. Because of combinations of the finite element scheme and spectral algorithms, this method can be used for complex models, including free surface boundaries and strong heterogeneity.

  7. Enrichment analysis of Alu elements with different spatial chromatin proximity in the human genome

    Directory of Open Access Journals (Sweden)

    Zhuoya Gu

    2016-02-01

    Full Text Available ABSTRACT Transposable elements (TEs have no longer been totally considered as “junk DNA” for quite a time since the continual discoveries of their multifunctional roles in eukaryote genomes. As one of the most important and abundant TEs that still active in human genome, Alu, a SINE family, has demonstrated its indispensable regulatory functions at sequence level, but its spatial roles are still unclear. Technologies based on 3C (chromosome conformation capture have revealed the mysterious three-dimensional structure of chromatin, and make it possible to study the distal chromatin interaction in the genome. To find the role TE playing in distal regulation in human genome, we compiled the new released Hi-C data, TE annotation, histone marker annotations, and the genome-wide methylation data to operate correlation analysis, and found that the density of Alu elements showed a strong positive correlation with the level of chromatin interactions (hESC: r = 0.9, P < 2.2 × 1016; IMR90 fibroblasts: r = 0.94, P < 2.2 × 1016 and also have a significant positive correlation with some remote functional DNA elements like enhancers and promoters (Enhancer: hESC: r = 0.997, P = 2.3 × 10−4; IMR90: r = 0.934, P = 2 × 10−2; Promoter: hESC: r = 0.995, P = 3.8 × 10−4; IMR90: r = 0.996, P = 3.2 × 10−4. Further investigation involving GC content and methylation status showed the GC content of Alu covered sequences shared a similar pattern with that of the overall sequence, suggesting that Alu elements also function as the GC nucleotide and CpG site provider. In all, our results suggest that the Alu elements may act as an alternative parameter to evaluate the Hi-C data, which is confirmed by the correlation analysis of Alu elements and histone markers. Moreover, the GC-rich Alu sequence can bring high GC content and methylation flexibility to the regions with more distal chromatin contact, regulating the transcription of tissue

  8. The Chemistry of Superheavy Elements

    CERN Document Server

    Schädel, M

    2003-01-01

    The chemistry of transactinide or superheavy elements has reached element 108. Preparations are under way to leap to element 112 and beyond. The current status of this atom-at-a-time chemical research and its future perspectives are reviewed from an experimental point of view together with some of the interesting results from n -rich nuclides near and at the N=162 neutron shell. Experimental techniques and important results enlightening typical chemical properties of elements 104 through 108 are presented in an exemplary way. From the results of these experiments it is justified to place these elements in the Periodic Table of the Elements in to groups 4 through 8, respectively. However, mainly due to the influence of relativistic effects, it is no longer possible to deduce detailed chemical properties of these superheavy elements simply from this position.

  9. Occurrence of Tn4371-related mobile elements and sequences in (chloro)biphenyl-degrading bacteria.

    Science.gov (United States)

    Springael, D; Ryngaert, A; Merlin, C; Toussaint, A; Mergeay, M

    2001-01-01

    Tn4371, a 55-kb transposable element involved in the degradation and biphenyl or 4-chlorobiphenyl identified in Ralstonia eutropha A5, displays a modular structure including a phage-like integrase gene (int), a Pseudomonas-like (chloro)biphenyl catabolic gene cluster (bph), and RP4- and Ti-plasmid-like transfer genes (trb) (C. Merlin, D. Springael, and A. Toussaint, Plasmid 41:40-54, 1999). Southern blot hybridization was used to examine the presence of different regions of Tn4371 in a collection of (chloro)biphenyl-degrading bacteria originating from different habitats and belonging to different bacterial genera. Tn4371-related sequences were never detected on endogenous plasmids. Although the gene probes containing only bph sequences hybridized to genomic DNA from most strains tested, a limited selection of strains, all beta-proteobacteria, displayed hybridization patterns similar to the Tn4371 bph cluster. Homology between Tn4371 and DNA of two of those strains, originating from the same area as strain A5, extended outside the catabolic genes and covered the putative transfer region of Tn4371. On the other hand, none of the (chloro)biphenyl degraders hybridized with the outer left part of Tn4371 containing the int gene. The bph catabolic determinant of the two strains displaying homology to the Tn4371 transfer genes and a third strain isolated from the A5 area could be mobilized to a R. eutropha recipient, after insertion into an endogenous or introduced IncP1 plasmid. The mobilized DNA of those strains included all Tn4371 homologous sequences previously identified in their genome. Our observations show that the bph genes present on Tn4371 are highly conserved between different (chloro)biphenyl-degrading hosts, isolated globally but belonging mainly to the beta-proteobacteria. On the other hand, Tn4371-related mobile elements carrying bph genes are apparently only found in isolates from the environment that provided the Tn4371-bearing isolate A5.

  10. A divergent P element and its associated MITE, BuT5, generate chromosomal inversions and are widespread within the Drosophila repleta species group.

    Science.gov (United States)

    Rius, Nuria; Delprat, Alejandra; Ruiz, Alfredo

    2013-01-01

    The transposon BuT5 caused two chromosomal inversions fixed in two Drosophila species of the repleta group, D. mojavensis and D. uniseta. BuT5 copies are approximately 1-kb long, lack any coding capacity, and do not resemble any other transposable element (TE). Because of its elusive features, BuT5 has remained unclassified to date. To fully characterize BuT5, we carried out bioinformatic similarity searches in available sequenced genomes, including 21 Drosophila species. Significant hits were only recovered for D. mojavensis genome, where 48 copies were retrieved, 22 of them approximately 1-kb long. Polymerase chain reaction (PCR) and dot blot analyses on 54 Drosophila species showed that BuT5 is homogeneous in size and has a widespread distribution within the repleta group. Thus, BuT5 can be considered as a miniature inverted-repeat TE. A detailed analysis of the BuT5 hits in D. mojavensis revealed three partial copies of a transposon with ends very similar to BuT5 and a P-element-like transposase-encoding region in between. A putatively autonomous copy of this P element was isolated by PCR from D. buzzatii. This copy is 3,386-bp long and possesses a seven-exon gene coding for an 822-aa transposase. Exon-intron boundaries were confirmed by reverse transcriptase-PCR experiments. A phylogenetic tree built with insect P superfamily transposases showed that the D. buzzatii P element belongs to an early diverging lineage within the P-element family. This divergent P element is likely the master transposon mobilizing BuT5. The BuT5/P element partnership probably dates back approximately 16 Ma and is the ultimate responsible for the generation of the two chromosomal inversions in the Drosophila repleta species group.

  11. Expression of human LINE-1 elements in enhanced by isochromosome 12p; evidence from testicular germ cell tumors and the Pallister-Killian syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Swergold, D. [Food & Drug Admin, Bethesda, MD (United States)

    1994-09-01

    Expression of the human LINE-1 (L1Hs) transposable element is restricted to a narrow range of cell types. Specific expression of either endogenous elements or transfected recombinant elements has been reported primarily in tumors and cell lines of germ cell origin, including the NTera2D1, 2102EP, and JEG3 cell lines. These tumors and cell lines often contain one or more copies of isochromosome 12p, or translocations of 12p. Another human condition, the Pallister-Killian syndrome, is also characterized by the mosaic presence of an isochromosome 12p in patient`s cells. M28, a previously described somatic hybrid cell line, contains a human isochromosone 12p derived from fibroblasts of a patient with Pallister-Killian syndrome in a mouse LMTK-background. I asked whether the M28 cell line would exhibit enhanced expression of endogenous or transfected L1Hs elements. Expression of transfected recombinant L1Hs elements was 10-20 fold higher in M28 than in LMTK-cells. Expression of L1Hs elements was not increased in the GM10868A somatic cell hybrid line which contains a complete human chromosome 12 in a Chinese Hamster Ovary background. Somatic cell hybrid lines containing various human chromosomes in a LMTK-background also exhibited no enhanced L1Hs expression. P40, the protein encoded by the L1Hs first open reading frame, was detected in NTera2D1 but not in non-transfected M28 cells. Preliminary promoter deletion experiments indicate that similar, but non-identical regions of the L1Hs 5{prime} UTR, contribute to high level expression in the NTera2D1 and the M28 cell lines. These data suggest that the enhanced expression of human LINE-1 elements in tumors of germ cell origin is due in part to the presence of the isochromosome 12p.

  12. Chemistry of the superheavy elements.

    Science.gov (United States)

    Schädel, Matthias

    2015-03-13

    The quest for superheavy elements (SHEs) is driven by the desire to find and explore one of the extreme limits of existence of matter. These elements exist solely due to their nuclear shell stabilization. All 15 presently 'known' SHEs (11 are officially 'discovered' and named) up to element 118 are short-lived and are man-made atom-at-a-time in heavy ion induced nuclear reactions. They are identical to the transactinide elements located in the seventh period of the periodic table beginning with rutherfordium (element 104), dubnium (element 105) and seaborgium (element 106) in groups 4, 5 and 6, respectively. Their chemical properties are often surprising and unexpected from simple extrapolations. After hassium (element 108), chemistry has now reached copernicium (element 112) and flerovium (element 114). For the later ones, the focus is on questions of their metallic or possibly noble gas-like character originating from interplay of most pronounced relativistic effects and electron-shell effects. SHEs provide unique opportunities to get insights into the influence of strong relativistic effects on the atomic electrons and to probe 'relativistically' influenced chemical properties and the architecture of the periodic table at its farthest reach. In addition, they establish a test bench to challenge the validity and predictive power of modern fully relativistic quantum chemical models.

  13. Vesta's Elemental Composition

    Science.gov (United States)

    Prettyman, T. H.; Beck, A. W.; Feldman, W. C.; Lawrence, D. J.; McCoy, T. J.; McSween, H. Y.; Mittlefehldt, D. W.; Peplowski, P. N.; Raymond, C. A.; Reedy, R. C.; Russell, C. T.; Titus, T. N.; Toplis, M. J.; Yamashita, N.

    2014-01-01

    Many lines of evidence (e.g. common geochemistry, chronology, O-isotope trends, and the presence of different HED rock types in polymict breccias) indicate that the howardite, eucrite, and diogenite (HED) meteorites originated from a single parent body. Meteorite studies show that this protoplanet underwent igneous differentiation to form a metallic core, an ultramafic mantle, and a basaltic crust. A spectroscopic match between the HEDs and 4 Vesta along with a plausible mechanism for their transfer to Earth, perhaps as chips off V-type asteroids ejected from Vesta's southern impact basin, supports the consensus view that many of these achondritic meteorites are samples of Vesta's crust and upper mantle. The HED-Vesta connection was put to the test by the NASA Dawn mission, which spent a year in close proximity to Vesta. Measurements by Dawn's three instruments, redundant Framing Cameras (FC), a Visible-InfraRed (VIR) spectrometer, and a Gamma Ray and Neutron Detector (GRaND), along with radio science have strengthened the link. Gravity measurements by Dawn are consistent with a differentiated, silicate body, with a dense Fe-rich core. The range of pyroxene compositions determined by VIR overlaps that of the howardites. Elemental abundances determined by nuclear spectroscopy are also consistent with HED-compositions. Observations by GRaND provided a new view of Vesta inaccessible by telescopic observations. Here, we summarize the results of Dawn's geochemical investigation of Vesta and their implications.

  14. EAF optimal managing elements

    Science.gov (United States)

    Ioana, A.; Constantin, N.; Dragna, E. C.

    2017-01-01

    Electric Arc Furnaces (EAF) is an important and complex aggregate. We present elements of EAF operating efficiency. The reliability of the EAF is mainly determined by electric circuit reliability and especially of the transformator of the furnace. This due to the fact that, in an electric steel plant, the objective „24 tapping/day” involves. Due to the complexity of the process, the EAF operation needs a computer usage and, in his componence, it must have two independent calculation units (UC1) and (UC2). Based on these two input sets (Σi1) and ((Σi2), the calculation unit (UC1) builds the general operation procedure based on mathematical methods. For that purpose, there are used the results of the 5 mathematical methods: the mathematical model to write-off the function objective (M.F.O.); the mathematical model of calculating the charge (M.C.C.); the mathematical model of conducting the effective melt (M.C.M.); the mathematical model of reheating the charge (M.R.C.); the mathematical model of blasting the reactive dusts (M.B.R.D.).

  15. Matrix elements of unstable states

    CERN Document Server

    Bernard, V; Meißner, U -G; Rusetsky, A

    2012-01-01

    Using the language of non-relativistic effective Lagrangians, we formulate a systematic framework for the calculation of resonance matrix elements in lattice QCD. The generalization of the L\\"uscher-Lellouch formula for these matrix elements is derived. We further discuss in detail the procedure of the analytic continuation of the resonance matrix elements into the complex energy plane and investigate the infinite-volume limit.

  16. EDGE-ORIENTED HEXAGONAL ELEMENTS

    Institute of Scientific and Technical Information of China (English)

    Chao Yang; Jiachang Sun

    2007-01-01

    In this paper, two new nonconforming hexagonal elements are presented, which are based on the trilinear function space Q(3)1 and are edge-oriented, analogical to the case of the rotated Q1 quadrilateral element. A priori error estimates are given to show that the new elements achieve first-order accuracy in the energy norm and second-order accuracy in the L2 norm. This theoretical result is confirmed by the numerical tests.

  17. Radiation-induced changes in DNA methylation of repetitive elements in the mouse heart

    Energy Technology Data Exchange (ETDEWEB)

    Koturbash, Igor, E-mail: ikoturbash@uams.edu [Department of Environmental and Occupational Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Miousse, Isabelle R. [Department of Environmental and Occupational Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Sridharan, Vijayalakshmi [Division of Radiation Health, Department of Pharmaceutical Sciences, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Nzabarushimana, Etienne; Skinner, Charles M. [Department of Environmental and Occupational Health, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Melnyk, Stepan B.; Pavliv, Oleksandra [Department of Pediatrics, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Hauer-Jensen, Martin [Division of Radiation Health, Department of Pharmaceutical Sciences, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States); Surgical Service, Central Arkansas Veterans Healthcare System, Little Rock, AR 72205 (United States); Nelson, Gregory A. [Departments of Basic Sciences and Radiation Medicine, Loma Linda University, Loma Linda, CA 92354 (United States); Boerma, Marjan [Division of Radiation Health, Department of Pharmaceutical Sciences, University of Arkansas for Medical Sciences, Little Rock, AR 72205 (United States)

    2016-05-15

    Highlights: • Radiation-induced dynamic changes in cardiac DNA methylation were detected. • Early LINE-1 hypomethylation was followed by hypermethylation at a later time-point. • Radiation affected one-carbon metabolism in the heart tissue. • Irradiation resulted in accumulation of satellite DNA mRNA transcripts. - Abstract: DNA methylation is a key epigenetic mechanism, needed for proper control over the expression of genetic information and silencing of repetitive elements. Exposure to ionizing radiation, aside from its strong genotoxic potential, may also affect the methylation of DNA, within the repetitive elements, in particular. In this study, we exposed C57BL/6J male mice to low absorbed mean doses of two types of space radiation—proton (0.1 Gy, 150 MeV, dose rate 0.53 ± 0.08 Gy/min), and heavy iron ions ({sup 56}Fe) (0.5 Gy, 600 MeV/n, dose rate 0.38 ± 0.06 Gy/min). Radiation-induced changes in cardiac DNA methylation associated with repetitive elements were detected. Specifically, modest hypomethylation of retrotransposon LINE-1 was observed at day 7 after irradiation with either protons or {sup 56}Fe. This was followed by LINE-1, and other retrotransposons, ERV2 and SINE B1, as well as major satellite DNA hypermethylation at day 90 after irradiation with {sup 56}Fe. These changes in DNA methylation were accompanied by alterations in the expression of DNA methylation machinery and affected the one-carbon metabolism pathway. Furthermore, loss of transposable elements expression was detected in the cardiac tissue at the 90-day time-point, paralleled by substantial accumulation of mRNA transcripts, associated with major satellites. Given that the one-carbon metabolism pathway can be modulated by dietary modifications, these findings suggest a potential strategy for the mitigation and, possibly, prevention of the negative effects exerted by ionizing radiation on the cardiovascular system. Additionally, we show that the methylation status and

  18. Gamification Elements for Learning Applications

    Directory of Open Access Journals (Sweden)

    Firas Layth Khaleel

    2016-12-01

    Full Text Available Gamification technique is getting popular to be implemented in learning or training application. It is referred to the use of game elements or game thinking in a non-game context in order to increase engagement between students and learning application. Since there are many elements of games that are identified from previous works, this study focuses on game elements from Gamification technique that positively affect learning when applied to a learning application. Therefore, the objectives of this research are to identify game elements that can be gamified in a learning application; and to verify those elements by multiple users (gamers, students, and experts. Suitable game elements are identified through literature reviews. Two approaches are used to verify these elements; interview experts and administer a survey to gamers and students. The finding of this study suggests the use of a group of game elements with three aims, (1 increase the level of fun and entertainment; (2 motivate students to challenge each other; and (3 improve gaming and learning skills. In a further study, these elements will be implemented in a learning application and its effectiveness shall be tested.

  19. Photoshop Elements 10 For Dummies

    CERN Document Server

    Obermeier, Barbara

    2011-01-01

    Perfect your photos and images with this "focused" guide to the latest version of Photoshop Elements For most of us, the professional-level Photoshop is overkill for our needs. Amateur photographers and photo enthusiasts turn to Photoshop Elements for a powerful but simpler way to edit and retouch their snapshots. Photoshop Elements 10 For Dummies, fully updated and revised for the latest release of this software product, helps you navigate Elements to create, edit, fix, share, and organize the high-quality images you desire. Full color pages bring the techniques to life and make taking great

  20. SNTP program fuel element design

    Science.gov (United States)

    Walton, Lewis A.; Ales, Matthew W.

