Developmental immunotoxicity testing of 4-methyl anisole.

Science.gov (United States)

Tonk, Elisa C M; Verhoef, Aart; Gremmer, Eric R; van Loveren, Henk; Piersma, Aldert H

2015-07-01

The developmental immunotoxicity of 4-methyl anisole (4MA) was investigated in the rat. Four study designs were used, with either premating or post-weaning onset of exposure, continued to postnatal day 50, and with or without additional oral gavage of pups from postnatal day 10 onward. Reduced litter size (benchmark dose lower confidence limit (BMDL) 80mg/kg bw/day) was the most sensitive developmental parameter, with pup relative organ weight effects observed at similar BMDLs, in the absence of maternal toxicity. Eosinophil numbers were reduced at lower doses (BMDL 16mg/kg bw/day). KLH challenge resulted in increased IL-13 and TNF-α responses, and variably reduced IgG production (BMDL 27mg/kg bw/day). T4 levels were reduced by 11% at maximum with a BMDL of 73mg/kg bw/day. Differences between exposure cohorts were limited and were considered to be without biological significance. This study shows that 4MA induces developmental immunotoxicity at doses below those inducing developmental and general toxicity. These observations being independent of the study designs applied suggest that the post-weaning period, included in all designs, is the most relevant sensitive period for inducing 4MA mediated developmental immunotoxicity. Moreover, this study stresses the importance of including developmental immunotoxicity testing by default in regulatory toxicology. Copyright © 2015 Elsevier Inc. All rights reserved.

Characterization and protective property of Brucella abortus cydC and looP mutants.

Science.gov (United States)

Truong, Quang Lam; Cho, Youngjae; Barate, Abhijit Kashinath; Kim, Suk; Hahn, Tae-Wook

2014-11-01

Brucella abortus readily multiplies in professional or nonprofessional phagocytes in vitro and is highly virulent in mice. Isogenic mutants of B. abortus biovar 1 strain IVKB9007 lacking the ATP/GDP-binding protein motif A (P-loop) (named looP; designated here the IVKB9007 looP::Tn5 mutant) and the ATP-binding/permease protein (cydC; designated here the IVKB9007 cydC::Tn5 mutant) were identified and characterized by transposon mutagenesis using the mini-Tn5Km2 transposon. Both mutants were found to be virtually incapable of intracellular replication in both murine macrophages (RAW264.7) and the HeLa cell line, and their virulence was significantly impaired in BALB/c mice. Respective complementation of the IVKB9007 looP::Tn5 and IVKB9007 cydC::Tn5 mutants restored their ability to survive in vitro and in vivo to a level comparable with that of the wild type. These findings indicate that the cydC and looP genes play important roles in the virulence of B. abortus. In addition, intraperitoneal immunization of mice with a dose of the live IVKB9007 looP::Tn5 and IVKB9007 cydC::Tn5 mutants provided a high degree of protection against challenge with pathogenic B. abortus strain 544. Both mutants should be evaluated further as a live attenuated vaccine against bovine brucellosis for their ability to stimulate a protective immune response. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Tomato golden mosaic virus open reading frame AL4 is genetically distinct from its C4 analogue in monopartite geminiviruses.

Science.gov (United States)

Pooma, W; Petty, I T

1996-08-01

Tomato golden mosaic virus (TGMV) is a bipartite geminivirus with six well-characterized genes. An additional open reading frame (ORF), AL4, lies within the essential AL1 gene. Recent studies of monopartite, dicot-infecting geminiviruses have revealed that mutations in their analogous C4 ORFs have host-specific effects on infectivity, symptomatology, virus movement and/or viral DNA accumulation. We have investigated whether TGMV has a similar host-specific requirement for AL4. The phenotypes of three TGMV al4 mutants were determined in a range of hosts, which included species that revealed c4 mutant phenotypes for monopartite geminiviruses. Each TGMV al4 mutant was indistinguishable from wild-type TGMV in all hosts tested. Additional analyses of double mutants revealed no evidence for functional redundancy between AL4 and the AL3, or AR1 genes. In contrast to the putative C4 proteins of monpartite geminiviruses, TGMV AL4, if it is expressed, is either non-functional, or functionally redundant with an essential TGMV gene product.

Sodium 4-phenylbutyrate ameliorates the effects of cataract-causing mutant gammaD-crystallin in cultured cells.

Science.gov (United States)

Gong, Bo; Zhang, Li-Yun; Lam, Dennis Shun-Chiu; Pang, Chi-Pui; Yam, Gary Hin-Fai

2010-06-04

gammaD-Crystallin (CRYGD) is a major structural lens crystallin and its mutations result in congenital cataract formation. In this study, we attempted to correct the altered protein features of G165fsX8 CRYGD protein with small chemical molecules. Recombinant FLAG-tagged mutants (R15C, R15S, P24T, R61C, and G165fsX8) of CRYGD were expressed in COS-7 cells and treated with small chemical molecules with reported protein chaperoning properties (sodium 4-phenylbutyrate [4-PBA], trimethylamine N-oxide [TMAO], and glycerol and DMSO [DMSO]). Protein solubility in 0.5% Triton X-100 and subcellular distribution was examined by western blotting and immunofluorescence, respectively. Apoptosis was assayed as the percentage of fragmented nuclei in transfected cells. Expression of heat-shock proteins (Hsp70 and Hsp90) was examined by reverse transcription-polymerase chain reaction analysis. Unlike WT and most mutants (R15C, R15S, P24T, and R61C) of CRYGD, G165fsX8 CRYGD was significantly insoluble in 0.5% Triton X-100. This insolubility was alleviated by dose-dependent 4-PBA treatment. The treatment relieved the mislocalization of G165fsX8 CRYGD from the nuclear envelope. Also, 4-PBA treatment reduced cell apoptosis and caused an upregulation of Hsp70. 4-PBA treatment reduced the defective phenotype of mutant G165fsX8 CRYGD and rescued the affected cells from apoptosis. This could be a potential treatment for lens structural protein and prevent lens opacity in cataract formation.

Involvement of C4 protein of beet severe curly top virus (family Geminiviridae in virus movement.

Directory of Open Access Journals (Sweden)

Kunling Teng

Full Text Available BACKGROUND: Beet severe curly top virus (BSCTV is a leafhopper transmitted geminivirus with a monopartite genome. C4 proteins encoded by geminivirus play an important role in virus/plant interaction. METHODS AND FINDINGS: To understand the function of C4 encoded by BSCTV, two BSCTV mutants were constructed by introducing termination codons in ORF C4 without affecting the amino acids encoded by overlapping ORF Rep. BSCTV mutants containing disrupted ORF C4 retained the ability to replicate in Arabidopsis protoplasts and in the agro-inoculated leaf discs of N. benthamiana, suggesting C4 is not required for virus DNA replication. However, both mutants did not accumulate viral DNA in newly emerged leaves of inoculated N. benthamiana and Arabidopsis, and the inoculated plants were asymptomatic. We also showed that C4 expression in plant could help C4 deficient BSCTV mutants to move systemically. C4 was localized in the cytosol and the nucleus in both Arabidopsis protoplasts and N. benthamiana leaves and the protein appeared to bind viral DNA and ds/ssDNA nonspecifically, displaying novel DNA binding properties. CONCLUSIONS: Our results suggest that C4 protein in BSCTV is involved in symptom production and may facilitate virus movement instead of virus replication.

Systems approaches to predict the functions of glycoside hydrolases during the life cycle of Aspergillus niger using developmental mutants ∆brlA and ∆flbA.

Directory of Open Access Journals (Sweden)

Jolanda M van Munster

Full Text Available The filamentous fungus Aspergillus niger encounters carbon starvation in nature as well as during industrial fermentations. In response, regulatory networks initiate and control autolysis and sporulation. Carbohydrate-active enzymes play an important role in these processes, for example by modifying cell walls during spore cell wall biogenesis or in cell wall degradation connected to autolysis.In this study, we used developmental mutants (ΔflbA and ΔbrlA which are characterized by an aconidial phenotype when grown on a plate, but also in bioreactor-controlled submerged cultivations during carbon starvation. By comparing the transcriptomes, proteomes, enzyme activities and the fungal cell wall compositions of a wild type A. niger strain and these developmental mutants during carbon starvation, a global overview of the function of carbohydrate-active enzymes is provided. Seven genes encoding carbohydrate-active enzymes, including cfcA, were expressed during starvation in all strains; they may encode enzymes involved in cell wall recycling. Genes expressed in the wild-type during starvation, but not in the developmental mutants are likely involved in conidiogenesis. Eighteen of such genes were identified, including characterized sporulation-specific chitinases and An15g02350, member of the recently identified carbohydrate-active enzyme family AA11. Eight of the eighteen genes were also expressed, independent of FlbA or BrlA, in vegetative mycelium, indicating that they also have a role during vegetative growth. The ΔflbA strain had a reduced specific growth rate, an increased chitin content of the cell wall and specific expression of genes that are induced in response to cell wall stress, indicating that integrity of the cell wall of strain ΔflbA is reduced.The combination of the developmental mutants ΔflbA and ΔbrlA resulted in the identification of enzymes involved in cell wall recycling and sporulation-specific cell wall modification

Systems Approaches to Predict the Functions of Glycoside Hydrolases during the Life Cycle of Aspergillus niger Using Developmental Mutants ∆brlA and ∆flbA

Science.gov (United States)

van Munster, Jolanda M.; Nitsche, Benjamin M.; Akeroyd, Michiel; Dijkhuizen, Lubbert; van der Maarel, Marc J. E. C.; Ram, Arthur F. J.

2015-01-01

Background The filamentous fungus Aspergillus niger encounters carbon starvation in nature as well as during industrial fermentations. In response, regulatory networks initiate and control autolysis and sporulation. Carbohydrate-active enzymes play an important role in these processes, for example by modifying cell walls during spore cell wall biogenesis or in cell wall degradation connected to autolysis. Results In this study, we used developmental mutants (ΔflbA and ΔbrlA) which are characterized by an aconidial phenotype when grown on a plate, but also in bioreactor-controlled submerged cultivations during carbon starvation. By comparing the transcriptomes, proteomes, enzyme activities and the fungal cell wall compositions of a wild type A. niger strain and these developmental mutants during carbon starvation, a global overview of the function of carbohydrate-active enzymes is provided. Seven genes encoding carbohydrate-active enzymes, including cfcA, were expressed during starvation in all strains; they may encode enzymes involved in cell wall recycling. Genes expressed in the wild-type during starvation, but not in the developmental mutants are likely involved in conidiogenesis. Eighteen of such genes were identified, including characterized sporulation-specific chitinases and An15g02350, member of the recently identified carbohydrate-active enzyme family AA11. Eight of the eighteen genes were also expressed, independent of FlbA or BrlA, in vegetative mycelium, indicating that they also have a role during vegetative growth. The ΔflbA strain had a reduced specific growth rate, an increased chitin content of the cell wall and specific expression of genes that are induced in response to cell wall stress, indicating that integrity of the cell wall of strain ΔflbA is reduced. Conclusion The combination of the developmental mutants ΔflbA and ΔbrlA resulted in the identification of enzymes involved in cell wall recycling and sporulation-specific cell wall

Mutants of Escherichia coli K-12 with enhanced resistance to ionizing radiation. 4. Peculiarities of recombination in Gamsup(r) mutants

International Nuclear Information System (INIS)

Bresler, S.E.; Kalinin, V.L.; Laneeva, N.I.

1984-01-01

Radioresistant mutant Gam sup(r) 444 differs from a wild type and from Gam sup(r) 445 mutant in decreased frequency of long episome heritage ORF 1 (pur E + -tsx + -proC + -lac + ) and F 14 (ilv + -argE + ), containing hot points of RecRecF - depending recombination and in increased frequency of chromosome mobilization and integrative suppression of temperature sensitive dna A46 mutation by sexual factor F. In this respect Gam sup(r) 444 mutant resembles rec BC sbs B mutant with RecF - recombination type

Hierarchical mutational events compensate for glutamate auxotrophy of a Bacillus subtilis gltC mutant.

Science.gov (United States)

Dormeyer, Miriam; Lübke, Anastasia L; Müller, Peter; Lentes, Sabine; Reuß, Daniel R; Thürmer, Andrea; Stülke, Jörg; Daniel, Rolf; Brantl, Sabine; Commichau, Fabian M

2017-06-01

Glutamate is the major donor of nitrogen for anabolic reactions. The Gram-positive soil bacterium Bacillus subtilis either utilizes exogenously provided glutamate or synthesizes it using the gltAB-encoded glutamate synthase (GOGAT). In the absence of glutamate, the transcription factor GltC activates expression of the GOGAT genes for glutamate production. Consequently, a gltC mutant strain is auxotrophic for glutamate. Using a genetic selection and screening system, we could isolate and differentiate between gltC suppressor mutants in one step. All mutants had acquired the ability to synthesize glutamate, independent of GltC. We identified (i) gain-of-function mutations in the gltR gene, encoding the transcription factor GltR, (ii) mutations in the promoter of the gltAB operon and (iii) massive amplification of the genomic locus containing the gltAB operon. The mutants belonging to the first two classes constitutively expressed the gltAB genes and produced sufficient glutamate for growth. By contrast, mutants that belong to the third class appeared most frequently and solved glutamate limitation by increasing the copy number of the poorly expressed gltAB genes. Thus, glutamate auxotrophy of a B. subtilis gltC mutant can be relieved in multiple ways. Moreover, recombination-dependent amplification of the gltAB genes is the predominant mutational event indicating a hierarchy of mutations. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

[Carcinogenesis and its mechanism of mutant-type[12Asp]K-ras4B gene].

Science.gov (United States)

Gui, Li-ming; Wei, Li-hui; Zhang, Ying-mei; Wang, Jian-liu; Wang, Ying; Chen, Ying; Ma, Da-long

2002-01-01

Ras gene plays an important role in the extra- and intra-cellular signal transduction pathway. It mediates series cascade reactions, and eventually actives transcriptional factors in nucleus. It is unknown on the mechanism of carcinogenesis of Ras gene in endometrial carcinoma, though K-ras mutant is very common in endometrial atypical hyperplasia and carcinoma. On basis of discovering the mutation in 12th codon of K-ras in endometrial carcinoma cell line, HEC-1A, we explored the carcinogenesis and molecular mechanism of mutant-type [12Asp] K-ras4B gene. (1) Full-length [12Asp]K-ras4B cDNA was amplified with RT-PCR, then inserted into pcDI eukaryotic expressive vector. (2) Morphological change, growth kinetics in vitro and tumorigencity in nude mice in vivo after-before transfection were observed. (3) To test the cell growth kinetics by methyl thiazolium tetrazolium (MTT) and [3H]thymidine incorporation method. (1) The authors have successfully constructed eukaryotic expression plasmid pcDI-[12Asp] K-ras4B; (2) To confirm that [12Asp] K-ras4B mutant can trigger the neoplastic transformation of NIH3T3 cells by test in vitro and in vivo. (3) After pMCV-RasN17 plasmid, a Ras mutant were transfected into pcDI-[12Asp] K-ras4B cells, the growth of this cell were restrained significantly in comparison with control group. (4) These findings indicate the expression of RafS621A resulted in remarkable inhibition in proliferation of pcDI-[12Asp]K-ras4B cell (P ras4B cell growth (P ras4B gene alone is able to cause neoplastic transformation in NIH3T3 cells in vitro and in vivo. (2) [12Asp]K-ras4B-induced NIH3T3 cells neoplastic transformation required Raf signaling pathway.

Developmental role of phenylalanine-ammonia-lyase (PAL) and cinnamate 4-hydroxylase (C4H) genes during adventitious rooting of Juglans regia L. microshoots.

Science.gov (United States)

Cheniany, Monireh; Ganjeali, Ali

2016-12-01

Phenylalanine-ammonia-lyase and cinnamate-4-hydroxylase play important role in the phenylpropanoid pathway, which produces many biologically important secondary metabolites participating in normal plant development. Flavonol quercetin is the main representant of these compounds that has been identified in numerous Juglans spp. In this survey, the developmental expression patterns of PAL and C4H genes during in vitro rooting of two walnut cultivars 'Sunland' and 'Howard' was examined by RT-PCR. To understand the potential role in rooting, the changing pattern of endogenous content of quercetin was also analyzed by HPLC. The 'Sunland' with better capacity to root had more quercetin content during the "inductive phase" of rooting than 'Howard'. In each cultivar, the level of PAL transcripts showed the same behavior with the changing patterns of quercetin during root formation of microshoots. The positive correlation between the changes of quercetin and PAL-mRNA indicated that PAL gene may have an immediate effect on flavonoid pathway metabolites including quercetin. Although the behavioral change of C4H expression was similar in both cultivars during root formation (with significantly more level for 'Howard'), it was not coincide with the changes of quercerin concentrations. Our results showed that C4H function is important for the normal development, but its transcriptional regulation does not correlate with quercetin as an efficient phenolic compound for walnut rhizogenesis.

The levels of mutant K-RAS and mutant N-RAS are rapidly reduced in a Beclin1 / ATG5 -dependent fashion by the irreversible ERBB1/2/4 inhibitor neratinib.

Science.gov (United States)

Booth, Laurence; Roberts, Jane L; Poklepovic, Andrew; Kirkwood, John; Sander, Cindy; Avogadri-Connors, Francesca; Cutler, Richard E; Lalani, Alshad S; Dent, Paul

2018-02-01

The FDA approved irreversible inhibitor of ERBB1/2/4, neratinib, was recently shown to rapidly down-regulate the expression of ERBB1/2/4 as well as the levels of c-MET and mutant K-RAS via autophagic degradation. In the present studies, in a dose-dependent fashion, neratinib reduced the expression levels of mutant K-RAS or of mutant N-RAS, which was augmented in an additive to greater than additive fashion by the HDAC inhibitors sodium valproate and AR42. Neratinib could reduce PDGFRα levels in GBM cells, that was enhanced by sodium valproate. Knock down of Beclin1 or of ATG5 prevented neratinib and neratinib combined with sodium valproate / AR42 from reducing the expression of mutant N-RAS in established PDX and fresh PDX models of ovarian cancer and melanoma, respectively. Neratinib and the drug combinations caused the co-localization of mutant RAS proteins and ERBB2 with Beclin1 and cathepsin B. The drug combination activated the AMP-dependent protein kinase that was causal in enhancing HMG Co A reductase phosphorylation. Collectively, our data reinforce the concept that the irreversible ERBB1/2/4 inhibitor neratinib has the potential for use in the treatment of tumors expressing mutant RAS proteins.

Nonsense mutants in the bacteriophage T4D v gene

Energy Technology Data Exchange (ETDEWEB)

Minderhout, L van; Grimbergen, J; Groot, B de [Rijksuniversiteit Leiden (Netherlands). Lab. voor Stralengenetica en Chemische Mutagenese; Cohen (J.A.) Instituut voor Radiopathologie en Stralenbescherming, Leiden (Netherlands))

1975-09-01

Ten UV-sensitive mutants of T4D with the v phenotype were isolated. Of these ten mutants, two are amber and two opal. In UV curves and in photoreactivation and multiplicity reactivation experiments the nonsense mutants show the v phenotype in su/sup -/ hosts and almost the T4/sup +/ phenotype in su/sup +/ hosts. The mutations are located between rl and e and are alleles of v/sub 1/. In crosses with irradiated and non-irradiated phages the recombinant frequency is not reduced by uvs5. Amber uvs5 propagated in CR63 su/sup +/ is with B su/sup -/ just as sensitive to UV as uvs5 propagated in B su/sup -/, which permits the conclusion that the capsid of T4 phage particles does not contain the v gene product.

RNA-seq analysis of an nsdC mutant in Aspergillus flavus

Science.gov (United States)

The C2H2-type transcription factor NsdC (Never in Sexual Development C) has been shown to play a role in asexual development and secondary metabolite production in Aspergillus flavus, an agriculturally relevant, aflatoxin-producing species. The nsdC knoackout mutant demonstrates perturbed morphologi...

Toll-like receptor 4 mutant and null mice retain morphine-induced tolerance, hyperalgesia, and physical dependence.

Directory of Open Access Journals (Sweden)

Theresa Alexandra Mattioli

Full Text Available The innate immune system modulates opioid-induced effects within the central nervous system and one target that has received considerable attention is the toll-like receptor 4 (TLR4. Here, we examined the contribution of TLR4 in the development of morphine tolerance, hyperalgesia, and physical dependence in two inbred mouse strains: C3H/HeJ mice which have a dominant negative point mutation in the Tlr4 gene rendering the receptor non-functional, and B10ScNJ mice which are TLR4 null mutants. We found that neither acute antinociceptive response to a single dose of morphine, nor the development of analgesic tolerance to repeated morphine treatment, was affected by TLR4 genotype. Likewise, opioid induced hyperalgesia and opioid physical dependence (assessed by naloxone precipitated withdrawal were not altered in TLR4 mutant or null mice. We also examined the behavioural consequence of two stereoisomers of naloxone: (- naloxone, an opioid receptor antagonist, and (+ naloxone, a purported antagonist of TLR4. Both stereoisomers of naloxone suppressed opioid induced hyperalgesia in wild-type control, TLR4 mutant, and TLR4 null mice. Collectively, our data suggest that TLR4 is not required for opioid-induced analgesic tolerance, hyperalgesia, or physical dependence.

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

Science.gov (United States)

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Alopecia in a viable phospholipase C delta 1 and phospholipase C delta 3 double mutant.

Directory of Open Access Journals (Sweden)

Fabian Runkel

Full Text Available BACKGROUND: Inositol 1,4,5trisphosphate (IP(3 and diacylglycerol (DAG are important intracellular signalling molecules in various tissues. They are generated by the phospholipase C family of enzymes, of which phospholipase C delta (PLCD forms one class. Studies with functional inactivation of Plcd isozyme encoding genes in mice have revealed that loss of both Plcd1 and Plcd3 causes early embryonic death. Inactivation of Plcd1 alone causes loss of hair (alopecia, whereas inactivation of Plcd3 alone has no apparent phenotypic effect. To investigate a possible synergy of Plcd1 and Plcd3 in postnatal mice, novel mutations of these genes compatible with life after birth need to be found. METHODOLOGY/PRINCIPAL FINDINGS: We characterise a novel mouse mutant with a spontaneously arisen mutation in Plcd3 (Plcd3(mNab that resulted from the insertion of an intracisternal A particle (IAP into intron 2 of the Plcd3 gene. This mutation leads to the predominant expression of a truncated PLCD3 protein lacking the N-terminal PH domain. C3H mice that carry one or two mutant Plcd3(mNab alleles are phenotypically normal. However, the presence of one Plcd3(mNab allele exacerbates the alopecia caused by the loss of functional Plcd1 in Del(9olt1Pas mutant mice with respect to the number of hair follicles affected and the body region involved. Mice double homozygous for both the Del(9olt1Pas and the Plcd3(mNab mutations survive for several weeks and exhibit total alopecia associated with fragile hair shafts showing altered expression of some structural genes and shortened phases of proliferation in hair follicle matrix cells. CONCLUSIONS/SIGNIFICANCE: The Plcd3(mNab mutation is a novel hypomorphic mutation of Plcd3. Our investigations suggest that Plcd1 and Plcd3 have synergistic effects on the murine hair follicle in specific regions of the body surface.

Identification of Photosynthesis-Associated C4 Candidate Genes through Comparative Leaf Gradient Transcriptome in Multiple Lineages of C3 and C4 Species

Science.gov (United States)

Ding, Zehong; Weissmann, Sarit; Wang, Minghui; Du, Baijuan; Huang, Lei; Wang, Lin; Tu, Xiaoyu; Zhong, Silin; Myers, Christopher; Brutnell, Thomas P.; Sun, Qi; Li, Pinghua

2015-01-01

Leaves of C4 crops usually have higher radiation, water and nitrogen use efficiencies compared to the C3 species. Engineering C4 traits into C3 crops has been proposed as one of the most promising ways to repeal the biomass yield ceiling. To better understand the function of C4 photosynthesis, and to identify candidate genes that are associated with the C4 pathways, a comparative transcription network analysis was conducted on leaf developmental gradients of three C4 species including maize, green foxtail and sorghum and one C3 species, rice. By combining the methods of gene co-expression and differentially co-expression networks, we identified a total of 128 C4 specific genes. Besides the classic C4 shuttle genes, a new set of genes associated with light reaction, starch and sucrose metabolism, metabolites transportation, as well as transcription regulation, were identified as involved in C4 photosynthesis. These findings will provide important insights into the differential gene regulation between C3 and C4 species, and a good genetic resource for establishing C4 pathways in C3 crops. PMID:26465154

Identification of Photosynthesis-Associated C4 Candidate Genes through Comparative Leaf Gradient Transcriptome in Multiple Lineages of C3 and C4 Species.

Science.gov (United States)

Ding, Zehong; Weissmann, Sarit; Wang, Minghui; Du, Baijuan; Huang, Lei; Wang, Lin; Tu, Xiaoyu; Zhong, Silin; Myers, Christopher; Brutnell, Thomas P; Sun, Qi; Li, Pinghua

2015-01-01

Leaves of C4 crops usually have higher radiation, water and nitrogen use efficiencies compared to the C3 species. Engineering C4 traits into C3 crops has been proposed as one of the most promising ways to repeal the biomass yield ceiling. To better understand the function of C4 photosynthesis, and to identify candidate genes that are associated with the C4 pathways, a comparative transcription network analysis was conducted on leaf developmental gradients of three C4 species including maize, green foxtail and sorghum and one C3 species, rice. By combining the methods of gene co-expression and differentially co-expression networks, we identified a total of 128 C4 specific genes. Besides the classic C4 shuttle genes, a new set of genes associated with light reaction, starch and sucrose metabolism, metabolites transportation, as well as transcription regulation, were identified as involved in C4 photosynthesis. These findings will provide important insights into the differential gene regulation between C3 and C4 species, and a good genetic resource for establishing C4 pathways in C3 crops.

Identification of Photosynthesis-Associated C4 Candidate Genes through Comparative Leaf Gradient Transcriptome in Multiple Lineages of C3 and C4 Species.

Directory of Open Access Journals (Sweden)

Zehong Ding

Full Text Available Leaves of C4 crops usually have higher radiation, water and nitrogen use efficiencies compared to the C3 species. Engineering C4 traits into C3 crops has been proposed as one of the most promising ways to repeal the biomass yield ceiling. To better understand the function of C4 photosynthesis, and to identify candidate genes that are associated with the C4 pathways, a comparative transcription network analysis was conducted on leaf developmental gradients of three C4 species including maize, green foxtail and sorghum and one C3 species, rice. By combining the methods of gene co-expression and differentially co-expression networks, we identified a total of 128 C4 specific genes. Besides the classic C4 shuttle genes, a new set of genes associated with light reaction, starch and sucrose metabolism, metabolites transportation, as well as transcription regulation, were identified as involved in C4 photosynthesis. These findings will provide important insights into the differential gene regulation between C3 and C4 species, and a good genetic resource for establishing C4 pathways in C3 crops.

Development of seedless fruits mutants in citrus including tangerine (C. reticulata) and pummelo (C. grandis) through induced mutations and biotechnology

Energy Technology Data Exchange (ETDEWEB)

Somsri, S. [Horticulture Research Institute, Department of Agriculture (DOA), Chatuchak, Bangkok (Thailand); Jompook, P. [Department of Applied Radiation and Isotopes, Faculty of Science, Kasetsart University, Chatuchak, Bangkok (Thailand); Kanhom, P. [Phare Horticultural Research Center, Muang, Phare (Thailand); Thayamanont, P.; Meecharoen, S. [Pichit Horticultural Research Center, Muang, Pichit (Thailand); Kumcha, U. [Srisaket Horticultural Research Center, Muang, Srisaket (Thailand)

2009-05-15

The development of seedless fruit mutants in citrus, including Tangerine (C. reticulata) and Pummelo (C. grandis), through induced mutation and biotechnology was studied at the Gamma Irradiation Service and Nuclear Technology Center, Pichit and Phare Horticultural Research Center for 4 years (August 2000 to September 2004). The results showed successful induction of mutants with gamma irradiation using both chronic and acute procedures for pot plants, scions and in vitro plantlets of tangerine (Citrus reticulata var. Shogun and Sai Nam Puaeng) and pummelo (Citrus grandis viz. Kao Thong Dee). MS medium with 2 mgL{sup -1} of BA was found to be the most suitable medium for shoot proliferation. The seedlings were sub-cultured at least 4 times, and then they were treated with acute and chronic irradiation. Shoot induction from M{sub 1}V{sub 0} to M{sub 1}V{sub 4} generation was performed in basic MS medium with 2 mgL{sup -1} added BA. Rooting was induced in the M{sub 1}V{sub 4} in halfstrength MS enriched with BA 2 mgL{sup -1}. Later, the shoots were excised and grafted on mature plants or the plantlets directly transferred in the field and later the fruits from mature trees were evaluated for seedlessness in M{sub 1}V{sub 4} at Pichit and Phare Horticultural Research Center. (author)

Semi-dwarf mutants in triticale and wheat breeding

International Nuclear Information System (INIS)

Driscoll, C.J.

1984-01-01

The triticale lines Beagle and DR-IRA have been subjected to ionizing irradiation and chemical mutagenesis in order to produce semi-dwarf mutants. Beagle is 100 cm tall and DR-IRA 80 cm under average field conditions. A bulk then pedigree method is currently represented by 158 single plots of M 6 (or in some cases M 7 ) mutants that are from 5 to 35 cm shorter than the control variety. The shortest mutants are 65 cm in height. Forty of these mutants are also earlier flowering than the control varieties. Replicated yield testing will be conducted on confirmed mutants in 1983. Response to gibberellic acid of these mutants will also be determined. The Cornerstone male-sterility mutant (ms1c) on chromosome arm 4Aα has been combined with the GA-insensitive/reduced height gene Gai/Rht1 which is also on chromosome arm 4Aα. The ms1c mutant has also been combined with Gai/Rht2 on chromosome 4D and with both Gai/Rht1 and Gai/Rht2. The combination ms1c and Gai/Rht1 has been chosen as the basis of a composite cross. Thirteen varieties were tested with GA 3 and seven (Warigal, Aroona, Oxley, Banks, Avocet, Matipo and Toquifen) which contain Gai/Rht1 were crossed with ms1c Gai/Rht1 and entered into an interpollinating F 2 . The entire composite is homozygous for this semi-dwarf allele and selection will be practiced for increased height on a GA-insensitive background. (author)

Isolation and cross-sensitivity of X-ray-sensitive mutants of V79-4 hamster cells

International Nuclear Information System (INIS)

Jones, N.J.; Cox, R.; Thacker, J.

1987-01-01

The V79-4 Chinese hamster line was mutagenized and surviving clones screened for X-ray sensitivity using a replica microwell technique. One slightly sensitive clone and 3 clearly sensitive clones were isolated from approximately 5000 screened, and designated irs 1 to irs 4. The 3 more sensitive clones showed different responses to the genotoxic agents mitomycin C (MMC), ethyl methanesulphonate (EMS) and ultraviolet light (UV). irs 1 showed considerable sensitivity to all the agents tested, in the order MMC >> EMS > UV. irs 2 and irs 3 had similar sensitivities to EMS and to UV (EMS > UV) but irs 3 was more sensitive than irs 2 to MMC. None of these mutants is identical in phenotype to previously published mutants. (Auth.)

Microarrays for global expression constructed with a low redundancy set of 27,500 sequenced cDNAs representing an array of developmental stages and physiological conditions of the soybean plant

Directory of Open Access Journals (Sweden)

Retzel Ernest

2004-09-01

Full Text Available Abstract Background Microarrays are an important tool with which to examine coordinated gene expression. Soybean (Glycine max is one of the most economically valuable crop species in the world food supply. In order to accelerate both gene discovery as well as hypothesis-driven research in soybean, global expression resources needed to be developed. The applications of microarray for determining patterns of expression in different tissues or during conditional treatments by dual labeling of the mRNAs are unlimited. In addition, discovery of the molecular basis of traits through examination of naturally occurring variation in hundreds of mutant lines could be enhanced by the construction and use of soybean cDNA microarrays. Results We report the construction and analysis of a low redundancy 'unigene' set of 27,513 clones that represent a variety of soybean cDNA libraries made from a wide array of source tissue and organ systems, developmental stages, and stress or pathogen-challenged plants. The set was assembled from the 5' sequence data of the cDNA clones using cluster analysis programs. The selected clones were then physically reracked and sequenced at the 3' end. In order to increase gene discovery from immature cotyledon libraries that contain abundant mRNAs representing storage protein gene families, we utilized a high density filter normalization approach to preferentially select more weakly expressed cDNAs. All 27,513 cDNA inserts were amplified by polymerase chain reaction. The amplified products, along with some repetitively spotted control or 'choice' clones, were used to produce three 9,728-element microarrays that have been used to examine tissue specific gene expression and global expression in mutant isolines. Conclusions Global expression studies will be greatly aided by the availability of the sequence-validated and low redundancy cDNA sets described in this report. These cDNAs and ESTs represent a wide array of developmental

Evaluation of some mutant lines of rice induced by gamma radiation treatment 1. mean performance of rice mutants in M4 generation

International Nuclear Information System (INIS)

El-Banna, M.N.; El-Wakil, H.M.F.; Ebaid, R.A.; Sallam, R.A.

2009-01-01

Grains of eight rice mutants; SC 1, SC 6, RTY 1, RTY 3, HY 14, HYI 17, EH 4 and HYPI 22 were secured from Botany Department Faculty of Agriculture Cairo university. The procedures and the methodology for induction these mutants as well as the original mean performance of such mutants are presented else where; Sabbour, (1989) and Sabbour etal. (2002). Grains were sown (M4 generation) at the experimental farm in Itai EI-Baroud Agricultural Research Station Behaira Governorate Agricultural Research Center (ARC) in the summer season (2007). The mean performance of such mutants was studied during M4 generation. The most exciting results were as follows: the selected line SC 1 showed in M4 generation superior agronomic and yield traits. Sc 1 mutant line is not bred truly and it need more generations to reach stability. SC 6 in M4 generation showed considerable number of individuals scored low mean values toward the negative direction and lowering the overall trait mean performance. The rice lines RTY 1 and RTY 3 proved that, the average number of fertile tillers per plant of the selected lines maintained previously recorded mean values of M3 generation in M4. The traits showed significant differences among their progeny that recorded high CV% values as compared with those showed no significant differences. The rice lines HY 14 and HYI 17 showed a true breeding signs and no more breeding generations are required. Rice lines EH 4, showed a considerable reduction in number of days elapsed from date of cultivation till harvest. As, this mutant maintained 86.58 days till heading. Rice mutant line HYPI 22 did not bred truly for the original selected traits (high yield and high protein content) and it still need more generations of selection to reach considerable stability

Expression of CALR mutants causes mpl-dependent thrombocytosis in zebrafish.

Science.gov (United States)

Lim, K-H; Chang, Y-C; Chiang, Y-H; Lin, H-C; Chang, C-Y; Lin, C-S; Huang, L; Wang, W-T; Gon-Shen Chen, C; Chou, W-C; Kuo, Y-Y

2016-10-07

CALR mutations are identified in about 30% of JAK2/MPL-unmutated myeloproliferative neoplasms (MPNs) including essential thrombocythemia (ET) and primary myelofibrosis. Although the molecular pathogenesis of CALR mutations leading to MPNs has been studied using in vitro cell lines models, how mutant CALR may affect developmental hematopoiesis remains unknown. Here we took advantage of the zebrafish model to examine the effects of mutant CALR on early hematopoiesis and model human CALR-mutated MPNs. We identified three zebrafish genes orthologous to human CALR, referred to as calr, calr3a and calr3b. The expression of CALR-del52 and CALR-ins5 mutants caused an increase in the hematopoietic stem/progenitor cells followed by thrombocytosis without affecting normal angiogenesis. The expression of CALR mutants also perturbed early developmental hematopoiesis in zebrafish. Importantly, morpholino knockdown of mpl but not epor or csf3r could significantly attenuate the effects of mutant CALR. Furthermore, the expression of mutant CALR caused jak-stat signaling activation in zebrafish that could be blocked by JAK inhibitors (ruxolitinib and fedratinib). These findings showed that mutant CALR activates jak-stat signaling through an mpl-dependent mechanism to mediate pathogenic thrombopoiesis in zebrafish, and illustrated that the signaling machinery related to mutant CALR tumorigenesis are conserved between human and zebrafish.

A sorghum (Sorghum bicolor mutant with altered carbon isotope ratio.

Directory of Open Access Journals (Sweden)

Govinda Rizal

Full Text Available Recent efforts to engineer C4 photosynthetic traits into C3 plants such as rice demand an understanding of the genetic elements that enable C4 plants to outperform C3 plants. As a part of the C4 Rice Consortium's efforts to identify genes needed to support C4 photosynthesis, EMS mutagenized sorghum populations were generated and screened to identify genes that cause a loss of C4 function. Stable carbon isotope ratio (δ13C of leaf dry matter has been used to distinguishspecies with C3 and C4 photosynthetic pathways. Here, we report the identification of a sorghum (Sorghum bicolor mutant with a low δ13C characteristic. A mutant (named Mut33 with a pale phenotype and stunted growth was identified from an EMS treated sorghum M2 population. The stable carbon isotope analysis of the mutants showed a decrease of 13C uptake capacity. The noise of random mutation was reduced by crossing the mutant and its wildtype (WT. The back-cross (BC1F1 progenies were like the WT parent in terms of 13C values and plant phenotypes. All the BC1F2 plants with low δ13C died before they produced their 6th leaf. Gas exchange measurements of the low δ13C sorghum mutants showed a higher CO2 compensation point (25.24 μmol CO2.mol-1air and the maximum rate of photosynthesis was less than 5μmol.m-2.s-1. To identify the genetic determinant of this trait, four DNA pools were isolated; two each from normal and low δ13C BC1F2 mutant plants. These were sequenced using an Illumina platform. Comparison of allele frequency of the single nucleotide polymorphisms (SNPs between the pools with contrasting phenotype showed that a locus in Chromosome 10 between 57,941,104 and 59,985,708 bps had an allele frequency of 1. There were 211 mutations and 37 genes in the locus, out of which mutations in 9 genes showed non-synonymous changes. This finding is expected to contribute to future research on the identification of the causal factor differentiating C4 from C3 species that can be used

AcrA suppressor alterations reverse the drug hypersensitivity phenotype of a TolC mutant by inducing TolC aperture opening

Science.gov (United States)

Weeks, Jon W.; Celaya-Kolb, Teresa; Pecora, Sara; Misra, Rajeev

2010-01-01

Summary In Escherichia coli, the TolC–AcrAB complex forms a major antibiotic efflux system with broad substrate specificity. During the complex assembly, the periplasmic helices and bottom turns of TolC are thought to interact with a hairpin helix of AcrA and hairpin loops of AcrB respectively. In the present study we show that a four-residue substitution in TolC’s turn 1, which connects outer helices 3 and 4 proximal to TolC’s periplasmic aperture, confers antibiotic hypersensitivity without affecting TolC-mediated phage or colicin infection. However, despite the null-like drug sensitivity phenotype, chemical cross-linking analysis revealed no apparent defects in the ability of the mutant TolC protein to physically interact with AcrA and AcrB. A role for TolC turn 1 residues in the functional assembly of the tripartite efflux pump complex was uncovered through isolating suppressor mutations of the mutant TolC protein that mapped within acrA and by utilizing a labile AcrA protein. The data showed that AcrA-mediated suppression of antibiotic sensitivity was achieved by dilating the TolC aperture/channel in an AcrB-dependent manner. The results underscore the importance of the periplasmic turn 1 of TolC in the functional assembly of the tripartite efflux complex and AcrA in transitioning TolC from its closed to open state. PMID:20132445

Characterization of mitomycin-C-sensitive mouse lymphoma L5178Y cell mutants

International Nuclear Information System (INIS)

Inaba, Hiroko; Shiomi, Naoko; Shiomi, Tadahiro; Sato, Koki; Yoshida, Michihiro.

1985-01-01

Twenty-six mutants showing high sensitivity to mytomicin-C (MMC) were isolated from mouse lymphoma L5178Y cells by a replica-plating technique. Twenty-five of the mutants were 5 - 10 times more sensitive to MMC than were parental cells, and showed normal sensitivity to U.V. light and x-rays. From a complementation analysis, 5 mutants (MC s ) isolated from independently mutagenized cell populations were classified into two groups. These mutants possessed recessive character for MMC-sensitivity and there were at least two genes involved in the MMC-sensitivity. As for DNA-damaging factors, such as photoadducts of 8-methoxypsoralen (8-MOP) and 3-carbethoxysoralen (3-CPs), MC s mutants showed higher sensitivity to photoadducts of 8-MOP than to (3-CPs). MC s mutants were also highly sensitive to a DNA cross-linking agent, cisplatin. Characterization of the sensitivity of mouse MC s mutants was analogous to that of Fanconi's anemia (FA)-derived cells. Low concentrations (10 ng/ml) of MMC induced chromosome aberration in a high incidence in mouse MC s cells, as well as in FA cells. The frequency of MMC-induced chromosome aberrations was normal in hybrid cells between normal human diploid somatic cells and mouse mutants and between FA cells and mouse wild cells, and hereditary deficiency became normal by hybrization. (Namekawa, K.)

Developmental status of preschool children receiving cART: a descriptive cohort study.

Science.gov (United States)

Potterton, J; Hilburn, N; Strehlau, R

2016-05-01

HIV is known to cause neurodevelopmental problems in infants and young children. The impact of HIV on the development of preschool-age children has been less well described. The study was conducted at an urban paediatric HIV clinic in Johannesburg, South Africa. A sample of convenience was used. Sixty-eight medically stable children between the ages of 3 and 5 years were assessed with the Griffiths Scales of Mental Development. Children were excluded from the study if they had severe HIV encephalopathy, which made it impossible for them to participate in the items on the Griffiths Scales of Mental Development. The children had started combination antiretroviral treatment (cART) at a mean age of 8.1 months. The majority of the children were virologically suppressed and did not present with wasting or stunting. Severe overall developmental delay (z-scores perception were the most severely affected. Personal-social development was the least affected with only 13.4% of the children demonstrating severe delay. Despite having early access to cART, children infected with HIV are still at risk for severe developmental delay across a number of facets. Very early initiation of cART may help alleviate this problem. All preschool children infected with HIV should have routine developmental screening. © 2016 John Wiley & Sons Ltd.

4,4'-Dichlorodiphenyltrichloroethane (DDT) and 4,4'-dichlorodiphenyldichloroethylene (DDE) inhibit myogenesis in C2C12 myoblasts.

Science.gov (United States)

Kim, Jonggun; Park, Min Young; Kim, Yoo; Yoon, Kyong Sup; Clark, John Marshall; Park, Yeonhwa; Whang, Kwang-Youn

2017-12-01

Most countries have banned the use of 4,4'-dichlorodiphenyltrichloroethane (DDT). However, owing to its extremely high lipophilic characteristics, DDT and its metabolite 4,4'-dichlorodiphenyldichloroethylene (DDE) are ubiquitous in the environment and in many types of food. The positive correlation between exposure to insecticides, including DDT and DDE, and weight gain, resulting in impaired energy metabolism in offspring following perinatal DDT and DDE exposure, was previously reported. Therefore the influence of DDT and DDE on myogenesis using C2C12 myoblasts was investigated in this study. DDT and DDE decreased myotube formation dose- and time-dependently. Among myogenic regulatory factors, DDT and DDE mainly decreased MyoD1 and Myf5 expression. DDT and DDE treatment also altered Myostatin expression, phosphorylation of protein kinase B, p70 ribosomal protein S6 kinase, forkhead box O protein 3 and mammalian target of rapamycin, resulting in attenuation of myotube formation. These results may have significant implications for understanding the effects of developmental exposure of DDT and DDE on myogenesis and development of obesity and type 2 diabetes later in life. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Generation and characterization of pigment mutants of ...

African Journals Online (AJOL)

Compared to the wild CC-124, these mutants are characterized by a decrease in chlorophyll a & b content and an increase in carotenoids. The lowest decrease in chlorophyll a was 3 to 4 folds, while the highest increase in carotenoids was 2 to 4 folds. The result of bio-test, using the resulting pigment mutant of C. reinhardtii ...

Cinnamic acid 4-hydroxylase of sorghum [Sorghum biocolor (L.) Moench] gene SbC4H1 restricts lignin synthesis in Arabidopsis

Science.gov (United States)

Cinnamic acid 4-hydroxylase (C4H) is the first hydroxylase enzyme of the phenylpropanoid pathway, and its content and activity affects the lignin synthesis. In this study, we isolated a C4H gene SbC4H1 from the suppression subtractive hybridization library of brown midrib (bmr) mutants of Sorghum b...

DCL2- and RDR6-dependent transitive silencing of SMXL4 and SMXL5 in Arabidopsis dcl4 mutants causes defective phloem transport and carbohydrate over-accumulation.

Science.gov (United States)

Wu, Yu-Yi; Hou, Bo-Han; Lee, Wen-Chi; Lu, Shin-Hua; Yang, Chen-Jui; Vaucheret, Hervé; Chen, Ho-Ming

2017-06-01

DICER-LIKE (DCL) enzymes process double-stranded RNA into small RNAs that act as regulators of gene expression. Arabidopsis DCL4 and DCL2 each allow the post-transcriptional gene silencing (PTGS) of viruses and transgenes, but primary PTGS-prone DCL4 outcompetes transitive PTGS-prone DCL2 in wild-type plants. This hierarchy likely prevents DCL2 having any detrimental effects on endogenous genes. Indeed, dcl4 mutants exhibit developmental defects and increased sensitivity to genotoxic stress. In this study, the mechanism underlying dcl4 defects was investigated using genetic, biochemical and high-throughput sequencing approaches. We show that the purple phenotype of dcl4 leaves correlates with carbohydrate over-accumulation and defective phloem transport, and depends on the activity of SUPPRESSOR OF GENE SILENCING 3, RNA-DEPENDENT RNA POLYMERASE 6 (RDR6) and DCL2. This phenotype correlates with the downregulation of two genes expressed in the apex and the vasculature, SMAX1-LIKE 4 (SMXL4) and SMXL5, and the accumulation of DCL2- and RDR6-dependent small interfering RNAs derived from these two genes. Supporting a causal effect, smxl4 smxl5 double mutants exhibit leaf pigmentation, enhanced starch accumulation and defective phloem transport, similar to dcl4 plants. Overall, this study elucidates the detrimental action of DCL2 when DCL4 is absent, and indicates that DCL4 outcompeting DCL2 in wild-type plants is crucial to prevent the degradation of endogenous transcripts by DCL2- and RDR6-dependent transitive PTGS. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

45 CFR 1385.4 - Rights of individuals with developmental disabilities.

Science.gov (United States)

2010-10-01

... university affiliated programs or for projects of national significance grants must also contain an assurance... DISABILITIES, DEVELOPMENTAL DISABILITIES PROGRAM REQUIREMENTS APPLICABLE TO THE DEVELOPMENTAL DISABILITIES PROGRAM § 1385.4 Rights of individuals with developmental disabilities. (a) Section 110 of the Act, Rights...

Integration of developmental and environmental signals via a polyadenylation factor in Arabidopsis.

Directory of Open Access Journals (Sweden)

Man Liu

Full Text Available The ability to integrate environmental and developmental signals with physiological responses is critical for plant survival. How this integration is done, particularly through posttranscriptional control of gene expression, is poorly understood. Previously, it was found that the 30 kD subunit of Arabidopsis cleavage and polyadenylation specificity factor (AtCPSF30 is a calmodulin-regulated RNA-binding protein. Here we demonstrated that mutant plants (oxt6 deficient in AtCPSF30 possess a novel range of phenotypes--reduced fertility, reduced lateral root formation, and altered sensitivities to oxidative stress and a number of plant hormones (auxin, cytokinin, gibberellic acid, and ACC. While the wild-type AtCPSF30 (C30G was able to restore normal growth and responses, a mutant AtCPSF30 protein incapable of interacting with calmodulin (C30GM could only restore wild-type fertility and responses to oxidative stress and ACC. Thus, the interaction with calmodulin is important for part of AtCPSF30 functions in the plant. Global poly(A site analysis showed that the C30G and C30GM proteins can restore wild-type poly(A site choice to the oxt6 mutant. Genes associated with hormone metabolism and auxin responses are also affected by the oxt6 mutation. Moreover, 19 genes that are linked with calmodulin-dependent CPSF30 functions, were identified through genome-wide expression analysis. These data, in conjunction with previous results from the analysis of the oxt6 mutant, indicate that the polyadenylation factor AtCPSF30 is a regulatory hub where different signaling cues are transduced, presumably via differential mRNA 3' end formation or alternative polyadenylation, into specified phenotypic outcomes. Our results suggest a novel function of a polyadenylation factor in environmental and developmental signal integration.

Brucella Rough Mutant Induce Macrophage Death via Activating IRE1α Pathway of Endoplasmic Reticulum Stress by Enhanced T4SS Secretion.

Science.gov (United States)

Li, Peng; Tian, Mingxing; Bao, Yanqing; Hu, Hai; Liu, Jiameng; Yin, Yi; Ding, Chan; Wang, Shaohui; Yu, Shengqing

2017-01-01

Brucella is a Gram-negative facultative intracellular pathogen that causes the worldwide zoonosis, known as brucellosis. Brucella virulence relies mostly on its ability to invade and replicate within phagocytic cells. The type IV secretion system (T4SS) and lipopolysaccharide are two major Brucella virulence factors. Brucella rough mutants reportedly induce the death of infected macrophages, which is T4SS dependent. However, the underlying molecular mechanism remains unclear. In this study, the T4SS secretion capacities of Brucella rough mutant and its smooth wild-type strain were comparatively investigated, by constructing the firefly luciferase fused T4SS effector, BPE123 and VceC. In addition, quantitative real-time PCR and western blotting were used to analyze the T4SS expression. The results showed that T4SS expression and secretion were enhanced significantly in the Brucella rough mutant. We also found that the activity of the T4SS virB operon promoter was notably increased in the Brucella rough mutant, which depends on quorum sensing-related regulators of VjbR upregulation. Cell infection and cell death assays revealed that deletion of vjbR in the Brucella rough mutant absolutely abolished cytotoxicity within macrophages by downregulating T4SS expression. This suggests that up-regulation of T4SS promoted by VjbR in rough mutant Δ rfbE contribute to macrophage death. In addition, we found that the Brucella rough mutant induce macrophage death via activating IRE1α pathway of endoplasmic reticulum stress. Taken together, our study provide evidence that in comparison to the Brucella smooth wild-type strain, VjbR upregulation in the Brucella rough mutant increases transcription of the virB operon, resulting in overexpression of the T4SS gene, accompanied by the over-secretion of effecter proteins, thereby causing the death of infected macrophages via activating IRE1α pathway of endoplasmic reticulum stress, suggesting novel insights into the molecular

Brucella Rough Mutant Induce Macrophage Death via Activating IRE1α Pathway of Endoplasmic Reticulum Stress by Enhanced T4SS Secretion

Directory of Open Access Journals (Sweden)

Peng Li

2017-09-01

Full Text Available Brucella is a Gram-negative facultative intracellular pathogen that causes the worldwide zoonosis, known as brucellosis. Brucella virulence relies mostly on its ability to invade and replicate within phagocytic cells. The type IV secretion system (T4SS and lipopolysaccharide are two major Brucella virulence factors. Brucella rough mutants reportedly induce the death of infected macrophages, which is T4SS dependent. However, the underlying molecular mechanism remains unclear. In this study, the T4SS secretion capacities of Brucella rough mutant and its smooth wild-type strain were comparatively investigated, by constructing the firefly luciferase fused T4SS effector, BPE123 and VceC. In addition, quantitative real-time PCR and western blotting were used to analyze the T4SS expression. The results showed that T4SS expression and secretion were enhanced significantly in the Brucella rough mutant. We also found that the activity of the T4SS virB operon promoter was notably increased in the Brucella rough mutant, which depends on quorum sensing-related regulators of VjbR upregulation. Cell infection and cell death assays revealed that deletion of vjbR in the Brucella rough mutant absolutely abolished cytotoxicity within macrophages by downregulating T4SS expression. This suggests that up-regulation of T4SS promoted by VjbR in rough mutant ΔrfbE contribute to macrophage death. In addition, we found that the Brucella rough mutant induce macrophage death via activating IRE1α pathway of endoplasmic reticulum stress. Taken together, our study provide evidence that in comparison to the Brucella smooth wild-type strain, VjbR upregulation in the Brucella rough mutant increases transcription of the virB operon, resulting in overexpression of the T4SS gene, accompanied by the over-secretion of effecter proteins, thereby causing the death of infected macrophages via activating IRE1α pathway of endoplasmic reticulum stress, suggesting novel insights into the

Soybean promising mutant lines super early maturity Q-298 and 4-Psj

International Nuclear Information System (INIS)

Arwin; Mulyana, H.I.; Tarmizi; Masrizal; Faozi, K.; Adie, M.

2012-01-01

One of the efforts to increase the national soybean (Glycine max L. Merr.) production is by growing super early maturity with high yielding varieties, so that the planting time can be shortened to fill out the cropping pattern of ''rice-rice-soybean''. Such varieties can be developed through mutation breeding method using γ ray irradiation. In this research the seeds of Tidar variety were irradiated by 200 Gy γ ray from 60 Co. Irradiated seeds were planted in the field and selections with emphasis on early maturing character were conducted in M 2 generation. Selected plants were purified to M 7 generation and selected pure mutant lines were subjected to preliminary and advanced yield trials. Based on these results 5 promising mutant lines were selected to continue in multi location yield trials. A set of lines for multi location yield trials consist of 14 lines included 5 mutant lines from this experiment, 5 lines from UNSUD, 3 national leading varieties, Argomulyo, Gorobogan, Burangrang, as national control varieties and Tidar as an original of mutant lines. Based on the result of multi location yield trials, 2 mutant lines, Q-298 dan 4-Psj, have significant high productivities compared to productivities of other lines and varieties. The growth duration of these lines were only 66 days and 68 days, respectively with average productivities were 2.41 tons / ha and 2.42 tons / ha, respectively. Index stability of Q-298 and 4-Psj mutant lines were 0.84 and 0.79, respectively, it means that the productivities of these two lines were stable in all tested locations. Based on the results, the Q-298 and 4-Psj mutant lines were proposed to be released as new varieties with the names of Gamasugen 1 and Gamasugen 2, respectively. (author)

Analysis of fast neutron-generated mutants at the Arabidopsis thaliana HY4 locus

International Nuclear Information System (INIS)

Bruggemann, E.; Handwerger, K.; Essex, C.; Storz, G.

1996-01-01

Ionizing radiation is expected to produce mutants with deletions or other chromosomal rearrangements. These mutants are useful for a variety of purposes, such as creating null alleles and cloning genes whose existence is known only from their mutant phenotype; however, only a few mutations generated by ionizing radiation have been characterized at the molecular level in Arabidopsis thaliana. Twenty fast neutron-generated alleles of the Arabidopsis HY4 locus, which encodes a blue light receptor, CRY1, were isolated and characterized. Nine of the mutant alleles displayed normal genetic behavior. The other 11 mutant alleles were poorly transmitted through the male gametophyte and were lethal in homozygous plants. Southern blot analysis demonstrated that alleles of the first group generally contain small or moderate-sized deletions at HY4, while alleles of the second group contain large deletions at this locus. These results demonstrate that fast neutrons can produce a range of deletions at a single locus in Arabidopsis. Many of these deletions would be suitable for cloning by genomic subtraction or representational difference analysis. The results also suggest the presence of an essential locus adjacent to HY4. (author)

The cellular Mre11 protein interferes with adenovirus E4 mutant DNA replication

International Nuclear Information System (INIS)

Mathew, Shomita S.; Bridge, Eileen

2007-01-01

Adenovirus type 5 (Ad5) relocalizes and degrades the host DNA repair protein Mre11, and efficiently initiates viral DNA replication. Mre11 associates with Ad E4 mutant DNA replication centers and is important for concatenating viral genomes. We have investigated the role of Mre11 in the E4 mutant DNA replication defect. RNAi-mediated knockdown of Mre11 dramatically rescues E4 mutant DNA replication in cells that do or do not concatenate viral genomes, suggesting that Mre11 inhibits DNA replication independent of genome concatenation. The mediator of DNA damage checkpoint 1 (Mdc1) protein is involved in recruiting and sustaining Mre11 at sites of DNA damage following ionizing radiation. We observe foci formation by Mdc1 in response to viral infection, indicating that this damage response protein is activated. However, knockdown of Mdc1 does not prevent Mre11 from localizing at viral DNA replication foci or rescue E4 mutant DNA replication. Our results are consistent with a model in which Mre11 interferes with DNA replication when it is localized at viral DNA replication foci

Crystal structure of a C-terminal deletion mutant of human protein kinase CK2 catalytic subunit

DEFF Research Database (Denmark)

Ermakova, Inessa; Boldyreff, Brigitte; Issinger, Olaf-Georg

2003-01-01

structure of a C-terminal deletion mutant of human CK2alpha was solved and refined to 2.5A resolution. In the crystal the CK2alpha mutant exists as a monomer in agreement with the organization of the subunits in the CK2 holoenzyme. The refined structure shows the helix alphaC and the activation segment, two...

Arabidopsis phosphoinositide-specific phospholipase C 4 negatively regulates seedling salt tolerance.

