WorldWideScience

Sample records for c4 developmental mutants

  1. Search for C4 developmental mutants in Panicum maximum Jacq

    International Nuclear Information System (INIS)

    Fladung, M.

    2001-01-01

    Full text: Mutant plants are useful tools for studying developmental processes in defined genetic backgrounds by comparing them with their respective wild type forms. In this sense, developmental mutants or mutations involved in the establishment of certain leaf or flower specific traits are of special interest. In particular, the evolution of C 4 photosynthesis from C 3 precursors was accompanied by severe developmental changes in leaf morphology and anatomy. Our search of such mutants was followed by the idea to approach the evolution of the C 4 syndrome from a mutagenic point of view. Variants affecting normal development of the C 4 leaf anatomy may, in fact, represent possible regressive steps in C4 photosynthesis. Seeds of the C4 grass Panicum maximum Jacq. were mutagenized using ethylmethanesulfonate (EMS) and putative variants were isolated in the M2 generation by visual inspection. Main selection characteristics were whole plant, leaf morphology and pigmentation, and growth characteristics. The choice of a polyploid species for mutagenesis experiments was based on the need of detecting rare mutants, which are possibly lethal when using a diploid plant species. These variants could be of regulatory nature, affecting both morphology and physiology of C 4 photosynthesis early in leaf development. In total, nearly 100 variants were isolated and grown to maturity. Main isolated variants, which conforms to the prediction mentioned above, were as following: large interveinal space-1 and -3 (lis1, lis3), abnormal bundle sheath (abs), midribless (mbl) and variegated leaf -1 (var1). The variant lis1 was a short plant with leaves smaller than the wild type, and had a leaf lamina with a crinkly surface. Photosynthetically, lis1 indicates a clear regression from the C 4 to the C 3 photosynthesis type, which was correlated in the leaf lamina with an increase in the distance between small veins. The variant lis3 was not similar phenotypically to lis1, but it also had very

  2. Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes.

    Science.gov (United States)

    Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich

    2012-02-01

    The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information.

  3. Developmental role of phenylalanine-ammonia-lyase (PAL) and cinnamate 4-hydroxylase (C4H) genes during adventitious rooting of Juglans regia L. microshoots.

    Science.gov (United States)

    Cheniany, Monireh; Ganjeali, Ali

    2016-12-01

    Phenylalanine-ammonia-lyase and cinnamate-4-hydroxylase play important role in the phenylpropanoid pathway, which produces many biologically important secondary metabolites participating in normal plant development. Flavonol quercetin is the main representant of these compounds that has been identified in numerous Juglans spp. In this survey, the developmental expression patterns of PAL and C4H genes during in vitro rooting of two walnut cultivars 'Sunland' and 'Howard' was examined by RT-PCR. To understand the potential role in rooting, the changing pattern of endogenous content of quercetin was also analyzed by HPLC. The 'Sunland' with better capacity to root had more quercetin content during the "inductive phase" of rooting than 'Howard'. In each cultivar, the level of PAL transcripts showed the same behavior with the changing patterns of quercetin during root formation of microshoots. The positive correlation between the changes of quercetin and PAL-mRNA indicated that PAL gene may have an immediate effect on flavonoid pathway metabolites including quercetin. Although the behavioral change of C4H expression was similar in both cultivars during root formation (with significantly more level for 'Howard'), it was not coincide with the changes of quercerin concentrations. Our results showed that C4H function is important for the normal development, but its transcriptional regulation does not correlate with quercetin as an efficient phenolic compound for walnut rhizogenesis.

  4. Submerged Conidiation and Product Formation by Aspergillus niger at Low Specific Growth Rates Are Affected in Aerial Developmental Mutants

    DEFF Research Database (Denmark)

    Jørgensen, Thomas R.; Nielsen, Kristian Fog; Arentshorst, Mark

    2011-01-01

    as associated with conidium formation, while fumonisins B2, B4, and B6 were characteristic of early response to nutrient limitation by the vegetative mycelium. The developmental mutants responded differently to the severe substrate limitation, which resulted in distinct profiles of growth and product formation...

  5. Developmental impairment of compound action potential in the optic nerve of myelin mutant taiep rats.

    Science.gov (United States)

    Roncagliolo, Manuel; Schlageter, Carol; León, Claudia; Couve, Eduardo; Bonansco, Christian; Eguibar, José R

    2006-01-05

    The taiep rat is a myelin mutant with an initial hypomyelination, followed by a progressive demyelination of the CNS. The neurological correlates start with tremor, followed by ataxia, immobility episodes, epilepsy and paralysis. The optic nerve, an easily-isolable central tract fully myelinated by oligodendrocytes, is a suitable preparation to evaluate the developmental impairment of central myelin. We examined the ontogenic development of optic nerve compound action potentials (CAP) throughout the first 6 months of life of control and taiep rats. Control optic nerves (ON) develop CAPs characterized by three waves. Along the first month, the CAPs of taiep rats showed a delayed maturation, with lower amplitudes and longer latencies than controls; at P30, the conduction velocity has only a third of the normal value. Later, as demyelination proceeds, the conduction velocity of taiep ONs begins to decrease and CAPs undergo a gradual temporal dispersion. CAPs of control and taiep showed differences in their pharmacological sensitivity to TEA and 4-AP, two voltage dependent K+ channel-blockers. As compared with TEA, 4-AP induced a significant increase of the amplitudes and a remarkable broadening of CAPs. After P20, unlike controls, the greater sensitivity to 4-AP exhibited by taiep ONs correlates with the detachment and retraction of paranodal loops suggesting that potassium conductances could regulate the excitability as demyelination of CNS axons progresses. It is concluded that the taiep rat, a long-lived mutant, provides a useful model to study the consequences of partial demyelination and the mechanisms by which glial cells regulate the molecular organization and excitability of axonal membranes during development and disease.

  6. A Sordaria macrospora mutant lacking the leu1 gene shows a developmental arrest during fruiting body formation.

    Science.gov (United States)

    Kück, Ulrich

    2005-10-01

    Developmental mutants with defects in fruiting body formation are excellent resources for the identification of genetic components that control cellular differentiation processes in filamentous fungi. The mutant pro4 of the ascomycete Sordaria macrospora is characterized by a developmental arrest during the sexual life cycle. This mutant generates only pre-fruiting bodies (protoperithecia), and is unable to form ascospores. Besides being sterile, pro4 is auxotrophic for leucine. Ascospore analysis revealed that the two phenotypes are genetically linked. After isolation of the wild-type leu1 gene from S. macrospora, complementation experiments demonstrated that the gene was able to restore both prototrophy and fertility in pro4. To investigate the control of leu1 expression, other genes involved in leucine biosynthesis specifically and in the general control of amino acid biosynthesis ("cross-pathway control") have been analysed using Northern hybridization and quantitative RT-PCR. These analyses demonstrated that genes of leucine biosynthesis are transcribed at higher levels under conditions of amino acid starvation. In addition, the expression data for the cpc1 and cpc2 genes indicate that cross-pathway control is superimposed on leucine-specific regulation of fruiting body development in the leu1 mutant. This was further substantiated by growth experiments in which the wild-type strain was found to show a sterile phenotype when grown on a medium containing the amino acid analogue 5-methyl-tryptophan. Taken together, these data show that pro4 represents a novel mutant type in S. macrospora, in which amino acid starvation acts as a signal that interrupts the development of the fruiting body.

  7. Neurologic function during developmental and adult stages in Dab1(scm) (scrambler) mutant mice.

    Science.gov (United States)

    Jacquelin, C; Strazielle, C; Lalonde, R

    2012-01-01

    Homozygous Dab1(scm) mouse mutants with cell ectopias in cerebellar cortex, hippocampus, and neocortex were compared to non-ataxic controls on the SHIRPA primary screening battery on postnatal days 8, 15, and 22, as well as in the adult period. Dab1(scm) mutants were distinguished from non-ataxic controls as early as postnatal day 8 based on body tremor, gait anomalies, and body weight. On postnatal day 15, motor coordination deficits were evident on horizontal bar and inclined or vertical grid tests in association with a weaker grip strength. Likewise, mutants were distinguished from controls on drop righting and hindpaw clasping tests. Further differences were detected on postnatal day 22 in the form of fewer visual placing, touch escape, trunk curl, freezing, and vocalization responses, as well as squares traversed in the open-field. Evaluation at the adult age demonstrated similar impairments, indicative of permanent motor alterations. Neuronal metabolic activity was estimated by cytochrome oxidase histochemistry on cerebellar sections. Cerebellar cortical layers and efferent deep nuclei of Dab1(scm) mice appeared hypometabolic relative to non-ataxic mice despite normal metabolism in both regular and ectopic Purkinje cells. Copyright © 2011 Elsevier B.V. All rights reserved.

  8. A pharmacological screen for compounds that rescue the developmental lethality of a Drosophila ATM mutant.

    Science.gov (United States)

    Rimkus, Stacey A; Wassarman, David A

    2018-01-01

    Ataxia-telangiectasia (A-T) is a neurodegenerative disease caused by mutation of the A-T mutated (ATM) gene. ATM encodes a protein kinase that is activated by DNA damage and phosphorylates many proteins, including those involved in DNA repair, cell cycle control, and apoptosis. Characteristic biological and molecular functions of ATM observed in mammals are conserved in Drosophila melanogaster. As an example, conditional loss-of-function ATM alleles in flies cause progressive neurodegeneration through activation of the innate immune response. However, unlike in mammals, null alleles of ATM in flies cause lethality during development. With the goals of understanding biological and molecular roles of ATM in a whole animal and identifying candidate therapeutics for A-T, we performed a screen of 2400 compounds, including FDA-approved drugs, natural products, and bioactive compounds, for modifiers of the developmental lethality caused by a temperature-sensitive ATM allele (ATM8) that has reduced kinase activity at non-permissive temperatures. Ten compounds reproducibly suppressed the developmental lethality of ATM8 flies, including Ronnel, which is an organophosphate. Ronnel and other suppressor compounds are known to cause mitochondrial dysfunction or to inhibit the enzyme acetylcholinesterase, which controls the levels of the neurotransmitter acetylcholine, suggesting that detrimental consequences of reduced ATM kinase activity can be rescued by inhibiting the function of mitochondria or increasing acetylcholine levels. We carried out further studies of Ronnel because, unlike the other compounds that suppressed the developmental lethality of homozygous ATM8 flies, Ronnel was toxic to the development of heterozygous ATM8 flies. Ronnel did not affect the innate immune response of ATM8 flies, and it further increased the already high levels of DNA damage in brains of ATM8 flies, but its effects were not harmful to the lifespan of rescued ATM8 flies. These results provide

  9. Improved yields of daunomycinone glycosides in developmental mutants of Streptomyces coeruleorubidus

    International Nuclear Information System (INIS)

    Blumauerova, M.; Pokorny, V.; Stastna, J.; Hostalek, Z.; Vanek, Z.

    1978-01-01

    When improving Streptomyces coeruleorubidus JA 10092, a producer of antibiotics of the daunomycinone complex, the most active variants were found among isolates of morphological types bld-1 (with a suppressed production of the aerial mycelium on organic media containing glucose) and whi (with an asporogenic aerial mycelium on glucose media and with the bald phenotype on media containing starch). Submerged cultures of the whi mutants produced increased quantities of daunomycinone glycosides in the antibiotic complex, the amount of free anthracyclinones being simultaneously decreased. The whi strains differed from the wild type also in higher demands for aeration, concentration of glucose and in an increased production capacity in starch media. The overall antibiotic activity increased more than 40 times after a six-step selection (application of UV light, γ-radiation, nitrous acid and natural spreads) combined with an altered fermentation technology. (author)

  10. Early nodule senescence is activated in symbiotic mutants of pea (Pisum sativum L.) forming ineffective nodules blocked at different nodule developmental stages.

    Science.gov (United States)

    Serova, Tatiana A; Tsyganova, Anna V; Tsyganov, Viktor E

    2018-04-03

    Plant symbiotic mutants are useful tool to uncover the molecular-genetic mechanisms of nodule senescence. The pea (Pisum sativum L.) mutants SGEFix - -1 (sym40), SGEFix - -3 (sym26), and SGEFix - -7 (sym27) display an early nodule senescence phenotype, whereas the mutant SGEFix - -2 (sym33) does not show premature degradation of symbiotic structures, but its nodules show an enhanced immune response. The nodules of these mutants were compared with each other and with those of the wild-type SGE line using seven marker genes that are known to be activated during nodule senescence. In wild-type SGE nodules, transcript levels of all of the senescence-associated genes were highest at 6 weeks after inoculation (WAI). The senescence-associated genes showed higher transcript abundance in mutant nodules than in wild-type nodules at 2 WAI and attained maximum levels in the mutant nodules at 4 WAI. Immunolocalization analyses showed that the ethylene precursor 1-aminocyclopropane-1-carboxylate accumulated earlier in the mutant nodules than in wild-type nodules. Together, these results showed that nodule senescence was activated in ineffective nodules blocked at different developmental stages in pea lines that harbor mutations in four symbiotic genes.

  11. Developmental delay in a Streptomyces venezuelae glgE null mutant is associated with the accumulation of α-maltose 1-phosphate.

    Science.gov (United States)

    Miah, Farzana; Bibb, Maureen J; Barclay, J Elaine; Findlay, Kim C; Bornemann, Stephen

    2016-07-01

    The GlgE pathway is thought to be responsible for the conversion of trehalose into a glycogen-like α-glucan polymer in bacteria. Trehalose is first converted to maltose, which is phosphorylated by maltose kinase Pep2 to give α-maltose 1-phosphate. This is the donor substrate of the maltosyl transferase GlgE that is known to extend α-1,4-linked maltooligosaccharides, which are thought to be branched with α-1,6 linkages. The genome of Streptomyces venezuelae contains all the genes coding for the GlgE pathway enzymes but none of those of related pathways, including glgC and glgA of the glycogen pathway. This provides an opportunity to study the GlgE pathway in isolation. The genes of the GlgE pathway were upregulated at the onset of sporulation, consistent with the known timing of α-glucan deposition. A constructed ΔglgE null mutant strain was viable but showed a delayed developmental phenotype when grown on maltose, giving less cell mass and delayed sporulation. Pre-spore cells and spores of the mutant were frequently double the length of those of the wild-type, implying impaired cross-wall formation, and spores showed reduced tolerance to stress. The mutant accumulated α-maltose 1-phosphate and maltose but no α-glucan. Therefore, the GlgE pathway is necessary and sufficient for polymer biosynthesis. Growth of the ΔglgE mutant on galactose and that of a Δpep2 mutant on maltose were analysed. In both cases, neither accumulation of α-maltose 1-phosphate/α-glucan nor a developmental delay was observed. Thus, high levels of α-maltose 1-phosphate are responsible for the developmental phenotype of the ΔglgE mutant, rather than the lack of α-glucan.

  12. Systems Approaches to Predict the Functions of Glycoside Hydrolases during the Life Cycle of Aspergillus niger Using Developmental Mutants ∆brlA and ∆flbA

    Science.gov (United States)

    van Munster, Jolanda M.; Nitsche, Benjamin M.; Akeroyd, Michiel; Dijkhuizen, Lubbert; van der Maarel, Marc J. E. C.; Ram, Arthur F. J.

    2015-01-01

    Background The filamentous fungus Aspergillus niger encounters carbon starvation in nature as well as during industrial fermentations. In response, regulatory networks initiate and control autolysis and sporulation. Carbohydrate-active enzymes play an important role in these processes, for example by modifying cell walls during spore cell wall biogenesis or in cell wall degradation connected to autolysis. Results In this study, we used developmental mutants (ΔflbA and ΔbrlA) which are characterized by an aconidial phenotype when grown on a plate, but also in bioreactor-controlled submerged cultivations during carbon starvation. By comparing the transcriptomes, proteomes, enzyme activities and the fungal cell wall compositions of a wild type A. niger strain and these developmental mutants during carbon starvation, a global overview of the function of carbohydrate-active enzymes is provided. Seven genes encoding carbohydrate-active enzymes, including cfcA, were expressed during starvation in all strains; they may encode enzymes involved in cell wall recycling. Genes expressed in the wild-type during starvation, but not in the developmental mutants are likely involved in conidiogenesis. Eighteen of such genes were identified, including characterized sporulation-specific chitinases and An15g02350, member of the recently identified carbohydrate-active enzyme family AA11. Eight of the eighteen genes were also expressed, independent of FlbA or BrlA, in vegetative mycelium, indicating that they also have a role during vegetative growth. The ΔflbA strain had a reduced specific growth rate, an increased chitin content of the cell wall and specific expression of genes that are induced in response to cell wall stress, indicating that integrity of the cell wall of strain ΔflbA is reduced. Conclusion The combination of the developmental mutants ΔflbA and ΔbrlA resulted in the identification of enzymes involved in cell wall recycling and sporulation-specific cell wall

  13. Systems approaches to predict the functions of glycoside hydrolases during the life cycle of Aspergillus niger using developmental mutants ∆brlA and ∆flbA.

    Directory of Open Access Journals (Sweden)

    Jolanda M van Munster

    Full Text Available The filamentous fungus Aspergillus niger encounters carbon starvation in nature as well as during industrial fermentations. In response, regulatory networks initiate and control autolysis and sporulation. Carbohydrate-active enzymes play an important role in these processes, for example by modifying cell walls during spore cell wall biogenesis or in cell wall degradation connected to autolysis.In this study, we used developmental mutants (ΔflbA and ΔbrlA which are characterized by an aconidial phenotype when grown on a plate, but also in bioreactor-controlled submerged cultivations during carbon starvation. By comparing the transcriptomes, proteomes, enzyme activities and the fungal cell wall compositions of a wild type A. niger strain and these developmental mutants during carbon starvation, a global overview of the function of carbohydrate-active enzymes is provided. Seven genes encoding carbohydrate-active enzymes, including cfcA, were expressed during starvation in all strains; they may encode enzymes involved in cell wall recycling. Genes expressed in the wild-type during starvation, but not in the developmental mutants are likely involved in conidiogenesis. Eighteen of such genes were identified, including characterized sporulation-specific chitinases and An15g02350, member of the recently identified carbohydrate-active enzyme family AA11. Eight of the eighteen genes were also expressed, independent of FlbA or BrlA, in vegetative mycelium, indicating that they also have a role during vegetative growth. The ΔflbA strain had a reduced specific growth rate, an increased chitin content of the cell wall and specific expression of genes that are induced in response to cell wall stress, indicating that integrity of the cell wall of strain ΔflbA is reduced.The combination of the developmental mutants ΔflbA and ΔbrlA resulted in the identification of enzymes involved in cell wall recycling and sporulation-specific cell wall modification

  14. Involvement of C4 protein of beet severe curly top virus (family Geminiviridae in virus movement.

    Directory of Open Access Journals (Sweden)

    Kunling Teng

    Full Text Available BACKGROUND: Beet severe curly top virus (BSCTV is a leafhopper transmitted geminivirus with a monopartite genome. C4 proteins encoded by geminivirus play an important role in virus/plant interaction. METHODS AND FINDINGS: To understand the function of C4 encoded by BSCTV, two BSCTV mutants were constructed by introducing termination codons in ORF C4 without affecting the amino acids encoded by overlapping ORF Rep. BSCTV mutants containing disrupted ORF C4 retained the ability to replicate in Arabidopsis protoplasts and in the agro-inoculated leaf discs of N. benthamiana, suggesting C4 is not required for virus DNA replication. However, both mutants did not accumulate viral DNA in newly emerged leaves of inoculated N. benthamiana and Arabidopsis, and the inoculated plants were asymptomatic. We also showed that C4 expression in plant could help C4 deficient BSCTV mutants to move systemically. C4 was localized in the cytosol and the nucleus in both Arabidopsis protoplasts and N. benthamiana leaves and the protein appeared to bind viral DNA and ds/ssDNA nonspecifically, displaying novel DNA binding properties. CONCLUSIONS: Our results suggest that C4 protein in BSCTV is involved in symptom production and may facilitate virus movement instead of virus replication.

  15. Characterization of developmental immature fiber (im) mutant and Texas Marker-1 (TM-1) cotton fibers by Attenuated Total Reflection Fourier Transform Infrared (ATR FT-IR) spectroscopy

    Science.gov (United States)

    The immature fiber (im) mutant is one type of cotton fiber mutants with unique characteristics of non-fluffy cotton bolls. Compared to its near-isogenic wild type Texas Marker-1 (TM-1), im fiber has thin secondary cell wall and is less mature. In this work, we applied the previously proposed princip...

  16. Identification of Photosynthesis-Associated C4 Candidate Genes through Comparative Leaf Gradient Transcriptome in Multiple Lineages of C3 and C4 Species

    Science.gov (United States)

    Ding, Zehong; Weissmann, Sarit; Wang, Minghui; Du, Baijuan; Huang, Lei; Wang, Lin; Tu, Xiaoyu; Zhong, Silin; Myers, Christopher; Brutnell, Thomas P.; Sun, Qi; Li, Pinghua

    2015-01-01

    Leaves of C4 crops usually have higher radiation, water and nitrogen use efficiencies compared to the C3 species. Engineering C4 traits into C3 crops has been proposed as one of the most promising ways to repeal the biomass yield ceiling. To better understand the function of C4 photosynthesis, and to identify candidate genes that are associated with the C4 pathways, a comparative transcription network analysis was conducted on leaf developmental gradients of three C4 species including maize, green foxtail and sorghum and one C3 species, rice. By combining the methods of gene co-expression and differentially co-expression networks, we identified a total of 128 C4 specific genes. Besides the classic C4 shuttle genes, a new set of genes associated with light reaction, starch and sucrose metabolism, metabolites transportation, as well as transcription regulation, were identified as involved in C4 photosynthesis. These findings will provide important insights into the differential gene regulation between C3 and C4 species, and a good genetic resource for establishing C4 pathways in C3 crops. PMID:26465154

  17. Identification of Photosynthesis-Associated C4 Candidate Genes through Comparative Leaf Gradient Transcriptome in Multiple Lineages of C3 and C4 Species.

    Science.gov (United States)

    Ding, Zehong; Weissmann, Sarit; Wang, Minghui; Du, Baijuan; Huang, Lei; Wang, Lin; Tu, Xiaoyu; Zhong, Silin; Myers, Christopher; Brutnell, Thomas P; Sun, Qi; Li, Pinghua

    2015-01-01

    Leaves of C4 crops usually have higher radiation, water and nitrogen use efficiencies compared to the C3 species. Engineering C4 traits into C3 crops has been proposed as one of the most promising ways to repeal the biomass yield ceiling. To better understand the function of C4 photosynthesis, and to identify candidate genes that are associated with the C4 pathways, a comparative transcription network analysis was conducted on leaf developmental gradients of three C4 species including maize, green foxtail and sorghum and one C3 species, rice. By combining the methods of gene co-expression and differentially co-expression networks, we identified a total of 128 C4 specific genes. Besides the classic C4 shuttle genes, a new set of genes associated with light reaction, starch and sucrose metabolism, metabolites transportation, as well as transcription regulation, were identified as involved in C4 photosynthesis. These findings will provide important insights into the differential gene regulation between C3 and C4 species, and a good genetic resource for establishing C4 pathways in C3 crops.

  18. Identification of Photosynthesis-Associated C4 Candidate Genes through Comparative Leaf Gradient Transcriptome in Multiple Lineages of C3 and C4 Species.

    Directory of Open Access Journals (Sweden)

    Zehong Ding

    Full Text Available Leaves of C4 crops usually have higher radiation, water and nitrogen use efficiencies compared to the C3 species. Engineering C4 traits into C3 crops has been proposed as one of the most promising ways to repeal the biomass yield ceiling. To better understand the function of C4 photosynthesis, and to identify candidate genes that are associated with the C4 pathways, a comparative transcription network analysis was conducted on leaf developmental gradients of three C4 species including maize, green foxtail and sorghum and one C3 species, rice. By combining the methods of gene co-expression and differentially co-expression networks, we identified a total of 128 C4 specific genes. Besides the classic C4 shuttle genes, a new set of genes associated with light reaction, starch and sucrose metabolism, metabolites transportation, as well as transcription regulation, were identified as involved in C4 photosynthesis. These findings will provide important insights into the differential gene regulation between C3 and C4 species, and a good genetic resource for establishing C4 pathways in C3 crops.

  19. Despite phylogenetic effects, C3-C4 lineages bridge the ecological gap to C4 photosynthesis.

    Science.gov (United States)

    Lundgren, Marjorie R; Christin, Pascal-Antoine

    2017-01-01

    C 4 photosynthesis is a physiological innovation involving several anatomical and biochemical components that emerged recurrently in flowering plants. This complex trait evolved via a series of physiological intermediates, broadly termed 'C 3 -C 4 ', which have been widely studied to understand C 4 origins. While this research program has focused on biochemistry, physiology, and anatomy, the ecology of these intermediates remains largely unexplored. Here, we use global occurrence data and local habitat descriptions to characterize the niches of multiple C 3 -C 4 lineages, as well as their close C 3 and C 4 relatives. While C 3 -C 4 taxa tend to occur in warm climates, their abiotic niches are spread along other dimensions, making it impossible to define a universal C 3 -C 4 niche. Phylogeny-based comparisons suggest that, despite shifts associated with photosynthetic types, the precipitation component of the C 3 -C 4 niche is particularly lineage specific, being highly correlated with that of closely related C 3 and C 4 taxa. Our large-scale analyses suggest that C 3 -C 4 lineages converged toward warm habitats, which may have facilitated the transition to C 4 photosynthesis, effectively bridging the ecological gap between C 3 and C 4 plants. The intermediates retained some precipitation aspects of their C 3 ancestors' habitat, and likely transmitted them to their C 4 descendants, contributing to the diversity among C 4 lineages seen today. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  20. ISLSCP II C4 Vegetation Percentage

    Data.gov (United States)

    National Aeronautics and Space Administration — The photosynthetic composition (C3 or C4) of vegetation on the land surface is essential for accurate simulations of biosphere-atmosphere exchanges of carbon, water,...

  1. ISLSCP II C4 Vegetation Percentage

    Data.gov (United States)

    National Aeronautics and Space Administration — ABSTRACT: The photosynthetic composition (C3 or C4) of vegetation on the land surface is essential for accurate simulations of biosphere-atmosphere exchanges of...

  2. Real-time PCR quantification of human complement C4A and C4B genes

    Directory of Open Access Journals (Sweden)

    Fust George

    2006-01-01

    Full Text Available Abstract Background The fourth component of human complement (C4, an essential factor of the innate immunity, is represented as two isoforms (C4A and C4B in the genome. Although these genes differ only in 5 nucleotides, the encoded C4A and C4B proteins are functionally different. Based on phenotypic determination, unbalanced production of C4A and C4B is associated with several diseases, such as systemic lupus erythematosus, type 1 diabetes, several autoimmune diseases, moreover with higher morbidity and mortality of myocardial infarction and increased susceptibility for bacterial infections. Despite of this major clinical relevance, only low throughput, time and labor intensive methods have been used so far for the quantification of C4A and C4B genes. Results A novel quantitative real-time PCR (qPCR technique was developed for rapid and accurate quantification of the C4A and C4B genes applying a duplex, TaqMan based methodology. The reliable, single-step analysis provides the determination of the copy number of the C4A and C4B genes applying a wide range of DNA template concentration (0.3–300 ng genomic DNA. The developed qPCR was applied to determine C4A and C4B gene dosages in a healthy Hungarian population (N = 118. The obtained data were compared to the results of an earlier study of the same population. Moreover a set of 33 samples were analyzed by two independent methods. No significant difference was observed between the gene dosages determined by the employed techniques demonstrating the reliability of the novel qPCR methodology. A Microsoft Excel worksheet and a DOS executable are also provided for simple and automated evaluation of the measured data. Conclusion This report describes a novel real-time PCR method for single-step quantification of C4A and C4B genes. The developed technique could facilitate studies investigating disease association of different C4 isotypes.

  3. C# 4.0 in a Nutshell

    CERN Document Server

    Albahari, Joseph

    2010-01-01

    What people are saying about C# 4.0 in a Nutshell "C# 4.0 in a Nutshell is one of the few books I keep on my desk as a quick reference. It is a book I recommend."--Scott Guthrie, Corporate Vice President, .NET Developer Platform, Microsoft Corporation "A must-read for a concise but thorough examination of the parallel programming features in the .NET Framework 4."--Stephen Toub, Parallel Computing Platform Program Manager, Microsoft "This wonderful book is a great reference for developers of all levels."-- Chris Burrows, C# Compiler Team, Microsoft When you have questions about how to u

  4. Enhancing drought tolerance in C(4) crops.

    Science.gov (United States)

    Lopes, Marta S; Araus, Jose Luis; van Heerden, Philippus D R; Foyer, Christine H

    2011-05-01

    Adaptation to abiotic stresses is a quantitative trait controlled by many different genes. Enhancing the tolerance of crop plants to abiotic stresses such as drought has therefore proved to be somewhat elusive in terms of plant breeding. While many C(4) species have significant agronomic importance, most of the research effort on improving drought tolerance has focused on maize. Ideally, drought tolerance has to be achieved without penalties in yield potential. Possibilities for success in this regard are highlighted by studies on maize hybrids performed over the last 70 years that have demonstrated that yield potential and enhanced stress tolerance are associated traits. However, while our understanding of the molecular mechanisms that enable plants to tolerate drought has increased considerably in recent years, there have been relatively few applications of DNA marker technologies in practical C(4) breeding programmes for improved stress tolerance. Moreover, until recently, targeted approaches to drought tolerance have concentrated largely on shoot parameters, particularly those associated with photosynthesis and stay green phenotypes, rather than on root traits such as soil moisture capture for transpiration, root architecture, and improvement of effective use of water. These root traits are now increasingly considered as important targets for yield improvement in C(4) plants under drought stress. Similarly, the molecular mechanisms underpinning heterosis have considerable potential for exploitation in enhancing drought stress tolerance. While current evidence points to the crucial importance of root traits in drought tolerance in C(4) plants, shoot traits may also be important in maintaining high yields during drought.

  5. On the smell of Composition C-4.

    Science.gov (United States)

    Kranz, William; Kitts, Kelley; Strange, Nicholas; Cummins, Joshua; Lotspeich, Erica; Goodpaster, John

    2014-03-01

    In efforts to locate hidden explosives, humans have had few allies as valuable as the explosives-detecting canine. The unrivaled sensitivity and selectivity of the canine nose have combined to make these animals an attractive choice for law enforcement, military, and private security applications. Although the efficacy of trained detector dogs is well-established, the question of which chemical compounds are responsible for causing a dog to recognize a particular odor and alert to it remains a subject of debate for several explosive formulations--including, perhaps most notably, Composition C-4. Previous studies have indicated that cyclohexanone, 2,3-dimethyl-2,3-dinitrobutane, and 2-ethyl-1-hexanol are the chemicals that may cause canines to alert to C-4. This has led to the suggestion that these substances could be used as a substitute for genuine C-4 in the training, testing, and maintenance of explosives-detecting canines. In this paper, we present an alternative view. Using gas chromatography-mass spectrometry with solid phase microextraction as a pre-concentration technique, we have discovered that 2-ethyl-1-hexanol off-gasses not only from C-4, but also from benign sources, such as the common plasticizers bis(2-ethylhexyl)adipate, bis(2-ethylhexyl)sebacate, and bis(2-ethylhexyl)phthalate; as well as several plasticized items common to our everyday world, including PVC tile, PVC pipe, electrical tape, and credit cards. This observation may potentially discourage the use of 2-ethyl-1-hexanol for training purposes. We also present the results of our own canine field trials focused on the detection of C-4. Through the use of contingency tables and statistical testing, we demonstrate the failure of trained law enforcement dogs in our study to respond in any significant way to these potential odor compounds. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  6. Cometary Coma Chemical Composition (C4) Mission

    Science.gov (United States)

    Carle, Glenn C.; Clark, Benton C.; Knocke, Philip C.; OHara, Bonnie J.; Adams, Larry; Niemann, Hasso B.; Alexander, Merle; Veverka, Joseph; Goldstein, Raymond; Huebner, Walter; hide

    1994-01-01

    Cometary exploration remains of great importance to virtually all of space science. Because comets are presumed to be remnants of the early solar nebula, they are expected to provide fundamental knowledge as to the origin and development of the solar system as well as to be key to understanding of the source of volatiles and even life itself in the inner solar system. Clearly the time for a detailed study of the composition of these apparent messages from the past has come. A comet rendezvous mission, the Cometary Coma Chemical Composition (C4) Mission, is now being studied as a candidate for the new Discovery program. This mission is a highly-focussed and usefully-limited subset of the Cometary Rendezvous Asteroid Flyby (CRAF) Mission. The C4 mission will concentrate on measurements that will produce an understanding of the composition and physical makeup of a cometary nucleus. The core science goals of the C4 mission are 1) to determine the chemical, elemental, and isotopic composition of a cometary nucleus and 2) to characterize the chemical and isotopic nature of its atmosphere. A related goal is to obtain temporal information about the development of the cometary coma as a function of time and orbital position. The four short-period comets -- Tempel 1, Tempel 2, Churyumov-Gerasimenko, and Wirtanen -which all appear to have acceptable dust production rates, were identified as candidate targets. Mission opportunities have been identified beginning as early as 1998. Tempel I with a launch in 1999, however, remains the baseline comet for studies of and planning the C4 mission. The C4 mission incorporates two science instruments and two engineering instruments in the payload to obtain the desired measurements. The science instruments include an advanced version of the Cometary Ice and Dust Experiment (CIDEX), a mini-CIDEX with a sample collection system, an X-ray Fluorescence Spectrometer and a Pyrolysis-Gas Chromatograph, and a simplified version of the Neutral

  7. Drosophila mutants of the autism candidate gene neurobeachin (rugose) exhibit neuro-developmental disorders, aberrant synaptic properties, altered locomotion, and impaired adult social behavior and activity patterns.

    Science.gov (United States)

    Wise, Alexandria; Tenezaca, Luis; Fernandez, Robert W; Schatoff, Emma; Flores, Julian; Ueda, Atsushi; Zhong, Xiaotian; Wu, Chun-Fang; Simon, Anne F; Venkatesh, Tadmiri

    2015-01-01

    Autism spectrum disorder (ASD) is a neurodevelopmental disorder in humans characterized by complex behavioral deficits, including intellectual disability, impaired social interactions, and hyperactivity. ASD exhibits a strong genetic component with underlying multigene interactions. Candidate gene studies have shown that the neurobeachin (NBEA) gene is disrupted in human patients with idiopathic autism ( Castermans et al., 2003 ). The NBEA gene spans the common fragile site FRA 13A and encodes a signal scaffold protein ( Savelyeva et al., 2006 ). In mice, NBEA has been shown to be involved in the trafficking and function of a specific subset of synaptic vesicles. ( Medrihan et al., 2009 ; Savelyeva et al., 2006 ). Rugose (rg) is the Drosophila homolog of the mammalian and human NBEA. Our previous genetic and molecular analyses have shown that rg encodes an A kinase anchor protein (DAKAP 550), which interacts with components of the epidermal growth factor receptor or EGFR and Notch-mediated signaling pathways, facilitating cross talk between these and other pathways ( Shamloula et al., 2002 ). We now present functional data from studies on the larval neuromuscular junction that reveal abnormal synaptic architecture and physiology. In addition, adult rg loss-of-function mutants exhibit defective social interactions, impaired habituation, aberrant locomotion, and hyperactivity. These results demonstrate that Drosophila NBEA (rg) mutants exhibit phenotypic characteristics reminiscent of human ASD and thus could serve as a genetic model for studying ASDs.

  8. Cinnamic acid 4-hydroxylase of sorghum [Sorghum biocolor (L.) Moench] gene SbC4H1 restricts lignin synthesis in Arabidopsis

    Science.gov (United States)

    Cinnamic acid 4-hydroxylase (C4H) is the first hydroxylase enzyme of the phenylpropanoid pathway, and its content and activity affects the lignin synthesis. In this study, we isolated a C4H gene SbC4H1 from the suppression subtractive hybridization library of brown midrib (bmr) mutants of Sorghum b...

  9. Crystal structures of Er4Ni13C4 and UW4C4

    International Nuclear Information System (INIS)

    Khalili, M.M.; Bodak, O.I.; Marusin, E.P.; Pecharskaya, A.O.

    1990-01-01

    Crystal structures of Er 4 Ni 13 C 4 (1) (sp.gr. Cmmm, a=1.1975(4), b=1.1694(3), c=0.3856(1) nm, Z=2) and UW 4 C 4 (2) (sp.gr. P4/m, a=0.8328(8), c=0.31345(9) nm, Z=2), relating to new types are determined. Structural type (1) is a derivative of La 2 Ni 5 C 3 structure, structural type (2) is close to UCr 4 C 4 structure

  10. Theoretical studies of the C4 molecule

    International Nuclear Information System (INIS)

    Ritchie, J.P.; King, H.F.; Young, W.S.

    1985-01-01

    Optimized geometries and relative energies for three states of the C 4 molecule have been obtained from single-reference configuration interaction (SRCI) calculations. At the SRCI level, a rhombic form is calculated to lie 1.1 kcal below the triplet form; consideration of the Davidson correction reduces this difference to 0.4 kcal, while more complete basis sets are expected to increase the difference only by about 0.2 kcal. Consideration of these effects and difference in zero-point energy leads to a final estimated splitting of 1.2 kcal, favoring the rhombus. To aid the determination of the ground state, preliminary estimates of the lowest optical transitions were obtained from SRCI calculations and vibrational frequencies were obtained from SCF calculations. Comparison of the calculated results with experimentally obtained spectra suggest the possibility that both the linear triplet and the rhombus may have already been observed. 19 refs., 4 figs., 4 tabs

  11. The roles of phosphorylation and SHAGGY-like protein kinases in geminivirus C4 protein induced hyperplasia.

    Directory of Open Access Journals (Sweden)

    Katherine Mills-Lujan

    Full Text Available Even though plant cells are highly plastic, plants only develop hyperplasia under very specific abiotic and biotic stresses, such as when exposed to pathogens like Beet curly top virus (BCTV. The C4 protein of BCTV is sufficient to induce hyperplasia and alter Arabidopsis development. It was previously shown that C4 interacts with two Arabidopsis Shaggy-like protein kinases, AtSK21 and 23, which are negative regulators of brassinosteroid (BR hormone signaling. Here we show that the C4 protein interacts with five additional AtSK family members. Bikinin, a competitive inhibitor of the seven AtSK family members that interact with C4, induced hyperplasia similar to that induced by the C4 protein. The Ser49 residue of C4 was found to be critical for C4 function, since: 1 mutagenesis of Ser49 to Ala abolished the C4-induced phenotype, abolished C4/AtSK interactions, and resulted in a mutant protein that failed to induce changes in the BR signaling pathway; 2 Ser49 is phosphorylated in planta; and 3 plant-encoded AtSKs must be catalytically active to interact with C4. A C4 N-myristoylation site mutant that does not localize to the plasma membrane and does not induce a phenotype, retained the ability to bind AtSKs. Taken together, these results suggest that plasma membrane associated C4 interacts with and co-opts multiple AtSKs to promote its own phosphorylation and activation to subsequently compromise cell cycle control.

  12. Olefins production from C4 stream; Producao de olefinas a partir de corrente C4

    Energy Technology Data Exchange (ETDEWEB)

    Basso, Julia A.; Feltran, Marina B.; Becker, Patricia Luiza; Rocha, Priscila L. [PETROBRAS, Rio de Janeiro, RJ (Brazil)

    2008-07-01

    The petrochemical sector in Brazil has been growing in terms of investment and expansion of production capacity, due to increased demand for thermoplastic products. However, the offer of basic petrochemical raw materials obtained by conventional routes is not following this increasing demand which stimulates the search for new competitive technologies. Moreover, there is the opportunity to use low value added C4 streams from FCC process that are available in the Brazilian refineries, for the production of petrochemicals. Several possibilities of C4 stream use to produce butadienes, MTBE, maleic anhydride, ethylene and propylene have been discussed in this work. The production of propylene seems to be the most economically attractive option in Brazil, since its offer will not keep up with the growth in its demand, according to ABIQUIM forecasts. Therefore some propylene production technologies from C4 streams - steam cracking, metathesis and selective cracking - have been evaluated considering their basic characteristics and applications. The goal of this study is to provide preliminary information to support future project evaluations of petrochemical/refinery integration, through comparative analysis of these technologies. (author)

  13. Major alterations in transcript profiles between C3-C4 and C4 photosynthesis of an amphibious species Eleocharis baldwinii.

    Science.gov (United States)

    Chen, Taiyu; Zhu, Xin-Guang; Lin, Yongjun

    2014-09-01

    Engineering C4 photosynthetic metabolism into C3 crops is regarded as a major strategy to increase crop productivity, and clarification of the evolutionary processes of C4 photosynthesis can help the better use of this strategy. Here, Eleocharis baldwinii, a species in which C4 photosynthesis can be induced from a C3-C4 state under either environmental or ABA treatments, was used to identify the major transcriptional modifications during the process from C3-C4 to C4. The transcriptomic comparison suggested that in addition to the major differences in C4 core pathway, the pathways of glycolysis, citrate acid metabolism and protein synthesis were dramatically modified during the inducement of C4 photosynthetic states. Transcripts of many transporters, including not only metabolite transporters but also ion transporters, were dramatically increased in C4 photosynthetic state. Many candidate regulatory genes with unidentified functions were differentially expressed in C3-C4 and C4 photosynthetic states. Finally, it was indicated that ABA, auxin signaling and DNA methylation play critical roles in the regulation of C4 photosynthesis. In summary, by studying the different photosynthetic states of the same species, this work provides the major transcriptional differences between C3-C4 and C4 photosynthesis, and many of the transcriptional differences are potentially related to C4 development and therefore are the potential targets for reverse genetics studies.

  14. Using Evolution as a Guide to Engineer Kranz-Type C4 photosynthesis

    Directory of Open Access Journals (Sweden)

    Thomas L. Slewinski

    2013-07-01

    Full Text Available Kranz-type C4 photosynthesis has independently and rapidly evolved over sixty times to dramatically increase radiation use efficiency in both monocots and eudicots. Indeed, it is one of the most exceptional examples of convergent evolution in the history of life. The repeated and rapid evolution of Kranz-type C4 suggests that it may be a derivative of a conserved developmental pathway that is present in all angiosperms. Here, I argue that the Kranz-type C4 photosynthetic system is an extension of the endodermis/starch sheath, that is normally only found in the roots and stems, into photosynthetic structures such as leaves. Support for this hypothesis was recently provided by a study that showed that the same genetic pathway that gives rise to the endodermis in roots, the SCARECROW/SHORT-ROOT radial pattering system, also regulates the development of Kranz anatomy and C4 physiology in leaves. This new hypothesis for the evolution of Kranz-type C4 photosynthesis has opened new opportunities to explore the underlying genetic networks that regulate the development and physiology of C4 and provides new potential avenues for the engineering of the mechanism into C3 crops.

  15. Product Manager C4ISR On-The-Move Experimentation

    National Research Council Canada - National Science Library

    Utroska, William; Langan, Russell; Amabile, Michael

    2006-01-01

    Product Manager C4ISR On-The-Move (PM C4ISR OTM) provides a relevant operational field experimentation venue for the purpose of assessing emerging technologies in a System-of- Systems (SoS) environment...

  16. Complement C4 phenotypes in dementia of the Alzheimer type

    NARCIS (Netherlands)

    Eikelenboom, P.; Goetz, J.; Pronk, J. C.; Hauptmann, G.

    1988-01-01

    Complement C4 phenotype distribution was studied in 64 patients with dementia of the Alzheimer type. In contrast to reported findings we failed to find a significant association between C4B2 gene frequency and Alzheimer's dementia

  17. 17 CFR 240.16c-4 - Derivative securities.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Derivative securities. 240.16c-4 Section 240.16c-4 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION (CONTINUED... Exchange Act of 1934 Exemption of Certain Transactions from Section 16(c) § 240.16c-4 Derivative securities...

  18. Characterization of a C 4 maize pyruvate orthophosphate dikinase ...

    African Journals Online (AJOL)

    Pyruvate orthophosphate dikinase (PPDK) is a key enzyme in plants that utilize the C4 photosynthetic pathway to fix CO2. The enzymatic reaction catalyzed by PPDK is critically controlled by light and is one of the rate-limiting steps of the C4 pathway. The intact maize (Zea mays) C4-PPDK gene, containing its own promoter, ...

  19. 19 CFR 142.49 - Deletion of C-4 Code.

    Science.gov (United States)

    2010-04-01

    .... Entry filers may delete C-4 Codes from Line Release by notifying the port director in writing on a Deletion Data Loading Sheet. Such notification shall state the C-4 Code which is to be deleted, the port... TREASURY (CONTINUED) ENTRY PROCESS Line Release § 142.49 Deletion of C-4 Code. (a) By Customs. A port...

  20. Structural and metabolic transitions of C4 leaf development and differentiation defined by microscopy and quantitative proteomics in maize.

    Science.gov (United States)

    Majeran, Wojciech; Friso, Giulia; Ponnala, Lalit; Connolly, Brian; Huang, Mingshu; Reidel, Edwin; Zhang, Cankui; Asakura, Yukari; Bhuiyan, Nazmul H; Sun, Qi; Turgeon, Robert; van Wijk, Klaas J

    2010-11-01

    C(4) grasses, such as maize (Zea mays), have high photosynthetic efficiency through combined biochemical and structural adaptations. C(4) photosynthesis is established along the developmental axis of the leaf blade, leading from an undifferentiated leaf base just above the ligule into highly specialized mesophyll cells (MCs) and bundle sheath cells (BSCs) at the tip. To resolve the kinetics of maize leaf development and C(4) differentiation and to obtain a systems-level understanding of maize leaf formation, the accumulation profiles of proteomes of the leaf and the isolated BSCs with their vascular bundle along the developmental gradient were determined using large-scale mass spectrometry. This was complemented by extensive qualitative and quantitative microscopy analysis of structural features (e.g., Kranz anatomy, plasmodesmata, cell wall, and organelles). More than 4300 proteins were identified and functionally annotated. Developmental protein accumulation profiles and hierarchical cluster analysis then determined the kinetics of organelle biogenesis, formation of cellular structures, metabolism, and coexpression patterns. Two main expression clusters were observed, each divided in subclusters, suggesting that a limited number of developmental regulatory networks organize concerted protein accumulation along the leaf gradient. The coexpression with BSC and MC markers provided strong candidates for further analysis of C(4) specialization, in particular transporters and biogenesis factors. Based on the integrated information, we describe five developmental transitions that provide a conceptual and practical template for further analysis. An online protein expression viewer is provided through the Plant Proteome Database.

  1. Yersinia enterocolitica serum resistance proteins YadA and ail bind the complement regulator C4b-binding protein.

    Directory of Open Access Journals (Sweden)

    Vesa Kirjavainen

    Full Text Available Many pathogens are equipped with factors providing resistance against the bactericidal action of complement. Yersinia enterocolitica, a Gram-negative enteric pathogen with invasive properties, efficiently resists the deleterious action of human complement. The major Y. enterocolitica serum resistance determinants include outer membrane proteins YadA and Ail. Lipopolysaccharide (LPS O-antigen (O-ag and outer core (OC do not contribute directly to complement resistance. The aim of this study was to analyze a possible mechanism whereby Y. enterocolitica could inhibit the antibody-mediated classical pathway of complement activation. We show that Y. enterocolitica serotypes O:3, O:8, and O:9 bind C4b-binding protein (C4bp, an inhibitor of both the classical and lectin pathways of complement. To identify the C4bp receptors on Y. enterocolitica serotype O:3 surface, a set of mutants expressing YadA, Ail, O-ag, and OC in different combinations was tested for the ability to bind C4bp. The studies showed that both YadA and Ail acted as C4bp receptors. Ail-mediated C4bp binding, however, was blocked by the O-ag and OC, and could be observed only with mutants lacking these LPS structures. C4bp bound to Y. enterocolitica was functionally active and participated in the factor I-mediated degradation of C4b. These findings show that Y. enterocolitica uses two proteins, YadA and Ail, to bind C4bp. Binding of C4bp could help Y. enterocolitica to evade complement-mediated clearance in the human host.

  2. Tomato golden mosaic virus open reading frame AL4 is genetically distinct from its C4 analogue in monopartite geminiviruses.

    Science.gov (United States)

    Pooma, W; Petty, I T

    1996-08-01

    Tomato golden mosaic virus (TGMV) is a bipartite geminivirus with six well-characterized genes. An additional open reading frame (ORF), AL4, lies within the essential AL1 gene. Recent studies of monopartite, dicot-infecting geminiviruses have revealed that mutations in their analogous C4 ORFs have host-specific effects on infectivity, symptomatology, virus movement and/or viral DNA accumulation. We have investigated whether TGMV has a similar host-specific requirement for AL4. The phenotypes of three TGMV al4 mutants were determined in a range of hosts, which included species that revealed c4 mutant phenotypes for monopartite geminiviruses. Each TGMV al4 mutant was indistinguishable from wild-type TGMV in all hosts tested. Additional analyses of double mutants revealed no evidence for functional redundancy between AL4 and the AL3, or AR1 genes. In contrast to the putative C4 proteins of monpartite geminiviruses, TGMV AL4, if it is expressed, is either non-functional, or functionally redundant with an essential TGMV gene product.

  3. C4.5 programs for machine learning

    CERN Document Server

    Quinlan, J Ross

    1992-01-01

    Classifier systems play a major role in machine learning and knowledge-based systems, and Ross Quinlan's work on ID3 and C4.5 is widely acknowledged to have made some of the most significant contributions to their development. This book is a complete guide to the C4.5 system as implemented in C for the UNIX environment. It contains a comprehensive guide to the system's use , the source code (about 8,800 lines), and implementation notes. The source code and sample datasets are also available for download (see below). C4.5 starts with large sets of cases belonging to known classes. The cases,

  4. Isomerisation of c4-c6 aldoses with zeolites

    DEFF Research Database (Denmark)

    2014-01-01

    The present invention relates to isomerization of C4-C6 aldoses to their corresponding C4-C6 ketoses. In particular, the invention concerns isomerization of C4-C6 aldoses over solid zeolite catalysts free of any metals other than aluminum, in the presence of suitable solvent(s) at suitable elevated...... temperatures. C6 and C5 aldose sugars such as glucose and xylose, which are available in large amounts from biomass precursors, are isomerized to fructose and xylulose respectively, in a one or two-step process over inexpensive commercially available zeolite catalysts, containing aluminum as the only metal...

  5. Joint C4ISR Architecture Planning/Analysis System (JCAPS)

    National Research Council Canada - National Science Library

    Wostbrock, Bill

    2002-01-01

    The contractor satisfactorily completed all tasks under both efforts, providing the technology and technical expertise in the development of the Joint C4ISR Architecture Planning/Analysis System (JCAPS) Database Tool...

  6. C4 photosynthetic machinery: insights from maize chloroplast proteomics

    Directory of Open Access Journals (Sweden)

    Qi eZhao

    2013-04-01

    Full Text Available C4 plants exhibit much higher CO2 assimilation rates than C3 plants. The specialized differentiation of mesophyll cell (M and bundle sheath cell (BS type chloroplasts is unique to C4 plants and improves photosynthesis efficiency. Maize (Zea mays is an important crop and model with C4 photosynthetic machinery. Current high-throughput quantitative proteomics approaches (e.g., 2DE, iTRAQ, and shotgun proteomics have been employed to investigate maize chloroplast structure and function. These proteomic studies have provided valuable information on C4 chloroplast protein components, photosynthesis, and other metabolic mechanisms underlying chloroplast biogenesis, stromal and membrane differentiation, as well as response to salinity, high/low temperature, and light stress. This review presents an overview of proteomics advances in maize chloroplast biology.

  7. Aerial energetic residue data from JBER C4 testing

    Data.gov (United States)

    U.S. Environmental Protection Agency — Aerially-collected energetic residues from surface detonation of C4. This dataset is associated with the following publication: Walsh, M., B. Gullett, M. Walsh, M....

  8. New C4D Sensor with a Simulated Inductor

    Directory of Open Access Journals (Sweden)

    Yingchao Lyu

    2016-01-01

    Full Text Available A new capacitively coupled contactless conductivity detection (C4D sensor with an improved simulated inductor is developed in this work. The improved simulated inductor is designed on the basis of the Riordan-type floating simulated inductor. With the improved simulated inductor, the negative influence of the coupling capacitances is overcome and the conductivity measurement is implemented by the series resonance principle. The conductivity measurement experiments are carried out in three pipes with different inner diameters of 3.0 mm, 4.6 mm and 6.4 mm, respectively. The experimental results show that the designs of the new C4D sensor and the improved simulated inductor are successful. The maximum relative error of the conductivity measurement is less than 5%. Compared with the C4D sensors using practical inductors, the measurement accuracy of the new C4D sensor is comparable. The research results also indicate that the adjustability of a simulated inductor can reduce the requirement for the AC source and guarantee the interchangeableness. Meanwhile, it is recommended that making the potential of one terminal of a simulated inductor stable is beneficial to the running stability. Furthermore, this work indirectly verifies the possibility and feasibility of the miniaturization of the C4D sensor by using the simulated inductor technique and lays a good foundation for future research work.

  9. 118-C-4 Horizontal Rod Cave Characterization Report

    International Nuclear Information System (INIS)

    Encke, B.D.; Thoren, R.A.

    1998-03-01

    This report addresses the characterization data collected from 118-C- 4 Horizontal Rod Cave in December 1996 and August 1997. The characterization activities evaluated the radiological status and identified hazardous materials locations. The scope of this report is limited to the 118-C-4 Facility Structure. Information in this report can be used to identify the waste streams, provide specific chemical and radiological data to aid in planning decontamination and decommissioning (D ampersand D) activities, and allow proper disposal of the demolition debris, as required by the Comprehensive Environmental Response, Compensation, and Liability Act of 1980

  10. Evolution of CAM and C4 carbon-concentrating mechanisms

    Science.gov (United States)

    Keeley, Jon E.; Rundel, Philip W.

    2003-01-01

    Mechanisms for concentrating carbon around the Rubisco enzyme, which drives the carbon-reducing steps in photosynthesis, are widespread in plants; in vascular plants they are known as crassulacean acid metabolism (CAM) and C4 photosynthesis. CAM is common in desert succulents, tropical epiphytes, and aquatic plants and is characterized by nighttime fixation of CO2. The proximal selective factor driving the evolution of this CO2-concentrating pathway is low daytime CO2, which results from the unusual reverse stomatal behavior of terrestrial CAM species or from patterns of ambient CO2 availability for aquatic CAM species. In terrestrials the ultimate selective factor is water stress that has selected for increased water use efficiency. In aquatics the ultimate selective factor is diel fluctuations in CO2 availability for palustrine species and extreme oligotrophic conditions for lacustrine species. C4 photosynthesis is based on similar biochemistry but carboxylation steps are spatially separated in the leaf rather than temporally as in CAM. This biochemical pathway is most commonly associated with a specialized leaf anatomy known as Kranz anatomy; however, there are exceptions. The ultimate selective factor driving the evolution of this pathway is excessively high photorespiration that inhibits normal C3 photosynthesis under high light and high temperature in both terrestrial and aquatic habitats. CAM is an ancient pathway that likely has been present since the Paleozoic era in aquatic species from shallow-water palustrine habitats. While atmospheric CO2 levels have undoubtedly affected the evolution of terrestrial plant carbon-concentrating mechanisms, there is reason to believe that past atmospheric changes have not played as important a selective role in the aquatic milieu since palustrine habitats today are not generally carbon sinks, and the selective factors driving aquatic CAM are autogenic. Terrestrial CAM, in contrast, is of increasing selective value under

  11. Applicability of Virtual Environments as C4ISR Displays

    Science.gov (United States)

    2006-06-01

    simulator sickness questionnaire (ssq): A method for quantifying simulator sickness. International Journal of Aviation Psychology, 3(3):203ff. Ergonomie ...Displays Thomas Alexander FGAN - Research Institute for Communication, Information Processing, and Ergonomics Wachtberg, Germany Ergonomie und...Führungssysteme FORSCHUNGSINSTITUT FÜR KOMMUNIKATION, INFORMATIONSVERARBEITUNG UND ERGONOMIE 1 FGAN Applicability of Virtual Environments as C4ISR Displays

  12. Microscale modeling of gas exchange during C4 photosythesis

    NARCIS (Netherlands)

    Retta, Moges

    2017-01-01

    Improving the efficiency of photosynthesis could contribute to better food security under an unprecedented rise in global population and climate-change. The photosynthesis pathway in C4 plants, such as maize (Zea mays L.), Miscanthus (Miscanthus x giganteus), and

  13. 26 CFR 1.1092(c)-4 - Definitions.

    Science.gov (United States)

    2010-04-01

    ...) INCOME TAXES Wash Sales of Stock Or Securities § 1.1092(c)-4 Definitions. The following definitions apply... by the Philadelphia Stock Exchange, Inc., Relating to the Listing of Flexible Exchange Traded Equity... of the underlying security. (e) Adjusted applicable stock price means the applicable stock price, as...

  14. The ionisation balance of C0 to C+4

    International Nuclear Information System (INIS)

    Nussbaumer, H.; Storey, P.J.

    1975-01-01

    The ionisation balance for the ions C 0 -C +4 has been calculated for 10 8 -3 ] 12 and 2 x 10 4 K 5 K. The presence of metastable terms is included in the calculation of the collisional dielectronic recombination and ionisation coefficients. The influence of the observed solar radiation field on the ionisation balance is investigated. Changes in that field do strongly influence the results. (orig.) [de

  15. Access control within military C4ISR systems

    Science.gov (United States)

    Maschino, Mike

    2003-07-01

    Command, Control, Communications, Computers, Intelligence, Surveillance and Reconnaissance (C4ISR) tactical battlefield systems must provide the right information and resources to the right individuals at the right time. At the same time, the C4ISR system must enforce access controls to prevent the wrong individuals from obtaining sensitive information, or consuming scarce resources. Because lives, missions and property depend upon them, these access control mechanisms must be effective, reliable, efficient and flexible. The mechanisms employed must suit the nature of the items that are to be protected, as well as the varieties of access policies that must be enforced, and the types of access that will be made to these items. Some access control technologies are inherently centralized, while others are suitable for distributed implementation. The C4ISR architect must select from among the available technologies a combination of mechanisms that eases the burden of policy administration, but is inherently survivable, accurate, resource efficient, and which provides low latency. This paper explores various alternative access enforcement mechanisms, and assesses their effectiveness in managing policy-driven access control within the battlespace.

  16. The Citrus transcription factor, CitERF13, regulates citric acid accumulation via a protein-protein interaction with the vacuolar proton pump, CitVHA-c4.

    Science.gov (United States)

    Li, Shao-jia; Yin, Xue-ren; Xie, Xiu-lan; Allan, Andrew C; Ge, Hang; Shen, Shu-ling; Chen, Kun-song

    2016-02-03

    Organic acids are essential to fruit flavor. The vacuolar H(+) transporting adenosine triphosphatase (V-ATPase) plays an important role in organic acid transport and accumulation. However, less is known of V-ATPase interacting proteins and their relationship with organic acid accumulation. The relationship between V-ATPase and citric acid was investigated, using the citrus tangerine varieties 'Ordinary Ponkan (OPK)' and an early maturing mutant 'Zaoshu Ponkan (ZPK)'. Five V-ATPase genes (CitVHA) were predicted as important to citric acid accumulation. Among the genes, CitVHA-c4 was observed, using a yeast two-hybrid screen, to interact at the protein level with an ethylene response factor, CitERF13. This was verified using bimolecular fluorescence complementation assays. A similar interaction was also observed between Arabidopsis AtERF017 (a CitERF13 homolog) and AtVHA-c4 (a CitVHA-c4 homolog). A synergistic effect on citric acid levels was observed between V-ATPase proteins and interacting ERFs when analyzed using transient over-expression in tobacco and Arabidopsis mutants. Furthermore, the transcript abundance of CitERF13 was concomitant with CitVHA-c4. CitERF13 or AtERF017 over-expression leads to significant citric acid accumulation. This accumulation was abolished in an AtVHA-c4 mutant background. ERF-VHA interactions appear to be involved in citric acid accumulation, which was observed in both citrus and Arabidopsis.

  17. Molecular cloning, genomic organization, developmental regulation, and a knock-out mutant of a novel leu-rich repeats-containing G protein-coupled receptor (DLGR-2) from Drosophila melanogaster

    DEFF Research Database (Denmark)

    Eriksen, Kathrine Krageskov; Hauser, Frank; Schiøtt, Morten

    2000-01-01

    After screening the Berkeley Drosophila Genome Project database with sequences from a recently characterized Leu-rich repeats-containing G protein-coupled receptor (LGR) fromDrosophila (DLGR-1), we identified a second gene for a different LGR (DLGR-2) and cloned its cDNA. DLGR-2 is 1360 amino aci...... knock-out mutants, where the DLGR-2 gene is interrupted by a P element insertion, die around the time of hatching. This finding, together with the expression data, strongly suggests that DLGR-2 is exclusively involved in development....

  18. The potential of C4 grasses for cellulosic biofuel production

    Directory of Open Access Journals (Sweden)

    Tim eWeijde

    2013-05-01

    Full Text Available With the advent of biorefinery technologies enabling plant biomass to be processed into biofuel, many researchers set out to study and improve candidate biomass crops. Many of these candidates are C4 grasses, characterized by a high productivity and resource use efficiency. In this review the potential of five C4 grasses as lignocellulose feedstock for biofuel production is discussed. These include three important field crops - maize, sugarcane and sorghum - and two undomesticated perennial energy grasses - miscanthus and switchgrass. Although all these grasses are high yielding, they produce different products. While miscanthus and switchgrass are exploited exclusively for lignocellulosic biomass, maize, sorghum and sugarcane are dual-purpose crops. It is unlikely that all the prerequisites for the sustainable and economic production of biomass for a global cellulosic biofuel industry will be fulfilled by a single crop. High and stable yields of lignocellulose are required in diverse environments worldwide, to sustain a year-round production of biofuel. A high resource use efficiency is indispensable to allow cultivation with minimal inputs of nutrients and water and the exploitation of marginal soils for biomass production. Finally, the lignocellulose composition of the feedstock should be optimized to allow its efficient conversion into biofuel and other by-products. Breeding for these objectives should encompass diverse crops, to meet the demands of local biorefineries and provide adaptability to different environments. Collectively, these C4 grasses are likely to play a central role in the supply of lignocellulose for the cellulosic ethanol industry. Moreover, as these species are evolutionary closely related, advances in each of these crops will expedite improvements in the other crops. This review aims to provide an overview of their potential, prospects and research needs as lignocellulose feedstocks for the commercial production of

  19. de la fotosíntesis C4

    Directory of Open Access Journals (Sweden)

    J. C. Raya-Pérez

    2008-01-01

    Full Text Available La fotosíntesis C4 surgió hace unos 7-5 millones de años y tiene un origen polifilético. La disminución en la concentración atmosférica de CO2 a menos de 500 partes por millón (ppm propició la aparición de un mecanismo para concentrar este gas en la zona donde actúa la Rubisco (ribulosa bifosfato carboxilasa/oxigenasa, evitando así su actividad de oxigenasa. El análisis de los genes que codifican para las enzimas usadas en la vía C4, así como la caracterización bioquímica de algunas de estas enzimas, permiten entrever algunos de los cambios que han sufrido a fin de adaptarse a una nueva función, la de concentrar el CO2 a fin de que sea utilizado por la Rubisco.

  20. Pharmacological modulation of human platelet leukotriene C4-synthase.

    Science.gov (United States)

    Sala, A; Folco, G; Henson, P M; Murphy, R C

    1997-03-21

    The aim of this study was to test if human platelet leukotriene C4-synthase (LTC4-S) is pharmacologically different from cloned and expressed LTC4-S and, in light of the significant homologies between 5-lipoxygenase activating protein (FLAP) and LTC4-S, if different potencies of leukotriene synthesis inhibitors acting through binding with FLAP (FLAP inhibitors) reflect in different potencies as LTC4-S inhibitors. Leukotriene C4 (LTC4) synthesis by washed human platelets supplemented with synthetic leukotriene A4 (LTA4) was studied in the absence and presence of two different, structurally unrelated FLAP inhibitors (MK-886 and BAY-X1005) as well as a direct 5-lipoxygenase inhibitor (zileuton). LTC4 production was analyzed by RP-HPLC coupled to diode array detection. We report that human platelet LTC4-S was inhibited by MK-886 and BAY-X1005 (IC50 of 4.7 microM and 91.2 microM, respectively), but not by zileuton (inactive up to 300 microM); all 3 compounds were able to inhibit 5-lipoxygenase metabolite biosynthesis in intact human polymorphonuclear leukocytes (IC50 of 0.044 microM, 0.85 microM, and 1.5 microM, respectively). Platelet LTC4-S does not appear pharmacologically different from expression cloned LTC4-S. LTC4-S inhibition by FLAP inhibitors is in agreement with the significant homology reported for expression-cloned LTC4-S with FLAP, Furthermore, functional homology of the binding sites for inhibitors on LTC4-S and FLAP is suggested by the conservation of the relative potencies of MK-886 and BAY-X1005 vs FLAP-dependent 5-lipoxygenase activity and LTC4-S inhibition: MK-886 was 19.3-fold more potent than BAY-X1005 as FLAP inhibitor and 19.6-fold more potent than BAY-X1005 as LTC4-S inhibitor.

  1. A specific assay for quantification of human C4c by use of an anti-C4c monoclonal antibody

    DEFF Research Database (Denmark)

    Pilely, Katrine; Skjoedt, Mikkel-Ole; Nielsen, Christian

    2014-01-01

    a mouse monoclonal antibody (mAb) that is able to detect fluid phase C4c without interference from other products generated from the complement component C4. The C4c specific mAb was tested in different enzyme-linked immunosorbent assay (ELISA) combinations with various types of in vitro activated sera...

  2. Characterization of a Weak Allele of Zebrafish cloche Mutant

    Science.gov (United States)

    Ma, Ning; Huang, Zhibin; Chen, Xiaohui; He, Fei; Wang, Kun; Liu, Wei; Zhao, Linfeng; Xu, Xiangmin; Liao, Wangjun; Ruan, Hua; Luo, Shenqiu; Zhang, Wenqing

    2011-01-01

    Hematopoiesis is a complicated and dynamic process about which the molecular mechanisms remain poorly understood. Danio rerio (zebrafish) is an excellent vertebrate system for studying hematopoiesis and developmental mechanisms. In the previous study, we isolated and identified a cloche 172 (clo 172) mutant, a novel allele compared to the original cloche (clo) mutant, through using complementation test and initial mapping. Here, according to whole mount in-situ hybridization, we report that the endothelial cells in clo 172 mutant embryos, although initially developed, failed to form the functional vascular system eventually. In addition, further characterization indicates that the clo 172 mutant exhibited weaker defects instead of completely lost in primitive erythroid cells and definitive hematopoietic cells compared with the clo s5 mutant. In contrast, primitive myeloid cells were totally lost in clo 172 mutant. Furthermore, these reappeared definitive myeloid cells were demonstrated to initiate from the remaining hematopoietic stem cells (HSCs) in clo 172 mutant, confirmed by the dramatic decrease of lyc in clo 172 runx1w84x double mutant. Collectively, the clo 172 mutant is a weak allele compared to the clo s5 mutant, therefore providing a model for studying the early development of hematopoietic and vascular system, as well as an opportunity to further understand the function of the cloche gene. PMID:22132109

  3. Promising rice mutants

    International Nuclear Information System (INIS)

    Hakim, L.; Azam, M.A.; Miah, A.J.; Mansur, M.A.; Akanda, H.R.

    1988-01-01

    Two induced mutants namely, Mut NS 1 (tall) and Mut NS 5 (semi-dwarf) derived from rice variety Nizersail were evaluated for various agronomic characters at four locations in Bangladesh. Both the mutants matured about three weeks earlier and yielded significantly higher than the parent variety Nizersail. (author). 3 tabs., 9 refs

  4. Mutant heterosis in rice

    International Nuclear Information System (INIS)

    1987-01-01

    In the variety TKM6 a high yielding semidwarf mutant has been induced. This TKM6 mutant was used in test crosses with a number of other varieties and mutants to examine the extent of heterosis of dwarfs in rice and to select superior crosses. An excerpt of the published data is given. It appears from the backcross of the mutant with its original variety, that an increase in number of productive tillers occurs in the hybrid, leading to a striking grain yield increase, while the semi-dwarf culm length (the main mutant character) reverts to the normal phenotype. In the cross with IR8 on the other hand, there is only a minimal increase in tiller number but a substantial increase in TGW leading to more than 30% yield increase over the better parent

  5. A sorghum (Sorghum bicolor mutant with altered carbon isotope ratio.

    Directory of Open Access Journals (Sweden)

    Govinda Rizal

    Full Text Available Recent efforts to engineer C4 photosynthetic traits into C3 plants such as rice demand an understanding of the genetic elements that enable C4 plants to outperform C3 plants. As a part of the C4 Rice Consortium's efforts to identify genes needed to support C4 photosynthesis, EMS mutagenized sorghum populations were generated and screened to identify genes that cause a loss of C4 function. Stable carbon isotope ratio (δ13C of leaf dry matter has been used to distinguishspecies with C3 and C4 photosynthetic pathways. Here, we report the identification of a sorghum (Sorghum bicolor mutant with a low δ13C characteristic. A mutant (named Mut33 with a pale phenotype and stunted growth was identified from an EMS treated sorghum M2 population. The stable carbon isotope analysis of the mutants showed a decrease of 13C uptake capacity. The noise of random mutation was reduced by crossing the mutant and its wildtype (WT. The back-cross (BC1F1 progenies were like the WT parent in terms of 13C values and plant phenotypes. All the BC1F2 plants with low δ13C died before they produced their 6th leaf. Gas exchange measurements of the low δ13C sorghum mutants showed a higher CO2 compensation point (25.24 μmol CO2.mol-1air and the maximum rate of photosynthesis was less than 5μmol.m-2.s-1. To identify the genetic determinant of this trait, four DNA pools were isolated; two each from normal and low δ13C BC1F2 mutant plants. These were sequenced using an Illumina platform. Comparison of allele frequency of the single nucleotide polymorphisms (SNPs between the pools with contrasting phenotype showed that a locus in Chromosome 10 between 57,941,104 and 59,985,708 bps had an allele frequency of 1. There were 211 mutations and 37 genes in the locus, out of which mutations in 9 genes showed non-synonymous changes. This finding is expected to contribute to future research on the identification of the causal factor differentiating C4 from C3 species that can be used

  6. Developmental Immunotoxicity

    Science.gov (United States)

    Animal models suggest that the immature immune system is more susceptible to xenobiotics than the fully mature system, and sequelae of developmental immunotoxicant exposure may be persistent well into adulthood. Immune maturation may be delayed by xenobiotic exposure and recover...

  7. De novo Transcriptome Assembly and Comparison of C3, C3-C4, and C4 Species of Tribe Salsoleae (Chenopodiaceae

    Directory of Open Access Journals (Sweden)

    Maximilian Lauterbach

    2017-11-01

    Full Text Available C4 photosynthesis is a carbon-concentrating mechanism that evolved independently more than 60 times in a wide range of angiosperm lineages. Among other alterations, the evolution of C4 from ancestral C3 photosynthesis requires changes in the expression of a vast number of genes. Differential gene expression analyses between closely related C3 and C4 species have significantly increased our understanding of C4 functioning and evolution. In Chenopodiaceae, a family that is rich in C4 origins and photosynthetic types, the anatomy, physiology and phylogeny of C4, C2, and C3 species of Salsoleae has been studied in great detail, which facilitated the choice of six samples of five representative species with different photosynthetic types for transcriptome comparisons. mRNA from assimilating organs of each species was sequenced in triplicates, and sequence reads were de novo assembled. These novel genetic resources were then analyzed to provide a better understanding of differential gene expression between C3, C2 and C4 species. All three analyzed C4 species belong to the NADP-ME type as most genes encoding core enzymes of this C4 cycle are highly expressed. The abundance of photorespiratory transcripts is decreased compared to the C3 and C2 species. Like in other C4 lineages of Caryophyllales, our results suggest that PEPC1 is the C4-specific isoform in Salsoleae. Two recently identified transporters from the PHT4 protein family may not only be related to the C4 syndrome, but also active in C2 photosynthesis in Salsoleae. In the two populations of the C2 species S. divaricata transcript abundance of several C4 genes are slightly increased, however, a C4 cycle is not detectable in the carbon isotope values. Most of the core enzymes of photorespiration are highly increased in the C2 species compared to both C3 and C4 species, confirming a successful establishment of the C2 photosynthetic pathway. Furthermore, a function of PEP-CK in C2 photosynthesis

  8. Effects of low atmospheric CO2 and elevated temperature during growth on the gas exchange responses of C3, C3-C4 intermediate, and C4 species from three evolutionary lineages of C4 photosynthesis.

