WorldWideScience

Sample records for c-terminal region 640-967

  1. The C-terminal region (640-967) of Arabidopsis CPL1 interacts with the abiotic stress- and ABA-responsive transcription factors

    International Nuclear Information System (INIS)

    Bang, Woo Young; Kim, Se Won; Jeong, In Sil; Koiwa, Hisashi; Bahk, Jeong Dong

    2008-01-01

    Proteins in CPL1 family are unique to plants and contain a phosphatase catalytic domain and double-stranded RNA (dsRNA)-binding motifs (DRMs) in a single peptide. Though DRMs are important for the function of Arabidopsis CPL1 in vivo, the role of CPL1 DRM has been obscure. We have isolated two transcription factors, ANAC019 (At1g52890) and AtMYB3 (At1g22640), which specifically interact with the C-terminal region (640-967) of AtCPL1 containing two DRMs. Detailed interaction analysis indicated that AtMYB3 specifically interacted with the first DRM but not with the second DRM in CPL1 C-terminal fragment. GFP-fusion analysis indicated that AtMYB3 localized in nuclei-like CPL1, and its expression is induced by abiotic stress and ABA treatment. These results suggest that AtMYB3 function in abiotic stress signaling in concert with CPL1

  2. Role of the ribosomal P-site elements of m²G966, m⁵C967, and the S9 C-terminal tail in maintenance of the reading frame during translational elongation in Escherichia coli.

    Science.gov (United States)

    Arora, Smriti; Bhamidimarri, Satya Prathyusha; Weber, Michael H W; Varshney, Umesh

    2013-08-01

    The ribosomal P-site hosts the peptidyl-tRNAs during translation elongation. Which P-site elements support these tRNA species to maintain codon-anticodon interactions has remained unclear. We investigated the effects of P-site features of methylations of G966, C967, and the conserved C-terminal tail sequence of Ser, Lys, and Arg (SKR) of the S9 ribosomal protein in maintenance of the translational reading frame of an mRNA. We generated Escherichia coli strains deleted for the SKR sequence in S9 ribosomal protein, RsmB (which methylates C967), and RsmD (which methylates G966) and used them to translate LacZ from its +1 and -1 out-of-frame constructs. We show that the S9 SKR tail prevents both the +1 and -1 frameshifts and plays a general role in holding the P-site tRNA/peptidyl-tRNA in place. In contrast, the G966 and C967 methylations did not make a direct contribution to the maintenance of the translational frame of an mRNA. However, deletion of rsmB in the S9Δ3 background caused significantly increased -1 frameshifting at 37°C. Interestingly, the effects of the deficiency of C967 methylation were annulled when the E. coli strain was grown at 30°C, supporting its context-dependent role.

  3. An intermediate region in C-terminal of phosphoprotein is required ...

    African Journals Online (AJOL)

    In this study, the region of P that binds to NPNC was mapped. To determine the binding region, 18 N- and C-terminally truncated P mutants were synthesized by in vitro translation in rabbit reticulocytes and mixed with purified NP (NPNC). The mutants which did not bind to NP were considered as mutants and they contain ...

  4. 38 CFR 1.967 - Refunds.

    Science.gov (United States)

    2010-07-01

    ... Referrals to Gao, Department of Justice, Or Irs § 1.967 Refunds. (a) Except as provided in paragraph (c) of... educational institution found liable under 38 U.S.C. 3685. Waiver of collection of educational benefit overpayments from all or a portion of the eligible persons attending an educational institution which has been...

  5. Differential subcellular localization of insulin receptor substrates depends on C-terminal regions and importin β

    International Nuclear Information System (INIS)

    Kabuta, Tomohiro; Take, Kazumi; Kabuta, Chihana; Hakuno, Fumihiko; Takahashi, Shin-Ichiro

    2008-01-01

    Insulin receptor substrates (IRSs) play essential roles in signal transduction of insulin and insulin-like growth factors. Previously, we showed that IRS-3 is localized to the nucleus as well as the cytosol, while IRS-1 and 2 are mainly localized to the cytoplasm. In the present study, we found that importin β directly interacts with IRS-3 and is able to mediate nuclear transport of IRS-3. Importin β interacted with the pleckstrin homology domain, the phosphotyrosine binding domain and the C-terminal region of IRS-3; indeed all of these fragments exhibited predominant nuclear localization. By contrast, almost no interaction of importin β with IRS-1 and -2 was observed, and their C-terminal regions displayed discrete spotty images in the cytosol. In addition, using chimeric proteins between IRS-1 and IRS-3, we revealed that the C-terminal regions are the main determinants of the differing subcellular localizations of IRS-1 and IRS-3.

  6. Structural and dynamic properties of the C-terminal region of the Escherichia coli RNA chaperone Hfq: integrative experimental and computational studies.

    Science.gov (United States)

    Wen, Bin; Wang, Weiwei; Zhang, Jiahai; Gong, Qingguo; Shi, Yunyu; Wu, Jihui; Zhang, Zhiyong

    2017-08-09

    In Escherichia coli, hexameric Hfq is an important RNA chaperone that facilitates small RNA-mediated post-transcriptional regulation. The Hfq monomer consists of an evolutionarily conserved Sm domain (residues 1-65) and a flexible C-terminal region (residues 66-102). It has been recognized that the existence of the C-terminal region is important for the function of Hfq, but its detailed structural and dynamic properties remain elusive due to its disordered nature. In this work, using integrative experimental techniques, such as nuclear magnetic resonance spectroscopy and small-angle X-ray scattering, as well as multi-scale computational simulations, new insights into the structure and dynamics of the C-terminal region in the context of the Hfq hexamer are provided. Although the C-terminal region is intrinsically disordered, some residues (83-86) are motionally restricted. The hexameric core may affect the secondary structure propensity of the C-terminal region, due to transient interactions between them. The residues at the rim and the proximal side of the core have significantly more transient contacts with the C-terminal region than those residues at the distal side, which may facilitate the function of the C-terminal region in the release of double-stranded RNAs and the cycling of small non-coding RNAs. Structure ensembles constructed by fitting the experimental data also support that the C-terminal region prefers to locate at the proximal side. From multi-scale simulations, we propose that the C-terminal region may play a dual role of steric effect (especially at the proximal side) and recruitment (at the both sides) in the binding process of RNA substrates. Interestingly, we have found that these motionally restricted residues may serve as important binding sites for the incoming RNAs that is probably driven by favorable electrostatic interactions. These integrative studies may aid in our understanding of the functional role of the C-terminal region of Hfq.

  7. Kaposi's sarcoma herpesvirus C-terminal LANA concentrates at pericentromeric and peri-telomeric regions of a subset of mitotic chromosomes

    International Nuclear Information System (INIS)

    Kelley-Clarke, Brenna; Ballestas, Mary E.; Komatsu, Takashi; Kaye, Kenneth M.

    2007-01-01

    The Kaposi's sarcoma-associated herpesvirus (KSHV) latency-associated nuclear antigen (LANA) tethers KSHV terminal repeat (TR) DNA to mitotic chromosomes to efficiently segregate episomes to progeny nuclei. LANA contains N- and C-terminal chromosome binding regions. We now show that C-terminal LANA preferentially concentrates to paired dots at pericentromeric and peri-telomeric regions of a subset of mitotic chromosomes through residues 996-1139. Deletions within C-terminal LANA abolished both self-association and chromosome binding, consistent with a requirement for self-association to bind chromosomes. A deletion abolishing TR DNA binding did not affect chromosome targeting, indicating LANA's localization is not due to binding its recognition sequence in chromosomal DNA. LANA distributed similarly on human and non-human mitotic chromosomes. These results are consistent with C-terminal LANA interacting with a cell factor that concentrates at pericentromeric and peri-telomeric regions of mitotic chromosomes

  8. Insights into the Structure of Dimeric RNA Helicase CsdA and Indispensable Role of Its C-Terminal Regions.

    Science.gov (United States)

    Xu, Ling; Wang, Lijun; Peng, Junhui; Li, Fudong; Wu, Lijie; Zhang, Beibei; Lv, Mengqi; Zhang, Jiahai; Gong, Qingguo; Zhang, Rongguang; Zuo, Xiaobing; Zhang, Zhiyong; Wu, Jihui; Tang, Yajun; Shi, Yunyu

    2017-12-05

    CsdA has been proposed to be essential for the biogenesis of ribosome and gene regulation after cold shock. However, the structure of CsdA and the function of its long C-terminal regions are still unclear. Here, we solved all of the domain structures of CsdA and found two previously uncharacterized auxiliary domains: a dimerization domain (DD) and an RNA-binding domain (RBD). Small-angle X-ray scattering experiments helped to track the conformational flexibilities of the helicase core domains and C-terminal regions. Biochemical assays revealed that DD is indispensable for stabilizing the CsdA dimeric structure. We also demonstrate for the first time that CsdA functions as a stable dimer at low temperature. The C-terminal regions are critical for RNA binding and efficient enzymatic activities. CsdA_RBD could specifically bind to the regions with a preference for single-stranded G-rich RNA, which may help to bring the helicase core to unwind the adjacent duplex. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. Structure and function of C-terminal catalytic region of pasteurella multocida toxin

    International Nuclear Information System (INIS)

    Kitadokoro, Kengo; Kamitami, Shigeki; Horiguchi, Yasuhiko

    2008-01-01

    Pasteurella multocida toxin (PMT) is one of virulence factors responsible for the pathogenesis in some Pasteurellosis. We determined the crystal structure of the C-terminal region of PMT (C-PMT), which carries an intracellularly active moiety. The overall structure of C-PMT displays three different domains designated C1, C2 and C3. We found in the C3 domain the Cys-His-Asp catalytic triad that is organized only when the Cys is released from a disulfide bond. The steric alignment of the triad corresponded well to that of papain or other enzymes carrying the Cys-His-Asp triad. Our results demonstrate that PMT is an enzymatic toxin carrying the cysteine-protease like catalytic triad, which is organized only under reducing conditions. (author)

  10. 14 CFR 27.967 - Fuel tank installation.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Fuel tank installation. 27.967 Section 27.967 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION AIRCRAFT AIRWORTHINESS STANDARDS: NORMAL CATEGORY ROTORCRAFT Powerplant Fuel System § 27.967 Fuel tank installation. (a...

  11. 14 CFR 29.967 - Fuel tank installation.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Fuel tank installation. 29.967 Section 29.967 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION AIRCRAFT AIRWORTHINESS STANDARDS: TRANSPORT CATEGORY ROTORCRAFT Powerplant Fuel System § 29.967 Fuel tank installation...

  12. 14 CFR 25.967 - Fuel tank installations.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 1 2010-01-01 2010-01-01 false Fuel tank installations. 25.967 Section 25.967 Aeronautics and Space FEDERAL AVIATION ADMINISTRATION, DEPARTMENT OF TRANSPORTATION AIRCRAFT AIRWORTHINESS STANDARDS: TRANSPORT CATEGORY AIRPLANES Powerplant Fuel System § 25.967 Fuel tank installations...

  13. Unique C-terminal region of Hap3 is required for methanol-regulated gene expression in the methylotrophic yeast Candida boidinii.

    Science.gov (United States)

    Oda, Saori; Yurimoto, Hiroya; Nitta, Nobuhisa; Sakai, Yasuyoshi

    2016-05-01

    The Hap complex of the methylotrophic yeast Candida boidinii was found to be required for methanol-regulated gene expression. In this study, we performed functional characterization of CbHap3p, one of the Hap complex components in C. boidinii. Sequence alignment of Hap3 proteins revealed the presence of a unique extended C-terminal region, which is not present in Hap3p from Saccharomyces cerevisiae (ScHap3p), but is found in Hap3p proteins of methylotrophic yeasts. Deletion of the C-terminal region of CbHap3p (Δ256-292 or Δ107-237) diminished activation of methanol-regulated genes and abolished the ability to grow on methanol, but did not affect nuclear localization or DNA-binding ability. However, deletion of the N-terminal region of CbHap3p (Δ1-20) led to not only a growth defect on methanol and a decreased level of methanol-regulated gene expression, but also impaired nuclear localization and binding to methanol-regulated gene promoters. We also revealed that CbHap3p could complement the growth defect of the Schap3Δ strain on glycerol, although ScHap3p could not complement the growth defect of a Cbhap3Δ strain on methanol. We conclude that the unique C-terminal region of CbHap3p contributes to maximum activation of methanol-regulated genes, whilst the N-terminal region is required for nuclear localization and binding to DNA.

  14. C-terminal region of MAP7 domain containing protein 3 (MAP7D3 promotes microtubule polymerization by binding at the C-terminal tail of tubulin.

    Directory of Open Access Journals (Sweden)

    Saroj Yadav

    Full Text Available MAP7 domain containing protein 3 (MAP7D3, a newly identified microtubule associated protein, has been shown to promote microtubule assembly and stability. Its microtubule binding region has been reported to consist of two coiled coil motifs located at the N-terminus. It possesses a MAP7 domain near the C-terminus and belongs to the microtubule associated protein 7 (MAP7 family. The MAP7 domain of MAP7 protein has been shown to bind to kinesin-1; however, the role of MAP7 domain in MAP7D3 remains unknown. Based on the bioinformatics analysis of MAP7D3, we hypothesized that the MAP7 domain of MAP7D3 may have microtubule binding activity. Indeed, we found that MAP7 domain of MAP7D3 bound to microtubules as well as enhanced the assembly of microtubules in vitro. Interestingly, a longer fragment MDCT that contained the MAP7 domain (MD with the C-terminal tail (CT of the protein promoted microtubule polymerization to a greater extent than MD and CT individually. MDCT stabilized microtubules against dilution induced disassembly. MDCT bound to reconstituted microtubules with an apparent dissociation constant of 3.0 ± 0.5 µM. An immunostaining experiment showed that MDCT localized along the length of the preassembled microtubules. Competition experiments with tau indicated that MDCT shares its binding site on microtubules with tau. Further, we present evidence indicating that MDCT binds to the C-terminal tail of tubulin. In addition, MDCT could bind to tubulin in HeLa cell extract. Here, we report a microtubule binding region in the C-terminal region of MAP7D3 that may have a role in regulating microtubule assembly dynamics.

  15. C-terminal region of DNA ligase IV drives XRCC4/DNA ligase IV complex to chromatin

    International Nuclear Information System (INIS)

    Liu, Sicheng; Liu, Xunyue; Kamdar, Radhika Pankaj; Wanotayan, Rujira; Sharma, Mukesh Kumar; Adachi, Noritaka; Matsumoto, Yoshihisa

    2013-01-01

    Highlights: •Chromatin binding of XRCC4 is dependent on the presence of DNA ligase IV. •C-terminal region of DNA ligase IV alone can recruit itself and XRCC4 to chromatin. •Two BRCT domains of DNA ligase IV are essential for the chromatin binding of XRCC4. -- Abstract: DNA ligase IV (LIG4) and XRCC4 form a complex to ligate two DNA ends at the final step of DNA double-strand break (DSB) repair through non-homologous end-joining (NHEJ). It is not fully understood how these proteins are recruited to DSBs. We recently demonstrated radiation-induced chromatin binding of XRCC4 by biochemical fractionation using detergent Nonidet P-40. In the present study, we examined the role of LIG4 in the recruitment of XRCC4/LIG4 complex to chromatin. The chromatin binding of XRCC4 was dependent on the presence of LIG4. The mutations in two BRCT domains (W725R and W893R, respectively) of LIG4 reduced the chromatin binding of LIG4 and XRCC4. The C-terminal fragment of LIG4 (LIG4-CT) without N-terminal catalytic domains could bind to chromatin with XRCC4. LIG4-CT with W725R or W893R mutation could bind to chromatin but could not support the chromatin binding of XRCC4. The ability of C-terminal region of LIG4 to interact with chromatin might provide us with an insight into the mechanisms of DSB repair through NHEJ

  16. 21 CFR 640.23 - Testing the blood.

    Science.gov (United States)

    2010-04-01

    ... this chapter and § 640.5 (a), (b), and (c). (b) The tests shall be performed on a sample of blood... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Testing the blood. 640.23 Section 640.23 Food and... ADDITIONAL STANDARDS FOR HUMAN BLOOD AND BLOOD PRODUCTS Platelets § 640.23 Testing the blood. (a) Blood from...

  17. 21 CFR 640.53 - Testing the blood.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Testing the blood. 640.53 Section 640.53 Food and... ADDITIONAL STANDARDS FOR HUMAN BLOOD AND BLOOD PRODUCTS Cryoprecipitate § 640.53 Testing the blood. (a) Blood... prescribed in § 610.40 of this chapter and § 640.5 (a), (b), and (c). (b) The tests shall be performed on a...

  18. Roles of C-Terminal Region of Yeast and Human Rad52 in Rad51-Nucleoprotein Filament Formation and ssDNA Annealing.

    Directory of Open Access Journals (Sweden)

    Nilesh V Khade

    Full Text Available Yeast Rad52 (yRad52 has two important functions at homologous DNA recombination (HR; annealing complementary single-strand DNA (ssDNA molecules and recruiting Rad51 recombinase onto ssDNA (recombination mediator activity. Its human homolog (hRAD52 has a lesser role in HR, and apparently lacks mediator activity. Here we show that yRad52 can load human Rad51 (hRAD51 onto ssDNA complexed with yeast RPA in vitro. This is biochemically equivalent to mediator activity because it depends on the C-terminal Rad51-binding region of yRad52 and on functional Rad52-RPA interaction. It has been reported that the N-terminal two thirds of both yRad52 and hRAD52 is essential for binding to and annealing ssDNA. Although a second DNA binding region has been found in the C-terminal region of yRad52, its role in ssDNA annealing is not clear. In this paper, we also show that the C-terminal region of yRad52, but not of hRAD52, is involved in ssDNA annealing. This suggests that the second DNA binding site is required for the efficient ssDNA annealing by yRad52. We propose an updated model of Rad52-mediated ssDNA annealing.

  19. The C-terminal domain of the bacteriophage T4 terminase docks on the prohead portal clip region during DNA packaging

    Science.gov (United States)

    Dixit, Aparna Banerjee; Ray, Krishanu; Thomas, Julie A.; Black, Lindsay W.

    2013-01-01

    Bacteriophage ATP-based packaging motors translocate DNA into a pre-formed prohead through a dodecameric portal ring channel to high density. We investigated portal–terminase docking interactions at specifically localized residues within a terminase-interaction region (aa279–316) in the phage T4 portal protein gp20 equated to the clip domain of the SPP1 portal crystal structure by 3D modeling. Within this region, three residues allowed A to C mutations whereas three others did not, consistent with informatics analyses showing the tolerated residues are not strongly conserved evolutionarily. About 7.5 nm was calculated by FCS-FRET studies employing maleimide Alexa488 dye labeled A316C proheads and gp17 CT-ReAsH supporting previous work docking the C-terminal end of the T4 terminase (gp17) closer to the N-terminal GFP-labeled portal (gp20) than the N-terminal end of the terminase. Such a terminase–portal orientation fits better to a proposed “DNA crunching” compression packaging motor and to portal determined DNA headful cutting. PMID:24074593

  20. Asparagine 326 in the extremely C-terminal region of XRCC4 is essential for the cell survival after irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Wanotayan, Rujira; Fukuchi, Mikoto; Imamichi, Shoji; Sharma, Mukesh Kumar; Matsumoto, Yoshihisa, E-mail: yoshim@nr.titech.ac.jp

    2015-02-20

    XRCC4 is one of the crucial proteins in the repair of DNA double-strand break (DSB) through non-homologous end-joining (NHEJ). As XRCC4 consists of 336 amino acids, N-terminal 200 amino acids include domains for dimerization and for association with DNA ligase IV and XLF and shown to be essential for XRCC4 function in DSB repair and V(D)J recombination. On the other hand, the role of the remaining C-terminal region of XRCC4 is not well understood. In the present study, we noticed that a stretch of ∼20 amino acids located at the extreme C-terminus of XRCC4 is highly conserved among vertebrate species. To explore its possible importance, series of mutants in this region were constructed and assessed for the functionality in terms of ability to rescue radiosensitivity of M10 cells lacking XRCC4. Among 13 mutants, M10 transfectant with N326L mutant (M10-XRCC4{sup N326L}) showed elevated radiosensitivity. N326L protein showed defective nuclear localization. N326L sequence matched the consensus sequence of nuclear export signal. Leptomycin B treatment accumulated XRCC4{sup N326L} in the nucleus but only partially rescued radiosensitivity of M10-XRCC4{sup N326L}. These results collectively indicated that the functional defects of XRCC4{sup N326L} might be partially, but not solely, due to its exclusion from nucleus by synthetic nuclear export signal. Further mutation of XRCC4 Asn326 to other amino acids, i.e., alanine, aspartic acid or glutamine did not affect the nuclear localization but still exhibited radiosensitivity. The present results indicated the importance of the extremely C-terminal region of XRCC4 and, especially, Asn326 therein. - Highlights: • Extremely C-terminal region of XRCC4 is highly conserved among vertebrate species. • XRCC4 C-terminal point mutants, R325F and N326L, are functionally deficient in terms of survival after irradiation. • N326L localizes to the cytoplasm because of synthetic nuclear export signal. • Leptomycin B restores the

  1. C-terminal domains of bacterial proteases: structure, function and the biotechnological applications.

    Science.gov (United States)

    Huang, J; Wu, C; Liu, D; Yang, X; Wu, R; Zhang, J; Ma, C; He, H

    2017-01-01

    C-terminal domains widely exist in the C-terminal region of multidomain proteases. As a β-sandwich domain in multidomain protease, the C-terminal domain plays an important role in proteolysis including regulation of the secretory process, anchoring and swelling the substrate molecule, presenting as an inhibitor for the preprotease and adapting the protein structural flexibility and stability. In this review, the diversity, structural characteristics and biological function of C-terminal protease domains are described. Furthermore, the application prospects of C-terminal domains, including polycystic kidney disease, prepeptidase C-terminal and collagen-binding domain, in the area of medicine and biological artificial materials are also discussed. © 2016 The Society for Applied Microbiology.

  2. PTEN C-Terminal Deletion Causes Genomic Instability and Tumor Development

    Directory of Open Access Journals (Sweden)

    Zhuo Sun

    2014-03-01

    Full Text Available Tumor suppressor PTEN controls genomic stability and inhibits tumorigenesis. The N-terminal phosphatase domain of PTEN antagonizes the PI3K/AKT pathway, but its C-terminal function is less defined. Here, we describe a knockin mouse model of a nonsense mutation that results in the deletion of the entire Pten C-terminal region, referred to as PtenΔC. Mice heterozygous for PtenΔC develop multiple spontaneous tumors, including cancers and B cell lymphoma. Heterozygous deletion of the Pten C-terminal domain also causes genomic instability and common fragile site rearrangement. We found that Pten C-terminal disruption induces p53 and its downstream targets. Simultaneous depletion of p53 promotes metastasis without influencing the initiation of tumors, suggesting that p53 mainly suppresses tumor progression. Our data highlight the essential role of the PTEN C terminus in the maintenance of genomic stability and suppression of tumorigenesis.

  3. DNA clasping by mycobacterial HU: the C-terminal region of HupB mediates increased specificity of DNA binding.

    Directory of Open Access Journals (Sweden)

    Sandeep Kumar

    Full Text Available BACKGROUND: HU a small, basic, histone like protein is a major component of the bacterial nucleoid. E. coli has two subunits of HU coded by hupA and hupB genes whereas Mycobacterium tuberculosis (Mtb has only one subunit of HU coded by ORF Rv2986c (hupB gene. One noticeable feature regarding Mtb HupB, based on sequence alignment of HU orthologs from different bacteria, was that HupB(Mtb bears at its C-terminal end, a highly basic extension and this prompted an examination of its role in Mtb HupB function. METHODOLOGY/PRINCIPAL FINDINGS: With this objective two clones of Mtb HupB were generated; one expressing full length HupB protein (HupB(Mtb and another which expresses only the N terminal region (first 95 amino acid of hupB (HupB(MtbN. Gel retardation assays revealed that HupB(MtbN is almost like E. coli HU (heat stable nucleoid protein in terms of its DNA binding, with a binding constant (K(d for linear dsDNA greater than 1000 nM, a value comparable to that obtained for the HUalphaalpha and HUalphabeta forms. However CTR (C-terminal Region of HupB(Mtb imparts greater specificity in DNA binding. HupB(Mtb protein binds more strongly to supercoiled plasmid DNA than to linear DNA, also this binding is very stable as it provides DNase I protection even up to 5 minutes. Similar results were obtained when the abilities of both proteins to mediate protection against DNA strand cleavage by hydroxyl radicals generated by the Fenton's reaction, were compared. It was also observed that both the proteins have DNA binding preference for A:T rich DNA which may occur at the regulatory regions of ORFs and the oriC region of Mtb. CONCLUSIONS/SIGNIFICANCE: These data thus point that HupB(Mtb may participate in chromosome organization in-vivo, it may also play a passive, possibly an architectural role.

  4. Contribution of the C-terminal tri-lysine regions of human immunodeficiency virus type 1 integrase for efficient reverse transcription and viral DNA nuclear import

    Directory of Open Access Journals (Sweden)

    Fowke Keith R

    2005-10-01

    Full Text Available Abstract Background In addition to mediating the integration process, HIV-1 integrase (IN has also been implicated in different steps during viral life cycle including reverse transcription and viral DNA nuclear import. Although the karyophilic property of HIV-1 IN has been well demonstrated using a variety of experimental approaches, the definition of domain(s and/or motif(s within the protein that mediate viral DNA nuclear import and its mechanism are still disputed and controversial. In this study, we performed mutagenic analyses to investigate the contribution of different regions in the C-terminal domain of HIV-1 IN to protein nuclear localization as well as their effects on virus infection. Results Our analysis showed that replacing lysine residues in two highly conserved tri-lysine regions, which are located within previously described Region C (235WKGPAKLLWKGEGAVV and sequence Q (211KELQKQITK in the C-terminal domain of HIV-1 IN, impaired protein nuclear accumulation, while mutations for RK263,4 had no significant effect. Analysis of their effects on viral infection in a VSV-G pseudotyped RT/IN trans-complemented HIV-1 single cycle replication system revealed that all three C-terminal mutant viruses (KK215,9AA, KK240,4AE and RK263,4AA exhibited more severe defect of induction of β-Gal positive cells and luciferase activity than an IN class 1 mutant D64E in HeLa-CD4-CCR5-β-Gal cells, and in dividing as well as non-dividing C8166 T cells, suggesting that some viral defects are occurring prior to viral integration. Furthermore, by analyzing viral DNA synthesis and the nucleus-associated viral DNA level, the results clearly showed that, although all three C-terminal mutants inhibited viral reverse transcription to different extents, the KK240,4AE mutant exhibited most profound effect on this step, whereas KK215,9AA significantly impaired viral DNA nuclear import. In addition, our analysis could not detect viral DNA integration in each C-terminal

  5. Mutations in the C-terminal region affect subcellular localization of crucian carp herpesvirus (CaHV) GPCR.

    Science.gov (United States)

    Wang, Jun; Gui, Lang; Chen, Zong-Yan; Zhang, Qi-Ya

    2016-08-01

    G protein-coupled receptors (GPCRs) are known as seven transmembrane domain receptors and consequently can mediate diverse biological functions via regulation of their subcellular localization. Crucian carp herpesvirus (CaHV) was recently isolated from infected fish with acute gill hemorrhage. CaHV GPCR of 349 amino acids (aa) was identified based on amino acid identity. A series of variants with truncation/deletion/substitution mutation in the C-terminal (aa 315-349) were constructed and expressed in fathead minnow (FHM) cells. The roles of three key C-terminal regions in subcellular localization of CaHV GPCR were determined. Lysine-315 (K-315) directed the aggregation of the protein preferentially at the nuclear side. Predicted N-myristoylation site (GGGWTR, aa 335-340) was responsible for punctate distribution in periplasm or throughout the cytoplasm. Predicted phosphorylation site (SSR, aa 327-329) and GGGWTR together determined the punctate distribution in cytoplasm. Detection of organelles localization by specific markers showed that the protein retaining K-315 colocalized with the Golgi apparatus. These experiments provided first evidence that different mutations of CaHV GPCR C-terminals have different affects on the subcellular localization of fish herpesvirus-encoded GPCRs. The study provided valuable information and new insights into the precise interactions between herpesvirus and fish cells, and could also provide useful targets for antiviral agents in aquaculture.

  6. Single point mutations distributed in 10 soluble and membrane regions of the Nicotiana plumbaginifolia plasma membrane PMA2 H+-ATPase activate the enzyme and modify the structure of the C-terminal region.

    Science.gov (United States)

    Morsomme, P; Dambly, S; Maudoux, O; Boutry, M

    1998-12-25

    The Nicotiana plumbaginifolia pma2 (plasma membrane H+-ATPase) gene is capable of functionally replacing the H+-ATPase genes of the yeast Saccharomyces cerevisiae, provided that the external pH is kept above 5.0. Single point mutations within the pma2 gene were previously identified that improved H+-ATPase activity and allowed yeast growth at pH 4.0. The aim of the present study was to identify most of the PMA2 positions, the mutation of which would lead to improved growth and to determine whether all these mutations result in similar enzymatic and structural modifications. We selected additional mutants in total 42 distinct point mutations localized in 30 codons. They were distributed in 10 soluble and membrane regions of the enzyme. Most mutant PMA2 H+-ATPases were characterized by a higher specific activity, lower inhibition by ADP, and lower stimulation by lysophosphatidylcholine than wild-type PMA2. The mutants thus seem to be constitutively activated. Partial tryptic digestion and immunodetection showed that the PMA2 mutants had a conformational change making the C-terminal region more accessible. These data therefore support the hypothesis that point mutations in various H+-ATPase parts displace the inhibitory C-terminal region, resulting in enzyme activation. The high density of mutations within the first half of the C-terminal region suggests that this part is involved in the interaction between the inhibitory C-terminal region and the rest of the enzyme.

  7. Nucleotide sequence of a cDNA coding for the amino-terminal region of human prepro. alpha. 1(III) collagen

    Energy Technology Data Exchange (ETDEWEB)

    Toman, P D; Ricca, G A [Rorer Biotechnology, Inc., Springfield, VA (USA); de Crombrugghe, B [National Institutes of Health, Bethesda, MD (USA)

    1988-07-25

    Type III Collagen is synthesized in a variety of tissues as a precursor macromolecule containing a leader sequence, a N-propeptide, a N-telopeptide, the triple helical region, a C-telopeptide, and C-propeptide. To further characterize the human type III collagen precursor, a human placental cDNA library was constructed in gt11 using an oligonucleotide derived from a partial cDNA sequence corresponding to the carboxy-terminal part of the 1(III) collagen. A cDNA was identified which contains the leader sequence, the N-propeptide and N-telopeptide regions. The DNA sequence of these regions are presented here. The triple helical, C-telopeptide and C-propeptide amino acid sequence for human type III collagen has been determined previously. A comparison of the human amino acid sequence with mouse, chicken, and calf sequence shows 81%, 81%, and 92% similarity, respectively. At the DNA level, the sequence similarity between human and mouse or chicken type III collagen sequences in this area is 82% and 77%, respectively.

  8. Function of C-terminal hydrophobic region in fructose dehydrogenase

    International Nuclear Information System (INIS)

    Sugimoto, Yu; Kawai, Shota; Kitazumi, Yuki; Shirai, Osamu; Kano, Kenji

    2015-01-01

    Fructose dehydrogenase (FDH) catalyzes oxidation of D-fructose into 2-keto-D-fructose and is one of the enzymes allowing a direct electron transfer (DET)-type bioelectrocatalysis. FDH is a heterotrimeric membrane-bound enzyme (subunit I, II, and III) and subunit II has a C terminal hydrophobic region (CHR), which was expected to play a role in anchoring to membranes from the amino acid sequence. We have constructed a mutated FDH lacking of CHR (ΔchrFDH). Contrary to the expected function of CHR, ΔchrFDH is expressed in the membrane fraction, and subunit I/III subcomplex (ΔcFDH) is also expressed in a similar activity level but in the soluble fraction. In addition, the enzyme activity of the purified ΔchrFDH is about one twentieth of the native FDH. These results indicate that CHR is concerned with the binding between subunit I(/III) and subunit II and then with the enzyme activity. ΔchrFDH has clear DET activity that is larger than that expected from the solution activity, and the characteristics of the catalytic wave of ΔchrFDH are very similar to those of FDH. The deletion of CHR seems to increase the amounts of the enzyme with the proper orientation for the DET reaction at electrode surfaces. Gel filtration chromatography coupled with urea treatment shows that the binding in ΔchrFDH is stronger than that in FDH. It can be considered that the rigid binding between subunit I(/III) and II without CHR results in a conformation different from the native one, which leads to the decrease in the enzyme activity in solution

  9. Modified nucleotides m2G966/m5C967 of Escherichia coli 16S rRNA are required for attenuation of tryptophan operon

    Science.gov (United States)

    Prokhorova, Irina V.; Osterman, Ilya A.; Burakovsky, Dmitry E.; Serebryakova, Marina V.; Galyamina, Maria A.; Pobeguts, Olga V.; Altukhov, Ilya; Kovalchuk, Sergey; Alexeev, Dmitry G.; Govorun, Vadim M.; Bogdanov, Alexey A.; Sergiev, Petr V.; Dontsova, Olga A.

    2013-11-01

    Ribosomes contain a number of modifications in rRNA, the function of which is unclear. Here we show - using proteomic analysis and dual fluorescence reporter in vivo assays - that m2G966 and m5C967 in 16S rRNA of Escherichia coli ribosomes are necessary for correct attenuation of tryptophan (trp) operon. Expression of trp operon is upregulated in the strain where RsmD and RsmB methyltransferases were deleted, which results in the lack of m2G966 and m5C967 modifications. The upregulation requires the trpL attenuator, but is independent of the promotor of trp operon, ribosome binding site of the trpE gene, which follows trp attenuator and even Trp codons in the trpL sequence. Suboptimal translation initiation efficiency in the rsmB/rsmD knockout strain is likely to cause a delay in translation relative to transcription which causes misregulation of attenuation control of trp operon.

  10. Contribution of the C-terminal region within the catalytic core domain of HIV-1 integrase to yeast lethality, chromatin binding and viral replication

    Directory of Open Access Journals (Sweden)

    Belhumeur Pierre

    2008-11-01

    Full Text Available Abstract Background HIV-1 integrase (IN is a key viral enzymatic molecule required for the integration of the viral cDNA into the genome. Additionally, HIV-1 IN has been shown to play important roles in several other steps during the viral life cycle, including reverse transcription, nuclear import and chromatin targeting. Interestingly, previous studies have demonstrated that the expression of HIV-1 IN induces the lethal phenotype in some strains of Saccharomyces cerevisiae. In this study, we performed mutagenic analyses of the C-terminal region of the catalytic core domain of HIV-1 IN in order to delineate the critical amino acid(s and/or motif(s required for the induction of the lethal phenotype in the yeast strain HP16, and to further elucidate the molecular mechanism which causes this phenotype. Results Our study identified three HIV-1 IN mutants, V165A, A179P and KR186,7AA, located in the C-terminal region of the catalytic core domain of IN that do not induce the lethal phenotype in yeast. Chromatin binding assays in yeast and mammalian cells demonstrated that these IN mutants were impaired for the ability to bind chromatin. Additionally, we determined that while these IN mutants failed to interact with LEDGF/p75, they retained the ability to bind Integrase interactor 1. Furthermore, we observed that VSV-G-pseudotyped HIV-1 containing these IN mutants was unable to replicate in the C8166 T cell line and this defect was partially rescued by complementation with the catalytically inactive D64E IN mutant. Conclusion Overall, this study demonstrates that three mutations located in the C-terminal region of the catalytic core domain of HIV-1 IN inhibit the IN-induced lethal phenotype in yeast by inhibiting the binding of IN to the host chromatin. These results demonstrate that the C-terminal region of the catalytic core domain of HIV-1 IN is important for binding to host chromatin and is crucial for both viral replication and the promotion of

  11. Cisco CCNA/CCENT Exam 640-802, 640-822, 640-816 Preparation Kit With Cisco Router Simulations

    CERN Document Server

    Liu, Dale

    2009-01-01

    Three exams, two certifications, one complete Cisco training solution for networking professionals! .. .. The CCNA exam is an entry-level IT certification from Cisco Systems for professionals installing and maintaining route and switched networks. The current exam material covers networking concepts along with new and updated content on network security fundamentals and the basics of wireless networking. .. .. This book can be used as a study guide for either track you choose to receive your CCNA – the single exam, 640-802 or the combined 640-822 and 640-816, and for the CCENT certification wh

  12. Detection of prosecretory mitogen lacritin in nonprimate tears primarily as a C-terminal-like fragment.

    Science.gov (United States)

    Laurie, Diane E; Splan, Rebecca K; Green, Kari; Still, Katherine M; McKown, Robert L; Laurie, Gordon W

    2012-09-12

    Lacritin is a human tear glycoprotein that promotes basal tear protein secretion in cultured rat lacrimal acinar cells and proliferation of subconfluent human corneal epithelial cells. When topically added to rabbit eyes, lacritin promotes basal tearing. Despite these activities on several species, lacritin's presence in nonprimate tears or other tissues has not been explored. Here we probed for lacritin in normal horse tears. Sequences were collected from the Ensembl genomic alignment of human LACRT gene with high-quality draft horse genome (EquCab2.0) and analyzed. Normal horse tears were collected and assayed by Western blotting, ELISA, and mass spectrometry. Newly generated rabbit antibodies, respectively, against N- and C-terminal regions of human lacritin were employed. Identity was 75% and 45%, respectively, at nucleotide and protein levels. Structural features were conserved, including a C-terminal amphipathic α-helix. Anti-C-terminal antibodies strongly detected a ∼13 kDa band in horse tears that was validated by mass spectrometry. In human tears, the same antibody detected uncleaved lacritin (∼24 kDa) strongly and C-terminal fragments of ∼13 and ∼11 kDa weakly. Anti-N-terminal antibodies were slightly reactive with a ∼24 kDa horse antigen and showed no reaction with the anti-C-terminal-reactive ∼13 kDa species. Similar respective levels of horse C-terminal versus N-terminal immunoreactivity were apparent by ELISA. Lacritin is present in horse tears, largely as a C-terminal fragment homologous to the mitogenic and bactericidal region in human lacritin, suggesting potential benefit in corneal wound repair.

  13. GBNV encoded movement protein (NSm) remodels ER network via C-terminal coiled coil domain

    Energy Technology Data Exchange (ETDEWEB)

    Singh, Pratibha; Savithri, H.S., E-mail: bchss@biochem.iisc.ernet.in

    2015-08-15

    Plant viruses exploit the host machinery for targeting the viral genome–movement protein complex to plasmodesmata (PD). The mechanism by which the non-structural protein m (NSm) of Groundnut bud necrosis virus (GBNV) is targeted to PD was investigated using Agrobacterium mediated transient expression of NSm and its fusion proteins in Nicotiana benthamiana. GFP:NSm formed punctuate structures that colocalized with mCherry:plasmodesmata localized protein 1a (PDLP 1a) confirming that GBNV NSm localizes to PD. Unlike in other movement proteins, the C-terminal coiled coil domain of GBNV NSm was shown to be involved in the localization of NSm to PD, as deletion of this domain resulted in the cytoplasmic localization of NSm. Treatment with Brefeldin A demonstrated the role of ER in targeting GFP NSm to PD. Furthermore, mCherry:NSm co-localized with ER–GFP (endoplasmic reticulum targeting peptide (HDEL peptide fused with GFP). Co-expression of NSm with ER–GFP showed that the ER-network was transformed into vesicles indicating that NSm interacts with ER and remodels it. Mutations in the conserved hydrophobic region of NSm (residues 130–138) did not abolish the formation of vesicles. Additionally, the conserved prolines at positions 140 and 142 were found to be essential for targeting the vesicles to the cell membrane. Further, systematic deletion of amino acid residues from N- and C-terminus demonstrated that N-terminal 203 amino acids are dispensable for the vesicle formation. On the other hand, the C-terminal coiled coil domain when expressed alone could also form vesicles. These results suggest that GBNV NSm remodels the ER network by forming vesicles via its interaction through the C-terminal coiled coil domain. Interestingly, NSm interacts with NP in vitro and coexpression of these two proteins in planta resulted in the relocalization of NP to PD and this relocalization was abolished when the N-terminal unfolded region of NSm was deleted. Thus, the NSm

  14. Expression, purification, and functional analysis of the C-terminal domain of Herbaspirillum seropedicae NifA protein.

    Science.gov (United States)

    Monteiro, Rose A; Souza, Emanuel M; Geoffrey Yates, M; Steffens, M Berenice R; Pedrosa, Fábio O; Chubatsu, Leda S

    2003-02-01

    The Herbaspirillum seropedicae NifA protein is responsible for nif gene expression. The C-terminal domain of the H. seropedicae NifA protein, fused to a His-Tag sequence (His-Tag-C-terminal), was over-expressed and purified by metal-affinity chromatography to yield a highly purified and active protein. Band-shift assays showed that the NifA His-Tag-C-terminal bound specifically to the H. seropedicae nifB promoter region in vitro. In vivo analysis showed that this protein inhibited the Central + C-terminal domains of NifA protein from activating the nifH promoter of K. pneumoniae in Escherichia coli, indicating that the protein must be bound to the NifA-binding site (UAS site) at the nifH promoter region to activate transcription. Copyright 2002 Elsevier Science (USA)

  15. The influence of the N-terminal region of antimicrobial peptide pleurocidin on fungal apoptosis.

    Science.gov (United States)

    Choi, Hyemin; Lee, Dong Gun

    2013-10-28

    In our previous study, the 25-mer antimicrobial peptide pleurocidin (Ple) had been thought to induce apoptosis in Candida albicans. This study demonstrated that reactive oxygen species (ROS) production was a major cause of Ple-induced apoptosis. Four truncated analogs were synthesized to understand the functional roles in the N- and C-terminal regions of Ple on the apoptosis. Ple, Ple (4-25), Ple (1-22), and Ple (1-19) produced ROS, including hydroxyl radicals, on the order of [Ple > Ple (1-22) > Ple (4-25) > Ple (1-19)], whereas Ple (7-25) did not induce any ROS production. The results suggested that the N-terminal deletion affected the ROS-inducing activities much more than that of the C-terminal deletion, and net hydrophobicity [Ple > Ple (1-22) > Ple (4-25) > Ple (1-19) > Ple (7-25)] was related to ROS generation rather than other primary factors like net charge. Hence, we focused on the N-terminal-truncated peptides, Ple (4-25) and Ple (7-25), and examined other apoptotic features, including mitochondrial membrane depolarization, caspase activation, phosphatidylserine externalization, and DNA and nuclear fragmentation. The results also confirmed the disappearance of apoptotic activity of Ple (7-25) by the truncation of the N-terminal region (1-6) and the specific activity patterns between Ple and analogs. In conclusion, the N-terminal region of Ple played an important role in apoptosis.

  16. Genetics, structure, and prevalence of FP967 (CDC Triffid) T-DNA in flax.

    Science.gov (United States)

    Young, Lester; Hammerlindl, Joseph; Babic, Vivijan; McLeod, Jamille; Sharpe, Andrew; Matsalla, Chad; Bekkaoui, Faouzi; Marquess, Leigh; Booker, Helen M

    2015-01-01

    The detection of T-DNA from a genetically modified flaxseed line (FP967, formally CDC Triffid) in a shipment of Canadian flaxseed exported to Europe resulted in a large decrease in the amount of flax planted in Canada. The Canadian flaxseed industry undertook major changes to ensure the removal of FP967 from the supply chain. This study aimed to resolve the genetics and structure of the FP967 transfer DNA (T-DNA). The FP967 T-DNA is thought to be inserted in at single genomic locus. The junction between the T-DNA and genomic DNA consisted of two inverted Right Borders with no Left Border (LB) flanking genomic DNA sequences recovered. This information was used to develop an event-specific quantitative PCR (qPCR) assay. This assay and an existing assay specific to the T-DNA construct were used to determine the genetics and prevalence of the FP967 T-DNA. These data supported the hypothesis that the T-DNA is present at a single location in the genome. The FP967 T-DNA is present at a low level (between 0.01 and 0.1%) in breeder seed lots from 2009 and 2010. None of the 11,000 and 16,000 lines selected for advancement through the Flax Breeding Program in 2010 and 2011, respectively, tested positive for the FP967 T-DNA, however. Most of the FP967 T-DNA sequence was resolved via PCR cloning and next generation sequencing. A 3,720 bp duplication of an internal portion of the T-DNA (including a Right Border) was discovered between the flanking genomic DNA and the LB. An event-specific assay, SAT2-LB, was developed for the junction between this repeat and the LB.

  17. Epimerization-free C-terminal peptide activation, elongation and cyclization

    NARCIS (Netherlands)

    Popović, S.

    2015-01-01

    C-terminal peptide activation and cyclization reactions are generally accompanied with epimerization (partial loss of C‐terminal stereointegrity). Therefore, the focus of this thesis was to develop epimerization-free methods for C-terminal peptide activation to enable C-terminal peptide elongation

  18. Sequence diversity of the C-terminal region of Plasmodium falciparum merozoite surface protein 1 in southern Iran.

    Science.gov (United States)

    Zamani, Zahra; Razavi, Mohammad Reza; Sadeghi, Sedigheh; Naddaf, Saeed; Pourfallah, Fatemeh; Mirkhani, Fatemeh; Arjmand, Mohammad; Feizhaddad, Hossein; Rad, Mina Ebrahimi; Ebrahimi Rad, Mina; Tameemi, Marzieh; Assmar, Mehdi

    2009-01-01

    The C-terminal region of the merozoite surface protein 1 (MSP-1) of Plasmodium falciparum is a strong vaccine candidate as it is associated with immunity to the parasite. This corresponds approximately to the conserved 17th block of the gene and is composed of two EGF- like domains. These domains exhibit only four single amino acid substitutions which show several potential variants in this region of the gene. As the variations might be important for a regional vaccine design, a study was carried out to determine the variations present in P. falciparum isolates from southern Iran. Besides the usual E-T-S-R-L and the Q-K-N-G-F types, we found Q-T-S-R-L, E-K-N-G-F, E-T-S-G-L, Z-T-S-G-L and Z-T-S-R-L types, where Z was E or Q signifying the presence of mixed clones in single isolates.

  19. 7 CFR 58.640 - Packaging.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 3 2010-01-01 2010-01-01 false Packaging. 58.640 Section 58.640 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Standards... Procedures § 58.640 Packaging. The packaging of the semifrozen product shall be done by means which will in...

  20. 31 CFR 20.640 - Employee.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Employee. 20.640 Section 20.640 Money...-FREE WORKPLACE (FINANCIAL ASSISTANCE) Definitions § 20.640 Employee. (a) Employee means the employee of... charge employees; (2) All indirect charge employees, unless their impact or involvement in the...

  1. 29 CFR 1472.640 - Employee.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 4 2010-07-01 2010-07-01 false Employee. 1472.640 Section 1472.640 Labor Regulations... DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Definitions § 1472.640 Employee. (a) Employee means the employee of a recipient directly engaged in the performance of work under the award, including— (1) All...

  2. 14 CFR 1267.640 - Employee.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Employee. 1267.640 Section 1267.640... WORKPLACE (FINANCIAL ASSISTANCE) Definitions § 1267.640 Employee. (a) Employee means the employee of a... employees; (2) All indirect charge employees, unless their impact or involvement in the performance of work...

  3. 32 CFR 26.640 - Employee.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 1 2010-07-01 2010-07-01 false Employee. 26.640 Section 26.640 National Defense... REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Definitions § 26.640 Employee. (a) Employee means the employee of a recipient directly engaged in the performance of work under the award, including— (1...

  4. 43 CFR 43.640 - Employee.

    Science.gov (United States)

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Employee. 43.640 Section 43.640 Public... WORKPLACE (FINANCIAL ASSISTANCE) Definitions § 43.640 Employee. (a) Employee means the employee of a... employees; (2) All indirect charge employees, unless their impact or involvement in the performance of work...

  5. 13 CFR 147.640 - Employee.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Employee. 147.640 Section 147.640... WORKPLACE (NONPROCUREMENT) Definitions § 147.640 Employee. (a) Employee means the employee of a recipient directly engaged in the performance of work under the award, including— (1) All direct charge employees; (2...

  6. 28 CFR 83.640 - Employee.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Employee. 83.640 Section 83.640 Judicial...) Definitions § 83.640 Employee. (a) Employee means the employee of a recipient directly engaged in the performance of work under the award, including— (1) All direct charge employees; (2) All indirect charge...

  7. 20 CFR 439.640 - Employee.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Employee. 439.640 Section 439.640 Employees... ASSISTANCE) Definitions § 439.640 Employee. (a) Employee means the employee of a recipient directly engaged in the performance of work under the award, including— (1) All direct charge employees; (2) All...

  8. 22 CFR 210.640 - Employee.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Employee. 210.640 Section 210.640 Foreign... (FINANCIAL ASSISTANCE) Definitions § 210.640 Employee. (a) Employee means the employee of a recipient directly engaged in the performance of work under the award, including— (1) All direct charge employees; (2...

  9. 49 CFR 32.640 - Employee.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Employee. 32.640 Section 32.640 Transportation... ASSISTANCE) Definitions § 32.640 Employee. (a) Employee means the employee of a recipient directly engaged in the performance of work under the award, including— (1) All direct charge employees; (2) All indirect...

  10. 10 CFR 607.640 - Employee.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Employee. 607.640 Section 607.640 Energy DEPARTMENT OF... ASSISTANCE) Definitions § 607.640 Employee. (a) Employee means the employee of a recipient directly engaged in the performance of work under the award, including— (1) All direct charge employees; (2) All...

  11. 22 CFR 312.640 - Employee.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Employee. 312.640 Section 312.640 Foreign... § 312.640 Employee. (a) Employee means the employee of a recipient directly engaged in the performance of work under the award, including— (1) All direct charge employees; (2) All indirect charge...

  12. 45 CFR 630.640 - Employee.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 3 2010-10-01 2010-10-01 false Employee. 630.640 Section 630.640 Public Welfare... DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Definitions § 630.640 Employee. (a) Employee means the employee of a recipient directly engaged in the performance of work under the award, including— (1) All...

  13. 22 CFR 1509.640 - Employee.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Employee. 1509.640 Section 1509.640 Foreign... ASSISTANCE) Definitions § 1509.640 Employee. (a) Employee means the employee of a recipient directly engaged in the performance of work under the award, including— (1) All direct charge employees; (2) All...

  14. 22 CFR 133.640 - Employee.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Employee. 133.640 Section 133.640 Foreign... ASSISTANCE) Definitions § 133.640 Employee. (a) Employee means the employee of a recipient directly engaged in the performance of work under the award, including— (1) All direct charge employees; (2) All...

  15. 15 CFR 29.640 - Employee.

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false Employee. 29.640 Section 29.640... WORKPLACE (FINANCIAL ASSISTANCE) Definitions § 29.640 Employee. (a) Employee means the employee of a... employees; (2) All indirect charge employees, unless their impact or involvement in the performance of work...

  16. 2 CFR 182.640 - Employee.

    Science.gov (United States)

    2010-01-01

    ... 2 Grants and Agreements 1 2010-01-01 2010-01-01 false Employee. 182.640 Section 182.640 Grants and... GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Definitions § 182.640 Employee. (a) Employee means the employee of a recipient directly engaged in the performance of work under the award...

  17. 22 CFR 1008.640 - Employee.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Employee. 1008.640 Section 1008.640 Foreign... ASSISTANCE) Definitions § 1008.640 Employee. (a) Employee means the employee of a recipient directly engaged in the performance of work under the award, including— (1) All direct charge employees; (2) All...

  18. 24 CFR 21.640 - Employee.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Employee. 21.640 Section 21.640... GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (GRANTS) Definitions § 21.640 Employee. (a) Employee means the employee of a recipient directly engaged in the performance of work under the award, including— (1...

  19. 40 CFR 36.640 - Employee.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Employee. 36.640 Section 36.640... REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Definitions § 36.640 Employee. (a) Employee means the employee of a recipient directly engaged in the performance of work under the award, including— (1...

  20. 45 CFR 1173.640 - Employee.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 3 2010-10-01 2010-10-01 false Employee. 1173.640 Section 1173.640 Public Welfare...) Definitions § 1173.640 Employee. (a) Employee means the employee of a recipient directly engaged in the performance of work under the award, including— (1) All direct charge employees; (2) All indirect charge...

  1. 21 CFR 1405.640 - Employee.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 9 2010-04-01 2010-04-01 false Employee. 1405.640 Section 1405.640 Food and Drugs... ASSISTANCE) Definitions § 1405.640 Employee. (a) Employee means the employee of a recipient directly engaged in the performance of work under the award, including— (1) All direct charge employees; (2) All...

  2. 29 CFR 94.640 - Employee.

    Science.gov (United States)

    2010-07-01

    ... 29 Labor 1 2010-07-01 2010-07-01 true Employee. 94.640 Section 94.640 Labor Office of the... § 94.640 Employee. (a) Employee means the employee of a recipient directly engaged in the performance of work under the award, including— (1) All direct charge employees; (2) All indirect charge...

  3. 34 CFR 84.640 - Employee.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 1 2010-07-01 2010-07-01 false Employee. 84.640 Section 84.640 Education Office of the...) Definitions § 84.640 Employee. (a) Employee means the employee of a recipient directly engaged in the performance of work under the award, including— (1) All direct charge employees; (2) All indirect charge...

  4. 45 CFR 1155.640 - Employee.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 3 2010-10-01 2010-10-01 false Employee. 1155.640 Section 1155.640 Public Welfare...) Definitions § 1155.640 Employee. (a) Employee means the employee of a recipient directly engaged in the performance of work under the award, including— (1) All direct charge employees; (2) All indirect charge...

  5. Functional interaction between the N- and C-terminal domains of murine leukemia virus surface envelope protein

    International Nuclear Information System (INIS)

    Lu, C.-W.; Roth, Monica J.

    2003-01-01

    A series of murine leukemia viruses (MuLVs) with chimeric envelope proteins (Env) was generated to map functional interactions between the N- and the C-terminal domains of surface proteins (SU). All these chimeras have the 4070A amphotropic receptor-binding region flanked by various lengths of Moloney ecotropic N- and C-terminal Env. A charged residue, E49 (E16 on the mature protein), was identified at the N-terminals of Moloney MuLV SU that is important for the interaction with the C-terminal domain of the SU. The region that interacts with E49 was localized between junction 4 (R265 of M-MuLV Env) and junction 6 (L374 of M-MuLV Env) of SU. Sequencing the viable chimeric Env virus populations identified residues within the SU protein that improved the replication kinetics of the input chimeric Env viruses. Mutations in the C-domain of SU (G387E/R, L435I, L442P) were found to improve chimera IV4, which displayed a delayed onset of replication. The replication of AE6, containing a chimeric junction in the SU C-terminus, was improved by mutations in the N-domain (N40H, E80K), the proline-rich region (Q252R), or the transmembrane protein (L538N). Altogether, these observations provide insights into the structural elements required for Env function

  6. 21 CFR 640.30 - Plasma.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Plasma. 640.30 Section 640.30 Food and Drugs FOOD... STANDARDS FOR HUMAN BLOOD AND BLOOD PRODUCTS Plasma § 640.30 Plasma. (a) Proper name and definition. The proper name of this component is Plasma. The component is defined as: (1) The fluid portion of one unit...

  7. Crystallization and X-ray data analysis of the 10 kDa C-terminal lid subdomain from Caenorhabditis elegans Hsp70

    Energy Technology Data Exchange (ETDEWEB)

    Worrall, Liam; Walkinshaw, Malcolm D., E-mail: m.walkinshaw@ed.ac.uk [School of Biological Sciences, University of Edinburgh, The King’s Buildings, Mayfield Road, Edinburgh EH9 3JR,Scotland (United Kingdom)

    2006-09-01

    Crystals of the C-terminal 10 kDa lid subdomain from the C. elegans chaperone Hsp70 have been obtained that diffract X-rays to ∼3.5 Å and belong to space group I2{sub 1}2{sub 1}2{sub 1}. Analysis of X-ray data and initial heavy-atom phasing reveals 24 monomers in the asymmetric unit related by 432 non-crystallographic symmetry. Hsp70 is an important molecular chaperone involved in the regulation of protein folding. Crystals of the C-terminal 10 kDa helical lid domain (residues 542–640) from a Caenorhabditis elegans Hsp70 homologue have been produced that diffract X-rays to ∼3.4 Å. Crystals belong to space group I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = b = 197, c = 200 Å. The Matthews coefficient, self-rotation function and Patterson map indicate 24 monomers in the asymmetric unit, showing non-crystallographic 432 symmetry. Molecular-replacement studies using the corresponding domain from rat, the only eukaryotic homologue with a known structure, failed and a mercury derivative was obtained. Preliminary MAD phasing using SHELXD and SHARP for location and refinement of the heavy-atom substructure and SOLOMON for density modification produced interpretable maps with a clear protein–solvent boundary. Further density-modification, model-building and refinement are currently under way.

  8. Technical Efficiency Analysis of Container Terminals in the Middle Eastern Region

    Directory of Open Access Journals (Sweden)

    Ebrahim Sharaf Almawsheki

    2015-12-01

    Full Text Available Despite an increasing number of studies on the efficiency of container terminals, their focus has mostly been on advanced and emerging markets. There are limited studies on container terminals in developing countries such as those of the Middle Eastern region, which are located in a critical geographic position in the international maritime route between the East and the West. Information on their potential for development relative to other terminals worldwide is thus not readily available. This study aims to evaluate the technical efficiency of 19 container terminals in the Middle Eastern region. The DEA approach is used to measure technical efficiency, and slack variable analysis identifies potential areas of improvement for inefficient terminals. The results show that the Jebel Ali, Salalah and Beirut container terminals are the most efficient terminals in the region, and that the least efficient is the terminal in Aden. The results provide valuable information for terminal managers, helping to develop resource utilisation for steady development in operational efficiency.

  9. NMR assignments of SPOC domain of the human transcriptional corepressor SHARP in complex with a C-terminal SMRT peptide.

    Science.gov (United States)

    Mikami, Suzuka; Kanaba, Teppei; Ito, Yutaka; Mishima, Masaki

    2013-10-01

    The transcriptional corepressor SMRT/HDAC1-associated repressor protein (SHARP) recruits histone deacetylases. Human SHARP protein is thought to function in processes involving steroid hormone responses and the Notch signaling pathway. SHARP consists of RNA recognition motifs (RRMs) in the N-terminal region and the spen paralog and ortholog C-terminal (SPOC) domain in the C-terminal region. It is known that the SPOC domain binds the LSD motif in the C-terminal tail of corepressors silencing mediator for retinoid and thyroid receptor (SMRT)/nuclear receptor corepressor (NcoR). We are interested in delineating the mechanism by which the SPOC domain recognizes the LSD motif of the C-terminal tail of SMRT/NcoR. To this end, we are investigating the tertiary structure of the SPOC/SMRT peptide using NMR. Herein, we report on the (1)H, (13)C and (15)N resonance assignments of the SPOC domain in complex with a SMRT peptide, which contributes towards a structural understanding of the SPOC/SMRT peptide and its molecular recognition.

  10. Structure predictions of two Bauhinia variegata lectins reveal patterns of C-terminal properties in single chain legume lectins.

    Science.gov (United States)

    Moreira, Gustavo M S G; Conceição, Fabricio R; McBride, Alan J A; Pinto, Luciano da S

    2013-01-01

    Bauhinia variegata lectins (BVL-I and BVL-II) are single chain lectins isolated from the plant Bauhinia variegata. Single chain lectins undergo post-translational processing on its N-terminal and C-terminal regions, which determines their physiological targeting, carbohydrate binding activity and pattern of quaternary association. These two lectins are isoforms, BVL-I being highly glycosylated, and thus far, it has not been possible to determine their structures. The present study used prediction and validation algorithms to elucidate the likely structures of BVL-I and -II. The program Bhageerath-H was chosen from among three different structure prediction programs due to its better overall reliability. In order to predict the C-terminal region cleavage sites, other lectins known to have this modification were analysed and three rules were created: (1) the first amino acid of the excised peptide is small or hydrophobic; (2) the cleavage occurs after an acid, polar, or hydrophobic residue, but not after a basic one; and (3) the cleavage spot is located 5-8 residues after a conserved Leu amino acid. These rules predicted that BVL-I and -II would have fifteen C-terminal residues cleaved, and this was confirmed experimentally by Edman degradation sequencing of BVL-I. Furthermore, the C-terminal analyses predicted that only BVL-II underwent α-helical folding in this region, similar to that seen in SBA and DBL. Conversely, BVL-I and -II contained four conserved regions of a GS-I association, providing evidence of a previously undescribed X4+unusual oligomerisation between the truncated BVL-I and the intact BVL-II. This is the first report on the structural analysis of lectins from Bauhinia spp. and therefore is important for the characterisation C-terminal cleavage and patterns of quaternary association of single chain lectins.