Science.gov (United States)

Xia, Keke; Wang, Bo; Zhang, Jiewei; Li, Yuan; Yang, Hailian; Ren, Dongtao

2017-08-01

Previous physiological and pharmacological studies have suggested that the activity of phosphoinositide-specific phospholipase C (PI-PLC) plays an important role in regulating plant salt stress responses by altering the intracellular Ca 2+ concentration. However, the individual members of plant PLCs involved in this process need to be identified. Here, the function of AtPLC4 in the salt stress response of Arabidopsis seedlings was analysed. plc4 mutant seedlings showed hyposensitivity to salt stress compared with Col-0 wild-type seedlings, and the salt hyposensitive phenotype could be complemented by the expression of native promoter-controlled AtPLC4. Transgenic seedlings with AtPLC4 overexpression (AtPLC4 OE) exhibited a salt-hypersensitive phenotype, while transgenic seedlings with its inactive mutant expression (AtPLC4m OE) did not exhibit this phenotype. Using aequorin as a Ca 2+ indicator in plc4 mutant and AtPLC4 OE seedlings, AtPLC4 was shown to positively regulate the salt-induced Ca 2+ increase. The salt-hypersensitive phenotype of AtPLC4 OE seedlings was partially rescued by EGTA. An analysis of salt-responsive genes revealed that the transcription of RD29B, MYB15 and ZAT10 was inversely regulated in plc4 mutant and AtPLC4 OE seedlings. Our findings suggest that AtPLC4 negatively regulates the salt tolerance of Arabidopsis seedlings, and Ca 2+ may be involved in regulating this process. © 2017 John Wiley & Sons Ltd.

Identification of four novel XPC mutations in two xeroderma pigmentosum complementation group C patients and functional study of XPC Q320X mutant.

Science.gov (United States)

Gu, Yajuan; Chang, Xiaodan; Dai, Shan; Song, Qinghua; Zhao, Hongshan; Lei, Pengcheng

2017-09-10

Xeroderma pigmentosum (XP) is a rare, recessive hereditary disease characterized by sunlight hypersensitivity and high incidence of skin cancer with clinical and genetic heterogeneity. We collected two unrelated Chinese patients showing typical symptoms of XPC without neurologic symptoms. Direct sequencing of XPC gene revealed that patient 1 carried IVS1+1G>A and c.958 C>T mutations, and patient 2 carried c.545_546delTA and c.2257_2258insC mutations. All these four mutations introduced premature terminal codons (PTCs) in XPC gene. The nonsense mutation c.958 C>T yielded truncated mutant Q320X, and we studied its function for global genome repair kinetics. Overexpressed Q320X mutant can localize to site of DNA damage, but it is defective in CPD and 6-4PP repair. Readthrough of PTCs is a new approach to treatment of genetic diseases. We found that aminoglycosides could significantly increase the full length protein expression of Q320X mutant, but NER defects were not rescued in vitro. Copyright © 2017 Elsevier B.V. All rights reserved.

Elucidating the Mechanism of Gain of Toxic Function From Mutant C1 Inhibitor Proteins in Hereditary Angioedema

Science.gov (United States)

2017-10-01

antibodies to 5 specifically blot wild-type C1INH in the pathologic polymers.. A FLAG tag was placed into the wild-type C1INH cDNA located immediately...resulted in decreased secretion of the 3x-FLAG-WT-C1INH when cotransfected with the mutant cDNA . This was an important confirmation of our...C1INH plus mutant C1INH cDNA in the presence or absence of a lactacystin, a proteasome inhibitor. As shown in figure 2, blocking degradation of

Phenotypic Analysis and Virulence of Candida albicans LIG4 Mutants

Science.gov (United States)

Andaluz, Encarnación; Calderone, Richard; Reyes, Guadalupe; Larriba, Germán

2001-01-01

In previous studies, we reported the isolation and preliminary characterization of a DNA ligase-encoding gene of Candida albicans. This gene (LIG4) is the structural and functional homologue of both yeast and human ligase IV, which is involved in nonhomologous end joining (NHEJ) of DNA double-strand breaks. In the present study, we have shown that there are no other LIG4 homologues in C. albicans. In order to study the function of LIG4 in morphogenesis and virulence, we constructed gene deletions. LIG4 transcript levels were reduced in the heterozygote and were completely absent in null strains. Concomitantly, the heterozygote showed a pronounced defect in myceliation, which was slightly greater in the null strain. This was true with several solid and liquid media, such as Spider medium, medium 199, and 2% glucose–1% yeast extract–2% Bacto Peptone, at several pHs. Reintroduction of the wild-type allele into the null mutant partially restored the ability of cells to form hyphae. In agreement with the positive role of LIG4 in morphogenesis, we detected a significant rise in mRNA levels during the morphological transition. LIG4 is not essential for DNA replication or for the repair of DNA damage induced by ionizing radiation or UV light, indicating that these lesions are repaired primarily by homologous recombination. However, our data show that the NHEJ apparatus of C. albicans may control morphogenesis in this diploid organism. In addition, deletion of one or both copies of LIG4 resulted in attenuation of virulence in a murine model of candidiasis. PMID:11119499

Functional phenotypic rescue of Caenorhabditis elegans neuroligin-deficient mutants by the human and rat NLGN1 genes.

Directory of Open Access Journals (Sweden)

Fernando Calahorro

Full Text Available Neuroligins are cell adhesion proteins that interact with neurexins at the synapse. This interaction may contribute to differentiation, plasticity and specificity of synapses. In humans, single mutations in neuroligin encoding genes lead to autism spectrum disorder and/or mental retardation. Caenorhabditis elegans mutants deficient in nlg-1, an orthologue of human neuroligin genes, have defects in different behaviors. Here we show that the expression of human NLGN1 or rat Nlgn1 cDNAs in C. elegans nlg-1 mutants rescues the fructose osmotic strength avoidance and gentle touch response phenotypes. Two specific point mutations in NLGN3 and NLGN4 genes, involved in autistic spectrum disorder, were further characterized in this experimental system. The R451C allele described in NLGN3, was analyzed with both human NLGN1 (R453C and worm NLG-1 (R437C proteins, and both were not functional in rescuing the osmotic avoidance behavior and the gentle touch response phenotype. The D396X allele described in NLGN4, which produces a truncated protein, was studied with human NLGN1 (D432X and they did not rescue any of the behavioral phenotypes analyzed. In addition, RNAi feeding experiments measuring gentle touch response in wild type strain and worms expressing SID-1 in neurons (which increases the response to dsRNA, both fed with bacteria expressing dsRNA for nlg-1, provided evidence for a postsynaptic in vivo function of neuroligins both in muscle cells and neurons, equivalent to that proposed in mammals. This finding was further confirmed generating transgenic nlg-1 deficient mutants expressing NLG-1 under pan-neuronal (nrx-1 or pan-muscular (myo-3 specific promoters. All these results suggest that the nematode could be used as an in vivo model for studying particular synaptic mechanisms with proteins orthologues of humans involved in pervasive developmental disorders.

UDP-N-acetylmuramic acid l-alanine ligase (MurC) inhibition in a tolC mutant Escherichia coli strain leads to cell death.

Science.gov (United States)

Humnabadkar, Vaishali; Prabhakar, K R; Narayan, Ashwini; Sharma, Sreevalli; Guptha, Supreeth; Manjrekar, Praveena; Chinnapattu, Murugan; Ramachandran, Vasanthi; Hameed, Shahul P; Ravishankar, Sudha; Chatterji, Monalisa

2014-10-01

The Mur ligases play an essential role in the biosynthesis of bacterial peptidoglycan and hence are attractive antibacterial targets. A screen of the AstraZeneca compound library led to the identification of compound A, a pyrazolopyrimidine, as a potent inhibitor of Escherichia coli and Pseudomonas aeruginosa MurC. However, cellular activity against E. coli or P. aeruginosa was not observed. Compound A was active against efflux pump mutants of both strains. Experiments using an E. coli tolC mutant revealed accumulation of the MurC substrate and a decrease in the level of product upon treatment with compound A ,: indicating inhibition of MurC enzyme in these cells. Such a modulation was not observed in the E. coli wild-type cells. Further, overexpression of MurC in the E. coli tolC mutant led to an increase in the compound A MIC by ≥16-fold, establishing a correlation between MurC inhibition and cellular activity. In addition, estimation of the intracellular compound A level showed an accumulation of the compound over time in the tolC mutant strain. A significant compound A level was not detected in the wild-type E. coli strain even upon treatment with high concentrations of the compound. Therefore, the lack of MIC and absence of MurC inhibition in wild-type E. coli were possibly due to suboptimal compound concentration as a consequence of a high efflux level and/or poor permeativity of compound A. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

C30F12.4 influences oogenesis, fat metabolism, and lifespan in C. elegans

Directory of Open Access Journals (Sweden)

Lu Wang

2016-09-01

Full Text Available ABSTRACT Reproduction, fat metabolism, and longevity are intertwined regulatory axes; recent studies in C. elegans have provided evidence that these processes are directly coupled. However, the mechanisms by which they are coupled and the reproductive signals modulating fat metabolism and lifespan are poorly understood. Here, we find that an oogenesis-enriched gene, c30f12.4, is specifically expressed and located in germ cells and early embryos; when the gene is knocked out, oogenesis is disrupted and brood size is decreased. In addition to the reproductive phenotype, we find that the loss of c30f12.4 alters fat metabolism, resulting in decreased fat storage and smaller lipid droplets. Meanwhile, c30f12.4 mutant worms display a shortened lifespan. Our results highlight an important role for c30f12.4 in regulating reproduction, fat homeostasis, and aging in C. elegans, which helps us to better understand the relationship between these processes.

A cGMP kinase mutant with increased sensitivity to the protein kinase inhibitor peptide PKI(5-24).

Science.gov (United States)

Ruth, P; Kamm, S; Nau, U; Pfeifer, A; Hofmann, F

1996-01-01

Synthetic peptides corresponding to the active domain of the heat-stable inhibitor protein PKI are very potent inhibitors of cAMP-dependent protein kinase, but are extremely weak inhibitors of cGMP-dependent protein kinase. In this study, we tried to confer PKI sensitivity to cGMP kinase by site-directed mutagenesis. The molecular requirements for high affinity inhibition by PKI were deduced from the crystal structure of the cAMP kinase/PKI complex. A prominent site of interaction are residues Tyr235 and Phe239 in the catalytic subunit, which from a sandwich-like structure with Phe10 of the PKI(5-24) peptide. To increase the sensitivity for PKI, the cGMP kinase codons at the corresponding sites, Ser555 and Ser559, were changed to Tyr and Phe. The mutant cGMP kinase was stimulated half maximally by cGMP at 3-fold higher concentrations (240 nM) than the wild type (77 nM). Wild type and mutant cGMP kinase did not differ significantly in their Km and Vmax for three different substrate peptides. The PKI(5-24) peptide inhibited phosphotransferase activity of the mutant cGMP kinase with higher potency than that of wild type, with Ki values of 42 +/- .3 microM and 160 +/- .7 microM, respectively. The increased affinity of the mutant cGMP kinase was specific for the PKI(5-24) peptide. Mutation of the essential Phe10 in the PKI(5-24) sequence to an Ala yielded a peptide that inhibited mutant and wild type cGMP kinase with similar potency, with Ki values of 160 +/- 11 and 169 +/- 27 microM, respectively. These results suggest that the mutations Ser555Tyr and Ser559Phe are required, but not sufficient, for high affinity inhibition of cGMP kinase by PKI.

The role of carbonic anhydrase in C₄ photosynthesis

Energy Technology Data Exchange (ETDEWEB)

Studer, Anthony [Life Sciences Research Foundation, Baltimore, MD (United States)

2015-10-01

Current pressures on the global food supply have accelerated the urgency for a second green revolution using novel and sustainable approaches to increase crop yield and efficiency. This proposal outlines experiments to address fundamental questions regarding the biology of C₄ photosynthesis, the method of carbon fixation utilized by the most productive food, feed and bioenergy crops. Carbonic anhydrase (CA) has been implicated in multiple cellular functions including nitrogen metabolism, water use efficiency, and photosynthesis. CA catalyzes the first dedicated step in C₄ photosynthesis, the hydration of CO₂ into bicarbonate, and is potentially rate limiting in C₄ grasses. Using insertional mutagenesis, we have generated CA mutants in maize, and propose the characterization of these mutants using phenotypic, physiological, and transcriptomic profiling to assay the plant’s response to altered CA activity. In addition, florescent protein tagging experiments will be employed to study the subcellular localization of CA paralogs, providing critical data for modeling carbon fixation in C₄ plants. Finally, I propose parallel experiments in Setaria viridis to explore its relevance as model C₄ grass. Using a multifaceted approach, this proposal addresses important questions in basic biology, as well as the need for translation research in response to looming global food challenges.

Improved ethanol fermentation of a yeast mutant by C-12 ion beam irradiation

International Nuclear Information System (INIS)

Lu Dong; Liu Qingfang; Wu Xin; Wang Ying; Wang Jufang; Ma Shuang; Li Wenjian

2010-01-01

The yeast Saccharomyces cerevisiae YY was irradiated with 100 MeV/u 12 C 6+ ion beams. After screening,we obtained the mutant strain C03A of high ethanol yield. The influence of fermentation temperature, pH and concentration of sugar on ethanol fermentation were studied. The range analysis and analysis of variance were applied for the result of orthogonal experiments. The optimal ethanol fermentation conditions are: fermentation temperature 35 degree C, pH value 5.0, and sugar concentration 24%. The results of fermentation in the 10 L bioreactor showed that the ethanol fermentation of the mutant strain could be completed in 36 hours, the production of ethanol was to 13.2%(V/V), which means 12 hours faster and 1.6%(V /V) ethanol yield higher than original strain. (authors)

Characterization of new radiation-sensitive mutant, Escherichia coli K-12 radC102

International Nuclear Information System (INIS)

Felzenszwalb, I.; Sargentini, N.J.; Smith, K.C.

1984-01-01

A new radiation-sensitive mutant, radC, has been isolated. The radC gene is located at 81.0 min on the Escherichia coli K-12 linkage map. The radC mutation sensitized cells to uv radiation, but unlike most DNA repair mutations, sensitization to X rays was observed only for rich medium-grown cells. For cells grown in rich medium, the radC mutant was normal for γ radiation mutagenesis, but showed less uv-radiation mutagenesis than the wild-type strain; it showed normal amount of X- and uv-radiation-induced DNA degradation, and it wasapprox. =60% deficient in recombination ability. The radC strain was normal for host cell reactivation of γ and uv-irradiated bacteriophage the radC mutation did not sensitize a recA strain, but did sensitize a radA and a polA strain to X and uv radiation and a uvrA strain to uv radiation. Therefore, it is suggested that the radC gene product plays a role in the growth medium-dependent, recA gene-dependent repair of DNA single-strand breaks after X irradiation, and in postreplication repair after uv irradiation

The C-terminal domain of TRPV4 is essential for plasma membrane localization.

Science.gov (United States)

Becker, Daniel; Müller, Margarethe; Leuner, Kristina; Jendrach, Marina

2008-02-01

Many members of the TRP superfamily oligomerize in the ER before trafficking to the plasma membrane. For membrane localization of the non-selective cation channel TRPV4 specific domains in the N-terminus are required, but the role of the C-terminus in the oligomerization and trafficking process has been not determined until now. Therefore, the localization of recombinant TRPV4 in two cell models was analyzed: HaCaT keratinocytes that express TRPV4 endogenously were compared to CHO cells that are devoid of endogenous TRPV4. When deletions were introduced in the C-terminal domain three states of TRPV4 localization were defined: a truncated TRPV4 protein of 855 amino acids was exported to the plasma membrane like the full-length channel (871 aa) and was also functional. Mutants with a length of 828 to 844 amino acids remained in the ER of CHO cells, but in HaCaT cells plasma membrane localization was partially rescued by oligomerization with endogenous TRPV4. This was confirmed by coexpression of recombinant full-length TRPV4 together with these deletion mutants, which resulted in an almost complete plasma membrane localization of both proteins and significant FRET in the plasma membrane and the ER. All deletions upstream of amino acid 828 resulted in total ER retention that could not rescued by coexpression with the full-length protein. However, these deletion mutants did not impair export of full-length TRPV4, implying that no oligomerization took place. These data indicate that the C-terminus of TRPV4 is required for oligomerization, which takes place in the ER and precedes plasma membrane trafficking.

The Arabidopsis Rho of Plants GTPase AtROP6 Functions in Developmental and Pathogen Response Pathways1[C][W][OA

Science.gov (United States)

Poraty-Gavra, Limor; Zimmermann, Philip; Haigis, Sabine; Bednarek, Paweł; Hazak, Ora; Stelmakh, Oksana Rogovoy; Sadot, Einat; Schulze-Lefert, Paul; Gruissem, Wilhelm; Yalovsky, Shaul

2013-01-01

How plants coordinate developmental processes and environmental stress responses is a pressing question. Here, we show that Arabidopsis (Arabidopsis thaliana) Rho of Plants6 (AtROP6) integrates developmental and pathogen response signaling. AtROP6 expression is induced by auxin and detected in the root meristem, lateral root initials, and leaf hydathodes. Plants expressing a dominant negative AtROP6 (rop6DN) under the regulation of its endogenous promoter are small and have multiple inflorescence stems, twisted leaves, deformed leaf epidermis pavement cells, and differentially organized cytoskeleton. Microarray analyses of rop6DN plants revealed that major changes in gene expression are associated with constitutive salicylic acid (SA)-mediated defense responses. In agreement, their free and total SA levels resembled those of wild-type plants inoculated with a virulent powdery mildew pathogen. The constitutive SA-associated response in rop6DN was suppressed in mutant backgrounds defective in SA signaling (nonexpresser of PR genes1 [npr1]) or biosynthesis (salicylic acid induction deficient2 [sid2]). However, the rop6DN npr1 and rop6DN sid2 double mutants retained the aberrant developmental phenotypes, indicating that the constitutive SA response can be uncoupled from ROP function(s) in development. rop6DN plants exhibited enhanced preinvasive defense responses to a host-adapted virulent powdery mildew fungus but were impaired in preinvasive defenses upon inoculation with a nonadapted powdery mildew. The host-adapted powdery mildew had a reduced reproductive fitness on rop6DN plants, which was retained in mutant backgrounds defective in SA biosynthesis or signaling. Our findings indicate that both the morphological aberrations and altered sensitivity to powdery mildews of rop6DN plants result from perturbations that are independent from the SA-associated response. These perturbations uncouple SA-dependent defense signaling from disease resistance execution. PMID

Deletion map of CYC1 mutants and its correspondence to mutationally altered iso-1-cytochromes c of yeast

International Nuclear Information System (INIS)

Sherman, F.; Jackson, M.; Liebman, S.W.; Schweingruber, A.M.; Stewart, J.W.

1975-01-01

Mutants arising spontaneously from sporulated cultures of certain strains of yeast, Saccharomyces cerevisiae, contained deletions of the CYC1 gene which controls the primary structure of iso-1-cytochrome c. At least 60 different kinds of deletions were uncovered among the 104 deletions examined and these ranged in length from those encompassing only two adjacent point mutants to those encompassing at least the entire CYC1 gene. X-ray-induced recombination rates of crosses involving these deletions and cyc1 point mutants resulted in the assignment of 211 point mutants to 47 mutational sites and made it possible to unambiguously order 40 of these 47 sites. Except for one mutant, cyc1-15, there was a strict colinear relationship between the deletion map and the positions of 13 sites that were previously determined by amino acid alterations in iso-1-cytochromes c from intragenic revertants

P22 Arc repressor: enhanced expression of unstable mutants by addition of polar C-terminal sequences.

OpenAIRE

Milla, M. E.; Brown, B. M.; Sauer, R. T.

1993-01-01

Many mutant variants of the P22 Arc repressor are subject to intracellular proteolysis in Escherichia coli, which precludes their expression at levels sufficient for purification and subsequent biochemical characterization. Here we examine the effects of several different C-terminal extension sequences on the expression and activity of a set of Arc mutants. We show that two tail sequences, KNQHE (st5) and H6KNQHE (st11), increase the expression levels of most mutants from 10- to 20-fold and, ...

Juvenile manifestation of ultrasound communication deficits in the neuroligin-4 null mutant mouse model of autism.

Science.gov (United States)

Ju, Anes; Hammerschmidt, Kurt; Tantra, Martesa; Krueger, Dilja; Brose, Nils; Ehrenreich, Hannelore

2014-08-15

Neuroligin-4 (Nlgn4) is a member of the neuroligin family of postsynaptic cell adhesion molecules. Loss-of-function mutations of NLGN4 are among the most frequent, known genetic causes of heritable autism. Adult Nlgn4 null mutant (Nlgn4(-/-)) mice are a construct valid model of human autism, with both genders displaying a remarkable autistic phenotype, including deficits in social interaction and communication as well as restricted and repetitive behaviors. In contrast to adults, autism-related abnormalities in neonatal and juvenile Nlgn4(-/-) mice have not been reported yet. The present study has been designed to systematically investigate in male and female Nlgn4(-/-) pups versus wildtype littermates (WT, Nlgn4(+/+)) developmental milestones and stimulus-induced ultrasound vocalization (USV). Neonatal development, followed daily from postnatal days (PND) 4 to 21, including physical development, neurological reflexes and neuromotor coordination, did not yield any differences between Nlgn4(-/-) and their WT littermates. USV in pups (PND8-9) in response to brief separation from their mothers revealed remarkable gender effects, and a genotype influence in females regarding latency to first call. In juveniles (PND22-23), USV monitoring upon exposure to an anesthetized female intruder mouse uncovered a clear genotype effect with reduced USV in Nlgn4(-/-) mice, and again a more prominent phenotype in females. Together, these data support an early manifestation of communication deficits in Nlgn4(-/-) mice that appear more pronounced in immature females with their overall stronger USV as compared to males. Copyright © 2014 Elsevier B.V. All rights reserved.

Phenotypic and epistatic grouping of hypo- and hyper-rec mus mutants in Aspergillus.

Science.gov (United States)

Kafer, E; Chae, S K

1994-03-01

The mutants musK to musS of Aspergillus nidulans are sensitive to methyl-methanesulfonate (MMS) and several of them are meiotic-defective and alter mitotic recombination frequencies. All were found to be cross-sensitive to 4-nitro-quinoline-N-oxide (4-NQO) but unexpectedly none of them was hypersensitive to gamma-rays and few to UV light. Double mus; uvs mutants were constructed to test for interactions with uvs mutations of the four epistatic groups of Aspergillus, "UvsF", "UvsC", "UvsI", and "UvsB". All meiotic-defective mus mutations caused some lethal interactions, usually with uvsF. None of them showed epistasis with UvsF or UvsB group mutants and one, musO, may represent a new group. Three mus mutations that affect recombination were assigned to the UvsC group, namely musN and K, and also musL which is recombination-defective and closely resembles uvsC. While uvsC mutants are mutators and lack UV-mutagenesis, most mus mutants had no effects on mutation. Only musR, which appeared epistatic with uvsI, showed reduced UV-reversion frequencies similar to uvsI. The recombination-proficient mus mutants appeared to be epistatic with more than one group, but in several cases sensitivities were slight and overlaps insufficient to obtain corroborating results with MMS and 4-NQO.

Identification and molecular characterization of the second Chlamydomonas gun4 mutant, gun4-II [v2; ref status: indexed, http://f1000r.es/1id

Directory of Open Access Journals (Sweden)

Phillip B Grovenstein

2013-07-01

Full Text Available The green micro-alga Chlamydomonas reinhardtii is an elegant model organism to study oxygenic photosynthesis. Chlorophyll (Chl and heme are major tetrapyrroles that play an essential role in photosynthesis and respiration. These tetrapyrroles are synthesized via a common branched pathway that involves mainly enzymes, encoded by nuclear genes. One of the enzymes in the pathway is Mg chelatase (MgChel. MgChel catalyzes insertion of Mg2+ into protoporphyrin IX (PPIX, proto to form Magnesium-protoporphyrin IX (MgPPIX, Mgproto, the first biosynthetic intermediate in the Chl branch. The GUN4 (genomes uncoupled 4 protein is not essential for the MgChel activity but has been shown to significantly stimulate its activity. We have isolated a light sensitive mutant, 6F14, by random DNA insertional mutagenesis. 6F14 cannot tolerate light intensities higher than 90-100 μmol photons m-2 s-1. It shows a light intensity dependent progressive photo-bleaching. 6F14 is incapable of photo-autotrophic growth under light intensity higher than 100 μmol photons m-2 s-1. PCR based analyses show that in 6F14 the insertion of the plasmid outside the GUN4 locus has resulted in a genetic rearrangement of the GUN4 gene and possible deletions in the genomic region flanking the GUN4 gene. Our gun4 mutant has a Chl content very similar to that in the wild type in the dark and is very sensitive to fluctuations in the light intensity in the environment unlike the earlier identified Chlamydomonas gun4 mutant. Complementation with a functional copy of the GUN4 gene restored light tolerance, Chl biosynthesis and photo-autotrophic growth under high light intensities in 6F14. 6F14 is the second gun4 mutant to be identified in C. reinhardtii. Additionally, we show that our two gun4 complements over-express the GUN4 protein and show a higher Chl content per cell compared to that in the wild type strain.

Vitamin C selectively kills KRAS and BRAF mutant colorectal cancer cells by targeting GAPDH.

Science.gov (United States)

Yun, Jihye; Mullarky, Edouard; Lu, Changyuan; Bosch, Kaitlyn N; Kavalier, Adam; Rivera, Keith; Roper, Jatin; Chio, Iok In Christine; Giannopoulou, Eugenia G; Rago, Carlo; Muley, Ashlesha; Asara, John M; Paik, Jihye; Elemento, Olivier; Chen, Zhengming; Pappin, Darryl J; Dow, Lukas E; Papadopoulos, Nickolas; Gross, Steven S; Cantley, Lewis C

2015-12-11

More than half of human colorectal cancers (CRCs) carry either KRAS or BRAF mutations and are often refractory to approved targeted therapies. We found that cultured human CRC cells harboring KRAS or BRAF mutations are selectively killed when exposed to high levels of vitamin C. This effect is due to increased uptake of the oxidized form of vitamin C, dehydroascorbate (DHA), via the GLUT1 glucose transporter. Increased DHA uptake causes oxidative stress as intracellular DHA is reduced to vitamin C, depleting glutathione. Thus, reactive oxygen species accumulate and inactivate glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Inhibition of GAPDH in highly glycolytic KRAS or BRAF mutant cells leads to an energetic crisis and cell death not seen in KRAS and BRAF wild-type cells. High-dose vitamin C impairs tumor growth in Apc/Kras(G12D) mutant mice. These results provide a mechanistic rationale for exploring the therapeutic use of vitamin C for CRCs with KRAS or BRAF mutations. Copyright © 2015, American Association for the Advancement of Science.

Expression of wild-type and mutant medium-chain acyl-CoA dehydrogenase (MCAD) cDNA in eucaryotic cells

DEFF Research Database (Denmark)

Jensen, T G; Andresen, B S; Bross, P

1992-01-01

An effective EBV-based expression system for eucaryotic cells has been developed and used for the study of the mitochondrial enzyme medium-chain acyl-CoA dehydrogenase (MCAD). 1325 bp of PCR-generated MCAD cDNA, containing the entire coding region, was placed between the SV40 early promoter...... and polyadenylation signals in the EBV-based vector. Both wild-type MCAD cDNA and cDNA containing the prevalent disease-causing mutation A to G at position 985 of the MCAD cDNA were tested. In transfected COS-7 cells, the steady state amount of mutant MCAD protein was consistently lower than the amount of wild......-type human enzyme. The enzyme activity in extracts from cells harbouring the wild-type MCAD cDNA was dramatically higher than in the controls (harbouring the vector without the MCAD gene) while only a slightly higher activity was measured with the mutant MCAD. The mutant MCAD present behaves like wild...

Mutant Mice Lacking the p53 C-Terminal Domain Model Telomere Syndromes

NARCIS (Netherlands)

Simeonova, I.; Jaber, S.; Draskovic, I.; Bardot, B.; Fang, M.; Bouarich-Bourimi, R.; Lejour, V.; Charbonnier, L.; Soudais, C.; Bourdon, J.C.; Huerre, M.; Londono-Vallejo, A.; Toledo, F.

2013-01-01

Mutations in p53, although frequent in human cancers, have not been implicated in telomere-related syndromes. Here, we show that homozygous mutant mice expressing p53(Delta31), a p53 lacking the C-terminal domain, exhibit increased p53 activity and suffer from aplastic anemia and pulmonary fibrosis,

C. elegans as a model in developmental neurotoxicology.

Science.gov (United States)

Ruszkiewicz, Joanna A; Pinkas, Adi; Miah, Mahfuzur R; Weitz, Rebecca L; Lawes, Michael J A; Akinyemi, Ayodele J; Ijomone, Omamuyovwi M; Aschner, Michael

2018-03-14

Due to many advantages Caenorhabditis elegans (C. elegans) has become a preferred model of choice in many fields, including neurodevelopmental toxicity studies. This review discusses the benefits of using C. elegans as an alternative to mammalian systems and gives examples of the uses of the nematode in evaluating the effects of major known neurodevelopmental toxins, including manganese, mercury, lead, fluoride, arsenic and organophosphorus pesticides. Reviewed data indicates numerous similarities with mammals in response to these toxins. Thus, C. elegans studies have the potential to predict possible effects of developmental neurotoxicants in higher animals, and may be used to identify new molecular pathways behind neurodevelopmental disruptions, as well as new toxicants. Copyright © 2018 Elsevier Inc. All rights reserved.

Crystallization and preliminary crystallographic analysis of decameric and monomeric forms of C49S mutant thioredoxin-dependent AhpC from Helicobacter pylori

International Nuclear Information System (INIS)

Supangat; Seo, Kyung Hye; Furqoni, Ahmad; Kwon, Young-Chul; Cho, Myung-Je; Rhee, Kwang-Ho; Lee, Sang Yeol; Lee, Kon Ho

2008-01-01

Decameric and monomeric forms of recombinant C49S mutant AhpC from H. pylori have been crystallized. Diffraction data were collected to 2.8 and 2.25 Å, respectively. Cys49Ser mutant Helicobacter pylori alkyl hydroperoxide reductase (C49S HpAhpC) was purified under reducing conditions in monomeric and decameric forms. The monomeric form was crystallized by the hanging-drop vapour-diffusion method. The crystals diffracted to 2.25 Å resolution and belonged to space group C2, with unit-cell parameters a = 245.8, b = 140.7, c = 189.5 Å, β = 127°, and contained 20 molecules in the asymmetric unit. A crystal of the decameric form was obtained by the microbatch crystallization method and diffracted to 2.8 Å resolution. It belonged to space group C222, with unit-cell parameters a = 257.5, b = 417.5, c = 95.6 Å. The structure of the monomeric form of C49S HpAhpC has been solved by the molecular-replacement method

The roles of phosphorylation and SHAGGY-like protein kinases in geminivirus C4 protein induced hyperplasia.

Directory of Open Access Journals (Sweden)

Katherine Mills-Lujan

Full Text Available Even though plant cells are highly plastic, plants only develop hyperplasia under very specific abiotic and biotic stresses, such as when exposed to pathogens like Beet curly top virus (BCTV. The C4 protein of BCTV is sufficient to induce hyperplasia and alter Arabidopsis development. It was previously shown that C4 interacts with two Arabidopsis Shaggy-like protein kinases, AtSK21 and 23, which are negative regulators of brassinosteroid (BR hormone signaling. Here we show that the C4 protein interacts with five additional AtSK family members. Bikinin, a competitive inhibitor of the seven AtSK family members that interact with C4, induced hyperplasia similar to that induced by the C4 protein. The Ser49 residue of C4 was found to be critical for C4 function, since: 1 mutagenesis of Ser49 to Ala abolished the C4-induced phenotype, abolished C4/AtSK interactions, and resulted in a mutant protein that failed to induce changes in the BR signaling pathway; 2 Ser49 is phosphorylated in planta; and 3 plant-encoded AtSKs must be catalytically active to interact with C4. A C4 N-myristoylation site mutant that does not localize to the plasma membrane and does not induce a phenotype, retained the ability to bind AtSKs. Taken together, these results suggest that plasma membrane associated C4 interacts with and co-opts multiple AtSKs to promote its own phosphorylation and activation to subsequently compromise cell cycle control.

Arabidopsis C3HC4-RING finger E3 ubiquitin ligase AtAIRP4 positively regulates stress-responsive abscisic acid signaling.

Science.gov (United States)

Yang, Liang; Liu, Qiaohong; Liu, Zhibin; Yang, Hao; Wang, Jianmei; Li, Xufeng; Yang, Yi

2016-01-01

Degradation of proteins via the ubiquitin system is an important step in many stress signaling pathways in plants. E3 ligases recognize ligand proteins and dictate the high specificity of protein degradation, and thus, play a pivotal role in ubiquitination. Here, we identified a gene, named Arabidopsis thaliana abscisic acid (ABA)-insensitive RING protein 4 (AtAIRP4), which is induced by ABA and other stress treatments. AtAIRP4 encodes a cellular protein with a C3HC4-RING finger domain in its C-terminal side, which has in vitro E3 ligase activity. Loss of AtAIRP4 leads to a decrease in sensitivity of root elongation and stomatal closure to ABA, whereas overexpression of this gene in the T-DNA insertion mutant atairp4 effectively recovered the ABA-associated phenotypes. AtAIRP4 overexpression plants were hypersensitive to salt and osmotic stresses during seed germination, and showed drought avoidance compared with the wild-type and atairp4 mutant plants. In addition, the expression levels of ABA- and drought-induced marker genes in AtAIRP4 overexpression plants were markedly higher than those in the wild-type and atairp4 mutant plants. Hence, these results indicate that AtAIRP4 may act as a positive regulator of ABA-mediated drought avoidance and a negative regulator of salt tolerance in Arabidopsis. © 2015 The Authors. Journal of Integrative Plant Biology published by Wiley Publishing Asia Pty Ltd on behalf of Institute of Botany, Chinese Academy of Sciences.

Effects of age and liquid holding on the UV-radiation sensitivities of wild-type and mutant Caenorhabditis elegans dauer larvae

Energy Technology Data Exchange (ETDEWEB)

Hartman, P S

1984-01-01

The dauer larva is a facultative developmental stage in the life cycle of the nematode Caenorhabditis elegans. Dauer larvae, which can survive under starvation for over 60 days, resume normal development when feeding is resumed. Wild-type (N2) and 4 radiation-sensitive (rad) mutant dauer larvae were tested for their abilities to develop into adults after UV-irradiation. The rad-3 mutant was over 30 times as sensitive as N2; rad-1, rad-2 and rad-7 mutants were not hypersensitive. Irradiation also delayed development in survivors. Wild-type dauer larvae did not differ in radiation sensitivity from 0 through 50 days of age. There was no liquid holding recovery (LHR); that is, survival did not increase when wild-type dauer larvae were held in buffer after irradiation. (orig.). 28 refs.; 4 figs.

Double-strand break repair and genetic recombination in topoisomerase and primase mutants of bacteriophage T4.

Science.gov (United States)

Shcherbakov, Victor P; Kudryashova, Elena

2014-09-01

The effects of primase and topoisomerase II deficiency on the double-strand break (DSB) repair and genetic recombination in bacteriophage T4 were studied in vivo using focused recombination. Site-specific DSBs were induced by SegC endonuclease in the rIIB gene of one of the parents. The frequency/distance relationship was determined in crosses of the wild-type phage, topoisomerase II mutant amN116 (gene 39), and primase mutant E219 (gene 61). Ordinary two-factor (i×j) and three-factor (i k×j) crosses between point rII mutations were also performed. These data provide information about the frequency and distance distribution of the single-exchange (splice) and double-exchange (patch) events. In two-factor crosses ets1×i, the topoisomerase and primase mutants had similar recombinant frequencies in crosses at ets1-i distances longer than 1000 bp, comprising about 80% of the corresponding wild-type values. They, however, differ remarkably in crosses at shorter distances. In the primase mutant, the recombinant frequencies are similar to those in the wild-type crosses at distances less than 100 bp, being a bit diminished at longer distances. In two-factor crosses ets1×i of the topoisomerase mutant, the recombinant frequencies were reduced ten-fold at the shortest distances. In three-factor crosses a6 ets1×i, where we measure patch-related recombination, the primase mutant was quite proficient across the entire range of distances. The topoisomerase mutant crosses demonstrated virtually complete absence of rII(+) recombinants at distances up to 33 bp, with the frequencies increasing steadily at longer distances. The data were interpreted as follows. The primase mutant is fully recombination-proficient. An obvious difference from the wild-type state is some shortage of EndoVII function leading to prolonged existence of HJs and thus stretched out ds-branch migration. This is also true for the topoisomerase mutant. However, the latter is deficient in the ss

PhMYB4 fine-tunes the floral volatile signature of Petunia x hybrida through PhC4H.

Science.gov (United States)

Colquhoun, Thomas A; Kim, Joo Young; Wedde, Ashlyn E; Levin, Laura A; Schmitt, Kyle C; Schuurink, Robert C; Clark, David G

2011-01-01

In Petunia × hybrida cv 'Mitchell Diploid' (MD), floral volatile benzenoid/phenylpropanoid (FVBP) biosynthesis is controlled spatially, developmentally, and daily at molecular, metabolic, and biochemical levels. Multiple genes have been shown to encode proteins that either directly catalyse a biochemical reaction yielding FVBP compounds or are involved in metabolite flux prior to the formation of FVBP compounds. It was hypothesized that multiple transcription factors are involved in the precise regulation of all necessary genes, resulting in the specific volatile signature of MD flowers. After acquiring all available petunia transcript sequences with homology to Arabidopsis thaliana R2R3-MYB transcription factors, PhMYB4 (named for its close identity to AtMYB4) was identified, cloned, and characterized. PhMYB4 transcripts accumulate to relatively high levels in floral tissues at anthesis and throughout open flower stages, which coincides with the spatial and developmental distribution of FVBP production and emission. Upon RNAi suppression of PhMYB4 (ir-PhMYB4) both petunia cinnamate-4-hydroxylase (PhC4H1 and PhC4H2) gene transcript levels were significantly increased. In addition, ir-PhMYB4 plants emit higher levels of FVBP compounds derived from p-coumaric acid (isoeugenol and eugenol) compared with MD. Together, these results indicate that PhMYB4 functions in the repression of C4H transcription, indirectly controlling the balance of FVBP production in petunia floral tissue (i.e. fine-tunes).

Lipid composition of cAMP-dependent protein kinase mutants of Aspergillus niger.

Science.gov (United States)

Jernejc, Katarina; Bencina, Mojca

2003-08-29

Lipid composition of cAMP-dependent protein kinase (PKA) Aspergillus niger mutants with overexpressed or deleted genes for either regulatory and/or the catalytic subunit of PKA was analyzed. Disruption of the gene encoding the PKA regulatory subunit resulted in 20% less total lipids, 30% less neutral lipids, four times more glycolipids and two-fold higher triacylglycerol lipase activity compared to the control strain. Concomitantly a five-fold decrease in phosphatidylcholine, accompanied with 1.5-, 1.8- and 2.8-fold increases in phosphatidylethanolamine, lysophosphatidylethanolamine and phosphatidylinositol, was determined, respectively. The lack of PKA activity, due to the disruption of a gene encoding the PKA catalytic subunit, resulted in a 1.6-times increase in total lipids with two times more neutral lipids associated with lower triacylglycerol lipase activity and a decrease in phospholipids. The mutants with unrestricted PKA activity synthesized twice as much citric acid as the control strain and three times more than strains lacking PKA activity. The results indicate the involvement of cAMP-mediated PKA activity in regulation of lipid biosynthesis as well as citric acid synthesis.

Oxidant resistance in a yeast mutant deficient in the Sit4 phosphatase

DEFF Research Database (Denmark)

López-Mirabal, H Reynaldo; Winther, Jakob R; Kielland-Brandt, Morten C

2008-01-01

Resistance to thiol oxidation can arise from mutations altering redox homeostasis. A Saccharomyces cerevisiae sit4-110 mutant is here described, which was isolated as resistant to the thiol-specific oxidant dipyridyl disulfide (DPS) and which contains a single-residue substitution in the SIT4 gene...

Temperature sensitive riboflavin mutants of Penicillium vermiculatum Dangeard

International Nuclear Information System (INIS)

Mitra, J.; Chaudhari, K.L.

1974-01-01

Two temperature sensitive UV induced riboflavin mutants rib 1 and rib 6 have been physiologically and genetically characterized. The two mutants behave differently with regard to their temperature sensitivity. The rib 1 mutant exhibits a leaky growth in minimal medium between 15 0 C and 30 0 C but grows well when the medium is supplemented with riboflavin. At 35 0 C the growth response of the mutant is at its max. and at 40 0 C and below 15 0 C it ceases to grow. The rib 6 mutant which is red brown in colour shows wild type character at temp. below 25 0 C in minimal medium but requires riboflavin at 30 0 C and above. Heterokaryotic analysis revealed the nonallelic nature of the two temperature mutants. Genetic tests of allelic relationship between riboflavin markers by crossing were also done. (author)

Structural and metabolic transitions of C4 leaf development and differentiation defined by microscopy and quantitative proteomics in maize.

Science.gov (United States)

Majeran, Wojciech; Friso, Giulia; Ponnala, Lalit; Connolly, Brian; Huang, Mingshu; Reidel, Edwin; Zhang, Cankui; Asakura, Yukari; Bhuiyan, Nazmul H; Sun, Qi; Turgeon, Robert; van Wijk, Klaas J

2010-11-01

C(4) grasses, such as maize (Zea mays), have high photosynthetic efficiency through combined biochemical and structural adaptations. C(4) photosynthesis is established along the developmental axis of the leaf blade, leading from an undifferentiated leaf base just above the ligule into highly specialized mesophyll cells (MCs) and bundle sheath cells (BSCs) at the tip. To resolve the kinetics of maize leaf development and C(4) differentiation and to obtain a systems-level understanding of maize leaf formation, the accumulation profiles of proteomes of the leaf and the isolated BSCs with their vascular bundle along the developmental gradient were determined using large-scale mass spectrometry. This was complemented by extensive qualitative and quantitative microscopy analysis of structural features (e.g., Kranz anatomy, plasmodesmata, cell wall, and organelles). More than 4300 proteins were identified and functionally annotated. Developmental protein accumulation profiles and hierarchical cluster analysis then determined the kinetics of organelle biogenesis, formation of cellular structures, metabolism, and coexpression patterns. Two main expression clusters were observed, each divided in subclusters, suggesting that a limited number of developmental regulatory networks organize concerted protein accumulation along the leaf gradient. The coexpression with BSC and MC markers provided strong candidates for further analysis of C(4) specialization, in particular transporters and biogenesis factors. Based on the integrated information, we describe five developmental transitions that provide a conceptual and practical template for further analysis. An online protein expression viewer is provided through the Plant Proteome Database.

Foot-and-Mouth Disease (FMD) Virus 3C Protease Mutant L127P: Implications for FMD Vaccine Development.

Science.gov (United States)

Puckette, Michael; Clark, Benjamin A; Smith, Justin D; Turecek, Traci; Martel, Erica; Gabbert, Lindsay; Pisano, Melia; Hurtle, William; Pacheco, Juan M; Barrera, José; Neilan, John G; Rasmussen, Max

2017-11-15

The foot-and-mouth disease virus (FMDV) afflicts livestock in more than 80 countries, limiting food production and global trade. Production of foot-and-mouth disease (FMD) vaccines requires cytosolic expression of the FMDV 3C protease to cleave the P1 polyprotein into mature capsid proteins, but the FMDV 3C protease is toxic to host cells. To identify less-toxic isoforms of the FMDV 3C protease, we screened 3C mutants for increased transgene output in comparison to wild-type 3C using a Gaussia luciferase reporter system. The novel point mutation 3C(L127P) increased yields of recombinant FMDV subunit proteins in mammalian and bacterial cells expressing P1-3C transgenes and retained the ability to process P1 polyproteins from multiple FMDV serotypes. The 3C(L127P) mutant produced crystalline arrays of FMDV-like particles in mammalian and bacterial cells, potentially providing a practical method of rapid, inexpensive FMD vaccine production in bacteria. IMPORTANCE The mutant FMDV 3C protease L127P significantly increased yields of recombinant FMDV subunit antigens and produced virus-like particles in mammalian and bacterial cells. The L127P mutation represents a novel advancement for economical FMD vaccine production. Copyright © 2017 Puckette et al.

Identification of new developmentally regulated genes involved in Streptomyces coelicolor sporulation.

Science.gov (United States)

Salerno, Paola; Persson, Jessica; Bucca, Giselda; Laing, Emma; Ausmees, Nora; Smith, Colin P; Flärdh, Klas

2013-12-05

The sporulation of aerial hyphae of Streptomyces coelicolor is a complex developmental process. Only a limited number of the genes involved in this intriguing morphological differentiation programme are known, including some key regulatory genes. The aim of this study was to expand our knowledge of the gene repertoire involved in S. coelicolor sporulation. We report a DNA microarray-based investigation of developmentally controlled gene expression in S. coelicolor. By comparing global transcription patterns of the wild-type parent and two mutants lacking key regulators of aerial hyphal sporulation, we found a total of 114 genes that had significantly different expression in at least one of the two mutants compared to the wild-type during sporulation. A whiA mutant showed the largest effects on gene expression, while only a few genes were specifically affected by whiH mutation. Seven new sporulation loci were investigated in more detail with respect to expression patterns and mutant phenotypes. These included SCO7449-7451 that affect spore pigment biogenesis; SCO1773-1774 that encode an L-alanine dehydrogenase and a regulator-like protein and are required for maturation of spores; SCO3857 that encodes a protein highly similar to a nosiheptide resistance regulator and affects spore maturation; and four additional loci (SCO4421, SCO4157, SCO0934, SCO1195) that show developmental regulation but no overt mutant phenotype. Furthermore, we describe a new promoter-probe vector that takes advantage of the red fluorescent protein mCherry as a reporter of cell type-specific promoter activity. Aerial hyphal sporulation in S. coelicolor is a technically challenging process for global transcriptomic investigations since it occurs only as a small fraction of the colony biomass and is not highly synchronized. Here we show that by comparing a wild-type to mutants lacking regulators that are specifically affecting processes in aerial hypha, it is possible to identify previously

Hepatitis C virus NS3/4A protease inhibits complement activation by cleaving complement component 4.

Directory of Open Access Journals (Sweden)

Seiichi Mawatari

Full Text Available BACKGROUND: It has been hypothesized that persistent hepatitis C virus (HCV infection is mediated in part by viral proteins that abrogate the host immune response, including the complement system, but the precise mechanisms are not well understood. We investigated whether HCV proteins are involved in the fragmentation of complement component 4 (C4, composed of subunits C4α, C4β, and C4γ, and the role of HCV proteins in complement activation. METHODS: Human C4 was incubated with HCV nonstructural (NS 3/4A protease, core, or NS5. Samples were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and then subjected to peptide sequencing. The activity of the classical complement pathway was examined using an erythrocyte hemolysis assay. The cleavage pattern of C4 in NS3/4A-expressing and HCV-infected cells, respectively, was also examined. RESULTS: HCV NS3/4A protease cleaved C4γ in a concentration-dependent manner, but viral core and NS5 did not. A specific inhibitor of NS3/4A protease reduced C4γ cleavage. NS3/4A protease-mediated cleavage of C4 inhibited classical pathway activation, which was abrogated by a NS3/4A protease inhibitor. In addition, co-transfection of cells with C4 and wild-type NS3/4A, but not a catalytic-site mutant of NS3/4A, produced cleaved C4γ fragments. Such C4 processing, with a concomitant reduction in levels of full-length C4γ, was also observed in HCV-infected cells expressing C4. CONCLUSIONS: C4 is a novel cellular substrate of the HCV NS3/4A protease. Understanding disturbances in the complement system mediated by NS3/4A protease may provide new insights into the mechanisms underlying persistent HCV infection.

Asparagine 326 in the extremely C-terminal region of XRCC4 is essential for the cell survival after irradiation

Energy Technology Data Exchange (ETDEWEB)

Wanotayan, Rujira; Fukuchi, Mikoto; Imamichi, Shoji; Sharma, Mukesh Kumar; Matsumoto, Yoshihisa, E-mail: yoshim@nr.titech.ac.jp

2015-02-20

XRCC4 is one of the crucial proteins in the repair of DNA double-strand break (DSB) through non-homologous end-joining (NHEJ). As XRCC4 consists of 336 amino acids, N-terminal 200 amino acids include domains for dimerization and for association with DNA ligase IV and XLF and shown to be essential for XRCC4 function in DSB repair and V(D)J recombination. On the other hand, the role of the remaining C-terminal region of XRCC4 is not well understood. In the present study, we noticed that a stretch of ∼20 amino acids located at the extreme C-terminus of XRCC4 is highly conserved among vertebrate species. To explore its possible importance, series of mutants in this region were constructed and assessed for the functionality in terms of ability to rescue radiosensitivity of M10 cells lacking XRCC4. Among 13 mutants, M10 transfectant with N326L mutant (M10-XRCC4{sup N326L}) showed elevated radiosensitivity. N326L protein showed defective nuclear localization. N326L sequence matched the consensus sequence of nuclear export signal. Leptomycin B treatment accumulated XRCC4{sup N326L} in the nucleus but only partially rescued radiosensitivity of M10-XRCC4{sup N326L}. These results collectively indicated that the functional defects of XRCC4{sup N326L} might be partially, but not solely, due to its exclusion from nucleus by synthetic nuclear export signal. Further mutation of XRCC4 Asn326 to other amino acids, i.e., alanine, aspartic acid or glutamine did not affect the nuclear localization but still exhibited radiosensitivity. The present results indicated the importance of the extremely C-terminal region of XRCC4 and, especially, Asn326 therein. - Highlights: • Extremely C-terminal region of XRCC4 is highly conserved among vertebrate species. • XRCC4 C-terminal point mutants, R325F and N326L, are functionally deficient in terms of survival after irradiation. • N326L localizes to the cytoplasm because of synthetic nuclear export signal. • Leptomycin B restores the

Characterization of a Weak Allele of Zebrafish cloche Mutant

Science.gov (United States)

Ma, Ning; Huang, Zhibin; Chen, Xiaohui; He, Fei; Wang, Kun; Liu, Wei; Zhao, Linfeng; Xu, Xiangmin; Liao, Wangjun; Ruan, Hua; Luo, Shenqiu; Zhang, Wenqing

2011-01-01

Hematopoiesis is a complicated and dynamic process about which the molecular mechanisms remain poorly understood. Danio rerio (zebrafish) is an excellent vertebrate system for studying hematopoiesis and developmental mechanisms. In the previous study, we isolated and identified a cloche 172 (clo 172) mutant, a novel allele compared to the original cloche (clo) mutant, through using complementation test and initial mapping. Here, according to whole mount in-situ hybridization, we report that the endothelial cells in clo 172 mutant embryos, although initially developed, failed to form the functional vascular system eventually. In addition, further characterization indicates that the clo 172 mutant exhibited weaker defects instead of completely lost in primitive erythroid cells and definitive hematopoietic cells compared with the clo s5 mutant. In contrast, primitive myeloid cells were totally lost in clo 172 mutant. Furthermore, these reappeared definitive myeloid cells were demonstrated to initiate from the remaining hematopoietic stem cells (HSCs) in clo 172 mutant, confirmed by the dramatic decrease of lyc in clo 172 runx1w84x double mutant. Collectively, the clo 172 mutant is a weak allele compared to the clo s5 mutant, therefore providing a model for studying the early development of hematopoietic and vascular system, as well as an opportunity to further understand the function of the cloche gene. PMID:22132109

Isolation and characterization of prophage mutants of the defective Bacillus subtilis bacteriophage PBSX

International Nuclear Information System (INIS)

Thurm, P.; Garro, A.J.

1975-01-01

Bacillus subtilis mutants with lesions in PBSX prophage genes have been isolated. One of these appears to be a regulatory mutant and is defective for mitomycin C-induced derepression of PBSX; the others are defective for phage capsid formation. All of the PBSX structural proteins are synthesized during induction of the capsid defective mutants; however, several of these proteins exhibit abnormal serological reactivity with anti-PBSX antiserum. The two head proteins X4 and X7 are not immunoprecipitable in a mutant which fails to assemble phage head structures. In the tail mutant, proteins X5 and X6 are not immunoprecipitable, tails are not assembled, and a possible tail protein precursor remains uncleaved. The noninducible mutant does not synthesize any PBSX structural proteins after exposure to mitomycin C. The mutation is specific for PBSX since phi 105 and SPO2 lysogens of the mutant are inducible. All of the known PBSX-specific mutations were shown to be clustered between argC and metC on the host chromosome. In addition, the metC marker was shown to be present in multiple copies in cells induced for PBSX replication. This suggests that the derepressed prophage replicates while still integrated and that replication extends into the adjacent regions of the host chromosome

C. elegans germline-deficient mutants respond to pathogen infection using shared and distinct mechanisms.

Directory of Open Access Journals (Sweden)

Michael TeKippe

2010-07-01

Full Text Available Reproduction extracts a cost in resources that organisms are then unable to utilize to deal with a multitude of environmental stressors. In the nematode C. elegans, development of the germline shortens the lifespan of the animal and increases its susceptibility to microbial pathogens. Prior studies have demonstrated germline-deficient nematodes to have increased resistance to gram negative bacteria. We show that germline-deficient strains display increased resistance across a broad range of pathogens including gram positive and gram negative bacteria, and the fungal pathogen Cryptococcus neoformans. Furthermore, we show that the FOXO transcription factor DAF-16, which regulates longevity and immunity in C. elegans, appears to be crucial for maintaining longevity in both wild-type and germline-deficient backgrounds. Our studies indicate that germline-deficient mutants glp-1 and glp-4 respond to pathogen infection using common and different mechanisms that involve the activation of DAF-16.

Description of some characteristics of flowers and seeds of Arabidopsis thaliana - ecotype landsberg erecta and mutant NW4

Directory of Open Access Journals (Sweden)

Leszek Trząski

2014-01-01

Full Text Available Flowers and seeds of Landsberg erecta (Ler ecotype and NW4 mutant were studied by light microscopy and scanning electron microscopy to reveal characteristic features of their structure. The NW4 mutant flowers differ from Ler mainly in presence of two bract-like sepals with complicated vasculature and a variable number of secondary flowers. In the two outer whorls of NW4 flower, variable number of transformed stamen-, petal-, sepal- and style-like elements also occur. The NW4 mutant seeds are characterized by the absence of mucilage around the surface and a deviating seed coat morphology.

Hearing loss associated with enlarged vestibular aqueduct and zero or one mutant allele of SLC26A4.

Science.gov (United States)

Rose, Jane; Muskett, Julie A; King, Kelly A; Zalewski, Christopher K; Chattaraj, Parna; Butman, John A; Kenna, Margaret A; Chien, Wade W; Brewer, Carmen C; Griffith, Andrew J

2017-07-01

To characterize the severity and natural history of hearing loss, and the prevalence of having a cochlear implant in a maturing cohort of individuals with enlarged vestibular aqueduct (EVA) and zero or one mutant allele of SLC26A4. Prospective cohort study of subjects ascertained between 1998 and 2015 at the National Institutes of Health Clinical Center. Study subjects were 127 individuals (median age, 8 years; range, 0-59 years) with EVA in at least one ear. Ears with EVA and zero or one mutant allele of SLC26A4 had mean 0.5/1/2/4-kHz pure-tone averages of 62.6 and 52.9 dB HL, respectively, in contrast to EVA ears with two mutant alleles of SLC26A4 (88.1 dB HL; P zero, one, and two mutant alleles, respectively (P = .00833). This association was not independent (P = .534) but reflected underlying correlations with age at time of first audiogram (P = .003) or severity of hearing loss (P = .000). Ears with EVA and zero or one mutant allele of SLC26A4 have less severe hearing loss, no difference in prevalence of fluctuation, and a lower prevalence of cochlear implantation in comparison to ears with two mutant alleles of SLC26A4. NA Laryngoscope, 127:E238-E243, 2017. © 2016 The American Laryngological, Rhinological and Otological Society, Inc.

Assessment of Lupin Induced Mutants for Quality Traits and Susceptibility to Callosbruchus chinensis and Heliothis armigera insects

International Nuclear Information System (INIS)

Ragab, A.I.; Boshra, S.A.; Mehany, A.L.; Darwish, A.A.; Kharrab, M.M.

2008-01-01

This study was conducted to assess 23 induced mutants and two parental varieties Giza1 and Giza2 in the three generations (M3, M4, and M5) for seed quality traits, and susceptibility to two insects i.e C. chinnensis and H.armigera. The obtained results exhibited highly significant decrease for alkaloid content of mutants 20 and 23 as compared with the two local varieties. Most of mutants and Giza 2 showed marked increase for protein content as compared with Giza1, however, the increase did not reach the level of significance for the most mutants as compared with Giza2 in the three generations. Except of M4 generation. marked resistance for infestations with C.chinensis and H.armigera was obtained for mutants 1, 5 and 11 in the three generations. However, for total infestation with the two insects, resistance was obtained in mutants 4 and 10. Except of mutant lines 1, 5 and 11, all mutants showed higher loss percentage than that of the local varieties

Biosynthetic pathways to delta-aminolevulinic acid induced by blue light in the pigment mutant C-2A' of Scenedesmus obliquus

International Nuclear Information System (INIS)

Klein, O.; Senger, H.