    1993-06-01

    The SNTP program is evaluating the feasibility of utilizing a particle bed reactor to develop a high-performance nuclear thermal rocket engine. The optimum fuel element arrangement depends on the power level desired and the intended application. The key components of the fuel element have been developed and are being tested.

  1. RESEARCH METHODS OF LOCATIVE ELEMENT

    Directory of Open Access Journals (Sweden)

    SULAYMANOVA N.J.

    2012-01-01

    Full Text Available The article is devoted to the methods of investigation of locative elements. Sentence analysis with locative elements is taken according to the results of component analysis in the system of contradicting – opposition. More over the article is full of examples related to the description of various syntactic units.

  2. Repetitive elements in parasitic protozoa

    Directory of Open Access Journals (Sweden)

    Clayton Christine

    2010-05-01

    Full Text Available Abstract A recent paper published in BMC Genomics suggests that retrotransposition may be active in the human gut parasite Entamoeba histolytica. This adds to our knowledge of the various types of repetitive elements in parasitic protists and the potential influence of such elements on pathogenicity. See research article http://www.biomedcentral.com/1471-2164/11/321

  3. Clean Elements in Abelian Rings

    Indian Academy of Sciences (India)

    Angelina Y M Chin

    2009-04-01

    Let be a ring with identity. An element in is said to be clean if it is the sum of a unit and an idempotent. is said to be clean if all of its elements are clean. If every idempotent in is central, then is said to be abelian. In this paper we obtain some conditions equivalent to being clean in an abelian ring.

  4. Solution of Finite Element Equations

    DEFF Research Database (Denmark)

    Krenk, Steen

    An important step in solving any problem by the finite element method is the solution of the global equations. Numerical solution of linear equations is a subject covered in most courses in numerical analysis. However, the equations encountered in most finite element applications have some special...

  5. Chemical experiments with superheavy elements.

    Science.gov (United States)

    Türler, Andreas

    2010-01-01

    Unnoticed by many chemists, the Periodic Table of the Elements has been extended significantly in the last couple of years and the 7th period has very recently been completed with eka-Rn (element 118) currently being the heaviest element whose synthesis has been reported. These 'superheavy' elements (also called transactinides with atomic number > or = 104 (Rf)) have been artificially synthesized in fusion reactions at accelerators in minute quantities of a few single atoms. In addition, all isotopes of the transactinide elements are radioactive and decay with rather short half-lives. Nevertheless, it has been possible in some cases to investigate experimentally chemical properties of transactinide elements and even synthesize simple compounds. The experimental investigation of superheavy elements is especially intriguing, since theoretical calculations predict significant deviations from periodic trends due to the influence of strong relativistic effects. In this contribution first experiments with hassium (Hs, atomic number 108), copernicium (Cn, atomic number 112) and element 114 (eka-Pb) are reviewed.

  6. Massively Parallel Finite Element Programming

    KAUST Repository

    Heister, Timo

    2010-01-01

    Today\\'s large finite element simulations require parallel algorithms to scale on clusters with thousands or tens of thousands of processor cores. We present data structures and algorithms to take advantage of the power of high performance computers in generic finite element codes. Existing generic finite element libraries often restrict the parallelization to parallel linear algebra routines. This is a limiting factor when solving on more than a few hundreds of cores. We describe routines for distributed storage of all major components coupled with efficient, scalable algorithms. We give an overview of our effort to enable the modern and generic finite element library deal.II to take advantage of the power of large clusters. In particular, we describe the construction of a distributed mesh and develop algorithms to fully parallelize the finite element calculation. Numerical results demonstrate good scalability. © 2010 Springer-Verlag.

  7. Chemical elements distribution in cells

    Science.gov (United States)

    Ortega, R.

    2005-04-01

    Analysing, imaging and understanding the cellular chemistry, from macromolecules to monoatomic elements, is probably a major challenge for the scientific community after the conclusion of the genome project. In order to probe the distribution of elements in cells, especially the so-called inorganic elements, it is necessary to apply microanalytical techniques with sub-micrometer resolution and high chemical sensitivity. This paper presents the current status of chemical element imaging inside cells, and a comparison of the different analytical techniques available: nuclear microprobe, electron microprobe and electron energy loss spectroscopy, synchrotron radiation microprobe, secondary ion mass spectrometry and fluorescence microscopy methods. Examples of intracellular chemical elements distributions relevant to cancer pharmacology, medical imaging, metal carcinogenesis and neuropathology studies obtained by nuclear microprobe and other microanalytical techniques are presented.

  8. Second order tensor finite element

    Science.gov (United States)

    Oden, J. Tinsley; Fly, J.; Berry, C.; Tworzydlo, W.; Vadaketh, S.; Bass, J.

    1990-01-01

    The results of a research and software development effort are presented for the finite element modeling of the static and dynamic behavior of anisotropic materials, with emphasis on single crystal alloys. Various versions of two dimensional and three dimensional hybrid finite elements were implemented and compared with displacement-based elements. Both static and dynamic cases are considered. The hybrid elements developed in the project were incorporated into the SPAR finite element code. In an extension of the first phase of the project, optimization of experimental tests for anisotropic materials was addressed. In particular, the problem of calculating material properties from tensile tests and of calculating stresses from strain measurements were considered. For both cases, numerical procedures and software for the optimization of strain gauge and material axes orientation were developed.

  9. Deep investigation of Arabidopsis thaliana junk DNA reveals a continuum between repetitive elements and genomic dark matter.

    Science.gov (United States)

    Maumus, Florian; Quesneville, Hadi

    2014-01-01

    Eukaryotic genomes contain highly variable amounts of DNA with no apparent function. This so-called junk DNA is composed of two components: repeated and repeat-derived sequences (together referred to as the repeatome), and non-annotated sequences also known as genomic dark matter. Because of their high duplication rates as compared to other genomic features, transposable elements are predominant contributors to the repeatome and the products of their decay is thought to be a major source of genomic dark matter. Determining the origin and composition of junk DNA is thus important to help understanding genome evolution as well as host biology. In this study, we have used a combination of tools enabling to show that the repeatome from the small and reducing A. thaliana genome is significantly larger than previously thought. Furthermore, we present the concepts and results from a series of innovative approaches suggesting that a significant amount of the A. thaliana dark matter is of repetitive origin. As a tentative standard for the community, we propose a deep compendium annotation of the A. thaliana repeatome that may help addressing farther genome evolution as well as transcriptional and epigenetic regulation in this model plant.

  10. Kriging-Based Finite Element Method: Element-By-Element Kriging Interpolation

    Directory of Open Access Journals (Sweden)

    W. Kanok-Nukulchai

    2009-01-01

    Full Text Available An enhancement of the finite element method with Kriging shape functions (K-FEM was recently proposed. In this method, the field variables of a boundary value problem are approximated using ‘element-by-element’ piecewise Kriging interpolation (el-KI. For each element, the interpolation function is constructed from a set of nodes within a prescribed domain of influence comprising the element and its several layers of neighbouring elements. This paper presents a numerical study on the accuracy and convergence of the el-KI in function fitting problems. Several examples of functions in two-dimensional space are employed in this study. The results show that very accurate function fittings and excellent convergence can be attained by the el-KI.

  11. Imaging techniques for elements and element species in plant science.

    Science.gov (United States)

    Wu, Bei; Becker, J Sabine

    2012-05-01

    Revealing the uptake, transport, localization and speciation of both essential and toxic elements in plants is important for understanding plant homeostasis and metabolism, subsequently, providing information for food and nutrient studies, agriculture activities, as well as environmental research. In the last decade, emerging techniques for elemental imaging and speciation analysis allowed us to obtain increasing knowledge of elemental distribution and availabilities in plants. Chemical imaging techniques include mass spectrometric methods such as secondary ionization mass spectrometry (SIMS), laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) and synchrotron-based techniques such as X-ray fluorescence spectroscopy (SRXRF), and so forth. On the other hand, X-ray absorption spectroscopy (XAS) based on synchrotron radiation is capable of in situ investigation of local atomic structure around the central element of interest. This technique can also be operated in tandem with SRXRF to image each element species of interest within plant tissue. In this review, the principles and state-of-the-art of these techniques regarding sample preparation, advantages and limitations, and improvement of sensitivity and spatial resolution are discussed. New results with respect to elemental distribution and speciation in plants revealed by these techniques are presented.

  12. Finite element computational fluid mechanics

    Science.gov (United States)

    Baker, A. J.

    1983-01-01

    Finite element analysis as applied to the broad spectrum of computational fluid mechanics is analyzed. The finite element solution methodology is derived, developed, and applied directly to the differential equation systems governing classes of problems in fluid mechanics. The heat conduction equation is used to reveal the essence and elegance of finite element theory, including higher order accuracy and convergence. The algorithm is extended to the pervasive nonlinearity of the Navier-Stokes equations. A specific fluid mechanics problem class is analyzed with an even mix of theory and applications, including turbulence closure and the solution of turbulent flows.

  13. Finite element methods for engineers

    CERN Document Server

    Fenner, Roger T

    2013-01-01

    This book is intended as a textbook providing a deliberately simple introduction to finite element methods in a way that should be readily understandable to engineers, both students and practising professionals. Only the very simplest elements are considered, mainly two dimensional three-noded “constant strain triangles”, with simple linear variation of the relevant variables. Chapters of the book deal with structural problems (beams), classification of a broad range of engineering into harmonic and biharmonic types, finite element analysis of harmonic problems, and finite element analysis of biharmonic problems (plane stress and plane strain). Full Fortran programs are listed and explained in detail, and a range of practical problems solved in the text. Despite being somewhat unfashionable for general programming purposes, the Fortran language remains very widely used in engineering. The programs listed, which were originally developed for use on mainframe computers, have been thoroughly updated for use ...

  14. An efficient rectangular plate element

    Institute of Scientific and Technical Information of China (English)

    SHI; Zhongci

    2001-01-01

    [1]Shi Zhong-ci, On the accuracy of the quasi-conforming and generalize conforming finite elements, Chin. Ann. Math., 1990, 11B: 148.[2]Shi Zhong-ci, Chen Shao-chun, Huang Hong-ci, Plate elements with high accuracy, Collec. Geom. Anal. Math. Phys. (ed. Li Ta-Tsien), Singapore: World Scientific, 1997, 155—164.[3]Chen Shao-chun, Shi Zhong-ci, Double set parameter method for the construction of the element stiffness matrix, Mathematica Numerica Sinica (in Chinese), 1991, 13: 286.[4]Ciarlet, P., The Finite Element Method for Elliptic Problems, Amsterdam: North-Holland, 1978.

  15. Repetitive genome elements in a European corn borer, Ostrinia nubilalis, bacterial artificial chromosome library were indicated by bacterial artificial chromosome end sequencing and development of sequence tag site markers: implications for lepidopteran genomic research.

    Science.gov (United States)

    Coates, Brad S; Sumerford, Douglas V; Hellmich, Richard L; Lewis, Leslie C

    2009-01-01

    The European corn borer, Ostrinia nubilalis, is a serious pest of food, fiber, and biofuel crops in Europe, North America, and Asia and a model system for insect olfaction and speciation. A bacterial artificial chromosome library constructed for O. nubilalis contains 36 864 clones with an estimated average insert size of >or=120 kb and genome coverage of 8.8-fold. Screening OnB1 clones comprising approximately 2.76 genome equivalents determined the physical position of 24 sequence tag site markers, including markers linked to ecologically important and Bacillus thuringiensis toxin resistance traits. OnB1 bacterial artificial chromosome end sequence reads (GenBank dbGSS accessions ET217010 to ET217273) showed homology to annotated genes or expressed sequence tags and identified repetitive genome elements, O. nubilalis miniature subterminal inverted repeat transposable elements (OnMITE01 and OnMITE02), and ezi-like long interspersed nuclear elements. Mobility of OnMITE01 was demonstrated by the presence or absence in O. nubilalis of introns at two different loci. A (GTCT)n tetranucleotide repeat at the 5' ends of OnMITE01 and OnMITE02 are evidence for transposon-mediated movement of lepidopteran microsatellite loci. The number of repetitive elements in lepidopteran genomes will affect genome assembly and marker development. Single-locus sequence tag site markers described here have downstream application for integration within linkage maps and comparative genomic studies.

  16. PROPOSAL OF NEW OPTICAL ELEMENTS

    Directory of Open Access Journals (Sweden)

    Goce Chadzitaskos

    2013-10-01

    Full Text Available A overview of our patented proposals of new optical elements is presented. The elements are suitable for laser pulse analysis, telescopy, X-ray microscopy and X-ray telescopy. They are based on the interference properties of light: a special grating for a double slit pattern, parabolic strip imaging for a telescope, and Bragg’s condition for X-ray scattering on a slice of a single crystal for X-raymicroscopy and X-ray telescopy.

  17. Naturalistic Elements in The Egg

    Institute of Scientific and Technical Information of China (English)

    惠菲菲

    2013-01-01

    The purpose of the study is to analyze the naturalistic elements in The Egg, which is taken from the collection of short stories, The Triumph of the Egg. The study states the ideology and technique of naturalism and then exams how naturalistic ele-ments are revealed in the fiction. Then it comes to the conclusion that the family is defeated by the egg and the life of human be-ings is under control of complicated forces from both inside and outside.

  18. Elements of EAF automation processes

    Science.gov (United States)

    Ioana, A.; Constantin, N.; Dragna, E. C.

    2017-01-01

    Our article presents elements of Electric Arc Furnace (EAF) automation. So, we present and analyze detailed two automation schemes: the scheme of electrical EAF automation system; the scheme of thermic EAF automation system. The application results of these scheme of automation consists in: the sensitive reduction of specific consummation of electrical energy of Electric Arc Furnace, increasing the productivity of Electric Arc Furnace, increase the quality of the developed steel, increasing the durability of the building elements of Electric Arc Furnace.

  19. [Unusual elements in renal calculi].

    Science.gov (United States)

    Rodríguez-Miñón Cifuentes, J L; Salvador, E; Traba Villameytide, M L

    2006-01-01

    A group of 54 renal calculi were spontaneously passed renal stone after a nephritic colic. Two groups of calculi were found: papillary and non-papillary calculi. All calculi were analyzed by infrared spectroscopy and electronic microscopy scan (EMS) and EDAX. When the stones were analyzed with EDAX, elements such as C, N, O, Na, S, Mg, Al, Si, Cl, K, Ca, Mn, Fe, Ni, Zn were detected. The possible origin of these elements is discussed in this work.

  20. Nuclear chemistry of transactinide elements

    Energy Technology Data Exchange (ETDEWEB)

    Nagame, Yuichiro [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    1997-07-01

    The current status on the nuclear chemistry studies of transactinide elements is reviewed. The production of transactinides in heavy ion reactions is briefly discussed, and nuclear properties on the stability of transactinides are presented. Chemical properties of the trans-actinide elements 104, 105 and 106, and a typical experimental technique used to study these properties on an atom-at-a-time base are introduced. (author)

  1. Resistance determinants and mobile genetic elements of an NDM-1-encoding Klebsiella pneumoniae strain.

    Directory of Open Access Journals (Sweden)

    Corey M Hudson

    Full Text Available Multidrug-resistant Enterobacteriaceae are emerging as a serious infectious disease challenge. These strains can accumulate many antibiotic resistance genes though horizontal transfer of genetic elements, those for β-lactamases being of particular concern. Some β-lactamases are active on a broad spectrum of β-lactams including the last-resort carbapenems. The gene for the broad-spectrum and carbapenem-active metallo-β-lactamase NDM-1 is rapidly spreading. We present the complete genome of Klebsiella pneumoniae ATCC BAA-2146, the first U.S. isolate found to encode NDM-1, and describe its repertoire of antibiotic-resistance genes and mutations, including genes for eight β-lactamases and 15 additional antibiotic-resistance enzymes. To elucidate the evolution of this rich repertoire, the mobile elements of the genome were characterized, including four plasmids with varying degrees of conservation and mosaicism and eleven chromosomal genomic islands. One island was identified by a novel phylogenomic approach, that further indicated the cps-lps polysaccharide synthesis locus, where operon translocation and fusion was noted. Unique plasmid segments and mosaic junctions were identified. Plasmid-borne blaCTX-M-15 was transposed recently to the chromosome by ISEcp1. None of the eleven full copies of IS26, the most frequent IS element in the genome, had the expected 8-bp direct repeat of the integration target sequence, suggesting that each copy underwent homologous recombination subsequent to its last transposition event. Comparative analysis likewise indicates IS26 as a frequent recombinational junction between plasmid ancestors, and also indicates a resolvase site. In one novel use of high-throughput sequencing, homologously recombinant subpopulations of the bacterial culture were detected. In a second novel use, circular transposition intermediates were detected for the novel insertion sequence ISKpn21 of the ISNCY family, suggesting that it uses

  2. Physical model of Nernst element

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Hiroaki [Venture Business Lab., Nagoya Univ., Nagoya (Japan); Ikeda, Kazuaki; Yamaguchi, Satarou

    1998-08-01

    Generation of electric power by the Nernst effect is a new application of a semiconductor. A key point of this proposal is to find materials with a high thermomagnetic figure-of-merit, which are called Nernst elements. In order to find candidates of the Nernst element, a physical model to describe its transport phenomena is needed. As the first model, we began with a parabolic two-band model in classical statistics. According to this model, we selected InSb as candidates of the Nernst element and measured their transport coefficients in magnetic fields up to 4 Tesla within a temperature region from 270 K to 330 K. In this region, we calculated transport coefficients numerically by our physical model. For InSb, experimental data are coincident with theoretical values in strong magnetic field. (author)

  3. Spectral element simulation of ultrafiltration

    DEFF Research Database (Denmark)

    Hansen, M.; Barker, Vincent A.; Hassager, Ole

    1998-01-01

    A spectral element method for simulating stationary 2-D ultrafiltration is presented. The mathematical model is comprised of the Navier-Stokes equations for the velocity field of the fluid and a transport equation for the concentration of the solute. In addition to the presence of the velocity...... vector in the transport equation, the system is coupled by the dependency of the fluid viscosity on the solute concentration and by a concentration-dependent boundary condition for the Navier-Stokes equations at the membrane surface. The spectral element discretization yields a nonlinear algebraic system....... The performance of the spectral element code when applied to several ultrafiltration problems is reported. (C) 1998 Elsevier Science Ltd. All rights reserved....