  11. Functional analysis of the C-terminal region of human adenovirus E1A reveals a misidentified nuclear localization signal

    International Nuclear Information System (INIS)

    Cohen, Michael J.; King, Cason R.; Dikeakos, Jimmy D.; Mymryk, Joe S.

    2014-01-01

    The immortalizing function of the human adenovirus 5 E1A oncoprotein requires efficient localization to the nucleus. In 1987, a consensus monopartite nuclear localization sequence (NLS) was identified at the C-terminus of E1A. Since that time, various experiments have suggested that other regions of E1A influence nuclear import. In addition, a novel bipartite NLS was recently predicted at the C-terminal region of E1A in silico. In this study, we used immunofluorescence microscopy and co-immunoprecipitation analysis with importin-α to verify that full nuclear localization of E1A requires the well characterized NLS spanning residues 285–289, as well as a second basic patch situated between residues 258 and 263 ( 258 RVGGRRQAVECIEDLLNEPGQPLDLSCKRPRP 289 ). Thus, the originally described NLS located at the C-terminus of E1A is actually a bipartite signal, which had been misidentified in the existing literature as a monopartite signal, altering our understanding of one of the oldest documented NLSs. - Highlights: • Human adenovirus E1A is localized to the nucleus. • The C-terminus of E1A contains a bipartite nuclear localization signal (NLS). • This signal was previously misidentified to be a monopartite NLS. • Key basic amino acid residues within this sequence are highly conserved

  12. The C-terminal domain of the Bloom syndrome DNA helicase is essential for genomic stability

    Directory of Open Access Journals (Sweden)

    Noonan James P

    2001-07-01

    Full Text Available Abstract Background Bloom syndrome is a rare cancer-prone disorder in which the cells of affected persons have a high frequency of somatic mutation and genomic instability. Bloom syndrome cells have a distinctive high frequency of sister chromatid exchange and quadriradial formation. BLM, the protein altered in BS, is a member of the RecQ DNA helicase family, whose members share an average of 40% identity in the helicase domain and have divergent N-terminal and C-terminal flanking regions of variable lengths. The BLM DNA helicase has been shown to localize to the ND10 (nuclear domain 10 or PML (promyelocytic leukemia nuclear bodies, where it associates with TOPIIIα, and to the nucleolus. Results This report demonstrates that the N-terminal domain of BLM is responsible for localization of the protein to the nuclear bodies, while the C-terminal domain directs the protein to the nucleolus. Deletions of the N-terminal domain of BLM have little effect on sister chromatid exchange frequency and chromosome stability as compared to helicase and C-terminal mutations which can increase SCE frequency and chromosome abnormalities. Conclusion The helicase activity and the C-terminal domain of BLM are critical for maintaining genomic stability as measured by the sister chromatid exchange assay. The localization of BLM into the nucleolus by the C-terminal domain appears to be more important to genomic stability than localization in the nuclear bodies.

  13. Acetylation within the N- and C-Terminal Domains of Src Regulates Distinct Roles of STAT3-Mediated Tumorigenesis.

    Science.gov (United States)

    Huang, Chao; Zhang, Zhe; Chen, Lihan; Lee, Hank W; Ayrapetov, Marina K; Zhao, Ting C; Hao, Yimei; Gao, Jinsong; Yang, Chunzhang; Mehta, Gautam U; Zhuang, Zhengping; Zhang, Xiaoren; Hu, Guohong; Chin, Y Eugene

    2018-06-01

    Posttranslational modifications of mammalian c-Src N-terminal and C-terminal domains regulate distinct functions. Myristoylation of G 2 controls its cell membrane association and phosphorylation of Y419/Y527 controls its activation or inactivation, respectively. We provide evidence that Src-cell membrane association-dissociation and catalytic activation-inactivation are both regulated by acetylation. In EGF-treated cells, CREB binding protein (CBP) acetylates an N-terminal lysine cluster (K5, K7, and K9) of c-Src to promote dissociation from the cell membrane. CBP also acetylates the C-terminal K401, K423, and K427 of c-Src to activate intrinsic kinase activity for STAT3 recruitment and activation. N-terminal domain phosphorylation (Y14, Y45, and Y68) of STAT3 by c-Src activates transcriptionally active dimers of STAT3. Moreover, acetyl-Src translocates into nuclei, where it forms the Src-STAT3 enhanceosome for gene regulation and cancer cell proliferation. Thus, c-Src acetylation in the N-terminal and C-terminal domains play distinct roles in Src activity and regulation. Significance: CBP-mediated acetylation of lysine clusters in both the N-terminal and C-terminal regions of c-Src provides additional levels of control over STAT3 transcriptional activity. Cancer Res; 78(11); 2825-38. ©2018 AACR . ©2018 American Association for Cancer Research.

  14. 21 CFR 640.80 - Albumin (Human).

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Albumin (Human). 640.80 Section 640.80 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) BIOLOGICS ADDITIONAL STANDARDS FOR HUMAN BLOOD AND BLOOD PRODUCTS Albumin (Human) § 640.80 Albumin (Human). (a) Proper...

  15. Investigation of the 14N/d,α/12C reaction at Esub(d)=640-310 keV deuteron energies

    International Nuclear Information System (INIS)

    Bakr, M.H.S.; Hunyadi, I.; Schlenk, G.; Somogyi, G.; Valek, A.

    1974-01-01

    Angular distributions of the α 0 , α 1 , α 2 , and α 3 groups from the 14 N/d,α/ 12 C reaction have been measured at deuteron energies 640, 510, and 350 keV using solid state track detectors. Semiconductor detector was used to measure the excitation functions of the α 0 and α 1 groups from the same reaction in the energy range 640-310 keV at THETAsub(lab)=90 0 . The absolute cross-section values are given for the alpha groups investigated. The experimentally obtained angular distributions have been analysed in terms of Legendre polynomials. The measured relative intensity ratios of the α 0 , α 1 , and α 3 groups could be reproduced by a simple calculation assuming statistical compound reaction mechanism. (B.T.)

  16. Mapping the transcription termination region of the mouse immunoglobulin kappa gene

    International Nuclear Information System (INIS)

    Xu, M.; Garrard, W.T.

    1986-01-01

    To define the transcription termination region of the mouse immunoglobulin kappa gene, they have subcloned single copy DNA sequences corresponding to both the template and the non-template strands of this locus. In vitro nuclear transcription with isolated MPC-11 nuclei was performed and the resulting 32 P-labeled RNA was hybridized to slot-blotted, single-stranded M13 probes covering regions within and flanking the kappa gene. The hybridization pattern for the template-strand reveals that transcription terminates within the region between 1.1 to 2.3 kb downstream from the poly(A) site. Ten different short sequences (8-13 bp) reside within 460 bp of this region that exhibit homology with sequences found in the termination regions of mouse β-globin and chicken ovalbumin genes. Transcription of the non-template strand occurs on either side of this termination region. They note that no transcription is detectable on the non-template strand downstream of the enhancer, indicating that if RNA polymerase II enters at this site, it does not initiate transcription during transit to the promoter region. They conclude that transcription of the kappa gene passes the poly(A) addition site and terminates within 2.3 Kb downstream

  17. Characterization of glutamate decarboxylase from Lactobacillus plantarum and its C-terminal function for the pH dependence of activity.

    Science.gov (United States)

    Shin, Sun-Mi; Kim, Hana; Joo, Yunhye; Lee, Sang-Jae; Lee, Yong-Jik; Lee, Sang Jun; Lee, Dong-Woo

    2014-12-17

    The gadB gene encoding glutamate decarboxylase (GAD) from Lactobacillus plantarum was cloned and expressed in Escherichia coli. The recombinant enzyme exhibited maximal activity at 40 °C and pH 5.0. The 3D model structure of L. plantarum GAD proposed that its C-terminal region (Ile454-Thr468) may play an important role in the pH dependence of catalysis. Accordingly, C-terminally truncated (Δ3 and Δ11 residues) mutants were generated and their enzyme activities compared with that of the wild-type enzyme at different pH values. Unlike the wild-type GAD, the mutants showed pronounced catalytic activity in a broad pH range of 4.0-8.0, suggesting that the C-terminal region is involved in the pH dependence of GAD activity. Therefore, this study may provide effective target regions for engineering pH dependence of GAD activity, thereby meeting industrial demands for the production of γ-aminobutyrate in a broad range of pH values.

  18. 21 CFR 640.60 - Source Plasma.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Source Plasma. 640.60 Section 640.60 Food and... ADDITIONAL STANDARDS FOR HUMAN BLOOD AND BLOOD PRODUCTS Source Plasma § 640.60 Source Plasma. The proper name of the product shall be Source Plasma. The product is defined as the fluid portion of human blood...

  19. 21 CFR 640.62 - Medical supervision.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Medical supervision. 640.62 Section 640.62 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) BIOLOGICS ADDITIONAL STANDARDS FOR HUMAN BLOOD AND BLOOD PRODUCTS Source Plasma § 640.62 Medical supervision. A qualified licensed physician shall be on the...

  20. Superficial disposition of the N-terminal region of the surfactant protein SP-C and the absence of specific SP-B-SP-C interactions in phospholipid bilayers

    DEFF Research Database (Denmark)

    Plasencia, I; Cruz, A; Casals, C

    2001-01-01

    . The fluorescence emission spectrum of Dns-SP-C in phospholipid bilayers is similar to the spectrum of dansyl-phosphatidylethanolamine, and indicates that the N-terminal end of the protein is located at the surface of the membranes and is exposed to the aqueous environment. In membranes containing...... phosphatidylglycerol (PG), the fluorescence of Dns-SP-C shows a 3-fold increase with respect to the fluorescence of phosphatidylcholine (PC), suggesting that electrostatic lipid-protein interactions induce important effects on the structure and disposition of the N-terminal segment of the protein in these membranes...... of the N-terminal segment of the protein into less polar environments that originate during protein lateral segregation. This suggests that conformation and interactions of the N-terminal segment of SP-C could be important in regulating the lateral distribution of the protein in surfactant bilayers...

  1. Functional analysis of the C-terminal region of human adenovirus E1A reveals a misidentified nuclear localization signal

    Energy Technology Data Exchange (ETDEWEB)

    Cohen, Michael J.; King, Cason R.; Dikeakos, Jimmy D. [Department of Microbiology and Immunology, The University of Western Ontario, A4-833 London Regional Cancer Centre, 800 Commissioners Road E., London, Ontario, N6A 4L6 Canada (Canada); Mymryk, Joe S., E-mail: jmymryk@uwo.ca [Department of Microbiology and Immunology, The University of Western Ontario, A4-833 London Regional Cancer Centre, 800 Commissioners Road E., London, Ontario, N6A 4L6 Canada (Canada); Department of Oncology, The University of Western Ontario, London Regional Cancer Centre, Ontario (Canada)

    2014-11-15

    The immortalizing function of the human adenovirus 5 E1A oncoprotein requires efficient localization to the nucleus. In 1987, a consensus monopartite nuclear localization sequence (NLS) was identified at the C-terminus of E1A. Since that time, various experiments have suggested that other regions of E1A influence nuclear import. In addition, a novel bipartite NLS was recently predicted at the C-terminal region of E1A in silico. In this study, we used immunofluorescence microscopy and co-immunoprecipitation analysis with importin-α to verify that full nuclear localization of E1A requires the well characterized NLS spanning residues 285–289, as well as a second basic patch situated between residues 258 and 263 ({sup 258}RVGGRRQAVECIEDLLNEPGQPLDLSCKRPRP{sup 289}). Thus, the originally described NLS located at the C-terminus of E1A is actually a bipartite signal, which had been misidentified in the existing literature as a monopartite signal, altering our understanding of one of the oldest documented NLSs. - Highlights: • Human adenovirus E1A is localized to the nucleus. • The C-terminus of E1A contains a bipartite nuclear localization signal (NLS). • This signal was previously misidentified to be a monopartite NLS. • Key basic amino acid residues within this sequence are highly conserved.

  2. Properties of catalase-peroxidase lacking its C-terminal domain

    International Nuclear Information System (INIS)

    Baker, Ruletha D.; Cook, Carma O.; Goodwin, Douglas C.

    2004-01-01

    Catalase-peroxidases have a two-domain structure. The N-terminal domain contains the bifunctional active site, but the function of the C-terminal domain is unknown. We produced catalase-peroxidase containing only its N-terminal domain (KatG Nterm ). Removal of the C-terminal domain did not result in unexpected changes in secondary structure as evaluated by CD, but KatG Nterm had neither catalase nor peroxidase activity. Partial recovery of both activities was achieved by incubating KatG Nterm with the separately expressed and isolated KatG C-terminal domain. Spectroscopic measurements revealed a shift in heme environment from a mixture of high-spin species (wtKatG) to exclusively hexacoordinate, low-spin (KatG Nterm ). Moreover, a >1000-fold lower k on for CN - binding was observed for KatG Nterm . EPR spectra for KatG Nterm and the results of site-specific substitution of active site histidines suggested that the distal histidine was the sixth ligand. Thus, one important role for the C-terminal domain may be to support the architecture of the active site, preventing heme ligation by this catalytically essential residue

  3. Truncation of the C-terminal region of Toscana Virus NSs protein is critical for interferon-β antagonism and protein stability.

    Science.gov (United States)

    Gori Savellini, Gianni; Gandolfo, Claudia; Cusi, Maria Grazia

    2015-12-01

    Toscana Virus (TOSV) is a Phlebovirus responsible for central nervous system (CNS) injury in humans. The TOSV non-structural protein (NSs), which interacting with RIG-I leads to its degradation, was analysed in the C terminus fragment in order to identify its functional domains. To this aim, two C-terminal truncated NSs proteins, Δ1C-NSs (aa 1-284) and Δ2C-NSs (aa 1-287) were tested. Only Δ1C-NSs did not present any inhibitory effect on RIG-I and it showed a greater stability than the whole NSs protein. Moreover, the deletion of the TLQ aa sequence interposed between the two ΔC constructs caused a greater accumulation of the protein with a weak inhibitory effect on RIG-I, indicating some involvement of these amino acids in the NSs activity. Nevertheless, all the truncated proteins were still able to interact with RIG-I, suggesting that the domains responsible for RIG-I signaling and RIG-I interaction are mapped on different regions of the protein. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. 20 CFR 640.4 - Standard for conformity.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Standard for conformity. 640.4 Section 640.4 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF LABOR STANDARD FOR BENEFIT PAYMENT PROMPTNESS-UNEMPLOYMENT COMPENSATION § 640.4 Standard for conformity. A State law will satisfy the...

  5. Insights into amyloid-like aggregation of H2 region of the C-terminal domain of nucleophosmin.

    Science.gov (United States)

    Russo, Anna; Diaferia, Carlo; La Manna, Sara; Giannini, Cinzia; Sibillano, Teresa; Accardo, Antonella; Morelli, Giancarlo; Novellino, Ettore; Marasco, Daniela

    2017-02-01

    Nucleophosmin (NPM1) is a multifunctional protein involved in a variety of biological processes including the pathogenesis of several human malignancies and is the most frequently mutated gene in Acute Myeloid Leukemia (AML). To deepen the role of protein regions in its biological activities, lately we reported on the structural behavior of dissected C-terminal domain (CTD) helical fragments. Unexpectedly the H2 (residues 264-277) and H3 AML-mutated regions showed a remarkable tendency to form amyloid-like assemblies with fibrillar morphology and β-sheet structure that resulted as toxic when exposed to human neuroblastoma cells. More recently NPM1 was found to be highly expressed and toxic in neurons of mouse models of Huntington's disease (HD). Here we investigate the role of each residue in the β-strand aggregation process of H2 region of NPM1 by performing a systematic alanine scan of its sequence and structural and kinetic analyses of aggregation of derived peptides by means of Circular Dichorism (CD) and Thioflavin T (Th-T) assay. These solution state investigations pointed out the crucial role exerted by the basic amyloidogenic stretch of H2 (264-271) and to shed light on the initial and main interactions involved in fibril formation we performed studies on fibrils deriving from the related Ala peptides through the analysis of fibrils with birefringence of polarized optical microscopy and wide-angle X-ray scattering (WAXS). This analysis suggested that the presence of branched Ile 269 conferred preferential packing patterns that, instead, appeared geometrically hampered by the aromatic side-chain of Phe 268 . Present investigations could be useful to deepen the knowledge of AML molecular mechanisms and the role of cytoplasmatic aggregates of NPM1c+. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Inhibition of muscle-specific gene expression by Id3: requirement of the C-terminal region of the protein for stable expression and function.

    Science.gov (United States)

    Chen, B; Han, B H; Sun, X H; Lim, R W

    1997-01-15

    We have examined the role of an Id-like protein, Id3 (also known as HLH462), in the regulation of muscle-specific gene expression. Id proteins are believed to block expression of muscle-specific genes by preventing the dimerization between ubiquitous bHLH proteins (E proteins) and myogenic bHLH proteins such as MyoD. Consistent with its putative role as an inhibitor of differentiation, Id3 mRNA was detected in proliferating skeletal muscle cells, was further induced by basic fibroblast growth factor (bFGF) and was down-regulated in differentiated muscle cultures. Overexpression of Id3 efficiently inhibited the MyoD-mediated activation of the muscle-specific creatine kinase (MCK) reporter gene. Deletion analysis indicated that the C-terminal 15 amino acids of Id3 are critical for the full inhibitory activity while deleting up to 42 residues from the C-terminus of the related protein, Id2, did not affect its ability to inhibit the MCK reporter gene. Chimeric protein containing the N-terminal region of Id3 and the C-terminus of Id2 was also non-functional in transfected cells. In contrast, wild-type Id3, the C-terminal mutants, and the Id3/Id2 chimera could all interact with the E-protein E47in vitro. Additional studies indicated that truncation of the Id3 C-terminus might have adversely affected the expression level of the mutant proteins but the Id3/Id2 chimera was stably expressed. Taken together, our results revealed a more complex requirement for the expression and proper function of the Id family proteins than was hitherto expected.

  7. Structural Insight into the Critical Role of the N-Terminal Region in the Catalytic Activity of Dual-Specificity Phosphatase 26.

    Directory of Open Access Journals (Sweden)

    Eun-Young Won

    Full Text Available Human dual-specificity phosphatase 26 (DUSP26 is a novel target for anticancer therapy because its dephosphorylation of the p53 tumor suppressor regulates the apoptosis of cancer cells. DUSP26 inhibition results in neuroblastoma cell cytotoxicity through p53-mediated apoptosis. Despite the previous structural studies of DUSP26 catalytic domain (residues 61-211, DUSP26-C, the high-resolution structure of its catalytically active form has not been resolved. In this study, we determined the crystal structure of a catalytically active form of DUSP26 (residues 39-211, DUSP26-N with an additional N-terminal region at 2.0 Å resolution. Unlike the C-terminal domain-swapped dimeric structure of DUSP26-C, the DUSP26-N (C152S monomer adopts a fold-back conformation of the C-terminal α8-helix and has an additional α1-helix in the N-terminal region. Consistent with the canonically active conformation of its protein tyrosine phosphate-binding loop (PTP loop observed in the structure, the phosphatase assay results demonstrated that DUSP26-N has significantly higher catalytic activity than DUSP26-C. Furthermore, size exclusion chromatography-multiangle laser scattering (SEC-MALS measurements showed that DUSP26-N (C152S exists as a monomer in solution. Notably, the crystal structure of DUSP26-N (C152S revealed that the N-terminal region of DUSP26-N (C152S serves a scaffolding role by positioning the surrounding α7-α8 loop for interaction with the PTP-loop through formation of an extensive hydrogen bond network, which seems to be critical in making the PTP-loop conformation competent for phosphatase activity. Our study provides the first high-resolution structure of a catalytically active form of DUSP26, which will contribute to the structure-based rational design of novel DUSP26-targeting anticancer therapeutics.

  8. 17 CFR 200.640 - Employment.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Employment. 200.640 Section... Programs or Activities Conducted by the Securities and Exchange Commission § 200.640 Employment. No... employment under any program or activity conducted by the agency. The definitions, requirements, and...

  9. 21 CFR 640.100 - Immune Globulin (Human).

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Immune Globulin (Human). 640.100 Section 640.100 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) BIOLOGICS ADDITIONAL STANDARDS FOR HUMAN BLOOD AND BLOOD PRODUCTS Immune Globulin (Human) § 640.100 Immune...

  10. 38 CFR 48.640 - Employee.

    Science.gov (United States)

    2010-07-01

    ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Employee. 48.640 Section...) GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Definitions § 48.640 Employee. (a) Employee means the employee of a recipient directly engaged in the performance of work under the award...

  11. 7 CFR 3021.640 - Employee.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 15 2010-01-01 2010-01-01 false Employee. 3021.640 Section 3021.640 Agriculture... Employee. (a) Employee means the employee of a recipient directly engaged in the performance of work under the award, including— (1) All direct charge employees; (2) All indirect charge employees, unless their...

  12. 36 CFR 1212.640 - Employee.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Employee. 1212.640 Section... GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Definitions § 1212.640 Employee. (a) Employee means the employee of a recipient directly engaged in the performance of work under the award...

  13. Apoptotic Activity of MeCP2 Is Enhanced by C-Terminal Truncating Mutations.

    Directory of Open Access Journals (Sweden)

    Alison A Williams

    Full Text Available Methyl-CpG binding protein 2 (MeCP2 is a widely abundant, multifunctional protein most highly expressed in post-mitotic neurons. Mutations causing Rett syndrome and related neurodevelopmental disorders have been identified along the entire MECP2 locus, but symptoms vary depending on mutation type and location. C-terminal mutations are prevalent, but little is known about the function of the MeCP2 C-terminus. We employ the genetic efficiency of Drosophila to provide evidence that expression of p.Arg294* (more commonly identified as R294X, a human MECP2 E2 mutant allele causing truncation of the C-terminal domains, promotes apoptosis of identified neurons in vivo. We confirm this novel finding in HEK293T cells and then use Drosophila to map the region critical for neuronal apoptosis to a small sequence at the end of the C-terminal domain. In vitro studies in mammalian systems previously indicated a role of the MeCP2 E2 isoform in apoptosis, which is facilitated by phosphorylation at serine 80 (S80 and decreased by interactions with the forkhead protein FoxG1. We confirm the roles of S80 phosphorylation and forkhead domain transcription factors in affecting MeCP2-induced apoptosis in Drosophila in vivo, thus indicating mechanistic conservation between flies and mammalian cells. Our findings are consistent with a model in which C- and N-terminal interactions are required for healthy function of MeCP2.

  14. 21 CFR 640.68 - Processing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Processing. 640.68 Section 640.68 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) BIOLOGICS ADDITIONAL... deterioration or contamination. Prior to filling, the final container shall be marked or identified by number or...

  15. 21 CFR 640.54 - Processing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Processing. 640.54 Section 640.54 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) BIOLOGICS ADDITIONAL... storage system. A combination of dry ice and organic solvent may be used for freezing: Provided, That the...

  16. 21 CFR 640.34 - Processing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Processing. 640.34 Section 640.34 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) BIOLOGICS ADDITIONAL... container shall have no color added to the plastic and shall be transparent to permit visual inspection of...

  17. 21 CFR 640.10 - Red Blood Cells.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Red Blood Cells. 640.10 Section 640.10 Food and... ADDITIONAL STANDARDS FOR HUMAN BLOOD AND BLOOD PRODUCTS Red Blood Cells § 640.10 Red Blood Cells. The proper name of this product shall be Red Blood Cells. The product is defined as red blood cells remaining...

  18. The C-terminal MIR-containing region in the Pmt1 O-mannosyltransferase restrains sporulation and is dispensable for virulence in Beauveria bassiana.

    Science.gov (United States)

    He, Zhangjiang; Luo, Linli; Keyhani, Nemat O; Yu, Xiaodong; Ying, Shenghua; Zhang, Yongjun

    2017-02-01

    Protein O-mannosyltransferases (Pmts) belong to a highly conserved protein family responsible for the initiation of O-glycosylation of many proteins. Pmts contain one dolichyl-phosphate-mannose-protein mannosyltransferases (PMT) domain and three MIR motifs (mannosyltransferase, inositol triphosphate, and ryanodine receptor) that are essential for activity in yeast. We report that in the insect fungal pathogen, Beauveria bassiana, deletion of the C-terminal Pmt1 MIR-containing region (Pmt1∆ 311-902 ) does not alter O-mannosyltransferase activity, but does increase total cell wall protein O-mannosylation levels and results in phenotypic changes in fungal development and cell wall stability. B. bassiana mutants harboring the Pmt1 ∆ 311-902 mutation displayed a significant increase in conidiation with up-regulation of conidiation-associated genes and an increase in biomass accumulation as compared to the wild-type parent. However, decreased vegetative growth and blastospore production was noted, and Pmt1 ∆ 311-902 mutants were altered in cell wall composition and cell surface features. Insect bioassays revealed little effect on virulence for the Pmt1 ∆ 311-902 strain via cuticle infection or intrahemocoel injection assays, although differences in hyphal body differentiation in the host hemolymph and up-regulation of virulence-associated genes were noted. These data suggest novel roles for Pmt1 in negatively regulating conidiation and demonstrate that the C-terminal Pmt1 MIR-containing region is dispensable for enzymatic activity and organismal virulence.

  19. Hydrogen terminal solubility in Zircaloy-4

    International Nuclear Information System (INIS)

    Vizcaino, Pablo; Banchik, Abrahan D.

    1999-01-01

    Terminal solubility temperature of hydrogen in zirconium and its alloys is an important parameter because hydrides precipitation embrittled these materials making them susceptible to the phenomenon known as retarded hydrogen cracking. This work continues the study presented in the 25 AATN Meeting. Within this framework, a study focused on determining these curves in recrystallized Zircaloy-4, using scanning differential calorimetric technique. Terminal solubility curves for Zircaloy-4 were constructed within a concentration range from 40 to 640 ppm in hydrogen weight and comparisons with results obtained by other authors were made. (author)

  20. Heparan sulfate regulates fibrillin-1 N- and C-terminal interactions

    DEFF Research Database (Denmark)

    Cain, Stuart A; Baldwin, Andrew K; Mahalingam, Yashithra

    2008-01-01

    Fibrillin-1 N- and C-terminal heparin binding sites have been characterized. An unprocessed monomeric N-terminal fragment (PF1) induced a very high heparin binding response, indicating heparin-mediated multimerization. Using PF1 deletion and short fragments, a heparin binding site was localized w......-terminal interactions with heparin/heparan sulfate directly influence cell behavior, whereas C-terminal interactions with heparin/heparan sulfate regulate elastin deposition. These data highlight how heparin/heparan sulfate controls fibrillin-1 interactions....

  1. Single bead near-infrared random laser based on silica-gel infiltrated with Rhodamine 640

    Science.gov (United States)

    Moura, André L.; Barbosa-Silva, Renato; Dominguez, Christian T.; Pecoraro, Édison; Gomes, Anderson S. L.; de Araújo, Cid B.

    2018-04-01

    Photoluminescence properties of single bead silica-gel (SG) embedded with a laser-dye were studied aiming at the operation of near-infrared (NIR) Random Lasers (RLs). The operation of RLs in the NIR spectral region is especially important for biological applications since the optical radiation has deep tissue penetration with negligible damage. Since laser-dyes operating in the NIR have poor stability and are poor emitters, ethanol solutions of Rhodamine 640 (Rh640) infiltrated in SG beads were used. The Rh640 concentrations in ethanol varied from 10-5 to 10-2 M and the excitation at 532 nm was made by using a 7 ns pulsed laser. The proof-of-principle RL scheme herein presented was adopted in order to protect the dye-molecules from the environment and to favor formation of aggregates. The RL emission from ≈650 nm to 720 nm, beyond the typical Rh640 monomer and dimer wavelengths emissions range, was attributed to the trade-off between reabsorption and reemission processes along the light pathways inside the SG bead and the contribution of Rh640 aggregates.

  2. Genetic variation in N- and C-terminal regions of bovine DNAJA1 heat shock protein gene in African, Asian and American cattle

    Science.gov (United States)

    Ajayi, Oyeyemi O.; Peters, Sunday O.; De Donato, Marcos; Mujibi, F. Denis; Khan, Waqas A.; Hussain, Tanveer; Babar, Masroor E.; Imumorin, Ikhide G.; Thomas, Bolaji N.

    2018-01-01

    DNAJA1 or heat shock protein 40 (Hsp40) is associated with heat adaptation in various organisms. We amplified and sequenced a total of 1,142 bp of bovine Hsp40 gene representing the critical N-terminal (NTR) and C-terminal (CTR) regions in representative samples of African, Asian and American cattle breeds. Eleven and 9 different haplotypes were observed in the NTR in Asian and African breeds respectively while in American Brangus, only two mutations were observed resulting in two haplotypes. The CTR appears to be highly conserved between cattle and yak. In-silico functional analysis with PANTHER predicted putative deleterious functional impact of c.161 T>A; p. V54Q while alignment of bovine and human NTR-J domains revealed that p.Q19H, p.E20Q and p. E21X mutations occurred in helix 2 and p.V54Q missense mutation occurred in helix 3 respectively. The 124 bp insertion found in the yak DNAJA1 ortholog may have significant functional relevance warranting further investigation. Our results suggest that these genetic differences may be concomitant with population genetic history and possible functional consequences for climate adaptation in bovidae. PMID:29290829

  3. C-terminal region of herpes simplex virus ICP8 protein needed for intranuclear localization

    International Nuclear Information System (INIS)

    Taylor, Travis J; Knipe, David M.

    2003-01-01

    The herpes simplex virus single-stranded DNA-binding protein, ICP8, localizes initially to structures in the nucleus called prereplicative sites. As replication proceeds, these sites mature into large globular structures called replication compartments. The details of what signals or proteins are involved in the redistribution of viral and cellular proteins within the nucleus between prereplicative sites and replication compartments are poorly understood; however, we showed previously that the dominant-negative d105 ICP8 does not localize to prereplicative sites and prevents the localization of other viral proteins to prereplicative sites (J. Virol. 74 (2000) 10122). Within the residues deleted in d105 (1083 to 1168), we identified a region between amino acid residues 1080 and 1135 that was predicted by computer models to contain two α-helices, one with considerable amphipathic nature. We used site-specific and random mutagenesis techniques to identify residues or structures within this region that are required for proper ICP8 localization within the nucleus. Proline substitutions in the predicted helix generated ICP8 molecules that did not localize to prereplicative sites and acted as dominant-negative inhibitors. Other substitutions that altered the charged residues in the predicted α-helix to alanine or leucine residues had little or no effect on ICP8 intranuclear localization. The predicted α-helix was dispensable for the interaction of ICP8 with the U L 9 origin-binding protein. We propose that this C-terminal α-helix is required for localization of ICP8 to prereplicative sites by binding viral or cellular factors that target or retain ICP8 at specific intranuclear sites

  4. Requirement for the E1 Helicase C-Terminal Domain in Papillomavirus DNA Replication In Vivo.

    Science.gov (United States)

    Bergvall, Monika; Gagnon, David; Titolo, Steve; Lehoux, Michaël; D'Abramo, Claudia M; Melendy, Thomas; Archambault, Jacques

    2016-01-06

    The papillomavirus (PV) E1 helicase contains a conserved C-terminal domain (CTD), located next to its ATP-binding site, whose function in vivo is still poorly understood. The CTD is comprised of an alpha helix followed by an acidic region (AR) and a C-terminal extension termed the C-tail. Recent biochemical studies on bovine papillomavirus 1 (BPV1) E1 showed that the AR and C-tail regulate the oligomerization of the protein into a double hexamer at the origin. In this study, we assessed the importance of the CTD of human papillomavirus 11 (HPV11) E1 in vivo, using a cell-based DNA replication assay. Our results indicate that combined deletion of the AR and C-tail drastically reduces DNA replication, by 85%, and that further truncation into the alpha-helical region compromises the structural integrity of the E1 helicase domain and its interaction with E2. Surprisingly, removal of the C-tail alone or mutation of highly conserved residues within the domain still allows significant levels of DNA replication (55%). This is in contrast to the absolute requirement for the C-tail reported for BPV1 E1 in vitro and confirmed here in vivo. Characterization of chimeric proteins in which the AR and C-tail from HPV11 E1 were replaced by those of BPV1 indicated that while the function of the AR is transferable, that of the C-tail is not. Collectively, these findings define the contribution of the three CTD subdomains to the DNA replication activity of E1 in vivo and suggest that the function of the C-tail has evolved in a PV type-specific manner. While much is known about hexameric DNA helicases from superfamily 3, the papillomavirus E1 helicase contains a unique C-terminal domain (CTD) adjacent to its ATP-binding site. We show here that this CTD is important for the DNA replication activity of HPV11 E1 in vivo and that it can be divided into three functional subdomains that roughly correspond to the three conserved regions of the CTD: an alpha helix, needed for the structural

  5. Requirement for the E1 Helicase C-Terminal Domain in Papillomavirus DNA Replication In Vivo

    Science.gov (United States)

    Bergvall, Monika; Gagnon, David; Titolo, Steve; Lehoux, Michaël; D'Abramo, Claudia M.

    2016-01-01

    ABSTRACT The papillomavirus (PV) E1 helicase contains a conserved C-terminal domain (CTD), located next to its ATP-binding site, whose function in vivo is still poorly understood. The CTD is comprised of an alpha helix followed by an acidic region (AR) and a C-terminal extension termed the C-tail. Recent biochemical studies on bovine papillomavirus 1 (BPV1) E1 showed that the AR and C-tail regulate the oligomerization of the protein into a double hexamer at the origin. In this study, we assessed the importance of the CTD of human papillomavirus 11 (HPV11) E1 in vivo, using a cell-based DNA replication assay. Our results indicate that combined deletion of the AR and C-tail drastically reduces DNA replication, by 85%, and that further truncation into the alpha-helical region compromises the structural integrity of the E1 helicase domain and its interaction with E2. Surprisingly, removal of the C-tail alone or mutation of highly conserved residues within the domain still allows significant levels of DNA replication (55%). This is in contrast to the absolute requirement for the C-tail reported for BPV1 E1 in vitro and confirmed here in vivo. Characterization of chimeric proteins in which the AR and C-tail from HPV11 E1 were replaced by those of BPV1 indicated that while the function of the AR is transferable, that of the C-tail is not. Collectively, these findings define the contribution of the three CTD subdomains to the DNA replication activity of E1 in vivo and suggest that the function of the C-tail has evolved in a PV type-specific manner. IMPORTANCE While much is known about hexameric DNA helicases from superfamily 3, the papillomavirus E1 helicase contains a unique C-terminal domain (CTD) adjacent to its ATP-binding site. We show here that this CTD is important for the DNA replication activity of HPV11 E1 in vivo and that it can be divided into three functional subdomains that roughly correspond to the three conserved regions of the CTD: an alpha helix, needed

  6. Tissue factor pathway inhibitor 2 is found in skin and its C-terminal region encodes for antibacterial activity.

    Science.gov (United States)

    Papareddy, Praveen; Kalle, Martina; Sørensen, Ole E; Lundqvist, Katarina; Mörgelin, Matthias; Malmsten, Martin; Schmidtchen, Artur

    2012-01-01

    Tissue factor pathway inhibitor 2 (TFPI-2) is a matrix-associated serine protease inhibitor with an enigmatic function in vivo. Here, we describe that TFPI-2 is present in fibrin of wounds and also expressed in skin, where it is up-regulated upon wounding. Neutrophil elastase cleaved TFPI-2, and a C-terminal fragment was found to bind to bacteria. Similarly, a prototypic peptide representing this C-terminal part, EDC34, bound to bacteria and bacterial lipopolysaccharide, and induced bacterial permeabilization. The peptide also induced leakage in artificial liposomes, and displayed a random coil conformation upon interactions with liposomes as well as lipopolysaccharide. EDC34 was antibacterial against both Gram-negative and Gram-positive bacteria in physiological buffer conditions. The results demonstrate that the C-terminus of TFPI-2 encodes for antimicrobial activity, and may be released during wounding.

  7. COOH-terminal substitutions in the serpin C1 inhibitor that cause loop overinsertion and subsequent multimerization

    NARCIS (Netherlands)

    Eldering, E.; Verpy, E.; Roem, D.; Meo, T.; Tosi, M.

    1995-01-01

    The region COOH-terminal to the reactive center loop is highly conserved in the serine protease inhibitor (serpin) family. We have studied the structural consequences of three substitutions (Val451-->Met, Phe455-->Ser, and Pro476-->Ser) found in this region of C1 inhibitor in patients suffering from

  8. 20 CFR 404.640 - Withdrawal of an application.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 2 2010-04-01 2010-04-01 false Withdrawal of an application. 404.640 Section 404.640 Employees' Benefits SOCIAL SECURITY ADMINISTRATION FEDERAL OLD-AGE, SURVIVORS AND DISABILITY INSURANCE (1950- ) Filing of Applications and Other Forms Withdrawal of Application § 404.640 Withdrawal of...

  9. Characterization of a digestive carboxypeptidase from the insect pest corn earworm (Helicoverpa armigera) with novel specificity towards C-terminal glutamate residues.

    Science.gov (United States)

    Bown, David P; Gatehouse, John A

    2004-05-01

    Carboxypeptidases were purified from guts of larvae of corn earworm (Helicoverpa armigera), a lepidopteran crop pest, by affinity chromatography on immobilized potato carboxypeptidase inhibitor, and characterized by N-terminal sequencing. A larval gut cDNA library was screened using probes based on these protein sequences. cDNA HaCA42 encoded a carboxypeptidase with sequence similarity to enzymes of clan MC [Barrett, A. J., Rawlings, N. D. & Woessner, J. F. (1998) Handbook of Proteolytic Enzymes. Academic Press, London.], but with a novel predicted specificity towards C-terminal acidic residues. This carboxypeptidase was expressed as a recombinant proprotein in the yeast Pichia pastoris. The expressed protein could be activated by treatment with bovine trypsin; degradation of bound pro-region, rather than cleavage of pro-region from mature protein, was the rate-limiting step in activation. Activated HaCA42 carboxypeptidase hydrolysed a synthetic substrate for glutamate carboxypeptidases (FAEE, C-terminal Glu), but did not hydrolyse substrates for carboxypeptidase A or B (FAPP or FAAK, C-terminal Phe or Lys) or methotrexate, cleaved by clan MH glutamate carboxypeptidases. The enzyme was highly specific for C-terminal glutamate in peptide substrates, with slow hydrolysis of C-terminal aspartate also observed. Glutamate carboxypeptidase activity was present in larval gut extract from H. armigera. The HaCA42 protein is the first glutamate-specific metallocarboxypeptidase from clan MC to be identified and characterized. The genome of Drosophila melanogaster contains genes encoding enzymes with similar sequences and predicted specificity, and a cDNA encoding a similar enzyme has been isolated from gut tissue in tsetse fly. We suggest that digestive carboxypeptidases with sequence similarity to the classical mammalian enzymes, but with specificity towards C-terminal glutamate, are widely distributed in insects.

  10. 21 CFR 640.74 - Modification of Source Plasma.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Modification of Source Plasma. 640.74 Section 640...) BIOLOGICS ADDITIONAL STANDARDS FOR HUMAN BLOOD AND BLOOD PRODUCTS Source Plasma § 640.74 Modification of Source Plasma. (a) Upon approval by the Director, Center for Biologics Evaluation and Research, Food and...

  11. Possibilities of Using Transport Terminals in South Bohemian Region

    Science.gov (United States)

    Čejka, Jiří; Bartuška, Ladislav; Turinská, Libuše

    2017-03-01

    Currently, when there is a need for transport services adapted to the customer requirements and create a workable operational system, there is increasing talk about transport terminals. Since the South Bohemian region is one of those where this issue will be increasingly dealt with, this paper suggests ways to use transport terminals as important support systems for freight and passenger transport.

  12. Expression, refolding and crystallizations of the Grb2-like (GADS) C-terminal SH3 domain complexed with a SLP-76 motif peptide

    International Nuclear Information System (INIS)

    Faravelli, Alessandro; Dimasi, Nazzareno

    2005-01-01

    Several crystals of the Grb2-like C-terminal SH3 domain in complex with a motif peptide from the SLP-76 protein were obtained and characterized. The Grb2-like adaptor protein GADS is composed of an N-terminal SH3 domain, an SH2 domain, a proline-rich region and a C-terminal SH3 domain. GADS interacts through its C-terminal SH3 domain with the adaptor protein SLP-76, thus recruiting this protein and other associated molecules to the linker for activation of T-cell (LAT) protein. The DNA encoding the C-terminal SH3 domain of GADS (GADS-cSH3) was assembled synthetically using a recursive PCR technique and the protein was overexpressed in Escherichia coli, refolded and purified. Several crystals of this domain in complex with the SLP-76 peptide were obtained and characterized

  13. Comparison of the carboxy-terminal DP-repeat region in the co-chaperones Hop and Hip.

    Science.gov (United States)

    Nelson, Gregory M; Huffman, Holly; Smith, David F

    2003-01-01

    Functional steroid receptor complexes are assembled and maintained by an ordered pathway of interactions involving multiple components of the cellular chaperone machinery. Two of these components, Hop and Hip, serve as co-chaperones to the major heat shock proteins (Hsps), Hsp70 and Hsp90, and participate in intermediate stages of receptor assembly. In an effort to better understand the functions of Hop and Hip in the assembly process, we focused on a region of similarity located near the C-terminus of each co-chaperone. Contained within this region is a repeated sequence motif we have termed the DP repeat. Earlier mutagenesis studies implicated the DP repeat of either Hop or Hip in Hsp70 binding and in normal assembly of the co-chaperones with progesterone receptor (PR) complexes. We report here that the DP repeat lies within a protease-resistant domain that extends to or is near the C-terminus of both co-chaperones. Point mutations in the DP repeats render the C-terminal regions hypersensitive to proteolysis. In addition, a Hop DP mutant displays altered proteolytic digestion patterns, which suggest that the DP-repeat region influences the folding of other Hop domains. Although the respective DP regions of Hop and Hip share sequence and structural similarities, they are not functionally interchangeable. Moreover, a double-point mutation within the second DP-repeat unit of Hop that converts this to the sequence found in Hip disrupts Hop function; however, the corresponding mutation in Hip does not alter its function. We conclude that the DP repeats are important structural elements within a C-terminal domain, which is important for Hop and Hip function.

  14. N-Terminal Domains in Two-Domain Proteins Are Biased to Be Shorter and Predicted to Fold Faster Than Their C-Terminal Counterparts

    Directory of Open Access Journals (Sweden)

    Etai Jacob

    2013-04-01

    Full Text Available Computational analysis of proteomes in all kingdoms of life reveals a strong tendency for N-terminal domains in two-domain proteins to have shorter sequences than their neighboring C-terminal domains. Given that folding rates are affected by chain length, we asked whether the tendency for N-terminal domains to be shorter than their neighboring C-terminal domains reflects selection for faster-folding N-terminal domains. Calculations of absolute contact order, another predictor of folding rate, provide additional evidence that N-terminal domains tend to fold faster than their neighboring C-terminal domains. A possible explanation for this bias, which is more pronounced in prokaryotes than in eukaryotes, is that faster folding of N-terminal domains reduces the risk for protein aggregation during folding by preventing formation of nonnative interdomain interactions. This explanation is supported by our finding that two-domain proteins with a shorter N-terminal domain are much more abundant than those with a shorter C-terminal domain.

  15. 41 CFR 105-74.640 - Employee.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 3 2010-07-01 2010-07-01 false Employee. 105-74.640...-GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Definitions § 105-74.640 Employee. (a) Employee means the employee of a recipient directly engaged in the performance of work under the award...

  16. In vitro and in vivo mapping of the Prunus necrotic ringspot virus coat protein C-terminal dimerization domain by bimolecular fluorescence complementation.

    Science.gov (United States)

    Aparicio, Frederic; Sánchez-Navarro, Jesús A; Pallás, Vicente

    2006-06-01

    Interactions between viral proteins are critical for virus viability. Bimolecular fluorescent complementation (BiFC) technique determines protein interactions in real-time under almost normal physiological conditions. The coat protein (CP) of Prunus necrotic ringspot virus is required for multiple functions in its replication cycle. In this study, the region involved in CP dimerization has been mapped by BiFC in both bacteria and plant tissue. Full-length and C-terminal deleted forms of the CP gene were fused in-frame to the N- and C-terminal fragments of the yellow fluorescent protein. The BiFC analysis showed that a domain located between residues 9 and 27 from the C-end plays a critical role in dimerization. The importance of this C-terminal region in dimer formation and the applicability of the BiFC technique to analyse viral protein interactions are discussed.

  17. The C-terminal region of A-kinase anchor protein 350 (AKAP350A) enables formation of microtubule-nucleation centers and interacts with pericentriolar proteins.

    Science.gov (United States)

    Kolobova, Elena; Roland, Joseph T; Lapierre, Lynne A; Williams, Janice A; Mason, Twila A; Goldenring, James R

    2017-12-15

    Microtubules in animal cells assemble (nucleate) from both the centrosome and the cis-Golgi cisternae. A-kinase anchor protein 350 kDa (AKAP350A, also called AKAP450/CG-NAP/AKAP9) is a large scaffolding protein located at both the centrosome and Golgi apparatus. Previous findings have suggested that AKAP350 is important for microtubule dynamics at both locations, but how this scaffolding protein assembles microtubule nucleation machinery is unclear. Here, we found that overexpression of the C-terminal third of AKAP350A, enhanced GFP-AKAP350A(2691-3907), induces the formation of multiple microtubule-nucleation centers (MTNCs). Nevertheless, these induced MTNCs lacked "true" centriole proteins, such as Cep135. Mapping analysis with AKAP350A truncations demonstrated that AKAP350A contains discrete regions responsible for promoting or inhibiting the formation of multiple MTNCs. Moreover, GFP-AKAP350A(2691-3907) recruited several pericentriolar proteins to MTNCs, including γ-tubulin, pericentrin, Cep68, Cep170, and Cdk5RAP2. Proteomic analysis indicated that Cdk5RAP2 and Cep170 both interact with the microtubule nucleation-promoting region of AKAP350A, whereas Cep68 interacts with the distal C-terminal AKAP350A region. Yeast two-hybrid assays established a direct interaction of Cep170 with AKAP350A. Super-resolution and deconvolution microscopy analyses were performed to define the association of AKAP350A with centrosomes, and these studies disclosed that AKAP350A spans the bridge between centrioles, co-localizing with rootletin and Cep68 in the linker region. siRNA-mediated depletion of AKAP350A caused displacement of both Cep68 and Cep170 from the centrosome. These results suggest that AKAP350A acts as a scaffold for factors involved in microtubule nucleation at the centrosome and coordinates the assembly of protein complexes associating with the intercentriolar bridge.

  18. Deletion of the B-B' and C-C' regions of inverted terminal repeats reduces rAAV productivity but increases transgene expression.

    Science.gov (United States)

    Zhou, Qingzhang; Tian, Wenhong; Liu, Chunguo; Lian, Zhonghui; Dong, Xiaoyan; Wu, Xiaobing

    2017-07-14

    Inverted terminal repeats (ITRs) of the adeno-associated virus (AAV) are essential for rescue, replication, packaging, and integration of the viral genome. While ITR mutations have been identified in previous reports, we designed a new truncated ITR lacking the B-B' and C-C' regions named as ITRΔBC and investigated its effects on viral genome replication, packaging, and expression of recombinant AAV (rAAV). The packaging ability was compared between ITRΔBC rAAV and wild-type (wt) ITR rAAV. Our results showed the productivity of ITRΔBC rAAV was reduced 4-fold, which is consistent with the 8-fold decrease in the replication of viral genomic DNA of ITRΔBC rAAV compared with wt ITR rAAV. Surprisingly, transgene expression was significantly higher for ITRΔBC rAAV. A preliminary exploration of the underlying mechanisms was carried out by inhibiting and degrading the ataxia telangiectasia mutated (ATM) protein and the Mre11 complex (MRN), respectively, since the rAAV expression was inhibited by the ATM and/or MRN through cis interaction or binding with wt ITRs. We demonstrated that the inhibitory effects were weakened on ITRΔBC rAAV expression. This study suggests deletion in ITR can affect the transgene expression of AAV, which provides a new way to improve the AAV expression through ITRs modification.

  19. Distinct repeat motifs at the C-terminal region of CagA of Helicobacter pylori strains isolated from diseased patients and asymptomatic individuals in West Bengal, India

    Directory of Open Access Journals (Sweden)

    Chattopadhyay Santanu

    2012-05-01

    Full Text Available Abstract Background Infection with Helicobacter pylori strains that express CagA is associated with gastritis, peptic ulcer disease, and gastric adenocarcinoma. The biological function of CagA depends on tyrosine phosphorylation by a cellular kinase. The phosphate acceptor tyrosine moiety is present within the EPIYA motif at the C-terminal region of the protein. This region is highly polymorphic due to variations in the number of EPIYA motifs and the polymorphism found in spacer regions among EPIYA motifs. The aim of this study was to analyze the polymorphism at the C-terminal end of CagA and to evaluate its association with the clinical status of the host in West Bengal, India. Results Seventy-seven H. pylori strains isolated from patients with various clinical statuses were used to characterize the C-ternimal polymorphic region of CagA. Our analysis showed that there is no correlation between the previously described CagA types and various disease outcomes in Indian context. Further analyses of different CagA structures revealed that the repeat units in the spacer sequences within the EPIYA motifs are actually more discrete than the previously proposed models of CagA variants. Conclusion Our analyses suggest that EPIYA motifs as well as the spacer sequence units are present as distinct insertions and deletions, which possibly have arisen from extensive recombination events. Moreover, we have identified several new CagA types, which could not be typed by the existing systems and therefore, we have proposed a new typing system. We hypothesize that a cagA gene encoding higher number EPIYA motifs may perhaps have arisen from cagA genes that encode lesser EPIYA motifs by acquisition of DNA segments through recombination events.

  20. X-ray crystal structure of the N-terminal region of Moloney murine leukemia virus integrase and its implications for viral DNA recognition: N-Terminal Region of M-MuLV Integrase

    Energy Technology Data Exchange (ETDEWEB)

    Guan, Rongjin [Center for Advanced Biotechnology and Medicine, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Northeast Structural Genomics Consortium, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Department of Molecular Biology and Biochemistry, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Aiyer, Sriram [Department of Pharmacology, Robert Wood Johnson Medical School, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Cote, Marie L. [Department of Biochemistry, Robert Wood Johnson Medical School, UMDNJ, Piscataway New Jersey 08854; Xiao, Rong [Center for Advanced Biotechnology and Medicine, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Northeast Structural Genomics Consortium, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Department of Molecular Biology and Biochemistry, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Jiang, Mei [Center for Advanced Biotechnology and Medicine, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Northeast Structural Genomics Consortium, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Department of Molecular Biology and Biochemistry, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Acton, Thomas B. [Center for Advanced Biotechnology and Medicine, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Northeast Structural Genomics Consortium, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Department of Molecular Biology and Biochemistry, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Roth, Monica J. [Department of Pharmacology, Robert Wood Johnson Medical School, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Montelione, Gaetano T. [Center for Advanced Biotechnology and Medicine, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Northeast Structural Genomics Consortium, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Department of Molecular Biology and Biochemistry, Rutgers, The State University of New Jersey, Piscataway New Jersey 08854; Department of Biochemistry, Robert Wood Johnson Medical School, UMDNJ, Piscataway New Jersey 08854

    2017-02-03

    The retroviral integrase (IN) carries out the integration of a dsDNA copy of the viral genome into the host DNA, an essential step for viral replication. All IN proteins have three general domains, the N-terminal domain (NTD), the catalytic core domain, and the C-terminal domain. The NTD includes an HHCC zinc finger-like motif, which is conserved in all retroviral IN proteins. Two crystal structures of Moloney murine leukemia virus (M-MuLV) IN N-terminal region (NTR) constructs that both include an N-terminal extension domain (NED, residues 1–44) and an HHCC zinc-finger NTD (residues 45–105), in two crystal forms are reported. The structures of IN NTR constructs encoding residues 1–105 (NTR1–105) and 8–105 (NTR8–105) were determined at 2.7 and 2.15 Å resolution, respectively and belong to different space groups. While both crystal forms have similar protomer structures, NTR1–105 packs as a dimer and NTR8–105 packs as a tetramer in the asymmetric unit. The structure of the NED consists of three anti-parallel β-strands and an α-helix, similar to the NED of prototype foamy virus (PFV) IN. These three β-strands form an extended β-sheet with another β-strand in the HHCC Zn2+ binding domain, which is a unique structural feature for the M-MuLV IN. The HHCC Zn2+ binding domain structure is similar to that in HIV and PFV INs, with variations within the loop regions. Differences between the PFV and MLV IN NEDs localize at regions identified to interact with the PFV LTR and are compared with established biochemical and virological data for M-MuLV. Proteins 2017; 85:647–656.

  1. Interaction of the N-terminal segment of pulmonary surfactant protein SP-C with interfacial phospholipid films

    DEFF Research Database (Denmark)

    Plasencia, Inés; Keough, Kevin M W; Perez-Gil, Jesus

    2005-01-01

    Pulmonary surfactant protein SP-C is a 35-residue polypeptide composed of a hydrophobic transmembrane alpha-helix and a polycationic, palmitoylated-cysteine containing N-terminal segment. This segment is likely the only structural motif the protein projects out of the bilayer in which SP-C is ins......Pulmonary surfactant protein SP-C is a 35-residue polypeptide composed of a hydrophobic transmembrane alpha-helix and a polycationic, palmitoylated-cysteine containing N-terminal segment. This segment is likely the only structural motif the protein projects out of the bilayer in which SP...... or anionic phospholipid monolayers. The peptide expands the pi-A compression isotherms of interfacial phospholipid/peptide films, and perturbs the lipid packing of phospholipid films during compression-driven liquid-expanded to liquid-condensed lateral transitions, as observed by epifluorescence microscopy....... These results demonstrate that the sequence of the SP-C N-terminal region has intrinsic ability to interact with, insert into, and perturb the structure of zwitterionic and anionic phospholipid films, even in the absence of the palmitic chains attached to this segment in the native protein. This effect has been...

  2. 10 CFR 603.640 - Audits of for-profit participants.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Audits of for-profit participants. 603.640 Section 603.640 Energy DEPARTMENT OF ENERGY (CONTINUED) ASSISTANCE REGULATIONS TECHNOLOGY INVESTMENT AGREEMENTS Award Terms Affecting Participants' Financial, Property, and Purchasing Systems Financial Matters § 603.640...

  3. 40 CFR 1042.640 - Special provisions for branded engines.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 32 2010-07-01 2010-07-01 false Special provisions for branded engines. 1042.640 Section 1042.640 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR... Special Compliance Provisions § 1042.640 Special provisions for branded engines. The following provisions...

  4. Dusty plasma in the region of the lunar terminator

    Energy Technology Data Exchange (ETDEWEB)

    Popel, S. I., E-mail: popel@iki.rssi.ru; Zelenyi, L. M. [Russian Academy of Sciences, Space Research Institute (Russian Federation); Atamaniuk, B. [Polish Academy of Sciences, Space Research Center (Poland)

    2016-05-15

    Dusty plasma in the region of the lunar terminator is considered. It is shown that, in this region, a structure resembling a plasma sheath forms near the lunar surface. This sheath creates a potential barrier, due to which electrons over the illuminated part of the Moon are confined by electrostatic forces. The width of the sheath-like structure is on the order of the ion Debye length. In this structure, significant (about several hundred V/m) electric fields arise, which lift charged micron-size dust grains to heights of several tens of centimeters. The suggested effect may be used to explain the glow observed by the Surveyor spacecraft over the lunar terminator.

  5. Structure, Orientation and Dynamics of the C-Terminal Hexapeptide of LRAP Determined Using Solid State NMR

    International Nuclear Information System (INIS)

    Shaw, Wendy J.; Ferris, Kim F.

    2008-01-01

    Amelogenin is the predominant protein found during enamel development and has been shown to be essential to proper enamel formation. LRAP is a naturally occurring splice variant that preserves the charged N- and C-termini of full length amelogenin, regions thought to be crucial in interacting with hydroxyapatite. Particularly, the highly charged C-terminal hexapeptide (KREEVD) is thought to be the region most intimately interacting with HAP. We investigated the structure of this charged region, as well as the proximity to the surface and the mobility of two of the residues. We found the structure to be consistent with a random coil or more extended structure, as has been found for more internalized residues in the C-terminus. The backbone K 54 ( 13 C(prime)), V 58 ( 13 C(prime)) and V 58 ( 15 N) were all found to be very close to the surface of HAP, ∼ 6.0 (angstrom), suggesting a strong interaction and emphasizing the importance of these residues in interacting with HAP. However, both ends of the hexapeptide, at residues K 54 and V 58 , experience significant mobility under hydrated conditions, implying that another portion of the protein helps to stabilize the strong LRAP-HAP interaction. Interestingly, the backbone of the C-terminal third of the protein is consistently 6.0 (angstrom) from the HAP surface, suggesting that this region of the protein is laying flat on the surface with no 3-dimensional folding. The combination of these features, i.e., a random coil structure, a significant mobility and a lack of three-dimensional folding in this region of the protein may be important in a functional role, allowing the C-terminus to effectively interact with HAP while at the same time allowing maximum crystal inhibition

  6. Human terminal deoxyribonucleotidyltransferase: molecular cloning and structural analysis of the gene and 5' flanking region

    International Nuclear Information System (INIS)

    Riley, L.K.; Morrow, J.K.; Danton, M.J.; Coleman, M.S.

    1988-01-01

    Human terminal deoxyribonucleotidyltransferase cDNA contains an open reading frame of 1530 base pairs (bp) corresponding to a protein containing 510 amino acids. The encoded protein is a template-independent DNA polymerase found only in a restricted population of normal and malignant prelymphocytes. To begin to investigate the genetic elements responsible for the tissue-specific expression of terminal deoxyribonucleotidyltransferase, genomic clones, containing the entire human gene were isolated and characterized. Initially, cDNA clones were isolated from a library generated from the human lymphoblastoid cell line, MOLT-4R. A cDNA clone containing the entire coding region of the protein was used to isolate a series of overlapping clones from two human genomic libraries. The gene comprises 11 exons and 10 introns and spans 49.4 kilobases. The 5' flanking region (709 bp) including exon 1 was sequenced. Several putative transcription initiation sites were mapped. Within 500 nucleotides of the translation start site, a series of promoter elements was detected. TATA and CAAT sequences, respectively, were found to start at nucleotides -185 and -204, -328 and -370, and -465 and -505. Start sites were found for a cyclic AMP-dependent promoter analog at nucleotide -121, an eight-base sequence corresponding to the IgG promoter enhancer (cd) at nucleotide -455, and an analog of the IgG promoter (pd) at nucleotide -159. These findings suggest that transcripts coding for terminal deoxyribonucleotidyltransferase may be variable in length and that transcription may be influenced by a variety of genetic elements

  7. Evolutionarily conserved regions of the human c-myc protein can be uncoupled from transforming activity

    International Nuclear Information System (INIS)

    Sarid, J.; Halazonetis, T.D.; Murphy, W.; Leder, P.