    Science.gov (United States)

    Vogan, Patrick J; Sage, Rowan F

    2012-06-01

    This study evaluates acclimation of photosynthesis and stomatal conductance in three evolutionary lineages of C(3), C(3)-C(4) intermediate, and C(4) species grown in the low CO(2) and hot conditions proposed to favo r the evolution of C(4) photosynthesis. Closely related C(3), C(3)-C(4), and C(4) species in the genera Flaveria, Heliotropium, and Alternanthera were grown near 380 and 180 μmol CO(2) mol(-1) air and day/night temperatures of 37/29°C. Growth CO(2) had no effect on photosynthetic capacity or nitrogen allocation to Rubisco and electron transport in any of the species. There was also no effect of growth CO(2) on photosynthetic and stomatal responses to intercellular CO(2) concentration. These results demonstrate little ability to acclimate to low CO(2) growth conditions in closely related C(3) and C(3)-C(4) species, indicating that, during past episodes of low CO(2), individual C(3) plants had little ability to adjust their photosynthetic physiology to compensate for carbon starvation. This deficiency could have favored selection for more efficient modes of carbon assimilation, such as C(3)-C(4) intermediacy. The C(3)-C(4) species had approximately 50% greater rates of net CO(2) assimilation than the C(3) species when measured at the growth conditions of 180 μmol mol(-1) and 37°C, demonstrating the superiority of the C(3)-C(4) pathway in low atmospheric CO(2) and hot climates of recent geological time.

  9. Potential Hazards Relating to Pyrolysis of c-C4F8O, n-C4F10 and c-C4F8 in selected gaseous diffusion plant operations

    International Nuclear Information System (INIS)

    Trowbridge, L.D.

    2000-01-01

    As part of a program intended to replace the present evaporative coolant at the gaseous diffusion plants (GDPs) with a non-ozone-depleting alternate, a series of investigations of the suitability of candidate substitutes is under way. This report summarizes studies directed at estimating the chemical and thermal stability of three candidate coolants, c-C 4 F 8 O, n-C 4 F 10 and c-C 4 4F 8 , in a few specific environments to be found in gaseous diffusion plant operations

  10. Developmental Scaffolding

    DEFF Research Database (Denmark)

    Giorgi, Franco; Bruni, Luis Emilio

    2015-01-01

    . Within the developmental hierarchy, each module yields an inter-level relationship that makes it possible for the scaffolding to mediate the production of selectable variations. Awide range of genetic, cellular and morphological mechanisms allows the scaffolding to integrate these modular variations...... to the complexity of sign recognition proper of a cellular community. In this semiotic perspective, the apparent goal directness of any developmental strategy should no longer be accounted for by a predetermined genetic program, but by the gradual definition of the relationships selected amongst the ones...

  11. Command, Control, Communication, Computers and Information Technology (C4&IT). Strategic Plan, FY2008 - 2012

    National Research Council Canada - National Science Library

    2008-01-01

    ...&IT)/CG-6, Chief Information Officer (CIO), for the Coast Guard publishes this C4&IT Strategic Plan. The purpose of this plan is to provide a unifying strategy to better integrate and synchronize Coast Guard C4...

  12. Revealing diversity in structural and biochemical forms of C4 photosynthesis and a C3-C4 intermediate in genus Portulaca L. (Portulacaceae).

    Science.gov (United States)

    Voznesenskaya, Elena V; Koteyeva, Nuria K; Edwards, Gerald E; Ocampo, Gilberto

    2010-08-01

    Portulacaceae is one of 19 families of terrestrial plants in which species having C(4) photosynthesis have been found. Representative species from major clades of the genus Portulaca were studied to characterize the forms of photosynthesis structurally and biochemically. The species P. amilis, P. grandiflora, P. molokiniensis, P. oleracea, P. pilosa, and P. umbraticola belong to the subgenus Portulaca and are C(4) plants based on leaf carbon isotope values, Kranz anatomy, and expression of key C(4) enzymes. Portulaca umbraticola, clade Umbraticola, is NADP-malic enzyme (NADP-ME)-type C(4) species, while P. oleracea and P. molokiniensis in clade Oleracea are NAD-ME-type C(4) species, all having different forms of Atriplicoid-type leaf anatomy. In clade Pilosa, P. amilis, P. grandiflora, and P. pilosa are NADP-ME-type C(4) species. They have Pilosoid-type anatomy in which Kranz tissues enclose peripheral vascular bundles with water storage in the centre of the leaf. Portulaca cf. bicolor, which belongs to subgenus Portulacella, is an NADP-ME C(4) species with Portulacelloid-type anatomy; it has well-developed Kranz chlorenchyma surrounding lateral veins distributed in one plane under the adaxial epidermis with water storage cells underneath. Portulaca cryptopetala (clade Oleracea), an endemic species from central South America, was identified as a C(3)-C(4) based on its intermediate CO(2) compensation point and selective localization of glycine decarboxylase of the photorespiratory pathway in mitochondria of bundle sheath cells. The C(4) Portulaca species which were examined also have cotyledons with Kranz-type anatomy, while the stems of all species have C(3)-type photosynthetic cells. The results indicate that multiple structural and biochemical forms of C(4) photosynthesis evolved in genus Portulaca.

  13. Revealing diversity in structural and biochemical forms of C4 photosynthesis and a C3–C4 intermediate in genus Portulaca L. (Portulacaceae)

    Science.gov (United States)

    Voznesenskaya, Elena V.; Koteyeva, Nuria K.; Edwards, Gerald E.; Ocampo, Gilberto

    2010-01-01

    Portulacaceae is one of 19 families of terrestrial plants in which species having C4 photosynthesis have been found. Representative species from major clades of the genus Portulaca were studied to characterize the forms of photosynthesis structurally and biochemically. The species P. amilis, P. grandiflora, P. molokiniensis, P. oleracea, P. pilosa, and P. umbraticola belong to the subgenus Portulaca and are C4 plants based on leaf carbon isotope values, Kranz anatomy, and expression of key C4 enzymes. Portulaca umbraticola, clade Umbraticola, is NADP-malic enzyme (NADP-ME)-type C4 species, while P. oleracea and P. molokiniensis in clade Oleracea are NAD-ME-type C4 species, all having different forms of Atriplicoid-type leaf anatomy. In clade Pilosa, P. amilis, P. grandiflora, and P. pilosa are NADP-ME-type C4 species. They have Pilosoid-type anatomy in which Kranz tissues enclose peripheral vascular bundles with water storage in the centre of the leaf. Portulaca cf. bicolor, which belongs to subgenus Portulacella, is an NADP-ME C4 species with Portulacelloid-type anatomy; it has well-developed Kranz chlorenchyma surrounding lateral veins distributed in one plane under the adaxial epidermis with water storage cells underneath. Portulaca cryptopetala (clade Oleracea), an endemic species from central South America, was identified as a C3–C4 based on its intermediate CO2 compensation point and selective localization of glycine decarboxylase of the photorespiratory pathway in mitochondria of bundle sheath cells. The C4 Portulaca species which were examined also have cotyledons with Kranz-type anatomy, while the stems of all species have C3-type photosynthetic cells. The results indicate that multiple structural and biochemical forms of C4 photosynthesis evolved in genus Portulaca. PMID:20591900

  14. Developmental delay

    Science.gov (United States)

    Nutrition support is essential for the care of the child with developmental delay. After a thorough evaluation, an individualized intervention plan that accounts for the child’s nutrition status, feeding ability, and medical condition may be determined. Nutrition assessments may be performed at leas...

  15. Developmental Work

    DEFF Research Database (Denmark)

    Møller, Niels; Hvid, Helge; Kristensen, Tage Søndergaard

    2003-01-01

    Human Deveoplment and Working Life - Work for Welfare explores whether the development of human resources at company level can improve individuals' quality of life, companies' possibilities of development, and welfare and democracy in society. Chapter two discuss the concept "developmental work...

  16. Productive mutants of niger

    International Nuclear Information System (INIS)

    Misra, R.C.

    2001-01-01

    Seeds of six niger (Guizotia abyssinica Cass.) varieties ('GA-10', 'ONS-8', 'IGP-72', 'N-71', 'NB-9' and 'UN-4') were treated with 0.5, 0.75 and 1% ethyl methanesulphonate. After four generations of selection, 29 mutant lines were developed and those were evaluated from 1990-92 during Kharif (July to October) and Rabi (December to March) seasons. Average plant characteristics and yield data of four high yielding mutants along with 'IGP-76' (National Check), GA-10 (Zonal Check) and 'Semiliguda Local' (Local Check) are presented

  17. Africa's wild C4 plant foods and possible early hominid diets.

    Science.gov (United States)

    Peters, Charles R; Vogel, John C

    2005-03-01

    A small minority of Africa's wild plant foods are C4. These are primarily the seeds of some of the C4 grasses, the rootstocks and stem/leaf bases of some of the C4 sedges (especially papyrus), and the leaves of some of the C4 herbaceous dicots (forbs). These wild food plants are commonly found in disturbed ground and wetlands (particularly the grasses and sedges). Multiple lines of evidence indicate that C4 grasses were present in Africa by at least the late Miocene. It is a reasonable hypothesis that the prehistory of the C4 sedges parallels that of the C4 grasses, but the C4 forbs may not have become common until the late Pleistocene. CAM plants may have a more ancient history, but offer few opportunities for an additional C4-like dietary signal. The environmental reconstructions available for the early South African hominid sites do not indicate the presence of large wetlands, and therefore probably the absence of a strong potential for a C4 plant food diet. However, carbon isotope analyses of tooth enamel from three species of early South African hominids have shown that there was a significant but not dominant contribution of C4 biomass in their diets. Since it appears unlikely that this C4 component could have come predominantly from C4 plant foods, a broad range of potential animal contributors is briefly considered, namely invertebrates, reptiles, birds, and small mammals. It is concluded that the similar average C4 dietary intake seen in the three South African hominid species could have been acquired by differing contributions from the various sources, without the need to assume scavenging or hunting of medium to large grazing ungulates. Effectively similar dominantly dryland paleo-environments may also be part of the explanation. Theoretically, elsewhere in southern and eastern Africa, large wetlands would have offered early hominids greater opportunities for a C4 plant diet.

  18. Unique photosynthetic phenotypes in Portulaca (Portulacaceae): C3-C4 intermediates and NAD-ME C4 species with Pilosoid-type Kranz anatomy.

    Science.gov (United States)

    Voznesenskaya, Elena V; Koteyeva, Nuria K; Edwards, Gerald E; Ocampo, Gilberto

    2017-01-01

    Portulacaceae is a family that has considerable diversity in photosynthetic phenotypes. It is one of 19 families of terrestrial plants where species having C 4 photosynthesis have been found. Most species in Portulaca are in the alternate-leaved (AL) lineage, which includes one clade (Cryptopetala) with taxa lacking C 4 photosynthesis and three clades having C 4 species (Oleracea, Umbraticola and Pilosa). All three species in the Cryptopetala clade lack Kranz anatomy, the leaves have C 3 -like carbon isotope composition and they have low levels of C 4 cycle enzymes. Anatomical, biochemical and physiological analyses show they are all C 3 -C 4 intermediates. They have intermediate CO 2 compensation points, enrichment of organelles in the centripetal position in bundle sheath (BS) cells, with selective localization of glycine decarboxylase in BS mitochondria. In the three C 4 clades there are differences in Kranz anatomy types and form of malic enzyme (ME) reported to function in C 4 (NAD-ME versus NADP-ME): Oleracea (Atriplicoid, NAD-ME), Umbraticola (Atriplicoid, NADP-ME) and Pilosa (Pilosoid, NADP-ME). Structural and biochemical analyses were performed on Pilosa clade representatives having Pilosoid-type leaf anatomy with Kranz tissue enclosing individual peripheral vascular bundles and water storage in the center of the leaf. In this clade, all species except P. elatior are NADP-ME-type C 4 species with grana-deficient BS chloroplasts and grana-enriched M chloroplasts. Surprisingly, P. elatior has BS chloroplasts enriched in grana and NAD-ME-type photosynthesis. The results suggest photosynthetic phenotypes were probably derived from an ancestor with NADP-ME-type C 4 , with two independent switches to NAD-ME type. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  19. Genetics and physiology of cell wall polysaccharides in the model C4 grass, Setaria viridis spp.

    Science.gov (United States)

    Ermawar, Riksfardini A; Collins, Helen M; Byrt, Caitlin S; Henderson, Marilyn; O'Donovan, Lisa A; Shirley, Neil J; Schwerdt, Julian G; Lahnstein, Jelle; Fincher, Geoffrey B; Burton, Rachel A

    2015-10-02

    Setaria viridis has emerged as a model species for the larger C4 grasses. Here the cellulose synthase (CesA) superfamily has been defined, with an emphasis on the amounts and distribution of (1,3;1,4)-β-glucan, a cell wall polysaccharide that is characteristic of the grasses and is of considerable value for human health. Orthologous relationship of the CesA and Poales-specific cellulose synthase-like (Csl) genes among Setaria italica (Si), Sorghum bicolor (Sb), Oryza sativa (Os), Brachypodium distachyon (Bradi) and Hordeum vulgare (Hv) were compared using bioinformatics analysis. Transcription profiling of Csl gene families, which are involved in (1,3;1,4)-β-glucan synthesis, was performed using real-time quantitative PCR (Q-PCR). The amount of (1,3;1,4)-β-glucan was measured using a modified Megazyme assay. The fine structures of the (1,3;1,4)-β-glucan, as denoted by the ratio of cellotriosyl to cellotetraosyl residues (DP3:DP4 ratio) was assessed by chromatography (HPLC and HPAEC-PAD). The distribution and deposition of the MLG was examined using the specific antibody BG-1 and captured using fluorescence and transmission electron microscopy (TEM). The cellulose synthase gene superfamily contains 13 CesA and 35 Csl genes in Setaria. Transcript profiling of CslF, CslH and CslJ gene families across a vegetative tissue series indicated that SvCslF6 transcripts were the most abundant relative to all other Csl transcripts. The amounts of (1,3;1,4)-β-glucan in Setaria vegetative tissues ranged from 0.2% to 2.9% w/w with much smaller amounts in developing grain (0.003% to 0.013% w/w). In general, the amount of (1,3;1,4)-β-glucan was greater in younger than in older tissues. The DP3:DP4 ratios varied between tissue types and across developmental stages, and ranged from 2.4 to 3.0:1. The DP3:DP4 ratios in developing grain ranged from 2.5 to 2.8:1. Micrographs revealing the distribution of (1,3;1,4)-β-glucan in walls of different cell types and the data were

  20. Promotion of Cyclic Electron Transport Around Photosystem I with the Development of C4 Photosynthesis.

    Science.gov (United States)

    Munekage, Yuri Nakajima; Taniguchi, Yukimi Y

    2016-05-01

    C4 photosynthesis is present in approximately 7,500 species classified into 19 families, including monocots and eudicots. In the majority of documented cases, a two-celled CO2-concentrating system that uses a metabolic cycle of four-carbon compounds is employed. C4 photosynthesis repeatedly evolved from C3 photosynthesis, possibly driven by the survival advantages it bestows in the hot, often dry, and nutrient-poor soils of the tropics and subtropics. The development of the C4 metabolic cycle greatly increased the ATP demand in chloroplasts during the evolution of malic enzyme-type C4 photosynthesis, and the additional ATP required for C4 metabolism may be produced by the cyclic electron transport around PSI. Recent studies have revealed the nature of cyclic electron transport and the elevation of its components during C4 evolution. In this review, we discuss the energy requirements of C3 and C4 photosynthesis, the current model of cyclic electron transport around PSI and how cyclic electron transport is promoted during C4 evolution using studies on the genus Flaveria, which contains a number of closely related C3, C4 and C3-C4 intermediate species. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  1. The Drosophila melanogaster Eip74EF-PA transcription factor directly binds the sciarid BhC4-1 promoter.

    Science.gov (United States)

    Frank, Henrique Oliveira; Sanchez, Danilo Garcia; de Freitas Oliveira, Lucas; Kobarg, Jörg; Monesi, Nadia

    2017-11-01

    The DNA puff BhC4-1 gene of Bradysia hygida (Diptera, Sciaridae) is amplified and expressed in the salivary glands at the end of the last larval instar. Even though there are no BhC4-1 orthologs in Drosophila melanogaster, the mechanisms that regulate BhC4-1 gene expression in B. hygida are for the most part conserved in D. melanogaster. The BhC4-1 promoter contains a 129bp (-186/-58) cis-regulatory module (CRM) that drives developmentally regulated expression in transgenic salivary glands at the onset of metamorphosis. Both in the sciarid and in transgenic D. melanogaster, BhC4-1 gene expression is induced by the increase in ecdysone titers that triggers metamorphosis. Genetic interaction experiments revealed that in the absence of the Eip74EF-PA early gene isoform BhC4-1-lacZ levels of expression in the salivary gland are severely reduced. Here we show that the overexpression of the Eip74EF-PA transcription factor is sufficient to anticipate BhC4-1-lacZ expression in transgenic D. melanogaster. Through yeast one-hybrid assays we confirm that the Eip74EF-PA transcription factor directly binds to the 129 bp sciarid CRM. Together, these results contribute to the characterization of an insect CRM and indicate that the ecdysone gene regulatory network that promotes metamorphosis is conserved between D. melanogaster and the sciarid B. hygida. © 2017 Wiley Periodicals, Inc.

  2. Connexin mutants and cataracts

    Directory of Open Access Journals (Sweden)

    Eric C Beyer

    2013-04-01

    Full Text Available The lens is a multicellular, but avascular tissue that must stay transparent to allow normal transmission of light and focusing of it on the retina. Damage to lens cells and/or proteins can cause cataracts, opacities that disrupt these processes. The normal survival of the lens is facilitated by an extensive network of gap junctions formed predominantly of connexin46 and connexin50. Mutations of the genes that encode these connexins (GJA3 and GJA8 have been identified and linked to inheritance of cataracts in human families and mouse lines. In vitro expression studies of several of these mutants have shown that they exhibit abnormalities that may lead to disease. Many of the mutants reduce or modify intercellular communication due to channel alterations (including loss of function or altered gating or due to impaired cellular trafficking which reduces the number of gap junction channels within the plasma membrane. However, the abnormalities detected in studies of other mutants suggest that they cause cataracts through other mechanisms including gain of hemichannel function (leading to cell injury and death and formation of cytoplasmic accumulations (that may act as light scattering particles. These observations and the anticipated results of ongoing studies should elucidate the mechanisms of cataract development due to mutations of lens connexins and abnormalities of other lens proteins. They may also contribute to our understanding of the mechanisms of disease due to connexin mutations in other tissues.

  3. Pressure effect on structural, elastic, and thermodynamic properties of tetragonal B4C4

    Directory of Open Access Journals (Sweden)

    Baobing Zheng

    2015-03-01

    Full Text Available The compressibility, elastic anisotropy, and thermodynamic properties of the recently proposed tetragonal B4C4 (t-B4C4 are investigated under high temperature and high pressure by using of first-principles calculations method. The elastic constants, bulk modulus, shear modulus, Young’s modulus, Vickers hardness, Pugh’s modulus ratio, and Poisson’s ratio for t-B4C4 under various pressures are systematically explored, the obtained results indicate that t-B4C4 is a stiffer material. The elastic anisotropies of t-B4C4 are discussed in detail under pressure from 0 GPa to 100 GPa. The thermodynamic properties of t-B4C4, such as Debye temperature, heat capacity, and thermal expansion coefficient are investigated by the quasi-harmonic Debye model.

  4. Annexin C4 in A. fumigatus: a proteomics approach to understand the function.

    OpenAIRE

    Khalaj , Vahid; Azarian , Bahareh; Enayati , Somayeh; Vaziri , Behrouz

    2011-01-01

    International audience; Annexin C4 has been identified as a new member of fungal annexin family. In search of function, we have generated an annexin C4 disruptant strain of human pathogen, Aspergillus fumigatus. Detailed phenotypic analysis confirmed a non essential role of annexin C4 in the growth and sporulation of this pathogen. We applied a comparative proteomics strategy to understand the possible role of this protein in the fungus. The modification of respiratory chain proteins and stre...

  5. Recruitment of pre-existing networks during the evolution of C4 photosynthesis.

    Science.gov (United States)

    Reyna-Llorens, Ivan; Hibberd, Julian M

    2017-09-26

    During C 4 photosynthesis, CO 2 is concentrated around the enzyme RuBisCO. The net effect is to reduce photorespiration while increasing water and nitrogen use efficiencies. Species that use C 4 photosynthesis have evolved independently from their C 3 ancestors on more than 60 occasions. Along with mimicry and the camera-like eye, the C 4 pathway therefore represents a remarkable example of the repeated evolution of a highly complex trait. In this review, we provide evidence that the polyphyletic evolution of C 4 photosynthesis is built upon pre-existing metabolic and genetic networks. For example, cells around veins of C 3 species show similarities to those of the C 4 bundle sheath in terms of C 4 acid decarboxylase activity and also the photosynthetic electron transport chain. Enzymes of C 4 photosynthesis function together in gluconeogenesis during early seedling growth of C 3 Arabidopsis thaliana Furthermore, multiple C 4 genes appear to be under control of both light and chloroplast signals in the ancestral C 3 state. We, therefore, hypothesize that relatively minor rewiring of pre-existing genetic and metabolic networks has facilitated the recurrent evolution of this trait. Understanding how these changes are likely to have occurred could inform attempts to install C 4 traits into C 3 crops.This article is part of the themed issue 'Enhancing photosynthesis in crop plants: targets for improvement'. © 2017 The Author(s).

  6. Shared origins of a key enzyme during the evolution of C4 and CAM metabolism

    Science.gov (United States)

    Christin, Pascal-Antoine; Arakaki, Monica; Osborne, Colin P.; Bräutigam, Andrea; Sage, Rowan F.; Hibberd, Julian M.; Kelly, Steven; Covshoff, Sarah; Wong, Gane Ka-Shu; Hancock, Lillian; Edwards, Erika J.

    2014-01-01

    CAM and C4 photosynthesis are two key plant adaptations that have evolved independently multiple times, and are especially prevalent in particular groups of plants, including the Caryophyllales. We investigate the origin of photosynthetic PEPC, a key enzyme of both the CAM and C4 pathways. We combine phylogenetic analyses of genes encoding PEPC with analyses of RNA sequence data of Portulaca, the only plants known to perform both CAM and C4 photosynthesis. Three distinct gene lineages encoding PEPC exist in eudicots (namely ppc-1E1, ppc-1E2 and ppc-2), one of which (ppc-1E1) was recurrently recruited for use in both CAM and C4 photosynthesis within the Caryophyllales. This gene is present in multiple copies in the cacti and relatives, including Portulaca. The PEPC involved in the CAM and C4 cycles of Portulaca are encoded by closely related yet distinct genes. The CAM-specific gene is similar to genes from related CAM taxa, suggesting that CAM has evolved before C4 in these species. The similar origin of PEPC and other genes involved in the CAM and C4 cycles highlights the shared early steps of evolutionary trajectories towards CAM and C4, which probably diverged irreversibly only during the optimization of CAM and C4 phenotypes. PMID:24638902

  7. Are changes in sulfate assimilation pathway needed for evolution of C4 photosynthesis?

    Directory of Open Access Journals (Sweden)

    Silke Christine Weckopp

    2015-01-01

    Full Text Available C4 photosynthesis characteristically features a cell-specific localization of enzymes involved in CO2 assimilation in bundle sheath cells or mesophyll cells. Interestingly, enzymes of sulfur assimilation are also specifically present in bundle sheath cells of maize and many other C4 species. This localization, however, could not be confirmed in C4 species of the genus Flaveria. It was, therefore, concluded that the bundle sheath localization of sulfate assimilation occurs only in C4 monocots. However, recently the sulfate assimilation pathway was found coordinately enriched in bundle sheath cells of Arabidopsis, opening new questions about the significance of such cell-specific localization of the pathway. In addition, next generation sequencing revealed expression gradients of many genes from C3 to C4 species and mathematical modelling proposed a sequence of adaptations during the evolutionary path from C3 to C4. Indeed, such gradient, with higher expression of genes for sulfate reduction in C4 species, has been observed within the genus Flaveria. These new tools provide the basis for reexamining the intriguing question of compartmentalization of sulfur assimilation. Therefore, this review summarizes the findings on spatial separation of sulfur assimilation in C4 plants and Arabidopsis, assesses the information on sulfur assimilation provided by the recent transcriptomics data and discusses their possible impact on understanding this interesting feature of plant sulfur metabolism to find out whether changes in sulfate assimilation are part of a general evolutionary trajectory towards C4 photosynthesis.

  8. Cheating by exploitation of developmental prestalk patterning in Dictyostelium discoideum.

    Directory of Open Access Journals (Sweden)

    Anupama Khare

    2010-02-01

    Full Text Available The cooperative developmental system of the social amoeba Dictyostelium discoideum is susceptible to exploitation by cheaters-strains that make more than their fair share of spores in chimerae. Laboratory screens in Dictyostelium have shown that the genetic potential for facultative cheating is high, and field surveys have shown that cheaters are abundant in nature, but the cheating mechanisms are largely unknown. Here we describe cheater C (chtC, a strong facultative cheater mutant that cheats by affecting prestalk differentiation. The chtC gene is developmentally regulated and its mRNA becomes stalk-enriched at the end of development. chtC mutants are defective in maintaining the prestalk cell fate as some of their prestalk cells transdifferentiate into prespore cells, but that defect does not affect gross developmental morphology or sporulation efficiency. In chimerae between wild-type and chtC mutant cells, the wild-type cells preferentially give rise to prestalk cells, and the chtC mutants increase their representation in the spore mass. Mixing chtC mutants with other cell-type proportioning mutants revealed that the cheating is directly related to the prestalk-differentiation propensity of the victim. These findings illustrate that a cheater can victimize cooperative strains by exploiting an established developmental pathway.

  9. Cheating by Exploitation of Developmental Prestalk Patterning in Dictyostelium discoideum

    Science.gov (United States)

    Khare, Anupama; Shaulsky, Gad

    2010-01-01

    The cooperative developmental system of the social amoeba Dictyostelium discoideum is susceptible to exploitation by cheaters—strains that make more than their fair share of spores in chimerae. Laboratory screens in Dictyostelium have shown that the genetic potential for facultative cheating is high, and field surveys have shown that cheaters are abundant in nature, but the cheating mechanisms are largely unknown. Here we describe cheater C (chtC), a strong facultative cheater mutant that cheats by affecting prestalk differentiation. The chtC gene is developmentally regulated and its mRNA becomes stalk-enriched at the end of development. chtC mutants are defective in maintaining the prestalk cell fate as some of their prestalk cells transdifferentiate into prespore cells, but that defect does not affect gross developmental morphology or sporulation efficiency. In chimerae between wild-type and chtC mutant cells, the wild-type cells preferentially give rise to prestalk cells, and the chtC mutants increase their representation in the spore mass. Mixing chtC mutants with other cell-type proportioning mutants revealed that the cheating is directly related to the prestalk-differentiation propensity of the victim. These findings illustrate that a cheater can victimize cooperative strains by exploiting an established developmental pathway. PMID:20195510

  10. Whole transcriptome analysis using next-generation sequencing of model species Setaria viridis to support C4 photosynthesis research.

    Science.gov (United States)

    Xu, Jiajia; Li, Yuanyuan; Ma, Xiuling; Ding, Jianfeng; Wang, Kai; Wang, Sisi; Tian, Ye; Zhang, Hui; Zhu, Xin-Guang

    2013-09-01

    Setaria viridis is an emerging model species for genetic studies of C4 photosynthesis. Many basic molecular resources need to be developed to support for this species. In this paper, we performed a comprehensive transcriptome analysis from multiple developmental stages and tissues of S. viridis using next-generation sequencing technologies. Sequencing of the transcriptome from multiple tissues across three developmental stages (seed germination, vegetative growth, and reproduction) yielded a total of 71 million single end 100 bp long reads. Reference-based assembly using Setaria italica genome as a reference generated 42,754 transcripts. De novo assembly generated 60,751 transcripts. In addition, 9,576 and 7,056 potential simple sequence repeats (SSRs) covering S. viridis genome were identified when using the reference based assembled transcripts and the de novo assembled transcripts, respectively. This identified transcripts and SSR provided by this study can be used for both reverse and forward genetic studies based on S. viridis.

  11. PhMYB4 fine-tunes the floral volatile signature of Petunia x hybrida through PhC4H.

    Science.gov (United States)

    Colquhoun, Thomas A; Kim, Joo Young; Wedde, Ashlyn E; Levin, Laura A; Schmitt, Kyle C; Schuurink, Robert C; Clark, David G

    2011-01-01

    In Petunia × hybrida cv 'Mitchell Diploid' (MD), floral volatile benzenoid/phenylpropanoid (FVBP) biosynthesis is controlled spatially, developmentally, and daily at molecular, metabolic, and biochemical levels. Multiple genes have been shown to encode proteins that either directly catalyse a biochemical reaction yielding FVBP compounds or are involved in metabolite flux prior to the formation of FVBP compounds. It was hypothesized that multiple transcription factors are involved in the precise regulation of all necessary genes, resulting in the specific volatile signature of MD flowers. After acquiring all available petunia transcript sequences with homology to Arabidopsis thaliana R2R3-MYB transcription factors, PhMYB4 (named for its close identity to AtMYB4) was identified, cloned, and characterized. PhMYB4 transcripts accumulate to relatively high levels in floral tissues at anthesis and throughout open flower stages, which coincides with the spatial and developmental distribution of FVBP production and emission. Upon RNAi suppression of PhMYB4 (ir-PhMYB4) both petunia cinnamate-4-hydroxylase (PhC4H1 and PhC4H2) gene transcript levels were significantly increased. In addition, ir-PhMYB4 plants emit higher levels of FVBP compounds derived from p-coumaric acid (isoeugenol and eugenol) compared with MD. Together, these results indicate that PhMYB4 functions in the repression of C4H transcription, indirectly controlling the balance of FVBP production in petunia floral tissue (i.e. fine-tunes).

  12. A specific inactivator of mammalian C'4 isolated from nurse shark (Ginglymostoma cirratum) serum.

    Science.gov (United States)

    Jensen, J A

    1969-08-01

    A material which specifically inactivates mammalian C'4 was isolated from low ionic strength precipitates of nurse shark serum. The C'4 inactivator was not detected in whole serum. The conditions of its generation and its immunoelectrophoretic behavior seem to indicate that it is an enzymatically formed cleavage product of a precursor contained in whole shark serum. The inactivator was partially purified and characterized. It had an S-value of 3.3 (sucrose gradient) which was in agreement with its retardation on gel filtration, was stable between pH 5.0 and 10.0, had a half-life of 5 min at 56 degrees C, pH 7.5, was inactivated by trypsin and was nontoxic. Its powerful anticomplementary activity in vitro and in vivo was solely due to the rapid inactivation of C'4; no other complement components were affected. No cofactor requirement was observed for the equally rapid inactivation of highly purified human and guinea pig C'4. The kinetics of C'4 inactivation and TAME hydrolysis, the greater anodic mobility of inactivated human C'4, and the influence of temperature on the rate of inactivation suggest that the inactivator is an enzyme and C'4 its substrate. This conclusion was supported by the more recent detection of a split product of C'4. Intravenous administration of the C'4 inactivator could prevent lethal Forssman shock and suppress the Arthus reaction in guinea pigs; it prolonged significantly the rejection time of renal xenografts but had no detectable effect on passive cutaneous anaphylaxis. Anaphylatoxin could be generated in C'4 depleted guinea pig serum with the cobra venom factor, but not with immune precipitates. The possible relationship between C'1 esterase and the C'4 inactivator is discussed on the basis of similarities and dissimilarities.

  13. Complement activation in astrocytomas: deposition of C4d and patient outcome

    International Nuclear Information System (INIS)

    Mäkelä, Katri; Helén, Pauli; Haapasalo, Hannu; Paavonen, Timo

    2012-01-01

    C4d is a cleavage product of complement component C4 and is considered to serve as a marker for the site of complement activation. In this study C4d staining of grade I-IV astrocytic tumors was studied to explore if there is an association between complement activation and the grade of tumor, or patient survival. Tissue micro-array samples of 102 astrocytomas were stained immunohistochemically. The material consisted of 9 pilocytic astrocytomas and 93 grade II-IV astrocytomas, of which 67 were primary resections and 26 recurrent tumors. The intensity of C4d staining as well as extent of C4d and CD34 staining were evaluated. The intensity of C4d staining was scored semiquantitatively. The extent of the staining was counted morphometrically with a point counting grid yielding a percent of C4d and CD34 positive area of the sample. The intensity and extent of C4d staining increased in grade II-IV diffusely infiltrating astrocytoma tumors in line with the malignancy grade (p = 0.034 and p = 0.016, respectively, Kruskal-Wallis test). However, C4d positive tumor area percentages were higher in grade I pilocytic astrocytomas than in grade II-IV diffusely infiltrating astrocytomas (p = 0.041, Mann–Whitney test). There was a significant correlation between CD34 positive and C4d positive endothelial area fraction in diffusely infiltrating astrocytomas (p < 0.001, Pearson correlation). In these tumors, the increasing intensity of C4d staining was also associated with worsened patient outcome (p = 0.014, log-rank test). The worsening of patient outcome and malignant progression of tumor cells seem to be connected to microenvironmental changes evoked by chronically activated complement

  14. Human pentraxin 3 binds to the complement regulator c4b-binding protein.

    Directory of Open Access Journals (Sweden)

    Anne Braunschweig

    Full Text Available The long pentraxin 3 (PTX3 is a soluble recognition molecule with multiple functions including innate immune defense against certain microbes and the clearance of apoptotic cells. PTX3 interacts with recognition molecules of the classical and lectin complement pathways and thus initiates complement activation. In addition, binding of PTX3 to the alternative complement pathway regulator factor H was shown. Here, we show that PTX3 binds to the classical and lectin pathway regulator C4b-binding protein (C4BP. A PTX3-binding site was identified within short consensus repeats 1-3 of the C4BP α-chain. PTX3 did not interfere with the cofactor activity of C4BP in the fluid phase and C4BP maintained its complement regulatory activity when bound to PTX3 on surfaces. While C4BP and factor H did not compete for PTX3 binding, the interaction of C4BP with PTX3 was inhibited by C1q and by L-ficolin. PTX3 bound to human fibroblast- and endothelial cell-derived extracellular matrices and recruited functionally active C4BP to these surfaces. Whereas PTX3 enhanced the activation of the classical/lectin pathway and caused enhanced C3 deposition on extracellular matrix, deposition of terminal pathway components and the generation of the inflammatory mediator C5a were not increased. Furthermore, PTX3 enhanced the binding of C4BP to late apoptotic cells, which resulted in an increased rate of inactivation of cell surface bound C4b and a reduction in the deposition of C5b-9. Thus, in addition to complement activators, PTX3 interacts with complement inhibitors including C4BP. This balanced interaction on extracellular matrix and on apoptotic cells may prevent excessive local complement activation that would otherwise lead to inflammation and host tissue damage.

  15. Characterization of Novel Sorghum brown midrib Mutants from an EMS-Mutagenized Population

    OpenAIRE

    Sattler, Scott E.; Saballos, Ana; Xin, Zhanguo; Funnell-Harris, Deanna L.; Vermerris, Wilfred; Pedersen, Jeffrey F.

    2014-01-01

    Reducing lignin concentration in lignocellulosic biomass can increase forage digestibility for ruminant livestock and saccharification yields of biomass for bioenergy. In sorghum (Sorghum bicolor (L.) Moench) and several other C4 grasses, brown midrib (bmr) mutants have been shown to reduce lignin concentration. Putative bmr mutants isolated from an EMS-mutagenized population were characterized and classified based on their leaf midrib phenotype and allelism tests with the previously describe...

  16. 26 CFR 1.381(c)(4)-1 - Method of accounting.

    Science.gov (United States)

    2010-04-01

    ... 26 Internal Revenue 4 2010-04-01 2010-04-01 false Method of accounting. 1.381(c)(4)-1 Section 1... TAX (CONTINUED) INCOME TAXES Insolvency Reorganizations § 1.381(c)(4)-1 Method of accounting. (a... section 381(a) applies, an acquiring corporation shall use the same method of accounting used by the...

  17. Germination Shifts of C3 and C4 Species under Simulated Global Warming Scenario

    Science.gov (United States)

    Zhang, Hongxiang; Yu, Qiang; Huang, Yingxin; Zheng, Wei; Tian, Yu; Song, Yantao; Li, Guangdi; Zhou, Daowei

    2014-01-01

    Research efforts around the world have been increasingly devoted to investigating changes in C3 and C4 species' abundance or distribution with global warming, as they provide important insight into carbon fluxes and linked biogeochemical cycles. However, changes in the early life stage (e.g. germination) of C3 and C4 species in response to global warming, particularly with respect to asymmetric warming, have received less attention. We investigated germination percentage and rate of C3 and C4 species under asymmetric (+3/+6°C at day/night) and symmetric warming (+5/+5°C at day/night), simulated by alternating temperatures. A thermal time model was used to calculate germination base temperature and thermal time constant. Two additional alternating temperature regimes were used to test temperature metrics effect. The germination percentage and rate increased continuously for C4 species, but increased and then decreased with temperature for C3 species under both symmetric and asymmetric warming. Compared to asymmetric warming, symmetric warming significantly overestimated the speed of germination percentage change with temperature for C4 species. Among the temperature metrics (minimum, maximum, diurnal temperature range and average temperature), maximum temperature was most correlated with germination of C4 species. Our results indicate that global warming may favour germination of C4 species, at least for the C4 species studied in this work. The divergent effects of asymmetric and symmetric warming on plant germination also deserve more attention in future studies. PMID:25137138

  18. Germination shifts of C3 and C4 species under simulated global warming scenario.

    Directory of Open Access Journals (Sweden)

    Hongxiang Zhang

    Full Text Available Research efforts around the world have been increasingly devoted to investigating changes in C3 and C4 species' abundance or distribution with global warming, as they provide important insight into carbon fluxes and linked biogeochemical cycles. However, changes in the early life stage (e.g. germination of C3 and C4 species in response to global warming, particularly with respect to asymmetric warming, have received less attention. We investigated germination percentage and rate of C3 and C4 species under asymmetric (+3/+6°C at day/night and symmetric warming (+5/+5°C at day/night, simulated by alternating temperatures. A thermal time model was used to calculate germination base temperature and thermal time constant. Two additional alternating temperature regimes were used to test temperature metrics effect. The germination percentage and rate increased continuously for C4 species, but increased and then decreased with temperature for C3 species under both symmetric and asymmetric warming. Compared to asymmetric warming, symmetric warming significantly overestimated the speed of germination percentage change with temperature for C4 species. Among the temperature metrics (minimum, maximum, diurnal temperature range and average temperature, maximum temperature was most correlated with germination of C4 species. Our results indicate that global warming may favour germination of C4 species, at least for the C4 species studied in this work. The divergent effects of asymmetric and symmetric warming on plant germination also deserve more attention in future studies.

  19. The role of photorespiration during the evolution of C4 photosynthesis in the genus Flaveria.

    Science.gov (United States)

    Mallmann, Julia; Heckmann, David; Bräutigam, Andrea; Lercher, Martin J; Weber, Andreas P M; Westhoff, Peter; Gowik, Udo

    2014-06-16

    C4 photosynthesis represents a most remarkable case of convergent evolution of a complex trait, which includes the reprogramming of the expression patterns of thousands of genes. Anatomical, physiological, and phylogenetic and analyses as well as computational modeling indicate that the establishment of a photorespiratory carbon pump (termed C2 photosynthesis) is a prerequisite for the evolution of C4. However, a mechanistic model explaining the tight connection between the evolution of C4 and C2 photosynthesis is currently lacking. Here we address this question through comparative transcriptomic and biochemical analyses of closely related C3, C3-C4, and C4 species, combined with Flux Balance Analysis constrained through a mechanistic model of carbon fixation. We show that C2 photosynthesis creates a misbalance in nitrogen metabolism between bundle sheath and mesophyll cells. Rebalancing nitrogen metabolism requires anaplerotic reactions that resemble at least parts of a basic C4 cycle. Our findings thus show how C2 photosynthesis represents a pre-adaptation for the C4 system, where the evolution of the C2 system establishes important C4 components as a side effect.

  20. The role of photorespiration during the evolution of C4 photosynthesis in the genus Flaveria

    Science.gov (United States)

    Mallmann, Julia; Heckmann, David; Bräutigam, Andrea; Lercher, Martin J; Weber, Andreas PM; Westhoff, Peter; Gowik, Udo

    2014-01-01

    C4 photosynthesis represents a most remarkable case of convergent evolution of a complex trait, which includes the reprogramming of the expression patterns of thousands of genes. Anatomical, physiological, and phylogenetic and analyses as well as computational modeling indicate that the establishment of a photorespiratory carbon pump (termed C2 photosynthesis) is a prerequisite for the evolution of C4. However, a mechanistic model explaining the tight connection between the evolution of C4 and C2 photosynthesis is currently lacking. Here we address this question through comparative transcriptomic and biochemical analyses of closely related C3, C3–C4, and C4 species, combined with Flux Balance Analysis constrained through a mechanistic model of carbon fixation. We show that C2 photosynthesis creates a misbalance in nitrogen metabolism between bundle sheath and mesophyll cells. Rebalancing nitrogen metabolism requires anaplerotic reactions that resemble at least parts of a basic C4 cycle. Our findings thus show how C2 photosynthesis represents a pre-adaptation for the C4 system, where the evolution of the C2 system establishes important C4 components as a side effect. DOI: http://dx.doi.org/10.7554/eLife.02478.001 PMID:24935935

  1. Integration of C4-specific ppdk gene of Echinochloa to C3 upland ...

    African Journals Online (AJOL)

    Pyruvate orthophosphate dikinase (PPDK) plays a key role in C4 photosynthetic pathway. The enzymatic reaction is one of the rate-limiting steps of the C4 photosynthetic pathway. In this paper, the gene encoding Echinochloa pyruvate orthosphate dikinase (GenBank accession number: AB289641) was introduced into H65 ...

  2. Phosphoenolpyruvate carboxylase from C4 leaves is selectively targeted for inhibition by anionic phospholipids

    NARCIS (Netherlands)

    Monreal, J.A.; McLoughlin, F.; Echevarría, C.; García-Mauriño, S.; Testerink, C.

    2010-01-01

    Phosphoenolpyruvate carboxylase (PEPC; EC 4.1.1.31) is an enzyme playing a crucial role in photosynthesis of C4 plants. Here, we identify anionic phospholipids as novel regulators that inhibit C4 PEPC activity and provide evidence that the enzyme partially localizes to membranes.

  3. Germination shifts of C3 and C4 species under simulated global warming scenario.

    Science.gov (United States)

    Zhang, Hongxiang; Yu, Qiang; Huang, Yingxin; Zheng, Wei; Tian, Yu; Song, Yantao; Li, Guangdi; Zhou, Daowei

    2014-01-01

    Research efforts around the world have been increasingly devoted to investigating changes in C3 and C4 species' abundance or distribution with global warming, as they provide important insight into carbon fluxes and linked biogeochemical cycles. However, changes in the early life stage (e.g. germination) of C3 and C4 species in response to global warming, particularly with respect to asymmetric warming, have received less attention. We investigated germination percentage and rate of C3 and C4 species under asymmetric (+3/+6°C at day/night) and symmetric warming (+5/+5°C at day/night), simulated by alternating temperatures. A thermal time model was used to calculate germination base temperature and thermal time constant. Two additional alternating temperature regimes were used to test temperature metrics effect. The germination percentage and rate increased continuously for C4 species, but increased and then decreased with temperature for C3 species under both symmetric and asymmetric warming. Compared to asymmetric warming, symmetric warming significantly overestimated the speed of germination percentage change with temperature for C4 species. Among the temperature metrics (minimum, maximum, diurnal temperature range and average temperature), maximum temperature was most correlated with germination of C4 species. Our results indicate that global warming may favour germination of C4 species, at least for the C4 species studied in this work. The divergent effects of asymmetric and symmetric warming on plant germination also deserve more attention in future studies.

  4. New introductions of enterovirus 71 subgenogroup C4 strains, France, 2012.

    Science.gov (United States)

    Schuffenecker, Isabelle; Henquell, Cécile; Mirand, Audrey; Coste-Burel, Marianne; Marque-Juillet, Stéphanie; Desbois, Delphine; Lagathu, Gisèle; Bornebusch, Laure; Bailly, Jean-Luc; Lina, Bruno

    2014-08-01

    In France during 2012, human enterovirus 71 (EV-A71) subgenogroup C4 strains were detected in 4 children hospitalized for neonatal fever or meningitis. Phylogenetic analysis showed novel and independent EV-A71 introductions, presumably from China, and suggested circulation of C4 strains throughout France. This observation emphasizes the need for monitoring EV-A71 infections in Europe.

  5. Kinetic alteration of a human dihydrodiol/3alpha-hydroxysteroid dehydrogenase isoenzyme, AKR1C4, by replacement of histidine-216 with tyrosine or phenylalanine.

    Science.gov (United States)

    Ohta, T; Ishikura, S; Shintani, S; Usami, N; Hara, A

    2000-01-01

    Human dihydrodiol dehydrogenase with 3alpha-hydroxysteroid dehydrogenase activity exists in four forms (AKR1C1-1C4) that belong to the aldo-keto reductase (AKR) family. Recent crystallographic studies on the other proteins in this family have indicated a role for a tyrosine residue (corresponding to position 216 in these isoenzymes) in stacking the nicotinamide ring of the coenzyme. This tyrosine residue is conserved in most AKR family members including AKR1C1-1C3, but is replaced with histidine in AKR1C4 and phenylalanine in some AKR members. In the present study we prepared mutant enzymes of AKR1C4 in which His-216 was replaced with tyrosine or phenylalanine. The two mutations decreased 3-fold the K(m) for NADP(+) and differently influenced the K(m) and k(cat) for substrates depending on their structures. The kinetic constants for bile acids with a 12alpha-hydroxy group were decreased 1.5-7-fold and those for the other substrates were increased 1.3-9-fold. The mutation also yielded different changes in sensitivity to competitive inhibitors such as hexoestrol analogues, 17beta-oestradiol, phenolphthalein and flufenamic acid and 3,5,3', 5'-tetraiodothyropropionic acid analogues. Furthermore, the mutation decreased the stimulatory effects of the enzyme activity by sulphobromophthalein, clofibric acid and thyroxine, which increased the K(m) for the coenzyme and substrate of the mutant enzymes more highly than those of the wild-type enzyme. These results indicate the importance of this histidine residue in creating the cavity of the substrate-binding site of AKR1C4 through the orientation of the nicotinamide ring of the coenzyme, as well as its involvement in the conformational change by binding non-essential activators. PMID:11104674

  6. Variations of Leaf Cuticular Waxes Among C3 and C4 Gramineae Herbs.

    Science.gov (United States)

    He, Yuji; Gao, Jianhua; Guo, Na; Guo, Yanjun

    2016-11-01

    Modern C4 plants are commonly distributed in hot and dry environments whereas C3 plants predominate in cool and shade areas. At the outmost of plant surface, the deposition and chemical composition of cuticular waxes vary under different environmental conditions. However, whether such variation of cuticular wax is related to the distribution of C3 and C4 under different environmental conditions is still not clear. In this study, leaves of six C3 Gramineae herbs distributed in spring, Roegneria kamoji, Polypogon fugax, Poa annua, Avena fatua, Alopecurus aequalis, and Oplismenus undulatifolius, and four C4 and one C3 Gramineae herbs distributed in summer, Digitaria sanguinalis, Eleusine indica, Setaria viridis, S. plicata, and O. undulatifolius, were sampled and analyzed for cuticular wax. Plates were the main epicuticular wax morphology in both C3 and C4 plants except S. plicata. The plates melted in C4 plants but not in C3 plants. The total cuticular wax amounts in C4 plants were significantly lower than those in C3 plants, except for O. undulatifolius. Primary alcohols were the most abundant compounds in C3 plants, whereas n-alkanes were relatively the most abundant compounds in C4 plants. C 29 was the most abundant n-alkane in C3 plants except for O. undulatifolius, whereas the most abundant n-alkane was C 31 or C 33 in C4 plants. The average chain length (ACL) of n-alkanes was higher in C4 than in C3 plants, whereas the ACL of n-alkanoic acids was higher in C3 than C4 plants. The cluster analysis based on the distribution of n-alkanes clearly distinguished C3 and C4 plants into two groups, except for O. undulatifolius which was grouped with C4 plants. These results suggest that the variations of cuticular waxes among C3 and C4 Gramineae herbs are related to the distribution of C3 and C4 plants under different environmental conditions. © 2016 Wiley-VHCA AG, Zurich, Switzerland.

  7. Photosynthetic metabolism of malate and aspartate in Flaveria trinervia a C4 dicot

    International Nuclear Information System (INIS)

    Moore, B.A.

    1986-01-01

    C 4 species are known to vary in their apparent relative use of malate and aspartate to mediate carbon flux through the C 4 cycle. These studies investigate some of the adjustments in photosynthetic carbon metabolism that occur during a dark to light transition and during expansion of leaves of Flaveria trinervia, a C 4 dicot. Enzyme localization studies with isolated leaf mesophyll and bundle sheath protoplasts, indicated that both C 4 acids are formed in the mesophyll chloroplast, and that aspartate is metabolized to malate in the bundle sheath chloroplast prior to decaroxylation there. During photosynthetic induction, the partitioning of 14 CO 2 between malate and aspartate showed a single oscillation of increased aspartate labelling after 5 min of illumination. Turnover of [4-14C] (malate plus aspartate) was slow initially during illumination, prior to establishment of active pools of C 4 cycle metabolites

  8. Photorepair mutants of Arabidopsis

    International Nuclear Information System (INIS)

    Jiang, C.Z.; Yee, J.; Mitchell, D.L.; Britt, A.B.

    1997-01-01

    UV radiation induces two major DNA damage products, the cyclobutane pyrimidine dimer (CPD) and, at a lower frequency, the pyrimidine (6-4) pyrimidinone dimer (6-4 product). Although Escherichia coli and Saccharomyces cerevisiae produce a CPD-specific photolyase that eliminates only this class of dimer, Arabidopsis thaliana, Drosophila melanogaster, Crotalus atrox, and Xenopus laevis have recently been shown to photoreactivate both CPDs and 6-4 products. We describe the isolation and characterization of two new classes of mutants of Arabidopsis, termed uvr2 and uvr3, that are defective in the photoreactivation of CPDs and 6-4 products, respectively. We demonstrate that the CPD photolyase mutation is genetically linked to a DNA sequence encoding a type II (metazoan) CPD photolyase. In addition, we are able to generate plants in which only CPDs or 6-4 products are photoreactivated in the nuclear genome by exposing these mutants to UV light and then allowing them to repair one or the other class of dimers. This provides us with a unique opportunity to study the biological consequences of each of these two major UV-induced photoproducts in an intact living system

  9. Construindo Marcas Mutantes

    Directory of Open Access Journals (Sweden)

    Elizete De Azevedo Kreutz

    2012-09-01

    Full Text Available O presente artigo é o resultado de estudos realizados desde 2000 e busca instrumentalizar os proñssionals para a construção de Marcas Mutantes, que é   uma tendência contemporânea nas estratégias comunicacionais e de branding. Embora esta estratégia ainda não esteja consolidada, observamos que a mesma tem obtido um crescimento constante e tem sido adotadas pelas mais diferentes categorias de marcas e não apenas por aquelas direcionadas aos jovens, ao esporte, ao entretenimento, como era no principia. Com base na Hermenêutica de Profundidade de Thompson (1995, alicerçada nas pesquisas bibliográficas, de intemet, entrevistas e análise semiótica, desenhamos um método de construção de Marcas Mutantes dividido em sete fases. Como resultado, esperamos que este estudo possa auxiliar na compreensão dos processos envolvidos, ao mesmo tempo que provoque a discussão sobreo mesmo e, por consequência, o seu aprimoramento.

  10. Development of compact mutants in apple and sour cherry

    International Nuclear Information System (INIS)

    Zagaja, S.W.; Przybyla, A.; Machnik, B.

    1982-01-01

    During the period 1973 - 79 studies were conducted with the aim of developing compact mutants in apple and cherry cultivars and in apple vegetative rootstocks. During the investigations the effect of the dose of gamma rays on frequency of the mutants was studied. Attempts were also made to evolve a micropropagation technique adapted to propagate P 2 and P 22 apple rootstocks, as an aid in mutation breeding. Several mutants were produced in all the material studied, but none of them have yet reached a sufficient developmental stage to enable their complete assessment. On the basis of the results obtained so far the following conclusions can be drawn: higher doses of irradiation resulted in higher frequency of mutants in most apple cultivars and apple rootstocks; in sour cherries the effect of dose depended on the cultivars. Among V 1 shoots developed from sleeping buds on irradiated scion wood, compact mutants were found; their frequency, however, was about 60% lower than among V 1 shoots developed directly from irradiated dormant buds. In apple rootstocks A 2 and M 26 several dwarfed mutants were found; some of these produced thorny plants and some had lower rooting ability; both these characteristics are inferior from the practical point of view. Multiplication and rooting media for in vitro propagation of apple rootstocks, worked out for M 26, were found unsuitable for the rootstocks P 2 and P 22; modifications made in the growth substance composition of the above media enabled satisfactory propagation to be obtained. (author)

  11. Characterization and Stability of Trypanosoma cruzi 24-C4 (Tc24-C4), a Candidate Antigen for a Therapeutic Vaccine Against Chagas Disease.

    Science.gov (United States)

    Biter, Amadeo B; Weltje, Sarah; Hudspeth, Elissa M; Seid, Christopher A; McAtee, C Patrick; Chen, Wen-Hsiang; Pollet, Jeroen B; Strych, Ulrich; Hotez, Peter J; Bottazzi, Maria Elena

    2018-05-01

    Chagas disease due to chronic infection with Trypanosoma cruzi is a neglected cause of heart disease, affecting approximately 6-10 million individuals in Latin America and elsewhere. T. cruzi Tc24, a calcium-binding protein in the flagellar pocket of the parasite, is a candidate antigen for an injectable therapeutic vaccine as an alternative or a complement to chemotherapy. Previously, we reported that a genetically engineered construct from which all cysteine residues had been eliminated (Tc24-C4) yields a recombinant protein with reduced aggregation and improved analytical purity in comparison to the wild-type form, without compromising antigenicity and immunogenicity. We now report that the established process for producing Escherichia coli-expressed Tc24-C4 protein is robust and reproducibly yields protein lots with consistent analytical characteristics, freeze-thaw, accelerated, and long-term stability profiles. The data indicate that, like most proteins, Tc24-C4 should be stable at -80°C, but also at 4°C and room temperature for at least 30 days, and up to 7-15 days at 37°C. Thus, the production process for recombinant Tc24-C4 is suitable for Current Good Manufacturing Practice production and clinical testing, based on process robustness, analytical characteristics, and stability profile. Copyright © 2018 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  12. Transcriptome comparisons shed light on the pre-condition and potential barrier for C4 photosynthesis evolution in eudicots.

    Science.gov (United States)

    Tao, Yimin; Lyu, Ming-Ju Amy; Zhu, Xin-Guang

    2016-05-01

    C4 photosynthesis evolved independently from C3 photosynthesis in more than 60 lineages. Most of the C4 lineages are clustered together in the order Poales and the order Caryophyllales while many other angiosperm orders do not have C4 species, suggesting the existence of biological pre-conditions in the ancestral C3 species that facilitate the evolution of C4 photosynthesis in these lineages. To explore pre-adaptations for C4 photosynthesis evolution, we classified C4 lineages into the C4-poor and the C4-rich groups based on the percentage of C4 species in different genera and conducted a comprehensive comparison on the transcriptomic changes between the non-C4 species from the C4-poor and the C4-rich groups. Results show that species in the C4-rich group showed higher expression of genes related to oxidoreductase activity, light reaction components, terpene synthesis, secondary cell synthesis, C4 cycle related genes and genes related to nucleotide metabolism and senescence. In contrast, C4-poor group showed up-regulation of a PEP/Pi translocator, genes related to signaling pathway, stress response, defense response and plant hormone metabolism (ethylene and brassinosteroid). The implications of these transcriptomic differences between the C4-rich and C4-poor groups to C4 evolution are discussed.

  13. High-biomass C4 grasses-Filling the yield gap.

    Science.gov (United States)

    Mullet, John E

    2017-08-01

    A significant increase in agricultural productivity will be required by 2050 to meet the needs of an expanding and rapidly developing world population, without allocating more land and water resources to agriculture, and despite slowing rates of grain yield improvement. This review examines the proposition that high-biomass C 4 grasses could help fill the yield gap. High-biomass C 4 grasses exhibit high yield due to C 4 photosynthesis, long growth duration, and efficient capture and utilization of light, water, and nutrients. These C 4 grasses exhibit high levels of drought tolerance during their long vegetative growth phase ideal for crops grown in water-limited regions of agricultural production. The stems of some high-biomass C 4 grasses can accumulate high levels of non-structural carbohydrates that could be engineered to enhance biomass yield and utility as feedstocks for animals and biofuels production. The regulatory pathway that delays flowering of high-biomass C 4 grasses in long days has been elucidated enabling production and deployment of hybrids. Crop and landscape-scale modeling predict that utilization of high-biomass C 4 grass crops on land and in regions where water resources limit grain crop yield could increase agricultural productivity. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Isozyme differences in barley mutants

    Energy Technology Data Exchange (ETDEWEB)

    AI-Jibouri, A A.M.; Dham, K M [Department of Botany, Nuclear Research Centre, Baghdad (Iraq)

    1990-01-01

    Full text: Thirty mutants (M{sub 11}) of barley (Hordeum vulgare L.) induced by physical and chemical mutagens were analysed for isozyme composition using polyacrylamide gel electrophoresis. Results show that these mutants were different in the isozymes leucine aminopeptidase, esterase and peroxidase. The differences included the number of forms of each enzyme, relative mobility value and their intensity on the gel. Glutamate oxaloacetate transaminase isozyme was found in six molecular forms and these forms were similar in all mutants. (author)

  15. Isozyme differences in barley mutants

    International Nuclear Information System (INIS)

    AI-Jibouri, A.A.M.; Dham, K.M.

    1990-01-01

    Full text: Thirty mutants (M 11 ) of barley (Hordeum vulgare L.) induced by physical and chemical mutagens were analysed for isozyme composition using polyacrylamide gel electrophoresis. Results show that these mutants were different in the isozymes leucine aminopeptidase, esterase and peroxidase. The differences included the number of forms of each enzyme, relative mobility value and their intensity on the gel. Glutamate oxaloacetate transaminase isozyme was found in six molecular forms and these forms were similar in all mutants. (author)

  16. Developmental dyscalculia.

    Science.gov (United States)

    Kucian, Karin; von Aster, Michael

    2015-01-01

    Numerical skills are essential in our everyday life, and impairments in the development of number processing and calculation have a negative impact on schooling and professional careers. Approximately 3 to 6 % of children are affected from specific disorders of numerical understanding (developmental dyscalculia (DD)). Impaired development of number processing skills in these children is characterized by problems in various aspects of numeracy as well as alterations of brain activation and brain structure. Moreover, DD is assumed to be a very heterogeneous disorder putting special challenges to define homogeneous diagnostic criteria. Finally, interdisciplinary perspectives from psychology, neuroscience and education can contribute to the design for interventions, and although results are still sparse, they are promising and have shown positive effects on behaviour as well as brain function. In the current review, we are going to give an overview about typical and atypical development of numerical abilities at the behavioural and neuronal level. Furthermore, current status and obstacles in the definition and diagnostics of DD are discussed, and finally, relevant points that should be considered to make an intervention as successful as possible are summarized.

  17. Renal AA amyloidosis in a patient with hereditary complete complement C4 deficiency

    Directory of Open Access Journals (Sweden)

    Imed Helal

    2011-01-01

    Full Text Available Hereditary complete C4 deficiency has until now been reported in 30 cases only. A disturbed clearance of immune- complexes probably predisposes these individuals to systemic lupus erythematosus, other immune- complex diseases and recurrent microbial infections. We present here a 20- year- old female with hereditary complete C4 deficiency. Renal biopsy demonstrated renal AA amyloidosis. This unique case further substantiates that deficiency of classical pathway components predisposes to the development of recurrent microbial infections and that the patients may develop AA amyloidosis. Furthermore, in clinical practice, the nephrotic syndrome occurring in a patient with hereditary complete complement C4 deficiency should lead to the suspicion of renal AA amyloidosis.

  18. Expression of CALR mutants causes mpl-dependent thrombocytosis in zebrafish.

    Science.gov (United States)

    Lim, K-H; Chang, Y-C; Chiang, Y-H; Lin, H-C; Chang, C-Y; Lin, C-S; Huang, L; Wang, W-T; Gon-Shen Chen, C; Chou, W-C; Kuo, Y-Y

    2016-10-07

    CALR mutations are identified in about 30% of JAK2/MPL-unmutated myeloproliferative neoplasms (MPNs) including essential thrombocythemia (ET) and primary myelofibrosis. Although the molecular pathogenesis of CALR mutations leading to MPNs has been studied using in vitro cell lines models, how mutant CALR may affect developmental hematopoiesis remains unknown. Here we took advantage of the zebrafish model to examine the effects of mutant CALR on early hematopoiesis and model human CALR-mutated MPNs. We identified three zebrafish genes orthologous to human CALR, referred to as calr, calr3a and calr3b. The expression of CALR-del52 and CALR-ins5 mutants caused an increase in the hematopoietic stem/progenitor cells followed by thrombocytosis without affecting normal angiogenesis. The expression of CALR mutants also perturbed early developmental hematopoiesis in zebrafish. Importantly, morpholino knockdown of mpl but not epor or csf3r could significantly attenuate the effects of mutant CALR. Furthermore, the expression of mutant CALR caused jak-stat signaling activation in zebrafish that could be blocked by JAK inhibitors (ruxolitinib and fedratinib). These findings showed that mutant CALR activates jak-stat signaling through an mpl-dependent mechanism to mediate pathogenic thrombopoiesis in zebrafish, and illustrated that the signaling machinery related to mutant CALR tumorigenesis are conserved between human and zebrafish.

  19. INTEGRASI ALGORITMA POHON KEPUTUSAN C4.5 YANG DIKEMBANGKAN KE DALAM OBJECT-RELATIONAL DBMS

    Directory of Open Access Journals (Sweden)

    Veronica S. Moertini

    2007-07-01

    Full Text Available Integrasi teknik-teknik data mining ke dalam DBMS, khususnya Object-Relational DBMS (ORDBMS, masih merupakan bidang penelitian yang aktif. Isu utama pada integrasi ini adalah: peleburan algoritma data mining ke dalam ORDBMS dengan memanfaatkan fitur-fiturnya untuk memperbaiki kualitas teknik tersebut. Pada penelitian ini, algoritma klasifikasi C4.5 dikembangkan dengan pendekatan aljabar relasional dan diintegrasikan ke dalam ORDBMS sebagai prosedur-prosedur tersimpan Java dan berbasis SQL, dengan tujuan untuk meningkatkan skalabilitas dan efisiensinya. Hasil eksperimen menunjukkan bahwa algoritma yang sudah diintegrasikan berhasil memperbaiki skalabilitas dan pada kasus khusus juga memperbaiki  efisiensi.   Kata kunci: pengembangan algoritma C.5, integrasi C4.5 ke dalam Object-Relational DBMS, algoritma C4.5, perbaikan skalabilitas C4.5.

  20. Deployment of 802.15.4 Sensor Networks for C4ISR Operations

    National Research Council Canada - National Science Library

    Ngo, Damian N

    2006-01-01

    .... The objective of this thesis is to focus on the deployment issues of WSNs. In addition, this thesis assesses the optimal configurations and environment that enables the sensor networks to thrive in a C4ISR environment...

  1. Application of preprocessing filtering on Decision Tree C4.5 and rough set theory

    Science.gov (United States)

    Chan, Joseph C. C.; Lin, Tsau Y.

    2001-03-01

    This paper compares two artificial intelligence methods: the Decision Tree C4.5 and Rough Set Theory on the stock market data. The Decision Tree C4.5 is reviewed with the Rough Set Theory. An enhanced window application is developed to facilitate the pre-processing filtering by introducing the feature (attribute) transformations, which allows users to input formulas and create new attributes. Also, the application produces three varieties of data set with delaying, averaging, and summation. The results prove the improvement of pre-processing by applying feature (attribute) transformations on Decision Tree C4.5. Moreover, the comparison between Decision Tree C4.5 and Rough Set Theory is based on the clarity, automation, accuracy, dimensionality, raw data, and speed, which is supported by the rules sets generated by both algorithms on three different sets of data.

  2. Electron attachment properties of c-C4F8O\

    Czech Academy of Sciences Publication Activity Database

    Chachereau, A.; Fedor, Juraj; Janečková, R.; Kočišek, Jaroslav; Rabie, M.; Franck, C. M.

    2016-01-01

    Roč. 49, č. 37 (2016), 375201 ISSN 0022-3727 Institutional support: RVO:61388955 Keywords : C4F8O * octafluorotetrahydrofuran * attachment cross section Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.588, year: 2016

  3. SELECTIVE C-2 AND C-4 DEACYLATION AND ACYLATION OF TAXOL - THE FIRST SYNTHESIS OF A C-4 SUBSTITUTED TAXOL ANALOG

    DEFF Research Database (Denmark)

    GEORG, GI; ALI, SM; BOGE, TC

    1994-01-01

    Hydrolytic procedures for selective 2-debenzoylation and 2,4-dideacylation of 2'-0-tert-butyldimethylsilyl-7-0-(triethylsilyl)taxol are reported. The first synthesis and biological evaluation of a 4-substituted analogue, 4-deacetyl-4-isobutanoyltaxol, is presented. The chemistry described in this...... in this letter is suitable for the facile synthesis of taxol congeners modified at C-2 and/or C-4....

  4. PhC-4 new high-speed camera with mirror scanning

    International Nuclear Information System (INIS)

    Daragan, A.O.; Belov, B.G.

    1979-01-01

    The description of the optical system and the construction of the high-speed PhC-4 photographic camera with mirror scanning of the continuously operating type is given. The optical system of the camera is based on the foursided rotating mirror, two optical inlets and two working sectors. The PhC-4 camera provides the framing rate up to 600 thousand frames per second. (author)

  5. New Introductions of Enterovirus 71 Subgenogroup C4 Strains, France, 2012

    Science.gov (United States)

    Henquell, Cécile; Mirand, Audrey; Coste-Burel, Marianne; Marque-Juillet, Stéphanie; Desbois, Delphine; Lagathu, Gisèle; Bornebusch, Laure; Bailly, Jean-Luc; Lina, Bruno

    2014-01-01

    In France during 2012, human enterovirus 71 (EV-A71) subgenogroup C4 strains were detected in 4 children hospitalized for neonatal fever or meningitis. Phylogenetic analysis showed novel and independent EV-A71 introductions, presumably from China, and suggested circulation of C4 strains throughout France. This observation emphasizes the need for monitoring EV-A71 infections in Europe. PMID:25061698

  6. NDH-Mediated Cyclic Electron Flow Around Photosystem I is Crucial for C4 Photosynthesis.

    Science.gov (United States)

    Ishikawa, Noriko; Takabayashi, Atsushi; Noguchi, Ko; Tazoe, Youshi; Yamamoto, Hiroshi; von Caemmerer, Susanne; Sato, Fumihiko; Endo, Tsuyoshi

    2016-10-01

    C 4 photosynthesis exhibits efficient CO 2 assimilation in ambient air by concentrating CO 2 around ribulose 1,5-bisphosphate carboxylase/oxygenase (Rubisco) through a metabolic pathway called the C 4 cycle. It has been suggested that cyclic electron flow (CEF) around PSI mediated by chloroplast NADH dehydrogenase-like complex (NDH), an alternative pathway of photosynthetic electron transport (PET), plays a crucial role in C 4 photosynthesis, although the contribution of NDH-mediated CEF is small in C 3 photosynthesis. Here, we generated NDH-suppressed transformants of a C 4 plant, Flaveria bidentis, and showed that the NDH-suppressed plants grow poorly, especially under low-light conditions. CO 2 assimilation rates were consistently decreased in the NDH-suppressed plants under low and medium light intensities. Measurements of non-photochemical quenching (NPQ) of Chl fluorescence, the oxidation state of the reaction center of PSI (P700) and the electrochromic shift (ECS) of pigment absorbance indicated that proton translocation across the thylakoid membrane is impaired in the NDH-suppressed plants. Since proton translocation across the thylakoid membrane induces ATP production, these results suggest that NDH-mediated CEF plays a role in the supply of ATP which is required for C 4 photosynthesis. Such a role is more crucial when the light that is available for photosynthesis is limited and the energy production by PET becomes rate-determining for C 4 photosynthesis. Our results demonstrate that the physiological contribution of NDH-mediated CEF is greater in C 4 photosynthesis than in C 3 photosynthesis, suggesting that the mechanism of PET in C 4 photosynthesis has changed from that in C 3 photosynthesis accompanying the changes in the mechanism of CO 2 assimilation. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  7. Acute humoral rejection and C4d immunostaining in ABO blood type-incompatible liver transplantation.

    Science.gov (United States)

    Haga, Hironori; Egawa, Hiroto; Fujimoto, Yasuhiro; Ueda, Mikiko; Miyagawa-Hayashino, Aya; Sakurai, Takaki; Okuno, Tomoko; Koyanagi, Itsuko; Takada, Yasutsugu; Manabe, Toshiaki

    2006-03-01

    Complement C4d deposition in graft capillaries has been reported to be associated with antibody-mediated rejection in kidney and other solid organ transplantation. The correlation of C4d deposits and humoral rejection in liver transplants, however, is not well understood. We investigated the C4d immunostaining pattern in 34 patients whose liver biopsy was taken within the first 3 postoperative weeks for suspected acute rejection after ABO blood type-incompatible liver transplantation. The staining pattern was classified as positive (portal stromal staining), indeterminate (endothelial staining only), and negative (no staining). Positive C4d immunostaining was seen in 17 (50%) patients and was significantly associated with high (x64 or more) postoperative antidonor A/B antibody (immunoglobulin M (IgM)) titers (88 vs. 35%, P = 0.002) and poorer overall survival rate (41 vs. 88%, P = 0.007). Ten of 11 (91%) cases with histological acute humoral rejection (periportal edema and necrosis (PEN) or portal hemorrhagic edema) were positive for C4d, all of which showed high postoperative antibody titers. The other histologies associated with C4d positivity was purulent cholangitis (n = 4), coagulative hepatocyte necrosis (n = 1), acute cellular rejection (n = 1), and hepatocanalicular cholestasis (n = 1). Full clinical recovery was observed in only 6 of 17 (35%) C4d-positive patients, and tended to be associated with a lower rejection activity index (RAI). In conclusion, our study indicates that C4d deposits in the portal stroma can be a hallmark of acute humoral rejection in ABO-incompatible liver transplantation, and allograft damage can be reversible in a minority of cases. Copyright 2006 AASLD

  8. Differential Diagnosis Knowledge Building by Using CUC-C4.5 Framework

    OpenAIRE

    Kusrini; Sri Hartati; Retantyo Wardoyo; Agus Harjoko

    2010-01-01

    Problem statement: The Case Based Reasoning (CBR) method can be implemented in differential diagnosis analysis. C4.5 algorithm has been commonly used to help the method's knowledge building process. This process is completed by constructing decision tree from previously handled cases data. The C4.5 algorithm itself can be used with an assumption that all the cases has an exact and equal truth value thus have an exact contribution in decision tree building process. However, the decision makers...