  4. Element-Based Computational Model

    Directory of Open Access Journals (Sweden)

    Conrad Mueller

    2012-02-01

    Full Text Available A variation on the data-flow model is proposed to use for developing parallel architectures. While the model is a data driven model it has significant differences to the data-flow model. The proposed model has an evaluation cycleof processing elements (encapsulated data that is similar to the instruction cycle of the von Neumann model. The elements contain the information required to process them. The model is inherently parallel. An emulation of the model has been implemented. The objective of this paper is to motivate support for taking the research further. Using matrix multiplication as a case study, the element/data-flow based model is compared with the instruction-based model. This is done using complexity analysis followed by empirical testing to verify this analysis. The positive results are given as motivation for the research to be taken to the next stage - that is, implementing the model using FPGAs.

  5. Mechanical Analogies of Fractional Elements

    Institute of Scientific and Technical Information of China (English)

    HU Kai-Xin; ZHU Ke-Qin

    2009-01-01

    A Fractional element model describes a special kind of viscoelastic material.Its stress is proportional to the fractional-order derivative of strain. Physically the mechanical analogies of fractional elements can be represented by spring-dashpot fractal networks. We introduce a constitutive operator in the constitutive equations of viscoelastic materials.To derive constitutive operators for spring-dashpot fractal networks, we use Heaviside operational calculus, which provides explicit answers not otherwise obtainable simply.Then the series-parallel formulas for the constitutive operator are derived. Using these formulas, a constitutive equation of fractional element with 1/2-order derivative is obtained.Finally we find the way to derive the constitutive equations with other fractional-order derivatives and their mechanical analogies.

  6. SUPERCONVERGENCE ANALYSIS FOR CUBIC TRIANGULAR ELEMENT OF THE FINITE ELEMENT

    Institute of Scientific and Technical Information of China (English)

    Qi-ding Zhu

    2000-01-01

    In this paper, we construct a projection interpolation for cubic triangular ele- ment by using othogonal expansion triangular method. We show two fundamental formulas of estimation on a special partion and obtain a superconvergence result of 1 -e order higher for the placement function and its tangential derivative on the third order Lobatto points and Gauss points on each edge of triangular element.

  7. Finite elements of nonlinear continua

    CERN Document Server

    Oden, J T

    2000-01-01

    Geared toward undergraduate and graduate students, this text extends applications of the finite element method from linear problems in elastic structures to a broad class of practical, nonlinear problems in continuum mechanics. It treats both theory and applications from a general and unifying point of view.The text reviews the thermomechanical principles of continuous media and the properties of the finite element method, and then brings them together to produce discrete physical models of nonlinear continua. The mathematical properties of these models are analyzed, along with the numerical s

  8. Organic chemistry of elemental phosphorus

    Energy Technology Data Exchange (ETDEWEB)

    Milyukov, V A; Budnikova, Yulia H; Sinyashin, Oleg G [A.E. Arbuzov Institute of Organic and Physical Chemistry, Kazan Scientific Centre of the Russian Academy of Sciences, Kazan (Russian Federation)

    2005-09-30

    The principal achievements and the modern trends in the development of the chemistry of elemental phosphorus are analysed, described systematically and generalised. The possibilities and advantages of the preparation of organophosphorus compounds directly from white phosphorus are demonstrated. Attention is focused on the activation and transformation of elemental phosphorus in the coordination sphere of transition metal complexes. The mechanisms of the reactions of white phosphorus with nucleophilic and electrophilic reagents are discussed. Electrochemical approaches to the synthesis of organic phosphorus derivatives based on white phosphorus are considered.

  9. FINITE ELEMENT ANALYSIS OF STRUCTURES

    Directory of Open Access Journals (Sweden)

    PECINGINA OLIMPIA-MIOARA

    2015-05-01

    Full Text Available The application of finite element method is analytical when solutions can not be applied for deeper study analyzes static, dynamic or other types of requirements in different points of the structures .In practice it is necessary to know the behavior of the structure or certain parts components of the machine under the influence of certain factors static and dynamic . The application of finite element in the optimization of components leads to economic growth , to increase reliability and durability organs studied, thus the machine itself.

  10. Elements of spatial data quality

    CERN Document Server

    Guptill, SC

    1995-01-01

    Elements of Spatial Data Quality outlines the need and suggests potential categories for the content of a comprehensive statement of data quality that must be imbedded in the metadata that accompanies the transfer of a digital spatial data file or is available in a separate metadata catalog. Members of the International Cartographic Association's Commission on Spatial Data Quality have identified seven elements of data quality: positional accuracy, attribute accuracy, completeness, logical consistency, lineage, semantic accuracy and temporal information. In the book the authors describe: compo

  11. Fractal elements and their applications

    CERN Document Server

    Gil’mutdinov, Anis Kharisovich; El-Khazali, Reyad

    2017-01-01

    This book describes a new type of passive electronic components, called fractal elements, from a theoretical and practical point of view. The authors discuss in detail the physical implementation and design of fractal devices for application in fractional-order signal processing and systems. The concepts of fractals and fractal signals are explained, as well as the fundamentals of fractional calculus. Several implementations of fractional impedances are discussed, along with comparison of their performance characteristics. Details of design, schematics, fundamental techniques and implementation of RC-based fractal elements are provided. .

  12. A high temperature fuel element

    Energy Technology Data Exchange (ETDEWEB)

    Sekido, A.; Nakai, M.; Ninomiya, Y.

    1982-12-21

    A solid electrolyte which conducts electricity with heating by oxygen ions and operates at a temperature of 1,000C is used in the element. The cathode, besides the ionic conductivity in oxygen, has an electron conductivity. The anode has electron conductivity. Substances such as Bi203, into which oxides of alkaline earth metals are added, are used for making the cathode. The electrolyte consists of ZrO2 and Y2O3, to which CaO is added. WC, to which an H2 type fuel is fed, serves as the anode. The element has a long service life.

  13. A 3D pyramid spline element

    Institute of Scientific and Technical Information of China (English)

    Juan Chen; Chong-Jun Li; Wan-Ji Chen

    2011-01-01

    In this paper,a 13-node pyramid spline element is derived by using the tetrahedron volume coordinates and the B-net method,which achieves the second order completeness in Cartesian coordinates.Some appropriate examples were employed to evaluate the performance of the proposed element.The numerical results show that the spline element has much better performance compared with the isoparametric serendipity element Q20 and its degenerate pyramid element P13 especially when mesh is distorted,and it is comparable to the Lagrange element Q27.It has been demonstrated that the spline finite element method is an efficient tool for developing high accuracy elements.

  14. Nuclear fuel elements design, fabrication and performance

    CERN Document Server

    Frost, Brian R T

    1982-01-01

    Nuclear Fuel Elements: Design, Fabrication and Performance is concerned with the design, fabrication, and performance of nuclear fuel elements, with emphasis on fast reactor fuel elements. Topics range from fuel types and the irradiation behavior of fuels to cladding and duct materials, fuel element design and modeling, fuel element performance testing and qualification, and the performance of water reactor fuels. Fast reactor fuel elements, research and test reactor fuel elements, and unconventional fuel elements are also covered. This volume consists of 12 chapters and begins with an overvie

  15. On Gothic Elements in Beloved

    Institute of Scientific and Technical Information of China (English)

    任欢

    2016-01-01

    Toni Morrison,a well-known female writer,won Nobel Prize for literature in 1993.Beloved,her fifth novel,wins great popu-larity among readers and it is famous for adopting gothic genre to represent black people’s trauma and deal with it.This paper aims at analy-zing the gothic elements demonstrated in this novel.

  16. Gothic Elements in Folding Beijing

    Institute of Scientific and Technical Information of China (English)

    Hua Yan

    2016-01-01

    The study claims that Folding Beijing can not only be read as science fiction but also as Gothic literature,in which perspective,Gothic Elements such as Gothic Setting, Gothic Wanderer and Transgressions,and Gothic Terror are discussed respectively.

  17. Environmental research on actinide elements

    Energy Technology Data Exchange (ETDEWEB)

    Pinder, J.E. III; Alberts, J.J.; McLeod, K.W.; Schreckhise, R.G. (eds.)

    1987-08-01

    The papers synthesize the results of research sponsored by DOE's Office of Health and Environmental Research on the behavior of transuranic and actinide elements in the environment. Separate abstracts have been prepared for the 21 individual papers. (ACR)

  18. Trace elements: implications for nursing.

    Science.gov (United States)

    Hayter, J

    1980-01-01

    Although most were unknown a few years ago, present evidence indicates that at least 25 trace elements have some pertinence to health. Unlike vitamins, they cannot be synthesized. Some trace elements are now considered important only because of their harmful effects but traces of them may be essential. Zinc is especially important during puberty, pregnancy and menopause and is related to protein metabolism. Both fluoride and cadmium accumulate in the body year after year. Cadmium is positively correlated with several chronic diseases, especially hypertension. It is obtained from smoking and drinking soft water. Silicon, generally associated with silicosis, may be necessary for healthy bone and connective tissue. Chromium, believed to be the glucose tolerance factor, is obtained from brewer's yeast, spices, and whole wheat products. Copper deficiency may be implicated in a wide range of cardiovascular and blood related disorders. Either marginal deficiencies or slight excesses of most trace elements are harmful. Nurses should instruct patients to avoid highly refined foods, fad diets, or synthetic and fabricated foods. A well balanced and varied diet is the best safeguard against trace element excesses or deficiencies.

  19. Dynamic and Transient Infinite Elements

    CERN Document Server

    Zhao, Chongbin

    2009-01-01

    Intends to provide the theory and the application of dynamic and transient infinite elements for simulating the far fields of infinite domains involved in many of scientific and engineering problems, based on the author's own work over the years. This title is suitable for computational geoscientists, geotechnical engineers, and civil engineers.

  20. Evidence for primordial superheavy elements

    Energy Technology Data Exchange (ETDEWEB)

    Gentry, R.V.; Cahill, T.A.; Fletcher, N.R.; Kaufmann, H.C.; Medsker, L.R.; Nelson, J.W.; Flocchini, R.G.

    1976-07-05

    Microscopic crystalline monazite inclusions showing giant halo formation in biotite mica have been analyzed by the method of proton-induced x-ray emission. The observed x-ray energy spectra are best explained by the presence of a number of superheavy elements. (AIP)

  1. Presidential elements in government: introduction

    NARCIS (Netherlands)

    Reestman, J.H.

    2006-01-01

    The editorial board of the European Constitutional Law Review has solicited a number of contributions on presidential elements in government systems in Europe. At the origin of the project are some recent sweeping interventions of heads of state in the political arena. These are notably the (suspens

  2. Naturalistic Elements in Sister Carrie

    Institute of Scientific and Technical Information of China (English)

    刘艳晖

    2007-01-01

    @@ Theodore Dreiser is considered to be a controversial writer.His first novel.Sister Carrie makes a new way of presenting re-ality.This paper discusses the naturalistic elements from the de-tailed description of the environment in that society.

  3. Compact Fuel Element Environment Test

    Science.gov (United States)

    Bradley, D. E.; Mireles, O. R.; Hickman, R. R.; Broadway, J. W.

    2012-01-01

    Deep space missions with large payloads require high specific impulse (I(sub sp)) and relatively high thrust to achieve mission goals in reasonable time frames. Conventional, storable propellants produce average I(sub sp). Nuclear thermal rockets (NTRs) capable of high I(sub sp) thrust have been proposed. NTR employs heat produced by fission reaction to heat and therefore accelerate hydrogen, which is then forced through a rocket nozzle providing thrust. Fuel element temperatures are very high (up to 3,000 K) and hydrogen is highly reactive with most materials at high temperatures. Data covering the effects of high-temperature hydrogen exposure on fuel elements are limited. The primary concern is the mechanical failure of fuel elements that employ high melting point metals, ceramics, or a combination (cermet) as a structural matrix into which the nuclear fuel is distributed. It is not necessary to include fissile material in test samples intended to explore high-temperature hydrogen exposure of the structural support matrices. A small-scale test bed designed to heat fuel element samples via noncontact radio frequency heating and expose samples to hydrogen for typical mission durations has been developed to assist in optimal material and manufacturing process selection without employing fissile material. This Technical Memorandum details the test bed design and results of testing conducted to date.

  4. Actinomycete integrative and conjugative elements

    NARCIS (Netherlands)

    Poele, Evelien M. te; Bolhuis, Henk; Dijkhuizen, Lubbert

    2008-01-01

    This paper reviews current knowledge on actinomycete integrative and conjugative elements (AICEs). The best characterised AICEs, pSAM2 of Streptomyces ambofaciens (10.9 kb), SLP1 (17.3 kb) of Streptomyces coelicolor and pMEA300 of Amycolatopsis methanolica (13.3 kb), are present as integrative eleme

  5. Superheavy-element spectroscopy: Correlations along element 115 decay chains

    Directory of Open Access Journals (Sweden)

    Rudolph D.

    2016-01-01

    Full Text Available Following a brief summary of the region of the heaviest atomic nuclei yet created in the laboratory, data on more than hundred α-decay chains associated with the production of element 115 are combined to investigate time and energy correlations along the observed decay chains. Several of these are analysed using a new method for statistical assessments of lifetimes in sets of decay chains.

  6. An improved optimal elemental method for updating finite element models

    Institute of Scientific and Technical Information of China (English)

    Duan Zhongdong(段忠东); Spencer B.F.; Yan Guirong(闫桂荣); Ou Jinping(欧进萍)

    2004-01-01

    The optimal matrix method and optimal elemental method used to update finite element models may not provide accurate results. This situation occurs when the test modal model is incomplete, as is often the case in practice. An improved optimal elemental method is presented that defines a new objective function, and as a byproduct, circumvents the need for mass normalized modal shapes, which are also not readily available in practice. To solve the group of nonlinear equations created by the improved optimal method, the Lagrange multiplier method and Matlab function fmincon are employed. To deal with actual complex structures,the float-encoding genetic algorithm (FGA) is introduced to enhance the capability of the improved method. Two examples, a 7-degree of freedom (DOF) mass-spring system and a 53-DOF planar frame, respectively, are updated using the improved method.Thc example results demonstrate the advantages of the improved method over existing optimal methods, and show that the genetic algorithm is an effective way to update the models used for actual complex structures.

  7. Low cost, lightweight fuel cell elements

    Science.gov (United States)

    Kindler, Andrew (Inventor)

    2001-01-01

    New fuel cell elements for use in liquid feed fuel cells are provided. The elements including biplates and endplates are low in cost, light in weight, and allow high efficiency operation. Electrically conductive elements are also a part of the fuel cell elements.

  8. The Transuranium Elements - Present Status: Nobel Lecture

    Science.gov (United States)

    Seaborg, G. T.

    1951-12-12

    The discovery of the transuranium elements and the work done on them up to the present time are reviewed. The properties of these elements, their relationship to other elements, their place in the periodic table, and the possibility of production and identification of other transuranium elements are discussed briefly.

  9. Transcriptional landscape of ncRNA and Repeat elements in somatic cells

    KAUST Repository

    Ghosheh, Yanal

    2016-12-01

    The advancement of Nucleic acids (DNA and RNA) sequencing technology has enabled many projects targeted towards the identification of genome structure and transcriptome complexity of organisms. The first conclusions of the human and mouse projects have underscored two important, yet unexpected, findings. First, while almost the entire genome is transcribed, only 5% of it encodes for proteins. Thereby, most transcripts are noncoding RNA. This includes both short RNA (<200 nucleotides (nt)) comprising piRNAs; microRNAs (miRNAs); endogenous Short Interfering RNAs (siRNAs) among others, and includes lncRNA (>200nt). Second, a significant portion of the mammalian genome (45%) is composed of Repeat Elements (REs). RE are mostly relics of ancestral viruses that during evolution have invaded the host genome by producing thousands of copies. Their roles within their host genomes have yet to be fully explored considering that they sometimes produce lncRNA, and have been shown to influence expression at the transcriptional and post-transcriptional levels. Moreover, because some REs can still mobilize within host genomes, host genomes have evolved mechanisms, mainly epigenetic, to maintain REs under tight control. Recent reports indicate that REs activity is regulated in somatic cells, particularily in the brain, suggesting a physiological role of RE mobilization during normal development. In this thesis, I focus on the analysis of ncRNAs, specifically REs; piRNAs; lncRNAs in human and mouse post-mitotic somatic cells. The main aspects of this analysis are: Using sRNA-Seq, I show that piRNAs, a class of ncRNAs responsible for the silencing of Transposable elements (TEs) in testes, are present also in adult mouse brain. Furthermore, their regulation shows only a subset of testes piRNAs are expressed in the brain and may be controlled by known neurogenesis factors. To investigate the dynamics of the transcriptome during cellular differentiation, I examined deep RNA-Seq and Cap

  10. Composite oxygen ion transport element

    Science.gov (United States)

    Chen, Jack C.; Besecker, Charles J.; Chen, Hancun; Robinson, Earil T.

    2007-06-12

    A composite oxygen ion transport element that has a layered structure formed by a dense layer to transport oxygen ions and electrons and a porous support layer to provide mechanical support. The dense layer can be formed of a mixture of a mixed conductor, an ionic conductor, and a metal. The porous support layer can be fabricated from an oxide dispersion strengthened metal, a metal-reinforced intermetallic alloy, a boron-doped Mo.sub.5Si.sub.3-based intermetallic alloy or combinations thereof. The support layer can be provided with a network of non-interconnected pores and each of said pores communicates between opposite surfaces of said support layer. Such a support layer can be advantageously employed to reduce diffusion resistance in any type of element, including those using a different material makeup than that outlined above.