    1987-01-01

    The myc family of oncogenes contains coding sequences that have been preserved in different species for over 400 million years. This conservation (which implies functional selection) is broadly represented throughout the C-terminal portion of the human c-myc protein but is largely restricted to three cluster of amino acid sequences in the N-terminal region. The authors have examined the role that the latter three regions of the c-myc protein might play in the transforming function of the c-myc gene. Several mutations, deletions and frameshifts, were introduced into the c-myc gene, and these mutant genes were tested for their ability to collaborate with the EJ-ras oncogene to transform rat embryo fibroblasts. Complete elimination of the first two N-terminal conserved segments abolished transforming activity. In contrast, genes altered in a portion of the second or the entire third conserved segment retained their transforming activity. Thus, the latter two segments are not required for the transformation process, suggesting that they serve another function related only to the normal expression of the c-myc gene

  8. A prawn core histone 4: derivation of N- and C-terminal peptides and their antimicrobial properties, molecular characterization and mRNA transcription.

    Science.gov (United States)

    Chaurasia, Mukesh Kumar; Palanisamy, Rajesh; Bhatt, Prasanth; Kumaresan, Venkatesh; Gnanam, Annie J; Pasupuleti, Mukesh; Kasi, Marimuthu; Harikrishnan, Ramaswamy; Arockiaraj, Jesu

    2015-01-01

    This study investigates the complete molecular characterization including bioinformatics characterization, gene expression, synthesis of N and C terminal peptides and their antimicrobial activity of the core histone 4 (H4) from freshwater giant prawn Macrobrachium rosenbergii (Mr). A cDNA encoding MrH4 was identified from the constructed cDNA library of M. rosenbergii during screening and the sequence was obtained using internal sequencing primers. The MrH4 coding region possesses a polypeptide of 103 amino acids with a calculated molecular weight of 11kDa and an isoelectric point of 11.5. The bioinformatics analysis showed that the MrH4 polypeptide contains a H4 signature at (15)GAKRH(19). Multiple sequence alignment of MrH4 showed that the N-terminal (21-42) and C-terminal (87-101) antimicrobial peptide regions and the pentapeptide or H4 signature (15-19) are highly conserved including in humans. The phylogenetic tree formed two separate clades of vertebrate and invertebrate H4, wherein MrH4 was located within the arthropod monophyletic clade of invertebrate H4 groups. Three-dimensional model of MrH4 was established using I-TASSER program and the model was validated using Ramachandran plot analysis. Schiffer-Edmundson helical wheel modeling was used to predict the helix propensity of N (21-42) and C (87-101) terminal derived Mr peptides. The highest gene expression was observed in gills and is induced by viral [white spot syndrome baculovirus (WSBV) and M. rosenbergii nodovirus (MrNV)] and bacterial (Aeromonas hydrophila and Vibrio harveyi) infections. The N and C terminal peptides were synthesized and their antimicrobial and hemolytic properties were examined. Both peptides showed activity against the tested Gram negative and Gram positive bacteria; however, the highest activity was noticed against Gram negative bacteria. Among the two peptides used in this study, C-terminal peptide yielded better results than the N-terminal peptide. Therefore, C terminal

  9. Mutated but Not Deleted Ovine PrP(C) N-Terminal Polybasic Region Strongly Interferes with Prion Propagation in Transgenic Mice.

    Science.gov (United States)

    Khalifé, Manal; Reine, Fabienne; Paquet-Fifield, Sophie; Castille, Johan; Herzog, Laetitia; Vilotte, Marthe; Moudjou, Mohammed; Moazami-Goudarzi, Katayoun; Makhzami, Samira; Passet, Bruno; Andréoletti, Olivier; Vilette, Didier; Laude, Hubert; Béringue, Vincent; Vilotte, Jean-Luc

    2016-02-01

    Mammalian prions are proteinaceous infectious agents composed of misfolded assemblies of the host-encoded, cellular prion protein (PrP). Physiologically, the N-terminal polybasic region of residues 23 to 31 of PrP has been shown to be involved in its endocytic trafficking and interactions with glycosaminoglycans or putative ectodomains of membrane-associated proteins. Several recent reports also describe this PrP region as important for the toxicity of mutant prion proteins and the efficiency of prion propagation, both in vitro and in vivo. The question remains as to whether the latter observations made with mouse PrP and mouse prions would be relevant to other PrP species/prion strain combinations given the dramatic impact on prion susceptibility of minimal amino acid substitutions and structural variations in PrP. Here, we report that transgenic mouse lines expressing ovine PrP with a deletion of residues 23 to 26 (KKRP) or mutated in this N-terminal region (KQHPH instead of KKRPK) exhibited a variable, strain-dependent susceptibility to prion infection with regard to the proportion of affected mice and disease tempo relative to findings in their wild-type counterparts. Deletion has no major effect on 127S scrapie prion pathogenesis, whereas mutation increased by almost 3-fold the survival time of the mice. Deletion marginally affected the incubation time of scrapie LA19K and ovine bovine spongiform encephalopathy (BSE) prions, whereas mutation caused apparent resistance to disease. Recent reports suggested that the N-terminal polybasic region of the prion protein could be a therapeutic target to prevent prion propagation or toxic signaling associated with more common neurodegenerative diseases such as Alzheimer's disease. Mutating or deleting this region in ovine PrP completes the data previously obtained with the mouse protein by identifying the key amino acid residues involved. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  10. Dual role of the carboxyl-terminal region of pig liver L-kynurenine 3-monooxygenase: mitochondrial-targeting signal and enzymatic activity.

    Science.gov (United States)

    Hirai, Kumiko; Kuroyanagi, Hidehito; Tatebayashi, Yoshitaka; Hayashi, Yoshitaka; Hirabayashi-Takahashi, Kanako; Saito, Kuniaki; Haga, Seiich; Uemura, Tomihiko; Izumi, Susumu

    2010-12-01

    l-kynurenine 3-monooxygenase (KMO) is an NAD(P)H-dependent flavin monooxygenase that catalyses the hydroxylation of l-kynurenine to 3-hydroxykynurenine, and is localized as an oligomer in the mitochondrial outer membrane. In the human brain, KMO may play an important role in the formation of two neurotoxins, 3-hydroxykynurenine and quinolinic acid, both of which provoke severe neurodegenerative diseases. In mosquitos, it plays a role in the formation both of eye pigment and of an exflagellation-inducing factor (xanthurenic acid). Here, we present evidence that the C-terminal region of pig liver KMO plays a dual role. First, it is required for the enzymatic activity. Second, it functions as a mitochondrial targeting signal as seen in monoamine oxidase B (MAO B) or outer membrane cytochrome b(5). The first role was shown by the comparison of the enzymatic activity of two mutants (C-terminally FLAG-tagged KMO and carboxyl-terminal truncation form, KMOΔC50) with that of the wild-type enzyme expressed in COS-7 cells. The second role was demonstrated with fluorescence microscopy by the comparison of the intracellular localization of the wild-type, three carboxyl-terminal truncated forms (ΔC20, ΔC30 and ΔC50), C-terminally FLAG-tagged wild-type and a mutant KMO, where two arginine residues, Arg461-Arg462, were replaced with Ser residues.

  11. Confirming the Revised C-Terminal Domain of the MscL Crystal Structure

    OpenAIRE

    Maurer, Joshua A.; Elmore, Donald E.; Clayton, Daniel; Xiong, Li; Lester, Henry A.; Dougherty, Dennis A.

    2008-01-01

    The structure of the C-terminal domain of the mechanosensitive channel of large conductance (MscL) has generated significant controversy. As a result, several structures have been proposed for this region: the original crystal structure (1MSL) of the Mycobacterium tuberculosis homolog (Tb), a model of the Escherichia coli homolog, and, most recently, a revised crystal structure of Tb-MscL (2OAR). To understand which of these structures represents a physiological conformation, we measured the ...

  12. The C-terminal random coil region tunes the Ca²⁺-binding affinity of S100A4 through conformational activation.

    Directory of Open Access Journals (Sweden)

    Annette Duelli

    Full Text Available S100A4 interacts with many binding partners upon Ca2+ activation and is strongly associated with increased metastasis formation. In order to understand the role of the C-terminal random coil for the protein function we examined how small angle X-ray scattering of the wild-type S100A4 and its C-terminal deletion mutant (residues 1-88, Δ13 changes upon Ca2+ binding. We found that the scattering intensity of wild-type S100A4 changes substantially in the 0.15-0.25 Å-1 q-range whereas a similar change is not visible in the C-terminus deleted mutant. Ensemble optimization SAXS modeling indicates that the entire C-terminus is extended when Ca2+ is bound. Pulsed field gradient NMR measurements provide further support as the hydrodynamic radius in the wild-type protein increases upon Ca2+ binding while the radius of Δ13 mutant does not change. Molecular dynamics simulations provide a rational explanation of the structural transition: the positively charged C-terminal residues associate with the negatively charged residues of the Ca2+-free EF-hands and these interactions loosen up considerably upon Ca2+-binding. As a consequence the Δ13 mutant has increased Ca2+ affinity and is constantly loaded at Ca2+ concentration ranges typically present in cells. The activation of the entire C-terminal random coil may play a role in mediating interaction with selected partner proteins of S100A4.

  13. Purification, crystallization and X-ray diffraction analysis of the C-terminal protease domain of Venezuelan equine encephalitis virus nsP2

    International Nuclear Information System (INIS)

    Russo, Andrew T.; Watowich, Stanley J.

    2006-01-01

    The C-terminal protease domain of Venezuelan equine encephalitis virus (VEEV) nsP2 has been overexpressed in E. coli, purified and successfully crystallized. Native crystals diffract to beyond 2.5 Å resolution and isomorphous heavy-atom derivatives suitable for phase analysis have been identified. The C-terminal region of Venezuelan equine encephalitis virus (VEEV) nsP2 is responsible for proteolytic processing of the VEEV polyprotein replication complex. This action regulates the activity of the replication complex and is essential for viral replication, thus making nsP2 a very attractive target for development of VEEV therapeutics. The 338-amino-acid C-terminal region of VEEV nsP2 has been overexpressed in Escherichia coli, purified and crystallized. Crystals diffract to beyond 2.5 Å resolution and belong to the orthorhombic space group P2 1 2 1 2 1 . Isomorphous heavy-atom derivatives suitable for phase analysis have been obtained and work on building a complete structural model is under way

  14. Purification, crystallization and X-ray diffraction analysis of the C-terminal protease domain of Venezuelan equine encephalitis virus nsP2

    Energy Technology Data Exchange (ETDEWEB)

    Russo, Andrew T.; Watowich, Stanley J., E-mail: watowich@xray.utmb.edu [Department of Biochemistry and Molecular Biology, University of Texas Medical Branch, Galveston, TX (United States)

    2006-06-01

    The C-terminal protease domain of Venezuelan equine encephalitis virus (VEEV) nsP2 has been overexpressed in E. coli, purified and successfully crystallized. Native crystals diffract to beyond 2.5 Å resolution and isomorphous heavy-atom derivatives suitable for phase analysis have been identified. The C-terminal region of Venezuelan equine encephalitis virus (VEEV) nsP2 is responsible for proteolytic processing of the VEEV polyprotein replication complex. This action regulates the activity of the replication complex and is essential for viral replication, thus making nsP2 a very attractive target for development of VEEV therapeutics. The 338-amino-acid C-terminal region of VEEV nsP2 has been overexpressed in Escherichia coli, purified and crystallized. Crystals diffract to beyond 2.5 Å resolution and belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}. Isomorphous heavy-atom derivatives suitable for phase analysis have been obtained and work on building a complete structural model is under way.

  15. The impact of the human DNA topoisomerase II C-terminal domain on activity.

    Directory of Open Access Journals (Sweden)

    Emma L Meczes

    2008-03-01

    Full Text Available Type II DNA topoisomerases (topos are essential enzymes needed for the resolution of topological problems that occur during DNA metabolic processes. Topos carry out an ATP-dependent strand passage reaction whereby one double helix is passed through a transient break in another. Humans have two topoII isoforms, alpha and beta, which while enzymatically similar are differentially expressed and regulated, and are thought to have different cellular roles. The C-terminal domain (CTD of the enzyme has the most diversity, and has been implicated in regulation. We sought to investigate the impact of the CTD domain on activity.We have investigated the role of the human topoII C-terminal domain by creating constructs encoding C-terminally truncated recombinant topoIIalpha and beta and topoIIalpha+beta-tail and topoIIbeta+alpha-tail chimeric proteins. We then investigated function in vivo in a yeast system, and in vitro in activity assays. We find that the C-terminal domain of human topoII isoforms is needed for in vivo function of the enzyme, but not needed for cleavage activity. C-terminally truncated enzymes had similar strand passage activity to full length enzymes, but the presence of the opposite C-terminal domain had a large effect, with the topoIIalpha-CTD increasing activity, and the topoIIbeta-CTD decreasing activity.In vivo complementation data show that the topoIIalpha C-terminal domain is needed for growth, but the topoIIbeta isoform is able to support low levels of growth without a C-terminal domain. This may indicate that topoIIbeta has an additional localisation signal. In vitro data suggest that, while the lack of any C-terminal domain has little effect on activity, the presence of either the topoIIalpha or beta C-terminal domain can affect strand passage activity. Data indicates that the topoIIbeta-CTD may be a negative regulator. This is the first report of in vitro data with chimeric human topoIIs.

  16. 20 CFR 640.2 - Federal law requirements.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Federal law requirements. 640.2 Section 640.2 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF LABOR STANDARD FOR BENEFIT PAYMENT... methods of administration * * * as are found by the Secretary of Labor to be reasonably calculated to...

  17. 21 CFR 640.103 - The final product.

    Science.gov (United States)

    2010-04-01

    ... manufacturer by the Director, Center for Biologics Evaluation and Research, Food and Drug Administration. [38... 21 Food and Drugs 7 2010-04-01 2010-04-01 false The final product. 640.103 Section 640.103 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) BIOLOGICS...

  18. C-terminal KDEL-modified cystatin C is retained in transfected CHO cells

    DEFF Research Database (Denmark)

    Johansen, Teit Eliot; Vogel, Charlotte Katrine; Schwartz, Thue W.

    1990-01-01

    The significance of a C-terminal tetrapeptide, Lys-Asp-Glu-Leu (KDEL), as a retention signal for the endoplasmatic reticulum was studied using cystatin C, a general thiol protease inhibitor, as the reporter protein. Clones of CHO cells were analyzed after stable transfection with eukaryotic...

  19. Replacement of the C-terminal tetrapeptide ( 314 PAPV 317 to 314 ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Biosciences; Volume 35; Issue 4. Replacement of the C-terminal tetrapeptide (314PAPV317 to 314SSSM317) in interferon regulatory factor-2 alters its N-terminal DNA-binding activity. Krishna Prakash Pramod C Rath. Articles Volume 35 Issue 4 December 2010 pp 547-556 ...

  20. 21 CFR 640.3 - Suitability of donor.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Suitability of donor. 640.3 Section 640.3 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) BIOLOGICS... determination shall be made on the day of collection from the donor by means of medical history, a test for...

  1. 21 CFR 640.63 - Suitability of donor.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Suitability of donor. 640.63 Section 640.63 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) BIOLOGICS... determination shall be made on the day of collection from the donor by means of a medical history, tests, and...

  2. The Chikungunya Virus Capsid Protein Contains Linear B Cell Epitopes in the N- and C-Terminal Regions that are Dependent on an Intact C-Terminus for Antibody Recognition

    Directory of Open Access Journals (Sweden)

    Lucas Y. H. Goh

    2015-06-01

    Full Text Available Chikungunya virus (CHIKV is an arthropod-borne agent that causes severe arthritic disease in humans and is considered a serious health threat in areas where competent mosquito vectors are prevalent. CHIKV has recently been responsible for several millions of cases of disease, involving over 40 countries. The recent re-emergence of CHIKV and its potential threat to human health has stimulated interest in better understanding of the biology and pathogenesis of the virus, and requirement for improved treatment, prevention and control measures. In this study, we mapped the binding sites of a panel of eleven monoclonal antibodies (mAbs previously generated towards the capsid protein (CP of CHIKV. Using N- and C-terminally truncated recombinant forms of the CHIKV CP, two putative binding regions, between residues 1–35 and 140–210, were identified. Competitive binding also revealed that five of the CP-specific mAbs recognized a series of overlapping epitopes in the latter domain. We also identified a smaller, N-terminally truncated product of native CP that may represent an alternative translation product of the CHIKV 26S RNA and have potential functional significance during CHIKV replication. Our data also provides evidence that the C-terminus of CP is required for authentic antigenic structure of CP. This study shows that these anti-CP mAbs will be valuable research tools for further investigating the structure and function of the CHIKV CP.

  3. Distinct regions in the C-Terminus required for GLP-1R cell surface expression, activity and internalisation.

    Science.gov (United States)

    Thompson, Aiysha; Kanamarlapudi, Venkateswarlu

    2015-09-15

    The glucagon-like peptide-1 (GLP-1) receptor (GLP-1R), an important drug target in the treatment of type 2 diabetes, is a G-protein coupled receptor (GPCR) that mediates insulin secretion by GLP-1. The N-terminus controls GLP-1R biosynthetic trafficking to the cell surface but the C-terminus involvement in that trafficking is unknown. The aim of this study was to identify distinct regions within the C-terminal domain required for human GLP-1R (hGLP-1R) cell surface expression, activity and internalisation using a number of C-terminal deletions and site-directed mutations. The results of this study revealed that the residues 411-418 within the C-terminal domain of the hGLP-1R are critical in targeting the newly synthesised receptor to the plasma membrane. The residues 419-430 are important for cAMP producing activity of the receptor, most likely by coupling to Gαs. However, the residues 431-450 within the C-terminus are essential for agonist-induced hGLP-1R internalisation. In conclusion, these findings demonstrate the hGLP-1R has distinct regions within the C-terminal domain required for its cell surface expression, activity and agonist-induced internalisation. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  4. Updating the profile of C-terminal MECP2 deletions in Rett syndrome

    Science.gov (United States)

    Bebbington, A; Percy, A; Christodoulou, J; Ravine, D; Ho, G; Jacoby, P; Anderson, A; Pineda, M; Ben Zeev, B; Bahi-Buisson, N; Smeets, E; Leonard, H

    2014-01-01

    Objectives This study aimed to compare the phenotype of Rett syndrome cases with C-terminal deletions to that of cases with different MECP2 mutations and to examine the phenotypic variation within C-terminal deletions. Methods Cases were selected from InterRett, an international database and from the population-based Australian Rett Syndrome Database. Cases (n=832) were included if they had a pathogenic MECP2 mutation in which the nature of the amino acid change was known. Three severity scale systems were used, and individual aspects of the phenotype were also compared. Results Lower severity was associated with C-terminal deletions (n=79) compared to all other MECP2 mutations (e.g. Pineda scale C-terminals mean 15.0 (95% CI 14.0–16.0) vs 16.2 (15.9–16.5). Cases with C-terminal deletions were more likely to have a normal head circumference (odds ratio 3.22, 95% CI 1.53 – 6.79) and weight (odds ratio 2.97, 95% CI 1.25–5.76). Onset of stereotypies tended to be later (median age 2.5 years vs 2 years, pmiddle of the range. In terms of individual aspects of phenotype growth and ability to ambulate appear to be particular strengths. By pooling data internationally this study has achieved the case numbers to provide a phenotypic profile of C-terminal deletions in Rett syndrome. PMID:19914908

  5. Feline infectious peritonitis virus with a large deletion in the 5'-terminal region of the spike gene retains its virulence for cats.

    Science.gov (United States)

    Terada, Yutaka; Shiozaki, Yuto; Shimoda, Hiroshi; Mahmoud, Hassan Youssef Abdel Hamid; Noguchi, Keita; Nagao, Yumiko; Shimojima, Masayuki; Iwata, Hiroyuki; Mizuno, Takuya; Okuda, Masaru; Morimoto, Masahiro; Hayashi, Toshiharu; Tanaka, Yoshikazu; Mochizuki, Masami; Maeda, Ken

    2012-09-01

    In this study, the Japanese strain of type I feline infectious peritonitis virus (FIPV), C3663, was found to have a large deletion of 735 bp within the gene encoding the spike (S) protein, with a deduced loss of 245 aa of the N-terminal region of the S protein. This deletion is similar to that observed in porcine respiratory coronavirus (PRCoV) when compared to transmissible gastroenteritis virus, which correlates with reduced virulence. By analogy to PRCoV, we expected that the pathogenicity of C3663 may be attenuated in cats. However, two of four cats inoculated with C3663 died of FIP, and a third C3663-inoculated cat showed FIP lesions at 91 days after challenge. These results indicate that the 5'-terminal region of the S gene is not essential for the development of FIP.

  6. Structure of the DNA-bound BRCA1 C-terminal region from human replication factor C p140 and model of the protein-DNA complex

    NARCIS (Netherlands)

    Kobayashi, M.; AB, E.; Bonvin, A.M.J.J.; Siegal, G.

    2010-01-01

    BRCA1 C-terminal domain (BRCT)-containing proteins are found widely throughout the animal and bacteria kingdoms where they are exclusively involved in cell cycle regulation and DNA metabolism. Whereas most BRCT domains are involved in protein-protein interactions, a small subset has bona fide DNA

  7. Structure of the C-terminal effector-binding domain of AhrC bound to its corepressor l-arginine

    International Nuclear Information System (INIS)

    Garnett, James A.; Baumberg, Simon; Stockley, Peter G.; Phillips, Simon E. V.

    2007-01-01

    The crystal structure of the C-terminal domain hexameric core of AhrC, with bound corepressor (l-arginine), has been solved at 1.95 Å resolution. Binding of l-arginine results in a rotation between the two trimers of the hexamer, leading to the activation of the DNA-binding state. The arginine repressor/activator protein (AhrC) from Bacillus subtilis belongs to a large family of multifunctional transcription factors that are involved in the regulation of bacterial arginine metabolism. AhrC interacts with operator sites in the promoters of arginine biosynthetic and catabolic operons, acting as a transcriptional repressor at biosynthetic sites and an activator of transcription at catabolic sites. AhrC is a hexamer of identical subunits, each having two domains. The C-terminal domains form the core of the protein and are involved in oligomerization and l-arginine binding. The N-terminal domains lie on the outside of the compact core and play a role in binding to 18 bp DNA operators called ARG boxes. The C-terminal domain of AhrC has been expressed, purified and characterized, and also crystallized as a hexamer with the bound corepressor l-arginine. Here, the crystal structure refined to 1.95 Å is presented

  8. 47 CFR 25.134 - Licensing provisions of Very Small Aperture Terminal (VSAT) and C-band Small Aperture Terminal...

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 2 2010-10-01 2010-10-01 false Licensing provisions of Very Small Aperture Terminal (VSAT) and C-band Small Aperture Terminal (CSAT) networks. 25.134 Section 25.134 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES SATELLITE COMMUNICATIONS...

  9. The N-terminal segment of pulmonary surfactant lipopeptide SP-C has intrinsic propensity to interact with and perturb phospholipid bilayers

    DEFF Research Database (Denmark)

    Plasencia, Inés; Rivas, Luis; Keough, Kevin M W

    2004-01-01

    aggregation, and leakage of the aqueous content of the vesicles. The lipid-peptide interaction includes a significant hydrophobic component for both zwitterionic and anionic membranes, although the interaction with phosphatidylglycerol bilayers is also electrostatic in nature. The effects of the SP-C N......-terminal peptides on the membrane structure are mediated by significant perturbations of the packing order and mobility of phospholipid acyl chain segments deep in the bilayer, as detected by differential scanning calorimetry and spin-label ESR. These results suggest that the N-terminal region of SP-C, even...

  10. Antimicrobial activity of human prion protein is mediated by its N-terminal region.

    Directory of Open Access Journals (Sweden)

    Mukesh Pasupuleti

    Full Text Available BACKGROUND: Cellular prion-related protein (PrP(c is a cell-surface protein that is ubiquitously expressed in the human body. The multifunctionality of PrP(c, and presence of an exposed cationic and heparin-binding N-terminus, a feature characterizing many antimicrobial peptides, made us hypothesize that PrP(c could exert antimicrobial activity. METHODOLOGY AND PRINCIPAL FINDINGS: Intact recombinant PrP exerted antibacterial and antifungal effects at normal and low pH. Studies employing recombinant PrP and N- and C-terminally truncated variants, as well as overlapping peptide 20mers, demonstrated that the antimicrobial activity is mediated by the unstructured N-terminal part of the protein. Synthetic peptides of the N-terminus of PrP killed the Gram-negative bacteria Escherichia coli and Pseudomonas aeruginosa, and the Gram-positive Bacillus subtilis and Staphylococcus aureus, as well as the fungus Candida parapsilosis. Fluorescence studies of peptide-treated bacteria, paired with analysis of peptide effects on liposomes, showed that the peptides exerted membrane-breaking effects similar to those seen after treatment with the "classical" human antimicrobial peptide LL-37. In contrast to LL-37, however, no marked helix induction was detected for the PrP-derived peptides in presence of negatively charged (bacteria-mimicking liposomes. PrP furthermore showed an inducible expression during wounding of human skin ex vivo and in vivo, as well as stimulation of keratinocytes with TGF-alpha in vitro. CONCLUSIONS: The demonstration of an antimicrobial activity of PrP, localisation of its activity to the N-terminal and heparin-binding region, combined with results showing an increased expression of PrP during wounding, indicate that PrPs could have a previously undisclosed role in host defense.

  11. The N-terminal, polybasic region is critical for prion protein neuroprotective activity.

    Directory of Open Access Journals (Sweden)

    Jessie A Turnbaugh

    Full Text Available Several lines of evidence suggest that the normal form of the prion protein, PrP(C, exerts a neuroprotective activity against cellular stress or toxicity. One of the clearest examples of such activity is the ability of wild-type PrP(C to suppress the spontaneous neurodegenerative phenotype of transgenic mice expressing a deleted form of PrP (Δ32-134, called F35. To define domains of PrP involved in its neuroprotective activity, we have analyzed the ability of several deletion mutants of PrP (Δ23-31, Δ23-111, and Δ23-134 to rescue the phenotype of Tg(F35 mice. Surprisingly, all of these mutants displayed greatly diminished rescue activity, although Δ23-31 PrP partially suppressed neuronal loss when expressed at very high levels. Our results pinpoint the N-terminal, polybasic domain as a critical determinant of PrP(C neuroprotective activity, and suggest that identification of molecules interacting with this region will provide important clues regarding the normal function of the protein. Small molecule ligands targeting this region may also represent useful therapeutic agents for treatment of prion diseases.

  12. C-terminal peptide extension via gas-phase ion/ion reactions

    Science.gov (United States)

    Peng, Zhou; McLuckey, Scott A.

    2015-01-01

    The formation of peptide bonds is of great importance from both a biological standpoint and in routine organic synthesis. Recent work from our group demonstrated the synthesis of peptides in the gas-phase via ion/ion reactions with sulfo-NHS reagents, which resulted in conjugation of individual amino acids or small peptides to the N-terminus of an existing ‘anchor’ peptide. Here, we demonstrate a complementary approach resulting in the C-terminal extension of peptides. Individual amino acids or short peptides can be prepared as reagents by incorporating gas phase-labile protecting groups to the reactive C-terminus and then converting the N-terminal amino groups to the active ketenimine reagent. Gas-phase ion/ion reactions between the anionic reagents and doubly protonated “anchor” peptide cations results in extension of the “anchor” peptide with new amide bond formation at the C-terminus. We have demonstrated that ion/ion reactions can be used as a fast, controlled, and efficient means for C-terminal peptide extension in the gas phase. PMID:26640400

  13. Activity of the C-terminal-dependent vacuolar sorting signal of horseradish peroxidase C1a is enhanced by its secondary structure.

    Science.gov (United States)

    Matsui, Takeshi; Tabayashi, Ayako; Iwano, Megumi; Shinmyo, Atsuhiko; Kato, Ko; Nakayama, Hideki

    2011-02-01

    Plant class III peroxidase (PRX) catalyzes the oxidation and oxidative polymerization of a variety of phenolic compounds while reducing hydrogen peroxide. PRX proteins are classified into apoplast type and vacuole type based on the absence or the presence of C-terminal propeptides, which probably function as vacuolar sorting signals (VSSs). In this study, in order to improve our understanding of vacuole-type PRX, we analyzed regulatory mechanisms of vacuolar sorting of a model vacuole-type PRX, the C1a isozyme of horseradish (Armoracia rusticana) (HRP C1a). Using cultured transgenic tobacco cells and protoplasts derived from horseradish leaves, we characterized HRP C1a's VSS, which is a 15 amino acid C-terminal propeptide (C15). We found that the C-terminal hexapeptide of C15 (C6), which is well conserved among vacuole-type PRX proteins, forms the core of the C-terminal-dependent VSS. We also found that the function of C6 is enhanced by the remaining N-terminal part of C15 which probably folds into an amphiphilic α-helix.

  14. 40 CFR 1039.640 - What special provisions apply to branded engines?

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 32 2010-07-01 2010-07-01 false What special provisions apply to branded engines? 1039.640 Section 1039.640 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... ENGINES Special Compliance Provisions § 1039.640 What special provisions apply to branded engines? The...

  15. 40 CFR 1060.640 - What special provisions apply to branded equipment?

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 32 2010-07-01 2010-07-01 false What special provisions apply to branded equipment? 1060.640 Section 1060.640 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... STATIONARY EQUIPMENT Special Compliance Provisions § 1060.640 What special provisions apply to branded...

  16. 40 CFR 1045.640 - What special provisions apply to branded engines?

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 32 2010-07-01 2010-07-01 false What special provisions apply to branded engines? 1045.640 Section 1045.640 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... VESSELS Special Compliance Provisions § 1045.640 What special provisions apply to branded engines? The...

  17. 40 CFR 1054.640 - What special provisions apply to branded engines?

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 32 2010-07-01 2010-07-01 false What special provisions apply to branded engines? 1054.640 Section 1054.640 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... EQUIPMENT Special Compliance Provisions § 1054.640 What special provisions apply to branded engines? The...

  18. Upregulation of α7 Nicotinic Receptors by Acetylcholinesterase C-Terminal Peptides

    Science.gov (United States)

    Bond, Cherie E.; Zimmermann, Martina; Greenfield, Susan A.

    2009-01-01

    Background The alpha-7 nicotinic acetylcholine receptor (α7-nAChR) is well known as a potent calcium ionophore that, in the brain, has been implicated in excitotoxicity and hence in the underlying mechanisms of neurodegenerative disorders such as Alzheimer's disease. Previous research implied that the activity of this receptor may be modified by exposure to a peptide fragment derived from the C-terminal region of the enzyme acetylcholinesterase. This investigation was undertaken to determine if the functional changes observed could be attributed to peptide binding interaction with the α7-nAChR, or peptide modulation of receptor expression. Methodology/Principal Findings This study provides evidence that two peptides derived from the C-terminus of acetylcholinesterase, not only selectively displace specific bungarotoxin binding at the α7-nAChR, but also alter receptor binding properties for its familiar ligands, including the alternative endogenous agonist choline. Of more long-term significance, these peptides also induce upregulation of α7-nAChR mRNA and protein expression, as well as enhancing receptor trafficking to the plasma membrane. Conclusions/Significance The results reported here demonstrate a hitherto unknown relationship between the α7-nAChR and the non-enzymatic functions of acetylcholinesterase, mediated independently by its C-terminal domain. Such an interaction may prove valuable as a pharmacological tool, prompting new approaches for understanding, and combating, the process of neurodegeneration. PMID:19287501

  19. 13 CFR 120.640 - Administration of the Pool and Individual Certificates.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Administration of the Pool and Individual Certificates. 120.640 Section 120.640 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION BUSINESS LOANS Secondary Market Miscellaneous Provisions § 120.640 Administration of the Pool and...

  20. C-Terminus of Progranulin Interacts with the Beta-Propeller Region of Sortilin to Regulate Progranulin Trafficking

    OpenAIRE

    Zheng, Yanqiu; Brady, Owen A.; Meng, Peter S.; Mao, Yuxin; Hu, Fenghua

    2011-01-01

    Progranulin haplo-insufficiency is a main cause of frontotemporal lobar degeneration (FTLD) with TDP-43 aggregates. Previous studies have shown that sortilin regulates progranulin trafficking and is a main determinant of progranulin level in the brain. In this study, we mapped the binding site between progranulin and sortilin. Progranulin binds to the beta-propeller region of sortilin through its C-terminal tail. The C-terminal progranulin fragment is fully sufficient for sortilin binding and...

  1. Transformation mechanism of n-butyl terminated Si nanoparticles embedded into Si1-xCx nanocomposites mixed with Si nanoparticles and C atoms

    International Nuclear Information System (INIS)

    Shin, J.W.; Oh, D.H.; Kim, T.W.; Cho, W.J.

    2009-01-01

    Bright-field transmission electron microscopy (TEM) images, high-resolution TEM (HRTEM) images, and fast-Fourier transformed electron-diffraction patterns showed that n-butyl terminated Si nanoparticles were aggregated. The formation of Si 1-x C x nanocomposites was mixed with Si nanoparticles and C atoms embedded in a SiO 2 layer due to the diffusion of C atoms from n-butyl termination shells into aggregated Si nanoparticles. Atomic force microscopy (AFM) images showed that the Si 1-x C x nanocomposites mixed with Si nanoparticles and C atoms existed in almost all regions of the SiO 2 layer. The formation mechanism of Si nanoparticles and the transformation mechanism of n-butyl terminated Si nanoparticles embedded into Si 1-x C x nanocomposites mixed with Si nanoparticles and C atoms are described on the basis of the TEM, HRTEM, and AFM results. These results can help to improve the understanding of the formation mechanism of Si nanoparticles.

  2. MCM interference during licensing of DNA replication in Xenopus egg extracts-Possible Role of a C-terminal region of MCM3.

    Science.gov (United States)

    Mimura, Satoru; Kubota, Yumiko; Takisawa, Haruhiko

    2018-01-01

    The minichromosome maintenance (MCM) complex, consisting of six subunits, Mcm2-7, is loaded onto replication origins through loading factors (origin recognition complex [ORC], Cdc6, and Cdt1) and forms an MCM double hexamer that licenses the initiation of DNA replication. Previous studies with Xenopus egg extracts showed that loading factors, especially Cdc6, dissociate from chromatin on MCM loading, but the molecular mechanism and physiological significance remain largely unknown. Using a cell-free system for MCM loading onto plasmid DNA in Xenopus egg extracts, we found that MCM loaded onto DNA prevents DNA binding of the loading factors ORC, Cdc6, and Cdt1. We further report that a peptide of the C-terminal region of MCM3 (MCM3-C), previously implicated in the initial association with ORC/Cdc6 in budding yeast, prevents ORC/Cdc6/Cdt1 binding to DNA in the absence of MCM loading. ATP-γ-S suppresses inhibitory activities of both the MCM loaded onto DNA and the MCM3-C peptide. Other soluble factors in the extract, but neither MCM nor Cdt1, are required for the activity. Conservation of the amino acid sequences of MCM3-C and its activity in vertebrates implies a novel negative autoregulatory mechanism that interferes with MCM loading in the vicinity of licensed origins to ensure proper origin licensing.

  3. Uncovering the role of the flexible C-terminal tail: A model study with Strep-tagged GFP.

    Science.gov (United States)

    Lassalle, Michael W; Kondou, Shinobu

    2016-06-01

    Recently, it has been recognized that, much like an electric current in an electric circuit, dynamic disruptions from flexible, unstructured regions distal to the active region are transferred through the contact network to the active site and influence protein stability and/or function. As transmembrane proteins frequently possess the β-barrel structure, studies of proteins with this topology are required. The unstructured lid segments of the β-barrel GFP protein are conserved and could play a role in the backbone stabilization required for chromophore function. A study of the disordered C-terminus and the function within the lid is necessary. In this study, we entirely truncated the flexible C-terminal tail and investigated the N-terminal Strep-tagged GFP by fluorescence spectroscopy, and the temperature- and GdnHCl-induced unfolding by circular dichroism. The introduction of the unstructured Strep-tag itself changed the unfolding pathway. Truncating the entire flexible tail did not decrease the fluorescence intensity to a large extent; however, the protein stability changed dramatically. The temperature for half-denaturation T 1/2 changed significantly from 79 °C for the wild-type to 72.8 °C for the mutant. Unfolding kinetics at different temperatures have been induced by 4 M GdnHCl, and the apparent Arrhenius activation energy decreased by 40% as compared to the wild-type.

  4. Uncovering the role of the flexible C-terminal tail: A model study with Strep-tagged GFP

    Directory of Open Access Journals (Sweden)

    Michael W. Lassalle

    2016-06-01

    Full Text Available Recently, it has been recognized that, much like an electric current in an electric circuit, dynamic disruptions from flexible, unstructured regions distal to the active region are transferred through the contact network to the active site and influence protein stability and/or function. As transmembrane proteins frequently possess the β-barrel structure, studies of proteins with this topology are required. The unstructured lid segments of the β-barrel GFP protein are conserved and could play a role in the backbone stabilization required for chromophore function. A study of the disordered C-terminus and the function within the lid is necessary. In this study, we entirely truncated the flexible C-terminal tail and investigated the N-terminal Strep-tagged GFP by fluorescence spectroscopy, and the temperature- and GdnHCl-induced unfolding by circular dichroism. The introduction of the unstructured Strep-tag itself changed the unfolding pathway. Truncating the entire flexible tail did not decrease the fluorescence intensity to a large extent; however, the protein stability changed dramatically. The temperature for half-denaturation T1/2 changed significantly from 79 °C for the wild-type to 72.8 °C for the mutant. Unfolding kinetics at different temperatures have been induced by 4 M GdnHCl, and the apparent Arrhenius activation energy decreased by 40% as compared to the wild-type.

  5. Evolutionary analysis of a novel zinc ribbon in the N-terminal region of threonine synthase.

    Science.gov (United States)

    Kaur, Gurmeet; Subramanian, Srikrishna

    2017-10-18

    Threonine synthase (TS) catalyzes the terminal reaction in the biosynthetic pathway of threonine and requires pyridoxal phosphate as a cofactor. TSs share a common catalytic domain with other fold type II PALP dependent enzymes. TSs are broadly grouped into two classes based on their sequence, quaternary structure, and enzyme regulation. We report the presence of a novel zinc ribbon domain in the N-terminal region preceding the catalytic core in TS. The zinc ribbon domain is present in TSs belonging to both classes. Our sequence analysis reveals that archaeal TSs possess all zinc chelating residues to bind a metal ion that are lacking in the structurally characterized homologs. Phylogenetic analysis suggests that TSs with an N-terminal zinc ribbon likely represents the ancestral state of the enzyme while TSs without a zinc ribbon must have diverged later in specific lineages. The zinc ribbon and its N- and C-terminal extensions are important for enzyme stability, activity and regulation. It is likely that the zinc ribbon domain is involved in higher order oligomerization or mediating interactions with other biomolecules leading to formation of larger metabolic complexes.

  6. 50 CFR 640.22 - Gear and diving restrictions.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 8 2010-10-01 2010-10-01 false Gear and diving restrictions. 640.22... ATLANTIC Management Measures § 640.22 Gear and diving restrictions. (a) Prohibited gear and methods. (1) A spiny lobster may not be taken in the EEZ with a spear, hook, or similar device, or gear containing such...

  7. N-terminally truncated POM121C inhibits HIV-1 replication.

    Directory of Open Access Journals (Sweden)

    Hideki Saito

    Full Text Available Recent studies have identified host cell factors that regulate early stages of HIV-1 infection including viral cDNA synthesis and orientation of the HIV-1 capsid (CA core toward the nuclear envelope, but it remains unclear how viral DNA is imported through the nuclear pore and guided to the host chromosomal DNA. Here, we demonstrate that N-terminally truncated POM121C, a component of the nuclear pore complex, blocks HIV-1 infection. This truncated protein is predominantly localized in the cytoplasm, does not bind to CA, does not affect viral cDNA synthesis, reduces the formation of 2-LTR and diminished the amount of integrated proviral DNA. Studies with an HIV-1-murine leukemia virus (MLV chimeric virus carrying the MLV-derived Gag revealed that Gag is a determinant of this inhibition. Intriguingly, mutational studies have revealed that the blockade by N-terminally-truncated POM121C is closely linked to its binding to importin-β/karyopherin subunit beta 1 (KPNB1. These results indicate that N-terminally-truncated POM121C inhibits HIV-1 infection after completion of reverse transcription and before integration, and suggest an important role for KPNB1 in HIV-1 replication.

  8. Structures of the Gasdermin D C-Terminal Domains Reveal Mechanisms of Autoinhibition.

    Science.gov (United States)

    Liu, Zhonghua; Wang, Chuanping; Rathkey, Joseph K; Yang, Jie; Dubyak, George R; Abbott, Derek W; Xiao, Tsan Sam

    2018-05-01

    Pyroptosis is an inflammatory form of programmed cell death that plays important roles in immune protection against infections and in inflammatory disorders. Gasdermin D (GSDMD) is an executor of pyroptosis upon cleavage by caspases-1/4/5/11 following canonical and noncanonical inflammasome activation. GSDMD N-terminal domain assembles membrane pores to induce cytolysis, whereas its C-terminal domain inhibits cell death through intramolecular association with the N domain. The molecular mechanisms of autoinhibition for GSDMD are poorly characterized. Here we report the crystal structures of the human and murine GSDMD C-terminal domains, which differ from those of the full-length murine GSDMA3 and the human GSDMB C-terminal domain. Mutations of GSDMD C-domain residues predicted to locate at its interface with the N-domain enhanced pyroptosis. Our results suggest that GSDMDs may employ a distinct mode of intramolecular domain interaction and autoinhibition, which may be relevant to its unique role in pyroptosis downstream of inflammasome activation. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. Gating of human ClC-2 chloride channels and regulation by carboxy-terminal domains.

    Science.gov (United States)

    Garcia-Olivares, Jennie; Alekov, Alexi; Boroumand, Mohammad Reza; Begemann, Birgit; Hidalgo, Patricia; Fahlke, Christoph

    2008-11-15

    Eukaryotic ClC channels are dimeric proteins with each subunit forming an individual protopore. Single protopores are gated by a fast gate, whereas the slow gate is assumed to control both protopores through a cooperative movement of the two carboxy-terminal domains. We here study the role of the carboxy-terminal domain in modulating fast and slow gating of human ClC-2 channels, a ubiquitously expressed ClC-type chloride channel involved in transepithelial solute transport and in neuronal chloride homeostasis. Partial truncation of the carboxy-terminus abolishes function of ClC-2 by locking the channel in a closed position. However, unlike other isoforms, its complete removal preserves function of ClC-2. ClC-2 channels without the carboxy-terminus exhibit fast and slow gates that activate and deactivate significantly faster than in WT channels. In contrast to the prevalent view, a single carboxy-terminus suffices for normal slow gating, whereas both domains regulate fast gating of individual protopores. Our findings demonstrate that the carboxy-terminus is not strictly required for slow gating and that the cooperative gating resides in other regions of the channel protein. ClC-2 is expressed in neurons and believed to open at negative potentials and increased internal chloride concentrations after intense synaptic activity. We propose that the function of the ClC-2 carboxy-terminus is to slow down the time course of channel activation in order to stabilize neuronal excitability.

  10. Automation of C-terminal sequence analysis of 2D-PAGE separated proteins

    Directory of Open Access Journals (Sweden)

    P.P. Moerman

    2014-06-01

    Full Text Available Experimental assignment of the protein termini remains essential to define the functional protein structure. Here, we report on the improvement of a proteomic C-terminal sequence analysis method. The approach aims to discriminate the C-terminal peptide in a CNBr-digest where Met-Xxx peptide bonds are cleaved in internal peptides ending at a homoserine lactone (hsl-derivative. pH-dependent partial opening of the lactone ring results in the formation of doublets for all internal peptides. C-terminal peptides are distinguished as singlet peaks by MALDI-TOF MS and MS/MS is then used for their identification. We present a fully automated protocol established on a robotic liquid-handling station.

  11. Identification of the C-terminal domain of Daxx acts as a potential regulator of intracellular cholesterol synthesis in HepG2 cells

    International Nuclear Information System (INIS)

    Sun, Shaowei; Wen, Juan; Qiu, Fei; Yin, Yufang; Xu, Guina; Li, Tianping; Nie, Juan; Xiong, Guozuo; Zhang, Caiping; Liao, Duangfang; Chen, Jianxiong; Tuo, Qinhui

    2016-01-01

    Daxx is a highly conserved nuclear transcriptional factor, which has been implicated in many nuclear processes including transcription and cell cycle regulation. Our previous study demonstrated Daxx also plays a role in regulation of intracellular cholesterol content. Daxx contains several domains that are essential for interaction with a growing number of proteins. To delineate the underlying mechanism of hypocholesterolemic activity of Daxx, we constructed a set of plasmids which can be used to overexpress different fragments of Daxx and transfected to HepG2 cells. We found that the C- terminal region Daxx626–740 clearly reduced intracellular cholesterol levels and inhibited the expression of SREBPs and SCAP. In GST pull-down experiments and Double immunofluorescence assays, Daxx626–740 was demonstrated to bind directly to androgen receptor (AR). Our findings suggest that the interaction of Daxx626-740 and AR abolishes the AR-mediated activation of SCAP/SREBPs pathway, which suppresses the de novo cholesterol synthesis. Thus, C-terminal domain of Daxx acts as a potential regulator of intracellular cholesterol content in HepG2 cells. - Highlights: • Daxx C-terminal domain reduces cholesterol levels. • Daxx C-terminal domain binds directly to AR. • The interaction of Daxx C-terminal domain and AR suppresses cholesterol synthesis.

  12. Synergy between the N-terminal and C-terminal domains of Mycobacterium tuberculosis HupB is essential for high-affinity binding, DNA supercoiling and inhibition of RecA-promoted strand exchange.

    Science.gov (United States)

    Sharadamma, N; Khan, Krishnendu; Kumar, Sandeep; Patil, K Neelakanteshwar; Hasnain, Seyed E; Muniyappa, K

    2011-09-01

    The occurrence of DNA architectural proteins containing two functional domains derived from two different architectural proteins is an interesting emerging research theme in the field of nucleoid structure and function. Mycobacterium tuberculosis HupB, unlike Escherichia coli HU, is a two-domain protein that, in the N-terminal region, shows broad sequence homology with bacterial HU. The long C-terminal extension, on the other hand, contains seven PAKK/KAAK motifs, which are characteristic of the histone H1/H5 family of proteins. In this article, we describe several aspects of HupB function, in comparison with its truncated derivatives lacking either the C-terminus or N-terminus. We found that HupB binds a variety of DNA repair and replication intermediates with K(d) values in the nanomolar range. By contrast, the N-terminal fragment of M. tuberculosis HupB (HupB(MtbN)) showed diminished DNA-binding activity, with K(d) values in the micromolar range, and the C-terminal domain was completely devoid of DNA-binding activity. Unlike HupB(MtbN) , HupB was able to constrain DNA in negative supercoils and introduce negative superhelical turns into relaxed DNA. Similarly, HupB exerted a robust inhibitory effect on DNA strand exchange promoted by cognate and noncognate RecA proteins, whereas HupB(MtbN), even at a 50-fold molar excess, had no inhibitory effect. Considered together, these results suggest that synergy between the N-terminal and C-terminal domains of HupB is essential for its DNA-binding ability, and to modulate the topological features of DNA, which has implications for processes such as DNA compaction, gene regulation, homologous recombination, and DNA repair. © 2011 The Authors Journal compilation © 2011 FEBS.

  13. Presence and expression of hydrogenase specific C-terminal endopeptidases in cyanobacteria

    Directory of Open Access Journals (Sweden)

    Lindblad Peter

    2003-05-01

    Full Text Available Abstract Background Hydrogenases catalyze the simplest of all chemical reactions: the reduction of protons to molecular hydrogen or vice versa. Cyanobacteria can express an uptake, a bidirectional or both NiFe-hydrogenases. Maturation of those depends on accessory proteins encoded by hyp-genes. The last maturation step involves the cleavage of a ca. 30 amino acid long peptide from the large subunit by a C-terminal endopeptidase. Until know, nothing is known about the maturation of cyanobacterial NiFe-hydrogenases. The availability of three complete cyanobacterial genome sequences from strains with either only the uptake (Nostoc punctiforme ATCC 29133/PCC 73102, only the bidirectional (Synechocystis PCC 6803 or both NiFe-hydrogenases (Anabaena PCC 7120 prompted us to mine these genomes for hydrogenase maturation related genes. In this communication we focus on the presence and the expression of the NiFe-hydrogenases and the corresponding C-terminal endopeptidases, in the three strains mentioned above. Results We identified genes encoding putative cyanobacterial hydrogenase specific C-terminal endopeptidases in all analyzed cyanobacterial genomes. The genes are not part of any known hydrogenase related gene cluster. The derived amino acid sequences show only low similarity (28–41% to the well-analyzed hydrogenase specific C-terminal endopeptidase HybD from Escherichia coli, the crystal structure of which is known. However, computational secondary and tertiary structure modeling revealed the presence of conserved structural patterns around the highly conserved active site. Gene expression analysis shows that the endopeptidase encoding genes are expressed under both nitrogen-fixing and non-nitrogen-fixing conditions. Conclusion Anabaena PCC 7120 possesses two NiFe-hydrogenases and two hydrogenase specific C-terminal endopeptidases but only one set of hyp-genes. Thus, in contrast to the Hyp-proteins, the C-terminal endopeptidases are the only known

  14. The C-Terminal O-S Acyl Shift Pathway under Acidic Condition to Propose Peptide-Thioesters

    Directory of Open Access Journals (Sweden)

    Bo Mi Kim

    2016-11-01

    Full Text Available Peptide-thioester is a pivotal intermediate for peptide ligation and N-, C-terminal cyclization. In this study, desired pathway and the side products of two C-terminal handles, hydroxyethylthiol (HET and hydroxypropylthiol (HPT are described in different conditions as well as kinetic studies. In addition, a new mechanism of C-terminal residue racemization is proposed on the basis of differentiation of products derived from the two C-terminal handles in preparing peptide thioesters through an acid-catalyzed tandem thiol switch, first by an intramolecular O-S acyl shift, and then by an intermolecular S-S exchange.

  15. 20 CFR 670.640 - Are students provided with clothing?

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Are students provided with clothing? 670.640 Section 670.640 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF LABOR THE JOB... the work force. Center operators and other service providers must issue clothing and clothing...

  16. Shape and spin of asteroid 967 Helionape

    Science.gov (United States)

    Apostolovska, G.; Kostov, A.; Donchev, Z.; Bebekovska, E. Vchkova; Kuzmanovska, O.

    2018-04-01

    Knowledge of the spin and shape parameters of the asteroids is very important for understanding of the conditions during the creation of our planetary system and formation of asteroid populations. The main belt asteroid and Flora family member 967 Helionape was observed during five apparitions. The observations were made at the Bulgarian National Astronomical Observatory (BNAO) Rozhen, since March 2006 to March 2016. Lihtcurve inversion method (Kaasalainen et al. (2001)), applied on 12 relative lightcurves obtained at various geometric conditions of the asteroid, reveals the spin vector, the sense of rotation and the preliminary shape model of the asteroid. Our aim is to contribute in increasing the set of asteroids with known spin and shape parameters. This could be done with dense lightcurves, obtained during small number of apparitions, in combination with sparse data produced by photometric asteroid surveys such as the Gaia satellite (Hanush (2011)).

  17. All-Optical Signal Processing for 640 Gbit/s Applications

    DEFF Research Database (Denmark)

    Mulvad, Hans Christian Hansen

    2008-01-01

    This thesis concerns all-optical signal processing technologies for ultra-high serial data rates up to 640 Gbit/s. Firstly, time-division add-drop multiplexing at 640 Gbit/s is demonstrated for the first time using two different fibre-based switching techniques. Secondly, a novel principle for po...

  18. Circulating forms of immunoreactive parathyroid hormone-related protein for identifying patients with humoral hypercalcemia of malignancy. A comparative study with C-terminal (109-141)- and N-terminal (1-86)-region-specific PTHrP radioassay

    International Nuclear Information System (INIS)

    Suehiro, Mitsuko; Murakami, Minoru; Fukuchi, Minoru

    1994-01-01

    We evaluated the circulating forms of immunoreactive parathyroid hormone-related protein(PTHrP) in 115 healthy subjects and 122 patients with malignant diseases by using radioassay systems (RAS) specific for the C-terminal (109-141) fragment of PTHrP (C-RAS) and for the N-terminal(1-86) (N-RAS). PTHrP levels in healthy controls ranged from 1.5 to 38.2 (mean: 24.5) pmol/L with the C-RAS and from 0.9 to 2.5 (mean: 1.7) pmol/L with the N-RAS. The ratio of circulating N-terminal fragment (N) to C-terminal fragment (C) of PTHrP was calculated to be about 1 : 14.4 in the healthy subjects. Of the 122 patients with malignant diseases, 40 (32.8%) had circulating PTHrP levels undetectable with the N-RAS, but only 11 (9.0%) patients had levels undetectable with the C-RAS. Of the former 122 patients, 41 (33.6%) had high PTHrP as determined with the C-RAS, and 10 (8.2%) had high PTHrP as determined with the N-RAS. The former of these included only 8 (19.5%) humoral hypercalcemia malignancy(HHM) patients, while the latter included 8 (80.0%) HHM patients. The circulating N to C ratio was about 1 : 70.7 in the HHM patients. The N and C obtained with the different RASs showed a close correlation (r=0.86). The values also showed a close correlation with serum Ca; r=0.75 for C-RAS and r=0.81 for N-RAS. In addition, the correlation between the PTHrP reading obtained with the different RASs and serum Cr were: r=0.42 with C-RAS and r=0.26 with N-RAS. The circulating form of immunoreactive PTHrP fragments is therefore comprised mainly of PTHrP (109-141). In contrast, circulating concentrations of the PTHrP (1-86) fragment are very low, but detection of the PTHrP (1-86) fragment with the N-RAS is a more useful indicator of HHM with fewer false positive results and is less likely to be influenced by renal function than the detection of the PHPrP (109-141) fragment with C-RAS. (author)

  19. The Kaarstoe gas terminal during operation - regional economic effects

    International Nuclear Information System (INIS)

    Wiig, W.; Kristiansen, F.

    1995-02-01

    In the period 1981-1989 a comprehensive study was made of the impact on society of the establishment of Statoil's gas terminal at Kaarstoe, Norway. Some of this work is updated in the present report. The organization at Kaarstoe is Statoil's transport division for gas (GASS-T) and is described in Chapter 2. A survey is given in Chapter 3 of how the employees are associated with the local community, their distribution in age, sex and type of job. Chapter 4 treats the importance for the Haugesund region of the company's purchasing in the area, in particular from suppliers within the Tysvaer municipality. The development of the structure of industry in Tysvaer and the employment situation are described in Chapter 5. Population trends and housebuilding in Tysvaer are described in Chapter 6 and the impact of GASS-T on the municipal economy is described in Chapter 7. Finally, Chapter 8 discusses whether what is learned from Kaarstoe can be transferred to other regions where gas terminals have been established. 14 refs., 24 figs., 12 tabs

  20. Crystallization and preliminary X-ray analysis of a C-terminal fragment of FlgJ, a putative flagellar rod cap protein from Salmonella

    International Nuclear Information System (INIS)

    Kikuchi, Yuki; Matsunami, Hideyuki; Yamane, Midori; Imada, Katsumi; Namba, Keiichi

    2008-01-01

    A C-terminal fragment of Salmonella FlgJ, FlgJ 120–316 , which has peptidoglycan-hydrolysing activity, has been overproduced, purified and crystallized and the crystals have been characterized by X-ray diffraction. The formation of the bacterial flagellar axial structure, including the filament, the hook and the rod, requires the attachment of a cap complex to the distal end of the growing structure. Because the rod penetrates the peptidoglycan (PG) layer, the rod cap complex is thought to have PG-hydrolyzing activity. FlgJ is a putative rod cap protein whose C-terminal region shows sequence similarity to known muramidases. In this study, FlgJ 120–316 , a C-terminal fragment of FlgJ which contains the muramidase region, was overproduced, purified and crystallized. Crystals were obtained by the sitting-drop vapour-diffusion technique using PEG 3350 as a crystallizing agent and belonged to the orthorhombic space group P2 1 2 1 2 1 , with unit-cell parameters a = 38.8, b = 43.9, c = 108.5 Å. Anomalous difference Patterson maps calculated from the diffraction data set of a selenomethionine-labelled crystal showed significant peaks in the Harker sections, indicating that the data were suitable for structure determination

  1. Interaction between the C-terminal domains of measles virus nucleoprotein and phosphoprotein: a tight complex implying one binding site.

    Science.gov (United States)

    Blocquel, David; Habchi, Johnny; Costanzo, Stéphanie; Doizy, Anthony; Oglesbee, Michael; Longhi, Sonia

    2012-10-01

    The intrinsically disordered C-terminal domain (N(TAIL) ) of the measles virus (MeV) nucleoprotein undergoes α-helical folding upon binding to the C-terminal X domain (XD) of the phosphoprotein. The N(TAIL) region involved in binding coupled to folding has been mapped to a conserved region (Box2) encompassing residues 489-506. In the previous studies published in this journal, we obtained experimental evidence supporting a K(D) for the N(TAIL) -XD binding reaction in the nM range and also showed that an additional N(TAIL) region (Box3, aa 517-525) plays a role in binding to XD. In striking contrast with these data, studies published in this journal by Kingston and coworkers pointed out a much less stable complex (K(D) in the μM range) and supported lack of involvement of Box3 in complex formation. The objective of this study was to critically re-evaluate the role of Box3 in N(TAIL) -XD binding. Since our previous studies relied on N(TAIL) -truncated forms possessing an irrelevant Flag sequence appended at their C-terminus, we, herein, generated an N(TAIL) devoid of Box3 and any additional C-terminal residues, as well as a form encompassing only residues 482-525. We then used isothermal titration calorimetry to characterize the binding reactions between XD and these N(TAIL) forms. Results effectively argue for the presence of a single XD-binding site located within Box2, in agreement with the results by Kingston et al., while providing clear experimental support for a high-affinity complex. Altogether, the present data provide mechanistic insights into the replicative machinery of MeV and clarify a hitherto highly debated point. Copyright © 2012 The Protein Society.

  2. Multiple C-terminal tail Ca(2+)/CaMs regulate Ca(V)1.2 function but do not mediate channel dimerization.

    Science.gov (United States)

    Kim, Eun Young; Rumpf, Christine H; Van Petegem, Filip; Arant, Ryan J; Findeisen, Felix; Cooley, Elizabeth S; Isacoff, Ehud Y; Minor, Daniel L

    2010-12-01

    Interactions between voltage-gated calcium channels (Ca(V)s) and calmodulin (CaM) modulate Ca(V) function. In this study, we report the structure of a Ca(2+)/CaM Ca(V)1.2 C-terminal tail complex that contains two PreIQ helices bridged by two Ca(2+)/CaMs and two Ca(2+)/CaM-IQ domain complexes. Sedimentation equilibrium experiments establish that the complex has a 2:1 Ca(2+)/CaM:C-terminal tail stoichiometry and does not form higher order assemblies. Moreover, subunit-counting experiments demonstrate that in live cell membranes Ca(V)1.2s are monomers. Thus, contrary to previous proposals, the crystallographic dimer lacks physiological relevance. Isothermal titration calorimetry and biochemical experiments show that the two Ca(2+)/CaMs in the complex have different properties. Ca(2+)/CaM bound to the PreIQ C-region is labile, whereas Ca(2+)/CaM bound to the IQ domain is not. Furthermore, neither of lobes of apo-CaM interacts strongly with the PreIQ domain. Electrophysiological studies indicate that the PreIQ C-region has a role in calcium-dependent facilitation. Together, the data show that two Ca(2+)/CaMs can bind the Ca(V)1.2 tail simultaneously and indicate a functional role for Ca(2+)/CaM at the C-region site.

  3. 21 CFR 640.102 - Manufacture of Immune Globulin (Human).

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Manufacture of Immune Globulin (Human). 640.102 Section 640.102 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES....102 Manufacture of Immune Globulin (Human). (a) Processing method. The processing method shall be one...