  9. Generator Pohon Keputusan Dengan Menerapkan Algoritma C4.5 Untuk Program Konsultasi

    OpenAIRE

    Kharis, Irma; Delima, Rosa; Purwadi, Joko

    2013-01-01

    C4.5 algorithm is used to simplify decision tree from decision table by generating decision tree from an existing decision tree. With this algorithm, knowledge base in the decision table can be simplified. This research will build a consultation program using C4.5 algorithm which is called decision tree generator. Decision tree generator provides inference facility and a user interface for consultation. The user is required to build a knowledge base first, and the application will generate u...

  10. Rising atmospheric carbon dioxide concentration and the future of C4 crops for food and fuel

    OpenAIRE

    Leakey, Andrew D.B.

    2009-01-01

    Crops with the C4 photosynthetic pathway are vital to global food supply, particularly in the tropical regions where human well-being and agricultural productivity are most closely linked. While rising atmospheric [CO2] is the driving force behind the greater temperatures and water stress, which threaten to reduce future crop yields, it also has the potential to directly benefit crop physiology. The nature of C4 plant responses to elevated [CO2] has been controversial. Recent evidence from fr...

  11. Arterial Blood Pressure Induces Transient C4b-Binding Protein in Human Saphenous Vein Grafts.

    Science.gov (United States)

    Kupreishvili, Koba; Meischl, Christof; Vonk, Alexander B A; Stooker, Wim; Eijsman, Leon; Blom, Anna M; Quax, Paul H A; van Hinsbergh, Victor W M; Niessen, Hans W M; Krijnen, Paul A J

    2017-05-01

    Complement is an important mediator in arterial blood pressure-induced vein graft failure. Previously, we noted activation of cell protective mechanisms in human saphenous veins too. Here we have analyzed whether C4b-binding protein (C4bp), an endogenous complement inhibitor, is present in the vein wall. Human saphenous vein segments obtained from patients undergoing coronary artery bypass grafting (n = 55) were perfused in vitro at arterial blood pressure with either autologous blood for 1, 2, 4, or 6 hr or with autologous blood supplemented with reactive oxygen species scavenger N-acetylcysteine. The segments were subsequently analyzed quantitatively for presence of C4bp and complement activation product C3d using immunohistochemistry. Perfusion induced deposition of C3d and C4bp within the media of the vessel wall, which increased reproducibly and significantly over a period of 4 hr up to 3.8% for C3d and 81% for C4bp of the total vessel area. Remarkably after 6 hr of perfusion, the C3d-positive area decreased significantly to 1.3% and the C4bp-positive area to 19% of the total area of the vein. The areas positive for both C4bp and C3d were increased in the presence of N-acetylcysteine. Exposure to arterial blood pressure leads to a transient presence of C4bp in the vein wall. This may be part of a cell-protective mechanism to counteract arterial blood pressure-induced cellular stress and inflammation in grafted veins. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Tomato leaf curl Yunnan virus-encoded C4 induces cell division through enhancing stability of Cyclin D 1.1 via impairing NbSKη -mediated phosphorylation in Nicotiana benthamiana

    Science.gov (United States)

    Mei, Yuzhen; Yang, Xiuling; Huang, Changjun

    2018-01-01

    The whitefly-transmitted geminiviruses induce severe developmental abnormalities in plants. Geminivirus-encoded C4 protein functions as one of viral symptom determinants that could induce abnormal cell division. However, the molecular mechanism by which C4 contributes to cell division induction remains unclear. Here we report that tomato leaf curl Yunnan virus (TLCYnV) C4 interacts with a glycogen synthase kinase 3 (GSK3)/SHAGGY-like kinase, designed NbSKη, in Nicotiana benthamiana. Pro32, Asn34 and Thr35 of TLCYnV C4 are critical for its interaction with NbSKη and required for C4-induced typical symptoms. Interestingly, TLCYnV C4 directs NbSKη to the membrane and reduces the nuclear-accumulation of NbSKη. The relocalization of NbSKη impairs phosphorylation dependent degradation on its substrate-Cyclin D1.1 (NbCycD1;1), thereby increasing the accumulation level of NbCycD1;1 and inducing the cell division. Moreover, NbSKη-RNAi, 35S::NbCycD1;1 transgenic N. benthamiana plants have the similar phenotype as 35S::C4 transgenic N. benthamiana plants on callus-like tissue formation resulted from abnormal cell division induction. Thus, this study provides new insights into mechanism of how a viral protein hijacks NbSKη to induce abnormal cell division in plants. PMID:29293689

  13. Diversification of C(4) grasses (Poaceae) does not coincide with their ecological dominance.

    Science.gov (United States)

    Bouchenak-Khelladi, Yanis; Slingsby, Jasper A; Verboom, G Anthony; Bond, William J

    2014-02-01

    The radiation of a lineage and its rise to ecological dominance are distinct phenomena and driven by different processes. For example, paleoecological data has been used to show that the Cretaceous angiosperm radiation did not coincide with their rise to dominance. Using a phylogenetic approach, we here explored the evolution of C4 grasses and evaluated whether the diversification of this group and its rise to ecological dominance in the late Miocene were decoupled. We assembled a matrix including 675 grass species of the PACMAD clade and 2784 characters (ITS and ndhF) to run a molecular dating analysis using three fossils as reference calibrations. We coded species as C3 vs. C4 and reconstructed ancestral states under maximum likelihood. We used the program BiSSE to test whether rates of diversification are correlated with photosynthetic pathway and whether the radiation of C4 lineages preceded or coincided with their rise to ecological dominance from ∼10 Ma. C4 grass lineages first originated around 35 Ma at the time of the Eocene-Oligocene transition. Accelerated diversification of C4 lineages did not coincide with their rise to ecological dominance. C4-dominated grasslands have expanded only since the Late Miocene and Pliocene. The initial diversification of their biotic elements can be tracked back as far as the Eocene-Oligocene transition. We suggest that shifts in taxonomic diversification and ecological dominance were stimulated by different factors, as in the case of the early angiosperms in the Cretaceous.

  14. C4 Photosynthesis Promoted Species Diversification during the Miocene Grassland Expansion

    Science.gov (United States)

    Spriggs, Elizabeth L.; Christin, Pascal-Antoine; Edwards, Erika J.

    2014-01-01

    Identifying how organismal attributes and environmental change affect lineage diversification is essential to our understanding of biodiversity. With the largest phylogeny yet compiled for grasses, we present an example of a key physiological innovation that promoted high diversification rates. C4 photosynthesis, a complex suite of traits that improves photosynthetic efficiency under conditions of drought, high temperatures, and low atmospheric CO2, has evolved repeatedly in one lineage of grasses and was consistently associated with elevated diversification rates. In most cases there was a significant lag time between the origin of the pathway and subsequent radiations, suggesting that the ‘C4 effect’ is complex and derives from the interplay of the C4 syndrome with other factors. We also identified comparable radiations occurring during the same time period in C3 Pooid grasses, a diverse, cold-adapted grassland lineage that has never evolved C4 photosynthesis. The mid to late Miocene was an especially important period of both C3 and C4 grass diversification, coincident with the global development of extensive, open biomes in both warm and cool climates. As is likely true for most “key innovations”, the C4 effect is context dependent and only relevant within a particular organismal background and when particular ecological opportunities became available. PMID:24835188

  15. Evaluation of tall rice mutant

    International Nuclear Information System (INIS)

    Hakim, L.; Azam, M.A.; Miah, A.J.; Mansur, M.A.; Akanda, H.R.

    1989-01-01

    One tall mutant (Mut NS1) of rice variety Nizersail was put to multilocation on-farm trial. It showed improvement over the parent in respect of by earlier maturity and higher grain yield at all locations and thus it appears as an improved mutant of Nizersail. (author). 6 refs

  16. Molecular biology of C4 phosphoenolpyruvate carboxylase: Structure, regulation and genetic engineering.

    Science.gov (United States)

    Rajagopalan, A V; Devi, M T; Raghavendra, A S

    1994-02-01

    Three to four families of nuclear genes encode different isoforms of phosphoenolpyruvate (PEP) carboxylase (PEPC): C4-specific, C3 or etiolated, CAM and root forms. C4 leaf PEPC is encoded by a single gene (ppc) in sorghum and maize, but multiple genes in the C4-dicot Flaveria trinervia. Selective expression of ppc in only C4-mesophyll cells is proposed to be due to nuclear factors, DNA methylation and a distinct gene promoter. Deduced amino acid sequences of C4-PEPC pinpoint the phosphorylatable serine near the N-terminus, C4-specific valine and serine residues near the C-terminus, conserved cysteine, lysine and histidine residues and PEP binding/catalytic sites. During the PEPC reaction, PEP and bicarbonate are first converted into carboxyphosphate and the enolate of pyruvate. Carboxyphosphate decomposes within the active site into Pi and CO2, the latter combining with the enolate to form oxalacetate. Besides carboxylation, PEPC catalyzes a HCO3 (-)-dependent hydrolysis of PEP to yield pyruvate and Pi. Post-translational regulation of PEPC occurs by a phosphorylation/dephosphorylation cascade in vivo and by reversible enzyme oligomerization in vitro. The interrelation between phosphorylation and oligomerization of the enzyme is not clear. PEPC-protein kinase (PEPC-PK), the enzyme responsible for phosphorylation of PEPC, has been studied extensively while only limited information is available on the protein phosphatase 2A capable of dephosphorylating PEPC. The C4 ppc was cloned and expressed in Escherichia coli as well as tobacco. The transformed E. coli produced a functional/phosphorylatable C4 PEPC and the transgenic tobacco plants expressed both C3 and C4 isoforms. Site-directed mutagenesis of ppc indicates the importance of His(138), His(579) and Arg(587) in catalysis and/or substrate-binding by the E. coli enzyme, Ser(8) in the regulation of sorghum PEPC. Important areas for further research on C4 PEPC are: mechanism of transduction of light signal during

  17. Improving our understanding of environmental controls on the distribution of C3 and C4 grasses.

    Science.gov (United States)

    Pau, Stephanie; Edwards, Erika J; Still, Christopher J

    2013-01-01

    A number of studies have demonstrated the ecological sorting of C3 and C4 grasses along temperature and moisture gradients. However, previous studies of C3 and C4 grass biogeography have often inadvertently compared species in different and relatively unrelated lineages, which are associated with different environmental settings and distinct adaptive traits. Such confounded comparisons of C3 and C4 grasses may bias our understanding of ecological sorting imposed strictly by photosynthetic pathway. Here, we used MaxEnt species distribution modeling in combination with satellite data to understand the functional diversity of C3 and C4 grasses by comparing both large clades and closely related sister taxa. Similar to previous work, we found that C4 grasses showed a preference for regions with higher temperatures and lower precipitation compared with grasses using the C3 pathway. However, air temperature differences were smaller (2 °C vs. 4 °C) and precipitation and % tree cover differences were larger (1783 mm vs. 755 mm, 21.3% vs. 7.7%, respectively) when comparing C3 and C4 grasses within the same clade vs. comparing all C4 and all C3 grasses (i.e., ignoring phylogenetic structure). These results were due to important differences in the environmental preferences of C3 BEP and PACMAD clades (the two main grass clades). Winter precipitation was found to be more important for understanding the distribution and environmental niche of C3 PACMADs in comparison with both C3 BEPs and C4 taxa, for which temperature was much more important. Results comparing closely related C3 -C4 sister taxa supported the patterns derived from our modeling of the larger clade groupings. Our findings, which are novel in comparing the distribution and niches of clades, demonstrate that the evolutionary history of taxa is important for understanding the functional diversity of C3 and C4 grasses, and should have implications for how grasslands will respond to global change. © 2012

  18. Sphingolipid base modifying enzymes in sunflower (Helianthus annuus): cloning and characterization of a C4-hydroxylase gene and a new paralogous Δ8-desaturase gene.

    Science.gov (United States)

    Moreno-Pérez, Antonio J; Martínez-Force, Enrique; Garcés, Rafael; Salas, Joaquín J

    2011-05-15

    Sphingolipids are components of plant cell membranes that participate in the regulation of important physiological processes. Unlike their animal counterparts, plant sphingolipids are characterized by high levels of base C4-hydroxylation. Moreover, desaturation at the Δ8 position predominates over the Δ4 desaturation typically found in animal sphingolipids. These modifications are due to the action of C4-hydroxylases and Δ8-long chain base desaturases, and they are important for complex sphingolipids finally becoming functional. The long chain bases of sunflower sphingolipids have high levels of hydroxylated and unsaturated moieties. Here, a C4-long chain base hydroxylase was functionally characterized in sunflower plant, an enzyme that could complement the sur2Δ mutation when heterologously expressed in this yeast mutant deficient in hydroxylation. This hydroxylase was ubiquitously expressed in sunflower, with the highest levels found in the developing cotyledons. In addition, we identified a new Δ8-long base chain desaturase gene that displays strong homology to a previously reported desaturase gene. This desaturase was also expressed in yeast and was able to change the long chain base composition of the transformed host. We studied the expression of this desaturase and compared it with that of the other isoform described in sunflower. The desaturase form studied in this paper displayed higher expression levels in developing seeds. Copyright © 2010 Elsevier GmbH. All rights reserved.

  19. Heat inactivation of leaf phosphoenolpyruvate carboxylase: Protection by aspartate and malate in C4 plants.

    Science.gov (United States)

    Rathnam, C K

    1978-01-01

    The activity of phosphoenolpyruvate (PEP) carboxylase EC 4.1.1.31 in leaf extracts of Eleusine indica L. Gaertn., a C4 plant, exhibited a temperature optimum of 35-37° C with a complete loss of activity at 50° C. However, the enzyme was protected effectively from heat inactivation up to 55° C by L-aspartate. Activation energies (Ea) for the enzyme in the presence of aspartate were 2.5 times lower than that of the control enzyme. Arrhenius plots of PEP carboxylase activity (±aspartate) showed a break in the slope around 17-20° C with a 3-fold increase in the Ea below the break. The discontinuity in the slopes was abolished by treating the enzyme extracts with Triton X-100, suggesting that PEP carboxylase in C4 plants is associated with lipid and may be a membrane bound enzyme. Depending upon the species, the major C4 acid formed during photosynthesis (malate or aspartate) was found to be more protective than the minor C4 acid against the heat inactivation of their PEP carboxylase. Oxaloacetate, the reaction product, was less effective compared to malate or aspartate. Several allosteric inhibitors of PEP carboxylase were found to be moderately to highly effective in protecting the C4 enzyme while its activators showed no significant effect. PEP carboxylase from C3 species was not protected from thermal inactivation by the C4 acids. The physiological significance of these results is discussed in relation to the high temperature tolerance of C4 plants.

  20. Photosynthetic induction in a C4, Flaveria trinervia. I. Initial products of 14CO2 assimilation and levels of whole leaf C4 metabolites

    International Nuclear Information System (INIS)

    Moore, B.D.; Edwards, G.E.

    1986-01-01

    Labeling patterns from 14 CO 2 pulses to leaves and whole leaf metabolite contents were examined during photosynthetic induction in Flaveria trinervia, a C 4 dicot of the NADP-malic enzyme subgroup. During the first one to two minutes of illumination, malate was the primary initial product of 14 CO 2 assimilation (about 77% of total 14 C incorporated). After about 5 minutes of illumination, the proportion of initial label to aspartate increased from 16 to 66%, and then gradually declined during the following 7 to 10 minutes of illumination. Nutrition experiments showed that the increase in 14 CO 2 partitioning to aspartate was delayed about 2.5 minutes in plants grown with limiting N, and was highly dampened in plants previously treated 10 to 12 days with ammonia as the sole N source. Measurements of C 4 leaf metabolites revealed several transients in metabolite pools during the first few minutes of illumination, and subsequently, more gradual adjustments in pool sizes. These include a large initial decrease in malate (about 1.6 micromoles per milligram chlorophyll) and a small initial decrease in pyruvate. There was a transient increase in alanine levels after 1 minute of illumination, which was followed by a gradual, prolonged decrease during the remainder of the induction period. Total leaf aspartate decreased initially, but temporarily doubled in amount between 5 and 10 minutes of illumination (after its surge as a primary product). These results are discussed in terms of a plausible sequence of metabolic events which lead to the formation of the intercellular metabolite gradients required in C 4 photosynthesis

  1. Enzymatic Kinetic Properties of the Lactate Dehydrogenase Isoenzyme C4 of the Plateau Pika (Ochotona curzoniae

    Directory of Open Access Journals (Sweden)

    Yang Wang

    2016-01-01

    Full Text Available Testis-specific lactate dehydrogenase (LDH-C4 is one of the lactate dehydrogenase (LDH isozymes that catalyze the terminal reaction of pyruvate to lactate in the glycolytic pathway. LDH-C4 in mammals was previously thought to be expressed only in spermatozoa and testis and not in other tissues. Plateau pika (Ochotona curzoniae belongs to the genus Ochotona of the Ochotonidea family. It is a hypoxia-tolerant species living in remote mountain areas at altitudes of 3000–5000 m above sea level on the Qinghai-Tibet Plateau. Surprisingly, Ldh-c is expressed not only in its testis and sperm, but also in somatic tissues of plateau pika. To shed light on the function of LDH-C4 in somatic cells, Ldh-a, Ldh-b, and Ldh-c of plateau pika were subcloned into bacterial expression vectors. The pure enzymes of Lactate Dehydrogenase A4 (LDH-A4, Lactate Dehydrogenase B4 (LDH-B4, and LDH-C4 were prepared by a series of expression and purification processes, and the three enzymes were identified by the method of sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE and native polyacrylamide gel electrophoresis (PAGE. The enzymatic kinetics properties of these enzymes were studied by Lineweaver-Burk double-reciprocal plots. The results showed the Michaelis constant (Km of LDH-C4 for pyruvate and lactate was 0.052 and 4.934 mmol/L, respectively, with an approximate 90 times higher affinity of LDH-C4 for pyruvate than for lactate. At relatively high concentrations of lactate, the inhibition constant (Ki of the LDH isoenzymes varied: LDH-A4 (Ki = 26.900 mmol/L, LDH-B4 (Ki = 23.800 mmol/L, and LDH-C4 (Ki = 65.500 mmol/L. These data suggest that inhibition of lactate by LDH-A4 and LDH-B4 were stronger than LDH-C4. In light of the enzymatic kinetics properties, we suggest that the plateau pika can reduce reliance on oxygen supply and enhance its adaptation to the hypoxic environments due to increased anaerobic glycolysis by LDH-C4.

  2. The Swedish mutant barley collection

    International Nuclear Information System (INIS)

    1989-01-01

    Full text: The Swedish mutation research programme in barley began about 50 years ago and has mainly been carried out at Svaloev in co-operation with the institute of Genetics at the University of Lund. The collection has been produced from different Swedish high-yielding spring barley varieties, using the following mutagens: X-rays, neutrons, several organic chemical compounds such as ethyleneimine, several sulfonate derivatives and the inorganic chemical mutagen sodium azide. Nearly 10,000 barley mutants are stored in the Nordic Gene Bank and documented in databases developed by Udda Lundquist, Svaloev AB. The collection consists of the following nine categories with 94 different types of mutants: 1. Mutants with changes in the spike and spikelets; 2. Changes in culm length and culm composition; 3. Changes in growth types; 4. Physiological mutants; 5. Changes in awns; 6. Changes in seed size and shape; 7. Changes in leaf blades; 8. Changes in anthocyanin and colour; 9. Resistance to barley powdery mildew. Barley is one of the most thoroughly investigated crops in terms of induction of mutations and mutation genetics. So far, about half of the mutants stored at the Nordic Gene Bank, have been analysed genetically; They constitute, however, only a minority of the 94 different mutant types. The genetic analyses have given valuable insights into the mutation process but also into the genetic architecture of various characters. A number of mutants of two-row barley have been registered and commercially released. One of the earliest released, Mari, an early maturing, daylength neutral, straw stiff mutant, is still grown in Iceland. The Swedish mutation material has been used in Sweden, but also in other countries, such as Denmark, Germany, and USA, for various studies providing a better understanding of the barley genome. The collection will be immensely valuable for future molecular genetical analyses of clone mutant genes. (author)

  3. The Swedish mutant barley collection

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1989-07-01

    Full text: The Swedish mutation research programme in barley began about 50 years ago and has mainly been carried out at Svaloev in co-operation with the institute of Genetics at the University of Lund. The collection has been produced from different Swedish high-yielding spring barley varieties, using the following mutagens: X-rays, neutrons, several organic chemical compounds such as ethyleneimine, several sulfonate derivatives and the inorganic chemical mutagen sodium azide. Nearly 10,000 barley mutants are stored in the Nordic Gene Bank and documented in databases developed by Udda Lundquist, Svaloev AB. The collection consists of the following nine categories with 94 different types of mutants: 1. Mutants with changes in the spike and spikelets; 2. Changes in culm length and culm composition; 3. Changes in growth types; 4. Physiological mutants; 5. Changes in awns; 6. Changes in seed size and shape; 7. Changes in leaf blades; 8. Changes in anthocyanin and colour; 9. Resistance to barley powdery mildew. Barley is one of the most thoroughly investigated crops in terms of induction of mutations and mutation genetics. So far, about half of the mutants stored at the Nordic Gene Bank, have been analysed genetically; They constitute, however, only a minority of the 94 different mutant types. The genetic analyses have given valuable insights into the mutation process but also into the genetic architecture of various characters. A number of mutants of two-row barley have been registered and commercially released. One of the earliest released, Mari, an early maturing, daylength neutral, straw stiff mutant, is still grown in Iceland. The Swedish mutation material has been used in Sweden, but also in other countries, such as Denmark, Germany, and USA, for various studies providing a better understanding of the barley genome. The collection will be immensely valuable for future molecular genetical analyses of clone mutant genes. (author)

  4. Optional use of CAM photosynthesis in two C4 species, Portulaca cyclophylla and Portulaca digyna.

    Science.gov (United States)

    Holtum, Joseph A M; Hancock, Lillian P; Edwards, Erika J; Winter, Klaus

    2017-07-01

    Low levels of crassulacean acid metabolism (CAM) are demonstrated in two species with C 4 photosynthesis, Portulaca cyclophylla and P. digyna. The expression of CAM in P. cyclophylla and P. digyna is facultative, i.e. optional. Well-watered plants did not accumulate acid at night and exhibited gas-exchange patterns consistent with C 4 photosynthesis. CAM-type nocturnal acidification was reversible in that it was induced following drought and lost when droughted plants were rewatered. In P. cyclophylla, droughting was accompanied by a small but discernible net uptake of CO 2 during the dark, whereas in P. digyna, net CO 2 exchange at night approached the CO 2 compensation point but did not transition beyond it. This report brings the number of known C 4 species with a capacity for expressing CAM to six. All are species of Portulaca. The observation of CAM in P. cyclophylla and P. digyna is the first for species in the opposite-leaved (OL) Portulacelloid-anatomy lineage of Portulaca and for the Australian clade therein. The other four species are within the alternate-leaved (AL) lineage, in the Atriploid-anatomy Oleracea and the Pilosoid-anatomy Pilosa clades. Studies of the evolutionary origins of C 4 and CAM in Portulaca will benefit from a more wide-range survey of CAM across its species, particularly in the C 3 -C 4 intermediate-containing Cryptopetala clade. Copyright © 2017 Elsevier GmbH. All rights reserved.

  5. Chronic effects of the ionic liquid [C4mim][Cl] towards the microalga Scenedesmus quadricauda

    International Nuclear Information System (INIS)

    Deng, Yun; Beadham, Ian; Wu, Jie; Chen, Xiao-Di; Hu, Lan; Gu, Jun

    2015-01-01

    Chronic effects of the ionic liquid [C 4 mim][Cl] (mp 73 °C) towards the microalga, Scenedesmus quadricauda were studied by flow cytometry, monitoring multiple endpoints of cell density, esterase activity, membrane integrity, reactive oxygen species and chlorophyll fluorescence. Toxicity was clearly in evidence, and although increased esterase activity indicated hormesis during initial exposure to [C 4 mim][Cl], inhibition of both esterase activity and chlorophyll fluorescence became apparent after 3 days. Cell density was also decreased by culturing with [C 4 mim][Cl], but this effect was clearly concentration-dependent and only became significant during the second half of the experiment. In contrast, [C 4 mim][Cl] had only a modest effect on reactive oxygen species (ROS) and caused little damage to cell membranes. - Highlights: • Use of an advanced biological technique, flow cytometry, to elucidate ionic liquid toxicity. • Chronic effects of ionic liquid. • Membrane integrity and ROS studied. • Mechanism of ionic liquid toxicity. - [C 4 mim][Cl] significantly inhibited esterase activity, chlorophyll fluorescence and cell density, having only a modest effect on reactive oxygen species and cell membranes

  6. ON THE ORIGIN OF C_4H AND CH_3OH IN PROTOSTELLAR ENVELOPES

    International Nuclear Information System (INIS)

    Lindberg, Johan E.; Charnley, Steven B.; Cordiner, Martin A.

    2016-01-01

    The formation pathways of different types of organic molecules in protostellar envelopes and other regions of star formation are subjects of intense current interest. We present here observations of C_4H and CH_3OH, tracing two distinct groups of interstellar organic molecules, toward 16 protostars in the Ophiuchus and Corona Australis molecular clouds. Together with observations in the literature, we present C_4H and CH_3OH data from single-dish observations of 40 embedded protostars. We find no correlation between the C_4H and CH_3OH column densities in this large sample. Based on this lack of correlation, a difference in line profiles between C_4H and CH_3OH, and previous interferometric observations of similar sources, we propose that the emission from these two molecules is spatially separated, with the CH_3OH tracing gas that has been transiently heated to high (∼70–100 K) temperatures and the C_4H tracing the cooler large-scale envelope where CH_4 molecules have been liberated from ices. These results provide insight in the differentiation between hot corino and warm carbon-chain chemistry in embedded protostars.

  7. Temporal and spatial variations of canopy temperature over a C3C4 mixture grassland

    Science.gov (United States)

    Shimoda, S.; Oikawa, T.

    2006-10-01

    This study discusses the photosynthetic pathway types involved in canopy temperature measurements on a mixed grassland consisting of C3 and C4 plants (dominant species in biomass were Solidago altissima (C3), Miscanthus sinensis (C4), and Imperata cylindrica (C4)). In the wet conditions immediately after the rainy season, the mean canopy temperature for S. altissima was the lowest among the dominant species, mainly due to its leaf conductance being twice as large as the other two species. Despite using the same C4 photosynthetic pathway, M. sinensis had a lower apparent canopy temperature than I. cylindrica due to a smaller proportion of sunlit elements in the field of view. In the dry conditions during late July, the mean canopy temperatures of the three dominant species were within 0.3 °C of one another. These results can be explained by poor water conditions for C3 species (S. altissima). The simultaneous survey of vegetation and thermal imaging can help clarify characteristics of C3 and C4 canopy temperature over complicated grassland.

  8. Biochemical approaches to C4 photosynthesis evolution studies: the case of malic enzymes decarboxylases.

    Science.gov (United States)

    Saigo, Mariana; Tronconi, Marcos A; Gerrard Wheeler, Mariel C; Alvarez, Clarisa E; Drincovich, María F; Andreo, Carlos S

    2013-11-01

    C4 photosynthesis enables the capture of atmospheric CO2 and its concentration at the site of RuBisCO, thus counteracting the negative effects of low atmospheric levels of CO2 and high atmospheric levels of O2 (21 %) on photosynthesis. The evolution of this complex syndrome was a multistep process. It did not occur by simply recruiting pre-exiting components of the pathway from C3 ancestors which were already optimized for C4 function. Rather it involved modifications in the kinetics and regulatory properties of pre-existing isoforms of non-photosynthetic enzymes in C3 plants. Thus, biochemical studies aimed at elucidating the functional adaptations of these enzymes are central to the development of an integrative view of the C4 mechanism. In the present review, the most important biochemical approaches that we currently use to understand the evolution of the C4 isoforms of malic enzyme are summarized. It is expected that this information will help in the rational design of the best decarboxylation processes to provide CO2 for RuBisCO in engineering C3 species to perform C4 photosynthesis.

  9. Photosynthetic responses of C3 and C4 species to seasonal water variability and competition.

    Science.gov (United States)

    Niu, Shuli; Yuan, Zhiyou; Zhang, Yanfang; Liu, Weixing; Zhang, Lei; Huang, Jianhui; Wan, Shiqiang

    2005-11-01

    This study examined the impacts of seasonal water variability and interspecific competition on the photosynthetic characteristics of a C3 (Leymus chinensis) and a C4 (Chloris virgata) grass species. Plants received the same amount of water but in three seasonal patterns, i.e. the one-peak model (more water in the summer than in the spring and autumn), the two-peak model (more water in the spring and autumn than in the summer), and the average model (water evenly distributed over the growing season). The effects of water variability on the photosynthetic characteristics of the C3 and C4 species were dependent on season. There were significant differences in the photosynthetic characteristics of the C4 species in the summer and the C3 species in the autumn among the three water treatments. Interspecific competition exerted negative impacts on the C3 species in August and September but had no effects on the C4 species in any of the four measuring dates. The relative competitive capability of the two species was not altered by water availability. The assimilation rate, the maximum quantum yield of net CO2 assimilation, and the maximum rate of carboxylation of the C3 species were 13-56%, 5-11%, and 11-48% greater, respectively, in a monoculture than in a mixture in August and September. The results demonstrated that the photosynthetic characteristics of the C3 and C4 species were affected by water availability, but the effects varied considerably with season.

  10. Radiation-induced darkening of ionic liquid [C4mim][NTf2] and its decoloration

    International Nuclear Information System (INIS)

    Yuan Liyong; Peng Jing; Xu Ling; Zhai Maolin; Li Jiuqiang; Wei Genshuan

    2009-01-01

    The radiation effect on a hydrophobic room-temperature ionic liquid (RTIL), 1-butyl-3-methyl-imidazolium bis[(trifluoromethyl)sulfonyl]imide ([C 4 mim][NTf 2 ]), was studied by γ-irradiation under nitrogen atmosphere. Accompanied by color darkening and increase of light absorbance in a wide wavelength range, a distinct absorption peak at around 290 nm for irradiated [C 4 mim][NTf 2 ] appeared when acetonitrile was used as solvent, and the intensity of the peak enhanced with increasing dose. The spectrophotometric study on the irradiated RTILs containing 1,3-dialkylimidazolium cations associated with different inorganic anions revealed that the peak is ascribed to the radiolysis products of the [C 4 mim] + . And the wavelength of the peak was affected by alkyl chain length on imidazolium cation, while the intensity of the peak was influenced by anions. With incorporating a little amounts of oxidants, such as KMnO 4 and HNO 3 into irradiated [C 4 mim][NTf 2 ], the intensity of the peak at 290 nm decreased obviously and the decoloration of [C 4 mim][NTf 2 ] occurred, suggesting that the peak at 290 nm is assigned to the colored species and the species can be oxidized.

  11. Improvement of photosynthesis in rice (Oryza sativa L.) by inserting the C4 pathway.

    Science.gov (United States)

    Karki, Shanta; Rizal, Govinda; Quick, William Paul

    2013-10-28

    To boost food production for a rapidly growing global population, crop yields must significantly increase. One of the avenues being recently explored is the improvement of photosynthetic capacity by installing the C4 photosynthetic pathway into C3 crops like rice to drastically increase their yield. Crops with an enhanced photosynthetic mechanism would better utilize the solar radiation that can be translated into yield. This subsequently will help in producing more grain yield, reduce water loss and increase nitrogen use efficiency especially in hot and dry environments. This review provides a summary of the factors that need to be modified in rice so that the C4 pathway can be introduced successfully. It also discusses the differences between the C3 and C4 photosynthetic pathways in terms of anatomy, biochemistry and genetics.

  12. Expression of the C3-C 4 intermediate character in somatic hybrids between Brassica napus and the C3-C 4 species Moricandia arvensis.

    Science.gov (United States)

    O'Neill, C M; Murata, T; Morgan, C L; Mathias, R J

    1996-12-01

    The wild crucifer Moricandia arvensis is a potential source of alien genes for the genetic improvement of related Brassica crops. In particular M. arvensis has a C3-C4 intermediate photosynthetic mechanism which results in enhanced recapture of photorespired CO2 and may increase plant water-use efficiency. In order to transfer this trait into Brassica napus, somatic hybridisations were made between leaf mesophyll protoplasts from cultured M. arvensis shoot tips and hypocotyl protoplasts from three Brassica napus cultivars, 'Ariana', 'Cobra' and 'Westar'. A total of 23 plants were recovered from fusion experiments and established in the greenhouse. A wide range of chromosome numbers were observed among the regenerated plants, including some apparent mixoploids. Thirteen of the regenerated plants were identified as nuclear hybrids between B. napus and M. arvensis on the basis of isozyme analysis. The phenotypes of these hybrids were typically rather B. napus-like, but much variability was observed, including variation in flower colour, leaf shape and colour, leaf waxiness, fertility and plant vigour. CO2 compensation point measurements on the regenerated plants demonstrated that 3 of the hybrids express the M. arvensis C3-C4 intermediate character at the physiological level. Semi-thin sections through leaf tissues of these 3 plants revealed the presence of a Kranz-like leaf anatomy characteristic of M. arvensis but not found in B. napus. This is the first report of the expression of this potentially important agronomic trait, transferred from Moricandia, in M. arvensis x B. napus hybrids.

  13. Histological Characterization of the Dicer1 Mutant Zebrafish Retina

    Directory of Open Access Journals (Sweden)

    Saeed Akhtar

    2015-01-01

    Full Text Available DICER1, a multidomain RNase III endoribonuclease, plays a critical role in microRNA (miRNA and RNA-interference (RNAi functional pathways. Loss of Dicer1 affects different developmental processes. Dicer1 is essential for retinal development and maintenance. DICER1 was recently shown to have another function of silencing the toxicity of Alu RNAs in retinal pigment epithelium (RPE cells, which are involved in the pathogenesis of age related macular degeneration. In this study, we characterized a Dicer1 mutant fish line, which carries a nonsense mutation (W1457Ter induced by N-ethyl-N-nitrosourea mutagenesis. Zebrafish DICER1 protein is highly conserved in the evolution. Zebrafish Dicer1 is expressed at the earliest stages of zebrafish development and persists into late developmental stages; it is widely expressed in adult tissues. Homozygous Dicer1 mutant fish (DICER1W1457Ter/W1457Ter have an arrest in early growth with significantly smaller eyes and are dead at 14–18 dpf. Heterozygous Dicer1 mutant fish have similar retinal structure to that of control fish; the retinal pigment epithelium (RPE cells are normal with no sign of degeneration at the age of 20 months.

  14. C# 4, ASP.NET 4, and WPF, with Visual Studio 2010 jump start

    CERN Document Server

    Nagel, Christian; Stephens, Rod; Hanselman, Scott; Glynn, Jay; Rader, Devin; Watson, Karli; Skinner, Morgan

    2010-01-01

    This Wrox Blox is a value-packed resource to help experienced .NETdevelopers learn the new .NET release. It is excerpted from theWrox books: Professional C# 4 and .NET 4, Professional ASP.NET4, and WPF Programmer's Reference by Christian Nagel,Bill Evjen, Scott Hanselman, and Rod Stephens, and includes morethan 100 print book pages drawn from these three key titles. It isan excellent resource to help .NET developers get up to speed faston .NET 4, C# 4.0, ASP.NET 4, and WPF, providing all theinformation needed to program with the important new features,including: C# Dynamic Types and Par

  15. C4.4A as a biomarker in pulmonary adenocarcinoma and squamous cell carcinoma

    DEFF Research Database (Denmark)

    Jacobsen, Benedikte; Kriegbaum, Mette Camilla; Santoni-Rugiu, Eric

    2014-01-01

    to invasive carcinomas of the lung, i.e., in bronchial hyperplasia/metaplasia and atypical adenomatous hyperplasia. In the stages leading to pulmonary squamous cell carcinoma, expression is sustained in dysplasia, carcinoma in situ and invasive carcinomas, and this pertains to the normal presence of C4.4A...... in squamous epithelium. In pulmonary adenocarcinomas, a fraction of cases is positive for C4.4A, which is surprising, given the origin of these carcinomas from mucin-producing and not squamous epithelium. Interestingly, this correlates with a highly compromised patient survival and a predominant solid tumor...

  16. Investigating C4 Grass Contributions to N-alkane Based Paleoclimate Reconstructions

    Science.gov (United States)

    Doman, C. E.; Enders, S. K.; Chadwick, O.; Freeman, K. H.

    2014-12-01

    Plant wax n-alkanes are long-chain, saturated hydrocarbons contained within the protective waxy cuticle on leaves. These lipids are pervasive and persistent in soils and sediments and thus are ideal biomarkers of ancient terrestrial organic matter. In ecosystems dominated by C3 plants, the relationship between the carbon isotopic value of whole leaves and lipids is fairly well documented, but this relationship has not been fully investigated for plants that use C4 photosynthesis. In both cases, it is unclear if the isotopic relationships are sensitive to environmental conditions, or reflect inherited characteristics. This study used a natural climate gradient on the Kohala peninsula of Hawaii to investigate relationships between climate and the δ13C and δ2H values of n-alkanes in C3 and C4 plants. δ13C of C3 leaves and lipids decreased 5 ‰ from the driest to the wettest sites, consistent with published data. Carbon isotope values of C4 plants showed no relationship to moisture up to 1000 mm mean annual precipitation (MAP). Above this threshold, δ 13C values were around 10‰ more depleted, likely due to a combination of canopy effects and C4 grasses growing in an uncharacteristically wet and cold environment. In C3 plants, the fractionation between leaf and lipid carbon isotopes did not vary with MAP, which allows estimations of δ13C leaf to be made from alkanes preserved in ancient sediments. Along this transect, C3 plants produce around twice the quantity of n-alkanes as C4 grasses. C4 grasses produce longer carbon chains. As a result, n-alkanes in the geologic record will be biased towards C3 plants, but the presence of alkanes C33 and C35 indicate the contributions of C4 grasses. In both C3 and C4 plants, average chain length increased with mean annual precipitation, but the taxonomic differences in chain length were greater than environmental differences. Hydrogen isotopes of n-alkanes show no trends with MAP, but do show clear differences between plant

  17. Research On C4.5 As One Of The Inductive Learning Techniques

    OpenAIRE

    Yıldırım, Savaş

    2003-01-01

    The thesis in hand deals with C4.5 (Decision Tree Construction Algorithm) as one of the most significant techniques of machine learning, and how it differs from its older version ID3. With this aim in mind, not only the approaches provided by C4.5 but also other approaches are examined. The decision tree algorithms are useful in a variety of spheres from defense to medicine or economics; and bear a vital importance for decision support systems in these areas. Written by Quinlan in 1993 in C p...

  18. Analisis Kinerja Algoritma C4.5 Pada Sistem Pendukung Keputusan Penentuan Jenis Pelatihan

    OpenAIRE

    Oktavia, Chaulina Alfianti; Rahmadwati, Rahmadwati; Santoso, Purnomo Budi

    2015-01-01

    - This study describes the application of the algorithm C4.5 on decision support systems to support trainees in PPTIK STIKI Malang in choosing the appropriate type of training. Decision support system based on several criteria derived from the data filled out by participants prior to register as a participant. Further analysis using an algorithm that is used to form a C4.5 decision tree. The decision tree is a method of classification and prediction that represent rules. the rule is then deve...

  19. The C4 clustering algorithm: Clusters of galaxies in the Sloan Digital Sky Survey

    Energy Technology Data Exchange (ETDEWEB)

    Miller, Christopher J.; Nichol, Robert; Reichart, Dan; Wechsler, Risa H.; Evrard, August; Annis, James; McKay, Timothy; Bahcall, Neta; Bernardi, Mariangela; Boehringer,; Connolly, Andrew; Goto, Tomo; Kniazev, Alexie; Lamb, Donald; Postman, Marc; Schneider, Donald; Sheth, Ravi; Voges, Wolfgang; /Cerro-Tololo InterAmerican Obs. /Portsmouth U.,

    2005-03-01

    We present the ''C4 Cluster Catalog'', a new sample of 748 clusters of galaxies identified in the spectroscopic sample of the Second Data Release (DR2) of the Sloan Digital Sky Survey (SDSS). The C4 cluster-finding algorithm identifies clusters as overdensities in a seven-dimensional position and color space, thus minimizing projection effects that have plagued previous optical cluster selection. The present C4 catalog covers {approx}2600 square degrees of sky and ranges in redshift from z = 0.02 to z = 0.17. The mean cluster membership is 36 galaxies (with redshifts) brighter than r = 17.7, but the catalog includes a range of systems, from groups containing 10 members to massive clusters with over 200 cluster members with redshifts. The catalog provides a large number of measured cluster properties including sky location, mean redshift, galaxy membership, summed r-band optical luminosity (L{sub r}), velocity dispersion, as well as quantitative measures of substructure and the surrounding large-scale environment. We use new, multi-color mock SDSS galaxy catalogs, empirically constructed from the {Lambda}CDM Hubble Volume (HV) Sky Survey output, to investigate the sensitivity of the C4 catalog to the various algorithm parameters (detection threshold, choice of passbands and search aperture), as well as to quantify the purity and completeness of the C4 cluster catalog. These mock catalogs indicate that the C4 catalog is {approx_equal}90% complete and 95% pure above M{sub 200} = 1 x 10{sup 14} h{sup -1}M{sub {circle_dot}} and within 0.03 {le} z {le} 0.12. Using the SDSS DR2 data, we show that the C4 algorithm finds 98% of X-ray identified clusters and 90% of Abell clusters within 0.03 {le} z {le} 0.12. Using the mock galaxy catalogs and the full HV dark matter simulations, we show that the L{sub r} of a cluster is a more robust estimator of the halo mass (M{sub 200}) than the galaxy line-of-sight velocity dispersion or the richness of the cluster

  20. Can miscanthus C4 photosynthesis compete with festulolium C3 photosynthesis in a temperate climate?

    DEFF Research Database (Denmark)

    Jiao, Xiurong; Kørup, Kirsten; Andersen, Mathias Neumann

    2017-01-01

    Miscanthus, a perennial grass with C4 photosynthesis, is regarded as a promising energy crop due to its high biomass productivity. Compared with other C4 species, most miscanthus genotypes have high cold tolerances at 14 °C. However, in temperate climates, temperatures below 14 °C are common...... at each temperature level and still maintained photosynthesis after growing for a longer period at 6/4 °C. Only two of five measured miscanthus genotypes increased photosynthesis immediately after the temperature was raised again. The photosynthetic capacity of festulolium was significantly higher at 10...

  1. A study of immunoglobulins and complements (C3 &C4 in alopecia areata

    Directory of Open Access Journals (Sweden)

    Sharma R

    1995-01-01

    Full Text Available Estimation of serum Immunoglobulins (IgG, IgM and IgA and complements (C3 and C4 was carried out in 100 cases of alopecia areata as per method described by Mancini (1965.[1] Clinically patients were divided in two groups, alopecia areata circumscribed (group I and severe alopecia areata (group II. Significant decrease in levels of one or more Immunoglobulins were observed in most of the patients. However, Serum complements (C3 and C4 were within range of normal control values

  2. Mutants of alfalfa mosaic virus

    International Nuclear Information System (INIS)

    Roosien, J.

    1983-01-01

    In this thesis the isolation and characterization of a number of mutants of alfalfa mosaic virus, a plant virus with a coat protein dependent genome, is described. Thermo-sensitive (ts) mutants were selected since, at least theoretically, ts mutations can be present in all virus coded functions. It was found that a high percentage of spontaneous mutants, isolated because of their aberrant symptoms, were ts. The majority of these isolates could grow at the non-permissive temperature in the presence of a single wild type (wt) component. To increase the mutation rate virus preparations were treated with several mutagens. After nitrous acid treatment or irradiation with ultraviolet light, an increase in the level of mutations was observed. UV irradiation was preferred since it did not require large amounts of purified viral components. During the preliminary characterization of potential ts mutants the author also obtained one structural and several symptom mutants which were analysed further (chapter 7, 8 and 9). The properties of the ts mutants are described in chapter 3-7. (Auth.)

  3. Root hair mutants of barley

    International Nuclear Information System (INIS)

    Engvild, K.C.; Rasmussen, K.

    2005-01-01

    Barley mutants without root hairs or with short or reduced root hairs were isolated among M 2 seeds of 'Lux' barley (Hordeum vulgare L.) after acidified sodium azide mutagenesis. Root hair mutants are investigated intensively in Arabidopsis where about 40 genes are known. A few root hair mutants are known in maize, rice, barley and tomato. Many plants without root hairs grow quite well with good plant nutrition, and mutants have been used for investigations of uptake of strongly bound nutrients like phosphorus, iron, zinc and silicon. Seed of 'Lux' barley (Sejet Plant Breeding, Denmark) were soaked overnight, and then treated with 1.5-millimolarsodium azide in 0.1 molar sodium phosphate buffer, pH 3, for 2.5 hours according to the IAEA Manual on Mutation Breeding (2nd Ed.). After rinsing in tap water and air-drying, the M 2 seeds were sown in the field the same day. Spikes, 4-6 per M 1 plant, were harvested. The mutation frequency was similar to that obtained with other barley cultivars from which low-phytate mutants were isolated [5]. Seeds were germinated on black filter paper in tap water for 3 or 4 days before scoring for root hair mutants

  4. Genetic analysis of tachyzoite to bradyzoite differentiation mutants in Toxoplasma gondii reveals a hierarchy of gene induction.

    Science.gov (United States)

    Singh, Upinder; Brewer, Jeremy L; Boothroyd, John C

    2002-05-01

    Developmental switching in Toxoplasma gondii, from the virulent tachyzoite to the relatively quiescent bradyzoite stage, is responsible for disease propagation and reactivation. We have generated tachyzoite to bradyzoite differentiation (Tbd-) mutants in T. gondii and used these in combination with a cDNA microarray to identify developmental pathways in bradyzoite formation. Four independently generated Tbd- mutants were analysed and had defects in bradyzoite development in response to multiple bradyzoite-inducing conditions, a stable phenotype after in vivo passages and a markedly reduced brain cyst burden in a murine model of chronic infection. Transcriptional profiles of mutant and wild-type parasites, growing under bradyzoite conditions, revealed a hierarchy of developmentally regulated genes, including many bradyzoite-induced genes whose transcripts were reduced in all mutants. A set of non-developmentally regulated genes whose transcripts were less abundant in Tbd- mutants were also identified. These may represent genes that mediate downstream effects and/or whose expression is dependent on the same transcription factors as the bradyzoite-induced set. Using these data, we have generated a model of transcription regulation during bradyzoite development in T. gondii. Our approach shows the utility of this system as a model to study developmental biology in single-celled eukaryotes including protozoa and fungi.

  5. Response to elevated CO 2 from a natural spring in a C 4 ...

    African Journals Online (AJOL)

    Eragrostis racemosa (C4), a slow grower, showed no significant responses to high CO2 during the late season. CO2-responsiveness in the field generally followed the seasonal phenologies of each species, being greatest during the most active growth period. Keywords: climate change; gas exchange; photosynthetic ...

  6. Bulk plasma fragmentation in a C4F8 inductively coupled plasma: A hybrid modeling study

    International Nuclear Information System (INIS)

    Zhao, Shu-Xia; Zhang, Yu-Ru; Gao, Fei; Wang, You-Nian; Bogaerts, Annemie

    2015-01-01

    A hybrid model is used to investigate the fragmentation of C 4 F 8 inductive discharges. Indeed, the resulting reactive species are crucial for the optimization of the Si-based etching process, since they determine the mechanisms of fluorination, polymerization, and sputtering. In this paper, we present the dissociation degree, the density ratio of F vs. C x F y (i.e., fluorocarbon (fc) neutrals), the neutral vs. positive ion density ratio, details on the neutral and ion components, and fractions of various fc neutrals (or ions) in the total fc neutral (or ion) density in a C 4 F 8 inductively coupled plasma source, as well as the effect of pressure and power on these results. To analyze the fragmentation behavior, the electron density and temperature and electron energy probability function (EEPF) are investigated. Moreover, the main electron-impact generation sources for all considered neutrals and ions are determined from the complicated C 4 F 8 reaction set used in the model. The C 4 F 8 plasma fragmentation is explained, taking into account many factors, such as the EEPF characteristics, the dominance of primary and secondary processes, and the thresholds of dissociation and ionization. The simulation results are compared with experiments from literature, and reasonable agreement is obtained. Some discrepancies are observed, which can probably be attributed to the simplified polymer surface kinetics assumed in the model

  7. Photosynthetic plasticity in Flaveria brownii: Growth irradiance and the expression of C4 photosynthesis

    International Nuclear Information System (INIS)

    Cheng, Shuhua; Moore, B.D.; Wu, Jingrui; Edwards, G.E.; Ku, M.S.B.

    1989-01-01

    Photosynthesis was examined in leaves of Flaveria brownii A. M. Powell, grown under either 14% or 100% full sunlight. In leaves of high light grown plants, the CO 2 compensation point and the inhibition of photosynthesis by 21% O 2 were significantly lower, while activities of ribulose 1,5-bisphosphate carboxylase/oxygenase and various C 4 cycle enzymes were considerably higher than those in leaves grown in low light. Both the CO 2 compensation point and the degree of O 2 inhibition of apparent photosynthesis were relatively insensitive to the light intensity used during measurements with plants from either growth conditions. Partitioning of atmospheric CO 2 between Rubisco of the C 3 pathway and phosphoenolpyruvate carboxylase of the C 4 cycle was determined by exposing leaves to 14 CO 2 for 3 to 16 seconds, and extrapolating the labeling curves of initial products to zero time. Results indicated that ∼94% of the CO 2 was fixed by the C 4 cycle in high light grown plants, versus ∼78% in low light grown plants. Consistent with the carbon partitioning patterns, photosynthetic enzyme activities (on a chlorophyll basis) in protoplasts from leaves of high light grown plants showed a more C 4 -like pattern of compartmentation. Pyruvate,Pi dikinase and phosphoenolpyruvate carboxylase were more enriched in the mesophyll cells, while NADP-malic enzyme and ribulose 1,5-bisphosphate carboxylase/oxygenase were relatively more abundant in the bundle sheath cells of high light than of low light grown plants

  8. Integration of C4-specific ppdk gene of Echinochloa to C3 upland ...

    African Journals Online (AJOL)

    SERVER

    2008-03-18

    Mar 18, 2008 ... rice though increased photoinhibition was noted under high light intensity. Key words: Pyrurate ... PPDK is regarded as an important target in efforts to .... transgenic upland rice. The introduction of C4 photosynthetic enzyme into C3 plants was intended to improve the efficiency of solar energy utilization.

  9. Nitrogen washing from C3 and C4 cover grasses residues by rain

    Directory of Open Access Journals (Sweden)

    Ciro Antonio Rosolem

    2010-12-01

    Full Text Available Crop species with the C4 photosynthetic pathway are more efficient in assimilating N than C3 plants, which results in different N amounts prone to be washed from its straw by rain water. Such differences may affect N recycling in agricultural systems where these species are grown as cover crops. In this experiment, phytomass production and N leaching from the straw of grasses with different photosynthetic pathways were studied in response to N application. Pearl millet (Pennisetum glaucum and congo grass (Brachiaria ruziziensis with the C4 photosynthetic pathway, and black oat (Avena Strigosa and triticale (X Triticosecale, with the C3 photosynthetic pathway, were grown for 47 days. After determining dry matter yields and N and C contents, a 30 mm rainfall was simulated over 8 t ha-1 of dry matter of each plant residue and the leached amounts of ammonium and nitrate were determined. C4 grasses responded to higher fertilizer rates, whereas N contents in plant tissue were lower. The amount of N leached from C4 grass residues was lower, probably because the C/N ratio is higher and N is more tightly bound to organic compounds. When planning a crop rotation system it is important to take into account the difference in N release of different plant residues which may affect N nutrition of the subsequent crop.

  10. PENERAPAN ALGORITMA C4.5 UNTUK PREDIKSI PENGGUNAAN JENIS KONTRASEPSI BERBASIS WEB

    Directory of Open Access Journals (Sweden)

    Rusda Wajhillah

    2017-09-01

    Keluarga Berencana (KB merupakan suatu program pemerintah yang dirancang untuk menyeimbangkan antara kebutuhan dan jumlah penduduk dengan menggunakan alat kontrasepsi. Kurangnya pengetahuan tentang kontrasepsi menyebabkan tidak sedikit akseptor lebih memilih menggunakan kontrasepsi berdasarkan coba-coba atau bahkan mengikuti saran dari orang lain yang kurang paham terhadap alat kontrasepsi. Oleh sebab itu, diperlukan adanya tindakan/penanganan khusus untuk mempermudah para akseptor dalam memilih kontrasepsi yang efektif dan sesuai dengan kondisi tubuhnya. Algoritma C4.5 yaitu metode pohon keputusan mengubah fakta yang sangat besar menjadi pohon keputusan yang merepresentasikan aturan. Aturan dapat dengan mudah dipahami dengan bahasa alami.Untuk itu, dalam penelitian ini akan dilakukan analisa data penggunaan jenis kontrasepsi menggunakan klasifikasi data mining yakni algoritma C4.5 dengan menggunakan beberapa parameter diantaranya usia, jumlah anak, tekanan darah dan riwayat penyakit yang akan diaplikasikan dalam bentuk web guna mempermudah para akseptor dalam mendapatkan nilai informasi yang lebih cepat dan fleksibel. Dari 130 jumlah kasus yang terdiri dari 104 kasus akseptor pengguna kontrasepsi hormonal dan 26 kasus pengguna kontrasepsi non hormonal yang didapat dari Posyandu Desa Nyangkowek Kecamatan Cicurug, maka didapatkan 14 rule yang dihasilkan dari pohon keputusan algoritma C4.5 dengan jumlah class non hormonal sebanyak 8 rule dan jumlah class hormonal sebanyak 6 rule serta dievaluasi dengan pengujian Cross Validation yangmenghasilkan tingkat akurasi sebesar 85,38%, sehingga dapat disimpulkan bahwa penelitian ini dapat membantu para akseptor KB dalam memilih jenis kontrasepsi yang efektif. Kata Kunci: Akseptor, Algoritma C4.5, Kontrasepsi, Sistem Pakar

  11. Structural analysis and tissue localization of human C4.4A

    DEFF Research Database (Denmark)

    Hansen, Line V.; Gårdsvoll, Henrik; Nielsen, Boye S

    2004-01-01

    recombinant human C4.4A is extensively modified by post-translational glycosylation, which include 5-6 N-linked carbohydrates primarily located in or close to its second Ly-6/uPAR/alpha-neurotoxin module and approximately 15 O-linked carbohydrates clustered in a Ser/Thr/Pro-rich region at the C...

  12. Optimization of C4.5 algorithm-based particle swarm optimization for breast cancer diagnosis

    Science.gov (United States)

    Muslim, M. A.; Rukmana, S. H.; Sugiharti, E.; Prasetiyo, B.; Alimah, S.

    2018-03-01

    Data mining has become a basic methodology for computational applications in the field of medical domains. Data mining can be applied in the health field such as for diagnosis of breast cancer, heart disease, diabetes and others. Breast cancer is most common in women, with more than one million cases and nearly 600,000 deaths occurring worldwide each year. The most effective way to reduce breast cancer deaths was by early diagnosis. This study aims to determine the level of breast cancer diagnosis. This research data uses Wisconsin Breast Cancer dataset (WBC) from UCI machine learning. The method used in this research is the algorithm C4.5 and Particle Swarm Optimization (PSO) as a feature option and to optimize the algorithm. C4.5. Ten-fold cross-validation is used as a validation method and a confusion matrix. The result of this research is C4.5 algorithm. The particle swarm optimization C4.5 algorithm has increased by 0.88%.

  13. Identification of intermediates leading to chloroform and C-4 diacids in the chlorination of humic acid

    NARCIS (Netherlands)

    Sinninghe Damsté, J.S.; Leer, E.W.B. de; Erkelens, Corrie; Galan, L.

    1985-01-01

    The chlorination of terrestrial humic acid was studied at pH 7. 2 with varying chlorine to carbon ratios. The principal products are chloroform, di- and trichloroacetic acid, and chlorinated C-4 diacids. At a high chlorine dose many new chlorination products were detected, among them

  14. A Common histone modification code on C4 genes in maize and its conservation in Sorghum and Setaria italica.

    Science.gov (United States)

    Heimann, Louisa; Horst, Ina; Perduns, Renke; Dreesen, Björn; Offermann, Sascha; Peterhansel, Christoph

    2013-05-01

    C4 photosynthesis evolved more than 60 times independently in different plant lineages. Each time, multiple genes were recruited into C4 metabolism. The corresponding promoters acquired new regulatory features such as high expression, light induction, or cell type-specific expression in mesophyll or bundle sheath cells. We have previously shown that histone modifications contribute to the regulation of the model C4 phosphoenolpyruvate carboxylase (C4-Pepc) promoter in maize (Zea mays). We here tested the light- and cell type-specific responses of three selected histone acetylations and two histone methylations on five additional C4 genes (C4-Ca, C4-Ppdk, C4-Me, C4-Pepck, and C4-RbcS2) in maize. Histone acetylation and nucleosome occupancy assays indicated extended promoter regions with regulatory upstream regions more than 1,000 bp from the transcription initiation site for most of these genes. Despite any detectable homology of the promoters on the primary sequence level, histone modification patterns were highly coregulated. Specifically, H3K9ac was regulated by illumination, whereas H3K4me3 was regulated in a cell type-specific manner. We further compared histone modifications on the C4-Pepc and C4-Me genes from maize and the homologous genes from sorghum (Sorghum bicolor) and Setaria italica. Whereas sorghum and maize share a common C4 origin, C4 metabolism evolved independently in S. italica. The distribution of histone modifications over the promoters differed between the species, but differential regulation of light-induced histone acetylation and cell type-specific histone methylation were evident in all three species. We propose that a preexisting histone code was recruited into C4 promoter control during the evolution of C4 metabolism.

  15. Comprehensive approach to study complement C4 in systemic lupus erythematosus: Gene polymorphisms, protein levels and functional activity.

    Science.gov (United States)

    Tsang-A-Sjoe, M W P; Bultink, I E M; Korswagen, L A; van der Horst, A; Rensink, I; de Boer, M; Hamann, D; Voskuyl, A E; Wouters, D

    2017-12-01

    Genetic variation of the genes encoding complement component C4 is strongly associated with systemic lupus erythematosus (SLE), a chronic multi-organ auto-immune disease. This study examined C4 and its isotypes on a genetic, protein, and functional level in 140 SLE patients and 104 healthy controls. Gene copy number (GCN) variation, silencing CT-insertion, and the retroviral HERV-K(C4) insertion) were analyzed with multiplex ligation-dependent probe amplification. Increased susceptibility to SLE was found for low GCN (≪2) of C4A. Serositis was the only clinical manifestation associated with low C4A GCN. One additional novel silencing mutation in the C4A gene was found by Sanger sequencing. This mutation causes a premature stop codon in exon 11. Protein concentrations of C4 isoforms C4A and C4B were determined with ELISA and were significantly lower in SLE patients compared to healthy controls. To study C4 isotypes on a functional level, a new C4 assay was developed, which distinguishes C4A from C4B by its binding capacity to amino or hydroxyl groups, respectively. This assay showed high correlation with ELISA and detected crossing over of Rodgers and Chido antigens in 3.2% (8/244) of individuals. The binding capacity of available C4 to its substrates was unaffected in SLE. Our study provides, for the first time, a complete overview of C4 in SLE from genetic variation to binding capacity using a novel test. As this test detects crossing over of Rodgers and Chido antigens, it will allow for more accurate measurement of C4 in future studies. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Mutants induced in winter rye (Secale cereale L.): Short straw-mutant No. 2714 and late-senescence mutant

    Energy Technology Data Exchange (ETDEWEB)

    Muszynski, S; Darlewska, M [Department of Plant Breeding and Seed Science, Warsaw Agricultural University, Warsaw (Poland)

    1990-01-01

    Full text: Mutants were induced by treating dormant seeds with ionizing radiation (fast neutrons) or chemicals (N-nitroso-N-ethyl urea or sodium azide). Among several mutants obtained, of special value is the short-straw mutant No. 2714 and a late senescent mutant. (author)

  17. The Domain of Developmental Psychopathology.

    Science.gov (United States)

    Sroufe, L. Alan; Rutter, Michael

    1984-01-01

    Describes how developmental psychopathology differs from related disciplines, including abnormal psychology, psychiatry, clinical child psychology, and developmental psychology. Points out propositions underlying a developmental perspective and discusses implications for research in developmental psychopathology. (Author/RH)

  18. C4.4A gene ablation is compatible with normal epidermal development and causes modest overt phenotypes

    DEFF Research Database (Denmark)

    Kriegbaum, Mette Camilla; Jacobsen, Benedikte; Füchtbauer, Annette

    2016-01-01

    of C4.4A in normal physiology and cancer progression. The unchallenged C4.4A-deficient mice were viable, fertile, born in a normal Mendelian distribution and, surprisingly, displayed normal development of squamous epithelia. The C4.4A-deficient mice were, nonetheless, significantly lighter than...

  19. The endogenous retroviral insertion in the human complement C4 gene modulates the expression of homologous genes by antisense inhibition.

    Science.gov (United States)

    Schneider, P M; Witzel-Schlömp, K; Rittner, C; Zhang, L

    2001-02-01

    Intron 9 contains the complete endogenous retrovirus HERV-K(C4) as a 6.4-kb insertion in 60% of human C4 genes. The retroviral insertion is in reverse orientation to the C4 coding sequence. Therefore, expression of C4 could lead to the transcription of an antisense RNA, which might protect against exogenous retroviral infections. To test this hypothesis, open reading frames from the HERV sequence were subcloned in sense orientiation into a vector allowing expression of a beta-galactosidase fusion protein. Mouse L cells which had been stably transfected with either the human C4A or C4B gene both carrying the HERV insertion (LC4 cells), and L(Tk-) cells without the C4 gene were transiently transfected either with a retroviral construct or with the wild-type vector. Expression was monitored using an enzymatic assay. We demonstrated that (1) HERV-K(C4) antisense mRNA transcripts are present in cells constitutively expressing C4, (2) expression of retroviral-like constructs is significantly downregulated in cells expressing C4, and (3) this downregulation is further modulated in a dose-dependent fashion following interferon-gamma stimulation of C4 expression. These results support the hypothesis of a genomic antisense strategy mediated by the HERV-K(C4) insertion as a possible defense mechanism against exogenous retroviral infections.

  20. Low C4 gene copy numbers are associated with superior graft survival in patients transplanted with a deceased donor kidney

    DEFF Research Database (Denmark)

    Bay, Jakob T; Schejbel, Lone; Madsen, Hans O

    2013-01-01

    rejection, but a relationship between graft survival and serum C4 concentration as well as C4 genetic variation has not been established. We evaluated this using a prospective study design of 676 kidney transplant patients and 211 healthy individuals as controls. Increasing C4 gene copy numbers......Complement C4 is a central component of the classical and the lectin pathways of the complement system. The C4 protein exists as two isotypes C4A and C4B encoded by the C4A and C4B genes, both of which are found with varying copy numbers. Deposition of C4 has been implicated in kidney graft...... significantly correlated with the C4 serum concentration in both patients and controls. Patients with less than four total copies of C4 genes transplanted with a deceased donor kidney experienced a superior 5-year graft survival (hazard ratio 0.46, 95% confidence interval: 0.25-0.84). No significant association...

  1. Mutants dissecting development and behaviour in drosophila

    International Nuclear Information System (INIS)

    Joshi, Adita; Chandrashekaran, Shanti; Sharma, R.P.

    2005-01-01

    We have traced in this paper the progress in Drosophila genetics research from the 1960s, at the IARI, spearheaded by the visionary insight of M. S. Swaminathan. The work started with the study of indirect effect of radiation and the synergistic interaction of physical and chemical mutagens on chromosomal and genetic changes. This paved the way for the study of single gene mutants in dissecting developmental and behavioural processes. New genes discovered by us have been shown to encode conserved cell signalling molecules controlling developmental and behavioural pathways. With the complete sequencing of the Drosophila genome, in the year 2000, mounting evidence for the homology between Drosophila and human genes controlling genetic disorders became available. This has led to the fly becoming an indispensable tool for studying human diseases as well as a model to test for drugs and pharmaceuticals against human diseases and complex behavioural processes. For example wingless in Drosophila belongs to the conserved Wnt gene family and aberrant WNT signalling is linked to a range of human diseases, most notably cancer. Inhibition as well as activation of WNT signalling form the basis of an effective therapy for some cancers as well as several other clinical conditions. Recent experiments have shown that WNTs might also normally participate in self-renewal, proliferation or differentiation of stem cells and altering WNT signalling might be beneficial to the use of stem cells for therapeutic means. Likewise, the stambhA mutant of Drosophila which was discovered for its temperature-dependent paralytic behaviour is the fly homologue of Phospholipase Cβ. Phospholipase C mediated G protein signalling plays a central role in vital processes controlling epilepsy, vision, taste, and olfaction in animals. Proteins of the G-signalling pathway are of intense research interest since many human diseases involve defects in G-protein signalling pathways. In fact, approximately 50

  2. Photoelectron spectroscopy of B4O4−: Dual 3c-4e π hyperbonds and rhombic 4c-4e o-bond in boron oxide clusters

    International Nuclear Information System (INIS)

    Tian, Wen-Juan; Chen, Qiang; Ou, Ting; Li, Si-Dian; Zhao, Li-Juan; Xu, Hong-Guang; Zheng, Wei-Jun; Zhai, Hua-Jin

    2015-01-01

    Gas-phase anion photoelectron spectroscopy (PES) is combined with global structural searches and electronic structure calculations at the hybrid Becke 3-parameter exchange functional and Lee-Yang-Parr correlation functional (B3LYP) and single-point coupled-cluster with single, double, and perturbative triple excitations (CCSD(T)) levels to probe the structural and electronic properties and chemical bonding of the B 4 O 4 0/− clusters. The measured PES spectra of B 4 O 4 − exhibit a major band with the adiabatic and vertical detachment energies (ADE and VDE) of 2.64 ± 0.10 and 2.81 ± 0.10 eV, respectively, as well as a weak peak with the ADE and VDE of 1.42 ± 0.08 and 1.48 ± 0.08 eV. The former band proves to correspond to the Y-shaped global minimum of C s B 4 O 4 − ( 2 A″), with the calculated ADE/VDE of 2.57/2.84 eV at the CCSD(T) level, whereas the weak band is associated with the second lowest-energy, rhombic isomer of D 2h B 4 O 4 − ( 2 B 2g ) with the predicted ADE/VDE of 1.43/1.49 eV. Both anion structures are planar, featuring a B atom or a B 2 O 2 core bonded with terminal BO and/or BO 2 groups. The same Y-shaped and rhombic structures are also located for the B 4 O 4 neutral cluster, albeit with a reversed energy order. Bonding analyses reveal dual three-center four-electron (3c-4e) π hyperbonds in the Y-shaped B 4 O 4 0/− clusters and a four-center four-electron (4c-4e) π bond, that is, the so-called o-bond in the rhombic B 4 O 4 0/− clusters. This work is the first experimental study on a molecular system with an o-bond

  3. Photoelectron spectroscopy of B4O4-: Dual 3c-4e π hyperbonds and rhombic 4c-4e o-bond in boron oxide clusters

    Science.gov (United States)

    Tian, Wen-Juan; Zhao, Li-Juan; Chen, Qiang; Ou, Ting; Xu, Hong-Guang; Zheng, Wei-Jun; Zhai, Hua-Jin; Li, Si-Dian

    2015-04-01

    Gas-phase anion photoelectron spectroscopy (PES) is combined with global structural searches and electronic structure calculations at the hybrid Becke 3-parameter exchange functional and Lee-Yang-Parr correlation functional (B3LYP) and single-point coupled-cluster with single, double, and perturbative triple excitations (CCSD(T)) levels to probe the structural and electronic properties and chemical bonding of the B4O40/- clusters. The measured PES spectra of B4O4- exhibit a major band with the adiabatic and vertical detachment energies (ADE and VDE) of 2.64 ± 0.10 and 2.81 ± 0.10 eV, respectively, as well as a weak peak with the ADE and VDE of 1.42 ± 0.08 and 1.48 ± 0.08 eV. The former band proves to correspond to the Y-shaped global minimum of Cs B4O4- (2A″), with the calculated ADE/VDE of 2.57/2.84 eV at the CCSD(T) level, whereas the weak band is associated with the second lowest-energy, rhombic isomer of D2h B4O4- (2B2g) with the predicted ADE/VDE of 1.43/1.49 eV. Both anion structures are planar, featuring a B atom or a B2O2 core bonded with terminal BO and/or BO2 groups. The same Y-shaped and rhombic structures are also located for the B4O4 neutral cluster, albeit with a reversed energy order. Bonding analyses reveal dual three-center four-electron (3c-4e) π hyperbonds in the Y-shaped B4O40/- clusters and a four-center four-electron (4c-4e) π bond, that is, the so-called o-bond in the rhombic B4O40/- clusters. This work is the first experimental study on a molecular system with an o-bond.

  4. Photoelectron spectroscopy of B4O4 (-): Dual 3c-4e π hyperbonds and rhombic 4c-4e o-bond in boron oxide clusters.

    Science.gov (United States)

    Tian, Wen-Juan; Zhao, Li-Juan; Chen, Qiang; Ou, Ting; Xu, Hong-Guang; Zheng, Wei-Jun; Zhai, Hua-Jin; Li, Si-Dian

    2015-04-07

    Gas-phase anion photoelectron spectroscopy (PES) is combined with global structural searches and electronic structure calculations at the hybrid Becke 3-parameter exchange functional and Lee-Yang-Parr correlation functional (B3LYP) and single-point coupled-cluster with single, double, and perturbative triple excitations (CCSD(T)) levels to probe the structural and electronic properties and chemical bonding of the B4O4 (0/-) clusters. The measured PES spectra of B4O4 (-) exhibit a major band with the adiabatic and vertical detachment energies (ADE and VDE) of 2.64 ± 0.10 and 2.81 ± 0.10 eV, respectively, as well as a weak peak with the ADE and VDE of 1.42 ± 0.08 and 1.48 ± 0.08 eV. The former band proves to correspond to the Y-shaped global minimum of Cs B4O4 (-) ((2)A″), with the calculated ADE/VDE of 2.57/2.84 eV at the CCSD(T) level, whereas the weak band is associated with the second lowest-energy, rhombic isomer of D2h B4O4 (-) ((2)B2g) with the predicted ADE/VDE of 1.43/1.49 eV. Both anion structures are planar, featuring a B atom or a B2O2 core bonded with terminal BO and/or BO2 groups. The same Y-shaped and rhombic structures are also located for the B4O4 neutral cluster, albeit with a reversed energy order. Bonding analyses reveal dual three-center four-electron (3c-4e) π hyperbonds in the Y-shaped B4O4 (0/-) clusters and a four-center four-electron (4c-4e) π bond, that is, the so-called o-bond in the rhombic B4O4 (0/-) clusters. This work is the first experimental study on a molecular system with an o-bond.

  5. Accuracy Evaluation of C4.5 and Naive Bayes Classifiers Using Attribute Ranking Method

    Directory of Open Access Journals (Sweden)

    S. Sivakumari

    2009-03-01

    Full Text Available This paper intends to classify the Ljubljana Breast Cancer dataset using C4.5 Decision Tree and Nai?ve Bayes classifiers. In this work, classification is carriedout using two methods. In the first method, dataset is analysed using all the attributes in the dataset. In the second method, attributes are ranked using information gain ranking technique and only the high ranked attributes are used to build the classification model. We are evaluating the results of C4.5 Decision Tree and Nai?ve Bayes classifiers in terms of classifier accuracy for various folds of cross validation. Our results show that both the classifiers achieve good accuracy on the dataset.