  11. Selective Smoothed Finite Element Method

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The paper examines three selective schemes for the smoothed finite element method (SFEM) which was formulated by incorporating a cell-wise strain smoothing operation into the standard compatible finite element method (FEM). These selective SFEM schemes were formulated based on three selective integration FEM schemes with similar properties found between the number of smoothing cells in the SFEM and the number of Gaussian integration points in the FEM. Both scheme 1 and scheme 2 are free of nearly incompressible locking, but scheme 2 is more general and gives better results than scheme 1. In addition, scheme 2 can be applied to anisotropic and nonlinear situations, while scheme 1 can only be applied to isotropic and linear situations. Scheme 3 is free of shear locking. This scheme can be applied to plate and shell problems. Results of the numerical study show that the selective SFEM schemes give more accurate results than the FEM schemes.

  12. Surface energies of elemental crystals

    Science.gov (United States)

    Tran, Richard; Xu, Zihan; Radhakrishnan, Balachandran; Winston, Donald; Sun, Wenhao; Persson, Kristin A.; Ong, Shyue Ping

    2016-09-01

    The surface energy is a fundamental property of the different facets of a crystal that is crucial to the understanding of various phenomena like surface segregation, roughening, catalytic activity, and the crystal’s equilibrium shape. Such surface phenomena are especially important at the nanoscale, where the large surface area to volume ratios lead to properties that are significantly different from the bulk. In this work, we present the largest database of calculated surface energies for elemental crystals to date. This database contains the surface energies of more than 100 polymorphs of about 70 elements, up to a maximum Miller index of two and three for non-cubic and cubic crystals, respectively. Well-known reconstruction schemes are also accounted for. The database is systematically improvable and has been rigorously validated against previous experimental and computational data where available. We will describe the methodology used in constructing the database, and how it can be accessed for further studies and design of materials.

  13. Automation of finite element methods

    CERN Document Server

    Korelc, Jože

    2016-01-01

    New finite elements are needed as well in research as in industry environments for the development of virtual prediction techniques. The design and implementation of novel finite elements for specific purposes is a tedious and time consuming task, especially for nonlinear formulations. The automation of this process can help to speed up this process considerably since the generation of the final computer code can be accelerated by order of several magnitudes. This book provides the reader with the required knowledge needed to employ modern automatic tools like AceGen within solid mechanics in a successful way. It covers the range from the theoretical background, algorithmic treatments to many different applications. The book is written for advanced students in the engineering field and for researchers in educational and industrial environments.

  14. ADAPTIVE ELLIPSOIDAL ACOUSTIC INFINITE ELEMENT

    Institute of Scientific and Technical Information of China (English)

    Yang Ruiliang; Wang Hongzhen

    2004-01-01

    It is shown that the basis of the ellipsoidal acoustic infinite element Burnett method,the multipole expansion,cannot represent real ellipsoidal acoustic field exactly.To solve the problem,a weight of angular direction is added to the multipole expansion.The comparison of the modified method and the prime method shows that the modified method can describe and solve the ellipsoidal acoustic field more accurately than ever.A dilating sphere is used to test the new method further.Unlike other infinite element methods,varied ratio of the ellipsoidal artificial boundary instead of sphere is used.The pressure value of the artificial boundary is utilized as the initial value of the new method.Then the radiating phenomena of the ellipsoidal acoustic field can be researched using the new method.These examples show the feasibility of the adaptive method.

  15. DOLFIN: Automated Finite Element Computing

    CERN Document Server

    Logg, Anders; 10.1145/1731022.1731030

    2011-01-01

    We describe here a library aimed at automating the solution of partial differential equations using the finite element method. By employing novel techniques for automated code generation, the library combines a high level of expressiveness with efficient computation. Finite element variational forms may be expressed in near mathematical notation, from which low-level code is automatically generated, compiled and seamlessly integrated with efficient implementations of computational meshes and high-performance linear algebra. Easy-to-use object-oriented interfaces to the library are provided in the form of a C++ library and a Python module. This paper discusses the mathematical abstractions and methods used in the design of the library and its implementation. A number of examples are presented to demonstrate the use of the library in application code.

  16. CONSTRAINED QUADRILATERAL NONCONFORMING ROTATED Q1 ELEMENT

    Institute of Scientific and Technical Information of China (English)

    Jun Hu; Zhong-ci Shi

    2005-01-01

    In this paper, we define a new nonconforming quadrilateral finite element based on the nonconforming rotated Q1 element by enforcing a constraint on each element, which has only three degrees of freedom. We investigate the consistency, approximation, superclose property, discrete Green's function and superconvergence of this element. Moreover, we propose a new postprocessing technique and apply it to this element. It is proved that the postprocessed discrete solution is superconvergent under a mild assumption on the mesh.

  17. LOG PERIODIC DIPOLE ARRAY WITH PARASITIC ELEMENTS

    Science.gov (United States)

    The design and measured characteristics of dipole and monopole versions of a log periodic array with parasitic elements are discussed. In a dipole...array with parasitic elements, these elements are used in place of every alternate dipole, thereby eliminating the need of a twisted feed arrangement...for the elements to obtain log periodic performance of the anntenna. This design with parasitic elements lends itself to a monopole version of the

  18. Backfire antennas with dipole elements

    DEFF Research Database (Denmark)

    Nielsen, Erik Dragø; Pontoppidan, Knud

    1970-01-01

    A method is set up for a theoretical investigation of arbitrary backfire antennas based upon dipole structures. The mutual impedance between the dipole elements of the antenna is taken into account, and the field radiated due to a surface wave reflector of finite extent is determined by calculating...... the surface current distribution on the reflector plate. Numerical results obtained for Yagi backfire antennas and short-backfire antennas using this theory are compared with experimental results....

  19. Origin of the Chemical Elements

    CERN Document Server

    Rauscher, T

    2010-01-01

    This review provides the necessary background from astrophysics, nuclear, and particle physics to understand the cosmic origin of the chemical elements. It reflects the year 2009 state of the art in this extremely quickly developing interdisciplinary research direction. The discussion summarizes the nucleosynthetic processes in the course of the evolution of the Universe and the galaxies contained within, including primordial nucleosynthesis, stellar evolution, and explosive nucleosynthesis in single and binary systems.

  20. Conrad's Skeptical Elements in Nostromo

    Institute of Scientific and Technical Information of China (English)

    何旭

    2016-01-01

    The Paper analyze the skeptical elements in Nostromo through mostly the analysis of the values held by different char-acter and their respective destiny. Conrad expresses his skepticism towards material interest through the character of Charles Gould, who firmly believes that material interests alone can bring order and peace to the country. But his success is temporary. Eventually success of his silver mine not only intensifies political conflicts but also brings him disillusionment and loneliness.

  1. Elements of Bayesian experimental design

    Energy Technology Data Exchange (ETDEWEB)

    Sivia, D.S. [Rutherford Appleton Lab., Oxon (United Kingdom)

    1997-09-01

    We consider some elements of the Bayesian approach that are important for optimal experimental design. While the underlying principles used are very general, and are explained in detail in a recent tutorial text, they are applied here to the specific case of characterising the inferential value of different resolution peakshapes. This particular issue was considered earlier by Silver, Sivia and Pynn (1989, 1990a, 1990b), and the following presentation confirms and extends the conclusions of their analysis.

  2. Peridynamic Multiscale Finite Element Methods

    Energy Technology Data Exchange (ETDEWEB)

    Costa, Timothy [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Bond, Stephen D. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Littlewood, David John [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Moore, Stan Gerald [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2015-12-01

    The problem of computing quantum-accurate design-scale solutions to mechanics problems is rich with applications and serves as the background to modern multiscale science research. The prob- lem can be broken into component problems comprised of communicating across adjacent scales, which when strung together create a pipeline for information to travel from quantum scales to design scales. Traditionally, this involves connections between a) quantum electronic structure calculations and molecular dynamics and between b) molecular dynamics and local partial differ- ential equation models at the design scale. The second step, b), is particularly challenging since the appropriate scales of molecular dynamic and local partial differential equation models do not overlap. The peridynamic model for continuum mechanics provides an advantage in this endeavor, as the basic equations of peridynamics are valid at a wide range of scales limiting from the classical partial differential equation models valid at the design scale to the scale of molecular dynamics. In this work we focus on the development of multiscale finite element methods for the peridynamic model, in an effort to create a mathematically consistent channel for microscale information to travel from the upper limits of the molecular dynamics scale to the design scale. In particular, we first develop a Nonlocal Multiscale Finite Element Method which solves the peridynamic model at multiple scales to include microscale information at the coarse-scale. We then consider a method that solves a fine-scale peridynamic model to build element-support basis functions for a coarse- scale local partial differential equation model, called the Mixed Locality Multiscale Finite Element Method. Given decades of research and development into finite element codes for the local partial differential equation models of continuum mechanics there is a strong desire to couple local and nonlocal models to leverage the speed and state of the

  3. Adobe Photoshop Elements 10 unleash the hidden performance of Elements

    CERN Document Server

    Galer, Mark

    2011-01-01

    Master the most powerful photo editing tools and techniques that Elements has to offer! Using step-by-step projects, Mark Galer will have you creating stunning images in no time at all. Whether you want to create impressive, seamless montages, optimize your photos for perfect print quality, or simply enhance your images for maximum impact, Maximum Performance will give you the skills and know-how you need to create professional quality results. Featured projects teach you how to work with multilayered 16 bit/channel files, as well as convert to black and white using Adobe Camera Raw, create

  4. Finite element analysis of elasto-plastic plate bending problems using transition rectangular plate elements

    Institute of Scientific and Technical Information of China (English)

    Bahattin Kanber; O.Yavuz Bozkurt

    2006-01-01

    In this work,the finite element analysis of the elasto-plastic plate bending problems is carried out using transition rectangular plate elements.The shape functions of the transition plate elements are derived based on a practical rule.The transition plate elements are all quadrilateral and can be used to obtain efficient finite element models using minimum number of elements.The mesh convergence rates of the models including the transition elements are compared with the regular element models.To verify the developed elements,simple tests are demonstrated and various elasto-plastic problems are solved.Their results are compared with ANSYS results.

  5. Implementing wavelet transform with SAW elements

    Institute of Scientific and Technical Information of China (English)

    卢文科; 朱长纯; 刘君华; 刘清洪

    2003-01-01

    In the design of the finger-overlap envelope according to the envelope of wavelet function, it is concluded that the pulse-response function of the interdigital transducer (IDT) for surface acoustic wave (SAW) is identical to the wavelet function. SAW type of the wavelet-transform element is manufactured. A new method of using two wavelet-transform elements to manufacture the reconstruction element of the wavelet transform is proposed. The sources of the element error are analyzed, and the methods for reducing the error are put forward. SAW type of the wavelet transformation element and its reconstruction element have the following three characteristics: (i) the implementing methods of the wavelet transform element and its reconstruction element are simple, and free of complicated mathematical algorithms of the wavelet transform; (ii) because one of SAW element is fast, the response velocities of SAW type of the wavelet transform element and its reconstruction element are also fast; (iii) the costs of the wavelet transform element and its reconstruction element are low, so the elements may be manufactured in a large quantity.

  6. A study of preconditioned Krylov subspace methods with reordering for linear systems from a biphasic v-p finite element formulation.

    Science.gov (United States)

    Yang, Taiseung; Spilker, Robert L

    2007-02-01

    A study was conducted on combinations of preconditioned iterative methods with matrix reordering to solve the linear systems arising from a biphasic velocity-pressure (v-p) finite element formulation used to simulate soft hydrated tissues in the human musculoskeletal system. Krylov subspace methods were tested due to the symmetric indefiniteness of our systems, specifically the generalized minimal residual (GMRES), transpose-free quasi-minimal residual (TFQMR), and biconjugate gradient stabilized (BiCGSTAB) methods. Standard graph reordering techniques were used with incomplete LU (ILU) preconditioning. Performance of the methods was compared on the basis of convergence rate, computing time, and memory requirements. Our results indicate that performance is affected more significantly by the choice of reordering scheme than by the choice of Krylov method. Overall, BiCGSTAB with one-way dissection (OWD) reordering performed best for a test problem representative of a physiological tissue layer. The preferred methods were then used to simulate the contact of the humeral head and glenoid tissue layers in glenohumeral joint of the shoulder, using a penetration-based method to approximate contact. The distribution of pressure and stress fields within the tissues shows significant through-thickness effects and demonstrates the importance of simulating soft hydrated tissues with a biphasic model.

  7. Duration judgements over multiple elements

    Directory of Open Access Journals (Sweden)

    Inci eAyhan

    2012-11-01

    Full Text Available We investigated the limits of the number of events observers can simultaneously time. For single targets occurring in one of eight positions sensitivity to duration was improved for spatially pre-cued items as compared to post-cued items indicating that exogenous driven attention can improve duration discrimination. Sensitivity to duration for pre-cued items was also marginally better for single items as compared to eight items indicating that even after the allocation of focal attention, distracter items can interfere with the encoding of duration. For an eight item array discrimination was worse for post-cued locations as compared to pre-cued locations indicating both that attention can improve duration discrimination performance and that it was not possible to access a perfect memory trace of the duration of eight elements. The interference from the distracters in the pre-cued eight item array may reflect some mandatory averaging of target and distracter events. To further explore duration averaging we asked subjects to explicitly compare average durations of multiple item arrays against a single item standard duration. Duration discrimination thresholds were significantly lower for single elements as compared to multiple elements, showing that averaging, either automatically or intentionally, impairs duration discrimination. There was no set size effect. Performance was the same for averages of two and eight items, but performance with even an average of two items was worse than for one item. This was also true for sequential presentation indicating poor performance was not due to limits on the division of attention across items. Rather performance appears to be limited by an inability to remember or aggregate duration information from two or more items. Although it is possible to manipulate perceived duration locally, there appears to be no perceptual mechanisms for aggregating local durations across space.

  8. Elemental composition of Malawian rice.

    Science.gov (United States)

    Joy, Edward J M; Louise Ander, E; Broadley, Martin R; Young, Scott D; Chilimba, Allan D C; Hamilton, Elliott M; Watts, Michael J

    2016-07-20

    Widespread potential dietary deficiencies of calcium (Ca), iron (Fe), iodine (I), selenium (Se) and zinc (Zn) have been identified in Malawi. Several deficiencies are likely to be compounded by high phytic acid (PA) consumption. Rice (Oryza sativa) is commonly consumed in some Malawian populations, and its mineral micronutrient content is important for food security. The considerable irrigation requirements and flooded conditions of paddy soils can also introduce or mobilise potentially toxic elements including arsenic (As), cadmium (Cd) and lead (Pb). The aim of this study was to determine the mineral composition of rice sampled from farmers' fields and markets in Malawi. Rice was sampled from 18 extension planning areas across Malawi with 21 white (i.e. polished) and 33 brown samples collected. Elemental composition was determined by inductively coupled plasma-mass spectrometry (ICP-MS). Arsenic speciation was performed using high-performance liquid chromatography (HPLC)-ICP-MS. Concentration of PA was determined using a PA-total phosphorus assay. Median total concentrations (mg kg(-1), dry weight) of elements important for human nutrition in brown and white rice, respectively, were: Ca = 66.5 and 37.8; Cu = 3.65 and 2.49; Fe = 22.1 and 7.2; I = 0.006 and Biofortification strategies could significantly increase Se and Zn concentrations and require further investigation. Concentrations of Fe in rice grain varied greatly, and this was likely due to contamination of rice samples with soil. Risk of As, Cd or Pb toxicity due to rice consumption in Malawi appears to be minimal.

  9. Fluidic Elements based on Coanda Effect

    Directory of Open Access Journals (Sweden)

    Constantin OLIVOTTO

    2010-12-01

    Full Text Available This paper contains first some definitions and classifications regarding the fluidic elements. Thegeneral current status is presented, nominating the main specific elements based on the Coanda effect developedspecially in Romania. In particularly the development of an original bistable element using industrial compressedair at industrial pressure supply is presented. The function of this element is based on the controlled attachmentof the main jet at a curved wall through the Coanda effect. The methods used for particular calculation andexperiments are nominated. The main application of these elements was to develop a specific execution element:a fluidic step–by-step motor based on the Coanda effect.

  10. ACCURACY ANALYSIS FOR QUASI-CAREY ELEMENT

    Institute of Scientific and Technical Information of China (English)

    Dongyang SHI; Xiaobin HAO

    2008-01-01

    In this paper, a new triangular element (Quasi-Carey element) is constructed by the idea of Specht element. It is shown that this Quasi-Carey element possesses a very special property, i.e.,the consistency error is of order O(h2), one order higher than its interpolation error when the exact solution belongs to Ha(Ω). However, the interpolation error and consistency error of Carey element are of order O(h). It seems that the above special property has never been seen for other triangular elements for the second order problems.

  11. Formulations of a hydromechanical interface element

    Institute of Scientific and Technical Information of China (English)

    Zhong-Zhi Fu; Si-Hong Liu

    2011-01-01

    A hydromechanical interface element is proposed for the consideration of the hydraulic-mechanical coupling effect along the interface.The fully coupled governing equations and the relevant finite element formulations are derived in detail for the interface element.All the involved matrices are of the same form as those of a solid element,which makes the incorporation of the model into a finite element program straightforward.Three examples are then numerically simulated using the interface element.Reasonable results confirm the correctness of the proposed model and motivate its application in hydromechanical contact problems in the future.

  12. Elements of partial differential equations

    CERN Document Server

    Sneddon, Ian N

    2006-01-01

    Geared toward students of applied rather than pure mathematics, this volume introduces elements of partial differential equations. Its focus is primarily upon finding solutions to particular equations rather than general theory.Topics include ordinary differential equations in more than two variables, partial differential equations of the first and second orders, Laplace's equation, the wave equation, and the diffusion equation. A helpful Appendix offers information on systems of surfaces, and solutions to the odd-numbered problems appear at the end of the book. Readers pursuing independent st

  13. Nuclear reactor fuel element. Kernreaktorbrennelement

    Energy Technology Data Exchange (ETDEWEB)

    Lippert, H.J.