  4. C-terminus of progranulin interacts with the beta-propeller region of sortilin to regulate progranulin trafficking.

    Directory of Open Access Journals (Sweden)

    Yanqiu Zheng

    Full Text Available Progranulin haplo-insufficiency is a main cause of frontotemporal lobar degeneration (FTLD with TDP-43 aggregates. Previous studies have shown that sortilin regulates progranulin trafficking and is a main determinant of progranulin level in the brain. In this study, we mapped the binding site between progranulin and sortilin. Progranulin binds to the beta-propeller region of sortilin through its C-terminal tail. The C-terminal progranulin fragment is fully sufficient for sortilin binding and progranulin C-terminal peptide displaces progranulin binding to sortilin. Deletion of the last 3 residues of progranulin (QLL abolishes its binding to sortilin and also sortilin dependent regulation of progranulin trafficking. Since progranulin haplo-insufficiency results in FTLD, these results may provide important insights into future studies of progranulin trafficking and signaling and progranulin based therapy for FTLD.

  5. C-Terminus of Progranulin Interacts with the Beta-Propeller Region of Sortilin to Regulate Progranulin Trafficking

    Science.gov (United States)

    Meng, Peter S.; Mao, Yuxin; Hu, Fenghua

    2011-01-01

    Progranulin haplo-insufficiency is a main cause of frontotemporal lobar degeneration (FTLD) with TDP-43 aggregates. Previous studies have shown that sortilin regulates progranulin trafficking and is a main determinant of progranulin level in the brain. In this study, we mapped the binding site between progranulin and sortilin. Progranulin binds to the beta-propeller region of sortilin through its C-terminal tail. The C-terminal progranulin fragment is fully sufficient for sortilin binding and progranulin C-terminal peptide displaces progranulin binding to sortilin. Deletion of the last 3 residues of progranulin (QLL) abolishes its binding to sortilin and also sortilin dependent regulation of progranulin trafficking. Since progranulin haplo-insufficiency results in FTLD, these results may provide important insights into future studies of progranulin trafficking and signaling and progranulin based therapy for FTLD. PMID:21698296

  6. Biochemical Characterization of Mycobacterium smegmatis RnhC (MSMEG_4305), a Bifunctional Enzyme Composed of Autonomous N-Terminal Type I RNase H and C-Terminal Acid Phosphatase Domains.

    Science.gov (United States)

    Jacewicz, Agata; Shuman, Stewart

    2015-08-01

    Mycobacterium smegmatis encodes several DNA repair polymerases that are adept at incorporating ribonucleotides, which raises questions about how ribonucleotides in DNA are sensed and removed. RNase H enzymes, of which M. smegmatis encodes four, are strong candidates for a surveillance role. Here, we interrogate the biochemical activity and nucleic acid substrate specificity of M. smegmatis RnhC, a bifunctional RNase H and acid phosphatase. We report that (i) the RnhC nuclease is stringently specific for RNA:DNA hybrid duplexes; (ii) RnhC does not selectively recognize and cleave DNA-RNA or RNA-DNA junctions in duplex nucleic acid; (iii) RnhC cannot incise an embedded monoribonucleotide or diribonucleotide in duplex DNA; (iv) RnhC can incise tracts of 4 or more ribonucleotides embedded in duplex DNA, leaving two or more residual ribonucleotides at the cleaved 3'-OH end and at least one or two ribonucleotides on the 5'-PO4 end; (v) the RNase H activity is inherent in an autonomous 140-amino-acid (aa) N-terminal domain of RnhC; and (vi) the C-terminal 211-aa domain of RnhC is an autonomous acid phosphatase. The cleavage specificity of RnhC is clearly distinct from that of Escherichia coli RNase H2, which selectively incises at an RNA-DNA junction. Thus, we classify RnhC as a type I RNase H. The properties of RnhC are consistent with a role in Okazaki fragment RNA primer removal or in surveillance of oligoribonucleotide tracts embedded in DNA but not in excision repair of single misincorporated ribonucleotides. RNase H enzymes help cleanse the genome of ribonucleotides that are present either as ribotracts (e.g., RNA primers) or as single ribonucleotides embedded in duplex DNA. Mycobacterium smegmatis encodes four RNase H proteins, including RnhC, which is characterized in this study. The nucleic acid substrate and cleavage site specificities of RnhC are consistent with a role in initiating the removal of ribotracts but not in single-ribonucleotide surveillance. RnhC

  7. 21 CFR 640.56 - Quality control test for potency.

    Science.gov (United States)

    2010-04-01

    ... quality control test for potency may be performed by a clinical laboratory which meets the standards of... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Quality control test for potency. 640.56 Section...) BIOLOGICS ADDITIONAL STANDARDS FOR HUMAN BLOOD AND BLOOD PRODUCTS Cryoprecipitate § 640.56 Quality control...

  8. The C-terminal region of the non-structural protein 2B from Hepatitis A Virus demonstrates lipid-specific viroporin-like activity

    Science.gov (United States)

    Shukla, Ashutosh; Dey, Debajit; Banerjee, Kamalika; Nain, Anshu; Banerjee, Manidipa

    2015-10-01

    Viroporins are virally encoded, membrane-active proteins, which enhance viral replication and assist in egress of viruses from host cells. The 2B proteins in the picornaviridae family are known to have viroporin-like properties, and play critical roles during virus replication. The 2B protein of Hepatitis A Virus (2B), an unusual picornavirus, is somewhat dissimilar from its analogues in several respects. HAV 2B is approximately 2.5 times the length of other 2B proteins, and does not disrupt calcium homeostasis or glycoprotein trafficking. Additionally, its membrane penetrating properties are not yet clearly established. Here we show that the membrane interacting activity of HAV 2B is localized in its C-terminal region, which contains an alpha-helical hairpin motif. We show that this region is capable of forming small pores in membranes and demonstrates lipid specific activity, which partially rationalizes the intracellular localization of full-length 2B. Using a combination of biochemical assays and molecular dynamics simulation studies, we also show that HAV 2B demonstrates a marked propensity to dimerize in a crowded environment, and probably interacts with membranes in a multimeric form, a hallmark of other picornavirus viroporins. In sum, our study clearly establishes HAV 2B as a bona fide viroporin in the picornaviridae family.

  9. Polycystin-1 C-terminal Cleavage Is Modulated by Polycystin-2 Expression*

    Science.gov (United States)

    Bertuccio, Claudia A.; Chapin, Hannah C.; Cai, Yiqiang; Mistry, Kavita; Chauvet, Veronique; Somlo, Stefan; Caplan, Michael J.

    2009-01-01

    Autosomal dominant polycystic kidney disease is caused by mutations in the genes encoding polycystin-1 (PC-1) and polycystin-2 (PC-2). PC-1 cleavage releases its cytoplasmic C-terminal tail (CTT), which enters the nucleus. To determine whether PC-1 CTT cleavage is influenced by PC-2, a quantitative cleavage assay was utilized, in which the DNA binding and activation domains of Gal4 and VP16, respectively, were appended to PC-1 downstream of its CTT domain (PKDgalvp). Cells cotransfected with the resultant PKDgalvp fusion protein and PC-2 showed an increase in luciferase activity and in CTT expression, indicating that the C-terminal tail of PC-1 is cleaved and enters the nucleus. To assess whether CTT cleavage depends upon Ca2+ signaling, cells transfected with PKDgalvp alone or together with PC-2 were incubated with several agents that alter intracellular Ca2+ concentrations. PC-2 enhancement of luciferase activity was not altered by any of these treatments. Using a series of PC-2 C-terminal truncated mutations, we identified a portion of the PC-2 protein that is required to stimulate PC-1 CTT accumulation. These data demonstrate that release of the CTT from PC-1 is influenced and stabilized by PC-2. This effect is independent of Ca2+ but is regulated by sequences contained within the PC-2 C-terminal tail, suggesting a mechanism through which PC-1 and PC-2 may modulate a novel signaling pathway. PMID:19491093

  10. C-terminal substitution of MDM2 interacting peptides modulates binding affinity by distinctive mechanisms.

    Directory of Open Access Journals (Sweden)

    Christopher J Brown

    Full Text Available The complex between the proteins MDM2 and p53 is a promising drug target for cancer therapy. The residues 19-26 of p53 have been biochemically and structurally demonstrated to be a most critical region to maintain the association of MDM2 and p53. Variation of the amino acid sequence in this range obviously alters the binding affinity. Surprisingly, suitable substitutions contiguous to this region of the p53 peptides can yield tightly binding peptides. The peptide variants may differ by a single residue that vary little in their structural conformations and yet are characterized by large differences in their binding affinities. In this study a systematic analysis into the role of single C-terminal mutations of a 12 residue fragment of the p53 transactivation domain (TD and an equivalent phage optimized peptide (12/1 were undertaken to elucidate their mechanistic and thermodynamic differences in interacting with the N-terminal of MDM2. The experimental results together with atomistically detailed dynamics simulations provide insight into the principles that govern peptide design protocols with regard to protein-protein interactions and peptidomimetic design.

  11. Expression, purification, crystallization and preliminary X-ray analysis of a C-terminal fragment of the Epstein–Barr virus ZEBRA protein

    Energy Technology Data Exchange (ETDEWEB)

    Morand, Patrice [European Molecular Biology Laboratory, Grenoble Outstation, BP 181, 38042 Grenoble CEDEX 9 (France); Laboratoire de Virologie Moléculaire et Structurale, EA 2939, Université Joseph Fourier, Grenoble (France); Budayova-Spano, Monika [European Molecular Biology Laboratory, Grenoble Outstation, BP 181, 38042 Grenoble CEDEX 9 (France); Perrissin, Monique [Laboratoire de Virologie Moléculaire et Structurale, EA 2939, Université Joseph Fourier, Grenoble (France); Müller, Christoph W., E-mail: mueller@embl-grenoble.fr; Petosa, Carlo [European Molecular Biology Laboratory, Grenoble Outstation, BP 181, 38042 Grenoble CEDEX 9 (France)

    2006-03-01

    A C-terminal fragment of the Epstein–Barr virus lytic switch protein ZEBRA has been crystallized in complex with DNA. A C-terminal fragment of the Epstein–Barr virus immediate-early transcription factor ZEBRA has been expressed as a recombinant protein in Escherichia coli and purified to homogeneity. The fragment behaves as a dimer in solution, consistent with the presence of a basic region leucine-zipper (bZIP) domain. Crystals of the fragment in complex with a DNA duplex were grown by the hanging-drop vapour-diffusion technique using polyethylene glycol 4000 and magnesium acetate as crystallization agents. Crystals diffract to better than 2.5 Å resolution using synchrotron radiation (λ = 0.976 Å). Crystals belong to space group C2, with unit-cell parameters a = 94.2, b = 26.5, c = 98.1 Å, β = 103.9°.

  12. Functional mechanism of C-terminal tail in the enzymatic role of porcine testicular carbonyl reductase: a combined experiment and molecular dynamics simulation study of the C-terminal tail in the enzymatic role of PTCR.

    Directory of Open Access Journals (Sweden)

    Minky Son

    Full Text Available Porcine testicular carbonyl reductase, PTCR which is one of the short chain dehydrogenases/reductases (SDR superfamily catalyzes the NADPH-dependent reduction of carbonyl compounds including steroids and prostaglandins. Previously we reported C-terminal tail of PTCR was deleted due to a nonsynonymous single nucleotide variation (nsSNV. Here we identified from kinetic studies that the enzymatic properties for 5α-dihydrotestosterone (5α-DHT were different between wild-type and C-terminal-deleted PTCRs. Compared to wild-type PTCR, C-terminal-deleted PTCR has much higher reduction rate. To investigate structural difference between wild-type and C-terminal-deleted PTCRs upon 5α-DHT binding, we performed molecular dynamics simulations for two complexes. Using trajectories, molecular interactions including hydrogen bonding patterns, distance between 5α-DHT and catalytic Tyr193, and interaction energies are analyzed and compared. During the MD simulation time, the dynamic behavior of C-terminal tail in wild-type PTCR is also examined using essential dynamics analysis. The results of our simulations reveal that the binding conformation of 5α-DHT in C-terminal-deleted PTCR is more favorable for reduction reaction in PTCR, which shows strong agreement with kinetic data. These structural findings provide valuable information to understand substrate specificity of PTCR and further kinetic properties of enzymes belonging to the SDR superfamily.

  13. Interaction between the C-terminal region of human myelin basic protein and calmodulin: analysis of complex formation and solution structure

    Directory of Open Access Journals (Sweden)

    Hayashi Nobuhiro

    2008-02-01

    Full Text Available Abstract Background The myelin sheath is a multilamellar membrane structure wrapped around the axon, enabling the saltatory conduction of nerve impulses in vertebrates. Myelin basic protein, one of the most abundant myelin-specific proteins, is an intrinsically disordered protein that has been shown to bind calmodulin. In this study, we focus on a 19-mer synthetic peptide from the predicted calmodulin-binding segment near the C-terminus of human myelin basic protein. Results The interaction of native human myelin basic protein with calmodulin was confirmed by affinity chromatography. The binding of the myelin basic protein peptide to calmodulin was tested with isothermal titration calorimetry (ITC in different temperatures, and Kd was observed to be in the low μM range, as previously observed for full-length myelin basic protein. Surface plasmon resonance showed that the peptide bound to calmodulin, and binding was accompanied by a conformational change; furthermore, gel filtration chromatography indicated a decrease in the hydrodynamic radius of calmodulin in the presence of the peptide. NMR spectroscopy was used to map the binding area to reside mainly within the hydrophobic pocket of the C-terminal lobe of calmodulin. The solution structure obtained by small-angle X-ray scattering indicates binding of the myelin basic protein peptide into the interlobal groove of calmodulin, while calmodulin remains in an extended conformation. Conclusion Taken together, our results give a detailed structural insight into the interaction of calmodulin with a C-terminal segment of a major myelin protein, the myelin basic protein. The used 19-mer peptide interacts mainly with the C-terminal lobe of calmodulin, and a conformational change accompanies binding, suggesting a novel mode of calmodulin-target protein interaction. Calmodulin does not collapse and wrap around the peptide tightly; instead, it remains in an extended conformation in the solution structure

  14. Multi-decadal marine- and land-terminating glacier recession in the Ammassalik region, southeast Greenland

    Directory of Open Access Journals (Sweden)

    S. H. Mernild

    2012-06-01

    Full Text Available Landsat imagery was applied to elucidate glacier fluctuations of land- and marine-terminating outlet glaciers from the Greenland Ice Sheet (GrIS and local land-terminating glaciers and ice caps (GIC peripheral to the GrIS in the Ammassalik region, Southeast Greenland, during the period 1972–2011. Data from 21 marine-terminating glaciers (including the glaciers Helheim, Midgaard, and Fenris, the GrIS land-terminating margin, and 35 GIC were examined and compared to observed atmospheric air temperatures, precipitation, and reconstructed ocean water temperatures (at 400 m depth in the Irminger Sea. Here, we document that net glacier recession has occurred since 1972 in the Ammassalik region for all glacier types and sizes, except for three GIC. The land-terminating GrIS and GIC reflect lower marginal and areal changes than the marine-terminating outlet glaciers. The mean annual land-terminating GrIS and GIC margin recessions were about three to five times lower than the GrIS marine-terminating recession. The marine-terminating outlet glaciers had an average net frontal retreat for 1999–2011 of 0.098 km yr−1, which was significantly higher than in previous sub-periods 1972–1986 and 1986–1999. For the marine-terminating GrIS, the annual areal recession rate has been decreasing since 1972, while increasing for the land-terminating GrIS since 1986. On average for all the observed GIC, a mean net frontal retreat for 1986–2011 of 0.010 ± 0.006 km yr−1 and a mean areal recession of around 1% per year occurred; overall for all observed GIC, a mean recession rate of 27 ± 24% occurred based on the 1986 GIC area. Since 1986, five GIC melted away in the Ammassalik area.

  15. A C-terminal segment of the V{sub 1}R vasopressin receptor is unstructured in the crystal structure of its chimera with the maltose-binding protein

    Energy Technology Data Exchange (ETDEWEB)

    Adikesavan, Nallini Vijayarangan; Mahmood, Syed Saad; Stanley, Nithianantham; Xu, Zhen; Wu, Nan [Department of Biochemistry, School of Medicine, Case Western Reserve University, 10900 Euclid Avenue, Cleveland, OH 44106-4935 (United States); Thibonnier, Marc [Department of Medicine, School of Medicine, Case Western Reserve University, 10900 Euclid Avenue, Cleveland, OH 44106-4935 (United States); Shoham, Menachem, E-mail: mxs10@case.edu [Department of Biochemistry, School of Medicine, Case Western Reserve University, 10900 Euclid Avenue, Cleveland, OH 44106-4935 (United States)

    2005-04-01

    The 1.8 Å crystal structure of an MBP-fusion protein with the C-terminal cytoplasmic segment of the V1 vasopressin receptor reveals that the receptor segment is unstructured. The V{sub 1} vascular vasopressin receptor (V{sub 1}R) is a G-protein-coupled receptor (GPCR) involved in the regulation of body-fluid osmolality, blood volume and blood pressure. Signal transduction is mediated by the third intracellular loop of this seven-transmembrane protein as well as by the C-terminal cytoplasmic segment. A chimera of the maltose-binding protein (MBP) and the C-terminal segment of V{sub 1}R has been cloned, expressed, purified and crystallized. The crystals belong to space group P2{sub 1}, with unit-cell parameters a = 51.10, b = 66.56, c = 115.72 Å, β = 95.99°. The 1.8 Å crystal structure reveals the conformation of MBP and part of the linker region of this chimera, with the C-terminal segment being unstructured. This may reflect a conformational plasticity in the C-terminal segment that may be necessary for proper function of V{sub 1}R.

  16. Olivetti M6 640

    CERN Multimedia

    1993-01-01

    The M6-640 is the highest performance personal computer workstation in the Suprema range with multimedia, document imaging and communications capabilities. It has a 90MHz Pentium processor with 256Kb of secondary cache. It can accommodate up to 128Mb RAM and supports hard disks of up to 1Gb through an IDE interface.

  17. Growth hormone receptor C-terminal domains required for growth hormone-induced intracellular free Ca2+ oscillations and gene transcription

    DEFF Research Database (Denmark)

    Billestrup, N; Bouchelouche, P; Allevato, G

    1995-01-01

    of varying frequency and amplitude. GH-induced transcription of the serine protease inhibitor 2.1 gene required the same C-terminal 52-amino acid domain of the receptor as for Ca2+ signaling. Mutation of the four proline residues in the conserved box 1 region of the GHR, which is responsible for binding...

  18. C-Terminal Fluorescent Labeling Impairs Functionality of DNA Mismatch Repair Proteins

    Science.gov (United States)

    Brieger, Angela; Plotz, Guido; Hinrichsen, Inga; Passmann, Sandra; Adam, Ronja; Zeuzem, Stefan

    2012-01-01

    The human DNA mismatch repair (MMR) process is crucial to maintain the integrity of the genome and requires many different proteins which interact perfectly and coordinated. Germline mutations in MMR genes are responsible for the development of the hereditary form of colorectal cancer called Lynch syndrome. Various mutations mainly in two MMR proteins, MLH1 and MSH2, have been identified so far, whereas 55% are detected within MLH1, the essential component of the heterodimer MutLα (MLH1 and PMS2). Most of those MLH1 variants are pathogenic but the relevance of missense mutations often remains unclear. Many different recombinant systems are applied to filter out disease-associated proteins whereby fluorescent tagged proteins are frequently used. However, dye labeling might have deleterious effects on MutLα's functionality. Therefore, we analyzed the consequences of N- and C-terminal fluorescent labeling on expression level, cellular localization and MMR activity of MutLα. Besides significant influence of GFP- or Red-fusion on protein expression we detected incorrect shuttling of single expressed C-terminal GFP-tagged PMS2 into the nucleus and found that C-terminal dye labeling impaired MMR function of MutLα. In contrast, N-terminal tagged MutLαs retained correct functionality and can be recommended both for the analysis of cellular localization and MMR efficiency. PMID:22348133

  19. C-terminal fluorescent labeling impairs functionality of DNA mismatch repair proteins.

    Directory of Open Access Journals (Sweden)

    Angela Brieger

    Full Text Available The human DNA mismatch repair (MMR process is crucial to maintain the integrity of the genome and requires many different proteins which interact perfectly and coordinated. Germline mutations in MMR genes are responsible for the development of the hereditary form of colorectal cancer called Lynch syndrome. Various mutations mainly in two MMR proteins, MLH1 and MSH2, have been identified so far, whereas 55% are detected within MLH1, the essential component of the heterodimer MutLα (MLH1 and PMS2. Most of those MLH1 variants are pathogenic but the relevance of missense mutations often remains unclear. Many different recombinant systems are applied to filter out disease-associated proteins whereby fluorescent tagged proteins are frequently used. However, dye labeling might have deleterious effects on MutLα's functionality. Therefore, we analyzed the consequences of N- and C-terminal fluorescent labeling on expression level, cellular localization and MMR activity of MutLα. Besides significant influence of GFP- or Red-fusion on protein expression we detected incorrect shuttling of single expressed C-terminal GFP-tagged PMS2 into the nucleus and found that C-terminal dye labeling impaired MMR function of MutLα. In contrast, N-terminal tagged MutLαs retained correct functionality and can be recommended both for the analysis of cellular localization and MMR efficiency.

  20. Development of a cysteine-deprived and C-terminally truncated GLP-1 receptor

    DEFF Research Database (Denmark)

    Underwood, Christina Rye; Knudsen, Lotte Bjerre; Garibay, Patrick W.

    2013-01-01

    The glucagon-like peptide-1 receptor (GLP-1R) belongs to family B of the G-protein coupled receptors (GPCRs), and has become a promising target for the treatment of type 2 diabetes. Here we describe the development and characterization of a fully functional cysteine-deprived and C......-terminally truncated GLP-1R. Single cysteines were initially substituted with alanine, and functionally redundant cysteines were subsequently changed simultaneously. Our results indicate that Cys174, Cys226, Cys296 and Cys403 are important for the GLP-1-mediated response, whereas Cys236, Cys329, Cys341, Cys347, Cys438...... that the membrane proximal part of the C-terminal is involved in receptor expression at the cell surface. The results show that seven cysteines and more than half of the C-terminal tail can be removed from GLP-1R without compromising GLP-1 binding or function....

  1. 21 CFR 314.640 - Promotional materials.

    Science.gov (United States)

    2010-04-01

    ... Efficacy Studies Are Not Ethical or Feasible § 314.640 Promotional materials. For drug products being... publication within 120 days following marketing approval. After 120 days following marketing approval, unless...

  2. A C-terminal fragment of fibulin-7 interacts with endothelial cells and inhibits their tube formation in culture.

    Science.gov (United States)

    de Vega, Susana; Suzuki, Nobuharu; Nonaka, Risa; Sasaki, Takako; Forcinito, Patricia; Arikawa-Hirasawa, Eri; Yamada, Yoshihiko

    2014-03-01

    We have previously demonstrated that fibulin-7 (Fbln7) is expressed in teeth by pre-odontoblast and odontoblast cells, localized in the basement membrane and dentin matrices, and is an adhesion molecule for dental mesenchyme cells and odontoblasts. Fbln7 is also expressed in blood vessels by endothelial cells. In this report, we show that a recombinant C-terminal Fbln7 fragment (Fbln7-C) bound to Human Umbilical Vein Endothelial Cells (HUVECs) but did not promote cell spreading and actin stress fiber formation. Fbln7-C binding to HUVECs induced integrin clustering at cell adhesion sites with other focal adhesion molecules, and sustained activation of FAK, p130Cas, and Rac1. In addition, RhoA activation was inhibited, thereby preventing HUVEC spreading. As endothelial cell spreading is an important step for angiogenesis, we examined the effect of Fbln7-C on angiogenesis using in vitro assays for endothelial cell tube formation and vessel sprouting from aortic rings. We found that Fbln7-C inhibited the HUVEC tube formation and the vessel sprouting in aortic ring assays. Our findings suggest potential anti-angiogenic activity of the Fbln7 C-terminal region. Published by Elsevier Inc.

  3. Feline tetherin is characterized by a short N-terminal region and is counteracted by the feline immunodeficiency virus envelope glycoprotein.

    Science.gov (United States)

    Celestino, Michele; Calistri, Arianna; Del Vecchio, Claudia; Salata, Cristiano; Chiuppesi, Flavia; Pistello, Mauro; Borsetti, Alessandra; Palù, Giorgio; Parolin, Cristina

    2012-06-01

    Tetherin (BST2) is the host cell factor that blocks the particle release of some enveloped viruses. Two putative feline tetherin proteins differing at the level of the N-terminal coding region have recently been described and tested for their antiviral activity. By cloning and comparing the two reported feline tetherins (called here cBST2(504) and cBST2*) and generating specific derivative mutants, this study provides evidence that feline tetherin has a shorter intracytoplasmic domain than those of other known homologues. The minimal tetherin promoter was identified and assayed for its ability to drive tetherin expression in an alpha interferon-inducible manner. We also demonstrated that cBST2(504) is able to dimerize, is localized at the cellular membrane, and impairs human immunodeficiency virus type 1 (HIV-1) particle release, regardless of the presence of the Vpu antagonist accessory protein. While cBST2(504) failed to restrict wild-type feline immunodeficiency virus (FIV) egress, FIV mutants, bearing a frameshift at the level of the envelope-encoding region, were potently blocked. The transient expression of the FIV envelope glycoprotein was able to rescue mutant particle release from feline tetherin-positive cells but did not antagonize human BST2 activity. Moreover, cBST2(504) was capable of specifically immunoprecipitating the FIV envelope glycoprotein. Finally, cBST2(504) also exerted its function on HIV-2 ROD10 and on the simian immunodeficiency virus SIVmac239. Taken together, these results show that feline tetherin does indeed have a short N-terminal region and that the FIV envelope glycoprotein is the predominant factor counteracting tetherin restriction.

  4. Structure discrimination for the C-terminal domain of Escherichia coli trigger factor in solution

    International Nuclear Information System (INIS)

    Yao Yong; Bhabha, Gira; Kroon, Gerard; Landes, Mindy; Dyson, H. Jane

    2008-01-01

    NMR measurements can give important information on solution structure, without the necessity for a full-scale solution structure determination. The C-terminal protein binding domain of the ribosome-associated chaperone protein trigger factor is composed of non-contiguous parts of the polypeptide chain, with an interpolated prolyl isomerase domain. A construct of the C-terminal domain of Escherichia coli trigger factor containing residues 113-149 and 247-432, joined by a Gly-Ser-Gly-Ser linker, is well folded and gives excellent NMR spectra in solution. We have used NMR measurements on this construct, and on a longer construct that includes the prolyl isomerase domain, to distinguish between two possible structures for the C-terminal domain of trigger factor, and to assess the behavior of the trigger factor C-terminal domain in solution. Two X-ray crystal structures, of intact trigger factor from E. coli (Ferbitz et al., Nature 431:590-596, 2004), and of a truncated trigger factor from Vibrio cholerae (Ludlam et al., Proc Natl Acad Sci USA 101:13436-13441, 2004) showed significant differences in the structure of the C-terminal domain, such that the two structures could not be superimposed. We show using NMR chemical shifts and long range nuclear Overhauser effects that the secondary and tertiary structure of the E. coli C-terminal domain in solution is consistent with the crystal structure of the E. coli trigger factor and not with the V. cholerae protein. Given the similarity of the amino acid sequences of the E. coli and V. cholerae proteins, it appears likely that the structure of the V. cholerae protein has been distorted as a result of truncation of a 44-amino acid segment at the C-terminus. Analysis of residual dipolar coupling measurements shows that the overall topology of the solution structure is completely inconsistent with both structures. Dynamics analysis of the C-terminal domain using T 1 , T 2 and heteronuclear NOE parameters show that the protein is

  5. 21 CFR 640.64 - Collection of blood for Source Plasma.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Collection of blood for Source Plasma. 640.64... (CONTINUED) BIOLOGICS ADDITIONAL STANDARDS FOR HUMAN BLOOD AND BLOOD PRODUCTS Source Plasma § 640.64 Collection of blood for Source Plasma. (a) Supervision. All blood for the collection of Source Plasma shall...

  6. Laser processing for bevel termination of high voltage pn junction in SiC

    International Nuclear Information System (INIS)

    Kubiak, A; Ruta, Ł; Rosowski, A; French, P

    2016-01-01

    Proper edge termination of the p-n junction in silicon carbide is a key requirement in the fabrication of discrete devices able to withstand high voltages in reverse polarization. Due to the hardness of SiC the creation of the bevel termination remains difficult using mechanical machining. The use of laser beam sources with medium wavelength (532 nm) gives new possibilities in the machining of the silicon carbide. The paper presents the fabrication of the bevel termination structure in SiC using a green DPSS laser equipped with scanner and dedicated rotating sample holder. Characterization of the resulting structures proves the high potential of the proposed approach. (paper)

  7. Discovery of new molecular entities able to strongly interfere with Hsp90 C-terminal domain.

    Science.gov (United States)

    Terracciano, Stefania; Russo, Alessandra; Chini, Maria G; Vaccaro, Maria C; Potenza, Marianna; Vassallo, Antonio; Riccio, Raffaele; Bifulco, Giuseppe; Bruno, Ines

    2018-01-26

    Heat shock protein 90 (Hsp90) is an ATP dependent molecular chaperone deeply involved in the complex network of cellular signaling governing some key functions, such as cell proliferation and survival, invasion and angiogenesis. Over the past years the N-terminal protein domain has been fully investigated as attractive strategy against cancer, but despite the many efforts lavished in the field, none of the N-terminal binders (termed "classical inhibitors"), currently in clinical trials, have yet successfully reached the market, because of the detrimental heat shock response (HSR) that showed to induce; thus, recently, the selective inhibition of Hsp90 C-terminal domain has powerfully emerged as a more promising alternative strategy for anti-cancer therapy, not eliciting this cell rescue cascade. However, the structural complexity of the target protein and, mostly, the lack of a co-crystal structure of C-terminal domain-ligand, essential to drive the identification of new hits, represent the largest hurdles in the development of new selective C-terminal inhibitors. Continuing our investigations on the identification of new anticancer drug candidates, by using an orthogonal screening approach, here we describe two new potent C-terminal inhibitors able to induce cancer cell death and a considerable down-regulation of Hsp90 client oncoproteins, without triggering the undesired heat shock response.

  8. 21 CFR 573.640 - Methyl esters of higher fatty acids.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Methyl esters of higher fatty acids. 573.640... ANIMALS Food Additive Listing § 573.640 Methyl esters of higher fatty acids. The food additive methyl esters of higher fatty acids may be safely used in animal feeds in accordance with the following...

  9. Conformational and functional analysis of the C-terminal globular head of the reovirus cell attachment protein.

    Science.gov (United States)

    Duncan, R; Horne, D; Strong, J E; Leone, G; Pon, R T; Yeung, M C; Lee, P W

    1991-06-01

    We have been investigating structure-function relationships in the reovirus cell attachment protein sigma 1 using various deletion mutants and protease analysis. In the present study, a series of deletion mutants were constructed which lacked 90, 44, 30, 12, or 4 amino acids from the C-terminus of the 455-amino acid-long reovirus type 3 (T3) sigma 1 protein. The full-length and truncated sigma 1 proteins were expressed in an in vitro transcription/translation system and assayed for L cell binding activity. It was found that the removal of as few as four amino acids from the C-terminus drastically affected the cell binding function of the sigma 1 protein. The C-terminal-truncated proteins were further characterized using trypsin, chymotrypsin, and monoclonal and polyclonal antibodies. Our results indicated that the C-terminal portions of the mutant proteins were misfolded, leading to a loss in cell binding function. The N-terminal fibrous tail of the proteins was unaffected by the deletions as was sigma 1 oligomerization, further illustrating the discrete structural and functional roles of the N- and C-terminal domains of sigma 1. In an attempt to identify smaller, functional peptides, full-length sigma 1 expressed in vitro was digested with trypsin and subsequently with chymotrypsin under various conditions. The results clearly demonstrated the highly stable nature of the C-terminal globular head of sigma 1, even when separated from the N-terminal fibrous tail. We concluded that: (1) the C-terminal globular head of sigma 1 exists as a compact, protease-resistant oligomeric structure; (2) an intact C-terminus is required for proper head folding and generation of the conformationally dependent cell binding domain.

  10. 40 CFR 415.640 - Applicability; description of the cadmium pigments and salts production subcategory.

    Science.gov (United States)

    2010-07-01

    ... cadmium pigments and salts production subcategory. 415.640 Section 415.640 Protection of Environment... POINT SOURCE CATEGORY Cadmium Pigments and Salts Production Subcategory § 415.640 Applicability; description of the cadmium pigments and salts production subcategory. The provisions of this subpart are...

  11. 45 CFR 640.5 - Responsibilities and procedures for preparation of an environmental impact statement.

    Science.gov (United States)

    2010-10-01

    ... an environmental impact statement. 640.5 Section 640.5 Public Welfare Regulations Relating to Public Welfare (Continued) NATIONAL SCIENCE FOUNDATION COMPLIANCE WITH THE NATIONAL ENVIRONMENTAL POLICY ACT § 640.5 Responsibilities and procedures for preparation of an environmental impact statement. (a) If...

  12. Submicroscopic duplication of the Wolf-Hirschhorn critical region with a 4p terminal deletion.

    Science.gov (United States)

    Roselló, M; Monfort, S; Orellana, C; Ferrer-Bolufer, I; Quiroga, R; Oltra, S; Martínez, F

    2009-01-01

    Chromosomal rearrangements in the short arm of chromosome 4 can result in 2 different clinical entities: Wolf-Hirschhorn syndrome (WHS), characterized by severe growth delay, mental retardation, microcephaly, 'Greek helmet' facies, and closure defects, or partial 4p trisomy, associated with multiple congenital anomalies, mental retardation, and facial dysmorphisms. We present clinical and laboratory findings in a patient who showed a small duplication in 4p16.3 associated with a subtle terminal deletion in the same chromosomal region. GTG-banding analyses, multiplex ligation-dependent probe amplification analyses, and studies by array-based comparative genomic hybridization were performed. The results of the analyses revealed a de novo 1.3 Mb deletion of the terminal 4p and a 1.1 Mb duplication in our patient, encompassing the WHS critical region. Interestingly, this unusual duplication/deletion rearrangement results in an intermediate phenotype that shares characteristics of the WHS and the 4p trisomy syndrome. The use of novel technologies in the genetic diagnosis leads to the description of new clinical syndromes; there is a growing list of microduplication syndromes. Therefore, we propose that overexpression of candidate genes in WHS (WHSC1, WHSC2 and LETM1) due to a duplication causes a clinical entity different to both the WHS and 4p trisomy syndrome. (c) 2009 S. Karger AG, Basel.

  13. Roles of N- and C-terminal domains in the ligand-binding properties of cytoglobin.

    Science.gov (United States)

    Hanai, Shumpei; Tsujino, Hirofumi; Yamashita, Taku; Torii, Ryo; Sawai, Hitomi; Shiro, Yoshitsugu; Oohora, Koji; Hayashi, Takashi; Uno, Tadayuki

    2018-02-01

    Cytoglobin (Cygb) is a member of the hexacoordinated globin protein family and is expressed ubiquitously in rat and human tissues. Although Cygb is reportedly upregulated under hypoxic conditions both in vivo and in vitro, suggesting a physiological function to protect cells under hypoxic/ischemic conditions by scavenging reactive oxygen species or by signal transduction, the mechanisms associated with this function have not been fully elucidated. Recent studies comparing Cygbs among several species suggest that mammalian Cygbs show a distinctly longer C-terminal domain potentially involved in unique physiological functions. In this study, we prepared human Cygb mutants (ΔC, ΔN, and ΔNC) with either one or both terminal domains truncated and investigated the enzymatic functions and structural features by spectroscopic methods. Evaluation of the superoxide-scavenging activity between Cygb variants showed that the ΔC and ΔNC mutants exhibited slightly higher activity involving superoxide scavenging as compared with wild-type Cygb. Subsequent experiments involving ligand titration, flash photolysis, and resonance Raman spectroscopic studies suggested that the truncation of the C- and N-terminal domains resulted in less effective to dissociation constants and binding rates for carbon monoxide, respectively. Furthermore, structural stability was assessed by guanidine hydrochloride and revealed that the C-terminal domain might play a vital role in improving structure, whereas the N-terminal domain did not exert a similar effect. These findings indicated that long terminal domains could be important not only in regulating enzymatic activity but also for structural stability, and that the domains might be relevant to other hypothesized physiological functions for Cygb. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Acute treatment with fluvoxamine elevates rat brain serotonin synthesis in some terminal regions: An autoradiographic study

    International Nuclear Information System (INIS)

    Muck-Seler, Dorotea; Pivac, Nela; Diksic, Mirko

    2012-01-01

    Introduction: A considerable body of evidence indicates the involvement of the neurotransmitter serotonin (5-HT) in the pathogenesis and treatment of depression. Methods: The acute effect of fluvoxamine, on 5-HT synthesis rates was investigated in rat brain regions, using α- 14 C-methyl-L-tryptophan as a tracer. Fluvoxamine (25 mg/kg) and saline (control) were injected intraperitoneally, one hour before the injection of the tracer (30 μCi). Results: There was no significant effect of fluvoxamine on plasma free tryptophan. After Benjamini–Hochberg False Discovery Rate correction, a significant decrease in the 5-HT synthesis rate in the fluvoxamine treated rats, was found in the raphe magnus (− 32%), but not in the median (− 14%) and dorsal (− 3%) raphe nuclei. In the regions with serotonergic axon terminals, significant increases in synthesis rates were observed in the dorsal (+ 41%) and ventral (+ 43%) hippocampus, visual (+ 38%), auditory (+ 65%) and parietal (+ 37%) cortex, and the substantia nigra pars compacta (+ 56%). There were no significant changes in the 5-HT synthesis rates in the median (+ 11%) and lateral (+ 24%) part of the caudate-putamen, nucleus accumbens (+ 5%), VTA (+ 16%) or frontal cortex (+ 6%). Conclusions: The data show that the acute administration of fluvoxamine affects 5-HT synthesis rates in a regionally specific pattern, with a general elevation of the synthesis in the terminal regions and a reduction in some cell body structures. The reasons for the regional specific effect of fluvoxamine on 5-HT synthesis are unclear, but may be mediated by the presynaptic serotonergic autoreceptors.

  15. Solution structure and DNA-binding properties of the C-terminal domain of UvrC from E.coli

    NARCIS (Netherlands)

    Singh, S.; Folkers, G.E.; Bonvin, A.M.J.J.; Boelens, R.; Wechselberger, R.W.; Niztayev, A.; Kaptein, R.

    2002-01-01

    The C-terminal domain of the UvrC protein (UvrC CTD) is essential for 5' incision in the prokaryotic nucleotide excision repair process. We have determined the three-dimensional structure of the UvrC CTD using heteronuclear NMR techniques. The structure shows two helix±hairpin±helix (HhH) motifs

  16. The 14-3-3 protein interacts directly with the C-terminal region of the plant plasma membrane H(+)-ATPase

    DEFF Research Database (Denmark)

    Jahn, T.; Fuglsang, A.T.; Olsson, A.

    1997-01-01

    Accumulating evidence suggests that 14-3-3 proteins are involved in the regulation of plant plasma membrane H(+)-ATPase activity. However, it is not known whether the 14-3-3 protein interacts directly or indirectly with the H(+)-ATPase. In this study, detergent-solubilized plasma membrane H...... plasma membrane H(+)-ATPase. We propose that the 14-3-3 protein is a natural ligand of the plasma membrane H(+)-ATPase, regulating proton pumping by displacing the C-terminal autoinhibitory domain of the H(+)-ATPase....

  17. Order through disorder: hyper-mobile C-terminal residues stabilize the folded state of a helical peptide. a molecular dynamics study.

    Directory of Open Access Journals (Sweden)

    Kalliopi K Patapati

    Full Text Available Conventional wisdom has it that the presence of disordered regions in the three-dimensional structures of polypeptides not only does not contribute significantly to the thermodynamic stability of their folded state, but, on the contrary, that the presence of disorder leads to a decrease of the corresponding proteins' stability. We have performed extensive 3.4 µs long folding simulations (in explicit solvent and with full electrostatics of an undecamer peptide of experimentally known helical structure, both with and without its disordered (four residue long C-terminal tail. Our simulations clearly indicate that the presence of the apparently disordered (in structural terms C-terminal tail, increases the thermodynamic stability of the peptide's folded (helical state. These results show that at least for the case of relatively short peptides, the interplay between thermodynamic stability and the apparent structural stability can be rather subtle, with even disordered regions contributing significantly to the stability of the folded state. Our results have clear implications for the understanding of peptide energetics and the design of foldable peptides.

  18. Structural investigation of a C-terminal EphA2 receptor mutant: Does mutation affect the structure and interaction properties of the Sam domain?

    Science.gov (United States)

    Mercurio, Flavia A; Costantini, Susan; Di Natale, Concetta; Pirone, Luciano; Guariniello, Stefano; Scognamiglio, Pasqualina L; Marasco, Daniela; Pedone, Emilia M; Leone, Marilisa

    2017-09-01

    Ephrin A2 receptor (EphA2) plays a key role in cancer, it is up-regulated in several types of tumors and the process of ligand-induced receptor endocytosis, followed by degradation, is considered as a potential path to diminish tumor malignancy. Protein modulators of this mechanism are recruited at the cytosolic Sterile alpha motif (Sam) domain of EphA2 (EphA2-Sam) through heterotypic Sam-Sam associations. These interactions engage the C-terminal helix of EphA2 and close loop regions (the so called End Helix side). In addition, several studies report on destabilizing mutations in EphA2 related to cataract formation and located in/or close to the Sam domain. Herein, we analyzed from a structural point of view, one of these mutants characterized by the insertion of a novel 39 residue long polypeptide at the C-terminus of EphA2-Sam. A 3D structural model was built by computational methods and revealed partial disorder in the acquired C-terminal tail and a few residues participating in an α-helix and two short β-strands. We investigated by CD and NMR studies the conformational properties in solution of two peptides encompassing the whole C-terminal tail and its predicted helical region, respectively. NMR binding experiments demonstrated that these peptides do not interact relevantly with either EphA2-Sam or its interactor Ship2-Sam. Molecular dynamics (MD) simulations further indicated that the EphA2 mutant could be represented only through a conformational ensemble and that the C-terminal tail should not largely wrap the EphA2-Sam End-Helix interface and affect binding to other Sam domains. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. 21 CFR 640.16 - Processing.

    Science.gov (United States)

    2010-04-01

    ... STANDARDS FOR HUMAN BLOOD AND BLOOD PRODUCTS Red Blood Cells § 640.16 Processing. (a) Separation. Within the timeframe specified in the directions for use for the blood collecting, processing, and storage system used, Red Blood Cells may be prepared either by centrifugation, done in a manner that will not tend to...

  20. Functional analysis of the NH{sub 2}-terminal hydrophobic region and BRICHOS domain of GKN1

    Energy Technology Data Exchange (ETDEWEB)

    Yoon, Jung Hwan; Choi, Yoo Jin; Choi, Won Suk; Nam, Suk Woo; Lee, Jung Young; Park, Won Sang, E-mail: wonsang@catholic.ac.kr

    2013-11-01

    Highlights: •NH{sub 2}-terminal and BRICHOS domain of GKN1 inhibited tumor cell growth. •NH{sub 2}-terminal and BRICHOS domain of GKN1 regulated cell cycle. •NH{sub 2}-terminal and BRICHOS domain of GKN1 inhibited epigenetic regulators. -- Abstract: Gastrokine 1 (GKN1) protects the gastric antral mucosa and promotes healing by facilitating restitution and proliferation after injury. GKN1 is down-regulated in Helicobacter pylori-infected gastric epithelial cells and loss of GKN1 expression is tightly associated with gastric carcinogenesis. However, the underlying mechanisms as a tumor suppressor are largely unknown. Presently, the hydrophobic region and BRICHOS domain of GKN1, pGKN1{sup D13N}, pGKN1{sup Δ68–199}, and pGKN1{sup Δ1–67,165–199} were shown to suppress gastric cancer cell growth and recapitulate GKN1 functions. As well, the hydrophobic region and BRICHOS domain of GKN1 had a synergistic anti-cancer effect with 5-FU on tumor cell growth, implying that the NH{sub 2}-terminal hydrophobic region and BRICHOS domain of GKN1 are sufficient for tumor suppression, thereby suggesting a therapeutic intervention for gastric cancer. Also, its domain inducing endogenous miR-185 directly targeted the epigenetic effectors DNMT1 and EZH2 in gastric cancer cells. Our results suggest that the NH{sub 2}-terminal hydrophobic region and BRICHOS domain of GKN1 are sufficient for its tumor suppressor activities.

  1. Distinctive functions of Syk N-terminal and C-terminal SH2 domains in the signaling cascade elicited by oxidative stress in B cells.

    Science.gov (United States)

    Ding, J; Takano, T; Hermann, P; Gao, S; Han, W; Noda, C; Yanagi, S; Yamamura, H

    2000-05-01

    Syk plays a crucial role in the transduction of oxidative stress signaling. In this paper, we investigated the roles of Src homology 2 (SH2) domains of Syk in oxidative stress signaling, using Syk-negative DT40 cells expressing the N- or C-terminal SH2 domain mutant [mSH2(N) or mSH2(C)] of Syk. Tyrosine phosphorylation of Syk in cells expressing mSH2(N) Syk after H(2)O(2) treatment was higher than that in cells expressing wild-type Syk or mSH2(C) Syk. The tyrosine phosphorylation of wild-type Syk and mSH2(C) Syk, but not that of mSH2(N), was sensitive to PP2, a specific inhibitor of Src-family protein-tyrosine kinase. In oxidative stress, the C-terminal SH2 domain of Syk was demonstrated to be required for induction of tyrosine phosphorylation of cellular proteins, phospholipase C (PLC)-gamma2 phosphorylation, inositol 1,4, 5-triphosphate (IP(3)) generation, Ca(2)(+) release from intracellular stores, and c-Jun N-terminal kinase activation. In contrast, in mSH2(N) Syk-expressing cells, tyrosine phosphorylation of intracellular proteins including PLC-gamma2 was markedly induced in oxidative stress. The enhanced phosphorylation of mSH2(N) Syk and PLC-gamma2, however, did not link to Ca(2)(+) mobilization from intracellular pools and IP(3) generation. Thus, the N- and C-terminal SH2 domains of Syk possess distinctive functions in oxidative stress signaling.

  2. Forkhead Box C1 Regulates Human Primary Keratinocyte Terminal Differentiation.

    Directory of Open Access Journals (Sweden)

    Lianghua Bin

    Full Text Available The epidermis serves as a critical protective barrier between the internal and external environment of the human body. Its remarkable barrier function is established through the keratinocyte (KC terminal differentiation program. The transcription factors specifically regulating terminal differentiation remain largely unknown. Using a RNA-sequencing (RNA-seq profiling approach, we found that forkhead box c 1 (FOXC1 was significantly up-regulated in human normal primary KC during the course of differentiation. This observation was validated in human normal primary KC from several different donors and human skin biopsies. Silencing FOXC1 in human normal primary KC undergoing differentiation led to significant down-regulation of late terminal differentiation genes markers including epidermal differentiation complex genes, keratinization genes, sphingolipid/ceramide metabolic process genes and epidermal specific cell-cell adhesion genes. We further demonstrated that FOXC1 works down-stream of ZNF750 and KLF4, and upstream of GRHL3. Thus, this study defines FOXC1 as a regulator specific for KC terminal differentiation and establishes its potential position in the genetic regulatory network.

  3. Characterization of Staphylococcus aureus Primosomal DnaD Protein: Highly Conserved C-Terminal Region Is Crucial for ssDNA and PriA Helicase Binding but Not for DnaA Protein-Binding and Self-Tetramerization.

    Directory of Open Access Journals (Sweden)

    Yen-Hua Huang

    Full Text Available The role of DnaD in the recruitment of replicative helicase has been identified. However, knowledge of the DNA, PriA, and DnaA binding mechanism of this protein for the DnaA- and PriA-directed replication primosome assemblies is limited. We characterized the DNA-binding properties of DnaD from Staphylococcus aureus (SaDnaD and analyzed its interactions with SaPriA and SaDnaA. The gel filtration chromatography analysis of purified SaDnaD and its deletion mutant proteins (SaDnaD1-195, SaDnaD1-200 and SaDnaD1-204 showed a stable tetramer in solution. This finding indicates that the C-terminal region aa 196-228 is not crucial for SaDnaD oligomerization. SaDnaD forms distinct complexes with ssDNA of different lengths. In fluorescence titrations, SaDnaD bound to ssDNA with a binding-site size of approximately 32 nt. A stable complex of SaDnaD1-195, SaDnaD1-200, and SaDnaD1-204 with ssDNA dT40 was undetectable, indicating that the C-terminal region of SaDnaD (particularly aa 205-228 is crucial for ssDNA binding. The SPR results revealed that SaDnaD1-195 can interact with SaDnaA but not with SaPriA, which may indicate that DnaD has different binding sites for PriA and DnaA. Both SaDnaD and SaDnaDY176A mutant proteins, but not SaDnaD1-195, can significantly stimulate the ATPase activity of SaPriA. Hence, the stimulation effect mainly resulted from direct contact within the protein-protein interaction, not via the DNA-protein interaction. Kinetic studies revealed that the SaDnaD-SaPriA interaction increases the Vmax of the SaPriA ATPase fivefold without significantly affecting the Km. These results indicate that the conserved C-terminal region is crucial for ssDNA and PriA helicase binding, but not for DnaA protein-binding and self-tetramerization.

  4. Solution structure and dynamics of C-terminal regulatory domain of Vibrio vulnificus extracellular metalloprotease

    Energy Technology Data Exchange (ETDEWEB)

    Yun, Ji-Hye; Kim, Heeyoun [Department of Biochemistry, College of Life Science and Biotechnology, Yonsei University, Seoul 120-749 (Korea, Republic of); Park, Jung Eun [Department of Biotechnology, College of Natural Sciences, Chosun University, Gwangju 501-759 (Korea, Republic of); Lee, Jung Sup, E-mail: jsplee@mail.chosun.ac.kr [Department of Biotechnology, College of Natural Sciences, Chosun University, Gwangju 501-759 (Korea, Republic of); Lee, Weontae, E-mail: wlee@spin.yonsei.ac.kr [Department of Biochemistry, College of Life Science and Biotechnology, Yonsei University, Seoul 120-749 (Korea, Republic of)

    2013-01-11

    Highlights: Black-Right-Pointing-Pointer We have determined solution structures of vEP C-terminal regulatory domain. Black-Right-Pointing-Pointer vEP C-ter100 has a compact {beta}-barrel structure with eight anti-parallel {beta}-strands. Black-Right-Pointing-Pointer Solution structure of vEP C-ter100 shares its molecular topology with that of the collagen-binding domain of collagenase. Black-Right-Pointing-Pointer Residues in the {beta}3 region of vEP C-ter100 might be important in putative ligand/receptor binding. Black-Right-Pointing-Pointer vEP C-ter100 interacts strongly with iron ion. -- Abstract: An extracellular metalloprotease (vEP) secreted by Vibrio vulnificus ATCC29307 is a 45-kDa proteolytic enzyme that has prothrombin activation and fibrinolytic activities during bacterial infection. The action of vEP could result in clotting that could serve to protect the bacteria from the host defense machinery. Very recently, we showed that the C-terminal propeptide (C-ter100), which is unique to vEP, is involved in regulation of vEP activity. To understand the structural basis of this function of vEP C-ter100, we have determined the solution structure and backbone dynamics using multidimensional nuclear magnetic resonance spectroscopy. The solution structure shows that vEP C-ter100 is composed of eight anti-parallel {beta}-strands with a unique fold that has a compact {beta}-barrel formation which stabilized by hydrophobic and hydrogen bonding networks. Protein dynamics shows that the overall structure, including loops, is very rigid and stabilized. By structural database analysis, we found that vEP C-ter100 shares its topology with that of the collagen-binding domain of collagenase, despite low sequence homology between the two domains. Fluorescence assay reveals that vEP C-ter100 interacts strongly with iron (Fe{sup 3+}). These findings suggest that vEP protease might recruit substrate molecules, such as collagen, by binding at C-ter100 and that vEP participates

  5. Specific recognition of the C-terminal end of A beta 42 by a high affinity monoclonal antibody

    DEFF Research Database (Denmark)

    Axelsen, Trine Veje; Holm, Arne; Birkelund, Svend

    2009-01-01

    The neurotoxic peptide A beta(42) is derived from the amyloid precursor protein by proteolytic cleavage and is deposited in the brain of patients suffering from Alzheimer's disease (AD). In this study we generate a high affinity monoclonal antibody that targets the C-terminal end of A beta(42......) with high specificity. By this is meant that the paratope of the antibody must enclose the C-terminal end of A beta(42) including the carboxy-group of amino acid 42, and not just recognize a linear epitope in the C-terminal part of A beta. This has been accomplished by using a unique antigen construct made...... by the Ligand Presenting Assembly technology (LPA technology). This strategy results in dimeric presentation of the free C-terminal end of A beta(42). The generated Mab A beta1.1 is indeed specific for the C-terminal end of A beta(42) to which it binds with high affinity. Mab A beta1.1 recognizes the epitope...

  6. A Convenient Approach to Synthesizing Peptide C-Terminal N-Alkyl Amides

    Science.gov (United States)

    Fang, Wei-Jie; Yakovleva, Tatyana; Aldrich, Jane V.

    2014-01-01

    Peptide C-terminal N-alkyl amides have gained more attention over the past decade due to their biological properties, including improved pharmacokinetic and pharmacodynamic profiles. However, the synthesis of this type of peptide on solid phase by current available methods can be challenging. Here we report a convenient method to synthesize peptide C-terminal N-alkyl amides using the well-known Fukuyama N-alkylation reaction on a standard resin commonly used for the synthesis of peptide C-terminal primary amides, the PAL-PEG-PS (Peptide Amide Linker-polyethylene glycol-polystyrene) resin. The alkylation and oNBS deprotection were conducted under basic conditions and were therefore compatible with this acid labile resin. The alkylation reaction was very efficient on this resin with a number of different alkyl iodides or bromides, and the synthesis of model enkephalin N-alkyl amide analogs using this method gave consistently high yields and purities, demonstrating the applicability of this methodology. The synthesis of N-alkyl amides was more difficult on a Rink amide resin, especially the coupling of the first amino acid to the N-alkyl amine, resulting in lower yields for loading the first amino acid onto the resin. This method can be widely applied in the synthesis of peptide N-alkyl amides. PMID:22252422

  7. 21 CFR 640.72 - Records.

    Science.gov (United States)

    2010-04-01

    ... participation in the plasmapheresis program or for immunization. (4) The certification of the donor's good health as prescribed in § 640.63(b)(3). (5) If plasma that is reactive to a serologic test for syphilis... those units that are reactive. (b) Each donor record must be directly cross-referenced to the unit(s) of...

  8. High-resolution crystal structure reveals a HEPN domain at the C-terminal region of S. cerevisiae RNA endonuclease Swt1

    International Nuclear Information System (INIS)

    Peng, Shuxia; Zhou, Ke; Wang, Wenjia; Gao, Zengqiang; Dong, Yuhui; Liu, Quansheng

    2014-01-01

    Highlights: • Crystal structure of the C-terminal (CT) domain of Swt1 was determined at 2.3 Å. • Structure of the CT domain was identified as HEPN domain superfamily member. • Low-resolution envelope of Swt1 full-length in solution was analyzed by SAXS. • The middle and CT domains gave good fit to SAXS structural model. - Abstract: Swt1 is an RNA endonuclease that plays an important role in quality control of nuclear messenger ribonucleoprotein particles (mRNPs) in eukaryotes; however, its structural details remain to be elucidated. Here, we report the crystal structure of the C-terminal (CT) domain of Swt1 from Saccharomyces cerevisiae, which shares common characteristics of higher eukaryotes and prokaryotes nucleotide binding (HEPN) domain superfamily. To study in detail the full-length protein structure, we analyzed the low-resolution architecture of Swt1 in solution using small angle X-ray scattering (SAXS) method. Both the CT domain and middle domain exhibited a good fit upon superimposing onto the molecular envelope of Swt1. Our study provides the necessary structural information for detailed analysis of the functional role of Swt1, and its importance in the process of nuclear mRNP surveillance

  9. 31 CFR 19.640 - May a settlement include a voluntary exclusion?

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false May a settlement include a voluntary exclusion? 19.640 Section 19.640 Money and Finance: Treasury Office of the Secretary of the Treasury GOVERNMENTWIDE DEBARMENT AND SUSPENSION (NONPROCUREMENT) General Principles Relating to Suspension and Debarment...

  10. Stereoselective chlorothiolation of artemisinin-derived C-10 oxa terminal alkynes.

    Science.gov (United States)

    Surineni, Naresh; Buragohain, Pori; Barua, Nabin C

    2015-11-01

    A mild and efficient strategy is explored on the highly sensitive artemisinin-derived C-10 oxa terminal alkynes. Several novel artemisinin-derived (E)-2-chloroalkenyl sulfides (20) have been synthesized by using this protocol to study their anticancer activities.

  11. Occurrence of C-Terminal Residue Exclusion in Peptide Fragmentation by ESI and MALDI Tandem Mass Spectrometry

    Science.gov (United States)

    Dupré, Mathieu; Cantel, Sonia; Martinez, Jean; Enjalbal, Christine

    2012-02-01

    By screening a data set of 392 synthetic peptides MS/MS spectra, we found that a known C-terminal rearrangement was unexpectedly frequently occurring from monoprotonated molecular ions in both ESI and MALDI tandem mass spectrometry upon low and high energy collision activated dissociations with QqTOF and TOF/TOF mass analyzer configuration, respectively. Any residue localized at the C-terminal carboxylic acid end, even a basic one, was lost, provided that a basic amino acid such arginine and to a lesser extent histidine and lysine was present in the sequence leading to a fragment ion, usually depicted as (bn-1 + H2O) ion, corresponding to a shortened non-scrambled peptide chain. Far from being an epiphenomenon, such a residue exclusion from the peptide chain C-terminal extremity gave a fragment ion that was the base peak of the MS/MS spectrum in certain cases. Within the frame of the mobile proton model, the ionizing proton being sequestered onto the basic amino acid side chain, it is known that the charge directed fragmentation mechanism involved the C-terminal carboxylic acid function forming an anhydride intermediate structure. The same mechanism was also demonstrated from cationized peptides. To confirm such assessment, we have prepared some of the peptides that displayed such C-terminal residue exclusion as a C-terminal backbone amide. As expected in this peptide amide series, the production of truncated chains was completely suppressed. Besides, multiply charged molecular ions of all peptides recorded in ESI mass spectrometry did not undergo such fragmentation validating that any mobile ionizing proton will prevent such a competitive C-terminal backbone rearrangement. Among all well-known nondirect sequence fragment ions issued from non specific loss of neutral molecules (mainly H2O and NH3) and multiple backbone amide ruptures (b-type internal ions), the described C-terminal residue exclusion is highly identifiable giving raise to a single fragment ion in

  12. Osmostress induces autophosphorylation of Hog1 via a C-terminal regulatory region that is conserved in p38α.

    Directory of Open Access Journals (Sweden)

    Inbal Maayan

    Full Text Available Many protein kinases require phosphorylation at their activation loop for induction of catalysis. Mitogen-activated protein kinases (MAPKs are activated by a unique mode of phosphorylation, on neighboring Tyrosine and Threonine residues. Whereas many kinases obtain their activation via autophosphorylation, MAPKs are usually phosphorylated by specific, dedicated, MAPK kinases (MAP2Ks. Here we show however, that the yeast MAPK Hog1, known to be activated by the MAP2K Pbs2, is activated in pbs2Δ cells via an autophosphorylation activity that is induced by osmotic pressure. We mapped a novel domain at the Hog1 C-terminal region that inhibits this activity. Removal of this domain provides a Hog1 protein that is partially independent of MAP2K, namely, partially rescues osmostress sensitivity of pbs2Δ cells. We further mapped a short domain (7 amino acid residues long that is critical for induction of autophosphorylation. Its removal abolishes autophosphorylation, but maintains Pbs2-mediated phosphorylation. This 7 amino acids stretch is conserved in the human p38α. Similar to the case of Hog1, it's removal from p38α abolishes p38α's autophosphorylation capability, but maintains, although reduces, its activation by MKK6. This study joins a few recent reports to suggest that, like many protein kinases, MAPKs are also regulated via induced autoactivation.