  6. Molar Surface Gibbs Energy of the Aqueous Solution of Ionic Liquid [C4mim][Oac

    Institute of Scientific and Technical Information of China (English)

    TONG Jing; ZHENG Xu; TONG Jian; QU Ye; LIU Lu; LI Hui

    2017-01-01

    The values of density and surface tension for aqueous solution of ionic liquid(IL) 1-butyl-3-methylimidazolium acetate([C4mim][OAc]) with various molalities were measured in the range of 288.15-318.15 K at intervals of 5 K.On the basis of thermodynamics,a semi-empirical model-molar surface Gibbs energy model of the ionic liquid solution that could be used to predict the surface tension or molar volume of solutions was put forward.The predicted values of the surface tension for aqueous [C4im][OAc] and the corresponding experimental ones were highly correlated and extremely similar.In terms of the concept of the molar Gibbs energy,a new E(o)tv(o)s equation was obtained and each parameter of the new equation has a clear physical meaning.

  7. The urokinase receptor and its structural homologue C4.4A in human cancer

    DEFF Research Database (Denmark)

    Jacobsen, B; Ploug, M

    2008-01-01

    The urokinase-type plasminogen activator receptor (uPAR) and its structural homologue C4.4A are multidomain members of the Ly6/uPAR/alpha-neurotoxin protein domain family. Both are glycosylphosphatidylinositol-anchored membrane glycoproteins encoded by neighbouring genes located on chromosome 19q13...... that high protein expression in tumour cells of non-small cell pulmonary adenocarcinomas is associated with a particularly severe disease progression. This review will evaluate structural-functional and disease-related aspects of uPAR and C4.4A with a view to possible pharmacological targeting strategies...... in the human genome. The structural relationship between the two proteins is, however, not reflected at the functional level. Whereas uPAR has a well-established role in regulating and focalizing uPA-mediated plasminogen activation to the surface of those cells expressing the receptor, the biological function...

  8. Separation process of isobutene and 1-butene from spent C4 fraction

    International Nuclear Information System (INIS)

    Araki, M.; Okamura, M.; Deguchi, T.; Higashio, H.

    1987-01-01

    The following is the summary of characteristics of Sumitomo's MTBE process for C 4 separation: 1) High purity isobutylene and 1-butene are economically separated from spent C 4 . 2) No solvents or chemicals are used and little by-product is generated. Therefore, the process is simple and results in relatively low plant capital investment and running cost. 3) No special acid-resistant materials are required for the equipment and facilities of the process. 4) Since reactions in the process are made under mild conditions, no special high temperature or pressure is required. 5) Operation and maintenance work are easy. The process can be operated by a relatively small number of operators

  9. Excitation function of elastic scattering on 12C + 4He system, at low energies

    International Nuclear Information System (INIS)

    Perez-Torres, R.; Aguilera, E. F.; Martinez-Quiroz, E.; Murillo, G.; Belyaeva, T. L.; Maldonado-Velazquez, M.

    2011-01-01

    Interactions in the 12 C + 4 He system are of great interest in astrophysics and to help determine the relative abundances of elements in stars, at the end of helium burning [1, 2]. The Instituto Nacional de Investigaciones Nucleares (ININ) in Mexico, have made measurements of elastic scattering for this system, using the inverse kinematics method with thick white gas [3, 4], for E CM (0.5 - 4 MeV) θ CM = 180 o . In this work we obtain excitation functions of elastic scattering of 12 C + 4 He system with angular and energy dependence; E CM = 0.5 - 4 MeV and θ CM 100 o -170 o .Using inverse kinematics method with thick white gas and energy loss tables. (Author)

  10. The C4-pathway of C-fixation in Spinacea oleracea. Pt. 1

    International Nuclear Information System (INIS)

    Boecher, M.; Kluge, M.

    1977-01-01

    Spinach leaf slices readily fix 14 C supplied from a suspension medium. The pattern of label distribution after 14 C-fixation in the light depends on the pH of the suspension medium. In the range of pH 3.5 leaf slices show labelling patterns of the C 3 type as do intact leaves or leaf slices incubated with 14 CO 2 in a gas cuvette. In contrast, if the tissue slices were suspended at pH 7.5 substantially more label appears in malate and other compounds of the C 4 -pathway. Under these conditions also the malate content of the tissue increases. The addition of NaHCO 3 at pH 3.5 increases the rate of C-fixation and nearly the whole fixed carbon is metabolized in the Calvin-cycle. The C-fixation is also increased, if NaHCO 3 is added at pH 7.5. Here both, the C 3 - and the C 4 -pathway contribute to an enhancement of the C-fixation. It is assumed, that increasing amounts of bicarbonate (substrate of PEP carboxylase) become available to the cells when the pH of the external medium is raised. This could increase an operation of the C 4 -pathway of C-fixation. This view is supported by the finding, that in contrast to low pH, the C-fixation at high pH results in a dominant labelling of the C 4 -atoms of malate. (orig.) [de

  11. Valence band photoemission from in-situ grown GaAs(100)-c(4 x 4)

    Czech Academy of Sciences Publication Activity Database

    Jiříček, Petr; Cukr, Miroslav; Bartoš, Igor; Adell, M.; Strasser, T.; Schattke, W.

    2006-01-01

    Roč. 56, č. 1 (2006), s. 21-26 ISSN 0011-4626. [Symposium on Surface Physics /10./. Praha, 11.07.2005-15.07.2005] R&D Projects: GA ČR(CZ) GA202/04/0994 Institutional research plan: CEZ:AV0Z10100521 Keywords : GaAs(100)-c(4X4) * surface states * band structure * structure plot Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.568, year: 2006

  12. Long-lived transient anion of c-C4F8O

    Czech Academy of Sciences Publication Activity Database

    Kočišek, Jaroslav; Janečková, R.; Fedor, Juraj

    2018-01-01

    Roč. 148, č. 7 (2018), č. článku 074303. ISSN 0021-9606 R&D Projects: GA ČR GA17-04844S Institutional support: RVO:61388955 Keywords : negative-ion * electron-attachment * chemistry * c4f8o * lifetimes * gases Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 2.965, year: 2016

  13. Sensitive non-radioactive determination of aminotransferase stereospecificity for C-4' hydrogen transfer on the coenzyme.

    Science.gov (United States)

    Jomrit, Juntratip; Summpunn, Pijug; Meevootisom, Vithaya; Wiyakrutta, Suthep

    2011-02-25

    A sensitive non-radioactive method for determination of the stereospecificity of the C-4' hydrogen transfer on the coenzymes (pyridoxal phosphate, PLP; and pyridoxamine phosphate, PMP) of aminotransferases has been developed. Aminotransferase of unknown stereospecificity in its PLP form was incubated in (2)H(2)O with a substrate amino acid resulted in PMP labeled with deuterium at C-4' in the pro-S or pro-R configuration according to the stereospecificity of the aminotransferase tested. The [4'-(2)H]PMP was isolated from the enzyme protein and divided into two portions. The first portion was incubated in aqueous buffer with apo-aspartate aminotransferase (a reference si-face specific enzyme), and the other was incubated with apo-branched-chain amino acid aminotransferase (a reference re-face specific enzyme) in the presence of a substrate 2-oxo acid. The (2)H at C-4' is retained with the PLP if the aminotransferase in question transfers C-4' hydrogen on the opposite face of the coenzyme compared with the reference aminotransferase, but the (2)H is removed if the test and reference aminotransferases catalyze hydrogen transfer on the same face. PLP formed in the final reactions was analyzed by LC-MS/MS for the presence or absence of (2)H. The method was highly sensitive that for the aminotransferase with ca. 50 kDa subunit molecular weight, only 2mg of the enzyme was sufficient for the whole test. With this method, the use of radioactive substances could be avoided without compromising the sensitivity of the assay. Copyright © 2011 Elsevier Inc. All rights reserved.

  14. Selective pressures on C4 photosynthesis evolution in grasses through the lens of optimality

    OpenAIRE

    Akcay, Erol; Zhou, Haoran; Helliker, Brent

    2016-01-01

    CO2, temperature, water availability and light intensity were potential selective pressures to propel the initial evolution and global expansion of C4 photosynthesis in grasses. To tease apart the primary selective pressures along the evolutionary trajectory, we coupled photosynthesis and hydraulics models and optimized photosynthesis over stomatal resistance and leaf/fine-root allocation. We also examined the importance of nitrogen reallocation from the dark to the light reactions. Our resul...

  15. Contribution of the Federal Republic of Germany to chapter C.3/C.4

    International Nuclear Information System (INIS)

    1979-03-01

    The paper refers to chapters C.3 and C.4 of the WG 5C report. Different modes of international FBR activities are examined according to the aspects such as ownership, operation, electricity supply, and safeguards. Examples of realization of international FBR development are given. Three aspects are examined as the main potential incentives for internationalization i.e. environment, economics, non-proliferation; some problems are revealed. Aspects of collocation and internationalization in connection with FBRs are investigated based on 3 concepts

  16. Penerapan Algoritma Decision Tree C4.5 Untuk Penilaian Rumah Tinggal

    OpenAIRE

    Setiadi, Budi

    2015-01-01

    There is still a possibility of assessment error homes as a reference value of credit, which will open opportunities for NPL. So we need a way of assessment (predictive value) is quite proportional, credible and accurate. Inaccurate predictions led to the planning of improper credit management. Prediction value of collateral house has attracted the interest of many researchers because of its importance both in theoretical andempirical.Namely C4.5 decision tree algorithm, CART and CHAID that c...

  17. C4P cross-section libraries for safety analyses with SIMMER and related studies

    International Nuclear Information System (INIS)

    Rineiski, A.; Sinitsa, V.; Gabrielli, F.; Maschek, W.

    2011-01-01

    A code and data system, C 4 P, is under development at KIT. It includes fine-group master libraries and tools for generating problem-oriented cross-section libraries, primarily for safety studies with the SIMMER code and related analyses. In the paper, the 560-group master library and problem oriented 40-group and 72-group cross-section libraries, for thermal and fast systems, respectively, are described and their performances are investigated. (author)

  18. Human Terrain: A Tactical Issue or a Strategic C4I Problem?

    Science.gov (United States)

    2008-05-20

    C4I" 20-21 May 2008, George Mason University, Fairfax, Virginia Campus, The original document contains color images . 14. ABSTRACT 15. SUBJECT TERMS...can modify and control it – Terrain is many things: typography ; geology and soil type; it’s natural coverage (forests); it’s roadways, rail lines... image of “gun toting” field researchers who are doing military stuff and not research and in the process are poisoning the environment for real field

  19. Clinical and pathological correlations of C4d immunostaining and its infl uence on the outcome of kidney transplant recipients

    Directory of Open Access Journals (Sweden)

    Virna Nowotny Carpio

    2011-09-01

    Full Text Available INTRODUCTION: C4d is a marker of antibody-mediated rejection (ABMR in kidney allografts, although cellular rejection also have C4d deposits. OBJECTIVE: To correlate C4d expression with clinico-pathological parameters and graft outcomes at three years. METHODS: One hundred forty six renal transplantation recipients with graft biopsies by indication were included. C4d staining was performed by paraffin-immunohistochemistry. Graft function and survival were measured, and predictive variables of the outcome were determined by multivariate Cox regression. RESULTS: C4d staining was detected in 48 (31% biopsies, of which 23 (14.7% had diffuse and 25 (16% focal distribution. Pre-transplantation panel reactive antibodies (%PRA class I and II were significantly higher in C4d positive patients as compared to those C4d negative. Both glomerulitis and pericapillaritis were associated to C4d (p = 0.002 and p < 0.001, respectively. The presence of C4d in biopsies diagnosed as no rejection (NR, acute cellular rejection (ACR or interstitial fibrosis/ tubular atrophy (IF/TA did not impact graft function or survival. Compared to NR, ACR and IF/TA C4d-, patients with ABMR C4d+ had the worst graft survival over 3 years (p = 0.034, but there was no difference between ABMR versus NR, ACR and IF/TA that were C4d positive (p = 0.10. In Cox regression, graft function at biopsy and high %PRA levels were predictors of graft loss. CONCLUSIONS: This study confirmed that C4d staining in kidney graft biopsies is a clinically useful marker of ABMR, with well defined clinical and pathological correlations. The impact of C4d deposition in other histologic diagnoses deserves further investigation.

  20. Chemical synthesis of guanosine diphosphate mannuronic acid (GDP-ManA) and its C-4-O-methyl and C-4-deoxy congeners.

    Science.gov (United States)

    Zhang, Qingju; Howell, P Lynne; Overkleeft, Herman S; Filippov, Dmitri V; van der Marel, Gijsbert A; Codée, Jeroen D C

    2017-10-10

    Described is the first synthesis of guanosine diphosphate mannuronic acid (GDP-ManA), the sugar donor used by algae and bacteria for the production of alginate, an anionic polysaccharide composed of β-d-mannuronic acid (ManA) and α-l-guluronic acid (GulA). Understanding the biosynthesis of these polyanionic polysaccharides on the molecular level, opens up avenues to use and modulate the biosynthesis machinery for biotechnological and therapeutic applications. The synthesis reported here delivers multi-milligram amounts of the GDP-ManA donor that can be used to study the polymerase (Alg8 in Pseudomonas aeruginosa) that generates the poly-ManA chain. Also reported is the assembly of two close analogues of GDP-ManA: the first bears a C-4-O-methyl group, while the second has been deoxygenated at this position. Both molecules may be used as "chain stoppers" in future enzymatic ManA polymerisation reactions. The crucial pyrophosphate linkage of the GDP-mannuronic acids has been constructed by the phosphorylation of the appropriate ManA-1-phosphates with a guanosine phosphoramidite. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. PCA based feature reduction to improve the accuracy of decision tree c4.5 classification

    Science.gov (United States)

    Nasution, M. Z. F.; Sitompul, O. S.; Ramli, M.

    2018-03-01

    Splitting attribute is a major process in Decision Tree C4.5 classification. However, this process does not give a significant impact on the establishment of the decision tree in terms of removing irrelevant features. It is a major problem in decision tree classification process called over-fitting resulting from noisy data and irrelevant features. In turns, over-fitting creates misclassification and data imbalance. Many algorithms have been proposed to overcome misclassification and overfitting on classifications Decision Tree C4.5. Feature reduction is one of important issues in classification model which is intended to remove irrelevant data in order to improve accuracy. The feature reduction framework is used to simplify high dimensional data to low dimensional data with non-correlated attributes. In this research, we proposed a framework for selecting relevant and non-correlated feature subsets. We consider principal component analysis (PCA) for feature reduction to perform non-correlated feature selection and Decision Tree C4.5 algorithm for the classification. From the experiments conducted using available data sets from UCI Cervical cancer data set repository with 858 instances and 36 attributes, we evaluated the performance of our framework based on accuracy, specificity and precision. Experimental results show that our proposed framework is robust to enhance classification accuracy with 90.70% accuracy rates.

  2. Photodissociation of C3H5Br and C4H7Br at 234 nm

    International Nuclear Information System (INIS)

    Kim, Hyun Kook; Paul, Dababrata; Hong, Ki Ryong; Cho, Ha Na; Kim, Tae Kyu; Lee, Kyoung Seok

    2012-01-01

    The photodissociation dynamics of cyclopropyl bromide (C-3H 5 Br) and cyclobutyl bromide (C 4 H 7 Br) at 234 nm was investigated. A two-dimensional photofragment ion-imaging technique coupled with a [2+1] resonance enhanced multiphoton ionization scheme was utilized to obtain speed and angular distributions of the nascent Br( 2 P 3/2 ) and Br*( 2 P 1/2 ) atoms. The recoil anisotropies for the Br and Br* channels were measured to be βBr = 0.92 ± 0.03 and βBr* = 1.52 ± 0.04 for C 3 H 5 Br and βBr = 1.10 ± 0.03 and βBr* = 1.49 ± 0.05 for C 4 H 7 Br. The relative quantum yield for Br was found to be ΦBr = 0.13 ± 0.03 and for C 3 H 5 Br and C 4 H 7 Br, respectively. The soft radical limit of the impulsive model adequately modeled the related energy partitioning. The nonadiabatic transition probability from the 3A' and 4A' potential energy surfaces was estimated and discussed

  3. The superfamily of C3b/C4b-binding proteins

    DEFF Research Database (Denmark)

    Kristensen, Torsten; D'Eustachio, P; Ogata, R T

    1987-01-01

    The determination of primary structures by amino acid and nucleotide sequencing for the C3b-and/or C4b-binding proteins H, C4BP, CR1, B, and C2 has revealed the presence of a common structural element. This element is approximately 60 amino acids long and is repeated in a tandem fashion, commencing...... at the amino-terminal end of each molecule. Two other complement components, C1r and C1s, have two of these repeating units in the carboxy-terminal region of their noncatalytic A chains. Three noncomplement proteins, beta 2-glycoprotein I (beta 2I), the interleukin 2 receptor (IL 2 receptor), and the b chain...... of factor XIII, have 4, 2 and 10 of these repeating units, respectively. These proteins obviously belong to the above family, although there is no evidence that they interact with C3b and/or C4b. Human haptoglobin and rat leukocyte common antigen also contain two and three repeating units, respectively...

  4. Mapping the Superconducting Anti-ferromagnetic C4 Phase in Iron-Pnictides

    Science.gov (United States)

    Stadel, Ryan; Taddei, Keith; Bugaris, Dan; Lapidus, Saul; Claus, Helmut; Phelan, Daniel; Chung, Duck Young; Kanatzidis, Mercouri; Osborn, Raymond; Rosenkranz, Stephan; Chmaissem, Omar

    Following the discovery of the microscopic coexistence of antifermagnetic spin density waves and superconductivity in Ba1-xKxFe2As2 and the low temperature re-entrance to the novel magnetic C4 tetragonal phase in Ba1-xNaxFe2As2, there has been significant interest in developing an understanding of the properties and formation of these phases and analyzing their dependence on temperature and composition in hole-doped 122 alkaline earth metal/iron-pnictides. We describe the mapping of various Ba, Sr, and Ca 122 phase diagrams with systematically controlled levels of hole-doping of alkaline metal onto the alkaline earth metal site, which was investigated via x-ray and neutron diffraction. Our elaborate synthesis, diffraction work, and analysis maps and firmly establishes the C4 phase space in these ternary diagrams as well as the boundary lines that separate the individual phases, and provides natural clues as well as a framework to investigate the stability and formation of the C4 domes that shift location with doping contents in the phase diagrams. Work at Argonne was supported by US DOE, Office of Science, Materials Sciences and Engineering Division.

  5. Implementation of Data Mining to Analyze Drug Cases Using C4.5 Decision Tree

    Science.gov (United States)

    Wahyuni, Sri

    2018-03-01

    Data mining was the process of finding useful information from a large set of databases. One of the existing techniques in data mining was classification. The method used was decision tree method and algorithm used was C4.5 algorithm. The decision tree method was a method that transformed a very large fact into a decision tree which was presenting the rules. Decision tree method was useful for exploring data, as well as finding a hidden relationship between a number of potential input variables with a target variable. The decision tree of the C4.5 algorithm was constructed with several stages including the selection of attributes as roots, created a branch for each value and divided the case into the branch. These stages would be repeated for each branch until all the cases on the branch had the same class. From the solution of the decision tree there would be some rules of a case. In this case the researcher classified the data of prisoners at Labuhan Deli prison to know the factors of detainees committing criminal acts of drugs. By applying this C4.5 algorithm, then the knowledge was obtained as information to minimize the criminal acts of drugs. From the findings of the research, it was found that the most influential factor of the detainee committed the criminal act of drugs was from the address variable.

  6. Percutaneous vertebroplasty via anterolateral approach for the treatment of C4 to C7 vertebral tumor

    International Nuclear Information System (INIS)

    Wu Chungen; Cheng Yongde; Gu Yifeng; Zhang Ji; Wang Tao; Li Minghua; Apitzsch, D.E.

    2009-01-01

    Objective To investigate the feasibility and clinical efficacy of percutaneous vertebroplasty via anterolateral approach in treating the middle and lower cervical (C4-C7) vertebral tumor. Methods: During the past four years, percutaneous vertebroplasty via anterolateral approach was performed in 16 patients with middle or lower cervical tumor, including metastases (n=12), myeloma (n=3) and eosinophilic granuloma (n=1). Under fluoroscopic guidance, needle puncture was operated via the anterolateral approach, bone cement was injected into the target cervical body when the needle was in place. A follow-up of three months was made. Results: Twenty-one cervical bodies in the range of C4 to C7 were successfully punctured and injected with bone cement. Marked pain relief was obtained in all 16 patients. The average score of visual analogue scale (VAS) was dramatically decreased from 7 before the procedure to 1.7 after the procedure. The cervical motor function returned to good condition. Conclusion: Percutaneous vertebroplasty via anterolateral approach is a safe, effective and minimally-invasive technique in treating the middle and lower cervical (C4-C7) vertebral tumor. (authors)

  7. Characterization of novel Sorghum brown midrib mutants from an EMS-mutagenized population.

    Science.gov (United States)

    Sattler, Scott E; Saballos, Ana; Xin, Zhanguo; Funnell-Harris, Deanna L; Vermerris, Wilfred; Pedersen, Jeffrey F

    2014-09-02

    Reducing lignin concentration in lignocellulosic biomass can increase forage digestibility for ruminant livestock and saccharification yields of biomass for bioenergy. In sorghum (Sorghum bicolor (L.) Moench) and several other C4 grasses, brown midrib (bmr) mutants have been shown to reduce lignin concentration. Putative bmr mutants isolated from an EMS-mutagenized population were characterized and classified based on their leaf midrib phenotype and allelism tests with the previously described sorghum bmr mutants bmr2, bmr6, and bmr12. These tests resulted in the identification of additional alleles of bmr2, bmr6, and bmr12, and, in addition, six bmr mutants were identified that were not allelic to these previously described loci. Further allelism testing among these six bmr mutants showed that they represented four novel bmr loci. Based on this study, the number of bmr loci uncovered in sorghum has doubled. The impact of these lines on agronomic traits and lignocellulosic composition was assessed in a 2-yr field study. Overall, most of the identified bmr lines showed reduced lignin concentration of their biomass relative to wild-type (WT). Effects of the six new bmr mutants on enzymatic saccharification of lignocellulosic materials were determined, but the amount of glucose released from the stover was similar to WT in all cases. Like bmr2, bmr6, and bmr12, these mutants may affect monolignol biosynthesis and may be useful for bioenergy and forage improvement when stacked together or in combination with the three previously described bmr alleles. Copyright © 2014 Sattler et al.

  8. Arabidopsis phosphoinositide-specific phospholipase C 4 negatively regulates seedling salt tolerance.

    Science.gov (United States)

    Xia, Keke; Wang, Bo; Zhang, Jiewei; Li, Yuan; Yang, Hailian; Ren, Dongtao

    2017-08-01

    Previous physiological and pharmacological studies have suggested that the activity of phosphoinositide-specific phospholipase C (PI-PLC) plays an important role in regulating plant salt stress responses by altering the intracellular Ca 2+ concentration. However, the individual members of plant PLCs involved in this process need to be identified. Here, the function of AtPLC4 in the salt stress response of Arabidopsis seedlings was analysed. plc4 mutant seedlings showed hyposensitivity to salt stress compared with Col-0 wild-type seedlings, and the salt hyposensitive phenotype could be complemented by the expression of native promoter-controlled AtPLC4. Transgenic seedlings with AtPLC4 overexpression (AtPLC4 OE) exhibited a salt-hypersensitive phenotype, while transgenic seedlings with its inactive mutant expression (AtPLC4m OE) did not exhibit this phenotype. Using aequorin as a Ca 2+ indicator in plc4 mutant and AtPLC4 OE seedlings, AtPLC4 was shown to positively regulate the salt-induced Ca 2+ increase. The salt-hypersensitive phenotype of AtPLC4 OE seedlings was partially rescued by EGTA. An analysis of salt-responsive genes revealed that the transcription of RD29B, MYB15 and ZAT10 was inversely regulated in plc4 mutant and AtPLC4 OE seedlings. Our findings suggest that AtPLC4 negatively regulates the salt tolerance of Arabidopsis seedlings, and Ca 2+ may be involved in regulating this process. © 2017 John Wiley & Sons Ltd.

  9. Consequences of C4 differentiation for chloroplast membrane proteomes in maize mesophyll and bundle sheath cells.

    Science.gov (United States)

    Majeran, Wojciech; Zybailov, Boris; Ytterberg, A Jimmy; Dunsmore, Jason; Sun, Qi; van Wijk, Klaas J

    2008-09-01

    Chloroplasts of maize leaves differentiate into specific bundle sheath (BS) and mesophyll (M) types to accommodate C(4) photosynthesis. Chloroplasts contain thylakoid and envelope membranes that contain the photosynthetic machineries and transporters but also proteins involved in e.g. protein homeostasis. These chloroplast membranes must be specialized within each cell type to accommodate C(4) photosynthesis and regulate metabolic fluxes and activities. This quantitative study determined the differentiated state of BS and M chloroplast thylakoid and envelope membrane proteomes and their oligomeric states using innovative gel-based and mass spectrometry-based protein quantifications. This included native gels, iTRAQ, and label-free quantification using an LTQ-Orbitrap. Subunits of Photosystems I and II, the cytochrome b(6)f, and ATP synthase complexes showed average BS/M accumulation ratios of 1.6, 0.45, 1.0, and 1.33, respectively, whereas ratios for the light-harvesting complex I and II families were 1.72 and 0.68, respectively. A 1000-kDa BS-specific NAD(P)H dehydrogenase complex with associated proteins of unknown function containing more than 15 proteins was observed; we speculate that this novel complex possibly functions in inorganic carbon concentration when carboxylation rates by ribulose-bisphosphate carboxylase/oxygenase are lower than decarboxylation rates by malic enzyme. Differential accumulation of thylakoid proteases (Egy and DegP), state transition kinases (STN7,8), and Photosystem I and II assembly factors was observed, suggesting that cell-specific photosynthetic electron transport depends on post-translational regulatory mechanisms. BS/M ratios for inner envelope transporters phosphoenolpyruvate/P(i) translocator, Dit1, Dit2, and Mex1 were determined and reflect metabolic fluxes in carbon metabolism. A wide variety of hundreds of other proteins showed differential BS/M accumulation. Mass spectral information and functional annotations are

  10. Increasing water use efficiency along the C3 to C4 evolutionary pathway: a stomatal optimization perspective.

    Science.gov (United States)

    Way, Danielle A; Katul, Gabriel G; Manzoni, Stefano; Vico, Giulia

    2014-07-01

    C4 photosynthesis evolved independently numerous times, probably in response to declining atmospheric CO2 concentrations, but also to high temperatures and aridity, which enhance water losses through transpiration. Here, the environmental factors controlling stomatal behaviour of leaf-level carbon and water exchange were examined across the evolutionary continuum from C3 to C4 photosynthesis at current (400 μmol mol(-1)) and low (280 μmol mol(-1)) atmospheric CO2 conditions. To this aim, a stomatal optimization model was further developed to describe the evolutionary continuum from C3 to C4 species within a unified framework. Data on C3, three categories of C3-C4 intermediates, and C4 Flaveria species were used to parameterize the stomatal model, including parameters for the marginal water use efficiency and the efficiency of the CO2-concentrating mechanism (or C4 pump); these two parameters are interpreted as traits reflecting the stomatal and photosynthetic adjustments during the C3 to C4 transformation. Neither the marginal water use efficiency nor the C4 pump strength changed significantly from C3 to early C3-C4 intermediate stages, but both traits significantly increased between early C3-C4 intermediates and the C4-like intermediates with an operational C4 cycle. At low CO2, net photosynthetic rates showed continuous increases from a C3 state, across the intermediates and towards C4 photosynthesis, but only C4-like intermediates and C4 species (with an operational C4 cycle) had higher water use efficiencies than C3 Flaveria. The results demonstrate that both the marginal water use efficiency and the C4 pump strength increase in C4 Flaveria to improve their photosynthesis and water use efficiency compared with C3 species. These findings emphasize that the advantage of the early intermediate stages is predominantly carbon based, not water related. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  11. Reproductive and developmental toxicology

    National Research Council Canada - National Science Library

    Gupta, Ramesh C

    2011-01-01

    .... Reproductive and Developmental Toxicology is a comprehensive and authoritative resource providing the latest literature enriched with relevant references describing every aspect of this area of science...

  12. Flavonoid accumulation patterns of transparent testa mutants of arabidopsis

    Science.gov (United States)

    Peer, W. A.; Brown, D. E.; Tague, B. W.; Muday, G. K.; Taiz, L.; Murphy, A. S.

    2001-01-01

    Flavonoids have been implicated in the regulation of auxin movements in Arabidopsis. To understand when and where flavonoids may be acting to control auxin movement, the flavonoid accumulation pattern was examined in young seedlings and mature tissues of wild-type Arabidopsis. Using a variety of biochemical and visualization techniques, flavonoid accumulation in mature plants was localized in cauline leaves, pollen, stigmata, and floral primordia, and in the stems of young, actively growing inflorescences. In young Landsberg erecta seedlings, aglycone flavonols accumulated developmentally in three regions, the cotyledonary node, the hypocotyl-root transition zone, and the root tip. Aglycone flavonols accumulated at the hypocotyl-root transition zone in a developmental and tissue-specific manner with kaempferol in the epidermis and quercetin in the cortex. Quercetin localized subcellularly in the nuclear region, plasma membrane, and endomembrane system, whereas kaempferol localized in the nuclear region and plasma membrane. The flavonoid accumulation pattern was also examined in transparent testa mutants blocked at different steps in the flavonoid biosynthesis pathway. The transparent testa mutants were shown to have precursor accumulation patterns similar to those of end product flavonoids in wild-type Landsberg erecta, suggesting that synthesis and end product accumulation occur in the same cells.

  13. Energy sorghum--a genetic model for the design of C4 grass bioenergy crops.

    Science.gov (United States)

    Mullet, John; Morishige, Daryl; McCormick, Ryan; Truong, Sandra; Hilley, Josie; McKinley, Brian; Anderson, Robert; Olson, Sara N; Rooney, William

    2014-07-01

    Sorghum is emerging as an excellent genetic model for the design of C4 grass bioenergy crops. Annual energy Sorghum hybrids also serve as a source of biomass for bioenergy production. Elucidation of Sorghum's flowering time gene regulatory network, and identification of complementary alleles for photoperiod sensitivity, enabled large-scale generation of energy Sorghum hybrids for testing and commercial use. Energy Sorghum hybrids with long vegetative growth phases were found to accumulate more than twice as much biomass as grain Sorghum, owing to extended growing seasons, greater light interception, and higher radiation use efficiency. High biomass yield, efficient nitrogen recycling, and preferential accumulation of stem biomass with low nitrogen content contributed to energy Sorghum's elevated nitrogen use efficiency. Sorghum's integrated genetics-genomics-breeding platform, diverse germplasm, and the opportunity for annual testing of new genetic designs in controlled environments and in multiple field locations is aiding fundamental discovery, and accelerating the improvement of biomass yield and optimization of composition for biofuels production. Recent advances in wide hybridization between Sorghum and other C4 grasses could allow the deployment of improved genetic designs of annual energy Sorghums in the form of wide-hybrid perennial crops. The current trajectory of energy Sorghum genetic improvement indicates that it will be possible to sustainably produce biofuels from C4 grass bioenergy crops that are cost competitive with petroleum-based transportation fuels. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  14. Generation of Anaphylatoxins by Human β-Tryptase from C3, C4, and C51

    Science.gov (United States)

    Fukuoka, Yoshihiro; Xia, Han-Zhang; Sanchez-Muñoz, Laura B.; Dellinger, Anthony L.; Escribano, Luis; Schwartz, Lawrence B.

    2009-01-01

    Both mast cells and complement participate in innate and acquired immunity. The current study examines whether β-tryptase, the major protease of human mast cells, can directly generate bioactive complement anaphylatoxins. Important variables included pH, monomeric vs tetrameric forms of β-tryptase, and the β-tryptase-activating polyanion. The B12 mAb was used to stabilize β-tryptase in its monomeric form. C3a and C4a were best generated from C3 and C4, respectively, by monomeric β-tryptase in the presence of low molecular weight dextran sulfate or heparin at acidic pH. High molecular weight polyanions increased degradation of these anaphylatoxins. C5a was optimally generated from C5 at acidic pH by β-tryptase monomers in the presence of high molecular weight dextran sulfate and heparin polyanions, but also was produced by β-tryptase tetramers under these conditions. Mass spectrometry verified that the molecular mass of each anaphylatoxin was correct. Both β-tryptase-generated C5a and C3a (but not C4a) were potent activators of human skin mast cells. These complement anaphylatoxins also could be generated by β-tryptase in releasates of activated skin mast cells. Of further biologic interest, β-tryptase also generated C3a from C3 in human plasma at acidic pH. These results suggest β-tryptase might generate complement anaphylatoxins in vivo at sites of inflammation, such as the airway of active asthma patients where the pH is acidic and where elevated levels of β-tryptase and complement anaphylatoxins are detected. PMID:18424754

  15. Mutant power: using mutant allele collections for yeast functional genomics.

    Science.gov (United States)

    Norman, Kaitlyn L; Kumar, Anuj

    2016-03-01

    The budding yeast has long served as a model eukaryote for the functional genomic analysis of highly conserved signaling pathways, cellular processes and mechanisms underlying human disease. The collection of reagents available for genomics in yeast is extensive, encompassing a growing diversity of mutant collections beyond gene deletion sets in the standard wild-type S288C genetic background. We review here three main types of mutant allele collections: transposon mutagen collections, essential gene collections and overexpression libraries. Each collection provides unique and identifiable alleles that can be utilized in genome-wide, high-throughput studies. These genomic reagents are particularly informative in identifying synthetic phenotypes and functions associated with essential genes, including those modeled most effectively in complex genetic backgrounds. Several examples of genomic studies in filamentous/pseudohyphal backgrounds are provided here to illustrate this point. Additionally, the limitations of each approach are examined. Collectively, these mutant allele collections in Saccharomyces cerevisiae and the related pathogenic yeast Candida albicans promise insights toward an advanced understanding of eukaryotic molecular and cellular biology. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  16. New Line Lists for planetological applications: HC3N and C4H2

    Science.gov (United States)

    Jolly, A.; Benilan, Y.; Fayt, A.

    2009-04-01

    The Composite Infrared Spectrometer (CIRS) on-board Cassini, after four years of operation in Saturnian orbit with over thirty close fly-bys of Titan, has obtained spectra in the far and mid-infrared with a spectral resolution of 0.5 cm-1. Mismatch between observed spectra and model spectra obtained from the available line lists has led us to study the bending bands of HC3N and C4H2, the longest carbon chains observed on Titan. Our experimental study for HC3N (Jolly et al. 2007, J.Mol.Spec) has shown that band intensities had to be revised and that including hot bands with lower level as high as 1300 cm-1 was necessary to model our experimental spectra at 0.5 cm-1 resolution. A new extended line list could be obtained by fitting high resolution data with the help of a global analysis. This line list was made available to the astronomers of the CIRS team and will be included in the next version of the GEISA data base. Thanks to the precision of the new spectroscopic data, 13C isotopologues of HC3N have been detected and quantified for the first time in the atmosphere of Titan (Jennings et al. 2008, ApJL). Search for the 15N isotopologues of HC3N will also be presented. The proportion of hot bands is even more important for C4H2 than for HC3N and a new extended line list was absolutely necessary to improve the CIRS spectral analysis. We will present a new line list and show comparison between synthetic spectra and experimental spectra of C4H2 obtained between 193 and 296 K at 0.1 and 0.5 cm-1 resolution. Comparison of model spectra to CIRS observations of C4H2 at 220 and 630 cm-1 will also be presented. Detections of hot bands and isotopes in cold environments such as Titan will be emphasized.

  17. Measurement of resonances in 12 C + 4 He through inverse kinematics with thick targets

    International Nuclear Information System (INIS)

    Aguilera, E.F.; Lizcano, D.; Martinez Q, E.; Fernandez, M.C.; Murillo, G.; Goldberg, V.; Skorodumov, B.B.; Rogachev, G.

    2003-01-01

    The excitation function of elastic scattering for the system 12 C + 4 He to energy from 0.5 to 3.5 MeV in the center of mass system (c.m.) was measured. We use a gassy thick target and the technique of inverse kinematics which allows to make measurements at 180 degrees in c.m. Using the R matrix theory those was deduced parameters of the resonances and the results were compared with measurements reported in the literature made with other techniques. (Author)

  18. An unusual cause of chest pain: Fused cervical vertebra (C3-C4

    Directory of Open Access Journals (Sweden)

    Daipayan Chatterjee

    2014-01-01

    Full Text Available Cervicogenic angina is paroxysmal precordialgia usually due to lower cervical vertebral involvement. But upper cervical vertebral segmental anomaly causing cervicogenic angina is rare. Herein, we report a case of cervicogenic angina due to fused 3 rd and 4 th cervical vertebra in a 37-year female, which was initially misdiagnosed as angina and treated likewise. But, persistence of symptoms led to evaluation of her cervical spine and subsequent diagnosis. Cervical traction, physiotherapy and posture training relieved her of her symptoms with no recurrence till 6 months of follow-up. Fused C3-C4 can be a cause of precordialgia and physicians should be aware of it.

  19. Defective prevention of immune precipitation in autoimmune diseases is independent of C4A*Q0

    Science.gov (United States)

    Arason, G J; Kolka, R; Hreidarsson, A B; Gudjonsson, H; Schneider, P M; Fry, L; Arnason, A

    2005-01-01

    Increased prevalence of C4 null alleles is a common feature of autoimmune diseases. We have shown previously that complement-dependent prevention of immune precipitation (PIP) is defective in patients with systemic lupus erythematosus (SLE), and correlated this defect with C4A*Q0 and low levels of the C4A isotype. To further clarify the role of C4A in the aetiology of SLE, we now extend our studies to other diseases which have been associated with C4A*Q0. The frequency of C4A*Q0 was increased in Icelandic patients with coeliac disease (0·50; P Grave's disease (0·30; P = 0·002) and insulin-dependent diabetes mellitus (0·23; P = 0·04) and in British patients with dermatitis herpetiformis (0·42; P = 0·002) and this was reflected in low levels of C4A. In spite of this, PIP was normal in these patients, and in marked contrast to our previous observations on connective tissue diseases, PIP measurements in these patient groups correlated more strongly with levels of C4B (r = 0·51, P = 0·0000004) than C4A. Patients with increased levels of anti-C1q antibodies had significantly lower PIP than patients without such antibodies (P cause of the PIP defect in autoimmune connective tissue disease. PMID:15932521

  20. Prediksi Ketepatan Waktu Kelulusan Dengan Algoritma Data Mining C4.5

    Directory of Open Access Journals (Sweden)

    Indah Puji Astuti

    2017-11-01

    Full Text Available The student is one of entities in University or Higher Education. The student has a variety of data, such as self-identity information such as address, type of school, work of parents, type of class, etc. In fact many students whose graduation rate is different, on time and not on time. The number of students who graduate is not on time will be a problem not only for university but also for faculty. The number of students graduating each year is one of points of assessment when faculty or study program submits accreditation. C4.5 Algorithm is one of classification algorithm with decision trees. In this study conducted an analysis of student data Engineering Studies Program University of Muhammadiyah Ponorogo 2012/2013. The decision trees in this case is useful for exploring student data, finding the hidden relationship between a number of candidate input attributes with a target attribute. The input attribute consist of, the type of school, address, work of parent, and type of class. The output attribute to classify is status, which consists of "on time" and "not on time". The results from this analysis shown that in this case the C4.5 algorithm can predict with an accuracy value only 82%.

  1. Growing C4 perennial grass for bioenergy using a new Agro-BGC ecosystem model

    Science.gov (United States)

    di Vittorio, A. V.; Anderson, R. S.; Miller, N. L.; Running, S. W.

    2009-12-01

    Accurate, spatially gridded estimates of bioenergy crop yields require 1) biophysically accurate crop growth models and 2) careful parameterization of unavailable inputs to these models. To meet the first requirement we have added the capacity to simulate C4 perennial grass as a bioenergy crop to the Biome-BGC ecosystem model. This new model, hereafter referred to as Agro-BGC, includes enzyme driven C4 photosynthesis, individual live and dead leaf, stem, and root carbon/nitrogen pools, separate senescence and litter fall processes, fruit growth, optional annual seeding, flood irrigation, a growing degree day phenology with a killing frost option, and a disturbance handler that effectively simulates fertilization, harvest, fire, and incremental irrigation. There are four Agro-BGC vegetation parameters that are unavailable for Panicum virgatum (switchgrass), and to meet the second requirement we have optimized the model across multiple calibration sites to obtain representative values for these parameters. We have verified simulated switchgrass yields against observations at three non-calibration sites in IL. Agro-BGC simulates switchgrass growth and yield at harvest very well at a single site. Our results suggest that a multi-site optimization scheme would be adequate for producing regional-scale estimates of bioenergy crop yields on high spatial resolution grids.

  2. Responses of C4 grasses to atmospheric CO2 enrichment : I. Effect of irradiance.

    Science.gov (United States)

    Sionit, Nasser; Patterson, David T

    1984-12-01

    The growth and photosynethetic responses to atmospheric CO 2 enrichment of 4 species of C 4 grasses grown at two levels of irradiance were studied. We sought to determine whether CO 2 enrichment would yield proportionally greater growth enhancement in the C 4 grasses when they were grown at low irradiance than when grown at high irradiance. The species studied were Echinochloa crusgalli, Digitaria sanguinalis, Eleusine indica, and Setaria faberi. Plants were grown in controlled environment chambers at 350, 675 and 1,000 μl 1 -1 CO 2 and 1,000 or 150 μmol m -2 s -1 photosynthetic photon flux density (PPFD). An increase in CO 2 concentration and PPFD significantly affected net photosynthesis and total biomass production of all plants. Plants grown at low PPFD had significantly lower rates of photosynthesis, produced less biomass, and had reduced responses to increases in CO 2 . Plants grown in CO 2 -enriched atmosphere had lower photosynthetic capacity relative to the low CO 2 grown plants when exposed to lower CO 2 concentration at the time of measurement, but had greater rate of photosynthesis when exposed to increasing PPFD. The light level under which the plants were growing did not influence the CO 2 compensation point for photosynthesis.

  3. Theoretical charge-exchange total cross sections for B+3 + He and C+4 + He collisions

    International Nuclear Information System (INIS)

    Shipsey, E.J.; Browne, J.C.; Olson, R.E.

    1977-01-01

    Charge-exchange total cross sections for the B +3 + He and C +4 + He systems have been calculated in the velocity range v = (1--10) x 10 7 cm/sec. Ab initio potential-energy curves and coupling-matrix elements were computed and employed in the impact-parameter classical-coupled equations that describe the collision to obtain the cross sections. For the B +3 + He system, our calculations are in excellent agreement with experimental results with the finding that the single-electron-transfer cross section rises rapidly to a maximum of 1.45 x 10 -15 cm 2 at v = 5.5 x 10 7 cm/sec. For the C +4 + He system, however, we find that the double-electron-transfer process is more important than the single-electron-transfer process. For example, at v = 5 x 10 7 cm/sec, the double-electron-transfer cross section is found to be 0.6 x 10 -16 cm 2 vs 5.5 x 10 -17 for the single-electron transfer. This is in disagreement with an experiment of Crandall which gave the single-charge-transfer process as dominant. However, the more recent experiment reported by Crandall, Olson, Browne, and Shipsey verifies the double charge transfer as the dominant process for low energies

  4. Regulation of chloroplast biogenesis: the immutans mutant of Arabidopsis

    Energy Technology Data Exchange (ETDEWEB)

    Rodermel, Steven

    2015-11-16

    The immutans (im) variegation mutant of Arabidopsis is an ideal model to gain insight into factors that control chloroplast biogenesis. im defines the gene for PTOX, a plastoquinol terminal oxidase that participates in control of thylakoid redox. Here, we report that the im defect can be suppressed during the late stages of plant development by gigantea (gi2), which defines the gene for GIGANTEA (GI), a central component of the circadian clock that plays a poorly-understood role in diverse plant developmental processes. imgi2 mutants are late-flowering and display other well-known phenotypes associated with gi2, such as starch accumulation and resistance to oxidative stress. We show that the restoration of chloroplast biogenesis in imgi2 is caused by a developmental-specific de-repression of cytokinin signaling that involves crosstalk with signaling pathways mediated by gibberellin (GA) and SPINDLY (SPY), a GA response inhibitor. Suppression of the plastid defect in imgi2 is likely caused by a relaxation of excitation pressures in developing plastids by factors contributed by gi2, including enhanced rates of photosynthesis and increased resistance to oxidative stress. Interestingly, the suppression phenotype of imgi can be mimicked by crossing im with the starch accumulation mutant, sex1, perhaps because sex1 utilizes pathways similar to gi. We conclude that our studies provide a direct genetic linkage between GIGANTEA and chloroplast biogenesis, and we construct a model of interactions between signaling pathways mediated by gi, GA, SPY, cytokinins, and sex1 that are required for chloroplast biogenesis.

  5. Mutant genes in pea breeding

    International Nuclear Information System (INIS)

    Swiecicki, W.K.

    1990-01-01

    Full text: Mutations of genes Dpo (dehiscing pods) and A (anthocyanin synthesis) played a role in pea domestication. A number of other genes were important in cultivar development for 3 types of usage (dry seeds, green vegetable types, fodder), e.g. fn, fna, le, p, v, fas and af. New genes (induced and spontaneous), are important for present ideotypes and are registered by the Pisum Genetics Association (PGA). Comparison of a pea variety ideotype with the variation available in gene banks shows that breeders need 'new' features. In mutation induction experiments, genotype, mutagen and method of treatment (e.g. combined or fractionated doses) are varied for broadening the mutation spectrum and selecting more genes of agronomic value. New genes are genetically analysed. In Poland, some mutant varieties with the gene afila were registered, controlling lodging by a shorter stem and a higher number of internodes. Really non-lodging pea varieties could strongly increase seed yield. But the probability of detecting a major gene for lodging resistance is low. Therefore, mutant genes with smaller influence on plant architecture are sought, to combine their effect by crossing. Promising seem to be the genes rogue, reductus and arthritic as well as a number of mutant genes not yet genetically identified. The gene det for terminal inflorescence - similarly to Vicia faba - changes plant development. Utilisation of assimilates and ripening should be better. Improvement of harvest index should give higher seed yield. A number of genes controlling disease resistance are well known (eg. Fw, Fnw, En, mo and sbm). Important in mass screening of resistance are closely linked gene markers. Pea gene banks collect respective lines, but mutants induced in highly productive cultivars would be better. Inducing gene markers sometimes seems to be easier than transfer by crossing. Mutation induction in pea breeding is probably more important because a high number of monogenic features are

  6. Domain structure of human complement C4b extends with increasing NaCl concentration: implications for its regulatory mechanism.

    Science.gov (United States)

    Fung, Ka Wai; Wright, David W; Gor, Jayesh; Swann, Marcus J; Perkins, Stephen J

    2016-12-01

    During the activation of complement C4 to C4b, the exposure of its thioester domain (TED) is crucial for the attachment of C4b to activator surfaces. In the C4b crystal structure, TED forms an Arg 104 -Glu 1032 salt bridge to tether its neighbouring macroglobulin (MG1) domain. Here, we examined the C4b domain structure to test whether this salt bridge affects its conformation. Dual polarisation interferometry of C4b immobilised at a sensor surface showed that the maximum thickness of C4b increased by 0.46 nm with an increase in NaCl concentration from 50 to 175 mM NaCl. Analytical ultracentrifugation showed that the sedimentation coefficient s 20,w of monomeric C4b of 8.41 S in 50 mM NaCl buffer decreased to 7.98 S in 137 mM NaCl buffer, indicating that C4b became more extended. Small angle X-ray scattering reported similar R G values of 4.89-4.90 nm for C4b in 137-250 mM NaCl. Atomistic scattering modelling of the C4b conformation showed that TED and the MG1 domain were separated by 4.7 nm in 137-250 mM NaCl and this is greater than that of 4.0 nm in the C4b crystal structure. Our data reveal that in low NaCl concentrations, both at surfaces and in solution, C4b forms compact TED-MG1 structures. In solution, physiologically relevant NaCl concentrations lead to the separation of the TED and MG1 domain, making C4b less capable of binding to its complement regulators. These conformational changes are similar to those seen previously for complement C3b, confirming the importance of this salt bridge for regulating both C4b and C3b. © 2016 The Author(s).

  7. Mycorrhizal Symbiotic Efficiency on C3 and C4 Plants under Salinity Stress - A Meta-Analysis.

    Science.gov (United States)

    Chandrasekaran, Murugesan; Kim, Kiyoon; Krishnamoorthy, Ramasamy; Walitang, Denver; Sundaram, Subbiah; Joe, Manoharan M; Selvakumar, Gopal; Hu, Shuijin; Oh, Sang-Hyon; Sa, Tongmin

    2016-01-01

    A wide range of C3 and C4 plant species could acclimatize and grow under the impact of salinity stress. Symbiotic relationship between plant roots and arbuscular mycorrhizal fungi (AMF) are widespread and are well known to ameliorate the influence of salinity stress on agro-ecosystem. In the present study, we sought to understand the phenomenon of variability on AMF symbiotic relationship on saline stress amelioration in C3 and C4 plants. Thus, the objective was to compare varied mycorrhizal symbiotic relationship between C3 and C4 plants in saline conditions. To accomplish the above mentioned objective, we conducted a random effects models meta-analysis across 60 published studies. An effect size was calculated as the difference in mycorrhizal responses between the AMF inoculated plants and its corresponding control under saline conditions. Responses were compared between (i) identity of AMF species and AMF inoculation, (ii) identity of host plants (C3 vs. C4) and plant functional groups, (iii) soil texture and level of salinity and (iv) experimental condition (greenhouse vs. field). Results indicate that both C3 and C4 plants under saline condition responded positively to AMF inoculation, thereby overcoming the predicted effects of symbiotic efficiency. Although C3 and C4 plants showed positive effects under low (EC 8 ds/m) saline conditions, C3 plants showed significant effects for mycorrhizal inoculation over C4 plants. Among the plant types, C4 annual and perennial plants, C4 herbs and C4 dicot had a significant effect over other counterparts. Between single and mixed AMF inoculants, single inoculants Rhizophagus irregularis had a positive effect on C3 plants whereas Funneliformis mosseae had a positive effect on C4 plants than other species. In all of the observed studies, mycorrhizal inoculation showed positive effects on shoot, root and total biomass, and in nitrogen, phosphorous and potassium (K) uptake. However, it showed negative effects in sodium (Na

  8. A Medicago truncatula tobacco retrotransposon insertion mutant collection with defects in nodule development and symbiotic nitrogen fixation.

    Science.gov (United States)

    Pislariu, Catalina I; Murray, Jeremy D; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; Benedito, Vagner A; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S; Chen, Rujin; Udvardi, Michael K

    2012-08-01

    A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod-), 51 mutants with totally ineffective nodules (Nod+ Fix-), 17 mutants with partially ineffective nodules (Nod+ Fix+/-), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/- Fix-), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/- Fix+), and 11 supernodulating mutants (Nod++Fix+/-). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN'T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod- lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging.

  9. An extra early mutant of pigeonpea

    International Nuclear Information System (INIS)

    Ravikesavan, R.; Kalaimagal, T.; Rathnaswamy, R.

    2001-01-01

    The redgram (Cajanus cajan (L.) Huth) variety 'Prabhat DT' was gamma irradiated with 100, 200, 300 and 400 Gy doses. Several mutants have been identified viz., extra early mutants, monostem mutants, obcordifoliate mutants and bi-stigmatic mutants. The extra early mutant was obtained when treated with 100 Gy dose. The mutant was selfed and forwarded from M 2 to M 4 generation. In the M 4 generation the mutant line was raised along with the parental variety. Normal cultural practices were followed and the biometrical observations were recorded. It was observed that for the characters viz., total number of branches per plant, number of pods per plants, seeds per pod, 100 seed weight and seed yield per plant there was no difference between the mutant and parent variety. Whereas, regarding the days to flowering and maturity the mutants were earlier than the parents. The observation was recorded from two hundred plants each. The mutant gives the same yield in 90 days as that of the parent variety in 107 days, which make it an economic mutant

  10. Problem-Solving Test: Tryptophan Operon Mutants

    Science.gov (United States)

    Szeberenyi, Jozsef

    2010-01-01

    This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…

  11. Synergistic inhibition of the intrinsic factor X activation by protein S and C4b-binding protein

    NARCIS (Netherlands)

    Koppelman, S.J.

    1995-01-01

    The complement protein C4b-binding protein plays an important role in the regulation of the protein C anticoagulant pathway. C4b-binding protein can bind to protein S, thereby inhibiting the cofactor activity of protein S for activated protein C. In this report, we describe a new role for

  12. Elements Required for an Efficient NADP-Malic Enzyme Type C4 Photosynthesis1[C][W][OPEN

    Science.gov (United States)

    Wang, Yu; Long, Stephen P.; Zhu, Xin-Guang

    2014-01-01

    C4 photosynthesis has higher light, nitrogen, and water use efficiencies than C3 photosynthesis. Although the basic anatomical, cellular, and biochemical features of C4 photosynthesis are well understood, the quantitative significance of each element of C4 photosynthesis to the high photosynthetic efficiency are not well defined. Here, we addressed this question by developing and using a systems model of C4 photosynthesis, which includes not only the Calvin-Benson cycle, starch synthesis, sucrose synthesis, C4 shuttle, and CO2 leakage, but also photorespiration and metabolite transport between the bundle sheath cells and mesophyll cells. The model effectively simulated the CO2 uptake rates, and the changes of metabolite concentrations under varied CO2 and light levels. Analyses show that triose phosphate transport and CO2 leakage can help maintain a high photosynthetic rate by balancing ATP and NADPH amounts in bundle sheath cells and mesophyll cells. Finally, we used the model to define the optimal enzyme properties and a blueprint for C4 engineering. As such, this model provides a theoretical framework for guiding C4 engineering and studying C4 photosynthesis in general. PMID:24521879

  13. Metabolic flux ratio analysis and cell staining suggest the existence of C4 photosynthesis in Phaeodactylum tricornutum.

    Science.gov (United States)

    Huang, A; Liu, L; Zhao, P; Yang, C; Wang, G C

    2016-03-01

    Mechanisms for carbon fixation via photosynthesis in the diatom Phaeodactylum tricornutum Bohlin were studied recently but there remains a long-standing debate concerning the occurrence of C4 photosynthesis in this species. A thorough investigation of carbon metabolism and the evidence for C4 photosynthesis based on organelle partitioning was needed. In this study, we identified the flux ratios between C3 and C4 compounds in P. tricornutum using (13)C-labelling metabolic flux ratio analysis, and stained cells with various cell-permeant fluorescent probes to investigate the likely organelle partitioning required for single-cell C4 photosynthesis. Metabolic flux ratio analysis indicated the C3/C4 exchange ratios were high. Cell staining indicated organelle partitioning required for single-cell C4 photosynthesis might exist in P. tricornutum. The results of (13)C-labelling metabolic flux ratio analysis and cell staining suggest single-cell C4 photosynthesis exists in P. tricornutum. This study provides insights into photosynthesis patterns of P. tricornutum and the evidence for C4 photosynthesis based on (13)C-labelling metabolic flux ratio analysis and organelle partitioning. © 2015 The Society for Applied Microbiology.

  14. Can the progressive increase of C4 bundle sheath leakiness at low PFD be explained by incomplete suppression of photorespiration?

    NARCIS (Netherlands)

    Kromdijk, J.; Griffiths, H.; Schepers, H.E.

    2010-01-01

    The ability to concentrate CO2 around Rubisco allows C-4 crops to suppress photorespiration. However, as phosphoenolpyruvate regeneration requires ATP, the energetic efficiency of the C-4 pathway at low photosynthetic flux densities (PFD) becomes a balancing act between primary fixation and

  15. 17 CFR 240.19c-4 - Governing certain listing or authorization determinations by national securities exchanges and...

    Science.gov (United States)

    2010-04-01

    ... authorization determinations by national securities exchanges and associations. 240.19c-4 Section 240.19c-4... determinations by national securities exchanges and associations. (a) The rules of each exchange shall provide as... national securities exchange, registered as such with the Securities and Exchange Commission pursuant to...

  16. The differences between NAD-ME and NADP-ME subtypes of C4 photosynthesis: more than decarboxylating enzymes

    Directory of Open Access Journals (Sweden)

    Xiaolan Rao

    2016-10-01

    Full Text Available As an adaptation to changing climatic conditions that caused high rates of photorespiration, C4 plants have evolved to display higher photosynthetic efficiency than C3 plants under elevated temperature, high light intensities and drought. The C4 plants independently evolved more than 60 times in 19 families of angiosperms to establish similar but not uniform C4 mechanisms to concentrate CO2 around the carboxylating enzyme Rubisco. C4 photosynthesis is divided into at least two basic biochemical subtypes based on the primary decarboxylating enzymes, NAD-dependent malic enzyme (NAD-ME and NADP-dependent malic enzyme (NADP-ME. The multiple polygenetic origins of these subtypes raise questions about the association of C4 variation between biochemical subtypes and diverse lineages. This review addresses the differences in evolutionary scenario, leaf anatomy, and especially C4 metabolic flow, C4 transporters and cell-specific function deduced from recently reported cell-specific transcriptomic, proteomic and metabolic analyses of NAD-ME and NADP-ME subtypes. Current omic analysis has revealed the extent to which component abundances differ between the two biochemical subtypes, leading to a better understanding of C4 photosynthetic mechanisms in NAD-ME and NADP-ME subtypes.

  17. Complement system proteins which interact with C3b or C4b A superfamily of structurally related proteins

    DEFF Research Database (Denmark)

    Reid, K B M; Bentley, D R; Campbell, R D

    1986-01-01

    Recent cDNA sequencing data has allowed the prediction of the entire amino acid sequences of complement components factor B and C2, the complement control proteins factor H and C4b-binding protein and a partial sequence for the Cab/C4b receptor CR1. These proteins all contain internal repeating u...

  18. Comprehensive approach to study complement C4 in systemic lupus erythematosus: Gene polymorphisms, protein levels and functional activity

    NARCIS (Netherlands)

    Tsang-A-Sjoe, M. W. P.; Bultink, I. E. M.; Korswagen, L. A.; van der Horst, A. [=Anneke; Rensink, I.; de Boer, M.; Hamann, D.; Voskuyl, A. E.; Wouters, D.

    2017-01-01

    Genetic variation of the genes encoding complement component C4 is strongly associated with systemic lupus erythematosus (SLE), a chronic multi-organ auto-immune disease. This study examined C4 and its isotypes on a genetic, protein, and functional level in 140 SLE patients and 104 healthy controls.

  19. Genetic screens to identify new Notch pathway mutants in Drosophila.

    Science.gov (United States)

    Giagtzoglou, Nikolaos

    2014-01-01

    Notch signaling controls a wide range of developmental processes, including proliferation, apoptosis, and cell fate specification during both development and adult tissue homeostasis. The functional versatility of the Notch signaling pathway is tightly linked with the complexity of its regulation in different cellular contexts. To unravel the complexity of Notch signaling, it is important to identify the different components of the Notch signaling pathway. A powerful strategy to accomplish this task is based on genetic screens. Given that the developmental context of signaling is important, these screens should be customized to specific cell populations or tissues. Here, I describe how to perform F1 clonal forward genetic screens in Drosophila to identify novel components of the Notch signaling pathway. These screens combine a classical EMS (ethyl methanesulfonate) chemical mutagenesis protocol along with clonal analysis via FRT-mediated mitotic recombination. These F1 clonal screens allow rapid phenotypic screening within clones of mutant cells induced at specific developmental stages and in tissues of interest, bypassing the pleiotropic effects of isolated mutations. More importantly, since EMS mutations have been notoriously difficult to map to specific genes in the past, I briefly discuss mapping methods that allow rapid identification of the causative mutations.

  20. Mycorrhizal Symbiotic Efficiency on C3 and C4 Plants under Salinity Stress – A Meta-Analysis

    Directory of Open Access Journals (Sweden)

    Murugesan Chandrasekaran

    2016-08-01

    Full Text Available A wide range of C3 and C4 plant species could acclimatize and grow under the impact of salinity stress. Symbiotic relationship between plant roots and arbuscular mycorrhizal fungi (AMF are widespread and are well known to ameliorate the influence of salinity stress on agro-ecosystem. In the present study, we sought to understand the phenomenon of variability on AMF symbiotic relationship on saline stress amelioration in C3 and C4 plants. Thus, the objective was to compare varied mycorrhizal symbiotic relationship between C3 and C4 plants in saline conditions. To accomplish the above mentioned objective, we conducted a random effects models meta-analysis across 60 published studies. An effect size was calculated as the difference in mycorrhizal responses between the AMF inoculated plants and its corresponding control under saline conditions. Responses were compared between (i identity of AMF species and AMF inoculation, (ii identity of host plants (C3 vs. C4 and plant functional groups, (iii soil texture and level of salinity and (iv experimental condition (greenhouse vs. field. Results indicate that both C3 and C4 plants under saline condition responded positively to AMF inoculation, thereby overcoming the predicted effects of symbiotic efficiency. Although C3 and C4 plants showed positive effects under low (EC8 ds/m saline conditions, C3 plants showed significant effects for mycorrhizal inoculation over C4 plants. Among the plant types, C4 annual and perennial plants, C4 herbs and C4 dicot had a significant effect over other counterparts. Between single and mixed AMF inoculants, single inoculants Rhizophagus intraradices had a positive effect on C3 plants whereas Funneliformis mosseae had a positive effect on C4 plants than other species. In all of the observed studies, mycorrhizal inoculation showed positive effects on shoot, root and total biomass, and in nitrogen, phosphorous and potassium (K uptake. However, it showed negative effects in

  1. Life Span Developmental Approach

    Directory of Open Access Journals (Sweden)

    Ali Eryilmaz

    2011-03-01

    Full Text Available The Life Span Developmental Approach examines development of individuals which occurs from birth to death. Life span developmental approach is a multi-disciplinary approach related with disciplines like psychology, psychiatry, sociology, anthropology and geriatrics that indicates the fact that development is not completed in adulthood, it continues during the life course. Development is a complex process that consists of dying and death. This approach carefully investigates the development of individuals with respect to developmental stages. This developmental approach suggests that scientific disciplines should not explain developmental facts only with age changes. Along with aging, cognitive, biological, and socioemotional development throughout life should also be considered to provide a reasonable and acceptable context, guideposts, and reasonable expectations for the person. There are three important subjects whom life span developmental approach deals with. These are nature vs nurture, continuity vs discontinuity, and change vs stability. Researchers using life span developmental approach gather and produce knowledge on these three most important domains of individual development with their unique scientific methodology.

  2. Isolation and initial characterisation of complement components C3 and C4 of the nurse shark and the channel catfish.

    Science.gov (United States)

    Dodds, A W; Smith, S L; Levine, R P; Willis, A C

    1998-01-01

    Complement components C3 and C4 have been isolated from the serum of the nurse shark (Ginglymostoma cirratum) and of the channel catfish (Ictalurus punctatus). As in the higher vertebrates, the fish C4 proteins have three-chain structures while the C3 proteins have two-chain structures. All four proteins have intra-chain thioesters located within their highest molecular mass polypeptides. N-terminal sequence analysis of the polypeptides has confirmed the identity of the proteins. In all cases except the catfish C3 alpha-chain, which appears to have a blocked N-terminus, sequence similarities are apparent in comparisons with the chains of C3 and C4 from higher vertebrates. We have confirmed that the activity/protein previously designated C2n is the nurse shark analogue of mammalian C4. This is the first report of structural evidence for C4 in both the bony and cartilaginous fish.

  3. Expression of C4.4A in precursor lesions of pulmonary adenocarcinoma and squamous cell carcinoma

    DEFF Research Database (Denmark)

    Jacobsen, Benedikte; Santoni-Rugiu, Eric; Illemann, Martin

    2012-01-01

    in precursor lesions of lung squamous cell carcinoma and adenocarcinoma was investigated by stainings with a specific anti-C4.4A antibody. In the transformation from normal bronchial epithelium to squamous cell carcinoma, C4.4A was weakly expressed in basal cell hyperplasia but dramatically increased...... in squamous metaplasia. This was confined to the cell membrane and sustained in dysplasia, carcinoma in situ, and the invasive carcinoma. The induction of C4.4A already at the stage of hyperplasia could indicate that it is a marker of very early squamous differentiation, which aligns well with our earlier...... finding that C4.4A expression levels do not provide prognostic information on the survival of squamous cell carcinoma patients. In the progression from normal alveolar epithelium to peripheral adenocarcinoma, we observed an unexpected, distinct cytoplasmic staining for C4.4A in a fraction of atypical...

  4. Prospects for improving CO2 fixation in C3-crops through understanding C4-Rubisco biogenesis and catalytic diversity.

    Science.gov (United States)

    Sharwood, Robert E; Ghannoum, Oula; Whitney, Spencer M

    2016-06-01

    By operating a CO2 concentrating mechanism, C4-photosynthesis offers highly successful solutions to remedy the inefficiency of the CO2-fixing enzyme Rubisco. C4-plant Rubisco has characteristically evolved faster carboxylation rates with low CO2 affinity. Owing to high CO2 concentrations in bundle sheath chloroplasts, faster Rubisco enhances resource use efficiency in C4 plants by reducing the energy and carbon costs associated with photorespiration and lowering the nitrogen investment in Rubisco. Here, we show that C4-Rubisco from some NADP-ME species, such as maize, are also of potential benefit to C3-photosynthesis under current and future atmospheric CO2 pressures. Realizing this bioengineering endeavour necessitates improved understanding of the biogenesis requirements and catalytic variability of C4-Rubisco, as well as the development of transformation capabilities to engineer Rubisco in a wider variety of food and fibre crops. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Expression of C4.4A in an in Vitro Human Tissue-Engineered Skin Model

    DEFF Research Database (Denmark)

    Jacobsen, Benedikte; Larouche, Danielle; Rochette-Drouin, Olivier

    2017-01-01

    , the biological function of C4.4A remains unknown. To enable further studies, we evaluated the expression of C4.4A in monolayer cultures of normal human keratinocytes and in tissue-engineered skin substitutes (TESs) produced by the self-assembly approach, which allow the formation of a fully differentiated...... epidermis tissue. Results showed that, in monolayer, C4.4A was highly expressed in the centre of keratinocyte colonies at cell-cell contacts areas, while some cells located at the periphery presented little C4.4A expression. In TES, emergence of C4.4A expression coincided with the formation of the stratum...

  6. C-4 Gem-Dimethylated Oleanes of Gymnema sylvestre and Their Pharmacological Activities

    Directory of Open Access Journals (Sweden)

    Giovanni Di Fabio

    2013-12-01

    Full Text Available Gymnema sylvestre R. Br., one of the most important medicinal plants of the Asclepiadaceae family, is a herb distributed throughout the World, predominantly in tropical countries. The plant, widely used for the treatment of diabetes and as a diuretic in Indian proprietary medicines, possesses beneficial digestive, anti-inflammatory, hypoglycemic and anti-helmentic effects. Furthermore, it is believed to be useful in the treatment of dyspepsia, constipation, jaundice, hemorrhoids, cardiopathy, asthma, bronchitis and leucoderma. A literature survey revealed that some other notable pharmacological activities of the plant such as anti-obesity, hypolipidemic, antimicrobial, free radical scavenging and anti-inflammatory properties have been proven too. This paper aims to summarize the chemical and pharmacological reports on a large group of C-4 gem-dimethylated pentacyclic triterpenoids from Gymnema sylvestre.

  7. Numerical Calculation of Coherent Synchrotron Radiation Effects Using TraFiC4

    International Nuclear Information System (INIS)

    Kabel, Andreas C.

    2000-01-01

    Coherent synchrotron radiation (CSR) occurs when short bunches travel on strongly bent trajectories. Its effects on high-quality beams can be severe and are well understood qualitatively. For quantitative results, however, one has to rely on numerical methods. There exist several simulation codes utilizing different approaches. The authors describe in some detail the code TraFiC 4 developed at DESY for design and analysis purposes, which approaches the problem from first principles and solves the equations of motion either perturbatively or self-consistently. They present some calculational results and comparison with experimental data. Also, they give examples of how the code can be used to design beamlines with minimal emittance growth due to CSR

  8. Release of leukotriene C4 from human polymorphonuclear leucocytes as determined by radioimmunoassay

    International Nuclear Information System (INIS)

    Aehringhaus, U.; Woelbling, R.H.; Peskar, B.M.; Peskar, B.A.; Koenig, W.; Patrono, C.

    1982-01-01

    Rabbits were immunized with a conjugate of leukotriene (LT)C 4 and bovine serum albumin prepared by coupling the single free amino group of the hapten to the protein using gluteraldehyde. Binding of [ 3 H]LTC 4 to the antibodies obtained is inhibited by 50% with 1.5 ng LTC 4 . The relative cross-section of LTD 4 is 16% and of LTC 4 -methyl ester 3.6%. The validity of the radioimmunoassay was demonstrated by comparison with bioassay using the isolated guinea pig ileum. Using the radioimmunoassay it could be shown that endogenous LTC 4 is released in a dose-dependent manner by human polymorphonuclear leucocytes stimulated with the divalent cation ionophore A23187. (Auth.)

  9. FAD C(4a)-hydroxide stabilized in a naturally fused styrene monooxygenase

    Science.gov (United States)

    Schlömann, Michael; van Berkel, Willem J.H.; Gassner, George T.

    2013-01-01

    StyA2B represents a new class of styrene monooxygenases that integrates flavin-reductase and styrene-epoxidase activities into a single polypeptide. This naturally-occurring fusion protein offers new avenues for studying and engineering biotechnologically relevant enantioselective biochemical epoxidation reactions. Stopped-flow kinetic studies of StyA2B reported here identify reaction intermediates similar to those reported for the separate reductase and epoxidase components of related two-component systems. Our studies identify substrate epoxidation and elimination of water from the FAD C(4a)-hydroxide as rate-limiting steps in the styrene epoxidation reaction. Efforts directed at accelerating these reaction steps are expected to greatly increase catalytic efficiency and the value of StyA2B as biocatalyst. PMID:24157359

  10. Promotor polymorphisms in leukotriene C4 synthase and risk of ischemic cerebrovascular disease

    DEFF Research Database (Denmark)

    Freiberg, J.J.; Tybjaerg-Hansen, A.; Sillesen, H.

    2008-01-01

    OBJECTIVE: Cysteinyl leukotrienes are involved in inflammation and possibly in early carotid atherosclerosis. We tested the hypothesis that the -444 A/C and -1072 G/A polymorphisms of the leukotriene C(4) synthase associate with risk of ischemic cerebrovascular disease. METHODS AND RESULTS: We...... genotyped 10 592 individuals from the Danish general population, the Copenhagen City Heart Study. During 24 years of follow-up, 557 individuals developed ischemic cerebrovascular disease. The allele frequency was 0.07 for -1072 A and 0.29 for -444 C. Cumulative incidence for ischemic cerebrovascular disease...... was higher for -1072 AA versus GG genotype (log-rank: P=0.002), and lower for -444 CC versus AA genotype (log-rank: P=0.008). Combined genotypes showed corresponding cumulative incidence differences (log-rank: P=0.003). Multifactorially adjusted hazard ratios for ischemic cerebrovascular disease were 2...

  11. Dwarf mutant of rice variety Seratus Malam

    International Nuclear Information System (INIS)

    Mugiono, P. S.; Soemanggono, A.M.R.