    1985-03-28

    The fuel element box for a BWR is situated with a corner bolt on the inside in one corner of its top on the top side of the top plate. This corner bolt is screwed down with a bolt with a corner part which is provided with leaf springs outside on two sides, where the bolt has a smaller diameter and an expansion shank. The bolt is held captive to the bolt head on the top and the holder on the bottom of the corner part. The holder is a locknut. If the expansion forces are too great, the bolt can only break at the expansion shank.

  14. Elements of abstract harmonic analysis

    CERN Document Server

    Bachman, George

    2013-01-01

    Elements of Abstract Harmonic Analysis provides an introduction to the fundamental concepts and basic theorems of abstract harmonic analysis. In order to give a reasonably complete and self-contained introduction to the subject, most of the proofs have been presented in great detail thereby making the development understandable to a very wide audience. Exercises have been supplied at the end of each chapter. Some of these are meant to extend the theory slightly while others should serve to test the reader's understanding of the material presented. The first chapter and part of the second give

  15. Elements of a Spatial Web

    DEFF Research Database (Denmark)

    Jensen, Christian S.

    2010-01-01

    community is hard at work inventing means of efficiently supporting new spatial query functionality. Points of interest with a web presence, called spatial web objects, have a location as well as a textual description. Spatio-textual queries return such objects that are near a location argument...... and are relevant to a text argument. An important element in enabling such queries is to be able to rank spatial web objects. Another is to be able to determine the relevance of an object to a query. Yet another is to enable the efficient processing of such queries. The talk covers recent results on spatial web...

  16. Main Elements for Upscaling Recreation

    DEFF Research Database (Denmark)

    Zandersen, Marianne; Termansen, Mette

    2012-01-01

    This report provides information on the main elements used to scale up modelled local visitor flow data to regional level based on recreational de-mand models. These models are described in Report #1. This report also provides information on data sources such as spatial data (e.g. land cov......-er/land use information), demographic information. The report is accom-pagnied with a spatial database for the regional case of forest recreation in Northern Zealand, Denmark. The spatial database contains forest polygons; forest attribute; estimation of total annual number of visits per site; and es...

  17. Basic Elements of Knowledge Management

    Directory of Open Access Journals (Sweden)

    Marcin W. Staniewski

    2007-10-01

    Full Text Available The article is a review of basic knowledge management terminology. It presents such a description as: knowledge resources levels (data, information, knowledge, and wisdom, knowledge sources (internal, external, and knowledge typology (implicit, tacit or individual, social. Moreover the article characterizes knowledge management process, knowledge management system and main knowledge management strategies (codification, personalization. At the end of the article there is mentioned the knowledge creating process (the concept of knowledge creation spiral and the role of Intelligence Technology (IT and organizational culture as main elements supporting knowledge management implementation in organizations.

  18. New alternating direction procedures in finite element analysis based upon EBE approximate factorizations. [element-by-element

    Science.gov (United States)

    Hughes, T. J. R.; Winget, J.; Levit, I.; Tezduyar, T. E.

    1983-01-01

    Element-by-element approximate factorization procedures are proposed for solving the large finite element equation systems which arise in computational mechanics. A variety of techniques are compared on problems of structural mechanics, heat conduction and fluid mechanics. The results obtained suggest considerable potential for the methods described.

  19. Analysis of composite structural elements

    Directory of Open Access Journals (Sweden)

    A. Baier

    2010-12-01

    Full Text Available Purpose: The themes of the study are composite structural components. For this purpose have been designed and built several research positions.Design/methodology/approach: Using different structural materials to build new device components requires multiple tests of the components. Research posts were designed in the advanced graphical program CAx Siemens NX 7.5. Analysed samples were made from the glass fibre, aramid and carbon of various weights. Due to the specific use of composite materials it focuses on the elements in the form of plates and flat bars. For the examination of experimental strain gauge technique was used bead, the force sensor and displacement sensor. The experimental methods were compared with computer simulation using the FEM.Findings: The aim of this study was to determine the basic material constants and a comparison of the experimental method and the method of computer simulation.Research limitations/implications: Change the number of layers and how to connect the laminate with the steel plate changes mechanical properties of the structural component.Practical implications: The ultimate result will be knowledge on the different forms of laminates, such as material properties, the stresses in all layers, strain and comparing the results obtained by two methods.Originality/value: The expected outcome of the study will be the composition and method of joining composite laminate with a steel plate to the possible application in the repair and construction of structural elements of freight wagons.

  20. Light element opacities from ATOMIC

    Science.gov (United States)

    Colgan, J.; Kilcrease, D. P.; Magee, N. H.; Armstrong, G. S. J.; Abdallah, J.; Sherrill, M. E.; Fontes, C. J.; Zhang, H. L.; Hakel, P.

    2013-06-01

    We present new calculations of local-thermodynamic-equilibrium (LTE) light element opacities from the Los Alamos ATOMIC code. ATOMIC is a multi-purpose code that can generate LTE or non-LTE quantities of interest at various levels of approximation. A program of work is currently underway to compute new LTE opacity data for all elements H through Zn. New opacity tables for H through Ne are complete, and a new Fe opacity table will be available soon. Our calculations, which include fine-structure detail, represent a systematic improvement over previous Los Alamos opacity calculations using the LEDCOP legacy code. Our opacity calculations incorporate atomic structure data computed from the CATS code, which is based on Cowan's atomic structure codes, and photoionization cross section data computed from the Los Alamos ionization code GIPPER. We make use of a new equation-of-state (EOS) model based on the chemical picture. ATOMIC incorporates some physics packages from LEDCOP and also includes additional physical processes, such as improved free-free cross sections and additional scattering mechanisms. In this report, we briefly discuss the physics improvements included in our new opacity calculations and present comparisons of our new opacities with other work for C, O, and Fe at selected conditions.

  1. METHODOLOGICAL ELEMENTS OF SITUATIONAL ANALYSIS

    Directory of Open Access Journals (Sweden)

    Tetyana KOVALCHUK

    2016-07-01

    Full Text Available The article deals with the investigation of theoretical and methodological principles of situational analysis. The necessity of situational analysis is proved in modern conditions. The notion “situational analysis” is determined. We have concluded that situational analysis is a continuous system study which purpose is to identify dangerous situation signs, to evaluate comprehensively such signs influenced by a system of objective and subjective factors, to search for motivated targeted actions used to eliminate adverse effects of the exposure of the system to the situation now and in the future and to develop the managerial actions needed to bring the system back to norm. It is developed a methodological approach to the situational analysis, its goal is substantiated, proved the expediency of diagnostic, evaluative and searching functions in the process of situational analysis. The basic methodological elements of the situational analysis are grounded. The substantiation of the principal methodological elements of system analysis will enable the analyst to develop adaptive methods able to take into account the peculiar features of a unique object which is a situation that has emerged in a complex system, to diagnose such situation and subject it to system and in-depth analysis, to identify risks opportunities, to make timely management decisions as required by a particular period.

  2. Fuel elements of thermionic converters

    Energy Technology Data Exchange (ETDEWEB)

    Hunter, R.L. [ed.] [Sandia National Labs., Albuquerque, NM (United States). Environmental Systems Assessment Dept.; Gontar, A.S.; Nelidov, M.V.; Nikolaev, Yu.V.; Schulepov, L.N. [RI SIA Lutch, Podolsk (Russian Federation)

    1997-01-01

    Work on thermionic nuclear power systems has been performed in Russia within the framework of the TOPAZ reactor program since the early 1960s. In the TOPAZ in-core thermionic convertor reactor design, the fuel element`s cladding is also the thermionic convertor`s emitter. Deformation of the emitter can lead to short-circuiting and is the primary cause of premature TRC failure. Such deformation can be the result of fuel swelling, thermocycling, or increased unilateral pressure on the emitter due to the release of gaseous fission products. Much of the work on TRCs has concentrated on preventing or mitigating emitter deformation by improving the following materials and structures: nuclear fuel; emitter materials; electrical insulators; moderator and reflector materials; and gas-exhaust device. In addition, considerable effort has been directed toward the development of experimental techniques that accurately mimic operational conditions and toward the creation of analytical and numerical models that allow operational conditions and behavior to be predicted without the expense and time demands of in-pile tests. New and modified materials and structures for the cores of thermionic NPSs and new fabrication processes for the materials have ensured the possibility of creating thermionic NPSs for a wide range of powers, from tens to several hundreds of kilowatts, with life spans of 5 to 10 years.

  3. Recovery of trans-plutonium elements; Recuperation des elements transplutoniens

    Energy Technology Data Exchange (ETDEWEB)

    Espie, J.Y.; Poncet, B.; Simon, A. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1970-07-01

    The object of this work is to study the recovery of americium and curium from the fission-product solution obtained from the processing of irradiated fuel elements made of natural metallic uranium alloyed with aluminium, iron and silicon; these elements have been subjected to an average irradiation of 4000 MW days/ton in a gas-graphite type reactor having a thermal power of 3.7 MW/ton of uranium. The process used consists of 3 extraction cycles and one americium-curium separation: - 1) extraction cycle in 40 per cent TBP: extraction of actinides and lanthanides; elimination of fission products; - 2) extraction cycle in 8 per cent D2EHPA: decontamination from the fission products, decontamination of actinides from lanthanides; - 3) extraction cycle in 40 per cent TBP: separation of the complexing agent and concentration of the actinides; - 4) americium-curium separation by precipitation. (authors) [French] Cette etude a pour objet, la recuperation de l'americium et du curium de la solution de produits de fission provenant du traitement de combustibles irradies a base d'uranium naturel metallique allie a l'aluminium, le fer, et le silicium, et ayant subi une irradiation moyenne de 4000 MWj/t dans une pile du type graphite-gaz, dont la puissance thermique est de 3.7 MW/t d'uranium. Le procede utilise comprend 3 cycles d'extraction et une separation americium-curium: - 1. cycle d'extraction dans le TBP a 40 pour cent: extraction des actinides et des lanthanides, elimination des produits de fission; - 2. cycle d'extraction dans le D2EHPA a 8 pour cent: decontamination en produits de fission, decontamination des actinides en lanthanides; - 3. cycle d'extraction dans le TBP a 40 pour cent: separation du complexant et concentration des actinides; - 4. separation americium-curium par precipitation. (auteurs)

  4. Infinite Possibilities for the Finite Element.

    Science.gov (United States)

    Finlayson, Bruce A.

    1981-01-01

    Describes the uses of finite element methods in solving problems of heat transfer, fluid flow, etc. Suggests that engineers should know the general concepts and be able to apply the principles of finite element methods. (Author/WB)

  5. Natural wetland emissions of methylated trace elements

    NARCIS (Netherlands)

    Vriens, B.; Lenz, M.; Charlet, L.; Berg, M.; Winkel, L.H.E.

    2014-01-01

    Natural wetlands are well known for their significant methane emissions. However, trace element emissions via biomethylation and subsequent volatilization from pristine wetlands are virtually unstudied, even though wetlands constitute large reservoirs for trace elements. Here we show that the averag

  6. Finite element differential forms on cubical meshes

    CERN Document Server

    Arnold, Douglas N

    2012-01-01

    We develop a family of finite element spaces of differential forms defined on cubical meshes in any number of dimensions. The family contains elements of all polynomial degrees and all form degrees. In two dimensions, these include the serendipity finite elements and the rectangular BDM elements. In three dimensions they include a recent generalization of the serendipity spaces, and new H(curl) and H(div) finite element spaces. Spaces in the family can be combined to give finite element subcomplexes of the de Rham complex which satisfy the basic hypotheses of the finite element exterior calculus, and hence can be used for stable discretization of a variety of problems. The construction and properties of the spaces are established in a uniform manner using finite element exterior calculus.

  7. Superconvergence for rectangular serendipity finite elements

    Institute of Scientific and Technical Information of China (English)

    CHEN; Chuanmiao(陈传淼)

    2003-01-01

    Based on an orthogonal expansion and orthogonality correction in an element, superconvergenceat symmetric points for any degree rectangular serendipity finite element approximation to second order ellipticproblem is proved, and its behaviour up to the boundary is also discussed.

  8. Integrating Environmentally Responsive Elements in Buildings

    DEFF Research Database (Denmark)

    Heiselberg, Per; Andresen, Inger; Perino, Marco;

    2006-01-01

    Significant improvement have been achieved on efficiency improvements of specific building elements like the building envelope and building equipment and services and whilst most building elements still offer opportunities for efficiency improvements, the greatest future potential lie with techno...

  9. Continuous finite element methods for Hamiltonian systems

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    By applying the continuous finite element methods of ordinary differential equations, the linear element methods are proved having second-order pseudo-symplectic scheme and the quadratic element methods are proved having third-order pseudosymplectic scheme respectively for general Hamiltonian systems, and they both keep energy conservative. The finite element methods are proved to be symplectic as well as energy conservative for linear Hamiltonian systems. The numerical results are in agreement with theory.

  10. Superheavy Element Research at Tasca at GSI

    Science.gov (United States)

    Düllmann, Christoph E.

    2014-09-01

    Experiments on the synthesis of the heaviest elements are in the center of the current research program on superheavy elements at GSI Darmstadt. At the gas-filled recoil separator TASCA, search experiments for the new elements 119 and 120 have been performed in the reactions 50Ti + 249Bk and 50Ti + 249Cf, respectively, and the production of element 117 in the reaction 48Ca + 249Bk was studied. The experiments were performed successfully and the data are currently under analysis.

  11. Analysis of phage Mu DNA transposition by whole-genome Escherichia coli tiling arrays reveals a complex relationship to distribution of target selection protein B, transcription and chromosome architectural elements

    Indian Academy of Sciences (India)

    Jun Ge; Zheng Lou; Hong Cui; Lei Shang; Rasika M Harshey

    2011-09-01

    Of all known transposable elements, phage Mu exhibits the highest transposition efficiency and the lowest target specificity. In vitro, MuB protein is responsible for target choice. In this work, we provide a comprehensive assessment of the genome-wide distribution of MuB and its relationship to Mu target selection using high-resolution Escherichia coli tiling DNA arrays. We have also assessed how MuB binding and Mu transposition are influenced by chromosome-organizing elements such as AT-rich DNA signatures, or the binding of the nucleoid-associated protein Fis, or processes such as transcription. The results confirm and extend previous biochemical and lower resolution in vivo data. Despite the generally random nature of Mu transposition and MuB binding, there were hot and cold insertion sites and MuB binding sites in the genome, and differences between the hottest and coldest sites were large. The new data also suggest that MuB distribution and subsequent Mu integration is responsive to DNA sequences that contribute to the structural organization of the chromosome.

  12. Element Cycles: An Environmental Chemistry Board Game

    Science.gov (United States)

    Pippins, Tracy; Anderson, Cody M.; Poindexter, Eric F.; Sultemeier, S. Whitney; Schultz, Linda D.

    2011-01-01

    "Element Cycles" is an activity designed to reinforce correlation of essential elements and their different forms in the ecosystem. Students are assigned essential elements to research as homework, then share results, and construct game boards with four ecosphere sections: geosphere (earth), hydrosphere (water), atmosphere (air), and biosphere…

  13. Main: ELEMENT1GMLBC3 [PLACE

    Lifescience Database Archive (English)

    Full Text Available ELEMENT1GMLBC3 S000319 7-Sep-2000 (last modified) seki Element 1 found in the promo...ter of soybean (G.m.) leghaemoglobin lbc3 gene; Binding site of nuclear extract from soybean nodules; Locate...Element 2 share a common motif; See S000320; nodule; leghaemoglobin; lbc3; root; Soybean (Glycine max) GATATATTAATATTTTATTTTATA ...

  14. Elements from chlorine to calcium nuclear reactions

    CERN Document Server

    Kunz, Wunibald

    1968-01-01

    Nuclear Tables: Part II Nuclear Reactions, Volume 3: The Elements from Chlorine to Calcium contains tabulations of the nuclear reaction values of elements chlorine, argon, potassium, and calcium. These tabulations provide the calculated Q-values of the elements and their isotopes. This book will be of value to general chemistry researchers.

  15. Data Element Dictionary: Facilities. Preliminary Draft.

    Science.gov (United States)

    Thomas, Charles R.

    The draft includes--(1) comments on file structure, (2) descriptions of dictionary organization and format, (3) alphabetical lists of elements, and (4) facilities related elements in dictionary form. The data element definitions in this draft are compatible with the Higher Education Facilities Classification and Inventory Procedures Manual, which…

  16. 40 CFR 721.10068 - Elemental mercury.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 30 2010-07-01 2010-07-01 false Elemental mercury. 721.10068 Section... Substances § 721.10068 Elemental mercury. (a) Definitions. The definitions in § 721.3 apply to this section... elemental mercury (CAS. No. 7439-97-6) is subject to reporting under this section for the significant...

  17. Superheavy elements: existence, classification and experiment

    OpenAIRE

    Kostyghin, V. A.; Vaschenko, V. M.; Loza, Ye. A.

    2012-01-01

    This paper proposes spatial periodic table developed based on classic electron shell structure model. The periodic table determines location and chemical properties of superheavy elements. 14 new long-living superheavy elements found by Proton-21 laboratory and one long-living superheavy element found by A.Marinov were identified.

  18. Downhole elemental analysis with LIBS

    Science.gov (United States)

    Moreschini, P.; Zacny, K.; Rickman, D.