  13. Osmostress induces autophosphorylation of Hog1 via a C-terminal regulatory region that is conserved in p38α.

    Science.gov (United States)

    Maayan, Inbal; Beenstock, Jonah; Marbach, Irit; Tabachnick, Shira; Livnah, Oded; Engelberg, David

    2012-01-01

    Many protein kinases require phosphorylation at their activation loop for induction of catalysis. Mitogen-activated protein kinases (MAPKs) are activated by a unique mode of phosphorylation, on neighboring Tyrosine and Threonine residues. Whereas many kinases obtain their activation via autophosphorylation, MAPKs are usually phosphorylated by specific, dedicated, MAPK kinases (MAP2Ks). Here we show however, that the yeast MAPK Hog1, known to be activated by the MAP2K Pbs2, is activated in pbs2Δ cells via an autophosphorylation activity that is induced by osmotic pressure. We mapped a novel domain at the Hog1 C-terminal region that inhibits this activity. Removal of this domain provides a Hog1 protein that is partially independent of MAP2K, namely, partially rescues osmostress sensitivity of pbs2Δ cells. We further mapped a short domain (7 amino acid residues long) that is critical for induction of autophosphorylation. Its removal abolishes autophosphorylation, but maintains Pbs2-mediated phosphorylation. This 7 amino acids stretch is conserved in the human p38α. Similar to the case of Hog1, it's removal from p38α abolishes p38α's autophosphorylation capability, but maintains, although reduces, its activation by MKK6. This study joins a few recent reports to suggest that, like many protein kinases, MAPKs are also regulated via induced autoactivation.

  14. c-jun-N-Terminal Kinase (JNK) for the Treatment of Amyotrophic Lateral Sclerosis

    Science.gov (United States)

    2015-03-01

    1 AWARD NUMBER: W81XWH-12-1-0431 TITLE: “c-jun-N-Terminal Kinase (JNK) for the Treatment of Amyotrophic Lateral Sclerosis ” PRINCIPAL...TITLE AND SUBTITLE “c-jun-N-Terminal Kinase (JNK) for the Treatment of Amyotrophic Lateral Scelerosis” 5a. CONTRACT NUMBER 5b. GRANT NUMBER... Lateral   Sclerosis ”   Final  Report:  Project  Period  Sept  2012-­‐Dec  2014     Personnel  List:     Feng,  Yangbo

  15. N-terminal region of gelsolin induces apoptosis of activated hepatic stellate cells by a caspase-dependent mechanism.

    Directory of Open Access Journals (Sweden)

    Budhaditya Mazumdar

    Full Text Available Activated hepatic stellate cells (HSCs are the major source for alteration of extracellular matrix in fibrosis and cirrhosis. Conditioned medium (CM collected from immortalized human hepatocytes (IHH have earlier been shown to be responsible for apoptosis of HSCs. In this study, we have shown that antibodies raised against a peptide derived from a linear B-cell epitope in the N-terminal region of gelsolin identified a gelsolin fragment in IHH CM. Analysis of activated stellate cell death by CM collected from Huh7 cells transfected with plasmids encoding gelsolin deletion mutants suggested that the N-terminal half of gelsolin contained sequences which were responsible for stellate cell death. Further analysis determined that this activity was restricted to a region encompassing amino acids 1-70 in the gelsolin sequence; antibody directed to an epitope within this region was able to neutralize stellate cell death. Gelsolin modulation of cell death using this fragment involved upregulation of TRAIL-R1 and TRAIL-R2, and involved caspase 3 activation by extrinsic pathway. The apoptotic activity of N-terminal gelsolin fragments was restricted to activated but not quiescent stellate cells indicating its potential application in therapeutic use as an anti-fibrotic agent. Gelsolin fragments encompassing N-terminal regions in polypeptides of different molecular sizes were detected by N-terminal peptide specific antiserum in IHH CM immunoprecipitated with chronically HCV infected patient sera, suggesting the presence of autoantibodies generated against N-terminal gelsolin fragments in patients with chronic liver disease.

  16. Substituting Both the N-Terminal and "Cord" Regions of a Xylanase from Aspergillus oryzae to Improve Its Temperature Characteristics.

    Science.gov (United States)

    Li, Chuang; Li, Jianfang; Wang, Rui; Li, Xueqing; Li, Jinping; Deng, Chao; Wu, Minchen

    2018-02-06

    To improve the temperature characteristics of AoXyn11A, a mesophilic glycoside hydrolase family (GHF) 11 xylanase from Aspergillus oryzae CICC40186, its N-terminal and "cord" regions were selected to be substituted by means of the computer-aided analysis and calculation. In brief, one mutant, named ATX11A 41 , possessing the lowest root-mean-square deviation (RMSD) value was designed based on the molecular dynamics (MD) simulation by substituting the N-terminal 41 amino acids of AoXyn11A with the corresponding 42 ones of pXYL11, a thermophilic GHF11 xylanase from Thermobifida fusca. On the basis of the primary structure alignment of pXYL11 with ATX11A 41 (or AoXyn11A), another mutant, named ATX11A 41/cord , was designed by substituting the cord region ( 93 GTYNPGSGG 101 ) of ATX11A 41 with the corresponding one ( 93 GTYRPTG 99 ) of pXYL11. Both mutant-encoding genes, ATx11A 41 and ATx11A 41/cord , were constructed as designed theoretically by a megaprimer PCR technique and were expressed in Pichia pastoris GS115. The specific activities of recombinant (re) AoXyn11A, ATX11A 41 , and ATX11A 41/cord were 2916.7, 2667.6, and 2457.0 U/mg, respectively. The analysis of temperature characteristics displayed that the temperature optimum (T opt ) of reATX11A 41 or reATX11A 41/cord was 65 °C, which was 15 °C higher than that of reAoXyn11A. The thermal inactivation half-life (t 1/2 ) values of reATX11A 41 and reATX11A 41/cord at 60 °C were 55 and 83 min, respectively, whereas that of reAoXyn11A was only 18 min at 50 °C. The melting temperature (T m ) values of reAoXyn11A, reATX11A 41 , and reATX11A 41/cord were 54.2, 66.7, and 71.9 °C, respectively. In conclusion, the above findings indicated that the substitution of both the N-terminal and cord regions of a mesophilic AoXyn11A greatly contributed to its improved temperature characteristics.

  17. Activation of human acid sphingomyelinase through modification or deletion of C-terminal cysteine.

    Science.gov (United States)

    Qiu, Huawei; Edmunds, Tim; Baker-Malcolm, Jennifer; Karey, Kenneth P; Estes, Scott; Schwarz, Cordula; Hughes, Heather; Van Patten, Scott M

    2003-08-29

    One form of Niemann-Pick disease is caused by a deficiency in the enzymatic activity of acid sphingomyelinase. During efforts to develop an enzyme replacement therapy based on a recombinant form of human acid sphingomyelinase (rhASM), purified preparations of the recombinant enzyme were found to have substantially increased specific activity if cell harvest media were stored for several weeks at -20 degrees C prior to purification. This increase in activity was found to correlate with the loss of the single free thiol on rhASM, suggesting the involvement of a cysteine residue. It was demonstrated that a variety of chemical modifications of the free cysteine on rhASM all result in substantial activation of the enzyme, and the modified cysteine responsible for this activation was shown to be the C-terminal residue (Cys629). Activation was also achieved by copper-promoted dimerization of rhASM (via cysteine) and by C-terminal truncation using carboxypeptidase Y. The role of the C-terminal cysteine in activation was confirmed by creating mutant forms of rhASM in which this residue was either deleted or replaced by a serine, with both forms having substantially higher specific activity than wild-type rhASM. These results indicate that purified rhASM can be activated in vitro by loss of the free thiol on the C-terminal cysteine via chemical modification, dimerization, or deletion of this amino acid residue. This method of activation is similar to the cysteine switch mechanism described previously for matrix metalloproteinases and could represent a means of posttranslational regulation of ASM activity in vivo.

  18. Cloning of cDNAs coding for the heavy chain region and connecting region of human factor V, a blood coagulation factor with four types of internal repeats

    International Nuclear Information System (INIS)

    Kane, W.H.; Ichinose, A.; Hagen, F.S.; Davie, E.W.

    1987-01-01

    Human factor V is a high molecular weight plasma glycoprotein that participates as a cofactor in the conversion of prothrombin to thrombin by factor X/sub a/. Prior to its participation in the coagulation cascade, factor V is converted to factor V/sub a/ by thrombin generating a heavy chain and a light chain, and these two chains are held together by calcium ions. A connecting region originally located between the heavy and light chains is liberated during the activation reaction. In a previous study, a cDNA of 2970 nucleotides that codes for the carboxyl-terminal 938 amino acids of factor V was isolated and characterized from a Hep G2 cDNA library. This cDNA has been used to obtain additional clones from Hep G2 and human liver cDNA libraries. Furthermore, a Hep G2 cDNA library prepared with an oligonucleotide from the 5' end of these cDNAs was screened to obtain overlapping cDNA clones that code for the amino-terminal region of the molecule. The composite sequence of these clones spans 6911 nucleotides and is consistent with the size of the factor V message present in Hep G2 cells (approximately 7 kilobases). The cDNA codes for a leader sequence of 28 amino acids and a mature protein of 2196 amino acids. The amino acid sequence predicted from the cDNA was in complete agreement with 139 amino acid residues that were identified by Edman degradation of cyanogen bromide peptides isolated from the heavy chain region and connecting region of plasma factor V. The domain structure of human factor V is similar to that previously reported for human coagulation factor VIII. Two types of tandem repeats (17 and 9 amino acids) have also been identified in the connecting region of factor V. The present data indicate that the amino acid sequence in the heavy and light chain regions of factor V is ∼ 40% identical with the corresponding regions of factor VIII

  19. Association of ω with the C-terminal region of β' subunit is essential for assembly of RNA polymerase in Mycobacterium tuberculosis.

    Science.gov (United States)

    Mao, Chunyou; Zhu, Yan; Lu, Pei; Feng, Lipeng; Chen, Shiyun; Hu, Yangbo

    2018-04-09

    The ω subunit is the smallest subunit of bacterial RNA polymerase (RNAP). Although homologs of ω are essential in both eukaryotes and archaea, this subunit has been known to be dispensable for RNAP in Escherichia coli ( Eco ) and in other bacteria. In this study, we characterized an indispensable role of the ω subunit in Mycobacterium tuberculosis ( Mtb ). Unlike the well-studied Eco RNAP, the Mtb RNAP core enzyme cannot be functionally assembled in the absence of the ω subunit. Importantly, substitution of Mtb ω with ω subunits from Eco or Thermus thermophiles ( Tth ) cannot restore the assembly of Mtb RNAP. Furthermore, by replacing different regions in Mtb ω with the corresponding regions from Eco ω, we found a non-conserved loop region in Mtb ω essential for its function in RNAP assembly. From RNAP structures, we noticed that the location of the C-terminal region of the β' subunit (β'CTD) in Mtb RNAP but not in Eco or Tth RNAP is close to the ω loop region. Deletion of this β'CTD in Mtb RNAP destabilized the binding of Mtb ω on RNAP and compromised Mtb core assembly, suggesting that these two regions may function together to play a role in ω-dependent RNAP assembly in Mtb Sequence alignment of the ω loop and the β'CTD regions suggests that the essential role of ω is probably restricted to mycobacteria. Together, our study characterized an essential role of Mtb ω and highlighted the importance of the ω loop region in Mtb RNAP assembly. Importance DNA-dependent RNA polymerase (RNAP), which is consisted of a multi-subunit core enzyme (α 2 ββ'ω) and a dissociable σ subunit, is the only enzyme in charge of transcription in bacteria. As the smallest subunit, the roles of ω remain the least well-studied. In Escherichia coli ( Eco ) and some other bacteria, the ω subunit is known to be non-essential for RNAP. In this study, we revealed an essential role of the ω subunit for RNAP assembly in the human pathogen Mycobacterium tuberculosis , and

  20. Characterization of C-terminally engineered laccases.

    Science.gov (United States)

    Liu, Yingli; Cusano, Angela Maria; Wallace, Erin C; Mekmouche, Yasmina; Ullah, Sana; Robert, Viviane; Tron, Thierry

    2014-08-01

    Extremities of proteins are potent sites for functionalization. Carboxy terminus variants of the Trametes sp. strain C30 LAC3 laccase were generated and produced in Saccharomyces cerevisiae. A variant deleted of the last 13 residues (CΔ) and its 6 His tagged counterpart (CΔ6H) were found active enzymes. The production of CΔ6H resulted in the synthesis of a unusually high proportion of highly glycosylated forms of the enzyme therefore allowing the additional purification of a hyper-glycosylated form of CΔ6H noted CΔ6Hh. Properties of CΔ, CΔ6H and CΔ6Hh were compared. Globally, LAC3 catalytic efficiency was moderately affected by terminal modifications except in CΔ for which the kcat/KM ratio decreased 4 fold (with syringaldazine as substrate) and 10 fold (with ABTS as substrate) respectively. The catalytic parameters kcat and KM of CΔ6H and CΔ6Hh were found to be strictly comparable revealing that over glycosylation does not affect the enzyme catalytic efficiency. To the contrary, in vitro deglycosylation of laccase drastically reduced its activity. So, despite a complex glycosylated pattern observed for some of the variant enzymes, terminal sequences of laccases appear to be appropriate sites for the functionalization/immobilization of laccase. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Experimental study on the 4H-SiC-based VDMOSFETs with lightly doped P-well field-limiting rings termination

    Science.gov (United States)

    He, Yan Jing; Lv, Hong Liang; Tang, Xiao Yan; Song, Qing Wen; Zhang, Yi Meng; Han, Chao; Zhang, Yi Men; Zhang, Yu Ming

    2017-03-01

    A lightly doped P-well field-limiting rings (FLRs) termination on 4H-SiC vertical double-implanted metal-oxide-semiconductor field-effect transistors (VDMOSFETs) has been investigated. Based on the simulation, the proposed termination applied to 4H-SiC VDMOSFET could achieve an almost same breakdown voltage (BV) and have the advantage of lower ion-implantation damage comparing with P+ FLRs termination. Meanwhile, this kind of termination also reduces the difficulty and consumption of fabrication process. 4H-SiC VDMOSFETs with lightly doped P-well (FLRs) termination have been fabricated on 10 μm thick epi-layer with nitrogen doping concentration of 6.2 × 1015 cm-3. The maximum breakdown voltage of the 4H-SiC VDMOSFETs has achieved as high as 1610 V at a current of 15 μA, which is very close to the simulated result of 1643 V and about 90% of the plane parallel breakdown voltage of 1780 V. It is considered that P-well FLRs termination is an effective, robust and process-tolerant termination structure suitable for 4H-SiC VDMOSFET.

  2. Docking Studies of Binding of Ethambutol to the C-Terminal Domain of the Arabinosyltransferase from Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    Guillermo Salgado-Moran

    2013-01-01

    Full Text Available The binding of ethambutol to the C-terminal domain of the arabinosyltransferase from Mycobacterium tuberculosis was studied. The analysis was performed using an in silico approach in order to find out, by docking calculations and energy descriptors, the conformer of Ethambutol that forms the most stable complex with the C-terminal domain of arabinosyltransferase. The complex shows that location of the Ethambutol coincides with the cocrystallization ligand position and that amino acid residues ASH1051, ASN740, ASP1052, and ARG1055 should be critical in the binding of Ethambutol to C-terminal domain EmbC.

  3. Three-dimensional structure of a Streptomyces sviceus GNAT acetyltransferase with similarity to the C-terminal domain of the human GH84 O-GlcNAcase

    International Nuclear Information System (INIS)

    He, Yuan; Roth, Christian; Turkenburg, Johan P.; Davies, Gideon J.

    2013-01-01

    The crystal structure of a bacterial acetyltransferase with 27% sequence identity to the C-terminal domain of human O-GlcNAcase has been solved at 1.5 Å resolution. This S. sviceus protein is compared with known GCN5-related acetyltransferases, adding to the diversity observed in this superfamily. The mammalian O-GlcNAc hydrolysing enzyme O-GlcNAcase (OGA) is a multi-domain protein with glycoside hydrolase activity in the N-terminus and with a C-terminal domain that has low sequence similarity to known acetyltransferases, prompting speculation, albeit controversial, that the C-terminal domain may function as a histone acetyltransferase (HAT). There are currently scarce data available regarding the structure and function of this C-terminal region. Here, a bacterial homologue of the human OGA C-terminal domain, an acetyltransferase protein (accession No. ZP-05014886) from Streptomyces sviceus (SsAT), was cloned and its crystal structure was solved to high resolution. The structure reveals a conserved protein core that has considerable structural homology to the acetyl-CoA (AcCoA) binding site of GCN5-related acetyltransferases (GNATs). Calorimetric data further confirm that SsAT is indeed able to bind AcCoA in solution with micromolar affinity. Detailed structural analysis provided insight into the binding of AcCoA. An acceptor-binding cavity was identified, indicating that the physiological substrate of SsAT may be a small molecule. Consistent with recently published work, the SsAT structure further questions a HAT function for the human OGA domain

  4. Three-dimensional structure of a Streptomyces sviceus GNAT acetyltransferase with similarity to the C-terminal domain of the human GH84 O-GlcNAcase

    Energy Technology Data Exchange (ETDEWEB)

    He, Yuan [Northwest University, Xi’an 710069 (China); The University of York, York YO10 5DD (United Kingdom); Roth, Christian; Turkenburg, Johan P.; Davies, Gideon J., E-mail: gideon.davies@york.ac.uk [The University of York, York YO10 5DD (United Kingdom); Northwest University, Xi’an 710069 (China)

    2014-01-01

    The crystal structure of a bacterial acetyltransferase with 27% sequence identity to the C-terminal domain of human O-GlcNAcase has been solved at 1.5 Å resolution. This S. sviceus protein is compared with known GCN5-related acetyltransferases, adding to the diversity observed in this superfamily. The mammalian O-GlcNAc hydrolysing enzyme O-GlcNAcase (OGA) is a multi-domain protein with glycoside hydrolase activity in the N-terminus and with a C-terminal domain that has low sequence similarity to known acetyltransferases, prompting speculation, albeit controversial, that the C-terminal domain may function as a histone acetyltransferase (HAT). There are currently scarce data available regarding the structure and function of this C-terminal region. Here, a bacterial homologue of the human OGA C-terminal domain, an acetyltransferase protein (accession No. ZP-05014886) from Streptomyces sviceus (SsAT), was cloned and its crystal structure was solved to high resolution. The structure reveals a conserved protein core that has considerable structural homology to the acetyl-CoA (AcCoA) binding site of GCN5-related acetyltransferases (GNATs). Calorimetric data further confirm that SsAT is indeed able to bind AcCoA in solution with micromolar affinity. Detailed structural analysis provided insight into the binding of AcCoA. An acceptor-binding cavity was identified, indicating that the physiological substrate of SsAT may be a small molecule. Consistent with recently published work, the SsAT structure further questions a HAT function for the human OGA domain.

  5. Highly potent antimicrobial peptides from N-terminal membrane-binding region of E. coli MreB.

    Science.gov (United States)

    Saikia, Karabi; Sravani, Yalavarthi Durga; Ramakrishnan, Vibin; Chaudhary, Nitin

    2017-02-23

    Microbial pathogenesis is a serious health concern. The threat escalates as the existing conventional antimicrobials are losing their efficacy against the evolving pathogens. Peptides hold promise to be developed into next-generation antibiotics. Antimicrobial peptides adopt amphipathic structures that could selectively bind to and disrupt the microbial membranes. Interaction of proteins with membranes is central to all living systems and we reasoned that the membrane-binding domains in microbial proteins could be developed into efficient antimicrobials. This is an interesting approach as self-like sequences could elude the microbial strategies of degrading the antimicrobial peptides, one of the mechanisms of showing resistance to antimicrobials. We selected the 9-residue-long membrane-binding region of E. coli MreB protein. The 9-residue peptide (C-terminal amide) and its N-terminal acetylated analog displayed broad-spectrum activity, killing Gram-negative bacteria, Gram-positive bacteria, and fungi. Extension with a tryptophan residue at the N-terminus drastically improved the activity of the peptides with lethal concentrations ≤10 μM against all the organisms tested. The tryptophan-extended peptides caused complete killing of C. albicans as well as gentamicin and methicillin resistant S. aureus at 5 μM concentration. Lipid-binding studies and electron microscopic analyses of the peptide-treated microbes suggest membrane disruption as the mechanism of killing.

  6. Interaction of C-terminal truncated human alphaA-crystallins with target proteins.

    Directory of Open Access Journals (Sweden)

    Anbarasu Kumarasamy

    2008-09-01

    Full Text Available Significant portion of alphaA-crystallin in human lenses exists as C-terminal residues cleaved at residues 172, 168, and 162. Chaperone activity, determined with alcohol dehydrogenase (ADH and betaL-crystallin as target proteins, was increased in alphaA(1-172 and decreased in alphaA(1-168 and alphaA(1-162. The purpose of this study was to show whether the absence of the C-terminal residues influences protein-protein interactions with target proteins.Our hypothesis is that the chaperone-target protein binding kinetics, otherwise termed subunit exchange rates, are expected to reflect the changes in chaperone activity. To study this, we have relied on fluorescence resonance energy transfer (FRET utilizing amine specific and cysteine specific fluorescent probes. The subunit exchange rate (k for ADH and alphaA(1-172 was nearly the same as that of ADH and alphaA-wt, alphaA(1-168 had lower and alphaA(1-162 had the lowest k values. When betaL-crystallin was used as the target protein, alphaA(1-172 had slightly higher k value than alphaA-wt and alphaA(1-168 and alphaA(1-162 had lower k values. As expected from earlier studies, the chaperone activity of alphaA(1-172 was slightly better than that of alphaA-wt, the chaperone activity of alphaA(1-168 was similar to that of alphaA-wt and alphaA(1-162 had substantially decreased chaperone activity.Cleavage of eleven C-terminal residues including Arg-163 and the C-terminal flexible arm significantly affects the interaction with target proteins. The predominantly hydrophilic flexible arm appears to be needed to keep the chaperone-target protein complex soluble.

  7. Crystal Structure of the Carboxy-Terminal Region of the Bacteriophage T4 Proximal Long Tail Fiber Protein Gp34

    Directory of Open Access Journals (Sweden)

    Meritxell Granell

    2017-06-01

    Full Text Available Long tail fibers of bacteriophage T4 are formed by proteins gp34, gp35, gp36, and gp37, with gp34 located at the phage-proximal end and gp37 at the phage-distal, receptor-binding end. We have solved the structure of the carboxy-terminal region of gp34, consisting of amino acids 894–1289, by single-wavelength anomalous diffraction and extended the structure to amino acids 744–1289 using data collected from crystals containing longer gp34-fragments. The structure reveals three repeats of a mixed α-β fibrous domain in residues 744 to 877. A triple-helical neck connects to an extended triple β-helix domain (amino acids 900–1127 punctuated by two β-prism domains. Next, a β-prism domain decorated with short helices and extended β-helices is present (residues 1146–1238, while the C-terminal end is capped with another short β-helical region and three β-hairpins. The structure provides insight into the stability of the fibrous gp34 protein.

  8. Lipopolysaccharide interactions of C-terminal peptides from human thrombin.

    Science.gov (United States)

    Singh, Shalini; Kalle, Martina; Papareddy, Praveen; Schmidtchen, Artur; Malmsten, Martin

    2013-05-13

    Interactions with bacterial lipopolysaccharide (LPS), both in aqueous solution and in lipid membranes, were investigated for a series of amphiphilic peptides derived from the C-terminal region of human thrombin, using ellipsometry, dual polarization interferometry, fluorescence spectroscopy, circular dichroism (CD), dynamic light scattering, and z-potential measurements. The ability of these peptides to block endotoxic effects caused by LPS, monitored through NO production in macrophages, was compared to peptide binding to LPS and its endotoxic component lipid A, and to size, charge, and secondary structure of peptide/LPS complexes. While the antiendotoxic peptide GKY25 (GKYGFYTHVFRLKKWIQKVIDQFGE) displayed significant binding to both LPS and lipid A, so did two control peptides with either selected D-amino acid substitutions or with maintained composition but scrambled sequence, both displaying strongly attenuated antiendotoxic effects. Hence, the extent of LPS or lipid A binding is not the sole discriminant for the antiendotoxic effect of these peptides. In contrast, helix formation in peptide/LPS complexes correlates to the antiendotoxic effect of these peptides and is potentially linked to this functionality. Preferential binding to LPS over lipid membrane was furthermore demonstrated for these peptides and preferential binding to the lipid A moiety within LPS inferred.

  9. Platinum-Catalyzed, Terminal-Selective C(sp(3))-H Oxidation of Aliphatic Amines.

    Science.gov (United States)

    Lee, Melissa; Sanford, Melanie S

    2015-10-14

    This Communication describes the terminal-selective, Pt-catalyzed C(sp(3))-H oxidation of aliphatic amines without the requirement for directing groups. CuCl2 is employed as a stoichiometric oxidant, and the reactions proceed in high yield at Pt loadings as low as 1 mol%. These transformations are conducted in the presence of sulfuric acid, which reacts with the amine substrates in situ to form ammonium salts. We propose that protonation of the amine serves at least three important roles: (i) it renders the substrates soluble in the aqueous reaction medium; (ii) it limits binding of the amine nitrogen to Pt or Cu; and (iii) it electronically deactivates the C-H bonds proximal to the nitrogen center. We demonstrate that this strategy is effective for the terminal-selective C(sp(3))-H oxidation of a variety of primary, secondary, and tertiary amines.

  10. Structure of the Escherichia coli RNA polymerase α subunit C-terminal domain

    International Nuclear Information System (INIS)

    Lara-González, Samuel; Birktoft, Jens J.; Lawson, Catherine L.

    2010-01-01

    The crystal structure of the dimethyllysine derivative of the E. coli RNA polymerase α subunit C-terminal domain is reported at 2.0 Å resolution. The α subunit C-terminal domain (αCTD) of RNA polymerase (RNAP) is a key element in transcription activation in Escherichia coli, possessing determinants responsible for the interaction of RNAP with DNA and with transcription factors. Here, the crystal structure of E. coli αCTD (α subunit residues 245–329) determined to 2.0 Å resolution is reported. Crystals were obtained after reductive methylation of the recombinantly expressed domain. The crystals belonged to space group P2 1 and possessed both pseudo-translational symmetry and pseudo-merohedral twinning. The refined coordinate model (R factor = 0.193, R free = 0.236) has improved geometry compared with prior lower resolution determinations of the αCTD structure [Jeon et al. (1995 ▶), Science, 270, 1495–1497; Benoff et al. (2002 ▶), Science, 297, 1562–1566]. An extensive dimerization interface formed primarily by N- and C-terminal residues is also observed. The new coordinates will facilitate the improved modeling of αCTD-containing multi-component complexes visualized at lower resolution using X-ray crystallography and electron-microscopy reconstruction

  11. Co-expression of the C-terminal domain of Yersinia enterocolitica ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Biosciences; Volume 40; Issue 1. Co-expression of the C-terminal domain of Yersinia enterocolitica invasin enhances the efficacy of classical swine-fever-vectored vaccine based on human adenovirus. Helin Li Pengbo Ning Zhi Lin Wulong Liang Kai Kang Lei He Yanming Zhang. Articles Volume ...

  12. C-terminal peptides of tissue factor pathway inhibitor are novel host defense molecules.

    Science.gov (United States)

    Papareddy, Praveen; Kalle, Martina; Kasetty, Gopinath; Mörgelin, Matthias; Rydengård, Victoria; Albiger, Barbara; Lundqvist, Katarina; Malmsten, Martin; Schmidtchen, Artur

    2010-09-03

    Tissue factor pathway inhibitor (TFPI) inhibits tissue factor-induced coagulation, but may, via its C terminus, also modulate cell surface, heparin, and lipopolysaccharide interactions as well as participate in growth inhibition. Here we show that C-terminal TFPI peptide sequences are antimicrobial against the gram-negative bacteria Escherichia coli and Pseudomonas aeruginosa, gram-positive Bacillus subtilis and Staphylococcus aureus, as well as the fungi Candida albicans and Candida parapsilosis. Fluorescence studies of peptide-treated bacteria, paired with analysis of peptide effects on liposomes, showed that the peptides exerted membrane-breaking effects similar to those seen for the "classic" human antimicrobial peptide LL-37. The killing of E. coli, but not P. aeruginosa, by the C-terminal peptide GGLIKTKRKRKKQRVKIAYEEIFVKNM (GGL27), was enhanced in human plasma and largely abolished in heat-inactivated plasma, a phenomenon linked to generation of antimicrobial C3a and activation of the classic pathway of complement activation. Furthermore, GGL27 displayed anti-endotoxic effects in vitro and in vivo in a mouse model of LPS shock. Importantly, TFPI was found to be expressed in the basal layers of normal epidermis, and was markedly up-regulated in acute skin wounds as well as wound edges of chronic leg ulcers. Furthermore, C-terminal fragments of TFPI were associated with bacteria present in human chronic leg ulcers. These findings suggest a new role for TFPI in cutaneous defense against infections.

  13. Comparison of Glutamate Turnover in Nerve Terminals and Brain Tissue During [1,6-13C2]Glucose Metabolism in Anesthetized Rats.

    Science.gov (United States)

    Patel, Anant B; Lai, James C K; Chowdhury, Golam I M; Rothman, Douglas L; Behar, Kevin L

    2017-01-01

    The 13 C turnover of neurotransmitter amino acids (glutamate, GABA and aspartate) were determined from extracts of forebrain nerve terminals and brain homogenate, and fronto-parietal cortex from anesthetized rats undergoing timed infusions of [1,6- 13 C 2 ]glucose or [2- 13 C]acetate. Nerve terminal 13 C fractional labeling of glutamate and aspartate was lower than those in whole cortical tissue at all times measured (up to 120 min), suggesting either the presence of a constant dilution flux from an unlabeled substrate or an unlabeled (effectively non-communicating on the measurement timescale) glutamate pool in the nerve terminals. Half times of 13 C labeling from [1,6- 13 C 2 ]glucose, as estimated by least squares exponential fitting to the time course data, were longer for nerve terminals (Glu C4 , 21.8 min; GABA C2 21.0 min) compared to cortical tissue (Glu C4 , 12.4 min; GABA C2 , 14.5 min), except for Asp C3 , which was similar (26.5 vs. 27.0 min). The slower turnover of glutamate in the nerve terminals (but not GABA) compared to the cortex may reflect selective effects of anesthesia on activity-dependent glucose use, which might be more pronounced in the terminals. The 13 C labeling ratio for glutamate-C4 from [2- 13 C]acetate over that of 13 C-glucose was twice as large in nerve terminals compared to cortex, suggesting that astroglial glutamine under the 13 C glucose infusion was the likely source of much of the nerve terminal dilution. The net replenishment of most of the nerve terminal amino acid pools occurs directly via trafficking of astroglial glutamine.

  14. Solution structure of the C-terminal X domain of the measles virus phosphoprotein and interaction with the intrinsically disordered C-terminal domain of the nucleoprotein.

    Science.gov (United States)

    Gely, Stéphane; Lowry, David F; Bernard, Cédric; Jensen, Malene R; Blackledge, Martin; Costanzo, Stéphanie; Bourhis, Jean-Marie; Darbon, Hervé; Daughdrill, Gary; Longhi, Sonia

    2010-01-01

    In this report, the solution structure of the nucleocapsid-binding domain of the measles virus phosphoprotein (XD, aa 459-507) is described. A dynamic description of the interaction between XD and the disordered C-terminal domain of the nucleocapsid protein, (N(TAIL), aa 401-525), is also presented. XD is an all alpha protein consisting of a three-helix bundle with an up-down-up arrangement of the helices. The solution structure of XD is very similar to the crystal structures of both the free and bound form of XD. One exception is the presence of a highly dynamic loop encompassing XD residues 489-491, which is involved in the embedding of the alpha-helical XD-binding region of N(TAIL). Secondary chemical shift values for full-length N(TAIL) were used to define the precise boundaries of a transient helical segment that coincides with the XD-binding domain, thus shedding light on the pre-recognition state of N(TAIL). Titration experiments with unlabeled XD showed that the transient alpha-helical conformation of N(TAIL) is stabilized upon binding. Lineshape analysis of NMR resonances revealed that residues 483-506 of N(TAIL) are in intermediate exchange with XD, while the 475-482 and 507-525 regions are in fast exchange. The N(TAIL) resonance behavior in the titration experiments is consistent with a complex binding model with more than two states.

  15. 46 CFR 53.12-1 - General (modifies HG-600 through HG-640).

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 2 2010-10-01 2010-10-01 false General (modifies HG-600 through HG-640). 53.12-1... HEATING BOILERS Instruments, Fittings, and Controls (Article 6) § 53.12-1 General (modifies HG-600 through HG-640). (a) The instruments, fittings and controls for heating boilers shall be as indicated in HG...

  16. De-bugging and maximizing plant cytochrome P450 production in Escherichia coli with C-terminal GFP fusions

    DEFF Research Database (Denmark)

    Christensen, Ulla; Vazquez Albacete, Dario; Søgaard, Karina Marie

    2017-01-01

    Cytochromes P450 (CYP) are attractive enzyme targets in biotechnology as they catalyze stereospecific C-hydroxylations of complex core skeletons at positions that typically are difficult to access by chemical synthesis. Membrane bound CYPs are involved in nearly all plant pathways leading......-type E. coli strains using standard growth media. Furthermore, sequences encoding a small synthetic peptide and a small bacterial membrane anchor markedly enhance the expression of all six genes. For one of the CYPs, the length of the linker region between the predicted N-terminal transmembrane segment...

  17. 50 CFR 640.21 - Harvest limitations.

    Science.gov (United States)

    2010-10-01

    ... § 640.21 Harvest limitations. (a) Berried lobsters. A berried (egg-bearing) spiny lobster or slipper...) Undersized attractants. A live spiny lobster under the minimum size limit specified in paragraph (b)(1) of... future use as an attractant in a trap provided it is held in a live well aboard the vessel. No more than...

  18. Synchronisation of palaeoenvironmental events in the North Atlantic region during the last termination

    DEFF Research Database (Denmark)

    Lowe, John J.; Rasmussen, Sune Olander; Björck, Svante

    2008-01-01

    The North Atlantic INTIMATE group of the INQUA Palaeoclimate Commission has previously recommended an Event Stratigraphy approach for the synchronisation of records of the Last Termination using the Greenland GRIP isotopic record as the regional stratotype and INTCAL98 for the calibration...

  19. Generation of the beta-amyloid peptide and the amyloid precursor protein C-terminal fragment gamma are potentiated by FE65L1.

    Science.gov (United States)

    Chang, Yang; Tesco, Giuseppina; Jeong, William J; Lindsley, Loren; Eckman, Elizabeth A; Eckman, Christopher B; Tanzi, Rudolph E; Guénette, Suzanne Y

    2003-12-19

    Members of the FE65 family of adaptor proteins, FE65, FE65L1, and FE65L2, bind the C-terminal region of the amyloid precursor protein (APP). Overexpression of FE65 and FE65L1 was previously reported to increase the levels of alpha-secretase-derived APP (APPs alpha). Increased beta-amyloid (A beta) generation was also observed in cells showing the FE65-dependent increase in APPs alpha. To understand the mechanism for the observed increase in both A beta and APPs alpha given that alpha-secretase cleavage of a single APP molecule precludes A beta generation, we examined the effects of FE65L1 overexpression on APP C-terminal fragments (APP CTFs). Our data show that FE65L1 potentiates gamma-secretase processing of APP CTFs, including the amyloidogenic CTF C99, accounting for the ability of FE65L1 to increase generation of APP C-terminal domain and A beta 40. The FE65L1 modulation of these processing events requires binding of FE65L1 to APP and APP CTFs and is not because of a direct effect on gamma-secretase activity, because Notch intracellular domain generation is not altered by FE65L1. Furthermore, enhanced APP CTF processing can be detected in early endosome vesicles but not in endoplasmic reticulum or Golgi membranes, suggesting that the effects of FE65L1 occur at or near the plasma membrane. Finally, although FE65L1 increases APP C-terminal domain production, it does not mediate the APP-dependent transcriptional activation observed with FE65.

  20. The N-terminal region of the dopamine D2 receptor, a rhodopsin-like GPCR, regulates correct integration into the plasma membrane and endocytic routes

    Science.gov (United States)

    Cho, DI; Min, C; Jung, KS; Cheong, SY; Zheng, M; Cheong, SJ; Oak, MH; Cheong, JH; Lee, BK; Kim, KM

    2012-01-01

    BACKGROUND AND PURPOSE Functional roles of the N-terminal region of rhodopsin-like GPCR family remain unclear. Using dopamine D2 and D3 receptors as a model system, we probed the roles of the N-terminal region in the signalling, intracellular trafficking of receptor proteins, and explored the critical factors that determine the functionality of the N-terminal region. EXPERIMENTAL APPROACH The N-terminal region of the D2 receptor was gradually shortened or switched with that of the D3 receptor or a non-specific sequence (FLAG), or potential N-terminal glycosylation sites were mutated. Effects of these manipulations on surface expression, internalization, post-endocytic behaviours and signalling were determined. KEY RESULTS Shortening the N-terminal region of the D2 receptor enhanced receptor internalization and impaired surface expression and signalling; ligand binding, desensitization and down-regulation were not affected but their association with a particular microdomain, caveolae, was disrupted. Replacement of critical residues within the N-terminal region with the FLAG epitope failed to restore surface expression but partially restored the altered internalization and signalling. When the N-terminal regions were switched between D2 and D3 receptors, cell surface expression pattern of each receptor was switched. Mutations of potential N-terminal glycosylation sites inhibited surface expression but enhanced internalization of D2 receptors. CONCLUSIONS AND IMPLICATIONS Shortening of N-terminus or mutation of glycosylation sites located within the N-terminus enhanced receptor internalization but impaired the surface expression of D2 receptors. The N-terminal region of the D2 receptor, in a sequence-specific manner, controls the receptor's conformation and integration into the plasma membrane, which determine its subcellular localization, intracellular trafficking and signalling properties. PMID:22117524

  1. Akt kinase C-terminal modifications control activation loop dephosphorylation and enhance insulin response.

    Science.gov (United States)

    Chan, Tung O; Zhang, Jin; Tiegs, Brian C; Blumhof, Brian; Yan, Linda; Keny, Nikhil; Penny, Morgan; Li, Xue; Pascal, John M; Armen, Roger S; Rodeck, Ulrich; Penn, Raymond B

    2015-10-01

    The Akt protein kinase, also known as protein kinase B, plays key roles in insulin receptor signalling and regulates cell growth, survival and metabolism. Recently, we described a mechanism to enhance Akt phosphorylation that restricts access of cellular phosphatases to the Akt activation loop (Thr(308) in Akt1 or protein kinase B isoform alpha) in an ATP-dependent manner. In the present paper, we describe a distinct mechanism to control Thr(308) dephosphorylation and thus Akt deactivation that depends on intramolecular interactions of Akt C-terminal sequences with its kinase domain. Modifications of amino acids surrounding the Akt1 C-terminal mTORC2 (mammalian target of rapamycin complex 2) phosphorylation site (Ser(473)) increased phosphatase resistance of the phosphorylated activation loop (pThr(308)) and amplified Akt phosphorylation. Furthermore, the phosphatase-resistant Akt was refractory to ceramide-dependent dephosphorylation and amplified insulin-dependent Thr(308) phosphorylation in a regulated fashion. Collectively, these results suggest that the Akt C-terminal hydrophobic groove is a target for the development of agents that enhance Akt phosphorylation by insulin. © 2015 Authors; published by Portland Press Limited.

  2. Solution structure of the c-terminal dimerization domain of SARS coronavirus nucleocapsid protein solved by the SAIL-NMR method.

    Science.gov (United States)

    Takeda, Mitsuhiro; Chang, Chung-ke; Ikeya, Teppei; Güntert, Peter; Chang, Yuan-hsiang; Hsu, Yen-lan; Huang, Tai-huang; Kainosho, Masatsune

    2008-07-18

    The C-terminal domain (CTD) of the severe acute respiratory syndrome coronavirus (SARS-CoV) nucleocapsid protein (NP) contains a potential RNA-binding region in its N-terminal portion and also serves as a dimerization domain by forming a homodimer with a molecular mass of 28 kDa. So far, the structure determination of the SARS-CoV NP CTD in solution has been impeded by the poor quality of NMR spectra, especially for aromatic resonances. We have recently developed the stereo-array isotope labeling (SAIL) method to overcome the size problem of NMR structure determination by utilizing a protein exclusively composed of stereo- and regio-specifically isotope-labeled amino acids. Here, we employed the SAIL method to determine the high-quality solution structure of the SARS-CoV NP CTD by NMR. The SAIL protein yielded less crowded and better resolved spectra than uniform (13)C and (15)N labeling, and enabled the homodimeric solution structure of this protein to be determined. The NMR structure is almost identical with the previously solved crystal structure, except for a disordered putative RNA-binding domain at the N-terminus. Studies of the chemical shift perturbations caused by the binding of single-stranded DNA and mutational analyses have identified the disordered region at the N-termini as the prime site for nucleic acid binding. In addition, residues in the beta-sheet region also showed significant perturbations. Mapping of the locations of these residues onto the helical model observed in the crystal revealed that these two regions are parts of the interior lining of the positively charged helical groove, supporting the hypothesis that the helical oligomer may form in solution.

  3. Peptidoglycan-associated outer membrane protein Mep45 of rumen anaerobe Selenomonas ruminantium forms a non-specific diffusion pore via its C-terminal transmembrane domain.

    Science.gov (United States)

    Kojima, Seiji; Hayashi, Kanako; Tochigi, Saeko; Kusano, Tomonobu; Kaneko, Jun; Kamio, Yoshiyuki

    2016-10-01

    The major outer membrane protein Mep45 of Selenomonas ruminantium, an anaerobic Gram-negative bacterium, comprises two distinct domains: the N-terminal S-layer homologous (SLH) domain that protrudes into the periplasm and binds to peptidoglycan, and the remaining C-terminal transmembrane domain, whose function has been unknown. Here, we solubilized and purified Mep45 and characterized its function using proteoliposomes reconstituted with Mep45. We found that Mep45 forms a nonspecific diffusion channel via its C-terminal region. The channel was permeable to solutes smaller than a molecular weight of roughly 600, and the estimated pore radius was 0.58 nm. Truncation of the SLH domain did not affect the channel property. On the basis of the fact that Mep45 is the most abundant outer membrane protein in S. ruminantium, we conclude that Mep45 serves as a main pathway through which small solutes diffuse across the outer membrane of this bacterium.

  4. Detection of reverse transcriptase termination sites using cDNA ligation and massive parallel sequencing

    DEFF Research Database (Denmark)

    Kielpinski, Lukasz J; Boyd, Mette; Sandelin, Albin

    2013-01-01

    Detection of reverse transcriptase termination sites is important in many different applications, such as structural probing of RNAs, rapid amplification of cDNA 5' ends (5' RACE), cap analysis of gene expression, and detection of RNA modifications and protein-RNA cross-links. The throughput...... of these methods can be increased by applying massive parallel sequencing technologies.Here, we describe a versatile method for detection of reverse transcriptase termination sites based on ligation of an adapter to the 3' end of cDNA with bacteriophage TS2126 RNA ligase (CircLigase™). In the following PCR...

  5. Molecular cloning and biologically active production of IpaD N-terminal region.

    Science.gov (United States)

    Hesaraki, Mahdi; Saadati, Mojtaba; Honari, Hossein; Olad, Gholamreza; Heiat, Mohammad; Malaei, Fatemeh; Ranjbar, Reza

    2013-07-01

    Shigella is known as pathogenic intestinal bacteria in high dispersion and pathogenic bacteria due to invasive plasmid antigen (Ipa). So far, a number of Ipa proteins have been studied to introduce a new candidate vaccine. Here, for the first time, we examined whether the N-terminal region of IpaD(72-162) could be a proper candidate for Shigella vaccine. Initially, the DNA sequence coding N-terminal region was isolated by PCR from Shigella dysenteriae type I and cloned into pET-28a expression vector. Then, the heterologous protein was expressed, optimized and purified by affinity Ni-NTA column. Western blot analysis using, His-tag and IpaD(72-162) polyclonal antibodies, confirmed the purity and specificity of the recombinant protein, respectively. Subsequently, the high immunogenicity of the antigen was shown by ELISA. The results of the sereny test in Guinea pigs showed that IpaD(72-162) provides a protective system against Shigella flexneri 5a and S. dysenteriae type I. Copyright © 2013. Published by Elsevier Ltd.

  6. 21 CFR 640.4 - Collection of the blood.

    Science.gov (United States)

    2010-04-01

    ... manual of standard procedures and methods, approved by the Director of the Center for Biologics... whose identity shall be established to the extent necessary for compliance with § 640.3. (f) Prevention...

  7. C-terminal BRE overexpression in 11q23-rearranged and t(8;16) acute myeloid leukemia is caused by intragenic transcription initiation.

    Science.gov (United States)

    Marneth, A E; Prange, K H M; Al Hinai, A S A; Bergevoet, S M; Tesi, N; Janssen-Megens, E M; Kim, B; Sharifi, N; Yaspo, M L; Kuster, J; Sanders, M A; Stoetman, E C G; Knijnenburg, J; Arentsen-Peters, T C J M; Zwaan, C M; Stunnenberg, H G; van den Heuvel-Eibrink, M M; Haferlach, T; Fornerod, M; Jansen, J H; Valk, P J M; van der Reijden, B A; Martens, J H A

    2018-03-01

    Overexpression of the BRE (brain and reproductive organ-expressed) gene defines a distinct pediatric and adult acute myeloid leukemia (AML) subgroup. Here we identify a promoter enriched for active chromatin marks in BRE intron 4 causing strong biallelic expression of a previously unknown C-terminal BRE transcript. This transcript starts with BRE intron 4 sequences spliced to exon 5 and downstream sequences, and if translated might code for an N terminally truncated BRE protein. Remarkably, the new BRE transcript was highly expressed in over 50% of 11q23/KMT2A (lysine methyl transferase 2A)-rearranged and t(8;16)/KAT6A-CREBBP cases, while it was virtually absent from other AML subsets and normal tissues. In gene reporter assays, the leukemia-specific fusion protein KMT2A-MLLT3 transactivated the intragenic BRE promoter. Further epigenome analyses revealed 97 additional intragenic promoter marks frequently bound by KMT2A in AML with C-terminal BRE expression. The corresponding genes may be part of a context-dependent KMT2A-MLLT3-driven oncogenic program, because they were higher expressed in this AML subtype compared with other groups. C-terminal BRE might be an important contributor to this program because in a case with relapsed AML, we observed an ins(11;2) fusing CHORDC1 to BRE at the region where intragenic transcription starts in KMT2A-rearranged and KAT6A-CREBBP AML.

  8. Nonlinear dynamics of C-terminal tails in cellular microtubules

    Science.gov (United States)

    Sekulic, Dalibor L.; Sataric, Bogdan M.; Zdravkovic, Slobodan; Bugay, Aleksandr N.; Sataric, Miljko V.

    2016-07-01

    The mechanical and electrical properties, and information processing capabilities of microtubules are the permanent subject of interest for carrying out experiments in vitro and in silico, as well as for theoretical attempts to elucidate the underlying processes. In this paper, we developed a new model of the mechano-electrical waves elicited in the rows of very flexible C-terminal tails which decorate the outer surface of each microtubule. The fact that C-terminal tails play very diverse roles in many cellular functions, such as recruitment of motor proteins and microtubule-associated proteins, motivated us to consider their collective dynamics as the source of localized waves aimed for communication between microtubule and associated proteins. Our approach is based on the ferroelectric liquid crystal model and it leads to the effective asymmetric double-well potential which brings about the conditions for the appearance of kink-waves conducted by intrinsic electric fields embedded in microtubules. These kinks can serve as the signals for control and regulation of intracellular traffic along microtubules performed by processive motions of motor proteins, primarly from kinesin and dynein families. On the other hand, they can be precursors for initiation of dynamical instability of microtubules by recruiting the proper proteins responsible for the depolymerization process.

  9. Structure of the N-terminal region of Haemophilus Influenzae HI0017: Implications for function

    International Nuclear Information System (INIS)

    Yu Liping; Mack, Jamey; Hajduk, Phil; Fesik, Stephen W.

    2001-01-01

    Haemophilus influenzae is a gram-negative pathogen that causes infections ranging from asymptomatic colonization of the human upper respiratory tract to serious invasive diseases such as meningitis. Although the genome of Haemophilus influenzae has been completely sequenced, the structure and function of many of these proteins are unknown. HI0017 is one of these uncharacterized proteins. Here we describe the three-dimensional solution structure of the N-terminal portion of HI0017 as determined by NMR spectroscopy. The structure consists of a five-stranded antiparallel β-sheet and two short α-helices. It is similar to the C-terminal domain of Diphtheria toxin repressor (DtxR). The C-terminal portion of HI0017 has an amino acid sequence that closely resembles pyruvate formate-lyase - an enzyme that converts pyruvate and CoA into acetyl-CoA and formate by a radical mechanism. Based on structural and sequence comparisons, we propose that the C-terminus of HI0017 functions as an enzyme with a glycyl radical mechanism, while the N-terminus participates in protein/protein interactions involving an activase (iron-sulfur protein) and/or the substrate

  10. Structure of the N-terminal region of Haemophilus Influenzae HI0017: Implications for function

    Energy Technology Data Exchange (ETDEWEB)

    Yu Liping; Mack, Jamey; Hajduk, Phil; Fesik, Stephen W. [Abbott Laboratories, Pharmaceutical Discovery Division, D46Y, AP10/LL (United States)

    2001-06-15

    Haemophilus influenzae is a gram-negative pathogen that causes infections ranging from asymptomatic colonization of the human upper respiratory tract to serious invasive diseases such as meningitis. Although the genome of Haemophilus influenzae has been completely sequenced, the structure and function of many of these proteins are unknown. HI0017 is one of these uncharacterized proteins. Here we describe the three-dimensional solution structure of the N-terminal portion of HI0017 as determined by NMR spectroscopy. The structure consists of a five-stranded antiparallel {beta}-sheet and two short {alpha}-helices. It is similar to the C-terminal domain of Diphtheria toxin repressor (DtxR). The C-terminal portion of HI0017 has an amino acid sequence that closely resembles pyruvate formate-lyase - an enzyme that converts pyruvate and CoA into acetyl-CoA and formate by a radical mechanism. Based on structural and sequence comparisons, we propose that the C-terminus of HI0017 functions as an enzyme with a glycyl radical mechanism, while the N-terminus participates in protein/protein interactions involving an activase (iron-sulfur protein) and/or the substrate.

  11. Uranyl Photocleavage of Phosphopeptides Yields Truncated C-Terminally Amidated Peptide Products

    DEFF Research Database (Denmark)

    Elnegaard, Rasmus L B; Møllegaard, Niels Erik; Zhang, Qiang

    2017-01-01

    photocleavage reaction of a tetraphosphorylated β-casein model peptide. We show that the primary photocleavage products of the uranyl-catalysed reaction are C-terminally amidated. This could be of great interest to the pharmaceutical industry, as efficient peptide amidation reactions are one of the top...

  12. Role of the Cationic C-Terminal Segment of Melittin on Membrane Fragmentation.

    Science.gov (United States)

    Therrien, Alexandre; Fournier, Alain; Lafleur, Michel

    2016-05-05

    The widespread distribution of cationic antimicrobial peptides capable of membrane fragmentation in nature underlines their importance to living organisms. In the present work, we determined the impact of the electrostatic interactions associated with the cationic C-terminal segment of melittin, a 26-amino acid peptide from bee venom (net charge +6), on its binding to model membranes and on the resulting fragmentation. In order to detail the role played by the C-terminal charges, we prepared a melittin analogue for which the four cationic amino acids in positions 21-24 were substituted with the polar residue citrulline, providing a peptide with the same length and amphiphilicity but with a lower net charge (+2). We compared the peptide bilayer affinity and the membrane fragmentation for bilayers prepared from 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC)/1,2-dipalmitoyl-sn-glycero-3-phospho-l-serine (DPPS) mixtures. It is shown that neutralization of the C-terminal considerably increased melittin affinity for zwitterionic membranes. The unfavorable contribution associated with transferring the cationic C-terminal in a less polar environment was reduced, leaving the hydrophobic interactions, which drive the peptide insertion in bilayers, with limited counterbalancing interactions. The presence of negatively charged lipids (DPPS) in bilayers increased melittin binding by introducing attractive electrostatic interactions, the augmentation being, as expected, greater for native melittin than for its citrullinated analogue. The membrane fragmentation power of the peptide was shown to be controlled by electrostatic interactions and could be modulated by the charge carried by both the membrane and the lytic peptide. The analysis of the lipid composition of the extracted fragments from DPPC/DPPS bilayers revealed no lipid specificity. It is proposed that extended phase separations are more susceptible to lead to the extraction of a lipid species in a specific manner

  13. 13 CFR 107.640 - Requirement to file Portfolio Financing Reports (SBA Form 1031).

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Requirement to file Portfolio Financing Reports (SBA Form 1031). 107.640 Section 107.640 Business Credit and Assistance SMALL BUSINESS... (SBA Form 1031). For each Financing of a Small Business (excluding guarantees), you must submit a...

  14. 13 CFR 108.640 - Requirement to file portfolio financing reports (SBA Form 1031).

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Requirement to file portfolio financing reports (SBA Form 1031). 108.640 Section 108.640 Business Credit and Assistance SMALL BUSINESS... portfolio financing reports (SBA Form 1031). For each Financing you make (excluding guarantees), you must...

  15. Quasifree knockout of proton pairs from carbon with 640 MeV protons

    International Nuclear Information System (INIS)

    Komarov, V.I.; Kosarev, G.I.; Netzband, D.; Mueller, H.; Stiehler, T.; Tesch, S.

    1980-10-01

    The direct nuclear reaction C(p,3p) at 640 MeV has been investigated in an exclusive type of experiment using scintillation counter technique. The measuring conditions have been selected according to the kinematics of quasi-free two-nucleon knockout at large momentum transfer. A phenomenological model is discussed, which is capable of describing qualitatively the dependence of the differential cross section on the opening angle of the forward emitted proton pair as well as on the energy of backward going protons. (author)

  16. The C-Terminal Domain of Cernunnos/XLF Is Dispensable for DNA Repair In Vivo▿ †

    Science.gov (United States)

    Malivert, Laurent; Callebaut, Isabelle; Rivera-Munoz, Paola; Fischer, Alain; Mornon, Jean-Paul; Revy, Patrick; de Villartay, Jean-Pierre

    2009-01-01

    The core nonhomologous end-joining DNA repair pathway is composed of seven factors: Ku70, Ku80, DNA-PKcs, Artemis, XRCC4 (X4), DNA ligase IV (L4), and Cernunnos/XLF (Cernunnos). Although Cernunnos and X4 are structurally related and participate in the same complex together with L4, they have distinct functions during DNA repair. L4 relies on X4 but not on Cernunnos for its stability, and L4 is required for optimal interaction of Cernunnos with X4. We demonstrate here, using in vitro-generated Cernunnos mutants and a series of functional assays in vivo, that the C-terminal region of Cernunnos is dispensable for its activity during DNA repair. PMID:19103754

  17. C-terminal motif prediction in eukaryotic proteomes using comparative genomics and statistical over-representation across protein families

    Directory of Open Access Journals (Sweden)

    Cutler Sean R

    2007-06-01

    Full Text Available Abstract Background The carboxy termini of proteins are a frequent site of activity for a variety of biologically important functions, ranging from post-translational modification to protein targeting. Several short peptide motifs involved in protein sorting roles and dependent upon their proximity to the C-terminus for proper function have already been characterized. As a limited number of such motifs have been identified, the potential exists for genome-wide statistical analysis and comparative genomics to reveal novel peptide signatures functioning in a C-terminal dependent manner. We have applied a novel methodology to the prediction of C-terminal-anchored peptide motifs involving a simple z-statistic and several techniques for improving the signal-to-noise ratio. Results We examined the statistical over-representation of position-specific C-terminal tripeptides in 7 eukaryotic proteomes. Sequence randomization models and simple-sequence masking were applied to the successful reduction of background noise. Similarly, as C-terminal homology among members of large protein families may artificially inflate tripeptide counts in an irrelevant and obfuscating manner, gene-family clustering was performed prior to the analysis in order to assess tripeptide over-representation across protein families as opposed to across all proteins. Finally, comparative genomics was used to identify tripeptides significantly occurring in multiple species. This approach has been able to predict, to our knowledge, all C-terminally anchored targeting motifs present in the literature. These include the PTS1 peroxisomal targeting signal (SKL*, the ER-retention signal (K/HDEL*, the ER-retrieval signal for membrane bound proteins (KKxx*, the prenylation signal (CC* and the CaaX box prenylation motif. In addition to a high statistical over-representation of these known motifs, a collection of significant tripeptides with a high propensity for biological function exists

  18. An N-terminal Region of Mot-2 Binds to p53 In Vitro

    Directory of Open Access Journals (Sweden)

    Sunil C. Kaul

    2001-01-01

    Full Text Available The mouse mot-2 protein was earlier shown to bind to the tumor suppressor protein, p53. The mot-2 binding site of p53 was mapped to C-terminal amino acid residues 312–352, which includes the cytoplasmic sequestration domain. In the present study, we have found that both mot-1 and mot-2 bind to p53 in vitro. By using His-tagged deletion mutant proteins, the p53-binding domain of mot-2 was mapped to its Nterminal amino acid residues 253–282, which are identical in mot-1 and mot-2 proteins. Some peptides containing the p53-binding region of mot-2 were able to compete with the full-length protein for p53 binding. The data provided rationale for in vitro binding of mot-1 and mot-2 proteins to p53 and supported the conclusion that inability of mot-1 protein to bind p53 in vivo depends on secondary structure or its binding to other cellular factors. Most interestingly, the p53-binding region of mot-2 was common to its MKT-077, a cationic dye that exhibits antitumor activity, binding region. Therefore it is most likely that MKT-077-induced nuclear translocation and restoration of wild-type p53 function in transformed cells takes place by a competitional mechanism.

  19. DNA requirements for interaction of the C-terminal region of Ku80 with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs).

    Science.gov (United States)

    Radhakrishnan, Sarvan Kumar; Lees-Miller, Susan P

    2017-09-01

    Non-homologous end joining (NHEJ) is the major pathway for the repair of ionizing radiation induced DNA double strand breaks (DSBs) in human cells. Critical to NHEJ is the DNA-dependent interaction of the Ku70/80 heterodimer with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs) to form the DNA-PK holoenzyme. However, precisely how Ku recruits DNA-PKcs to DSBs ends to enhance its kinase activity has remained enigmatic, with contradictory findings reported in the literature. Here we address the role of the Ku80 C-terminal region (CTR) in the DNA-dependent interaction of Ku70/80 with DNA-PKcs using purified components and defined DNA structures. Our results show that the Ku80 CTR is required for interaction with DNA-PKcs on short segments of blunt ended 25bp dsDNA or 25bp dsDNA with a 15-base poly dA single stranded (ss) DNA extension, but this requirement is less stringent on longer dsDNA molecules (35bp blunt ended dsDNA) or 25bp duplex DNA with either a 15-base poly dT or poly dC ssDNA extension. Moreover, the DNA-PKcs-Ku complex preferentially forms on 25 bp DNA with a poly-pyrimidine ssDNA extension.Our work clarifies the role of the Ku80 CTR and dsDNA ends on the interaction of DNA-PKcs with Ku and provides key information to guide assembly and biology of NHEJ complexes. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Monoclonal Antibodies Directed toward the Hepatitis C Virus Glycoprotein E2 Detect Antigenic Differences Modulated by the N-Terminal Hypervariable Region 1 (HVR1), HVR2, and Intergenotypic Variable Region.