    1989-01-01

    Full text: Seeds of 'Seratus Malam', a local tall upland variety with long panicles and high yield potential were irradiated with 10-50 krad gamma rays in 1983. From 50,000 M 2 plants, 130 semidwarf mutants and 1 dwarf mutant were selected. The dwarf mutant M-362 was obtained from the 10 krad treatment. The mutant shows about 50% reduction in plant height, but also in number of productive tillers. Thus the yield per plant is also significantly less. However, the mutant gene is not allelic to DGWG and therefore may be useful in cross breeding. (author)

  12. UPLC-MS/MS based diagnostics for epithelial ovarian cancer using fully sialylated C4-binding protein.

    Science.gov (United States)

    Tanabe, Kazuhiro; Matsuo, Koji; Miyazawa, Masaki; Hayashi, Masaru; Ikeda, Masae; Shida, Masako; Hirasawa, Takeshi; Sho, Ryuichiro; Mikami, Mikio

    2018-05-01

    Serum levels of fully sialylated C4-binding protein (FS-C4BP) are remarkably elevated in patients with epithelial ovarian cancer (EOC) and can be used as a marker to distinguish ovarian clear cell carcinoma from endometrioma. This study aimed to develop a stable, robust and reliable liquid chromatography-hybrid mass spectrometry (UPLC-MS/MS) based diagnostic method that would generalize FS-C4BP as a clinical EOC biomarker. Glycopeptides derived from 20 μL of trypsin-digested serum glycoprotein were analyzed via UPLC equipped with an electrospray ionization time-of-flight mass spectrometer. This UPLC-MS/MS-based diagnostic method was optimized for FS-C4BP and validated using sera from 119 patients with EOC and 127 women without cancer. A1958 (C4BP peptide with two fully sialylated biantennary glycans) was selected as a marker of FS-C4BP because its level in serum was highest among FS-C4BP family members. Preparation and UPLC-MS/MS were optimized for A1958, and performance and robustness were significantly improved relative to our previous method. An area under the curve analysis of the FS-C4BP index receiver operating characteristic curve revealed that the ratio between A1958 and A1813 (C4BP peptide with two partially sialylated biantennary glycans) reached 85%. A combination of the FS-C4BP index and carbohydrate antigen-125 levels further enhanced the sensitivity and specificity. © 2017 The Authors. Biomedical Chromatography published by John Wiley & Sons Ltd.

  13. Physiological advantages of C4 grasses in the field: a comparative experiment demonstrating the importance of drought.

    Science.gov (United States)

    Taylor, Samuel H; Ripley, Brad S; Martin, Tarryn; De-Wet, Leigh-Ann; Woodward, F Ian; Osborne, Colin P

    2014-06-01

    Global climate change is expected to shift regional rainfall patterns, influencing species distributions where they depend on water availability. Comparative studies have demonstrated that C4 grasses inhabit drier habitats than C3 relatives, but that both C3 and C4 photosynthesis are susceptible to drought. However, C4 plants may show advantages in hydraulic performance in dry environments. We investigated the effects of seasonal variation in water availability on leaf physiology, using a common garden experiment in the Eastern Cape of South Africa to compare 12 locally occurring grass species from C4 and C3 sister lineages. Photosynthesis was always higher in the C4 than C3 grasses across every month, but the difference was not statistically significant during the wettest months. Surprisingly, stomatal conductance was typically lower in the C3 than C4 grasses, with the peak monthly average for C3 species being similar to that of C4 leaves. In water-limited, rain-fed plots, the photosynthesis of C4 leaves was between 2.0 and 7.4 μmol m(-2) s(-1) higher, stomatal conductance almost double, and transpiration 60% higher than for C3 plants. Although C4 average instantaneous water-use efficiencies were higher (2.4-8.1 mmol mol(-1)) than C3 averages (0.7-6.8 mmol mol(-1)), differences were not as great as we expected and were statistically significant only as drought became established. Photosynthesis declined earlier during drought among C3 than C4 species, coincident with decreases in stomatal conductance and transpiration. Eventual decreases in photosynthesis among C4 plants were linked with declining midday leaf water potentials. However, during the same phase of drought, C3 species showed significant decreases in hydrodynamic gradients that suggested hydraulic failure. Thus, our results indicate that stomatal and hydraulic behaviour during drought enhances the differences in photosynthesis between C4 and C3 species. We suggest that these drought responses are

  14. Low copy numbers of complement C4 and homozygous deficiency of C4A may predispose to severe disease and earlier disease onset in patients with systemic lupus erythematosus.

    Science.gov (United States)

    Jüptner, M; Flachsbart, F; Caliebe, A; Lieb, W; Schreiber, S; Zeuner, R; Franke, A; Schröder, J O

    2018-04-01

    Objectives Low copy numbers and deletion of complement C4 genes are potent risk factors for systemic lupus erythematosus (SLE). However, it is not known whether this genetic association affects the clinical outcome. We investigated C4 copy number variation and its relationship to clinical and serological features in a Northern European lupus cohort. Methods We genotyped the C4 gene locus using polymerase chain reaction (PCR)-based TaqMan assays in 169 patients with SLE classified according to the 1997 revised American College of Rheumatology (ACR) criteria and in 520 matched controls. In the patient group the mean C4 serum protein concentrations nephelometrically measured during a 12-month period prior to genetic analysis were compared to C4 gene copy numbers. Severity of disease was classified according to the intensity of the immunosuppressive regimens applied and compared to C4 gene copy numbers, too. In addition, we performed a TaqMan based analysis of three lupus-associated single-nucleotide polymorphisms (SNPs) located inside the major histocompatibility complex (MHC) to investigate the independence of complement C4 in association with SLE. Results Homozygous deficiency of the C4A isotype was identified as the strongest risk factor for SLE (odds ratio (OR) = 5.329; p = 7.7 × 10 -3 ) in the case-control comparison. Moreover, two copies of total C4 were associated with SLE (OR = 3.699; p = 6.8 × 10 -3 ). C4 serum levels were strongly related to C4 gene copy numbers in patients, the mean concentration ranging from 0.110 g/l (two copies) to 0.256 g/l (five to six copies; p = 4.9 × 10 -6 ). Two copies of total C4 and homozygous deletion of C4A were associated with a disease course requiring cyclophosphamide therapy (OR = 4.044; p = 0.040 and OR = 5.798; p = 0.034, respectively). Homozygous deletion of C4A was associated with earlier onset of SLE (median 24 vs. 34 years; p = 0.019) but not significant after

  15. Reproductive and developmental toxicology

    National Research Council Canada - National Science Library

    Gupta, Ramesh C

    2011-01-01

    .... With a special focus on placental toxicity, this book is the only available reference to connect the three key risk stages, and is the only resource to include reproductive and developmental toxicity in domestic animals, fish, and wildlife.

  16. Developmental coordination disorder

    Science.gov (United States)

    Developmental coordination disorder can lead to: Learning problems Low self-esteem resulting from poor ability at sports and teasing by other children Repeated injuries Weight gain as a result of not wanting to participate ...

  17. Facts about Developmental Disabilities

    Science.gov (United States)

    ... play, learn, speak, behave, and move (for example, crawling and walking). Children develop at their own pace, ... person’s lifetime. Most developmental disabilities begin before a baby is born, but some can happen after birth ...

  18. Life Span Developmental Approach

    OpenAIRE

    Ali Eryilmaz

    2011-01-01

    The Life Span Developmental Approach examines development of individuals which occurs from birth to death. Life span developmental approach is a multi-disciplinary approach related with disciplines like psychology, psychiatry, sociology, anthropology and geriatrics that indicates the fact that development is not completed in adulthood, it continues during the life course. Development is a complex process that consists of dying and death. This approach carefully investigates the development of...

  19. Mid-Miocene C4 expansion on the Chinese Loess Plateau under an enhanced Asian summer monsoon

    Science.gov (United States)

    Dong, Jibao; Liu, Zhonghui; An, Zhisheng; Liu, Weiguo; Zhou, Weijian; Qiang, Xiaoke; Lu, Fengyan

    2018-06-01

    Atmospheric CO2 starvation, aridity, fire and warm season precipitation have all been proposed as major contributors to C4 plant expansion during the Late Miocene. However, the driving factors responsible for the distribution of C4 plants in the early and mid-Miocene still remain enigmatic. Here we report pedogenic carbon and oxygen isotope data (δ13Cpedo, δ18Opedo), along with magnetic susceptibility (MS) results, from the Zhuang Lang drilling core on the Chinese Loess Plateau (CLP). Elevated δ13Cpedo values (>-5‰) signal a prominent C4 expansion and substantially increased δ18Opedo and MS values indicate enhanced Asian summer monsoon (ASM) precipitation. Both of these conditions are observed during the Mid-Miocene Climatic Optimum (MMCO), 14.5-17 million years ago. The marked increase in C4 plants, associated with warm temperatures and increased precipitation, strongly suggests the control of an enhanced ASM on C4 expansion on the CLP during the MMCO. This finding contrasts with the late-Miocene C4 expansion associated with cooling and drying conditions observed in low latitudes and argues for regionally specific control of C4 plant distribution/expansion.

  20. Deriving C4 photosynthetic parameters from combined gas exchange and chlorophyll fluorescence using an Excel tool: theory and practice.

    Science.gov (United States)

    Bellasio, Chandra; Beerling, David J; Griffiths, Howard

    2016-06-01

    The higher photosynthetic potential of C4 plants has led to extensive research over the past 50 years, including C4 -dominated natural biomes, crops such as maize, or for evaluating the transfer of C4 traits into C3 lineages. Photosynthetic gas exchange can be measured in air or in a 2% Oxygen mixture using readily available commercial gas exchange and modulated PSII fluorescence systems. Interpretation of these data, however, requires an understanding (or the development) of various modelling approaches, which limit the use by non-specialists. In this paper we present an accessible summary of the theory behind the analysis and derivation of C4 photosynthetic parameters, and provide a freely available Excel Fitting Tool (EFT), making rigorous C4 data analysis accessible to a broader audience. Outputs include those defining C4 photochemical and biochemical efficiency, the rate of photorespiration, bundle sheath conductance to CO2 diffusion and the in vivo biochemical constants for PEP carboxylase. The EFT compares several methodological variants proposed by different investigators, allowing users to choose the level of complexity required to interpret data. We provide a complete analysis of gas exchange data on maize (as a model C4 organism and key global crop) to illustrate the approaches, their analysis and interpretation. © 2015 John Wiley & Sons Ltd. © 2016 John Wiley & Sons Ltd.

  1. Banff initiative for quality assurance in transplantation (BIFQUIT): reproducibility of C4d immunohistochemistry in kidney allografts.

    Science.gov (United States)

    Mengel, M; Chan, S; Climenhaga, J; Kushner, Y B; Regele, H; Colvin, R B; Randhawa, P

    2013-05-01

    Detection of C4d is crucial for diagnosing antibody-mediated-rejection. We conducted a multicenter trial to assess the reproducibility for C4d immunohistochemistry on paraffin tissue. Unstained slides from a tissue microarray (TMA) comprising 44 kidney allograft specimens representing a full analytical spectrum for C4d were distributed to 73 institutions. Participants stained TMA slides using local protocols and evaluated their slides following the Banff C4d schema. Local staining details and evaluation scores were collected online. Stained slides were returned for centralized panel re-evaluation. Kappa statistics were used to determine reproducibility. Poor interinstitutional reproducibility was observed (kappa 0.17), which was equally due to limitations in interobserver (kappa 0.44) and interlaboratory reproducibility (kappa 0.46). Depending on the cut-off, reproducibility could be improved by omitting C4d grading and only considering ± calls. Heat-induced epitope recovery (pH 6-7, 20-30 min, citrate buffer) with polyclonal antibody incubation (40 min) appeared as best practice. The BIFQUIT trial results indicated that C4d staining on paraffin sections varies considerably between laboratories. Refinement of the current Banff C4d scoring schema and harmonization of tissue processing and staining protocols is necessary to achieve acceptable reproducibility. © Copyright 2013 The American Society of Transplantation and the American Society of Transplant Surgeons.

  2. Elevated levels of the complement activation product C4d in bronchial fluids for the diagnosis of lung cancer.

    Directory of Open Access Journals (Sweden)

    Daniel Ajona

    Full Text Available Molecular markers in bronchial fluids may contribute to the diagnosis of lung cancer. We previously observed a significant increase of C4d-containing complement degradation fragments in bronchoalveolar lavage (BAL supernatants from lung cancer patients in a cohort of 50 cases and 22 controls (CUN cohort. The present study was designed to determine the diagnostic performance of these complement fragments (hereinafter jointly referred as C4d in bronchial fluids. C4d levels were determined in BAL supernatants from two independent cohorts: the CU cohort (25 cases and 26 controls and the HUVR cohort (60 cases and 98 controls. A series of spontaneous sputum samples from 68 patients with lung cancer and 10 controls was also used (LCCCIO cohort. Total protein content, complement C4, complement C5a, and CYFRA 21-1 were also measured in all cohorts. C4d levels were significantly increased in BAL samples from lung cancer patients. The area under the ROC curve was 0.82 (95%CI = 0.71-0.94 and 0.67 (95%CI = 0.58-0.76 for the CU and HUVR cohorts, respectively. In addition, unlike the other markers, C4d levels in BAL samples were highly consistent across the CUN, CU and HUVR cohorts. Interestingly, C4d test markedly increased the sensitivity of bronchoscopy in the two cohorts in which cytological data were available (CUN and HUVR cohorts. Finally, in the LCCCIO cohort, C4d levels were higher in sputum supernatants from patients with lung cancer (area under the ROC curve: 0.7; 95%CI = 0.56-0.83. In conclusion, C4d is consistently elevated in bronchial fluids from lung cancer patients and may be used to improve the diagnosis of the disease.

  3. Bundle-sheath leakiness in C4 photosynthesis: a careful balancing act between CO2 concentration and assimilation.

    Science.gov (United States)

    Kromdijk, Johannes; Ubierna, Nerea; Cousins, Asaph B; Griffiths, Howard

    2014-07-01

    Crop species with the C4 photosynthetic pathway are generally characterized by high productivity, especially in environmental conditions favouring photorespiration. In comparison with the ancestral C3 pathway, the biochemical and anatomical modifications of the C4 pathway allow spatial separation of primary carbon acquisition in mesophyll cells and subsequent assimilation in bundle-sheath cells. The CO2-concentrating C4 cycle has to operate in close coordination with CO2 reduction via the Calvin-Benson-Bassham (CBB) cycle in order to keep the C4 pathway energetically efficient. The gradient in CO2 concentration between bundle-sheath and mesophyll cells facilitates diffusive leakage of CO2. This rate of bundle-sheath CO2 leakage relative to the rate of phosphoenolpyruvate carboxylation (termed leakiness) has been used to probe the balance between C4 carbon acquisition and subsequent reduction as a result of environmental perturbations. When doing so, the correct choice of equations to derive leakiness from stable carbon isotope discrimination (Δ(13)C) during gas exchange is critical to avoid biased results. Leakiness responses to photon flux density, either short-term (during measurements) or long-term (during growth and development), can have important implications for C4 performance in understorey light conditions. However, recent reports show leakiness to be subject to considerable acclimation. Additionally, the recent discovery of two decarboxylating C4 cycles operating in parallel in Zea mays suggests that flexibility in the transported C4 acid and associated decarboxylase could also aid in maintaining C4/CBB balance in a changing environment. In this paper, we review improvements in methodology to estimate leakiness, synthesize reports on bundle-sheath leakiness, discuss different interpretations, and highlight areas where future research is necessary. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology

  4. PNRI mutant variety: Cordyline 'Afable'

    International Nuclear Information System (INIS)

    Aurigue, Fernando B.

    2012-01-01

    Cordyline 'Afable', registered by the Philippine Nuclear Research Institute as NSIC 2009 Or-83, is an induced mutant developed from Cordyline 'Kiwi' by treating stem cuttings with acute gamma radiation from a Cobalt-60 source. The new mutant is identical to Cordyline 'Kiwi' in growth habit but differs in foliage color, and exhibits field resistance to Phytophthora sp., a fungus that causes leaf blight and rot in Ti plants. Results of this mutation breeding experiment showed that leaf color was altered by gamma irradiation and resistance to fungal diseases was improved. It also demonstrated how mutations that occur in nature may be generated artificially. Propagation of cordyline 'Afable' is true-to-type by vegetative propagation methods, such as separation of suckers and offshoots, shoot tip cutting, and top cutting. Aside from landscaping material, terrarium or dish-garden plant, it is ideal as containerized plant for indoor and outdoor use. The leaves or shoots may be harvested as cut foliage for flower arrangements. (author)

  5. Development mutants of anabaena doliolum defective in repair of UV-damage

    International Nuclear Information System (INIS)

    Tiwari, D.N.; Singh, C.B.

    1980-01-01

    Nitrosoguanidine induced 'blue' pigment mutants of the blue-green alga anabaena doliolum were isolated. The blue-mutants on further characterization were grouped into three developmental phenotypes - (i) those forming doli-form blue-spores of heterogenous size i.e., Ad 011, (ii) those forming spheroidal cells in the stationary phase, some of which behave like spores on transfer to fresh medium i.e., Ad 012, and (iii) those showing no sporulation and conditionally producing abnormal cells in the presence of combined nitrogen only i.e., Ad 007. The former two classes of mutants showed the formation of abnormal cells irrespective of the presence or absence of combined nitrogen sources in the medium. The formation of abnormal cells in the filaments of the above mutants were distinguished by their larger size and irregular mode of division leading to true-branch formation. The comparative characterization of these mutant strains with the parental one showed sluggish growth, increased UV-sensitivity, almost unchanged photorepair capacity, a marked change in the pigment composition and relative resistance to nitrosoguanidine. Irregular cell division in both space and time in the mutant strains and their increased sensitivity to ultraviolet irradiation indicate the possible involvement of dark repair system in maintaining the precision of cell cylce in this alga. (orig.) 891 AJ/orig. 892 HIS

  6. Analisis Perbandingan Teknik Support Vector Regression (SVR) Dan Decision Tree C4.5 Dalam Data Mining

    OpenAIRE

    Astuti, Yuniar Andi

    2011-01-01

    This study examines techniques Support Vector Regression and Decision Tree C4.5 has been used in studies in various fields, in order to know the advantages and disadvantages of both techniques that appear in Data Mining. From the ten studies that use both techniques, the results of the analysis showed that the accuracy of the SVR technique for 59,64% and C4.5 for 76,97% So in this study obtained a statement that C4.5 is better than SVR 097038020

  7. The Clinical and Genomic Significance of Donor-Specific Antibody–Positive/C4d-Negative and Donor-Specific Antibody–Negative/C4d-Negative Transplant Glomerulopathy

    Science.gov (United States)

    Hayde, Nicole; Bao, Yi; Pullman, James; Ye, Bin; Calder, R. Brent; Chung, Monica; Schwartz, Daniel; Lubetzky, Michelle; Ajaimy, Maria; de Boccardo, Graciela

    2013-01-01

    Summary Background This study investigated the mechanisms involved in development of donor-specific antibody (DSA) and/or C4d-negative transplant glomerulopathy (TGP) by allograft gene expression profiles using microarrays. Design, Setting, Participants, & Measurements This cohort study was conducted in kidney transplant recipients. Patients were eligible for inclusion if they required a clinically indicated biopsy at any time point after their transplant. They were then classified according to their histopathology findings and DSA and C4d results. Eighteen chronic antibody-mediated rejection (CAMR), 14 DSA+/C4d− TGP, 25 DSA−/C4d− TGP, and 47 nonspecific interstitial fibrosis/tubular atrophy (IFTA) biopsy specimens were identified. In a subset of patients from the study population, biopsy specimens in each group and normal transplant kidney specimens were analyzed with Affymetrix Human Gene 1.0 ST Arrays. Results The mean sum score of glomerulitis and peritubular capillaritis increased from 0.28±0.78 in IFTA specimens to 0.75±0.85 in DSA−/C4d− TGP specimens, 1.71±1.49 in DSA+/C4d−/TGP specimens, and 2.11±1.74 in CAMR specimens (PTGP specimens (14.3%), and DSA−/C4d− TGP specimens (16%) (P=0.01). With use of microarrays, comparison of the gene expression profiles of DSA−/C4d− TGP specimens with glomerulitis + peritubular capillaritis scores > 0 to normal and IFTA biopsy specimens revealed higher expression of quantitative cytotoxic T cell–associated transcripts (QCAT). However, both CAMR and DSA+/C4d− TGP specimens had higher expression of not only QCAT but also IFN-γ and rejection-induced, constitutive macrophage-associated, natural killer cell–associated, and DSA-selective transcripts. Endothelial cell–associated transcript expression was upregulated only in CAMR biopsy specimens. Conclusions These results suggested that DSA+/C4d− TGP biopsy specimens may be classified as CAMR. In contrast, DSA−/C4d− TGP specimens showed

  8. The clinical and genomic significance of donor-specific antibody-positive/C4d-negative and donor-specific antibody-negative/C4d-negative transplant glomerulopathy.

    Science.gov (United States)

    Hayde, Nicole; Bao, Yi; Pullman, James; Ye, Bin; Calder, R Brent; Chung, Monica; Schwartz, Daniel; Lubetzky, Michelle; Ajaimy, Maria; de Boccardo, Graciela; Akalin, Enver

    2013-12-01

    This study investigated the mechanisms involved in development of donor-specific antibody (DSA) and/or C4d-negative transplant glomerulopathy (TGP) by allograft gene expression profiles using microarrays. This cohort study was conducted in kidney transplant recipients. Patients were eligible for inclusion if they required a clinically indicated biopsy at any time point after their transplant. They were then classified according to their histopathology findings and DSA and C4d results. Eighteen chronic antibody-mediated rejection (CAMR), 14 DSA+/C4d- TGP, 25 DSA-/C4d- TGP, and 47 nonspecific interstitial fibrosis/tubular atrophy (IFTA) biopsy specimens were identified. In a subset of patients from the study population, biopsy specimens in each group and normal transplant kidney specimens were analyzed with Affymetrix Human Gene 1.0 ST Arrays. The mean sum score of glomerulitis and peritubular capillaritis increased from 0.28±0.78 in IFTA specimens to 0.75±0.85 in DSA-/C4d- TGP specimens, 1.71±1.49 in DSA+/C4d-/TGP specimens, and 2.11±1.74 in CAMR specimens (PTGP specimens (14.3%), and DSA-/C4d- TGP specimens (16%) (P=0.01). With use of microarrays, comparison of the gene expression profiles of DSA-/C4d- TGP specimens with glomerulitis + peritubular capillaritis scores > 0 to normal and IFTA biopsy specimens revealed higher expression of quantitative cytotoxic T cell-associated transcripts (QCAT). However, both CAMR and DSA+/C4d- TGP specimens had higher expression of not only QCAT but also IFN-γ and rejection-induced, constitutive macrophage-associated, natural killer cell-associated, and DSA-selective transcripts. Endothelial cell-associated transcript expression was upregulated only in CAMR biopsy specimens. These results suggested that DSA+/C4d- TGP biopsy specimens may be classified as CAMR. In contrast, DSA-/C4d- TGP specimens showed increased cytotoxic T cell-associated transcripts, suggesting T cell activation as a mechanism of injury.

  9. The phenotype of FancB-mutant mouse embryonic stem cells

    OpenAIRE

    Kim, Tae Moon; Ko, Jun Ho; Choi, Yong Jun; Hu, Lingchuan; Hasty, Paul

    2011-01-01

    Fanconi anemia (FA) is a rare autosomal recessive disease characterized by bone marrow failure, developmental defects and cancer. There are multiple FA genes that enable the repair of interstrand crosslinks (ICLs) in coordination with a variety of other DNA repair pathways in a way that is poorly understood. Here we present the phenotype of mouse embryonic stem (ES) cells mutated for FancB. We found FancB-mutant cells exhibited reduced cellular proliferation, hypersensitivity to the crosslink...

  10. Gamma ray induced mutants in Coleus

    International Nuclear Information System (INIS)

    Vasudevan, K.; Jos, J.S.

    1988-01-01

    The germplasm collection of Chinese potato (Coleus parviflorus Benth) contains almost no variation for yield contributing traits. The crop does not produce seeds. Treatment of underground tubers with 1 kR, 2 kR, 3 kR and 4 kR gamma rays resulted in 50 morphologically different mutants which are maintained as mutant clones. In the M 1 V 1 generation, suspected mutant sprouts, were carefully removed and grown separately. The most interesting mutant types are the following: (i) erect mutant with spoon shaped light green leaves, 30 cm long inflorescences against 20 cm in the control, cylindrical tubers measuring ca. 7.0 cm long and 3 cm girth against 4 cm and 2.5 cm in the control (ii) early mutants 1 and 2, one having less leaf serration, the other having light green small leaves and dwarf type (iii) fleshy leaf mutant, dark green, thick and smooth leaves. Control plants spread almost in 1 m 2 area and bear tubers from the nodes of branches. In the early mutants tuber formation is mainly restricted to the base of the plant, which makes harvest easier. The crop usually matures within 150 - 160 days, the early mutants are ready for harvest 100 days after planting. As the mutants are less spreading, the yield could be increased by closer spacing

  11. Gamma ray induced mutants in Coleus

    Energy Technology Data Exchange (ETDEWEB)

    Vasudevan, K; Jos, J S [Central Tuber Crops Research Institute, Trivandrum, Kerala (India)

    1988-07-01

    The germplasm collection of Chinese potato (Coleus parviflorus Benth) contains almost no variation for yield contributing traits. The crop does not produce seeds. Treatment of underground tubers with 1 kR, 2 kR, 3 kR and 4 kR gamma rays resulted in 50 morphologically different mutants which are maintained as mutant clones. In the M{sub 1}V{sub 1} generation, suspected mutant sprouts, were carefully removed and grown separately. The most interesting mutant types are the following: (i) erect mutant with spoon shaped light green leaves, 30 cm long inflorescences against 20 cm in the control, cylindrical tubers measuring ca. 7.0 cm long and 3 cm girth against 4 cm and 2.5 cm in the control (ii) early mutants 1 and 2, one having less leaf serration, the other having light green small leaves and dwarf type (iii) fleshy leaf mutant, dark green, thick and smooth leaves. Control plants spread almost in 1 m{sup 2} area and bear tubers from the nodes of branches. In the early mutants tuber formation is mainly restricted to the base of the plant, which makes harvest easier. The crop usually matures within 150 - 160 days, the early mutants are ready for harvest 100 days after planting. As the mutants are less spreading, the yield could be increased by closer spacing.

  12. Research on Service-Integrating-Based C4ISR System Simulation Environment%基于服务集成的C4ISR系统仿真环境研究

    Institute of Scientific and Technical Information of China (English)

    鲍广宇; 毛少杰; 居真奇; 刘晓明

    2008-01-01

    The future C4ISR systems will be based on the information grid environment, which is constructed with service-integrating technology. According to this, Modeling and Simulation (M&S) of C41SR systems will be based on the service-integrating technology, too. Firstly the principle of service-integrating was introduced, and then a service-integrating-based simulation environment was proposed to support the C4ISR system simulation and experiments in an SOA environment.%未来的C4ISR系统将建立在使用服务集成技术的信息栅格环境下,相应地,C4ISR建模与仿真系统也将基于服务集成技术构建.介绍了服务集成技术的原理,基于仿真服务总线技术,提出一个基于服务集成的C4ISR系统仿真环境,分析了该环境的技术体系结构和关键技术,为支持面向服务体系下的C4ISR系统仿真实验提供了一种可选解决方案.

  13. Sharing mutants and experimental information prepublication using FgMutantDb (https://scabusa.org/FgMutantDb).

    Science.gov (United States)

    Baldwin, Thomas T; Basenko, Evelina; Harb, Omar; Brown, Neil A; Urban, Martin; Hammond-Kosack, Kim E; Bregitzer, Phil P

    2018-06-01

    There is no comprehensive storage for generated mutants of Fusarium graminearum or data associated with these mutants. Instead, researchers relied on several independent and non-integrated databases. FgMutantDb was designed as a simple spreadsheet that is accessible globally on the web that will function as a centralized source of information on F. graminearum mutants. FgMutantDb aids in the maintenance and sharing of mutants within a research community. It will serve also as a platform for disseminating prepublication results as well as negative results that often go unreported. Additionally, the highly curated information on mutants in FgMutantDb will be shared with other databases (FungiDB, Ensembl, PhytoPath, and PHI-base) through updating reports. Here we describe the creation and potential usefulness of FgMutantDb to the F. graminearum research community, and provide a tutorial on its use. This type of database could be easily emulated for other fungal species. Published by Elsevier Inc.

  14. Klasifikasi Nilai Kelayakan Calon Debitur Baru Menggunakan Decision Tree C4.5

    Directory of Open Access Journals (Sweden)

    Bambang Hermanto

    2017-01-01

    Full Text Available In an effort to improve the quality of customer service, especially in terms of feasibility assessment of borrowers due to the increasing number of new prospective borrowers loans financing the purchase of a motor vehicle, then the company needs a decision making tool allowing you to easily and quickly estimate Where the debtor is able to pay off the loans. This study discusses the process generates C4.5 decision tree algorithm and utilizing the learning group of debtor financing dataset motorcycle. The decision tree is then interpreted into the form of decision rules that can be understood and used as a reference in processing the data of borrowers in determining the feasibility of prospective new borrowers. Feasibility value refers to the value of the destination parameter credit status. If the value of the credit is paid off status mean estimated prospective borrower is able to repay the loan in question, but if the credit status parameters estimated worth pull means candidates concerned debtor is unable to pay loans.. System testing is done by comparing the results of the testing data by learning data in three scenarios with the decision that the data is valid at over 70% for all case scenarios. Moreover, in generated tree  and generate rules takes fairly quickly, which is no more than 15 minutes for each test scenario

  15. High-resolution Moho model for Greenland from EIGEN-6C4 gravity data

    DEFF Research Database (Denmark)

    Steffen, Rebekka; Strykowski, Gabriel; Lund, Björn

    2017-01-01

    are difficult to obtain. Here, we take advantage of the global gravity model EIGEN-6C4, together with the Parker-Oldenburg algorithm, to estimate the depth to the Moho beneath Greenland and surroundings. The available free-air gravity data are corrected for the topographic effect and the effect of sedimentary...... basins. We also correct for the effect on gravity due to the weight of the ice sheet and the accompanying deflection of the Earth's surface, which has not previously been taken into account in gravity studies of currently glaciated regions. Our final Moho depth model for Greenland has an associated...... uncertainty of ±4.5 km for areas with sedimentary basins and ±4 km for areas without sedimentary basins. The model shows maximum Moho depths below east Greenland of up to 55 km and values less than 20 km offshore east Greenland. There is a marked increase in Moho depth of 10–15 km from northern to central...

  16. Fractal analysis of crack paths in Al2O3-TiC-4%Co composites

    Institute of Scientific and Technical Information of China (English)

    LI Jing; YIN Yan-sheng; LIU Ying-cai; MA Lai-peng

    2006-01-01

    Al2O3-TiC-4%Co(volume fraction) composites(ATC) with high toughness (7.8±0.8 MPa·m1/2) and strength (782±60 MPa) were fabricated. In comparison with Al2O3-TiC composites(AT), the fracture toughness was significantly improved by 60%. The crack paths, generated by Vickers indentation on the polished surfaces of both composites, were analyzed from a fractal point of view to distinguish the possible toughening mechanisms involved. Quantitative evaluation of indentation cracks indicates that the crack deflection plays a more effective role. Cracks of the ATC composites show higher deflection angles and more deflections along the path. ATC composites present higher fractal dimension (D=1.07) than AT composites (D=1.02), which is directly related to the higher fracture toughness. A significant relationship between crack path and toughness is evident: the more irregular the geometry of the crack, the higher the fracture toughness.

  17. Perfect Octagon Quadrangle Systems with an upper C4-system and a large spectrum

    Directory of Open Access Journals (Sweden)

    Luigia Berardi

    2011-02-01

    Full Text Available An octagon quadrangle is the graph consisting of an 8-cycle (x1, x2,..., x8 with two additional chords: the edges {x1, x4} and {x5, x8}. An octagon quadrangle system of order ν and index λ [OQS] is a pair (X,H, where X is a finite set of ν vertices and H is a collection of edge disjoint octagon quadrangles (called blocks which partition the edge set of λKν defined on X. An octagon quadrangle system Σ=(X,H of order ν and index λ is said to be upper C4-perfect if the collection of all of the upper 4-cycles contained in the octagon quadrangles form a μ-fold 4-cycle system of order ν; it is said to be upper strongly perfect, if the collection of all of the upper 4-cycles contained in the octagon quadrangles form a μ-fold 4-cycle system of order ν and also the collection of all of the outside 8-cycles contained in the octagon quadrangles form a ρ-fold 8-cycle system of order ν. In this paper, the authors determine the spectrum for these systems, in the case that it is the largest possible.

  18. Adsorption configurations of hydrocarbon ring molecules on GaAs(001)-c(4 x 4)

    Energy Technology Data Exchange (ETDEWEB)

    Passmann, R.; Bruhn, T.; Esser, N.; Vogt, P. [Institut fuer Festkoerperphysik, Technische Universitaet Berlin (Germany); ISAS, Institute for Analytical Sciences, Department Berlin, Berlin (Germany); Nilsen, T.A.; Fimland, B.O. [Department of Electronics and Telecomunications, Norwegian University of Science and Technology, Trondheim (Norway); Kneissl, M. [Institut fuer Festkoerperphysik, Technische Universitaet Berlin (Germany)

    2009-07-15

    The understanding of self-assembly and bonding mechanisms of organic molecules on semiconductor surfaces represents a central research aspect in the investigation of novel organic/inorganic interfaces and their technological applicability. Here, we investigated the adsorption and bond formation of cyclopentene and 1,4-cyclohexadiene on a GaAs(001)-c(4 x 4) surface in order to clarify the influence of the number of intra-molecular C=C double bonds on the respective adsorption sites. For a determination of the adsorption configuration, the interfaces were characterized electronically and optically by synchrotron based X-ray photoelectron spectroscopy (SXPS), low energy electron diffraction (LEED) and reflectance anisotropy spectroscopy (RAS). The results reveal significantly different adsorption configurations for the two molecules. While cyclopentene bonds with a single covalent bond to the surface, 1,4-cyclohexadiene adsorbs onto the surface by the formation of multiple covalent bonds, e.g. bridge bonds. (copyright 2009 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  19. Cultivating C4 crops in a changing climate: sugarcane in Ghana

    International Nuclear Information System (INIS)

    Black, Emily; Vidale, Pier Luigi; Osborne, Tom; Van den Hoof, Catherine; Verhoef, Anne; Cuadra, Santiago Vianna

    2012-01-01

    Over the next few decades, it is expected that increasing fossil fuel prices will lead to a proliferation of energy crop cultivation initiatives. The environmental sustainability of these activities is thus a pressing issue—particularly when they take place in vulnerable regions, such as West Africa. In more general terms, the effect of increased CO 2 concentrations and higher temperatures on biomass production and evapotranspiration affects the evolution of the global hydrological and carbon cycles. Investigating these processes for a C4 crop, such as sugarcane, thus provides an opportunity both to extend our understanding of the impact of climate change, and to assess our capacity to model the underpinning processes. This paper applies a process-based crop model to sugarcane in Ghana (where cultivation is planned), and the São Paulo region of Brazil (which has a well-established sugarcane industry). We show that, in the Daka River region of Ghana, provided there is sufficient irrigation, it is possible to generate approximately 75% of the yield achieved in the São Paulo region. In the final part of the study, the production of sugarcane under an idealized temperature increase climate change scenario is explored. It is shown that doubling CO 2 mitigates the degree of water stress associated with a 4 °C increase in temperature. (letter)

  20. Kinetic mechanism of V-shaped twinning in 3C/4H-SiC heteroepitaxy

    Energy Technology Data Exchange (ETDEWEB)

    Xin, Bin; Zhang, Yu-Ming; Jia, Ren-Xu, E-mail: rxjia@mail.xidian.edu.cn [School of Microelectronics, Xidian University, Key Laboratory of Wide Band-Gap Semiconductor Materials and Devices, Xi' an 710071 (China); Wu, Hong-Ming [Graduate Institute of Electronics Engineering, National Taiwan University, 10617 Taipei, Taiwan (China); Feng, Zhe Chuan [Graduate Institute of Photonics and Optoelectronics, National Taiwan University, 10617 Taipei, Taiwan and Laboratory of Optoelectronic Materials and Detection Technology, Guangxi Key Laboratory for the Relativistic Astrophysics, College of Physics Science and Technology, Guangxi University, Nanning 530004 (China); Lin, Hao-Hsiung [Graduate Institute of Electronics Engineering, National Taiwan University, 10617 Taipei, Taiwan and Graduate Institute of Photonics and Optoelectronics, National Taiwan University, 10617 Taipei, Taiwan (China)

    2016-05-15

    The authors investigated the kinetic mechanism of V-shaped twinning in 3C/4H-SiC heteroepitaxy. A fourfold V-shaped twinning complex was found, and its interface was measured with high-resolution transmission electron microscopy (HRTEM). Two linear coherent boundaries and a nonlinear incoherent boundary (also called the double-position boundary) were observed. On the basis of the HRTEM results, the authors proposed an adatom migration growth model, in which the activation barrier at the coherent boundary is much lower than that at the incoherent boundary. From a kinetic perspective, adatoms are prone to migrate to the side of the boundary with the lower potential energy if they have sufficient thermal energy to overcome the activation barrier. In the case of a coherent boundary, the growth rates of the domains either side of the boundary can be balanced through the intermigration of adatoms, leading to a linear boundary. Conversely, it is difficult for adatoms to migrate across an incoherent boundary, which results in asynchronous growth rates and a nonlinear boundary.

  1. Development of Digital I and C System using C4ISR Architect Framework

    Energy Technology Data Exchange (ETDEWEB)

    Jung, Jae Cheon [KEPCO, Ulsan (Korea, Republic of); Quang, Phamle [Ninh Thuan Nuclear Power Project Management Board, Province (Viet Nam)

    2014-08-15

    The architect framework for the digital I and C system is presented in this work. With rapid changes in digital I and C technology, there is a strong need to provide uniform methods to describe the system functions and their performance in context with the physical configuration and logical behavior. C4ISR framework would provide the process and method for the digital system in that it allows the three different views of operational, systems and services, and technical standards. Therefore, stake holders can share information that is related to the system interfaces, the actions or activities that those components perform, and rules or constraints for those activities from the initial state of system development. As a result, the life cycle cost and development time for the digital I and C system can also be optimized. These benefits can be obtained by introducing views and products to reveal the logical, behavioral, and performance characteristics of the architecture. To prove this approach, the plant protection system (PPS) is chosen and the measure of effectiveness (MOE) is evaluated. An MOE of PPS is introduced as: functional effectiveness, performance effectiveness, and interoperability effectiveness.

  2. COMPTEL gamma-ray observations of the C4 solar flare on 20 January 2000

    International Nuclear Information System (INIS)

    Young, C.A.; Arndt, M.B.; Bennett, K.; Winkler, C.; Connors, A.; Debrunner, H.; Diehl, R.; Rank, G.; Schoenfelder, V.; McConnell, M.; Miller, R.S.; Ryan, J.M.

    2001-01-01

    The 'Pre-SMM' (Vestrand and Miller 1998) picture of gamma-ray line (GRL) flares was that they are relatively rare events. This picture was quickly put in question with the launch of the Solar Maximum Mission (SMM). Over 100 GRL flares were seen with sizes ranging from very large GOES class events (X12) down to moderately small events (M2). It was argued by some (Bai 1986) that this was still consistent with the idea that GRL events are rare. Others, however, argued the opposite (Vestrand 1988; Cliver, Crosby and Dennis 1994), stating that the lower end of this distribution was just a function of SMM's sensitivity. They stated that the launch of the Compton Gamma-ray Observatory (CGRO) would in fact continue this distribution to show even smaller GRL flares. In response to a BACODINE cosmic gamma-ray burst alert, COMPtonTELescope on the CGRO recorded gamma rays above 1 MeV from the C4 flare at 0221 UT 20 January 2000. This event, though at the limits of COMPTEL's sensitivity, clearly shows a nuclear line excess above the continuum. Using new spectroscopy techniques we were able to resolve individual lines. This has allowed us to make a basic comparison of this event with the GRL flare distribution from SMM and also compare this flare with a well-observed large GRL flare seen by OSSE

  3. Multiparticle excitations in the 149 Gd superdeformed nucleus. Signature of new C4 nucleus symmetry

    International Nuclear Information System (INIS)

    Theisen, C.

    1995-01-01

    The use of 8 π and EUROGAM phase I multi-detectors for the study of high spin states of 149 Gd nucleus has revealed unexpected new phenomenons about the superdeformation in this nucleus. The new excited bands confirm the omnipresence of twin bands phenomenon. A new multi-particle excitation (two protons and one neutron) has been discovered. Thanks to the second generation EUROGAM detector, unexpected discoveries such as C 4 symmetry, level interactions, complete backbending were obtained for the second potential well. The knowledge of interacting levels gives informations about the nucleon-nucleon residual interaction and could allow the determination of SD bands excitation energy. The complex processing and analysis of high multiplicity events has led to the development of new computing tools. An automatic band research program has been written for the discovery of new excited bands, and an exact method for the elimination of uncorrected events has been developed. The improvements of multi-detector performances should allow the discovery of more exceptional phenomenons and new anomalies in the SD bands. (J.S.). 222 refs., 86 figs., 38 tabs

  4. Transgenerational developmental programming.

    Science.gov (United States)

    Aiken, Catherine E; Ozanne, Susan E

    2014-01-01

    The concept of developmental programming suggests that the early life environment influences offspring characteristics in later life, including the propensity to develop diseases such as the metabolic syndrome. There is now growing evidence that the effects of developmental programming may also manifest in further generations without further suboptimal exposure. This review considers the evidence, primarily from rodent models, for effects persisting to subsequent generations, and evaluates the mechanisms by which developmental programming may be transmitted to further generations. In particular, we focus on the potential role of the intrauterine environment in contributing to a developmentally programmed phenotype in subsequent generations. The literature was systematically searched at http://pubmed.org and http://scholar.google.com to identify published findings regarding transgenerational (F2 and beyond) developmental programming effects in human populations and animal models. Transmission of programming effects is often viewed as a form of epigenetic inheritance, either via the maternal or paternal line. Evidence exists for both germline and somatic inheritance of epigenetic modifications which may be responsible for phenotypic changes in further generations. However, there is increasing evidence for the role of both extra-genomic components of the zygote and the interaction of the developing conceptus with the intrauterine environment in propagating programming effects. The contribution of a suboptimal reproductive tract environment or maternal adaptations to pregnancy may be critical to inheritance of programming effects via the maternal line. As the effects of age exacerbate the programmed metabolic phenotype, advancing maternal age may increase the likelihood of developmental programming effects being transmitted to further generations. We suggest that developmental programming effects could be propagated through the maternal line de novo in generations

  5. Application of the pessimistic pruning to increase the accuracy of C4.5 algorithm in diagnosing chronic kidney disease

    Science.gov (United States)

    Muslim, M. A.; Herowati, A. J.; Sugiharti, E.; Prasetiyo, B.

    2018-03-01

    A technique to dig valuable information buried or hidden in data collection which is so big to be found an interesting patterns that was previously unknown is called data mining. Data mining has been applied in the healthcare industry. One technique used data mining is classification. The decision tree included in the classification of data mining and algorithm developed by decision tree is C4.5 algorithm. A classifier is designed using applying pessimistic pruning in C4.5 algorithm in diagnosing chronic kidney disease. Pessimistic pruning use to identify and remove branches that are not needed, this is done to avoid overfitting the decision tree generated by the C4.5 algorithm. In this paper, the result obtained using these classifiers are presented and discussed. Using pessimistic pruning shows increase accuracy of C4.5 algorithm of 1.5% from 95% to 96.5% in diagnosing of chronic kidney disease.

  6. Validation of reference genes for quantitative RT-PCR normalization in Suaeda aralocaspica, an annual halophyte with heteromorphism and C4 pathway without Kranz anatomy

    Directory of Open Access Journals (Sweden)

    Jing Cao

    2016-02-01

    Full Text Available Reverse transcription quantitative real-time polymerase chain reaction (qRT-PCR is a powerful analytical technique for the measurement of gene expression, which depends on the stability of the reference gene used for data normalization. Suaeda aralocaspica, an annual halophyte with heteromorphic seeds and possessing C4 photosynthesis pathway without Kranz anatomy, is an ideal plant species to identify stress tolerance-related genes and compare relative expression at transcriptional level. So far, no molecular information is available for this species. In the present study, six traditionally used reference genes were selected and their expression stability in two types of seeds of S. aralocaspica under different experimental conditions was evaluated. Three analytical programs, geNorm, NormFinder and BestKeeper, were used to assess and rank the stability of reference gene expression. Results revealed that although some reference genes may display different transcriptional profiles between the two types of seeds, β-TUB and GAPDH appeared to be the most suitable references under different developmental stages and tissues. GAPDH was the appropriate reference gene under different germination time points and salt stress conditions, and ACTIN was suitable for various abiotic stress treatments for the two types of seeds. For all the sample pools, β-TUB served as the most stable reference gene, whereas 18S rRNA and 28S rRNA performed poorly and presented as the least stable genes in our study. UBQ seemed to be unsuitable as internal control under different salt treatments. In addition, the expression of a photosynthesis-related gene (PPDK of C4 pathway and a salt tolerance-related gene (SAT of S. aralocaspica were used to validate the best performance reference genes. This is the first systematic comparison of reference gene selection for qRT-PCR work in S. aralocaspica and these data will facilitate further studies on gene expression in this species

  7. Properties of C4F7N–CO2 thermal plasmas: thermodynamic properties, transport coefficients and emission coefficients

    Science.gov (United States)

    Wu, Yi; Wang, Chunlin; Sun, Hao; Murphy, Anthony B.; Rong, Mingzhe; Yang, Fei; Chen, Zhexin; Niu, Chunpin; Wang, Xiaohua

    2018-04-01

    The thermophysical properties, including composition, thermodynamic properties, transport coefficients and net emission coefficients, of thermal plasmas formed from pure iso-C4 perfluoronitrile C4F7N and C4F7N–CO2 mixtures are calculated for temperatures from 300 to 30 000 K and pressures from 0.1 to 20 atm. These gases have received much attention as alternatives to SF6 for use in circuit breakers, due to the low global warming potential and good dielectric properties of C4F7N. Since the parameters of the large molecules formed in the dissociation of C4F7N are unavailable, the partition function and enthalpy of formation were calculated using computational chemistry methods. From the equilibrium composition calculations, it was found that when C4F7N is mixed with CO2, CO2 can capture C atoms from C4F7N, producing CO, since the system consisting of small molecules such as CF4 and CO has lower energy at room temperature. This is in agreement with previous experimental results, which show that CO dominates the decomposition products of C4F7N–CO2 mixtures; it could limit the repeated breaking performance of C4F7N. From the point of view of chemical stability, the mixing ratio of CO2 should therefore be chosen carefully. Through comparison with common arc quenching gases (including SF6, CF3I and C5F10O), it is found that for the temperature range for which electrical conductivity remains low, pure C4F7N has similar ρC p (product of mass density and specific heat) properties to SF6, and higher radiative emission coefficient, properties that are correlated with good arc extinguishing capability. For C4F7N–CO2 mixtures, the electrical conductivity is very close to that of SF6 while the ρC p peak at 7000 K caused by decomposition of CO implies inferior interruption capability to that of SF6. The calculated properties will be useful in arc simulations.

  8. Leukotriene C4 synthase and ischemic cardiovascular disease and obstructive pulmonary disease in 13,000 individuals

    DEFF Research Database (Denmark)

    Freiberg, Jacob J; Dahl, Morten; Tybjaerg-Hansen, Anne

    2009-01-01

    Ischemic cardiovascular disease and obstructive pulmonary disease involve inflammation. Leukotrienes may be important pro-inflammatory mediators. We tested the hypothesis that the (-1072)G > A and (-444)A > C promoter polymorphisms of leukotriene C4 synthase confer risk of transient ischemic atta...... with risk of asthma or COPD. Leukotriene C4 synthase promoter genotypes influence risk of TIA and ischemic stroke, but not risk of IHD/coronary atherosclerosis, asthma, or COPD....

  9. Histone Acetylation Modifications Affect Tissue-Dependent Expression of Poplar Homologs of C4 Photosynthetic Enzyme Genes

    Directory of Open Access Journals (Sweden)

    Yuan Li

    2017-06-01

    Full Text Available Histone modifications play important roles in regulating the expression of C4 photosynthetic genes. Given that all enzymes required for the C4 photosynthesis pathway are present in C3 plants, it has been hypothesized that this expression regulatory mechanism has been conserved. However, the relationship between histone modification and the expression of homologs of C4 photosynthetic enzyme genes has not been well determined in C3 plants. In the present study, we cloned nine hybrid poplar (Populus simonii × Populus nigra homologs of maize (Zea mays C4 photosynthetic enzyme genes, carbonic anhydrase (CA, pyruvate orthophosphate dikinase (PPDK, phosphoenolpyruvate carboxykinase (PCK, and phosphoenolpyruvate carboxylase (PEPC, and investigated the correlation between the expression levels of these genes and the levels of promoter histone acetylation modifications in four vegetative tissues. We found that poplar homologs of C4 homologous genes had tissue-dependent expression patterns that were mostly well-correlated with the level of histone acetylation modification (H3K9ac and H4K5ac determined by chromatin immunoprecipitation assays. Treatment with the histone deacetylase inhibitor trichostatin A further confirmed the role of histone acetylation in the regulation of the nine target genes. Collectively, these results suggest that both H3K9ac and H4K5ac positively regulate the tissue-dependent expression pattern of the PsnCAs, PsnPPDKs, PsnPCKs, and PsnPEPCs genes and that this regulatory mechanism seems to be conserved among the C3 and C4 species. Our findings provide new insight that will aid efforts to modify the expression pattern of these homologs of C4 genes to engineer C4 plants from C3 plants.

  10. The functional significance of C3-C4 intermediate traits in Heliotropium L. (Boraginaceae): gas exchange perspectives.

    Science.gov (United States)

    Vogan, Patrick J; Frohlich, Michael W; Sage, Rowan F

    2007-10-01

    We demonstrate for the first time the presence of species exhibiting C3-C4 intermediacy in Heliotropium (sensu lato), a genus with over 100 C3 and 150 C4 species. CO2 compensation points (Gamma) and photosynthetic water-use efficiencies (WUEs) were intermediate between C3 and C4 values in three species of Heliotropium: Heliotropium convolvulaceum (Gamma = 20 micromol CO2 mol(-1) air), Heliotropium racemosum (Gamma = 22 micromol mol(-1)) and Heliotropium greggii (Gamma = 17 micromol mol(-1)). Heliotropium procumbens may also be a weak C3-C4 intermediate based on a slight reduction in Gamma (48.5 micromol CO2 mol(-1)) compared to C3Heliotropium species (52-60 micromol mol(-1)). The intermediate species H. convolvulaceum, H. greggii and H. racemosum exhibited over 50% enhancement of net CO2 assimilation rates at low CO2 levels (200-300 micromol mol(-1)); however, no significant differences in stomatal conductance were observed between the C3 and C3-C4 species. We also assessed the response of Gamma to variation in O2 concentration for these species. Heliotropium convolvulaceum, H. greggii and H. racemosum exhibited similar responses of Gamma to O2 with response slopes that were intermediate between the responses of C3 and C4 species below 210 mmol O2 mol(-1) air. The presence of multiple species displaying C3-C4 intermediate traits indicates that Heliotropium could be a valuable new model for studying the evolutionary transition from C3 to C4 photosynthesis.

  11. Comparison of plants with C3 and C4 carbon fixation pathways for remediation of polycyclic aromatic hydrocarbon contaminated soils

    OpenAIRE

    Sivaram, Anithadevi Kenday; Logeshwaran, Panneerselvan; Subashchandrabose, Suresh R.; Lockington, Robin; Naidu, Ravi; Megharaj, Mallavarapu

    2018-01-01

    The phytoremediation technique has been demonstrated to be a viable option for the remediation of polycyclic aromatic hydrocarbons (PAHs) contaminated sites. This study evaluated the potential applicability of plants with C3 and C4 carbon fixation pathways for the phytoremediation of recalcitrant high molecular weight (HMW) PAHs contaminated soil. A 60 and 120-day greenhouse study was conducted which showed higher degradation of HMW PAHs in soil grown with C4 plants when compared to C3 plants...

  12. Photosynthetic characteristics of an amphibious plant, Eleocharis vivipara: Expression of C4 and C3 modes in contrasting environments

    International Nuclear Information System (INIS)

    Ueno, Osamu; Samejima, Muneaki; Muto, Shoshi; Miyachi, Shigetoh

    1988-01-01

    Eleocharis vivipara Link, a freshwater amphibious leafless plant belonging to the Cyperaceae can grow in both terrestrial and submersed aquatic conditions. Two forms of E. vivipara obtained from these contrasting environments were examined for the characteristics associated with C 4 and C 3 photosynthesis. In the terrestrial form, the culms, which are photosynthetic organs, possess a Kranz-type anatomy typical of C 4 plants, and well-developed bundle-sheath cells contain numerous large chloroplasts. In the submersed form, the culms possess anatomical features characteristic of submersed aquatic plants, and the reduced bundle-sheath cells contain only a few small chloroplasts. 14 C pulse- 12 C chase experiments showed that the terrestrial form and the submersed form fix carbon by way of the C 4 pathway, with aspartate (40%) and malate (35%) as the main primary products, and by way of the C 3 pathway, with 3-phosphoglyceric acid (53%) and sugar phosphates (14%) as the main primary products, respectively. The terrestrial form showed photosynthetic enzyme activities typical of the NAD-malic enzyme-C 4 subtype, whereas the submersed form showed decreased activities of key C 4 enzymes and an increased ribulose 1,5-bisphosphate carboxylase activity. These data suggest that this species can differentiate into the C 4 mode under terrestrial conditions and into the C 3 mode under submersed conditions

  13. A Modified Thermal Time Model Quantifying Germination Response to Temperature for C3 and C4 Species in Temperate Grassland

    Directory of Open Access Journals (Sweden)

    Hongxiang Zhang

    2015-07-01

    Full Text Available Thermal-based germination models are widely used to predict germination rate and germination timing of plants. However, comparison of model parameters between large numbers of species is rare. In this study, seeds of 27 species including 12 C4 and 15 C3 species were germinated at a range of constant temperatures from 5 °C to 40 °C. We used a modified thermal time model to calculate germination parameters at suboptimal temperatures. Generally, the optimal germination temperature was higher for C4 species than for C3 species. The thermal time constant for the 50% germination percentile was significantly higher for C3 than C4 species. The thermal time constant of perennials was significantly higher than that of annuals. However, differences in base temperatures were not significant between C3 and C4, or annuals and perennial species. The relationship between germination rate and seed mass depended on plant functional type and temperature, while the base temperature and thermal time constant of C3 and C4 species exhibited no significant relationship with seed mass. The results illustrate differences in germination characteristics between C3 and C4 species. Seed mass does not affect germination parameters, plant life cycle matters, however.

  14. Studies on reduced height mutants in rice

    International Nuclear Information System (INIS)

    Narahari, P.; Bhagwat, S.G.

    1984-01-01

    Two cross-bred derivatives of the mutant TR5xTR17 and TR21 continued to show promise and were advanced to wider scale testing. TR5 was found to carry a semi-dwarfing gene different from that in IR8. New semi-dwarf mutants were screened from M 2 through M 4 from two separate radiation experiments. The gibberellin response of seedlings of mutant and tester strains was evaluated and crosses of tester stocks and mutant semi-dwarfs were made for genetic analyses. (author)

  15. Effects of substitution on counterflow ignition and extinction of C3 and C4 alcohols

    KAUST Repository

    Alfazazi, Adamu

    2016-06-17

    Dwindling reserves and inherent uncertainty in the price of conventional fuels necessitates a search for alternative fuels. Alcohols represent a potential source of energy for the future. The structural features of an alcohol fuel have a direct impact on combustion properties. In particular, substitution in alcohols can alter the global combustion reactivity. In this study, experiments and numerical simulations were conducted to investigate the critical conditions of extinction and autoignition of n-propanol, 1-butanol, iso-propanol and iso-butanol in non-premixed diffusion flames. Experiments were carried out in the counterflow configuration, while simulations were conducted using a skeletal chemical kinetic model for the C3 and C4 alcohols. The fuel stream consists of the pre-vaporized fuel diluted with nitrogen, while the oxidizer stream is air. The experimental results show that autoignition temperatures of the tested alcohols increase in the following order: iso-propanol > iso-butanol > 1-butanol ≈ n-propanol. The simulated results for the branched alcohols agree with the experiments, while the autoignition temperature of 1-butanol is slightly higher than that of n-propanol. For extinction, the experiments show that the extinction limits of the tested fuels increase in the following order: n-propanol ≈ 1-butanol > iso-butanol > iso-propanol. The model suggests that the extinction limits of 1-butanol is slightly higher than n-propanol with extinction strain rate of iso-butanol and iso-propanol maintaining the experimentally observed trend. The transport weighted enthalpy (TWE) and radical index (Ri) concepts were utilized to rationalize the observed reactivity trends for these fuels.

  16. Non-specific phospholipase C4 mediates response to aluminum toxicity in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Přemysl ePejchar

    2015-02-01

    Full Text Available Aluminum ions (Al have been recognized as a major toxic factor for crop production in acidic soils. The first indication of the Al toxicity in plants is the cessation of root growth, but the mechanism of root growth inhibition is largely unknown. Here we examined the impact of Al on the expression, activity and function of the non-specific phospholipase C4 (NPC4, a plasma membrane-bound isoform of NPC, a member of the plant phospholipase family, in Arabidopsis thaliana.We observed a lower expression of NPC4 using GUS assay and a decreased formation of labeled diacylglycerol, product of NPC activity, using fluorescently labeled phosphatidylcholine as a phospholipase substrate in Arabidopsis WT seedlings treated with AlCl3 for 2 h. The effect on in situ NPC activity persisted for longer Al treatment periods (8, 14 h. Interestingly, in seedlings overexpressing NPC4, the Al-mediated NPC-inhibiting effect was alleviated at 14 h. However, in vitro activity and localization of NPC4 were not affected by Al, thus excluding direct inhibition by Al ions or possible translocation of NPC4 as the mechanisms involved in NPC-inhibiting effect. Furthermore, the growth of tobacco pollen tubes rapidly arrested by Al was partially rescued by the overexpression of AtNPC4 while Arabidopsis npc4 knockout lines were found to be more sensitive to Al stress during long-term exposure of Al at low phosphate conditions.Our observations suggest that NPC4 plays a role in both early and long-term responses to Al stress.

  17. Shade treatment affects structure and recovery of invasive C4 African grass Echinochloa pyramidalis.

    Science.gov (United States)

    López Rosas, Hugo; Moreno-Casasola, Patricia; Espejel González, Verónica E

    2015-03-01

    Echinochloa pyramidalis (Lam.) Hitchc. & Chase is an African grass with C4 photosynthesis, high biomass production, and high vegetative propagation that is tolerant to grazing and able to grow in flooded and dry conditions. Thus, it is highly invasive in tropical freshwater marshes where it is intentionally planted by ranchers to increase cattle production. This invasion is reducing plant biodiversity by increasing the invader's aerial coverage, changing wetland hydrology and causing soil physicochemical changes such as vertical accretion. Reducing the dominance of this species and increasing the density of native wetland species is a difficult, expensive, and time-consuming process. We applied a series of disturbance treatments aimed at eliminating E. pyramidalis and recovering the native vegetation of a partially invaded freshwater marsh. Treatments included physical (cutting, soil disking, transplanting individuals of the key native species Sagittaria lancifolia subsp. media (Micheli) Bogin, and/or reducing light with shade mesh) and/or chemical (spraying Round-Up™ herbicide) disturbances. At the end of the experiment, four of the five treatments used were effective in increasing the cover and biomass of native species and reducing that of E. pyramidalis. The combination of these treatments should be used to generate a proposal for the restoration of tropical wetlands invaded by non-native grasses. A promising treatment is using soil disked to soften the soil and destroy belowground structures such as roots and rhizomes. This treatment would be more promising if combined with the use of shade cloth. If it is desirable not to impact the soil or if there is not enough budget to make an effort to include active restoration disking soil, the use of shade cloth will suffice, although the recovery of native vegetation will be slower.

  18. Effects of substitution on counterflow ignition and extinction of C3 and C4 alcohols

    KAUST Repository

    Alfazazi, Adamu; Niemann, Ulrich; Selim, Hatem; Cattolica, Robert J.; Sarathy, Mani

    2016-01-01

    Dwindling reserves and inherent uncertainty in the price of conventional fuels necessitates a search for alternative fuels. Alcohols represent a potential source of energy for the future. The structural features of an alcohol fuel have a direct impact on combustion properties. In particular, substitution in alcohols can alter the global combustion reactivity. In this study, experiments and numerical simulations were conducted to investigate the critical conditions of extinction and autoignition of n-propanol, 1-butanol, iso-propanol and iso-butanol in non-premixed diffusion flames. Experiments were carried out in the counterflow configuration, while simulations were conducted using a skeletal chemical kinetic model for the C3 and C4 alcohols. The fuel stream consists of the pre-vaporized fuel diluted with nitrogen, while the oxidizer stream is air. The experimental results show that autoignition temperatures of the tested alcohols increase in the following order: iso-propanol > iso-butanol > 1-butanol ≈ n-propanol. The simulated results for the branched alcohols agree with the experiments, while the autoignition temperature of 1-butanol is slightly higher than that of n-propanol. For extinction, the experiments show that the extinction limits of the tested fuels increase in the following order: n-propanol ≈ 1-butanol > iso-butanol > iso-propanol. The model suggests that the extinction limits of 1-butanol is slightly higher than n-propanol with extinction strain rate of iso-butanol and iso-propanol maintaining the experimentally observed trend. The transport weighted enthalpy (TWE) and radical index (Ri) concepts were utilized to rationalize the observed reactivity trends for these fuels.

  19. Reading in developmental prosopagnosia

    DEFF Research Database (Denmark)

    Starrfelt, Randi; Klargaard, Solja K; Petersen, Anders

    2018-01-01

    exposure durations (targeting the word superiority effect), and d) text reading. RESULTS: Participants with developmental prosopagnosia performed strikingly similar to controls across the four reading tasks. Formal analysis revealed a significant dissociation between word and face recognition......, that is, impaired reading in developmental prosopagnosia. METHOD: We tested 10 adults with developmental prosopagnosia and 20 matched controls. All participants completed the Cambridge Face Memory Test, the Cambridge Face Perception test and a Face recognition questionnaire used to quantify everyday face...... recognition experience. Reading was measured in four experimental tasks, testing different levels of letter, word, and text reading: (a) single word reading with words of varying length,(b) vocal response times in single letter and short word naming, (c) recognition of single letters and short words at brief...

  20. Engineering Brevibacterium flavum for the production of renewable bioenergy: C4-C5 advanced alcohols.

    Science.gov (United States)

    Su, HaiFeng; Lin, JiaFu; Wang, YuanHong; Chen, Qiao; Wang, GuangWei; Tan, FuRong

    2017-09-01

    Biosynthesis of advanced biofuels by engineered non-natural microorganisms has been proposed to be the most promising approach for the replacement of dwindling fossil fuel resources. Brevibacterium flavum (Bf) is a model brevibacterium aerobe which lacks basic and applied research that could enable this species to produce biofuels. There are no reports regarding engineering this microorganism to produce advanced alcohols before. Here, for the first time, we developed the bacterium as a novel biosynthetic platform for advanced alcohols production via the mutagenesis and engineering to produce 2-ketoacids derived alcohols. In order to enhance the strain's capability of producing advanced alcohols, we preferentially improved intrinsic metabolism ability of the strain to obtain improved expression host (IEH) via generating mutagenesis libraries by whole cell mutagenesis (WCM). The IEH was determined via screening out the mutant strain with the highest production of branched-chain organic acids (BCOA) using high throughput screening method.. Subsequently, a novel vector system for Bf was established, and the corresponding biosynthetic pathway of directing carbon flux into the target advanced alcohols was recruited to make the bacterium possess the capability of producing advanced alcohols and further enhance the production using the IEH. Specifically, we generated bioengineered strains that were able to synthesize up to the highest 5362 and 4976 mg/L isobutanol, 1945 and 1747 mg/L 2-methyl-1-butanol (2 MB), and 785.34 and 781 mg/L 3-methyl-1-butanol (3 MB) from pure glucose and duckweed substrates, respectively. Our findings confirmed the feasibility and potential of using Bf as a novel biosynthetic platform to generate advanced biofuels with glucose and inexpensive renewable feedstock-duckweed as a fermentation substrate. Biotechnol. Bioeng. 2017;114: 1946-1958. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  1. The Developmental Work

    DEFF Research Database (Denmark)

    Møller, Niels; Hvid, Helge

    2001-01-01

    AbstractIn the nineties, the concept of the developmental work (DW) has become a significant point of orientation for the actors on Danish labour market. The DW has moved the focus of the labour market from wages and working time towards work and production. For employees, the DW promises...... developmental possibilities, influence and responsibility, but also greater social responsibility for the firm. For firms, the DW promises increased competitiveness and better products. In this paper we present the concept of the DW as one which encourages the development of work, production and organisation...... of the firm and show that the DW is different from mainstream management concepts, as the DW...

  2. Genetic fingerprinting of mutant rose cultivars

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, S; Prasad, K V; Singh, K P; Singh, A.P. [Division of Floriculture and Landscaping, Indian Agricultural Research Institute, Pusa, New Delhi (India)], E-mail: kvprasad66@gmail.com

    2008-07-01

    Six rose mutants evolved at the Indian Agricultural Research Institute, New Delhi from four parent cultivars were characterized based on RAPD markers. Contrary to the earlier findings our effort has conclusively proven that the RAPD markers are indeed robust tools to discern the mutants from their parents. Among 40 primers screened, 7 primers produced inconsistent banding pattern. The number of polymorphic bands varied between 4 (OPA 14) and 10 (OPA1) with an average of 6.5 bands per primer. The percentage polymorphism ranged from 62.5 (OPM 9) to 100 percent (OPA 1). Most of the primers produced monomorphic bands between parent and mutant rose cultivars. When primer OPA 2 was used a specific band of 2.5 kb was noticed in mutant cv. Pusa Urmil and cv. Pusa Abhishek but was absent in parent cv. Jantar Mantar. A polymorphic band of 750 bp was noticed in the parent Kiss of Fire and helped in differentiating the parent from its mutant when amplified with OPK 3. Primer OPS 16 produced discriminatory band of 800 bp in mutant cv. Pink Sport of Montezuma while it was absent in its parent cv. Montezuma. Another specific band of 650 bp was present in parent cv. Montezuma and absent in its mutant cv. Pink Sport of Montezuma signifying the uniqueness of the mutant. Primer OPM 5 brought out distinct polymorphism among the parent Jantar Mantar and its three mutants with absence of a specific band of 1.5 kb in the parent. The four parents and 6 mutants were divided into four distinct groups in the Dendogram constructed by UPGMA method. The most genetically similar cultivar among the 10 cultivars analyzed are Montezuma and its pink sport of Montezuma whereas Abhisarika a mutant of cv. Kiss of Fire was distinctly different and formed a separate cluster. (author)

  3. Stress-tolerant mutants induced by heavy-ion beams

    Energy Technology Data Exchange (ETDEWEB)

    Abe, Tomoko; Yoshida, Shigeo [Institute of Physical and Chemical Research, Wako, Saitama (Japan); Bae, Chang-Hyu [Sunchon National University, Sunchon (Korea); Ozaki, Takuo [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment; Wang, Jing Ming [Akita Prefectural Univ. (Japan)

    2000-07-01

    Comparative study was made on mutagenesis in tobacco embryo induced by exposure to EMS (ethyl methane-sulfonate) ion beams during the fertilization cycle. Tobacco embryo cells immediately after pollination were exposed to heavy ion beam and the sensitivity to the irradiation was assessed in each developmental stage and compared with the effects of EMS, a chemical mutagen. Morphologically abnormality such as chlorophyll deficiency was used as a marker. A total of 17 salt-tolerant plants were selected from 3447 M{sub 1} seeds. A cell line showed salt resistance. The cell growth and chlorophyll content were each two times higher than that of WT cells in the medium containing 154 mM NaCl. Seven strains of M{sub 3} progeny of 17 salt-tolerant plants, showed strong resistance, but no salt tolerant progeny were obtained from Xanthi or Ne-ion irradiation. This shows that the sensitivity of plant embryo to this irradiation technique may vary among species. When exposed to {sup 14}N ion beam for 24-108 hours after pollination, various morphological mutants appeared at 18% in M{sub 1} progeny and herbicide tolerant and salt tolerant mutants were obtained. A strong Co-tolerant strain was obtained in two of 17 salt-tolerant strains and a total of 46 tolerant strains (0.2%) were obtained from 22,272 grains of M{sub 1} seeds. In these tolerant strains, the absorption of Co was slightly decreased, but those of Mg and Mn were increased. Mutants induced with ion-beam irradiation have potential not only for practical use in the breeding of stress-tolerant plants but also for gene analysis that will surely facilitate the molecular understanding of the tolerance mechanisms. (M.N.)

  4. Stress-tolerant mutants induced by heavy-ion beams

    International Nuclear Information System (INIS)

    Abe, Tomoko; Yoshida, Shigeo; Bae, Chang-Hyu; Ozaki, Takuo

    2000-01-01

    Comparative study was made on mutagenesis in tobacco embryo induced by exposure to EMS (ethyl methane-sulfonate) ion beams during the fertilization cycle. Tobacco embryo cells immediately after pollination were exposed to heavy ion beam and the sensitivity to the irradiation was assessed in each developmental stage and compared with the effects of EMS, a chemical mutagen. Morphologically abnormality such as chlorophyll deficiency was used as a marker. A total of 17 salt-tolerant plants were selected from 3447 M 1 seeds. A cell line showed salt resistance. The cell growth and chlorophyll content were each two times higher than that of WT cells in the medium containing 154 mM NaCl. Seven strains of M 3 progeny of 17 salt-tolerant plants, showed strong resistance, but no salt tolerant progeny were obtained from Xanthi or Ne-ion irradiation. This shows that the sensitivity of plant embryo to this irradiation technique may vary among species. When exposed to 14 N ion beam for 24-108 hours after pollination, various morphological mutants appeared at 18% in M 1 progeny and herbicide tolerant and salt tolerant mutants were obtained. A strong Co-tolerant strain was obtained in two of 17 salt-tolerant strains and a total of 46 tolerant strains (0.2%) were obtained from 22,272 grains of M 1 seeds. In these tolerant strains, the absorption of Co was slightly decreased, but those of Mg and Mn were increased. Mutants induced with ion-beam irradiation have potential not only for practical use in the breeding of stress-tolerant plants but also for gene analysis that will surely facilitate the molecular understanding of the tolerance mechanisms. (M.N.)

  5. Effects of Light Intensity on Development and Chlorophyll Content in the Arabidopsis Mutant Plants with Defects in Photosynthesis

    Directory of Open Access Journals (Sweden)

    E.Yu. Garnik

    2015-12-01

    Full Text Available The developmental stages and adaptability to different light intensity (150 µmol*m-2*s-1 and 100 µmol*m-2*s-1 in Arabidopsis mutant lines with defects of photosynthetic apparatus were analyzed. Plant development in the mutant lines depended on the light intensity to varying degrees. Lines ch1-1 (lack of the chlorophyllide a oxygenase and rtn16 (decreased chlorophyll a and b amounts were the most susceptible to the light decrease. No one of the investigated lines demonstrated chlorophyll a/b rate alteration under the different light conditions. The depleted chlorophyll content has had the major effect on the mutant plants development under the different light conditions. The different chlorophyll a/b rate correlated with the different adaptability of mutant plants to low light.