    2011-12-01

    In this paper we discuss a novel instrument, currently under development at Honeybee Robotics with SBIR funding from NASA. The device is designed to characterize elemental composition as a function of depth in non-terrestrial geological formations. The instrument consists of a miniaturized LIBS analyzer integrated in a 2" diameter drill string. While the drill provides subsurface access, the LIBS analyzer provides information on the elemental composition of the borehole wall. This instrument has a variety of space applications ranging from exploration of the Moon for which it was originally designed, to Mars, as well as a variety of terrestrial applications. Subsurface analysis is usually performed by sample acquisition through a drill or excavator, followed by sample preparation and subsequent sample presentation to an instrument or suite of instruments. An alternative approach consisting in bringing a miniaturized version of the instrument to the sample has many advantages over the traditional methodology, as it allows faster response, reduced probability of cross-contamination and a simplification in the sampling mechanisms. LIBS functions by focusing a high energy laser on a material inducing a plasma consisting of a small fraction of the material under analysis. Optical emission from the plasma, analyzed by a spectrometer, can be used to determine elemental composition. A triangulation sensor located in the sensor head determines the distance of the sensor from the borehole wall. An actuator modifies the position of the sensor accordingly, in order to compensate for changes due to the profile of the borehole walls. This is necessary because LIBS measurements are negatively affected by changes in the relative position of the focus of the laser with respect to the position of the sample (commonly referred to as the "lens to sample distance"). Profiling the borehole is done by adjusting the position of the sensor with a vertical stage; a second actuator at the

  19. Elements of algebraic coding systems

    CERN Document Server

    Cardoso da Rocha, Jr, Valdemar

    2014-01-01

    Elements of Algebraic Coding Systems is an introductory textto algebraic coding theory. In the first chapter, you'll gain insideknowledge of coding fundamentals, which is essential for a deeperunderstanding of state-of-the-art coding systems.This book is a quick reference for those who are unfamiliar withthis topic, as well as for use with specific applications such as cryptographyand communication. Linear error-correcting block codesthrough elementary principles span eleven chapters of the text.Cyclic codes, some finite field algebra, Goppa codes, algebraic decodingalgorithms, and applications in public-key cryptography andsecret-key cryptography are discussed, including problems and solutionsat the end of each chapter. Three appendices cover the Gilbertbound and some related derivations, a derivation of the Mac-Williams' identities based on the probability of undetected error,and two important tools for algebraic decoding-namely, the finitefield Fourier transform and the Euclidean algorithm for polynomials.

  20. Spectroscopy of the Heaviest Elements

    Science.gov (United States)

    Clark, Roderick

    2009-10-01

    The specific ``magic'' proton and neutron numbers, representing major spherical shell gaps, beyond 208Pb are a matter of considerable debate. It is well established that nuclei near Z=100, N=152 (252Fm) have well-deformed prolate shapes. By performing prompt and delayed gamma-ray spectroscopy on deformed transfermium nuclei we can learn about the single-particle structure, shell gaps, pairing correlations, and excitation modes in the heaviest nuclei. After a brief overview of state-of-the-art measurements, I will describe recent results from experiments at the 88-Inch Cyclotron of the Lawrence Berkeley National Laboratory which use the Berkeley Gas-filled Separator (BGS). I will then discuss the prospects of a new generation of spectroscopy measurements on the heaviest elements when the BGS is used in conjunction with the GRETINA gamma--ray tracking array.

  1. Thermionic fuel element technology status

    Science.gov (United States)

    Holland, J. W.; Horner, M. W.; Yang, L.

    1985-01-01

    The results of research, conducted between the mid-1960s and 1973, on the multiconverter thermionic fuel elements (TFEs) that comprise the reactor core of an SP-100 thermionic reactor system are presented. Fueled-emitter technology, insulator technology and cell and TFE assembly technology of the prototypical TFEs which were tested in-pile and out-of-pile during these years are described. The proto-TFEs have demonstrated reproducible performance within 5 percent and no premature failures within the 1.5 yr of operation (with projected 3-yr lifetimes). The two primary life-limiting factors had been identified as thermionic emitter dimensional increase due to interactions with the fuel and electrical insulator structural damage from fast neutrons. Multiple options for extending TFE lifetimes to 7 yr or longer are available and will be investigated in the 1984-1985 SP-100 program for resolution of critical technology issues. Design diagrams and test graphs are included.

  2. Remediation using trace element humate surfactant

    Energy Technology Data Exchange (ETDEWEB)

    Riddle, Catherine Lynn; Taylor, Steven Cheney; Bruhn, Debra Fox

    2016-08-30

    A method of remediation at a remediation site having one or more undesirable conditions in which one or more soil characteristics, preferably soil pH and/or elemental concentrations, are measured at a remediation site. A trace element humate surfactant composition is prepared comprising a humate solution, element solution and at least one surfactant. The prepared trace element humate surfactant composition is then dispensed onto the remediation site whereby the trace element humate surfactant composition will reduce the amount of undesirable compounds by promoting growth of native species activity. By promoting native species activity, remediation occurs quickly and environmental impact is minimal.

  3. A New Geochemical Classification of Elements

    Institute of Scientific and Technical Information of China (English)

    Qi Changmou; L. Lynn Chyi

    2001-01-01

    The geochemical classification proposed by Goldschmidt was based on meteoritic analysis and elemental partition in blast furnace. There are many surprises when applied to the discussion of natural occurrences. A modified classification of elements based on basic chemical properties and their occurrences. A modified classification of elements based on basic chemical properties and their occurrences in nature is, therefore, proposed for students learning geochemistry and geologists working in the field. Elements are classified into six groups including lithophile, oxyphile, siderophile, chalcophile, biophile, and atmophile elements. Five terms are taken from Goldshcmidt's original classification. Oxyphile is a new term.

  4. Transition elements based on transfinite interpolation

    Science.gov (United States)

    Odabas, Onur R.; Sarigul-Klijn, Nesrin

    1993-01-01

    In this study the transfinite interpolation methodology, a 'blending-function' method in particular, is utilized for the formulation of transition elements. The method offers a formal way of meeting continuity requirements in a transition element. Element shape functions are derived by blending the continuity requirements of individual boundary segments. The blending directions are naturally orthogonal in rectangular domains therefore interpolation of the boundaries over rectangular 2D and 3D elements can be performed with minimal effort. In triangular domains, however, the choice of blending directions and interpolants is not straightforward. For that reason, two interpolation techniques are proposed for blending of the boundaries of triangular domains. A series of transition elements of various classes compatible with elements of different orders and dimensions is developed and the full potential of the transfinite interpolation, as it applies to element formulation, is explored.

  5. Rare earth elements: end use and recyclability

    Science.gov (United States)

    Goonan, Thomas G.

    2011-01-01

    Rare earth elements are used in mature markets (such as catalysts, glassmaking, lighting, and metallurgy), which account for 59 percent of the total worldwide consumption of rare earth elements, and in newer, high-growth markets (such as battery alloys, ceramics, and permanent magnets), which account for 41 percent of the total worldwide consumption of rare earth elements. In mature market segments, lanthanum and cerium constitute about 80 percent of rare earth elements used, and in new market segments, dysprosium, neodymium, and praseodymium account for about 85 percent of rare earth elements used. Regardless of the end use, rare earth elements are not recycled in large quantities, but could be if recycling became mandated or very high prices of rare earth elements made recycling feasible.

  6. Silencing of the PiAvr3a effector-encoding gene from Phytophthora infestans by transcriptional fusion to a short interspersed element.

    Science.gov (United States)

    Vetukuri, Ramesh R; Tian, Zhendong; Avrova, Anna O; Savenkov, Eugene I; Dixelius, Christina; Whisson, Stephen C

    2011-12-01

    Phytophthora infestans is the notorious oomycete causing late blight of potato and tomato. A large proportion of the P. infestans genome is composed of transposable elements, the activity of which may be controlled by RNA silencing. Accumulation of small RNAs is one of the hallmarks of RNA silencing. Here we demonstrate the presence of small RNAs corresponding to the sequence of a short interspersed retrotransposable element (SINE) suggesting that small RNAs might be involved in silencing of SINEs in P. infestans. This notion was exploited to develop novel tools for gene silencing in P. infestans by engineering transcriptional fusions of the PiAvr3a gene, encoding an RXLR avirulence effector, to the infSINEm retroelement. Transgenic P. infestans lines expressing either 5'-infSINEm::PiAvr3a-3' or 5'-PiAvr3a::SINEm-3' chimeric transcripts initially exhibited partial silencing of PiAvr3a. Over time, PiAvr3a either recovered wild type transcript levels in some lines, or became fully silenced in others. Introduction of an inverted repeat construct was also successful in yielding P. infestans transgenic lines silenced for PiAvr3a. In contrast, constructs expressing antisense or aberrant RNA transcripts failed to initiate silencing of PiAvr3a. Lines exhibiting the most effective silencing of PiAvr3a were either weakly or non-pathogenic on susceptible potato cv. Bintje. This study expands the repertoire of reverse genetics tools available for P. infestans research, and provides insights into a possible mode of variation in effector expression through spread of silencing from adjacent retroelements.

  7. 3-D Magnetotelluric Forward Modeling And Inversion Incorporating Topography By Using Vector Finite-Element Method Combined With Divergence Corrections Based On The Magnetic Field (VFEH++)

    Science.gov (United States)

    Shi, X.; Utada, H.; Jiaying, W.

    2009-12-01

    The vector finite-element method combined with divergence corrections based on the magnetic field H, referred to as VFEH++ method, is developed to simulate the magnetotelluric (MT) responses of 3-D conductivity models. The advantages of the new VFEH++ method are the use of edge-elements to eliminate the vector parasites and the divergence corrections to explicitly guarantee the divergence-free conditions in the whole modeling domain. 3-D MT topographic responses are modeling using the new VFEH++ method, and are compared with those calculated by other numerical methods. The results show that MT responses can be modeled highly accurate using the VFEH+ +method. The VFEH++ algorithm is also employed for the 3-D MT data inversion incorporating topography. The 3-D MT inverse problem is formulated as a minimization problem of the regularized misfit function. In order to avoid the huge memory requirement and very long time for computing the Jacobian sensitivity matrix for Gauss-Newton method, we employ the conjugate gradient (CG) approach to solve the inversion equation. In each iteration of CG algorithm, the cost computation is the product of the Jacobian sensitivity matrix with a model vector x or its transpose with a data vector y, which can be transformed into two pseudo-forwarding modeling. This avoids the full explicitly Jacobian matrix calculation and storage which leads to considerable savings in the memory required by the inversion program in PC computer. The performance of CG algorithm will be illustrated by several typical 3-D models with horizontal earth surface and topographic surfaces. The results show that the VFEH++ and CG algorithms can be effectively employed to 3-D MT field data inversion.

  8. A NOVEL ELLIPSOIDAL ACOUSTIC INFINITE ELEMENT

    Institute of Scientific and Technical Information of China (English)

    YANG Rui-liang; WANG Hong-zhen

    2005-01-01

    A novel ellipsoidal acoustic infinite element is proposed. It is based a new pressure representation, which can describe and solve the ellipsoidal acoustic field more exactly. The shape functions of this novel acoustic infinite element are similar .to the Burnett's method, while the weight functions are defined as the product of the complex conjugates of the shaped functions and an additional weighting factor. The code of this method is cheap to generate as for 1-D element because only 1-D integral needs to be numerical. Coupling with the standard finite element, this method provides a capability for very efficiently modeling acoustic fields surrounding structures of virtually any practical shape. This novel method was deduced in brief and the conclusion was kept in detail. To test the feasibility of this novel method efficiently, in the examples the infinite elements were considered, excluding the finite elements relative. This novel ellipsoidal acoustic infinite element can deduce the analytic solution of an oscillating sphere. The example of a prolate spheroid shows that the novel infinite element is superior to the boundary element and other acoustic infinite elements. Analytical and numerical results of these examples show that this novel method is feasible.

  9. Interstitial Functionalization in elemental Si

    Science.gov (United States)

    Kiefer, Boris; Fohtung, Edwin

    Societies in the 21st century will face many challenges. Materials science and materials design will be essential to address and master some if not all of these challenges. Semiconductors are among the most important technological material classes. Properties such as electrical transport are strongly affected by defects and a central goal continues to be the reduction of defect densities as much as possible in these compounds. Here we present results of interstitial Fe doping in elemental Si using first-principles DFT calculations. The preliminary results show that Fe will only occupy octahedral interstitial sites. The analysis of the electronic structure shows that the compounds are ferromagnetic and that a bandgap opens as interstitial Fe concentrations decrease, with a possible intermittent semi-metallic phase. The formation energy for interstitial Fe is unfavorable, as expected, by ~1.5 eV but becomes favorable as the chemical potential of Fe increases. Therefore, we expect that biasing the system with an external electrical field will lead to the formation of these materials. Thus, our results show that interstitial defects can be beneficial for the design of functionalities that differ significantly from those of the host material.

  10. Functional Metamirrors Using Bianisotropic Elements

    Science.gov (United States)

    Asadchy, V. S.; Ra'di, Y.; Vehmas, J.; Tretyakov, S. A.

    2015-03-01

    Conventional mirrors obey the simple reflection law that a plane wave is reflected as a plane wave, at the same angle. To engineer spatial distributions of fields reflected from a mirror, one can either shape the reflector or position some phase-correcting elements on top of a mirror surface. Here we show, both theoretically and experimentally, that full-power reflection with general control over the reflected wave phase is possible with a single-layer array of deeply subwavelength inclusions. These proposed artificial surfaces, metamirrors, provide various functions of shaped or nonuniform reflectors without utilizing any mirror. This can be achieved only if the forward and backward scattering of the inclusions in the array can be engineered independently, and we prove that it is possible using electrically and magnetically polarizable inclusions. The proposed subwavelength inclusions possess desired reflecting properties at the operational frequency band, while at other frequencies the array is practically transparent. The metamirror concept leads to a variety of applications over the entire electromagnetic spectrum, such as optically transparent focusing antennas for satellites, multifrequency reflector antennas for radio astronomy, low-profile conformal antennas for telecommunications, and nanoreflectarray antennas for integrated optics.

  11. Recycling of Rare Earth Elements

    Science.gov (United States)

    Lorenz, Tom; Bertau, Martin

    2017-01-01

    Any development of an effective process for rare earth (RE) recycling has become more and more challenging, especially in recent years. Since 2011, when commodity prices of REs had met their all-time maximum, prices have dropped rapidly by more than 90 %. An economic process able to offset these fluctuations has to take unconventional methods into account beside well-known strategies like acid/basic leaching or solvent extraction. The solid-state chlorination provides such an unconventional method for mobilizing RE elements from waste streams. Instead of hydrochloric acid this kind of chlorination decomposes NH4Cl thermally to release up to 400 °C hot HCl gas. After cooling the resulting solid metal chlorides may be easily dissolved in pH-adjusted water. Without producing strongly acidic wastes and with NH4Cl as cheap source for hydrogen chloride, solid-state chlorination provides various advantages in terms of costs and disposal. In the course of the SepSELSA project this method was examined, adjusted and optimized for RE recycling from fluorescent lamp scraps as well as Fe14Nd2B magnets. Thereby many surprising influences and trends required various analytic methods to examine the reasons and special mechanisms behind them.

  12. Trace Element Management in Rice

    Directory of Open Access Journals (Sweden)

    Abin Sebastian

    2015-08-01

    Full Text Available Trace elements (TEs are vital for the operation of metabolic pathways that promote growth and structural integrity. Paddy soils are often prone to TE limitation due to intensive cultivation and irrigation practices. Apart from this, rice paddies are potentially contaminated with transition metals such as Cd, which are often referred to as toxic TEs. Deficiency of TEs in the soil not only delays plant growth but also causes exposure of plant roots to toxic TEs. Fine-tuning of nutrient cycling in the rice field is a practical solution to cope with TEs deficiency. Adjustment of soil physicochemical properties, biological process such as microbial activities, and fertilization helps to control TEs mobilization in soil. Modifications in root architecture, metal transporters activity, and physiological processes are also promising approaches to enhance TEs accumulation in grains. Through genetic manipulation, these modifications help to increase TE mining capacity of rice plants as well as transport and trafficking of TEs into the grains. The present review summarizes that regulation of TE mobilization in soil, and the genetic improvement of TE acquisition traits help to boost essential TE content in rice grain.

  13. Composite structure of auxin response elements.

    Science.gov (United States)

    Ulmasov, T; Liu, Z B; Hagen, G; Guilfoyle, T J

    1995-10-01

    The auxin-responsive soybean GH3 gene promoter is composed of multiple auxin response elements (AuxREs), and each AuxRE contributes incrementally to the strong auxin inducibility to the promoter. Two independent AuxREs of 25 bp (D1) and 32 bp (D4) contain the sequence TGTCTC. Results presented here show that the TGTCTC element in D1 and D4 is required but not sufficient for auxin inducibility in carrot protoplast transient expression assays. Additional nucleotides upstream of TGTCTC are also required for auxin inducibility. These upstream sequences showed constitutive activity and no auxin inducibility when part or all of the TGTCTC element was mutated or deleted. In D1, the constitutive element overlaps the 5' portion of TGTCTC; in D4, the constitutive element is separated from TGTCTC. An 11-bp element in D1, CCTCGTGTCTC, conferred auxin inducibility to a minimal cauliflower mosaic virus 35S promoter in transgenic tobacco seedlings as well as in carrot protoplasts (i.e., transient expression assays). Both constitutive elements bound specifically to plant nuclear proteins, and the constitutive element in D1 bound to a recombinant soybean basic leucine zipper transcription factor with G-box specificity. To demonstrate further the composite nature of AuxREs and the ability of the TGTCTC element to confer auxin inducibility, we created a novel AuxRE by placing a yeast GAL4 DNA binding site adjacent to the TGTCTC element. Expression of a GAL4-c-Rel transactivator in the presence of this novel AuxRE resulted in auxin-inducible expression. Our results indicate that at least some AuxREs have a composite structure consisting of a constitutive element adjacent to a conserved TGTCTC element that confers auxin inducibility.