    Science.gov (United States)

    Alhammad, Yousef; Gu, Jun; Boo, Irene; Harrison, David; McCaffrey, Kathleen; Vietheer, Patricia T; Edwards, Stirling; Quinn, Charles; Coulibaly, Fásseli; Poumbourios, Pantelis; Drummer, Heidi E

    2015-12-01

    Hepatitis C virus (HCV) envelope glycoproteins E1 and E2 form a heterodimer and mediate receptor interactions and viral fusion. Both E1 and E2 are targets of the neutralizing antibody (NAb) response and are candidates for the production of vaccines that generate humoral immunity. Previous studies demonstrated that N-terminal hypervariable region 1 (HVR1) can modulate the neutralization potential of monoclonal antibodies (MAbs), but no information is available on the influence of HVR2 or the intergenotypic variable region (igVR) on antigenicity. In this study, we examined how the variable regions influence the antigenicity of the receptor binding domain of E2 spanning HCV polyprotein residues 384 to 661 (E2661) using a panel of MAbs raised against E2661 and E2661 lacking HVR1, HVR2, and the igVR (Δ123) and well-characterized MAbs isolated from infected humans. We show for a subset of both neutralizing and nonneutralizing MAbs that all three variable regions decrease the ability of MAbs to bind E2661 and reduce the ability of MAbs to inhibit E2-CD81 interactions. In addition, we describe a new MAb directed toward the region spanning residues 411 to 428 of E2 (MAb24) that demonstrates broad neutralization against all 7 genotypes of HCV. The ability of MAb24 to inhibit E2-CD81 interactions is strongly influenced by the three variable regions. Our data suggest that HVR1, HVR2, and the igVR modulate exposure of epitopes on the core domain of E2 and their ability to prevent E2-CD81 interactions. These studies suggest that the function of HVR2 and the igVR is to modulate antibody recognition of glycoprotein E2 and may contribute to immune evasion. This study reveals conformational and antigenic differences between the Δ123 and intact E2661 glycoproteins and provides new structural and functional data about the three variable regions and their role in occluding neutralizing and nonneutralizing epitopes on the E2 core domain. The variable regions may therefore function to

  1. Contribution of trimeric autotransporter C-terminal domains of oligomeric coiled-coil adhesin (Oca) family members YadA, UspA1, EibA, and Hia to translocation of the YadA passenger domain and virulence of Yersinia enterocolitica.

    Science.gov (United States)

    Ackermann, Nikolaus; Tiller, Maximilian; Anding, Gisela; Roggenkamp, Andreas; Heesemann, Jürgen

    2008-07-01

    The Oca family is a novel class of autotransporter-adhesins with highest structural similarity in their C-terminal transmembrane region, which supposedly builds a beta-barrel pore in the outer membrane (OM). The prototype of the Oca family is YadA, an adhesin of Yersinia enterocolitica and Yersinia pseudotuberculosis. YadA forms a homotrimeric lollipop-like structure on the bacterial surface. The C-terminal regions of three YadA monomers form a barrel in the OM and translocate the trimeric N-terminal passenger domain, consisting of stalk, neck, and head region to the exterior. To elucidate the structural and functional role of the C-terminal translocator domain (TLD) and to assess its promiscuous capability with respect to transport of related passenger domains, we constructed chimeric YadA proteins, which consist of the N-terminal YadA passenger domain and C-terminal TLDs of Oca family members UspA1 (Moraxella catarrhalis), EibA (Escherichia coli), and Hia (Haemophilus influenzae). These constructs were expressed in Y. enterocolitica and compared for OM localization, surface exposure, oligomerization, adhesion properties, serum resistance, and mouse virulence. We demonstrate that all chimeric YadA proteins translocated the YadA passenger domain across the OM. Y. enterocolitica strains producing YadA chimeras or wild-type YadA showed comparable binding to collagen and epithelial cells. However, strains producing YadA chimeras were attenuated in serum resistance and mouse virulence. These results demonstrate for the first time that TLDs of Oca proteins of different origin are efficient translocators of the YadA passenger domain and that the cognate TLD of YadA is essential for bacterial survival in human serum and mouse virulence.

  2. 33 CFR 334.640 - Gulf of Mexico south of Apalachee Bay, Fla.; Air Force rocket firing range.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 3 2010-07-01 2010-07-01 false Gulf of Mexico south of Apalachee Bay, Fla.; Air Force rocket firing range. 334.640 Section 334.640 Navigation and Navigable Waters... REGULATIONS § 334.640 Gulf of Mexico south of Apalachee Bay, Fla.; Air Force rocket firing range. (a) The...

  3. Structure of bacteriophage T4 fibritin: a segmented coiled coil and the role of the C-terminal domain.

    Science.gov (United States)

    Tao, Y; Strelkov, S V; Mesyanzhinov, V V; Rossmann, M G

    1997-06-15

    Oligomeric coiled-coil motifs are found in numerous protein structures; among them is fibritin, a structural protein of bacteriophage T4, which belongs to a class of chaperones that catalyze a specific phage-assembly process. Fibritin promotes the assembly of the long tail fibers and their subsequent attachment to the tail baseplate; it is also a sensing device that controls the retraction of the long tail fibers in adverse environments and, thus, prevents infection. The structure of fibritin had been predicted from sequence and biochemical analyses to be mainly a triple-helical coiled coil. The determination of its structure at atomic resolution was expected to give insights into the assembly process and biological function of fibritin, and the properties of modified coiled-coil structures in general. The three-dimensional structure of fibritin E, a deletion mutant of wild-type fibritin, was determined to 2.2 A resolution by X-ray crystallography. Three identical subunits of 119 amino acid residues form a trimeric parallel coiled-coil domain and a small globular C-terminal domain about a crystallographic threefold axis. The coiled-coil domain is divided into three segments that are separated by insertion loops. The C-terminal domain, which consists of 30 residues from each subunit, contains a beta-propeller-like structure with a hydrophobic interior. The residues within the C-terminal domain make extensive hydrophobic and some polar intersubunit interactions. This is consistent with the C-terminal domain being important for the correct assembly of fibritin, as shown earlier by mutational studies. Tight interactions between the C-terminal residues of adjacent subunits counteract the latent instability that is suggested by the structural properties of the coiled-coil segments. Trimerization is likely to begin with the formation of the C-terminal domain which subsequently initiates the assembly of the coiled coil. The interplay between the stabilizing effect of the C-terminal

  4. Solution structure of the N-terminal domain of a replication restart primosome factor, PriC, in Escherichia coli

    Science.gov (United States)

    Aramaki, Takahiko; Abe, Yoshito; Katayama, Tsutomu; Ueda, Tadashi

    2013-01-01

    In eubacterial organisms, the oriC-independent primosome plays an essential role in replication restart after the dissociation of the replication DNA-protein complex by DNA damage. PriC is a key protein component in the replication restart primosome. Our recent study suggested that PriC is divided into two domains: an N-terminal and a C-terminal domain. In the present study, we determined the solution structure of the N-terminal domain, whose structure and function have remained unknown until now. The revealed structure was composed of three helices and one extended loop. We also observed chemical shift changes in the heteronuclear NMR spectrum and oligomerization in the presence of ssDNA. These abilities may contribute to the PriC-ssDNA complex, which is important for the replication restart primosome. PMID:23868391

  5. Missense mutation in DISC1 C-terminal coiled-coil has GSK3β signaling and sex-dependent behavioral effects in mice

    Science.gov (United States)

    Dachtler, James; Elliott, Christina; Rodgers, R. John; Baillie, George S.; Clapcote, Steven J.

    2016-01-01

    Disrupted-in-Schizophrenia 1 (DISC1) is a risk factor for schizophrenia and affective disorders. The full-length DISC1 protein consists of an N-terminal ‘head’ domain and a C-terminal tail domain that contains several predicted coiled-coils, structural motifs involved in protein-protein interactions. To probe the in vivo effects of missense mutation of DISC1’s C-terminal tail, we tested mice carrying mutation D453G within a predicted α-helical coiled-coil region. We report that, relative to wild-type littermates, female DISC1D453G mice exhibited novelty-induced hyperlocomotion, an anxiogenic profile in the elevated plus-maze and open field tests, and reduced social exploration of unfamiliar mice. Male DISC1D453G mice displayed a deficit in passive avoidance, while neither males nor females exhibited any impairment in startle reactivity or prepulse inhibition. Whole brain homogenates showed normal levels of DISC1 protein, but decreased binding of DISC1 to GSK3β, decreased phospho-inhibition of GSK3β at serine 9, and decreased levels of β-catenin in DISC1D453G mice of either sex. Interrupted GSK3β signaling may thus be part of the mechanism underlying the behavioral phenotype associated with D453G, in common with the previously described N-terminal domain mutations Q31L and L100P in mice, and the schizophrenia risk-conferring variant R264Q in humans. PMID:26728762

  6. C-Jun N-terminal kinase signalling pathway in response to cisplatin.

    Science.gov (United States)

    Yan, Dong; An, GuangYu; Kuo, Macus Tien

    2016-11-01

    Cisplatin (cis diamminedichloroplatinum II, cDDP) is one of the most effective cancer chemotherapeutic agents and is used in the treatment of many types of human malignancies. However, inherent tumour resistance is a major barrier to effective cisplatin therapy. So far, the mechanism of cDDP resistance has not been well defined. In general, cisplatin is considered to be a cytotoxic drug, for damaging DNA and inhibiting DNA synthesis, resulting in apoptosis via the mitochondrial death pathway or plasma membrane disruption. cDDP-induced DNA damage triggers signalling pathways that will eventually decide between cell life and death. As a member of the mitogen-activated protein kinases family, c-Jun N-terminal kinase (JNK) is a signalling pathway in response to extracellular stimuli, especially drug treatment, to modify the activity of numerous proteins locating in the mitochondria or the nucleus. Recent studies suggest that JNK signalling pathway plays a major role in deciding the fate of the cell and inducing resistance to cDDP-induced apoptosis in human tumours. c-Jun N-terminal kinase regulates several important cellular functions including cell proliferation, differentiation, survival and apoptosis while activating and inhibiting substrates for phosphorylation transcription factors (c-Jun, ATF2: Activating transcription factor 2, p53 and so on), which subsequently induce pro-apoptosis and pro-survival factors expression. Therefore, it is suggested that JNK signal pathway is a double-edged sword in cDDP treatment, simultaneously being a significant pro-apoptosis factor but also being associated with increased resistance to cisplatin-based chemotherapy. This review focuses on current knowledge concerning the role of JNK in cell response to cDDP, as well as their role in cisplatin resistance. © 2016 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

  7. Molecular dissection of the C-terminal regulatory domain of the plant plasma membrane H+-ATPase AHA2: Mapping of residues that when altered give rise to an activated enzyme

    DEFF Research Database (Denmark)

    Axelsen, K.B.; Venema, K.; Jah, T.

    1999-01-01

    in an extension of the C-terminus unique to plant H+-ATPases, Alteration of residues in both regions led to increased binding of yeast 14-3-3 protein to the plasma membrane of transformed cells. Taken together, our data suggest that modification of residues in two regions of the C-terminal regulatory domain......The plasma membrane H+-ATPase is a proton pump belonging to the P-type ATPase superfamily and is important for nutrient acquisition in plants, The H+-ATPase is controlled by an autoinhibitory C-terminal regulatory domain and is activated by 14-3-3 proteins which bind to this part of the enzyme......+-ATPase. The enzymes were characterized by their ability to promote growth in acidic conditions and to promote H+ extrusion from intact cells, both of which are measures of plasma membrane H+-ATPase activity, and were also characterized with respect to kinetic properties such as affinity for H+ and ATP. Residues...

  8. Characterization of the promoter region of the human c-erbB-2 protooncogene

    International Nuclear Information System (INIS)

    Ishii, S.; Imamoto, F.; Yamanashi, Y.; Toyoshima, K.; Yamamoto, T.

    1987-01-01

    Three overlapping genomic clones that contain the 5'-terminal portion of the human c-erbB-2 gene (ERBB2) were isolated. The promoter region was identified by nuclease S1 mapping with c-erbB-2 mRNA. Seven transcriptional start sites were identified. DNA sequence analysis showed that the promoter region contains a TATA box and a CAAT box about 30 and 80 base pairs (bp), respectively, upstream of the most downstream RNA initiation site. Two putative binding sites for transcription factor Sp1 were identified about 50 and 110 bp upstream of the CAAT box, and six GGA repeats were found between the CAAT box and the TATA box. This region had strong promoter activity when placed upstream of the bacterial chloramphenicol acetyltransferase gene and transfected into monkey CV-1 cells. These data indicate that the promoter of the human c-erbB-2 protooncogene is different from that of the protooncogene c-erbB-1 (epidermal growth factor receptor gene), which does not contain either a TATA box or a CAAT box. Comparison of the promoter sequences and activities of the two protooncogenes should be helpful in analysis of the regulatory mechanism of expression of their gene products, which are growth-factor receptors

  9. The EspF N-Terminal of Enterohemorrhagic Escherichia coli O157:H7 EDL933w Imparts Stronger Toxicity Effects on HT-29 Cells than the C-Terminal.

    Science.gov (United States)

    Wang, Xiangyu; Du, Yanli; Hua, Ying; Fu, Muqing; Niu, Cong; Zhang, Bao; Zhao, Wei; Zhang, Qiwei; Wan, Chengsong

    2017-01-01

    Enterohemorrhagic Escherichia coli (EHEC) O157:H7 EspF is an important multifunctional protein that destroys the tight junctions of intestinal epithelial cells and promotes host cell apoptosis. However, its molecular mechanism remains elusive. We knocked out the espF sequence (747 bp, Δ espF ), N-terminal sequence (219 bp, Δ espF N ), and C-terminal sequence (528 bp, Δ espF C ) separately using the pKD46-mediated λ Red homologous recombination system. Then, we built the corresponding complementation strains, namely, Δ espF/pespF , Δ espF N /pespF N , and Δ espF C /pespF C by overlap PCR, which were used in infecting HT-29 cells and BALB/C mice. The level of reactive oxygen species, cell apoptosis, mitochondrial trans-membrane potential, inflammatory factors, transepithelial electrical resistance (TER), and animal mortality were evaluated by DCFH-DA, double staining of Annexin V-FITC/PI, JC-1 staining, ELISA kit, and a mouse assay. The wild-type (WT), Δ espF , Δ espF/pespF , Δ espF C , Δ espF C /pespF C , Δ espF N , and Δ espF N /pespF N groups exhibited apoptotic rates of 68.3, 27.9, 64.9, 65.7, 73.4, 41.3, and 35.3% respectively, and mean TNF-α expression levels of 428 pg/mL, 342, 466, 446, 381, 383, and 374 pg/mL, respectively. In addition, the apoptotic rates and TNF-α levels of the WT, Δ espF/pespF , and Δ espF C were significantly higher than that of Δ espF , Δ espF N , Δ espF C /pespF C , and Δ espF N /pespF N group ( p < 0.05). The N-terminal of EspF resulted in an increase in the number of apoptotic cells, TNF-α secretion, ROS generation, mitochondria apoptosis, and pathogenicity in BalB/c mice. In conclusion, the N-terminal domain of the Enterohemorrhagic E. coli O157:H7 EspF more strongly promotes apoptosis and inflammation than the C-terminal domain.

  10. Extensive de novo solid-state NMR assignments of the 33 kDa C-terminal domain of the Ure2 prion

    Energy Technology Data Exchange (ETDEWEB)

    Habenstein, Birgit [UMR 5086 CNRS/Universite de Lyon 1, Institut de Biologie et Chimie des Proteines (France); Wasmer, Christian [Harvard Medical School (United States); Bousset, Luc; Sourigues, Yannick [UPR 3082 CNRS, Laboratoire d' Enzymologie et Biochimie Structurales (France); Schuetz, Anne [ETH Zurich, Physical Chemistry (Switzerland); Loquet, Antoine [Max Planck Institute for Biophysical Chemistry (Germany); Meier, Beat H., E-mail: beme@ethz.ch [ETH Zurich, Physical Chemistry (Switzerland); Melki, Ronald, E-mail: melki@lebs.cnrs-gif.fr [UPR 3082 CNRS, Laboratoire d' Enzymologie et Biochimie Structurales (France); Boeckmann, Anja, E-mail: a.bockmann@ibcp.fr [UMR 5086 CNRS/Universite de Lyon 1, Institut de Biologie et Chimie des Proteines (France)

    2011-11-15

    We present the de novo resonance assignments for the crystalline 33 kDa C-terminal domain of the Ure2 prion using an optimized set of five 3D solid-state NMR spectra. We obtained, using a single uniformly {sup 13}C, {sup 15}N labeled protein sample, sequential chemical-shift information for 74% of the N, C{alpha}, C{beta} triples, and for 80% of further side-chain resonances for these spin systems. We describe the procedures and protocols devised, and discuss possibilities and limitations of the assignment of this largest protein assigned today by solid-state NMR, and for which no solution-state NMR shifts were available. A comparison of the NMR chemical shifts with crystallographic data reveals that regions with high crystallographic B-factors are particularly difficult to assign. While the secondary structure elements derived from the chemical shift data correspond mainly to those present in the X-ray crystal structure, we detect an additional helical element and structural variability in the protein crystal, most probably originating from the different molecules in the asymmetric unit, with the observation of doubled resonances in several parts, including entire stretches, of the protein. Our results provide the point of departure towards an atomic-resolution structural analysis of the C-terminal Ure2p domain in the context of the full-length prion fibrils.

  11. 640-slice DVCT multi-dimensionally and dynamically presents changes in bladder volume and urine flow rate

    Science.gov (United States)

    Su, Yunshan; Fang, Kewei; Mao, Chongwen; Xiang, Shutian; Wang, Jin; Li, Yingwen

    2018-01-01

    The present study aimed to explore the application of 640-slice dynamic volume computed tomography (DVCT) to excretory cystography and urethrography. A total of 70 healthy subjects were included in the study. Excretory cystography and urethrography using 640-slice DVCT was conducted to continuously record the motions of the bladder and the proximal female and male urethra. The patients' voiding process was divided into early, early to middle, middle, middle to late, and late voiding phases. The subjects were analyzed using DVCT and conventional CT. The cross-sectional areas of various sections of the male and female urethra were evaluated, and the average urine flow rate was calculated. The 640-slice DVCT technique was used to dynamically observe the urine flow rate and changes in bladder volume at all voiding phases. The urine volume detected by 640-slice DVCT exhibited no significant difference compared with the actual volume, and no significant difference compared with that determined using conventional CT. Furthermore, no significant difference in the volume of the bladder at each phase of the voiding process was detected between 640-slice DVCT and conventional CT. The results indicate that 640-slice DVCT can accurately evaluate the status of the male posterior urethra and female urethra. In conclusion, 640-slice DVCT is able to multi-dimensionally and dynamically present changes in bladder volume and urine flow rate, and could obtain similar results to conventional CT in detecting urine volume, as well as the status of the male posterior urethra and female urethra. PMID:29467853

  12. C-terminal region of the UV-B photoreceptor UVR8 initiates signaling through interaction with the COP1 protein

    Science.gov (United States)

    Cloix, Catherine; Kaiserli, Eirini; Heilmann, Monika; Baxter, Katherine J.; Brown, Bobby A.; O’Hara, Andrew; Smith, Brian O.; Christie, John M.; Jenkins, Gareth I.

    2012-01-01

    UV-B light initiates photomorphogenic responses in plants. Arabidopsis UV RESISTANCE LOCUS8 (UVR8) specifically mediates these responses by functioning as a UV-B photoreceptor. UV-B exposure converts UVR8 from a dimer to a monomer, stimulates the rapid accumulation of UVR8 in the nucleus, where it binds to chromatin, and induces interaction of UVR8 with CONSTITUTIVELY PHOTOMORPHOGENIC1 (COP1), which functions with UVR8 to control photomorphogenic UV-B responses. Although the crystal structure of UVR8 reveals the basis of photoreception, it does not show how UVR8 initiates signaling through interaction with COP1. Here we report that a region of 27 amino acids from the C terminus of UVR8 (C27) mediates the interaction with COP1. The C27 region is necessary for UVR8 function in the regulation of gene expression and hypocotyl growth suppression in Arabidopsis. However, UVR8 lacking C27 still undergoes UV-B–induced monomerization in both yeast and plant protein extracts, accumulates in the nucleus in response to UV-B, and interacts with chromatin at the UVR8-regulated ELONGATED HYPOCOTYL5 (HY5) gene. The UV-B–dependent interaction of UVR8 and COP1 is reproduced in yeast cells and we show that C27 is both necessary and sufficient for the interaction of UVR8 with the WD40 domain of COP1. Furthermore, we show that C27 interacts in yeast with the REPRESSOR OF UV-B PHOTOMORPHOGENESIS proteins, RUP1 and RUP2, which are negative regulators of UVR8 function. Hence the C27 region has a key role in UVR8 function. PMID:22988111

  13. Effect of automated ultraviolet C-emitting device on decontamination of hospital rooms with and without real-time observation of terminal room disinfection.

    Science.gov (United States)

    Penno, Katie; Jandarov, Roman A; Sopirala, Madhuri M

    2017-11-01

    We studied the effectiveness of an ultraviolet C (UV-C) emitter in clinical settings and compared it with observed terminal disinfection. We cultured 22 hospital discharge rooms at a tertiary care academic medical center. Phase 1 (unobserved terminal disinfection) included cultures of 11 high-touch environmental surfaces (HTSs) after terminal room disinfection (AD) and after the use of a UV-C-emitting device (AUV). Phase 2 (observed terminal disinfection) included cultures before terminal room disinfection (BD), AD, and AUV. Zero-inflated Poisson regression compared mean colony forming units (CFU) between the groups. Two-sample proportion tests identified significance of the observed differences in proportions of thoroughly cleaned HTSs (CFU cleaning significantly reduced microbial burden and improved the thoroughness of terminal disinfection. We found no further benefit to UV-C use if standard terminal disinfection was observed. Copyright © 2017 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  14. Conversion of functionally undefined homopentameric protein PbaA into a proteasome activator by mutational modification of its C-terminal segment conformation.

    Science.gov (United States)

    Yagi-Utsumi, Maho; Sikdar, Arunima; Kozai, Toshiya; Inoue, Rintaro; Sugiyama, Masaaki; Uchihashi, Takayuki; Yagi, Hirokazu; Satoh, Tadashi; Kato, Koichi

    2018-01-01

    Recent bioinformatic analyses identified proteasome assembly chaperone-like proteins, PbaA and PbaB, in archaea. PbaB forms a homotetramer and functions as a proteasome activator, whereas PbaA does not interact with the proteasome despite the presence of an apparent C-terminal proteasome activation motif. We revealed that PbaA forms a homopentamer predominantly in the closed conformation with its C-terminal segments packed against the core domains, in contrast to the PbaB homotetramer with projecting C-terminal segments. This prompted us to create a novel proteasome activator based on a well-characterized structural framework. We constructed a panel of chimeric proteins comprising the homopentameric scaffold of PbaA and C-terminal segment of PbaB and subjected them to proteasome-activating assays as well as small-angle X-ray scattering and high-speed atomic force microscopy. The results indicated that the open conformation and consequent proteasome activation activity could be enhanced by replacement of the crystallographically disordered C-terminal segment of PbaA with the corresponding disordered segment of PbaB. Moreover, these effects can be produced just by incorporating two glutamate residues into the disordered C-terminal segment of PbaA, probably due to electrostatic repulsion among the negatively charged segments. Thus, we successfully endowed a functionally undefined protein with proteasome-activating activity by modifying its C-terminal segment. © The Author(s) 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  15. Membrane binding properties of EBV gp110 C-terminal domain; evidences for structural transition in the membrane environment

    International Nuclear Information System (INIS)

    Park, Sung Jean; Seo, Min-Duk; Lee, Suk Kyeong; Lee, Bong Jin

    2008-01-01

    Gp110 of Epstein-Barr virus (EBV) mainly localizes on nuclear/ER membranes and plays a role in the assembly of EBV nucleocapsid. The C-terminal tail domain (gp110 CTD) is essential for the function of gp110 and the nuclear/ER membranes localization of gp110 is ruled by its C-terminal unique nuclear localization signal (NLS), consecutive four arginines. In the present study, the structural properties of gp110 CTD in membrane mimics were investigated using CD, size-exclusion chromatography, and NMR, to elucidate the effect of membrane environment on the structural transition and to compare the structural feature of the protein in the solution state with that of the membrane-bound form. CD and NMR analysis showed that gp110 CTD in a buffer solution appears to adopt a stable folding intermediate which lacks compactness, and a highly helical structure is formed only in membrane environments. The helical content of gp110 CTD was significantly affected by the negative charge as well as the size of membrane mimics. Based on the elution profiles of the size-exclusion chromatography, we found that gp110 CTD intrinsically forms a trimer, revealing that a trimerization region may exist in the C-terminal domain of gp110 like the ectodomain of gp110. The mutation of NLS (RRRR) to RTTR does not affect the overall structure of gp110 CTD in membrane mimics, while the helical propensity in a buffer solution was slightly different between the wild-type and the mutant proteins. This result suggests that not only the helicity induced in membrane environment but also the local structure around NLS may be related to trafficking to the nuclear membrane. More detailed structural difference between the wild-type and the mutant in membrane environment was examined using synthetic two peptides including the wild-type NLS and the mutant NLS

  16. Structural Basis for Toughness and Flexibility in the C-terminal Passenger Domain of an Acinetobacter Trimeric Autotransporter Adhesin*

    Science.gov (United States)

    Koiwai, Kotaro; Hartmann, Marcus D.; Linke, Dirk; Lupas, Andrei N.; Hori, Katsutoshi

    2016-01-01

    Trimeric autotransporter adhesins (TAAs) on the cell surface of Gram-negative pathogens mediate bacterial adhesion to host cells and extracellular matrix proteins. However, AtaA, a TAA in the nonpathogenic Acinetobacter sp. strain Tol 5, shows nonspecific high adhesiveness to abiotic material surfaces as well as to biotic surfaces. It consists of a passenger domain secreted by the C-terminal transmembrane anchor domain (TM), and the passenger domain contains an N-terminal head, N-terminal stalk, C-terminal head (Chead), and C-terminal stalk (Cstalk). The Chead-Cstalk-TM fragment, which is conserved in many Acinetobacter TAAs, has by itself the head-stalk-anchor architecture of a complete TAA. Here, we show the crystal structure of the Chead-Cstalk fragment, AtaA_C-terminal passenger domain (CPSD), providing the first view of several conserved TAA domains. The YadA-like head (Ylhead) of the fragment is capped by a unique structure (headCap), composed of three β-hairpins and a connector motif; it also contains a head insert motif (HIM1) before its last inner β-strand. The headCap, Ylhead, and HIM1 integrally form a stable Chead structure. Some of the major domains of the CPSD fragment are inherently flexible and provide bending sites for the fiber between segments whose toughness is ensured by topological chain exchange and hydrophobic core formation inside the trimer. Thus, although adherence assays using in-frame deletion mutants revealed that the characteristic adhesive sites of AtaA reside in its N-terminal part, the flexibility and toughness of the CPSD part provide the resilience that enables the adhesive properties of the full-length fiber across a wide range of conditions. PMID:26698633

  17. Expression and comparative characterization of complete and C-terminally truncated forms of saccharifying α-amylase from Lactobacillus plantarum S21.

    Science.gov (United States)

    Kanpiengjai, Apinun; Nguyen, Thu-Ha; Haltrich, Dietmar; Khanongnuch, Chartchai

    2017-10-01

    Lactobacillus plantarum S21 α-amylase possesses 475 amino acids at the C-terminal region identified as the starch-binding domain (SBD) and has been previously reported to play a role in raw starch degradation. To understand the specific roles of this SBD, cloning and expression of the complete (AmyL9) and C-terminally truncated (AmyL9Δ SBD ) forms of α-amylase were conducted for enzyme purification and comparative characterization. AmyL9 and AmyL9Δ SBD were overproduced in Escherichia coli at approximately 10- and 20-times increased values of volumetric productivity when compared to α-amylase produced by the wild type, respectively. AmyL9Δ SBD was unable to hydrolyze raw starch and exhibited substrate specificity in a similar manner to that of AmyL9, but it was weakly active toward amylopectin and glycogen. The hydrolysis products obtained from the amylaceous substrates of both enzymes were the same. In addition, AmyL9Δ SBD showed comparatively higher K m values than AmyL9 when it reacted with starch and amylopectin, and lower values for other kinetic constants namely v max , k cat , and k cat /K m . The results indicated that the C-terminal SBDs of L. plantarum S21 α-amylase contribute to not only substrate preference but also substrate affinity and the catalytic efficiency of the α-amylase without any changes in the degradation mechanisms of the enzyme. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Vesicular transport route of horseradish C1a peroxidase is regulated by N- and C-terminal propeptides in tobacco cells.

    Science.gov (United States)

    Matsui, T; Nakayama, H; Yoshida, K; Shinmyo, A

    2003-10-01

    Peroxidases (PRX, EC 1.11.1.7) are widely distributed across microorganisms, plants, and animals; and, in plants, they have been implicated in a variety of secondary metabolic reactions. In particular, horseradish (Armoracia rusticana) root represents the main source of commercial PRX production. The prxC1a gene, which encodes horseradish PRX (HRP) C, is expressed mainly in the roots and stems of the horseradish plant. HRP C1a protein is shown to be synthesized as a preprotein with both a N-terminal (NTPP) and a C-terminal propeptide (CTPP). These propeptides, which might be responsible for intracellular localization or secretion, are removed before or concomitant with production of the mature protein. We investigated the functional role of HRP C1a NTPP and CTPP in the determination of the vesicular transport route, using an analytical system of transgenically cultured tobacco cells (Nicotiana tabacum, BY2). Here, we report that NTPP and CTPP are necessary and sufficient for accurate localization of mature HRP C1a protein to vacuoles of the vesicular transport system. We also demonstrate that HRP C1a derived from a preprotein lacking CTPP is shunted into the secretory pathway.

  19. Structure of the Reston ebolavirus VP30 C-terminal domain.

    Science.gov (United States)

    Clifton, Matthew C; Kirchdoerfer, Robert N; Atkins, Kateri; Abendroth, Jan; Raymond, Amy; Grice, Rena; Barnes, Steve; Moen, Spencer; Lorimer, Don; Edwards, Thomas E; Myler, Peter J; Saphire, Erica Ollmann

    2014-04-01

    The ebolaviruses can cause severe hemorrhagic fever. Essential to the ebolavirus life cycle is the protein VP30, which serves as a transcriptional cofactor. Here, the crystal structure of the C-terminal, NP-binding domain of VP30 from Reston ebolavirus is presented. Reston VP30 and Ebola VP30 both form homodimers, but the dimeric interfaces are rotated relative to each other, suggesting subtle inherent differences or flexibility in the dimeric interface.

  20. RAD51AP2, a novel vertebrate- and meiotic-specific protein, sharesa conserved RAD51-interacting C-terminal domain with RAD51AP1/PIR51

    Energy Technology Data Exchange (ETDEWEB)

    Kovalenko, Oleg V.; Wiese, Claudia; Schild, David

    2006-07-25

    Many interacting proteins regulate and/or assist the activities of RAD51, a recombinase which plays a critical role in both DNA repair and meiotic recombination. Yeast two-hybrid screening of a human testis cDNA library revealed a new protein, RAD51AP2 (RAD51 Associated Protein 2), that interacts strongly with RAD51. A full-length cDNA clone predicts a novel vertebrate specific protein of 1159 residues, and the RAD51AP2 transcript was observed only in meiotic tissue (i.e. adult testis and fetal ovary), suggesting a meiotic-specific function for RAD51AP2. In HEK293 cells the interaction of RAD51 with an ectopically-expressed recombinant large fragment of RAD51AP2 requires the C-terminal 57 residues of RAD51AP2. This RAD51-binding region shows 81% homology to the C-terminus of RAD51AP1/PIR51, an otherwise totally unrelated RAD51-binding partner that is ubiquitously expressed. Analyses using truncations and point mutations in both RAD51AP1 and RAD51AP2 demonstrate that these proteins use the same structural motif for RAD51 binding. RAD54 shares some homology with this RAD51-binding motif, but this homologous region plays only an accessory role to the adjacent main RAD51-interacting region, which has been narrowed here to 40 amino acids. A novel protein, RAD51AP2, has been discovered that interacts with RAD51 through a C-terminal motif also present in RAD51AP1.

  1. Influence of C-terminal tail deletion on structure and stability of hyperthermophile Sulfolobus tokodaii RNase HI.

    Science.gov (United States)

    Chen, Lin; Zhang, Ji-Long; Zheng, Qing-Chuan; Chu, Wen-Ting; Xue, Qiao; Zhang, Hong-Xing; Sun, Chia-Chung

    2013-06-01

    The C-terminus tail (G144-T149) of the hyperthermophile Sulfolobus tokodaii (Sto-RNase HI) plays an important role in this protein's hyperstabilization and may therefore be a good protein stability tag. Detailed understanding of the structural and dynamic effects of C-terminus tail deletion is required for gaining insights into the thermal stability mechanism of Sto-RNase HI. Focused on Sulfolobus tokodaii RNase HI (Sto-RNase HI) and its derivative lacking the C-terminal tail (ΔC6 Sto-RNase HI) (PDB codes: 2EHG and 3ALY), we applied molecular dynamics (MD) simulations at four different temperatures (300, 375, 475, and 500 K) to examine the effect of the C-terminal tail on the hyperstabilization of Sto-RNase HI and to investigate the unfolding process of Sto-RNase HI and ΔC6 Sto-RNase HI. The simulations suggest that the C-terminal tail has significant impact in hyperstabilization of Sto-RNase HI and the unfolding of these two proteins evolves along dissimilar pathways. Essential dynamics analysis indicates that the essential subspaces of the two proteins at different temperatures are non-overlapping within the trajectories and they exhibit different directions of motion. Our work can give important information to understand the three-state folding mechanism of Sto-RNase HI and to offer alternative strategies to improve the protein stability.

  2. Untangling spider silk evolution with spidroin terminal domains

    Directory of Open Access Journals (Sweden)

    Garb Jessica E

    2010-08-01

    Full Text Available Abstract Background Spidroins are a unique family of large, structural proteins that make up the bulk of spider silk fibers. Due to the highly variable nature of their repetitive sequences, spidroin evolutionary relationships have principally been determined from their non-repetitive carboxy (C-terminal domains, though they offer limited character data. The few known spidroin amino (N-terminal domains have been difficult to obtain, but potentially contain critical phylogenetic information for reconstructing the diversification of spider silks. Here we used silk gland expression data (ESTs from highly divergent species to evaluate the functional significance and phylogenetic utility of spidroin N-terminal domains. Results We report 11 additional spidroin N-termini found by sequencing ~1,900 silk gland cDNAs from nine spider species that shared a common ancestor > 240 million years ago. In contrast to their hyper-variable repetitive regions, spidroin N-terminal domains have retained striking similarities in sequence identity, predicted secondary structure, and hydrophobicity. Through separate and combined phylogenetic analyses of N-terminal domains and their corresponding C-termini, we find that combined analysis produces the most resolved trees and that N-termini contribute more support and less conflict than the C-termini. These analyses show that paralogs largely group by silk gland type, except for the major ampullate spidroins. Moreover, spidroin structural motifs associated with superior tensile strength arose early in the history of this gene family, whereas a motif conferring greater extensibility convergently evolved in two distantly related paralogs. Conclusions A non-repetitive N-terminal domain appears to be a universal attribute of spidroin proteins, likely retained from the origin of spider silk production. Since this time, spidroin N-termini have maintained several features, consistent with this domain playing a key role in silk

  3. Chemical Shift Assignments of the C-terminal Eps15 Homology Domain-3 EH Domain*

    Science.gov (United States)

    Caplan, Steve; Sorgen, Paul L.

    2013-01-01

    The C-terminal Eps15 homology (EH) domain 3 (EHD3) belongs to a eukaryotic family of endocytic regulatory proteins and is involved in the recycling of various receptors from the early endosome to the endocytic recycling compartment or in retrograde transport from the endosomes to the Golgi. EH domains are highly conserved in the EHD family and function as protein-protein interaction units that bind to Asn-Pro-Phe (NPF) motif-containing proteins. The EH domain of EHD1 was the first C-terminal EH domain from the EHD family to be solved by NMR. The differences observed between this domain and proteins with N-terminal EH domains helped describe a mechanism for the differential binding of NPF-containing proteins. Here, structural studies were expanded to include the EHD3 EH domain. While the EHD1 and EHD3 EH domains are highly homologous, they have different protein partners. A comparison of these structures will help determine the selectivity in protein binding between the EHD family members and lead to a better understanding of their unique roles in endocytic regulation. PMID:23754701

  4. Role of N-terminal 28-amino-acid region of Rhizopus oryzae lipase in directing proteins to secretory pathway of Aspergillus oryzae.

    Science.gov (United States)

    Hama, Shinji; Tamalampudi, Sriappareddy; Shindo, Naoki; Numata, Takao; Yamaji, Hideki; Fukuda, Hideki; Kondo, Akihiko

    2008-07-01

    To develop a new approach for improving heterologous protein production in Aspergillus oryzae, we focused on the functional role of the N-terminal region of Rhizopus oryzae lipase (ROL). Several N-terminal deletion variants of ROL were expressed in A. oryzae. Interestingly, a segment of 28 amino acids from the C-terminal region of the propeptide (N28) was found to be critical for secretion of ROL into the culture medium. To further investigate the role of N28, the ROL secretory process was visualized in vivo using ROL-green fluorescent protein (GFP) fusion proteins. In cells producing ROL with N28, fluorescence observations showed that the fusion proteins are transported through endoplasmic reticulum (ER), Golgi, and cell wall, which is one of the typical secretory processes in a eukaryotic cell. Because the expression of the mature ROL-GFP fusion protein induced fluorescence accumulation without its translocation into the ER, N28 is considered to play a crucial role in protein transport. When N28 was inserted between the secretion signal and GFP, fluorescence observations showed that GFP, which is originally a cytoplasmic protein, was efficiently translocated into the ER of A. oryzae, resulting in an enhanced secretion of mature GFP after proteolytic cleavage of N28. These findings suggest that N28 facilitates protein translocation into ER and can be a promising candidate for improving heterologous protein production in A. oryzae.

  5. Unaxial stress relaxation and creep behaviour in weldments of the pressure vessel steel A533B between 600 and 640 degree C

    International Nuclear Information System (INIS)

    Otterberg, R.

    1979-10-01

    In order to predict the stress reduction during stress relief heat treatment in welded joints of the pressure vessel steel A533B, uniaxial stress relaxation as well as creep tests have been performed. The specimens were isothermally stress relaxed between 600 and 640 degree C from initial stresses corresponding to specimen elongations of 0.25, 0.5 and 0.2 percent. The stress relaxation results are excellently described by a Norton relationship. The magnitude of the initial stress has been found to affect the stress relaxation in the beginning of the tests, but at times longer than one hour the effect is very small. Creep strain data from creep tests in the actual temperature interval was converted to describe stress relaxation behaviour as well. The results will be used in a forthcoming study to predict the multiaxial stress reduction in thick weldments of A533B. (author)

  6. Crystal structures of the F and pSLT plasmid TraJ N-terminal regions reveal similar homodimeric PAS folds with functional interchangeability

    Energy Technology Data Exchange (ETDEWEB)

    Lu, Jun; Wu, Ruiying; Adkins, Joshua N.; Joachimiak, Andrzej; Glover, Mark

    2014-09-16

    In the F-family of conjugative plasmids, TraJ is an essential transcriptional activator of the tra operon that encodes most of the proteins required for conjugation. Here we report for the first time the X-ray crystal structures of the TraJ N-terminal regions from the prototypic F plasmid (TraJF11-130) and from the Salmonella virulence plasmid pSLT (TraJpSLT 1-128). Both proteins form similar homodimeric Per-ARNT-Sim (PAS) fold structures. Mutational analysis reveals that the observed dimeric interface is critical for TraJF transcriptional activation, indicating that dimerization of TraJ is required for its in vivo function. An artificial ligand (oxidized dithiothreitol) occupies a cavity in the TraJF dimer interface, while a smaller cavity in corresponding region of the TraJpSLT structure lacks a ligand. Gas chromatography/mass spectrometry-electron ionization analysis of dithiothreitol-free TraJF suggests indole may be the natural TraJ ligand; however, disruption of the indole biosynthetic pathway does not affect TraJF function. Heterologous PAS domains from pSLT and R100 TraJ can functionally replace the TraJF PAS domain, suggesting that TraJ allelic specificity is mediated by the region C-terminal to the PAS domain.

  7. Skin-Derived C-Terminal Filaggrin-2 Fragments Are Pseudomonas aeruginosa-Directed Antimicrobials Targeting Bacterial Replication.

    Directory of Open Access Journals (Sweden)

    Britta Hansmann

    2015-09-01

    Full Text Available Soil- and waterborne bacteria such as Pseudomonas aeruginosa are constantly challenging body surfaces. Since infections of healthy skin are unexpectedly rare, we hypothesized that the outermost epidermis, the stratum corneum, and sweat glands directly control the growth of P. aeruginosa by surface-provided antimicrobials. Due to its high abundance in the upper epidermis and eccrine sweat glands, filaggrin-2 (FLG2, a water-insoluble 248 kDa S100 fused-type protein, might possess these innate effector functions. Indeed, recombinant FLG2 C-terminal protein fragments display potent antimicrobial activity against P. aeruginosa and other Pseudomonads. Moreover, upon cultivation on stratum corneum, P. aeruginosa release FLG2 C-terminus-containing FLG2 fragments from insoluble material, indicating liberation of antimicrobially active FLG2 fragments by the bacteria themselves. Analyses of the underlying antimicrobial mechanism reveal that FLG2 C-terminal fragments do not induce pore formation, as known for many other antimicrobial peptides, but membrane blebbing, suggesting an alternative mode of action. The association of the FLG2 fragment with the inner membrane of treated bacteria and its DNA-binding implicated an interference with the bacterial replication that was confirmed by in vitro and in vivo replication assays. Probably through in situ-activation by soil- and waterborne bacteria such as Pseudomonads, FLG2 interferes with the bacterial replication, terminates their growth on skin surface and thus may contributes to the skin's antimicrobial defense shield. The apparent absence of FLG2 at certain body surfaces, as in the lung or of burned skin, would explain their higher susceptibility towards Pseudomonas infections and make FLG2 C-terminal fragments and their derivatives candidates for new Pseudomonas-targeting antimicrobials.

  8. Skin-Derived C-Terminal Filaggrin-2 Fragments Are Pseudomonas aeruginosa-Directed Antimicrobials Targeting Bacterial Replication.

    Science.gov (United States)

    Hansmann, Britta; Schröder, Jens-Michael; Gerstel, Ulrich

    2015-09-01

    Soil- and waterborne bacteria such as Pseudomonas aeruginosa are constantly challenging body surfaces. Since infections of healthy skin are unexpectedly rare, we hypothesized that the outermost epidermis, the stratum corneum, and sweat glands directly control the growth of P. aeruginosa by surface-provided antimicrobials. Due to its high abundance in the upper epidermis and eccrine sweat glands, filaggrin-2 (FLG2), a water-insoluble 248 kDa S100 fused-type protein, might possess these innate effector functions. Indeed, recombinant FLG2 C-terminal protein fragments display potent antimicrobial activity against P. aeruginosa and other Pseudomonads. Moreover, upon cultivation on stratum corneum, P. aeruginosa release FLG2 C-terminus-containing FLG2 fragments from insoluble material, indicating liberation of antimicrobially active FLG2 fragments by the bacteria themselves. Analyses of the underlying antimicrobial mechanism reveal that FLG2 C-terminal fragments do not induce pore formation, as known for many other antimicrobial peptides, but membrane blebbing, suggesting an alternative mode of action. The association of the FLG2 fragment with the inner membrane of treated bacteria and its DNA-binding implicated an interference with the bacterial replication that was confirmed by in vitro and in vivo replication assays. Probably through in situ-activation by soil- and waterborne bacteria such as Pseudomonads, FLG2 interferes with the bacterial replication, terminates their growth on skin surface and thus may contributes to the skin's antimicrobial defense shield. The apparent absence of FLG2 at certain body surfaces, as in the lung or of burned skin, would explain their higher susceptibility towards Pseudomonas infections and make FLG2 C-terminal fragments and their derivatives candidates for new Pseudomonas-targeting antimicrobials.

  9. Mutant Mice Lacking the p53 C-Terminal Domain Model Telomere Syndromes

    NARCIS (Netherlands)

    Simeonova, I.; Jaber, S.; Draskovic, I.; Bardot, B.; Fang, M.; Bouarich-Bourimi, R.; Lejour, V.; Charbonnier, L.; Soudais, C.; Bourdon, J.C.; Huerre, M.; Londono-Vallejo, A.; Toledo, F.

    2013-01-01

    Mutations in p53, although frequent in human cancers, have not been implicated in telomere-related syndromes. Here, we show that homozygous mutant mice expressing p53(Delta31), a p53 lacking the C-terminal domain, exhibit increased p53 activity and suffer from aplastic anemia and pulmonary fibrosis,

  10. The two C-terminal tyrosines stabilize occluded Na/K pump conformations containing Na or K ions.

    Science.gov (United States)

    Vedovato, Natascia; Gadsby, David C

    2010-07-01

    Interactions of the three transported Na ions with the Na/K pump remain incompletely understood. Na/K pump crystal structures show that the extended C terminus of the Na,K-adenosine triphosphatase (ATPase) alpha subunit directly contacts transmembrane helices. Deletion of the last five residues (KETYY in almost all Na/K pumps) markedly lowered the apparent affinity for Na activation of pump phosphorylation from ATP, a reflection of cytoplasmic Na affinity for forming the occluded E1P(Na3) conformation. ATPase assays further suggested that C-terminal truncations also interfere with low affinity Na interactions, which are attributable to extracellular effects. Because extracellular Na ions traverse part of the membrane's electric field to reach their binding sites in the Na/K pump, their movements generate currents that can be monitored with high resolution. We report here electrical measurements to examine how Na/K pump interactions with extracellular Na ions are influenced by C-terminal truncations. We deleted the last two (YY) or five (KESYY) residues in Xenopus laevis alpha1 Na/K pumps made ouabain resistant by either of two kinds of point mutations and measured their currents as 10-mM ouabain-sensitive currents in Xenopus oocytes after silencing endogenous Xenopus Na/K pumps with 1 microM ouabain. We found the low affinity inhibitory influence of extracellular Na on outward Na/K pump current at negative voltages to be impaired in all of the C-terminally truncated pumps. Correspondingly, voltage jump-induced transient charge movements that reflect pump interactions with extracellular Na ions were strongly shifted to more negative potentials; this signals a several-fold reduction of the apparent affinity for extracellular Na in the truncated pumps. Parallel lowering of Na affinity on both sides of the membrane argues that the C-terminal contacts provide important stabilization of the occluded E1P(Na3) conformation, regardless of the route of Na ion entry into the

  11. Platinum-Catalyzed Terminal-Selective C(sp3)–H Oxidation of Aliphatic Amines

    Science.gov (United States)

    Lee, Melissa; Sanford, Melanie S.

    2016-01-01

    This paper describes the terminal-selective Pt-catalyzed C(sp3)–H oxidation of aliphatic amines without the requirement for directing groups. CuCl2 is employed as a stoichiometric oxidant, and the reactions proceed in high yield at Pt loadings as low as 1 mol %. These transformations are conducted in the presence of sulfuric acid, which reacts with the amine substrates in situ to form ammonium salts. We propose that protonation of the amine serves at least three important roles: (i) it renders the substrates soluble in the aqueous reaction medium; (ii) it limits binding of the amine nitrogen to Pt or Cu; and (ii) it electronically deactivates the C–H bonds proximal to the nitrogen center. We demonstrate that this strategy is effective for the terminal-selective C(sp3)–H oxidation of a variety of primary, secondary and tertiary amines. PMID:26439251

  12. Dual N- and C-terminal helices are required for endoplasmic reticulum and lipid droplet association of alcohol acetyltransferases in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Jyun-Liang Lin

    Full Text Available In the yeast Saccharomyces cerevisiae two alcohol acetyltransferases (AATases, Atf1 and Atf2, condense short chain alcohols with acetyl-CoA to produce volatile acetate esters. Such esters are, in large part, responsible for the distinctive flavors and aromas of fermented beverages including beer, wine, and sake. Atf1 and Atf2 localize to the endoplasmic reticulum (ER and Atf1 is known to localize to lipid droplets (LDs. The mechanism and function of these localizations are unknown. Here, we investigate potential mechanisms of Atf1 and Atf2 membrane association. Segments of the N- and C-terminal domains of Atf1 (residues 24-41 and 508-525, respectively are predicted to be amphipathic helices. Truncations of these helices revealed that the terminal domains are essential for ER and LD association. Moreover, mutations of the basic or hydrophobic residues in the N-terminal helix and hydrophobic residues in the C-terminal helix disrupted ER association and subsequent sorting from the ER to LDs. Similar amphipathic helices are found at both ends of Atf2, enabling ER and LD association. As was the case with Atf1, mutations to the N- and C-terminal helices of Atf2 prevented membrane association. Sequence comparison of the AATases from Saccharomyces, non-Saccharomyces yeast (K. lactis and P. anomala and fruits species (C. melo and S. lycopersicum showed that only AATases from Saccharomyces evolved terminal amphipathic helices. Heterologous expression of these orthologs in S. cerevisiae revealed that the absence of terminal amphipathic helices eliminates LD association. Combined, the results of this study suggest a common mechanism of membrane association for AATases via dual N- and C-terminal amphipathic helices.

  13. Construction of Azabicyclo[6.4.0]dodecatrienes Based on Rhodium(I)-Catalyzed Intramolecular [6+2] Cycloaddition between Azetidine, Allene, and Alkynes.

    Science.gov (United States)

    Yasuda, Shigeo; Yokosawa, Haruna; Mukai, Chisato

    2016-01-01

    Treatment of the allenylazetidine-alkynes with a catalytic amount of [RhCl(CO)dppp]2 (dppp: 1,3-bis(diphenylphosphino)propane) effected the intramolecular hetero-[6+2]-type ring-closing reaction via the C-C bond cleavage of the azetidine ring to produce azabicyclo[6.4.0]dodecatriene derivatives in good to excellent yields. The formation of the oxa analogue could also be achieved.

  14. Passive linear-optics 640 Gbit/s logic NOT gate

    DEFF Research Database (Denmark)

    Maram, Reza; Kong, Deming; Galili, Michael

    2015-01-01

    We experimentally demonstrate a 640 Gbit/s all-optical NOT gate for high-speed telecommunication on-off-keying (OOK) data signals. We employ linear optical signal processing based on spectral phase-only (all-pass) optical filtering to perform the target logic NOT operation....

  15. Decay accelerating factor (DAF) is anchored to membranes by a C-terminal glycolipid

    International Nuclear Information System (INIS)

    Medof, M.E.; Haas, R.; Walter, E.I.; Rosenberry, T.L.

    1986-01-01

    Purified 70 kDa membrane (m) DAF incorporates into cells when added in vitro. A 2 kDa smaller DAF form which functions extrinsically like C4bp but is unable to incorporate can be isolated from urine (u). Because of common deficits of mDAF and acetylcholinesterase (AChE) in erythrocytes (E) of patients with paroxysmal nocturnal hemoglobinuria (PNH), mDAF was analyzed for a O-terminal glycolipid membrane anchor similar to that in E AChE. Incubation of E with phosphatidylinositol-specific phospholipase C, an enzyme which cleaves a similar glycolipid anchor in trypanosome variant surface glycoproteins (mfVSGs), released 20% of the DAF antigen. The released DAF species resembled uDAF in size, extrinsic model of C4b2a decay, and lack of hydrophobicity. Reductive radiomethylation of mDAF with [ 14 C]HCHO and NaCNBH 3 revealed ethanolamine and glucosamine in proportions similar to those in the E AChE glycolipid anchor. Papain cleavage of radiomethylated mDAF released the labeled ethanolamine and glucosamine in small O-terminal fragments from the residual DAF that retained N-terminal Asp. Following labeling of the anchors of mDAF and E AChE with the lipophilic photoreagent 3-trifluoromethyl-3-(m-[ 125 I]iodophenyl)diazirine, cleavage at the glucosamine residue by deamination quantitatively released the label from both proteins. Biosynthetic labeling of Hela cells with [ 3 H]ethanolamine resulted in rapid 3 H incorporation into both 48 kDa proDAF and 70 kDa mDAF. These data indicate that mDAF is anchored by a glycolipid similar to that in E AChE, mfVSGs and Thy-1 antigen and raise the possibility that a defect in the assembly or attachment of this structure could account for the deficits of mDAF and E AChE in PNH

  16. 50 CFR 640.27 - Spiny lobster import prohibitions.

    Science.gov (United States)

    2010-10-01

    ... ATLANTIC Management Measures § 640.27 Spiny lobster import prohibitions. (a) Minimum size limits for... than Puerto Rico or the U.S. Virgin Islands, and a more restrictive minimum size limit that applies to Puerto Rico and the U.S. Virgin Islands. (1) No person may import a spiny lobster with less than a 5...

  17. Two distinct binding modes define the interaction of Brox with the C-terminal tails of CHMP5 and CHMP4B.

    Science.gov (United States)

    Mu, Ruiling; Dussupt, Vincent; Jiang, Jiansheng; Sette, Paola; Rudd, Victoria; Chuenchor, Watchalee; Bello, Nana F; Bouamr, Fadila; Xiao, Tsan Sam

    2012-05-09

    Interactions of the CHMP protein carboxyl terminal tails with effector proteins play important roles in retroviral budding, cytokinesis, and multivesicular body biogenesis. Here we demonstrate that hydrophobic residues at the CHMP4B C-terminal amphipathic α helix bind a concave surface of Brox, a mammalian paralog of Alix. Unexpectedly, CHMP5 was also found to bind Brox and specifically recruit endogenous Brox to detergent-resistant membrane fractions through its C-terminal 20 residues. Instead of an α helix, the CHMP5 C-terminal tail adopts a tandem β-hairpin structure that binds Brox at the same site as CHMP4B. Additional Brox:CHMP5 interface is furnished by a unique CHMP5 hydrophobic pocket engaging the Brox residue Y348 that is not conserved among the Bro1 domains. Our studies thus unveil a β-hairpin conformation of the CHMP5 protein C-terminal tail, and provide insights into the overlapping but distinct binding profiles of ESCRT-III and the Bro1 domain proteins. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. Novel Structure and Unexpected RNA-Binding Ability of the C-Terminal Domain of Herpes Simplex Virus 1 Tegument Protein UL21

    Energy Technology Data Exchange (ETDEWEB)

    Metrick, Claire M.; Heldwein, Ekaterina E. (Tufts-MED)

    2016-04-06

    Proteins forming the tegument layers of herpesviral virions mediate many essential processes in the viral replication cycle, yet few have been characterized in detail. UL21 is one such multifunctional tegument protein and is conserved among alphaherpesviruses. While UL21 has been implicated in many processes in viral replication, ranging from nuclear egress to virion morphogenesis to cell-cell spread, its precise roles remain unclear. Here we report the 2.7-Å crystal structure of the C-terminal domain of herpes simplex virus 1 (HSV-1) UL21 (UL21C), which has a unique α-helical fold resembling a dragonfly. Analysis of evolutionary conservation patterns and surface electrostatics pinpointed four regions of potential functional importance on the surface of UL21C to be pursued by mutagenesis. In combination with the previously determined structure of the N-terminal domain of UL21, the structure of UL21C provides a 3-dimensional framework for targeted exploration of the multiple roles of UL21 in the replication and pathogenesis of alphaherpesviruses. Additionally, we describe an unanticipated ability of UL21 to bind RNA, which may hint at a yet unexplored function.

    IMPORTANCEDue to the limited genomic coding capacity of viruses, viral proteins are often multifunctional, which makes them attractive antiviral targets. Such multifunctionality, however, complicates their study, which often involves constructing and characterizing null mutant viruses. Systematic exploration of these multifunctional proteins requires detailed road maps in the form of 3-dimensional structures. In this work, we determined the crystal structure of the C-terminal domain of UL21, a multifunctional tegument protein that is conserved among alphaherpesviruses. Structural analysis pinpointed surface areas of potential functional importance that provide a starting point for mutagenesis. In addition, the unexpected RNA-binding ability of UL21 may expand its functional repertoire

  19. Capillary electrophoresis of Big-Dye terminator sequencing reactions for human mtDNA Control Region haplotyping in the identification of human remains.

    Science.gov (United States)

    Montesino, Marta; Prieto, Lourdes

    2012-01-01

    Cycle sequencing reaction with Big-Dye terminators provides the methodology to analyze mtDNA Control Region amplicons by means of capillary electrophoresis. DNA sequencing with ddNTPs or terminators was developed by (1). The progressive automation of the method by combining the use of fluorescent-dye terminators with cycle sequencing has made it possible to increase the sensibility and efficiency of the method and hence has allowed its introduction into the forensic field. PCR-generated mitochondrial DNA products are the templates for sequencing reactions. Different set of primers can be used to generate amplicons with different sizes according to the quality and quantity of the DNA extract providing sequence data for different ranges inside the Control Region.

  20. Mode of inhibition of HIV-1 Integrase by a C-terminal domain-specific monoclonal antibody*

    Directory of Open Access Journals (Sweden)

    Merkel George

    2006-06-01

    Full Text Available Abstract Background To further our understanding of the structure and function of HIV-1 integrase (IN we developed and characterized a library of monoclonal antibodies (mAbs directed against this protein. One of these antibodies, mAb33, which is specific for the C-terminal domain, was found to inhibit HIV-1 IN processing activity in vitro; a corresponding Fv fragment was able to inhibit HIV-1 integration in vivo. Our subsequent studies, using heteronuclear nuclear magnetic resonance spectroscopy, identified six solvent accessible residues on the surface of the C-terminal domain that were immobilized upon binding of the antibody, which were proposed to comprise the epitope. Here we test this hypothesis by measuring the affinity of mAb33 to HIV-1 proteins that contain Ala substitutions in each of these positions. To gain additional insight into the mode of inhibition we also measured the DNA binding capacity and enzymatic activities of the Ala substituted proteins. Results We found that Ala substitution of any one of five of the putative epitope residues, F223, R224, Y226, I267, and I268, caused a decrease in the affinity of the mAb33 for HIV-1 IN, confirming the prediction from NMR data. Although IN derivatives with Ala substitutions in or near the mAb33 epitope exhibited decreased enzymatic activity, none of the epitope substitutions compromised DNA binding to full length HIV-1 IN, as measured by surface plasmon resonance spectroscopy. Two of these derivatives, IN (I276A and IN (I267A/I268A, exhibited both increased DNA binding affinity and uncharacteristic dissociation kinetics; these proteins also exhibited non-specific nuclease activity. Results from these investigations are discussed in the context of current models for how the C-terminal domain interacts with substrate DNA. Conclusion It is unlikely that inhibition of HIV-1 IN activity by mAb33 is caused by direct interaction with residues that are essential for substrate binding. Rather

  1. Extensive de novo solid-state NMR assignments of the 33 kDa C-terminal domain of the Ure2 prion

    International Nuclear Information System (INIS)

    Habenstein, Birgit; Wasmer, Christian; Bousset, Luc; Sourigues, Yannick; Schütz, Anne; Loquet, Antoine; Meier, Beat H.; Melki, Ronald; Böckmann, Anja

    2011-01-01

    We present the de novo resonance assignments for the crystalline 33 kDa C-terminal domain of the Ure2 prion using an optimized set of five 3D solid-state NMR spectra. We obtained, using a single uniformly 13 C, 15 N labeled protein sample, sequential chemical-shift information for 74% of the N, Cα, Cβ triples, and for 80% of further side-chain resonances for these spin systems. We describe the procedures and protocols devised, and discuss possibilities and limitations of the assignment of this largest protein assigned today by solid-state NMR, and for which no solution-state NMR shifts were available. A comparison of the NMR chemical shifts with crystallographic data reveals that regions with high crystallographic B-factors are particularly difficult to assign. While the secondary structure elements derived from the chemical shift data correspond mainly to those present in the X-ray crystal structure, we detect an additional helical element and structural variability in the protein crystal, most probably originating from the different molecules in the asymmetric unit, with the observation of doubled resonances in several parts, including entire stretches, of the protein. Our results provide the point of departure towards an atomic-resolution structural analysis of the C-terminal Ure2p domain in the context of the full-length prion fibrils.