1978-01-01

The X-ray induced mutant C-2A' of Scenedesmus obliquus grows heterotrophically but forms only traces of chlorophyll in the dark. Upon illumination, delta-aminolevulinic acid (ALA) is synthesized and chlorophyll is formed. These processes are blue light dependent and ceased immediately when the cells were transferred back into darkness. Addition of levulinic acid (LA) inhibited the light-dependent formation of chlorophyll and caused accumulation of ALA by competitive inhibition of the ALA dehydratase (EC. 4.2.1.24). By feeding specifically labelled 14 C precursors to the pigment mutant, inhibiting the ALA dehydratase with LA, accumulating, extracting and analyzing the ALA, two pathways leading towards ALA could be established: glycine and succinyl CoA can be condensed to ALA and the 5 carbon skeleton of glutamate can completely be incorporated into ALA via a second pathway. The glycine-succinyl CoA pathway dominated over the glutamate pathway, but both led to chlorophyll formation. (author)

Maternal topoisomerase II alpha, not topoisomerase II beta, enables embryonic development of zebrafish top2a-/- mutants

LENUS (Irish Health Repository)

Sapetto-Rebow, Beata

2011-11-23

Abstract Background Genetic alterations in human topoisomerase II alpha (TOP2A) are linked to cancer susceptibility. TOP2A decatenates chromosomes and thus is necessary for multiple aspects of cell division including DNA replication, chromosome condensation and segregation. Topoisomerase II alpha is also required for embryonic development in mammals, as mouse Top2a knockouts result in embryonic lethality as early as the 4-8 cell stage. The purpose of this study was to determine whether the extended developmental capability of zebrafish top2a mutants arises from maternal expression of top2a or compensation from its top2b paralogue. Results Here, we describe bloody minded (blm), a novel mutant of zebrafish top2a. In contrast to mouse Top2a nulls, zebrafish top2a mutants survive to larval stages (4-5 day post fertilization). Developmental analyses demonstrate abundant expression of maternal top2a but not top2b. Inhibition or poisoning of maternal topoisomerase II delays embryonic development by extending the cell cycle M-phase. Zygotic top2a and top2b are co-expressed in the zebrafish CNS, but endogenous or ectopic top2b RNA appear unable to prevent the blm phenotype. Conclusions We conclude that maternal top2a enables zebrafish development before the mid-zygotic transition (MZT) and that zebrafish top2a and top2b are not functionally redundant during development after activation of the zygotic genome.

Maternal topoisomerase II alpha, not topoisomerase II beta, enables embryonic development of zebrafish top2a-/- mutants

Directory of Open Access Journals (Sweden)

Sapetto-Rebow Beata

2011-11-01

Full Text Available Abstract Background Genetic alterations in human topoisomerase II alpha (TOP2A are linked to cancer susceptibility. TOP2A decatenates chromosomes and thus is necessary for multiple aspects of cell division including DNA replication, chromosome condensation and segregation. Topoisomerase II alpha is also required for embryonic development in mammals, as mouse Top2a knockouts result in embryonic lethality as early as the 4-8 cell stage. The purpose of this study was to determine whether the extended developmental capability of zebrafish top2a mutants arises from maternal expression of top2a or compensation from its top2b paralogue. Results Here, we describe bloody minded (blm, a novel mutant of zebrafish top2a. In contrast to mouse Top2a nulls, zebrafish top2a mutants survive to larval stages (4-5 day post fertilization. Developmental analyses demonstrate abundant expression of maternal top2a but not top2b. Inhibition or poisoning of maternal topoisomerase II delays embryonic development by extending the cell cycle M-phase. Zygotic top2a and top2b are co-expressed in the zebrafish CNS, but endogenous or ectopic top2b RNA appear unable to prevent the blm phenotype. Conclusions We conclude that maternal top2a enables zebrafish development before the mid-zygotic transition (MZT and that zebrafish top2a and top2b are not functionally redundant during development after activation of the zygotic genome.

Histological Characterization of the Dicer1 Mutant Zebrafish Retina

Directory of Open Access Journals (Sweden)

Saeed Akhtar

2015-01-01

Full Text Available DICER1, a multidomain RNase III endoribonuclease, plays a critical role in microRNA (miRNA and RNA-interference (RNAi functional pathways. Loss of Dicer1 affects different developmental processes. Dicer1 is essential for retinal development and maintenance. DICER1 was recently shown to have another function of silencing the toxicity of Alu RNAs in retinal pigment epithelium (RPE cells, which are involved in the pathogenesis of age related macular degeneration. In this study, we characterized a Dicer1 mutant fish line, which carries a nonsense mutation (W1457Ter induced by N-ethyl-N-nitrosourea mutagenesis. Zebrafish DICER1 protein is highly conserved in the evolution. Zebrafish Dicer1 is expressed at the earliest stages of zebrafish development and persists into late developmental stages; it is widely expressed in adult tissues. Homozygous Dicer1 mutant fish (DICER1W1457Ter/W1457Ter have an arrest in early growth with significantly smaller eyes and are dead at 14–18 dpf. Heterozygous Dicer1 mutant fish have similar retinal structure to that of control fish; the retinal pigment epithelium (RPE cells are normal with no sign of degeneration at the age of 20 months.

Transgenic C. elegans dauer larvae expressing hookworm phospho null DAF-16/FoxO exit dauer.

Directory of Open Access Journals (Sweden)

Verena Gelmedin

Full Text Available Parasitic hookworms and the free-living model nematode Caenorhabtidis elegans share a developmental arrested stage, called the dauer stage in C. elegans and the infective third-stage larva (L3 in hookworms. One of the key transcription factors that regulate entrance to and exit from developmental arrest is the forkhead transcription factor DAF-16/FoxO. During the dauer stage, DAF-16 is activated and localized in the nucleus. DAF-16 is negatively regulated by phosphorylation by the upstream kinase AKT, which causes DAF-16 to localize out of the nucleus and the worm to exit from dauer. DAF-16 is conserved in hookworms, and hypothesized to control recovery from L3 arrest during infection. Lacking reverse genetic techniques for use in hookworms, we used C. elegans complementation assays to investigate the function of Ancylostoma caninum DAF-16 during entrance and exit from L3 developmental arrest. We performed dauer switching assays and observed the restoration of the dauer phenotype when Ac-DAF-16 was expressed in temperature-sensitive dauer defective C. elegans daf-2(e1370;daf-16(mu86 mutants. AKT phosphorylation site mutants of Ac-DAF-16 were also able to restore the dauer phenotype, but surprisingly allowed dauer exit when temperatures were lowered. We used fluorescence microscopy to localize DAF-16 during dauer and exit from dauer in C. elegans DAF-16 mutant worms expressing Ac-DAF-16, and found that Ac-DAF-16 exited the nucleus during dauer exit. Surprisingly, Ac-DAF-16 with mutated AKT phosphorylation sites also exited the nucleus during dauer exit. Our results suggest that another mechanism may be involved in the regulation DAF-16 nuclear localization during recovery from developmental arrest.

Structural characterization of V57D and V57P mutants of human cystatin C, an amyloidogenic protein

Energy Technology Data Exchange (ETDEWEB)

Orlikowska, Marta; Szymańska, Aneta [University of Gdansk, Sobieskiego 18/19, 80-952 Gdansk (Poland); Borek, Dominika; Otwinowski, Zbyszek [University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, TX 75390-8816 (United States); Skowron, Piotr; Jankowska, Elżbieta, E-mail: elaj@chem.univ.gda.pl [University of Gdansk, Sobieskiego 18/19, 80-952 Gdansk (Poland)

2013-04-01

Val57 point mutants of human cystatin C, which were designed to assess the influence of changes in the properties of the L1 loop on the dimerization propensity, were structurally characterized. Wild-type human cystatin C (hCC wt) is a low-molecular-mass protein (120 amino-acid residues, 13 343 Da) that is found in all nucleated cells. Physiologically, it functions as a potent regulator of cysteine protease activity. While the biologically active hCC wt is a monomeric protein, all crystallization efforts to date have resulted in a three-dimensional domain-swapped dimeric structure. In the recently published structure of a mutated hCC, the monomeric fold was preserved by a stabilization of the conformationally constrained loop L1 caused by a single amino-acid substitution: Val57Asn. Additional hCC mutants were obtained in order to elucidate the relationship between the stability of the L1 loop and the propensity of human cystatin C to dimerize. In one mutant Val57 was substituted by an aspartic acid residue, which is favoured in β-turns, and in the second mutant proline, a residue known for broadening turns, was substituted for the same Val57. Here, 2.26 and 3.0 Å resolution crystal structures of the V57D andV57P mutants of hCC are reported and their dimeric architecture is discussed in terms of the stabilization and destabilization effects of the introduced mutations.

Structural and Functional Recovery of Sensory Cilia in C. elegans IFT Mutants upon Aging.

Directory of Open Access Journals (Sweden)

Astrid Cornils

2016-12-01

Full Text Available The majority of cilia are formed and maintained by the highly conserved process of intraflagellar transport (IFT. Mutations in IFT genes lead to ciliary structural defects and systemic disorders termed ciliopathies. Here we show that the severely truncated sensory cilia of hypomorphic IFT mutants in C. elegans transiently elongate during a discrete period of adult aging leading to markedly improved sensory behaviors. Age-dependent restoration of cilia morphology occurs in structurally diverse cilia types and requires IFT. We demonstrate that while DAF-16/FOXO is dispensable, the age-dependent suppression of cilia phenotypes in IFT mutants requires cell-autonomous functions of the HSF1 heat shock factor and the Hsp90 chaperone. Our results describe an unexpected role of early aging and protein quality control mechanisms in suppressing ciliary phenotypes of IFT mutants, and suggest possible strategies for targeting subsets of ciliopathies.

PrkC-mediated phosphorylation of overexpressed YvcK protein regulates PBP1 protein localization in Bacillus subtilis mreB mutant cells.

Science.gov (United States)

Foulquier, Elodie; Pompeo, Frédérique; Freton, Céline; Cordier, Baptiste; Grangeasse, Christophe; Galinier, Anne

2014-08-22

The YvcK protein has been shown to be necessary for growth under gluconeogenic conditions in Bacillus subtilis. Amazingly, its overproduction rescues growth and morphology defects of the actin-like protein MreB deletion mutant by restoration of PBP1 localization. In this work, we observed that YvcK was phosphorylated at Thr-304 by the protein kinase PrkC and that phosphorylated YvcK was dephosphorylated by the cognate phosphatase PrpC. We show that neither substitution of this threonine with a constitutively phosphorylated mimicking glutamic acid residue or a phosphorylation-dead mimicking alanine residue nor deletion of prkC or prpC altered the ability of B. subtilis to grow under gluconeogenic conditions. However, we observed that a prpC mutant and a yvcK mutant were more sensitive to bacitracin compared with the WT strain. In addition, the bacitracin sensitivity of strains in which YvcK Thr-304 was replaced with either an alanine or a glutamic acid residue was also affected. We also analyzed rescue of the mreB mutant strain by overproduction of YvcK in which the phosphorylation site was substituted. We show that YvcK T304A overproduction did not rescue the mreB mutant aberrant morphology due to PBP1 mislocalization. The same observation was made in an mreB prkC double mutant overproducing YvcK. Altogether, these data show that YvcK may have two distinct functions: 1) in carbon source utilization independent of its phosphorylation level and 2) in cell wall biosynthesis and morphogenesis through its phosphorylation state. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Cross-species microarray hybridization to identify developmentally regulated genes in the filamentous fungus Sordaria macrospora.

Science.gov (United States)

Nowrousian, Minou; Ringelberg, Carol; Dunlap, Jay C; Loros, Jennifer J; Kück, Ulrich

2005-04-01

The filamentous fungus Sordaria macrospora forms complex three-dimensional fruiting bodies that protect the developing ascospores and ensure their proper discharge. Several regulatory genes essential for fruiting body development were previously isolated by complementation of the sterile mutants pro1, pro11 and pro22. To establish the genetic relationships between these genes and to identify downstream targets, we have conducted cross-species microarray hybridizations using cDNA arrays derived from the closely related fungus Neurospora crassa and RNA probes prepared from wild-type S. macrospora and the three developmental mutants. Of the 1,420 genes which gave a signal with the probes from all the strains used, 172 (12%) were regulated differently in at least one of the three mutants compared to the wild type, and 17 (1.2%) were regulated differently in all three mutant strains. Microarray data were verified by Northern analysis or quantitative real time PCR. Among the genes that are up- or down-regulated in the mutant strains are genes encoding the pheromone precursors, enzymes involved in melanin biosynthesis and a lectin-like protein. Analysis of gene expression in double mutants revealed a complex network of interaction between the pro gene products.

Up-regulation of granzyme B and perforin by staphylococcal enterotoxin C2 mutant induces enhanced cytotoxicity in Hepa1–6 cells

Energy Technology Data Exchange (ETDEWEB)

Zhang, Guojun [Institute of Applied Ecology, Chinese Academy of Sciences, No.72 Wenhua Road Shenhe Dis., Shenyang, Liaoning (China); University of Chinese Academy of Sciences, Beijing (China); Xu, Mingkai, E-mail: mkxu@iae.ac.cn [Institute of Applied Ecology, Chinese Academy of Sciences, No.72 Wenhua Road Shenhe Dis., Shenyang, Liaoning (China); Zhang, Huiwen [Institute of Applied Ecology, Chinese Academy of Sciences, No.72 Wenhua Road Shenhe Dis., Shenyang, Liaoning (China); Song, Yubo [Institute of Applied Ecology, Chinese Academy of Sciences, No.72 Wenhua Road Shenhe Dis., Shenyang, Liaoning (China); University of Chinese Academy of Sciences, Beijing (China); Wang, Jian; Zhang, Chenggang [Institute of Applied Ecology, Chinese Academy of Sciences, No.72 Wenhua Road Shenhe Dis., Shenyang, Liaoning (China)

2016-12-15

Staphylococcal enterotoxin C2 (SEC2), a member of bacterial superantigen, is one of the most potent known activators of T lymphocytes. With this property, SEC2 has already been used in clinic as a tumor immunotherapy agent in China. To increase the antitumor activity, a SEC2 mutant named ST-4 (GKVTG102-106WWH) with amino acid substitutions in T cell receptor (TCR)-binding domain was generated by site-directed mutagenesis, and the molecular mechanism of the enhanced antitumor activity was investigated. Results showed that ST-4 could activate much more Vβ 8.2 and 8.3 T cells and NK cells compared with SEC2, and exhibited significantly enhanced immunocyte stimulation and antitumor activity in vitro. The synthetic peptide sequencing the residues of mutant TCR-binding domain could competitively inhibit the immunocyte stimulation activity of ST-4. Most importantly, ST-4 up-regulated granzyme B and perforin at both mRNA and protein levels. We also found that expression of proapoptotic proteins cytochrome c, BAX and activation of caspase-3, 9 was up-regulated, and antiapoptotic protein Bcl-xL was down-regulated in the treatment with either ST-4 or SEC2. When granzyme B inhibitor or perforin inhibitor is presented, tumor cell viability was significantly rescued. Taken together, we demonstrate that increased ST-4-TCR recognition contributed to massive T cells and NK cells activation. These activated cells released up-regulated granzyme B and perforin, which induced the enhanced tumor cells apoptosis by mitochondrial apoptotic pathway, and ultimately led to enhanced tumor cell growth inhibition. ST-4 may be a promising candidate for antitumor clinic usage in future. - Highlights: • We obtained a SEC2 mutant ST-4 with enhanced superantigen and antitumor activity. • Increased ST-4-TCR recognition contributed to massive T cells and NK cells activation. • Up-regulated GzmB and PRF1 in T cell by ST-4 induced enhanced tumor cells apoptosis. • Enhanced tumor cell apoptosis

Biochemical characterization and cellular effects of CADASIL mutants of NOTCH3.

Directory of Open Access Journals (Sweden)

He Meng

Full Text Available Cerebral Autosomal Dominant Arteriopathy with Subcortical Infarcts and Leukoencephalopathy (CADASIL is the best understood cause of dominantly inherited stroke and results from NOTCH3 mutations that lead to NOTCH3 protein accumulation and selective arterial smooth muscle degeneration. Previous studies show that NOTCH3 protein forms multimers. Here, we investigate protein interactions between NOTCH3 and other vascular Notch isoforms and characterize the effects of elevated NOTCH3 on smooth muscle gene regulation. We demonstrate that NOTCH3 forms heterodimers with NOTCH1, NOTCH3, and NOTCH4. R90C and C49Y mutant NOTCH3 form complexes which are more resistant to detergents than wild type NOTCH3 complexes. Using quantitative NOTCH3-luciferase clearance assays, we found significant inhibition of mutant NOTCH3 clearance. In coculture assays of NOTCH function, overexpressed wild type and mutant NOTCH3 significantly repressed NOTCH-regulated smooth muscle transcripts and potently impaired the activity of three independent smooth muscle promoters. Wildtype and R90C recombinant NOTCH3 proteins applied to cell cultures also blocked canonical Notch fuction. We conclude that CADASIL mutants of NOTCH3 complex with NOTCH1, 3, and 4, slow NOTCH3 clearance, and that overexpressed wild type and mutant NOTCH3 protein interfere with key NOTCH-mediated functions in smooth muscle cells.

Brucella abortus 2308ΔNodVΔNodW double-mutant is highly attenuated and confers protection against wild-type challenge in BALB/c mice.

Science.gov (United States)

Li, Zhiqiang; Wang, Shuli; Zhang, Jinliang; Yang, Guangli; Yuan, Baodong; Huang, Jie; Han, Jincheng; Xi, Li; Xiao, Yanren; Chen, Chuangfu; Zhang, Hui

2017-05-01

Brucellosis is an important zoonotic disease of worldwide distribution, which causes animal and human disease. However, the current Brucella abortus (B. abortus) vaccines (S19 and RB51) have several drawbacks, including residual virulence for animals and humans. Moreover, S19 cannot allow serological differentiation between infected and vaccinated animals. We constructed double deletion (ΔNodVΔNodW) mutant from virulent B. abortus 2308 (S2308) by deleting the genes encoding two-component regulatory system (TCS) in chromosome II in S2308.2308ΔNodVΔNodW was significantly reduced survival in murine macrophages (RAW 264.7) and BALB/c mice. Moreover, the inoculated mice showed no splenomegaly. The mutant induced high protective immunity in BALB/c mice against challenge with S2308, and elicited an anti-Brucella-specific immunoglobulin G (IgG) response and induced the secretion of gamma interferon (IFN-γ) and interleukin-4 (IL-4). Moreover, NODV and NODW antigens would allow the serological differentiation between infected and vaccinated animals. These results suggest that 2308ΔNodVΔNodW mutant is a potential live attenuated vaccine candidate and can be used effectively against bovine brucellosis. Copyright © 2017 Elsevier Ltd. All rights reserved.

Conditioned taste aversion memory and c-Fos induction are disrupted in RIIbeta-protein kinase A mutant mice.

Science.gov (United States)

Koh, Ming Teng; Clarke, Sharon N D A; Spray, Kristina J; Thiele, Todd E; Bernstein, Ilene L

2003-07-14

The cAMP-dependent protein kinase (PKA) signaling pathway has been implicated in many forms of learning. The present studies examined conditioned taste aversion (CTA) learning, an amygdala-dependent task, in mice with a targeted disruption of a gene for a specific regulatory subunit of PKA (RIIbeta), which is selectively expressed in amygdala. Null mutant (RIIbeta(-/-)) mice and littermate controls (RIIbeta(+/+)) were tested for protein synthesis-independent short-term memory (STM) and protein synthesis-dependent long-term memory (LTM) for CTAs. The ability of the unconditioned stimulus (US) drug, LiCl, to induce c-Fos in regions thought to be important in this learning was also determined. RIIbeta(-/-) mice showed significant impairment in CTA memory when tested 24h after training (LTM). In contrast, STM was normal. With regard to the c-Fos response to LiCl, the US drug, significant elevations were evident in brainstem (nucleus of the solitary tract) and pontine (parabrachial nucleus) regions, in mutants as well as wild-type controls. However, in amygdala, elevations were seen in controls but were absent in the mutants. These findings suggest that disruption of PKA signaling interferes with LTM consolidation of CTA and that a possible mediator of this effect is interference with c-Fos expression in amygdala which may be necessary for CTA memory.

Apc-Mutant Kyoto Apc Delta (KAD) Rats Are Susceptible to 4-NQO-Induced Tongue Carcinogenesis

Energy Technology Data Exchange (ETDEWEB)

Tanaka, Takuji, E-mail: tmntt08@gmail.com [Department of Diagnostic Pathology (DDP) & Research Center of Diagnostic Pathology (RC-DiP), Gifu Municipal Hospital, 7-1 Kashima-Cho, Gifu 500-8513 (Japan); Department of Tumor Pathology, Gifu University Graduate School of Medicine, 1-1 Yanagido, Gifu 501-1194 (Japan); Shimizu, Masahito; Kochi, Takahiro; Shirakami, Yohei [Department of Internal Medicine/Gastroenterology, Gifu University Graduate School of Medicine, 1-1 Yanagido, Gifu 501-1194 (Japan); Mori, Takayuki [Department of Pharmacy, Ogaki Municipal Hospital, 4-86 Minaminokawa-cho, Ogaki 503-8502 (Japan); Watanabe, Naoki [Department of Diagnostic Pathology (DDP) & Research Center of Diagnostic Pathology (RC-DiP), Gifu Municipal Hospital, 7-1 Kashima-Cho, Gifu 500-8513 (Japan); Naiki, Takafumi [Department of Clinical Laboratory, Gifu Municipal Hospital, 7-1 Kashima-cho, Gifu 500-8513 (Japan); Moriwaki, Hisataka [Department of Internal Medicine/Gastroenterology, Gifu University Graduate School of Medicine, 1-1 Yanagido, Gifu 501-1194 (Japan); Yoshimi, Kazuto; Serikawa, Tadao; Kuramoto, Takashi [The Institute of Laboratory Animals, Graduate School of Medicine, Kyoto University, Yoshidakonoe-cho, Sakyo-ku, Kyoto 606-8501 (Japan)

2014-07-21

Despite widening interest in the possible association between infection/inflammation and cancer development, knowledge of this issue in relation to oral cancer remains inadequate. This study aimed to determine the susceptibility of Apc-mutant Kyoto Apc Delta (KAD) rats, which are vulnerable to developing inflammation-associated colorectal carcinogenesis, to 4-nitroquinoline 1-oxide (4-NQO)-induced tongue carcinogenesis in order to clarify the role of inflammation in oral cancer. KAD (20 males and 22 females) and F344/NS1c (22 males and 23 females) rats received drinking water with or without 4-NQO (20 ppm) for eight weeks. Histopathological and immunohistochemical analyses of the tongue were performed at week 20. Additionally, the mRNA expression of inflammatory cytokines in the tongue mucosa was determined at week 8. Tongue squamous cell carcinoma (SCC) developed in the KAD and F344/NS1c rats that received 4-NQO. Regardless of gender, the incidence and multiplicity of tongue SCC were greater in the KAD rats than in the F344/NS1c rats. In addition, the multiplicity of tongue SCC in the female KAD rats was significantly greater than that observed in the male KAD (p < 0.01) and female F344/NS1c rats (p < 0.05). The levels of inflammation and the mRNA expression of inflammatory cytokines in the tongue in the 4-NQO-treated female KAD rats were the highest among the rats given 4-NQO. These results show that KAD rats, particularly females, are susceptible to 4-NQO-induced tongue carcinogenesis, suggesting the utility of models employing KAD rats for investigating the pathobiology of oral (tongue) carcinogenesis associated with inflammation.

Apc-Mutant Kyoto Apc Delta (KAD) Rats Are Susceptible to 4-NQO-Induced Tongue Carcinogenesis

International Nuclear Information System (INIS)

Tanaka, Takuji; Shimizu, Masahito; Kochi, Takahiro; Shirakami, Yohei; Mori, Takayuki; Watanabe, Naoki; Naiki, Takafumi; Moriwaki, Hisataka; Yoshimi, Kazuto; Serikawa, Tadao; Kuramoto, Takashi

2014-01-01

Despite widening interest in the possible association between infection/inflammation and cancer development, knowledge of this issue in relation to oral cancer remains inadequate. This study aimed to determine the susceptibility of Apc-mutant Kyoto Apc Delta (KAD) rats, which are vulnerable to developing inflammation-associated colorectal carcinogenesis, to 4-nitroquinoline 1-oxide (4-NQO)-induced tongue carcinogenesis in order to clarify the role of inflammation in oral cancer. KAD (20 males and 22 females) and F344/NS1c (22 males and 23 females) rats received drinking water with or without 4-NQO (20 ppm) for eight weeks. Histopathological and immunohistochemical analyses of the tongue were performed at week 20. Additionally, the mRNA expression of inflammatory cytokines in the tongue mucosa was determined at week 8. Tongue squamous cell carcinoma (SCC) developed in the KAD and F344/NS1c rats that received 4-NQO. Regardless of gender, the incidence and multiplicity of tongue SCC were greater in the KAD rats than in the F344/NS1c rats. In addition, the multiplicity of tongue SCC in the female KAD rats was significantly greater than that observed in the male KAD (p < 0.01) and female F344/NS1c rats (p < 0.05). The levels of inflammation and the mRNA expression of inflammatory cytokines in the tongue in the 4-NQO-treated female KAD rats were the highest among the rats given 4-NQO. These results show that KAD rats, particularly females, are susceptible to 4-NQO-induced tongue carcinogenesis, suggesting the utility of models employing KAD rats for investigating the pathobiology of oral (tongue) carcinogenesis associated with inflammation

A detailed study of gerJ mutants of Bacillus subtilis.

Science.gov (United States)

Warburg, R J; Buchanan, C E; Parent, K; Halvorson, H O

1986-08-01

A total of nine gerJ mutants have now been isolated in Bacillus subtilis. All are defective in their spore germination properties, being blocked at an intermediate (phase grey) stage. The dormant spores are sensitive to heating at 90 degrees C and two of the mutants (generated by transposon insertion) produce spores sensitive at 80 degrees C. The spores of these two more extreme mutants had a visibly defective cortex when studied by electron microscopy, as did some of the other mutants. During sporulation, the acquisition of spore resistance properties and the appearance of the sporulation-specific penicillin-binding protein PBP5* were delayed. A strain probably carrying a lacZ fusion to the gerJ promoter demonstrated increased expression between t2 and t4. We propose that the gerJ locus is involved in the control of one or more sporulation-specific genes.

Developmental Toxicity of (4S-2- (4-hydroxy-3-methoxyphenyl thiazolidine-4-carboxylic acid in Zebrafish ( Danio rerio

Directory of Open Access Journals (Sweden)

Cansu Akbulut

2017-08-01

Full Text Available ABSTRACT (4S-2-(4-hydroxy-3-methoxyphenylthiazolidine-4-carboxylic acid is new synthesized substance obtained from cysteine and valine. Thiazolidine derivates have important biological responses so scientists work intensively on these compounds in recent years. It is obvious that thiazolidine contained compounds will be used in future in the pharmaceutical industry to treat important diseases. Median lethal concentrations (LC50 for 48 h and 96 h were found as 1.106±0.052 mM and 0.804mM ± 0.102 respectively. According to LC50, exposure doses were determined as control, 0.4 mM, 0.2 mM and 0.1 mM (4S-2-(4-hydroxy-3-methoxyphenylthiazolidine-4-carboxylic acid. Developmental toxicity and apoptotic features on zebrafish development were evaluated in this study. The results of this study indicate that (4S-2-(4-hydroxy-3-methoxyphenylthiazolidine-4-carboxylic acid exposure cause developmental defects like pericardial edema, bent spine, tail malformation, blood accumulation, yolk sac edema but on the other hand concentration-dependent decrease in apoptotic rate. Likewise, concentration-dependent decrease in hatching and increase in mortality of embryos were also detected.

The helicase and ATPase activities of RECQL4 are compromised by mutations reported in three human patients

DEFF Research Database (Denmark)

Jensen, Martin Borch; Dunn, Christopher A; Keijzers, Guido

2012-01-01

RECQL4 is one of five members of the human RecQ helicase family, and is implicated in three syndromes displaying accelerating aging, developmental abnormalities and a predisposition to cancer. In this study, we purified three variants of RECQL4 carrying previously reported patient mutations....... These three mutant proteins were analyzed for the known biochemical activities of RECQL4: DNA binding, unwinding of duplex DNA, ATP hydrolysis and annealing of simplex DNA. Further, the mutant proteins were evaluated for stability and recruitment to sites of laser-induced DNA damage. One mutant was helicase...

Characteristics of mutant lines of sweet potato flour

International Nuclear Information System (INIS)

Aryanti

2012-01-01

Research on mutation induction of sweet potato Sari variety has been conducted. Flour mutant lines were obtained from selection of M1V5 tubers irradiated by gamma rays at the dose of 10 Gy. Flour was made by peeling of tubers, then dried, blended and sieved. The quality test of flour have been done by measuring degree of whiteness, proximate, amylose contents, water content, soluble water, swelling power, and flour characteristics. The result of this work showed that flour of C6.26.13 mutant line had higher protein content than the parent plant with concentration of 3.62 % and its amylose content was also higher than the other mutant lines. The soluble water value of mutant lines were significant different compared to the parent plant from 1.82 to 2.25 % and swelling power from 4.28 to 5.55 %. The flour granule of the mutant line was different compared to the parent plant. (author)

Growth of non-toxigenic Clostridium botulinum mutant LNT01 in cooked beef: One-step kinetic analysis and comparison with C. sporogenes and C. perfringens.

Science.gov (United States)

Huang, Lihan

2018-05-01

The objective of this study was to investigate the growth kinetics of Clostridium botulinum LNT01, a non-toxigenic mutant of C. botulinum 62A, in cooked ground beef. The spores of C. botulinum LNT01 were inoculated to ground beef and incubated anaerobically under different temperature conditions to observe growth and develop growth curves. A one-step kinetic analysis method was used to analyze the growth curves simultaneously to minimize the global residual error. The data analysis was performed using the USDA IPMP-Global Fit, with the Huang model as the primary model and the cardinal parameters model as the secondary model. The results of data analysis showed that the minimum, optimum, and maximum growth temperatures of this mutant are 11.5, 36.4, and 44.3 °C, and the estimated optimum specific growth rate is 0.633 ln CFU/g per h, or 0.275 log CFU/g per h. The maximum cell density is 7.84 log CFU/g. The models and kinetic parameters were validated using additional isothermal and dynamic growth curves. The resulting residual errors of validation followed a Laplace distribution, with about 60% of the residual errors within ±0.5 log CFU/g of experimental observations, suggesting that the models could predict the growth of C. botulinum LNT01 in ground beef with reasonable accuracy. Comparing with C. perfringens, C. botulinum LNT01 grows at much slower rates and with much longer lag times. Its growth kinetics is also very similar to C. sporogenes in ground beef. The results of computer simulation using kinetic models showed that, while prolific growth of C. perfringens may occur in ground beef during cooling, no growth of C. botulinum LNT01 or C. sporogenes would occur under the same cooling conditions. The models developed in this study may be used for prediction of the growth and risk assessments of proteolytic C. botulinum in cooked meats. Published by Elsevier Ltd.

The C-terminal random coil region tunes the Ca²⁺-binding affinity of S100A4 through conformational activation.

Directory of Open Access Journals (Sweden)

Annette Duelli

Full Text Available S100A4 interacts with many binding partners upon Ca2+ activation and is strongly associated with increased metastasis formation. In order to understand the role of the C-terminal random coil for the protein function we examined how small angle X-ray scattering of the wild-type S100A4 and its C-terminal deletion mutant (residues 1-88, Δ13 changes upon Ca2+ binding. We found that the scattering intensity of wild-type S100A4 changes substantially in the 0.15-0.25 Å-1 q-range whereas a similar change is not visible in the C-terminus deleted mutant. Ensemble optimization SAXS modeling indicates that the entire C-terminus is extended when Ca2+ is bound. Pulsed field gradient NMR measurements provide further support as the hydrodynamic radius in the wild-type protein increases upon Ca2+ binding while the radius of Δ13 mutant does not change. Molecular dynamics simulations provide a rational explanation of the structural transition: the positively charged C-terminal residues associate with the negatively charged residues of the Ca2+-free EF-hands and these interactions loosen up considerably upon Ca2+-binding. As a consequence the Δ13 mutant has increased Ca2+ affinity and is constantly loaded at Ca2+ concentration ranges typically present in cells. The activation of the entire C-terminal random coil may play a role in mediating interaction with selected partner proteins of S100A4.

Booster vaccination with safe, modified, live-attenuated mutants of Brucella abortus strain RB51 vaccine confers protective immunity against virulent strains of B. abortus and Brucella canis in BALB/c mice.

Science.gov (United States)

Truong, Quang Lam; Cho, Youngjae; Kim, Kiju; Park, Bo-Kyoung; Hahn, Tae-Wook

2015-11-01

Brucella abortus attenuated strain RB51 vaccine (RB51) is widely used in prevention of bovine brucellosis. Although vaccination with this strain has been shown to be effective in conferring protection against bovine brucellosis, RB51 has several drawbacks, including residual virulence for animals and humans. Therefore, a safe and efficacious vaccine is needed to overcome these disadvantages. In this study, we constructed several gene deletion mutants (ΔcydC, ΔcydD and ΔpurD single mutants, and ΔcydCΔcydD and ΔcydCΔpurD double mutants) of RB51 with the aim of increasing the safety of the possible use of these mutants as vaccine candidates. The RB51ΔcydC, RB51ΔcydD, RB51ΔpurD, RB51ΔcydCΔcydD and RB51ΔcydCΔpurD mutants exhibited significant attenuation of virulence when assayed in murine macrophages in vitro or in BALB/c mice. A single intraperitoneal immunization with RB51ΔcydC, RB51ΔcydD, RB51ΔcydCΔcydD or RB51ΔcydCΔpurD mutants was rapidly cleared from mice within 3 weeks, whereas the RB51ΔpurD mutant and RB51 were detectable in spleens until 4 and 7 weeks, respectively. Vaccination with a single dose of RB51 mutants induced lower protective immunity in mice than did parental RB51. However, a booster dose of these mutants provided significant levels of protection in mice against challenge with either the virulent homologous B. abortus strain 2308 or the heterologous Brucella canis strain 26. In addition, these mutants were found to induce a mixed but T-helper-1-biased humoral and cellular immune response in immunized mice. These data suggest that immunization with a booster dose of attenuated RB51 mutants provides an attractive strategy to protect against either bovine or canine brucellosis.

Yersinia enterocolitica serum resistance proteins YadA and ail bind the complement regulator C4b-binding protein.

Directory of Open Access Journals (Sweden)

Vesa Kirjavainen

Full Text Available Many pathogens are equipped with factors providing resistance against the bactericidal action of complement. Yersinia enterocolitica, a Gram-negative enteric pathogen with invasive properties, efficiently resists the deleterious action of human complement. The major Y. enterocolitica serum resistance determinants include outer membrane proteins YadA and Ail. Lipopolysaccharide (LPS O-antigen (O-ag and outer core (OC do not contribute directly to complement resistance. The aim of this study was to analyze a possible mechanism whereby Y. enterocolitica could inhibit the antibody-mediated classical pathway of complement activation. We show that Y. enterocolitica serotypes O:3, O:8, and O:9 bind C4b-binding protein (C4bp, an inhibitor of both the classical and lectin pathways of complement. To identify the C4bp receptors on Y. enterocolitica serotype O:3 surface, a set of mutants expressing YadA, Ail, O-ag, and OC in different combinations was tested for the ability to bind C4bp. The studies showed that both YadA and Ail acted as C4bp receptors. Ail-mediated C4bp binding, however, was blocked by the O-ag and OC, and could be observed only with mutants lacking these LPS structures. C4bp bound to Y. enterocolitica was functionally active and participated in the factor I-mediated degradation of C4b. These findings show that Y. enterocolitica uses two proteins, YadA and Ail, to bind C4bp. Binding of C4bp could help Y. enterocolitica to evade complement-mediated clearance in the human host.

Loss of Hda activity stimulates replication initiation from I-box, but not R4 mutant origins in Escherichia coli.

Science.gov (United States)

Riber, Leise; Fujimitsu, Kazuyuki; Katayama, Tsutomu; Løbner-Olesen, Anders

2009-01-01

Initiation of chromosome replication in Escherichia coli is limited by the initiator protein DnaA associated with ATP. Within the replication origin, binding sites for DnaA associated with ATP or ADP (R boxes) and the DnaA(ATP) specific sites (I-boxes, tau-boxes and 6-mer sites) are found. We analysed chromosome replication of cells carrying mutations in conserved regions of oriC. Cells carrying mutations in DnaA-boxes I2, I3, R2, R3 and R5 as well as FIS and IHF binding sites resembled wild-type cells with respect to origin concentration. Initiation of replication in these mutants occurred in synchrony or with slight asynchrony only. Furthermore, lack of Hda stimulated initiation in all these mutants. The DnaA(ATP) containing complex that leads to initiation can therefore be formed in the absence of several of the origin DnaA binding sites including both DnaA(ATP) specific I-boxes. However, competition between I-box mutant and wild-type origins, revealed a positive role of I-boxes on initiation. On the other hand, mutations affecting DnaA-box R4 were found to be compromised for initiation and could not be augmented by an increase in cellular DnaA(ATP)/DnaA(ADP) ratio. Compared with the sites tested here, R4 therefore seems to contribute to initiation most critically.

Chlorobium tepidum mutant lacking bacteriochlorophyll c made by inactivation of the bchK gene, encoding bacteriochlorophyll c synthase

DEFF Research Database (Denmark)

Frigaard, Niels-Ulrik; Voigt, Ginny D; Bryant, Donald A

2002-01-01

of the BChl c antenna, the mutant grew about seven times slower than the wild type at light intensities that were limiting to the wild type (... found in the wild type, the bchK mutant should prove valuable for future analyses of the photosynthetic reaction center and of the roles of BChl a in photosynthesis in green bacteria. An evolutionary implication of our findings is that the photosynthetic ancestor of green sulfur bacteria could have...... evolved without chlorosomes and BChl c and instead used only BChl a-containing proteins as the major light-harvesting antennae....

Restriction of phage T4 internal protein I mutants by a strain of Escherichia coli

International Nuclear Information System (INIS)

Black, L.W.; Abremski, K.

1974-01-01

Phage T4 internal protein I(IPI), a small (ca, 10,000 MW), basic protein injected into the host with the phage DNA, is not required for infection of most hosts, but mutants defective in IPI are restricted by at least one naturally occurring strain of Escherichia coli, CT 596 (CT). Phages lacking IPI (IPI - ) appear to inject their DNA and bind it to the membrane of CT cells as well as wild-type phage T4 does, but shutoff of host protein synthesis, initiation of T4 protein synthesis, and cell killing are abnormal in the IPI - mutant infected CT host. The injection of IPI appears to be important in allowing T4 DNA to carry out early steps involved in takeover of this host. Restriction of IPI - phage growth by CT cells appears to be due, at least in part, to a defective prophage it harbors which renders the host resistant to successful infection by phage T4 which lack IPI or rII functions. Bacteria cured of this prophage can be infected by mutants defective in these functions. The resistance of CT cells to other coliphages, and the question of T-even phage internal protein diversity are discussed. (U.S.)

Mek1Y130C mice recapitulate aspects of human cardio-facio-cutaneous syndrome

Science.gov (United States)

Aoidi, Rifdat; Houde, Nicolas; Landry-Truchon, Kim; Holter, Michael; Jacquet, Kevin; Charron, Louis; Yu, Benjamin D.; Rauen, Katherine A.; Bisson, Nicolas; Newbern, Jason

2018-01-01

ABSTRACT The RAS/MAPK signaling pathway is one of the most investigated pathways, owing to its established role in numerous cellular processes and implication in cancer. Germline mutations in genes encoding members of the RAS/MAPK pathway also cause severe developmental syndromes collectively known as RASopathies. These syndromes share overlapping characteristics, including craniofacial dysmorphology, cardiac malformations, cutaneous abnormalities and developmental delay. Cardio-facio-cutaneous syndrome (CFC) is a rare RASopathy associated with mutations in BRAF, KRAS, MEK1 (MAP2K1) and MEK2 (MAP2K2). MEK1 and MEK2 mutations are found in ∼25% of the CFC patients and the MEK1Y130C substitution is the most common one. However, little is known about the origins and mechanisms responsible for the development of CFC. To our knowledge, no mouse model carrying RASopathy-linked Mek1 or Mek2 gene mutations has been reported. To investigate the molecular and developmental consequences of the Mek1Y130C mutation, we generated a mouse line carrying this mutation. Analysis of mice from a Mek1 allelic series revealed that the Mek1Y130C allele expresses both wild-type and Y130C mutant forms of MEK1. However, despite reduced levels of MEK1 protein and the lower abundance of MEK1 Y130C protein than wild type, Mek1Y130C mutants showed increased ERK (MAPK) protein activation in response to growth factors, supporting a role for MEK1 Y130C in hyperactivation of the RAS/MAPK pathway, leading to CFC. Mek1Y130C mutant mice exhibited pulmonary artery stenosis, cranial dysmorphia and neurological anomalies, including increased numbers of GFAP+ astrocytes and Olig2+ oligodendrocytes in regions of the cerebral cortex. These data indicate that the Mek1Y130C mutation recapitulates major aspects of CFC, providing a new animal model to investigate the physiopathology of this RASopathy. This article has an associated First Person interview with the first author of the paper. PMID:29590634

Factors Related to the Developmental Experiences of Youth Serving as 4-H Camp Counselors

Science.gov (United States)

Carter, David N.; Kotrlik, Joe W.

2008-01-01

The purpose of this study was to investigate the developmental experiences of high-school-aged 4-H youth volunteering as counselors at Louisiana 4-H summer camps. A total of 288 counselors from 10 different camping sessions participated in the study. The Youth Experiences Survey 2.0 and the Developmental Experience Survey measured the personal…

Gamma-radiation Mutagenesis in Genetically Unstable Barley Mutants. Pt. 1. Chlorophyll Mutations in Allelic tw Mutants and Their Revertants

International Nuclear Information System (INIS)

Vaitkuniene, V.

1995-01-01

Genotypical environment is an essential factor determining the mutability of mutants of the same type. Decreased chlorophyll mutant frequency was a common characteristic of all tested tw type (tw, tw 1 , tw 2 ) mutants induced in barley c. 'Auksiniai II'. The mutability of all the tested revertants was close to that of the initial c. 'Auksiniai II'. (author). 9 refs., 2 tabs

Delayed expression of apoptosis in X-irradiated human leukemic MOLT-4 cells transfected with mutant p53

International Nuclear Information System (INIS)

Nakano, Hisako; Yonekawa, Hiromichi; Shinohara, Kunio

2003-01-01

The effects of X-rays on cell survival, apoptosis, and long-term response in the development of cell death as measured by the dye exclusion test were studied in human leukemic MOLT-4 cells (p53 wild-type) stably transfected with a mutant p53 cDNA expression vector. Cell survival, as determined from colony-forming ability, was increased in an expression level dependent manner, but the increase was partial even with the highest-expressing clone (B3). This contrasts with the prior observation that cell death and apoptosis in B3 are completely inhibited at 24 h after irradiation with 1.8 Gy of X-rays. The examination of B3 cells incubated for longer than 24 h after X-irradiation showed a delay in the induction of cell death and apoptosis. Western blot analysis revealed that the time required to reach the highest level of wild-type p53 protein in B3 was longer than the time in MOLT-4 and that the p53 may be stabilized by the phosphorylation at Ser-15. These results suggest that the introduction of mutant p53 into MOLT-4 merely delays the development of apoptosis, during which the cells could repair the damage induced by X-rays, and results in the partial increase in cell survival. (author)

An extra early mutant of pigeonpea

International Nuclear Information System (INIS)

Ravikesavan, R.; Kalaimagal, T.; Rathnaswamy, R.

2001-01-01

The redgram (Cajanus cajan (L.) Huth) variety 'Prabhat DT' was gamma irradiated with 100, 200, 300 and 400 Gy doses. Several mutants have been identified viz., extra early mutants, monostem mutants, obcordifoliate mutants and bi-stigmatic mutants. The extra early mutant was obtained when treated with 100 Gy dose. The mutant was selfed and forwarded from M 2 to M 4 generation. In the M 4 generation the mutant line was raised along with the parental variety. Normal cultural practices were followed and the biometrical observations were recorded. It was observed that for the characters viz., total number of branches per plant, number of pods per plants, seeds per pod, 100 seed weight and seed yield per plant there was no difference between the mutant and parent variety. Whereas, regarding the days to flowering and maturity the mutants were earlier than the parents. The observation was recorded from two hundred plants each. The mutant gives the same yield in 90 days as that of the parent variety in 107 days, which make it an economic mutant

A pro-cathepsin L mutant is a luminal substrate for endoplasmic-reticulum-associated degradation in C. elegans.

Directory of Open Access Journals (Sweden)

Mark T Miedel

Full Text Available Endoplasmic-reticulum associated degradation (ERAD is a major cellular misfolded protein disposal pathway that is well conserved from yeast to mammals. In yeast, a mutant of carboxypeptidase Y (CPY* was found to be a luminal ER substrate and has served as a useful marker to help identify modifiers of the ERAD pathway. Due to its ease of genetic manipulation and the ability to conduct a genome wide screen for modifiers of molecular pathways, C. elegans has become one of the preferred metazoans for studying cell biological processes, such as ERAD. However, a marker of ERAD activity comparable to CPY* has not been developed for this model system. We describe a mutant of pro-cathepsin L fused to YFP that no longer targets to the lysosome, but is efficiently eliminated by the ERAD pathway. Using this mutant pro-cathepsin L, we found that components of the mammalian ERAD system that participate in the degradation of ER luminal substrates were conserved in C. elegans. This transgenic line will facilitate high-throughput genetic or pharmacological screens for ERAD modifiers using widefield epifluorescence microscopy.

Structure of a PKA RIα Recurrent Acrodysostosis Mutant Explains Defective cAMP-Dependent Activation.

Science.gov (United States)

Bruystens, Jessica Gh; Wu, Jian; Fortezzo, Audrey; Del Rio, Jason; Nielsen, Cole; Blumenthal, Donald K; Rock, Ruth; Stefan, Eduard; Taylor, Susan S

2016-12-04

Most disease-related mutations that impair cAMP protein kinase A (PKA) signaling are present within the regulatory (R) PKA RI alpha-subunit (RIα). Although mutations in the PRKAR1A gene are linked to Carney complex (CNC) disease and, more recently, to acrodysostosis-1 (ACRDYS1), the two diseases show contrasting phenotypes. While CNC mutations cause increased PKA activity, ACRDYS1 mutations result in decreased PKA activity and cAMP resistant holoenzymes. Mapping the ACRDYS1 disease mutations reveals their localization to the second of two tandem cAMP-binding (CNB) domains (CNB-B), and here, we characterize a recurrent deletion mutant where the last 14 residues are missing. The crystal structure of a monomeric form of this mutant (RIα92-365) bound to the catalytic (C)-subunit reveals the dysfunctional regions of the RIα subunit. Beyond the missing residues, the entire capping motif is disordered (residues 357-379) and explains the disrupted cAMP binding. Moreover, the effects of the mutation extend far beyond the CNB-B domain and include the active site and N-lobe of the C-subunit, which is in a partially open conformation with the C-tail disordered. A key residue that contributes to this crosstalk, D267, is altered in our structure, and we confirmed its functional importance by mutagenesis. In particular, the D267 interaction with Arg241, a residue shown earlier to be important for allosteric regulation, is disrupted, thereby strengthening the interaction of D267 with the C-subunit residue Arg194 at the R:C interface. We see here how the switch between active (cAMP-bound) and inactive (holoenzyme) conformations is perturbed and how the dynamically controlled crosstalk between the helical domains of the two CNB domains is necessary for the functional regulation of PKA activity. Copyright © 2016 Elsevier Ltd. All rights reserved.

2C-Methyl- D- erythritol 2,4-cyclodiphosphate synthase from Stevia rebaudiana Bertoni is a functional gene.

Science.gov (United States)

Kumar, Hitesh; Singh, Kashmir; Kumar, Sanjay

2012-12-01

Stevia [Stevia rebaudiana (Bertoni)] is a perennial herb which accumulates sweet diterpenoid steviol glycosides (SGs) in its leaf tissue. SGs are synthesized by 2C-methyl-D-erythritol 4-phosphate (MEP) pathway. Of the various enzymes of the MEP pathway, 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (MDS) (encoded by MDS) catalyzes the cyclization of 4-(cytidine 5' diphospho)-2C-methyl-D-erythritol 2-phosphate into 2C-methyl-D-erythritol 2,4-cyclodiphosphate. Complementation of the MDS knockout mutant strain of Escherichia coli, EB370 with putative MDS of stevia (SrMDS) rescued the lethal mutant, suggesting SrMDS to be a functional gene. Experiments conducted in plant growth chamber and in the field suggested SrMDS to be a light regulated gene. Indole 3-acetic acid (IAA; 50, 100 μM) down-regulated the expression of SrMDS at 4 h of the treatment, whereas, abscisic acid did not modulate its expression. A high expression of SrMDS was observed during the light hours of the day as compared to the dark hours. The present work established functionality of SrMDS and showed the role of light and IAA in regulating expression of SrMDS.

Programmed cell death in the leaves of the Arabidopsis spontaneous necrotic spots (sns-D mutant correlates with increased expression of the eukaryotic translation initiation factor eIF4B2

Directory of Open Access Journals (Sweden)

Gwenael M.D.J.-M. Gaussand

2011-04-01

Full Text Available From a pool of transgenic Arabidopsis (Arabidopsis thaliana plants harboring an activator T-DNA construct, one mutant was identified that developed spontaneous necrotic spots (sns-D on the rosette leaves under aseptic conditions. The sns-D mutation is dominant and homozygous plants are embryo lethal. The mutant produced smaller rosettes with a different number of stomata than the wild-type. DNA fragmentation in the nuclei of cells in the necrotic spots and a significant increase of caspase-3 and caspase-6 like activities in sns-D leaf extracts indicated that the sns-D mutation caused programmed cell death (PCD. The integration of the activator T-DNA caused an increase of the expression level of At1g13020, which encodes the eukaryotic translation initiation factor eIF4B2. The expression level of eIF4B2 was positively correlated with the severity of sns-D mutant phenotype. Overexpression of the eIF4B2 cDNA mimicked phenotypic traits of the sns-D mutant indicating that the sns-D mutant phenotype is indeed caused by activation tagging of eIF4B2. Thus, incorrect regulation of translation initiation may result in PCD.

Isolation and Characterization of Carotenosomes from a Bacteriochlorophyll c-less Mutant of Chlorobium tepidum

DEFF Research Database (Denmark)

Frigaard, Niels-Ulrik; Li, Hui; Martinsson, Peter

2005-01-01

Chlorosomes are the light-harvesting organelles in photosynthetic green bacteria and typically contain large amounts of bacteriochlorophyll (BChl) c in addition to smaller amounts of BChl a, carotenoids, and several protein species. We have isolated vestigial chlorosomes, denoted carotenosomes......, from a BChl c-less, bchK mutant of the green sulfur bacterium Chlorobium tepidum. The physical shape of the carotenosomes (86 +/- 17 nm x 66 +/- 13 nm x 4.3 +/- 0.8 nm on average) was reminiscent of a flattened chlorosome. The carotenosomes contained carotenoids, BChl a, and the proteins CsmA and Csm...... that the carotenosomes have an intact baseplate made of remarkably stable oligomeric CsmA-BChl a complexes but are flattened in structure due to the absence of BChl c. Carotenosomes thus provide a valuable material for studying the biogenesis, structure, and function of the photosynthetic antennae in green bacteria....

Phosphorylation in the C-terminal domain of Aquaporin-4 is required for Golgi transition in primary cultured astrocytes

International Nuclear Information System (INIS)

Kadohira, Ikuko; Abe, Yoichiro; Nuriya, Mutsuo; Sano, Kazumi; Tsuji, Shoji; Arimitsu, Takeshi; Yoshimura, Yasunori; Yasui, Masato

2008-01-01

Aquaporin-4 (AQP4) is expressed in the perivascular and subpial astrocytes end-feet in mammalian brain, and plays a critical component of an integrated water and potassium homeostasis. Here we examine whether AQP4 is phosphorylated in primary cultured mouse astrocytes. Astrocytes were metabolically labeled with [ 32 P]phosphoric acid, then AQP4 was immunoprecipitated with anti-AQP4 antibody. We observed that AQP4 was constitutively phosphorylated, which is reduced by treatment with protein kinase CK2 inhibitors. To elucidate the phosphorylation of AQP4 by CK2, myc-tagged wild-type or mutant AQP4 was transiently transfected in primary cultured astrocytes. Substitution of Ala residues for four putative CK2 phosphorylation sites in the C terminus abolished the phosphorylation of AQP4. Immunofluorescent microscopy revealed that the quadruple mutant was localized in the Golgi apparatus. These observations indicate that the C-terminal domain of AQP4 is constitutively phosphorylated at least in part by protein kinase CK2 and it is required for Golgi transition.

Using Evolution as a Guide to Engineer Kranz-Type C4 photosynthesis

Directory of Open Access Journals (Sweden)

Thomas L. Slewinski

2013-07-01

Full Text Available Kranz-type C4 photosynthesis has independently and rapidly evolved over sixty times to dramatically increase radiation use efficiency in both monocots and eudicots. Indeed, it is one of the most exceptional examples of convergent evolution in the history of life. The repeated and rapid evolution of Kranz-type C4 suggests that it may be a derivative of a conserved developmental pathway that is present in all angiosperms. Here, I argue that the Kranz-type C4 photosynthetic system is an extension of the endodermis/starch sheath, that is normally only found in the roots and stems, into photosynthetic structures such as leaves. Support for this hypothesis was recently provided by a study that showed that the same genetic pathway that gives rise to the endodermis in roots, the SCARECROW/SHORT-ROOT radial pattering system, also regulates the development of Kranz anatomy and C4 physiology in leaves. This new hypothesis for the evolution of Kranz-type C4 photosynthesis has opened new opportunities to explore the underlying genetic networks that regulate the development and physiology of C4 and provides new potential avenues for the engineering of the mechanism into C3 crops.

Crystal structures of Er4Ni13C4 and UW4C4

International Nuclear Information System (INIS)

Khalili, M.M.; Bodak, O.I.; Marusin, E.P.; Pecharskaya, A.O.

1990-01-01

Crystal structures of Er 4 Ni 13 C 4 (1) (sp.gr. Cmmm, a=1.1975(4), b=1.1694(3), c=0.3856(1) nm, Z=2) and UW 4 C 4 (2) (sp.gr. P4/m, a=0.8328(8), c=0.31345(9) nm, Z=2), relating to new types are determined. Structural type (1) is a derivative of La 2 Ni 5 C 3 structure, structural type (2) is close to UCr 4 C 4 structure

Fitness and virulence of a coxsackievirus mutant that can circumnavigate the need for phosphatidylinositol 4-kinase class III beta

NARCIS (Netherlands)

Thibaut, Hendrik Jan; van der Schaar, Hilde M; Lanke, Kjerstin H W; Verbeken, Erik; Andrews, Martin; Leyssen, Pieter; Neyts, Johan; van Kuppeveld, Frank J M

2014-01-01

Coxsackieviruses require phosphatidylinositol-4-kinase IIIβ (PI4KIIIβ) for replication but can bypass this need by an H57Y mutation in protein 3A (3A-H57Y). We show that mutant coxsackievirus is not outcompeted by wild-type virus during 10 passages in vitro. In mice, the mutant virus proved as

Identification of a mutant locus that bypasses the BsgA protease requirement for social development in Myxococcus xanthus.

Science.gov (United States)

Cusick, John K; Hager, Elizabeth; Gill, Ronald E

2015-01-01

The BsgA protease is required for the earliest morphological changes observed in Myxococcus xanthus development. We hypothesize that the BsgA protease is required to cleave an inhibitor of the developmental program, and isolation of genetic bypass suppressors of a bsgA mutant was used to identify signaling components controlling development downstream of the BsgA protease. Strain M955 was created by transposon mutagenesis of a bsgA mutant followed by screening for strains that could develop despite the absence of the BsgA protease. Strain M955 was able to aggregate, form fruiting bodies, and partially restored the production of viable spores in comparison to the parental bsgA mutant. The bsgA Tn5Ω955 strain partially restored developmental expression to a subset of genes normally induced during development, and expressed one developmentally induced fusion at higher amounts during vegetative growth in comparison to wild-type cells. The transposon in strain M955 was localized to a Ribonuclease D homolog that appears to exist in an operon with a downstream aminopeptidase-encoding gene. The identification of a third distinct bypass suppressor of the BsgA protease suggests that the BsgA protease may regulate a potentially complex pathway during the initiation of the M. xanthus developmental program. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

A mutant of a mutant of a mutant of a ...: Irradiation of progressive radiation-induced mutants in a mutation-breeding programme with Chrysanthenum morifolium RAM

International Nuclear Information System (INIS)

Broertjes, C.; Koene, P.; Veen, J.W.H. van.

1980-01-01

Radiation-induced sports in Chrysanthemum morifolium RAM. have been reported for several years. It has become an everyday practice to produce flower-colour mutants from outstanding cross-breeding products, even before they are distributed for the commercial production of cut flowers. One of the most successful and recent examples is that of cv. Horim, of which hundreds of mutants were produced by successive use of radiation-induced mutants in the mutation-breeding programme. Over about 4 years a variety of flower-colour mutants was obtained, not only largely including the outstanding characteristics of the original cultivar but sometimes even with an appreciable improvement in quality and yield. It is expected that the latter types, the Miros group, will soon completely supersede the spontaneous or raditation-induced Horim sports and mutants and take over the leading position of the Horim group in the production of all-year-round (AYR) cut-flowers. (orig.)

Genetic analyses of nonfluorescent root mutants induced by mutagenesis in soybean

International Nuclear Information System (INIS)

Sawada, S.; Palmer, R.G.