  14. Noncoding Elements: Evolution and Epigenetic Regulation

    KAUST Repository

    Seridi, Loqmane

    2016-03-09

    When the human genome project was completed, it revealed a surprising result. 98% of the genome did not code for protein of which more than 50% are repeats— later known as ”Junk DNA”. However, comparative genomics unveiled that many noncoding elements are evolutionarily constrained; thus luckily to have a role in genome stability and regulation. Though, their exact functions remained largely unknown. Several large international consortia such as the Functional Annotation of Mammalian Genomes (FANTOM) and the Encyclopedia of DNA Elements (ENCODE) were set to understand the structure and the regulation of the genome. Specifically, these endeavors aim to measure and reveal the transcribed components and functional elements of the genome. One of the most the striking findings of these efforts is that most of the genome is transcribed, including non-conserved noncoding elements and repeat elements. Specifically, we investigated the evolution and epigenetic properties of noncoding elements. 1. We compared genomes of evolutionarily distant species and showed the ubiquity of constrained noncoding elements in metazoa. 2. By integrating multi-omic data (such as transcriptome, nucleosome profiling, histone modifications), I conducted a comprehensive analysis of epigenetic properties (chromatin states) of conserved noncoding elements in insects. We showed that those elements have distinct and protective sequence features, undergo dynamic epigenetic regulation, and appear to be associated with the structural components of the chromatin, replication origins, and nuclear matrix. 3. I focused on the relationship between enhancers and repetitive elements. Using Cap Analysis of Gene Expression (CAGE) and RNASeq, I compiled a full catalog of active enhancers (a class of noncoding elements) during myogenesis of human primary cells of healthy donors and donors affected by Duchenne muscular dystrophy (DMD). Comparing the two time-courses, a significant change in the epigenetic

  15. Benchmarking the QUAD4/TRIA3 element

    Science.gov (United States)

    Pitrof, Stephen M.; Venkayya, Vipperla B.

    1993-01-01

    The QUAD4 and TRIA3 elements are the primary plate/shell elements in NASTRAN. These elements enable the user to analyze thin plate/shell structures for membrane, bending and shear phenomena. They are also very new elements in the NASTRAN library. These elements are extremely versatile and constitute a substantially enhanced analysis capability in NASTRAN. However, with the versatility comes the burden of understanding a myriad of modeling implications and their effect on accuracy and analysis quality. The validity of many aspects of these elements were established through a series of benchmark problem results and comparison with those available in the literature and obtained from other programs like MSC/NASTRAN and CSAR/NASTRAN. Never-the-less such a comparison is never complete because of the new and creative use of these elements in complex modeling situations. One of the important features of QUAD4 and TRIA3 elements is the offset capability which allows the midsurface of the plate to be noncoincident with the surface of the grid points. None of the previous elements, with the exception of bar (beam), has this capability. The offset capability played a crucial role in the design of QUAD4 and TRIA3 elements. It allowed modeling layered composites, laminated plates and sandwich plates with the metal and composite face sheets. Even though the basic implementation of the offset capability is found to be sound in the previous applications, there is some uncertainty in relatively simple applications. The main purpose of this paper is to test the integrity of the offset capability and provide guidelines for its effective use. For the purpose of simplicity, references in this paper to the QUAD4 element will also include the TRIA3 element.

  16. Quantum mechanics and elements of reality

    OpenAIRE

    Mohrhoff, Ulrich

    1999-01-01

    It is widely accepted that a Born probability of 1 is sufficient for the existence of a corresponding element of reality. Recently Vaidman has extended this idea to the ABL probabilities of the time-symmetrized version of quantum mechanics originated by Aharonov, Bergmann, and Lebowitz. Several authors have objected to Vaidman's time-symmetrized elements of reality without casting doubt on the widely accepted sufficiency condition for `ordinary' elements of reality. In this paper I show that ...

  17. DETERMINATION OF IMPURITY ELEMENTS IN ALUMINIUM

    Institute of Scientific and Technical Information of China (English)

    侯小琳; 张永保

    1994-01-01

    Twenty five impurity elements in aluminium applied as reactor material are determined.Titanium and nickel are determined with epithermal neutron activation analysis(NAA),magnesium and silicon by inductance coupling plasma emission spectra(ICP),other elements by thermal NAA.The fission coefficient of uranium is given by an experiment,the interferences of uranium to Ce,Nd,Mo,Zr,La,Sm are subtracted.The detection limits of these methods to all of impurity elements in aluminium are calculated.

  18. Domain decomposition methods for mortar finite elements

    Energy Technology Data Exchange (ETDEWEB)

    Widlund, O.

    1996-12-31

    In the last few years, domain decomposition methods, previously developed and tested for standard finite element methods and elliptic problems, have been extended and modified to work for mortar and other nonconforming finite element methods. A survey will be given of work carried out jointly with Yves Achdou, Mario Casarin, Maksymilian Dryja and Yvon Maday. Results on the p- and h-p-version finite elements will also be discussed.

  19. Superheavy Elements Challenge Experimental and Theoretical Chemistry

    CERN Document Server

    Zvára, I

    2003-01-01

    When reflecting on the story of superheavy elements, the an experimenter, acknowledges the role, which the predictions of nuclear and chemical theories have played in ongoing studies. Today, the problems of major interest for experimental chemistry are the studies of elements 112 and 114 including their chemical identification. Advanced quantum chemistry calculations of atoms and molecules would be of much help. First experiments with element 112 evidence that the metal is much more volatile and inert than mercury.

  20. The elements of life and medicines.

    Science.gov (United States)

    Chellan, Prinessa; Sadler, Peter J

    2015-03-13

    Which elements are essential for human life? Here we make an element-by-element journey through the periodic table and attempt to assess whether elements are essential or not, and if they are, whether there is a relevant code for them in the human genome. There are many difficulties such as the human biochemistry of several so-called essential elements is not well understood, and it is not clear how we should classify elements that are involved in the destruction of invading microorganisms, or elements which are essential for microorganisms with which we live in symbiosis. In general, genes do not code for the elements themselves, but for specific chemical species, i.e. for the element, its oxidation state, type and number of coordinated ligands, and the coordination geometry. Today, the biological periodic table is in a position somewhat similar to Mendeleev's chemical periodic table of 1869: there are gaps and we need to do more research to fill them. The periodic table also offers potential for novel therapeutic and diagnostic agents, based on not only essential elements, but also non-essential elements, and on radionuclides. Although the potential for inorganic chemistry in medicine was realized more than 2000 years ago, this area of research is still in its infancy. Future advances in the design of inorganic drugs require more knowledge of their mechanism of action, including target sites and metabolism. Temporal speciation of elements in their biological environments at the atomic level is a major challenge, for which new methods are urgently needed.

  1. Jucys-Murphy elements for partition algebras

    CERN Document Server

    Enyang, John

    2010-01-01

    An inductive formula is given for a family of elements which are shown to play a role in the partition algebras which is analogous to the part played by classical Jucys-Murphy elements in the symmetric group. Using Schur-Weyl duality it is shown that the aforementioned inductive definition is equivalent to the combinatorial definition given by Halverson and Ram for Jucys-Murphy elements of partition algebras. As a consequence of the inductive formula for Jucys-Murphy elements, a new presentation for partition algebras in terms of certain involutions is also derived.

  2. Unified Framework for Finite Element Assembly

    CERN Document Server

    Alnæs, Martin Sandve; Mardal, Kent-Andre; Skavhaug, Ola; Langtangen, Hans Petter; 10.1504/IJCSE.2009.029160

    2012-01-01

    At the heart of any finite element simulation is the assembly of matrices and vectors from discrete variational forms. We propose a general interface between problem-specific and general-purpose components of finite element programs. This interface is called Unified Form-assembly Code (UFC). A wide range of finite element problems is covered, including mixed finite elements and discontinuous Galerkin methods. We discuss how the UFC interface enables implementations of variational form evaluation to be independent of mesh and linear algebra components. UFC does not depend on any external libraries, and is released into the public domain.

  3. Photoshop Elements 8 After the Shoot

    CERN Document Server

    Fitzgerald, Mark

    2010-01-01

    A handy, full-color reference for using Photoshop Elements 8 while on the go. Photoshop Elements combines an easy-to-use set of features and enhancements with image editing power in an affordable program. The newest version—Photoshop Elements 8—features more online integration with products like the new Flash-based Web galleries. Featuring a convenient trim size that goes where you go, this portable guide is essential reading for Elements users and especially suited if you are a mobile user who wants to edit and post your digital photographs while on the go.: Serves as a portable reference for

  4. Trace Elements in Ovaries: Measurement and Physiology.

    Science.gov (United States)

    Ceko, Melanie J; O'Leary, Sean; Harris, Hugh H; Hummitzsch, Katja; Rodgers, Raymond J

    2016-04-01

    Traditionally, research in the field of trace element biology and human and animal health has largely depended on epidemiological methods to demonstrate involvement in biological processes. These studies were typically followed by trace element supplementation trials or attempts at identification of the biochemical pathways involved. With the discovery of biological molecules that contain the trace elements, such as matrix metalloproteinases containing zinc (Zn), cytochrome P450 enzymes containing iron (Fe), and selenoproteins containing selenium (Se), much of the current research focuses on these molecules, and, hence, only indirectly on trace elements themselves. This review focuses largely on two synchrotron-based x-ray techniques: X-ray absorption spectroscopy and x-ray fluorescence imaging that can be used to identify the in situ speciation and distribution of trace elements in tissues, using our recent studies of bovine ovaries, where the distribution of Fe, Se, Zn, and bromine were determined. It also discusses the value of other techniques, such as inductively coupled plasma mass spectrometry, used to garner information about the concentrations and elemental state of the trace elements. These applications to measure trace elemental distributions in bovine ovaries at high resolutions provide new insights into possible roles for trace elements in the ovary.

  5. EDITORIAL: King of the elements? King of the elements?

    Science.gov (United States)

    Demming, Anna

    2010-07-01

    Throughout the history of science, carbon-based research has played a defining role in the development of a range of fundamental and technological fields. It was used in Avagadro's definition of the mole in the early 18th century, it provides the 'backbone' of molecules in organic compounds, and in the environmental debate currently raging in the press and international government discussions, the 'carbon footprint' has become the metric of our species' impact on our planet. Also in nanotechnology, with the discovery of various wonder materials, carbon is once again asserting its claim as king of the elements. Until the 1980s the only known forms of carbon were diamond, graphite and amorphous carbon, as in soot or charcoal. In 1985 Robert Curl, Harold Kroto and Richard Smalley reported the existence of fullerenes, spherical structures comprising hexagonal carbon rings [1], work for which they won the Nobel Prize for Chemistry in 1996 [2]. The discovery of fullerenes was followed in 1991 by Sumio Ijima with the discovery of rolled graphite sheets, the carbon nanotube [3]. The discovery of these novel carbon nanostructures inspired researchers in a range of fields, largely as a result of the extraordinary capacity for investigations of these structures to reveal ever more intriguing properties. One of the fascinating properties attributed to carbon nanotubes is their phenomenal strength, with a Young's modulus of single walled carbon nanotubes approaching a terapascal [4]. Ingenious methods of harnessing this strength have since been developed, including bucky paper, a term used to refer to a mat of randomly self-entangled carbon nanotubes. Steven Crannford and Markus Buehler have recently reported a novel computational technique for probing the mechanical properties of these structures and show that the Young's modulus of bucky paper can be tuned by manipulation of the carbon nanotube type and density [5]. The electrical properties of carbon nanotubes, which depend

  6. Retrotransposition of long interspersed nucleotide element-1 is associated with colitis but not tumors in a murine colitic cancer model.

    Directory of Open Access Journals (Sweden)

    Takeshi Otsubo

    Full Text Available Long interspersed element-1 (L1 is a transposable element that can move within the genome, potentially leading to genome diversity and modified gene function. Although L1 activity in somatic cells is normally suppressed through DNA methylation, some L1s are activated in tumors including colorectal carcinoma. However, how L1-retrotransposition (L1-RTP is involved in gastrointestinal disorders remains to be elucidated. We hypothesized that L1-RTP in somatic cells might contribute to colitis-associated cancer (CAC. To address this, we employed an experimental model of CAC using transgenic L1-reporter mice carrying a human L1-EGFP reporter gene. Mice were subjected to repeated cycles of colitis induced by administration of dextran sodium sulfate (DSS in drinking water with injection of carcinogen azoxymethane (AOM. L1-RTP levels were measured by a quantitative polymerase chain reaction targeting the newly inserted reporter EGFP in various tissues and cell types, including samples obtained by laser microdissection and cell sorting with flow cytometry. DNA methylation levels of the human L1 promoter were analyzed by bisulfite pyrosequencing. AOM+DSS-treated mice exhibited significantly higher levels of L1-RTP in whole colon tissue during the acute phase of colitis when compared with control naïve mice. L1-RTP levels in whole colon tissue were positively correlated with the histological severity of colitis and degree of neutrophil infiltration into the lamina propria (LP, but not with tumor development in the colon. L1-RTP was enriched in LP mesenchymal cells rather than epithelial cells (ECs, myeloid, or lymphoid cells. DNA methylation levels of the human L1 promoter region showed a negative correlation with L1-RTP levels. L1-RTP was absent from most tumors found in 22-week-old mice. In conclusion, we demonstrated that L1-RTP was induced in the mouse CAC mucosa in accordance with the acute inflammatory response; however, retrotransposition appears

  7. Just-in-time elements and benefits

    CERN Document Server

    García-Alcaraz, Jorge Luis

    2016-01-01

    This book reports the elements required for implementing Just in Time (JIT) technique in companies. The main reasons for low implementation processes and the main benefits from the successful implementation of them are highlighted in this book. Structural equation models are presented to help identify the essential elements in JIT.

  8. Protein export elements from Lactococcus lactis

    NARCIS (Netherlands)

    Perez-Martinez, Gaspar; Kok, Jan; Venema, Gerhardus; Dijl, Jan Maarten van; Smith, Hilda; Bron, Sierd

    1992-01-01

    Broad-host-range plasmids carrying α-amylase or β-lactamase reporter genes lacking a signal sequence were used to select export elements from Lactococcus lactis chromosomal DNA that could function as signal sequences. Fragments containing such elements were identified by their ability to direct the

  9. Trace elements in animal production systems

    NARCIS (Netherlands)

    Schlegel, P.; Durosoy, S.; Jongbloed, A.W.

    2008-01-01

    This book deals with trace elements, such as cobalt, copper, iron, manganese, selenium and zinc which are essential to modern animal nutrition, but are increasingly detrimental to soil and water quality in today's globalized production. The goal in finding a sustainable balance between trace element

  10. Micromagnetic simulations of semielliptical permalloy elements

    Energy Technology Data Exchange (ETDEWEB)

    Waifalkar, P.P.; Patil, P.S. [Thin Film Materials Laboratory, Department of Physics, Shivaji University, Kolhapur 416004, Maharashtra (India); Patil, P.B., E-mail: prashantphy@gmail.com [Department of Physics, The New College, Kolhapur 416012, Maharashtra (India)

    2014-09-01

    Magnetic spin configuration of patterned semielliptical permalloy elements useful for transportation of biofunctionlized magnetic particles was investigated by micromagnetic simulations. A demagnetized state at zero field shows a stable vortex state around the center. Application of 100 Oe field along a short axis of semiellipse was found to be sufficient to completely saturate the element along the field direction.

  11. Reference: ELEMENT1GMLBC3 [PLACE

    Lifescience Database Archive (English)

    Full Text Available ELEMENT1GMLBC3 Jensen EO, Marcker KA, Schell J, de Bruijn J Interaction of a nodule... specific, trans-acting factor with distinct DNA elements in the soybean leghaemoglobin lbc3 5' upstream region EMBO J 7:1265-1271 (1988) ...

  12. Reference: ELEMENT2GMLBC3 [PLACE

    Lifescience Database Archive (English)

    Full Text Available ELEMENT2GMLBC3 Jensen EO, Marcker KA, Schell J, de Bruijn J Interaction of a nodule... specific, trans-acting factor with distinct DNA elements in the soybean leghaemoglobin lbc3 5' upstream region EMBO J 7:1265-1271 (1988) ...

  13. Enhanced patch test of finite element methods

    Institute of Scientific and Technical Information of China (English)

    CHEN; Wanji

    2006-01-01

    Theoretically, the constant stress patch test is not rigorous. Also, either the patch test of non-zero constant shear for Mindlin plate problem or non-zero strain gradient curvature of the microstructures cannot be performed. To improve the theory of the patch test, in this paper, based on the variational principle with relaxed continuity requirement of nonconforming element for homogeneous differential equations, the author proposed the individual element condition for passing the patch test and the convergence condition of the element: besides passing the patch test, the element function should include the rigid body modes and constant strain modes and satisfy the weak continuity condition, and no extra zero energy modes occur. Moreover, the author further established a variational principle with relaxed continuity requirement of nonconforming element for inhomogeneous differential equations, the enhanced patch test condition and the individual element condition. To assure the convergence of the element that should pass the enhanced patch test, the element function should include the rigid body modes and non-zero strain modes which satisfied the equilibrium equations, and no spurious zero energy modes occur and should satisfy new weak continuity condition. The theory of the enhanced patch test proposed in this paper can be applied to both homogeneous and inhomogeneous differential equations. Based on this theory, the patch test of the non-zero constant shear stress for Mindlin plate and the C0-1 patch test of the non-zero constant curvature for the couple stress/strain gradient theory were established.

  14. Non-linear finite element modeling

    DEFF Research Database (Denmark)

    Mikkelsen, Lars Pilgaard

    The note is written for courses in "Non-linear finite element method". The note has been used by the author teaching non-linear finite element modeling at Civil Engineering at Aalborg University, Computational Mechanics at Aalborg University Esbjerg, Structural Engineering at the University...... on the governing equations and methods of implementing....

  15. MODERATOR ELEMENTS FOR UNIFORM POWER NUCLEAR REACTOR

    Science.gov (United States)

    Balent, R.

    1963-03-12

    This patent describes a method of obtaining a flatter flux and more uniform power generation across the core of a nuclear reactor. The method comprises using moderator elements having differing moderating strength. The elements have an increasing amount of the better moderating material as a function of radial and/or axial distance from the reactor core center. (AEC)

  16. 42 CFR 56.203 - Project elements.