  6. A shock tube study of C4–C6 straight chain alkenes + OH reactions

    KAUST Repository

    Khaled, Fathi

    2016-06-28

    Alkenes are known to be good octane boosters and they are major components of commercial fuels. Detailed theoretical calculations and direct kinetic measurements of elementary reactions of alkenes with combustion radicals are scarce for C4 alkenes and they are practically absent for C5 and larger alkenes. The overall rate coefficients for the reaction of OH radical with 1-butene (CH CHCH CH, k ), 1-pentene (CH CHCH CH-CH, k ), cis/trans 2-pentene (CH CHCHCH CH, k and k ), 1-hexene (CH CHCH CH CH CH, k ) and cis/trans 2-hexene (CH CHCHCH CH CH, k and k ) were measured behind reflected shock waves over the temperature range of 833-1377K and pressures near 1.5atm. The reaction progress was followed by measuring mole fraction of OH radicals near 306.7nm using UV laser absorption technique. It is found that the rate coefficients of OH+trans-2-alkenes are larger than those of OH+cis-2-alkenes, followed by OH+1-alkenes. The derived Arrhenius expressions for the overall rate coefficients (in cm.mol.s) are:. kI=(4.83±0.03)104.T2.72±0.01.exp(940.8±2.9cal/molRT)(946K-1256K) + kII=(5.66±0.54)10-1.T4.14±0.80.exp(4334±227cal/molRT)(875K-1379K) + kIII=(3.25±0.12)104.T2.76±0.5.exp(1962±83cal/molRT)(877K-1336K) + kIV=(3.42±0.09)104.T2.76±0.5.exp(1995±59cal/molRT)(833K-1265K) + kV=(7.65±0.58)10-4.T5±1.exp(5840±175cal/molRT)(836K-1387K) + kVI=(2.58±0.06)106.T2.17±0.37.exp(1461±55cal/molRT)(891K-1357K) + kVII=(3.08±0.05)106.T2.18±0.37.exp(1317±38cal/molRT)(881K-1377K) +

  7. Effects of Temperature and Humidity on the Characterization of C-4 Explosive Threats

    Science.gov (United States)

    Miller, C. J.; Yoder, T. S.

    2012-06-01

    Both the quantity and the amount of time that an explosive is present on the surface of a material is dependent upon the amount of explosive originally deposited on the surface, the adhesive forces, temperature and humidity, as well as other environmental factors. This laboratory study focused on evaluating RDX crystal morphology changes resulting from variations in temperature and humidity conditions of the sample. The temperature and humidity conditions were controlled using a Tenney THRJ environmental chamber and a Tenney T11RC-1.5 environmental chamber. These chambers allow the temperature and humidity to be held within ±3 °C and ±5 % RH. The temperature and humidity conditions used for this test series were: 4 °C/40 %RH, 21 °C/20 %RH (samples left on benchtop), 21 °C/70 %RH, 21 °C/95 %RH, 35 °C/40 %RH, 35 °C/70 %RH, and 35 °C/95 %RH. These temperature and humidity set points were chosen to represent a wide range of conditions that may be found in real world scenarios. C-4 (RDX crystals and binder material) was deposited on the surface of one of six substrates by placing a fingerprint from the explosive block onto the matrix surface. The substrates were chosen to provide a range of items that are commonly used. Six substrate types were used during these tests: 50 % cotton/50 % polyester as found in T-shirts, 100 % cotton with a smooth surface such as that found in a cotton dress shirt, 100 % cotton on a rough surface such as that found on canvas or denim, suede leather such as might be found on jackets, purses, or shoes, painted metal obtained from a car hood, and a computer diskette. The samples were not pre-cleaned prior to testing and contained sizing agents, and in the case of the metal: oil, dirt, scratches, and rust spots. The substrates were photographed at various stages of testing, using a Zeiss Discover V12 stereoscope with Axiocam ICc1 3 megapixel digital camera, to determine any changes in the crystalline morphology. Some of the samples

  8. Competition among warm season C4-cereals influence water use efficiency and competition ratios

    Directory of Open Access Journals (Sweden)

    Amanullah

    2015-12-01

    Full Text Available Water use efficiency (WUE and competition ratio (CR response of three warm season C4-cereals (grasses viz. corn (Zea mays L., cv. Hybrid-5393 VT3, grain sorghum (Sorghum bicolor L. Moench, cv. Hybrid-84G62 PAT, and foxtail millets (Setaria italic, cv. German Strain R in pure and mixed stands under low and high water levels was investigated. The experiment was conducted in pot experiment at Dryland Agriculture Institute, West Texas A&M University, Canyon, Texas, USA, during spring 2010. The objective of this study was to know whether the differences in the competitive ability of different crop species influence WUE or not? The planned mean comparison indicated that the corn WUE was 20, 11, and 6% higher in the mixed stand than in pure stand at 30, 60, and 90 days after emergence (DAE, respectively. The corn plants in pure stand had 91, 72, and 81% higher WUE than the average WUE of sorghum and millets in pure stand at 30, 60, and 90 DAE, respectively. Grain sorghum in pure stand had 70, 32, and 36% higher WUE than that of millets in pure stand at 30, 60, and 90 DAE, respectively. The WUE of three crops in mixed stand was 10 and 8% higher than the two crops mixed stand at the two early stages; but the WUE was 24% less in the three crops mixed stand than the two crops mixed stand at 90 DAE. Corn-mixed stand in two crops (average of corn + sorghum and corn + millets had 78, 74, and 74% higher WUE than the mixed stand of sorghum and millets at 30, 60, and 90 DAE, respectively. Corn and millets mixed stand had 14, 10, and 26% higher WUE than the corn and sorghum mixed stand at 30, 60, and 90 DAE, respectively. The increase in water level decreased WUE at the two late growth stages in all three crop plants. At the early growth stage (30 DAE, WUE increased in all crops at the higher water level. On the basis of CR, corn was found the best competitor, while millets was declared the least competitor in the mixed stands (corn

  9. A shock tube study of C4–C6 straight chain alkenes + OH reactions

    KAUST Repository

    Khaled, Fathi; Badra, Jihad; Farooq, Aamir

    2016-01-01

    Alkenes are known to be good octane boosters and they are major components of commercial fuels. Detailed theoretical calculations and direct kinetic measurements of elementary reactions of alkenes with combustion radicals are scarce for C4 alkenes and they are practically absent for C5 and larger alkenes. The overall rate coefficients for the reaction of OH radical with 1-butene (CH CHCH CH, k ), 1-pentene (CH CHCH CH-CH, k ), cis/trans 2-pentene (CH CHCHCH CH, k and k ), 1-hexene (CH CHCH CH CH CH, k ) and cis/trans 2-hexene (CH CHCHCH CH CH, k and k ) were measured behind reflected shock waves over the temperature range of 833-1377K and pressures near 1.5atm. The reaction progress was followed by measuring mole fraction of OH radicals near 306.7nm using UV laser absorption technique. It is found that the rate coefficients of OH+trans-2-alkenes are larger than those of OH+cis-2-alkenes, followed by OH+1-alkenes. The derived Arrhenius expressions for the overall rate coefficients (in cm.mol.s) are:. kI=(4.83±0.03)104.T2.72±0.01.exp(940.8±2.9cal/molRT)(946K-1256K) + kII=(5.66±0.54)10-1.T4.14±0.80.exp(4334±227cal/molRT)(875K-1379K) + kIII=(3.25±0.12)104.T2.76±0.5.exp(1962±83cal/molRT)(877K-1336K) + kIV=(3.42±0.09)104.T2.76±0.5.exp(1995±59cal/molRT)(833K-1265K) + kV=(7.65±0.58)10-4.T5±1.exp(5840±175cal/molRT)(836K-1387K) + kVI=(2.58±0.06)106.T2.17±0.37.exp(1461±55cal/molRT)(891K-1357K) + kVII=(3.08±0.05)106.T2.18±0.37.exp(1317±38cal/molRT)(881K-1377K) +

  10. A New Experiment for the Measurement of nJ(C,P) Coupling Constants Including 3J(C4'i,Pi) and 3J(C4'i,Pi+1) in Oligonucleotides

    International Nuclear Information System (INIS)

    Richter, Christian; Reif, Bernd; Woerner, Karlheinz; Quant, Stefanie; Marino, John P.; Engels, Joachim W.; Griesinger, Christian; Schwalbe, Harald

    1998-01-01

    A new experiment for the measurement of nJ(C,P) coupling constants along the phosphodiester backbone in RNA and DNA based on a quantitative-J HCP experiment is presented. In addition to coupling constants, in which a carbon atom couples to only one phosphorus atom, both the intraresidual 3J(C4'i,Pi) and the sequential 3J(C4'i,Pi+1) for the C4' resonances that couple to two phosphorus atoms can be obtained. Coupling constants obtained by this new method are compared to values obtained from the P-FIDS experiment. Together with 3J(H,P) coupling constants measured using the P-FIDS experiment, the backbone angles β and element of can be determined

  11. Expression of brown-midrib in a spontaneous sorghum mutant is linked to a 5'-UTR deletion in lignin biosynthesis gene SbCAD2

    Science.gov (United States)

    Brown midrib (bmr) mutants in sorghum (Sorghum bicolor (L.) Moench) and several other C4 grasses are associated with reduced lignin concentration, altered lignin composition and improved cell wall digestibility, which are desirable properties in biomass development for the emerging lignocellulosic b...

  12. Parameters of mitotic recombination in minute mutants of Drosophila melanogaster

    International Nuclear Information System (INIS)

    Ferrus, A.

    1975-01-01

    A sample of 16 Minutes, representing 12 loci distributed over all the chromosome arms and including 3 pairs of alleles and 4 deficiencies, has been studied with respect to several developmental and recombinational parameters. Cell marker mutants located in most of the chromosome arms were used to assess (1) spontaneous and x-ray-induced mitotic recombination frequencies of each Minute, and (2) clone sizes of the different cell marker clones. These parameters were analyzed both in the wing disc and in the abdominal histoblasts. Whereas spontaneous frequencies are not affected by the presence of the Minutes studied, the different Minutes characteristically increase the frequency of recombination clones arising after x irradiation. The recombinant clones which are M + /M + are significantly larger than clones in the same fly which retain the M + /M condition. This is particularly striking in clones in the wing disc, slightly so in clones in the tergites. The occurrence of mitotic recombination in the fourth chromosome is reported for the first time. Chaeta length and developmental delay correlates with the recombinational parameters in different ways. Possible causal interrelationships of the different traits of the Minute syndrome are discussed. (U.S.)

  13. Generation and characterization of pigment mutants of ...

    African Journals Online (AJOL)

    Compared to the wild CC-124, these mutants are characterized by a decrease in chlorophyll a & b content and an increase in carotenoids. The lowest decrease in chlorophyll a was 3 to 4 folds, while the highest increase in carotenoids was 2 to 4 folds. The result of bio-test, using the resulting pigment mutant of C. reinhardtii ...

  14. Leaf anatomy and subgeneric affiliations of C3 and C4 species of Suaeda (Chenopodiaceae) in North America

    International Nuclear Information System (INIS)

    Fisher, D.D.; Schenk, H.J.; Thorsch, J.A.; Ferren, W.R. Jr.

    1997-01-01

    The halophytic genus Suaeda (Chenopodiaceae) includes species with the C3 and C4 photosynthetic pathways. North American species of this genus were investigated to determine whether C3 and C4 leaf anatomy are consistent within the two sections of Suaeda, Chenopodina and Limbogermen, present on this continent. All species from section Chenopodina were found to possess C3 anatomy, whereas all species from section Limbogermen were found to be C4 species. Characteristics of leaf anatomy and chloroplast ultrastructure are similar to those reported from C3 and C4 species, respectively, from the Eastern Hemisphere. All species from section Limbogermen have the suaedoid type of leaf anatomy, characterized by differentiation of the mesophyll into palisade parenchyma and a chlorenchymatous sheath surrounding central water-storage tissue, as well as leaf carbon isotope ratios of above -20. All species from section Chenopodina have austrobassioid leaf anatomy without a chlorenchymatous sheath and leaf carbon isotope ratio values of below -20. According to our literature review, the photosynthetic pathway has now been reported for about half (44) of the Suaeda species worldwide. The C3 and C4 photosynthetic syndromes are with few exceptions distributed along sectional or subsectional lines. These findings throw new light on the infrageneric taxonomy of this genus

  15. A mutant of a mutant of a mutant of a ...: Irradiation of progressive radiation-induced mutants in a mutation-breeding programme with Chrysanthenum morifolium RAM

    International Nuclear Information System (INIS)

    Broertjes, C.; Koene, P.; Veen, J.W.H. van.

    1980-01-01

    Radiation-induced sports in Chrysanthemum morifolium RAM. have been reported for several years. It has become an everyday practice to produce flower-colour mutants from outstanding cross-breeding products, even before they are distributed for the commercial production of cut flowers. One of the most successful and recent examples is that of cv. Horim, of which hundreds of mutants were produced by successive use of radiation-induced mutants in the mutation-breeding programme. Over about 4 years a variety of flower-colour mutants was obtained, not only largely including the outstanding characteristics of the original cultivar but sometimes even with an appreciable improvement in quality and yield. It is expected that the latter types, the Miros group, will soon completely supersede the spontaneous or raditation-induced Horim sports and mutants and take over the leading position of the Horim group in the production of all-year-round (AYR) cut-flowers. (orig.)

  16. Arguments from Developmental Order.

    Science.gov (United States)

    Stöckle-Schobel, Richard

    2016-01-01

    In this article, I investigate a special type of argument regarding the role of development in theorizing about psychological processes and cognitive capacities. Among the issues that developmental psychologists study, discovering the ontogenetic trajectory of mechanisms or capacities underpinning our cognitive functions ranks highly. The order in which functions are developed or capacities are acquired is a matter of debate between competing psychological theories, and also philosophical conceptions of the mind - getting the role and the significance of the different steps in this order right could be seen as an important virtue of such theories. Thus, a special kind of strategy in arguments between competing philosophical or psychological theories is using developmental order in arguing for or against a given psychological claim. In this article, I will introduce an analysis of arguments from developmental order, which come in two general types: arguments emphasizing the importance of the early cognitive processes and arguments emphasizing the late cognitive processes. I will discuss their role in one of the central tools for evaluating scientific theories, namely in making inferences to the best explanation. I will argue that appeal to developmental order is, by itself, an insufficient criterion for theory choice and has to be part of an argument based on other core explanatory or empirical virtues. I will end by proposing a more concerted study of philosophical issues concerning (cognitive) development, and I will present some topics that also pertain to a full-fledged 'philosophy of development.'

  17. Developmental Education Evaluation Model.

    Science.gov (United States)

    Perry-Miller, Mitzi; And Others

    A developmental education evaluation model designed to be used at a multi-unit urban community college is described. The purpose of the design was to determine the cost effectiveness/worth of programs in order to initiate self-improvement. A needs assessment was conducted by interviewing and taping the responses of students, faculty, staff, and…

  18. Arguments from Developmental Order

    Directory of Open Access Journals (Sweden)

    Richard eStöckle-Schobel

    2016-05-01

    Full Text Available In this article, I investigate a special type of argument regarding the role of development in theorising about psychological processes and cognitive capacities. Among the issues that developmental psychologists study, discovering the ontogenetic trajectory of mechanisms or capacities underpinning our cognitive functions ranks highly. The order in which functions are developed or capacities are acquired is a matter of debate between competing psychological theories, and also philosophical conceptions of the mind – getting the role and the significance of the different steps in this order right could be seen as an important virtue of such theories.Thus, a special kind of strategy in arguments between competing philosophical or psychological theories is using developmental order in arguing for or against a given psychological claim. In this article, I will introduce an analysis of arguments from developmental order, which come in two general types: arguments emphasising the importance of the early cognitive processes and arguments emphasising the late cognitive processes. I will discuss their role in one of the central tools for evaluating scientific theories, namely in making inferences to the best explanation. I will argue that appeal to developmental order is, by itself, an insufficient criterion for theory choice and has to be part of an argument based on other core explanatory or empirical virtues. I will end by proposing a more concerted study of philosophical issues concerning (cognitive development, and I will present some topics that also pertain to a full-fledged ‘philosophy of development’.

  19. Developmental paediatric anaesthetic pharmacology

    DEFF Research Database (Denmark)

    Hansen, Tom Giedsing

    2015-01-01

    Safe and effective drug therapy in neonates, infants and children require detailed knowledge about the ontogeny of drug disposition and action as well how these interact with genetics and co-morbidity of children. Recent advances in developmental pharmacology in children follow the increased...

  20. Los mutantes de la escuela

    Directory of Open Access Journals (Sweden)

    Diego Armando Jaramillo-Ocampo

    2013-01-01

    Full Text Available El presente artículo muestra los resultados parciales del estudio “Juegos en el recreo escolar: un escenario para la formación ciudadana”, cuya pretensión fue comprender los imaginarios sociales de juego en el recreo escolar y su relación con la convivencia social desde la proximidad del enfoque de complementariedad y el diseño de investigación emergente, planteado por Murcia y Jaramillo (2008. Se presentan los desarrollos logrados en dos categorías centrales del estudio: el patio y el cuerpo; dos categorías que mutan constantemente como entidades vivas en la escuela, hacia la configuración de sujetos que reconocen en el otro y lo otro su posibilidad. La escuela viva, donde es posible “ser en relación con”… se reduce a un espacio temporal y físico, limitado por la campana, “el recreo”. El texto muestra, desde la voz de los actores, esa vida que se da y se quita en la escuela y que se posiciona como una más de las imposiciones normalizadas para controlar. Reconoce, finalmente, una propuesta desde la posibilidad que estos dos mutantes propician para una escuela libre y dinámica.

  1. Plant cells without detectable plastids are generated in the crumpled leaf mutant of Arabidopsis thaliana.

    Science.gov (United States)

    Chen, Yuling; Asano, Tomoya; Fujiwara, Makoto T; Yoshida, Shigeo; Machida, Yasunori; Yoshioka, Yasushi

    2009-05-01

    Plastids are maintained in cells by proliferating prior to cell division and being partitioned to each daughter cell during cell division. It is unclear, however, whether cells without plastids are generated when plastid division is suppressed. The crumpled leaf (crl) mutant of Arabidopsis thaliana is a plastid division mutant that displays severe abnormalities in plastid division and plant development. We show that the crl mutant contains cells lacking detectable plastids; this situation probably results from an unequal partitioning of plastids to each daughter cell. Our results suggest that crl has a partial defect in plastid expansion, which is suggested to be important in the partitioning of plastids to daughter cells when plastid division is suppressed. The absence of cells without detectable plastids in the accumulation and replication of chloroplasts 6 (arc6) mutant, another plastid division mutant of A. thaliana having no significant defects in plant morphology, suggests that the generation of cells without detectable plastids is one of the causes of the developmental abnormalities seen in crl plants. We also demonstrate that plastids with trace or undetectable amounts of chlorophyll are generated from enlarged plastids by a non-binary fission mode of plastid replication in both crl and arc6.

  2. Studies on anatomical characters indicating C3 and C4 photosynthetic metabolism in the genus Boerhavia L. (Nyctaginaceae

    Directory of Open Access Journals (Sweden)

    Abdulwakeel Ayokun-nun Ajao

    2017-08-01

    Full Text Available The C3 and C4 photosynthetic pathways in dicotyledons were investigated with the four species of Boerhavia occurring in Nigeria using light microscopy. The study is not yet well reported on dicotyledons as done for monocotyledons. The features cross-examined were stomata index, stomata size, inter-stomatal distance, stomatal density, interveinal distance, intercellular air spaces, leaf thickness, mesophyll thickness, Kranz tissue, one cell distant count criterion, maximum lateral cell count criterion, vein density and vein distance. Based on these features, these species (B. erecta, B. coccinea and B. repens were grouped into C4 while B. diffusa was grouped as a C3 plant. In particular, interveinal distance less than 166µm and maximum lateral count ranging 2 to 6 will help in grouping C4 dicotyledons species while those that were greater than these values are useful in grouping C3 and plants.

  3. Identification of a mutant locus that bypasses the BsgA protease requirement for social development in Myxococcus xanthus.

    Science.gov (United States)

    Cusick, John K; Hager, Elizabeth; Gill, Ronald E

    2015-01-01

    The BsgA protease is required for the earliest morphological changes observed in Myxococcus xanthus development. We hypothesize that the BsgA protease is required to cleave an inhibitor of the developmental program, and isolation of genetic bypass suppressors of a bsgA mutant was used to identify signaling components controlling development downstream of the BsgA protease. Strain M955 was created by transposon mutagenesis of a bsgA mutant followed by screening for strains that could develop despite the absence of the BsgA protease. Strain M955 was able to aggregate, form fruiting bodies, and partially restored the production of viable spores in comparison to the parental bsgA mutant. The bsgA Tn5Ω955 strain partially restored developmental expression to a subset of genes normally induced during development, and expressed one developmentally induced fusion at higher amounts during vegetative growth in comparison to wild-type cells. The transposon in strain M955 was localized to a Ribonuclease D homolog that appears to exist in an operon with a downstream aminopeptidase-encoding gene. The identification of a third distinct bypass suppressor of the BsgA protease suggests that the BsgA protease may regulate a potentially complex pathway during the initiation of the M. xanthus developmental program. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. Photosynthetic characteristics of an amphibious plant, Eleocharis vivipara: Expression of C4 and C3 modes in contrasting environments

    Science.gov (United States)

    Ueno, Osamu; Samejima, Muneaki; Muto, Shoshi; Miyachi, Shigetoh

    1988-01-01

    Eleocharis vivipara Link, a freshwater amphibious leafless plant belonging to the Cyperaceae can grow in both terrestrial and submersed aquatic conditions. Two forms of E. vivipara obtained from these contrasting environments were examined for the characteristics associated with C4 and C3 photosynthesis. In the terrestrial form (δ 13C values = -13.5 to -15.4‰, where ‰ is parts per thousand), the culms, which are photosynthetic organs, possess a Kranz-type anatomy typical of C4 plants, and well-developed bundle-sheath cells contain numerous large chloroplasts. In the submersed form (δ 13C value = -25.9‰), the culms possess anatomical features characteristic of submersed aquatic plants, and the reduced bundle-sheath cells contain only a few small chloroplasts. 14C pulse-12C chase experiments showed that the terrestrial form and the submersed form fix carbon by way of the C4 pathway, with aspartate (40%) and malate (35%) as the main primary products, and by way of the C3 pathway, with 3-phosphoglyceric acid (53%) and sugar phosphates (14%) as the main primary products, respectively. The terrestrial form showed photosynthetic enzyme activities typical of the NAD-malic enzyme-C4 subtype, whereas the submersed form showed decreased activities of key C4 enzymes and an increased ribulose 1,5-bisphosphate carboxylase (EC 4.1.1.39) activity. These data suggest that this species can differentiate into the C4 mode under terrestrial conditions and into the C3 mode under submersed conditions. Images PMID:16593980

  5. Genetics and developmental biology

    International Nuclear Information System (INIS)

    Barnett, W.E.

    1975-01-01

    Progress is reported on research activities in the fields of mutagenesis in Haemophilus influenzae and Escherichia coli; radioinduced chromosomal aberrations in mammalian germ cells; effects of uv radiation on xeroderma pigmentosum skin cells; mutations in Chinese hamster ovary cells; radioinduced hemoglobin variants in the mouse; analysis of mutants in yeast; Drosophila genetics; biochemical genetics of Neurospora; DNA polymerase activity in Xenopus laevis oocytes; uv-induced damage in Bacillus subtilis; and others

  6. CEREBELLUM: LINKS BETWEEN DEVELOPMENT, DEVELOPMENTAL DISORDERS AND MOTOR LEARNING

    Directory of Open Access Journals (Sweden)

    Mario U Manto

    2012-01-01

    Full Text Available The study of the links and interactions between development and motor learning has noticeable implications for the understanding and management of neurodevelopmental disorders. This is particularly relevant for the cerebellum which is critical for sensorimotor learning. The olivocerebellar pathway is a key pathway contributing to learning of motor skills. Its developmental maturation and remodelling are being unravelled. Advances in genetics have led to major improvements in our appraisal of the genes involved in cerebellar development, especially studies in mutant mice. Cerebellar neurogenesis is compartmentalized in relationship with neurotransmitter fate. The Engrailed-2 gene is a major actor of the specification of cerebellar cell types and late embryogenic morphogenesis. Math1, expressed by the rhombic lip (RL, is required for the genesis of glutamatergic neurons. Mutants deficient for the transcription factor Ptf1a display a lack of Purkinje cells and gabaergic interneurons. Rora gene contributes to the developmental signalling between granule cells and Purkinje neurons. The expression profile of SHH (Sonic hedgehog in postnatal stages determines the final size/shape of the cerebellum. Genes affecting the development impact upon the physiological properties of the cerebellar circuits. For instance, receptors are developmentally regulated and their action interferes directly with developmental processes. Another field of research which is expanding relates to very preterm neonates. They are at risk for cerebellar lesions, which may themselves impair the developmental events. Very preterm neonates often show sensori-motor deficits, highlighting another major link between impaired development and learning deficiencies. Pathways playing a critical role in cerebellar development are likely to become therapeutical targets for several neurodevelopmental disorders.

  7. Induction of Mutants in Durum Wheat

    International Nuclear Information System (INIS)

    AL-Ubaidi, M.; Ibrahim, I.; AL-Hadithi, A.

    2002-01-01

    This investigation presents a breeding program for induction and development of a new genotype of durum wheat, resistant to lodging with high yield, by irradiation durum wheat hybrids (F2) with gamma rays 100 Gy, during 1990-1997 cultivation seasons. This program involves: induction of variability, selection evaluation of the mutants at three locations: Twaitha (Baghdad) Latifya ( Babylon) and Swari (Kutt). All mutants showed resistance to lodging and there was a significant reduction in plant height. Mutant SIXIZ-22 surpassed other mutants and its origin in lodging resistance and plant height (83.5,82.8 and 89.4 cm) in the three locations at generation M5 and M6, respectively. Also, there were significant differences between mutant and their origin in the number of spikes/M 2 and grain yild during the two successive generation. On the other hand, mutant IZxCO-105 surpassed other mutants in the number of spikes/M 2 (231.8,242.3 and 292) and grain yield (4336,3376 and 5232 kg/ha) in all testing location, respectively . (authors) 14 refs., 4 tabs

  8. Spectrum of induced floral mutants in Petunia

    International Nuclear Information System (INIS)

    Padmaja, V.; Sudhakar, P.

    1987-01-01

    A total of six floral mutants of garden Petunia isolated from the populations raised from the seed treatment with γ-rays, 2, 4-D and sodium azide are described. Five of the mutants viz. stellata, Campyloflora, Rubriflora mixed, Grandiflora and Albiflora mixed originated as segregants in M 2 generation while the chimeral floral phenotype was expressed in M 1 generation itself. Breeding behaviour of these horticulturally interesting altered floral phenotypes were studied in subsequent generations and appropriate conclusions were drawn regarding mode of inheritance of the mutant traits. 15 refs., 4 figures, 1 table. (author)

  9. A Medicago truncatula Tobacco Retrotransposon Insertion Mutant Collection with Defects in Nodule Development and Symbiotic Nitrogen Fixation1[W][OA

    Science.gov (United States)

    Pislariu, Catalina I.; D. Murray, Jeremy; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; A. Benedito, Vagner; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E.; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S.; Chen, Rujin; Udvardi, Michael K.

    2012-01-01

    A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod−), 51 mutants with totally ineffective nodules (Nod+ Fix−), 17 mutants with partially ineffective nodules (Nod+ Fix+/−), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/− Fix−), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/− Fix+), and 11 supernodulating mutants (Nod++Fix+/−). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN’T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod− lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging. PMID:22679222

  10. NIDCAP and developmental care

    Directory of Open Access Journals (Sweden)

    Dominique Haumont

    2014-06-01

    Full Text Available Perinatal mortality in very low birth weight infants has dramatically decreased during the last decades. However, 15-25% of these infants will show neurodevelopmental impairment later on. The aim of implementing early developmental care (EDC, emerged as a new field in neonatology, is to create an intervention program designed to provide support for optimal neurobehavioral development during this highly vulnerable period of brain growth. The theoretical framework, which underlies the approach, is supported by research in different scientific fields, including neuroscience, psychology, medicine and nursing. EDC utilizes a range of medical and nursing interventions that aim to decrease the stress of preterm neonates in neonatal intensive care units (NICUs. The Neonatal Individualized Developmental Care Assessment Program (NIDCAP is an integrated and holistic form of family-centered developmental care. Changing the traditional NICU towards an EDC-NICU includes training nursing and medical staff, investing in their quality and most importantly keeping parents in proximity to the infants. The new challenge of modern neonatology is to restore the mother-infant dyad applying “couplet care” starting at birth until discharge. Most of the European NICUs apply some elements of EDC, but it is more consistent in northern Europe. The development of NIDCAP training centers in Europe demonstrates the evolution of care. It is likely that future research and intervention programs will optimize our practices. Developmental care could prove to be an important recent step in improving outcome in extremely preterm neonates. Proceedings of the 10th International Workshop on Neonatology · Cagliari (Italy · October 22nd-25th, 2014 · The last ten years, the next ten years in Neonatology Guest Editors: Vassilios Fanos, Michele Mussap, Gavino Faa, Apostolos Papageorgiou

  11. Improved analysis of C4 and C3 photosynthesis via refined in vitro assays of their carbon fixation biochemistry

    Science.gov (United States)

    Sharwood, Robert E.; Sonawane, Balasaheb V.; Ghannoum, Oula; Whitney, Spencer M.

    2016-01-01

    Plants operating C3 and C4 photosynthetic pathways exhibit differences in leaf anatomy and photosynthetic carbon fixation biochemistry. Fully understanding this underpinning biochemical variation is requisite to identifying solutions for improving photosynthetic efficiency and growth. Here we refine assay methods for accurately measuring the carboxylase and decarboxylase activities in C3 and C4 plant soluble protein. We show that differences in plant extract preparation and assay conditions are required to measure NADP-malic enzyme and phosphoenolpyruvate carboxylase (pH 8, Mg2+, 22 °C) and phosphoenolpyruvate carboxykinase (pH 7, >2mM Mn2+, no Mg2+) maximal activities accurately. We validate how the omission of MgCl2 during leaf protein extraction, lengthy (>1min) centrifugation times, and the use of non-pure ribulose-1,5-bisphosphate (RuBP) significantly underestimate Rubisco activation status. We show how Rubisco activation status varies with leaf ontogeny and is generally lower in mature C4 monocot leaves (45–60% activation) relative to C3 monocots (55–90% activation). Consistent with their >3-fold lower Rubisco contents, full Rubisco activation in soluble protein from C4 leaves (<5min) was faster than in C3 plant samples (<10min), with addition of Rubisco activase not required for full activation. We conclude that Rubisco inactivation in illuminated leaves primarily stems from RuBP binding to non-carbamylated enzyme, a state readily reversible by dilution during cellular protein extraction. PMID:27122573

  12. Photosynthesis of C3 and C4 Species in Response to Increased CO2 Concentration and Drought Stress

    Directory of Open Access Journals (Sweden)

    HAMIM

    2005-12-01

    Full Text Available Photosynthetic gas exchange in response to increased carbon dioxide concentration ([CO2] and drought stress of two C3 (wheat and kale and two C4 species (Echinochloa crusgallii and Amaranthus caudatus were analysed. Plants were grown in controlled growth chambers with ambient (350 μmol mol−1 and doubled ambient [CO2]. Drought was given by withholding water until the plants severely wilted, whereas the control plants were watered daily. Even though stomatal conductance (Gs of C4 species either under ambient or double [CO2] was lower than those in C3, doubled [CO2] decreased Gs of all species under well watered conditions. As a result, the plants grown under doubled [CO2] transpired less water than those grown under ambient [CO2]. Photosynthesis (Pn of the C4 species was sustained during moderate drought when those of the C3 species decreased significantly. Doubled [CO2] increased photosynthesis of C3 but not of C4 species. Increased [CO2] was only able to delay Pn reduction of all species due to the drought, but not remove it completely. The positive effects of increased [CO2] during moderate drought and the disappearance of it under severe drought suggesting that metabolic effect may limit photosynthesis under severe drought.

  13. Photosynthesis of C3 and C4 Species in Response to Increased CO2 Concentration and Drought Stress

    Directory of Open Access Journals (Sweden)

    HAMIM

    2005-12-01

    Full Text Available Photosynthetic gas exchange in response to increased carbon dioxide concentration ([CO2] and drought stress of two C3 (wheat and kale and two C4 species (Echinochloa crusgallii and Amaranthus caudatus were analysed. Plants were grown in controlled growth chambers with ambient (350 mol mol-1 and doubled ambient [CO2]. Drought was given by withholding water until the plants severely wilted, whereas the control plants were watered daily. Even though stomatal conductance (Gs of C4 species either under ambient or double [CO2] was lower than those in C3, doubled [CO2] decreased Gs of all species under well watered conditions. As a result, the plants grown under doubled [CO2] transpired less water than those grown under ambient [CO2]. Photosynthesis (Pn of the C4 species was sustained during moderate drought when those of the C3 species decreased significantly. Doubled [CO2] increased photosynthesis of C3 but not of C4 species. Increased [CO2] was only able to delay Pn reduction of all species due to the drought, but not remove it completely. The positive effects of increased [CO2] during moderate drought and the disappearance of it under severe drought suggesting that metabolic effect may limit photosynthesis under severe drought.

  14. Probable C4d-negative accelerated acute antibody-mediated rejection due to non-HLA antibodies.

    Science.gov (United States)

    Niikura, Takahito; Yamamoto, Izumi; Nakada, Yasuyuki; Kamejima, Sahoko; Katsumata, Haruki; Yamakawa, Takafumi; Furuya, Maiko; Mafune, Aki; Kobayashi, Akimitsu; Tanno, Yudo; Miki, Jun; Yamada, Hiroki; Ohkido, Ichiro; Tsuboi, Nobuo; Yamamoto, Hiroyasu; Yokoo, Takashi

    2015-07-01

    We report a case of probable C4d-negative accelerated acute antibody-mediated rejection due to non-HLA antibodies. A 44 year-old male was admitted to our hospital for a kidney transplant. The donor, his wife, was an ABO minor mismatch (blood type O to A) and had Gitelman syndrome. Graft function was delayed; his serum creatinine level was 10.1 mg/dL at 3 days after transplantation. Open biopsy was performed immediately; no venous thrombosis was observed during surgery. Histology revealed moderate peritubular capillaritis and mild glomerulitis without C4d immunoreactivity. Flow cytometric crossmatching was positive, but no panel-reactive antibodies against HLA or donor-specific antibodies (DSAbs) to major histocompatibility complex class I-related chain A (MICA) were detected. Taken together, we diagnosed him with probable C4d-negative accelerated antibody-mediated rejection due to non-HLA, non-MICA antibodies, the patient was treated with steroid pulse therapy (methylprednisolone 500 mg/day for 3 days), plasma exchange, intravenous immunoglobulin (40 g/body), and rituximab (200 mg/body) were performed. Biopsy at 58 days after transplantation, at which time S-Cr levels were 1.56 mg/dL, found no evidence of rejection. This case, presented with a review of relevant literature, demonstrates that probable C4d-negative accelerated acute AMR can result from non-HLA antibodies. © 2015 Asian Pacific Society of Nephrology.

  15. Variations in IBD (ACAD8) in children with elevated C4-carnitine detected by tandem mass spectrometry newborn screening

    DEFF Research Database (Denmark)

    Pedersen, Christina B; Bischoff, Claus; Christensen, Ernst

    2006-01-01

    or compound heterozygous for variations in the IBD gene have been reported. We present IBD deficiency in an additional four newborns with elevated C(4)-carnitine identified by tandem mass spectrometry (MS/MS) screening in Denmark and the United States. Three showed urinary excretions of isobutyryl...

  16. Biomass and leaf-level gas exchange characteristics of three African savanna C4 grass species under optimum growth conditions

    NARCIS (Netherlands)

    Mantlana, K.B.; Veenendaal, E.M.; Arneth, A.; Grispen, V.; Bonyongo, C.M.; Heitkönig, I.M.A.; Lloyd, J.

    2009-01-01

    C4 savanna grass species, Digitaria eriantha, Eragrostis lehmanniana and Panicum repens, were grown under optimum growth conditions with the aim of characterizing their above- and below-ground biomass allocation and the response of their gas exchange to changes in light intensity, CO2 concentration

  17. Late pliocene-pleistocene expansion of C4 vegetation in semiarid East Asia linked to increased burning : Geology

    NARCIS (Netherlands)

    Zhou, B.; Shen, C.; Sun, W.; Bird, M.; Ma, W.; Taylor, D.; Liu, W.; Peterse, F.; Yi, W.; Zheng, H.

    2014-01-01

    Plants using the C4 photosynthetic pathway, commonly tropical and subtropical grasses, increased in abundance in East Asia during the late Cenozoic. Determining the exact timing and likely factors leading to this major vegetation change requires region-specific studies. Here variations in pyrogenic

  18. Approach to Interfacial and Intramolecular Electron Transfer of the Diheme Protein Cytochrome c(4) Assembled on Au(111) Surfaces

    DEFF Research Database (Denmark)

    Chi, Qijin; Zhang, Jingdong; Taner, Arslan

    2010-01-01

    in homogeneous solution for which kinetic analysis clearly testifies to electrostatic cooperative effects but no intramolecular, interheme ET higher than 0.1-10 s(-1). This difference suggests a strong gating feature of the process. On the basis of the three-dimensional structure of P. stutzeri cyt c(4), gating...

  19. Molecular and vibrational structure of the extracellular bacterial signal compound N-butyryl-homoserine lactone (C4-HSL)

    DEFF Research Database (Denmark)

    Bak, Jimmy; Spanget-Larsen, Jens

    2009-01-01

    contributions from suspended micro-crystalline aggregates and dissolved monomeric species. The key vibrational bands of the monomeric form of C4-HSL are reported here for the first time: 3425cm−1 (ν(N-H)), 1784cm−1 (ν(C&dbnd;O), lactone), 1688cm−1 (amide I), and 1494cm−1 (amide II) (CCl4)....

  20. 40 CFR 721.10103 - Naphtha (Fischer-Tropsch), C4-11-alkane, branched and linear.

    Science.gov (United States)

    2010-07-01

    ...-alkane, branched and linear. 721.10103 Section 721.10103 Protection of Environment ENVIRONMENTAL..., branched and linear. (a) Chemical substance and significant new uses subject to reporting. (1) The chemical substance identified as naphtha (fischer-tropsch), C4-11-alkane, branched and linear (PMN P-04-235; CAS No...

  1. US/UK Sensor-To-Shooter Multinational C4 Interoperability Study Force-On-Force Effectiveness Methodology

    National Research Council Canada - National Science Library

    Bailey, Timothy J

    2000-01-01

    .... This methodology has been successfully applied to Army, joint, and multinational studies. The latest of these studies, the US/UK Sensor-To-Shooter Multinational C4 Interoperability Study Force-On-Force Analysis, was an effort to measure the value...

  2. Elevated CO2 shifts the functional structure and metabolic potentials of soil microbial communities in a C4 agroecosystem.

    Science.gov (United States)

    Xiong, Jinbo; He, Zhili; Shi, Shengjing; Kent, Angela; Deng, Ye; Wu, Liyou; Van Nostrand, Joy D; Zhou, Jizhong

    2015-03-20

    Atmospheric CO2 concentration is continuously increasing, and previous studies have shown that elevated CO2 (eCO2) significantly impacts C3 plants and their soil microbial communities. However, little is known about effects of eCO2 on the compositional and functional structure, and metabolic potential of soil microbial communities under C4 plants. Here we showed that a C4 maize agroecosystem exposed to eCO2 for eight years shifted the functional and phylogenetic structure of soil microbial communities at both soil depths (0-5 cm and 5-15 cm) using EcoPlate and functional gene array (GeoChip 3.0) analyses. The abundances of key genes involved in carbon (C), nitrogen (N) and phosphorus (P) cycling were significantly stimulated under eCO2 at both soil depths, although some differences in carbon utilization patterns were observed between the two soil depths. Consistently, CO2 was found to be the dominant factor explaining 11.9% of the structural variation of functional genes, while depth and the interaction of depth and CO2 explained 5.2% and 3.8%, respectively. This study implies that eCO2 has profound effects on the functional structure and metabolic potential/activity of soil microbial communities associated with C4 plants, possibly leading to changes in ecosystem functioning and feedbacks to global change in C4 agroecosystems.

  3. Evolutionary and developmental modules.

    Science.gov (United States)

    Lacquaniti, Francesco; Ivanenko, Yuri P; d'Avella, Andrea; Zelik, Karl E; Zago, Myrka

    2013-01-01

    The identification of biological modules at the systems level often follows top-down decomposition of a task goal, or bottom-up decomposition of multidimensional data arrays into basic elements or patterns representing shared features. These approaches traditionally have been applied to mature, fully developed systems. Here we review some results from two other perspectives on modularity, namely the developmental and evolutionary perspective. There is growing evidence that modular units of development were highly preserved and recombined during evolution. We first consider a few examples of modules well identifiable from morphology. Next we consider the more difficult issue of identifying functional developmental modules. We dwell especially on modular control of locomotion to argue that the building blocks used to construct different locomotor behaviors are similar across several animal species, presumably related to ancestral neural networks of command. A recurrent theme from comparative studies is that the developmental addition of new premotor modules underlies the postnatal acquisition and refinement of several different motor behaviors in vertebrates.

  4. The spatial distribution of C3 and C4 grasses in North America through the next century

    Science.gov (United States)

    Cotton, J. M.; Mosier, T. M.; Cerling, T. E.; Ehleringer, J. R.; Hoppe, K. A.; Still, C. J.

    2014-12-01

    C4 grasses currently cover ~18% of the earth's surface and are economically important as food sources, but their distributions are likely to change with future climate changes. As a result of the opposing impacts of atmospheric CO2 and temperature on C3 and C4 physiology, future changes to the productivity and distributions of these grasses have remained unclear. We have used past and present tooth enamel, collagen, and bone carbon isotope ratios (δ13C) of Bison and Mammoth grazers to record the δ13C values of their diet, and the abundance of C3 and C4 vegetation in these habitats. Thus, the δ13C values of bison and mammoth tissues serve as a proxy for vegetation composition across North America through time. We combine these isotope data with ensemble CMIP5 climate model outputs, eight different climatic and fire predictor variables and advanced statistical techniques to model the spatial distribution of C3 and C4 grasses up through the year 2100 for two different emissions scenarios. Using the Random Forest algorithm, our model explains 91% of the spatial and temporal isotopic variability in bison and mammoth tissues and infers that mean summer temperature is the strongest predictor of all climate variables. For the emission scenario RCP4.5, in which atmospheric CO2 levels are predicted to rise to ~540 ppm by 2100, we find decreases in the abundance of C4 grasses of up to 30% in the south-central Great Plains and the Florida peninsula, and increases of up to 50% in the northern Great Plains. For the RCP8.5 scenario, in which atmospheric CO2 levels are expected to rise to ~930 ppm by 2100, our model predicts minor decreases in the abundance of C4 grasses in Texas and Oklahoma, but increases of 30-50% over the majority of the Great Plains. The overall effect of these changes is a homogenization of the Great Plains ecoregion in terms of grassland type distributions, and the loss of the highest abundance of C4 ecosystems of the panhandles of Texas, Oklahoma and

  5. A Common Histone Modification Code on C4 Genes in Maize and Its Conservation in Sorghum and Setaria italica1[W][OA

    Science.gov (United States)

    Heimann, Louisa; Horst, Ina; Perduns, Renke; Dreesen, Björn; Offermann, Sascha; Peterhansel, Christoph

    2013-01-01

    C4 photosynthesis evolved more than 60 times independently in different plant lineages. Each time, multiple genes were recruited into C4 metabolism. The corresponding promoters acquired new regulatory features such as high expression, light induction, or cell type-specific expression in mesophyll or bundle sheath cells. We have previously shown that histone modifications contribute to the regulation of the model C4 phosphoenolpyruvate carboxylase (C4-Pepc) promoter in maize (Zea mays). We here tested the light- and cell type-specific responses of three selected histone acetylations and two histone methylations on five additional C4 genes (C4-Ca, C4-Ppdk, C4-Me, C4-Pepck, and C4-RbcS2) in maize. Histone acetylation and nucleosome occupancy assays indicated extended promoter regions with regulatory upstream regions more than 1,000 bp from the transcription initiation site for most of these genes. Despite any detectable homology of the promoters on the primary sequence level, histone modification patterns were highly coregulated. Specifically, H3K9ac was regulated by illumination, whereas H3K4me3 was regulated in a cell type-specific manner. We further compared histone modifications on the C4-Pepc and C4-Me genes from maize and the homologous genes from sorghum (Sorghum bicolor) and Setaria italica. Whereas sorghum and maize share a common C4 origin, C4 metabolism evolved independently in S. italica. The distribution of histone modifications over the promoters differed between the species, but differential regulation of light-induced histone acetylation and cell type-specific histone methylation were evident in all three species. We propose that a preexisting histone code was recruited into C4 promoter control during the evolution of C4 metabolism. PMID:23564230

  6. Estimating photosynthesis and concurrent export rates in C3 and C4 species at ambient and elevated CO2

    International Nuclear Information System (INIS)

    Grodzinski, B.; Jiao, J.; Leonardos, E.D.

    1998-01-01

    The ability of 21 C3 and C4 monocot and dicot species to rapidly export newly fixed C in the light at both ambient and enriched CO2 levels was compared. Photosynthesis and concurrent export rates were estimated during isotopic equilibrium of the transport sugars using a steady-state 14CO2-labeling procedure. At ambient CO2 photosynthesis and export rates for C3 species were 5 to 15 and 1 to 10 micromole C m-2 s-1, respectively, and 20 to 30 and 15 to 22 micromole C m-2 s-1, respectively, for C4 species. A linear regression plot of export on photosynthesis rate of all species had a correlation coefficient of 0.87. When concurrent export was expressed as a percentage of photosynthesis, several C3 dicots that produced transport sugars other than Suc had high efflux rates relative to photosynthesis, comparable to those of C4 species. At high CO2 photosynthetic and export rates were only slightly altered in C4 species, and photosynthesis increased but export rates did not in all C3 species. The C3 species that had high efflux rates relative to photosynthesis at ambient CO2 exported at rates comparable to those of C4 species on both an absolute basis and as a percentage of photosynthesis. At ambient CO2 there were strong linear relationships between photosynthesis, sugar synthesis, and concurrent export. However, at high CO2 the relationships between photosynthesis and export rate and between sugar synthesis and export rate were not as strong because sugars and starch were accumulated

  7. Semi-dwarf mutants for rice improvement

    International Nuclear Information System (INIS)

    Othman, Ramli; Osman, Mohammad; Ibrahim, Rusli

    1990-01-01

    Full text: MARDI and the National University of Malaysia embarked on a programme to induce resistance against blast in rice in 1978. MARDI also obtained semi dwarf mutants of cvs 'Mahsuri', 'Muda', 'Pongsu seribu' and 'Jarum Mas', which are under evaluation. The popular local rice variety 'Manik' was subjected to gamma irradiation (15-40 krad) and 101 promising semidwarf mutants have been obtained following selection in M 2 -M 6 . 29 of them show grain yields of 6.0-7.3 t/ha, compared with 5.7t for 'Manik'. Other valuable mutants were found showing long grain, less shattering, earlier maturity, and glutinous endosperm. One mutant, resistant to brown plant hopper yields 6.3t/ha. (author)

  8. X-rays sensitive mammalian cell mutant

    International Nuclear Information System (INIS)

    Utsumi, Hiroshi

    1982-01-01

    A phenomenon that in x-ray-sensitive mammalian-cell mutants, cellular death due to x-ray radiation was not increased by caffeine, but on the contrary, the dead cells were resuscitated by it was discussed. The survival rate of mutant cells increased by caffein in a low concentration. This suggested that caffeine may have induced some mechanism to produce x-ray resistant mutant cells. Postirradiation treatment with caffeine increased considerably the survival rate of the mutant cells, and this suggested the existence of latent caffeine-sensitive potentially lethal damage repair system. This system, after a few hours, is thought to be substituted by caffeine-resistant repair system which is induced by caffeine, and this may be further substituted by x-ray-resistant repair system. The repair system was also induced by adenine. (Ueda, J.)

  9. Generation and characterization of pigment mutants of ...

    African Journals Online (AJOL)

    acer

    2014-01-08

    Jan 8, 2014 ... aquatic ecosystems were studied. In the present ... logy and photosynthesis research (Stolbov, 1995;. Pedersen ... Microalgal strain and cultivation conditions ..... evaluated for their ecotoxicological effects using 124y-1 mutant.

  10. Molecular analysis of waxy mutants in rice

    International Nuclear Information System (INIS)

    Yatou, O.; Amano, E.

    1990-01-01

    Full text: The 'waxy' gene is a structural gene coding a glycosyl transferase which synthesises amylose in the endosperm tissue. 'Non-waxy' rice cultivars have an active gene and their amylose content is 18-25% depending upon gene performance and modifier genes. In 'waxy' rice, no amylose is found because the enzyme is absent. In mutants induced by gamma rays, neutrons, EI or EMS, amylose content ranged from 0 to 20%, i.e. there are intermediate phenotypes as well. Some of them had the same amount of the enzyme as a 'non-waxy' cultivar, even fully 'waxy' mutants showed a certain amount of the enzyme. This suggests that in mutants there may be no structural change in the enzyme gene but the enzyme produced might be less active. By molecular analysis of the mutants' genes it was found that only two mutants induced by thermal neutrons show structural alterations, the changes in other mutants are either too small to be detected by Southern analysis or are outside the structural gene in question. (author)

  11. Commercialization Of Orchid Mutants For Floriculture Industry

    International Nuclear Information System (INIS)

    Sakinah Ariffin; Zaiton Ahmad

    2014-01-01

    Orchids are the main contributors to cut flower industry in Malaysia with an existing good market and a huge business potential. Orchid industry has been established in Malaysia since 1960s but only started to develop and expand since 1980s. Continuous development of new orchid varieties is essential to meet customers' demands. Orchid mutagenesis research using gamma irradiation at Malaysian Nuclear Agency has successfully generated a number of new orchid varieties with commercial potentials. Therefore, Nuclear Malaysia has collaborated with an industrial partner, Hexagon Green Sdn Bhd (HGSB), to carry out commercialization research on these mutants under a Technofund project entitled 'Pre-Commercialization of Mutant Orchids for Cut Flowers Industry' from July 2011 to July 2014. Through this collaboration, Dendrobium orchid mutant plants developed by Nuclear Malaysia were transferred to HGSB's commercial orchid nursery at Bukit Changgang Agrotechnology Park, Banting, Selangor, for mass-propagation. The activities include evaluations on plant growth performance, flower quality, post harvest and market potential of these mutants. Mutants with good field performance have been identified and filed for Plant Variety Protection (PVP) with Department of Agriculture Malaysia. This paper describes outputs from this collaboration and activities undertaken in commercializing these mutants. (author)

  12. From one body mutant to one cell mutant. A progress of radiation breeding in crops

    International Nuclear Information System (INIS)

    Nagatomi, Shigeki

    1996-01-01

    An effective method was established to obtain non-chimeral mutants with wide spectrum of flower colors, regenerated from floral organs on which mutated sectors were come out on chronic irradiated plants. By this way, six mutant varieties of flower colors have been selected from one pink flower of chrysanthemum, and cultivated for cut-flower production. By the same method, 3 mutant varieties with small and spray type flowers were selected in Eustoma. Mutant varieties such as a rust disease resistant in sugarcane, 6 dwarfs in Cytisus and pure-white mushroom in velvet shank have been selected successively for short period. (J.P.N.)

  13. Gamma-radiation Mutagenesis in Genetically Unstable Barley Mutants. Pt. 2. Comparison of Various Mutants

    International Nuclear Information System (INIS)

    Balchiuniene, L.

    1995-01-01

    Spontaneous and gamma-induced mutability was compared in two groups of genetically unstable barley ear structure mutants - tweaky spike (tw) and branched ear (be). Instability in different loci causes different levels of spontaneous and gamma-induced mutability. A high spontaneous level of chlorophyll mutations is peculiar to be-ust mutants. It is suggested that the high level of induced chlorophyll mutations in allelic tw mutants is a result of better surviving of chlorophyll mutation carriers in the genotypical-physiological environment created by mutant tw alleles. (author). 6 refs., 2 tabs

  14. Making C4 crops more water efficient under current and future climate: Tradeoffs between carbon gain and water loss

    Science.gov (United States)

    Srinivasan, V.; Pignon, C.

    2017-12-01

    C4 plants have a carbon concentrating mechanism that has evolved under historically low CO2 concentrations of around 200 ppm. However, increases in global CO2 concentrations in recent times (current CO2 concentrations are at 400 ppm and it is projected to be 550 ppm by mid-century) have diminished the relative advantage of C4 plants over C3 plants, which lack the expensive carbon concentrating machinery. Here we show by employing model simulations that under pre-historic CO2 concentrations, C4 plants are near optimal in their stomatal behavior and nitrogen partitioning between carbon concentrating machinery and carboxylation machinery, and they are significantly supra-optimal under current and future elevated CO2 concentrations. Model simulations performed at current CO2 concentrations of 400 ppm show that, under high light conditions, decreasing stomatal conductance by 20% results in a 15% increase in water use efficiency with negligible loss in photosynthesis. Under future elevated CO2 concentrations of 550 ppm, a 40% decrease in stomatal conductance produces a 35% increase in water use efficiency. Furthermore, stomatal closure is shown to be more effective in decreasing whole canopy transpiration compared to canopy top leaf transpiration, since shaded leaves are more supra-optimal than sunlit leaves. Model simulations for optimizing nitrogen distribution in C4 leaves show that under high light conditions, C4 plants over invest in carbon concentrating machinery and under invest in carboxylation machinery. A 20% redistribution in leaf nitrogen results in a 10% increase in leaf carbon assimilation without significant increases in transpiration under current CO2 concentrations of 400 ppm. Similarly, a 40% redistribution in leaf nitrogen results in a 15% increase in leaf carbon assimilation without significant increases in transpiration under future elevated CO2 concentrations of 550 ppm. Our model optimality simulations show that C4 leaves a supra optimal in their

  15. Homologous Recombination Defective Arabidopsis Mutants Exhibit Enhanced Sensitivity to Abscisic Acid.

    Directory of Open Access Journals (Sweden)

    Sujit Roy

    Full Text Available Abscisic acid (ABA acts as an important plant hormone in regulating various aspects of plant growth and developmental processes particularly under abiotic stress conditions. An increased ABA level in plant cells inhibits DNA replication and cell division, causing plant growth retardation. In this study, we have investigated the effects of ABA on the growth responses of some major loss-of-function mutants of DNA double-stand break (DSB repair genes in Arabidopsis during seed germination and early stages of seedling growth for understanding the role of ABA in the induction of genome instability in plants. A comparative analysis of ABA sensitivity of wild-type Arabidopsis and the knockout mutant lines related to DSB sensors, including atatm, atatr, the non-homologous end joining (NHEJ pathway genes, and mutants related to homologous recombination (HR pathway genes showed relatively enhanced sensitivity of atatr and HR-related mutants to ABA treatment. The expression levels of HR-related genes were increased in wild-type Arabidopsis (Col-0 during seed germination and early stages of seedling growth. Immunoblotting experiments detected phosphorylation of histone H2AX in wild-type (Col-0 and DSB repair gene mutants after ABA treatment, indicating the activation of DNA damage response due to ABA treatment. Analyses of DSB repair kinetics using comet assay under neutral condition have revealed comparatively slower DSB repair activity in HR mutants. Overall, our results have provided comprehensive information on the possible effect of ABA on DNA repair machinery in plants and also indicated potential functional involvement of HR pathway in repairing ABA induced DNA damage in Arabidopsis.

  16. Officially released mutant varieties in China

    International Nuclear Information System (INIS)

    Liu, L.; Van Zanten, L.; Shu, Q.Y.; Maluszynski, M.

    2004-01-01

    The use of mutation techniques for crop improvement in China has a long and well-established tradition of more than 50 years. As the result of intensive research in many institutes dealing with application of nuclear technologies more than 620 cultivars of 44 crop species have been released. Numerous mutant varieties have been grown on a large scale bringing significant economic impact, sustaining crop production and greatly contributing to increase of food production also in stress prone areas of the country. However, there is still missing information not only on the number of mutant varieties released in particular crop species but also on mutagens applied, selection approaches and on the use of mutants in cross breeding. Numerous Chinese scientists collected and systematized this information. Results of their work were often published in local scientific journals in the Chinese language and as such were unavailable to breeders from other countries. Having this in mind, we requested Dr. Liu Luxiang, the Director of the Department of Plant Mutation Breeding and Genetics, Institute for Application of Atomic Energy, Chinese Academy of Agricultural Sciences in Beijing to help us in finding as much information as possible on mutant varieties officially released in China. The data has been collected in close collaboration with his colleagues from various institutions all over the country and then evaluated, edited and prepared for publication by our team responsible for the FAO/IAEA Database of Officially Released Mutant Varieties. We would like to thank all Chinese colleagues who contributed to this list of Chinese mutant varieties. We hope that this publication will stimulate plant breeders in China to collect more information on released mutant varieties and especially on the use of mutated genes in cross breeding. (author)

  17. Development of high yielding mutants in lentil

    International Nuclear Information System (INIS)

    Rajput, M.A.; Sarwar, G.; Siddiqui, K.A.

    2001-01-01

    Full text: Lentil (Lens culinaris Medik.) locally known as Masoor, is the second most important rabi pulse crop, after chickpea, in Pakistan. It is cultivated on an area of over 63,400 ha, which constitutes about 4.83% of the total area under pulses. The annual production of the crop is 28,200 tones with an average yield of 445 kg/ha. Yield at the national level is very low, about one-half of the world's yield, which is mainly due to non-availability of high yield potential genotypes. Keeping in view the importance of mutants in developing a large number of new varieties, an induced mutations programme was initiated at AEARC, Tandojam during 1987-88, to develop high yielding varieties in lentil. For this, seeds of two lentil varieties, 'Masoor-85' and 'ICARDA-8' had been irradiated with gamma-rays ranging from 100-600 Gy in NIAB, Faisalabad during 1990. Selections were made in M2 on the basis of earliness, plant height, branches/plant and 100 grain weight. After confirming these mutants in M3 they were promoted in station yield trials and studied continuously for three consecutive years (1993- 1995). Overall results revealed that these mutants have consistent improvement of earliness in flowering and maturity. Plant height also increased in all mutant lines except AEL 23/40/91 where reduction in this attribute was observed as compared to parent variety. Mutant lines AEL 49/20/91 and AEL 13/30/91 showed improvement in 100 grain weight. The improvement of some agronomic characters enhanced the yield of mutant lines in comparison to parent varieties (Masoor-85 and ICARDA-8). The diversity in yield over the respective parents was computed from 6.94 to 60.12%. From these encouraging results it is hoped that mutant lines like AEL 12/30/91 and AEL 49/20/91 may serve as potential lentil genotypes in future. (author)

  18. Recent trend of δ13C of C4 plant cellulose as an indicator of atmospheric CO2 change

    International Nuclear Information System (INIS)

    Minagawa, Masao; Egawa, Saho

    1993-01-01

    Natural carbon isotope composition ( 13 C/ 12 C) of C4 plant have been analyzed to trace the 13 C content of atmospheric carbon dioxide. Cellulose fraction, kernel coat and starch fraction were separated from two group of Zea mays (corn) which were grown and harvested at Hokkaido and Nagano prefecture in Japan during 1963 and 1989, and each component was analyzed for 13 C/ 12 C isotope ratios. The purpose of this study is to assess if these components are useful for tracing 13 C/ 12 C ratio of atmospheric CO 2 and how such isotopic composition of C4 plants can be modified from original isotopic signals of global circulating carbon. (author)

  19. OPTIMASI KLASIFIKASI SEL TUNGGAL PAP SMEAR MENGGUNAKAN CORRELATION BASED FEATURES SELECTION (CFS BERBASIS C4.5 DAN NAIVE BAYES

    Directory of Open Access Journals (Sweden)

    Asti Herliana

    2016-11-01

    Full Text Available Abstract – Cervical cancer was the most dangerous disease and generally attacks women. Early detection through Pap Smear method was one way to prevent the desease to grow in womans cervival canal. Based on the result of Pap Smear methode, the single cell of data that known as herlev data is available. This data, then used as a reference by the experts to find the best level classification from each class of cervical cancer. The decision tree C4.5 and Naïve Bayes have proven to give the best result on 280 data trial of herlev with support by Correlation based Features Selection (CFS optimization method. The issues raised in the present study was does CFS optimization methode that combined with the classification method of C4.5 and Naïve Bayes can provide increased the accuracy results when it faced the 917 data of herlev. The results of this study show that CFS method that combined either with C4.5 methods and naïve bayes classification accuracy was decrease when compared without using CFS method. In terms of showing that CFS can not provide the best result when if confronted with big data. Keywords : optimization, classification, single cell of Pap Smear, Correlation based Features Selection, C4.5, Naïve Bayes   Abstrak – Kanker serviks merupakan penyakit yang sangat berbahaya dan pada umumnya menyerang kaum wanita. Deteksi sejak dini melalui metode Pap Smear merupakan salah satu cara untuk mencegah penyakit ini berkembang didalam saluran serviks wanita. Berdasarkan hasil dari metode Pap Smear, didapatkanlah data sel tunggal yang kini dikenal dengan data herlev. Data ini, kemudian dijadikan acuan dalam penelitian oleh para ahli dewasa ini untuk menemukan tingkat klasifikasi terbaik dari masing-masing kelas kanker serviks. Metode Decision tree C4.5 dan Naïve Bayes terbukti memberikan hasil yang terbaik pada ujicoba data herlev sebanyak 280 data dengan dukungan dari metode optimasi Correlation based Features Selection(CFS. Permasalahan

  20. Penerapan Dizcretization dan Teknik Bagging Untuk Meningkatkan Akurasi Klasifikasi Berbasis Ensemble pada Algoritma C4.5 dalam Mendiagnosa Diabetes

    Directory of Open Access Journals (Sweden)

    Mirqotussa’adah Mirqotussa’adah

    2017-08-01

    Full Text Available Pada bidang kesehatan, data mining dapat dimanfaatkan untuk memprediksi suatu penyakit dari data rekam medis pasien, diantaranya diabetes. Ada beberapa model data mining salah satunya klasifikasi. Di bidang klasifikasi,  ada banyak cabang yang berkembang yaitu pohon keputusan (decision tree. Salah satu decision tree yang populer adalah C4.5. Dalam riset ini, data yang digunakan adalah pima indian diabetes dataset yang diambil dari UCI repository of machine learning. Pada dataset ini seluruh atributnya bertipe numerik yang bersifat continuous dan untuk menangani data continuous digunakan discretization. Akurasi sangat penting dalam pengklasifikasian, ensemble method adalah metode yang digunakan untuk meningkatkan akurasi algoritma klasifikasi dengan membangun beberapa classifier dari data training. Dari hasil penelitian, dengan menerapkan discretization dan teknik bagging untuk klasifikasi berbasis ensemble pada algoritma C4.5 dapat meningkatkan akurasi sebesar 6,26%. Dengan akurasi awal 68,61%, setelah diterapkan discretization dan teknik bagging menjadi 74,87%.

  1. Complete chloroplast genome sequence of green foxtail (Setaria viridis), a promising model system for C4 photosynthesis.

    Science.gov (United States)

    Wang, Shuo; Gao, Li-Zhi

    2016-09-01

    The complete chloroplast genome of green foxtail (Setaria viridis), a promising model system for C4 photosynthesis, is first reported in this study. The genome harbors a large single copy (LSC) region of 81 016 bp and a small single copy (SSC) region of 12 456  bp separated by a pair of inverted repeat (IRa and IRb) regions of 22 315 bp. GC content is 38.92%. The proportion of coding sequence is 57.97%, comprising of 111 (19 duplicated in IR regions) unique genes, 71 of which are protein-coding genes, four are rRNA genes, and 36 are tRNA genes. Phylogenetic analysis indicated that S. viridis was clustered with its cultivated species S. italica in the tribe Paniceae of the family Poaceae. This newly determined chloroplast genome will provide valuable genetic resources to assist future studies on C4 photosynthesis in grasses.

  2. Solid-State Photochemistry as a Formation Mechanism for Titan's Stratospheric C4N2 Ice Clouds

    Science.gov (United States)

    Anderson, C. M.; Samuelson, R. E.; Yung, Y. L.; McLain, J. L.

    2016-01-01

    We propose that C4N2 ice clouds observed in Titan's springtime polar stratosphere arise due to solid-state photochemistry occurring within extant ice cloud particles of HCN-HC3N mixtures. This formation process resembles the halogen-induced ice particle surface chemistry that leads to condensed nitric acid trihydrate (NAT) particles and ozone depletion in Earth's polar stratosphere. As our analysis of the Cassini Composite Infrared Spectrometer 478 per centimeter ice emission feature demonstrates, this solid-state photochemistry mechanism eliminates the need for the relatively high C4N2 saturation vapor pressures required (even though they are not observed) when the ice is produced through the usual procedure of direct condensation from the vapor.

  3. From reconstruction to C>4 metabolic engineering: A case study for overproduction of polyhydroxybutyrate in bioenergy grasses

    DEFF Research Database (Denmark)

    Gomes de Oliveira Dal'Molin, Cristiana; Quek, Lake-Ee; Saa, Pedro A.

    2018-01-01

    bundle sheath (B) and mesophyll (M) across the day and night cycle. The C4 leaf model was used to explore how amenable polyhydroxybutyrate (PHB) production is with these four compartments working cooperatively. A strategic pattern of metabolite conversion and exchange emerged from a systems-level network......The compartmentalization of C4 plants increases photosynthetic efficiency, while constraining how material and energy must flow in leaf tissues. To capture this metabolic phenomenon, a generic plant metabolic reconstruction was replicated into four connected spatiotemporal compartments, namely...... that has very few constraints imposed; mainly the sequential two-step carbon capture in mesophyll, then bundle sheath and photosynthesis during the day only. The building of starch reserves during the day and their mobilization during the night connects day and night metabolism. Flux simulations revealed...

  4. Manganese oxide as a promoter for C2-C4 olefin production in the hydrogenation of carbon dioxide

    International Nuclear Information System (INIS)

    Kim, C.; Chen, K.; Hanson, F.V.; Oblad, A.G.; Tsai, Y.

    1986-01-01

    A number of active research and development programs have been initiated to explore the potential of CO hydrogenation process as a source of low molecular weight (C 2 -C 4 ) olefins. Metal catalysts such as Co-Mn, Ni-zeolite, Rd and Mo have been evaluated for low molecular weight olefin selectivity. The coprecipitated Fe-Mn system (Mn/Fe=9/1) was reported to be highly olefin selective. Recently, many investigators reported supporting evidence for the promotional effect of Mn for precipitated Fe catalysts. In this study, Raney Fe promoted with Mn has been evaluated for C 2 -C 4 olefin selectivity in the hydrogenation of CO relative to coprecipitated Fe-Mn catalysts. Catalyst characterization, including BET surface area, X-ray diffraction, selective chemisorption and ESCA, has been carried to provide insight into the role of manganese in both the Coprecipitated and Raney catalyst systems

  5. Synthesis of Al4SiC4 powders from kaolin grog, aluminum and carbon black by carbothermal reaction

    Science.gov (United States)

    Yuan, Wenjie; Yu, Chao; Deng, Chengji; Zhu, Hongxi

    2013-12-01

    In this paper, the synthesis of Al4SiC4 used as natural oxide materials by carbothermal reduction was investigated in order to explore the synthesis route with low costs. The samples were calcined by using kaolin grog, aluminum and carbon black as raw materials with the selected proportion at the temperature from 1500 to 1800 ° C for 2 hours under flow argon atmosphere. The phase composition of reaction products were determined by X-ray diffraction. The microstructure and elemental composition of different phases were observed and identified by scanning electron microscopy and energy dispersive spectroscopy. The mechanism of reaction processing was discussed. The results show that Al4SiC4 powders composed of hexagonal plate-like particulates with various sizes and the thickness of less than 20 μm are obtained when the temperature reaches 1800 °C.

  6. Synthesis of Al4SiC4 powders from kaolin grog, aluminum and carbon black by carbothermal reaction

    International Nuclear Information System (INIS)

    Yuan, Wenjie; Yu, Chao; Deng, Chengji; Zhu, Hongxi

    2013-01-01

    In this paper, the synthesis of Al 4 SiC 4 used as natural oxide materials by carbothermal reduction was investigated in order to explore the synthesis route with low costs. The samples were calcined by using kaolin grog, aluminum and carbon black as raw materials with the selected proportion at the temperature from 1500 to 1800 ° C for 2 hours under flow argon atmosphere. The phase composition of reaction products were determined by X-ray diffraction. The microstructure and elemental composition of different phases were observed and identified by scanning electron microscopy and energy dispersive spectroscopy. The mechanism of reaction processing was discussed. The results show that Al 4 SiC 4 powders composed of hexagonal plate-like particulates with various sizes and the thickness of less than 20 μm are obtained when the temperature reaches 1800 °C

  7. Phenotypical and biochemical characterisation of resistance for parasitic weed (Orobanche foetida Poir.) in radiation-mutagenised mutants of chickpea.

    Science.gov (United States)

    Brahmi, Ines; Mabrouk, Yassine; Brun, Guillaume; Delavault, Philippe; Belhadj, Omrane; Simier, Philippe

    2016-12-01

    Some radiation-mutagenised chickpea mutants potentially resistant to the broomrape, Orobanche foetida Poir., were selected through field trials. The objectives of this work were to confirm resistance under artificial infestation, in pots and mini-rhizotron systems, and to determine the developmental stages of broomrape affected by resistance and the relevant resistance mechanisms induced by radiation mutagenesis. Among 30 mutants tested for resistance to O. foetida, five shared strong resistance in both pot experiments and mini-rhizotron systems. Resistance was not complete, but the few individuals that escaped resistance displayed high disorders of shoot development. Results demonstrated a 2-3-fold decrease in stimulatory activity of root exudates towards broomrape seed germination in resistant mutants in comparison with non-irradiated control plants and susceptible mutants. Resistance was associated with an induction of broomrape necrosis early during infection. When infested, most of the resistant mutants shared enhanced levels of soluble phenolic contents, phenylalanine ammonia lyase activity, guaiacol peroxidase activity and polyphenol oxidase activity, in addition to glutathione and notably ascorbate peroxidase gene expression in roots. Results confirmed enhanced resistance in chickpea radiation-mutagenised mutants, and demonstrated that resistance is based on alteration of root exudation, presumed cell-wall reinforcement and change in root oxidative status in response to infection. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  8. MASTR: A Technique for Mosaic Mutant Analysis with Spatial and Temporal Control of Recombination Using Conditional Floxed Alleles in Mice

    Directory of Open Access Journals (Sweden)

    Zhimin Lao

    2012-08-01

    Full Text Available Mosaic mutant analysis, the study of cellular defects in scattered mutant cells in a wild-type environment, is a powerful approach for identifying critical functions of genes and has been applied extensively to invertebrate model organisms. A highly versatile technique has been developed in mouse: MASTR (mosaic mutant analysis with spatial and temporal control of recombination, which utilizes the increasing number of floxed alleles and simultaneously combines conditional gene mutagenesis and cell marking for fate analysis. A targeted allele (R26MASTR was engineered; the allele expresses a GFPcre fusion protein following FLP-mediated recombination, which serves the dual function of deleting floxed alleles and marking mutant cells with GFP. Within 24 hr of tamoxifen administration to R26MASTR mice carrying an inducible FlpoER transgene and a floxed allele, nearly all GFP-expressing cells have a mutant allele. The fate of single cells lacking FGF8 or SHH signaling in the developing hindbrain was analyzed using MASTR, and it was revealed that there is only a short time window when neural progenitors require FGFR1 for viability and that granule cell precursors differentiate rapidly when SMO is lost. MASTR is a powerful tool that provides cell-type-specific (spatial and temporal marking of mosaic mutant cells and is broadly applicable to developmental, cancer, and adult stem cell studies.

  9. Expansión y recambio foliar de gramíneas perennes C4 creciendo a temperaturas moderadamente bajas

    OpenAIRE

    Berone, Germán D.

    2016-01-01

    Understanding the mechanisms by which some C4 grasses grow more than others at moderately low temperatures (~12-20°C) is valuable to select materials to lengthen the growing season. In turn, the determination of leaf lifespan for each material to be used is relevant to optimize the balance between herbage production and herbage utilization. The objectives of this study were to analyze the growth capacity and the leaf lifespan in two native mat...

  10. Enhancement of growth, photosynthetic performance and yield by exclusion of ambient UV components in C3 and C4 plants.