1987-01-01

Nonfluorescent root mutants in soybean [Glycine max (L.) Merr.] are useful as markers in genetic studies and in tissue culture research. Our objective was to obtain mutagen-induced nonfluorescent root mutants and to conduct genetic studies with them. Thirteen nonfluorescent mutants were detected among 154016 seedlings derived from soybean lines treated with six mutagens. One of these mutants, derived from Williams treated with 20 kR gamma rays, did not correspond to any of the known (standard) nonfluorescent spontaneous mutants. This is the first mutagen-induced nonfluorescent root mutant in soybean. It was assigned Genetic Type Collection no. T285 and the gene symbol fr5 fr5. The fr5 allele was not located on trisomics A, B, or C and was not linked to five chlorophyll-deficient mutants (y9, y11, y12, y13, and y20-k2) or flower color mutant w1. The remaining nonfluorescent root mutants were at the same loci as known spontaneous mutants; i.e., four had the fr1 allele, five had the fr2 allele, and three had the fr4 allele

Crystallization and preliminary X-ray analysis of a decameric form of cytosolic thioredoxin peroxidase 1 (Tsa1), C47S mutant, from Saccharomyces cerevisiae

Energy Technology Data Exchange (ETDEWEB)

Oliveira, Marcos Antonio de, E-mail: scaff@lnls.br; Genu, Victor; Discola, Karen Fulan; Alves, Simone Vidigal; Netto, Luis Eduardo Soares [Departamento de Genética e Biologia Evolutiva, Instituto de Biociências, Universidade de São Paulo, 05508-900 São Paulo-SP (Brazil); Guimarães, Beatriz Gomes, E-mail: scaff@lnls.br [Centro de Biologia Molecular Estrutural, Laboratório Nacional de Luz Síncrotron, 13084-971 Campinas-SP (Brazil); Departamento de Genética e Biologia Evolutiva, Instituto de Biociências, Universidade de São Paulo, 05508-900 São Paulo-SP (Brazil)

2007-08-01

A recombinant mutant (C47S) of cytosolic thioredoxin peroxidase 1 from S. cerevisiae was expressed, purified and crystallized by the hanging-drop vapour-diffusion method from protein previously treated with 1,4-dithiothreitol. The crystals belong to the monoclinic space group C2 and diffraction data were collected to 2.8 Å resolution using a synchrotron-radiation source. Saccharomyces cerevisiae cytosolic thioredoxin peroxidase 1 (cTPxI or Tsa1) is a bifunctional enzyme with protective roles in cellular defence against oxidative and thermal stress that exhibits both peroxidase and chaperone activities. Protein overoxidation and/or high temperatures induce great changes in its quaternary structure and lead to its assembly into large complexes that possess chaperone activity. A recombinant mutant of Tsa1 from S. cerevisiae, with Cys47 substituted by serine, was overexpressed in Escherichia coli as a His{sub 6}-tagged fusion protein and purified by nickel-affinity chromatography. Crystals were obtained from protein previously treated with 1,4-dithiothreitol by the hanging-drop vapour-diffusion method using PEG 3000 as precipitant and sodium fluoride as an additive. Diffraction data were collected to 2.8 Å resolution using a synchrotron-radiation source. The crystal structure was solved by molecular-replacement methods and structure refinement is currently in progress.

Proline metabolism in the wild-type and in a salt-tolerant mutant of nicotiana plumbaginifolia studied by (13)C-nuclear magnetic resonance imaging

Science.gov (United States)

Roosens; Willem; Li; Verbruggen; Biesemans; Jacobs

1999-12-01

To obtain insight into the link between proline (Pro) accumulation and the increase in osmotolerance in higher plants, we investigated the biochemical basis for the NaCl tolerance of a Nicotiana plumbaginifolia mutant (RNa) that accumulates Pro. Pro biosynthesis and catabolism were investigated in both wild-type and mutant lines. (13)C-Nuclear magnetic resonance with [5-(13)C]glutamate (Glu) as the Pro precursor was used to provide insight into the mechanism of Pro accumulation via the Glu pathway. After 24 h under 200 mM NaCl stress in the presence of [5-(13)C]Glu, a significant enrichment in [5-(13)C]Pro was observed compared with non-stress conditions in both the wild type (P2) and the mutant (RNa). Moreover, under the same conditions, [5-(13)C]Pro was clearly synthesized in higher amounts in RNa than in P2. On the other hand, measurements of enzyme activities indicate that neither the biosynthesis via the ornithine pathway, nor the catabolism via the Pro oxidation pathway were affected in the RNa mutant. Finally, the regulatory effect exerted by Pro on its biosynthesis was evaluated. In P2 plantlets, exogenous Pro markedly reduced the conversion of [5-(13)C]Glu into [5-(13)C]Pro, whereas Pro feedback inhibition was not detected in the RNa plantlets. It is proposed that the origin of tolerance in the RNa mutant is due to a mutation leading to a substantial reduction of the feedback inhibition normally exerted in a wild-type (P2) plant by Pro at the level of the Delta-pyrroline-5-carboxylate synthetase enzyme.

Global deletion of glutathione S-Transferase A4 exacerbates developmental nonalcoholic steatohepatitis

Science.gov (United States)

We established a mouse model of developmental nonalcoholic steatohepatitis (NASH) by feeding a high polyunsaturated fat liquid diet to female glutathione-S-transferase 4-4 (Gsta4-/-)/peroxisome proliferator activated receptor a (Ppara-/-) double knockout 129/SvJ mice for 12 weeks from weaning. We us...

Transcriptome Analysis of a New Peanut Seed Coat Mutant for the Physiological Regulatory Mechanism Involved in Seed Coat Cracking and Pigmentation.

Science.gov (United States)

Wan, Liyun; Li, Bei; Pandey, Manish K; Wu, Yanshan; Lei, Yong; Yan, Liying; Dai, Xiaofeng; Jiang, Huifang; Zhang, Juncheng; Wei, Guo; Varshney, Rajeev K; Liao, Boshou

2016-01-01

Seed-coat cracking and undesirable color of seed coat highly affects external appearance and commercial value of peanuts ( Arachis hypogaea L.). With an objective to find genetic solution to the above problems, a peanut mutant with cracking and brown colored seed coat (testa) was identified from an EMS treated mutant population and designated as "peanut seed coat crack and brown color mutant line ( pscb )." The seed coat weight of the mutant was almost twice of the wild type, and the germination time was significantly shorter than wild type. Further, the mutant had lower level of lignin, anthocyanin, proanthocyanidin content, and highly increased level of melanin content as compared to wild type. Using RNA-Seq, we examined the seed coat transcriptome in three stages of seed development in the wild type and the pscb mutant. The RNA-Seq analysis revealed presence of highly differentially expressed phenylpropanoid and flavonoid pathway genes in all the three seed development stages, especially at 40 days after flowering (DAF40). Also, the expression of polyphenol oxidases and peroxidase were found to be activated significantly especially in the late seed developmental stage. The genome-wide comparative study of the expression profiles revealed 62 differentially expressed genes common across all the three stages. By analyzing the expression patterns and the sequences of the common differentially expressed genes of the three stages, three candidate genes namely c36498_g1 (CCoAOMT1), c40902_g2 (kinesin) , and c33560_g1 (MYB3) were identified responsible for seed-coat cracking and brown color phenotype. Therefore, this study not only provided candidate genes but also provided greater insights and molecular genetic control of peanut seed-coat cracking and color variation. The information generated in this study will facilitate further identification of causal gene and diagnostic markers for breeding improved peanut varieties with smooth and desirable seed coat color.

PT-Flax (phenotyping and TILLinG of flax): development of a flax (Linum usitatissimum L.) mutant population and TILLinG platform for forward and reverse genetics.

Science.gov (United States)

Chantreau, Maxime; Grec, Sébastien; Gutierrez, Laurent; Dalmais, Marion; Pineau, Christophe; Demailly, Hervé; Paysant-Leroux, Christine; Tavernier, Reynald; Trouvé, Jean-Paul; Chatterjee, Manash; Guillot, Xavier; Brunaud, Véronique; Chabbert, Brigitte; van Wuytswinkel, Olivier; Bendahmane, Abdelhafid; Thomasset, Brigitte; Hawkins, Simon

2013-10-15

Flax (Linum usitatissimum L.) is an economically important fiber and oil crop that has been grown for thousands of years. The genome has been recently sequenced and transcriptomics are providing information on candidate genes potentially related to agronomically-important traits. In order to accelerate functional characterization of these genes we have generated a flax EMS mutant population that can be used as a TILLinG (Targeting Induced Local Lesions in Genomes) platform for forward and reverse genetics. A population of 4,894 M2 mutant seed families was generated using 3 different EMS concentrations (0.3%, 0.6% and 0.75%) and used to produce M2 plants for subsequent phenotyping and DNA extraction. 10,839 viable M2 plants (4,033 families) were obtained and 1,552 families (38.5%) showed a visual developmental phenotype (stem size and diameter, plant architecture, flower-related). The majority of these families showed more than one phenotype. Mutant phenotype data are organised in a database and can be accessed and searched at UTILLdb (http://urgv.evry.inra.fr/UTILLdb). Preliminary screens were also performed for atypical fiber and seed phenotypes. Genomic DNA was extracted from 3,515 M2 families and eight-fold pooled for subsequent mutant detection by ENDO1 nuclease mis-match cleavage. In order to validate the collection for reverse genetics, DNA pools were screened for two genes coding enzymes of the lignin biosynthesis pathway: Coumarate-3-Hydroxylase (C3H) and Cinnamyl Alcohol Dehydrogenase (CAD). We identified 79 and 76 mutations in the C3H and CAD genes, respectively. The average mutation rate was calculated as 1/41 Kb giving rise to approximately 9,000 mutations per genome. Thirty-five out of the 52 flax cad mutant families containing missense or codon stop mutations showed the typical orange-brown xylem phenotype observed in CAD down-regulated/mutant plants in other species. We have developed a flax mutant population that can be used as an efficient

Isolation of Escherichia coli rpoB mutants resistant to killing by lambda cII protein and altered in pyrE gene attenuation

DEFF Research Database (Denmark)

Hammer, Karin; Jensen, Kaj Frank; Poulsen, Peter

1987-01-01

Escherichia coli mutants simultaneously resistant to rifampin and to the lethal effects of bacteriophage lambda cII protein were isolated. The sck mutant strains carry alterations in rpoB that allow them to survive cII killing (thus the name sck), but that do not impair either the expression of c......II or the activation by cII of the lambda promoters pE and pI. The sck-1, sck-2, and sck-3 mutations modify transcription termination. The growth of lambda, but not of the N-independent lambda variant, lambda nin-5, is hindered by these mutations, which act either alone or in concert with the bacterial nusA1 mutation....... In contrast to their effect on lambda growth, the three mutations reduce transcription termination in bacterial operons. The E. coli pyrE gene, which is normally regulated by attenuation, is expressed constitutively in the mutant strains. The sck mutations appear to prevent pyrE attenuation by slowing...

Phenotypic characterization of glucose repression mutants of Saccharomyce cerevisiae usinge experiments with C-13-labelled glucose

DEFF Research Database (Denmark)

Vijayendran, Raghevendran; Gombert, A.K.; Christensen, B.

2004-01-01

techniques, which do not provide information about the integrated response a specific genetic modification has on the cellular function. In this study we have performed phenotypic characterization of several mutants of the yeast Saccharomyces cerevisiae through the use of experiments with C-13-labelled...

Selection of mutants tolerant of oxidative stress from respiratory cultures of Lactobacillus plantarum C17.

Science.gov (United States)

Zotta, T; Ianniello, R G; Guidone, A; Parente, E; Ricciardi, A

2014-03-01

Lactobacillus plantarum is a lactic acid bacterium involved in the production of many fermented foods. Recently, several studies have demonstrated that aerobic or respiratory metabolism in this species leads to improved technological and stress response properties. We investigated respiratory growth, metabolite production and stress resistance of Lact. plantarum C17 during batch, fed-batch and chemostat cultivations under respiratory conditions. Sixty mutants were selected for their ability to tolerate oxidative stress using H2 O2 and menadione as selective agents and further screened for their capability to growth under anaerobic, respiratory and oxidative stress conditions. Dilution rate clearly affected the physiological state of cells and, generally, slow-growing cultures had improved survival to stresses, catalase production and oxygen uptake. Most mutants were more competitive in terms of biomass production and ROS degradation compared with wild-type strain (wt) C17 and two of these (C17-m19 and C17-m58) were selected for further experiments. This work confirms that, in Lact. plantarum, respiration and low growth rates confer physiological and metabolic advantages compared with anaerobic cultivation. Our strategy of natural selection successfully provides a rapid and inexpensive screening for a large number of strains and represents a food-grade approach of practical relevance in the production of starter and probiotic cultures. © 2013 The Society for Applied Microbiology.

Vitamin C (Vit C) added after irradiation reduces the number and alters the spectrum of CD59- mutants in human/CHO AL cells exposed to high LET carbon ions

International Nuclear Information System (INIS)

Vannais, D.B.; Hirai, Y.; Waldren, C.A.; Ueno, A.

2003-01-01

Full text: Miyazaki, Watanabe, Kumagai and colleagues discovered the existence in mammalian cells of long-lived radicals (LLR) with half-lives of minutes to hours. They further showed that concentrations of LLR were increased in a dose dependent manner by X-rays; that LLR were transforming and mutagenic but not clastogenic or lethal; that they were scavenged by Vit C but not by DMSO, and that they occured mainly (>99.8%) in proteins from which they escape by atomic tunneling. They also showed that Vit C added after radiation (but not DMSO) eliminated HPRT mutants in human cells exposed to X-rays. Following on their work, we found that Vit C (5 mM) added 30 min after radiation significantly reduced, but did not eliminate, induction of CD59- mutants in human-CHO hybrid AL cells exposed to high LET carbon beam radiation (NIRS-HIMAC, 290 MeV/nucleon, LET 100 KeV/μ: m). Lethality of the carbon beam was not affected by Vit C. DMSO decreased mutation and killing, only when present during radiation. Lycopene, reported to reduce spontaneous mutation, did not affect radiation killing or mutagenesis. Our findings with Vit C for high LET generally support the results reported for X-rays. Analysis of the spectrum of mutations in CD59- mutant cells isolated after carbon beam irradiation (2.5 Gy), indicates a substantial reduction by post-radiation Vit C in mutants with small mutations and those displaying genomic instability, seen as increased levels of translocations. Our results substantiate a role for LLR in radiation mutagenesis and implicate them in radiation-induced genomic instability

Mutant tamm-horsfall glycoprotein accumulation in endoplasmic reticulum induces apoptosis reversed by colchicine and sodium 4-phenylbutyrate.

Science.gov (United States)

Choi, Sung Won; Ryu, Ok Hee; Choi, Sun Jin; Song, In Sun; Bleyer, Anthony J; Hart, Thomas C

2005-10-01

As a consequence of uromodulin gene mutations, individuals develop precocious hyperuricemia, gout, and progressive renal failure. In vitro studies suggest that pathologic accumulation of uromodulin/Tamm-Horsfall glycoprotein (THP) occurs in the endoplasmic reticulum (ER), but the pathophysiology of renal damage is unclear. It was hypothesized that programmed cell death triggered by accumulation of misfolded THP in the ER causes progressive renal disease. Stably transfected human embryonic kidney 293 cells and immortalized thick ascending limb of Henle's loop cells with wild-type and mutated uromodulin cDNA were evaluated to test this hypothesis. Immunocytochemistry, ELISA, and deglycosylation studies indicated that accumulation of mutant THP occurred in the ER. FACS analyses showed a significant increase in early apoptosis signal in human embryonic kidney 293 and thick ascending limb of Henle's loop cells that were transfected with mutant uromodulin constructs. Colchicine and sodium 4-phenylbutyrate treatment increased secretion of THP from the ER to the cell membrane and into the culture media and significantly improved cell viability. These findings indicate that intracellular accumulation of THP facilitates apoptosis and that this may provide the pathologic mechanism responsible for the progressive renal damage associated with uromodulin gene mutations. Colchicine and sodium 4-phenylbutyrate reverse these processes and could potentially be beneficial in ameliorating the progressive renal damage in uromodulin-associated kidney diseases.

Dwarf Rice Mutant Derived from 0.2 kGy Gamma Rays Irradiated Seeds of Atomita 4 Variety

International Nuclear Information System (INIS)

Sobrizal; Sutisna Sanjaya; Carkum; Mohamad Ismachin

2004-01-01

Dwarf rice mutant was obtained when Atomita 4 seeds were irradiated by 0.2 kGy gamma rays. The results of segregation analyses in F2 populations and F3 lines derived from reciprocal crosses of mutant and Atomita 4 suggested that the dwarf was controlled by a single recessive gene. This gene was not located on rice cytoplasmic genome but on nuclear genome. The gene for dwarf obtained in this study tentatively could be assumed as a new finding until the allelic relationships with other dwarf genes are verified. (author)

Mast cell deficiency attenuates acupuncture analgesia for mechanical pain using c-kit gene mutant rats.

Science.gov (United States)

Cui, Xiang; Liu, Kun; Xu, Dandan; Zhang, Youyou; He, Xun; Liu, Hao; Gao, Xinyan; Zhu, Bing

2018-01-01

Acupuncture therapy plays a pivotal role in pain relief, and increasing evidence demonstrates that mast cells (MCs) may mediate acupuncture analgesia. The present study aims to investigate the role of MCs in acupuncture analgesia using c-kit gene mutant-induced MC-deficient rats. WsRC-Ws/Ws rats and their wild-type (WT) littermates (WsRC-+/+) were used. The number of MCs in skin of ST36 area was compared in two rats after immunofluorescence labeling. Mechanical withdrawal latency (MWL), mechanical withdrawal threshold (MWT), and thermal withdrawal latency (TWL) were measured on bilateral plantar for pain threshold evaluation before and after each stimulus. Acupuncture- and moxibustion-like stimuli (43°C, 46°C heat, 1 mA electroacupuncture [EA], 3 mA EA, and manual acupuncture [MA]) were applied randomly on different days. Fewer MCs were observed in the skin of ST36 in mutant rats compared to WT rats ( P 0.05). Bilateral MWL and MWT in WsRC-+/+ rats increased significantly after each stimulus compared to baseline ( P <0.01, P <0.001). In WsRC-Ws/Ws rats, only noxious stimuli could produce anti-nociceptive effects for mechanical pain (46°C, 3 mA EA, MA) ( P <0.01, P <0.001). Additionally, the net increases in MWL and MWT induced by most stimuli were greater in WT than in mutant rats ( P <0.05). For thermal nociception, either high- or low-intensity stimuli could significantly augment TWL in two rats ( P <0.001), and the net increases of TWL evoked by most stimuli were to the same extent in two genetic variants. MCs influence the basic mechanical but not thermal pain threshold. MCs participate in acupuncture analgesia in mechanical but not in thermal nociception, in that MC deficiency may attenuate the mechanical analgesia evoked by high-intensity stimuli and eliminate analgesia provoked by low-intensity stimuli.

Defective FANCI binding by a fanconi anemia-related FANCD2 mutant.

Directory of Open Access Journals (Sweden)

Koichi Sato

Full Text Available FANCD2 is a product of one of the genes associated with Fanconi anemia (FA, a rare recessive disease characterized by bone marrow failure, skeletal malformations, developmental defects, and cancer predisposition. FANCD2 forms a complex with FANCI (ID complex and is monoubiquitinated, which facilitates the downstream interstrand crosslink (ICL repair steps, such as ICL unhooking and nucleolytic end resection. In the present study, we focused on the chicken FANCD2 (cFANCD2 mutant harboring the Leu234 to Arg (L234R substitution. cFANCD2 L234R corresponds to the human FANCD2 L231R mutation identified in an FA patient. We found that cFANCD2 L234R did not complement the defective ICL repair in FANCD2-/- DT40 cells. Purified cFANCD2 L234R did not bind to chicken FANCI, and its monoubiquitination was significantly deficient, probably due to the abnormal ID complex formation. In addition, the histone chaperone activity of cFANCD2 L234R was also defective. These findings may explain some aspects of Fanconi anemia pathogenesis by a FANCD2 missense mutation.

Regulation of chloroplast biogenesis: the immutans mutant of Arabidopsis

Energy Technology Data Exchange (ETDEWEB)

Rodermel, Steven

2015-11-16

The immutans (im) variegation mutant of Arabidopsis is an ideal model to gain insight into factors that control chloroplast biogenesis. im defines the gene for PTOX, a plastoquinol terminal oxidase that participates in control of thylakoid redox. Here, we report that the im defect can be suppressed during the late stages of plant development by gigantea (gi2), which defines the gene for GIGANTEA (GI), a central component of the circadian clock that plays a poorly-understood role in diverse plant developmental processes. imgi2 mutants are late-flowering and display other well-known phenotypes associated with gi2, such as starch accumulation and resistance to oxidative stress. We show that the restoration of chloroplast biogenesis in imgi2 is caused by a developmental-specific de-repression of cytokinin signaling that involves crosstalk with signaling pathways mediated by gibberellin (GA) and SPINDLY (SPY), a GA response inhibitor. Suppression of the plastid defect in imgi2 is likely caused by a relaxation of excitation pressures in developing plastids by factors contributed by gi2, including enhanced rates of photosynthesis and increased resistance to oxidative stress. Interestingly, the suppression phenotype of imgi can be mimicked by crossing im with the starch accumulation mutant, sex1, perhaps because sex1 utilizes pathways similar to gi. We conclude that our studies provide a direct genetic linkage between GIGANTEA and chloroplast biogenesis, and we construct a model of interactions between signaling pathways mediated by gi, GA, SPY, cytokinins, and sex1 that are required for chloroplast biogenesis.

Sox4 is a key oncogenic target in C/EBP alpha mutant acute myeloid leukemia

Czech Academy of Sciences Publication Activity Database

Zhang, H.; Alberich-Jorda, Meritxell; Amabile, G.; Yang, H.; Staber, P.B.; DiRuscio, A.; Welner, R.S.; Ebralidze, A.; Zhang, J.; Levantini, E.; Lefebvre, V.; Valk, P.J.; Delwel, R.; Hoogenkamp, M.; Nerlov, C.; Cammenga, J.; Saez, B.; Scadden, D.T.; Bonifer, C.; Ye, M.; Tenen, D.G.

2013-01-01

Roč. 24, č. 5 (2013), s. 575-588 ISSN 1535-6108 R&D Projects: GA MŠk LK21307 Institutional support: RVO:68378050 Keywords : Sox4 * C/EBP alpha * acute myeloid leukemia Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 23.893, year: 2013

Characterization of Novel Sorghum brown midrib Mutants from an EMS-Mutagenized Population

OpenAIRE

Sattler, Scott E.; Saballos, Ana; Xin, Zhanguo; Funnell-Harris, Deanna L.; Vermerris, Wilfred; Pedersen, Jeffrey F.

2014-01-01

Reducing lignin concentration in lignocellulosic biomass can increase forage digestibility for ruminant livestock and saccharification yields of biomass for bioenergy. In sorghum (Sorghum bicolor (L.) Moench) and several other C4 grasses, brown midrib (bmr) mutants have been shown to reduce lignin concentration. Putative bmr mutants isolated from an EMS-mutagenized population were characterized and classified based on their leaf midrib phenotype and allelism tests with the previously describe...

NhaA Na+/H+ antiporter mutants that hardly react to the membrane potential.

Directory of Open Access Journals (Sweden)

Dudu Alkoby

Full Text Available pH and Na+ homeostasis in all cells requires Na+/H+ antiporters. The crystal structure, obtained at pH 4, of NhaA, the main antiporter of Escherichia coli, has provided general insights into an antiporter mechanism and its unique pH regulation. Here, we describe a general method to select various NhaA mutants from a library of randomly mutagenized NhaA. The selected mutants, A167P and F267C are described in detail. Both mutants are expressed in Escherichia coli EP432 cells at 70-95% of the wild type but grow on selective medium only at neutral pH, A167P on Li+ (0.1 M and F267C on Na+ (0.6 M. Surprising for an electrogenic secondary transporter, and opposed to wild type NhaA, the rates of A167P and F267C are almost indifferent to membrane potential. Detailed kinetic analysis reveals that in both mutants the rate limiting step of the cation exchange cycle is changed from an electrogenic to an electroneutral reaction.

Characterization of a crp* mutant of the E. coli cAMP receptor protein

International Nuclear Information System (INIS)

Ren, Y.L.; Garges, S.; Adhya, S.; Krakow, J.S.

1987-01-01

One of the crp* mutants previously isolated to activate lac promoter in vivo has been characterized with regard to its biochemical properties. CRP*592 shows a more open conformation than CRP as indicated by its sensitivity to proteolytic attack. Dithionitrobenzoic acid mediated intersubunit crosslinking of CRP requires cAMP; this reaction occurs with unliganded CRP*592. Binding of CRP to its site on the lac promoter and activation of abortive initiation is effected by cAMP but not by cGMP. CRP*592 can activate abortive initiation in the presence of cAMP or cGMP and also at a high CRP*592 concentration in the absence of cyclic nucleotide. DNase I footprinting shows that cAMP-CRP* binds to its site on lac P + while unliganded CRP* and cGMP-CRP* form a stable complex with the [ 32 P]lac P + only in the presence of RNA polymerase. While cGMP binds to CRP it cannot replace cAMP in effecting the conformation necessary for site specific promoter binding; the weakly active unliganded CRP*592 can be shifted to a functional conformation by cAMP, cGMP and RNA polymerase

Repair of pyrimidine dimers in radiation-sensitive mutants rad3, rad4, rad6, and rad9 of Saccharomyces cerevisiae. [nicking

Energy Technology Data Exchange (ETDEWEB)

Prakash, L [Rochester Univ., N.Y. (USA). Dept. of Radiation Biology and Biophysics; Rochester Univ., N.Y. (USA). School of Medicine and Dentistry)

1977-10-01

The ability to remove ultraviolet-induced pyrimidine dimers was examined in four radiation-sensitive mutants of Saccharomyces cerevisiae. The susceptibility of DNA from irradiated cells to nicking by either the T4 uv-endonuclease or an endonuclease activity found in crude extracts of Micrococcus luteus was used to measure the presence of dimers in DNA. The rad3 and rad4 mutants are shown to be defective in dimer excision whereas the rad6 and rad9 mutants are proficient in dimer excision.

Disruption and functional analysis of six ORFs on chromosome XV: YOL117w, YOL115w ( TRF4), YOL114c, YOL112w ( MSB4), YOL111c and YOL072w.

Science.gov (United States)

Iwanejko, L; Smith, K N; Loeillet, S; Nicolas, A; Fabre, F

1999-10-01

We have carried out the systematic disruption of six ORFs on chromosome XV, of Saccharomyces cerevisiae using the long flanking homology technique to replace each with the KanMX cassette; we have also constructed plasmids containing replacement cassettes and cognate clones for each ORF. Disruption of three of the ORFs-YOL117w, YOL114c, and YOL112w (also known as MSB4)-does not result in any noteworthy phenotype with respect to temperature or nutritional requirements, but yol112w mutants with an additional disruption of YNL293w, which encodes a protein similar to Yol112w, exhibit a slow growth phenotype. The protein specified by YOL114c shares similarity with the human DS-1 protein. Disruption of YOL115w confers slow growth, cold sensitivity and poor sporulation; this ORF has been described elsewhere as TRF4, which encodes a topoisomerase I-related protein. Cells with disruptions of YOL111c, whose product is weakly similar to the human ubiquitin-like protein GdX, are slightly impaired in mating. Mutants disrupted for YOL072w, the predicted product of which is unrelated to any protein of known function, grow slowly, are cold-sensitive and sporulate with reduced efficiency. Copyright 1999 John Wiley & Sons, Ltd.

Reversion by calcium of a yeast-like development to the original filamentous form, of the 10V10 5-fluorocytosine-sensitive mutant of Aspergillus niger Reversão pelo cálcio de um desenvolvimento leveduriforme para a forma filamentosa original em um mutante sensível a 5-fluorocitosina na linhagem 10V10 de Aspergillus niger

Directory of Open Access Journals (Sweden)

Rosangela de Carvalho Goulart

2005-09-01

Full Text Available Some filamentous fungi present the phenomenon of dimorphism, their morphological structure alterations being capable of inducing metabolism changes. The Aspergillus niger strain 10v10, a producer of citric acid, was submitted to the mutagenic action of ultraviolet irradiation which respectively selects mutants sensitive or resistant to the antifungi agent 5 fluorocytosine (5-FC. 5-FC sensitive mutants presented a morphological alteration to a yeast-like form. The effects of pH changes, addition of salts (KH2PO4, NH4NO3, MgSO4 and MgCl2, the presence of osmotic stabilizers, as well as of calcium chloride, on morphological reversal and acid production were studied. Morphological reversal to the filamentous form was observed only in the presence of CaCl2 (500mM for the mutants strains 1 and 2, while the acid production occurred in both, yeast-like and filamentous forms.Alguns fungos filamentosos apresentam o fenômeno de dimorfismo, sendo que as alterações da estrutura morfológica podem induzir alterações metabólicas. A linhagem de Aspergillus niger 10v10, produtora de ácido cítrico foi submetida à ação mutagênica da radiação ultravioleta selecionando mutantes sensíveis ou resistentes ao antifúngico 5-fluorocitosina (5-FC. Os mutantes selecionados como sensíveis a 5-FC apresentaram uma alteração morfológica com desenvolvimento leveduriforme. Nestes mutantes foram avaliados o efeito da alteração de pH, a adição de sais (KH2PO4, NH4NO3, MgSO4e MnCl2, a presença de estabilizadores osmóticos, cloreto de cálcio, e o seu efeito sobre a reversão morfológica e a produção de ácido. A reversão morfológica para a forma filamentosa ocorreu apenas na presença de CaCl2 (500mM para as linhagens mutantes 1 e 2, enquanto que a produção de ácido ocorreu nas duas formas, leveduriforme e filamentosa.

Proline Metabolism in the Wild-Type and in a Salt-Tolerant Mutant of Nicotiana plumbaginifolia Studied by 13C-Nuclear Magnetic Resonance Imaging1

Science.gov (United States)

Roosens, Nancy H.; Willem, Rudolph; Li, Yan; Verbruggen, Ingrid; Biesemans, Monique; Jacobs, Michel

1999-01-01

To obtain insight into the link between proline (Pro) accumulation and the increase in osmotolerance in higher plants, we investigated the biochemical basis for the NaCl tolerance of a Nicotiana plumbaginifolia mutant (RNa) that accumulates Pro. Pro biosynthesis and catabolism were investigated in both wild-type and mutant lines. 13C-Nuclear magnetic resonance with [5-13C]glutamate (Glu) as the Pro precursor was used to provide insight into the mechanism of Pro accumulation via the Glu pathway. After 24 h under 200 mm NaCl stress in the presence of [5-13C]Glu, a significant enrichment in [5-13C]Pro was observed compared with non-stress conditions in both the wild type (P2) and the mutant (RNa). Moreover, under the same conditions, [5-13C]Pro was clearly synthesized in higher amounts in RNa than in P2. On the other hand, measurements of enzyme activities indicate that neither the biosynthesis via the ornithine pathway, nor the catabolism via the Pro oxidation pathway were affected in the RNa mutant. Finally, the regulatory effect exerted by Pro on its biosynthesis was evaluated. In P2 plantlets, exogenous Pro markedly reduced the conversion of [5-13C]Glu into [5-13C]Pro, whereas Pro feedback inhibition was not detected in the RNa plantlets. It is proposed that the origin of tolerance in the RNa mutant is due to a mutation leading to a substantial reduction of the feedback inhibition normally exerted in a wild-type (P2) plant by Pro at the level of the Δ-pyrroline-5-carboxylate synthetase enzyme. PMID:10594115

The phenotype of FancB-mutant mouse embryonic stem cells

International Nuclear Information System (INIS)

Kim, Tae Moon; Ko, Jun Ho; Choi, Yong Jun; Hu Lingchuan; Hasty, Paul

2011-01-01

Fanconi anemia (FA) is a rare autosomal recessive disease characterized by bone marrow failure, developmental defects and cancer. There are multiple FA genes that enable the repair of interstrand crosslinks (ICLs) in coordination with a variety of other DNA repair pathways in a way that is poorly understood. Here we present the phenotype of mouse embryonic stem (ES) cells mutated for FancB. We found FancB-mutant cells exhibited reduced cellular proliferation, hypersensitivity to the crosslinking agent mitomycin C (MMC), increased spontaneous and MMC-induced chromosomal abnormalities, reduced spontaneous sister chromatid exchanges (SCEs), reduced gene targeting, reduced MMC-induced Rad51 foci and absent MMC-induced FancD2 foci. Since FancB is on the X chromosome and since ES cells are typically XY, FancB is an excellent target for an epistatic analysis to elucidate FA's role in ICL repair.

The constitutive activation of the CEF-4/9E3 chemokine gene depends on C/EBPbeta in v-src transformed chicken embryo fibroblasts

DEFF Research Database (Denmark)

Gagliardi, M; Maynard, S; Bojovic, B

2001-01-01

The CEF-4/9E3 chemokine gene is expressed constitutively in chicken embryo fibroblasts (CEF) transformed by the Rous sarcoma virus (RSV). This aberrant induction is controlled at the transcriptional and post-transcriptional levels. Transcriptional activation depends on multiple elements of the CEF....../EBPbeta binds to a second element located in proximity of the TRE. A mutation of this distal CAAT box impaired the activation of the CEF-4 promoter by pp60(v-src) indicating that this element is also part of the SRU. Using the RCASBP retroviral vector, we expressed a dominant negative mutant of C....../EBPbeta (designated Delta184-C/EBPbeta) in RSV-transformed CEF. Delta184-C/EBPbeta decreased the accumulation of the CEF-4 mRNA and activation of the CEF-4 promoter by pp60(v-src). The induction of the Cox-2 gene (CEF-147) was also reduced by Delta184-C/EBPbeta. The effect of the dominant negative mutant was observed...

CEREBELLUM: LINKS BETWEEN DEVELOPMENT, DEVELOPMENTAL DISORDERS AND MOTOR LEARNING

Directory of Open Access Journals (Sweden)

Mario U Manto

2012-01-01

Full Text Available The study of the links and interactions between development and motor learning has noticeable implications for the understanding and management of neurodevelopmental disorders. This is particularly relevant for the cerebellum which is critical for sensorimotor learning. The olivocerebellar pathway is a key pathway contributing to learning of motor skills. Its developmental maturation and remodelling are being unravelled. Advances in genetics have led to major improvements in our appraisal of the genes involved in cerebellar development, especially studies in mutant mice. Cerebellar neurogenesis is compartmentalized in relationship with neurotransmitter fate. The Engrailed-2 gene is a major actor of the specification of cerebellar cell types and late embryogenic morphogenesis. Math1, expressed by the rhombic lip (RL, is required for the genesis of glutamatergic neurons. Mutants deficient for the transcription factor Ptf1a display a lack of Purkinje cells and gabaergic interneurons. Rora gene contributes to the developmental signalling between granule cells and Purkinje neurons. The expression profile of SHH (Sonic hedgehog in postnatal stages determines the final size/shape of the cerebellum. Genes affecting the development impact upon the physiological properties of the cerebellar circuits. For instance, receptors are developmentally regulated and their action interferes directly with developmental processes. Another field of research which is expanding relates to very preterm neonates. They are at risk for cerebellar lesions, which may themselves impair the developmental events. Very preterm neonates often show sensori-motor deficits, highlighting another major link between impaired development and learning deficiencies. Pathways playing a critical role in cerebellar development are likely to become therapeutical targets for several neurodevelopmental disorders.

Development mutants of anabaena doliolum defective in repair of UV-damage

International Nuclear Information System (INIS)

Tiwari, D.N.; Singh, C.B.

1980-01-01

Nitrosoguanidine induced 'blue' pigment mutants of the blue-green alga anabaena doliolum were isolated. The blue-mutants on further characterization were grouped into three developmental phenotypes - (i) those forming doli-form blue-spores of heterogenous size i.e., Ad 011, (ii) those forming spheroidal cells in the stationary phase, some of which behave like spores on transfer to fresh medium i.e., Ad 012, and (iii) those showing no sporulation and conditionally producing abnormal cells in the presence of combined nitrogen only i.e., Ad 007. The former two classes of mutants showed the formation of abnormal cells irrespective of the presence or absence of combined nitrogen sources in the medium. The formation of abnormal cells in the filaments of the above mutants were distinguished by their larger size and irregular mode of division leading to true-branch formation. The comparative characterization of these mutant strains with the parental one showed sluggish growth, increased UV-sensitivity, almost unchanged photorepair capacity, a marked change in the pigment composition and relative resistance to nitrosoguanidine. Irregular cell division in both space and time in the mutant strains and their increased sensitivity to ultraviolet irradiation indicate the possible involvement of dark repair system in maintaining the precision of cell cylce in this alga. (orig.) 891 AJ/orig. 892 HIS

Temperature-sensitive host range mutants of herpes simplex virus type 2

International Nuclear Information System (INIS)

Koment, R.W.; Rapp, F.

1975-01-01

Herpesviruses are capable of several types of infection of a host cell. To investigate the early events which ultimately determine the nature of the virus-host cell interaction, a system was established utilizing temperature-sensitive mutants of herpes simplex virus type 2. Four mutants have been isolated which fail to induce cytopathic effects and do not replicate at 39 C in hamster embryo fibroblast cells. At least one mutant is virus DNA negative. Since intracellular complementation is detectable between pairs of mutants, a virus function is known to be temperature sensitive. However, all four mutants induce cytopathic effects and replicate to parental virus levels in rabbit kidney cells at 39 C. This suggests that a host cell function, lacking or nonfunctional in HEF cells but present in rabbit kidney cells at 39 C, is required for the replication of these mutants in hamster embryo fibroblast cells at 39 C. Therefore, we conclude that these mutants are both temperature sensitive and exhibit host range properties

Nature of mutants induced by ionizing radiation in cultured hamster cells. III. Molecular characterization of HPRT-deficient mutants induced by. gamma. -rays or. cap alpha. -particles showing that the majority have deletions of all or part of the hprt gene

Energy Technology Data Exchange (ETDEWEB)

Thacker, J

1986-05-01

DNA from 58 independent HPRT-deficient mutants of V79 hamster cells induced by ionizing radiation was analysed by Southern blot hybridization to a full-length hamster hprt cDNA. About half of the ..gamma..-ray-induced mutants (20/43) were apparently total gene deletions, because they lacked all functional hprt gene sequences hybridizing to the cDNA probe. Another 10 mutants showed various partial deletions and/or rearrangements of the hprt gene. The remaining 13 mutants showed no detectable change in comparison to the structure of the normal gene, which correlated well with previous characterization of these mutants indicating that most carry point mutations in the hprt gene. Thus, 70% or more of radiation-induced HPRT-deficient mutants arise through large genetic changes, especially deletions of all or part of the hprt gene. 16 references, 4 figures, 1 table.

Identification, cloning and characterization of sis7 and sis10 sugar-insensitive mutants of Arabidopsis

Directory of Open Access Journals (Sweden)

Biddle Kelly D

2008-10-01

Full Text Available Abstract Background The levels of soluble sugars, such as glucose and sucrose, help regulate many plant metabolic, physiological and developmental processes. Genetic screens are helping identify some of the loci involved in plant sugar response and reveal extensive cross-talk between sugar and phytohormone response pathways. Results A forward genetic screen was performed to identify mutants with increased resistance to the inhibitory effects of high levels of exogenous sugars on early Arabidopsis seedling development. The positional cloning and characterization of two of these sugar insensitive (sis mutants, both of which are also involved in abscisic acid (ABA biosynthesis or response, are reported. Plants carrying mutations in SIS7/NCED3/STO1 or SIS10/ABI3 are resistant to the inhibitory effects of high levels of exogenous Glc and Suc. Quantitative RT-PCR analyses indicate transcriptional upregulation of ABA biosynthesis genes by high concentrations of Glc in wild-type germinating seeds. Gene expression profiling revealed that a significant number of genes that are expressed at lower levels in germinating sis7-1/nced3-4/sto1-4 seeds than in wild-type seeds are implicated in auxin biosynthesis or transport, suggesting cross-talk between ABA and auxin response pathways. The degree of sugar insensitivity of different sis10/abi3 mutant seedlings shows a strong positive correlation with their level of ABA insensitivity during seed germination. Conclusion Mutations in the SIS7/NCED3/STO1 gene, which is primarily required for ABA biosynthesis under drought conditions, confer a sugar-insensitive phenotype, indicating that a constitutive role in ABA biosynthesis is not necessary to confer sugar insensitivity. Findings presented here clearly demonstrate that mutations in ABI3 can confer a sugar-insensitive phenotype and help explain previous, mixed reports on this topic by showing that ABA and sugar insensitivity exhibit a strong positive correlation in

Mutant Mice Lacking the p53 C-Terminal Domain Model Telomere Syndromes

Directory of Open Access Journals (Sweden)

Iva Simeonova

2013-06-01

Full Text Available Mutations in p53, although frequent in human cancers, have not been implicated in telomere-related syndromes. Here, we show that homozygous mutant mice expressing p53Δ31, a p53 lacking the C-terminal domain, exhibit increased p53 activity and suffer from aplastic anemia and pulmonary fibrosis, hallmarks of syndromes caused by short telomeres. Indeed, p53Δ31/Δ31 mice had short telomeres and other phenotypic traits associated with the telomere disease dyskeratosis congenita and its severe variant the Hoyeraal-Hreidarsson syndrome. Heterozygous p53+/Δ31 mice were only mildly affected, but decreased levels of Mdm4, a negative regulator of p53, led to a dramatic aggravation of their symptoms. Importantly, several genes involved in telomere metabolism were downregulated in p53Δ31/Δ31 cells, including Dyskerin, Rtel1, and Tinf2, which are mutated in dyskeratosis congenita, and Terf1, which is implicated in aplastic anemia. Together, these data reveal that a truncating mutation can activate p53 and that p53 plays a major role in the regulation of telomere metabolism.

Microclones derived from the mouse chromosome 7 D-E bands map within the proximal region of the c14CoS deletion in albino mutant mice

International Nuclear Information System (INIS)

Toenjes, R.R.W.; Weith, A.; Rinchik, E.M.; Winking, H.; Carnwath, J.W.; Kaliner, B.; Paul, D.

1991-01-01

A group of radiation-induced perinatal-lethal deletions that include the albino (c) locus on mouse chromosome 7 causes failure of expression of various hepatocyte-specific genes when homozygous. The transcription of such genes could be controlled in trans by a regulatory gene(s) located within the proximal region of the C14CoS deletion. To identify this potential regulatory gene, a microclone library was established from microdissected D and E bands of chromosome 7. Three nonoverlapping microclones (E305, E336B, and E453B) hybridizing with wildtype but not with C14CoS/C14CoS DNA were isolated. E336B represents a single-copy DNA fragment, whereas E305 and E453B hybridized with 3 and 10 EcoRI DNA restriction fragments, respectively. All fragments map exclusively within the deletion. The microclones hybridized to DNA of viable C6H/C14CoS deletion heterozygotes but not to DNA of homozygotes for the lethal mutation c10R75M, which belongs to the same complementation group as c14CoS. DNA of viable homozygous mutant C62DSD, which carries a deletion breakpoint proximal to that of c6H, hybridized only with E453B. This microclone identified 6 EcoRI restriction fragments in C62DSD/C62DSD DNA. The results demonstrate that of the isolated microclones, E453B identifies a locus (D7RT453B) that maps closest to the hsdr-1 (hepatocyte-specific developmental regulation) locus, which maps between the proximal breakpoints of deletions c10R75M and c62DSD

Gamma ray induced mutants in Coleus

Energy Technology Data Exchange (ETDEWEB)

Vasudevan, K; Jos, J S [Central Tuber Crops Research Institute, Trivandrum, Kerala (India)

1988-07-01

The germplasm collection of Chinese potato (Coleus parviflorus Benth) contains almost no variation for yield contributing traits. The crop does not produce seeds. Treatment of underground tubers with 1 kR, 2 kR, 3 kR and 4 kR gamma rays resulted in 50 morphologically different mutants which are maintained as mutant clones. In the M{sub 1}V{sub 1} generation, suspected mutant sprouts, were carefully removed and grown separately. The most interesting mutant types are the following: (i) erect mutant with spoon shaped light green leaves, 30 cm long inflorescences against 20 cm in the control, cylindrical tubers measuring ca. 7.0 cm long and 3 cm girth against 4 cm and 2.5 cm in the control (ii) early mutants 1 and 2, one having less leaf serration, the other having light green small leaves and dwarf type (iii) fleshy leaf mutant, dark green, thick and smooth leaves. Control plants spread almost in 1 m{sup 2} area and bear tubers from the nodes of branches. In the early mutants tuber formation is mainly restricted to the base of the plant, which makes harvest easier. The crop usually matures within 150 - 160 days, the early mutants are ready for harvest 100 days after planting. As the mutants are less spreading, the yield could be increased by closer spacing.

Gamma ray induced mutants in Coleus

International Nuclear Information System (INIS)

Vasudevan, K.; Jos, J.S.

1988-01-01

The germplasm collection of Chinese potato (Coleus parviflorus Benth) contains almost no variation for yield contributing traits. The crop does not produce seeds. Treatment of underground tubers with 1 kR, 2 kR, 3 kR and 4 kR gamma rays resulted in 50 morphologically different mutants which are maintained as mutant clones. In the M 1 V 1 generation, suspected mutant sprouts, were carefully removed and grown separately. The most interesting mutant types are the following: (i) erect mutant with spoon shaped light green leaves, 30 cm long inflorescences against 20 cm in the control, cylindrical tubers measuring ca. 7.0 cm long and 3 cm girth against 4 cm and 2.5 cm in the control (ii) early mutants 1 and 2, one having less leaf serration, the other having light green small leaves and dwarf type (iii) fleshy leaf mutant, dark green, thick and smooth leaves. Control plants spread almost in 1 m 2 area and bear tubers from the nodes of branches. In the early mutants tuber formation is mainly restricted to the base of the plant, which makes harvest easier. The crop usually matures within 150 - 160 days, the early mutants are ready for harvest 100 days after planting. As the mutants are less spreading, the yield could be increased by closer spacing

Flavonoid accumulation patterns of transparent testa mutants of arabidopsis

Science.gov (United States)

Peer, W. A.; Brown, D. E.; Tague, B. W.; Muday, G. K.; Taiz, L.; Murphy, A. S.

2001-01-01

Flavonoids have been implicated in the regulation of auxin movements in Arabidopsis. To understand when and where flavonoids may be acting to control auxin movement, the flavonoid accumulation pattern was examined in young seedlings and mature tissues of wild-type Arabidopsis. Using a variety of biochemical and visualization techniques, flavonoid accumulation in mature plants was localized in cauline leaves, pollen, stigmata, and floral primordia, and in the stems of young, actively growing inflorescences. In young Landsberg erecta seedlings, aglycone flavonols accumulated developmentally in three regions, the cotyledonary node, the hypocotyl-root transition zone, and the root tip. Aglycone flavonols accumulated at the hypocotyl-root transition zone in a developmental and tissue-specific manner with kaempferol in the epidermis and quercetin in the cortex. Quercetin localized subcellularly in the nuclear region, plasma membrane, and endomembrane system, whereas kaempferol localized in the nuclear region and plasma membrane. The flavonoid accumulation pattern was also examined in transparent testa mutants blocked at different steps in the flavonoid biosynthesis pathway. The transparent testa mutants were shown to have precursor accumulation patterns similar to those of end product flavonoids in wild-type Landsberg erecta, suggesting that synthesis and end product accumulation occur in the same cells.

Evidence for a developmental role for TLR4 in learning and memory.

Directory of Open Access Journals (Sweden)

Eitan Okun

Full Text Available Toll-like receptors (TLRs play essential roles in innate immunity and increasing evidence indicates that these receptors are expressed in neurons, astrocytes and microglia in the brain where they mediate responses to infection, stress and injury. Very little is known about the roles of TLRs in cognition. To test the hypothesis that TLR4 has a role in hippocampus-dependent spatial learning and memory, we used mice deficient for TLR4 and mice receiving chronic TLR4 antagonist infusion to the lateral ventricles in the brain. We found that developmental TLR4 deficiency enhances spatial reference memory acquisition and memory retention, impairs contextual fear-learning and enhances motor functions, traits that were correlated with CREB up-regulation in the hippocampus. TLR4 antagonist infusion into the cerebral ventricles of adult mice did not affect cognitive behavior, but instead affected anxiety responses. Our findings indicate a developmental role for TLR4 in shaping spatial reference memory, and fear learning and memory. Moreover, we show that central TLR4 inhibition using a TLR4 antagonist has no discernible physiological role in regulating spatial and contextual hippocampus-dependent cognitive behavior.

Parameters of mitotic recombination in minute mutants of Drosophila melanogaster

International Nuclear Information System (INIS)

Ferrus, A.

1975-01-01

A sample of 16 Minutes, representing 12 loci distributed over all the chromosome arms and including 3 pairs of alleles and 4 deficiencies, has been studied with respect to several developmental and recombinational parameters. Cell marker mutants located in most of the chromosome arms were used to assess (1) spontaneous and x-ray-induced mitotic recombination frequencies of each Minute, and (2) clone sizes of the different cell marker clones. These parameters were analyzed both in the wing disc and in the abdominal histoblasts. Whereas spontaneous frequencies are not affected by the presence of the Minutes studied, the different Minutes characteristically increase the frequency of recombination clones arising after x irradiation. The recombinant clones which are M + /M + are significantly larger than clones in the same fly which retain the M + /M condition. This is particularly striking in clones in the wing disc, slightly so in clones in the tergites. The occurrence of mitotic recombination in the fourth chromosome is reported for the first time. Chaeta length and developmental delay correlates with the recombinational parameters in different ways. Possible causal interrelationships of the different traits of the Minute syndrome are discussed. (U.S.)

Desynchronization of cells on the developmental path triggers the formation of spiral waves of cAMP during Dictyostelium aggregation.

Science.gov (United States)

Lauzeral, J; Halloy, J; Goldbeter, A

1997-08-19

Whereas it is relatively easy to account for the formation of concentric (target) waves of cAMP in the course of Dictyostelium discoideum aggregation after starvation, the origin of spiral waves remains obscure. We investigate a physiologically plausible mechanism for the spontaneous formation of spiral waves of cAMP in D. discoideum. The scenario relies on the developmental path associated with the continuous changes in the activity of enzymes such as adenylate cyclase and phosphodiesterase observed during the hours that follow starvation. These changes bring the cells successively from a nonexcitable state to an excitable state in which they relay suprathreshold cAMP pulses, and then to autonomous oscillations of cAMP, before the system returns to an excitable state. By analyzing a model for cAMP signaling based on receptor desensitization, we show that the desynchronization of cells on this developmental path triggers the formation of fully developed spirals of cAMP. Developmental paths that do not correspond to the sequence of dynamic transitions no relay-relay-oscillations-relay are less able or fail to give rise to the formation of spirals.

Induction of Mutants in Durum Wheat

International Nuclear Information System (INIS)

AL-Ubaidi, M.; Ibrahim, I.; AL-Hadithi, A.

2002-01-01

This investigation presents a breeding program for induction and development of a new genotype of durum wheat, resistant to lodging with high yield, by irradiation durum wheat hybrids (F2) with gamma rays 100 Gy, during 1990-1997 cultivation seasons. This program involves: induction of variability, selection evaluation of the mutants at three locations: Twaitha (Baghdad) Latifya ( Babylon) and Swari (Kutt). All mutants showed resistance to lodging and there was a significant reduction in plant height. Mutant SIXIZ-22 surpassed other mutants and its origin in lodging resistance and plant height (83.5,82.8 and 89.4 cm) in the three locations at generation M5 and M6, respectively. Also, there were significant differences between mutant and their origin in the number of spikes/M 2 and grain yild during the two successive generation. On the other hand, mutant IZxCO-105 surpassed other mutants in the number of spikes/M 2 (231.8,242.3 and 292) and grain yield (4336,3376 and 5232 kg/ha) in all testing location, respectively . (authors) 14 refs., 4 tabs

High-content screening of yeast mutant libraries by shotgun lipidomics

DEFF Research Database (Denmark)

Tarasov, Kirill; Stefanko, Adam; Casanovas, Albert

2014-01-01

To identify proteins with a functional role in lipid metabolism and homeostasis we designed a high-throughput platform for high-content lipidomic screening of yeast mutant libraries. To this end, we combined culturing and lipid extraction in 96-well format, automated direct infusion...... factor KAR4 precipitated distinct lipid metabolic phenotypes. These results demonstrate that the high-throughput shotgun lipidomics platform is a valid and complementary proxy for high-content screening of yeast mutant libraries....... nanoelectrospray ionization, high-resolution Orbitrap mass spectrometry, and a dedicated data processing framework to support lipid phenotyping across hundreds of Saccharomyces cerevisiae mutants. Our novel approach revealed that the absence of genes with unknown function YBR141C and YJR015W, and the transcription...

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

OpenAIRE

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...

Defective DNA cross-link removal in Chinese hamster cell mutants hypersensitive to bifunctional alkylating agents

International Nuclear Information System (INIS)

Hoy, C.A.; Thompson, L.H.; Mooney, C.L.; Salazar, E.P.

1985-01-01

DNA repair-deficient mutants from five genetic complementation groups isolated previously from Chinese hamster cells were assayed for survival after exposure to the bifunctional alkylating agents mitomycin C or diepoxybutane. Groups 1, 3, and 5 exhibited 1.6- to 3-fold hypersensitivity compared to the wild-type cells, whereas Groups 2 and 4 exhibited extraordinary hypersensitivity. Mutants from Groups 1 and 2 were exposed to 22 other bifunctional alkylating agents in a rapid assay that compared cytotoxicity of the mutants to the wild-type parental strain, AA8. With all but two of the compounds, the Group 2 mutant (UV4) was 15- to 60-fold more sensitive than AA8 or the Group 1 mutant (UV5). UV4 showed only 6-fold hypersensitivity to quinacrine mustard. Alkaline elution measurements showed that this compound produced few DNA interstrand cross-links but numerous strand breaks. Therefore, the extreme hypersensitivity of mutants from Groups 2 and 4 appeared specific for compounds the main cytotoxic lesions of which were DNA cross-links. Mutant UV5 was only 1- to 4-fold hypersensitive to all the compounds. Although the initial number of cross-links was similar for the three cell lines, the efficiency of removal of cross-links was lowest in UV4 and intermediate in UV5. These results suggest that the different levels of sensitivity are specifically related to different efficiencies of DNA cross-link removal. The phenotype of hypersensitivity to both UV radiation and cross-link damage exhibited by the mutants in Groups 2 and 4 appears to differ from those of the known human DNA repair syndromes

Determination of male strobilus developmental stages by cytological and gene expression analyses in Japanese cedar (Cryptomeria japonica).

Science.gov (United States)

Tsubomura, Miyoko; Kurita, Manabu; Watanabe, Atsushi

2016-05-01

The molecular mechanisms that control male strobilus development in conifers are largely unknown because the developmental stages and related genes have not yet been characterized. The determination of male strobilus developmental stages will contribute to genetic research and reproductive biology in conifers. Our objectives in this study were to determine the developmental stages of male strobili by cytological and transcriptome analysis, and to determine the stages at which aberrant morphology is observed in a male-sterile mutant of Cryptomeria japonica D. Don to better understand the molecular mechanisms that control male strobilus and pollen development. Male strobilus development was observed for 8 months, from initiation to pollen dispersal. A set of 19,209 expressed sequence tags (ESTs) collected from a male reproductive library and a pollen library was used for microarray analysis. We divided male strobilus development into 10 stages by cytological and transcriptome analysis. Eight clusters (7324 ESTs) exhibited major changes in transcriptome profiles during male strobili and pollen development in C. japonica Two clusters showed a gradual increase and decline in transcript abundance, respectively, while the other six clusters exhibited stage-specific changes. The stages at which the male sterility trait of Sosyun was expressed were identified using information on male strobilus and pollen developmental stages and gene expression profiles. Aberrant morphology was observed cytologically at Stage 6 (microspore stage), and differences in expression patterns compared with wild type were observed at Stage 4 (tetrad stage). © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Characteristics of 36C103- influx into nitrate reductase deficient mutant E1 pisum sativum seedlings: evidence for restricted ''induction'' by nitrate compared with wild type

International Nuclear Information System (INIS)

Deane-Drummond, C.E.; Jacobsen, E.

1986-01-01

The characteristics of nitrate uptake into seedlings of Pisum sativum L. cv. Rondo mutant E 1 defective for nitrate reductase (NR) and of its parent variety Rondo have been investigated using 36 C10 3 - as an analogue for nitrate. The apparent Michaelis Menten constants (K m ) for 36 ClO 3 - influx measured over 10 min were similar for mutant E 1 and the wild type (Wt). There was a 28% increase in 36 C10 3 - into Wt seedlings following nitrate pretreatment but this was not found when mutant seedlings were used. N starvation increased 36 C10 3 - influx into both mutant and Wt seedlings, and the rate of cycling E/I was also enhanced to a similar extent. The results are discussed in terms of current ideas on the regulation of nitrate uptake and assimilation. (author)

Functionality screen of streptavidin mutants by non-denaturing SDS-PAGE using biotin-4-fluorescein.

Science.gov (United States)

Humbert, Nicolas; Ward, Thomas R

2008-01-01

Site-directed mutagenesis or directed evolution of proteins often leads to the production of inactive mutants. For streptavidin and related proteins, mutations may lead to the loss of their biotin-binding properties. With high-throughput screening methodologies in mind, it is imperative to detect, prior to the high-density protein production, the bacteria that produce non-functional streptavidin isoforms. Based on the incorporation of biotin-4-fluorescein in streptavidin mutants present in Escherichia coli bacterial extracts, we detail a functional screen that allows the identification of biotin-binding streptavidin variants. Bacteria are cultivated in a small volume, followed by a rapid treatment of the cells; biotin-4-fluorescein is added to the bacterial extract and loaded on an Sodium Dodecyl Sulfate Poly-Acrylamide Gel Electrophoresis (SDS-PAGE) under non-denaturing conditions. Revealing is performed using a UV transilluminator. This screen is thus easy to implement, cheap and requires only readily available equipment.