    Science.gov (United States)

    2010-10-01

    ... SERVICES Grants for Planning and Developing Migrant Health Centers § 56.203 Project elements. A project for... population, based on the assessment prepared pursuant to paragraph (b) of this section which indicates in... 42 Public Health 1 2010-10-01 2010-10-01 false Project elements. 56.203 Section 56.203...

  17. 42 CFR 51c.203 - Project elements.

    Science.gov (United States)

    2010-10-01

    ... SERVICES Grants for Planning and Developing Community Health Centers § 51c.203 Project elements. A project... fulfill the needs identified in the assessment prepared pursuant to paragraph (a) of this section and how... 42 Public Health 1 2010-10-01 2010-10-01 false Project elements. 51c.203 Section 51c.203...

  18. Quadrature representation of finite element variational forms

    DEFF Research Database (Denmark)

    Ølgaard, Kristian Breum; Wells, Garth N.

    2012-01-01

    This chapter addresses the conventional run-time quadrature approach for the numerical integration of local element tensors associated with finite element variational forms, and in particular automated optimizations that can be performed to reduce the number of floating point operations...

  19. Kazhdan-Lusztig polynomials of boolean elements

    CERN Document Server

    Mongelli, Pietro

    2011-01-01

    We give closed combinatorial product formulas for Kazhdan-Lusztig poynomials and their parabolic analogue of type q in the case of boolean elements, introduced in [M. Marietti, Boolean elements in Kazhdan-Lusztig theory, J. Algebra 295 (2006)], in Coxeter groups whose Coxeter graph is a tree.

  20. The forgotten Elements of Action Learning

    DEFF Research Database (Denmark)

    Nunez, Heilyn Camacho; Aguirre, María

    The aim of this article is to provide a discussion and description of some topics of action learning that are not so commonly discussed in the literature and that I have called ‘the forgotten elements of action learning’. Those elements are dealing with Revans’ moral, spiritual and ethical reflec...

  1. Why do probabilistic finite element analysis ?

    CERN Document Server

    Thacker, B H

    2008-01-01

    The intention of this book is to provide an introduction to performing probabilistic finite element analysis. As a short guideline, the objective is to inform the reader of the use, benefits and issues associated with performing probabilistic finite element analysis without excessive theory or mathematical detail.

  2. A method for making an alkaline element

    Energy Technology Data Exchange (ETDEWEB)

    Obi, F.; Takada, K.

    1983-05-11

    A mixture of asphalt with polybutene is applied to the contacting surfaces of the body top and the hermetically sealing stuffing. After assembly the element is heated to a temperature which exceeds the softening point of the mixture. The edge of the body is rolled in. The element has high reliability.

  3. Writing analytic element programs in Python.

    Science.gov (United States)

    Bakker, Mark; Kelson, Victor A

    2009-01-01

    The analytic element method is a mesh-free approach for modeling ground water flow at both the local and the regional scale. With the advent of the Python object-oriented programming language, it has become relatively easy to write analytic element programs. In this article, an introduction is given of the basic principles of the analytic element method and of the Python programming language. A simple, yet flexible, object-oriented design is presented for analytic element codes using multiple inheritance. New types of analytic elements may be added without the need for any changes in the existing part of the code. The presented code may be used to model flow to wells (with either a specified discharge or drawdown) and streams (with a specified head). The code may be extended by any hydrogeologist with a healthy appetite for writing computer code to solve more complicated ground water flow problems.

  4. An Improved Linear Tetrahedral Element for Plasticity

    Energy Technology Data Exchange (ETDEWEB)

    Puso, M

    2005-04-25

    A stabilized, nodally integrated linear tetrahedral is formulated and analyzed. It is well known that linear tetrahedral elements perform poorly in problems with plasticity, nearly incompressible materials, and acute bending. For a variety of reasons, linear tetrahedral elements are preferable to quadratic tetrahedral elements in most nonlinear problems. Whereas, mixed methods work well for linear hexahedral elements, they don't for linear tetrahedrals. On the other hand, automatic mesh generation is typically not feasible for building many 3D hexahedral meshes. A stabilized, nodally integrated linear tetrahedral is developed and shown to perform very well in problems with plasticity, nearly incompressible materials and acute bending. Furthermore, the formulation is analytically and numerically shown to be stable and optimally convergent. The element is demonstrated to perform well in several standard linear and nonlinear benchmarks.

  5. LOCKING-FREE DEGENERATED ISOPARAMETRIC SHELL ELEMENT

    Institute of Scientific and Technical Information of China (English)

    章向明; 王安稳; 何汉林

    2001-01-01

    An 8-noded locking-free degenerated isoparametric shell element is presented.A revised interpolation for shear strain terms was constructed in natural co-ordinate system such that all necessary modes ( translation, rotation and constant curvature ) are preserved,which can be used to eliminate shear locking. A revised interpolation for membrane strains was produced in the local Cartesian co-ordinate system to overcome membrane locking behavior. The new 8-noded element has the proper rank, with the requisite number of zero eigenvalues each associated with a rigid mode. The element does not exhibit membrane or shear locking for large span-thickness ratio. The element does not form element mechanisms or extra spurious zero energy modes. Therefore, it can be used for both thin and thick shells.

  6. Element 74, the Wolfram Versus Tungsten Controversy

    Energy Technology Data Exchange (ETDEWEB)

    Holden,N.E.

    2008-08-11

    Two and a quarter centuries ago, a heavy mineral ore was found which was thought to contain a new chemical element called heavy stone (or tungsten in Swedish). A few years later, the metal was separated from its oxide and the new element (Z=74) was called wolfram. Over the years since that time, both the names wolfram and tungsten were attached to this element in various countries. Sixty years ago, IUPAC chose wolfram as the official name for the element. A few years later, under pressure from the press in the USA, the alternative name tungsten was also allowed by IUPAC. Now the original, official name 'wolfram' has been deleted by IUPAC as one of the two alternate names for the element. The history of this controversy is described here.

  7. Rolling Element Bearing Stiffness Matrix Determination (Presentation)

    Energy Technology Data Exchange (ETDEWEB)

    Guo, Y.; Parker, R.

    2014-01-01

    Current theoretical bearing models differ in their stiffness estimates because of different model assumptions. In this study, a finite element/contact mechanics model is developed for rolling element bearings with the focus of obtaining accurate bearing stiffness for a wide range of bearing types and parameters. A combined surface integral and finite element method is used to solve for the contact mechanics between the rolling elements and races. This model captures the time-dependent characteristics of the bearing contact due to the orbital motion of the rolling elements. A numerical method is developed to determine the full bearing stiffness matrix corresponding to two radial, one axial, and two angular coordinates; the rotation about the shaft axis is free by design. This proposed stiffness determination method is validated against experiments in the literature and compared to existing analytical models and widely used advanced computational methods. The fully-populated stiffness matrix demonstrates the coupling between bearing radial, axial, and tilting bearing deflections.

  8. Pump element for a tube pump

    DEFF Research Database (Denmark)

    2011-01-01

    relative to the rod element so as to allow for a fluid flow in the tube through the first valve member, along the rod element, and through the second valve member. The tube comprises an at least partly flexible tube portion between the valve members such that a repeated deformation of the flexible tube...... portion acts to alternately close and open the valve members thereby generating a fluid flow through the tube. The invention further relates to a pump element comprising at least two non-return valve members connected by a rod element, and for insertion in an at least partly flexible tube in such tube...... pump as mentioned above, thereby acting to generate a fluid flow through the tube upon repeated deformation of the tube between the two valve members. The pump element may comprise a connecting part for coupling to another tube and may comprise a sealing part establishing a fluid tight connection...

  9. A new multiresolution finite element method based on a multiresolution quadrilateral plate element

    CERN Document Server

    Xia, YiMing

    2014-01-01

    A new multiresolution quadrilateral plate element is proposed and a multiresolution finite element method is hence presented. The multiresolution analysis (MRA) framework is formulated out of a mutually nesting displacement subspace sequence, whose basis functions are constructed of scaling and shifting on the element domain of basic node shape function. The basic node shape function is constructed by extending shape function around a specific node. The MRA endows the proposed element with the resolution level (RL) to adjust the element node number, thus modulating structural analysis accuracy accordingly. As a result, the traditional 4-node quadrilateral plate element and method is a monoresolution one and also a special case of the proposed element and method. The meshing for the monoresolution plate element model is based on the empiricism while the RL adjusting for the multiresolution is laid on the rigorous mathematical basis. The accuracy of a structural analysis is fully determined by the RL, not by th...

  10. A multiresolution finite element method based on a new locking-free rectangular Mindlin plate element

    CERN Document Server

    Xia, Yi-Ming

    2015-01-01

    A locking-free rectangular Mindlin plate element with a new multi-resolution analysis (MRA) is proposed and a multireolution finite element method is hence presented. The MRA framework is formulated out of a mutually nesting displacement subspace sequence. The MRA endows the proposed element with the resolution level (RL) to adjust the element node number, thus modulating structural analysis accuracy accordingly. As a result, the traditional 4-node rectangular Mindlin plate element and method is a mono-resolution one and also a special case of the proposed element and method. The meshing for the monoresolution plate element model is based on the empiricism while the RL adjusting for the multiresolution is laid on the rigorous mathematical basis. The accuracy of a structural analysis is actually determined by the RL, not by the mesh. The rational MRA enables the implementation of the multiresolution Mindlin plate element method to be more rational and efficient than that of the conventional monoresolution or o...

  11. Multi-Element Lean Direct Injection Combustor Single Element Demonstration Project

    Data.gov (United States)

    National Aeronautics and Space Administration — We propose to demonstrate the feasibility in a single element of a Multi-Element Lean Direct Injection, ME-LDI, Combustion concept. The concept will have the...

  12. PRECONDITIONING HIGHER ORDER FINITE ELEMENT SYSTEMS BY ALGEBRAIC MULTIGRID METHOD OF LINEAR ELEMENTS

    Institute of Scientific and Technical Information of China (English)

    Yun-qing Huang; Shi Shu; Xi-jun Yu

    2006-01-01

    We present and analyze a robust preconditioned conjugate gradient method for the higher order Lagrangian finite element systems of a class of elliptic problems. An auxiliary linear element stiffness matrix is chosen to be the preconditioner for higher order finite elements. Then an algebraic multigrid method of linear finite element is applied for solving the preconditioner. The optimal condition number which is independent of the mesh size is obtained. Numerical experiments confirm the efficiency of the algorithm.

  13. The Connection between the Properties of Elements and Compounds; Mineralogical-Crystallochemical Classification of Elements

    OpenAIRE

    Godovikov, Alexander A.; Hariya, Yu

    1987-01-01

    The described mineralogical-crystallochemical classification bears some similar features with geochemical classification of elements. This similarity emphasizes a greater importance in conforming the vast practical data on petrology. The present classification also bears some resemblance to the technical classification of elements by Berg (1929). The similarity seems logical since the mineralogical. crystallochemical classification of elements unites them on the basis of crystallochemical sim...

  14. Analysis of bender element test interpretation using the discrete element method

    NARCIS (Netherlands)

    O’Donovan, J.; O’Sullivan, C.; Marketos, G.; Muir Wood, D.

    2015-01-01

    While bender element testing is now well-established as a laboratory technique to determine soil stiffness, a robust technique to interpret the data remains elusive. A discrete element method (DEM) model of a face-centred cubic packing of uniform spheres was created to simulate bender element tests

  15. Mortar Upwind Finite Volume Element Method with Crouzeix-Raviart Element for Parabolic Convection Diffusion Problems

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    In this paper, we study the semi-discrete mortar upwind finite volume element method with the Crouzeix-Raviart element for the parabolic convection diffusion problems.It is proved that the semi-discrete mortar upwind finite volume element approximations derived are convergent in the H1- and L2-norms.

  16. Streptococcus gallolyticus subsp. gallolyticus from human and animal origins: genetic diversity, antimicrobial susceptibility, and characterization of a vancomycin-resistant calf isolate carrying a vanA-Tn1546-like element.

    Science.gov (United States)

    Romero-Hernández, Beatriz; Tedim, Ana P; Sánchez-Herrero, José Francisco; Librado, Pablo; Rozas, Julio; Muñoz, Gloria; Baquero, Fernando; Cantón, Rafael; Del Campo, Rosa

    2015-04-01

    The aim of this work was to characterize the antibiotic susceptibility and genetic diversity of 41 Streptococcus gallolyticus subsp. gallolyticus isolates: 18 isolates obtained from animals and 23 human clinical isolates. Antibiotic susceptibility was determined by the semiautomatic Wider system and genetic diversity by pulsed-field gel electrophoresis (PFGE) with SmaI. Animal isolates grouped separately in the PFGE analysis, but no statistical differences in antimicrobial resistance were found between the two groups. The LMG 17956 sequence type 28 (ST28) strain recovered from the feces of a calf exhibited high levels of resistance to vancomycin and teicoplanin (MIC, ≥256 mg/liter). Its glycopeptide resistance mechanism was characterized by Southern blot hybridization and a primer-walking strategy, and finally its genome, determined by whole-genome sequencing, was compared with four closely related S. gallolyticus subsp. gallolyticus genomes. Hybridization experiments demonstrated that a Tn1546-like element was integrated into the bacterial chromosome. In agreement with this finding, whole-genome sequencing confirmed a partial deletion of the vanY-vanZ region and partial duplication of the vanH gene. The comparative genomic analyses revealed that the LMG 17956 ST28 strain had acquired an unusually high number of transposable elements and had experienced extensive chromosomal rearrangements, as well as gene gain and loss events. In conclusion, S. gallolyticus subsp. gallolyticus isolates from animals seem to belong to lineages separate from those infecting humans. In addition, we report a glycopeptide-resistant isolate from a calf carrying a Tn1546-like element integrated into its chromosome.

  17. Genome-wide identification of enhancer elements.

    Science.gov (United States)

    Tulin, Sarah; Barsi, Julius C; Bocconcelli, Carlo; Smith, Joel

    2016-01-01

    We present a prospective genome-wide regulatory element database for the sea urchin embryo and the modified chromosome capture-related methodology used to create it. The method we developed is termed GRIP-seq for genome-wide regulatory element immunoprecipitation and combines features of chromosome conformation capture, chromatin immunoprecipitation, and paired-end next-generation sequencing with molecular steps that enrich for active cis-regulatory elements associated with basal transcriptional machinery. The first GRIP-seq database, available to the community, comes from S. purpuratus 24 hpf embryos and takes advantage of the extremely well-characterized cis-regulatory elements in this system for validation. In addition, using the GRIP-seq database, we identify and experimentally validate a novel, intronic cis-regulatory element at the onecut locus. We find GRIP-seq signal sensitively identifies active cis-regulatory elements with a high signal-to-noise ratio for both distal and intronic elements. This promising GRIP-seq protocol has the potential to address a rate-limiting step in resolving comprehensive, predictive network models in all systems.

  18. Combining classifiers for robust PICO element detection

    Directory of Open Access Journals (Sweden)

    Grad Roland

    2010-05-01

    Full Text Available Abstract Background Formulating a clinical information need in terms of the four atomic parts which are Population/Problem, Intervention, Comparison and Outcome (known as PICO elements facilitates searching for a precise answer within a large medical citation database. However, using PICO defined items in the information retrieval process requires a search engine to be able to detect and index PICO elements in the collection in order for the system to retrieve relevant documents. Methods In this study, we tested multiple supervised classification algorithms and their combinations for detecting PICO elements within medical abstracts. Using the structural descriptors that are embedded in some medical abstracts, we have automatically gathered large training/testing data sets for each PICO element. Results Combining multiple classifiers using a weighted linear combination of their prediction scores achieves promising results with an f-measure score of 86.3% for P, 67% for I and 56.6% for O. Conclusions Our experiments on the identification of PICO elements showed that the task is very challenging. Nevertheless, the performance achieved by our identification method is competitive with previously published results and shows that this task can be achieved with a high accuracy for the P element but lower ones for I and O elements.

  19. Moving KML geometry elements within Google Earth

    Science.gov (United States)

    Zhu, Liang-feng; Wang, Xi-feng; Pan, Xin

    2014-11-01

    During the process of modeling and visualizing geospatial information on the Google Earth virtual globe, there is an increasing demand to carry out such operations as moving geospatial objects defined by KML geometry elements horizontally or vertically. Due to the absence of the functionality and user interface for performing the moving transformation, it is either hard or impossible to interactively move multiple geospatial objects only using the existing Google Earth desktop application, especially when the data sets are in large volume. In this paper, we present a general framework and associated implementation methods for moving multiple KML geometry elements within Google Earth. In our proposed framework, we first load KML objects into the Google Earth plug-in, and then extract KML geometry elements from the imported KML objects. Subsequently, we interactively control the movement distance along a specified orientation by employing a custom user interface, calculate the transformed geographic location for each KML geometry element, and adjust geographic coordinates of the points in each KML objects. And finally, transformed KML geometry elements can be displayed in Google Earth for 3D visualization and spatial analysis. A key advantage of the proposed framework is that it provides a simple, uniform and efficient user interface for moving multiple KML geometry elements within Google Earth. More importantly, the proposed framework and associated implementations can be conveniently integrated into other customizable Google Earth applications to support interactively visualizing and analyzing geospatial objects defined by KML geometry elements.

  20. The dynamic stiffness matrix of two-dimensional elements: application to Kirchhoff's plate continuous elements

    Science.gov (United States)

    Casimir, J. B.; Kevorkian, S.; Vinh, T.

    2005-10-01

    This paper describes a procedure for building the dynamic stiffness matrix of two-dimensional elements with free edge boundary conditions. The dynamic stiffness matrix is the basis of the continuous element method. Then, the formulation is used to build a Kirchhoff rectangular plate element. Gorman's method of boundary condition decomposition and Levy's series are used to obtain the strong solution of the elementary problem. A symbolic computation software partially performs the construction of the dynamic stiffness matrix from this solution. The performances of the element are evaluated from comparisons with harmonic responses of plates obtained by the finite element method.