  2. Natural monomeric form of fetal bovine serum acetylcholinesterase lacks the C-terminal tetramerization domain.

    Science.gov (United States)

    Saxena, Ashima; Hur, Regina S; Luo, Chunyuan; Doctor, Bhupendra P

    2003-12-30

    Acetylcholinesterase isolated from fetal bovine serum (FBS AChE) was previously characterized as a globular tetrameric form. Analysis of purified preparations of FBS AChE by gel permeation chromatography revealed the presence of a stable, catalytically active, monomeric form of this enzyme. The two forms could be distinguished from each other based on their molecular weight, hydrodynamic properties, kinetic properties, thermal stability, and the type of glycans they carry. No differences between the two forms were observed for the binding of classical inhibitors such as edrophonium and propidium or inhibitors that are current or potential drugs for the treatment of Alzheimer's disease such as (-) huperzine A and E2020; tacrine inhibited the monomeric form 2-3-fold more potently than the tetrameric form. Sequencing of peptides obtained from an in-gel tryptic digest of the monomer and tetramer by tandem mass spectrometry indicated that the tetramer consists of 583 amino acid residues corresponding to the mature form of the enzyme, whereas the monomer consists of 543-547 amino acid residues. The subunit molecular weight of the protein component of the monomer (major species) was determined to be 59 414 Da and that of the tetramer as 64 239 Da. The N-terminal of the monomer and the tetramer was Glu, suggesting that the monomer is not a result of truncation at the N-terminal. The only differences detected were at the C-terminus. The tetramer yielded the expected C-terminus, CSDL, whereas the C-terminus of the monomer yielded a mixture of peptides, of which LLSATDTLD was the most abundant. These results suggest that monomeric FBS AChE is trimmed at the C-terminus, and the results are consistent with the involvement of C-terminal amino acids in the assembly of monomers into tetramers.

  3. Chromosomal microarray testing identifies a 4p terminal region associated with seizures in Wolf–Hirschhorn syndrome

    Science.gov (United States)

    South, Sarah T; Lortz, Amanda; Hensel, Charles H; Sdano, Mallory R; Vanzo, Rena J; Martin, Megan M; Peiffer, Andreas; Lambert, Christophe G; Calhoun, Amy; Carey, John C; Battaglia, Agatino

    2016-01-01

    Background Wolf–Hirschhorn syndrome (WHS) is a contiguous gene deletion syndrome involving variable size deletions of the 4p16.3 region. Seizures are frequently, but not always, associated with WHS. We hypothesised that the size and location of the deleted region may correlate with seizure presentation. Methods Using chromosomal microarray analysis, we finely mapped the breakpoints of copy number variants (CNVs) in 48 individuals with WHS. Seizure phenotype data were collected through parent-reported answers to a comprehensive questionnaire and supplemented with available medical records. Results We observed a significant correlation between the presence of an interstitial 4p deletion and lack of a seizure phenotype (Fisher's exact test p=3.59e-6). In our cohort, there were five individuals with interstitial deletions with a distal breakpoint at least 751 kbp proximal to the 4p terminus. Four of these individuals have never had an observable seizure, and the fifth individual had a single febrile seizure at the age of 1.5 years. All other individuals in our cohort whose deletions encompass the terminal 751 kbp region report having seizures typical of WHS. Additional examples from the literature corroborate these observations and further refine the candidate seizure susceptibility region to a region 197 kbp in size, starting 368 kbp from the terminus of chromosome 4. Conclusions We identify a small terminal region of chromosome 4p that represents a seizure susceptibility region. Deletion of this region in the context of WHS is sufficient for seizure occurrence. PMID:26747863

  4. Craniotomia sem tricotomia: avaliação de 640 casos Craniotomy without tricotomy: analysis of 640 cases

    Directory of Open Access Journals (Sweden)

    Amylcar E. Dvilevicius

    2004-03-01

    Full Text Available A remoção do cabelo para realização de craniotomia utilizada rotineiramente na maioria dos serviços de neurocirurgia para procedimentos cranianos diversos questionada em sua necessidade a partir da avaliação retrospectiva de 640 pacientes submetidos a cirurgias cranianas, em que foi observada uma porcentagem de infecção de ferida cirúrgica de 1,09 %, não superior àquelas com tricotomia revisadas na literatura. Nos 7 casos com infecção, 3 pacientes foram submetidos a derivações liquóricas, 3 pacientes eram vítimas de traumatismo crânio-encefálico e uma paciente substituida a craniotomia para tratamento de tumor cerebral. A técnica para preservação e manuseio do cabelo, suas vantagens e desvantagens são descritas e discutidas.The hair shaving in preparation for neurosurgeris frequently used in most of neurosurgical centers to perform craniotomy. We question about its necessity after our retrospective analysis of 640 patients undergoing cranial procedures without previous hair shaving. We had the overall surgical wound infection rate of 1.09%, not higher than tricotomy in the review of the literature. In 7 cases with infection, 3 patients were undergoing to CSF shunts, 3 patients had head injury, and one had brain tumor. The technique for preparing skin and hair for cranial procedures, its advantages and disvantages are described and discussed.

  5. Modular organization of proteins containing C1q-like globular domain.

    Science.gov (United States)

    Kishore, U; Reid, K B

    1999-05-01

    The first step in the activation of the classical pathway of complement cascade by immune complexes involves the binding of the six globular heads of C1q to the Fc regions of immunoglobulin G (IgG) or immunoglobulin M (IgM). The globular heads of C1q are located C-terminal to the six triple-helical stalks present in the molecule, each head is considered to be composed of the C-terminal halves (3 x 135 residues) of one A-, one B- and one C-chain. It is not known if the C-terminal globular regions, present in each of the three types of chains, are independently folded modules (with each chain having distinct binding properties towards immunoglobulins) or whether the different binding functions of C1q are dependent upon a globular structure which relies on contributions from all three chains. Recent reports of recombinant production and characterisation of soluble globular head regions of all the three chains indicate that the globular regions of C1q may adopt a modular organization, i.e., each globular head of C1q may be composed of three, structurally and functionally, independent domains, thus retaining multivalency in the form of a heterotrimer. Modules of the same type as the C1q C-terminal module are also found in a variety of noncomplement proteins that include the C-terminal regions of the human type VIII and type X collagens, precerebellin, the chipmunk hibernation proteins, the human endothelial cell protein, multimerin, the serum protein, Acrp-30 which is secreted from mouse adipocytes, and the sunfish inner-ear specific structural protein. The C1q molecule is the only one of these proteins for which, to date, a function has been ascribed to the module. The existence of a shared structural region between C1q and certain collagens may suggest an evolutionarily common ancestral precursor. Various structural and biochemical data suggest that these modules may be responsible for multimerisation through patches of aromatic residues within them.

  6. Characterization of the C-terminal ER membrane anchor of PTP1B

    International Nuclear Information System (INIS)

    Anderie, Ines; Schulz, Irene; Schmid, Andreas

    2007-01-01

    The tyrosine phosphatase PTP1B is an important regulator of cell function. In living cells PTP1B activity is restricted to the vicinity of the endoplasmic reticulum (ER) by post-translational C-terminal attachment of PTP1B to the ER membrane network. In our study we investigated the membrane anchor of PTP1B by use of EGFP fusion proteins. We demonstrate that the membrane anchor of PTP1B cannot be narrowed down to a unique amino acid sequence with a defined start and stop point but rather is moveable within several amino acids. Removal of up to seven amino acids from the C-terminus, as well as exchange of single amino acids in the putative transmembrane sequence did not influence subcellular localization of PTP1B. With the method of bimolecular fluorescence complementation we could demonstrate dimerization of PTP1B in vivo. Homodimerization was, in contrast to other tail-anchored proteins, not dependent on the membrane anchor. Our data demonstrate that the C-terminal membrane anchor of PTP1B is formed by a combination of a single stretch transmembrane domain (TMD) followed by a tail. TMD and tail length are variable and there are no sequence-specific features. Our data for PTP1B are consistent with a concept that explains the ER membrane anchor of tail-anchored proteins as a physicochemical structure

  7. C-terminal region of EBNA-2 determines the superior transforming ability of type 1 Epstein-Barr virus by enhanced gene regulation of LMP-1 and CXCR7.

    Directory of Open Access Journals (Sweden)

    Laila Cancian

    2011-07-01

    Full Text Available Type 1 Epstein-Barr virus (EBV strains immortalize B lymphocytes in vitro much more efficiently than type 2 EBV, a difference previously mapped to the EBNA-2 locus. Here we demonstrate that the greater transforming activity of type 1 EBV correlates with a stronger and more rapid induction of the viral oncogene LMP-1 and the cell gene CXCR7 (which are both required for proliferation of EBV-LCLs during infection of primary B cells with recombinant viruses. Surprisingly, although the major sequence differences between type 1 and type 2 EBNA-2 lie in N-terminal parts of the protein, the superior ability of type 1 EBNA-2 to induce proliferation of EBV-infected lymphoblasts is mostly determined by the C-terminus of EBNA-2. Substitution of the C-terminus of type 1 EBNA-2 into the type 2 protein is sufficient to confer a type 1 growth phenotype and type 1 expression levels of LMP-1 and CXCR7 in an EREB2.5 cell growth assay. Within this region, the RG, CR7 and TAD domains are the minimum type 1 sequences required. Sequencing the C-terminus of EBNA-2 from additional EBV isolates showed high sequence identity within type 1 isolates or within type 2 isolates, indicating that the functional differences mapped are typical of EBV type sequences. The results indicate that the C-terminus of EBNA-2 accounts for the greater ability of type 1 EBV to promote B cell proliferation, through mechanisms that include higher induction of genes (LMP-1 and CXCR7 required for proliferation and survival of EBV-LCLs.

  8. Structure of a C-terminal AHNAK peptide in a 1:2:2 complex with S100A10 and an acetylated N-terminal peptide of annexin A2

    International Nuclear Information System (INIS)

    Ozorowski, Gabriel; Milton, Saskia; Luecke, Hartmut

    2013-01-01

    Structure of a 20-amino-acid peptide of AHNAK bound asymmetrically to the AnxA2–S100A10A heterotetramer (1:2:2 symmetry) provides insights into the atomic level interactions that govern this membrane-repair scaffolding complex. AHNAK, a large 629 kDa protein, has been implicated in membrane repair, and the annexin A2–S100A10 heterotetramer [(p11) 2 (AnxA2) 2 )] has high affinity for several regions of its 1002-amino-acid C-terminal domain. (p11) 2 (AnxA2) 2 is often localized near the plasma membrane, and this C2-symmetric platform is proposed to be involved in the bridging of membrane vesicles and trafficking of proteins to the plasma membrane. All three proteins co-localize at the intracellular face of the plasma membrane in a Ca 2+ -dependent manner. The binding of AHNAK to (p11) 2 (AnxA2) 2 has been studied previously, and a minimal binding motif has been mapped to a 20-amino-acid peptide corresponding to residues 5654–5673 of the AHNAK C-terminal domain. Here, the 2.5 Å resolution crystal structure of this 20-amino-acid peptide of AHNAK bound to the AnxA2–S100A10 heterotetramer (1:2:2 symmetry) is presented, which confirms the asymmetric arrangement first described by Rezvanpour and coworkers and explains why the binding motif has high affinity for (p11) 2 (AnxA2) 2 . Binding of AHNAK to the surface of (p11) 2 (AnxA2) 2 is governed by several hydrophobic interactions between side chains of AHNAK and pockets on S100A10. The pockets are large enough to accommodate a variety of hydrophobic side chains, allowing the consensus sequence to be more general. Additionally, the various hydrogen bonds formed between the AHNAK peptide and (p11) 2 (AnxA2) 2 most often involve backbone atoms of AHNAK; as a result, the side chains, particularly those that point away from S100A10/AnxA2 towards the solvent, are largely interchangeable. While the structure-based consensus sequence allows interactions with various stretches of the AHNAK C-terminal domain, comparison

  9. Chromosomal microarray testing identifies a 4p terminal region associated with seizures in Wolf-Hirschhorn syndrome.

    Science.gov (United States)

    Ho, Karen S; South, Sarah T; Lortz, Amanda; Hensel, Charles H; Sdano, Mallory R; Vanzo, Rena J; Martin, Megan M; Peiffer, Andreas; Lambert, Christophe G; Calhoun, Amy; Carey, John C; Battaglia, Agatino

    2016-04-01

    Wolf-Hirschhorn syndrome (WHS) is a contiguous gene deletion syndrome involving variable size deletions of the 4p16.3 region. Seizures are frequently, but not always, associated with WHS. We hypothesised that the size and location of the deleted region may correlate with seizure presentation. Using chromosomal microarray analysis, we finely mapped the breakpoints of copy number variants (CNVs) in 48 individuals with WHS. Seizure phenotype data were collected through parent-reported answers to a comprehensive questionnaire and supplemented with available medical records. We observed a significant correlation between the presence of an interstitial 4p deletion and lack of a seizure phenotype (Fisher's exact test p=3.59e-6). In our cohort, there were five individuals with interstitial deletions with a distal breakpoint at least 751 kbp proximal to the 4p terminus. Four of these individuals have never had an observable seizure, and the fifth individual had a single febrile seizure at the age of 1.5 years. All other individuals in our cohort whose deletions encompass the terminal 751 kbp region report having seizures typical of WHS. Additional examples from the literature corroborate these observations and further refine the candidate seizure susceptibility region to a region 197 kbp in size, starting 368 kbp from the terminus of chromosome 4. We identify a small terminal region of chromosome 4p that represents a seizure susceptibility region. Deletion of this region in the context of WHS is sufficient for seizure occurrence. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  10. C-terminal phenylalanine of bacteriophage T7 single-stranded DNA-binding protein is essential for strand displacement synthesis by T7 DNA polymerase at a nick in DNA.

    Science.gov (United States)

    Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C

    2009-10-30

    Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5'-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations.

  11. C-terminal Phenylalanine of Bacteriophage T7 Single-stranded DNA-binding Protein Is Essential for Strand Displacement Synthesis by T7 DNA Polymerase at a Nick in DNA*

    Science.gov (United States)

    Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C.

    2009-01-01

    Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5′-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations. PMID:19726688

  12. Recombinant production of peptide C-terminal α-amides using an engineered intein

    DEFF Research Database (Denmark)

    Albertsen, Louise; Shaw, Allan C; Norrild, Jens Chr.

    2013-01-01

    is that they contain a C-terminal that is α-amidated, and this amidation is crucial for biological function. A challenge is to generate such peptides by recombinant means and particularly in a production scale. Here, we have examined an intein-mediated approach to generate a PYY derivative in a larger scale. Initially......, we experienced challenges with hydrolysis of the intein fusion protein, which was reduced by a T3C mutation in the intein. Subsequently, we further engineered the intein to decrease the absolute size and improve the relative yield of the PYY derivative, which was achieved by substituting 54 residues...

  13. Rare RNF213 variants in the C-terminal region encompassing the RING-finger domain are associated with moyamoya angiopathy in Caucasians.

    Science.gov (United States)

    Guey, Stéphanie; Kraemer, Markus; Hervé, Dominique; Ludwig, Thomas; Kossorotoff, Manoëlle; Bergametti, Françoise; Schwitalla, Jan Claudius; Choi, Simone; Broseus, Lucile; Callebaut, Isabelle; Genin, Emmanuelle; Tournier-Lasserve, Elisabeth

    2017-08-01

    Moyamoya angiopathy (MMA) is a cerebral angiopathy affecting the terminal part of internal carotid arteries. Its prevalence is 10 times higher in Japan and Korea than in Europe. In East Asian countries, moyamoya is strongly associated to the R4810K variant in the RNF213 gene that encodes for a protein containing a RING-finger and two AAA+ domains. This variant has never been detected in Caucasian MMA patients, but several rare RNF213 variants have been reported in Caucasian cases. Using a collapsing test based on exome data from 68 European MMA probands and 573 ethnically matched controls, we showed a significant association between rare missense RNF213 variants and MMA in European patients (odds ratio (OR)=2.24, 95% confidence interval (CI)=(1.19-4.11), P=0.01). Variants specific to cases had higher pathogenicity predictive scores (median of 24.2 in cases versus 9.4 in controls, P=0.029) and preferentially clustered in a C-terminal hotspot encompassing the RING-finger domain of RNF213 (P<10 -3 ). This association was even stronger when restricting the analysis to childhood-onset and familial cases (OR=4.54, 95% CI=(1.80-11.34), P=1.1 × 10 -3 ). All clinically affected relatives who were genotyped were carriers. However, the need for additional factors to develop MMA is strongly suggested by the fact that only 25% of mutation carrier relatives were clinically affected.

  14. The EspF N-Terminal of Enterohemorrhagic Escherichia coli O157:H7 EDL933w Imparts Stronger Toxicity Effects on HT-29 Cells than the C-Terminal

    Directory of Open Access Journals (Sweden)

    Xiangyu Wang

    2017-09-01

    Full Text Available Enterohemorrhagic Escherichia coli (EHEC O157:H7 EspF is an important multifunctional protein that destroys the tight junctions of intestinal epithelial cells and promotes host cell apoptosis. However, its molecular mechanism remains elusive. We knocked out the espF sequence (747 bp, ΔespF, N-terminal sequence (219 bp, ΔespFN, and C-terminal sequence (528 bp, ΔespFC separately using the pKD46-mediated λ Red homologous recombination system. Then, we built the corresponding complementation strains, namely, ΔespF/pespF, ΔespFN/pespFN, and ΔespFC/pespFC by overlap PCR, which were used in infecting HT-29 cells and BALB/C mice. The level of reactive oxygen species, cell apoptosis, mitochondrial trans-membrane potential, inflammatory factors, transepithelial electrical resistance (TER, and animal mortality were evaluated by DCFH-DA, double staining of Annexin V-FITC/PI, JC-1 staining, ELISA kit, and a mouse assay. The wild-type (WT, ΔespF, ΔespF/pespF, ΔespFC, ΔespFC/pespFC, ΔespFN, and ΔespFN/pespFN groups exhibited apoptotic rates of 68.3, 27.9, 64.9, 65.7, 73.4, 41.3, and 35.3% respectively, and mean TNF-α expression levels of 428 pg/mL, 342, 466, 446, 381, 383, and 374 pg/mL, respectively. In addition, the apoptotic rates and TNF-α levels of the WT, ΔespF/pespF, and ΔespFC were significantly higher than that of ΔespF, ΔespFN, ΔespFC/pespFC, and ΔespFN/pespFN group (p < 0.05. The N-terminal of EspF resulted in an increase in the number of apoptotic cells, TNF-α secretion, ROS generation, mitochondria apoptosis, and pathogenicity in BalB/c mice. In conclusion, the N-terminal domain of the Enterohemorrhagic E. coli O157:H7 EspF more strongly promotes apoptosis and inflammation than the C-terminal domain.

  15. The catalytic chain of human complement subcomponent C1r. Purification and N-terminal amino acid sequences of the major cyanogen bromide-cleavage fragments.

    Science.gov (United States)

    Arlaud, G J; Gagnon, J; Porter, R R

    1982-01-01

    1. The a- and b-chains of reduced and alkylated human complement subcomponent C1r were separated by high-pressure gel-permeation chromatography and isolated in good yield and in pure form. 2. CNBr cleavage of C1r b-chain yielded eight major peptides, which were purified by gel filtration and high-pressure reversed-phase chromatography. As determined from the sum of their amino acid compositions, these peptides accounted for a minimum molecular weight of 28 000, close to the value 29 100 calculated from the whole b-chain. 3. N-Terminal sequence determinations of C1r b-chain and its CNBr-cleavage peptides allowed the identification of about two-thirds of the amino acids of C1r b-chain. From our results, and on the basis of homology with other serine proteinases, an alignment of the eight CNBr-cleavage peptides from C1r b-chain is proposed. 4. The residues forming the 'charge-relay' system of the active site of serine proteinases (His-57, Asp-102 and Ser-195 in the chymotrypsinogen numbering) are found in the corresponding regions of C1r b-chain, and the amino acid sequence around these residues has been determined. 5. The N-terminal sequence of C1r b-chain has been extended to residue 60 and reveals that C1r b-chain lacks the 'histidine loop', a disulphide bond that is present in all other known serine proteinases.

  16. Neurological disease mutations compromise a C-terminal ion pathway in the Na(+)/K(+)-ATPas

    DEFF Research Database (Denmark)

    Poulsen, Hanne; Khandelia, Himanshu; Morth, Jens Preben

    2010-01-01

    severe neurological diseases. This novel model for ion transport by the Na(+)/K(+)-ATPase is established by electrophysiological studies of C-terminal mutations in familial hemiplegic migraine 2 (FHM2) and is further substantiated by molecular dynamics simulations. A similar ion regulation is likely...

  17. Neurological disease mutations compromise a C-terminal ion pathway in the Na(+)/K(+)-ATPase

    DEFF Research Database (Denmark)

    Poulsen, Hanne; Khandelia, Himanshu; Morth, J Preben

    2010-01-01

    severe neurological diseases. This novel model for ion transport by the Na(+)/K(+)-ATPase is established by electrophysiological studies of C-terminal mutations in familial hemiplegic migraine 2 (FHM2) and is further substantiated by molecular dynamics simulations. A similar ion regulation is likely...

  18. The C'-terminal interaction domain of the thyroid hormone receptor confers the ability of the DNA site to dictate positive or negative transcriptional activity

    International Nuclear Information System (INIS)

    Holloway, J.M.; Glass, C.K.; Adler, S.; Nelson, C.A.; Rosenfeld, M.G.

    1990-01-01

    To investigate mechanisms responsible for positive and negative transcriptional control, the authors have utilized two types of promoters that are diffferentially regulated by thyroid hormone (T 3 ) receptors. Promoters containing the palindromic T 3 response element TCAGGTCA TGACCTGA are positively regulated by the T 3 receptor after the administration of T 3 , whereas otherwise identical promoters containing the estrogen response element TCAGGTCA CTG TGACCTGA can be regulated negatively; converse effects are observed with the estrogen receptor. They describe evidence that the transcriptional inhibitory effects of the T 3 or estrogen receptors on the estrogen or T 3 response elements, respectively, are imposed by amino acid sequences in the C'-terminal region that colocalize with dimerization and hormone-binding domains and that these sequences can transfer inhibitory functions to other classes of transcription factors. Removal of the C'-terminal dimerization and hormone-binding domains of either the αT 3 or estrogen receptors permits each receptor to act constitutively to enhance transcription on both T 3 and estrogen response elements. It is, therefore, suggested that protein-protein interactions between receptor C' termini limit the subset of DNA binding sites on which transcriptional activation occurs

  19. Unfinished Business in Families of Terminally Ill With Cancer Patients.

    Science.gov (United States)

    Yamashita, Ryoko; Arao, Harue; Takao, Ayumi; Masutani, Eiko; Morita, Tatsuya; Shima, Yasuo; Kizawa, Yoshiyuki; Tsuneto, Satoru; Aoyama, Maho; Miyashita, Mitsunori

    2017-12-01

    Unfinished business often causes psychological issues after bereavement. Providing care for families of terminally ill patients with cancer to prevent unfinished business is important. To clarify the prevalence and types of unfinished business in families of end-of-life patients with cancer admitted to palliative care units (PCUs), explore depression and grief associated with unfinished business, and explore the factors affecting unfinished business. We conducted a cross-sectional, anonymous, self-report questionnaire survey with 967 bereaved families of patients with cancer admitted to PCUs. The questionnaire assessed the presence or the absence of unfinished business, content of unfinished business, depression, grief, process of preparedness, condition of the family and patient, and the degree of involvement of health care professionals. Questionnaires were sent to 967 families, and 73.0% responded. In total, 26.0% of families had some unfinished business, with improvement of the patient-family relationship being a common type of unfinished business. Families with unfinished business had significantly higher depression and grief scores after bereavement compared with those without. Factors that influenced the presence or the absence of unfinished business were preparedness for the patient's death (P = 0.001), discussion between the patient and family about the disease trajectory and way to spend daily life (P business. Health care professionals should coordinate the appropriate timing for what the family wishes to do, with consideration of family dynamics, including the family's preparedness, communication pattern, and relationships. Copyright © 2017 American Academy of Hospice and Palliative Medicine. Published by Elsevier Inc. All rights reserved.

  20. Expression, crystallization and preliminary crystallographic study of mouse hepatitis virus (MHV) nucleocapsid protein C-terminal domain

    International Nuclear Information System (INIS)

    Tong, Xiaohang; Ma, Yanlin; Li, Xuemei

    2010-01-01

    The C-terminal domain of mouse hepatitis virus nucleocapsid protein has been overexpressed in E. coli, purified and crystallized. The crystal belonged to space group P422, with unit-cell parameters a = 66.6, c = 50.8 Å, and diffracted to 2.20 Å resolution. Mouse hepatitis virus (MHV) belongs to the group II coronaviruses. The virus produces nine genes encoding 11 proteins that could be recognized as structural proteins and nonstructural proteins and are crucial for viral RNA synthesis. The nucleocapsid (N) protein, one of the structural proteins, interacts with the 30.4 kb virus genomic RNA to form the helical nucleocapsid and associates with the membrane glycoprotein via its C-terminus to stabilize virion assembly. Here, the expression and crystallization of the MHV nucleocapsid protein C-terminal domain are reported. The crystals diffracted to 2.20 Å resolution and belonged to space group P422, with unit-cell parameters a = 66.6, c = 50.8 Å. Assuming the presence of two molecules in the asymmetric unit, the solvent content is 43.0% (V M = 2.16 Å 3 Da −1 )

  1. Integrated Marketing Communication (Imc) Green Radio 96,7 Fm Pekanbaru Dalam Membangun Brand Image Sebagai Media Berbasis Lingkungan

    OpenAIRE

    Marbun, Tresia Br; ", Rumyeni

    2017-01-01

    Integrated Marketing Communication (IMC) is the company's effort to integrate and coordinate all communication channels to deliver its message clearly, consistently and strongly influences its organization and products. Green Radio 96.7 FM Pekanbaru is the only electronic media that focuses on broadcasting news Environmental issues in Riau Province. This radio builds brand image as an environment-based media by choosing to use Integrated Marketing Communication (IMC). This study aims to find ...

  2. Characterization and chromosomal organization of the murD-murC-ftsQ region of Corynebacterium glutamicum ATCC 13869.

    Science.gov (United States)

    Ramos, Angelina; Honrubia, Maria P; Vega, Daniel; Ayala, Juan A; Bouhss, Ahmed; Mengin-Lecreulx, Dominique; Gil, José A

    2004-04-01

    The sequence of a 4.6-kb region of DNA from Corynebacterium glutamicum ATCC 13869 lying upstream from the ftsQ-ftsZ region has been determined. The region contains four genes with high similarity to the murD, ftsW, murG, and murC genes from different microorganisms. The products of these mur genes probably catalyse several steps in the formation of the precursors for peptidoglycan synthesis in C. glutamicum, whereas ftsW might play also a role in the stabilisation of the FtsZ ring during cell division. The murC gene product was purified to near homogeneity and its UDP-N-acetylmuramate: L-alanine adding activity was demonstrated. Northern analysis indicated that ftsW, murG and ftsQ are poorly expressed in C. glutamicum whereas murC and ftsZ are expressed at higher levels at the beginning of the exponential phase. Dicistronic (ftsQ-ftsZ) and monocistronic (murC and ftsZ) transcripts can be detected using specific probes and are in agreement with the lack of transcriptional terminators in the partially analysed dcw cluster. Disruption experiments performed in C. glutamicum using internal fragments of the ftsW, murG and murC genes allowed us to conclude that FtsW, MurG, and MurC are essential gene products in C. glutamicum.

  3. The C-terminal sequence of IFITM1 regulates its anti-HIV-1 activity.

    Directory of Open Access Journals (Sweden)

    Rui Jia

    Full Text Available The interferon-inducible transmembrane (IFITM proteins inhibit a wide range of viruses. We previously reported the inhibition of human immunodeficiency virus type 1 (HIV-1 strain BH10 by human IFITM1, 2 and 3. It is unknown whether other HIV-1 strains are similarly inhibited by IFITMs and whether there exists viral countermeasure to overcome IFITM inhibition. We report here that the HIV-1 NL4-3 strain (HIV-1NL4-3 is not restricted by IFITM1 and its viral envelope glycoprotein is partly responsible for this insensitivity. However, HIV-1NL4-3 is profoundly inhibited by an IFITM1 mutant, known as Δ(117-125, which is deleted of 9 amino acids at the C-terminus. In contrast to the wild type IFITM1, which does not affect HIV-1 entry, the Δ(117-125 mutant diminishes HIV-1NL4-3 entry by 3-fold. This inhibition correlates with the predominant localization of Δ(117-125 to the plasma membrane where HIV-1 entry occurs. In spite of strong conservation of IFITM1 among most species, mouse IFITM1 is 19 amino acids shorter at its C-terminus as compared to human IFITM1 and, like the human IFITM1 mutant Δ(117-125, mouse IFITM1 also inhibits HIV-1 entry. This is the first report illustrating the role of viral envelope protein in overcoming IFITM1 restriction. The results also demonstrate the importance of the C-terminal region of IFITM1 in modulating the antiviral function through controlling protein subcellular localization.

  4. Amino-terminal extension present in the methionine aminopeptidase type 1c of Mycobacterium tuberculosis is indispensible for its activity

    Directory of Open Access Journals (Sweden)

    Kumaran Sangaralingam

    2011-07-01

    Full Text Available Abstract Background Methionine aminopeptidase (MetAP is a ubiquitous enzyme in both prokaryotes and eukaryotes, which catalyzes co-translational removal of N-terminal methionine from elongating polypeptide chains during protein synthesis. It specifically removes the terminal methionine in all organisms, if the penultimate residue is non-bulky and uncharged. The MetAP action for exclusion of N-terminal methionine is mandatory in 50-70% of nascent proteins. Such an activity is required for proper sub cellular localization, additional processing and eventually for the degradation of proteins. Results We cloned genes encoding two such metalloproteases (MtMetAP1a and MtMetAP1c present in Mycobacterium tuberculosis and expressed them as histidine-tagged proteins in Escherichia coli. Although they have different substrate preferences, for Met-Ala-Ser, we found, MtMetAP1c had significantly high enzyme turnover rate as opposed to MtMetAP1a. Circular dichroism spectroscopic studies as well as monitoring of enzyme activity indicated high temperature stability (up to 50°C of MtMetAP1a compared to that of the MtMetAP1c. Modelling of MtMetAP1a based on MtMetAP1c crystal structure revealed the distinct spatial arrangements of identical active site amino acid residues and their mutations affected the enzymatic activities of both the proteins. Strikingly, we observed that 40 amino acid long N-terminal extension of MtMetAP1c, compared to its other family members, contributes towards the activity and stability of this enzyme, which has never been reported for any methionine aminopeptidase. Furthermore, mutational analysis revealed that Val-18 and Pro-19 of MtMetAP1c are crucial for its enzymatic activity. Consistent with this observation, molecular dynamic simulation studies of wild-type and these variants strongly suggest their involvement in maintaining active site conformation of MtMetAP1c. Conclusion Our findings unequivocally emphasized that N-terminal

  5. 7 CFR 205.640 - Fees and other charges for accreditation.

    Science.gov (United States)

    2010-01-01

    ... MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE (CONTINUED) ORGANIC FOODS PRODUCTION ACT PROVISIONS NATIONAL ORGANIC PROGRAM Administrative Fees § 205.640 Fees and other charges for accreditation. Fees and other charges equal as nearly as may be to the cost of the...

  6. CCNA Cisco Certified Network Associate Study Guide: Exam 640-801

    CERN Document Server

    Lammle, Todd

    2006-01-01

    Here's the book you need to prepare for Cisco's revised CCNA exam, 640-801. This new edition of the best-selling CCNA Study Guide provides in-depth coverage of every CCNA exam objective, practical information on Cisco internetworking solutions and hundreds of challenging review questions.

  7. An N-terminal region of a Myb-like protein is involved in its intracellular localization and activation of a gibberellin-inducible proteinase gene in germinated rice seeds.

    Science.gov (United States)

    Sutoh, Keita; Washio, Kenji; Imai, Ryozo; Wada, Masamitsu; Nakai, Tomonori; Yamauchi, Daisuke

    2015-01-01

    The expression of the gene for a proteinase (Rep1) is upregulated by gibberellins. The CAACTC regulatory element (CARE) of the Rep1 promoter is involved in the gibberellin response. We isolated a cDNA for a CARE-binding protein containing a Myb domain in its carboxyl-terminal region and designated the gene Carboxyl-terminal Myb1 (CTMyb1). This gene encodes two polypeptides of two distinctive lengths, CTMyb1L and CTMyb1S, which include or exclude 213 N-terminal amino acid residues, respectively. CTMyb1S transactivated the Rep1 promoter in the presence of OsGAMyb, but not CTMyb1L. We observed an interaction between CTMyb1S and the rice prolamin box-binding factor (RPBF). A bimolecular fluorescence complex analysis detected the CTMyb1S and RPBF complex in the nucleus, but not the CTMyb1L and RPBF complex. The results suggest that the arrangement of the transfactors is involved in gibberellin-inducible expression of Rep1.

  8. Performance of a 967 nm CW diode end-pumped Er:GSGG laser at 2.79 μm

    International Nuclear Information System (INIS)

    Wu, Z H; Sun, D L; Wang, S Z; Luo, J Q; Li, X L; Huang, L; Hu, A L; Tang, Y Q; Guo, Q

    2013-01-01

    We demonstrated a 967 nm diode end-pumped Er:GSGG laser operated at 2.794 μm with spectral width 3.6 nm in the continuous wave (CW) mode. A maximum output power of 440 mW is obtained at an incident pumping power of 3.4 W, which corresponds to an optical-to-optical efficiency of 13% and slope efficiency of 13.2%. The results suggest that a short cavity and efficient cooling setup for the crystal help to improve laser performance. (paper)

  9. Planning of Terminal Construction at the Port of Ploce

    Directory of Open Access Journals (Sweden)

    Čedomir Dundović

    2007-07-01

    Full Text Available The paper presents a systematic and comprehensive analysisof both the technological justification for the constructionof a container/multi-purpose terminal and a dry bulk terminal,and the efficiency of loading/unloading facilities. The organisationof Croatian ports is inefficient and the technology usedin outdated. Traffic links with the mainland, the continent andthe world are unsatisfactory, with traffic infrastructure impactingadversely on operational efficiency. Analysis results of thepresent condition of port traffic and the influence of traffic onport operations and development indicate that the Port ofPlace lacks a multi-purpose terminal that would enable modemcontainer traffic. Because of the inefficient cargo-handlingprocedure and manner of storing bulk cargo in the Port ofPlace, it is necessary to plan the construction of a coal andiron ore terminal taking into account spatia~ technological,economic and ecological development factors. The authorsalso examine the importance of regional initiatives spurringthe development of Croatia and, in particular, the port systemas part of the EU's Pan-European transport corridor V BranchC. Research results are presented by a traffic and technologicaldesign for a container/multi-purpose terminal and dry bulkterminal capable of providing an appropriate level of servicefor all terminal users.

  10. Arabidopsis Microtubule-Associated Protein MAP65-3 Cross-Links Antiparallel Microtubules toward Their Plus Ends in the Phragmoplast via Its Distinct C-Terminal Microtubule Binding Domain[W

    Science.gov (United States)

    Ho, Chin-Min Kimmy; Lee, Yuh-Ru Julie; Kiyama, Lindsay D.; Dinesh-Kumar, Savithramma P.; Liu, Bo

    2012-01-01

    Plant cytokinesis is brought about by the phragmoplast, which contains an antiparallel microtubule (MT) array. The MT-associated protein MAP65-3 acts as an MT-bundling factor that specifically cross-links antiparallel MTs near their plus ends. MAP65 family proteins contain an N-terminal dimerization domain and C-terminal MT interaction domain. Compared with other MAP65 isoforms, MAP65-3 contains an extended C terminus. A MT binding site was discovered in the region between amino acids 496 and 588 and found to be essential for the organization of phragmoplast MTs. The frequent cytokinetic failure caused by loss of MAP65-3 was not rescued by ectopic expression of MAP65-1 under the control of the MAP65-3 promoter, indicating nonoverlapping functions between the two isoforms. In the presence of MAP65-3, however, ectopic MAP65-1 appeared in the phragmoplast midline. We show that MAP65-1 could acquire the function of MAP65-3 when the C terminus of MAP65-3, which contains the MT binding site, was grafted to it. Our results also show that MAP65-1 and MAP65-3 may share redundant functions in MT stabilization. Such a stabilization effect was likely brought about by MT binding and bundling. We conclude that MAP65-3 contains a distinct C-terminal MT binding site with a specific role in cross-linking antiparallel MTs toward their plus ends in the phragmoplast. PMID:22570443

  11. Thermal behavior of Ni (99.967% and 99.5% purity) deformed to an ultra-high strain by high pressure torsion

    DEFF Research Database (Denmark)

    Zhang, H.W.; Huang, Xiaoxu; Pippan, R.

    2010-01-01

    Polycrystalline Ni of two purities (99.967% (4N) and 99.5% (2N)) was deformed to an ultra-high strain of εvM = 100 (εvM, von Mises strain) by high pressure torsion at room temperature. The 4N and 2N samples at this strain are nanostructured with an average boundary spacing of 100 nm, a high density...

  12. Cellulose microfibril crystallinity is reduced by mutating C-terminal transmembrane region residues CESA1{sup A903V} and CESA3{sup T942I} of cellulose synthase

    Energy Technology Data Exchange (ETDEWEB)

    Harris, Darby; Corbin, Kendall; Wang, Tuo; Gutierrez, Ryan; Bertolo, Ana; Petti, Caroalberto; Smilgies, Detlef-M; Estevez, Jose Manuel; Bonetta, Dario; Urbanowicz, Breeanna; Ehrhardt, David; Somerville, Chris; Rose, Jocelyn; Hong, Mei; DeBolt, Seth

    2012-01-08

    The mechanisms underlying the biosynthesis of cellulose in plants are complex and still poorly understood. A central question concerns the mechanism of microfibril structure and how this is linked to the catalytic polymerization action of cellulose synthase (CESA). Furthermore, it remains unclear whether modification of cellulose microfibril structure can be achieved genetically, which could be transformative in a bio-based economy. To explore these processes in planta, we developed a chemical genetic toolbox of pharmacological inhibitors and corresponding resistance-conferring point mutations in the C-terminal transmembrane domain region of CESA1{sup A903V} and CESA3{sup T942I} in Arabidopsis thaliana. Using {sup 13}C solid-state nuclear magnetic resonance spectroscopy and X-ray diffraction, we show that the cellulose microfibrils displayed reduced width and an additional cellulose C4 peak indicative of a degree of crystallinity that is intermediate between the surface and interior glucans of wild type, suggesting a difference in glucan chain association during microfibril formation. Consistent with measurements of lower microfibril crystallinity, cellulose extracts from mutated CESA1{sup A903V} and CESA3{sup T942I} displayed greater saccharification efficiency than wild type. Using live-cell imaging to track fluorescently labeled CESA, we found that these mutants show increased CESA velocities in the plasma membrane, an indication of increased polymerization rate. Collectively, these data suggest that CESA1{sup A903V} and CESA3{sup T942I} have modified microfibril structure in terms of crystallinity and suggest that in plants, as in bacteria, crystallization biophysically limits polymerization.

  13. 640 X 480 MOS PtSi IR sensor

    Science.gov (United States)

    Sauer, Donald J.; Shallcross, Frank V.; Hseuh, Fu-Lung; Meray, Grazyna M.; Levine, Peter A.; Gilmartin, Harvey R.; Villani, Thomas S.; Esposito, Benjamin J.; Tower, John R.

    1991-12-01

    The design of a 1st and 2nd generation 640(H) X 480(V) element PtSi Schottky-barrier infrared image sensor employing a low-noise MOS X-Y addressable readout multiplexer and on-chip low-noise output amplifier is described. Measured performance characteristics for Gen 1 devices are presented along with calculated performance for the Gen 2 design. A multiplexed horizontal/vertical input address port and on-chip decoding is used to load scan data into CMOS horizontal and vertical scanning registers. This allows random access to any sub-frame in the 640 X 480 element focal plane array. By changing the digital pattern applied to the vertical scan register, the FPA can be operated in either an interlaced or non- interlaced format, and the integration time may be varied over a wide range (60 microsecond(s) to > 30 ms, for RS170 operation) resulting in a form of 'electronic shutter,' or variable exposure control. The pixel size of 24-micrometers X 24-micrometers results in a fill factor of 38% for 1.5-micrometers process design rules. The overall die size for the IR imager is 13.7 mm X 17.2 mm. All digital inputs to the chip are TTL compatible and include ESD protection.

  14. C-terminal sequences of hsp70 and hsp90 as non-specific anchors for tetratricopeptide repeat (TPR) proteins.

    Science.gov (United States)

    Ramsey, Andrew J; Russell, Lance C; Chinkers, Michael

    2009-10-12

    Steroid-hormone-receptor maturation is a multi-step process that involves several TPR (tetratricopeptide repeat) proteins that bind to the maturation complex via the C-termini of hsp70 (heat-shock protein 70) and hsp90 (heat-shock protein 90). We produced a random T7 peptide library to investigate the roles played by the C-termini of the two heat-shock proteins in the TPR-hsp interactions. Surprisingly, phages with the MEEVD sequence, found at the C-terminus of hsp90, were not recovered from our biopanning experiments. However, two groups of phages were isolated that bound relatively tightly to HsPP5 (Homo sapiens protein phosphatase 5) TPR. Multiple copies of phages with a C-terminal sequence of LFG were isolated. These phages bound specifically to the TPR domain of HsPP5, although mutation studies produced no evidence that they bound to the domain's hsp90-binding groove. However, the most abundant family obtained in the initial screen had an aspartate residue at the C-terminus. Two members of this family with a C-terminal sequence of VD appeared to bind with approximately the same affinity as the hsp90 C-12 control. A second generation pseudo-random phage library produced a large number of phages with an LD C-terminus. These sequences acted as hsp70 analogues and had relatively low affinities for hsp90-specific TPR domains. Unfortunately, we failed to identify residues near hsp90's C-terminus that impart binding specificity to individual hsp90-TPR interactions. The results suggest that the C-terminal sequences of hsp70 and hsp90 act primarily as non-specific anchors for TPR proteins.

  15. Structure of a C-terminal AHNAK peptide in a 1:2:2 complex with S100A10 and an acetylated N-terminal peptide of annexin A2

    Energy Technology Data Exchange (ETDEWEB)

    Ozorowski, Gabriel [University of California, Irvine, Irvine, CA 92697-3900 (United States); University of California, Irvine, Irvine, CA 92697-3900 (United States); Milton, Saskia [University of California, Irvine, Irvine, CA 92697-3900 (United States); Luecke, Hartmut, E-mail: hudel@uci.edu [University of California, Irvine, Irvine, CA 92697-3900 (United States); University of California, Irvine, Irvine, CA 92697-3900 (United States); University of California, Irvine, Irvine, CA 92697 (United States); University of California, Irvine, Irvine, CA 92697 (United States)

    2013-01-01

    Structure of a 20-amino-acid peptide of AHNAK bound asymmetrically to the AnxA2–S100A10A heterotetramer (1:2:2 symmetry) provides insights into the atomic level interactions that govern this membrane-repair scaffolding complex. AHNAK, a large 629 kDa protein, has been implicated in membrane repair, and the annexin A2–S100A10 heterotetramer [(p11){sub 2}(AnxA2){sub 2})] has high affinity for several regions of its 1002-amino-acid C-terminal domain. (p11){sub 2}(AnxA2){sub 2} is often localized near the plasma membrane, and this C2-symmetric platform is proposed to be involved in the bridging of membrane vesicles and trafficking of proteins to the plasma membrane. All three proteins co-localize at the intracellular face of the plasma membrane in a Ca{sup 2+}-dependent manner. The binding of AHNAK to (p11){sub 2}(AnxA2){sub 2} has been studied previously, and a minimal binding motif has been mapped to a 20-amino-acid peptide corresponding to residues 5654–5673 of the AHNAK C-terminal domain. Here, the 2.5 Å resolution crystal structure of this 20-amino-acid peptide of AHNAK bound to the AnxA2–S100A10 heterotetramer (1:2:2 symmetry) is presented, which confirms the asymmetric arrangement first described by Rezvanpour and coworkers and explains why the binding motif has high affinity for (p11){sub 2}(AnxA2){sub 2}. Binding of AHNAK to the surface of (p11){sub 2}(AnxA2){sub 2} is governed by several hydrophobic interactions between side chains of AHNAK and pockets on S100A10. The pockets are large enough to accommodate a variety of hydrophobic side chains, allowing the consensus sequence to be more general. Additionally, the various hydrogen bonds formed between the AHNAK peptide and (p11){sub 2}(AnxA2){sub 2} most often involve backbone atoms of AHNAK; as a result, the side chains, particularly those that point away from S100A10/AnxA2 towards the solvent, are largely interchangeable. While the structure-based consensus sequence allows interactions with various

  16. Charge neutralization as the major factor for the assembly of nucleocapsid-like particles from C-terminal truncated hepatitis C virus core protein

    OpenAIRE

    Theo Luiz Ferraz de Souza; Sheila Maria Barbosa de Lima; Vanessa L. de Azevedo Braga; David S. Peabody; Davis Fernandes Ferreira; M. Lucia Bianconi; Andre Marco de Oliveira Gomes; Jerson Lima Silva; Andréa Cheble de Oliveira

    2016-01-01

    Background Hepatitis C virus (HCV) core protein, in addition to its structural role to form the nucleocapsid assembly, plays a critical role in HCV pathogenesis by interfering in several cellular processes, including microRNA and mRNA homeostasis. The C-terminal truncated HCV core protein (C124) is intrinsically unstructured in solution and is able to interact with unspecific nucleic acids, in the micromolar range, and to assemble into nucleocapsid-like particles (NLPs) in vitro. The specific...

  17. Conformational effects of a common codon 751 polymorphism on the C-terminal domain of the xeroderma pigmentosum D protein

    Directory of Open Access Journals (Sweden)

    Monaco Regina

    2009-01-01

    Full Text Available Aim: The xeroderma pigmentosum D (XPD protein is a DNA helicase involved in the repair of DNA damage, including nucleotide excision repair (NER and transcription-coupled repair (TCR. The C-terminal domain of XPD has been implicated in interactions with other components of the TFIIH complex, and it is also the site of a common genetic polymorphism in XPD at amino acid residue 751 (Lys->Gln. Some evidence suggests that this polymorphism may alter DNA repair capacity and increase cancer risk. The aim of this study was to investigate whether these effects could be attributable to conformational changes in XPD induced by the polymorphism. Materials and Methods: Molecular dynamics techniques were used to predict the structure of the wild-type and polymorphic forms of the C-terminal domain of XPD and differences in structure produced by the polymorphic substitution were determined. Results: The results indicate that, although the general configuration of both proteins is similar, the substitution produces a significant conformational change immediately N-terminal to the site of the polymorphism. Conclusion: These results provide support for the hypothesis that this polymorphism in XPD could affect DNA repair capability, and hence cancer risk, by altering the structure of the C-terminal domain.

  18. C-terminal low-complexity sequence repeats of Mycobacterium smegmatis Ku modulate DNA binding.

    Science.gov (United States)

    Kushwaha, Ambuj K; Grove, Anne

    2013-01-24

    Ku protein is an integral component of the NHEJ (non-homologous end-joining) pathway of DSB (double-strand break) repair. Both eukaryotic and prokaryotic Ku homologues have been characterized and shown to bind DNA ends. A unique feature of Mycobacterium smegmatis Ku is its basic C-terminal tail that contains several lysine-rich low-complexity PAKKA repeats that are absent from homologues encoded by obligate parasitic mycobacteria. Such PAKKA repeats are also characteristic of mycobacterial Hlp (histone-like protein) for which they have been shown to confer the ability to appose DNA ends. Unexpectedly, removal of the lysine-rich extension enhances DNA-binding affinity, but an interaction between DNA and the PAKKA repeats is indicated by the observation that only full-length Ku forms multiple complexes with a short stem-loop-containing DNA previously designed to accommodate only one Ku dimer. The C-terminal extension promotes DNA end-joining by T4 DNA ligase, suggesting that the PAKKA repeats also contribute to efficient end-joining. We suggest that low-complexity lysine-rich sequences have evolved repeatedly to modulate the function of unrelated DNA-binding proteins.

  19. Intrinsic structural differences in the N-terminal segment of pulmonary surfactant protein SP-C from different species

    DEFF Research Database (Denmark)

    Plasencia, I; Rivas, L; Casals, C

    2001-01-01

    Predictive studies suggest that the known sequences of the N-terminal segment of surfactant protein SP-C from animal species have an intrinsic tendency to form beta-turns, but there are important differences on the probable location of these motifs in different SP-C species. Our hypothesis...

  20. Crystal structure of a C-terminal deletion mutant of human protein kinase CK2 catalytic subunit

    DEFF Research Database (Denmark)

    Ermakova, Inessa; Boldyreff, Brigitte; Issinger, Olaf-Georg

    2003-01-01

    structure of a C-terminal deletion mutant of human CK2alpha was solved and refined to 2.5A resolution. In the crystal the CK2alpha mutant exists as a monomer in agreement with the organization of the subunits in the CK2 holoenzyme. The refined structure shows the helix alphaC and the activation segment, two...

  1. Cloning, expression, purification, crystallization and preliminary X-ray studies of the C-terminal domain of Rv3262 (FbiB) from Mycobacterium tuberculosis

    International Nuclear Information System (INIS)

    Rehan, Aisyah M.; Bashiri, Ghader; Paterson, Neil G.; Baker, Edward N.; Squire, Christopher J.

    2011-01-01

    The C-terminal domain of FbiB, a bifunctional protein that is essential for the biosynthesis of cofactor F 420 in M. tuberculosis, has been expressed, purified and crystallized. The crystals diffracted to 2.0 Å resolution and were suitable for structure determination. During cofactor F 420 biosynthesis, the enzyme F 420 -γ-glutamyl ligase (FbiB) catalyzes the addition of γ-linked l-glutamate residues to form polyglutamylated F 420 derivatives. In Mycobacterium tuberculosis, Rv3262 (FbiB) consists of two domains: an N-terminal domain from the F 420 ligase superfamily and a C-terminal domain with sequence similarity to nitro-FMN reductase superfamily proteins. To characterize the role of the C-terminal domain of FbiB in polyglutamyl ligation, it has been purified and crystallized in an apo form. The crystals diffracted to 2.0 Å resolution using a synchrotron source and belonged to the tetragonal space group P4 1 2 1 2 (or P4 3 2 1 2), with unit-cell parameters a = b = 136.6, c = 101.7 Å, α = β = γ = 90°

  2. New primers for amplification of cytochrome c oxidase subunit I barcode region designed for species of Decapoda (Crustacea

    Directory of Open Access Journals (Sweden)

    Fernando L. Mantelatto

    Full Text Available Abstract We designed 14 new primers for amplification of the COI barcode region of decapod crustacean species. We tested, with high level of success, the generation of ~ 640 ± 49 base-pair sequences in selected groups of decapods (hermit crabs, squat lobsters, marine and freshwater crabs and shrimps, encompassing representatives of 27 genera of 15 families, 11 of Pleocyemata (Anomura, Brachyura, and Caridea and 4 of Dendrobranchiata. Based on the results we expect the applicability of these primers for several studies with different taxa within Decapoda.

  3. Structure of metabotropic glutamate receptor C-terminal domains in contact with interacting proteins

    Directory of Open Access Journals (Sweden)

    Ralf eEnz

    2012-04-01

    Full Text Available Metabotropic glutamate receptors (mGluRs regulate intracellular signal pathways that control several physiological tasks, including neuronal excitability, learning and memory. This is achieved by the formation of synaptic signal complexes, in which mGluRs assemble with functionally related proteins such as enzymes, scaffolds and cytoskeletal anchor proteins. Thus, mGluR associated proteins actively participate in the regulation of glutamatergic neurotransmission. Importantly, dysfunction of mGluRs and interacting proteins may lead to impaired signal transduction and finally result in neurological disorders, e.g. night blindness, addiction, epilepsy, schizophrenia, autism spectrum disorders and Parkinson´s disease. In contrast to solved crystal structures of extracellular N-terminal domains of some mGluR types, only a few studies analyzed the conformation of intracellular receptor domains. Intracellular C-termini of most mGluR types are subject to alternative splicing and can be further modified by phosphorylation and SUMOylation. In this way, diverse interaction sites for intracellular proteins that bind to and regulate the glutamate receptors are generated. Indeed, most of the known mGluR binding partners interact with the receptors´ C-terminal domains. Within the last years, different laboratories analyzed the structure of these domains and described the geometry of the contact surface between mGluR C-termini and interacting proteins. Here, I will review recent progress in the structure characterization of mGluR C-termini and provide an up-to-date summary of the geometry of these domains in contact with binding partners.

  4. HIPK1 interacts with c-Myb and modulates its activity through phosphorylation

    International Nuclear Information System (INIS)

    Matre, Vilborg; Nordgard, Oddmund; Alm-Kristiansen, Anne Hege; Ledsaak, Marit; Gabrielsen, Odd Stokke

    2009-01-01

    The transcription factor v-Myb is a potent inducer of myeloid leukaemias, and its cellular homologue c-Myb plays a crucial role in the regulation of haematopoiesis. In a yeast two-hybrid (Y2H) screening we identified the nuclear kinase HIPK1 as an interaction partner for human c-Myb. The interaction involves a C-terminal region of HIPK1, while a bipartite interaction surface was identified in c-Myb, including regions in its N-terminal DNA-binding domain as well as in its C-terminal region. HIPK1 and c-Myb co-localize in distinct nuclear foci upon co-transfection. c-Myb appears to be phosphorylated by HIPK1 in its negative regulatory domain as supported by both in vivo and in vitro data. A functional assay revealed that HIPK1 repressed the ability of c-Myb to activate a chromatin embedded target gene, mim-1, in haematopoetic cells. Our findings point to a novel link between an important kinase and a key regulator of haematopoiesis.

  5. All-optical phase-preserving amplitude regeneration of a 640 Gbit/s RZ-DPSK signal

    DEFF Research Database (Denmark)

    Lali-Dastjerdi, Zohreh; Galili, Michael; Mulvad, Hans Christian Hansen

    2013-01-01

    Phase-preserving amplitude regeneration based on optical parametric amplification has been experimentally demonstrated for a 640 Gbit/s RZ-DPSK signal. Improvement of 2.2 dB in receiver sensitivity at a BER of 10-9 together with 13.3 dB net gain have been successfully achieved.......Phase-preserving amplitude regeneration based on optical parametric amplification has been experimentally demonstrated for a 640 Gbit/s RZ-DPSK signal. Improvement of 2.2 dB in receiver sensitivity at a BER of 10-9 together with 13.3 dB net gain have been successfully achieved....

  6. GlyGly-CTERM and rhombosortase: a C-terminal protein processing signal in a many-to-one pairing with a rhomboid family intramembrane serine protease.

    Directory of Open Access Journals (Sweden)

    Daniel H Haft

    Full Text Available The rhomboid family of serine proteases occurs in all domains of life. Its members contain at least six hydrophobic membrane-spanning helices, with an active site serine located deep within the hydrophobic interior of the plasma membrane. The model member GlpG from Escherichia coli is heavily studied through engineered mutant forms, varied model substrates, and multiple X-ray crystal studies, yet its relationship to endogenous substrates is not well understood. Here we describe an apparent membrane anchoring C-terminal homology domain that appears in numerous genera including Shewanella, Vibrio, Acinetobacter, and Ralstonia, but excluding Escherichia and Haemophilus. Individual genomes encode up to thirteen members, usually homologous to each other only in this C-terminal region. The domain's tripartite architecture consists of motif, transmembrane helix, and cluster of basic residues at the protein C-terminus, as also seen with the LPXTG recognition sequence for sortase A and the PEP-CTERM recognition sequence for exosortase. Partial Phylogenetic Profiling identifies a distinctive rhomboid-like protease subfamily almost perfectly co-distributed with this recognition sequence. This protease subfamily and its putative target domain are hereby renamed rhombosortase and GlyGly-CTERM, respectively. The protease and target are encoded by consecutive genes in most genomes with just a single target, but far apart otherwise. The signature motif of the Rhombo-CTERM domain, often SGGS, only partially resembles known cleavage sites of rhomboid protease family model substrates. Some protein families that have several members with C-terminal GlyGly-CTERM domains also have additional members with LPXTG or PEP-CTERM domains instead, suggesting there may be common themes to the post-translational processing of these proteins by three different membrane protein superfamilies.

  7. Study of the density of ganglion cells in the terminal bowel of rats with anorectal malformations Estudo da densidade das células ganglionares no intestino terminal de ratos portadores de anomalia anorretal

    Directory of Open Access Journals (Sweden)

    Maurício Macedo

    2007-12-01

    Full Text Available PURPOSE: To study the ganglion cells (GC in the terminal bowel of rats with ethylenethiourea (ETU induced anorectal malformations (ARM. METHODS: The animals were divided into three groups: Group A - normal fetuses from pregnant rats that were not administered ETU; Group B - fetuses without ARM born from pregnant rats that were administered ETU and Group C - fetuses with ARM born from pregnant rats that received ETU. ETU was administered on the 11th day of pregnancy at the dose of 125 mg/kg body weight by gastric gavage. The rats had cesarean section on the 21st day of gestation. The fetuses’ terminal bowel tissue was analyzed by immunohistochemistry to demonstrate ganglion cells. RESULTS: Statistically significant differences were found between groups A, B and C regarding ganglion cell densities. Group A had the highest cell density, followed by Group B and the lowest density was found in Group C. CONCLUSION: Ganglion cell densities are decreased in the terminal bowel of rats with ARM.OBJETIVO: Estudar as células ganglionares (CG no intestino terminal de ratos portadores de anomalia anorretal (AAR induzida pela etilenotiouréia (ETU. MÉTODOS: Os animais foram distribuídos em três grupos: Grupo A - fetos normais, obtidos de ratas grávidas às quais não foi administrada ETU; Grupo B - fetos não portadores de AAR obtidos de ratas grávidas às quais foi administrada ETU e Grupo C - fetos portadores de AAR obtidos de ratas grávidas às quais foi administrada ETU. A ETU foi administrada no décimo primeiro dia de gestação na dose de 125 mg/Kg, por gavagem. As ratas foram submetidas à laparotomia e histerotomia para retirada dos fetos no vigésimo primeiro dia de gestação. O intestino terminal dos fetos foi retirado e analisado por imunohistoquímica para pesquisa de CG. RESULTADOS: Foram encontradas diferenças estatisticamente significantes entre os grupos A, B e C quanto à densidade de CG. O grupo A apresentou a maior densidade

  8. C-Terminal carbohydrate-binding module 9_2 fused to the N-terminus of GH11 xylanase from Aspergillus niger.

    Science.gov (United States)

    Xu, Wenxuan; Liu, Yajuan; Ye, Yanxin; Liu, Meng; Han, Laichuang; Song, Andong; Liu, Liangwei

    2016-10-01

    The 9_2 carbohydrate-binding module (C2) locates natively at the C-terminus of the GH10 thermophilic xylanase from Thermotoga marimita. When fused to the C-terminus, C2 improved thermostability of a GH11 xylanase (Xyn) from Aspergillus niger. However, a question is whether the C-terminal C2 would have a thermostabilizing effect when fused to the N-terminus of a catalytic module. A chimeric enzyme, C2-Xyn, was created by step-extension PCR, cloned in pET21a(+), and expressed in E. coli BL21(DE3). The C2-Xyn exhibited a 2 °C higher optimal temperature, a 2.8-fold longer thermostability, and a 4.5-fold higher catalytic efficiency on beechwood xylan than the Xyn. The C2-Xyn exhibited a similar affinity for binding to beechwood xylan and a higher affinity for oat-spelt xylan than Xyn. C2 is a thermostabilizing carbohydrate-binding module and provides a model of fusion at an enzymatic terminus inconsistent with the modular natural terminal location.