Apolar Distal Pocket Mutants of Yeast Cytochrome c Peroxidase: Hydrogen Peroxide Reactivity and Cyanide Binding of the TriAla, TriVal, and TriLeu Variants

Science.gov (United States)

Bidwai, Anil K.; Meyen, Cassandra; Kilheeney, Heather; Wroblewski, Damian; Vitello, Lidia B.; Erman, James E.

2012-01-01

Three yeast cytochrome c peroxidase (CcP) variants with apolar distal heme pockets have been constructed. The CcP variants have Arg48, Trp51, and His52 mutated to either all alanines, CcP(triAla), all valines, CcP(triVal), or all leucines, CcP(triLeu). The triple mutants have detectable enzymatic activity at pH 6 but the activity is less than 0.02% that of wild-type CcP. The activity loss is primarily due to the decreased rate of reaction between the triple mutants and H2O2 compared to wild-type CcP. Spectroscopic properties and cyanide binding characteristics of the triple mutants have been investigated over the pH stability region of CcP, pH 4 to 8. The absorption spectra indicate that the CcP triple mutants have hemes that are predominantly five-coordinate, high-spin at pH 5 and six-coordinate, low-spin at pH 8. Cyanide binding to the triple mutants is biphasic indicating that the triple mutants have two slowly-exchanging conformational states with different cyanide affinities. The binding affinity for cyanide is reduced at least two orders of magnitude in the triple mutants compared to wild-type CcP and the rate of cyanide binding is reduced by four to five orders of magnitude. Correlation of the reaction rates of CcP and 12 distal pocket mutants with H2O2 and HCN suggests that both reactions require ionization of the reactants within the distal heme pocket allowing the anion to bind the heme iron. Distal pocket features that promote substrate ionization (basic residues involved in base-catalyzed substrate ionization or polar residues that can stabilize substrate anions) increase the overall rate of reaction with H2O2 and HCN while features that inhibit substrate ionization slow the reactions. PMID:23022490

Molecular and biochemical analyses of spontaneous and X-ray-induced mutants in human lymphoblastoid cells

Energy Technology Data Exchange (ETDEWEB)

Liber, H L; Call, K M; Little, J B

1987-05-01

The authors have isolated a series of 14 spontaneously arising and 28 X-ray-induced mutants at the hypoxanthine-guanine phosphoribosyltransferase (hgprt) locus in human lymphoblastoid cells. Among the spontaneous mutants, 5/14 (36%) had detectable alterations in their restriction fragment pattern after hybridization with a human cDNA probe for hgprt. Of the 10 remaining mutants, 4 had partial HGPRT enzyme activity, which suggested that they contained point mutations. Among the 28 mutants induced by 150 rad of X-rays, 15 (54%) had deletions of part or all of the hgprt gene. Of the remaining 13 (18% overall) 5 had partial HGPRT enzyme activity, which suggested that they contained point mutations. These data imply that in this human cell system, X-rays induce both point mutants which have residual enzyme activity as well as mutations involving relatively large deletions of DNA. 48 reference, 1 figure, 4 tables.

Existence of c-Kit negative cells with ultrastructural features of interstitial cells of Cajal in the subserosal layer of the W/Wv mutant mouse colon.

Science.gov (United States)

Tamada, Hiromi; Kiyama, Hiroshi

2015-01-01

Interstitial cells of Cajal (ICC) are mesenchymal cells that are distributed along the gastrointestinal tract and function as pacemaker cells or intermediary cells between nerves and smooth muscle cells. ICC express a receptor tyrosine kinase c-Kit, which is an established marker for ICC. The c-kit gene is allelic with the murine white-spotting locus (W), and some ICC subsets were reported to be missing in heterozygous mutant W/Wv mice carrying W and Wv mutated alleles. In this study, the characterization of interstitial cells in the subserosal layer of W/Wv mice was analyzed by immunohistochemistry and electron microscopy. In the proximal and distal colon of W/Wv mutant mice, no c-Kit-positive cells were detected in the subserosal layer by immunohistochemistry. By electron microscopy, the interstitial cells, which were characterized by the existence of caveolae, abundant mitochondria and gap junctions, were observed in the W/Wv mutant colon.The morphological characteristics were comparable to those of the multipolar c-Kit positive ICC seen in the subserosa of proximal and distal colon of wild-type mice. Fibroblasts were also located in the same layers,but the morphology of the fibroblasts was distinguishable from that of ICC in wild type mice or of ICC-like cells in W/Wv mutant mice. Collectively, it is concluded that c-Kit-negative interstitial cells showing a typical ICC ultrastructure exist in the proximal and distal colon of W/Wv mutant mice.

Mutants dissecting development and behaviour in drosophila

International Nuclear Information System (INIS)

Joshi, Adita; Chandrashekaran, Shanti; Sharma, R.P.

2005-01-01

We have traced in this paper the progress in Drosophila genetics research from the 1960s, at the IARI, spearheaded by the visionary insight of M. S. Swaminathan. The work started with the study of indirect effect of radiation and the synergistic interaction of physical and chemical mutagens on chromosomal and genetic changes. This paved the way for the study of single gene mutants in dissecting developmental and behavioural processes. New genes discovered by us have been shown to encode conserved cell signalling molecules controlling developmental and behavioural pathways. With the complete sequencing of the Drosophila genome, in the year 2000, mounting evidence for the homology between Drosophila and human genes controlling genetic disorders became available. This has led to the fly becoming an indispensable tool for studying human diseases as well as a model to test for drugs and pharmaceuticals against human diseases and complex behavioural processes. For example wingless in Drosophila belongs to the conserved Wnt gene family and aberrant WNT signalling is linked to a range of human diseases, most notably cancer. Inhibition as well as activation of WNT signalling form the basis of an effective therapy for some cancers as well as several other clinical conditions. Recent experiments have shown that WNTs might also normally participate in self-renewal, proliferation or differentiation of stem cells and altering WNT signalling might be beneficial to the use of stem cells for therapeutic means. Likewise, the stambhA mutant of Drosophila which was discovered for its temperature-dependent paralytic behaviour is the fly homologue of Phospholipase Cβ. Phospholipase C mediated G protein signalling plays a central role in vital processes controlling epilepsy, vision, taste, and olfaction in animals. Proteins of the G-signalling pathway are of intense research interest since many human diseases involve defects in G-protein signalling pathways. In fact, approximately 50

Neurologic function during developmental and adult stages in Dab1(scm) (scrambler) mutant mice.

Science.gov (United States)

Jacquelin, C; Strazielle, C; Lalonde, R

2012-01-01

Homozygous Dab1(scm) mouse mutants with cell ectopias in cerebellar cortex, hippocampus, and neocortex were compared to non-ataxic controls on the SHIRPA primary screening battery on postnatal days 8, 15, and 22, as well as in the adult period. Dab1(scm) mutants were distinguished from non-ataxic controls as early as postnatal day 8 based on body tremor, gait anomalies, and body weight. On postnatal day 15, motor coordination deficits were evident on horizontal bar and inclined or vertical grid tests in association with a weaker grip strength. Likewise, mutants were distinguished from controls on drop righting and hindpaw clasping tests. Further differences were detected on postnatal day 22 in the form of fewer visual placing, touch escape, trunk curl, freezing, and vocalization responses, as well as squares traversed in the open-field. Evaluation at the adult age demonstrated similar impairments, indicative of permanent motor alterations. Neuronal metabolic activity was estimated by cytochrome oxidase histochemistry on cerebellar sections. Cerebellar cortical layers and efferent deep nuclei of Dab1(scm) mice appeared hypometabolic relative to non-ataxic mice despite normal metabolism in both regular and ectopic Purkinje cells. Copyright © 2011 Elsevier B.V. All rights reserved.

Development of compact mutants in apple and sour cherry

International Nuclear Information System (INIS)

Zagaja, S.W.; Przybyla, A.; Machnik, B.

1982-01-01

During the period 1973 - 79 studies were conducted with the aim of developing compact mutants in apple and cherry cultivars and in apple vegetative rootstocks. During the investigations the effect of the dose of gamma rays on frequency of the mutants was studied. Attempts were also made to evolve a micropropagation technique adapted to propagate P 2 and P 22 apple rootstocks, as an aid in mutation breeding. Several mutants were produced in all the material studied, but none of them have yet reached a sufficient developmental stage to enable their complete assessment. On the basis of the results obtained so far the following conclusions can be drawn: higher doses of irradiation resulted in higher frequency of mutants in most apple cultivars and apple rootstocks; in sour cherries the effect of dose depended on the cultivars. Among V 1 shoots developed from sleeping buds on irradiated scion wood, compact mutants were found; their frequency, however, was about 60% lower than among V 1 shoots developed directly from irradiated dormant buds. In apple rootstocks A 2 and M 26 several dwarfed mutants were found; some of these produced thorny plants and some had lower rooting ability; both these characteristics are inferior from the practical point of view. Multiplication and rooting media for in vitro propagation of apple rootstocks, worked out for M 26, were found unsuitable for the rootstocks P 2 and P 22; modifications made in the growth substance composition of the above media enabled satisfactory propagation to be obtained. (author)

acn-1, a C. elegans homologue of ACE, genetically interacts with the let-7 microRNA and other heterochronic genes.

Science.gov (United States)

Metheetrairut, Chanatip; Ahuja, Yuri; Slack, Frank J

2017-10-02

The heterochronic pathway in C. elegans controls the relative timing of cell fate decisions during post-embryonic development. It includes a network of microRNAs (miRNAs), such as let-7, and protein-coding genes, such as the stemness factors, LIN-28 and LIN-41. Here we identified the acn-1 gene, a homologue of mammalian angiotensin-converting enzyme (ACE), as a new suppressor of the stem cell developmental defects of let-7 mutants. Since acn-1 null mutants die during early larval development, we used RNAi to characterize the role of acn-1 in C. elegans seam cell development, and determined its interaction with heterochronic factors, including let-7 and its downstream interactors - lin-41, hbl-1, and apl-1. We demonstrate that although RNAi knockdown of acn-1 is insufficient to cause heterochronic defects on its own, loss of acn-1 suppresses the retarded phenotypes of let-7 mutants and enhances the precocious phenotypes of hbl-1, though not lin-41, mutants. Conversely, the pattern of acn-1 expression, which oscillates during larval development, is disrupted by lin-41 mutants but not by hbl-1 mutants. Finally, we show that acn-1(RNAi) enhances the let-7-suppressing phenotypes caused by loss of apl-1, a homologue of the Alzheimer's disease-causing amyloid precursor protein (APP), while significantly disrupting the expression of apl-1 during the L4 larval stage. In conclusion, acn-1 interacts with heterochronic genes and appears to function downstream of let-7 and its target genes, including lin-41 and apl-1.

The Citrus transcription factor, CitERF13, regulates citric acid accumulation via a protein-protein interaction with the vacuolar proton pump, CitVHA-c4.

Science.gov (United States)

Li, Shao-jia; Yin, Xue-ren; Xie, Xiu-lan; Allan, Andrew C; Ge, Hang; Shen, Shu-ling; Chen, Kun-song

2016-02-03

Organic acids are essential to fruit flavor. The vacuolar H(+) transporting adenosine triphosphatase (V-ATPase) plays an important role in organic acid transport and accumulation. However, less is known of V-ATPase interacting proteins and their relationship with organic acid accumulation. The relationship between V-ATPase and citric acid was investigated, using the citrus tangerine varieties 'Ordinary Ponkan (OPK)' and an early maturing mutant 'Zaoshu Ponkan (ZPK)'. Five V-ATPase genes (CitVHA) were predicted as important to citric acid accumulation. Among the genes, CitVHA-c4 was observed, using a yeast two-hybrid screen, to interact at the protein level with an ethylene response factor, CitERF13. This was verified using bimolecular fluorescence complementation assays. A similar interaction was also observed between Arabidopsis AtERF017 (a CitERF13 homolog) and AtVHA-c4 (a CitVHA-c4 homolog). A synergistic effect on citric acid levels was observed between V-ATPase proteins and interacting ERFs when analyzed using transient over-expression in tobacco and Arabidopsis mutants. Furthermore, the transcript abundance of CitERF13 was concomitant with CitVHA-c4. CitERF13 or AtERF017 over-expression leads to significant citric acid accumulation. This accumulation was abolished in an AtVHA-c4 mutant background. ERF-VHA interactions appear to be involved in citric acid accumulation, which was observed in both citrus and Arabidopsis.

The phenotype of FancB-mutant mouse embryonic stem cells

Energy Technology Data Exchange (ETDEWEB)

Kim, Tae Moon; Ko, Jun Ho; Choi, Yong Jun; Hu Lingchuan [Department of Molecular Medicine and Institute of Biotechnology, University of Texas Health Science Center at San Antonio, 15355 Lambda Drive, San Antonio, TX 78245 (United States); Hasty, Paul, E-mail: hastye@uthscsa.edu [Department of Molecular Medicine and Institute of Biotechnology, University of Texas Health Science Center at San Antonio, 15355 Lambda Drive, San Antonio, TX 78245 (United States)

2011-07-01

Fanconi anemia (FA) is a rare autosomal recessive disease characterized by bone marrow failure, developmental defects and cancer. There are multiple FA genes that enable the repair of interstrand crosslinks (ICLs) in coordination with a variety of other DNA repair pathways in a way that is poorly understood. Here we present the phenotype of mouse embryonic stem (ES) cells mutated for FancB. We found FancB-mutant cells exhibited reduced cellular proliferation, hypersensitivity to the crosslinking agent mitomycin C (MMC), increased spontaneous and MMC-induced chromosomal abnormalities, reduced spontaneous sister chromatid exchanges (SCEs), reduced gene targeting, reduced MMC-induced Rad51 foci and absent MMC-induced FancD2 foci. Since FancB is on the X chromosome and since ES cells are typically XY, FancB is an excellent target for an epistatic analysis to elucidate FA's role in ICL repair.

Isolation of UV-sensitive mutants of mouse L5178Y cells by a cell suspension spotting method

International Nuclear Information System (INIS)

Shiomi, T.; Hieda-Shiomi, N.; Sato, K.

1982-01-01

We have isolated 56 UV-sensitive mutant clones from a mouse L51 T/t line of L5178Y cells by a cell suspension spotting method. Five mutants have also been isolated from L51 T/t and L5178Y cells by the method reported by Thompson and coworkers. We divided the mutants into two groups, highly sensitive and moderately sensitive mutants, according to their sensitivity to UV irradiation. Fifty-eight mutants were highly sensitive and three were moderately sensitive to UV. The reconstruction experiments indicate that more than 90% of highly sensitive mutants were recovered by the cell suspension spotting method. Frequencies of recovered mutants highly sensitive to UV increased with increasing dose of mutagens. Recovered mutant frequency reached 10(-2) after treatment with 1.5 micrograms/ml of N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) (survival 0.2%). Eight UV-sensitive mutants were divided into four complementation groups. These mutants were 2-6 times more sensitive to UV than parental L51 T/t cells in terms of D37 (dose required to reduce survival to 37%). Four representative UV-sensitive mutants which are classified into different complementation groups were examined for their sensitivity to killing by UV, 4-nitroquinoline-1-oxide (4NQO), mitomycin C (MMC), X-rays, and MNNG. All four classes of mutants were found to be cross-sensitive to UV, 4NQO, and MMC, but not sensitive to X-rays and MNNG

48 CFR 519.7012 - Developmental assistance.

Science.gov (United States)

2010-10-01

... guidance relating to— (1) Financial management; (2) Organizational management; (3) Overall business management/planning; and (4) Business development. (b) Engineering and other technical assistance. (c) Loans... SOCIOECONOMIC PROGRAMS SMALL BUSINESS PROGRAMS GSA Mentor-Protégé Program 519.7012 Developmental assistance...

Successful Use of [14C]Paracetamol Microdosing to Elucidate Developmental Changes in Drug Metabolism

NARCIS (Netherlands)

M.G. Mooij (Miriam); E. van Duijn (Esther); C.A.J. Knibbe (Catherijne); K.M. Allegaert (Karel); J. Windhorst (Judith); J.M. van Rosmalen (Joost); N.H. Hendrikse (N. Harry); D. Tibboel (Dick); W.H.J. Vaes (Wouter H. J.); S.N. de Wildt (Saskia)

2017-01-01

textabstractBackground: We previously showed the practical and ethical feasibility of using [14C]-microdosing for pharmacokinetic studies in children. We now aimed to show that this approach can be used to elucidate developmental changes in drug metabolism, more specifically, glucuronidation and

Successful Use of [(14)C]Paracetamol Microdosing to Elucidate Developmental Changes in Drug Metabolism

NARCIS (Netherlands)

Mooij, M.G.; Duijn, E. van; Knibbe, C.A.; Allegaert, K.; Windhorst, A.D.; Rosmalen, J. van; Hendrikse, N.H.; Tibboel, D.; Vaes, W.H.; Wildt, S.N. de

2017-01-01

BACKGROUND: We previously showed the practical and ethical feasibility of using [(14)C]-microdosing for pharmacokinetic studies in children. We now aimed to show that this approach can be used to elucidate developmental changes in drug metabolism, more specifically, glucuronidation and sulfation,

Desynchronization of cells on the developmental path triggers the formation of spiral waves of cAMP during Dictyostelium aggregation

Science.gov (United States)

Lauzeral, Jacques; Halloy, José; Goldbeter, Albert

1997-01-01

Whereas it is relatively easy to account for the formation of concentric (target) waves of cAMP in the course of Dictyostelium discoideum aggregation after starvation, the origin of spiral waves remains obscure. We investigate a physiologically plausible mechanism for the spontaneous formation of spiral waves of cAMP in D. discoideum. The scenario relies on the developmental path associated with the continuous changes in the activity of enzymes such as adenylate cyclase and phosphodiesterase observed during the hours that follow starvation. These changes bring the cells successively from a nonexcitable state to an excitable state in which they relay suprathreshold cAMP pulses, and then to autonomous oscillations of cAMP, before the system returns to an excitable state. By analyzing a model for cAMP signaling based on receptor desensitization, we show that the desynchronization of cells on this developmental path triggers the formation of fully developed spirals of cAMP. Developmental paths that do not correspond to the sequence of dynamic transitions no relay-relay-oscillations-relay are less able or fail to give rise to the formation of spirals. PMID:9256451

Root hair mutants of barley

International Nuclear Information System (INIS)

Engvild, K.C.; Rasmussen, K.

2005-01-01

Barley mutants without root hairs or with short or reduced root hairs were isolated among M 2 seeds of 'Lux' barley (Hordeum vulgare L.) after acidified sodium azide mutagenesis. Root hair mutants are investigated intensively in Arabidopsis where about 40 genes are known. A few root hair mutants are known in maize, rice, barley and tomato. Many plants without root hairs grow quite well with good plant nutrition, and mutants have been used for investigations of uptake of strongly bound nutrients like phosphorus, iron, zinc and silicon. Seed of 'Lux' barley (Sejet Plant Breeding, Denmark) were soaked overnight, and then treated with 1.5-millimolarsodium azide in 0.1 molar sodium phosphate buffer, pH 3, for 2.5 hours according to the IAEA Manual on Mutation Breeding (2nd Ed.). After rinsing in tap water and air-drying, the M 2 seeds were sown in the field the same day. Spikes, 4-6 per M 1 plant, were harvested. The mutation frequency was similar to that obtained with other barley cultivars from which low-phytate mutants were isolated [5]. Seeds were germinated on black filter paper in tap water for 3 or 4 days before scoring for root hair mutants

Characterization of a Thermo-Inducible Chlorophyll-Deficient Mutant in Barley

Directory of Open Access Journals (Sweden)

Rong Wang

2017-11-01

Full Text Available Leaf color is an important trait for not only controlling crop yield but also monitoring plant status under temperature stress. In this study, a thermo-inducible chlorophyll-deficient mutant, named V-V-Y, was identified from a gamma-radiated population of the barley variety Vlamingh. The leaves of the mutant were green under normal growing temperature but turned yellowish under high temperature in the glasshouse experiment. The ratio of chlorophyll a and chlorophyll b in the mutant declined much faster in the first 7–9 days under heat treatment. The leaves of V-V-Y turned yellowish but took longer to senesce under heat stress in the field experiment. Genetic analysis indicated that a single nuclear gene controlled the mutant trait. The mutant gene (vvy was mapped to the long arm of chromosome 4H between SNP markers 1_0269 and 1_1531 with a genetic distance of 2.2 cM and a physical interval of 9.85 Mb. A QTL for grain yield was mapped to the same interval and explained 10.4% of the yield variation with a LOD score of 4. This QTL is coincident with the vvy gene interval that is responsible for the thermo-inducible chlorophyll-deficient trait. Fine mapping, based on the barley reference genome sequence, further narrowed the vvy gene to a physical interval of 0.428 Mb with 11 annotated genes. This is the first report of fine mapping a thermo-inducible chlorophyll-deficient gene in barley.

Molecular basis of proton uptake in single and double mutants of cytochrome c oxidase

Energy Technology Data Exchange (ETDEWEB)

Henry, Rowan M; Caplan, David; Pomes, Regis [Molecular Structure and Function, Hospital for Sick Children, Toronto, ON, M5G 1X8 (Canada); Fadda, Elisa, E-mail: pomes@sickkids.ca [Department of Chemistry, University of Galway (Ireland)

2011-06-15

Cytochrome c oxidase, the terminal enzyme of the respiratory chain, utilizes the reduction of dioxygen into water to pump protons across the mitochondrial inner membrane. The principal pathway of proton uptake into the enzyme, the D channel, is a 2.5 nm long channel-like cavity named after a conserved, negatively charged aspartic acid (D) residue thought to help recruiting protons to its entrance (D132 in the first subunit of the S. sphaeroides enzyme). The single-point mutation of D132 to asparagine (N), a neutral residue, abolishes enzyme activity. Conversely, replacing conserved N139, one-third into the D channel, by D, induces a decoupled phenotype, whereby oxygen reduction proceeds but not proton pumping. Intriguingly, the double mutant D132N/N139D, which conserves the charge of the D channel, restores the wild-type phenotype. We use molecular dynamics simulations and electrostatic calculations to examine the structural and physical basis for the coupling of proton pumping and oxygen chemistry in single and double N139D mutants. The potential of mean force for the conformational isomerization of N139 and N139D side chains reveals the presence of three rotamers, one of which faces the channel entrance. This out-facing conformer is metastable in the wild-type and in the N139D single mutant, but predominant in the double mutant thanks to the loss of electrostatic repulsion with the carboxylate group of D132. The effects of mutations and conformational isomerization on the pKa of E286, an essential proton-shuttling residue located at the top of the D channel, are shown to be consistent with the electrostatic control of proton pumping proposed recently (Fadda et al 2008 Biochim. Biophys. Acta 1777 277-84). Taken together, these results suggest that preserving the spatial distribution of charges at the entrance of the D channel is necessary to guarantee both the uptake and the relay of protons to the active site of the enzyme. These findings highlight the interplay

Molecular basis of proton uptake in single and double mutants of cytochrome c oxidase

International Nuclear Information System (INIS)

Henry, Rowan M; Caplan, David; Pomes, Regis; Fadda, Elisa

2011-01-01

Cytochrome c oxidase, the terminal enzyme of the respiratory chain, utilizes the reduction of dioxygen into water to pump protons across the mitochondrial inner membrane. The principal pathway of proton uptake into the enzyme, the D channel, is a 2.5 nm long channel-like cavity named after a conserved, negatively charged aspartic acid (D) residue thought to help recruiting protons to its entrance (D132 in the first subunit of the S. sphaeroides enzyme). The single-point mutation of D132 to asparagine (N), a neutral residue, abolishes enzyme activity. Conversely, replacing conserved N139, one-third into the D channel, by D, induces a decoupled phenotype, whereby oxygen reduction proceeds but not proton pumping. Intriguingly, the double mutant D132N/N139D, which conserves the charge of the D channel, restores the wild-type phenotype. We use molecular dynamics simulations and electrostatic calculations to examine the structural and physical basis for the coupling of proton pumping and oxygen chemistry in single and double N139D mutants. The potential of mean force for the conformational isomerization of N139 and N139D side chains reveals the presence of three rotamers, one of which faces the channel entrance. This out-facing conformer is metastable in the wild-type and in the N139D single mutant, but predominant in the double mutant thanks to the loss of electrostatic repulsion with the carboxylate group of D132. The effects of mutations and conformational isomerization on the pKa of E286, an essential proton-shuttling residue located at the top of the D channel, are shown to be consistent with the electrostatic control of proton pumping proposed recently (Fadda et al 2008 Biochim. Biophys. Acta 1777 277-84). Taken together, these results suggest that preserving the spatial distribution of charges at the entrance of the D channel is necessary to guarantee both the uptake and the relay of protons to the active site of the enzyme. These findings highlight the interplay

Molecular basis of proton uptake in single and double mutants of cytochrome c oxidase

Science.gov (United States)

Henry, Rowan M.; Caplan, David; Fadda, Elisa; Pomès, Régis

2011-06-01

Cytochrome c oxidase, the terminal enzyme of the respiratory chain, utilizes the reduction of dioxygen into water to pump protons across the mitochondrial inner membrane. The principal pathway of proton uptake into the enzyme, the D channel, is a 2.5 nm long channel-like cavity named after a conserved, negatively charged aspartic acid (D) residue thought to help recruiting protons to its entrance (D132 in the first subunit of the S. sphaeroides enzyme). The single-point mutation of D132 to asparagine (N), a neutral residue, abolishes enzyme activity. Conversely, replacing conserved N139, one-third into the D channel, by D, induces a decoupled phenotype, whereby oxygen reduction proceeds but not proton pumping. Intriguingly, the double mutant D132N/N139D, which conserves the charge of the D channel, restores the wild-type phenotype. We use molecular dynamics simulations and electrostatic calculations to examine the structural and physical basis for the coupling of proton pumping and oxygen chemistry in single and double N139D mutants. The potential of mean force for the conformational isomerization of N139 and N139D side chains reveals the presence of three rotamers, one of which faces the channel entrance. This out-facing conformer is metastable in the wild-type and in the N139D single mutant, but predominant in the double mutant thanks to the loss of electrostatic repulsion with the carboxylate group of D132. The effects of mutations and conformational isomerization on the pKa of E286, an essential proton-shuttling residue located at the top of the D channel, are shown to be consistent with the electrostatic control of proton pumping proposed recently (Fadda et al 2008 Biochim. Biophys. Acta 1777 277-84). Taken together, these results suggest that preserving the spatial distribution of charges at the entrance of the D channel is necessary to guarantee both the uptake and the relay of protons to the active site of the enzyme. These findings highlight the interplay

Purification and characterization of naturally occurring HIV-1 (South African subtype C) protease mutants from inclusion bodies.

Science.gov (United States)

Maseko, Sibusiso B; Natarajan, Satheesh; Sharma, Vikas; Bhattacharyya, Neelakshi; Govender, Thavendran; Sayed, Yasien; Maguire, Glenn E M; Lin, Johnson; Kruger, Hendrik G

2016-06-01

Human immunodeficiency virus (HIV) infections in sub-Saharan Africa represent about 56% of global infections. Many studies have targeted HIV-1 protease for the development of drugs against AIDS. Recombinant HIV-1 protease is used to screen new drugs from synthetic compounds or natural substances. Along with the wild type (C-SA) we also over-expressed and characterized two mutant forms from patients that had shown resistance to protease inhibitors. Using recombinant DNA technology, we constructed three recombinant plasmids in pGEX-6P-1 and expressed them containing a sequence encoding wild type HIV protease and two mutants (I36T↑T contains 100 amino acids and L38L↑N↑L contains 101 amino acids). These recombinant proteins were isolated from inclusion bodies by using QFF anion exchange and GST trap columns. In SDS-PAGE, we obtained these HIV proteases as single bands of approximately 11.5, 11.6 and 11.7 kDa for the wild type, I36T↑Tand L38L↑N↑L mutants, respectively. The enzyme was recovered efficiently (0.25 mg protein/L of Escherichia coli culture) and had high specific activity of 2.02, 2.20 and 1.33 μmol min(-1) mg(-1) at an optimal pH of 5 and temperature of 37 °C for the wild type, I36T↑T and L38L↑N↑L, respectively. The method employed here provides an easy and rapid purification of the HIV-1(C-SA) protease from the inclusion bodies, with high yield and high specific activities. Copyright © 2016 Elsevier Inc. All rights reserved.

Transcriptome Analysis of a New Peanut Seed Coat Mutant for the Physiological Regulatory Mechanism Involved in Seed Coat Cracking and Pigmentation

Science.gov (United States)

Wan, Liyun; Li, Bei; Pandey, Manish K.; Wu, Yanshan; Lei, Yong; Yan, Liying; Dai, Xiaofeng; Jiang, Huifang; Zhang, Juncheng; Wei, Guo; Varshney, Rajeev K.; Liao, Boshou

2016-01-01

Seed-coat cracking and undesirable color of seed coat highly affects external appearance and commercial value of peanuts (Arachis hypogaea L.). With an objective to find genetic solution to the above problems, a peanut mutant with cracking and brown colored seed coat (testa) was identified from an EMS treated mutant population and designated as “peanut seed coat crack and brown color mutant line (pscb).” The seed coat weight of the mutant was almost twice of the wild type, and the germination time was significantly shorter than wild type. Further, the mutant had lower level of lignin, anthocyanin, proanthocyanidin content, and highly increased level of melanin content as compared to wild type. Using RNA-Seq, we examined the seed coat transcriptome in three stages of seed development in the wild type and the pscb mutant. The RNA-Seq analysis revealed presence of highly differentially expressed phenylpropanoid and flavonoid pathway genes in all the three seed development stages, especially at 40 days after flowering (DAF40). Also, the expression of polyphenol oxidases and peroxidase were found to be activated significantly especially in the late seed developmental stage. The genome-wide comparative study of the expression profiles revealed 62 differentially expressed genes common across all the three stages. By analyzing the expression patterns and the sequences of the common differentially expressed genes of the three stages, three candidate genes namely c36498_g1 (CCoAOMT1), c40902_g2 (kinesin), and c33560_g1 (MYB3) were identified responsible for seed-coat cracking and brown color phenotype. Therefore, this study not only provided candidate genes but also provided greater insights and molecular genetic control of peanut seed-coat cracking and color variation. The information generated in this study will facilitate further identification of causal gene and diagnostic markers for breeding improved peanut varieties with smooth and desirable seed coat color. PMID

Existence of c-Kit negative cells with ultrastructural features of interstitial cells of Cajal in the subserosal layer of the W/W(v) mutant mouse colon.

Science.gov (United States)

Tamada, Hiromi; Kiyama, Hiroshi

2015-01-01

Interstitial cells of Cajal (ICC) are mesenchymal cells that are distributed along the gastrointestinal tract and function as pacemaker cells or intermediary cells between nerves and smooth muscle cells. ICC express a receptor tyrosine kinase c-Kit, which is an established marker for ICC. The c-kit gene is allelic with the murine white-spotting locus (W), and some ICC subsets were reported to be missing in heterozygous mutant W/W(v) mice carrying W and W(v) mutated alleles. In this study, the characterization of interstitial cells in the subserosal layer of W/W(v) mice was analyzed by immunohistochemistry and electron microscopy. In the proximal and distal colon of W/W(v) mutant mice, no c-Kit-positive cells were detected in the subserosal layer by immunohistochemistry. By electron microscopy, the interstitial cells, which were characterized by the existence of caveolae, abundant mitochondria and gap junctions, were observed in the W/W(v) mutant colon. The morphological characteristics were comparable to those of the multipolar c-Kit positive ICC seen in the subserosa of proximal and distal colon of wild-type mice. Fibroblasts were also located in the same layers, but the morphology of the fibroblasts was distinguishable from that of ICC in wild type mice or of ICC-like cells in W/W(v) mutant mice. Collectively, it is concluded that c-Kit-negative interstitial cells showing a typical ICC ultrastructure exist in the proximal and distal colon of W/W(v) mutant mice.

The Arabidopsis aba4-1 mutant reveals a specific function for neoxanthin in protection against photooxidative stress.

Science.gov (United States)

Dall'Osto, Luca; Cazzaniga, Stefano; North, Helen; Marion-Poll, Annie; Bassi, Roberto

2007-03-01

The aba4-1 mutant completely lacks neoxanthin but retains all other xanthophyll species. The missing neoxanthin in light-harvesting complex (Lhc) proteins is compensated for by higher levels of violaxanthin, albeit with lower capacity for photoprotection compared with proteins with wild-type levels of neoxanthin. Detached leaves of aba4-1 were more sensitive to oxidative stress than the wild type when exposed to high light and incubated in a solution of photosensitizer agents. Both treatments caused more rapid pigment bleaching and lipid oxidation in aba4-1 than wild-type plants, suggesting that neoxanthin acts as an antioxidant within the photosystem II (PSII) supercomplex in thylakoids. While neoxanthin-depleted Lhc proteins and leaves had similar sensitivity as the wild type to hydrogen peroxide and singlet oxygen, they were more sensitive to superoxide anions. aba4-1 intact plants were not more sensitive than the wild type to high-light stress, indicating the existence of compensatory mechanisms of photoprotection involving the accumulation of zeaxanthin. However, the aba4-1 npq1 double mutant, lacking zeaxanthin and neoxanthin, underwent stronger PSII photoinhibition and more extensive oxidation of pigments than the npq1 mutant, which still contains neoxanthin. We conclude that neoxanthin preserves PSII from photoinactivation and protects membrane lipids from photooxidation by reactive oxygen species. Neoxanthin appears particularly active against superoxide anions produced by the Mehler's reaction, whose rate is known to be enhanced in abiotic stress conditions.

Genetic variation for germination and physiological traits in sunflower mutants induced by gamma rays [Helianthus annuus L.

International Nuclear Information System (INIS)

Alejo-Jaimes, A.; Jardinaud, M.F.; Maury, P.; Alibert, G.; Gentzbittel, L.; Sarrafi, A.; Grieu, P.; Petiprez, M.

2004-01-01

Seeds of sunflower line AS-613 were irradiated with gamma rays and 1,559 M4 progenies were studied for their germination characteristics and the following traits were studied: thousand seed weight, seed size, time before emergence, percentage of emerged seedlings, hypocotyl length and diameter, number of cotyledons and cotyledons pigmentation intensity. A high genetic variability was observed for all the studied traits. Through M4 progenies, 9 mutants presenting the most differences with the original genotype (AS-613) were planted in a randomized blocks design with 8 replications in a controlled greenhouse and some morphological and physiological traits were studied, which are: plant height, number of leaves, total leaf area, net photosynthesis, transpiration, stomatal conductance, water use efficiency and net carbon assimilation. When harvesting, flower head diameter, head weight, stem weight, leaves weight, total number of seeds per plant and thousand seed weight were measured. The differences between mutants and also non irradiated genotype (AS-613) were significant for most of studied traits suggesting that several developmental processes have been modified [it

Cholesterol pathways affected by small molecules that decrease sterol levels in Niemann-Pick type C mutant cells.

Directory of Open Access Journals (Sweden)

Madalina Rujoi

2010-09-01

Full Text Available Niemann-Pick type C (NPC disease is a genetically inherited multi-lipid storage disorder with impaired efflux of cholesterol from lysosomal storage organelles.The effect of screen-selected cholesterol lowering compounds on the major sterol pathways was studied in CT60 mutant CHO cells lacking NPC1 protein. Each of the selected chemicals decreases cholesterol in the lysosomal storage organelles of NPC1 mutant cells through one or more of the following mechanisms: increased cholesterol efflux from the cell, decreased uptake of low-density lipoproteins, and/or increased levels of cholesteryl esters. Several chemicals promote efflux of cholesterol to extracellular acceptors in both non-NPC and NPC1 mutant cells. The uptake of low-density lipoprotein-derived cholesterol is inhibited by some of the studied compounds.Results herein provide the information for prioritized further studies in identifying molecular targets of the chemicals. This approach proved successful in the identification of seven chemicals as novel inhibitors of lysosomal acid lipase (Rosenbaum et al, Biochim. Biophys. Acta. 2009, 1791:1155-1165.

Determination of the catalytic activity of LEOPARD syndrome-associated SHP2 mutants toward parafibromin, a bona fide SHP2 substrate involved in Wnt signaling

International Nuclear Information System (INIS)

Noda, Saori; Takahashi, Atsushi; Hayashi, Takeru; Tanuma, Sei-ichi; Hatakeyama, Masanori

2016-01-01

SHP2, encoded by the PTPN11 gene, is a protein tyrosine phosphatase that plays a key role in the proliferation of cells via RAS-ERK activation. SHP2 also promotes Wnt signaling by dephosphorylating parafibromin. Germline missense mutations of PTPN11 are found in more than half of patients with Noonan syndrome (NS) and LEOPARD syndrome (LS), both of which are congenital developmental disorders with multiple common symptoms. However, whereas NS-associated PTPN11 mutations give rise to gain-of-function SHP2 mutants, LS-associated SHP2 mutants are reportedly loss-of-function mutants. To determine the phosphatase activity of LS-associated SHP2 more appropriately, we performed an in vitro phosphatase assay using tyrosine-phosphorylated parafibromin, a biologically relevant substrate of SHP2 and the positive regulator of Wnt signaling that is activated through SHP2-mediated dephosphorylation. We found that LS-associated SHP2 mutants (Y279C, T468M, Q506P, and Q510E) exhibited a substantially reduced phosphatase activity toward parafibromin when compared with wild-type SHP2. Furthermore, each of the LS-associated mutants displayed a differential degree of decrease in phosphatase activity. Deviation of the SHP2 catalytic activity from a certain range, either too strong or too weak, may therefore lead to similar clinical outcomes in NS and LS, possibly through an imbalanced Wnt signal caused by inadequate dephosphorylation of parafibromin. - Highlights: • LS-associated SHP2 mutants dephosphorylate parafibromin on Y290, Y293, and Y315. • LS-associated SHP2 mutants display a reduced tyrosine phosphatase activity. • LS-specific SHP2-Y279C is catalytically less active than LS-specific SHP2-T468M. • NS/LS-associated SHP2-Q506P has both hyper- and hypomorphic enzymatic properties.

Determination of the catalytic activity of LEOPARD syndrome-associated SHP2 mutants toward parafibromin, a bona fide SHP2 substrate involved in Wnt signaling

Energy Technology Data Exchange (ETDEWEB)

Noda, Saori [Division of Microbiology, Graduate School of Medicine, The University of Tokyo, Tokyo (Japan); Department of Biochemistry, Faculty of Pharmaceutical Sciences, Tokyo University of Science, Chiba (Japan); Takahashi, Atsushi; Hayashi, Takeru [Division of Microbiology, Graduate School of Medicine, The University of Tokyo, Tokyo (Japan); Tanuma, Sei-ichi [Department of Biochemistry, Faculty of Pharmaceutical Sciences, Tokyo University of Science, Chiba (Japan); Hatakeyama, Masanori, E-mail: mhata@m.u-tokyo.ac.jp [Division of Microbiology, Graduate School of Medicine, The University of Tokyo, Tokyo (Japan)

2016-01-22

SHP2, encoded by the PTPN11 gene, is a protein tyrosine phosphatase that plays a key role in the proliferation of cells via RAS-ERK activation. SHP2 also promotes Wnt signaling by dephosphorylating parafibromin. Germline missense mutations of PTPN11 are found in more than half of patients with Noonan syndrome (NS) and LEOPARD syndrome (LS), both of which are congenital developmental disorders with multiple common symptoms. However, whereas NS-associated PTPN11 mutations give rise to gain-of-function SHP2 mutants, LS-associated SHP2 mutants are reportedly loss-of-function mutants. To determine the phosphatase activity of LS-associated SHP2 more appropriately, we performed an in vitro phosphatase assay using tyrosine-phosphorylated parafibromin, a biologically relevant substrate of SHP2 and the positive regulator of Wnt signaling that is activated through SHP2-mediated dephosphorylation. We found that LS-associated SHP2 mutants (Y279C, T468M, Q506P, and Q510E) exhibited a substantially reduced phosphatase activity toward parafibromin when compared with wild-type SHP2. Furthermore, each of the LS-associated mutants displayed a differential degree of decrease in phosphatase activity. Deviation of the SHP2 catalytic activity from a certain range, either too strong or too weak, may therefore lead to similar clinical outcomes in NS and LS, possibly through an imbalanced Wnt signal caused by inadequate dephosphorylation of parafibromin. - Highlights: • LS-associated SHP2 mutants dephosphorylate parafibromin on Y290, Y293, and Y315. • LS-associated SHP2 mutants display a reduced tyrosine phosphatase activity. • LS-specific SHP2-Y279C is catalytically less active than LS-specific SHP2-T468M. • NS/LS-associated SHP2-Q506P has both hyper- and hypomorphic enzymatic properties.

Absence of mutation at the 5'-upstream promoter region of the TPM4 gene from cardiac mutant axolotl (Ambystoma mexicanum).

Science.gov (United States)

Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K

2011-09-01

Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.

Structural analysis of Herbaspirillum seropedicae lipid-A and of two mutants defective to colonize maize roots.

Science.gov (United States)

Serrato, Rodrigo V; Balsanelli, Eduardo; Sassaki, Guilherme L; Carlson, Russell W; Muszynski, Artur; Monteiro, Rose A; Pedrosa, Fábio O; Souza, Emanuel M; Iacomini, Marcello

2012-11-01

Lipid-A was isolated by mild acid hydrolysis from lipopolysaccharides extracted from cells of Herbaspirillum seropedicae, strain SMR1, and from two mutants deficient in the biosynthesis of rhamnose (rmlB⁻ and rmlC⁻). Structural analyzes were carried out using MALDI-TOF and derivatization by per-O-trimethylsilylation followed by GC-MS in order to determine monosaccharide and fatty acid composition. De-O-acylation was also performed to determine the presence of N-linked fatty acids. Lipid-A from H. seropedicae SMR1 showed a major structure comprising 2-amino-2-deoxy-glucopyranose-(1→6)-2-amino-2-deoxy-glucopyranose phosphorylated at C4' and C1 positions, each carrying a unit of 4-amino-4-deoxy-arabinose. C2 and C2' positions were substituted by amide-linked 3-hydroxy-dodecanoic acids. Both rhamnose-defective mutants showed similar structure for their lipid-A moieties, except for the lack of 4-amino-4-deoxy-arabinose units attached to phosphoryl groups. Copyright © 2012 Elsevier B.V. All rights reserved.

On the nature of in vivo requirements for rde-4 in RNAi and developmental pathways in C. elegans.

Science.gov (United States)

Blanchard, Daniel; Parameswaran, Poornima; Lopez-Molina, Javier; Gent, Jonathan; Saynuk, Jamie Fleenor; Fire, Andrew

2011-01-01

C. elegans RDE-4 is a double-stranded RNA binding protein that has been shown to play a key role in response to foreign double-stranded RNA (dsRNA). We have used diverse tools for analysis of gene function to characterize the domain and organismal foci of RDE-4 action in C. elegans. First, we examined the focus of activity within the RDE-4 protein, by testing a series of RDE-4 deletion constructs for their ability to support dsRNA-triggered gene silencing. These assays indicated a molecular requirement for a linker region and the second dsRNA-binding domain of RDE-4, with ancillary contributions to function from the C and N terminal domains. Second, we used mosaic analysis to explore the cellular focus of action of RDE-4. These experiments indicated an ability of RDE-4 to function non-autonomously in foreign RNA responses. Third, we used growth under stressful conditions to search for evidence of an organismal focus of action for RDE-4 distinct from its role in response to foreign dsRNA. Propagation at high temperatures exposed a conditional requirement for RDE-4 for optimal growth and fertility, indicating at least under these conditions that RDE-4 can serve an essential role in C. elegans. © 2011 Landes Bioscience

Despite phylogenetic effects, C3-C4 lineages bridge the ecological gap to C4 photosynthesis.

Science.gov (United States)

Lundgren, Marjorie R; Christin, Pascal-Antoine

2017-01-01

C 4 photosynthesis is a physiological innovation involving several anatomical and biochemical components that emerged recurrently in flowering plants. This complex trait evolved via a series of physiological intermediates, broadly termed 'C 3 -C 4 ', which have been widely studied to understand C 4 origins. While this research program has focused on biochemistry, physiology, and anatomy, the ecology of these intermediates remains largely unexplored. Here, we use global occurrence data and local habitat descriptions to characterize the niches of multiple C 3 -C 4 lineages, as well as their close C 3 and C 4 relatives. While C 3 -C 4 taxa tend to occur in warm climates, their abiotic niches are spread along other dimensions, making it impossible to define a universal C 3 -C 4 niche. Phylogeny-based comparisons suggest that, despite shifts associated with photosynthetic types, the precipitation component of the C 3 -C 4 niche is particularly lineage specific, being highly correlated with that of closely related C 3 and C 4 taxa. Our large-scale analyses suggest that C 3 -C 4 lineages converged toward warm habitats, which may have facilitated the transition to C 4 photosynthesis, effectively bridging the ecological gap between C 3 and C 4 plants. The intermediates retained some precipitation aspects of their C 3 ancestors' habitat, and likely transmitted them to their C 4 descendants, contributing to the diversity among C 4 lineages seen today. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

High yielding mutants of blackgram variety 'PH-25'

International Nuclear Information System (INIS)

Misra, R.C.; Mohapatra, B.D.; Panda, B.S.

2001-01-01

Seeds of blackgram (Vigna mungo L.) variety 'PH-5' were treated with chemical mutagens ethyl methanesulfonate (EMS), nitrosoguanidine (NG), maleic hydrazide (MH) and sodium azide (NaN 3 ), each at 3 different concentrations. Thirty six mutant lines developed from mutagenic treatments along with parent varieties were tested in M 4 generation. The mutants showed wide variation in most of the traits and multivariante D 2 analysis showed genetic divergence among themselves. Twenty of the thirty mutants showed genetic divergence from parent. Ten selected high yielding mutants were tested in M 5 . Yield and other productive traits of five high yielding mutants in M 4 and M 5 are presented

Purification, cDNA Cloning, and Developmental Expression of the Nodule-Specific Uricase from Phaseolus vulgaris L. 1

Science.gov (United States)

Sánchez, Federico; Campos, Francisco; Padilla, Jaime; Bonneville, Jean-Marc; Enríquez, Consuelo; Caput, Daniel

1987-01-01

Nodule-specific uricase (uricase II) from Phaseolus vulgaris L. was purified to homogeneity by chromatographic methods. Purification data indicated that uricase II is approximately 2% of the total soluble protein from mature nodules. Specific antiserum was raised and used to determine the developmental expression and for immunoselection of polysomes. Uricase II was antigenically detected early in nodule development, 2 to 3 days before nitrogen fixation. Uricase-encoding cDNA clones were isolated by hybridizing a nodule-specific pUC9 cDNA library with labeled mRNA from immunoselected polysomes and a 35,000 molecular weight uricase II-encoding cDNA from soybean. An homologous clone (pNF-UR07) was used to assess the expression pattern of the specific transcript during development. Northern-blot analysis indicated that uricase II mRNA is exclusively expressed in nodule tissue. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:16665575

Cellulase production by two mutant strain of Trichoderma longibranchiatum QM9414 and Rut C30; Produccion de celulasas a partir de dos cepas hiperproductoras de trichoderma longibranchiatum Qm9-41 4 y Rut C30

Energy Technology Data Exchange (ETDEWEB)

Blanco, M J

1991-07-01

Native or pretreated biomass from Onopordum nervosum Boiss, has been examined as candidate feedstock for cellulase production by two mutant strain of Trichoderma Ionqibrachiatum QM9414 and Rut C30. Batch cultivation methods were evaluated and compared with previous experiments using ball-milled, crystalline cellulose (Solka floc). Batch cultivation of T. Ionqibrachiatum Rut C30 on 5% (w/v) acid pretreated O. nervosum biomass yielded enzyme productivities and activities comparable to those obtained on Solka floc. However, the overall enzyme production performance was lower than on Solka floc at comparable cellulose concentrations. This fact may be due to the accumulation of pretreated by products and lignin in the ferment. (Author) 40 refs.

The pro1(+) gene from Sordaria macrospora encodes a C6 zinc finger transcription factor required for fruiting body development.

Science.gov (United States)

Masloff, S; Pöggeler, S; Kück, U

1999-05-01

During sexual morphogenesis, the filamentous ascomycete Sordaria macrospora differentiates into multicellular fruiting bodies called perithecia. Previously it has been shown that this developmental process is under polygenic control. To further understand the molecular mechanisms involved in fruiting body formation, we generated the protoperithecia forming mutant pro1, in which the normal development of protoperithecia into perithecia has been disrupted. We succeeded in isolating a cosmid clone from an indexed cosmid library, which was able to complement the pro1(-) mutation. Deletion analysis, followed by DNA sequencing, subsequently demonstrated that fertility was restored to the pro1 mutant by an open reading frame encoding a 689-amino-acid polypeptide, which we named PRO1. A region from this polypeptide shares significant homology with the DNA-binding domains found in fungal C6 zinc finger transcription factors, such as the GAL4 protein from yeast. However, other typical regions of C6 zinc finger proteins, such as dimerization elements, are absent in PRO1. The involvement of the pro1(+) gene in fruiting body development was further confirmed by trying to complement the mutant phenotype with in vitro mutagenized and truncated versions of the pro1 open reading frame. Southern hybridization experiments also indicated that pro1(+) homologues are present in other sexually propagating filamentous ascomycetes.

New insights from an old mutant: SPADIX4 governs fruiting body development but not hyphal fusion in Sordaria macrospora.

Science.gov (United States)

Teichert, Ines; Lutomski, Miriam; Märker, Ramona; Nowrousian, Minou; Kück, Ulrich

2017-02-01

During the sexual life cycle of filamentous fungi, multicellular fruiting bodies are generated for the dispersal of spores. The filamentous ascomycete Sordaria macrospora has a long history as a model system for studying fruiting body formation, and two collections of sterile mutants have been generated. However, for most of these mutants, the underlying genetic defect remains unknown. Here, we investigated the mutant spadix (spd) that was generated by X-ray mutagenesis in the 1950s and terminates sexual development after the formation of pre-fruiting bodies (protoperithecia). We sequenced the spd genome and found a 22 kb deletion affecting four genes, which we termed spd1-4. Generation of deletion strains revealed that only spd4 is required for fruiting body formation. Although sterility in S. macrospora is often coupled with a vegetative hyphal fusion defect, Δspd4 was still capable of fusion. This feature distinguishes SPD4 from many other regulators of sexual development. Remarkably, GFP-tagged SPD4 accumulated in the nuclei of vegetative hyphae and fruiting body initials, the ascogonial coils, but not in sterile tissue from the developing protoperithecium. Our results point to SPD4 as a specific determinant of fruiting body formation. Research on SPD4 will, therefore, contribute to understanding cellular reprogramming during initiation of sexual development in fungi.

Cellulase production by two mutant strain of Trichoderma longibrachiatum Qm9414 and Rut C30

International Nuclear Information System (INIS)

Blanco, M.J.

1991-01-01

Native or pretreated biomass from Onopordum nervosum boiss, has been examined as candidate feedstock for cellulase production by two mutant strain of trichoderma longibrachiatum QM9414 and Rut C30. Batch cultivation methods were evaluated and compared with previous experiments using ball-milled, crystalline cellulose (Solka floc). Batch cultivation of T. longibrachiatum Rut C30 on 55% (W/V) acid pretreated O. nervosum biomass yielded enzyme productivities and activities comparable to those obtained on Solka floc. However, the overall enzyme production performance was lower than on Solka floc at comparable cellulose concentrations. This fact may be due to the accumulation of pretreated by products and lignin in the fermentor.(author)

Cell size and cell number in dwarf mutants of barley (Hordeum vulgare)

International Nuclear Information System (INIS)

Blonstein, A.D.; Gale, M.D.

1984-01-01

Sixteen height mutants, induced by sodium azide treatment of the two-rowed barley variety Proctor, have been used to investigate the relationship between the extent and nature of stem shortening with alterations in cell size and cell number, and the pleiotropic effects of dwarfing genes on vegetative development and agronomic performance. The studies on epidermal cell number and cell length in the developmentally earliest and latest elongated vegetative tissues - the coleoptile and peduncle resprectively - suggest that cell number may be the primary determinant of plant height. One semi-prostrate and one erectoides mutant are used to illustrate different cell number/cell size strategies and their relationships with gibberellin sensitivity, growth rate and lodging resistance are discussed. (author)

Collaborative Occupational Therapy: Teachers' Impressions of the Partnering for Change (P4C) Model.

Science.gov (United States)

Wilson, A L; Harris, S R

2018-05-01

Occupational therapists (OTs) often face barriers when trying to collaborate with teachers in school-based settings. Partnering for change (P4C), a collaborative practice model designed to support children with developmental coordination disorder, could potentially support all students with special needs. Therefore, the aim of this study was to explore how teachers experience OT services delivered using the P4C model to support children with a variety of special needs. P4C was implemented at one elementary school in Courtenay, British Columbia. Eleven teachers participated in two focus groups and a one-on-one interview to gather descriptive, qualitative data. Grounded theory techniques were used for data analysis. Four themes (collaborating in the thick of it all, learning and taking risks, managing limited time and resources, and appreciating responsive OT support) represented teachers' experiences of P4C. Teachers strongly preferred collaborative OT services based on the P4C model. Students with a variety of special needs were supported within their classrooms as teachers learned new strategies from the OT and found ways to embed these strategies into their daily routines.

The Shift of the Intestinal Microbiome in the Innate Immunity-Deficient Mutant rde-1 Strain of C. elegans upon Orsay Virus Infection.

Science.gov (United States)

Guo, Yuanyuan; Xun, Zhe; Coffman, Stephanie R; Chen, Feng

2017-01-01

The status of intestinal microbiota is a determinant of host health. However, the alteration of the gut microbiota caused by the innate immune response to virus infection is unclear. Caenorhabditis elegans and its natural virus Orsay provide an excellent model of host-virus interactions. We evaluated the intestinal microbial community complexity of the wild-type N2 and the innate immunity-deficient mutant rde-1 ( ne219 ) strains of C. elegans upon Orsay virus infection. The gut microbiota diversity was decreased in rde-1 ( ne219 ) mutant animals, and a large number of genes were associated with the difference between infected and uninfected rde-1 ( ne219 ) mutant animals. Therefore, this study provides the first evaluation of the alterations caused by Orsay virus on intestinal microbiota in wildtype and innate immunity-deficient animals using C. elegans as the model species. Our findings indicate that virus infection may alters the microbiome in animals with defective immune response.

The Shift of the Intestinal Microbiome in the Innate Immunity-Deficient Mutant rde-1 Strain of C. elegans upon Orsay Virus Infection

Directory of Open Access Journals (Sweden)

Yuanyuan Guo

2017-05-01

Full Text Available The status of intestinal microbiota is a determinant of host health. However, the alteration of the gut microbiota caused by the innate immune response to virus infection is unclear. Caenorhabditis elegans and its natural virus Orsay provide an excellent model of host–virus interactions. We evaluated the intestinal microbial community complexity of the wild-type N2 and the innate immunity-deficient mutant rde-1 (ne219 strains of C. elegans upon Orsay virus infection. The gut microbiota diversity was decreased in rde-1 (ne219 mutant animals, and a large number of genes were associated with the difference between infected and uninfected rde-1 (ne219 mutant animals. Therefore, this study provides the first evaluation of the alterations caused by Orsay virus on intestinal microbiota in wildtype and innate immunity-deficient animals using C. elegans as the model species. Our findings indicate that virus infection may alters the microbiome in animals with defective immune response.

The phenotype of FancB-mutant mouse embryonic stem cells

OpenAIRE

Kim, Tae Moon; Ko, Jun Ho; Choi, Yong Jun; Hu, Lingchuan; Hasty, Paul

2011-01-01

Fanconi anemia (FA) is a rare autosomal recessive disease characterized by bone marrow failure, developmental defects and cancer. There are multiple FA genes that enable the repair of interstrand crosslinks (ICLs) in coordination with a variety of other DNA repair pathways in a way that is poorly understood. Here we present the phenotype of mouse embryonic stem (ES) cells mutated for FancB. We found FancB-mutant cells exhibited reduced cellular proliferation, hypersensitivity to the crosslink...

Radiation induced mutants in cassava (Manihot esculenta Crantz)

International Nuclear Information System (INIS)

Nayar, G.G.; Rajendran, P.G.

1987-01-01

Full text: Stem cuttings and true seeds of three promising cultivars of cassava were exposed respectively to 1 to 5 kR and 10 to 50 kR acute gamma rays from a 60 Co source. Treatments of stem cuttings beyond 5 kR and seeds beyond 50 kR were lethal. One mutant each in the cultivars M4, H-165 and H-2304 was obtained from the stem irradiated populations. Another mutant was found in the seed irradiated progeny of H-2304. The mutant of M4 is characterised by light green (chlorina) leaves. The mutant of H-165 shows significantly shorter petiole (22,5 against 35.2 cm) and narrow leaf lobes, while the H-2304 mutant shows speckled leaves, branching and early flowering. The mutant found in the seed irradiated progeny of H-2304 is having yellow tuber flesh indicating the presence of carotene. The mutants may be useful in studies related to basic information as well as in practical breeding. The chlorina mutant in M4 showed slow growth and high HCN content in leaves. Late branching may be a useful trait in the traditionally non-branching clones of cassava to maintain the desirable leaf area index during high leaf fall period. Early flowering could be useful in a recombinant breeding programme. The tuber yield of the short petiole mutant in H-165 increased by 20% - 25% through closer planting. The narrow leaf lobes of this mutant permit better light penetration to lower leaves. (author)

Mutation update of transcription factor genes FOXE3, HSF4, MAF, and PITX3 causing cataracts and other developmental ocular defects.