    Science.gov (United States)

    Kataria, Sunita; Guruprasad, K N; Ahuja, Sumedha; Singh, Bupinder

    2013-10-05

    A field experiment was conducted under tropical climate for assessing the effect of ambient UV-B and UV-A by exclusion of UV components on the growth, photosynthetic performance and yield of C3 (cotton, wheat) and C4 (amaranthus, sorghum) plants. The plants were grown in specially designed UV exclusion chambers, wrapped with filters that excluded UV-B (plant species responded to UV exclusion by a significant increase in plant height, leaf area, leaf biomass, total biomass accumulation and yield. Measurements of the chlorophyll, chlorophyll fluorescence parameters, gas exchange parameters and the activity of Ribulose-1,5-bisphosphate carboxylase (Rubisco) by fixation of (14)CO2 indicated a direct relationship between enhanced rate of photosynthesis and yield of the plants. Quantum yield of electron transport was enhanced by the exclusion of UV indicating better utilization of PAR assimilation and enhancement in reducing power in all the four plant species. Exclusion of UV-B in particular significantly enhanced the net photosynthetic rate, stomatal conductance and activity of Rubisco. Additional fixation of carbon due to exclusion of ambient UV-B was channeled towards yield as there was a decrease in the level of UV-B absorbing substances and an increase in soluble proteins in all the four plant species. The magnitude of the promotion in all the parameters studied was higher in dicots (cotton, amaranthus) compared to monocots (wheat, sorghum) after UV exclusion. The results indicated a suppressive action of ambient UV-B on growth and photosynthesis; dicots were more sensitive than monocots in this suppression while no great difference in sensitivity was found between C3 and C4 plants. Experiments indicated the suppressive action of ambient UV on carbon fixation and yield of C3 and C4 plants. Exclusion of solar UV-B will have agricultural benefits in both C3 and C4 plants under tropical climate. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Generation of baryon excess in SUsub(L)(2) x SUsub(R)(2) x SUsub(c)(4)

    International Nuclear Information System (INIS)

    Deo, B.B.; Prasad, V.B.

    1980-08-01

    We have calculated the magnitude of the cosmological baryon asymmetry in a gauge theory based on the group SUsub(L)(2) x SUsub(R)(2) x SUsub(c)(4) and find that plausible parameters exist in the model to explain the baryon excess with a subunifying mass scale of 10 4 -10 5 GeV. The novel idea used is that the vacuum eats away antimatter through the VEV of the Higgs meson. (author)

  12. Coherent Structure in Solar Wind C$^{6+}$/C$^{4+}$ Ionic Composition Data During the Quiet-Sun Conditions of 2008

    OpenAIRE

    Edmondson, J. K.; Lynch, B. J.; Lepri, S. T.; Zurbuchen, T. H.

    2013-01-01

    This analysis offers evidence of characteristic scale sizes in solar wind charge state data measured in-situ for thirteen quiet-sun Carrington rotations in 2008. Using a previously established novel methodology, we analyze the wavelet power spectrum of the charge state ratio C$^{6+}$/C$^{4+}$ measured in-situ by ACE/SWICS for 2-hour and 12-minute cadence. We construct a statistical significance level in the wavelet power spectrum to quantify the interference effects arising from filling missi...

  13. Performance of a C4F8O gas radiator ring imaging Cherenkov detector using multi-anode photomultiplier tubes

    International Nuclear Information System (INIS)

    Artuso, M.; Boulahouache, C.; Blusk, S.; Butt, J.; Dorjkhaidav, O.; Menaa, N.; Mountain, R.; Muramatsu, H.; Nandakumar, R.; Randrianarivony, K.; Sia, R.; Skwarnicki, T.; Stone, S.; Wang, J.C.; Zhang, K.

    2006-01-01

    We report on tests of a novel ring imaging Cherenkov (RICH) detection system consisting of a 3-m-long gaseous C 4 F 8 O radiator, a focusing mirror, and a photon detector array based on Hamamatsu multi-anode photomultiplier tubes. This system was developed to identify charged particles in the momentum range from 3 to 70GeV/c for the BTeV experiment

  14. Anisotropy and polarization in charge changing collisions of C4+ with Na(3s) and laser aligned Na(3p)

    NARCIS (Netherlands)

    Hoekstra, R; Morgenstern, R; Olson, RE

    1996-01-01

    Absolute cross sections for C3+(6-->5) emission at 465.7 nm after collisions of C4+ ions with ground state Na(3s) and laser excited aligned Na(Sp) atoms are measured over the collision energy range of 3-7 keV amu(-1). For Na(3s) polarizations are observed by measuring the linear polarization of the

  15. Topographic processing in developmental prosopagnosia

    DEFF Research Database (Denmark)

    Klargaard, Solja K.; Starrfelt, Randi; Petersen, Anders

    2016-01-01

    deficit in visual processing or visual short-term memory. Interestingly, a classical dissociation could be demonstrated between impaired face memory and preserved topographic memory in two developmental prosopagnosics. We conclude that impairments in topographic memory tend to co-occur with developmental......Anecdotal evidence suggests a relation between impaired spatial (navigational) processing and developmental prosopagnosia. To address this formally, we tested two aspects of topographic processing – that is, perception and memory of mountain landscapes shown from different viewpoints. Participants...

  16. DEVELOPMENTAL TAXONOMY OF CONDUCT DISORDER

    OpenAIRE

    Jelena Kostić; Milkica Nešić; Jasminka Marković; Miodrag Stanković

    2015-01-01

    Conduct disorder is a heterogeneous disorder in terms of etiology, course and prognosis, and currently, there is no singular model that would describe the development of the disorder. The results of empirical research on males confirm this heterogeneity, as they point out to two possible developmental pathways: childhood-onset and adolescentonset type. This paper presents the basic elements of developmental taxonomic theory which argues that there are two different developmental pathways to c...

  17. Chloroplast Dysfunction Causes Multiple Defects in Cell Cycle Progression in the Arabidopsis crumpled leaf Mutant

    KAUST Repository

    Hudik, Elodie

    2014-07-18

    The majority of research on cell cycle regulation is focused on the nuclear events that govern the replication and segregation of the genome between the two daughter cells. However, eukaryotic cells contain several compartmentalized organelles with specialized functions, and coordination among these organelles is required for proper cell cycle progression, as evidenced by the isolation of several mutants in which both organelle function and overall plant development were affected. To investigate how chloroplast dysfunction affects the cell cycle, we analyzed the crumpled leaf (crl) mutant of Arabidopsis (Arabidopsis thaliana), which is deficient for a chloroplastic protein and displays particularly severe developmental defects. In the crl mutant, we reveal that cell cycle regulation is altered drastically and that meristematic cells prematurely enter differentiation, leading to reduced plant stature and early endoreduplication in the leaves. This response is due to the repression of several key cell cycle regulators as well as constitutive activation of stress-response genes, among them the cell cycle inhibitor SIAMESE-RELATED5. One unique feature of the crl mutant is that it produces aplastidic cells in several organs, including the root tip. By investigating the consequence of the absence of plastids on cell cycle progression, we showed that nuclear DNA replication occurs in aplastidic cells in the root tip, which opens future research prospects regarding the dialogue between plastids and the nucleus during cell cycle regulation in higher plants.

  18. Primary Cilia in the Murine Cerebellum and in Mutant Models of Medulloblastoma.

    Science.gov (United States)

    Di Pietro, Chiara; Marazziti, Daniela; La Sala, Gina; Abbaszadeh, Zeinab; Golini, Elisabetta; Matteoni, Rafaele; Tocchini-Valentini, Glauco P

    2017-01-01

    Cellular primary cilia crucially sense and transduce extracellular physicochemical stimuli. Cilium-mediated developmental signaling is tissue and cell type specific. Primary cilia are required for cerebellar differentiation and sonic hedgehog (Shh)-dependent proliferation of neuronal granule precursors. The mammalian G-protein-coupled receptor 37-like 1 is specifically expressed in cerebellar Bergmann glia astrocytes and participates in regulating postnatal cerebellar granule neuron proliferation/differentiation and Bergmann glia and Purkinje neuron maturation. The mouse receptor protein interacts with the patched 1 component of the cilium-associated Shh receptor complex. Mice heterozygous for patched homolog 1 mutations, like heterozygous patched 1 humans, have a higher incidence of Shh subgroup medulloblastoma (MB) and other tumors. Cerebellar cells bearing primary cilia were identified during postnatal development and in adulthood in two mouse strains with altered Shh signaling: a G-protein-coupled receptor 37-like 1 null mutant and an MB-susceptible, heterozygous patched homolog 1 mutant. In addition to granule and Purkinje neurons, primary cilia were also expressed by Bergmann glia astrocytes in both wild-type and mutant animals, from birth to adulthood. Variations in ciliary number and length were related to the different levels of neuronal and glial cell proliferation and maturation, during postnatal cerebellar development. Primary cilia were also detected in pre-neoplastic MB lesions in heterozygous patched homolog 1 mutant mice and they could represent specific markers for the development and analysis of novel cerebellar oncogenic models.

  19. Cell size and cell number in dwarf mutants of barley (Hordeum vulgare)

    International Nuclear Information System (INIS)

    Blonstein, A.D.; Gale, M.D.

    1984-01-01

    Sixteen height mutants, induced by sodium azide treatment of the two-rowed barley variety Proctor, have been used to investigate the relationship between the extent and nature of stem shortening with alterations in cell size and cell number, and the pleiotropic effects of dwarfing genes on vegetative development and agronomic performance. The studies on epidermal cell number and cell length in the developmentally earliest and latest elongated vegetative tissues - the coleoptile and peduncle resprectively - suggest that cell number may be the primary determinant of plant height. One semi-prostrate and one erectoides mutant are used to illustrate different cell number/cell size strategies and their relationships with gibberellin sensitivity, growth rate and lodging resistance are discussed. (author)

  20. Mesophyll conductance in Zea mays responds transiently to CO2 availability: implications for transpiration efficiency in C4 crops.

    Science.gov (United States)

    Kolbe, Allison R; Cousins, Asaph B

    2018-03-01

    Mesophyll conductance (g m ) describes the movement of CO 2 from the intercellular air spaces below the stomata to the site of initial carboxylation in the mesophyll. In contrast with C 3 -g m , little is currently known about the intraspecific variation in C 4 -g m or its responsiveness to environmental stimuli. To address these questions, g m was measured on five maize (Zea mays) lines in response to CO 2 , employing three different estimates of g m . Each of the methods indicated a significant response of g m to CO 2 . Estimates of g m were similar between methods at ambient and higher CO 2 , but diverged significantly at low partial pressures of CO 2 . These differences are probably driven by incomplete chemical and isotopic equilibrium between CO 2 and bicarbonate under these conditions. Carbonic anhydrase and phosphoenolpyruvate carboxylase in vitro activity varied significantly despite similar values of g m and leaf anatomical traits. These results provide strong support for a CO 2 response of g m in Z. mays, and indicate that g m in maize is probably driven by anatomical constraints rather than by biochemical limitations. The CO 2 response of g m indicates a potential role for facilitated diffusion in C 4 -g m . These results also suggest that water-use efficiency could be enhanced in C 4 species by targeting g m . © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  1. Classication of Status of the Region on Java Island using C4.5, CHAID, and CART Methods

    Science.gov (United States)

    Syaraswati, R. A.; Slamet, I.; Winarno, B.

    2017-06-01

    The indicator of region economic success can be measured by economic growth, presented by value of Gross Regional Domestic Product (GRDP). Java island has the biggest GDP contribution toward the Indonesian government, but not all of the region gives equality contribution. The C4.5, CHAID, and CART methods can be used for classifying the status of the region with nonparametric approach. The C4.5 and CHAID methods are non-binary decision tree, meanwhile the CART methods is binary decision tree. The purposes of this paper are to know how the classification and to determine the factors that influence on classification of the region. The dependent variable is status of the region which is divided into four categories based on Klassen typology. The result shows factors that have the biggest contribution on classification of status of the region on Java island based on C4.5 method are economic growth rate, electricity, gas, and water sector, and area. The factors that have the biggest contribution based on CHAID method are growth rate, manufacturing sector, and electricity, gas, and water sector, while based on CART method are growth rate, manufacturing sector, and electricity, gas, and water sector.

  2. Feasibility of robotic exoskeleton ambulation in a C4 person with incomplete spinal cord injury: a case report.

    Science.gov (United States)

    Lester, Robert M; Gorgey, Ashraf S

    2018-01-01

    To determine whether an individual with C4 incomplete spinal cord injury (SCI) with limited hand functions can effectively operate a powered exoskeleton (Ekso) to improve parameters of physical activity as determined by swing-time, up-time, walk-time, and total number of steps. A 21-year-old male with incomplete chronic (>1 year postinjury) SCI C4, participated in a clinical exoskeleton program to determine the feasibility of standing up and walking with limited hand functions. The participant was invited to attend 3 sessions including fitting, familiarization and gait training separated by one week intervals. Walk-time, up-time and total number of steps were measured during each training session. A complete body composition assessment using dual-energy X-ray absorptiometry (DXA) of the spine, knees and hips was conducted before training.Using a platform walker and cuffing both hands, the participant managed to stand up and ambulate successfully using exoskeleton. Over the course of 2 weeks, maximum walk-time increased from 7 to 17 min and number of steps increased from 83 to 589 steps. The total up-time increased from 19 to 31 min. Exoskeleton training may be a safe and feasible approach for persons with higher levels of SCI after effectively providing a supportive assistive device for weight shifting. The current case study demonstrates the use of a powered exoskeleton for an individual with high level tetraplegia (C4 and above) and limited hand functions.

  3. C3 and C4 biomass allocation responses to elevated CO2 and nitrogen: contrasting resource capture strategies

    Science.gov (United States)

    White, K.P.; Langley, J.A.; Cahoon, D.R.; Megonigal, J.P.

    2012-01-01

    Plants alter biomass allocation to optimize resource capture. Plant strategy for resource capture may have important implications in intertidal marshes, where soil nitrogen (N) levels and atmospheric carbon dioxide (CO2) are changing. We conducted a factorial manipulation of atmospheric CO2 (ambient and ambient + 340 ppm) and soil N (ambient and ambient + 25 g m-2 year-1) in an intertidal marsh composed of common North Atlantic C3 and C4 species. Estimation of C3 stem turnover was used to adjust aboveground C3 productivity, and fine root productivity was partitioned into C3-C4 functional groups by isotopic analysis. The results suggest that the plants follow resource capture theory. The C3 species increased aboveground productivity under the added N and elevated CO2 treatment (P 2 alone. C3 fine root production decreased with added N (P 2 (P = 0.0481). The C4 species increased growth under high N availability both above- and belowground, but that stimulation was diminished under elevated CO2. The results suggest that the marsh vegetation allocates biomass according to resource capture at the individual plant level rather than for optimal ecosystem viability in regards to biomass influence over the processes that maintain soil surface elevation in equilibrium with sea level.

  4. KLASIFIKASI CITRA PORNO DENGAN ALGORITMA C 4.5 BERBASIS MODEL WARNA YCbCr DAN SHAPE DETECTOR

    Directory of Open Access Journals (Sweden)

    Erwin Rizki Ariyanto

    2016-06-01

    Full Text Available Konten internet dapat berupa pornografi atau jebakan pornografi dengan tujuankorban anak di bawah umur. Tahun 2010 sebesar 97% remaja pernah mengaksescontent pronografi, dimana hal terebut berpengaruh negatif terhadap perkembangananak dan remaja. Dengan demikian akses terhadap pornografi oleh anak perlu dijaga.Beberapa penelitian telah menghasilkan aplikasi pendeteksi pornografi denganberbagai metode, seperti model warna YCbCr, shape descriptor yang saling mandiri.Dalam tulisan ini kami menyajikan klasifikasi citra porno dengan menggunakanalgoritma C 4.5 dan Shape descriptor berbasis model warna YCbCr. Klasifikasi denganC 4.5 merupakan tambahan metode perbaikan pada Shape Descriptor dan model warnaYCbCr dan di harapkan dapat secara presisi mengklasifikasikan citra porno dan bukan.Hasil dari percobaan terhadap 40 citra 8 bit dengan dimensi 256X256 yang terbagimenjadi citra porno, berbikini, mug shots dan non-porno, metode di atas dapatmengklasifikasikan True Positives (TP 16, False Positives (FP 10, False Negatives (FN 4,True Negatives (TN 10 dengan akurasi 65%, error rate 35%, precision 0,615, recall 0,8 sertanilai Root Mean Squared Error (RMSE 0,59.Semakin banyak data training semakin akurathasil dari testingnya, walaupun dalam beberapa kasus metode di atas belum akurat danhanya mengenail 3 dari 10 citra mug shots atau sebesar 43%.Kata Kunci: c 4.5, shape descriptor, model warna ycbcr, citra pornografi

  5. Atomic-scale microstructures of Zr2Al3C4 and Zr3Al3C5 ceramics

    International Nuclear Information System (INIS)

    Lin, Z.J.; Zhuo, M.J.; He, L.F.; Zhou, Y.C.; Li, M.S.; Wang, J.Y.

    2006-01-01

    The microstructures of bulk Zr 2 Al 3 C 4 and Zr 3 Al 3 C 5 ceramics have been investigated using transmission electron microscopy and scanning transmission electron microscopy. These two carbides were determined to have a point group 6/mmm and a space group P6 3 /mmc using selected-area electron diffraction and convergent beam electron diffraction. The atomic-scale microstructures of Zr 2 Al 3 C 4 and Zr 3 Al 3 C 5 were investigated through high-resolution imaging and Z-contrast imaging. Furthermore, intergrowth between Zr 2 Al 3 C 4 and Zr 3 Al 3 C 5 was identified. Stacking faults in Zr 3 Al 3 C 5 were found to result from the insertion of an additional Zr-C layer. Cubic ZrC was occasionally identified to be incorporated in elongated Zr 3 Al 3 C 5 grains. In addition, Al may induce a twinned ZrC structure and lead to the formation of ternary zirconium aluminum carbides

  6. Developmental plasticity: Friend or foe?

    Science.gov (United States)

    Michels, Karin B

    2017-01-01

    Developmental plasticity - the concept that adaptation to changing and unfavorable environmental conditions are possible but may come at the price of compromised health potentials - has evolutionary grounding as it facilitates survival but dissents with fundamental evolutionary principles in that it may advance the lesser fit. It is an important cornerstone of the Developmental Origins of Health and Disease (DOHaD). Unlike evolutionary adaptation developmental plasticity may be short-lived and restricted to one or few generations and inheritance is uncertain. Potential mechanisms include epigenetic modifications adopted in utero which may not transmit to the next generation; future insights may allow adjustments of the outcomes of developmental plasticity.

  7. Qualitative methodology in developmental psychology

    DEFF Research Database (Denmark)

    Demuth, Carolin; Mey, Günter

    2015-01-01

    Qualitative methodology presently is gaining increasing recognition in developmental psychology. Although the founders of developmental psychology to a large extent already used qualitative procedures, the field was long dominated by a (post) positivistic quantitative paradigm. The increasing rec...... in qualitative research offers a promising avenue to advance the field in this direction.......Qualitative methodology presently is gaining increasing recognition in developmental psychology. Although the founders of developmental psychology to a large extent already used qualitative procedures, the field was long dominated by a (post) positivistic quantitative paradigm. The increasing...

  8. Building a developmental toxicity ontology.

    Science.gov (United States)

    Baker, Nancy; Boobis, Alan; Burgoon, Lyle; Carney, Edward; Currie, Richard; Fritsche, Ellen; Knudsen, Thomas; Laffont, Madeleine; Piersma, Aldert H; Poole, Alan; Schneider, Steffen; Daston, George

    2018-04-03

    As more information is generated about modes of action for developmental toxicity and more data are generated using high-throughput and high-content technologies, it is becoming necessary to organize that information. This report discussed the need for a systematic representation of knowledge about developmental toxicity (i.e., an ontology) and proposes a method to build one based on knowledge of developmental biology and mode of action/ adverse outcome pathways in developmental toxicity. This report is the result of a consensus working group developing a plan to create an ontology for developmental toxicity that spans multiple levels of biological organization. This report provide a description of some of the challenges in building a developmental toxicity ontology and outlines a proposed methodology to meet those challenges. As the ontology is built on currently available web-based resources, a review of these resources is provided. Case studies on one of the most well-understood morphogens and developmental toxicants, retinoic acid, are presented as examples of how such an ontology might be developed. This report outlines an approach to construct a developmental toxicity ontology. Such an ontology will facilitate computer-based prediction of substances likely to induce human developmental toxicity. © 2018 Wiley Periodicals, Inc.

  9. Developmental immunotoxicology of lead

    International Nuclear Information System (INIS)

    Dietert, Rodney R.; Lee, Ji-Eun; Hussain, Irshad; Piepenbrink, Michael

    2004-01-01

    The heavy metal, lead, is a known developmental immunotoxicant that has been shown to produce immune alterations in humans as well as other species. Unlike many compounds that exert adverse immune effects, lead exposure at low to moderate levels does not produce widespread loss of immune cells. In contrast, changes resulting from lead exposure are subtle at the immune cell population level but, nevertheless, can be functionally dramatic. A hallmark of lead-induced immunotoxicity is a pronounced shift in the balance in T helper cell function toward T helper 2 responses at the expense of T helper 1 functions. This bias alters the nature and range of immune responses that can be produced thereby influencing host susceptibility to various diseases. Immunotoxic responses to lead appear to differ across life stages not only quantitatively with regard to dose response, but also qualitatively in terms of the spectrum of immune alterations. Experimental studies in several lab animal species suggest the latter stages of gestation are a period of considerable sensitivity for lead-induced immunotoxicity. This review describes the basic characteristics of lead-induced immunotoxicity emphasizing experimental animal results. It also provides a framework for the consideration of toxicant exposure effects across life stages. The existence of and probable basis for developmental windows of immune hyper-susceptibility are presented. Finally, the potential for lead to serve as a perinatal risk factor for childhood asthma as well as other diseases is considered

  10. The research progress on plant mutant germplasm resources in China

    International Nuclear Information System (INIS)

    He Cexi; Ji Linzhen; Zhao Shirong

    1991-07-01

    Mutants induced by nuclear radiation or other mutagens are new artificial germplasm resources. Some mutants have been applied in plant breeding and great achievements have been reached. The status and progress on the collection, identification and utilization of mutants in China are introduced. A proposal for developing mutant germplasm resources with good agronomic characters is suggested

  11. I. DEVELOPMENTAL METHODOLOGY AS A CENTRAL SUBDISCIPLINE OF DEVELOPMENTAL SCIENCE.

    Science.gov (United States)

    Card, Noel A

    2017-06-01

    This first chapter introduces the main goals of the monograph and previews the remaining chapters. The goals of this monograph are to provide summaries of our current understanding of advanced developmental methodologies, provide information that can advance our understanding of human development, identify shortcomings in our understanding of developmental methodology, and serve as a flagpost for organizing developmental methodology as a subdiscipline within the broader field of developmental science. The remaining chapters in this monograph address issues in design (sampling and big data), longitudinal data analysis, and issues of replication and research accumulation. The final chapter describes the history of developmental methodology, considers how the previous chapters in this monograph fit within this subdiscipline, and offers recommendations for further advancement. © 2017 The Society for Research in Child Development, Inc.

  12. Constructivist developmental theory is needed in developmental neuroscience

    Science.gov (United States)

    Arsalidou, Marie; Pascual-Leone, Juan

    2016-12-01

    Neuroscience techniques provide an open window previously unavailable to the origin of thoughts and actions in children. Developmental cognitive neuroscience is booming, and knowledge from human brain mapping is finding its way into education and pediatric practice. Promises of application in developmental cognitive neuroscience rests however on better theory-guided data interpretation. Massive amounts of neuroimaging data from children are being processed, yet published studies often do not frame their work within developmental models—in detriment, we believe, to progress in this field. Here we describe some core challenges in interpreting the data from developmental cognitive neuroscience, and advocate the use of constructivist developmental theories of human cognition with a neuroscience interpretation.

  13. Heavy and light beer: a carbon isotope approach to detect C(4) carbon in beers of different origins, styles, and prices.

    Science.gov (United States)

    Brooks, J Renée; Buchmann, Nina; Phillips, Sue; Ehleringer, Bruce; Evans, R David; Lott, Mike; Martinelli, Luiz A; Pockman, William T; Sandquist, Darren; Sparks, Jed P; Sperry, Lynda; Williams, Dave; Ehleringer, James R

    2002-10-23

    The carbon isotope ratios (delta(13)C) of 160 beers from around the world ranged from -27.3 to -14.9 per thousand, primarily due to variation in the percentage of C(3) or C(4) plant carbon in the final product. Thirty-one percent of beers had a carbon signature of C(3) plants (barley, rice, etc.), whereas the remaining 69% contained some C(3)-C(4) mixture (mean of mixtures, 39 +/- 11% C(4) carbon). Use of C(4) carbon (corn, cane sugar, etc.) was not confined to beers from any particular region (Pacific Rim, Mexico, Brazil, Europe, Canada, and the United States). However, the delta(13)C of European beers indicated mostly C(3) plant carbon. In contrast, U.S. and Canadian beers contained either only C(3) or C(3)-C(4) mixtures; Brazilian, Mexican, and Pacific Rim beers were mostly C(3)-C(4) mixtures. Among different lagers, U.S.-style lagers generally contained more C(4) carbon than did imported pilsners. Among different ales, those brewed by large high-production breweries contained significant proportions of C(4) carbon, while C(4) carbon was not detected in microbrewery or home-brew ales. Furthermore, inexpensive beers generally contained more C(4) carbon than expensive beers.

  14. Bacterio-opsin mutants of Halobacterium halobium

    Science.gov (United States)

    Betlach, Mary; Pfeifer, Felicitas; Friedman, James; Boyer, Herbert W.

    1983-01-01

    The bacterio-opsin (bop) gene of Halobacterium halobium R1 has been cloned with about 40 kilobases of flanking genomic sequence. The 40-kilobase segment is derived from the (G+C)-rich fraction of the chromosome and is not homologous to the major (pHH1) or minor endogenous covalently closed circular DNA species of H. halobium. A 5.1-kilobase Pst I fragment containing the bop gene was subcloned in pBR322 and a partial restriction map was determined. Defined restriction fragments of this clone were used as probes to analyze the defects associated with the bop gene in 12 bacterio-opsin mutants. Eleven out of 12 of the mutants examined had inserts ranging from 350 to 3,000 base pairs either in the bop gene or up to 1,400 base pairs upstream. The positions of the inserts were localized to four regions in the 5.1-kilobase genomic fragment: within the gene (one mutant), in a region that overlaps the 5′ end of the gene (seven mutants), and in two different upstream regions (three mutants). Two revertants of the mutant with the most distal insert had an additional insert in the same region. The polar effects of these inserts are discussed in terms of inactivation of a regulatory gene or disruption of part of a coordinately expressed operon. Given the defined nature of the bop mRNA—i.e., it has a 5′ leader sequence of three ribonucleotides—these observations indicate that the bop mRNA might be processed from a large mRNA transcript. Images PMID:16593291

  15. Chlorophyll mutants in Phaseolus vulgaris (L.) Savi

    International Nuclear Information System (INIS)

    Svetleva, D.; Petkova, S.

    1991-01-01

    Three-year investigations were conducted on chlorophyll mutants of three type: viridissima, claroviridis, flavoviridis, viridocostata and xanthomarginata produced post gamma irradiation ( 60 Co, 8 krad, 280 rad/min). Cell division rate in spectrum and in quantity of induced aberrations was found to have no significant differences with the control. Chlorophyll mutations compared to the control are less developed and their productive characters are less manifested. Cell division rate and the quantity of induced aberrations have no relation to the elements of productivity in the mutants investigated. 3 tabs., 12 refs

  16. Developmentally Appropriate Peace Education Curricula

    Science.gov (United States)

    Lewsader, Joellen; Myers-Walls, Judith A.

    2017-01-01

    Peace education has been offered to children for decades, but those curricula have been only minimally guided by children's developmental stages and needs. In this article, the authors apply their research on children's developmental understanding of peace along with peace education principles and Vygotsky's sociocultural theory to present…

  17. Developmental Kindergarten Program Evaluation Report.

    Science.gov (United States)

    Blois, George T.; Cushing, Katherine S.

    The evaluation of the Developmental Kindergarten (DK) Program at the Harrison School District #2, Colorado Springs, Colorado, involved pre- and post-testing of student academic gains and interviewing of principals and teachers. The program aimed to provide developmentally appropriate activities for students believed to be "at risk" of…

  18. Developmental programming of happiness.

    Science.gov (United States)

    Schmidt, Louis A; Fortier, Paz; Lahat, Ayelet; Tang, Alva; Mathewson, Karen J; Saigal, Saroj; Boyle, Michael H; Van Lieshout, Ryan J

    2017-09-01

    Being born at an extremely low birth weight (ELBW; programming hypotheses. Interfacing prenatal programming and differential susceptibility hypotheses, we tested whether individuals with ELBW in different childhood rearing environments showed different attention biases to positive and negative facial emotions in adulthood. Using the oldest known, prospectively followed cohort of ELBW survivors, we found that relative to normal birth weight controls (NBW; >2,500 grams), ELBW survivors displayed the highest and lowest attention bias to happy faces at age 30-35, depending on whether their total family income at age 8 was relatively low (environmental match) or high (environmental mismatch), respectively. This bias to happy faces was associated with a reduced likelihood of emotional problems. Findings suggest that differential susceptibility to positive emotions may be prenatally programmed, with effects lasting into adulthood. We discuss implications for integrating prenatal programming and differential susceptibility hypotheses, and the developmental origins of postnatal plasticity and resilience. © 2017 Wiley Periodicals, Inc.

  19. Developmental colour agnosia.

    Science.gov (United States)

    van Zandvoort, Martine J E; Nijboer, Tanja C W; de Haan, Edward

    2007-08-01

    Colour agnosia concerns the inability to recognise colours despite intact colour perception, semantic memory for colour information, and colour naming. Patients with selective colour agnosia have been described and the deficit is associated with left hemisphere damage. Here we report a case study of a 43-year-old man who was referred to us with a stroke in his right cerebellar hemisphere. During the standard assessment it transpired that he was unable to name coloured patches. Detailed assessment of his colour processing showed that he suffers from a selective colour agnosia. As he claimed to have had this problem all his life, and the fact that the infratentorial infarct that he had incurred was in an area far away from the brain structures that are known to be involved in colour processing, we suggest that he is the first reported case of developmental colour agnosia.

  20. [Neurotransmission in developmental disorders].

    Science.gov (United States)

    Takeuchi, Yoshihiro

    2008-11-01

    Attention deficit/hyperactivity disorder (AD/HD) is a heterogeneous developmental disorder with an etiology that is not fully understood. AD/HD has been considered to occur due to a disturbance in cathecholaminergic neurotransmission, with particular emphasis on dopamine. The neurotransmission of dopamine in subcortical regions such as the basal ganglia and limbic areas is synaptic; on the other hand, dopamine neurotransmission in the frontal cortex is quite different, because there are very few dopamine transporters (DAT) in the frontal cortex that allow dopamine to diffuse away from the dopamine synapse ("volume transmission"). It is now clear that noradrenergic neurons play a key regulatory role in dopaminergic function in the frontal cortex. Furthermore, serotonergic neurons exert an inhibitory effect on midbrain dopamine cell bodies, and they have an influence on dopamine release in terminal regions. There is accumulating neurobiological evidence pointing toward a role of the serotonin system in AD/HD. The etiology of autism spectrum disorders (ASD) is still unclear, but information from genetics, neuropathology, brain imaging, and basic neuroscience has provided insights into the understanding of this developmental disorder. In addition to abnormal circuitry in specific limbic and neocortical areas of the cerebral cortex, impairments in brainstem, cerebellar, thalamic, and basal ganglia connections have been reported. Numerous studies have pointed to abnormalities in serotonin and glutamate neurotransmission. Three important aspects involved in the pathophysiology of ASD have been proposed. The first is cell migration, the second is unbalanced excitatory-inhibitory networks, and the third is synapse formation and pruning, the key factors being reelin, neurexin, and neuroligin. Serotonin is considered to play an important role in all of these aspects of the pathophysiology of ASD. Finally, I would like to emphasize that it is crucial in the field of child

  1. Altered expression of the urokinase receptor homologue, C4.4A, in invasive areas of human esophageal squamous cell carcinoma

    DEFF Research Database (Denmark)

    Hansen, L.V.; Laerum, O.D.; Illemann, M.

    2008-01-01

    . In the present study, we have therefore analyzed the expression of C4.4A in 14 esophageal squamous cell carcinomas (ESCC). Normal squamous esophageal epithelium shows a strong cell surface associated C4.4A expression in the suprabasal layers, whereas basal cells are negative. Upon transition to dysplasia...... and carcinoma in situ the expression of C4.4A is abruptly and coordinately weakened. Double immunofluorescence staining of normal and dysplastic tissue showed that C4.4A colocalizes with the epithelial cell surface marker E-cadherin in the suprabasal cells and has a complementary expression pattern compared...... to the proliferation marker Ki-67. A prominent, but frequently intracellular, C4.4A expression reappeared in tumor cells located at the invasive front and local lymph node metastases. Because C4.4A was reported previously to be a putative laminin-5 (LN5) ligand, and both proteins are expressed by invasive tumor cells...

  2. Transcriptional dysregulation in NIPBL and cohesin mutant human cells.

    Directory of Open Access Journals (Sweden)

    Jinglan Liu

    2009-05-01

    Full Text Available Cohesin regulates sister chromatid cohesion during the mitotic cell cycle with Nipped-B-Like (NIPBL facilitating its loading and unloading. In addition to this canonical role, cohesin has also been demonstrated to play a critical role in regulation of gene expression in nondividing cells. Heterozygous mutations in the cohesin regulator NIPBL or cohesin structural components SMC1A and SMC3 result in the multisystem developmental disorder Cornelia de Lange Syndrome (CdLS. Genome-wide assessment of transcription in 16 mutant cell lines from severely affected CdLS probands has identified a unique profile of dysregulated gene expression that was validated in an additional 101 samples and correlates with phenotypic severity. This profile could serve as a diagnostic and classification tool. Cohesin binding analysis demonstrates a preference for intergenic regions suggesting a cis-regulatory function mimicking that of a boundary/insulator interacting protein. However, the binding sites are enriched within the promoter regions of the dysregulated genes and are significantly decreased in CdLS proband, indicating an alternative role of cohesin as a transcription factor.

  3. Natural variation of model mutant phenotypes in Ciona intestinalis.

    Directory of Open Access Journals (Sweden)

    Paolo Sordino

    Full Text Available BACKGROUND: The study of ascidians (Chordata, Tunicata has made a considerable contribution to our understanding of the origin and evolution of basal chordates. To provide further information to support forward genetics in Ciona intestinalis, we used a combination of natural variation and neutral population genetics as an approach for the systematic identification of new mutations. In addition to the significance of developmental variation for phenotype-driven studies, this approach can encompass important implications in evolutionary and population biology. METHODOLOGY/PRINCIPAL FINDINGS: Here, we report a preliminary survey for naturally occurring mutations in three geographically interconnected populations of C. intestinalis. The influence of historical, geographical and environmental factors on the distribution of abnormal phenotypes was assessed by means of 12 microsatellites. We identified 37 possible mutant loci with stereotyped defects in embryonic development that segregate in a way typical of recessive alleles. Local populations were found to differ in genetic organization and frequency distribution of phenotypic classes. CONCLUSIONS/SIGNIFICANCE: Natural genetic polymorphism of C. intestinalis constitutes a valuable source of phenotypes for studying embryonic development in ascidians. Correlating genetic structure and the occurrence of abnormal phenotypes is a crucial focus for understanding the selective forces that shape natural finite populations, and may provide insights of great importance into the evolutionary mechanisms that generate animal diversity.

  4. Natural Variation of Model Mutant Phenotypes in Ciona intestinalis

    Science.gov (United States)

    Brown, Euan R.; Leccia, Nicola I.; Squarzoni, Paola; Tarallo, Raffaella; Alfano, Christian; Caputi, Luigi; D'Ambrosio, Palmira; Daniele, Paola; D'Aniello, Enrico; D'Aniello, Salvatore; Maiella, Sylvie; Miraglia, Valentina; Russo, Monia Teresa; Sorrenti, Gerarda; Branno, Margherita; Cariello, Lucio; Cirino, Paola; Locascio, Annamaria; Spagnuolo, Antonietta; Zanetti, Laura; Ristoratore, Filomena

    2008-01-01

    Background The study of ascidians (Chordata, Tunicata) has made a considerable contribution to our understanding of the origin and evolution of basal chordates. To provide further information to support forward genetics in Ciona intestinalis, we used a combination of natural variation and neutral population genetics as an approach for the systematic identification of new mutations. In addition to the significance of developmental variation for phenotype-driven studies, this approach can encompass important implications in evolutionary and population biology. Methodology/Principal Findings Here, we report a preliminary survey for naturally occurring mutations in three geographically interconnected populations of C. intestinalis. The influence of historical, geographical and environmental factors on the distribution of abnormal phenotypes was assessed by means of 12 microsatellites. We identified 37 possible mutant loci with stereotyped defects in embryonic development that segregate in a way typical of recessive alleles. Local populations were found to differ in genetic organization and frequency distribution of phenotypic classes. Conclusions/Significance Natural genetic polymorphism of C. intestinalis constitutes a valuable source of phenotypes for studying embryonic development in ascidians. Correlating genetic structure and the occurrence of abnormal phenotypes is a crucial focus for understanding the selective forces that shape natural finite populations, and may provide insights of great importance into the evolutionary mechanisms that generate animal diversity. PMID:18523552

  5. Producing Conditional Mutants for Studying Plant Microtubule Function

    Energy Technology Data Exchange (ETDEWEB)

    Richard Cyr

    2009-09-29

    The cytoskeleton, and in particular its microtubule component, participates in several processes that directly affect growth and development in higher plants. Normal cytoskeletal function requires the precise and orderly arrangement of microtubules into several cell cycle and developmentally specific arrays. One of these, the cortical array, is notable for its role in directing the deposition of cellulose (the most prominent polymer in the biosphere). An understanding of how these arrays form, and the molecular interactions that contribute to their function, is incomplete. To gain a better understanding of how microtubules work, we have been working to characterize mutants in critical cytoskeletal genes. This characterization is being carried out at the subcellular level using vital microtubule gene constructs. In the last year of funding colleagues have discovered that gamma-tubulin complexes form along the lengths of cortical microtubules where they act to spawn new microtubules at a characteristic 40 deg angle. This finding complements nicely the finding from our lab (which was funded by the DOE) showing that microtubule encounters are angle dependent; high angles encounters results in catastrophic collisions while low angle encounters result in favorable zippering. The finding of a 40 deg spawn of new microtubules from extant microtubule, together with aforementioned rules of encounters, insures favorable co-alignment in the array. I was invited to write a New and Views essay on this topic and a PDF is attached (News and Views policy does not permit funding acknowledgments and so I was not allowed to acknowledge support from the DOE).

  6. Structure, ferroelectric ordering, and semiempirical quantum calculations of lanthanide based metal-organic framework: [Nd(C4H5O6)(C4H4O6)][3H2O

    Science.gov (United States)

    Ahmad, Bhat Zahoor; Want, Basharat

    2016-04-01

    We investigate the structure and ferroelectric behavior of a lanthanide based metal-organic framework (MOF), [Nd(C4H5O6)(C4H4O6)][3H2O]. X-ray crystal structure analyses reveal that it crystallizes in the P41212 space group with Nd centres, coordinated by nine oxygen atoms, forming a distorted capped square antiprismatic geometry. The molecules, bridged by tartrate ligands, form a 2D chiral structure. The 2D sheets are further linked into a 3D porous framework via strong hydrogen-bonding scheme (O-H…O ≈ 2.113 Å). Dielectric studies reveal two anomalies at 295 K and 185 K. The former is a paraelectric-ferroelectric transition, and the later is attributed to the freezing down of the motion of the hydroxyl groups. The phase transition is of second order, and the spontaneous polarization in low temperature phase is attributed to the ordering of protons of hydroxyl groups. The dielectric nonlinearity parameters have been calculated using Landau- Devonshire phenomenological theory. In addition, the most recent semiempirical models, Sparkle/PM7, Sparkle/RM1, and Sparkle/AM1, are tested on the present system to assay the accuracy of semiempirical quantum approaches to predict the geometries of solid MOFs. Our results show that Sparkle/PM7 model is the most accurate to predict the unit cell structure and coordination polyhedron geometry. The semiempirical methods are also used to calculate different ground state molecular properties.

  7. From museums to genomics: old herbarium specimens shed light on a C3 to C4 transition.

    Science.gov (United States)

    Besnard, Guillaume; Christin, Pascal-Antoine; Malé, Pierre-Jean G; Lhuillier, Emeline; Lauzeral, Christine; Coissac, Eric; Vorontsova, Maria S

    2014-12-01

    Collections of specimens held by natural history museums are invaluable material for biodiversity inventory and evolutionary studies, with specimens accumulated over 300 years readily available for sampling. Unfortunately, most museum specimens yield low-quality DNA. Recent advances in sequencing technologies, so called next-generation sequencing, are revolutionizing phylogenetic investigations at a deep level. Here, the Illumina technology (HiSeq) was used on herbarium specimens of Sartidia (subfamily Aristidoideae, Poaceae), a small African-Malagasy grass lineage (six species) characteristic of wooded savannas, which is the C3 sister group of Stipagrostis, an important C4 genus from Africa and SW Asia. Complete chloroplast and nuclear ribosomal sequences were assembled for two Sartidia species, one of which (S. perrieri) is only known from a single specimen collected in Madagascar 100 years ago. Partial sequences of a few single-copy genes encoding phosphoenolpyruvate carboxylases (ppc) and malic enzymes (nadpme) were also assembled. Based on these data, the phylogenetic position of Malagasy Sartidia in the subfamily Aristidoideae was investigated and the biogeographical history of this genus was analysed with full species sampling. The evolutionary history of two genes for C4 photosynthesis (ppc-aL1b and nadpme-IV) in the group was also investigated. The gene encoding the C4 phosphoenolpyruvate caroxylase of Stipagrostis is absent from S. dewinteri suggesting that it is not essential in C3 members of the group, which might have favoured its recruitment into a new metabolic pathway. Altogether, the inclusion of historical museum specimens in phylogenomic analyses of biodiversity opens new avenues for evolutionary studies. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  8. Simulating the Impacts of Tree, C3, and C4 Plant Functional Types on the Future Climate of West Africa

    Directory of Open Access Journals (Sweden)

    Christiana Funmilola Olusegun

    2018-05-01

    Full Text Available This study investigates the future climatic impacts of different percentages of trees/shrubs, C4 and C3 plant functional types (PFTs over the West Africa region. The ratio of co-existence among the different PFTs was done as a representation of agri-silviculture practices over the region. Nine sensitivity experiments of different percentages of trees/shrubs, and C4 and C3 PFTs were carried out with a regional climate model (RegCM4 driven by Global Climate Model (HADGEM2-ES outputs. These experiments were carried out along the Guinea Savana zone of West Africa using both prescribed and dynamic vegetation options of the model. The model simulated the seasonal evolution of precipitation and temperature fields quite well, with correlations greater than 0.8, but exhibited cold and wet biases of about 1–2 °C and 1–4 mm/day, respectively. Widespread warming (1–3 °C and drying (1–2 mm/day is projected in the near future across most parts of West Africa all year round. The West African future climate change associated with the different percentages of trees/shrubs, and C4 and C3 PFTs varied with the vegetation state (prescribed or dynamic and model domain sizes. The prescribed vegetation experiments induced cooling of about 0.5–2 °C in most areas along the designated agri-silviculture zone, except Liberia and Sierra Leone. Similarly, enhanced precipitation occurred over most parts of Ghana and coastal parts of Nigeria (0.5–3 mm/day. On the other hand, the dynamic vegetation option did not exhibit pronounced changes in temperature and precipitation, except with a larger domain size. This study suggests the implementation of agri-silviculture as a mitigation and adaptation land-use practice across West Africa if drought-tolerant crops and the deciduous trees are adopted.

  9. Scale and the isotopic record of C4 plants in pedogenic carbonate: from the biome to the rhizospere.

    Energy Technology Data Exchange (ETDEWEB)

    Monger, Dr. H Curtis [New Mexico State University, Las Cruces; Cole, David R [ORNL; Buck, Dr. Brenda [University of Nevada, Las Vegas; Gallegos, Robert [Sant fe Water Division

    2009-01-01

    The 13C/12C ratio in pedogenic carbonate (i.e., CaCO3 formed in soil) is a significant tool for investigating C4 biomes of the past. However, the paleoecological meaning of d13C values in pedogenic carbonate can change with the scale at which one considers the data. We describe studies of modern soils, fossil soils, and vegetation change in the Chihuahuan Desert of North America and elsewhere that reveal four scales important for paleoecologic interpretations. (1) At the broadest scale, the biome scale (hundreds to millions of km2), an isotopic record interpreted as C3 vegetation replacing C4 grasslands may indicate invading C3 woody shrubs instead of expanding C3 forests (a common interpretation). (2) At the landscape scale (several tens of m2 to hundreds of km2), the accuracy of scaling up paleoclimatic interpretations to a regional level is affected by the landform containing the isotopic record. (3) At the soil-profile scale (cm2 to m2), soil profiles with multiple generations of carbonate mixed together have a lower-resolution paleoecologic record than soil profiles repeatedly buried. (4) At the rhizosphere scale (lm2 to cm2), carbonate formed on roots lack the 14 17 enrichment observed at broader scales, revealing different fractionation processes at different scales. A multi-scale approach in dealing with d13C in pedogenic carbonate will increase the accuracy of paleoecologic interpretations and understanding of soil geomorphic climatic interactions that affect boundaries between C4 and C3 vegetation.

  10. Scale and the isotopic record of C4 plants in pedogenic carbonate: from the biome to the rhizosphere

    Energy Technology Data Exchange (ETDEWEB)

    Monger, Dr. H Curtis [New Mexico State University, Las Cruces; Cole, David [Ohio State University; Buck, Dr. Brenda [University of Nevada, Las Vegas; Gallegos, Robert [Sant fe Water Division

    2009-01-01

    The 13C/12C ratio in pedogenic carbonate (i.e., CaCO3 formed in soil) is a significant tool for investigating C4 biomes of the past. However, the paleoecological meaning of d13C values in pedogenic carbonate can change with the scale at which one considers the data. We describe studies of modern soils, fossil soils, and vegetation change in the Chihuahuan Desert of North America and elsewhere that reveal four scales important for paleoecologic interpretations. (1) At the broadest scale, the biome scale (hundreds to millions of km2), an isotopic record interpreted as C3 vegetation replacing C4 grasslands may indicate invading C3 woody shrubs instead of expanding C3 forests (a common interpretation). (2) At the landscape scale (several tens of m2 to hundreds of km2), the accuracy of scaling up paleoclimatic interpretations to a regional level is affected by the landform containing the isotopic record. (3) At the soil-profile scale (cm2 to m2), soil profiles with multiple generations of carbonate mixed together have a lower-resolution paleoecologic record than soil profiles repeatedly buried. (4) At the rhizosphere scale (lm2 to cm2), carbonate formed on roots lack the 14 17 enrichment observed at broader scales, revealing different fractionation processes at different scales. A multi-scale approach in dealing with d13C in pedogenic carbonate will increase the accuracy of paleoecologic interpretations and understanding of soil geomorphic climatic interactions that affect boundaries between C4 and C3 vegetation.

  11. Growth of the C4 dicot Flaveria bidentis: photosynthetic acclimation to low light through shifts in leaf anatomy and biochemistry.

    Science.gov (United States)

    Pengelly, Jasper J L; Sirault, Xavier R R; Tazoe, Youshi; Evans, John R; Furbank, Robert T; von Caemmerer, Susanne

    2010-09-01

    In C(4) plants, acclimation to growth at low irradiance by means of anatomical and biochemical changes to leaf tissue is considered to be limited by the need for a close interaction and coordination between bundle sheath and mesophyll cells. Here differences in relative growth rate (RGR), gas exchange, carbon isotope discrimination, photosynthetic enzyme activity, and leaf anatomy in the C(4) dicot Flaveria bidentis grown at a low (LI; 150 micromol quanta m(2) s(-1)) and medium (MI; 500 micromol quanta m(2) s(-1)) irradiance and with a 12 h photoperiod over 36 d were examined. RGRs measured using a 3D non-destructive imaging technique were consistently higher in MI plants. Rates of CO(2) assimilation per leaf area measured at 1500 micromol quanta m(2) s(-1) were higher for MI than LI plants but did not differ on a mass basis. LI plants had lower Rubisco and phosphoenolpyruvate carboxylase activities and chlorophyll content on a leaf area basis. Bundle sheath leakiness of CO(2) (phi) calculated from real-time carbon isotope discrimination was similar for MI and LI plants at high irradiance. phi increased at lower irradiances, but more so in MI plants, reflecting acclimation to low growth irradiance. Leaf thickness and vein density were greater in MI plants, and mesophyll surface area exposed to intercellular airspace (S(m)) and bundle sheath surface area per unit leaf area (S(b)) measured from leaf cross-sections were also both significantly greater in MI compared with LI leaves. Both mesophyll and bundle sheath conductance to CO(2) diffusion were greater in MI compared with LI plants. Despite being a C(4) species, F. bidentis is very plastic with respect to growth irradiance.

  12. 40 CFR Table C-4 to Subpart C of... - Test Specifications for PM10, PM2.5 and PM10-2.5 Candidate Equivalent Methods

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 5 2010-07-01 2010-07-01 false Test Specifications for PM10, PM2.5 and PM10-2.5 Candidate Equivalent Methods C Table C-4 to Subpart C of Part 53 Protection of Environment... Pt. 53, Subpt. C, Table C-4 Table C-4 to Subpart C of Part 53—Test Specifications for PM10, PM2.5 and...

  13. Using SPIRAL (Single Pollen Isotope Ratio AnaLysis) to estimate C 3- and C 4-grass abundance in the paleorecord

    Science.gov (United States)

    Nelson, David M.; Hu, Feng Sheng; Scholes, Daniel R.; Joshi, Neeraj; Pearson, Ann

    2008-05-01

    C 3 and C 4 grasses differ greatly in their responses to environmental controls and influences on biogeochemical processes (e.g. water, carbon, and nutrient cycling). Difficulties in distinguishing between these two functional groups of grasses have hindered paleoecological studies of grass-dominated ecosystems. Stable carbon isotopic analysis of individual grains of grass pollen using a spooling-wire microcombustion device interfaced with an isotope-ratio mass spectrometer holds promise for improving C 3 and C 4 grass reconstructions. This technique, SPIRAL (Single Pollen Isotope Ratio AnaLysis), has only been evaluated using pollen of known C 3 and C 4 grasses. To test the ability of SPIRAL to reproduce the abundance of C 3 and C 4 grasses on the landscape, we measured δ13C values of > 1500 individual grains of grass pollen isolated from the surface sediments of ten lakes in areas that span a large gradient of C 3- and C 4-grass abundance, as determined from vegetation surveys. Results indicate a strong positive correlation between the δ13C-based estimates of % C 4-grass pollen and the abundance of C 4 grasses on the landscape. The % C 4-grass pollen slightly underestimates the actual abundance of C 4 grasses at sites with high proportions of C 4 grasses, which can be corrected using regression analysis. Comparison of the % C 4-grass pollen with C/N and δ13C measurements of bulk organic matter illustrates the distinct advantages of grass-pollen δ13C as a proxy for distinguishing C 3 and C 4 shifts within the grass family. Thus SPIRAL promises to advance our understanding of grassland ecology and evolution.

  14. The cross-neutralizing activity of enterovirus 71 subgenotype c4 vaccines in healthy chinese infants and children.

    Directory of Open Access Journals (Sweden)

    Qunying Mao

    Full Text Available EV71 is one of major etiologic causes of hand-foot-mouth disease (HFMD and leads to severe neurological complications in young children and infants. Recently inactivated EV71 vaccines have been developed by five manufactures and clinically show good safety and immunogenicity. However, the cross-neutralizing activity of these vaccines remains unclear, and is of particular interest because RNA recombination is seen more frequently in EV71 epidemics.In this post-hoc study, sera from a subset of 119 infants and children in two clinical trials of EV71 subgenotype C4 vaccines (ClinicalTrials.gov Identifier: NCT01313715 and NCT01273246, were detected for neutralizing antibody (NTAb titres with sera from infected patients as controls. Cytopathogenic effect method was employed to test NTAb against EV71 subgenotype B4, B5, C2, C4 and C5, which were prominent epidemic strains worldwide over the past decade. To validate the accuracy of the results, ELISpot assay was employed in parallel to detect NTAb in all the post-vaccine sera. After two-dose vaccination, 49 out of 53 participants in initially seronegative group and 52 out of 53 participants in initially seropositive group showed less than 4-fold differences in NTAb titers against five EV71 strains, whereas corresponding values among sera from pediatric patients recovering from EV71-induced HFMD and subclinically infected participants were 8/8 and 41/43, respectively. The geometric mean titers of participants against five subgenotypes EV71 all grew significantly after vaccinations, irrespective of the baseline NTAb titer. The relative fold increase in antibody titers (NTAb-FI against B4, B5, C2, and C5 displayed a positive correlation to the NTAb-FI against C4.The results demonstrated broad cross-neutralizing activity induced by two C4 EV71 vaccines in healthy Chinese infants and children. However, the degree of induced cross-protective immunity, and the potential escape evolution for EV71 still need to

  15. Ensayos para la estandarizacion de una técnica de fenotipificacion de C4 del complemento serico.

    Directory of Open Access Journals (Sweden)

    Liliana Yanet Suarez-Contreras

    2000-01-01

    Full Text Available As part of the genetic characterization of the Colombian population, the Institute of Human Genetics at the Javeriana University, has been conducting research on various polymorphisms serum proteins, such as proteins: Haptoglobins, phosphoglucomutase, component specific group, C3 (Sarmiento, P , 1993, Transferrin (Ortiz, R, 1993, enzymes critocitarias, membrane proteins and molecular markers (Bernal, J, 1989. As part of this process, in this study the technique of high voltage electrophoresis and C4 lnmunolijación allowing include this protein in population studies in Colombia was standardized.

  16. Characterization of guinea pig myocardial leukotriene C4 binding sites. Regulation by cations and sulfhydryl-directed reagents

    International Nuclear Information System (INIS)

    Hogaboom, G.K.; Mong, S.; Stadel, J.M.; Crooke, S.T.

    1985-01-01

    Using [ 3 H]leukotriene C4 (LTC4) and radioligand-binding techniques, specific leukotriene C4 binding sites have been identified in membranes derived from guinea pig ventricular myocardium. High performance liquid chromatography analyses indicated that, in the presence of the gamma-glutamyl transpeptidase inhibitor L-serine-borate (80 mM), less than 2% of membrane-bound [ 3 H]LTC4 was converted at 20 degrees to [ 3 H]leukotriene D4 or [ 3 H]leukotriene E4. The specific binding of 4 nM [ 3 H]LTC4, in the presence of 80 mM L-serine-borate, reached a stable steady state within 15 min at 20 degrees (pH 7.5). A monophasic Scatchard plot of saturation binding data yielded a dissociation constant (Kd) of 27.5 +/- 6.0 nM and a maximum number of binding sites (Bmax) of 19.9 +/- 5.2 pmol/mg of membrane protein. Competition binding studies of [ 3 H]LTC4 with synthetic leukotriene C4, leukotriene D4, and leukotriene E4 and the putative peptidoleukotriene antagonists FPL 55712, SKF 88046, and 4R-hydroxy-5S-1-cysteinylglycine-6Z-nonadecanoic acid revealed an order of potency of leukotriene C4 much greater than 4R-hydroxy-5S-1-cysteinylglycine-6Z-nonadecanoic acid greater than SKF 88046 greater than LTE4 greater than LTD4 greater than FPL 55712. The specific [ 3 H]LTC4 binding was stimulated by the divalent cations Ca2+, Mg2+, and Mn2+ and to a lesser degree by the monovalent cations Na+, K+, Li+, and NH4+. CaCl2 (3 mM) and NaCl (150 mM) stimulated the LTC4 binding by increasing the Bmax to 42.6 +/- 5.9 and 35.0 +/- 2.0 pmol/mg, respectively, but had minimal effects on Kd

  17. Synthesis of disodium [benzene-U-{sup 14}C]-(4-chlorophenylthio)methylenediphosphonate, [benzene-U-{sup 14}C]-tiludronate

    Energy Technology Data Exchange (ETDEWEB)

    Burgos, Alain; Ellames, G.J. [Alnwick Research Centre (United Kingdom). Dept. of Metabolism and Pharmacokinetics

    1995-12-31

    Disodium [benzene-U-{sup 14}C]-(4-chlorophenylithio)methylenediphosphonate, [benzene-{sup 14}C]-Tiludronate, 2, has been prepared in six steps from [benzene-U-{sup 14}C]-acetanilide in an overall radiochemical yield of 41%. A key step in this transformation was the efficient conversion of [U-{sup 14}C]-4-chloroaniline to [benzene-U-{sup 14}C]-4-chlorophenylthiocyanate, 5, in 83% yield by treatment of the corresponding diazonium salt, 9 with iron(111) thiocyanate. It should be noted that formation of the isomeric [benzene-U-{sup 14}C]-4-chlorophenylisothiocyanate, 11, as a byproduct, was observed in only {approx} 1% yield. (author).

  18. Human C4orf14 interacts with the mitochondrial nucleoid and is involved in the biogenesis of the small mitochondrial ribosomal subunit.

    Science.gov (United States)

    He, J; Cooper, H M; Reyes, A; Di Re, M; Kazak, L; Wood, S R; Mao, C C; Fearnley, I M; Walker, J E; Holt, I J

    2012-07-01

    The bacterial homologue of C4orf14, YqeH, has been linked to assembly of the small ribosomal subunit. Here, recombinant C4orf14 isolated from human cells, co-purified with the small, 28S subunit of the mitochondrial ribosome and the endogenous protein co-fractionated with the 28S subunit in sucrose gradients. Gene silencing of C4orf14 specifically affected components of the small subunit, leading to decreased protein synthesis in the organelle. The GTPase of C4orf14 was critical to its interaction with the 28S subunit, as was GTP. Therefore, we propose that C4orf14, with bound GTP, binds to components of the 28S subunit facilitating its assembly, and GTP hydrolysis acts as the release mechanism. C4orf14 was also found to be associated with human mitochondrial nucleoids, and C4orf14 gene silencing caused mitochondrial DNA depletion. In vitro C4orf14 is capable of binding to DNA. The association of C4orf14 with mitochondrial translation factors and the mitochondrial nucleoid suggests that the 28S subunit is assembled at the mitochondrial nucleoid, enabling the direct transfer of messenger RNA from the nucleoid to the ribosome in the organelle.

  19. Two solid-phase recycling method for basic ionic liquid [C4mim]Ac by macroporous resin and ion exchange resin from Schisandra chinensis fruits extract.

    Science.gov (United States)

    Ma, Chun-hui; Zu, Yuan-gang; Yang, Lei; Li, Jian

    2015-01-22

    In this study, two solid-phase recycling method for basic ionic liquid (IL) 1-butyl-3-methylimidazolium acetate ([C4mim]Ac) were studied through a digestion extraction system of extracting biphenyl cyclooctene lignans from Schisandra chinensis. The RP-HPLC detection method for [C4mim]Ac was established in order to investigate the recovery efficiency of IL. The recycling method of [C4mim]Ac is divided into two steps, the first step was the separation of lignans from the IL solution containing HPD 5000 macroporous resin, the recovery efficiency and purity of [C4mim]Ac achieved were 97.8% and 67.7%, respectively. This method cannot only separate the lignans from [C4mim]Ac solution, also improve the purity of lignans, the absorption rate of lignans in [C4mim]Ac solution was found to be higher (69.2%) than that in ethanol solution (57.7%). The second step was the purification of [C4mim]Ac by the SK1B strong acid ion exchange resin, an [C4mim]Ac recovery efficiency of 55.9% and the purity higher than 90% were achieved. Additionally, [C4mim]Ac as solvent extraction of lignans from S. chinensis was optimized, the hydrolysis temperature was 90°C and the hydrolysis time was 2h. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Ethanol production using engineered mutant E. coli

    Science.gov (United States)

    Ingram, Lonnie O.; Clark, David P.

    1991-01-01

    The subject invention concerns novel means and materials for producing ethanol as a fermentation product. Mutant E. coli are transformed with a gene coding for pyruvate decarboxylase activity. The resulting system is capable of producing relatively large amounts of ethanol from a variety of biomass sources.

  1. Molecular Genetic Identification Of Some Flax Mutants

    International Nuclear Information System (INIS)

    AMER, I.M.; MOUSTAFA, H.A.M.

    2009-01-01

    Five flax genotypes (Linum usitatissimum L.) i.e., commercial cultivar Sakha 2, the mother variety Giza 4 and three mutant types induced by gamma rays, were screened for their salinity tolerance in field experiments (salinity concentration was 8600 and 8300 ppm for soil and irrigation water, respectively). Mutation 6 was the most salt tolerant as compared to the other four genotypes.RAPD technique was used to detect some molecular markers associated with salt tolerance in flax (Mut 6), RAPD-PCR results using 12 random primers exhibited 149 amplified fragments; 91.9% of them were polymorphic and twelve molecular markers (8.1%) for salt tolerant (mutant 6) were identified with molecular size ranged from 191 to 4159 bp and only eight primers successes to amplify these specific markers. Concerning the other mutants, Mut 15 and Mut 25 exhibited 4.3% and 16.2% specific markers, respectively. The induced mutants exhibited genetic similarity to the parent variety were about 51%, 58.3% and 61.1% for Mut 25, Mut 6 and Mut 15, respectively. These specific markers (SM) are used for identification of the induced mutations and it is important for new variety registration.

  2. Induced mutants for cereal grain protein improvement

    International Nuclear Information System (INIS)

    1982-01-01

    Out of 17 papers and one summary presented, six dealing with the genetic improvement of seed protein using ionizing radiations fall within the INIS subject scope. Other topics discussed were non-radiation induced mutants used for cereal grain protein improvement

  3. Male sterile mutant in Vigna radiata

    International Nuclear Information System (INIS)

    Pande, Kalpana; Raghuvanshi, S.S.

    1987-01-01

    Single and combined treatment of γ-rays and 0.25 per cent EMS were tried on Vigna radiata variety K851. A male sterile mutant was isolated in M 2 generation. Experiments indicated male sterility to be recessive and monogenic in nature. 6 figures. (author)

  4. Sex reversal in zebrafish fancl mutants is caused by Tp53-mediated germ cell apoptosis.

    Directory of Open Access Journals (Sweden)

    Adriana Rodríguez-Marí

    2010-07-01

    Full Text Available The molecular genetic mechanisms of sex determination are not known for most vertebrates, including zebrafish. We identified a mutation in the zebrafish fancl gene that causes homozygous mutants to develop as fertile males due to female-to-male sex reversal. Fancl is a member of the Fanconi Anemia/BRCA DNA repair pathway. Experiments showed that zebrafish fancl was expressed in developing germ cells in bipotential gonads at the critical time of sexual fate determination. Caspase-3 immunoassays revealed increased germ cell apoptosis in fancl mutants that compromised oocyte survival. In the absence of oocytes surviving through meiosis, somatic cells of mutant gonads did not maintain expression of the ovary gene cyp19a1a and did not down-regulate expression of the early testis gene amh; consequently, gonads masculinized and became testes. Remarkably, results showed that the introduction of a tp53 (p53 mutation into fancl mutants rescued the sex-reversal phenotype by reducing germ cell apoptosis and, thus, allowed fancl mutants to become fertile females. Our results show that Fancl function is not essential for spermatogonia and oogonia to become sperm or mature oocytes, but instead suggest that Fancl function is involved in the survival of developing oocytes through meiosis. This work reveals that Tp53-mediated germ cell apoptosis induces sex reversal after the mutation of a DNA-repair pathway gene by compromising the survival of oocytes and suggests the existence of an oocyte-derived signal that biases gonad fate towards the female developmental pathway and thereby controls zebrafish sex determination.

  5. Phanerochaete mutants with enhanced ligninolytic activity

    International Nuclear Information System (INIS)

    Kakar, S.N.; Perez, A.; Gonzales, J.

    1994-01-01

    In addition to lignin, the white rot fungus Phanerochaete chrysosporium has the ability to degrade a wide spectrum of recalcitrant organo pollutants in soils and aqueous media. Most of the organic compounds are degraded under ligninolytic conditions with the involvement of the extracellular enzymes, lignin peroxidases, and manganese-dependent peroxidases, which are produced as secondary metabolites triggered by conditions of nutrient starvation (e.g., nitrogen limitation). The fungus and its enzymes can thus provide alternative technologies for bioremediation, bio pulping, bio bleaching, and other industrial applications. The efficiency and effectiveness of the fungus can be enhanced by increasing production and secretion of the important enzymes in large quantities and as primary metabolites under enriched conditions. One way this can be achieved is through isolation of mutants that are deregulated, or are hyper producers or super secretors of key enzymes under enriched conditions. Through UV-light and γ-ray mutagenesis, we have isolated a variety of mutants, some of which produce key enzymes of the ligninolytic system under high-nitrogen growth conditions. One of the mutants, 76UV, produced 272 U of lignin peroxidases enzyme activity/L after 9 d under high nitrogen (although the parent strain does not produce this enzyme under these conditions). The mutant and the parent strains produced up to 54 and 62 U/L, respectively, of the enzyme activity under low nitrogen growth conditions during this period. In some experiments, the mutant showed 281 U/L of enzyme activity under high nitrogen after 17 d

  6. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    Science.gov (United States)

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  7. Borrelia burgdorferi outer surface protein C (OspC) binds complement component C4b and confers bloodstream survival.

    Science.gov (United States)

    Caine, Jennifer A; Lin, Yi-Pin; Kessler, Julie R; Sato, Hiromi; Leong, John M; Coburn, Jenifer

    2017-12-01

    Borrelia burgdorferi (Bb) is the causative agent of Lyme disease in the United States, a disease that can result in carditis, and chronic and debilitating arthritis and/or neurologic symptoms if left untreated. Bb survives in the midgut of the Ixodes scapularis tick, or within tissues of immunocompetent hosts. In the early stages of infection, the bacteria are present in the bloodstream where they must resist clearance by the innate immune system of the host. We have found a novel role for outer surface protein C (OspC) from B. burgdorferi and B. garinii in interactions with the complement component C4b and bloodstream survival in vivo. Our data show that OspC inhibits the classical and lectin complement pathways and competes with complement protein C2 for C4b binding. Resistance to complement is important for maintenance of the lifecycle of Bb, enabling survival of the pathogen within the host as well as in the midgut of a feeding tick when ospC expression is induced. © 2017 John Wiley & Sons Ltd.

  8. Environmental Performance of Miscanthus, Switchgrass and Maize: Can C4 Perennials Increase the Sustainability of Biogas Production?

    Directory of Open Access Journals (Sweden)

    Andreas Kiesel

    2016-12-01

    Full Text Available Biogas is considered a promising option for complementing the fluctuating energy supply from other renewable sources. Maize is currently the dominant biogas crop, but its environmental performance is questionable. Through its replacement with high-yielding and nutrient-efficient perennial C4 grasses, the environmental impact of biogas could be considerably improved. The objective of this paper is to assess and compare the environmental performance of the biogas production and utilization of perennial miscanthus and switchgrass and annual maize. An LCA was performed using data from field trials, assessing the impact in the five categories: climate change (CC, fossil fuel depletion (FFD, terrestrial acidification (TA, freshwater eutrophication (FE and marine eutrophication (ME. A system expansion approach was adopted to include a fossil reference. All three crops showed significantly lower CC and FFD potentials than the fossil reference, but higher TA and FE potentials, with nitrogen fertilizer production and fertilizer-induced emissions identified as hot spots. Miscanthus performed best and changing the input substrate from maize to miscanthus led to average reductions of −66% CC; −74% FFD; −63% FE; −60% ME and −21% TA. These results show that perennial C4 grasses and miscanthus in particular have the potential to improve the sustainability of the biogas sector.

  9. Stable carbon isotope analysis of fluvial sediment fluxes over two contrasting C(4) -C(3) semi-arid vegetation transitions.

    Science.gov (United States)

    Puttock, Alan; Dungait, Jennifer A J; Bol, Roland; Dixon, Elizabeth R; Macleod, Christopher J A; Brazier, Richard E

    2012-10-30

    Globally, many drylands are experiencing the encroachment of woody vegetation into grasslands. These changes in ecosystem structure and processes can result in increased sediment and nutrient fluxes due to fluvial erosion. As these changes are often accompanied by a shift from C(4) to C(3) vegetation with characteristic δ(13) C values, stable isotope analysis provides a promising mechanism for tracing these fluxes. Input vegetation, surface sediment and fluvially eroded sediment samples were collected across two contrasting C(4) -C(3) dryland vegetation transitions in New Mexico, USA. Isotope ratio mass spectrometric analyses were performed using a Carlo Erba NA2000 analyser interfaced to a SerCon 20-22 isotope ratio mass spectrometer to determine bulk δ(13) C values. Stable isotope analyses of contemporary input vegetation and surface sediments over the monitored transitions showed significant differences (p fluvially eroded sediment from each of the sites, with no significant variation between surface sediment and eroded sediment values. The significant differences in bulk δ(13) C values between sites were dependent on vegetation input. Importantly, these values were robustly expressed in fluvially eroded sediments, suggesting that stable isotope analysis is suitable for tracing sediment fluxes. Due to the prevalent nature of these dryland vegetation transitions in the USA and globally, further development of stable isotope ratio mass spectrometry has provided a valuable tool for enhanced understanding of functional changes in these ecosystems. Copyright © 2012 John Wiley & Sons, Ltd.

  10. Hybrid Modified K-Means with C4.5 for Intrusion Detection Systems in Multiagent Systems.

    Science.gov (United States)

    Laftah Al-Yaseen, Wathiq; Ali Othman, Zulaiha; Ahmad Nazri, Mohd Zakree

    2015-01-01

    Presently, the processing time and performance of intrusion detection systems are of great importance due to the increased speed of traffic data networks and a growing number of attacks on networks and computers. Several approaches have been proposed to address this issue, including hybridizing with several algorithms. However, this paper aims at proposing a hybrid of modified K-means with C4.5 intrusion detection system in a multiagent system (MAS-IDS). The MAS-IDS consists of three agents, namely, coordinator, analysis, and communication agent. The basic concept underpinning the utilized MAS is dividing the large captured network dataset into a number of subsets and distributing these to a number of agents depending on the data network size and core CPU availability. KDD Cup 1999 dataset is used for evaluation. The proposed hybrid modified K-means with C4.5 classification in MAS is developed in JADE platform. The results show that compared to the current methods, the MAS-IDS reduces the IDS processing time by up to 70%, while improving the detection accuracy.

  11. Attentional networks in developmental dyscalculia

    Directory of Open Access Journals (Sweden)

    Henik Avishai

    2010-01-01

    Full Text Available Abstract Background Very little is known about attention deficits in developmental dyscalculia, hence, this study was designed to provide the missing information. We examined attention abilities of participants suffering from developmental dyscalculia using the attention networks test - interactions. This test was designed to examine three different attention networks--executive function, orienting and alerting--and the interactions between them. Methods Fourteen university students that were diagnosed as suffering from developmental dyscalculia--intelligence and reading abilities in the normal range and no indication of attention-deficit hyperactivity disorder--and 14 matched controls were tested using the attention networks test - interactions. All participants were given preliminary tests to measure mathematical abilities, reading, attention and intelligence. Results The results revealed deficits in the alerting network--a larger alerting effect--and in the executive function networks--a larger congruity effect in developmental dyscalculia participants. The interaction between the alerting and executive function networks was also modulated by group. In addition, developmental dyscalculia participants were slower to respond in the non-cued conditions. Conclusions These results imply specific attentional deficits in pure developmental dyscalculia. Namely, those with developmental dyscalculia seem to be deficient in the executive function and alertness networks. They suffer from difficulty in recruiting attention, in addition to the deficits in numerical processing.