Science.gov (United States)

Anand, Deepti; Agrawal, Smriti A; Slavotinek, Anne; Lachke, Salil A

2018-04-01

Mutations in the transcription factor genes FOXE3, HSF4, MAF, and PITX3 cause congenital lens defects including cataracts that may be accompanied by defects in other components of the eye or in nonocular tissues. We comprehensively describe here all the variants in FOXE3, HSF4, MAF, and PITX3 genes linked to human developmental defects. A total of 52 variants for FOXE3, 18 variants for HSF4, 20 variants for MAF, and 19 variants for PITX3 identified so far in isolated cases or within families are documented. This effort reveals FOXE3, HSF4, MAF, and PITX3 to have 33, 16, 18, and 7 unique causal mutations, respectively. Loss-of-function mutant animals for these genes have served to model the pathobiology of the associated human defects, and we discuss the currently known molecular function of these genes, particularly with emphasis on their role in ocular development. Finally, we make the detailed FOXE3, HSF4, MAF, and PITX3 variant information available in the Leiden Online Variation Database (LOVD) platform at https://www.LOVD.nl/FOXE3, https://www.LOVD.nl/HSF4, https://www.LOVD.nl/MAF, and https://www.LOVD.nl/PITX3. Thus, this article informs on key variants in transcription factor genes linked to cataract, aphakia, corneal opacity, glaucoma, microcornea, microphthalmia, anterior segment mesenchymal dysgenesis, and Ayme-Gripp syndrome, and facilitates their access through Web-based databases. © 2018 Wiley Periodicals, Inc.

Constitutive expression of ftsZ overrides the whi developmental genes to initiate sporulation of Streptomyces coelicolor.

Science.gov (United States)

Willemse, Joost; Mommaas, A Mieke; van Wezel, Gilles P

2012-03-01

The filamentous soil bacteria Streptomyces undergo a highly complex developmental programme. Before streptomycetes commit themselves to sporulation, distinct morphological checkpoints are passed in the aerial hyphae that are subject to multi-level control by the whi sporulation genes. Here we show that whi-independent expression of FtsZ restores sporulation to the early sporulation mutants whiA, whiB, whiG, whiH, whiI and whiJ. Viability, stress resistance and high-resolution electron microscopy underlined that viable spores were formed. However, spores from sporulation-restored whiA and whiG mutants showed defects in DNA segregation/condensation, while spores from the complemented whiB mutant had increased stress sensitivity, perhaps as a result of changes in the spore sheath. In contrast to the whi mutants, normal sporulation of ssgB null mutants-which fail to properly localise FtsZ-could not be restored by enhancing FtsZ protein levels, forming spore-like bodies that lack spore walls. Our data strongly suggest that the whi genes control a decisive event towards sporulation of streptomycetes, namely the correct timing of developmental ftsZ transcription. The biological significance may be to ensure that sporulation-specific cell division will only start once sufficient aerial mycelium biomass has been generated. Our data shed new light on the longstanding question as to how whi genes control sporulation, which has intrigued scientists for four decades.

Submitochondrial distributions and stabilities of subunits 4, 5, and 6 of yeast cytochrome oxidase in assembly defective mutants.

Science.gov (United States)

Glerum, D M; Tzagoloff, A

1997-08-04

The concentration and submitochondrial distribution of the subunit polypeptides of cytochrome oxidase have been studied in wild type yeast and in different mutants impaired in assembly of this respiratory complex. All the subunit polypeptides of the enzyme are associated with mitochondrial membranes of wild type cells, except for a small fraction of subunits 4 and 6 that is recovered in the soluble protein fraction of mitochondria. Cytochrome oxidase mutants consistently display a severe reduction in the steady-state concentration of subunit 1 due to its increased turnover. As a consequence, most of subunit 4, which normally is associated with subunit 1, is found in the soluble fraction. A similar shift from membrane-bound to soluble subunit 6 is seen in mutants blocked in expression of subunit 5a. In contrast, null mutations in COX6 coding for subunit 6 promote loss of subunit 5a. The absence of subunit 5a in the cox6 mutant is the result of proteolytic degradation rather than regulation of its expression by subunit 6. The possible role of the ATP-dependent proteases Rca1p and Afg3p in proteolysis of subunits 1 and 5a has been assessed in strains with combined mutations in COX6, RCA1, and/or AFG3. Immunochemical assays indicate that another protease(s) must be responsible for most of the proteolytic loss of these proteins.

Substrate-induced stable enzyme-inhibitor complex formation allows tight binding of novel 2-aminopyrimidin-4(3H)-ones to drug-resistant HIV-1 reverse transcriptase mutants.

Science.gov (United States)

Samuele, Alberta; Facchini, Marcella; Rotili, Dante; Mai, Antonello; Artico, Marino; Armand-Ugón, Mercedes; Esté, José A; Maga, Giovanni

2008-09-01

We recently reported the synthesis and biological evaluation of a novel series of 5-alkyl-2-(N,N-disubstituted)amino-6-(2,6-difluorophenylalkyl)-3,4-dihydropyrimidin-4(3H)-ones (F(2)-N,N-DABOs). These compounds are highly active against both wild-type HIV-1 and the K103N, Y181C, and Y188L mutant strains. Herein we present novel 6-(2-chloro-6-fluorophenylalkyl)-N,N-DABO (2-Cl-6-F-N,N-DABO) derivatives and investigate the molecular basis for their high-affinity binding to HIV-1 reverse transcriptase (RT). Our results show that the new compounds display higher association rates than the difluoro derivatives toward wild-type HIV-1 RT or drug-resistant RT mutant forms. We also show that they preferentially associate to either the free enzyme or the enzyme-nucleic acid binary complex, and that this binding is stabilized upon formation of the ternary complex between HIV-1 RT and both the nucleic acid and nucleotide substrates. Interestingly, one compound showed dissociation rates from the ternary complex with RT mutants K103N and Y181I 10-20-fold slower than from the corresponding complex with wild-type RT.

Global transcriptional repression in C. elegans germline precursors by regulated sequestration of TAF-4.

Science.gov (United States)

Guven-Ozkan, Tugba; Nishi, Yuichi; Robertson, Scott M; Lin, Rueyling

2008-10-03

In C. elegans, four asymmetric divisions, beginning with the zygote (P0), generate transcriptionally repressed germline blastomeres (P1-P4) and somatic sisters that become transcriptionally active. The protein PIE-1 represses transcription in the later germline blastomeres but not in the earlier germline blastomeres P0 and P1. We show here that OMA-1 and OMA-2, previously shown to regulate oocyte maturation, repress transcription in P0 and P1 by binding to and sequestering in the cytoplasm TAF-4, a component critical for assembly of TFIID and the pol II preinitiation complex. OMA-1/2 binding to TAF-4 is developmentally regulated, requiring phosphorylation by the DYRK kinase MBK-2, which is activated at meiosis II after fertilization. OMA-1/2 are normally degraded after the first mitosis, but ectopic expression of wild-type OMA-1 is sufficient to repress transcription in both somatic and later germline blastomeres. We propose that phosphorylation by MBK-2 serves as a developmental switch, converting OMA-1/2 from oocyte to embryo regulators.

The Arabidopsis aba4-1 Mutant Reveals a Specific Function for Neoxanthin in Protection against Photooxidative Stress[W

Science.gov (United States)

Dall'Osto, Luca; Cazzaniga, Stefano; North, Helen; Marion-Poll, Annie; Bassi, Roberto

2007-01-01

The aba4-1 mutant completely lacks neoxanthin but retains all other xanthophyll species. The missing neoxanthin in light-harvesting complex (Lhc) proteins is compensated for by higher levels of violaxanthin, albeit with lower capacity for photoprotection compared with proteins with wild-type levels of neoxanthin. Detached leaves of aba4-1 were more sensitive to oxidative stress than the wild type when exposed to high light and incubated in a solution of photosensitizer agents. Both treatments caused more rapid pigment bleaching and lipid oxidation in aba4-1 than wild-type plants, suggesting that neoxanthin acts as an antioxidant within the photosystem II (PSII) supercomplex in thylakoids. While neoxanthin-depleted Lhc proteins and leaves had similar sensitivity as the wild type to hydrogen peroxide and singlet oxygen, they were more sensitive to superoxide anions. aba4-1 intact plants were not more sensitive than the wild type to high-light stress, indicating the existence of compensatory mechanisms of photoprotection involving the accumulation of zeaxanthin. However, the aba4-1 npq1 double mutant, lacking zeaxanthin and neoxanthin, underwent stronger PSII photoinhibition and more extensive oxidation of pigments than the npq1 mutant, which still contains neoxanthin. We conclude that neoxanthin preserves PSII from photoinactivation and protects membrane lipids from photooxidation by reactive oxygen species. Neoxanthin appears particularly active against superoxide anions produced by the Mehler's reaction, whose rate is known to be enhanced in abiotic stress conditions. PMID:17351115

Effects of mutant human Ki-rasG12C gene dosage on murine lung tumorigenesis and signaling to its downstream effectors

International Nuclear Information System (INIS)

Dance-Barnes, Stephanie T.; Kock, Nancy D.; Floyd, Heather S.; Moore, Joseph E.; Mosley, Libyadda J.; D'Agostino, Ralph B.; Pettenati, Mark J.; Miller, Mark Steven

2008-01-01

Studies in cell culture have suggested that the level of RAS expression can influence the transformation of cells and the signaling pathways stimulated by mutant RAS expression. However, the levels of RAS expression in vivo appear to be subject to feedback regulation, limiting the total amount of RAS protein that can be expressed. We utilized a bitransgenic mouse lung tumor model that expressed the human Ki-ras G12C allele in a tetracycline-inducible, lung-specific manner. Treatment for 12 months with 500 μg/ml of doxycycline (DOX) allowed for maximal expression of the human Ki-ras G12C allele in the lung, and resulted in the development of focal hyperplasia and adenomas. We determined if different levels of mutant RAS expression would influence the phenotype of the lung lesions. Treatment with 25, 100 and 500 μg/ml of DOX resulted in dose-dependent increases in transgene expression and tumor multiplicity. Microscopic analysis of the lungs of mice treated with the 25 μg/ml dose of DOX revealed infrequent foci of hyperplasia, whereas mice treated with the 100 and 500 μg/ml doses exhibited numerous hyperplastic foci and also adenomas. Immunohistochemical and RNA analysis of the downstream effector pathways demonstrated that different levels of mutant RAS transgene expression resulted in differences in the expression and/or phosphorylation of specific signaling molecules. Our results suggest that the molecular alterations driving tumorigenesis may differ at different levels of mutant Ki-ras G12C expression, and this should be taken into consideration when inducible transgene systems are utilized to promote tumorigenesis in mouse models

TAF-4 is required for the life extension of isp-1, clk-1 and tpk-1 Mit mutants.

Science.gov (United States)

Khan, Maruf H; Ligon, Melissa; Hussey, Lauren R; Hufnal, Bryce; Farber, Robert; Munkácsy, Erin; Rodriguez, Amanda; Dillow, Andy; Kahlig, Erynn; Rea, Shane L

2013-10-01

While numerous life-extending manipulations have been discovered in the nematode Caenorhabditis elegans, one that remains most enigmatic is disruption of oxidative phosphorylation. In order to unravel how such an ostensibly deleterious manipulation can extend lifespan, we sought to identify the ensemble of nuclear transcription factors that are activated in response to defective mitochondrial electron transport chain (ETC) function. Using a feeding RNAi approach, we targeted over 400 transcription factors and identified 15 that, when reduced in function, reproducibly and differentially altered the development, stress response, and/or fecundity of isp-1(qm150) Mit mutants relative to wild-type animals. Seven of these transcription factors--AHA-1, CEH-18, HIF-1, JUN-1, NHR-27, NHR-49 and the CREB homolog-1 (CRH-1)-interacting protein TAF-4--were also essential for isp-1 life extension. When we tested the involvement of these seven transcription factors in the life extension of two other Mit mutants, namely clk-1(qm30) and tpk-1(qm162), TAF-4 and HIF-1 were consistently required. Our findings suggest that the Mit phenotype is under the control of multiple transcriptional responses, and that TAF-4 and HIF-1 may be part of a general signaling axis that specifies Mit mutant life extension.

Mast cell deficiency attenuates acupuncture analgesia for mechanical pain using c-kit gene mutant rats

Directory of Open Access Journals (Sweden)

Cui X

2018-03-01

Full Text Available Xiang Cui,1,2,* Kun Liu,1,* Dandan Xu,1,3 Youyou Zhang,1,4 Xun He,1 Hao Liu,1,5 Xinyan Gao,1 Bing Zhu1 1Department of Physiology, Institute of Acupuncture and Moxibustion, China Academy of Chinese Medical Sciences, Beijing, China; 2College of Acupuncture and Orthopedics, Hubei University of Chinese Medicine, Wuhan, China; 3Classic TCM Department, The Affiliated Hospital of Shandong University of TCM, Jinan, China; 4Acupuncture and Massage Department, Hangzhou Qihuang Traditional Chinese Medicine Clinic, Hangzhou, China; 5TCM and Rehabilitation Department, The Third Hospital of Ulanchap, Ulanchap, China *These authors contributed equally to this work Background: Acupuncture therapy plays a pivotal role in pain relief, and increasing evidence demonstrates that mast cells (MCs may mediate acupuncture analgesia. The present study aims to investigate the role of MCs in acupuncture analgesia using c-kit gene mutant–induced MC-deficient rats. Materials and methods: WsRC-Ws/Ws rats and their wild-type (WT littermates (WsRC-+/+ were used. The number of MCs in skin of ST36 area was compared in two rats after immunofluorescence labeling. Mechanical withdrawal latency (MWL, mechanical withdrawal threshold (MWT, and thermal withdrawal latency (TWL were measured on bilateral plantar for pain threshold evaluation before and after each stimulus. Acupuncture- and moxibustion-like stimuli (43°C, 46°C heat, 1 mA electroacupuncture [EA], 3 mA EA, and manual acupuncture [MA] were applied randomly on different days. Results: Fewer MCs were observed in the skin of ST36 in mutant rats compared to WT rats (P<0.001. For pain thresholds, MWL and MWT were higher in WsRC-Ws/Ws compared to WsRC-+/+ on bilateral paws (P<0.05, but TWL was not different between the two rats (P>0.05. Bilateral MWL and MWT in WsRC-+/+ rats increased significantly after each stimulus compared to baseline (P<0.01, P<0.001. In WsRC-Ws/Ws rats, only noxious stimuli could produce antinociceptive

Exome analysis identified a novel mutation in the RBP4 gene in a consanguineous pedigree with retinal dystrophy and developmental abnormalities.

Directory of Open Access Journals (Sweden)

Catherine Cukras

Full Text Available Retinitis Pigmentosa (RP is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A in the gene encoding retinol binding protein 4 (RBP4. This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5(th decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism.

Exome analysis identified a novel mutation in the RBP4 gene in a consanguineous pedigree with retinal dystrophy and developmental abnormalities.

Science.gov (United States)

Cukras, Catherine; Gaasterland, Terry; Lee, Pauline; Gudiseva, Harini V; Chavali, Venkata R M; Pullakhandam, Raghu; Maranhao, Bruno; Edsall, Lee; Soares, Sandra; Reddy, G Bhanuprakash; Sieving, Paul A; Ayyagari, Radha

2012-01-01

Retinitis Pigmentosa (RP) is a common form of retinal degeneration characterized by photoreceptor degeneration and retinal pigment epithelium (RPE) atrophy causing loss of visual field and acuities. Exome sequencing identified a novel homozygous splice site variant (c.111+1G>A) in the gene encoding retinol binding protein 4 (RBP4). This change segregated with early onset, progressive, and severe autosomal recessive retinitis pigmentosa (arRP) in an eight member consanguineous pedigree of European ancestry. Additionally, one patient exhibited developmental abnormalities including patent ductus arteriosus and chorioretinal and iris colobomas. The second patient developed acne from young age and extending into the 5(th) decade. Both patients had undetectable levels of RBP4 in the serum suggesting that this mutation led to either mRNA or protein instability resulting in a null phenotype. In addition, the patients exhibited severe vitamin A deficiency, and diminished serum retinol levels. Circulating transthyretin levels were normal. This study identifies the RBP4 splice site change as the cause of RP in this pedigree. The presence of developmental abnormalities and severe acne in patients with retinal degeneration may indicate the involvement of genes that regulate vitamin A absorption, transport and metabolism.

Developmental wiring of specific neurons is regulated by RET-1/Nogo-A in Caenorhabditis elegans

DEFF Research Database (Denmark)

Torpe, Nanna; Nørgaard, Steffen; Høye, Anette M.

2017-01-01

Nogo-A is a membrane-bound protein that functions to inhibit neuronal migration, adhesion, and neurite outgrowth during development. In the mature nervous system, Nogo-A stabilizes neuronal wiring to inhibit neuronal plasticity and regeneration after injury. Here, we show that RET-1, the sole Nog...... present a previously unidentified function for RET-1 in the nervous system of C. elegans.......-A homolog in Caenorhabditis elegans, is required to control developmental wiring of a specific subset of neurons. In ret-1 deletion mutant animals, specific ventral nerve cord axons are misguided where they fail to respect the ventral midline boundary. We found that ret-1 is expressed in multiple neurons...

Cellulase production by two mutant strain of Trichoderma longibranchiatum QM 9414 and Rut C30

International Nuclear Information System (INIS)

Blanco, M. J.

1991-01-01

Native or pretreated biomass from Onopordum nervosum Boiss, has been examined as candidate feedstock for cellulase production by two mutant strain of Trichoderma Ionqibrachiatum QM9414 and Rut C30. Batch cultivation methods were evaluated and compared with previous experiments using ball-milled, crystalline cellulose (Solka floc). Batch cultivation of T. Ionqibrachiatum Rut C30 on 5% (w/v) acid pretreated O. nervosum biomass yielded enzyme productivities and activities comparable to those obtained on Solka floc. However, the overall enzyme production performance was lower than on Solka floc at comparable cellulose concentrations. This fact may be due to the accumulation of pretreated by products and lignin in the ferment. (Author) 40 refs

Both flagella and F4 fimbriae from F4ac+ enterotoxigenic Escherichia coli contribute to attachment to IPEC-J2 cells in vitro.

Science.gov (United States)

Zhou, Mingxu; Duan, Qiangde; Zhu, Xiaofang; Guo, Zhiyan; Li, Yinchau; Hardwidge, Philip R; Zhu, Guoqiang

2013-05-13

The role of flagella in the pathogenesis of F4ac+ Enterotoxigenic Escherichia coli (ETEC) mediated neonatal and post-weaning diarrhea (PWD) is not currently understood. We targeted the reference C83902 ETEC strain (O8:H19:F4ac+ LT+ STa+ STb+), to construct isogenic mutants in the fliC (encoding the major flagellin protein), motA (encoding the flagella motor), and faeG (encoding the major subunit of F4 fimbriae) genes. Both the ΔfliC and ΔfaeG mutants had a reduced ability to adhere to porcine intestinal epithelial IPEC-J2 cells. F4 fimbriae expression was significantly down-regulated after deleting fliC, which revealed that co-regulation exists between flagella and F4 fimbriae. However, there was no difference in adhesion between the ΔmotA mutant and its parent strain. These data demonstrate that both flagella and F4 fimbriae are required for efficient F4ac+ ETEC adhesion in vitro.

Analysis of AtCry1 and Mutants

Science.gov (United States)

Burdick, Derek; Purvis, Adam; Ahmad, Margaret; Link, Justin J.; Engle, Dorothy

Cryptochrome is an incredibly versatile protein that influences numerous biological processes such as plant growth, bird migration, and sleep cycles. Due to the versatility of this protein, understanding the mechanism would allow for advances in numerous fields such as crop growth, animal behavior, and sleep disorders. It is known that cryptochrome requires blue light to function, but the exact processes in the regulation of biological activity are still not fully understood. It is believed that the c-terminal domain of the protein undergoes a conformational change when exposed to blue light which allows for biological function. Three different non-functioning mutants were tested during this study to gain insight on the mechanism of cryptochrome. Absorbance spectra showed a difference between two of the mutants and the wild type with one mutant showing little difference. Immunoprecipitation experiments were also conducted to identify the different c-terminal responses of the mutants. By studying non functioning mutants of this protein, the mechanism of the protein can be further characterized. This two-month research experience in Paris allowed us to experience international and interdisciplinary collaborations in science and immerse in a different culture. The Borcer Fund for Student Research, Xavier University, Cincinnati, OH, and John Hauck Foundation.

Spectrum of induced floral mutants in Petunia

International Nuclear Information System (INIS)

Padmaja, V.; Sudhakar, P.

1987-01-01

A total of six floral mutants of garden Petunia isolated from the populations raised from the seed treatment with γ-rays, 2, 4-D and sodium azide are described. Five of the mutants viz. stellata, Campyloflora, Rubriflora mixed, Grandiflora and Albiflora mixed originated as segregants in M 2 generation while the chimeral floral phenotype was expressed in M 1 generation itself. Breeding behaviour of these horticulturally interesting altered floral phenotypes were studied in subsequent generations and appropriate conclusions were drawn regarding mode of inheritance of the mutant traits. 15 refs., 4 figures, 1 table. (author)

Effects of Light Intensity on Development and Chlorophyll Content in the Arabidopsis Mutant Plants with Defects in Photosynthesis

Directory of Open Access Journals (Sweden)

E.Yu. Garnik

2015-12-01

Full Text Available The developmental stages and adaptability to different light intensity (150 µmol*m-2*s-1 and 100 µmol*m-2*s-1 in Arabidopsis mutant lines with defects of photosynthetic apparatus were analyzed. Plant development in the mutant lines depended on the light intensity to varying degrees. Lines ch1-1 (lack of the chlorophyllide a oxygenase and rtn16 (decreased chlorophyll a and b amounts were the most susceptible to the light decrease. No one of the investigated lines demonstrated chlorophyll a/b rate alteration under the different light conditions. The depleted chlorophyll content has had the major effect on the mutant plants development under the different light conditions. The different chlorophyll a/b rate correlated with the different adaptability of mutant plants to low light.

Synthesis and biological properties of novel 2-aminopyrimidin-4(3H)-ones highly potent against HIV-1 mutant strains.

Science.gov (United States)

Mai, Antonello; Artico, Marino; Rotili, Dante; Tarantino, Domenico; Clotet-Codina, Imma; Armand-Ugón, Mercedes; Ragno, Rino; Simeoni, Silvia; Sbardella, Gianluca; Nawrozkij, Maxim B; Samuele, Alberta; Maga, Giovanni; Esté, José A

2007-11-01

Following the disclosure of dihydro-alkoxy-, dihydro-alkylthio-, and dihydro-alkylamino-benzyl-oxopyrimidines (DABOs, S-DABOs, and NH-DABOs) as potent and selective anti-HIV-1 agents belonging to the non-nucleoside reverse transcriptase inhibitor (NNRTI) class, we report here the synthesis and biological evaluation of a novel series of DABOs bearing a N,N-disubstituted amino group or a cyclic amine at the pyrimidine-C2 position, a hydrogen atom or a small alkyl group at C5 and/or at the benzylic position, and the favorable 2,6-difluorobenzyl moiety at the C6 position (F2-N,N-DABOs). The new compounds were highly active up to the subnanomolar level against both wt HIV-1 and the Y181C mutant and at the submicromolar to nanomolar range against the K103N and Y188L mutant strains. Such derivatives were more potent than S-DABOs, NH-DABOs, and nevirapine and efavirenz were chosen as reference drugs. The higher inhibitor adaptability to the HIV-1 RT non-nucleoside binding site (NNBS) may account for the higher inhibitory effect exerted by the new molecules against the mutated RTs.

Mutant power: using mutant allele collections for yeast functional genomics.

Science.gov (United States)

Norman, Kaitlyn L; Kumar, Anuj

2016-03-01

The budding yeast has long served as a model eukaryote for the functional genomic analysis of highly conserved signaling pathways, cellular processes and mechanisms underlying human disease. The collection of reagents available for genomics in yeast is extensive, encompassing a growing diversity of mutant collections beyond gene deletion sets in the standard wild-type S288C genetic background. We review here three main types of mutant allele collections: transposon mutagen collections, essential gene collections and overexpression libraries. Each collection provides unique and identifiable alleles that can be utilized in genome-wide, high-throughput studies. These genomic reagents are particularly informative in identifying synthetic phenotypes and functions associated with essential genes, including those modeled most effectively in complex genetic backgrounds. Several examples of genomic studies in filamentous/pseudohyphal backgrounds are provided here to illustrate this point. Additionally, the limitations of each approach are examined. Collectively, these mutant allele collections in Saccharomyces cerevisiae and the related pathogenic yeast Candida albicans promise insights toward an advanced understanding of eukaryotic molecular and cellular biology. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Utilization of 14C-tyrosine in brain and peripheral tissues of developmentally protein malnourished rats

International Nuclear Information System (INIS)

Miller, M.; Leahy, J.P.; McConville, F.; Morgane, P.J.; Resnick, O.

1978-01-01

Prior studies of developmentally protein malnourished rats have reported substantial changes in brain and peripheral utilization of 14 C-leucine, 14 C-phenylalanine, and 14 C-tryptophan. In the present study rats born to dams fed a low protein diet (8% casein) compared to the offspring of control rats fed a normal diet (25% casein) showed few significant differences in the uptake and incorporation of 14 C-tyrosine into brain and peripheral tissues from birth to age 21 days. At birth, the 8% casein pups exhibited significant decreases in brain and peripheral tissue incorporation of tracer only at short post-injection times (10 and 20 min), but not at longer intervals (90 and 180 min). During ontogenetic development (Days 5-21), the 8% casein rats showed significant increases in uptake of 14 C-tyrosine into the brain and peripheral tissues on Day 11 and a significantly higher percent incorporation of tracer into brain protein on Day 21 as compared to the 25% casein rats. For the most part, there were no significant changes in incorporation of radioactivity in peripheral tissues for the 2 diet groups on these post-birth days. Overall, the data indicates that developmental protein malnutrition causes relatively fewer changes in brain and peripheral utilization of the semi-essential amino acid tyrosine than those observed in previous studies with essential amino acids

Genetical, cytological and physiological studies on the induced mutants with special regard to effective methods for obtaining useful mutants in perennial woody plant

International Nuclear Information System (INIS)

Kukimura, H.; Ikeda, F.; Fujita, H.; Maeta, T.; Nakajima, K.; Katagiri, K.; Nakahira, K.; Somegou, M.

1976-01-01

The plants studied included apple trees, cryptomeria (japanese cedar) and mulberry. In apple, dwarf and compact types of mutants from cv. Fuji were found to be graft incompatible on Maruba-kaido(Malus prunifolia) rootstock. In Sunki mandarin(Citrus sunki), the number of nucellar embryo per seed was affected by gamma-irradiation, and morphological mutants from nucellar seedlings were obtained at high rate by irradiation at floral bud stage with 2kR exposure. In Cryptomeria, re-irradiated waxless mutants by gamma-rays showed very high rate of somatic mutation when compared to other morphological mutants. Pollen sterility and pollen shaped PMC were found in the most of gamma-induced-mutants. Mutants forming pollen shaped PMC had a genetical tendency of continuous male flower bud formation for a longer term. With mulberry, time of sprouting of induced mutants differed from the originals. Ability of root initiation of semi-softwood cuttings in morphological mutants were tested. Cytochimera induction were found at considerably high rate when actively growing diploid plants were irradiated by gamma-rays. Eight kinds of cytochimeras were induced. Frequency of 2-4-4 was extremely high(approx. 50%), then 4-2-2 and 2-4-2 chimeras followed. Seven kinds were induced by semi-acute irradiation(200R/h), while 4 kinds by acute irradiation(5kR/h). By breeding test it was cleared that the elongate and entire leaf was sexually transmissible, whereas the 'dwarf' was not obvious and the 'marginally curledleaf' was not transmissible. Pyronin-methylgreen staining method proved to be useful in some morphological mutants to distinguish the histo-genetical differences which exist in the shoot apex.

Sharing mutants and experimental information prepublication using FgMutantDb (https://scabusa.org/FgMutantDb).

Science.gov (United States)

Baldwin, Thomas T; Basenko, Evelina; Harb, Omar; Brown, Neil A; Urban, Martin; Hammond-Kosack, Kim E; Bregitzer, Phil P

2018-06-01

There is no comprehensive storage for generated mutants of Fusarium graminearum or data associated with these mutants. Instead, researchers relied on several independent and non-integrated databases. FgMutantDb was designed as a simple spreadsheet that is accessible globally on the web that will function as a centralized source of information on F. graminearum mutants. FgMutantDb aids in the maintenance and sharing of mutants within a research community. It will serve also as a platform for disseminating prepublication results as well as negative results that often go unreported. Additionally, the highly curated information on mutants in FgMutantDb will be shared with other databases (FungiDB, Ensembl, PhytoPath, and PHI-base) through updating reports. Here we describe the creation and potential usefulness of FgMutantDb to the F. graminearum research community, and provide a tutorial on its use. This type of database could be easily emulated for other fungal species. Published by Elsevier Inc.

UDP-N-Acetylmuramic Acid l-Alanine Ligase (MurC) Inhibition in a tolC Mutant Escherichia coli Strain Leads to Cell Death

OpenAIRE

Humnabadkar, Vaishali; Prabhakar, K. R.; Narayan, Ashwini; Sharma, Sreevalli; Guptha, Supreeth; Manjrekar, Praveena; Chinnapattu, Murugan; Ramachandran, Vasanthi; Hameed, Shahul P.; Ravishankar, Sudha; Chatterji, Monalisa

2014-01-01

The Mur ligases play an essential role in the biosynthesis of bacterial peptidoglycan and hence are attractive antibacterial targets. A screen of the AstraZeneca compound library led to the identification of compound A, a pyrazolopyrimidine, as a potent inhibitor of Escherichia coli and Pseudomonas aeruginosa MurC. However, cellular activity against E. coli or P. aeruginosa was not observed. Compound A was active against efflux pump mutants of both strains. Experiments using an E. coli tol...

Vitamin C, added after irradiation, reduces the mutant yield and alters the spectrum of CD59- mutations in AL cells irradiated with high LET carbon ions

International Nuclear Information System (INIS)

Ueno, A.M.; Vannais, D.B.; Lenarczyk, M.; Waldren, C.A.

2003-01-01

Miazaki, Watanabe, Kumagai and their colleagues reported that induction of HPRT - mutants by X-rays in cultured human cells was prevented by vitamin C (ascorbate) added 30 minutes after irradiation. They provided data that mutation extinction was due to neutralization by vitamin C of radiation-induced long-lived mutagenic radicals (LLR) with half-lives of several hours. We find that post-irradiation treatment with vitamin C reduces, but does not eliminate, the induction of CD59 - mutants in human-hamster hybrid A L cells exposed to high-LET carbon ions (LET of 100 keV/μm). The lethality of the carbon ions was not altered by vitamin C. Preliminary experiments indicate that post-radiation addition of vitamin C also changes the quality of CD59 - mutations induced by the carbon beam. The change in spectrum is seen as a reduction in prevalence of small mutations (not detectable by PCR) and of mutants displaying transmissible genomic instability (TGI) measured by chromosome translocation frequencies. Our results confirm the essential effect of vitamin C on X-ray induced mutation and suggest a role for LLR in genomic instability. (author)

Genetic Analysis and Mapping of TWH Gene in Rice Twisted Hull Mutant

Directory of Open Access Journals (Sweden)

Jin-bo LI

2009-03-01

Full Text Available A mutant with twisted hulls was found in a breeding population of rice (Oryza sativa L.. The mutant shows less grain weight and inferior grain quality in addition to twisted hulls. Genetic analysis indicated that the phenotype of mutant was controlled by a single recessive gene (temporarily designated as TWH. To map the TWH gene, an F2 population was generated by crossing the twh mutant to R725, an indica rice variety with normal hulls. For bulked segregant analysis, the bulk of mutant plants was prepared by mixing equal amount of plant tissue from 10 twisted-hull plants and the bulk of normal plants was obtained by pooling equal amount tissue of 10 normal-hull plants. Two hundred and seven pairs of simple sequence repeat (SSR primers, which are distributed on 12 rice chromosomes, were used for polymorphism analysis of the parents and the two bulks. The TWH locus was initially mapped close to the SSR marker RM526 on chromosome 2. Therefore, further mapping was performed using 50 pairs of SSR primers around the marker RM526. The TWH was delimited between the SSR markers RM14128 and RM208 on the long arm of chromosome 2 at the genetic distances of 1.4 cM and 2.7 cM, respectively. These results provide the foundation for further fine mapping, cloning and functional analysis of the TWH gene.

Studies on reduced height mutants in rice

International Nuclear Information System (INIS)

Narahari, P.; Bhagwat, S.G.

1984-01-01

Two cross-bred derivatives of the mutant TR5xTR17 and TR21 continued to show promise and were advanced to wider scale testing. TR5 was found to carry a semi-dwarfing gene different from that in IR8. New semi-dwarf mutants were screened from M 2 through M 4 from two separate radiation experiments. The gibberellin response of seedlings of mutant and tester strains was evaluated and crosses of tester stocks and mutant semi-dwarfs were made for genetic analyses. (author)

Decreased catalytic activity and altered activation properties of PDE6C mutants associated with autosomal recessive achromatopsia

DEFF Research Database (Denmark)

Grau, Tanja; Artemyev, Nikolai O; Rosenberg, Thomas

2011-01-01

study on PDE6C mutations including the mutation spectrum, its prevalence in a large cohort of ACHM/cone dysfunction patients, the clinical phenotype and the functional characterization of mutant PDE6C proteins. Twelve affected patients from seven independent families segregating PDE6C mutations were......Mutations in the gene encoding the catalytic subunit of the cone photoreceptor phosphodiesterase (PDE6C) have been recently reported in patients with autosomal recessive inherited achromatopsia (ACHM) and early-onset cone photoreceptor dysfunction. Here we present the results of a comprehensive...... identified in our total patient cohort of 492 independent families. Eleven different PDE6C mutations were found including two nonsense mutations, three mutations affecting transcript splicing as shown by minigene assays, one 1 bp-insertion and five missense mutations. We also performed a detailed functional...

The Transcription Factor ABI4 Is Required for the Ascorbic Acid–Dependent Regulation of Growth and Regulation of Jasmonate-Dependent Defense Signaling Pathways in Arabidopsis[C][W

Science.gov (United States)

Kerchev, Pavel I.; Pellny, Till K.; Vivancos, Pedro Diaz; Kiddle, Guy; Hedden, Peter; Driscoll, Simon; Vanacker, Hélène; Verrier, Paul; Hancock, Robert D.; Foyer, Christine H.

2011-01-01

Cellular redox homeostasis is a hub for signal integration. Interactions between redox metabolism and the ABSCISIC ACID-INSENSITIVE-4 (ABI4) transcription factor were characterized in the Arabidopsis thaliana vitamin c defective1 (vtc1) and vtc2 mutants, which are defective in ascorbic acid synthesis and show a slow growth phenotype together with enhanced abscisic acid (ABA) levels relative to the wild type (Columbia-0). The 75% decrease in the leaf ascorbate pool in the vtc2 mutants was not sufficient to adversely affect GA metabolism. The transcriptome signatures of the abi4, vtc1, and vtc2 mutants showed significant overlap, with a large number of transcription factors or signaling components similarly repressed or induced. Moreover, lincomycin-dependent changes in LIGHT HARVESTING CHLOROPHYLL A/B BINDING PROTEIN 1.1 expression were comparable in these mutants, suggesting overlapping participation in chloroplast to nucleus signaling. The slow growth phenotype of vtc2 was absent in the abi4 vtc2 double mutant, as was the sugar-insensitive phenotype of the abi4 mutant. Octadecanoid derivative-responsive AP2/ERF-domain transcription factor 47 (ORA47) and AP3 (an ABI5 binding factor) transcripts were enhanced in vtc2 but repressed in abi4 vtc2, suggesting that ABI4 and ascorbate modulate growth and defense gene expression through jasmonate signaling. We conclude that low ascorbate triggers ABA- and jasmonate-dependent signaling pathways that together regulate growth through ABI4. Moreover, cellular redox homeostasis exerts a strong influence on sugar-dependent growth regulation. PMID:21926335

Nanoformulated cell-penetrating survivin mutant and its dual actions

Directory of Open Access Journals (Sweden)

Sriramoju B

2014-07-01

Full Text Available Bhasker Sriramoju, Rupinder K Kanwar, Jagat R Kanwar Nanomedicine Laboratory of Immunology and Molecular Biomedical Research (NLIMBR, School of Medicine, Faculty of Health, Deakin University, Geelong, Australia Abstract: In this study, we investigated the differential actions of a dominant-negative survivin mutant (SurR9-C84A against cancerous SK-N-SH neuroblastoma cell lines and differentiated SK-N-SH neurons. In both the cases, the mutant protein displayed dual actions, where its effects were cytotoxic toward cancerous cells and proliferative toward the differentiated neurons. This can be explained by the fact that tumorous (undifferentiated SK-N-SH cells have a high endogenous survivin pool and upon treatment with mutant SuR9-C84A causes forceful survivin expression. These events significantly lowered the microtubule dynamics and stability, eventually leading to apoptosis. In the case of differentiated SK-N-SH neurons that express negligible levels of wild-type survivin, the mutant indistinguishably behaved in a wild-type fashion. It also favored cell-cycle progression, forming the chromosome-passenger complex, and stabilized the microtubule-organizing center. Therefore, mutant SurR9-C84A represents a novel therapeutic with its dual actions (cytotoxic toward tumor cells and protective and proliferative toward neuronal cells, and hence finds potential applications against a variety of neurological disorders. In this study, we also developed a novel poly(lactic-co-glycolic acid nanoparticulate formulation to surmount the hurdles associated with the delivery of SurR9-C84A, thus enhancing its effective therapeutic outcome. Keywords: survivin mutant, neurological disorders, protein therapeutics, inhibitor of apoptosis protein family, poly(lactic-co-glycolic acid

Design of an ectoine-responsive AraC mutant and its application in metabolic engineering of ectoine biosynthesis.

Science.gov (United States)

Chen, Wei; Zhang, Shan; Jiang, Peixia; Yao, Jun; He, Yongzhi; Chen, Lincai; Gui, Xiwu; Dong, Zhiyang; Tang, Shuang-Yan

2015-07-01

Advanced high-throughput screening methods for small molecules may have important applications in the metabolic engineering of the biosynthetic pathways of these molecules. Ectoine is an excellent osmoprotectant that has been widely used in cosmetics. In this study, the Escherichia coli regulatory protein AraC was engineered to recognize ectoine as its non-natural effector and to activate transcription upon ectoine binding. As an endogenous reporter of ectoine, the mutated AraC protein was successfully incorporated into high-throughput screening of ectoine hyper-producing strains. The ectoine biosynthetic cluster from Halomonas elongata was cloned into E. coli. By engineering the rate-limiting enzyme L-2,4-diaminobutyric acid (DABA) aminotransferase (EctB), ectoine production and the specific activity of the EctB mutant were increased. Thus, these results demonstrated the effectiveness of engineering regulatory proteins into sensitive and rapid screening tools for small molecules and highlighted the importance and efficacy of directed evolution strategies applied to the engineering of genetic components for yield improvement in the biosynthesis of small molecules. Copyright © 2015 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

Study on ionizing radiosensitivity of respiratory deficiency yeast mutants

International Nuclear Information System (INIS)

Mao Shuhong; Chinese Academy of Sciences, Beijing; Jin Genming; Wei Zengquan; Xie Hongmei

2006-01-01

The radiosensitivity of respiratory deficiency yeast mutants has been studied in this work. The mutants which were screened from the yeasts after ionizing irradiation were irradiated with 12 C 6+ at different doses. Because of the great change in its mitochondria and mitochondrial DNA, the respiratory deficiency yeast mutants show radio-sensitivity at dose less than 1 Gy and radioresistance at doses higher than 1 Gy. (authors)

Nonbehavioral Selection for Pawns, Mutants of PARAMECIUM AURELIA with Decreased Excitability

Science.gov (United States)

Schein, Stanley J.

1976-01-01

The reversal response in Paramecium aurelia is mediated by calcium which carries the inward current during excitation. Electrophysiological studies indicate that strontium and barium can also carry the inward current. Exposure to high concentrations of barium rapidly paralyzes and later kills wild-type paramecia. Following mutagenesis with nitrosoguanidine, seven mutants which continued to swim in the `high-barium' solution were selected. All of the mutants show decreased reversal behavior, with phenotypes ranging from extremely non-reversing (`extreme' pawns) to nearly wild-type reversal behavior (`partial' pawns). The mutations fall into three complementation groups, identical to the pwA, pwB, and pwC genes of Kung et al. (1975). All of the pwA and pwB mutants withstand longer exposure to barium, the pwB mutants surviving longer than the pwA mutants. Among mutants of each gene, survival is correlated with loss of reversal behavior. Double mutants (A–B, A–C, B–C), identified in the exautogamous progeny of crosses between `partial' mutants, exhibited a more extreme non-reversing phenotype than either of their single-mutant (`partial' pawn) parents.———Inability to reverse could be expected from an alteration in the calcium-activated reversal mechanism or in excitation. A normal calcium-activated structure was demonstrated in all pawns by chlorpromazine treatment. In a separate report (Schein, Bennett and Katz 1976) the results of electrophysiological investigations directly demonstrate decreased excitability in all of the mutants, a decrease due to an altered calcium activation. The studies of the genetics, the survival in barium and the electro-physiology of the pawns demonstrate that the pwA and pwB genes have different effects on calcium activation. PMID:1001878

De novo Transcriptome Assembly and Comparison of C3, C3-C4, and C4 Species of Tribe Salsoleae (Chenopodiaceae

Directory of Open Access Journals (Sweden)

Maximilian Lauterbach

2017-11-01

Full Text Available C4 photosynthesis is a carbon-concentrating mechanism that evolved independently more than 60 times in a wide range of angiosperm lineages. Among other alterations, the evolution of C4 from ancestral C3 photosynthesis requires changes in the expression of a vast number of genes. Differential gene expression analyses between closely related C3 and C4 species have significantly increased our understanding of C4 functioning and evolution. In Chenopodiaceae, a family that is rich in C4 origins and photosynthetic types, the anatomy, physiology and phylogeny of C4, C2, and C3 species of Salsoleae has been studied in great detail, which facilitated the choice of six samples of five representative species with different photosynthetic types for transcriptome comparisons. mRNA from assimilating organs of each species was sequenced in triplicates, and sequence reads were de novo assembled. These novel genetic resources were then analyzed to provide a better understanding of differential gene expression between C3, C2 and C4 species. All three analyzed C4 species belong to the NADP-ME type as most genes encoding core enzymes of this C4 cycle are highly expressed. The abundance of photorespiratory transcripts is decreased compared to the C3 and C2 species. Like in other C4 lineages of Caryophyllales, our results suggest that PEPC1 is the C4-specific isoform in Salsoleae. Two recently identified transporters from the PHT4 protein family may not only be related to the C4 syndrome, but also active in C2 photosynthesis in Salsoleae. In the two populations of the C2 species S. divaricata transcript abundance of several C4 genes are slightly increased, however, a C4 cycle is not detectable in the carbon isotope values. Most of the core enzymes of photorespiration are highly increased in the C2 species compared to both C3 and C4 species, confirming a successful establishment of the C2 photosynthetic pathway. Furthermore, a function of PEP-CK in C2 photosynthesis

A mutant screening method by critical annealing temperature-PCR for site-directed mutagenesis.

Science.gov (United States)

Liu, Ying; Wu, Ting; Song, Jian; Chen, Xuelian; Zhang, Yu; Wan, Yu

2013-03-11

Distinguishing desired mutants from parental templates and undesired mutants is a problem not well solved in Quikchange™ mutagenesis. Although Dpn I digestion can eliminate methylated parental (WT) DNA, the efficiency is not satisfying due to the existence of hemi-methylated DNA in the PCR products, which is resistant to Dpn I. The present study designed a novel critical annealing temperature (T(c))-PCR to replace Dpn I digestion for more perfect mutant distinguishing, in which part-overlapping primers containing mutation(s) were used to reduce initial concentration of template DNA in mutagenic PCR. A T(c)-PCR with the same mutagenic primers was performed without Dpn I digestion. The T(c) for each pair of the primers was identified by gradient PCR. The relationship between PCR-identified T(c) and T(m) of the primers was analyzed and modeled with correlation and regression. Gradient PCR identified a T(c) for each of 14 tested mutagenic primers, which could discriminate mismatched parental molecules and undesired mutants from desired mutants. The PCR-identified T(c) was correlated to the primer's T(m) (r = 0.804, P<0.0001). Thus, in practical applications, the T(c) can be easily calculated with a regression equation, T(c)= 48.81 + 0.253*T(m). The new protocol introduced a novel T(c)-PCR method for mutant screening which can more efficiently and accurately select against parental molecules and undesired mutations in mutagenic sequence segments.

Activity of second-generation ALK inhibitors against crizotinib-resistant mutants in an NPM-ALK model compared to EML4-ALK

International Nuclear Information System (INIS)

Fontana, Diletta; Ceccon, Monica; Gambacorti-Passerini, Carlo; Mologni, Luca

2015-01-01

Anaplastic lymphoma kinase (ALK) is a tyrosine kinase receptor involved in both solid and hematological tumors. About 80% of ALK-positive anaplastic large-cell lymphoma (ALCL) cases are characterized by the t(2;5)(p23;q35) translocation, encoding for the aberrant fusion protein nucleophosmin (NPM)-ALK, whereas 5% of non-small-cell lung cancer (NSCLC) patients carry the inv(2)(p21;p23) rearrangement, encoding for the echinoderm microtubule-associated protein-like 4 (EML4)-ALK fusion. The ALK/c-MET/ROS inhibitor crizotinib successfully improved the treatment of ALK-driven diseases. However, several cases of resistance appeared in NSCLC patients, and ALK amino acid substitutions were identified as a leading cause of resistance to crizotinib. Second-generation ALK inhibitors have been developed in order to overcome crizotinib resistance. In this work, we profiled in vitro the activity of crizotinib, AP26113, ASP3026, alectinib, and ceritinib against six mutated forms of ALK associated with clinical resistance to crizotinib (C1156Y, L1196M, L1152R, G1202R, G1269A, and S1206Y) and provide a classification of mutants according to their level of sensitivity/resistance to the drugs. Since the biological activity of ALK mutations extends beyond the specific type of fusion, both NPM-ALK- and EML4-ALK-positive cellular models were used. Our data revealed that most mutants may be targeted by using different inhibitors. One relevant exception is represented by the G1202R substitution, which was highly resistant to all drugs (>10-fold increased IC 50 compared to wild type) and may represent the most challenging mutation to overcome. These results provide a prediction of cross-resistance of known crizotinib-resistant mutations against all second-generation tyrosine kinase inhibitors (TKIs) clinically available, and therefore could be a useful tool to help clinicians in the management of crizotinib-resistance cases

Directed mutagenesis in Candida albicans: one-step gene disruption to isolate ura3 mutants

International Nuclear Information System (INIS)

Kelly, R.; Miller, S.M.; Kurtz, M.B.; Kirsch, D.R.

1987-01-01

A method for introducing specific mutations into the diploid Candida albicans by one-step gene disruption and subsequent UV-induced recombination was developed. The cloned C. albicans URA3 gene was disrupted with the C. albicans ADE2 gene, and the linearized DNA was used for transformation of two ade2 mutants, SGY-129 and A81-Pu. Both an insertional inactivation of the URA3 gene and a disruption which results in a 4.0-kilobase deletion were made. Southern hybridization analyses demonstrated that the URA3 gene was disrupted on one of the chromosomal homologs in 15 of the 18 transformants analyzed. These analyses also revealed restriction site dimorphism of EcoRI at the URA3 locus which provides a unique marker to distinguish between chromosomal homologs. This enabled us to show that either homolog could be disrupted and that disrupted transformants of SGY-129 contained more than two copies of the URA3 locus. The A81-Pu transformants heterozygous for the ura3 mutations were rendered homozygous and Ura- by UV-induced recombination. The homozygosity of a deletion mutant and an insertion mutant was confirmed by Southern hybridization. Both mutants were transformed to Ura+ with plasmids containing the URA3 gene and in addition, were resistant to 5-fluoro-orotic acid, a characteristic of Saccharomyces cerevisiae ura3 mutants as well as of orotidine-5'-phosphate decarboxylase mutants of other organisms

X-ray-induced mutants resistant to 8-azaguanine

International Nuclear Information System (INIS)

Carver, J.H.; Dewey, W.C.; Hopwood, L.E.

1976-01-01

Asynchronous Chinese hamster ovary cells were irradiated and colony survival in Alpha MEM medium with dialyzed serum was determined with or without 15 μg/ml 8-Azaguanine (AG). Data indicated that a reproducible assay for the system was dependent upon controlling cell density at least two days prior to induction as well as throughout the expression period. Generally, spontaneous and radiation-induced mutant frequencies decreased when cell densities exceeded a critical density of 3-6 x 10 4 cells/cm 2 . Infrequently, the critical density was exceeded by a factor of two with no observed decrease, possibly correlated with a longer cell doubling time. Drug depletion artifacts can occur because of drug degradation, or because wild-type cells utilize the drug or produce conditions which reduce uptake of the drug. Thus, as the effective drug concentration is lowered, the observed mutant frequency increases because a spectrum of mutants resistant to only low concentrations can now survive. In fact, refeeding with AG at intervals during the incubation period lowered spontaneous and radiation-induced frequencies approx. 5-fold. Therefore, to standardize conditions, cells were trypsinized at the end of the expression time and replated at a constant cell number for mutant selection by AG. Over two generations of growth during the expression period were required for optimal manifestation of induced mutants, and when densities were kept below 4 x 10 4 cells/cm 2 at all times, observed mutant frequencies did not change significantly over a period between 80 and 140 h post-induction (over 4 generations for irradiated cells and over 6 generations for controls). Previous reports of observed mutant frequencies decreasing beyond three generations may be due to cell interaction prior to mutant selection

Site-directed mutagenesis of HIV-1 vpu gene demonstrates two clusters of replication-defective mutants with distinct ability to down-modulate cell surface CD4 and tetherin

Directory of Open Access Journals (Sweden)

Masako Nomaguchi

2010-11-01

Full Text Available HIV-1 Vpu acts positively on viral infectivity by mediating CD4 degradation in endoplasmic reticulum and enhances virion release by counteracting a virion release restriction factor, tetherin. In order to define the impact of Vpu activity on HIV-1 replication, we have generated a series of site-specific proviral vpu mutants. Of fifteen mutants examined, seven exhibited a replication-defect similar to that of a vpu-deletion mutant in a lymphocyte cell line H9. These mutations clustered in narrow regions within transmembrane domain (TMD and cytoplasmic domain (CTD. Replication-defective mutants displayed the reduced ability to enhance virion release from a monolayer cell line HEp2 without exception. Upon transfection with Vpu expression vectors, neither TMD mutants nor CTD mutants blocked CD4 expression at the cell surface in another monolayer cell line MAGI. While TMD mutants were unable to down-modulate cell surface tetherin in HEp2 cells, CTD mutants did quite efficiently. Confocal microscopy analysis revealed the difference of intracellular localization between TMD and CTD mutants. In total, replication capability of HIV-1 carrying vpu mutations correlates well with the ability of Vpu to enhance virion release and to impede the cell surface expression of CD4 but not with the ability to down-modulate cell surface tetherin. Our results here suggest that efficient viral replication requires not only down-regulation of cell surface tetherin but also its degradation.

Cloning, sequencing, disruption and phenotypic analysis of uvsC, an Aspergillus nidulans homologue of yeast RAD51.

Science.gov (United States)

van Heemst, D; Swart, K; Holub, E F; van Dijk, R; Offenberg, H H; Goosen, T; van den Broek, H W; Heyting, C

1997-05-01

We have cloned the uvsC gene of Aspergillus nidulans by complementation of the A. nidulans uvsC114 mutant. The predicted protein UVSC shows 67.4% sequence identity to the Saccharomyces cerevisiae Rad51 protein and 27.4% sequence identity to the Escherichia coli RecA protein. Transcription of uvsC is induced by methyl-methane sulphonate (MMS), as is transcription of RAD51 of yeast. Similar levels of uvsC transcription were observed after MMS induction in a uvsC+ strain and the uvsC114 mutant. The coding sequence of the uvsC114 allele has a deletion of 6 bp, which results in deletion of two amino acids and replacement of one amino acid in the translation product. In order to gain more insight into the biological function of the uvsC gene, a uvsC null mutant was constructed, in which the entire uvsC coding sequence was replaced by a selectable marker gene. Meiotic and mitotic phenotypes of a uvsC+ strain, the uvsC114 mutant and the uvsC null mutant were compared. The uvsC null mutant was more sensitive to both UV and MMS than the uvsC114 mutant. The uvsC114 mutant arrested in meiotic prophase-I. The uvsC null mutant arrested at an earlier stage, before the onset of meiosis. One possible interpretation of these meiotic phenotypes is that the A. nidulans homologue of Rad51 of yeast has a role both in the specialized processes preceding meiosis and in meiotic prophase I.

Unusual Δ7,12,19 C35:3 Alkenone Produced by the Mutant Emiliania huxleyi strain CCMP2758 in Culture

Science.gov (United States)

Zheng, Y.; Huang, Y.; Zhang, Y.; Dillon, J. T.

2015-12-01

Alkenones with chain length ranging from C37 to C40 are highly specific biomarkers for certain haptophyte algae in ocean and lake sediments and have been widely used for paleoclimate studies. Short chain alkenones (e.g., C35 and C36) have been found in environmental and culture samples but the origin and structures of these compounds are not fully understood. The benchmark marine alkenone producer, Emiliania huxleyi CCMP2758 strain (the mutant of strain CCMP1742, NEPCC55a) was reported to make 35:2 alkenone when cultured at 15 °C (Prahl et al., 2006). Here we show, when this strain is cultured at lower temperatures (e.g., 4°C), CCMP2758 produces large amount of 35:3 alkenone with unusual double bond positions of Δ7,12,19. We determined the double bond positions of the C35:3 methyl ketonee based on GC-MS analysis of cyclobutylimine derivatives and dimethyl disulfide derivatives respectively, and provide the first temperature calibrations based on the unsaturation ratios of C35 alkenones. Previous studies have found 35:2 alkenone with three methylene interruption in the Black Sea sediment, but it is the first time that an alkenone with a mixed three and five methylene interruption is found. The discovery of short chain alkenones with unusual double bond positions may shed new light to alkenone biosynthesis.

CFP1 Regulates Histone H3K4 Trimethylation and Developmental Potential in Mouse Oocytes

Directory of Open Access Journals (Sweden)

Chao Yu

2017-08-01

Full Text Available Trimethylation of histone H3 at lysine-4 (H3K4me3 is associated with eukaryotic gene promoters and poises their transcriptional activation during development. To examine the in vivo function of H3K4me3 in the absence of DNA replication, we deleted CXXC finger protein 1 (CFP1, the DNA-binding subunit of the SETD1 histone H3K4 methyltransferase, in developing oocytes. We find that CFP1 is required for H3K4me3 accumulation and the deposition of histone variants onto chromatin during oocyte maturation. Decreased H3K4me3 in oocytes caused global downregulation of transcription activity. Oocytes lacking CFP1 failed to complete maturation and were unable to gain developmental competence after fertilization, due to defects in cytoplasmic lattice formation, meiotic division, and maternal-zygotic transition. Our study highlights the importance of H3K4me3 in continuous histone replacement for transcriptional regulation, chromatin remodeling, and normal developmental progression in a non-replicative system.

Thermosensitive mutant of Bacillus subtilis deficient in uracil and cell division

Energy Technology Data Exchange (ETDEWEB)

Nagai, K; Some, H; Tamura, G

1976-01-01

Thermonsensitive division mutants were derived from Bacillus subtilis Marburg 168 thy trp/sub 2/ by means of membrane filtration after nitrosoguanidine mutagenesis. Among them, ts42 requiring uracil for normal growth at 48/sup 0/C was investigated. In the absence of uracil, the mutant cells grew normally at 37/sup 0/C and stopped dividing after temperature shift to 48/sup 0/C resulting in filaments of two to four times length of normal rods. The total cell number after the temperature shift increased two to three fold in 90 min and remained constant thereafter. The viable count after the temperature shift to 48/sup 0/C, increased 1.5 to 2 fold in initial 60 min and then decreased exponentially. A rapid restoration of colony forming ability was shown when the mutant cells were shifted back to the permissive temperature after 120 to 180 min of incubation at 48/sup 0/C or when uracil was introduced to the culture at 48/sup 0/C. This recovery of viability was partly observed even in the presence of chloramphenicol. The synthesis of RNA of this mutant was shown to decline 20 min after the temperature shift to 48/sup 0/C whereas the syntheses of DNA and protein proceeded for more than 80 min at that temperature. No newly isolated uracil requiring mutants formed filaments in the medium lacking uracil or showed growth pattern like ts42.

uvsI mutants defective in UV mutagenesis define a fourth epistatic group of uvs genes in Aspergillus.

Science.gov (United States)

Chae, S K; Kafer, E

1993-01-01

Three UV-sensitive mutations of A. nidulans, uvsI, uvsJ and uvsA, were tested for epistatic relationships with members of the previously established groups, here called the "UvsF", "UvsC", and "UvsB" groups. uvsI mutants are defective for spontaneous and induced reversion of certain point mutations and differ also for other properties from previously analyzed uvs types. They are very sensitive to the killing effects of UV-light and 4-NQO (4-nitro-quinoline-N-oxide) but not to MMS (methylmethane sulfonate). When double- and single-mutant uvs strains were compared for sensitivity to these three agents, synergistic or additive effects were found for uvsI with all members of the three groups. The uvsI gene may therefore represent a fourth epistatic group, possibly involved in mutagenic repair. On the other hand, uvsJ was clearly epistatic with members of the UvsF group and fitted well into this group also by phenotype. The uvsA gene was tentatively assigned to the UvsC group. uvsA showed epistatic interactions with uvsC in all tests, and like UvsC-group mutants is UV-sensitive mainly in dividing cells. However, the uvsA mutation does not cause the defects in recombination and UV mutagenesis typical for this group.

Flagellin and F4 fimbriae have opposite effects on biofilm formation and quorum sensing in F4ac+ enterotoxigenic Escherichia coli.

Science.gov (United States)

Zhou, Mingxu; Guo, Zhiyan; Yang, Yang; Duan, Qiangde; Zhang, Qi; Yao, Fenghua; Zhu, Jun; Zhang, Xinjun; Hardwidge, Philip R; Zhu, Guoqiang

2014-01-10

Bacteria that form biofilms are often highly resistant to antibiotics and are capable of evading the host immune system. To evaluate the role of flagellin and F4 fimbriae on biofilm formation by enterotoxigenic Escherichia coli (ETEC), we deleted the fliC (encoding the major flagellin protein) and/or the faeG (encoding the major subunit of F4 fimbriae) genes from ETEC C83902. Biofilm formation was reduced in the fliC mutant but increased in the faeG mutant, as compared with the wild-type strain. The expression of AI-2 quorum sensing associated genes was regulated in the fliC and faeG mutants, consistent with the biofilm formation of these strains. But, deleting fliC and/or faeG also inhibited AI-2 quorum sensing activity. Copyright © 2013 Elsevier B.V. All rights reserved.

Comparative analysis on inactivation kinetics of between piezotolerant and piezosensitive mutant strains of Saccharomyces cerevisiae under combinations of high hydrostatic pressure and temperature.

Science.gov (United States)

Nomura, Kazuki; Kuwabara, Yuki; Kuwabara, Wataru; Takahashi, Hiroyuki; Nakajima, Kanako; Hayashi, Mayumi; Iguchi, Akinori; Shigematsu, Toru

2017-12-01

We previously obtained a pressure-tolerant (piezotolerant) and a pressure sensitive (piezosensitive) mutant strain, under ambient temperature, from Saccharomyces cerevisiae strain KA31a. The inactivation kinetics of these mutants were analyzed at 150 to 250MPa with 4 to 40°C. By a multiple regression analysis, the pressure and temperature dependency of the inactivation rate constants k values of both mutants, as well as the parent strain KA31a, were well approximated with high correlation coefficients (0.92 to 0.95). For both mutants, as well as strain KA31a, the lowest k value was shown at a low pressure levels with around ambient temperature. The k value approximately increased with increase in pressure level, and with increase and decrease in temperature. The piezosensitive mutant strain a924E1 showed piezosensitivity at all pressure and temperature levels, compared with the parent strain KA31a. In contrast, the piezotolerant mutant strain a2568D8 showed piezotolerance at 4 to 20°C, but did not show significant piezotolerance at 40°C. These results of the variable influence of temperature on pressure inactivation of these strains would be important for better understanding of piezosensitive and piezotolerant mechanisms, as well as the pressure inactivation mechanism of S. cerevisiae. Copyright © 2017 Elsevier B.V. All rights reserved.

A new method for the construction of a mutant library with a predictable occurrence rate using Poisson distribution.

Science.gov (United States)

Seong, Ki Moon; Park, Hweon; Kim, Seong Jung; Ha, Hyo Nam; Lee, Jae Yung; Kim, Joon

2007-06-01

A yeast transcriptional activator, Gcn4p, induces the expression of genes that are involved in amino acid and purine biosynthetic pathways under amino acid starvation. Gcn4p has an acidic activation domain in the central region and a bZIP domain in the C-terminus that is divided into the DNA-binding motif and dimerization leucine zipper motif. In order to identify amino acids in the DNA-binding motif of Gcn4p which are involved in transcriptional activation, we constructed mutant libraries in the DNA-binding motif through an innovative application of random mutagenesis. Mutant library made by oligonucleotides which were mutated randomly using the Poisson distribution showed that the actual mutation frequency was in good agreement with expected values. This method could save the time and effort to create a mutant library with a predictable mutation frequency. Based on the studies using the mutant libraries constructed by the new method, the specific residues of the DNA-binding domain in Gcn4p appear to be involved in the transcriptional activities on a conserved binding site.

Construction and functional analysis of Trichoderma harzianum mutants that modulate maize resistance to the pathogen Curvularia lunata.

Science.gov (United States)

Fan, Lili; Fu, Kehe; Yu, Chuanjin; Ma, Jia; Li, Yaqian; Chen, Jie

2014-01-01

Agrobacterium tumefaciens-mediated transformation (ATMT) was used to generate an insertional mutant library of the mycelial fungus Trichoderma harzianum. From a total of 450 mutants, six mutants that showed significant influence on maize resistance to C. lunata were analyzed in detail. Maize coated with these mutants was more susceptible to C. lunata compared with those coated with a wild-type (WT) strain. Similar to other fungal ATMT libraries, all six mutants were single copy integrations, which occurred preferentially in noncoding regions (except two mutants) and were frequently accompanied by the loss of border sequences. Two mutants (T66 and T312) that were linked to resistance were characterized further. Maize seeds coated with T66 and T312 were more susceptible to C. lunata than those treated with WT. Moreover, the mutants affected the resistance of maize to C. lunata by enhancing jasmonate-responsive gene expression. T66 and T312 induced maize resistance to C. lunata infection through a jasmonic acid-dependent pathway.

Chondroitin 4-O-Sulfotransferase Is Indispensable for Sulfation of Chondroitin and Plays an Important Role in Maintaining Normal Life Span and Oxidative Stress Responses in Nematodes*

Science.gov (United States)

Izumikawa, Tomomi; Dejima, Katsufumi; Watamoto, Yukiko; Nomura, Kazuko H.; Kanaki, Nanako; Rikitake, Marika; Tou, Mai; Murata, Daisuke; Yanagita, Eri; Kano, Ai; Mitani, Shohei; Nomura, Kazuya; Kitagawa, Hiroshi

2016-01-01

Chondroitin sulfate (CS)/chondroitin (Chn) chains are indispensable for embryonic cell division and cytokinesis in the early developmental stages in Caenorhabditis elegans and mice, whereas heparan sulfate (HS) is essential for axon guidance during nervous system development. These data indicate that the fundamental functions of CS and HS are conserved from worms to mammals and that the function of CS/Chn differs from that of HS. Although previous studies have shown that C. elegans produces HS and non-sulfated Chn, whether the organism produces CS remains unclear. Here, we demonstrate that C. elegans produces a small amount of 4-O-sulfated Chn and report the identification of C41C4.1, an orthologue of the human chondroitin 4-O-sulfotransferase gene. Loss of C41C4.1 in C. elegans resulted in a decline in 4-O-sulfation of CS and an increase in the number of sulfated units in HS. C41C4.1 deletion mutants exhibited reduced survival rates after synchronization with sodium hypochlorite. Collectively, these results show for the first time that CS glycans are present in C. elegans and that the Chn 4-O-sulfotransferase responsible for the sulfation plays an important role in protecting nematodes from oxidative stress. PMID:27645998

A METABOLIC SIGNATURE FOR LONG-LIFE IN THE C. ELEGANS MIT MUTANTS

Science.gov (United States)

Butler, Jeffrey A.; Mishur, Robert J.; Bhaskaran, Shylesh; Rea, Shane L.

2012-01-01

SUMMARY Mit mutations that disrupt function of the mitochondrial electron transport chain can, inexplicably, prolong Caenorhabditis elegans lifespan. In this study we use a metabolomics approach to identify an ensemble of mitochondrial-derived α-ketoacids and α-hydroxyacids that are produced by long-lived Mit mutants but not by other long-lived mutants or by short-lived mitochondrial mutants. We show that accumulation of these compounds is dependent upon concerted inhibition of three α-ketoacid dehydrogenases that share dihydrolipoamide dehydrogenase (DLD) as a common subunit, a protein previously linked in humans with increased risk of Alzheimer’s disease. When the expression of DLD in wild type animals was reduced using RNA interference we observed an unprecedented effect on lifespan - as RNAi dosage was increased lifespan was significantly shortened but, at higher doses, it was significantly lengthened, suggesting DLD plays a unique role in modulating length of life. Our findings provide novel insight into the origin of the Mit phenotype. PMID:23173729

Homologous Recombination Defective Arabidopsis Mutants Exhibit Enhanced Sensitivity to Abscisic Acid.

Directory of Open Access Journals (Sweden)

Sujit Roy

Full Text Available Abscisic acid (ABA acts as an important plant hormone in regulating various aspects of plant growth and developmental processes particularly under abiotic stress conditions. An increased ABA level in plant cells inhibits DNA replication and cell division, causing plant growth retardation. In this study, we have investigated the effects of ABA on the growth responses of some major loss-of-function mutants of DNA double-stand break (DSB repair genes in Arabidopsis during seed germination and early stages of seedling growth for understanding the role of ABA in the induction of genome instability in plants. A comparative analysis of ABA sensitivity of wild-type Arabidopsis and the knockout mutant lines related to DSB sensors, including atatm, atatr, the non-homologous end joining (NHEJ pathway genes, and mutants related to homologous recombination (HR pathway genes showed relatively enhanced sensitivity of atatr and HR-related mutants to ABA treatment. The expression levels of HR-related genes were increased in wild-type Arabidopsis (Col-0 during seed germination and early stages of seedling growth. Immunoblotting experiments detected phosphorylation of histone H2AX in wild-type (Col-0 and DSB repair gene mutants after ABA treatment, indicating the activation of DNA damage response due to ABA treatment. Analyses of DSB repair kinetics using comet assay under neutral condition have revealed comparatively slower DSB repair activity in HR mutants. Overall, our results have provided comprehensive information on the possible effect of ABA on DNA repair machinery in plants and also indicated potential functional involvement of HR pathway in repairing ABA induced DNA damage in Arabidopsis.

Primary study on lesion mimic mutants of rice (oryza sativa L.)

International Nuclear Information System (INIS)

Hao Zhongna; Zhang Hongzhi; Tao Rongixang

2007-01-01

Nineteen lesion mimic mutants (xsl1-19) of japonica rice Xiushui11 were obtained by γ-rays irradiation treatment. All mutants belonged to whole life lesion mimic. Lesion mimic of mutants didn't largen after tillering stage, leaves didn't wither, and no effect on the plants exsert spikes and seed. When the highest temperature in day exceeded 32 degree C in seedling stage, lesion mimic of all mutant expect xsl19 disappeared. Under 32 degree C, lesion mimic would appear gradually, and symptoms weren't inhibited by high temperature after 5 leaf stage. The plant heights of all lesion mimic mutants were 47.56-63.54 cm in the tillering stage, and that of CK was 83.75 cm; but the dwarf phenomenon of mutants only appeared before tillering stage, and didn't affect plant heights finally; the heading dates of mutants were the same to the CK, the ear length of all mutants were 9.43-15.19 cm, and that of CK was 16.41 cm; the total grain quantity per spike of all mutants were 88.17-165.33, and those of xsl19 and CK were 49.50 and 76.17. The results showed all lesion mimic mutants except xsl19 had short spikes and total grain quantity per spike increasing. All lesion mimic mutants were susceptible to Magnaporthe grisea, and they had no relationship with resistance. (authors)

DNA binding properties of dioxin receptors in wild-type and mutant mouse hepatoma cells

International Nuclear Information System (INIS)

Cuthill, S.; Poellinger, L.

1988-01-01

The current model of action of 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) entails stimulation of target gene transcription via the formation of dioxin-receptor complexes and subsequent accumulation of the complexes within the cell nucleus. Here, the authors have analyzed the DNA binding properties of the dioxin receptor in wild-type mouse hepatoma (Hepa 1c1c7) cells and a class of nonresponsive mutant cells which fail to accumulate dioxin-receptor complexes within the nucleus in vivo. In vitro, both the wild-type and mutant [ 3 H]dioxin-receptor complexes exhibited low affinity for DNA-cellulose (5-8% and around 4% retention, respectively) in the absence of prior biochemical manipulations. However, following chromatography on heparin-Sepharose, the wild-type but not the mutant dioxin receptor was transformed to a species with an increased affinity for DNA (40-50% retention on DNA-cellulose). The gross molecular structure of the mutant, non DNA binding dioxin receptor did not appear to be altered as compared to that of the wild-type receptor. These results imply that the primary deficiency in the mutant dioxin receptor form may reside at the DNA binding level and that, in analogy to steroid hormone receptors, DNA binding of the receptor may be an essential step in the regulation of target gene transcription by dioxin

The functional significance of the autolysis loop in protein C and activated protein C.

Science.gov (United States)

Yang, Likui; Manithody, Chandrashekhara; Rezaie, Alireza R

2005-07-01

The autolysis loop of activated protein C (APC) is five residues longer than the autolysis loop of other vitamin K-dependent coagulation proteases. To investigate the role of this loop in the zymogenic and anticoagulant properties of the molecule, a protein C mutant was constructed in which the autolysis loop of the protein was replaced with the corresponding loop of factor X. The protein C mutant was activated by thrombin with approximately 5-fold higher rate in the presence of Ca2+. Both kinetics and direct binding studies revealed that the Ca2+ affinity of the mutant has been impaired approximately 3-fold. The result of a factor Va degradation assay revealed that the anticoagulant function of the mutant has been improved 4-5-fold in the absence but not in the presence of protein S. The improvement was due to a better recognition of both the P1-Arg506 and P1-Arg306 cleavage sites by the mutant protease. However, the plasma half-life of the mutant was markedly shortened due to faster inactivation by plasma serpins. These results suggest that the autolysis loop of protein C is critical for the Ca(2+)-dependence of activation by thrombin. Moreover, a longer autolysis loop in APC is not optimal for interaction with factor Va in the absence of protein S, but it contributes to the lack of serpin reactivity and longer half-life of the protease in plasma.

Mutants induced in winter rye (Secale cereale L.): Short straw-mutant No. 2714 and late-senescence mutant

Energy Technology Data Exchange (ETDEWEB)

Muszynski, S; Darlewska, M [Department of Plant Breeding and Seed Science, Warsaw Agricultural University, Warsaw (Poland)

1990-01-01

Full text: Mutants were induced by treating dormant seeds with ionizing radiation (fast neutrons) or chemicals (N-nitroso-N-ethyl urea or sodium azide). Among several mutants obtained, of special value is the short-straw mutant No. 2714 and a late senescent mutant. (author)

Evaluation of CLSI M44-A2 Disk Diffusion and Associated Breakpoint Testing of Caspofungin and Micafungin Using a Well-Characterized Panel of Wild-Type and fks Hot Spot Mutant Candida Isolates▿

Science.gov (United States)

Arendrup, Maiken Cavling; Park, Steven; Brown, Steven; Pfaller, Michael; Perlin, David S.

2011-01-01

Disk diffusion testing has recently been standardized by the CLSI, and susceptibility breakpoints have been established for several antifungal compounds. For caspofungin, 5-μg disks are approved, and for micafungin, 10-μg disks are under evaluation. We evaluated the performances of caspofungin and micafungin disk testing using a panel of Candida isolates with and without known FKS echinocandin resistance mechanisms. Disk diffusion and microdilution assays were performed strictly according to CLSI documents M44-A2 and M27-A3. Eighty-nine clinical Candida isolates were included: Candida albicans (20 isolates/10 mutants), C. glabrata (19 isolates/10 mutants), C. dubliniensis (2 isolates/1 mutant), C. krusei (16 isolates/3 mutants), C. parapsilosis (14 isolates/0 mutants), and C. tropicalis (18 isolates/4 mutants). Quality control strains were C. parapsilosis ATCC 22019 and C. krusei ATCC 6258. The correlations between zone diameters and MIC results were good for both compounds, with identical susceptibility classifications for 93.3% of the isolates by applying the current CLSI breakpoints. However, the numbers of fks hot spot mutant isolates misclassified as being susceptible (S) (very major errors [VMEs]) were high (61% for caspofungin [S, ≥11 mm] and 93% for micafungin [S, ≥14 mm]). Changing the disk diffusion breakpoint to S at ≥22 mm significantly improved the discrimination. For caspofungin, 1 VME was detected (a C. tropicalis isolate with an F76S substitution) (3.5%), and for micafungin, 10 VMEs were detected, the majority of which were for C. glabrata (8/10). The broadest separation between zone diameter ranges for wild-type (WT) and mutant isolates was seen for caspofungin (6 to 12 mm versus −4 to 7 mm). In conclusion, caspofungin disk diffusion testing with a modified breakpoint led to excellent separation between WT and mutant isolates for all Candida species. PMID:21357293

Developmental and transcriptional consequences of mutations in Drosophila TAF(II)60.

Science.gov (United States)

Aoyagi, N; Wassarman, D A

2001-10-01

In vitro, the TAF(II)60 component of the TFIID complex contributes to RNA polymerase II transcription initiation by serving as a coactivator that interacts with specific activator proteins and possibly as a promoter selectivity factor that interacts with the downstream promoter element. In vivo roles for TAF(II)60 in metazoan transcription are not as clear. Here we have investigated the developmental and transcriptional requirements for TAF(II)60 by analyzing four independent Drosophila melanogaster TAF(II)60 mutants. Loss-of-function mutations in Drosophila TAF(II)60 result in lethality, indicating that TAF(II)60 provides a nonredundant function in vivo. Molecular analysis of TAF(II)60 alleles revealed that essential TAF(II)60 functions are provided by two evolutionarily conserved regions located in the N-terminal half of the protein. TAF(II)60 is required at all stages of Drosophila development, in both germ cells and somatic cells. Expression of TAF(II)60 from a transgene rescued the lethality of TAF(II)60 mutants and exposed requirements for TAF(II)60 during imaginal development, spermatogenesis, and oogenesis. Phenotypes of rescued TAF(II)60 mutant flies implicate TAF(II)60 in transcriptional mechanisms that regulate cell growth and cell fate specification and suggest that TAF(II)60 is a limiting component of the machinery that regulates the transcription of dosage-sensitive genes. Finally, TAF(II)60 plays roles in developmental regulation of gene expression that are distinct from those of other TAF(II) proteins.

dbl-1/TGF-β and daf-12/NHR Signaling Mediate Cell-Nonautonomous Effects of daf-16/FOXO on Starvation-Induced Developmental Arrest.

Directory of Open Access Journals (Sweden)

Rebecca E W Kaplan

2015-12-01

Full Text Available Nutrient availability has profound influence on development. In the nematode C. elegans, nutrient availability governs post-embryonic development. L1-stage larvae remain in a state of developmental arrest after hatching until they feed. This "L1 arrest" (or "L1 diapause" is associated with increased stress resistance, supporting starvation survival. Loss of the transcription factor daf-16/FOXO, an effector of insulin/IGF signaling, results in arrest-defective and starvation-sensitive phenotypes. We show that daf-16/FOXO regulates L1 arrest cell-nonautonomously, suggesting that insulin/IGF signaling regulates at least one additional signaling pathway. We used mRNA-seq to identify candidate signaling molecules affected by daf-16/FOXO during L1 arrest. dbl-1/TGF-β, a ligand for the Sma/Mab pathway, daf-12/NHR and daf-36/oxygenase, an upstream component of the daf-12 steroid hormone signaling pathway, were up-regulated during L1 arrest in a daf-16/FOXO mutant. Using genetic epistasis analysis, we show that dbl-1/TGF-β and daf-12/NHR steroid hormone signaling pathways are required for the daf-16/FOXO arrest-defective phenotype, suggesting that daf-16/FOXO represses dbl-1/TGF-β, daf-12/NHR and daf-36/oxygenase. The dbl-1/TGF-β and daf-12/NHR pathways have not previously been shown to affect L1 development, but we found that disruption of these pathways delayed L1 development in fed larvae, consistent with these pathways promoting development in starved daf-16/FOXO mutants. Though the dbl-1/TGF-β and daf-12/NHR pathways are epistatic to daf-16/FOXO for the arrest-defective phenotype, disruption of these pathways does not suppress starvation sensitivity of daf-16/FOXO mutants. This observation uncouples starvation survival from developmental arrest, indicating that DAF-16/FOXO targets distinct effectors for each phenotype and revealing that inappropriate development during starvation does not cause the early demise of daf-16/FOXO mutants. Overall

dbl-1/TGF-β and daf-12/NHR Signaling Mediate Cell-Nonautonomous Effects of daf-16/FOXO on Starvation-Induced Developmental Arrest.

Science.gov (United States)

Kaplan, Rebecca E W; Chen, Yutao; Moore, Brad T; Jordan, James M; Maxwell, Colin S; Schindler, Adam J; Baugh, L Ryan

2015-12-01

Nutrient availability has profound influence on development. In the nematode C. elegans, nutrient availability governs post-embryonic development. L1-stage larvae remain in a state of developmental arrest after hatching until they feed. This "L1 arrest" (or "L1 diapause") is associated with increased stress resistance, supporting starvation survival. Loss of the transcription factor daf-16/FOXO, an effector of insulin/IGF signaling, results in arrest-defective and starvation-sensitive phenotypes. We show that daf-16/FOXO regulates L1 arrest cell-nonautonomously, suggesting that insulin/IGF signaling regulates at least one additional signaling pathway. We used mRNA-seq to identify candidate signaling molecules affected by daf-16/FOXO during L1 arrest. dbl-1/TGF-β, a ligand for the Sma/Mab pathway, daf-12/NHR and daf-36/oxygenase, an upstream component of the daf-12 steroid hormone signaling pathway, were up-regulated during L1 arrest in a daf-16/FOXO mutant. Using genetic epistasis analysis, we show that dbl-1/TGF-β and daf-12/NHR steroid hormone signaling pathways are required for the daf-16/FOXO arrest-defective phenotype, suggesting that daf-16/FOXO represses dbl-1/TGF-β, daf-12/NHR and daf-36/oxygenase. The dbl-1/TGF-β and daf-12/NHR pathways have not previously been shown to affect L1 development, but we found that disruption of these pathways delayed L1 development in fed larvae, consistent with these pathways promoting development in starved daf-16/FOXO mutants. Though the dbl-1/TGF-β and daf-12/NHR pathways are epistatic to daf-16/FOXO for the arrest-defective phenotype, disruption of these pathways does not suppress starvation sensitivity of daf-16/FOXO mutants. This observation uncouples starvation survival from developmental arrest, indicating that DAF-16/FOXO targets distinct effectors for each phenotype and revealing that inappropriate development during starvation does not cause the early demise of daf-16/FOXO mutants. Overall, this study shows

Endoreduplication intensity as a marker of seed developmental stage in the Fabaceae.

Science.gov (United States)

Rewers, Monika; Sliwinska, Elwira

2012-12-01

Flow cytometry (FCM) can be used to study cell cycle activity in developing, mature and germinating seeds. It provides information about a seed's physiological state and therefore can be used by seed growers for assessing optimal harvest times and presowing treatments. Because an augmented proportion of 4C nuclei usually is indicative of high mitotic activity, the 4C/2C ratio is commonly used to follow the progress of seed development and germination. However, its usefulness for polysomatic (i.e., containing cells with different DNA content) seeds is questioned. Changes in cell cycle/endoreduplication activity in developing seeds of five members of the Fabaceae were studied to determine a more suitable marker of seed developmental stages for polysomatic species based on FCM measurements. Seeds of Phaseolus vulgaris, Medicago sativa, Pisum sativum, Vicia sativa, and Vicia faba var. minor were collected 20, 30, 40, 50, and 60 days after flowering (DAF), embryos were isolated and the proportion of nuclei with different DNA contents in the embryo axis and cotyledon was established. The ratios 4C/2C and (Σ>2C)/2C were calculated. Dried seeds were subjected to laboratory germination tests following international seed testing association (ISTA) rules. Additionally, the absolute nuclear DNA content was estimated in the leaves of the studied species. During seed development nuclei with DNA contents from 2C to 128C were detected; the endopolyploidy pattern depended on the species, seed organ and developmental stage. The cell cycle/endoreduplication parameters correlated negatively with genome size. The (Σ>2C)/2C ratio in the cotyledons reflected the seed developmental stage and corresponded with seed germinability. Therefore, this ratio is recommended as a marker in polysomatic seed research and production instead of the 4C/2C ratio, which does not consider the occurrence of endopolyploid cells. Copyright © 2012 International Society for Advancement of Cytometry.

The Swedish mutant barley collection

Energy Technology Data Exchange (ETDEWEB)

NONE

1989-07-01

Full text: The Swedish mutation research programme in barley began about 50 years ago and has mainly been carried out at Svaloev in co-operation with the institute of Genetics at the University of Lund. The collection has been produced from different Swedish high-yielding spring barley varieties, using the following mutagens: X-rays, neutrons, several organic chemical compounds such as ethyleneimine, several sulfonate derivatives and the inorganic chemical mutagen sodium azide. Nearly 10,000 barley mutants are stored in the Nordic Gene Bank and documented in databases developed by Udda Lundquist, Svaloev AB. The collection consists of the following nine categories with 94 different types of mutants: 1. Mutants with changes in the spike and spikelets; 2. Changes in culm length and culm composition; 3. Changes in growth types; 4. Physiological mutants; 5. Changes in awns; 6. Changes in seed size and shape; 7. Changes in leaf blades; 8. Changes in anthocyanin and colour; 9. Resistance to barley powdery mildew. Barley is one of the most thoroughly investigated crops in terms of induction of mutations and mutation genetics. So far, about half of the mutants stored at the Nordic Gene Bank, have been analysed genetically; They constitute, however, only a minority of the 94 different mutant types. The genetic analyses have given valuable insights into the mutation process but also into the genetic architecture of various characters. A number of mutants of two-row barley have been registered and commercially released. One of the earliest released, Mari, an early maturing, daylength neutral, straw stiff mutant, is still grown in Iceland. The Swedish mutation material has been used in Sweden, but also in other countries, such as Denmark, Germany, and USA, for various studies providing a better understanding of the barley genome. The collection will be immensely valuable for future molecular genetical analyses of clone mutant genes. (author)

The Swedish mutant barley collection

International Nuclear Information System (INIS)

1989-01-01

Full text: The Swedish mutation research programme in barley began about 50 years ago and has mainly been carried out at Svaloev in co-operation with the institute of Genetics at the University of Lund. The collection has been produced from different Swedish high-yielding spring barley varieties, using the following mutagens: X-rays, neutrons, several organic chemical compounds such as ethyleneimine, several sulfonate derivatives and the inorganic chemical mutagen sodium azide. Nearly 10,000 barley mutants are stored in the Nordic Gene Bank and documented in databases developed by Udda Lundquist, Svaloev AB. The collection consists of the following nine categories with 94 different types of mutants: 1. Mutants with changes in the spike and spikelets; 2. Changes in culm length and culm composition; 3. Changes in growth types; 4. Physiological mutants; 5. Changes in awns; 6. Changes in seed size and shape; 7. Changes in leaf blades; 8. Changes in anthocyanin and colour; 9. Resistance to barley powdery mildew. Barley is one of the most thoroughly investigated crops in terms of induction of mutations and mutation genetics. So far, about half of the mutants stored at the Nordic Gene Bank, have been analysed genetically; They constitute, however, only a minority of the 94 different mutant types. The genetic analyses have given valuable insights into the mutation process but also into the genetic architecture of various characters. A number of mutants of two-row barley have been registered and commercially released. One of the earliest released, Mari, an early maturing, daylength neutral, straw stiff mutant, is still grown in Iceland. The Swedish mutation material has been used in Sweden, but also in other countries, such as Denmark, Germany, and USA, for various studies providing a better understanding of the barley genome. The collection will be immensely valuable for future molecular genetical analyses of clone mutant genes. (author)

denV gene of bacteriophage T4 restores DNA excision repair to mei-9 and mus201 mutants of Drosophila melanogaster

International Nuclear Information System (INIS)

Banga, S.S.; Boyd, J.B.; Valerie, K.; Harris, P.V.; Kurz, E.M.; de Riel, J.K.

1989-01-01

The denV gene of bacteriophage T4 was fused to a Drosophila hsp70 (70-kDa heat shock protein) promoter and introduced into the germ line of Drosophila by P-element-mediated transformation. The protein product of that gene (endonuclease V) was detected in extracts of heat-shocked transformants with both enzymological and immunoblotting procedures. That protein restores both excision repair and UV resistance to mei-9 and mus201 mutants of this organism. These results reveal that the denV gene can compensate for excision-repair defects in two very different eukayotic mutants, in that the mus201 mutants are typical of excision-deficient mutants in other organisms, whereas the mei-9 mutants exhibit a broad pleiotropism that includes a strong meiotic deficiency. This study permits an extension of the molecular analysis of DNA repair to the germ line of higher eukaryotes. It also provides a model system for future investigations of other well-characterized microbial repair genes on DNA damage in the germ line of this metazoan organism

Productive mutants of niger

International Nuclear Information System (INIS)

Misra, R.C.

2001-01-01

Seeds of six niger (Guizotia abyssinica Cass.) varieties ('GA-10', 'ONS-8', 'IGP-72', 'N-71', 'NB-9' and 'UN-4') were treated with 0.5, 0.75 and 1% ethyl methanesulphonate. After four generations of selection, 29 mutant lines were developed and those were evaluated from 1990-92 during Kharif (July to October) and Rabi (December to March) seasons. Average plant characteristics and yield data of four high yielding mutants along with 'IGP-76' (National Check), GA-10 (Zonal Check) and 'Semiliguda Local' (Local Check) are presented

Study on growth condition of Trichoderma mutants

International Nuclear Information System (INIS)

Chen Jian'ai; Xiao Min; Wang Weiming; Chen Weijing; Sun Yongtang

2002-01-01

Some Trichoderma mutants were cultured under different conditions 4 strains, T5, T0803, T1010, T1003 were selected with different mediums and every medium was mixed with fungicide of 40 ppm. The fungicides were procymidone + chlorothalonil, maneb and phosethyl-Al. The pH of medium were 5, 6, 7 and 8, respectively. The growing temperatures were 15, 20, 25 and 30 degree C, respectively. After the hypha growing for some days under natural high temperature, they were put in low temperature for producing spores. The growing times for these hypha were 3,4,5 and 6 days, respectively. All dates were analyzed on statistics with the orthogonal array and ranges (R) were different with different factor and levels (R = 40.4, 42.4, 48.0, 62.8, 107.0). The results showed that the strain was the most influent condition (R = 107.0) and the changed temperature time from high to low was the least influent condition (R = 40.4). Each factor variance was significant and A 3 b 4 C 2 D 1 E 3 was the optimum combined condition, under which T1010 grew more quickly and produced the most spores

A specific assay for quantification of human C4c by use of an anti-C4c monoclonal antibody

DEFF Research Database (Denmark)

Pilely, Katrine; Skjoedt, Mikkel-Ole; Nielsen, Christian

2014-01-01

a mouse monoclonal antibody (mAb) that is able to detect fluid phase C4c without interference from other products generated from the complement component C4. The C4c specific mAb was tested in different enzyme-linked immunosorbent assay (ELISA) combinations with various types of in vitro activated sera...

A Medicago truncatula tobacco retrotransposon insertion mutant collection with defects in nodule development and symbiotic nitrogen fixation.

Science.gov (United States)

Pislariu, Catalina I; Murray, Jeremy D; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; Benedito, Vagner A; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S; Chen, Rujin; Udvardi, Michael K

2012-08-01

A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod-), 51 mutants with totally ineffective nodules (Nod+ Fix-), 17 mutants with partially ineffective nodules (Nod+ Fix+/-), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/- Fix-), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/- Fix+), and 11 supernodulating mutants (Nod++Fix+/-). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN'T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod- lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging.

Brucella abortus mutants lacking ATP-binding cassette transporter proteins are highly attenuated in virulence and confer protective immunity against virulent B. abortus challenge in BALB/c mice.

Science.gov (United States)

Truong, Quang Lam; Cho, Youngjae; Park, Soyeon; Park, Bo-Kyoung; Hahn, Tae-Wook

2016-06-01

Brucella abortus RB51 is an attenuated vaccine strain that has been most frequently used for bovine brucellosis. Although it is known to provide good protection in cattle, it still has some drawbacks including resistance to rifampicin, residual virulence and pathogenicity in humans. Thus, there has been a continuous interest on new safe and effective bovine vaccine candidates. In the present study, we have constructed unmarked mutants by deleting singly cydD and cydC genes, which encode ATP-binding cassette transporter proteins, from the chromosome of the virulent Brucella abortus isolate from Korean cow (referred to as IVK15). Both IVK15ΔcydD and ΔcydC mutants showed increased sensitivity to metal ions, hydrogen peroxide and acidic pH, which are mimic to intracellular environment during host infection. Additionally, the mutants exhibited a significant growth defect in RAW264.7 cells and greatly attenuated in mice. Vaccination of mice with either IVK15ΔcydC or IVK15ΔcydD mutant could elicit an anti-Brucella specific immunoglobulin G (IgG) and IgG subclass responses as well as enhance the secretion of interferon-gamma, and provided better protection against challenge with B. abortus strain 2308 than with the commercial B. abortus strain RB51 vaccine. Collectively, these results suggest that both IVK15ΔcydC and IVK15ΔcydD mutants could be an attenuated vaccine candidate against B. abortus. Copyright © 2016 Elsevier Ltd. All rights reserved.

Characterization of the snowy cotyledon 1 mutant of Arabidopsis thaliana: the impact of chloroplast elongation factor G on chloroplast development and plant vitality.

Science.gov (United States)

Albrecht, Verónica; Ingenfeld, Anke; Apel, Klaus

2006-03-01

During seedling development chloroplast formation marks the transition from heterotrophic to autotrophic growth. The development and activity of chloroplasts may differ in cotyledons that initially serve as a storage organ and true leaves whose primary function is photosynthesis. A genetic screen was used for the identification of genes that affect selectively chloroplast function in cotyledons of Arabidopsis thaliana. Several mutants exhibiting pale cotyledons and green true leaves were isolated and dubbed snowy cotyledon (sco). One of the mutants, sco1, was characterized in more detail. The mutated gene was identified using map-based cloning. The mutant contains a point mutation in a gene encoding the chloroplast elongation factor G, leading to an amino acid exchange within the predicted 70S ribosome-binding domain. The mutation results in a delay in the onset of germination. At this early developmental stage embryos still contain undifferentiated proplastids, whose proper function seems necessary for seed germination. In light-grown sco1 seedlings the greening of cotyledons is severely impaired, whereas the following true leaves develop normally as in wild-type plants. Despite this apparent similarity of chloroplast development in true leaves of mutant and wild-type plants various aspects of mature plant development are also affected by the sco1 mutation such as the onset of flowering, the growth rate, and seed production. The onset of senescence in the mutant and the wild-type plants occurs, however, at the same time, suggesting that in the mutant this particular developmental step does not seem to suffer from reduced protein translation efficiency in chloroplasts.

Global transcriptional repression in C. elegans germline precursors by regulated sequestration of TFIID component TAF-4

Science.gov (United States)

Guven-Ozkan, Tugba; Nishi, Yuichi; Robertson, Scott M.; Lin, Rueyling

2008-01-01

In C. elegans, four asymmetric divisions, beginning with the zygote (P0), generate transcriptionally repressed germline blastomeres (P1–P4) and somatic sisters that become transcriptionally active. The protein PIE-1 represses transcription in the later germline blastomeres, but not in the earlier germline blastomeres P0 and P1. We show here that OMA-1 and OMA-2, previously shown to regulate oocyte maturation, repress transcription in P0 and P1 by binding to and sequestering in the cytoplasm TAF-4, a component critical for assembly of TFIID and the pol II preinitiation complex. OMA-1/2 binding to TAF-4 is developmentally regulated, requiring phosphorylation by the DYRK kinase MBK-2, which is activated at meiosis II following fertilization. OMA-1/2 are normally degraded after the first mitosis, but ectopic expression of wildtype OMA-1 is sufficient to repress transcription in both somatic and later germline blastomeres. We propose that phosphorylation by MBK-2 serves as a developmental switch, converting OMA-1/2 from oocyte to embryo regulators. PMID:18854162

Evaluation of dwarf mutant of cowpea (Vigna Unguiculata L. Walp.) developed through gamma irradiation for nitrogen fixation characters

International Nuclear Information System (INIS)

Anjana, G.; Thimmaiah, S.K.

2002-01-01

A dwarf mutant developed through gamma-irradiation and mutation breeding of its parent cowpea variety, namely KBC-1 has been characterized for nitrogen-fixation characters such as root nodule acetylene reduction activity (ARA) and legthemoglobin content at different days after sowing (DAS). Significant variations in these characters were noticed among the varieties and for interactions between the varieties and DAS. The ARA was nearly one-and-a half fold higher in the mutant at both 30 (12.69 μmoles)C 2 H 4 formed/h/g fr.wt. of nodules) and 50 DAS (6.74 μmoles) over its parent (9.20 and 4.46 μmoles at 30 and 50 DAS, respectively). Further, the ARA in the mutant decreased linearly with an increase in the DAS. The leghemoglobin (Lb) content was also higher in the mutant over the parent at all the DAS. However, it decreased linearly with an increase in the DAS in both the mutant and the parent. The highest leghemoglobin content was noticed at 30 DAS in both mutant (2.1 mg/g fr. wt. of nodules) and the parent (1.45 mg/g). Thus, the dwarf cowpea mutant was found to be associated with higher nitrogen-fixing ability which could be exploited in future breeding programmes. (author)

Construction of an Unmarked Zymomonas mobilis Mutant Using a Site-Specific FLP Recombinase

Directory of Open Access Journals (Sweden)

Shao-Lan Zou

2012-01-01

Full Text Available Flippase expression was carried out in Zymomonas mobilis strain ZM4. The FRT-flanked selection marker gene was first integrated into the ZM4 chromosome by homologous recombination. The Saccharomyces cerevisiae flp gene was then introduced under the control of the ZM4 gap gene promoter (Pgap, encoding glyceraldehyde-3-phosphate dehydrogenase or the λ bacteriophage cI857-pR contained in the broad-host-range cloning vector pBBR1-MCS-2. This study demonstrated that flp was expressed and that the deletion frequency of the FRT-flanked marker gene was very high (approx. 100 %. In addition, the flp gene expression vector could be conveniently removed from the resulting unmarked Z. mobilis mutants by serially transferring the cells three times into antibiotic-free medium, thereby establishing an efficient method for constructing unmarked Z. mobilis mutants.

Natural variation of model mutant phenotypes in Ciona intestinalis.

Directory of Open Access Journals (Sweden)

Paolo Sordino

Full Text Available BACKGROUND: The study of ascidians (Chordata, Tunicata has made a considerable contribution to our understanding of the origin and evolution of basal chordates. To provide further information to support forward genetics in Ciona intestinalis, we used a combination of natural variation and neutral population genetics as an approach for the systematic identification of new mutations. In addition to the significance of developmental variation for phenotype-driven studies, this approach can encompass important implications in evolutionary and population biology. METHODOLOGY/PRINCIPAL FINDINGS: Here, we report a preliminary survey for naturally occurring mutations in three geographically interconnected populations of C. intestinalis. The influence of historical, geographical and environmental factors on the distribution of abnormal phenotypes was assessed by means of 12 microsatellites. We identified 37 possible mutant loci with stereotyped defects in embryonic development that segregate in a way typical of recessive alleles. Local populations were found to differ in genetic organization and frequency distribution of phenotypic classes. CONCLUSIONS/SIGNIFICANCE: Natural genetic polymorphism of C. intestinalis constitutes a valuable source of phenotypes for studying embryonic development in ascidians. Correlating genetic structure and the occurrence of abnormal phenotypes is a crucial focus for understanding the selective forces that shape natural finite populations, and may provide insights of great importance into the evolutionary mechanisms that generate animal diversity.

Natural Variation of Model Mutant Phenotypes in Ciona intestinalis

Science.gov (United States)

Brown, Euan R.; Leccia, Nicola I.; Squarzoni, Paola; Tarallo, Raffaella; Alfano, Christian; Caputi, Luigi; D'Ambrosio, Palmira; Daniele, Paola; D'Aniello, Enrico; D'Aniello, Salvatore; Maiella, Sylvie; Miraglia, Valentina; Russo, Monia Teresa; Sorrenti, Gerarda; Branno, Margherita; Cariello, Lucio; Cirino, Paola; Locascio, Annamaria; Spagnuolo, Antonietta; Zanetti, Laura; Ristoratore, Filomena

2008-01-01

Background The study of ascidians (Chordata, Tunicata) has made a considerable contribution to our understanding of the origin and evolution of basal chordates. To provide further information to support forward genetics in Ciona intestinalis, we used a combination of natural variation and neutral population genetics as an approach for the systematic identification of new mutations. In addition to the significance of developmental variation for phenotype-driven studies, this approach can encompass important implications in evolutionary and population biology. Methodology/Principal Findings Here, we report a preliminary survey for naturally occurring mutations in three geographically interconnected populations of C. intestinalis. The influence of historical, geographical and environmental factors on the distribution of abnormal phenotypes was assessed by means of 12 microsatellites. We identified 37 possible mutant loci with stereotyped defects in embryonic development that segregate in a way typical of recessive alleles. Local populations were found to differ in genetic organization and frequency distribution of phenotypic classes. Conclusions/Significance Natural genetic polymorphism of C. intestinalis constitutes a valuable source of phenotypes for studying embryonic development in ascidians. Correlating genetic structure and the occurrence of abnormal phenotypes is a crucial focus for understanding the selective forces that shape natural finite populations, and may provide insights of great importance into the evolutionary mechanisms that generate animal diversity. PMID:18523552

Disruption of Mediator rescues the stunted growth of a lignin-deficient Arabidopsis mutant.

Science.gov (United States)

Bonawitz, Nicholas D; Kim, Jeong Im; Tobimatsu, Yuki; Ciesielski, Peter N; Anderson, Nickolas A; Ximenes, Eduardo; Maeda, Junko; Ralph, John; Donohoe, Bryon S; Ladisch, Michael; Chapple, Clint

2014-05-15

Lignin is a phenylpropanoid-derived heteropolymer important for the strength and rigidity of the plant secondary cell wall. Genetic disruption of lignin biosynthesis has been proposed as a means to improve forage and bioenergy crops, but frequently results in stunted growth and developmental abnormalities, the mechanisms of which are poorly understood. Here we show that the phenotype of a lignin-deficient Arabidopsis mutant is dependent on the transcriptional co-regulatory complex, Mediator. Disruption of the Mediator complex subunits MED5a (also known as REF4) and MED5b (also known as RFR1) rescues the stunted growth, lignin deficiency and widespread changes in gene expression seen in the phenylpropanoid pathway mutant ref8, without restoring the synthesis of guaiacyl and syringyl lignin subunits. Cell walls of rescued med5a/5b ref8 plants instead contain a novel lignin consisting almost exclusively of p-hydroxyphenyl lignin subunits, and moreover exhibit substantially facilitated polysaccharide saccharification. These results demonstrate that guaiacyl and syringyl lignin subunits are largely dispensable for normal growth and development, implicate Mediator in an active transcriptional process responsible for dwarfing and inhibition of lignin biosynthesis, and suggest that the transcription machinery and signalling pathways responding to cell wall defects may be important targets to include in efforts to reduce biomass recalcitrance.

Genetic fingerprinting of mutant rose cultivars

Energy Technology Data Exchange (ETDEWEB)

Kumar, S; Prasad, K V; Singh, K P; Singh, A.P. [Division of Floriculture and Landscaping, Indian Agricultural Research Institute, Pusa, New Delhi (India)], E-mail: kvprasad66@gmail.com

2008-07-01

Six rose mutants evolved at the Indian Agricultural Research Institute, New Delhi from four parent cultivars were characterized based on RAPD markers. Contrary to the earlier findings our effort has conclusively proven that the RAPD markers are indeed robust tools to discern the mutants from their parents. Among 40 primers screened, 7 primers produced inconsistent banding pattern. The number of polymorphic bands varied between 4 (OPA 14) and 10 (OPA1) with an average of 6.5 bands per primer. The percentage polymorphism ranged from 62.5 (OPM 9) to 100 percent (OPA 1). Most of the primers produced monomorphic bands between parent and mutant rose cultivars. When primer OPA 2 was used a specific band of 2.5 kb was noticed in mutant cv. Pusa Urmil and cv. Pusa Abhishek but was absent in parent cv. Jantar Mantar. A polymorphic band of 750 bp was noticed in the parent Kiss of Fire and helped in differentiating the parent from its mutant when amplified with OPK 3. Primer OPS 16 produced discriminatory band of 800 bp in mutant cv. Pink Sport of Montezuma while it was absent in its parent cv. Montezuma. Another specific band of 650 bp was present in parent cv. Montezuma and absent in its mutant cv. Pink Sport of Montezuma signifying the uniqueness of the mutant. Primer OPM 5 brought out distinct polymorphism among the parent Jantar Mantar and its three mutants with absence of a specific band of 1.5 kb in the parent. The four parents and 6 mutants were divided into four distinct groups in the Dendogram constructed by UPGMA method. The most genetically similar cultivar among the 10 cultivars analyzed are Montezuma and its pink sport of Montezuma whereas Abhisarika a mutant of cv. Kiss of Fire was distinctly different and formed a separate cluster. (author)

Rab27a regulates epithelial sodium channel (ENaC) activity through synaptotagmin-like protein (SLP-5) and Munc13-4 effector mechanism

International Nuclear Information System (INIS)

Saxena, Sunil K.; Horiuchi, Hisanori; Fukuda, Mitsunori

2006-01-01

Liddle's syndrome (excessive absorption of sodium ions) and PHA-1 (pseudohypoaldosteronism type 1) with decreased sodium absorption are caused by the mutations in the amiloride-sensitive epithelial sodium channel ENaC. Rab proteins are small GTPases involved in vesicle transport, docking, and fusion. Earlier, we reported that Rab27a inhibits ENaC-mediated currents through protein-protein interaction in HT-29 cells. We hereby report that Rab27a-dependent inhibition is associated with the GTP/GDP status as constitutively active or GTPase-deficient mutant Q78L inhibits amiloride-sensitive currents whereas GDP-locked inactive mutant T23N showed no effect. In order to further explore the molecular mechanism of this regulation, we performed competitive assays with two Rab27a-binding proteins: synaptotagmin-like protein (SLP-5) and Munc13-4 (a putative priming factor for exocytosis). Both proteins eliminate negative modulation of Rab27a on ENaC function. The SLP-5 reversal of Rab27a effect was restricted to C-terminal C2A/C2B domains assigned for putative phospholipids-binding function while the Rab27a-binding SHD motif imparted higher inhibition. The ENaC-mediated currents remain unaffected by Rab27a though SLP-5 appears to strongly bind it. The immunoprecipitation experiments suggest that in the presence of excessive Munc13-4 and SLP-5 proteins, Rab27a interaction with ENaC is diminished. Munc13-4 and SLP-5 limit the Rab27a availability to ENaC, thus minimizing its effect on channel function. These observations decisively prove that Rab27a inhibits ENaC function through a complex mechanism that involves GTP/GDP status, and protein-protein interactions involving Munc13-4 and SLP-5 effector proteins

Selective production of deacetylated mannosylerythritol lipid, MEL-D, by acetyltransferase disruption mutant of Pseudozyma hubeiensis.

Science.gov (United States)

Konishi, Masaaki; Makino, Motoki

2018-01-01

Mannosylerythritol lipids (MELs) are produced by several smut fungi of the Ustilaginaceae family; they are promising microbial biosurfactants and have excellent surface-active and self-assembling properties. Pseudozyma hubeiensis is a candidate for abundant MEL production and produces large amounts of 4-O-[(4'-mono-O-acetyl-2',3'-di-O-alkanoyl)-β-d-mannopyranosyl]-meso-erythritol (MEL-C). An acetyltransferase disruption mutant of P. hubeiensis, SY62-MM36, was obtained to selectively produce deacetylated 4-O-[(2',3'-di-O-alkanoyl)-β-d-mannopyranosyl]-meso-erythritol (MEL-D), and the structures of the products were determined. Lower mobility of major spots of the mutant on silica gel thin-layer chromatography verified its more hydrophilic nature than that of wild-type MEL-A, B, and C. Structural analyses confirmed the product to be MEL-D, which comprises acyl chains of caproic acid (C6:0), capric acid (C10:0), and lauric acid (C12:0). The critical micelle concentration (CMC) and the surface tension (γCMC) of the MEL-D were 2.0 × 10 -5  M and 29.7 mN/m, respectively. SY62-MM36 also produced a minor product that was estimated as triacylated MEL-D. The triacylated MEL-D had a CMC of 3.5 × 10 -5  M and a γCMC of 29.6 mN/m. In water, MEL-D formed a lamella liquid crystal phase over a broad range of concentrations. By fed-batch cultivation, the mutant produced 91.6 ± 6.3 g/L of MEL-D for 7 days. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Molybdenum x-ray absorption studies of the mutant Kp nifV of nitrogenase MO-FE protein

International Nuclear Information System (INIS)

Eidsness, M.K.; Smith, B.E.; Flood, A.C.; Garner, C.D.; Cramer, S.P.

1985-01-01

The nifV mutant nitrogenase enzyme of Klebsiella pheumoniae exhibits altered substrate reducing activity. This nitrogenase mutant cannot fix N 2 in vivo but can reduce C 2 H 2 to C 2 H 4 . The nifV mutant enzyme differs further from the wild-type enzyme by CO inhibition of its H 2 evolution activity, up to 80%. The NifV - phenotype (NifV - Kp1) has been shown to be associated with the iron-molybdenum cofactor (FeMoco) in the Mo Fe protein which is generally accepted as the site for substrate reduction. An X-Ray absorption study of the Mo site in this mutant may reveal a difference in its FeMoco structure. The authors report here a comparison of Mo X-Ray absorption data from the nitrogenase enzymes of the wild-type and NifV - strains in three different forms: (1) as isolated, (2) dye-oxidized, and (3) fixing enzyme systems. Mo edge structure of NifV - Kp1 and wild-type enzymes are nearly identical. Small shifts to higher energies are observed in the oxidized and fixing states. Mo EXAFS of NifV - Kp1 and wild-type in the ''as isolated'' state appear indistinguishable. Curve fitting results best describe the molybdenum in FeMoco as bound by 4-5 S atoms at 2.36 A ,3 Fe atoms at 2.69 A, and 0-2 O(N) atoms at 2.19 A. The spectral similarity of these results concerning the nifV mutant FeMoco structure is discussed

Potential Hazards Relating to Pyrolysis of c-C4F8O, n-C4F10 and c-C4F8 in selected gaseous diffusion plant operations

International Nuclear Information System (INIS)

Trowbridge, L.D.

2000-01-01

As part of a program intended to replace the present evaporative coolant at the gaseous diffusion plants (GDPs) with a non-ozone-depleting alternate, a series of investigations of the suitability of candidate substitutes is under way. This report summarizes studies directed at estimating the chemical and thermal stability of three candidate coolants, c-C 4 F 8 O, n-C 4 F 10 and c-C 4 4F 8 , in a few specific environments to be found in gaseous diffusion plant operations

Subtelomeric Copy Number Variations: The Importance of 4p/4q Deletions in Patients with Congenital Anomalies and Developmental Disability.

Science.gov (United States)

Novo-Filho, Gil M; Montenegro, Marília M; Zanardo, Évelin A; Dutra, Roberta L; Dias, Alexandre T; Piazzon, Flavia B; Costa, Taís V M M; Nascimento, Amom M; Honjo, Rachel S; Kim, Chong A; Kulikowski, Leslie D

2016-01-01

The most prevalent structural variations in the human genome are copy number variations (CNVs), which appear predominantly in the subtelomeric regions. Variable sizes of 4p/4q CNVs have been associated with several different psychiatric findings and developmental disability (DD). We analyzed 105 patients with congenital anomalies (CA) and developmental and/or intellectual disabilities (DD/ID) using MLPA subtelomeric specific kits (P036 /P070) and 4 of them using microarrays. We found abnormal subtelomeric CNVs in 15 patients (14.3%), including 8 patients with subtelomeric deletions at 4p/4q (53.3%). Additional genomic changes were observed at 1p36, 2q37.3, 5p15.3, 5q35.3, 8p23.3, 13q11, 14q32.3, 15q11.2, and Xq28/Yq12. This indicates the prevalence of independent deletions at 4p/4q, involving PIGG, TRIML2, and FRG1. Furthermore, we identified 15 genes with changes in copy number that contribute to neurological development and/or function, among them CRMP1, SORCS2, SLC25A4, and HELT. Our results highlight the association of genes with changes in copy number at 4p and 4q subtelomeric regions and the DD phenotype. Cytogenomic characterization of additional cases with distal deletions should help clarifying the role of subtelomeric CNVs in neurological diseases. © 2016 S. Karger AG, Basel.

A γA-Crystallin Mouse Mutant Secc with Small Eye, Cataract and Closed Eyelid.

Directory of Open Access Journals (Sweden)

Man Hei Cheng

Full Text Available Cataract is the most common cause of visual loss in humans. A spontaneously occurred, autosomal dominant mouse mutant Secc, which displayed combined features of small eye, cataract and closed eyelid was discovered in our laboratory. In this study, we identified the mutation and characterized the cataract phenotype of this novel Secc mutant. The Secc mutant mice have eyelids that remain half-closed throughout their life. The mutant lens has a significant reduction in size and with opaque spots clustered in the centre. Histological analysis showed that in the core region of the mutant lens, the fiber cells were disorganized and clefts and vacuoles were observed. The cataract phenotype was evident from new born stage. We identified the Secc mutation by linkage analysis using whole genome microsatellite markers and SNP markers. The Secc locus was mapped at chromosome 1 flanked by SNPs rs3158129 and rs13475900. Based on the chromosomal position, the candidate cataract locus γ-crystallin gene cluster (Cryg was investigated by sequencing. A single base deletion (299delG in exon 3 of Cryga which led to a frame-shift of amino acid sequence from position 91 was identified. As a result of this mutation, the sequences of the 3rd and 4th Greek-key motifs of the γA-crystallin are replaced with an unrelated C-terminal peptide of 75 residues long. Coincidentally, the point mutation generated a HindIII restriction site, allowing the identification of the CrygaSecc mutant allele by RFLP. Western blot analysis of 3-week old lenses showed that the expression of γ-crystallins was reduced in the CrygaSecc mutant. Furthermore, in cell transfection assays using CrygaSecc mutant cDNA expression constructs in 293T, COS-7 and human lens epithelial B3 cell lines, the mutant γA-crystallins were enriched in the insoluble fractions and appeared as insoluble aggregates in the transfected cells. In conclusion, we have demonstrated that the Secc mutation leads to the

Developmental and Subcellular Organization of Single-Cell C₄ Photosynthesis in Bienertia sinuspersici Determined by Large-Scale Proteomics and cDNA Assembly from 454 DNA Sequencing.

Science.gov (United States)

Offermann, Sascha; Friso, Giulia; Doroshenk, Kelly A; Sun, Qi; Sharpe, Richard M; Okita, Thomas W; Wimmer, Diana; Edwards, Gerald E; van Wijk, Klaas J

2015-05-01

Kranz C4 species strictly depend on separation of primary and secondary carbon fixation reactions in different cell types. In contrast, the single-cell C4 (SCC4) species Bienertia sinuspersici utilizes intracellular compartmentation including two physiologically and biochemically different chloroplast types; however, information on identity, localization, and induction of proteins required for this SCC4 system is currently very limited. In this study, we determined the distribution of photosynthesis-related proteins and the induction of the C4 system during development by label-free proteomics of subcellular fractions and leaves of different developmental stages. This was enabled by inferring a protein sequence database from 454 sequencing of Bienertia cDNAs. Large-scale proteome rearrangements were observed as C4 photosynthesis developed during leaf maturation. The proteomes of the two chloroplasts are different with differential accumulation of linear and cyclic electron transport components, primary and secondary carbon fixation reactions, and a triose-phosphate shuttle that is shared between the two chloroplast types. This differential protein distribution pattern suggests the presence of a mRNA or protein-sorting mechanism for nuclear-encoded, chloroplast-targeted proteins in SCC4 species. The combined information was used to provide a comprehensive model for NAD-ME type carbon fixation in SCC4 species.

Distinct signaling mechanisms in multiple developmental pathways by the SCRAMBLED receptor of Arabidopsis.

Science.gov (United States)

Kwak, Su-Hwan; Woo, Sooah; Lee, Myeong Min; Schiefelbein, John

2014-10-01

SCRAMBLED (SCM), a leucine-rich repeat receptor-like kinase in Arabidopsis (Arabidopsis thaliana), is required for positional signaling in the root epidermis and for tissue/organ development in the shoot. To further understand SCM action, we generated a series of kinase domain variants and analyzed their ability to complement scm mutant defects. We found that the SCM kinase domain, but not kinase activity, is required for its role in root epidermal patterning, supporting the view that SCM is an atypical receptor kinase. We also describe a previously uncharacterized role for SCM in fruit dehiscence, because mature siliques from scm mutants fail to open properly. Interestingly, the kinase domain of SCM appears to be dispensable for this developmental process. Furthermore, we found that most of the SCM kinase domain mutations dramatically inhibit inflorescence development. Because this process is not affected in scm null mutants, it is likely that SCM acts redundantly to regulate inflorescence size. The importance of distinct kinase residues for these three developmental processes provides an explanation for the maintenance of the conserved kinase domain in the SCM protein, and it may generally explain its conservation in other atypical kinases. Furthermore, these results indicate that individual leucine-rich repeat receptor-like kinases may participate in multiple pathways using distinct signaling mechanisms to mediate diverse cellular communication events. © 2014 American Society of Plant Biologists. All Rights Reserved.