  12. Attentional networks in developmental dyscalculia.

    Science.gov (United States)

    Askenazi, Sarit; Henik, Avishai

    2010-01-07

    Very little is known about attention deficits in developmental dyscalculia, hence, this study was designed to provide the missing information. We examined attention abilities of participants suffering from developmental dyscalculia using the attention networks test - interactions. This test was designed to examine three different attention networks--executive function, orienting and alerting--and the interactions between them. Fourteen university students that were diagnosed as suffering from developmental dyscalculia--intelligence and reading abilities in the normal range and no indication of attention-deficit hyperactivity disorder--and 14 matched controls were tested using the attention networks test-interactions. All participants were given preliminary tests to measure mathematical abilities, reading, attention and intelligence. The results revealed deficits in the alerting network--a larger alerting effect--and in the executive function networks--a larger congruity effect in developmental dyscalculia participants. The interaction between the alerting and executive function networks was also modulated by group. In addition, developmental dyscalculia participants were slower to respond in the non-cued conditions. These results imply specific attentional deficits in pure developmental dyscalculia. Namely, those with developmental dyscalculia seem to be deficient in the executive function and alertness networks. They suffer from difficulty in recruiting attention, in addition to the deficits in numerical processing.

  13. LPS-Toll-Like Receptor-Mediated Signaling on Expression of Protein S and C4b-Binding Protein in the Liver

    Directory of Open Access Journals (Sweden)

    Tatsuya Hayashi

    2010-01-01

    Full Text Available Protein S (PS, mainly synthesized in hepatocytes and endothelial cells, plays a critical role as a cofactor of anticoagulant activated protein C (APC. PS activity is regulated by C4b-binding protein (C4BP, structurally composed of seven α-chains (C4BPα and a β-chain (C4BPβ. In this paper, based primarily on our previous studies, we review the lipopolysaccharide (LPS-induced signaling which affects expression of PS and C4BP in the liver. Our in vivo studies in rats showed that after LPS injection, plasma PS levels are significantly decreased, whereas plasma C4BP levels first are transiently decreased after 2 to 12 hours and then significantly increased after 24 hours. LPS decreases PS antigen and mRNA levels in both hepatocytes and sinusoidal endothelial cells (SECs, and decreases C4BP antigen and both C4BPα and C4BPβ mRNA levels in hepatocytes. Antirat CD14 and antirat Toll-like receptor (TLR-4 antibodies inhibited LPS-induced NFκB activation in both hepatocytes and SECs. Furthermore, inhibitors of NFκB and MEK recovered the LPS-induced decreased expression of PS in both cell types and the LPS-induced decreased expression of C4BP in hepatocytes. These data suggest that the LPS-induced decrease in PS expression in hepatocytes and SECs and LPS-induced decrease in C4BP expression in hepatocytes are mediated by MEK/ERK signaling and NFκB activation and that membrane-bound CD14 and TLR-4 are involved in this mechanism.

  14. Cross-species microarray hybridization to identify developmentally regulated genes in the filamentous fungus Sordaria macrospora.

    Science.gov (United States)

    Nowrousian, Minou; Ringelberg, Carol; Dunlap, Jay C; Loros, Jennifer J; Kück, Ulrich

    2005-04-01

    The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies that protect the developing ascospores and ensure their proper discharge. Several regulatory genes essential for fruiting body development were previously isolated by complementation of the sterile mutants pro1, pro11 and pro22. To establish the genetic relationships between these genes and to identify downstream targets, we have conducted cross-species microarray hybridizations using cDNA arrays derived from the closely related fungus Neurospora crassa and RNA probes prepared from wild-type S. macrospora and the three developmental mutants. Of the 1,420 genes which gave a signal with the probes from all the strains used, 172 (12%) were regulated differently in at least one of the three mutants compared to the wild type, and 17 (1.2%) were regulated differently in all three mutant strains. Microarray data were verified by Northern analysis or quantitative real time PCR. Among the genes that are up- or down-regulated in the mutant strains are genes encoding the pheromone precursors, enzymes involved in melanin biosynthesis and a lectin-like protein. Analysis of gene expression in double mutants revealed a complex network of interaction between the pro gene products.

  15. Structure, ferroelectric ordering, and semiempirical quantum calculations of lanthanide based metal-organic framework: [Nd(C4H5O6)(C4H4O6)][3H2O

    International Nuclear Information System (INIS)

    Ahmad, Bhat Zahoor; Want, Basharat

    2016-01-01

    We investigate the structure and ferroelectric behavior of a lanthanide based metal-organic framework (MOF), [Nd(C 4 H 5 O 6 )(C 4 H 4 O 6 )][3H 2 O]. X-ray crystal structure analyses reveal that it crystallizes in the P4 1 2 1 2 space group with Nd centres, coordinated by nine oxygen atoms, forming a distorted capped square antiprismatic geometry. The molecules, bridged by tartrate ligands, form a 2D chiral structure. The 2D sheets are further linked into a 3D porous framework via strong hydrogen-bonding scheme (O-H…O ≈ 2.113 Å). Dielectric studies reveal two anomalies at 295 K and 185 K. The former is a paraelectric-ferroelectric transition, and the later is attributed to the freezing down of the motion of the hydroxyl groups. The phase transition is of second order, and the spontaneous polarization in low temperature phase is attributed to the ordering of protons of hydroxyl groups. The dielectric nonlinearity parameters have been calculated using Landau– Devonshire phenomenological theory. In addition, the most recent semiempirical models, Sparkle/PM7, Sparkle/RM1, and Sparkle/AM1, are tested on the present system to assay the accuracy of semiempirical quantum approaches to predict the geometries of solid MOFs. Our results show that Sparkle/PM7 model is the most accurate to predict the unit cell structure and coordination polyhedron geometry. The semiempirical methods are also used to calculate different ground state molecular properties.

  16. A rapid method to screen for cell-wall mutants using discriminant analysis of Fourier transform infrared spectra

    International Nuclear Information System (INIS)

    Chen LiMei; Carpita, N.C.; Reiter, W.D.; Wilson, R.H.; Jeffries, C.; McCann, M.C.

    1998-01-01

    We have developed a rapid method to screen large numbers of mutant plants for a broad range of cell wall phenotypes using Fourier transform infrared (FTIR) microspectroscopy of leaves. We established and validated a model that can discriminate between the leaves of wild-type and a previously defined set of cell-wall mutants of Arabidopsis. Exploratory principal component analysis indicated that mutants deficient in different cell-wall sugars can be distinguished from each other. Discrimination of cell-wall mutants from wild-type was independent of variability in starch content or additional unrelated mutations that might be present in a heavily mutagenised population. We then developed an analysis of FTIR spectra of leaves obtained from over 1000 mutagenised flax plants, and selected 59 plants whose spectral variation from wild-type was significantly out of the range of a wild-type population, determined by Mahalanobis distance. Cell wall sugars from the leaves of selected putative mutants were assayed by gas chromatography-mass spectrometry and 42 showed significant differences in neutral sugar composition. The FTIR spectra indicated that six of the remaining 17 plants have altered ester or protein content. We conclude that linear discriminant analysis of FTIR spectra is a robust method to identify a broad range of structural and architectural alterations in cell walls, appearing as a consequence of developmental regulation, environmental adaptation or genetic modification. (author)

  17. Water use patterns of co-occurring C3 and C4 shrubs in the Gurbantonggut desert in northwestern China.

    Science.gov (United States)

    Tiemuerbieke, Bahejiayinaer; Min, Xiao-Jun; Zang, Yong-Xin; Xing, Peng; Ma, Jian-Ying; Sun, Wei

    2018-09-01

    In water-limited ecosystems, spatial and temporal partitioning of water sources is an important mechanism that facilitates plant survival and lessens the competition intensity of co-existing plants. Insights into species-specific root functional plasticity and differences in the water sources of co-existing plants under changing water conditions can aid in accurate prediction of the response of desert ecosystems to future climate change. We used stable isotopes of soil water, groundwater and xylem water to determine the seasonal and inter- and intraspecific differences variations in the water sources of six C 3 and C 4 shrubs in the Gurbantonggut desert. We also measured the stem water potentials to determine the water stress levels of each species under varying water conditions. The studied shrubs exhibited similar seasonal water uptake patterns, i.e., all shrubs extracted shallow soil water recharged by snowmelt water during early spring and reverted to deeper water sources during dry summer periods, indicating that all of the studied shrubs have dimorphic root systems that enable them to obtain water sources that differ in space and time. Species in the C 4 shrub community exhibited differences in seasonal water absorption and water status due to differences in topography and rooting depth, demonstrating divergent adaptations to water availability and water stress. Haloxylon ammodendron and T. ramosissima in the C 3 /C 4 mixed community were similar in terms of seasonal water extraction but differed with respect to water potential, which indicated that plant water status is controlled by both root functioning and shoot eco-physiological traits. The two Tamarix species in the C 3 shrub community were similar in terms of water uptake and water status, which suggests functional convergence of the root system and physiological performance under same soil water conditions. In different communities, Haloxylon ammodendron differed in terms of summer water extraction

  18. Expression of recombinant Pseudomonas stutzeri di-heme cytochrome c(4) by high-cell-density fed-batch cultivation of Pseudomonas putida

    DEFF Research Database (Denmark)

    Thuesen, Marianne Hallberg; Nørgaard, Allan; Hansen, Anne Merete

    2003-01-01

    The gene of the di-heme protein cytochrome c(4) from Pseudomonas stutzeri was expressed in Pseudomonas putida. High-yield expression of the protein was achieved by high-cell-density fed-batch cultivation using an exponential glucose feeding strategy. The recombinant cytochrome c(4) protein...

  19. Ly6/uPAR-related protein C4.4A as a marker of solid growth pattern and poor prognosis in lung adenocarcinoma

    DEFF Research Database (Denmark)

    Jacobsen, Benedikte; Muley, Thomas; Meister, Michael

    2013-01-01

    We have recently shown that the protein C4.4A is induced in early precursor lesions of pulmonary adenocarcinomas and squamous cell carcinomas. In the present study, we aimed at analyzing the impact of C4.4A on the survival of non-small cell lung cancer patients and determining whether its...

  20. Developmental transcriptome of Aplysia californica'

    KAUST Repository

    Heyland, Andreas; Vue, Zer; Voolstra, Christian R.; Medina, Mó nica; Moroz, Leonid L.

    2010-01-01

    developmental transcriptome with similar studies in the zebra fish Danio rerio, the fruit fly Drosophila melanogaster, the nematode Caenorhabditis elegans, and other studies on molluscs suggests an overall highly divergent pattern of gene regulatory mechanisms

  1. PREVALENCE AND EFFECT OF DEVELOPMENTAL ...

    African Journals Online (AJOL)

    uvp

    among children might even be higher, as medical and educational systems frequently fail to ... formally diagnosed, but rather described by their teachers as lazy or ..... Developmental Coordination Disorder Questionnaire for Brazilian children.

  2. The Management of Developmental Apraxia.

    Science.gov (United States)

    Gubbay, S. S.

    1978-01-01

    Of 39 children (5-12 years old) with developmental apraxia and agnosia, who were assessed neurologically, 19 were also given simple standarized tests of motor ability. Journal availability: see EC 112 661. (Author/SBH)

  3. Developmental toxicity of engineered nanomaterials

    DEFF Research Database (Denmark)

    Hougaard, Karin S.; Hansen, Jitka S.; Jackson, Petra

    2016-01-01

    Study of air pollution indicates that minute particles may adversely interfere with pregnancy and fetal development. As engineering of nanoparticles have emerged, so has concern that these might interfere with reproductive and developmental functions. This is because nanotechnology may potentially...... increase the overall particle burden in air and introduce particles with novel characteristics and surface reactivity. To evaluate safety for pregnant women, we have studied developmental toxicity of engineered nanoparticles (ENPs), following exposure of pregnant mice by inhalation (ENPs of titanium...

  4. Complement factors C4 and C3 are down regulated in response to short term overfeeding in healthy young men

    DEFF Research Database (Denmark)

    Foghmar, Caroline; Brøns, Charlotte; Pilely, Katrine

    2017-01-01

    individuals only, while both groups had the same degree of hepatic insulin resistance after HFO. Viewing all individuals circulating levels of C4, C3, C3bc, TCC and complement activation capacity decreased paradoxically along the development of insulin resistance after HFO (P = 0.0015, P ...Insulin resistance is associated with high circulating level of complement factor C3. Animal studies suggest that improper complement activation mediates high-fat-diet-induced insulin resistance. Individuals born with low birth weight (LBW) are at increased risk of developing insulin resistance. We...... hypothesized that high-fat overfeeding (HFO) increase circulating C3 and induce complement activation in a birth weight differential manner. Twenty LBW and 26 normal birth weight (NBW) young men were studied using a randomised crossover design. Insulin resistance was measured after a control-diet and after 5...

  5. Movie Popularity Classification based on Inherent Movie Attributes using C4.5, PART and Correlation Coefficient

    DEFF Research Database (Denmark)

    Ibnal Asad, Khalid; Ahmed, Tanvir; Rahman, Md. Saiedur

    2012-01-01

    Abundance of movie data across the internet makes it an obvious candidate for machine learning and knowledge discovery. But most researches are directed towards bi-polar classification of movie or generation of a movie recommendation system based on reviews given by viewers on various internet...... sites. Classification of movie popularity based solely on attributes of a movie i.e. actor, actress, director rating, language, country and budget etc. has been less highlighted due to large number of attributes that are associated with each movie and their differences in dimensions. In this paper, we...... propose classification scheme of pre-release movie popularity based on inherent attributes using C4.S and PART classifier algorithm and define the relation between attributes of post release movies using correlation coefficient....

  6. Charge Exchange in Low-Energy H, D + C4+ Collisions with Full Account of Electron Translation

    Directory of Open Access Journals (Sweden)

    N. Vaeck

    2002-03-01

    Full Text Available We report the application of the quantum approach, which takes full account of electron translation at low collisional energies, to the charge exchange process H, D + C4+ → H+, D+ + C3+(3s; 3p; 3d. The partial and the total integral cross sections of the process are calculated in the energy range from 1 till 60 eV/amu. It is shown that the present results are independent from the upper integration limit for numerical solution of the coupled channel equations although nonadiabatic couplings remain nonzero up to infinity. The calculated partial and total cross sections are in agreement with the previous low-energy calculations and the available experimental data. It is shown that for low collisional energies the isotopic effect takes place. The observed effect is explained in terms of the nonadiabatic dynamics.

  7. Physicochemical, Nutritional, and Organoleptic Characterization of a Skimmed Goat Milk Fermented with the Probiotic Strain Lactobacillus plantarum C4.

    Science.gov (United States)

    Moreno-Montoro, Miriam; Navarro-Alarcón, Miguel; Bergillos-Meca, Triana; Giménez-Martínez, Rafael; Sánchez-Hernández, Silvia; Olalla-Herrera, Manuel

    2018-05-17

    The benefits of goat milk, fermented milks, and probiotics for the humans are well documented. In this study, a novel fermented goat milk was manufactured with the putative probiotic strain Lactobacillus plantarum C4 together with L. bulgaricus and Streptococcus thermophilus . Ultrafiltration was chosen as the skimmed milk concentration method because it produced the best viscosity and syneresis and a high casein content. The viability rate of all bacterial strains was >10⁷ cfu/mL, even after 5 weeks of storage or after in vitro gastrointestinal digestion, which is especially important for exertion of the probiotic strain functionalities. This fermented milk is also a good source of nutrients, having a low lactose and fat content, high protein proportion, and good mineral concentration. According to these data and the overall acceptability described by panelists, this fermented milk is a healthy dairy product comparable with commercially available fermented milks.

  8. PNRI mutant variety: sansevieria 'Sword of Ibe'

    International Nuclear Information System (INIS)

    Aurigue, Fernando B.

    2011-01-01

    Sansevieria 'Sword of Ibe,' registered by the Philippine Nuclear Research Institute as NSIC 2008 Or-66, is a chlorophyll mutant of Sansevieria trifasciata 'Moonshine' developed by treating its suckers or shoots arising from a rhizome with acute gamma radiation from a Cobalt-60 source. The new mutant is identical in growth habit and vigor to Sansevieria 'Moonshine,' also known as Moonglow. Results of this mutation breeding experiment showed that leaf color and flowering were altered by gamma irradiation without changing the other characteristics of the plant. Propagation is true-to-type by separation of sucker and top cutting. The plant is recommended for use as landscaping material and as pot plant for indoor and outdoor use. The leaves may be harvested as cut foliage for Japanese flower arrangements. (author)

  9. Serine:glyoxylate aminotransferase mutant of barley

    International Nuclear Information System (INIS)

    Blackwell, R.; Murray, A.; Joy, K.; Lea, P.

    1987-01-01

    A photorespiratory mutant of barley (LaPr 85/84), deficient in both of the major peaks of serine:glyoxylate aminotransferase activity detected in the wild type, also lacks serine:pyruvate and asparagine:glyoxylate aminotransferase activities. Genetic analysis of the mutation demonstrated that these three activities are all carried on the same enzyme. The mutant, when placed in air, accumulated a large pool of serine, showed the expected rate (50%) of ammonia release during photorespiration but produced CO 2 at twice the wild type rate when it was fed [ 14 C] glyoxylate. Compared with the wild type, LaPr 85/84 exhibited abnormal transient changes in chlorophyll a fluorescence when the CO 2 concentration of the air was altered, indicating that the rates of the fluorescence quenching mechanisms were affected in vivo by the lack of this enzyme

  10. Intact interval timing in circadian CLOCK mutants.

    Science.gov (United States)

    Cordes, Sara; Gallistel, C R

    2008-08-28

    While progress has been made in determining the molecular basis for the circadian clock, the mechanism by which mammalian brains time intervals measured in seconds to minutes remains a mystery. An obvious question is whether the interval-timing mechanism shares molecular machinery with the circadian timing mechanism. In the current study, we trained circadian CLOCK +/- and -/- mutant male mice in a peak-interval procedure with 10 and 20-s criteria. The mutant mice were more active than their wild-type littermates, but there were no reliable deficits in the accuracy or precision of their timing as compared with wild-type littermates. This suggests that expression of the CLOCK protein is not necessary for normal interval timing.

  11. Deep evolutionary comparison of gene expression identifies parallel recruitment of trans-factors in two independent origins of C4 photosynthesis.

    Directory of Open Access Journals (Sweden)

    Sylvain Aubry

    2014-06-01

    Full Text Available With at least 60 independent origins spanning monocotyledons and dicotyledons, the C4 photosynthetic pathway represents one of the most remarkable examples of convergent evolution. The recurrent evolution of this highly complex trait involving alterations to leaf anatomy, cell biology and biochemistry allows an increase in productivity by ∼ 50% in tropical and subtropical areas. The extent to which separate lineages of C4 plants use the same genetic networks to maintain C4 photosynthesis is unknown. We developed a new informatics framework to enable deep evolutionary comparison of gene expression in species lacking reference genomes. We exploited this to compare gene expression in species representing two independent C4 lineages (Cleome gynandra and Zea mays whose last common ancestor diverged ∼ 140 million years ago. We define a cohort of 3,335 genes that represent conserved components of leaf and photosynthetic development in these species. Furthermore, we show that genes encoding proteins of the C4 cycle are recruited into networks defined by photosynthesis-related genes. Despite the wide evolutionary separation and independent origins of the C4 phenotype, we report that these species use homologous transcription factors to both induce C4 photosynthesis and to maintain the cell specific gene expression required for the pathway to operate. We define a core molecular signature associated with leaf and photosynthetic maturation that is likely shared by angiosperm species derived from the last common ancestor of the monocotyledons and dicotyledons. We show that deep evolutionary comparisons of gene expression can reveal novel insight into the molecular convergence of highly complex phenotypes and that parallel evolution of trans-factors underpins the repeated appearance of C4 photosynthesis. Thus, exploitation of extant natural variation associated with complex traits can be used to identify regulators. Moreover, the transcription factors

  12. Thermophysical and radiation properties of high-temperature C4F8-CO2 mixtures to replace SF6 in high-voltage circuit breakers

    Science.gov (United States)

    Zhong, Linlin; Cressault, Yann; Teulet, Philippe

    2018-03-01

    C4F8-CO2 mixtures are one of the potential substitutes to SF6 in high-voltage circuit breakers. However, the arc quenching ability of C4F8-CO2 mixtures is still unknown. In order to provide the necessary basic data for the further investigation of arc quenching performance, the compositions, thermodynamic properties, transport coefficients, and net emission coefficients (NEC) of various C4F8-CO2 mixtures are calculated at temperatures of 300-30 000 K in this work. The thermodynamic properties are presented as the product of mass density and specific heat, i.e., ρCp. The transport coefficients include electrical conductivity, viscosity, and thermal conductivity. The atomic and molecular radiation are both taken into account in the calculation of NEC. The comparison of the properties between SF6 and C4F8-CO2 mixtures is also discussed to find their differences. The results of compositions show that C4F8-CO2 mixtures have a distinctive advantage over other alternative gases e.g., CF3I and C3F8, because the dissociative product (i.e., C4F6) of C4F8 at low temperatures has a very high dielectric strength. This is good for an arc quenching medium to endure the arc recovery phase. Compared with SF6, C4F8-CO2 mixtures present lower ρCp at temperatures below 2800 K and larger thermal conductivity above 2800 K. Based on the position of peaks in thermal conductivity, we predict that the cooling of C4F8-CO2 arc will be slowed down at higher temperatures than that of SF6 arc. It is also found that the mixing of CO2 shows slight effects on the electrical conductivity and NEC of C4F8-CO2 mixtures.

  13. Deep evolutionary comparison of gene expression identifies parallel recruitment of trans-factors in two independent origins of C4 photosynthesis.

    Science.gov (United States)

    Aubry, Sylvain; Kelly, Steven; Kümpers, Britta M C; Smith-Unna, Richard D; Hibberd, Julian M

    2014-06-01

    With at least 60 independent origins spanning monocotyledons and dicotyledons, the C4 photosynthetic pathway represents one of the most remarkable examples of convergent evolution. The recurrent evolution of this highly complex trait involving alterations to leaf anatomy, cell biology and biochemistry allows an increase in productivity by ∼ 50% in tropical and subtropical areas. The extent to which separate lineages of C4 plants use the same genetic networks to maintain C4 photosynthesis is unknown. We developed a new informatics framework to enable deep evolutionary comparison of gene expression in species lacking reference genomes. We exploited this to compare gene expression in species representing two independent C4 lineages (Cleome gynandra and Zea mays) whose last common ancestor diverged ∼ 140 million years ago. We define a cohort of 3,335 genes that represent conserved components of leaf and photosynthetic development in these species. Furthermore, we show that genes encoding proteins of the C4 cycle are recruited into networks defined by photosynthesis-related genes. Despite the wide evolutionary separation and independent origins of the C4 phenotype, we report that these species use homologous transcription factors to both induce C4 photosynthesis and to maintain the cell specific gene expression required for the pathway to operate. We define a core molecular signature associated with leaf and photosynthetic maturation that is likely shared by angiosperm species derived from the last common ancestor of the monocotyledons and dicotyledons. We show that deep evolutionary comparisons of gene expression can reveal novel insight into the molecular convergence of highly complex phenotypes and that parallel evolution of trans-factors underpins the repeated appearance of C4 photosynthesis. Thus, exploitation of extant natural variation associated with complex traits can be used to identify regulators. Moreover, the transcription factors that are shared by

  14. Efficient removal of H2S at high temperature using the ionic liquid solutions of [C4mim]3PMo12O40-An organic polyoxometalate.

    Science.gov (United States)

    Ma, Yunqian; Liu, Xinpeng; Wang, Rui

    2017-06-05

    An innovative approach to H 2 S capture and sulfur recovery via liquid redox at high temperature has been developed using [C 4 mim] 3 PMo 12 O 40 at temperatures ranging from 80 to 180°C, which is superior to the conventional water-based system with an upper limit of working temperature normally below 60°C. The ionic liquids used as solvents include [C 4 mim]Cl, [C 4 mim]BF 4 , [C 4 mim]PF 6 and [C 4 mim]NTf 2 . Microscopic observation and turbidity measurement were used to investigate the dissolution of [C 4 mim] 3 PMo 12 O 40 in the ionic liquids. Stabilization energy between H 2 S and the anion of ionic liquid as well as H 2 O was calculated to illustrate the interaction between H 2 S and the solvents. The cavity theory can be adopted to illustrate the mechanism for H 2 S absorption: the Cl - ion with small radius can be incorporated into the cavities of [C 4 mim] 3 PMo 12 O 40 , and interact with H 2 S strongly. The underlying mechanism for sulfur formation is the redox reaction between H 2 S and PMo 12 O 40 3- . H 2 S can be oxidized to elemental sulfur and Mo 6+ is partly reduced during absorption, according to UV-vis and FTIR spectra. The [C 4 mim] 3 PMo 12 O 40 -[C 4 mim]Cl after reaction can be readily regenerated by air and thus enabling its efficient and repeatitive use. The absorbent of [C 4 mim] 3 PMo 12 O 40 -ionic liquid system provides a new approach for wet oxidation desulfurization at high temperature. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Micro-fabricated membrane gas valves with a non-stiction coating deposited by C4F8/Ar plasma

    International Nuclear Information System (INIS)

    Han, Jeahyeong; Flachsbart, Bruce; Shannon, Mark A; Masel, Rich I

    2008-01-01

    Micro-fabricated gas valves with C 4 F 8 /Ar treatment at the sealing interface are designed, fabricated and characterized to passively control gases in a micro gas analysis system. The check valves form a seal between a polished Si/SiO 2 substrate and a smooth polyimide (PI) membrane. The smooth PI membrane touches the SiO 2 surface, giving rise to relatively strong van der Waals adhesion, and under humid conditions hydrogen-bonded stiction can occur at the interface between PI and SiO 2 . To prevent stiction from dominating adhesion, the valve-seat surface was treated with a hydrophobic CF n thin film, which was formed by exposing the surface to C 4 F 8 /Ar inductively coupled plasma (ICP) at low power. The valves without a non-stiction coating did not open with inlet pressures up to 210 kPa. With a non-stiction coating, the valves showed an average initial opening pressure of 59.25 kPa. In order to further reduce the opening pressure, 40% of the valve-seat area is reduced. After modification, the average opening pressure is reduced to 32.5 kPa. After the initial opening, the average in-use opening pressure was 16.9 kPa before area modification, and 13.1 kPa after the modification. The valve has been tested up to 10 000 open/close cycles under dry N 2 gas flow, and an additional 3000 open/close cycles under humid N 2 gas flow. The average forward flow conductance of the valves before modification was 1.1 sccm kPa −1 , and the conductance after modification was 1.41 sccm kPa −1 . The measured leakage is between 0.0003 and 0.004 sccm up to 35 kPa reverse pressure

  16. Population dynamics and genetic diversity of C4 strains of human enterovirus 71 in Mainland China, 1998-2010.

    Directory of Open Access Journals (Sweden)

    Dawei Guan

    Full Text Available BACKGROUND: Since 1997, several countries within the Asian Pacific region have been affected by one or more massive outbreaks of Hand Foot and Mouth Disease (HFMD. Virus typing experiments revealed that these outbreaks were caused by strains of human enterovirus 71 (EV71 belonging to several different, recently emerged subgenogroups. In mainland China, a different situation was observed. The first outbreak, localized in Shangdong Province, was reported in 2007, and was followed by a wide-spread outbreak in mainland China in 2008. Since then, numbers of reported HFMD cases have been persistently high. METHODOLOGY/PRINCIPAL FINDINGS: To gain insight in the epidemiological behavior of EV71 in China, we studied genetic diversity and EV71 population dynamics to address whether the increase in number of reported EV71 infections reflects a real increase in viral spread or is just the result of increased awareness and surveillance. We used systematically collected VP1 gene sequences of 257 EV71 strains collected in Guangdong province from 2008 to 2010 as part of HFMD surveillance activities, and supplemented them with 305 GenBank EV71 reference stains collected in China from 1998 to 2010. All isolates from Guangdong Province belonged to subgenogroup C4. Viral population dynamics indicated that the increased reporting of HFMD in China since 2007 reflects a real increase in viral spread and continued replacement of viral lineages through time. Amino acid sequence comparisons revealed substitution of amino acid in residues 22, 145 and 289 through time regularly with the VP1 gene of EV71 strains isolated in mainland China from 1998 to 2010. CONCLUSIONS: EV71 strains isolated in mainland China mainly belonged to subgenogroup C4. There was exponential growth of the EV71 virus population in 2007 and 2008. There was amino acid substitution through time regularly with the VP1 gene which possibly increased viral spread and/or ability of the virus to circulate

  17. Reduced combustion mechanism for C1-C4 hydrocarbons and its application in computational fluid dynamics flare modeling.

    Science.gov (United States)

    Damodara, Vijaya; Chen, Daniel H; Lou, Helen H; Rasel, Kader M A; Richmond, Peyton; Wang, Anan; Li, Xianchang

    2017-05-01

    Emissions from flares constitute unburned hydrocarbons, carbon monoxide (CO), soot, and other partially burned and altered hydrocarbons along with carbon dioxide (CO 2 ) and water. Soot or visible smoke is of particular concern for flare operators/regulatory agencies. The goal of the study is to develop a computational fluid dynamics (CFD) model capable of predicting flare combustion efficiency (CE) and soot emission. Since detailed combustion mechanisms are too complicated for (CFD) application, a 50-species reduced mechanism, LU 3.0.1, was developed. LU 3.0.1 is capable of handling C 4 hydrocarbons and soot precursor species (C 2 H 2 , C 2 H 4 , C 6 H 6 ). The new reduced mechanism LU 3.0.1 was first validated against experimental performance indicators: laminar flame speed, adiabatic flame temperature, and ignition delay. Further, CFD simulations using LU 3.0.1 were run to predict soot emission and CE of air-assisted flare tests conducted in 2010 in Tulsa, Oklahoma, using ANSYS Fluent software. Results of non-premixed probability density function (PDF) model and eddy dissipation concept (EDC) model are discussed. It is also noteworthy that when used in conjunction with the EDC turbulence-chemistry model, LU 3.0.1 can reasonably predict volatile organic compound (VOC) emissions as well. A reduced combustion mechanism containing 50 C 1 -C 4 species and soot precursors has been developed and validated against experimental data. The combustion mechanism is then employed in the computational fluid dynamics (CFD) of modeling of soot emission and combustion efficiency (CE) of controlled flares for which experimental soot and CE data are available. The validated CFD modeling tools are useful for oil, gas, and chemical industries to comply with U.S. Environmental Protection Agency's (EPA) mandate to achieve smokeless flaring with a high CE.

  18. Active elbow flexion is possible in C4 quadriplegia using hybrid assistive limb (HAL®) technology: A case study.

    Science.gov (United States)

    Shimizu, Yukiyo; Kadone, Hideki; Kubota, Shigeki; Ikumi, Akira; Abe, Tetsuya; Marushima, Aiki; Ueno, Tomoyuki; Endo, Ayumu; Kawamoto, Hiroaki; Saotome, Kousaku; Matsushita, Akira; Matsumura, Akira; Sankai, Yoshiyuki; Hada, Yasushi; Yamazaki, Masashi

    2017-07-01

    Patients with complete quadriplegia after high cervical spinal cord injury are fully dependent with activities of daily living. Assistive technology can improve their quality of life. We examined the use of a hybrid assistive limb for single joints (HAL-SJ) in a 19-year-old man with complete C4 quadriplegia due to chronic spinal cord injury to restore function of active elbow flexion. This is the first report on the use of the HAL-SJ in a patient with spinal cord injury. The HAL-SJ intervention for each elbow was administered in 10 sessions. Clinical assessment using surface EMG was conducted to evaluate muscle activity of the trapezius, biceps brachii, infraspinatus, and triceps brachii muscle before, and during the 2nd, 3rd, 6th, and 9th interventions. Surface electromyography (EMG) before intervention showed no contraction in the upper arms, but in the bilateral trapezius. The HAL-SJ used motion intention from the right trapezius for activation. After the 6th and 7th session, respectively, biceps EMG showed that voluntary contraction and right elbow flexion could be performed by motion intention from the right biceps. After the 10th session, voluntary bicep contraction was possible. HAL-SJ treatment on the left elbow was performed using the same protocol with a similar outcome. After completing treatment on both upper extremities, both biceps contracted voluntarily, and he could operate a standard wheelchair for a short distance independently. HAL-SJ intervention is feasible and effective in restoring elbow flexor function in a patient with C4 chronic spinal cord injury and complete quadriplegia.

  19. The application of shortened upper leaf mutant in barley breeding

    International Nuclear Information System (INIS)

    Jin Hua

    2004-01-01

    The shortened upper leaf mutant was induced from Fuji Nigo by γ-ray irradiation. Fuji Nigo, the mutant, cross-cut F 1 , F 2 and back-cross F 1 , F 2 were used to analyze mutant heredity by comparative study. The yield, chlorophyll content, light intensity, dry matter of mutant were investigated. The results showed that (1) the mutant character was controlled by a couple of nuclear genes which were partial dominance; (2) the transmittance of the mutant colony was better than that of Fuji Nigo and bottom dry matter was much more than that of Fuji Nigo; (3) under the condition of high fertilizer and high plant population , the yield of mutant was higher than that of Fuji Nigo; (4) the content of chlorophyll a in the mutant was higher than that in Fuji Nigo

  20. Arabidopsis thaliana cdd1 mutant uncouples the constitutive activation of salicylic acid signalling from growth defects.

    Science.gov (United States)

    Swain, Swadhin; Roy, Shweta; Shah, Jyoti; Van Wees, Saskia; Pieterse, Corné M; Nandi, Ashis K

    2011-12-01

    Arabidopsis genotypes with a hyperactive salicylic acid-mediated signalling pathway exhibit enhanced disease resistance, which is often coupled with growth and developmental defects, such as dwarfing and spontaneous necrotic lesions on the leaves, resulting in reduced biomass yield. In this article, we report a novel recessive mutant of Arabidopsis, cdd1 (constitutive defence without defect in growth and development1), that exhibits enhanced disease resistance associated with constitutive salicylic acid signalling, but without any observable pleiotropic phenotype. Both NPR1 (NON-EXPRESSOR OF PATHOGENESIS-RELATED GENES1)-dependent and NPR1-independent salicylic acid-regulated defence pathways are hyperactivated in cdd1 mutant plants, conferring enhanced resistance against bacterial pathogens. However, a functional NPR1 allele is required for the cdd1-conferred heightened resistance against the oomycete pathogen Hyaloperonospora arabidopsidis. Salicylic acid accumulates at elevated levels in cdd1 and cdd1 npr1 mutant plants and is necessary for cdd1-mediated PR1 expression and disease resistance phenotypes. In addition, we provide data which indicate that the cdd1 mutation negatively regulates the npr1 mutation-induced hyperactivation of ethylene/jasmonic acid signalling. © 2011 The Authors. Molecular Plant Pathology © 2011 BSPP and Blackwell Publishing Ltd.

  1. ''Fushi'' - excellent mutant germplasm for peanut improvement

    International Nuclear Information System (INIS)

    Jiang, X.; Zhou, Y.

    1989-01-01

    Full text: The mutant line ''Fushi'' was selected following seed treatment of the variety ''Shi Xuan 64'' in 1960 with 32 P. Many good peanut varieties were developed using ''Fushi'' in cross-breeding (ref. Mutation Breeding Newsletter No. 30 (July 1987) p. 2-3). In the past 10 years, planting areas of these varieties added up to 3,3 million ha in South China, peanut production was increased by more than 500 000 t valued 500 million Yuan. (author)

  2. Radiation induced early maturing mutants in barley

    International Nuclear Information System (INIS)

    Kumar, R.; Chauhan, S.V.S.; Sharma, R.P.

    1978-01-01

    In M 2 generation, two early maturing plants were screened from a single spike progeny of a plant obtained from 20 kR of gamma-ray irradiation of a six-rowed barley (Hordeum vulgare L. var. Jyoti). Their true breeding nature was confirmed in M 3 generation. These mutants flower and mature 38 and 22 days earlier than those of control. (auth.)

  3. Developmental Science: Past, Present, and Future

    Science.gov (United States)

    Lerner, Richard M.

    2012-01-01

    The goal of developmental science is to describe, explain, and optimize intraindividual changes in adaptive developmental regulations and, as well, interindividual differences in such relations, across life. The history of developmental science is reviewed and its current foci, which are framed by relational developmental systems models that…

  4. Grain product of 34 soya mutant lines

    International Nuclear Information System (INIS)

    Salmeron E, J.; Mastache L, A. A.; Valencia E, F.; Diaz V, G. E.; Cervantes S, T.; De la Cruz T, E.; Garcia A, J. M.; Falcon B, T.; Gatica T, M. A.

    2009-01-01

    This work was development with the objective of obtaining information of the agronomic behavior of 34 soya mutant lines (R 4 M 18 ) for human consumption and this way to select the 2 better lines. The genetic materials were obtained starting from the variety ISAAEG-B M2 by means of the application of recurrent radiation with Co 60 gammas, to a dose of 350 Gray for the first two generations and both later to 200 Gray and selection during 17 cycles, being obtained the 34 better lines mutants with agronomic characteristic wanted and good flavor. The obtained results were that the mutant lines L 25 and L 32 produced the major quantity in branches/plant number with 7.5 and 7.25, pods/plant number with 171.25 and 167, grains/plant number with 350.89 and 333.07 and grain product (ton/ha) to 15% of humidity 5.15 and 4.68 ton/ha, respectively. (Author)

  5. Multivariate analysis for selecting apple mutants

    International Nuclear Information System (INIS)

    Faedi, W.; Bagnara, G.L.; Rosati, P.; Cecchini, M.

    1992-01-01

    The mutlivariate analysis of four year records on several vegetative and productive traits of twenty-one apple mutants (3 of 'Jonathan', 3 of 'Ozark Gold', 14 of 'Mollie's Delicious', 1 of 'Neipling's Early Stayman)' induced by gamma radiations showed that observation of some traits of one-year-old shoots is the most efficient way to reveal compact growing apple mutants. In particular, basal cross-section area, total length and leaf area resulted the most appropriate parameters, while internode length together with conopy height and width are less appropriate. The most interesting mutants we found are: one of 'Mollie's Delicious for the best balance among tree and fruit traits and for high skin color; one of 'Neipling's Early Stayman' with an earlier and more extensively red colored apple than the original clone. (author)

  6. Probiotic features of Lactobacillus plantarum mutant strains.

    Science.gov (United States)

    Bove, Pasquale; Gallone, Anna; Russo, Pasquale; Capozzi, Vittorio; Albenzio, Marzia; Spano, Giuseppe; Fiocco, Daniela

    2012-10-01

    In this study, the probiotic potential of Lactobacillus plantarum wild-type and derivative mutant strains was investigated. Bacterial survival was evaluated in an in vitro system, simulating the transit along the human oro-gastro-intestinal tract. Interaction with human gut epithelial cells was studied by assessing bacterial adhesive ability to Caco-2 cells and induction of genes involved in innate immunity. L. plantarum strains were resistant to the combined stress at the various steps of the simulated gastrointestinal tract. Major decreases in the viability of L. plantarum cells were observed mainly under drastic acidic conditions (pH ≤ 2.0) of the gastric compartment. Abiotic stresses associated to small intestine poorly affected bacterial viability. All the bacterial strains significantly adhered to Caco-2 cells, with the ΔctsR mutant strain exhibiting the highest adhesion. Induction of immune-related genes resulted higher upon incubation with heat-inactivated bacteria rather than with live ones. For specific genes, a differential transcriptional pattern was observed upon stimulation with different L. plantarum strains, evidencing a possible role of the knocked out bacterial genes in the modulation of host cell response. In particular, cells from Δhsp18.55 and ΔftsH mutants strongly triggered immune defence genes. Our study highlights the relevance of microbial genetic background in host-probiotic interaction and might contribute to identify candidate bacterial genes and molecules involved in probiosis.

  7. Zebrafish eda and edar mutants reveal conserved and ancestral roles of ectodysplasin signaling in vertebrates.

    Directory of Open Access Journals (Sweden)

    Matthew P Harris

    2008-10-01

    Full Text Available The genetic basis of the development and variation of adult form of vertebrates is not well understood. To address this problem, we performed a mutant screen to identify genes essential for the formation of adult skeletal structures of the zebrafish. Here, we describe the phenotypic and molecular characterization of a set of mutants showing loss of adult structures of the dermal skeleton, such as the rays of the fins and the scales, as well as the pharyngeal teeth. The mutations represent adult-viable, loss of function alleles in the ectodysplasin (eda and ectodysplasin receptor (edar genes. These genes are frequently mutated in the human hereditary disease hypohidrotic ectodermal dysplasia (HED; OMIM 224900, 305100 that affects the development of integumentary appendages such as hair and teeth. We find mutations in zebrafish edar that affect similar residues as mutated in human cases of HED and show similar phenotypic consequences. eda and edar are not required for early zebrafish development, but are rather specific for the development of adult skeletal and dental structures. We find that the defects of the fins and scales are due to the role of Eda signaling in organizing epidermal cells into discrete signaling centers of the scale epidermal placode and fin fold. Our genetic analysis demonstrates dose-sensitive and organ-specific response to alteration in levels of Eda signaling. In addition, we show substantial buffering of the effect of loss of edar function in different genetic backgrounds, suggesting canalization of this developmental system. We uncover a previously unknown role of Eda signaling in teleosts and show conservation of the developmental mechanisms involved in the formation and variation of both integumentary appendages and limbs. Lastly, our findings point to the utility of adult genetic screens in the zebrafish in identifying essential developmental processes involved in human disease and in morphological evolution.

  8. Zebrafish eda and edar Mutants Reveal Conserved and Ancestral Roles of Ectodysplasin Signaling in Vertebrates

    Science.gov (United States)

    Harris, Matthew P.; Rohner, Nicolas; Schwarz, Heinz; Perathoner, Simon; Konstantinidis, Peter; Nüsslein-Volhard, Christiane

    2008-01-01

    The genetic basis of the development and variation of adult form of vertebrates is not well understood. To address this problem, we performed a mutant screen to identify genes essential for the formation of adult skeletal structures of the zebrafish. Here, we describe the phenotypic and molecular characterization of a set of mutants showing loss of adult structures of the dermal skeleton, such as the rays of the fins and the scales, as well as the pharyngeal teeth. The mutations represent adult-viable, loss of function alleles in the ectodysplasin (eda) and ectodysplasin receptor (edar) genes. These genes are frequently mutated in the human hereditary disease hypohidrotic ectodermal dysplasia (HED; OMIM 224900, 305100) that affects the development of integumentary appendages such as hair and teeth. We find mutations in zebrafish edar that affect similar residues as mutated in human cases of HED and show similar phenotypic consequences. eda and edar are not required for early zebrafish development, but are rather specific for the development of adult skeletal and dental structures. We find that the defects of the fins and scales are due to the role of Eda signaling in organizing epidermal cells into discrete signaling centers of the scale epidermal placode and fin fold. Our genetic analysis demonstrates dose-sensitive and organ-specific response to alteration in levels of Eda signaling. In addition, we show substantial buffering of the effect of loss of edar function in different genetic backgrounds, suggesting canalization of this developmental system. We uncover a previously unknown role of Eda signaling in teleosts and show conservation of the developmental mechanisms involved in the formation and variation of both integumentary appendages and limbs. Lastly, our findings point to the utility of adult genetic screens in the zebrafish in identifying essential developmental processes involved in human disease and in morphological evolution. PMID:18833299

  9. Radiation studies in Cajanus cajan: meiotic behaviour in some M/sub 2/ mutants

    Energy Technology Data Exchange (ETDEWEB)

    Sinha, S.S.N.; Akhaury, S.B. (Ranchi Univ. (India). Dept. of Botany)

    1982-01-01

    A qualitative study of the mutants produced in M/sub 2/ generation has been made. The mutants were classified as: (1) chlorophyll mutant, (2) morphological mutant, (3) pollen mutant, (4) semi-sterile and (5) sterile mutant. Cytological investigations of pollen mutants, sterile and semi-sterile mutants have revealed that these mutants generally arise at higher dose levels (20 Kr and 25 Kr).

  10. Molecular analysis of mutants of the Neurospora adenylosuccinate ...

    Indian Academy of Sciences (India)

    2012-08-07

    Aug 7, 2012 ... and mutants induced with X-ray, UV or chemical mutagens. ... We have sequenced the ad-8 locus from 13 of these mutants and identified the molecular nature ..... mutants in yeast by selection for constitutive behavior in pig-.

  11. Biological changes in Barley mutants resistant to powdery mildew disease

    International Nuclear Information System (INIS)

    Amer, I. M.; Fahim, M. M.; Moustafa, N. A.

    2012-12-01

    physiological studies showed that all kinds of chlorophyll (a), (b) and (a + b) content in infected plant were decreased while, the carotenes pigment were increased. Infection generally reduced total sugars content of all resistant mutants. Infected resistant mutant showed more phenols content and peroxidase, polyphenoloxidase activities than healthy ones of the mutants. (Author)

  12. C4 plants use fluctuating light less efficiently than do C3 plants: a study of growth, photosynthesis and carbon isotope discrimination.

    Science.gov (United States)

    Kubásek, Jiří; Urban, Otmar; Šantrůček, Jiří

    2013-12-01

    Plants in the field are commonly exposed to fluctuating light intensity, caused by variable cloud cover, self-shading of leaves in the canopy and/or leaf movement due to turbulence. In contrast to C3 plant species, only little is known about the effects of dynamic light (DL) on photosynthesis and growth in C4 plants. Two C4 and two C3 monocot and eudicot species were grown under steady light or DL conditions with equal sum of daily incident photon flux. We measured leaf gas exchange, plant growth and dry matter carbon isotope discrimination to infer CO2 bundle sheath leakiness in C4 plants. The growth of all species was reduced by DL, despite only small changes in steady-state gas exchange characteristics, and this effect was more pronounced in C4 than C3 species due to lower assimilation at light transitions. This was partially attributed to increased bundle sheath leakiness in C4 plants under the simulated lightfleck conditions. We hypothesize that DL leads to imbalances in the coordination of C4 and C3 cycles and increasing leakiness, thereby decreasing the quantum efficiency of photosynthesis. In addition to their other constraints, the inability of C4 plants to efficiently utilize fluctuating light likely contributes to their absence in such environments as forest understoreys. © 2013 Scandinavian Plant Physiology Society.

  13. Maternal topoisomerase II alpha, not topoisomerase II beta, enables embryonic development of zebrafish top2a-/- mutants

    LENUS (Irish Health Repository)

    Sapetto-Rebow, Beata

    2011-11-23

    Abstract Background Genetic alterations in human topoisomerase II alpha (TOP2A) are linked to cancer susceptibility. TOP2A decatenates chromosomes and thus is necessary for multiple aspects of cell division including DNA replication, chromosome condensation and segregation. Topoisomerase II alpha is also required for embryonic development in mammals, as mouse Top2a knockouts result in embryonic lethality as early as the 4-8 cell stage. The purpose of this study was to determine whether the extended developmental capability of zebrafish top2a mutants arises from maternal expression of top2a or compensation from its top2b paralogue. Results Here, we describe bloody minded (blm), a novel mutant of zebrafish top2a. In contrast to mouse Top2a nulls, zebrafish top2a mutants survive to larval stages (4-5 day post fertilization). Developmental analyses demonstrate abundant expression of maternal top2a but not top2b. Inhibition or poisoning of maternal topoisomerase II delays embryonic development by extending the cell cycle M-phase. Zygotic top2a and top2b are co-expressed in the zebrafish CNS, but endogenous or ectopic top2b RNA appear unable to prevent the blm phenotype. Conclusions We conclude that maternal top2a enables zebrafish development before the mid-zygotic transition (MZT) and that zebrafish top2a and top2b are not functionally redundant during development after activation of the zygotic genome.

  14. Maternal topoisomerase II alpha, not topoisomerase II beta, enables embryonic development of zebrafish top2a-/- mutants

    Directory of Open Access Journals (Sweden)

    Sapetto-Rebow Beata

    2011-11-01

    Full Text Available Abstract Background Genetic alterations in human topoisomerase II alpha (TOP2A are linked to cancer susceptibility. TOP2A decatenates chromosomes and thus is necessary for multiple aspects of cell division including DNA replication, chromosome condensation and segregation. Topoisomerase II alpha is also required for embryonic development in mammals, as mouse Top2a knockouts result in embryonic lethality as early as the 4-8 cell stage. The purpose of this study was to determine whether the extended developmental capability of zebrafish top2a mutants arises from maternal expression of top2a or compensation from its top2b paralogue. Results Here, we describe bloody minded (blm, a novel mutant of zebrafish top2a. In contrast to mouse Top2a nulls, zebrafish top2a mutants survive to larval stages (4-5 day post fertilization. Developmental analyses demonstrate abundant expression of maternal top2a but not top2b. Inhibition or poisoning of maternal topoisomerase II delays embryonic development by extending the cell cycle M-phase. Zygotic top2a and top2b are co-expressed in the zebrafish CNS, but endogenous or ectopic top2b RNA appear unable to prevent the blm phenotype. Conclusions We conclude that maternal top2a enables zebrafish development before the mid-zygotic transition (MZT and that zebrafish top2a and top2b are not functionally redundant during development after activation of the zygotic genome.

  15. LC-MS/MS quantification of 7α-hydroxy-4-cholesten-3-one (C4) in rat and monkey plasma.

    Science.gov (United States)

    Kang, Lijuan; Connolly, Thomas M; Weng, Naidong; Jian, Wenying

    2017-10-01

    7α-hydroxy-4-cholesten-3-one (C4) is an oxidative enzymatic product of cholesterol metabolism via cholesterol 7α-hydroxylase, an enzyme also known as cholesterol 7-alpha-monooxygenase or cytochrome P450 7A1 (CYP7A1). C4 is a stable intermediate in the rate limiting pathway of bile acid biosynthesis. Previous studies showed that plasma C4 levels correlated with CYP7A1 enzymatic activity and could serve as a biomarker for bile acid synthesis. Here we developed and qualified a simple and robust high-throughput method using liquid chromatography coupled with tandem mass spectrometry (LC-MS/MS) to quantify C4 in rat and monkey plasma. As C4 being an endogenous compound, this method used calibration standards in 50/50: acetonitrile/water (v/v). In order to mimic the incurred samples, quality control samples were prepared in the authentic plasma. Stable isotope labeled C4 (C4-d 7 ) was used as the internal standard. The sample volume for analysis was 20μL and the sample preparation method was protein precipitation with acetonitrile. The average endogenous C4 concentrations, from 10 different lots of rat and monkey plasma, were 53.0±16.5ng/mL and 6.8±5.6ng/mL, respectively. Based on these observed endogenous C4 levels, the calibration curve ranges were established at 1-200ng/mL and 0.5-100ng/mL for rat assay and monkey assay, respectively. The method was qualified with acceptable accuracy, precision, linearity, and specificity. Matrix effect, recovery, and plasma stability of bench-top, freeze-thaw, and long-term frozen storage were also evaluated. The method has been successfully applied to pre-clinical studies. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Gamma-radiation Mutagenesis in Genetically Unstable Barley Mutants. Pt. 1. Chlorophyll Mutations in Allelic tw Mutants and Their Revertants

    International Nuclear Information System (INIS)

    Vaitkuniene, V.

    1995-01-01

    Genotypical environment is an essential factor determining the mutability of mutants of the same type. Decreased chlorophyll mutant frequency was a common characteristic of all tested tw type (tw, tw 1 , tw 2 ) mutants induced in barley c. 'Auksiniai II'. The mutability of all the tested revertants was close to that of the initial c. 'Auksiniai II'. (author). 9 refs., 2 tabs

  17. Stacking reactions of the borole complex Cp*Rh(η5-C4H4BPh) with the dicationic fragments [Cp*M]2+ (M = Rh or Ir)

    International Nuclear Information System (INIS)

    Loginov, D.A.; Muratov, D.V.; Starikova, Z.A.; Petrovskij, P.V.; Kudinov, A.R.

    2006-01-01

    The reaction of the (borole)rhodium iodide complex [(η-C 4 H 4 BPh)RhI] 4 with Cp*Li afforded the sandwich compound Cp*Rh(η-C 4 H 4 BPh) (1). The reactions of compound 1 with the solvated complexes [Cp*M(MeNO 2 ) 3 ] 2+ (BF 4 - ) 2 gave triple-decker cationic complexes with the central borole ligand [Cp*Rh(μ-η 5 :η 5 -C 4 H 4 BPh)MCp*] 2+ (BF 4 - ) 2 (M = Rh or Ir). The structure of complex 1 was established by X-ray diffraction [ru

  18. Expression of C4.4A, a structural uPAR homolog, reflects squamous epithelial differentiation in the adult mouse and during embryogenesis

    DEFF Research Database (Denmark)

    Kriegbaum, Mette Camilla; Jacobsen, Benedikte; Hald, Andreas

    2011-01-01

    by a comprehensive immunohistochemical mapping. This task was accomplished by staining paraffin-embedded tissues with a specific rabbit polyclonal anti-C4.4A antibody. In the adult mouse, C4.4A was predominantly expressed in the suprabasal layers of the squamous epithelia of the oral cavity, esophagus, non...... expression first appears in the developing squamous epithelium at embryonic day 13.5. This anatomical location of C4.4A is thus concordant with a possible functional role in early differentiation of stratified squamous epithelia....

  19. Identification of new developmentally regulated genes involved in Streptomyces coelicolor sporulation.

    Science.gov (United States)

    Salerno, Paola; Persson, Jessica; Bucca, Giselda; Laing, Emma; Ausmees, Nora; Smith, Colin P; Flärdh, Klas

    2013-12-05

    The sporulation of aerial hyphae of Streptomyces coelicolor is a complex developmental process. Only a limited number of the genes involved in this intriguing morphological differentiation programme are known, including some key regulatory genes. The aim of this study was to expand our knowledge of the gene repertoire involved in S. coelicolor sporulation. We report a DNA microarray-based investigation of developmentally controlled gene expression in S. coelicolor. By comparing global transcription patterns of the wild-type parent and two mutants lacking key regulators of aerial hyphal sporulation, we found a total of 114 genes that had significantly different expression in at least one of the two mutants compared to the wild-type during sporulation. A whiA mutant showed the largest effects on gene expression, while only a few genes were specifically affected by whiH mutation. Seven new sporulation loci were investigated in more detail with respect to expression patterns and mutant phenotypes. These included SCO7449-7451 that affect spore pigment biogenesis; SCO1773-1774 that encode an L-alanine dehydrogenase and a regulator-like protein and are required for maturation of spores; SCO3857 that encodes a protein highly similar to a nosiheptide resistance regulator and affects spore maturation; and four additional loci (SCO4421, SCO4157, SCO0934, SCO1195) that show developmental regulation but no overt mutant phenotype. Furthermore, we describe a new promoter-probe vector that takes advantage of the red fluorescent protein mCherry as a reporter of cell type-specific promoter activity. Aerial hyphal sporulation in S. coelicolor is a technically challenging process for global transcriptomic investigations since it occurs only as a small fraction of the colony biomass and is not highly synchronized. Here we show that by comparing a wild-type to mutants lacking regulators that are specifically affecting processes in aerial hypha, it is possible to identify previously

  20. Quantum-Chemical ab initio Calculations on the Three Isomers of Diborabenzene (C4H4B2)

    Science.gov (United States)

    Singh, Jaswinder; Wang, Yuekui; Raabe, Gerhard

    2010-01-01

    Quantum-chemical ab initio calculations up to the ZPE+CCSD(T)/aug-cc-pVTZ//MP2/6- 311++G** level were performed on three possible structural isomers of diborabenzene (C4H4B2). All three molecules were found to be local minima on the C4H4B2 energy surface and to have closed shell singlet ground states. While the ground states of the 1,3- and 1,4-isomer are planar and of C2v and D2h symmetry, respectively, 1,2-diborabenzene is non-planar with a C2 axis passing through the center of the BB bond and the middle of the opposite carbon-carbon bond as the only symmetry element. The energetically most favourable 1,3-diborabenzene was found to be about 19 and 36 kcal/mol lower in energy than the 1,2- and the 1,4-isomer. Planar 1,3- and 1,4-diborabenzene have three doubly occupied π orbitals while non-planar 1,2-diborabenzene has also three doubly occupied orbitals which can be derived from the π orbitals of its 3.7 kcal/mol energetically less favourable planar form ("π-like" orbitals). The lowest unoccupied orbitals of all three isomers have σ symmetry with large coefficients at the two boron atoms. These orbitals are lower in energy than the lowest unoccupied molecular orbitals (LUMOs) of e. g. benzene and pyridine and might cause pronounced acceptor properties which could be one of the reasons for the elusiveness of the title compounds. The results of bond separation reactions show that cyclic conjugation stabilizes all three diborabenzenes relative to their isolated fragments. The most effective stabilization energy of about 24 kcal/mol was found for the energetically lowest 1,3-isomer. This value amounts to approximately one third of the experimental value for the bond separation energy of pyridine. In all cases the energetically lowest triplet states are significantly (16 - 24 kcal/mol) higher in energy than the singlet ground states. Also among the triplets the 1,3-isomer is the energetically most fabourable species.

  1. High yielding mutants of blackgram variety 'PH-25'

    International Nuclear Information System (INIS)

    Misra, R.C.; Mohapatra, B.D.; Panda, B.S.

    2001-01-01

    Seeds of blackgram (Vigna mungo L.) variety 'PH-5' were treated with chemical mutagens ethyl methanesulfonate (EMS), nitrosoguanidine (NG), maleic hydrazide (MH) and sodium azide (NaN 3 ), each at 3 different concentrations. Thirty six mutant lines developed from mutagenic treatments along with parent varieties were tested in M 4 generation. The mutants showed wide variation in most of the traits and multivariante D 2 analysis showed genetic divergence among themselves. Twenty of the thirty mutants showed genetic divergence from parent. Ten selected high yielding mutants were tested in M 5 . Yield and other productive traits of five high yielding mutants in M 4 and M 5 are presented

  2. Dearth and Delayed Maturation of Testicular Germ Cells in Fanconi Anemia E Mutant Male Mice.

    Directory of Open Access Journals (Sweden)

    Chun Fu

    Full Text Available After using a self-inactivating lentivirus for non-targeted insertional mutagenesis in mice, we identified a transgenic family with a recessive mutation that resulted in reduced fertility in homozygous transgenic mice. The lentiviral integration site was amplified by inverse PCR. Sequencing revealed that integration had occurred in intron 8 of the mouse Fance gene, which encodes the Fanconi anemia E (Fance protein. Fanconi anemia (FA proteins play pivotal roles in cellular responses to DNA damage and Fance acts as a molecular bridge between the FA core complex and Fancd2. To investigate the reduced fertility in the mutant males, we analyzed postnatal development of testicular germ cells. At one week after birth, most tubules in the mutant testes contained few or no germ cells. Over the next 2-3 weeks, germ cells accumulated in a limited number of tubules, so that some tubules contained germ cells around the full periphery of the tubule. Once sufficient numbers of germ cells had accumulated, they began to undergo the later stages of spermatogenesis. Immunoassays revealed that the Fancd2 protein accumulated around the periphery of the nucleus in normal developing spermatocytes, but we did not detect a similar localization of Fancd2 in the Fance mutant testes. Our assays indicate that although Fance mutant males are germ cell deficient at birth, the extant germ cells can proliferate and, if they reach a threshold density, can differentiate into mature sperm. Analogous to previous studies of FA genes in mice, our results show that the Fance protein plays an important, but not absolutely essential, role in the initial developmental expansion of the male germ line.

  3. Gravity-dependent differentiation and root coils in Arabidopsis thaliana wild type and phospholipase-A-I knockdown mutant grown on the International Space Station.

    Science.gov (United States)

    Scherer, G F E; Pietrzyk, P

    2014-01-01

    Arabidopsis roots on 45° tilted agar in 1-g grow in wave-like figures. In addition to waves, formation of root coils is observed in several mutants compromised in gravitropism and/or auxin transport. The knockdown mutant ppla-I-1 of patatin-related phospholipase-A-I is delayed in root gravitropism and forms increased numbers of root coils. Three known factors contribute to waving: circumnutation, gravisensing and negative thigmotropism. In microgravity, deprivation of wild type (WT) and mutant roots of gravisensing and thigmotropism and circumnutation (known to slow down in microgravity, and could potentially lead to fewer waves or increased coiling in both WT and mutant). To resolve this, mutant ppla-I-1 and WT were grown in the BIOLAB facility in the International Space Station. In 1-g, roots of both types only showed waving. In the first experiment in microgravity, the mutant after 9 days formed far more coils than in 1-g but the WT also formed several coils. After 24 days in microgravity, in both types the coils were numerous with slightly more in the mutant. In the second experiment, after 9 days in microgravity only the mutant formed coils and the WT grew arcuated roots. Cell file rotation (CFR) on the mutant root surface in microgravity decreased in comparison to WT, and thus was not important for coiling. Several additional developmental responses (hypocotyl elongation, lateral root formation, cotyledon expansion) were found to be gravity-influenced. We tentatively discuss these in the context of disturbances in auxin transport, which are known to decrease through lack of gravity. © 2013 German Botanical Society and The Royal Botanical Society of the Netherlands.

  4. Vaporization, fusion and sublimation enthalpies of the dicarboxylic acids from C4 to C14 and C16

    International Nuclear Information System (INIS)

    Roux, Maria Victoria; Temprado, Manuel; Chickos, James S.

    2005-01-01

    The fusion enthalpies of the series butanedioic acid through to tetradecanedioic acid and hexadecanedioic acids have been measured by DSC. In addition to fusion, a number of solid-solid phase transitions have also been detected in these diacids. The vaporization enthalpies of these compounds have been measured by correlation gas chromatography using the vaporization enthalpies of butanedioic, hexanedioic and decanedioic acids as standards. The vaporization enthalpies of the diacids from C 4 to C 10 correlated linearly with the number of methylene groups present. Above C 10 , the vaporization enthalpies of C 11 -C 14 and C 16 begin to deviate from linearity. The vaporization enthalpies for these compounds are dependent on the temperature of the GC column used. Similar departure from linearity has also been observed previously in the sublimation enthalpies for these compounds. The results are discussed in terms of formation of a cyclic intramolecular hydrogen bonded network in the gas phase similar to the bimolecular association observed in smaller mono-carboxylic acids at ambient temperatures

  5. Alternative electrode placement in (automatic) sleep scoring (Fpz-Cz/Pz-Oz versus C4-A1).

    Science.gov (United States)

    van Sweden, B; Kemp, B; Kamphuisen, H A; Van der Velde, E A

    1990-06-01

    The purpose of this study is to investigate whether the international standard electrode placement (C4-A1) can be replaced by an alternative placement (Fpz-Cz/Pz-Oz) in an automatic sleep monitoring system without losing Rechtschaffen and Kales (R-K) balances. Single night-sleep polygraphic recordings of 10 patients, screened in a clinical sleep disorder setting, were recorded simultaneously with both placements, and visual sleep classification was performed separately by two independent observers. Interobserver and interplacement agreement were evaluated by way of average (dis)agreement matrices and kappa values computed for overall and individual stage scoring. Interobserver agreement for both the test and the standard electrode placements and interplacement agreement for both observers were assessed as fair to good or excellent. Scoring differences were evaluated by the rank sign test applied to clinical and theoretical difference scores. It appears that the interplacement differences are about equal to the interobserver differences, except for a slight tendency for sleep to be scored in a deeper stage with the proposed alternative placement. The data are presented and discussed in relation to current literature concepts.

  6. Duplication and Loss of Function of Genes Encoding RNA Polymerase III Subunit C4 Causes Hybrid Incompatibility in Rice

    Directory of Open Access Journals (Sweden)

    Giao Ngoc Nguyen

    2017-08-01

    Full Text Available Reproductive barriers are commonly observed in both animals and plants, in which they maintain species integrity and contribute to speciation. This report shows that a combination of loss-of-function alleles at two duplicated loci, DUPLICATED GAMETOPHYTIC STERILITY 1 (DGS1 on chromosome 4 and DGS2 on chromosome 7, causes pollen sterility in hybrid progeny derived from an interspecific cross between cultivated rice, Oryza sativa, and an Asian annual wild rice, O. nivara. Male gametes carrying the DGS1 allele from O. nivara (DGS1-nivaras and the DGS2 allele from O. sativa (DGS2-T65s were sterile, but female gametes carrying the same genotype were fertile. We isolated the causal gene, which encodes a protein homologous to DNA-dependent RNA polymerase (RNAP III subunit C4 (RPC4. RPC4 facilitates the transcription of 5S rRNAs and tRNAs. The loss-of-function alleles at DGS1-nivaras and DGS2-T65s were caused by weak or nonexpression of RPC4 and an absence of RPC4, respectively. Phylogenetic analysis demonstrated that gene duplication of RPC4 at DGS1 and DGS2 was a recent event that occurred after divergence of the ancestral population of Oryza from other Poaceae or during diversification of AA-genome species.

  7. New insight into the spatiotemporal variability and source apportionments of C1-C4 alkyl nitrates in Hong Kong

    Science.gov (United States)

    Ling, Zhenhao; Guo, Hai; Simpson, Isobel Jane; Saunders, Sandra Maria; Lam, Sean Ho Man; Lyu, Xiaopu; Blake, Donald Ray

    2016-07-01

    C1-C4 alkyl nitrates (RONO2) were measured concurrently at a mountain site, Tai Mo Shan (TMS), and an urban site, Tsuen Wan (TW), at the base of the same mountain in Hong Kong from September to November 2010. Although the levels of parent hydrocarbons were much lower at TMS (p TMS mainly resulted from the photooxidation of the parent hydrocarbons at TW during mesoscale circulation, i.e., valley breezes, corresponding to 52-86 % of the alkyl nitrate levels at TMS. Furthermore, regional transport from the inland PRD region made significant contributions to the levels of alkyl nitrates (˜ 58-82 %) at TMS in the non-meso scenario, resulting in similar levels of alkyl nitrates observed at the two sites. The simulation of secondary formation pathways using a photochemical box model found that the reaction of alkyl peroxy radicals (RO2) with nitric oxide (NO) dominated the formation of RONO2 at both sites, and the formation of alkyl nitrates contributed negatively to O3 production, with average reduction rates of 4.1 and 4.7 pptv pptv-1 at TMS and TW, respectively.

  8. Pasteurella pneumotropica evades the human complement system by acquisition of the complement regulators factor H and C4BP.

    Directory of Open Access Journals (Sweden)

    Alfredo Sahagún-Ruiz

    Full Text Available Pasteurella pneumotropica is an opportunist Gram negative bacterium responsible for rodent pasteurellosis that affects upper respiratory, reproductive and digestive tracts of mammals. In animal care facilities the presence of P. pneumotropica causes severe to lethal infection in immunodeficient mice, being also a potential source for human contamination. Indeed, occupational exposure is one of the main causes of human infection by P. pneumotropica. The clinical presentation of the disease includes subcutaneous abscesses, respiratory tract colonization and systemic infections. Given the ability of P. pneumotropica to fully disseminate in the organism, it is quite relevant to study the role of the complement system to control the infection as well as the possible evasion mechanisms involved in bacterial survival. Here, we show for the first time that P. pneumotropica is able to survive the bactericidal activity of the human complement system. We observed that host regulatory complement C4BP and Factor H bind to the surface of P. pneumotropica, controlling the activation pathways regulating the formation and maintenance of C3-convertases. These results show that P. pneumotropica has evolved mechanisms to evade the human complement system that may increase the efficiency by which this pathogen is able to gain access to and colonize inner tissues where it may cause severe infections.

  9. Method for Walking Gait Identification in a Lower Extremity Exoskeleton Based on C4.5 Decision Tree Algorithm

    Directory of Open Access Journals (Sweden)

    Qing Guo

    2015-04-01

    Full Text Available A gait identification method for a lower extremity exoskeleton is presented in order to identify the gait sub-phases in human-machine coordinated motion. First, a sensor layout for the exoskeleton is introduced. Taking the difference between human lower limb motion and human-machine coordinated motion into account, the walking gait is divided into five sub-phases, which are ‘double standing’, ‘right leg swing and left leg stance’, ‘double stance with right leg front and left leg back’, ‘right leg stance and left leg swing’, and ‘double stance with left leg front and right leg back’. The sensors include shoe pressure sensors, knee encoders, and thigh and calf gyroscopes, and are used to measure the contact force of the foot, and the knee joint angle and its angular velocity. Then, five sub-phases of walking gait are identified by a C4.5 decision tree algorithm according to the data fusion of the sensors' information. Based on the simulation results for the gait division, identification accuracy can be guaranteed by the proposed algorithm. Through the exoskeleton control experiment, a division of five sub-phases for the human-machine coordinated walk is proposed. The experimental results verify this gait division and identification method. They can make hydraulic cylinders retract ahead of time and improve the maximal walking velocity when the exoskeleton follows the person's motion.

  10. C4N3H monolayer: A two-dimensional organic Dirac material with high Fermi velocity

    Science.gov (United States)

    Pan, Hongzhe; Zhang, Hongyu; Sun, Yuanyuan; Li, Jianfu; Du, Youwei; Tang, Nujiang

    2017-11-01

    Searching for two-dimensional (2D) organic Dirac materials, which have more adaptable practical applications compared with inorganic ones, is of great significance and has been ongoing. However, only two such materials with low Fermi velocity have been discovered so far. Herein, we report the design of an organic monolayer with C4N3H stoichiometry that possesses fascinating structure and good stability in its free-standing state. More importantly, we demonstrate that this monolayer is a semimetal with anisotropic Dirac cones and very high Fermi velocity. This Fermi velocity is roughly one order of magnitude larger than the largest velocity ever reported in 2D organic Dirac materials, and it is comparable to that in graphene. The Dirac states in this monolayer arise from the extended π -electron conjugation system formed by the overlapping 2 pz orbitals of carbon and nitrogen atoms. Our finding paves the way to a search for more 2D organic Dirac materials with high Fermi velocity.

  11. The Raman Spectrum of the Squarate (C4O4-2 Anion: An Ab Initio Basis Set Dependence Study

    Directory of Open Access Journals (Sweden)

    Miranda Sandro G. de

    2002-01-01

    Full Text Available The Raman excitation profile of the squarate anion, C4O4-2 , was calculated using ab initio methods at the Hartree-Fock using Linear Response Theory (LRT for six excitation frequencies: 632.5, 514.5, 488.0, 457.9, 363.8 and 337.1 nm. Five basis set functions (6-31G*, 6-31+G*, cc-pVDZ, aug-cc-pVDZ and Sadlej's polarizability basis set were investigated aiming to evaluate the performance of the 6-31G* set for numerical convergence and computational cost in relation to the larger basis sets. All basis sets reproduce the main spectroscopic features of the Raman spectrum of this anion for the excitation interval investigated. The 6-31G* basis set presented, on average, the same accuracy of numerical results as the larger sets but at a fraction of the computational cost showing that it is suitable for the theoretical investigation of the squarate dianion and its complexes and derivatives.

  12. Germination of dimorphic seeds of the desert annual halophyte Suaeda aralocaspica (Chenopodiaceae), a C4 plant without Kranz anatomy.

    Science.gov (United States)

    Wang, Lei; Huang, Zhenying; Baskin, Carol C; Baskin, Jerry M; Dong, Ming

    2008-11-01

    Suaeda aralocaspica is a C4 summer annual halophyte without Kranz anatomy that is restricted to the deserts of central Asia. It produces two distinct types of seeds that differ in colour, shape and size. The primary aims of the present study were to compare the dormancy and germination characteristics of dimorphic seeds of S. aralocaspica and to develop a conceptual model of their dynamics. Temperatures simulating those in the natural habitat of S. aralocaspica were used to test for primary dormancy and germination behaviour of fresh brown and black seeds. The effects of cold stratification, gibberellic acid, seed coat scarification, seed coat removal and dry storage on dormancy breaking were tested in black seeds. Germination percentage and recovery responses of brown seeds, non-treated black seeds and 8-week cold-stratified black seeds to salt stress were tested. Brown seeds were non-dormant, whereas black seeds had non-deep Type 2 physiological dormancy (PD). Germination percentage and rate of germination of brown seeds and of variously pretreated black seeds were significantly higher than those of non-pretreated black seeds. Exposure of seeds to various salinities had significant effects on germination, germination recovery and induction into secondary dormancy. A conceptual model is presented that ties these results together and puts them into an ecological context. The two seed morphs of S. aralocaspica exhibit distinct differ