Evaluating Andrographolide as a Potent Inhibitor of NS3-4A Protease and Its Drug-Resistant Mutants Using In Silico Approaches

Directory of Open Access Journals (Sweden)

Vivek Chandramohan

2015-01-01

Full Text Available Current combination therapy of PEG-INF and ribavirin against the Hepatitis C Virus (HCV genotype-1 infections is ineffective in maintaining sustained viral response in 50% of the infection cases. New compounds in the form of protease inhibitors can complement the combination therapy. Asunaprevir is new to the drug regiment as the NS3-4A protease inhibitor, but it is susceptible to two mutations, namely, R155K and D168A in the protein. Thus, in our study, we sought to evaluate Andrographolide, a labdane-diterpenoid from the Andrographis paniculata plant as an effective compound for inhibiting the NS3-4A protease as well as its concomitant drug-resistant mutants by using molecular docking and dynamic simulations. Our study shows that Andrographolide has best docking scores of −15.0862, −15.2322, and −13.9072 compared to those of Asunaprevir −3.7159, −2.6431, and −5.4149 with wild-type R155K and D168A mutants, respectively. Also, as shown in the MD simulations, the compound was good in binding the target proteins and maintains strong bonds causing very less to negligible perturbation in the protein backbone structures. Our results validate the susceptibility of Asunaprevir to protein variants as seen from our docking studies and trajectory period analysis. Therefore, from our study, we hope to add one more option in the drug regiment to tackle drug resistance in HCV infections.

Altered Regulation of the Diguanylate Cyclase YaiC Reduces Production of Type 1 Fimbriae in a Pst Mutant of Uropathogenic Escherichia coli CFT073.

Science.gov (United States)

Crépin, Sébastien; Porcheron, Gaëlle; Houle, Sébastien; Harel, Josée; Dozois, Charles M

2017-12-15

The pst gene cluster encodes the phosphate-specific transport (Pst) system. Inactivation of the Pst system constitutively activates the two-component regulatory system PhoBR and attenuates the virulence of pathogenic bacteria. In uropathogenic Escherichia coli strain CFT073, attenuation by inactivation of pst is predominantly attributed to the decreased expression of type 1 fimbriae. However, the molecular mechanisms connecting the Pst system and type 1 fimbriae are unknown. To address this, a transposon library was constructed in the pst mutant, and clones were tested for a regain in type 1 fimbrial production. Among them, the diguanylate cyclase encoded by yaiC ( adrA in Salmonella ) was identified to connect the Pst system and type 1 fimbrial expression. In the pst mutant, the decreased expression of type 1 fimbriae is connected by the induction of yaiC This is predominantly due to altered expression of the FimBE-like recombinase genes ipuA and ipbA , affecting at the same time the inversion of the fim promoter switch ( fimS ). In the pst mutant, inactivation of yaiC restored fim -dependent adhesion to bladder cells and virulence. Interestingly, the expression of yaiC was activated by PhoB, since transcription of yaiC was linked to the PhoB-dependent phoA-psiF operon. As YaiC is involved in cyclic di-GMP (c-di-GMP) biosynthesis, an increased accumulation of c-di-GMP was observed in the pst mutant. Hence, the results suggest that one mechanism by which deletion of the Pst system reduces the expression of type 1 fimbriae is through PhoBR-mediated activation of yaiC , which in turn increases the accumulation of c-di-GMP, represses the fim operon, and, consequently, attenuates virulence in the mouse urinary tract infection model. IMPORTANCE Urinary tract infections (UTIs) are common bacterial infections in humans. They are mainly caused by uropathogenic Escherichia coli (UPEC). We previously showed that interference with phosphate homeostasis decreases the

Further studies on O2-resistant photosynthesis and photorespiration in a tobacco mutant with enhanced catalase activity

International Nuclear Information System (INIS)

Zelitch, I.

1990-01-01

The increase in net photosynthesis in M 4 progeny of an O 2 -resistant tobacco (Nicotiana tabacum) mutant relative to wild-type plants at 21 and 42% O 2 has been confirmed and further investigated. Self-pollination of an M 3 mutant produced M 4 progeny segregating high catalase phenotypes (average 40% greater than wild type) at a frequency of about 60%. The high catalase phenotype cosegregated precisely with O 2 -resistant photosynthesis. About 25% of the F 1 progeny of reciprocal crosses between the same M 3 mutant and wild type had high catalase activity, whether the mutant was used as the maternal or paternal parent, indicating nuclear inheritance. In high-catalase mutants the activity of NADH-hydroxypyruvate reductase, another peroxisomal enzyme, was the same as wild type. The mutants released 15% less photorespiratory CO 2 as a percent of net photosynthesis in CO 2 -free 21% O 2 and 36% less in CO 2 -free 42% O 2 compared with wild type. The mutant leaf tissue also released less 14 CO 2 per [1- 14 C]glycolate metabolized than wild type in normal air, consistent with less photorespiration in the mutant. The O 2 -resistant photosynthesis appears to be caused by a decrease in photorespiration especially under conditions of high O 2 where the stoichiometry of CO 2 release per glycolate metabolized is expected to be enhanced. The higher catalase activity in the mutant may decrease the nonenzymatic peroxidation of keto-acids such as hydroxypyruvate and glyoxylate by photorespiratory H 2 O 2

E4orf1 Limits the Oncolytic Potential of the E1B-55K Deletion Mutant Adenovirus▿

Science.gov (United States)

Thomas, Michael A.; Broughton, Robin S.; Goodrum, Felicia D.; Ornelles, David A.

2009-01-01

Clinical trials have shown oncolytic adenoviruses to be tumor selective with minimal toxicity toward normal tissue. The virus ONYX-015, in which the gene encoding the early region 1B 55-kDa (E1B-55K) protein is deleted, has been most effective when used in combination with either chemotherapy or radiation therapy. Therefore, improving the oncolytic nature of tumor-selective adenoviruses remains an important objective for improving this form of cancer therapy. Cells infected during the G1 phase of the cell cycle with the E1B-55K deletion mutant virus exhibit a reduced rate of viral late protein synthesis, produce fewer viral progeny, and are less efficiently killed than cells infected during the S phase. Here we demonstrate that the G1 restriction imposed on the E1B-55K deletion mutant virus is due to the viral oncogene encoded by open reading frame 1 of early region 4 (E4orf1). E4orf1 has been reported to signal through the phosphatidylinositol 3′-kinase pathway leading to the activation of Akt, mTOR, and p70 S6K. Evidence presented here shows that E4orf1 may also induce the phosphorylation of Akt and p70 S6K in a manner that depends on Rac1 and its guanine nucleotide exchange factor Tiam1. Accordingly, agents that have been reported to disrupt the Tiam1-Rac1 interaction or to prevent phosphorylation of the ribosomal S6 kinase partially alleviated the E4orf1 restriction to late viral protein synthesis and enhanced tumor cell killing by the E1B-55K mutant virus. These results demonstrate that E4orf1 limits the oncolytic nature of a conditionally replicating adenovirus such as ONYX-015. The therapeutic value of similar oncolytic adenoviruses may be improved by abrogating E4orf1 function. PMID:19129452

E4orf1 limits the oncolytic potential of the E1B-55K deletion mutant adenovirus.

Science.gov (United States)

Thomas, Michael A; Broughton, Robin S; Goodrum, Felicia D; Ornelles, David A

2009-03-01

Clinical trials have shown oncolytic adenoviruses to be tumor selective with minimal toxicity toward normal tissue. The virus ONYX-015, in which the gene encoding the early region 1B 55-kDa (E1B-55K) protein is deleted, has been most effective when used in combination with either chemotherapy or radiation therapy. Therefore, improving the oncolytic nature of tumor-selective adenoviruses remains an important objective for improving this form of cancer therapy. Cells infected during the G(1) phase of the cell cycle with the E1B-55K deletion mutant virus exhibit a reduced rate of viral late protein synthesis, produce fewer viral progeny, and are less efficiently killed than cells infected during the S phase. Here we demonstrate that the G(1) restriction imposed on the E1B-55K deletion mutant virus is due to the viral oncogene encoded by open reading frame 1 of early region 4 (E4orf1). E4orf1 has been reported to signal through the phosphatidylinositol 3'-kinase pathway leading to the activation of Akt, mTOR, and p70 S6K. Evidence presented here shows that E4orf1 may also induce the phosphorylation of Akt and p70 S6K in a manner that depends on Rac1 and its guanine nucleotide exchange factor Tiam1. Accordingly, agents that have been reported to disrupt the Tiam1-Rac1 interaction or to prevent phosphorylation of the ribosomal S6 kinase partially alleviated the E4orf1 restriction to late viral protein synthesis and enhanced tumor cell killing by the E1B-55K mutant virus. These results demonstrate that E4orf1 limits the oncolytic nature of a conditionally replicating adenovirus such as ONYX-015. The therapeutic value of similar oncolytic adenoviruses may be improved by abrogating E4orf1 function.

Improved yields of daunomycinone glycosides in developmental mutants of Streptomyces coeruleorubidus

International Nuclear Information System (INIS)

Blumauerova, M.; Pokorny, V.; Stastna, J.; Hostalek, Z.; Vanek, Z.

1978-01-01

When improving Streptomyces coeruleorubidus JA 10092, a producer of antibiotics of the daunomycinone complex, the most active variants were found among isolates of morphological types bld-1 (with a suppressed production of the aerial mycelium on organic media containing glucose) and whi (with an asporogenic aerial mycelium on glucose media and with the bald phenotype on media containing starch). Submerged cultures of the whi mutants produced increased quantities of daunomycinone glycosides in the antibiotic complex, the amount of free anthracyclinones being simultaneously decreased. The whi strains differed from the wild type also in higher demands for aeration, concentration of glucose and in an increased production capacity in starch media. The overall antibiotic activity increased more than 40 times after a six-step selection (application of UV light, γ-radiation, nitrous acid and natural spreads) combined with an altered fermentation technology. (author)

Hypolipidemic effects of starch and γ-oryzanol from wx/ae double-mutant rice on BALB/c.KOR-Apoe(shl) mice.

Science.gov (United States)

Nakaya, Makoto; Shojo, Aiko; Hirai, Hiroaki; Matsumoto, Kenji; Kitamura, Shinichi

2013-01-01

waxy/amylose-extender (wx/ae) double-mutant japonica rice (Oryza sativa L.) produces resistant starch (RS) and a large amount of γ-oryzanol. Our previous study has shown the hypolipidemic effect of wx/ae brown rice on mice. To identify the functional constituents of the hypolipidemic activity in wx/ae rice, we prepared pure wx/ae starch and γ-oryzanol from wx/ae rice and investigated their effect on the lipid metabolism in BALB/c.KOR/Stm Slc-Apoe(shl) mice. The mice were fed for 3 weeks a diet containing non-mutant rice starch, non-mutant rice starch plus γ-oryzanol, wx/ae starch, or wx/ae starch plus γ-oryzanol. γ-Oryzanol by itself had no effect on the lipid metabolism, and wx/ae starch prevented an accumulation of triacylglycerol (TAG) in the liver. Interestingly, the combination of wx/ae starch plus γ-oryzanol not only prevented a TAG accumulation in the liver, but also partially suppressed the rise in plasma TAG concentration, indicating that wx/ae starch and γ-oryzanol could have a synergistic effect on the lipid metabolism.

Plant cells without detectable plastids are generated in the crumpled leaf mutant of Arabidopsis thaliana.

Science.gov (United States)

Chen, Yuling; Asano, Tomoya; Fujiwara, Makoto T; Yoshida, Shigeo; Machida, Yasunori; Yoshioka, Yasushi

2009-05-01

Plastids are maintained in cells by proliferating prior to cell division and being partitioned to each daughter cell during cell division. It is unclear, however, whether cells without plastids are generated when plastid division is suppressed. The crumpled leaf (crl) mutant of Arabidopsis thaliana is a plastid division mutant that displays severe abnormalities in plastid division and plant development. We show that the crl mutant contains cells lacking detectable plastids; this situation probably results from an unequal partitioning of plastids to each daughter cell. Our results suggest that crl has a partial defect in plastid expansion, which is suggested to be important in the partitioning of plastids to daughter cells when plastid division is suppressed. The absence of cells without detectable plastids in the accumulation and replication of chloroplasts 6 (arc6) mutant, another plastid division mutant of A. thaliana having no significant defects in plant morphology, suggests that the generation of cells without detectable plastids is one of the causes of the developmental abnormalities seen in crl plants. We also demonstrate that plastids with trace or undetectable amounts of chlorophyll are generated from enlarged plastids by a non-binary fission mode of plastid replication in both crl and arc6.

Radiation studies in Cajanus cajan: meiotic behaviour in some M/sub 2/ mutants

Energy Technology Data Exchange (ETDEWEB)

Sinha, S.S.N.; Akhaury, S.B. (Ranchi Univ. (India). Dept. of Botany)

1982-01-01

A qualitative study of the mutants produced in M/sub 2/ generation has been made. The mutants were classified as: (1) chlorophyll mutant, (2) morphological mutant, (3) pollen mutant, (4) semi-sterile and (5) sterile mutant. Cytological investigations of pollen mutants, sterile and semi-sterile mutants have revealed that these mutants generally arise at higher dose levels (20 Kr and 25 Kr).

DEVELOPMENTAL TAXONOMY OF CONDUCT DISORDER

OpenAIRE

Jelena Kostić; Milkica Nešić; Jasminka Marković; Miodrag Stanković

2015-01-01

Conduct disorder is a heterogeneous disorder in terms of etiology, course and prognosis, and currently, there is no singular model that would describe the development of the disorder. The results of empirical research on males confirm this heterogeneity, as they point out to two possible developmental pathways: childhood-onset and adolescentonset type. This paper presents the basic elements of developmental taxonomic theory which argues that there are two different developmental pathways to c...

Major alterations in transcript profiles between C3-C4 and C4 photosynthesis of an amphibious species Eleocharis baldwinii.

Science.gov (United States)

Chen, Taiyu; Zhu, Xin-Guang; Lin, Yongjun

2014-09-01

Engineering C4 photosynthetic metabolism into C3 crops is regarded as a major strategy to increase crop productivity, and clarification of the evolutionary processes of C4 photosynthesis can help the better use of this strategy. Here, Eleocharis baldwinii, a species in which C4 photosynthesis can be induced from a C3-C4 state under either environmental or ABA treatments, was used to identify the major transcriptional modifications during the process from C3-C4 to C4. The transcriptomic comparison suggested that in addition to the major differences in C4 core pathway, the pathways of glycolysis, citrate acid metabolism and protein synthesis were dramatically modified during the inducement of C4 photosynthetic states. Transcripts of many transporters, including not only metabolite transporters but also ion transporters, were dramatically increased in C4 photosynthetic state. Many candidate regulatory genes with unidentified functions were differentially expressed in C3-C4 and C4 photosynthetic states. Finally, it was indicated that ABA, auxin signaling and DNA methylation play critical roles in the regulation of C4 photosynthesis. In summary, by studying the different photosynthetic states of the same species, this work provides the major transcriptional differences between C3-C4 and C4 photosynthesis, and many of the transcriptional differences are potentially related to C4 development and therefore are the potential targets for reverse genetics studies.

Structure of the lamin A/C R482W mutant responsible for dominant familial partial lipodystrophy (FPLD)

Energy Technology Data Exchange (ETDEWEB)

Magracheva, Eugenia; Kozlov, Serguei; Stewart, Colin L.; Wlodawer, Alexander; Zdanov, Alexander; (NCI)

2009-08-07

Proteins of the A-type lamin family, which consists of two members, lamin A and lamin C, are the major components of a thin proteinaceous filamentous meshwork, the lamina, that underlies the inner nuclear membrane. A-type lamins have recently become the focus of extensive functional studies as a consequence of the linking of at least eight congenital diseases to mutations in the lamin A/C gene (LMNA). This spectrum of pathologies, which mostly manifest themselves as dominant traits, includes muscle dystrophies, dilated cardiomyopathies, the premature aging syndrome Hutchinson-Guilford progeria and familial partial lipodystrophy (FPLD). The crystal structure of the lamin A/C mutant R482W, a variant that causes FPLD, has been determined at 1.5 {angstrom} resolution. A completely novel aggregation state of the C-terminal globular domain and the position of the mutated amino-acid residue suggest means by which the mutation may affect lamin A/C-protein and protein-DNA interactions.

One of the Two Genes Encoding Nucleoid-Associated HU Proteins in Streptomyces coelicolor Is Developmentally Regulated and Specifically Involved in Spore Maturation▿ †

Science.gov (United States)

Salerno, Paola; Larsson, Jessica; Bucca, Giselda; Laing, Emma; Smith, Colin P.; Flärdh, Klas

2009-01-01

Streptomyces genomes encode two homologs of the nucleoid-associated HU proteins. One of them, here designated HupA, is of a conventional type similar to E. coli HUα and HUβ, while the other, HupS, is a two-domain protein. In addition to the N-terminal part that is similar to that of HU proteins, it has a C-terminal domain that is similar to the alanine- and lysine-rich C termini of eukaryotic linker histones. Such two-domain HU proteins are found only among Actinobacteria. In this phylum some organisms have only a single HU protein of the type with a C-terminal histone H1-like domain (e.g., Hlp in Mycobacterium smegmatis), while others have only a single conventional HU. Yet others, including the streptomycetes, produce both types of HU proteins. We show here that the two HU genes in Streptomyces coelicolor are differentially regulated and that hupS is specifically expressed during sporulation, while hupA is expressed in vegetative hyphae. The developmental upregulation of hupS occurred in sporogenic aerial hyphal compartments and was dependent on the developmental regulators whiA, whiG, and whiI. HupS was found to be nucleoid associated in spores, and a hupS deletion mutant had an average nucleoid size in spores larger than that in the parent strain. The mutant spores were also defective in heat resistance and spore pigmentation, although they possessed apparently normal spore walls and displayed no increased sensitivity to detergents. Overall, the results show that HupS is specifically involved in sporulation and may affect nucleoid architecture and protection in spores of S. coelicolor. PMID:19717607

A fasciclin-like arabinogalactan-protein (FLA mutant of Arabidopsis thaliana, fla1, shows defects in shoot regeneration.

Directory of Open Access Journals (Sweden)

Kim L Johnson

Full Text Available BACKGROUND: The fasciclin-like arabinogalactan-proteins (FLAs are an enigmatic class of 21 members within the larger family of arabinogalactan-proteins (AGPs in Arabidopsis thaliana. Located at the cell surface, in the cell wall/plasma membrane, they are implicated in many developmental roles yet their function remains largely undefined. Fasciclin (FAS domains are putative cell-adhesion domains found in extracellular matrix proteins of organisms from all kingdoms, but the juxtaposition of FAS domains with highly glycosylated AGP domains is unique to plants. Recent studies have started to elucidate the role of FLAs in Arabidopsis development. FLAs containing a single FAS domain are important for the integrity and elasticity of the plant cell wall matrix (FLA11 and FLA12 and FLA3 is involved in microspore development. FLA4/SOS5 with two FAS domains and two AGP domains has a role in maintaining proper cell expansion under salt stressed conditions. The role of other FLAs remains to be uncovered. METHOD/PRINCIPAL FINDINGS: Here we describe the characterisation of a T-DNA insertion mutant in the FLA1 gene (At5g55730. Under standard growth conditions fla1-1 mutants have no obvious phenotype. Based on gene expression studies, a putative role for FLA1 in callus induction was investigated and revealed that fla1-1 has a reduced ability to regenerate shoots in an in vitro shoot-induction assay. Analysis of FLA1p:GUS reporter lines show that FLA1 is expressed in several tissues including stomata, trichomes, the vasculature of leaves, the primary root tip and in lateral roots near the junction of the primary root. CONCLUSION: The results of the developmental expression of FLA1 and characterisation of the fla1 mutant support a role for FLA1 in the early events of lateral root development and shoot development in tissue culture, prior to cell-type specification.

Grain product of 34 soya mutant lines;Rendimiento de grano de 34 lineas mutantes de soya

Energy Technology Data Exchange (ETDEWEB)

Salmeron E, J.; Mastache L, A. A.; Valencia E, F.; Diaz V, G. E. [Colegio Superior Agropecuario del Estado de Guerrero, Vicente Guerrero No. 81, Col. Centro, 40000 Iguala, Guerrero (Mexico); Cervantes S, T. [Instituto de Recursos Geneticos y Productividad, Colegio de Posgraduados, Carretera Mexico-Texcoco Km. 36.5, Montecillo, 56230 Texcoco, Estado de Mexico (Mexico); De la Cruz T, E.; Garcia A, J. M.; Falcon B, T.; Gatica T, M. A. [ININ, Departamento de Biologia, Carretera Mexico-Toluca s/n, 52750 Ocoyoacac, Estado de Mexico (Mexico)

2009-07-01

This work was development with the objective of obtaining information of the agronomic behavior of 34 soya mutant lines (R{sub 4}M{sub 18}) for human consumption and this way to select the 2 better lines. The genetic materials were obtained starting from the variety ISAAEG-B M2 by means of the application of recurrent radiation with Co{sup 60} gammas, to a dose of 350 Gray for the first two generations and both later to 200 Gray and selection during 17 cycles, being obtained the 34 better lines mutants with agronomic characteristic wanted and good flavor. The obtained results were that the mutant lines L{sub 25} and L{sub 32} produced the major quantity in branches/plant number with 7.5 and 7.25, pods/plant number with 171.25 and 167, grains/plant number with 350.89 and 333.07 and grain product (ton/ha) to 15% of humidity 5.15 and 4.68 ton/ha, respectively. (Author)

Inherited phenotype instability of inflorescence and floral organ development in homeotic barley double mutants and its specific modification by auxin inhibitors and 2,4-D.

Science.gov (United States)

Šiukšta, Raimondas; Vaitkūnienė, Virginija; Kaselytė, Greta; Okockytė, Vaiva; Žukauskaitė, Justina; Žvingila, Donatas; Rančelis, Vytautas

2015-03-01

Barley (Hordeum vulgare) double mutants Hv-Hd/tw2, formed by hybridization, are characterized by inherited phenotypic instability and by several new features, such as bract/leaf-like structures, long naked gaps in the spike, and a wide spectrum of variations in the basic and ectopic flowers, which are absent in single mutants. Several of these features resemble those of mutations in auxin distribution, and thus the aim of this study was to determine whether auxin imbalances are related to phenotypic variations and instability. The effects of auxin inhibitors and 2,4-D (2,4-dichlorophenoxyacetic acid) on variation in basic and ectopic flowers were therefore examined, together with the effects of 2,4-D on spike structure. The character of phenotypic instability and the effects of auxin inhibitors and 2,4-D were compared in callus cultures and intact plants of single homeotic Hv-tw2 and Hv-Hooded/Kap (in the BKn3 gene) mutants and alternative double mutant lines: offspring from individual plants in distal hybrid generations (F9-F10) that all had the same BKn3 allele as determined by DNA sequencing. For intact plants, two auxin inhibitors, 9-hydroxyfluorene-9-carboxylic acid (HFCA) and p-chlorophenoxyisobutyric acid (PCIB), were used. Callus growth and flower/spike structures of the Hv-tw2 mutant differed in their responses to HFCA and PCIB. An increase in normal basic flowers after exposure to auxin inhibitors and a decrease in their frequencies caused by 2,4-D were observed, and there were also modifications in the spectra of ectopic flowers, especially those with sexual organs, but the effects depended on the genotype. Exposure to 2,4-D decreased the frequency of short gaps and lodicule transformations in Hv-tw2 and of long naked gaps in double mutants. The effects of auxin inhibitors and 2,4-D suggest that ectopic auxin maxima or deficiencies arise in various regions of the inflorescence/flower primordia. Based on the phenotypic instability observed, definite

Regulation of 1, 4, 5-triphosphate receptor channel gating dynamics by mutant presenilin in Alzheimer's disease cells

Science.gov (United States)

Wei, Fang; Li, Xiang; Cai, Meichun; Liu, Yanping; Jung, Peter; Shuai, Jianwei

2017-06-01

In neurons of patients with Alzheimer's disease, the intracellular Ca2+ concentration is increased by its release from the endoplasmic reticulum via the inositol 1, 4, 5-triphosphate receptor (IP3R). In this paper, we discuss the IP3R gating dynamics in familial Alzheimer's disease (FAD) cells induced with presenilin mutation PS1. By fitting the parameters of an IP3R channel model to experimental data of the open probability, the mean open time and the mean closed time of IP3R channels, in control cells and FAD mutant cells, we suggest that the interaction of presenilin mutation PS1 with IP3R channels leads the decrease in the unbinding rates of IP3 and the activating Ca2+ from IP3Rs. As a result, the increased affinities of IP3 and activating Ca2+ for IP3R channels induce the increase in the Ca2+ signal in FAD mutant cells. Specifically, the PS1 mutation decreases the IP3 dissociation rate of IP3R channels significantly in FAD mutant cells. Our results suggest possible novel targets for FAD therapeutic intervention.

Understanding the -C-X1-X2-C- motif in the active site of the thioredoxin superfamily: E. coli DsbA and its mutants as a model system.

Science.gov (United States)

Karshikoff, Andrey; Nilsson, Lennart; Foloppe, Nicolas

2013-08-27

E. coli DsbA is an intensively studied enzyme of the thioredoxin superfamily of thiol-disulfide oxidoreductases. DsbA catalyzes the disulfide bond formation and folding of proteins in the bacterial periplasm. DsbA and its mutants have highlighted the strong and puzzling influence of the -C-X1-X2-C- active site variants, found across the thioredoxin superfamily, on the ionization and redox properties of this site. However, the interpretation of these observations remains wanting, largely due to a dearth of structural information. Here, molecular dynamics simulations are used to provide extensive information on the structure and dynamics of reduced -C30-X31-X32-C33- motifs in wild type DsbA and 13 of its mutants. These simulations are combined with calculations of the pK of H32 and of the very low pK of the catalytic cysteine C30. In wild type DsbA, the titrations of C30 and H32 are shown to be coupled; the protonation states and dynamics of H32 are examined. The thiolate of C30 is stabilized by hydrogen bonds with the protein. Modulation of these hydrogen bonds by alteration of residue X32 has the greatest impact on the pK of C30, which rationalizes its higher pK in thioredoxin and tryparedoxin. Because of structural constrains, residue X31 has only an indirect and weak influence on the pK of C30. The dynamics of C30 is clearly related to its stabilizing interactions and pK value. Although relatively small differences between pKs were not reproduced in the calculations, the major trends are explained, adding new insights to our understanding of enzymes in this family.

Characterization of novel Sorghum brown midrib mutants from an EMS-mutagenized population.

Science.gov (United States)

Sattler, Scott E; Saballos, Ana; Xin, Zhanguo; Funnell-Harris, Deanna L; Vermerris, Wilfred; Pedersen, Jeffrey F

2014-09-02

Reducing lignin concentration in lignocellulosic biomass can increase forage digestibility for ruminant livestock and saccharification yields of biomass for bioenergy. In sorghum (Sorghum bicolor (L.) Moench) and several other C4 grasses, brown midrib (bmr) mutants have been shown to reduce lignin concentration. Putative bmr mutants isolated from an EMS-mutagenized population were characterized and classified based on their leaf midrib phenotype and allelism tests with the previously described sorghum bmr mutants bmr2, bmr6, and bmr12. These tests resulted in the identification of additional alleles of bmr2, bmr6, and bmr12, and, in addition, six bmr mutants were identified that were not allelic to these previously described loci. Further allelism testing among these six bmr mutants showed that they represented four novel bmr loci. Based on this study, the number of bmr loci uncovered in sorghum has doubled. The impact of these lines on agronomic traits and lignocellulosic composition was assessed in a 2-yr field study. Overall, most of the identified bmr lines showed reduced lignin concentration of their biomass relative to wild-type (WT). Effects of the six new bmr mutants on enzymatic saccharification of lignocellulosic materials were determined, but the amount of glucose released from the stover was similar to WT in all cases. Like bmr2, bmr6, and bmr12, these mutants may affect monolignol biosynthesis and may be useful for bioenergy and forage improvement when stacked together or in combination with the three previously described bmr alleles. Copyright © 2014 Sattler et al.

Developmental validation of the PowerPlex(®) Fusion 6C System.

Science.gov (United States)

Ensenberger, Martin G; Lenz, Kristy A; Matthies, Learden K; Hadinoto, Gregory M; Schienman, John E; Przech, Angela J; Morganti, Michael W; Renstrom, Daniel T; Baker, Victoria M; Gawrys, Kori M; Hoogendoorn, Marlijn; Steffen, Carolyn R; Martín, Pablo; Alonso, Antonio; Olson, Hope R; Sprecher, Cynthia J; Storts, Douglas R

2016-03-01

The PowerPlex(®) Fusion 6C System is a 27-locus, six-dye, multiplex that includes all markers in the expanded CODIS core loci and increases overlap with STR database standards throughout the world. Additionally, it contains two, rapidly mutating, Y-STRs and is capable of both casework and database workflows, including direct amplification. A multi-laboratory developmental validation study was performed on the PowerPlex(®) Fusion 6C System. Here, we report the results of that study which followed SWGDAM guidelines and includes data for: species specificity, sensitivity, stability, precision, reproducibility and repeatability, case-type samples, concordance, stutter, DNA mixtures, and PCR-based procedures. Where appropriate we report data from both extracted DNA samples and direct amplification samples from various substrates and collection devices. Samples from all studies were separated on both Applied Biosystems 3500 series and 6-dye capable 3130 series Genetic Analyzers and data is reported for each. Together, the data validate the design and demonstrate the performance of the PowerPlex(®) Fusion 6C System. Copyright © 2015 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

Developmental pathways in infants from 4 to 24 months.

Science.gov (United States)

Valla, L; Birkeland, M S; Hofoss, D; Slinning, K

2017-07-01

There has been limited epidemiological research describing population-based samples regarding developmental pathways throughout infancy, and the research that exists has revealed substantial diversity. Identifying predictors for developmental pathways can inform early intervention services. The Ages and Stages Questionnaire was used to measure communication, gross motor, fine motor, problem-solving and personal-social skills longitudinally in a large, population-based sample of 1555 infants recruited from well-baby clinics in five municipalities in southeast Norway. We conducted latent class analyses to identify common pathways within the five developmental areas. Our results indicated that most classes of infants showed generally positive and stable normative developmental pathways. However, for communication and gross motor areas, more heterogeneity was found. For gross motor development, a class of 10% followed a U-shaped curve. A class of 8% had a declining communication pathway and did not reach the level of the high stable communication class at 24 months. Low gestational age, low Apgar score, male sex, maternal depression symptoms, non-Scandinavian maternal ethnicity and high maternal education significantly predict less beneficial communication pathways. The results suggest that infants with low gestational age, low Apgar score, male sex and a mother with depression symptoms or non-Scandinavian ethnicity may be at risk of developing less beneficial developmental pathways, especially within the communication area. Targeting these infants for surveillance and support might be protective against delayed development in several areas during a critical window of development. © 2017 John Wiley & Sons Ltd.

Pre-thymic somatic mutation leads to high mutant frequency at hypoxanthine-guanine phosphoribosyltransferase gene

Energy Technology Data Exchange (ETDEWEB)

Jett, J. [Lawrence Livermore National Lab., CA (United States)

1994-12-01

While characterizing the background mutation spectrum of the Hypoxathine-guanine phosphoribosyltransferase (HPRT) gene in a healthy population, an outlier with a high mutant frequency of thioguanine resistant lymphocytes was found. When studied at the age of 46, this individual had been smoking 60 cigarettes per day for 38 years. His mutant frequency was calculated at 3.6 and 4.2x10{sup {minus}4} for two sampling periods eight months apart. Sequencing analysis of the HPRT gene in his mutant thioguanine resistant T lymphocytes was done to find whether the cells had a high rate of mutation, or if the mutation was due to a single occurrence of mutation and, if so, when in the T lymphocyte development the mutation occurred. By T-cell receptor analysis it has been found that out of 35 thioguanine resistant clones there was no dominant gamma T cell receptor gene rearrangement. During my appointment in the Science & Engineering Research Semester, I found that 34 of those clones have the same base substitution of G{yields}T at cDNA position 197. Due to the consistent mutant frequency from both sampling periods and the varying T cell receptors, the high mutant frequency cannot be due to recent proliferation of a mature mutant T lymphocyte. From the TCR and DNA sequence analysis we conclude that the G{yields}T mutation must have occurred in a T lymphocyte precursor before thymic differentiation so that the thioguanine resistant clones share the same base substitution but not the same gamma T cell receptor gene.

KV4.3 N-terminal deletion mutant Δ2–39

Science.gov (United States)

Hovind, Laura J; Skerritt, Matthew R

2011-01-01

Gating transitions in the KV4.3 N-terminal deletion mutant Δ2–39 were characterized in the absence and presence of KChIP2b. We particularly focused on gating characteristics of macroscopic (open state) versus closed state inactivation (CSI) and recovery. In the absence of KChIP2b Δ2–39 did not significantly alter the steady-state activation “a4” relationship or general CSI characteristics, but it did slow the kinetics of deactivation, macroscopic inactivation and macroscopic recovery. Recovery kinetics (for both WT KV4.3 and Δ2–39) were complicated and displayed sigmoidicity, a process which was enhanced by Δ2–39. Deletion of the proximal N-terminal domain therefore appeared to specifically slow mechanisms involved in regulating gating transitions occurring after the channel open state(s) had been reached. In the presence of KChIP2b Δ2–39 recovery kinetics (from both macroscopic and CSI) were accelerated, with an apparent reduction in initial sigmoidicity. Hyperpolarizing shifts in both “a4” and isochronal inactivation “i” were also produced. KChIP2b-mediated remodeling of KV4.3 gating transitions was therefore not obligatorily dependent upon an intact N-terminus. To account for these effects we propose that KChIP2 regulatory domains exist in KV4.3 α subunit regions outside of the proximal N-terminal. In addition to regulating macroscopic inactivation, we also propose that the KV4.3 N-terminus may act as a novel regulator of deactivation-recovery coupling. PMID:21057209

Real-time PCR quantification of human complement C4A and C4B genes

Directory of Open Access Journals (Sweden)

Fust George

2006-01-01

Full Text Available Abstract Background The fourth component of human complement (C4, an essential factor of the innate immunity, is represented as two isoforms (C4A and C4B in the genome. Although these genes differ only in 5 nucleotides, the encoded C4A and C4B proteins are functionally different. Based on phenotypic determination, unbalanced production of C4A and C4B is associated with several diseases, such as systemic lupus erythematosus, type 1 diabetes, several autoimmune diseases, moreover with higher morbidity and mortality of myocardial infarction and increased susceptibility for bacterial infections. Despite of this major clinical relevance, only low throughput, time and labor intensive methods have been used so far for the quantification of C4A and C4B genes. Results A novel quantitative real-time PCR (qPCR technique was developed for rapid and accurate quantification of the C4A and C4B genes applying a duplex, TaqMan based methodology. The reliable, single-step analysis provides the determination of the copy number of the C4A and C4B genes applying a wide range of DNA template concentration (0.3–300 ng genomic DNA. The developed qPCR was applied to determine C4A and C4B gene dosages in a healthy Hungarian population (N = 118. The obtained data were compared to the results of an earlier study of the same population. Moreover a set of 33 samples were analyzed by two independent methods. No significant difference was observed between the gene dosages determined by the employed techniques demonstrating the reliability of the novel qPCR methodology. A Microsoft Excel worksheet and a DOS executable are also provided for simple and automated evaluation of the measured data. Conclusion This report describes a novel real-time PCR method for single-step quantification of C4A and C4B genes. The developed technique could facilitate studies investigating disease association of different C4 isotypes.

Variability of Streptomyces narbonesis producing ν-1,3/1,4 glucanglucan hydrolasi induced by UV and mitomycin C

International Nuclear Information System (INIS)

Elinov, N.P.; Pronina, M.I.; Zaikina, N.A.; Azizov, P.I.

1982-01-01

Effect of mitomycin c and ultraviolet rays on spores and spore sprouts of 2 hour old of Streptomyces narbonensis of 2a producer of ν-1.3/1.4 glucanglucanhydrolase (ν-gluconase) has been studied. It is shown that the lethal effect of mitomycin c on spore sprouts is considerably higher than on producer spores. Mutageneous activity of mitomycin C is closely related to the process of spore germination. Under the effect of mitomycin C on spore sprouts noted is higher mutability as compared with the effect on spores. Frequency of morphological mutations is lower under the effect of ultraviolet rays as compared with the effect of mitomycin C. Under ultraviolet rays produced were mutants synthesizing during fermentation on medium without inductor of exotype ν-gluconase

Genetic screens to identify new Notch pathway mutants in Drosophila.

Science.gov (United States)

Giagtzoglou, Nikolaos

2014-01-01

Notch signaling controls a wide range of developmental processes, including proliferation, apoptosis, and cell fate specification during both development and adult tissue homeostasis. The functional versatility of the Notch signaling pathway is tightly linked with the complexity of its regulation in different cellular contexts. To unravel the complexity of Notch signaling, it is important to identify the different components of the Notch signaling pathway. A powerful strategy to accomplish this task is based on genetic screens. Given that the developmental context of signaling is important, these screens should be customized to specific cell populations or tissues. Here, I describe how to perform F1 clonal forward genetic screens in Drosophila to identify novel components of the Notch signaling pathway. These screens combine a classical EMS (ethyl methanesulfonate) chemical mutagenesis protocol along with clonal analysis via FRT-mediated mitotic recombination. These F1 clonal screens allow rapid phenotypic screening within clones of mutant cells induced at specific developmental stages and in tissues of interest, bypassing the pleiotropic effects of isolated mutations. More importantly, since EMS mutations have been notoriously difficult to map to specific genes in the past, I briefly discuss mapping methods that allow rapid identification of the causative mutations.

Attenuated bioluminescent Brucella melitensis mutants GR019 (virB4), GR024 (galE), and GR026 (BMEI1090-BMEI1091) confer protection in mice.

Science.gov (United States)

Rajashekara, Gireesh; Glover, David A; Banai, Menachem; O'Callaghan, David; Splitter, Gary A

2006-05-01

In vivo bioluminescence imaging is a persuasive approach to investigate a number of issues in microbial pathogenesis. Previously, we have applied bioluminescence imaging to gain greater insight into Brucella melitensis pathogenesis. Endowing Brucella with bioluminescence allowed direct visualization of bacterial dissemination, pattern of tissue localization, and the contribution of Brucella genes to virulence. In this report, we describe the pathogenicity of three attenuated bioluminescent B. melitensis mutants, GR019 (virB4), GR024 (galE), and GR026 (BMEI1090-BMEI1091), and the dynamics of bioluminescent virulent bacterial infection following vaccination with these mutants. The virB4, galE, and BMEI1090-BMEI1091 mutants were attenuated in interferon regulatory factor 1-deficient (IRF-1(-/-)) mice; however, only the GR019 (virB4) mutant was attenuated in cultured macrophages. Therefore, in vivo imaging provides a comprehensive approach to identify virulence genes that are relevant to in vivo pathogenesis. Our results provide greater insights into the role of galE in virulence and also suggest that BMEI1090 and downstream genes constitute a novel set of genes involved in Brucella virulence. Survival of the vaccine strain in the host for a critical period is important for effective Brucella vaccines. The galE mutant induced no changes in liver and spleen but localized chronically in the tail and protected IRF-1(-/-) and wild-type mice from virulent challenge, implying that this mutant may serve as a potential vaccine candidate in future studies and that the direct visualization of Brucella may provide insight into selection of improved vaccine candidates.

Isolation and characterization of MMS-sensitive mutants of Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Prakash, L.; Prakash, S.

1977-01-01

We have isolated mutants sensitive to methyl methanesulfonate (MMS) in Saccharomyces cerevisiae. Alleles of rad1, rad4, rad6, rad52, rad55 and rad57 were found among these mms mutants. Twenty-nine of the mms mutants which complement the existing radiation-sensitive (rad and rev) mutants belong to 22 new complementation groups. Mutants from five complementation groups are sensitive only to MMS. Mutants of 11 complementation groups are sensitive to uv or x rays in addition to MMS, mutants of six complementation groups are sensitive to all three agents. The cross-sensitivities of these mms mutants to uv and x rays are discussed in terms of their possible involvement in DNA repair. Sporulation is reduced or absent in homozygous diploids of mms mutants from nine complementation groups

PedonnanceofE3rly MatUring MutantS Derived from ''SuPa'~ Rice ...

African Journals Online (AJOL)

Vienna, Austria in 1994. The dry seeds were in-adiated with gamma rays using three doses (170, 210. --iifid 24OC;Y).frOm C.obalt 60 (lCO) in order shorten the plant height and maturity period. From the resulting mutant. PoPulations ortgindtiriifroni modified single seed descent method, five Jery early maturing lines plus the ...

Mutation induction of pleurotus ferulae by low-energy N+ ion implantation and characters of the selected mutant

International Nuclear Information System (INIS)

Chen Henglei; Wan Honggui; Zhang Jun; Zeng Xianxian

2008-01-01

In order to obtain Pleurotus ferulae with high temperature tolerance, mycelium mono-cells of wild type strain ACK was treated by nitrogen ion (5-30 keV, 1.5x10 15 -1.5x10 16 cm -2 ) implantation, and mutant CGMCC1762 was selected through auxotrophy screening method, which was Lys, VB6 auxotrophy stress with high temperature. We found that during riper period the surface layer mycelium of the mutant was not aging neither grew tegument even above 30 degree C. The mycelium endurable temperature of the mutant was increased 7 degree C compared with that of the wild type strain. The fruiting bodies growth temperature of the mutant was 16-20 degree C in daytime and was 6-12 degree C at night. The highest growth temperature of fruiting bodies of the mutant was increased by 5 degree C than that of original strain. Through three generation investigation, we found that the mutant CGMCC1762 was stable with high temperature tolerance. (authors)

Photorepair mutants of Arabidopsis

International Nuclear Information System (INIS)

Jiang, C.Z.; Yee, J.; Mitchell, D.L.; Britt, A.B.

1997-01-01

UV radiation induces two major DNA damage products, the cyclobutane pyrimidine dimer (CPD) and, at a lower frequency, the pyrimidine (6-4) pyrimidinone dimer (6-4 product). Although Escherichia coli and Saccharomyces cerevisiae produce a CPD-specific photolyase that eliminates only this class of dimer, Arabidopsis thaliana, Drosophila melanogaster, Crotalus atrox, and Xenopus laevis have recently been shown to photoreactivate both CPDs and 6-4 products. We describe the isolation and characterization of two new classes of mutants of Arabidopsis, termed uvr2 and uvr3, that are defective in the photoreactivation of CPDs and 6-4 products, respectively. We demonstrate that the CPD photolyase mutation is genetically linked to a DNA sequence encoding a type II (metazoan) CPD photolyase. In addition, we are able to generate plants in which only CPDs or 6-4 products are photoreactivated in the nuclear genome by exposing these mutants to UV light and then allowing them to repair one or the other class of dimers. This provides us with a unique opportunity to study the biological consequences of each of these two major UV-induced photoproducts in an intact living system

Defining the requirements for the pathogenic interaction between mutant calreticulin and MPL in MPN.

Science.gov (United States)

Elf, Shannon; Abdelfattah, Nouran S; Baral, April J; Beeson, Danielle; Rivera, Jeanne F; Ko, Amy; Florescu, Natalie; Birrane, Gabriel; Chen, Edwin; Mullally, Ann

2018-02-15

Mutations in calreticulin ( CALR ) are phenotypic drivers in the pathogenesis of myeloproliferative neoplasms. Mechanistic studies have demonstrated that mutant CALR binds to the thrombopoietin receptor MPL, and that the positive electrostatic charge of the mutant CALR C terminus is required for mutant CALR-mediated activation of JAK-STAT signaling. Here we demonstrate that although binding between mutant CALR and MPL is required for mutant CALR to transform hematopoietic cells; binding alone is insufficient for cytokine independent growth. We further show that the threshold of positive charge in the mutant CALR C terminus influences both binding of mutant CALR to MPL and activation of MPL signaling. We find that mutant CALR binds to the extracellular domain of MPL and that 3 tyrosine residues within the intracellular domain of MPL are required to activate signaling. With respect to mutant CALR function, we show that its lectin-dependent function is required for binding to MPL and for cytokine independent growth, whereas its chaperone and polypeptide-binding functionalities are dispensable. Together, our findings provide additional insights into the mechanism of the pathogenic mutant CALR-MPL interaction in myeloproliferative neoplasms. © 2018 by The American Society of Hematology.

Chondroitin 4-O-Sulfotransferase Is Indispensable for Sulfation of Chondroitin and Plays an Important Role in Maintaining Normal Life Span and Oxidative Stress Responses in Nematodes.

Science.gov (United States)

Izumikawa, Tomomi; Dejima, Katsufumi; Watamoto, Yukiko; Nomura, Kazuko H; Kanaki, Nanako; Rikitake, Marika; Tou, Mai; Murata, Daisuke; Yanagita, Eri; Kano, Ai; Mitani, Shohei; Nomura, Kazuya; Kitagawa, Hiroshi

2016-10-28

Chondroitin sulfate (CS)/chondroitin (Chn) chains are indispensable for embryonic cell division and cytokinesis in the early developmental stages in Caenorhabditis elegans and mice, whereas heparan sulfate (HS) is essential for axon guidance during nervous system development. These data indicate that the fundamental functions of CS and HS are conserved from worms to mammals and that the function of CS/Chn differs from that of HS. Although previous studies have shown that C. elegans produces HS and non-sulfated Chn, whether the organism produces CS remains unclear. Here, we demonstrate that C. elegans produces a small amount of 4-O-sulfated Chn and report the identification of C41C4.1, an orthologue of the human chondroitin 4-O-sulfotransferase gene. Loss of C41C4.1 in C. elegans resulted in a decline in 4-O-sulfation of CS and an increase in the number of sulfated units in HS. C41C4.1 deletion mutants exhibited reduced survival rates after synchronization with sodium hypochlorite. Collectively, these results show for the first time that CS glycans are present in C. elegans and that the Chn 4-O-sulfotransferase responsible for the sulfation plays an important role in protecting nematodes from oxidative stress. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Function of the PHA-4/FOXA transcription factor during C. elegans post-embryonic development

Directory of Open Access Journals (Sweden)

Chen Di

2008-02-01

Full Text Available Abstract Background pha-4 encodes a forkhead box (FOX A transcription factor serving as the C. elegans pharynx organ identity factor during embryogenesis. Using Serial Analysis of Gene Expression (SAGE, comparison of gene expression profiles between growing stages animals and long-lived, developmentally diapaused dauer larvae revealed that pha-4 transcription is increased in the dauer stage. Results Knocking down pha-4 expression by RNAi during post-embryonic development showed that PHA-4 is essential for dauer recovery, gonad and vulva development. daf-16, which encodes a FOXO transcription factor regulated by insulin/IGF-1 signaling, shows overlapping expression patterns and a loss-of-function post-embryonic phenotype similar to that of pha-4 during dauer recovery. pha-4 RNAi and daf-16 mutations have additive effects on dauer recovery, suggesting these two regulators may function in parallel pathways. Gene expression studies using RT-PCR and GFP reporters showed that pha-4 transcription is elevated under starvation, and a conserved forkhead transcription factor binding site in the second intron of pha-4 is important for the neuronal expression. The vulval transcription of lag-2, which encodes a ligand for the LIN-12/Notch lateral signaling pathway, is inhibited by pha-4 RNAi, indicating that LAG-2 functions downstream of PHA-4 in vulva development. Conclusion Analysis of PHA-4 during post-embryonic development revealed previously unsuspected functions for this important transcriptional regulator in dauer recovery, and may help explain the network of transcriptional control integrating organogenesis with the decision between growth and developmental arrest at the dauer entry and exit stages.

Methods of producing protoporphyrin IX and bacterial mutants therefor

Science.gov (United States)

Zhou, Jizhong; Qiu, Dongru; He, Zhili; Xie, Ming

2016-03-01

The presently disclosed inventive concepts are directed in certain embodiments to a method of producing protoporphyrin IX by (1) cultivating a strain of Shewanella bacteria in a culture medium under conditions suitable for growth thereof, and (2) recovering the protoporphyrin IX from the culture medium. The strain of Shewanella bacteria comprises at least one mutant hemH gene which is incapable of normal expression, thereby causing an accumulation of protoporphyrin IX. In certain embodiments of the method, the strain of Shewanella bacteria is a strain of S. loihica, and more specifically may be S. loihica PV-4. In certain embodiments, the mutant hemH gene of the strain of Shewanella bacteria may be a mutant of shew_2229 and/or of shew_1140. In other embodiments, the presently disclosed inventive concepts are directed to mutant strains of Shewanella bacteria having at least one mutant hemH gene which is incapable of normal expression, thereby causing an accumulation of protoporphyrin IX during cultivation of the bacteria. In certain embodiments the strain of Shewanella bacteria is a strain of S. loihica, and more specifically may be S. loihica PV-4. In certain embodiments, the mutant hemH gene of the strain of Shewanella bacteria may be a mutant of shew_2229 and/or shew_1140.

Fanconi anemia group A and C double-mutant mice: functional evidence for a multi-protein Fanconi anemia complex.

Science.gov (United States)

Noll, Meenakshi; Battaile, Kevin P; Bateman, Raynard; Lax, Timothy P; Rathbun, Keany; Reifsteck, Carol; Bagby, Grover; Finegold, Milton; Olson, Susan; Grompe, Markus

2002-07-01

Fanconi anemia (FA) is a genetically heterogeneous disorder associated with defects in at least eight genes. The biochemical function(s) of the FA proteins are unknown, but together they define the FA pathway, which is involved in cellular responses to DNA damage and in other cellular processes. It is currently unknown whether all FA proteins are involved in controlling a single function or whether some of the FA proteins have additional roles. The aim of this study was 1) to determine whether the FA group A and group C genes have identical or partially distinct functions, and 2) to have a better model for human FA. We generated mice with a targeted mutation in fanca and crossed them with fancc disrupted animals. Several phenotypes including sensitivity to DNA cross linkers and ionizing radiation, hematopoietic colony growth, and germ cell loss were analyzed in fanca-/-, fancc-/-, fanca/fancc double -/-, and controls. Fibroblast cells and hematopoietic precursors from fanca/fancc double-mutant mice were not more sensitive to MMC than those of either single mutant. fanca/fancc double mutants had no evidence for an additive phenotype at the cellular or organismal level. These results support a model where both FANCA and FANCC are part of a multi-protein nuclear FA complex with identical function in cellular responses to DNA damage and germ cell survival.

Prevalence of precore-defective mutant of hepatitis B virus in HBV carriers.

Science.gov (United States)

Niitsuma, H; Ishii, M; Saito, Y; Miura, M; Kobayashi, K; Ohori, H; Toyota, T

1995-08-01

Two hundred and seventy-three serum specimens from hepatitis B virus (HBV) carriers were examined for the presence of a characteristic one point mutation at nucleotide (nt) 1896 from the EcoRI site of the HBV genome in the precore region (the preC mutant) using restriction fragment length polymorphism (RFLP) analysis. This assay approach could detect preC mutants or wild-type sequences when either form constituted more than 10% of the total sample. Overall, 65.5% (76/116) of HBeAg-positive carriers had only the preC wild-type. All HBeAg-positive asymptomatic carriers (n = 14) had only the preC wild-type. In patients with chronic hepatitis B and in anti-HBe-positive asymptomatic carriers, increased prevalence of the preC mutant was associated with the development of anti-HBe antibodies and normalization of the serum alanine aminotransferase concentration. Furthermore, 27 (29.0%) of 93 HBeAg-negative carriers had unexpectedly preC wild-type sequences only. Direct sequencing of the HBV precore region of HBV specimens from 24 patients revealed no mutation at nt 1896, supporting the specificity of the RFLP analysis. These results suggest that RFLP analysis was accurate for the detection of the preC mutation and that the absence of serum HBeAg cannot be explained solely by the dominance of the preC mutant.

The phosphoinositide 3-kinase α selective inhibitor BYL719 enhances the effect of the protein kinase C inhibitor AEB071 in GNAQ/GNA11-mutant uveal melanoma cells.

Science.gov (United States)

Musi, Elgilda; Ambrosini, Grazia; de Stanchina, Elisa; Schwartz, Gary K

2014-05-01

G-protein mutations are one of the most common mutations occurring in uveal melanoma activating the protein kinase C (PKC)/mitogen-activated protein kinase and phosphoinositide 3-kinase (PI3K)/AKT pathways. In this study, we described the effect of dual pathway inhibition in uveal melanoma harboring GNAQ and GNA11 mutations via PKC inhibition with AEB071 (sotrastaurin) and PI3K/AKT inhibition with BYL719, a selective PI3Kα inhibitor. Growth inhibition was observed in GNAQ/GNA11-mutant cells with AEB071 versus no activity in wild-type cells. In the GNAQ-mutant cells, AEB071 decreased phosphorylation of myristoylated alanine-rich C-kinase substrate, a substrate of PKC, along with ERK1/2 and ribosomal S6, but persistent AKT activation was present. BYL719 had minimal antiproliferative activity in all uveal melanoma cell lines, and inhibited phosphorylation of AKT in most cell lines. In the GNA11-mutant cell line, similar effects were observed with ERK1/2 inhibition, mostly inhibited by BYL719. With the combination treatment, both GNAQ- and GNA11-mutant cell lines showed synergistic inhibition of cell proliferation and apoptotic cell death. In vivo studies correlated with in vitro findings showing reduced xenograft tumor growth with the combination therapy in a GNAQ-mutant model. These findings suggest a new therapy treatment option for G-protein-mutant uveal melanoma with a focus on specific targeting of multiple downstream pathways as part of combination therapy.

DMPD: Developmental plasticity of lymphocytes. [Dynamic Macrophage Pathway CSML Database

Lifescience Database Archive (English)

Full Text Available 18472258 Developmental plasticity of lymphocytes. Cobaleda C, Busslinger M. Curr Op...in Immunol. 2008 Apr;20(2):139-48. Epub 2008 May 9. (.png) (.svg) (.html) (.csml) Show Developmental plastic...ity of lymphocytes. PubmedID 18472258 Title Developmental plasticity of lymphocytes. Authors Cobaleda C, Bus

Human liver cell trafficking mutants: characterization and whole exome sequencing.

Directory of Open Access Journals (Sweden)

Fei Yuan

Full Text Available The HuH7 liver cell mutant Trf1 is defective in membrane trafficking and is complemented by the casein kinase 2α subunit CK2α''. Here we identify characteristic morphologies, trafficking and mutational changes in six additional HuH7 mutants Trf2-Trf7. Trf1 cells were previously shown to be severely defective in gap junction functions. Using a Lucifer yellow transfer assay, remarkable attenuation of gap junction communication was revealed in each of the mutants Trf2-Trf7. Electron microscopy and light microscopy of thiamine pyrophosphatase showed that several mutants exhibited fragmented Golgi apparatus cisternae compared to parental HuH7 cells. Intracellular trafficking was investigated using assays of transferrin endocytosis and recycling and VSV G secretion. Surface binding of transferrin was reduced in all six Trf2-Trf7 mutants, which generally correlated with the degree of reduced expression of the transferrin receptor at the cell surface. The mutants displayed the same transferrin influx rates as HuH7, and for efflux rate, only Trf6 differed, having a slower transferrin efflux rate than HuH7. The kinetics of VSV G transport along the exocytic pathway were altered in Trf2 and Trf5 mutants. Genetic changes unique to particular Trf mutants were identified by exome sequencing, and one was investigated in depth. The novel mutation Ile34Phe in the GTPase RAB22A was identified in Trf4. RNA interference knockdown of RAB22A or overexpression of RAB22AI34F in HuH7 cells caused phenotypic changes characteristic of the Trf4 mutant. In addition, the Ile34Phe mutation reduced both guanine nucleotide binding and hydrolysis activities of RAB22A. Thus, the RAB22A Ile34Phe mutation appears to contribute to the Trf4 mutant phenotype.

Mutante espontâneo de Bacillus licheniformis bloqueado no estágio I da esporogênese, possuidor de metabolismo respiratório aumentado A spontaneous mutant of Bacillus licheniformis with increased respiratory metabolism, blocked in stage I of sporogenesis

Directory of Open Access Journals (Sweden)

Leon Rabinovitch

1976-01-01

Full Text Available Um mutante espontâneo de Bacillus licheniformis, derivado da amostra esporogênica 2390, foi estudado com vistas ao reconhecimento do estágio da evolução para esporo em que o mesmo se encontrava bloqueado. Eletronmicrografias sugeriram que as células desse mutante, colhidas durante a fase estacionária da curva de crescimento, não ultrapassaram o estágio I da esporogênese (i.e., permaneceram com o nucleóide disposto como filamento axial, enquanto a produção de antibiótico (bacitracina e a atividade proteolítica foram francamente detectadas. A linhagem mutante, designada Spolp-72, nas condições experimentais empregadas não biossintetizou esporos por estarvação em solução de sais inorgãnicos, mas evidenciou uma frequência de esporulação menor que 10*-7, após crescimento vegetativo em meio de cultura favorável á esporogênese. A amostra Spolp-72 externa um crescimento vegetativo inicial restringido, quando comparada com a amostra 2390, enquanto que, inversamente, sua atividade respiratória é significativamente mais elevada. Este último comportamento foi confirmado no presente trabalho, contrastando, nesse particular, com outros tipos de mutantes de esporulação já descritos, os quais se encontram bloqueados nos primeiros estágios da via esporogenética.A spontaneous mutant strain derived from the sporogenic B. licheniformis 2390 was studied with a view to determining at what developmental stage toward sporulation it was blocked. Electronmicrographs suggested that the mutant cells harvested during the stationary phase of the growth curve were unable to go beyond stage I of sporogenesis (i. e., their nucleoid remained as an axial filament. On the other hand, antibiotic production (bacitracin and proteolytic activity were easily detected. Under the present experimental conditions the mutant strain, named Spolp-72, did not synthesize spores by starvation in a solution of inorganic salts, in contrast with the parental