  9. Factor H C-Terminal Domains Are Critical for Regulation of Platelet/Granulocyte Aggregate Formation

    Directory of Open Access Journals (Sweden)

    Adam Z. Blatt

    2017-11-01

    Full Text Available Platelet/granulocyte aggregates (PGAs increase thromboinflammation in the vasculature, and PGA formation is tightly controlled by the complement alternative pathway (AP negative regulator, Factor H (FH. Mutations in FH are associated with the prothrombotic disease atypical hemolytic uremic syndrome (aHUS, yet it is unknown whether increased PGA formation contributes to the thrombosis seen in patients with aHUS. Here, flow cytometry assays were used to evaluate the effects of aHUS-related mutations on FH regulation of PGA formation and characterize the mechanism. Utilizing recombinant fragments of FH spanning the entire length of the protein, we mapped the regions of FH most critical for limiting AP activity on the surface of isolated human platelets and neutrophils, as well as the regions most critical for regulating PGA formation in human whole blood stimulated with thrombin receptor-activating peptide (TRAP. FH domains 19–20 were the most critical for limiting AP activity on platelets, neutrophils, and at the platelet/granulocyte interface. The role of FH in PGA formation was attributed to its ability to regulate AP-mediated C5a generation. AHUS-related mutations in domains 19–20 caused differential effects on control of PGA formation and AP activity on platelets and neutrophils. Our data indicate FH C-terminal domains are key for regulating PGA formation, thus increased FH protection may have a beneficial impact on diseases characterized by increased PGA formation, such as cardiovascular disease. Additionally, aHUS-related mutations in domains 19–20 have varying effects on control of TRAP-mediated PGA formation, suggesting that some, but not all, aHUS-related mutations may cause increased PGA formation that contributes to excessive thrombosis in patients with aHUS.

  10. Kelvin probe force microscopy studies of the charge effects upon adsorption of carbon nanotubes and C60 fullerenes on hydrogen-terminated diamond

    Science.gov (United States)

    Kölsch, S.; Fritz, F.; Fenner, M. A.; Kurch, S.; Wöhrl, N.; Mayne, A. J.; Dujardin, G.; Meyer, C.

    2018-01-01

    Hydrogen-terminated diamond is known for its unusually high surface conductivity that is ascribed to its negative electron affinity. In the presence of acceptor molecules, electrons are expected to transfer from the surface to the acceptor, resulting in p-type surface conductivity. Here, we present Kelvin probe force microscopy (KPFM) measurements on carbon nanotubes and C60 adsorbed onto a hydrogen-terminated diamond(001) surface. A clear reduction in the Kelvin signal is observed at the position of the carbon nanotubes and C60 molecules as compared with the bare, air-exposed surface. This result can be explained by the high positive electron affinity of carbon nanotubes and C60, resulting in electron transfer from the surface to the adsorbates. When an oxygen-terminated diamond(001) is used instead, no reduction in the Kelvin signal is obtained. While the presence of a charged adsorbate or a difference in work function could induce a change in the KPFM signal, a charge transfer effect of the hydrogen-terminated diamond surface, by the adsorption of the carbon nanotubes and the C60 fullerenes, is consistent with previous theoretical studies.

  11. Designing a Long Acting Erythropoietin by Fusing Three Carboxyl-Terminal Peptides of Human Chorionic Gonadotropin β Subunit to the N-Terminal and C-Terminal Coding Sequence

    Directory of Open Access Journals (Sweden)

    Fuad Fares

    2011-01-01

    Full Text Available A new analog of EPO was designed by fusing one and two CTPs to the N-terminal and C-terminal ends of EPO (EPO-(CTP3, respectively. This analog was expressed and secreted efficiently in CHO cells. The in vitro test shows that the activity of EPO-(CTP3 in TFI-1 cell proliferation assay is similar to that of EPO-WT and commercial rHEPO. However, in vivo studies indicated that treatment once a week with EPO-(CTP3 (15 μg/kg dramatically increased (~8 folds haematocrit as it was compared to rHuEPO. Moreover, it was found that EPO-(CTP3 is more effective than rHuEPO and Aranesp in increasing reticulocyte number in mice blood. The detected circulatory half-lives of rHuEPO, Aranesp, and EPO-(CTP3 following IV injection of 20 IU were 4.4, 10.8, and 13.1 h, respectively. These data established the rational for using this chimera as a long-acting EPO analog in clinics. The therapeutic efficacy of EPO-CTP analog needs to be established in higher animals and in human clinical trials.

  12. [Craniotomy without trichotomy: analysis of 640 cases].

    Science.gov (United States)

    Dvilevicius, Amylcar E; Machado, Silvio; do Rêgo, José Iram M; Santos, Daniel Souza; Pietrowski, Fábio; Reis, Arnaldo Dias

    2004-03-01

    The hair shaving in preparation for neurosurgery is frequently used in most of neurosurgical centers to perform craniotomy. We question about its necessity after our retrospective analysis of 640 patients undergoing cranial procedures without previous hair shaving. We had the overall surgical wound infection rate of 1.09%, not higher than tricotomy in the review of the literature. In 7 cases with infection, 3 patients were undergoing to CSF shunts, 3 patients had head injury, and one had brain tumor. The technique for preparing skin and hair for cranial procedures, its advantages and disadvantages are described and discussed.

  13. Amino Terminal Region of Dengue Virus NS4A Cytosolic Domain Binds to Highly Curved Liposomes

    Directory of Open Access Journals (Sweden)

    Yu-Fu Hung

    2015-07-01

    Full Text Available Dengue virus (DENV is an important human pathogen causing millions of disease cases and thousands of deaths worldwide. Non-structural protein 4A (NS4A is a vital component of the viral replication complex (RC and plays a major role in the formation of host cell membrane-derived structures that provide a scaffold for replication. The N-terminal cytoplasmic region of NS4A(1–48 is known to preferentially interact with highly curved membranes. Here, we provide experimental evidence for the stable binding of NS4A(1–48 to small liposomes using a liposome floatation assay and identify the lipid binding sequence by NMR spectroscopy. Mutations L6E;M10E were previously shown to inhibit DENV replication and to interfere with the binding of NS4A(1–48 to small liposomes. Our results provide new details on the interaction of the N-terminal region of NS4A with membranes and will prompt studies of the functional relevance of the curvature sensitive membrane anchor at the N-terminus of NS4A.

  14. 640 Gbit/s Optical Packet Switching using a Novel In-Band Optical Notch-Filter Labeling Scheme

    DEFF Research Database (Denmark)

    Medhin, Ashenafi Kiros; Galili, Michael; Oxenløwe, Leif Katsuo

    2014-01-01

    Optical packet switching of 640 Gbit/s data packets is reported using an in-band optical labeling technique based on notch-filtering of the data spectrum and extracting the label using a bandpass filter. BER 10􀀀9 is achieved.......Optical packet switching of 640 Gbit/s data packets is reported using an in-band optical labeling technique based on notch-filtering of the data spectrum and extracting the label using a bandpass filter. BER 10􀀀9 is achieved....

  15. Crystallization and preliminary crystallographic studies of the C-terminal domain of outer membrane protein A from enterohaemorrhagic Escherichia coli

    International Nuclear Information System (INIS)

    Gu, Jiang; Ji, Xiaowei; Qi, Jianxun; Ma, Ying; Mao, Xuhu; Zou, Quanming

    2010-01-01

    In this study, recombinant OmpAC from EHEC was purified and crystallized and a diffraction data set was collected to 2.7 Å resolution. Outer membrane protein A (OmpA) of enterohaemorrhagic Escherichia coli (EHEC) plays multiple roles in bacterial physiology and pathogenesis, such as mediation of bacterial conjunction, maintenance of cell shape, induction of adhesion of EHEC to host cells etc. Better understanding of the functions of OmpA will help in the control of EHEC infections. OmpA is composed of two domains: the N-terminal domain and the C-terminal domain. The N-terminal domain is a β-barrel structure and embeds in the outer membrane of the bacterium. The structure and function of the C-terminal domain of OmpA (OmpAC) remain elusive. In this study, recombinant OmpAC from EHEC was purified and crystallized and a diffraction data set was collected to 2.7 Å resolution. The crystals belonged to space group I4 1 32, with unit-cell parameter a = 158.99 Å. The Matthews coefficient and solvent content were calculated to be 2.55 Å 3 Da −1 and 51.77%, respectively, for two molecules in the asymmetric unit

  16. Crystallization of the C-terminal domain of the mouse brain cytosolic long-chain acyl-CoA thioesterase

    International Nuclear Information System (INIS)

    Serek, Robert; Forwood, Jade K.; Hume, David A.; Martin, Jennifer L.; Kobe, Bostjan

    2006-01-01

    The C-terminal domain of the mouse long-chain acyl-CoA thioesterase has been expressed in bacteria and crystallized by vapour diffusion. The crystals diffract to 2.4 Å resolution. The mammalian long-chain acyl-CoA thioesterase, the enzyme that catalyses the hydrolysis of acyl-CoAs to free fatty acids, contains two fused 4HBT (4-hydroxybenzoyl-CoA thioesterase) motifs. The C-terminal domain of the mouse long-chain acyl-CoA thioesterase (Acot7) has been expressed in bacteria and crystallized. The crystals were obtained by vapour diffusion using PEG 2000 MME as precipitant at pH 7.0 and 290 K. The crystals have the symmetry of space group R32 (unit-cell parameters a = b = 136.83, c = 99.82 Å, γ = 120°). Two molecules are expected in the asymmetric unit. The crystals diffract to 2.4 Å resolution using the laboratory X-ray source and are suitable for crystal structure determination

  17. Abl N-terminal Cap stabilization of SH3 domain dynamics†

    OpenAIRE

    Chen, Shugui; Dumitrescu, Teodora Pene; Smithgall, Thomas E.; Engen, John R.

    2008-01-01

    Crystal structures and other biochemical data indicate that the N-terminal cap (NCap) region of the Abelson tyrosine kinase (c-Abl) is important for maintaining the downregulated conformation of the kinase domain. The exact contributions that NCap makes in stabilizing the various intramolecular interactions within c-Abl are less clear. While the NCap appears important for locking the SH3/SH2 domains to the back of the kinase domain, there may be other more subtle elements of regulation. Hydro...

  18. Animal-specific C-terminal domain links myeloblastosis oncoprotein (Myb) to an ancient repressor complex

    Science.gov (United States)

    Andrejka, Laura; Wen, Hong; Ashton, Jonathan; Grant, Megan; Iori, Kevin; Wang, Amy; Manak, J. Robert; Lipsick, Joseph S.

    2011-01-01

    Members of the Myb oncoprotein and E2F-Rb tumor suppressor protein families are present within the same highly conserved multiprotein transcriptional repressor complex, named either as Myb and synthetic multivuval class B (Myb-MuvB) or as Drosophila Rb E2F and Myb-interacting proteins (dREAM). We now report that the animal-specific C terminus of Drosophila Myb but not the more highly conserved N-terminal DNA-binding domain is necessary and sufficient for (i) adult viability, (ii) proper localization to chromosomes in vivo, (iii) regulation of gene expression in vivo, and (iv) interaction with the highly conserved core of the MuvB/dREAM transcriptional repressor complex. In addition, we have identified a conserved peptide motif that is required for this interaction. Our results imply that an ancient function of Myb in regulating G2/M genes in both plants and animals appears to have been transferred from the DNA-binding domain to the animal-specific C-terminal domain. Increased expression of B-MYB/MYBL2, the human ortholog of Drosophila Myb, correlates with poor prognosis in human patients with breast cancer. Therefore, our results imply that the specific interaction of the C terminus of Myb with the MuvB/dREAM core complex may provide an attractive target for the development of cancer therapeutics. PMID:21969598

  19. Structure of the C-terminal domain of nsp4 from feline coronavirus

    International Nuclear Information System (INIS)

    Manolaridis, Ioannis; Wojdyla, Justyna A.; Panjikar, Santosh; Snijder, Eric J.; Gorbalenya, Alexander E.; Berglind, Hanna; Nordlund, Pär; Coutard, Bruno; Tucker, Paul A.

    2009-01-01

    The structure of the cytosolic C-terminal domain of nonstructural protein 4 from feline coronavirus has been determined and analyzed. Coronaviruses are a family of positive-stranded RNA viruses that includes important pathogens of humans and other animals. The large coronavirus genome (26–31 kb) encodes 15–16 nonstructural proteins (nsps) that are derived from two replicase polyproteins by autoproteolytic processing. The nsps assemble into the viral replication–transcription complex and nsp3, nsp4 and nsp6 are believed to anchor this enzyme complex to modified intracellular membranes. The largest part of the coronavirus nsp4 subunit is hydrophobic and is predicted to be embedded in the membranes. In this report, a conserved C-terminal domain (∼100 amino-acid residues) has been delineated that is predicted to face the cytoplasm and has been isolated as a soluble domain using library-based construct screening. A prototypical crystal structure at 2.8 Å resolution was obtained using nsp4 from feline coronavirus. Unmodified and SeMet-substituted proteins were crystallized under similar conditions, resulting in tetragonal crystals that belonged to space group P4 3 . The phase problem was initially solved by single isomorphous replacement with anomalous scattering (SIRAS), followed by molecular replacement using a SIRAS-derived composite model. The structure consists of a single domain with a predominantly α-helical content displaying a unique fold that could be engaged in protein–protein interactions

  20. Structure of the C-terminal domain of nsp4 from feline coronavirus

    Energy Technology Data Exchange (ETDEWEB)

    Manolaridis, Ioannis; Wojdyla, Justyna A.; Panjikar, Santosh [EMBL Hamburg Outstation, c/o DESY, Notkestrasse 85, D-22603 Hamburg (Germany); Snijder, Eric J.; Gorbalenya, Alexander E. [Molecular Virology Laboratory, Department of Medical Microbiology, Center of Infectious Diseases, Leiden University Medical Center, PO Box 9600, 2300 RC Leiden (Netherlands); Berglind, Hanna; Nordlund, Pär [Division of Biophysics, Department of Medical Biochemistry and Biophysics, Scheeles väg 2, Karolinska Institute, SE-171 77 Stockholm (Sweden); Coutard, Bruno [Laboratoire Architecture et Fonction des Macromolécules Biologiques, UMR 6098, AFMB-CNRS-ESIL, Case 925, 163 Avenue de Luminy, 13288 Marseille (France); Tucker, Paul A., E-mail: tucker@embl-hamburg.de [EMBL Hamburg Outstation, c/o DESY, Notkestrasse 85, D-22603 Hamburg (Germany)

    2009-08-01

    The structure of the cytosolic C-terminal domain of nonstructural protein 4 from feline coronavirus has been determined and analyzed. Coronaviruses are a family of positive-stranded RNA viruses that includes important pathogens of humans and other animals. The large coronavirus genome (26–31 kb) encodes 15–16 nonstructural proteins (nsps) that are derived from two replicase polyproteins by autoproteolytic processing. The nsps assemble into the viral replication–transcription complex and nsp3, nsp4 and nsp6 are believed to anchor this enzyme complex to modified intracellular membranes. The largest part of the coronavirus nsp4 subunit is hydrophobic and is predicted to be embedded in the membranes. In this report, a conserved C-terminal domain (∼100 amino-acid residues) has been delineated that is predicted to face the cytoplasm and has been isolated as a soluble domain using library-based construct screening. A prototypical crystal structure at 2.8 Å resolution was obtained using nsp4 from feline coronavirus. Unmodified and SeMet-substituted proteins were crystallized under similar conditions, resulting in tetragonal crystals that belonged to space group P4{sub 3}. The phase problem was initially solved by single isomorphous replacement with anomalous scattering (SIRAS), followed by molecular replacement using a SIRAS-derived composite model. The structure consists of a single domain with a predominantly α-helical content displaying a unique fold that could be engaged in protein–protein interactions.

  1. Powdery mildew fungal effector candidates share N-terminal Y/F/WxC-motif

    Directory of Open Access Journals (Sweden)

    Emmersen Jeppe

    2010-05-01

    Full Text Available Abstract Background Powdery mildew and rust fungi are widespread, serious pathogens that depend on developing haustoria in the living plant cells. Haustoria are separated from the host cytoplasm by a plant cell-derived extrahaustorial membrane. They secrete effector proteins, some of which are subsequently transferred across this membrane to the plant cell to suppress defense. Results In a cDNA library from barley epidermis containing powdery mildew haustoria, two-thirds of the sequenced ESTs were fungal and represented ~3,000 genes. Many of the most highly expressed genes encoded small proteins with N-terminal signal peptides. While these proteins are novel and poorly related, they do share a three-amino acid motif, which we named "Y/F/WxC", in the N-terminal of the mature proteins. The first amino acid of this motif is aromatic: tyrosine, phenylalanine or tryptophan, and the last is always cysteine. In total, we identified 107 such proteins, for which the ESTs represent 19% of the fungal clones in our library, suggesting fundamental roles in haustoria function. While overall sequence similarity between the powdery mildew Y/F/WxC-proteins is low, they do have a highly similar exon-intron structure, suggesting they have a common origin. Interestingly, searches of public fungal genome and EST databases revealed that haustoria-producing rust fungi also encode large numbers of novel, short proteins with signal peptides and the Y/F/WxC-motif. No significant numbers of such proteins were identified from genome and EST sequences from either fungi which do not produce haustoria or from haustoria-producing Oomycetes. Conclusion In total, we identified 107, 178 and 57 such Y/F/WxC-proteins from the barley powdery mildew, the wheat stem rust and the wheat leaf rust fungi, respectively. All together, our findings suggest the Y/F/WxC-proteins to be a new class of effectors from haustoria-producing pathogenic fungi.

  2. Compaction and binding properties of the intrinsically disordered C-terminal domain of Henipavirus nucleoprotein as unveiled by deletion studies.

    Science.gov (United States)

    Blocquel, David; Habchi, Johnny; Gruet, Antoine; Blangy, Stéphanie; Longhi, Sonia

    2012-01-01

    Henipaviruses are recently emerged severe human pathogens within the Paramyxoviridae family. Their genome is encapsidated by the nucleoprotein (N) within a helical nucleocapsid that recruits the polymerase complex via the phosphoprotein (P). We have previously shown that in Henipaviruses the N protein possesses an intrinsically disordered C-terminal domain, N(TAIL), which undergoes α-helical induced folding in the presence of the C-terminal domain (P(XD)) of the P protein. Using computational approaches, we previously identified within N(TAIL) four putative molecular recognition elements (MoREs) with different structural propensities, and proposed a structural model for the N(TAIL)-P(XD) complex where the MoRE encompassing residues 473-493 adopt an α-helical conformation at the P(XD) surface. In this work, for each N(TAIL) protein, we designed four deletion constructs bearing different combinations of the predicted MoREs. Following purification of the N(TAIL) truncated proteins from the soluble fraction of E. coli, we characterized them in terms of their conformational, spectroscopic and binding properties. These studies provided direct experimental evidence for the structural state of the four predicted MoREs, and showed that two of them have clear α-helical propensities, with the one spanning residues 473-493 being strictly required for binding to P(XD). We also showed that Henipavirus N(TAIL) and P(XD) form heterologous complexes, indicating that the P(XD) binding regions are functionally interchangeable between the two viruses. By combining spectroscopic and conformational analyses, we showed that the content in regular secondary structure is not a major determinant of protein compaction.

  3. c-Jun N-terminal kinase mediates AML1-ETO protein-induced connexin-43 expression

    International Nuclear Information System (INIS)

    Gao Fenghou; Wang Qiong; Wu Yingli; Li Xi; Zhao Kewen; Chen Guoqiang

    2007-01-01

    AML1-ETO fusion protein, a product of leukemia-related chromosomal translocation t(8;21), was reported to upregulate expression of connexin-43 (Cx43), a member of gap junction-constituted connexin family. However, its mechanism(s) remains unclear. By bioinformatic analysis, here we showed that there are two putative AML1-binding consensus sequences followed by two activated protein (AP)1 sites in the 5'-flanking region upstream to Cx43 gene. AML1-ETO could directly bind to these two AML1-binding sites in electrophoretic mobility shift assay, but luciferase reporter assay revealed that the AML1 binding sites were not indispensable for Cx43 induction by AML1-ETO protein. Conversely, AP1 sites exerted an important role in this event. In agreement, AML1-ETO overexpression in leukemic U937 cells activated c-Jun N-terminal kinase (JNK), while its specific inhibitor SP600125 effectively abrogated AML1-ETO-induced Cx43 expression, indicating that JNK signaling pathway contributes to AML1-ETO induced Cx43 expression. These results would shed new insights for understanding mechanisms of AML1-ETO-associated leukemogenesis

  4. The C-terminal extension of human RTEL1, mutated in Hoyeraal-Hreidarsson syndrome, contains harmonin-N-like domains.

    Science.gov (United States)

    Faure, Guilhem; Revy, Patrick; Schertzer, Michael; Londono-Vallejo, Arturo; Callebaut, Isabelle

    2014-06-01

    Several studies have recently shown that germline mutations in RTEL1, an essential DNA helicase involved in telomere regulation and DNA repair, cause Hoyeraal-Hreidarsson syndrome (HHS), a severe form of dyskeratosis congenita. Using original new softwares, facilitating the delineation of the different domains of the protein and the identification of remote relationships for orphan domains, we outline here that the C-terminal extension of RTEL1, downstream of its catalytic domain and including several HHS-associated mutations, contains a yet unidentified tandem of harmonin-N-like domains, which may serve as a hub for partner interaction. This finding highlights the potential critical role of this region for the function of RTEL1 and gives insights into the impact that the identified mutations would have on the structure and function of these domains. © 2013 Wiley Periodicals, Inc.

  5. The superfamily of C3b/C4b-binding proteins

    DEFF Research Database (Denmark)

    Kristensen, Torsten; D'Eustachio, P; Ogata, R T

    1987-01-01

    The determination of primary structures by amino acid and nucleotide sequencing for the C3b-and/or C4b-binding proteins H, C4BP, CR1, B, and C2 has revealed the presence of a common structural element. This element is approximately 60 amino acids long and is repeated in a tandem fashion, commencing...... at the amino-terminal end of each molecule. Two other complement components, C1r and C1s, have two of these repeating units in the carboxy-terminal region of their noncatalytic A chains. Three noncomplement proteins, beta 2-glycoprotein I (beta 2I), the interleukin 2 receptor (IL 2 receptor), and the b chain...... of factor XIII, have 4, 2 and 10 of these repeating units, respectively. These proteins obviously belong to the above family, although there is no evidence that they interact with C3b and/or C4b. Human haptoglobin and rat leukocyte common antigen also contain two and three repeating units, respectively...

  6. Characterization of cDNA for human tripeptidyl peptidase II: The N-terminal part of the enzyme is similar to subtilisin

    International Nuclear Information System (INIS)

    Tomkinson, B.; Jonsson, A-K

    1991-01-01

    Tripeptidyl peptidase II is a high molecular weight serine exopeptidase, which has been purified from rat liver and human erythrocytes. Four clones, representing 4453 bp, or 90% of the mRNA of the human enzyme, have been isolated from two different cDNA libraries. One clone, designated A2, was obtained after screening a human B-lymphocyte cDNA library with a degenerated oligonucleotide mixture. The B-lymphocyte cDNA library, obtained from human fibroblasts, were rescreened with a 147 bp fragment from the 5' part of the A2 clone, whereby three different overlapping cDNA clones could be isolated. The deduced amino acid sequence, 1196 amino acid residues, corresponding to the longest open rading frame of the assembled nucleotide sequence, was compared to sequences of current databases. This revealed a 56% similarity between the bacterial enzyme subtilisin and the N-terminal part of tripeptidyl peptidase II. The enzyme was found to be represented by two different mRNAs of 4.2 and 5.0 kilobases, respectively, which probably result from the utilziation of two different polyadenylation sites. Futhermore, cDNA corresponding to both the N-terminal and C-terminal part of tripeptidyl peptidase II hybridized with genomic DNA from mouse, horse, calf, and hen, even under fairly high stringency conditions, indicating that tripeptidyl peptidase II is highly conserved

  7. Crystallization of the C-terminal domain of the addiction antidote CcdA in complex with its toxin CcdB

    International Nuclear Information System (INIS)

    Buts, Lieven; De Jonge, Natalie; Loris, Remy; Wyns, Lode; Dao-Thi, Minh-Hoa

    2005-01-01

    The CcdA C-terminal domain was crystallized in complex with CcdB in two crystal forms that diffract to beyond 2.0 Å resolution. CcdA and CcdB are the antidote and toxin of the ccd addiction module of Escherichia coli plasmid F. The CcdA C-terminal domain (CcdA C36 ; 36 amino acids) was crystallized in complex with CcdB (dimer of 2 × 101 amino acids) in three different crystal forms, two of which diffract to high resolution. Form II belongs to space group P2 1 2 1 2 1 , with unit-cell parameters a = 37.6, b = 60.5, c = 83.8 Å and diffracts to 1.8 Å resolution. Form III belongs to space group P2 1 , with unit-cell parameters a = 41.0, b = 37.9, c = 69.6 Å, β = 96.9°, and diffracts to 1.9 Å resolution

  8. The C-terminal domain of Rac1 contains two motifs that control targeting and signaling specificity

    NARCIS (Netherlands)

    van Hennik, Paula B.; ten Klooster, Jean Paul; Halstead, Jon R.; Voermans, Carlijn; Anthony, Eloise C.; Divecha, Nullin; Hordijk, Peter L.

    2003-01-01

    Rho-like GTPases control a wide range of cellular functions such as integrin- and cadherin-mediated adhesion, cell motility, and gene expression. The hypervariable C-terminal domain of these GTPases has been implicated in membrane association and effector binding. We found that cell-permeable

  9. A Compact MIMO Antenna with Inverted C-Shaped Ground Branches for Mobile Terminals

    Directory of Open Access Journals (Sweden)

    Zixian Yang

    2016-01-01

    Full Text Available A compact printed MIMO antenna for mobile terminals is presented. With two planar antenna elements, the −6 dB impedance bandwidth of 2.32 GHz (1.48–3.8 GHz is obtained, which covers GSM 1800/1900, UMTS, WLAN, Wimax, S-band, and most of LTE bands. Each antenna element with a small occupation of 15 × 20 mm2 consists of a driven strip and a shorted strip. Two inverted C-shaped ground branches are introduced between two elements to improve the isolation. The simulated results are studied and the measured results show that high isolation of more than 18 dB at the entire operating band is achieved. Meanwhile, the impedance performance is also improved by adding the branches. Furthermore, the measured radiation performances and envelope correlation coefficient also demonstrate that the proposed antenna could be a good candidate for mobile terminals.

  10. Quantitation of some amino-terminal residues in proteins using 3H-labelled dansyl chloride and 14C labelled amino acids

    International Nuclear Information System (INIS)

    Flengsrud, R.

    1979-01-01

    A method for quantitation of amino-terminal residues in proteins is presented. The method is a modification of a double isotope-labelling technique, using 3 H-labelled dansyl chloride and 14 C-labelled amino acids as internal standards. The method is demonstrated on human fibrinogen, horse myoglobin and on mouse myoloma IgA. A linear relationship between the ratio 3 H/ 14 C in the separated amino-terminal amino acid of the protein and the amount of protein added in the labelling mixture was obtained with standard deviations of +- 7.4%, +-3.4% and +-10.3%, respectively. An application of the method is demonstrated by measuring the increase in amino-terminal glycine in fibrinogen following the proteolytic action of thrombin. The method seems to be useful when 0.1 nmol or more of protein is used. (author)

  11. C-terminal of human histamine H1 receptors regulates their agonist-induced clathrin-mediated internalization and G-protein signaling.

    Science.gov (United States)

    Hishinuma, Shigeru; Nozawa, Hiroki; Akatsu, Chizuru; Shoji, Masaru

    2016-11-01

    It has been suggested that the agonist-induced internalization of G-protein-coupled receptors from the cell surface into intracellular compartments regulates cellular responsiveness. We previously reported that G q/11 -protein-coupled human histamine H 1 receptors internalized via clathrin-dependent mechanisms upon stimulation with histamine. However, the molecular determinants of H 1 receptors responsible for agonist-induced internalization remain unclear. In this study, we evaluated the roles of the intracellular C-terminal of human histamine H 1 receptors tagged with hemagglutinin (HA) at the N-terminal in histamine-induced internalization in Chinese hamster ovary cells. The histamine-induced internalization was evaluated by the receptor binding assay with [ 3 H]mepyramine and confocal immunofluorescence microscopy with an anti-HA antibody. We found that histamine-induced internalization was inhibited under hypertonic conditions or by pitstop, a clathrin terminal domain inhibitor, but not by filipin or nystatin, disruptors of the caveolar structure and function. The histamine-induced internalization was also inhibited by truncation of a single amino acid, Ser487, located at the end of the intracellular C-terminal of H 1 receptors, but not by its mutation to alanine. In contrast, the receptor-G-protein coupling, which was evaluated by histamine-induced accumulation of [ 3 H]inositol phosphates, was potentiated by truncation of Ser487, but was lost by its mutation to alanine. These results suggest that the intracellular C-terminal of human H 1 receptors, which only comprises 17 amino acids (Cys471-Ser487), plays crucial roles in both clathrin-dependent internalization of H 1 receptors and G-protein signaling, in which truncation of Ser487 and its mutation to alanine are revealed to result in biased signaling toward activation of G-proteins and clathrin-mediated internalization, respectively. © 2016 International Society for Neurochemistry.

  12. Secondary structure and lipid interactions of the N-terminal segment of pulmonary surfactant SP-C in Langmuir films: IR reflection-absorption spectroscopy and surface pressure studies

    DEFF Research Database (Denmark)

    Bi, Xiaohong; Flach, Carol R; Pérez-Gil, Jesus

    2002-01-01

    reversibly with surface pressure (pi), suggestive of the peptide being squeezed out from hydrophobic regions of the monolayer. No such effect was observed for DPPG/peptide monolayers, indicative of stronger, probably electrostatic, interactions. Depalmitoylation produced a weakened interaction with either...... phospholipid as deduced from IRRAS spectra and from pi-area isotherms. S-Palmitoylation may modulate peptide hydration and conformation in the N-terminal region of SP-C and may thus permit the peptide to remain in the film at the high surface pressures present during lung compression. The unique capability...... of IRRAS to detect the surface pressure dependence of protein or peptide structure/interactions in a physiologically relevant model for surfactant is clearly demonstrated. Udgivelsesdato: 2002-Jul-2...

  13. The C-terminus hot spot region helps in the fibril formation of bacteriophage-associated hyaluronate lyase (HylP2).

    Science.gov (United States)

    Shukla, Harish; Singh, Sudhir Kumar; Singh, Amit Kumar; Mitra, Kalyan; Akhtar, Md Sohail

    2015-09-23

    The bacteriophage encoded hyaluronate lyases (HylP and HylP2) degrade hyaluronan and other glycosaminoglycans. HylP2 forms a functional fibril under acidic conditions in which its N-terminus is proposed to form the fibrillar core, leading to nucleation and acceleration of fibril formation. Here we report the presence of a hot spot region (A144GVVVY149) towards the carboxy terminus of HylP2, essential for the acceleration of fibril formation. The 'hot spot' is observed to be inherently mutated for valines (A178AMVMY183) in case of HylP. The N- terminal swapped chimeras between these phage HLs ((N)HylP2(C)HylP and (N)HylP(C)HylP2) or HylP did not form fibrils at acidic pH. However, seeding of prefibrils of HylP2 recompensed nucleation and led to fibrillation in (N)HylP(C)HylP2. The V147A mutation in the 'hot spot' region abolished fibril formation in HylP2. The M179V and M181V double mutations in the 'hot spot' region of HylP led to fibrillation with the seeding of prefibrils. It appears that fibrillation in HylP2 even though is initiated by the N-terminus, is accelerated by the conserved 'hot spot' region in the C-terminus. A collagenous (Gly-X-Y)10 motif in the N-terminus and a mutated 'hot spot' region in the C-terminus of HylP affect fibrillar nucleation and acceleration respectively.

  14. Comparison of 640-Slice Multidetector Computed Tomography Versus 32-Slice MDCT for Imaging of the Osteo-odonto-keratoprosthesis Lamina.

    Science.gov (United States)

    Norris, Joseph M; Kishikova, Lyudmila; Avadhanam, Venkata S; Koumellis, Panos; Francis, Ian S; Liu, Christopher S C

    2015-08-01

    To investigate the efficacy of 640-slice multidetector computed tomography (MDCT) for detecting osteo-odonto laminar resorption in the osteo-odonto-keratoprosthesis (OOKP) compared with the current standard 32-slice MDCT. Explanted OOKP laminae and bone-dentine fragments were scanned using 640-slice MDCT (Aquilion ONE; Toshiba) and 32-slice MDCT (LightSpeed Pro32; GE Healthcare). Pertinent comparisons including image quality, radiation dose, and scanning parameters were made. Benefits of 640-slice MDCT over 32-slice MDCT were shown. Key comparisons of 640-slice MDCT versus 32-slice MDCT included the following: percentage difference and correlation coefficient between radiological and anatomical measurements, 1.35% versus 3.67% and 0.9961 versus 0.9882, respectively; dose-length product, 63.50 versus 70.26; rotation time, 0.175 seconds versus 1.000 seconds; and detector coverage width, 16 cm versus 2 cm. Resorption of the osteo-odonto lamina after OOKP surgery can result in potentially sight-threatening complications, hence it warrants regular monitoring and timely intervention. MDCT remains the gold standard for radiological assessment of laminar resorption, which facilitates detection of subtle laminar changes earlier than the onset of clinical signs, thus indicating when preemptive measures can be taken. The 640-slice MDCT exhibits several advantages over traditional 32-slice MDCT. However, such benefits may not offset cost implications, except in rare cases, such as in young patients who might undergo years of radiation exposure.

  15. Charge neutralization as the major factor for the assembly of nucleocapsid-like particles from C-terminal truncated hepatitis C virus core protein.

    Science.gov (United States)

    de Souza, Theo Luiz Ferraz; de Lima, Sheila Maria Barbosa; Braga, Vanessa L de Azevedo; Peabody, David S; Ferreira, Davis Fernandes; Bianconi, M Lucia; Gomes, Andre Marco de Oliveira; Silva, Jerson Lima; de Oliveira, Andréa Cheble

    2016-01-01

    Hepatitis C virus (HCV) core protein, in addition to its structural role to form the nucleocapsid assembly, plays a critical role in HCV pathogenesis by interfering in several cellular processes, including microRNA and mRNA homeostasis. The C-terminal truncated HCV core protein (C124) is intrinsically unstructured in solution and is able to interact with unspecific nucleic acids, in the micromolar range, and to assemble into nucleocapsid-like particles (NLPs) in vitro . The specificity and propensity of C124 to the assembly and its implications on HCV pathogenesis are not well understood. Spectroscopic techniques, transmission electron microscopy and calorimetry were used to better understand the propensity of C124 to fold or to multimerize into NLPs when subjected to different conditions or in the presence of unspecific nucleic acids of equivalent size to cellular microRNAs. The structural analysis indicated that C124 has low propensity to self-folding. On the other hand, for the first time, we show that C124, in the absence of nucleic acids, multimerizes into empty NLPs when subjected to a pH close to its isoelectric point (pH ≈ 12), indicating that assembly is mainly driven by charge neutralization. Isothermal calorimetry data showed that the assembly of NLPs promoted by nucleic acids is enthalpy driven. Additionally, data obtained from fluorescence correlation spectroscopy show that C124, in nanomolar range, was able to interact and to sequester a large number of short unspecific nucleic acids into NLPs. Together, our data showed that the charge neutralization is the major factor for the nucleocapsid-like particles assembly from C-terminal truncated HCV core protein. This finding suggests that HCV core protein may physically interact with unspecific cellular polyanions, which may correspond to microRNAs and mRNAs in a host cell infected by HCV, triggering their confinement into infectious particles.

  16. Pseudomonas aeruginosa elastase cleaves a C-terminal peptide from human thrombin that inhibits host inflammatory responses

    DEFF Research Database (Denmark)

    van der Plas, Mariena J A; Bhongir, Ravi K V; Kjellström, Sven

    2016-01-01

    Pseudomonas aeruginosa is an opportunistic pathogen known for its immune evasive abilities amongst others by degradation of a large variety of host proteins. Here we show that digestion of thrombin by P. aeruginosa elastase leads to the release of the C-terminal thrombin-derived peptide FYT21...

  17. Modular approach for satellite communication ground terminals

    Science.gov (United States)

    Gould, G. R.

    1984-01-01

    The trend in satellite communications is toward completely digital, time division multiple access (TDMA) systems with uplink and downlink data rates dictated by the type of service offered. Trunking terminals will operate in the 550 MBPS (megabit per second) region uplink and downlink, whereas customer premise service (CPS) terminals will operate in the 25 to 10 MBPS region uplink and in the 200 MBPS region downlink. Additional criteria for the ground terminals will be to maintain clock sychronization with the system and burst time integrity to within a matter of nanoseconds, to process required order-fire information, to provide adaptive data scrambing, and to compensate for variations in the user input output data rates, and for changes in range in the satellite communications links resulting from satellite perturbations in orbit. To achieve the required adaptability of a ground terminal to the above mentioned variables, programmable building blocks can be developed that will meet all of these requirements. To maintain system synchronization, i.e., all bursted data arriving at the satellite within assigned TDMA windows, ground terminal transmit data rates and burst timing must be maintained within tight tolerances. With a programmable synchronizer as the heart of the terminal timing generation, variable data rates and burst timing tolerances are achievable. In essence, the unit inputs microprocessor generated timing words and outputs discrete timing pulses.

  18. The methylation of the C-terminal region of hnRNPQ (NSAP1) is important for its nuclear localization

    International Nuclear Information System (INIS)

    Passos, Dario O.; Quaresma, Alexandre J.C.; Kobarg, Joerg

    2006-01-01

    Protein arginine methylation is an irreversible post-translational protein modification catalyzed by a family of at least nine different enzymes entitled PRMTs (protein arginine methyl transferases). Although PRMT1 is responsible for 85% of the protein methylation in human cells, its substrate spectrum has not yet been fully characterized nor are the functional consequences of methylation for the protein substrates well understood. Therefore, we set out to employ the yeast two-hybrid system in order to identify new substrate proteins for human PRMT1. We were able to identify nine different PRMT1 interacting proteins involved in different aspects of RNA metabolism, five of which had been previously described either as substrates for PRMT1 or as functionally associated with PRMT1. Among the four new identified possible protein substrates was hnRNPQ3 (NSAP1), a protein whose function has been implicated in diverse steps of mRNA maturation, including splicing, editing, and degradation. By in vitro methylation assays we were able to show that hnRNPQ3 is a substrate for PRMT1 and that its C-terminal RGG box domain is the sole target for methylation. By further studies with the inhibitor of methylation Adox we provide evidence that hnRNPQ1-3 are methylated in vivo. Finally, we demonstrate by immunofluorescence analysis of HeLa cells that the methylation of hnRNPQ is important for its nuclear localization, since Adox treatment causes its re-distribution from the nucleus to the cytoplasm

  19. The C-terminal HRET sequence of Kv1.3 regulates gating rather than targeting of Kv1.3 to the plasma membrane.

    Science.gov (United States)

    Voros, Orsolya; Szilagyi, Orsolya; Balajthy, András; Somodi, Sándor; Panyi, Gyorgy; Hajdu, Péter

    2018-04-12

    Kv1.3 channels are expressed in several cell types including immune cells, such as T lymphocytes. The targeting of Kv1.3 to the plasma membrane is essential for T cell clonal expansion and assumed to be guided by the C-terminus of the channel. Using two point mutants of Kv1.3 with remarkably different features compared to the wild-type Kv1.3 (A413V and H399K having fast inactivation kinetics and tetraethylammonium-insensitivity, respectively) we showed that both Kv1.3 channel variants target to the membrane when the C-terminus was truncated right after the conserved HRET sequence and produce currents identical to those with a full-length C-terminus. The truncation before the HRET sequence (NOHRET channels) resulted in reduced membrane-targeting but non-functional phenotypes. NOHRET channels did not display gating currents, and coexpression with wild-type Kv1.3 did not rescue the NOHRET-A413V phenotype, no heteromeric current was observed. Interestingly, mutants of wild-type Kv1.3 lacking HRET(E) (deletion) or substituted with five alanines for the HRET(E) motif expressed current indistinguishable from the wild-type. These results demonstrate that the C-terminal region of Kv1.3 immediately proximal to the S6 helix is required for the activation gating and conduction, whereas the presence of the distal region of the C-terminus is not exclusively required for trafficking of Kv1.3 to the plasma membrane.

  20. Crystal structure of the C-terminal domain of the RAP74 subunit of human transcription factor IIF

    Energy Technology Data Exchange (ETDEWEB)

    Kamada, Katsuhiko; De Angelis, Jacqueline; Roeder, Robert G.; Burley, Stephen K. (Rockefeller)

    2012-12-13

    The x-ray structure of a C-terminal fragment of the RAP74 subunit of human transcription factor (TF) IIF has been determined at 1.02-{angstrom} resolution. The {alpha}/{beta} structure is strikingly similar to the globular domain of linker histone H5 and the DNA-binding domain of hepatocyte nuclear factor 3{gamma} (HNF-3{gamma}), making it a winged-helix protein. The surface electrostatic properties of this compact domain differ significantly from those of bona fide winged-helix transcription factors (HNF-3{gamma} and RFX1) and from the winged-helix domains found within the RAP30 subunit of TFIIF and the {beta} subunit of TFIIE. RAP74 has been shown to interact with the TFIIF-associated C-terminal domain phosphatase FCP1, and a putative phosphatase binding site has been identified within the RAP74 winged-helix domain.

  1. 7 CFR 1469.25 - Contract violations and termination.

    Science.gov (United States)

    2010-01-01

    ... termination without delay. (c) If NRCS terminates a contract due to breach of contract, the participant will... terminates a contract due to breach of contract, or the participant voluntarily terminates the contract... 7 Agriculture 10 2010-01-01 2010-01-01 false Contract violations and termination. 1469.25 Section...

  2. Involvement of C-Terminal Histidines in Soybean PM1 Protein Oligomerization and Cu2+ Binding.

    Science.gov (United States)

    Liu, Guobao; Liu, Ke; Gao, Yang; Zheng, Yizhi

    2017-06-01

    Late embryogenesis abundant (LEA) proteins are widely distributed among plant species, where they contribute to abiotic stress tolerance. LEA proteins can be classified into seven groups according to conserved sequence motifs. The PM1 protein from soybean, which belongs to the Pfam LEA_1 group, has been shown previously to be at least partially natively unfolded, to bind metal ions and potentially to stabilize proteins and membranes. Here, we investigated the role of the PM1 C-terminal domain and in particular the multiple histidine residues in this half of the protein. We constructed recombinant plasmids expressing full-length PM1 and two truncated forms, PM1-N and PM1-C, which represent the N- and C-terminal halves of the protein, respectively. Immunoblotting and cross-linking experiments showed that full-length PM1 forms oligomers and high molecular weight (HMW) complexes in vitro and in vivo, while PM1-C, but not PM1-N, also formed oligomers and HMW complexes in vitro. When the histidine residues in PM1 and PM1-C were chemically modified, oligomerization was abolished, suggesting that histidines play a key role in this process. Furthermore, we demonstrated that high Cu2+ concentrations promote oligomerization and induce PM1 and PM1-C to form HMW complexes. Therefore, we speculate that PM1 proteins not only maintain ion homeostasis in the cytoplasm, but also potentially stabilize and protect other proteins during abiotic stress by forming a large, oligomeric molecular shield around biological targets. © The Author 2017. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  3. C0 and C1 N-terminal Ig domains of myosin binding protein C exert different effects on thin filament activation.

    Science.gov (United States)

    Harris, Samantha P; Belknap, Betty; Van Sciver, Robert E; White, Howard D; Galkin, Vitold E

    2016-02-09

    Mutations in genes encoding myosin, the molecular motor that powers cardiac muscle contraction, and its accessory protein, cardiac myosin binding protein C (cMyBP-C), are the two most common causes of hypertrophic cardiomyopathy (HCM). Recent studies established that the N-terminal domains (NTDs) of cMyBP-C (e.g., C0, C1, M, and C2) can bind to and activate or inhibit the thin filament (TF). However, the molecular mechanism(s) by which NTDs modulate interaction of myosin with the TF remains unknown and the contribution of each individual NTD to TF activation/inhibition is unclear. Here we used an integrated structure-function approach using cryoelectron microscopy, biochemical kinetics, and force measurements to reveal how the first two Ig-like domains of cMyPB-C (C0 and C1) interact with the TF. Results demonstrate that despite being structural homologs, C0 and C1 exhibit different patterns of binding on the surface of F-actin. Importantly, C1 but not C0 binds in a position to activate the TF by shifting tropomyosin (Tm) to the "open" structural state. We further show that C1 directly interacts with Tm and traps Tm in the open position on the surface of F-actin. Both C0 and C1 compete with myosin subfragment 1 for binding to F-actin and effectively inhibit actomyosin interactions when present at high ratios of NTDs to F-actin. Finally, we show that in contracting sarcomeres, the activating effect of C1 is apparent only once low levels of Ca(2+) have been achieved. We suggest that Ca(2+) modulates the interaction of cMyBP-C with the TF in the sarcomere.

  4. Combined histochemical staining, RNA amplification, regional, and single cell cDNA analysis within the hippocampus.

    Science.gov (United States)

    Ginsberg, Stephen D; Che, Shaoli

    2004-08-01

    The use of five histochemical stains (cresyl violet, thionin, hematoxylin & eosin, silver stain, and acridine orange) was evaluated in combination with an expression profiling paradigm that included regional and single cell analyses within the hippocampus of post-mortem human brains and adult mice. Adjacent serial sections of human and mouse hippocampus were labeled by histochemistry or neurofilament immunocytochemistry. These tissue sections were used as starting material for regional and single cell microdissection followed by a newly developed RNA amplification procedure (terminal continuation (TC) RNA amplification) and subsequent hybridization to custom-designed cDNA arrays. Results indicated equivalent levels of global hybridization signal intensity and relative expression levels for individual genes for hippocampi stained by cresyl violet, thionin, and hematoxylin & eosin, and neurofilament immunocytochemistry. Moreover, no significant differences existed between the Nissl stains and neurofilament immunocytochemistry for individual CA1 neurons obtained via laser capture microdissection. In contrast, a marked decrement was observed in adjacent hippocampal sections stained for silver stain and acridine orange, both at the level of the regional dissection and at the CA1 neuron population level. Observations made on the cDNA array platform were validated by real-time qPCR using primers directed against beta-actin and glyceraldehyde-3 phosphate dehydrogenase. Thus, this report demonstrated the utility of using specific Nissl stains, but not stains that bind RNA species directly, in both human and mouse brain tissues at the regional and cellular level for state-of-the-art molecular fingerprinting studies.

  5. A C-terminal HSP90 inhibitor restores glucocorticoid sensitivity and relieves a mouse allograft model of Cushing disease.

    Science.gov (United States)

    Riebold, Mathias; Kozany, Christian; Freiburger, Lee; Sattler, Michael; Buchfelder, Michael; Hausch, Felix; Stalla, Günter K; Paez-Pereda, Marcelo

    2015-03-01

    One function of the glucocorticoid receptor (GR) in corticotroph cells is to suppress the transcription of the gene encoding proopiomelanocortin (POMC), the precursor of the stress hormone adrenocorticotropin (ACTH). Cushing disease is a neuroendocrine condition caused by partially glucocorticoid-resistant corticotroph adenomas that excessively secrete ACTH, which leads to hypercortisolism. Mutations that impair GR function explain glucocorticoid resistance only in sporadic cases. However, the proper folding of GR depends on direct interactions with the chaperone heat shock protein 90 (HSP90, refs. 7,8). We show here that corticotroph adenomas overexpress HSP90 compared to the normal pituitary. N- and C-terminal HSP90 inhibitors act at different steps of the HSP90 catalytic cycle to regulate corticotroph cell proliferation and GR transcriptional activity. C-terminal inhibitors cause the release of mature GR from HSP90, which promotes its exit from the chaperone cycle and potentiates its transcriptional activity in a corticotroph cell line and in primary cultures of human corticotroph adenomas. In an allograft mouse model, the C-terminal HSP90 inhibitor silibinin showed anti-tumorigenic effects, partially reverted hormonal alterations, and alleviated symptoms of Cushing disease. These results suggest that the pathogenesis of Cushing disease caused by overexpression of heat shock proteins and consequently misregulated GR sensitivity may be overcome pharmacologically with an appropriate HSP90 inhibitor.

  6. Delta ¹³C depleted oceans before the termination 2: More nutrient-rich deep-water formation or light-carbon transfer?

    Digital Repository Service at National Institute of Oceanography (India)

    Banakar, V.K.

    show an unexplained shift in the long-term mean oceanic-delta ¹³C around the penultimate glacial termination (T2: 132 ka). The time-series planktic- and benthic- species delta ¹³C records exhibit two distinct mean- delta ¹³C levels. The low mean delta...

  7. A novel PKD2L1 C-terminal domain critical for trimerization and channel function.

    Science.gov (United States)

    Zheng, Wang; Hussein, Shaimaa; Yang, JungWoo; Huang, Jun; Zhang, Fan; Hernandez-Anzaldo, Samuel; Fernandez-Patron, Carlos; Cao, Ying; Zeng, Hongbo; Tang, Jingfeng; Chen, Xing-Zhen

    2015-03-30

    As a transient receptor potential (TRP) superfamily member, polycystic kidney disease 2-like-1 (PKD2L1) is also called TRPP3 and has similar membrane topology as voltage-gated cation channels. PKD2L1 is involved in hedgehog signaling, intestinal development, and sour tasting. PKD2L1 and PKD1L3 form heterotetramers with 3:1 stoichiometry. C-terminal coiled-coil-2 (CC2) domain (G699-W743) of PKD2L1 was reported to be important for its trimerization but independent studies showed that CC2 does not affect PKD2L1 channel function. It thus remains unclear how PKD2L1 proteins oligomerize into a functional channel. By SDS-PAGE, blue native PAGE and mutagenesis we here identified a novel C-terminal domain called C1 (K575-T622) involved in stronger homotrimerization than the non-overlapping CC2, and found that the PKD2L1 N-terminus is critical for dimerization. By electrophysiology and Xenopus oocyte expression, we found that C1, but not CC2, is critical for PKD2L1 channel function. Our co-immunoprecipitation and dynamic light scattering experiments further supported involvement of C1 in trimerization. Further, C1 acted as a blocking peptide that inhibits PKD2L1 trimerization as well as PKD2L1 and PKD2L1/PKD1L3 channel function. Thus, our study identified C1 as the first PKD2L1 domain essential for both PKD2L1 trimerization and channel function, and suggest that PKD2L1 and PKD2L1/PKD1L3 channels share the PKD2L1 trimerization process.

  8. In-Fiber Subpicosecond Pulse Shaping for Nonlinear Optical Telecommunication Data Processing at 640 Gbit/s

    Directory of Open Access Journals (Sweden)

    J. Azaña

    2012-01-01

    Full Text Available We review recent work on all-fiber (long-period fiber grating devices for optical pulse shaping, particularly flat-top pulse generation, down to the subpicosecond range and their application for nonlinear switching (demultiplexing of optical time-division multiplexed (OTDM data signals in fiber-optic telecommunication links operating up to 640 Gbit/s. Experiments are presented demonstrating error-free 640-to-10 Gbit/s demultiplexing of the 64 tributary channels using the generated flat-top pulses for temporal gating in a Kerr-effect-based nonlinear optical loop mirror. The use of flat-top pulses has critical benefits in the demultiplexing process, including a significantly increased timing-jitter tolerance (up to ~500 fs, i.e., 30% of the bit period and the associated improvement in the bit-error-rate performance (e.g., with a sensitivity increase of up to ~13 dB as compared with the use of Gaussian-like gating pulses. Long-period fiber grating pulse shapers with reduced polarization dependence are fabricated and successfully used for polarization-independent 640-to-10 Gbit/s demultiplexing experiments.

  9. The ubiquitin C-terminal hydrolase UCH-L1 promotes bacterial invasion by altering the dynamics of the actin cytoskeleton

    DEFF Research Database (Denmark)

    Basseres, Eugene; Coppotelli, Giuseppe; Pfirrmann, Thorsten

    2010-01-01

    Invasion of eukaryotic target cells by pathogenic bacteria requires extensive remodelling of the membrane and actin cytoskeleton. Here we show that the remodelling process is regulated by the ubiquitin C-terminal hydrolase UCH-L1 that promotes the invasion of epithelial cells by Listeria monocyto......Invasion of eukaryotic target cells by pathogenic bacteria requires extensive remodelling of the membrane and actin cytoskeleton. Here we show that the remodelling process is regulated by the ubiquitin C-terminal hydrolase UCH-L1 that promotes the invasion of epithelial cells by Listeria...... of downstream ERK1/2- and AKT-dependent signalling in response to the natural ligand Hepatocyte Growth Factor (HGF). The regulation of cytoskeleton dynamics was further confirmed by the induction of actin stress fibres in HeLa expressing the active enzyme but not the catalytic mutant UCH-L1(C90S...

  10. A protein kinase binds the C-terminal domain of the readthrough protein of Turnip yellows virus and regulates virus accumulation

    International Nuclear Information System (INIS)

    Rodriguez-Medina, Caren; Boissinot, Sylvaine; Chapuis, Sophie; Gereige, Dalya; Rastegar, Maryam; Erdinger, Monique; Revers, Frédéric; Ziegler-Graff, Véronique; Brault, Véronique

    2015-01-01

    Turnip yellows virus (TuYV), a phloem-limited virus, encodes a 74 kDa protein known as the readthrough protein (RT) involved in virus movement. We show here that a TuYV mutant deleted of the C-terminal part of the RT protein (TuYV-∆RT_C_t_e_r) was affected in long-distance trafficking in a host-specific manner. By using the C-terminal domain of the RT protein as a bait in a yeast two-hybrid screen of a phloem cDNA library from Arabidopsis thaliana we identified the calcineurin B-like protein-interacting protein kinase-7 (AtCIPK7). Transient expression of a GFP:CIPK7 fusion protein in virus-inoculated Nicotiana benthamiana leaves led to local increase of wild-type TuYV accumulation, but not that of TuYV-∆RT_C_t_e_r. Surprisingly, elevated virus titer in inoculated leaves did not result in higher TuYV accumulation in systemic leaves, which indicates that virus long-distance movement was not affected. Since GFP:CIPK7 was localized in or near plasmodesmata, CIPK7 could negatively regulate TuYV export from infected cells. - Highlights: • The C-terminal domain of TuYV-RT is required for long-distance movement. • CIPK7 from Arabidopsis interacts with RT_C_t_e_r in yeast and in plants. • CIPK7 overexpression increases virus titer locally but not virus systemic movement. • CIPK7 localizes to plasmodesmata. • CIPK7 could be a defense protein regulating virus export.

  11. True-color 640 ppi OLED arrays patterned by CA i-line photolithography

    NARCIS (Netherlands)

    Malinowski, P.E.; Ke, T.; Nakamura, A.; Chang, T.-Y.; Gokhale, P.; Steudel, S.; Janssen, D.; Kamochi, Y.; Koyama, I.; Iwai,Y.; Heremans, P.

    2015-01-01

    In this paper, side-by-side patterning of red, green and blue OLEDs is demonstrated. To achieve 640 ppi arrays with 20 µm subpixel pitch, chemically amplified, i-line photoresist system with submicron resolution was used. These results show feasibility of obtaining full-color displays with

  12. Study of band terminating in the A {approx_equal} 100 by EUROGAM; Recherche de terminaisons de bandes dans la region A {approx_equal} 100 avec EUROGAM

    Energy Technology Data Exchange (ETDEWEB)

    Gizon, J.; Gizon, A.; Genevey, J.; Santos, D. [Inst. des Sciences Nucleaires, Grenoble-1 Univ., 38 (France); Nyako, B.M.; Timar, J.; Zolnai, L. [Institute of Nuclear Research, Debrecen (Hungary); Boston, A.J.; Zoss, D.T.; Paul, E.S.; Semple, A.T. [Oliver Lodge Laboratory, University of Liverpool, Liverpool (United Kingdom); O`Brien, N.J.; Parry, C.M. [Department of Physics, University of York, Heslington, York (United Kingdom); Cata-Danil, Gh.; Bucurescu, D. [Horia Hulubei Institute of Physics and Nuclear Engineering, Bucharest (Romania); Afanasjev, A.V.; Ragnarsson, I. [Department of Mathematical Physics, University of Lund, Lund (Sweden)

    1997-12-31

    Terminating bands in nuclei in the A{approx_equal} 100 region have been investigated using the EUROGAM2 array. Results have been obtained for Pd (Z 46) and Rh (Z = 45) isotopes. In the nucleus {sup 102}Pd, eight terminating configurations are identified. It is the first nucleus where terminating bands built on the valence space configurations and on core excited configurations are observed. Terminating bands have been also found in {sup 103}Pd and {sup 102}Rh. For {sup 102}Rh it is the first case of band terminations identified in a doubly-odd nucleus below the Z = 50 shell closure. (authors) 9 refs., 2 figs.

  13. Evolutionary Divergence of the C-terminal Domain of Complexin Accounts for Functional Disparities between Vertebrate and Invertebrate Complexins

    Directory of Open Access Journals (Sweden)

    Rachel T. Wragg

    2017-05-01

    Full Text Available Complexin is a critical presynaptic protein that regulates both spontaneous and calcium-triggered neurotransmitter release in all synapses. Although the SNARE-binding central helix of complexin is highly conserved and required for all known complexin functions, the remainder of the protein has profoundly diverged across the animal kingdom. Striking disparities in complexin inhibitory activity are observed between vertebrate and invertebrate complexins but little is known about the source of these differences or their relevance to the underlying mechanism of complexin regulation. We found that mouse complexin 1 (mCpx1 failed to inhibit neurotransmitter secretion in Caenorhabditis elegans neuromuscular junctions lacking the worm complexin 1 (CPX-1. This lack of inhibition stemmed from differences in the C-terminal domain (CTD of mCpx1. Previous studies revealed that the CTD selectively binds to highly curved membranes and directs complexin to synaptic vesicles. Although mouse and worm complexin have similar lipid binding affinity, their last few amino acids differ in both hydrophobicity and in lipid binding conformation, and these differences strongly impacted CPX-1 inhibitory function. Moreover, function was not maintained if a critical amphipathic helix in the worm CPX-1 CTD was replaced with the corresponding mCpx1 amphipathic helix. Invertebrate complexins generally shared more C-terminal similarity with vertebrate complexin 3 and 4 isoforms, and the amphipathic region of mouse complexin 3 significantly restored inhibitory function to worm CPX-1. We hypothesize that the CTD of complexin is essential in conferring an inhibitory function to complexin, and that this inhibitory activity has been attenuated in the vertebrate complexin 1 and 2 isoforms. Thus, evolutionary changes in the complexin CTD differentially shape its synaptic role across phylogeny.

  14. Awareness and use of contraception by women seeking termination of pregnancy in south eastern Nigeria

    Directory of Open Access Journals (Sweden)

    Echendu Dolly Adinma

    2011-03-01

    Full Text Available Objective: To determine the awareness and use of contraception by women seeking for termination of pregnancy in south eastern Nigeria. Methods: A descriptive cross-sectional questionnaire based on the study of one hundred consecutive abortion seekers attending a clinic in southeastern Nigeria was utilized. Results: Mean age of the respondents was (23.5暲 4.4 years. The majority were students (55.0% with 64.0% having secondary education and 33.0% possesing tertiary educational qualifications. Seventy five percent were nulliparous while 49% had one or more previous pregnancy termination. The majority of the respondents (73% were aware of contraceptive methods but only 10% had ever used including 6% using male condom. Only 38% of the respondents desired to use contraceptives after the termination of index pregnancy. Conclusions: It is concluded that the majority have the high level of contraceptive awareness but contraceptive usage is shockingly low. Therefore, there is a strong need to conduct further and wide spread research not only into the various factors that influence access to contraception but also factors that promote induced abortion and overall unsafe abortion morbidity and mortality as a basis towards the enrichment of discussion related to family planning and contraception, the magnitude of abortion problems, and abortion laws in Nigeria.

  15. First principles calculations of optical properties of the armchair SiC nanoribbons with O, F and H termination

    Science.gov (United States)

    Lu, Dao-Bang; Song, Yu-Ling

    2018-03-01

    Based on density functional theory, we perform first-principles investigations to study the optical properties of the O-, F- and H-terminated SiC nanoribbons with armchair edges (ASiCNRs). By irradiating with an external electromagnetic field, we calculate the dielectric function, reflection spectra, energy loss coefficient and the real part of the conductance. It is demonstrated that the optical constants are sensitive to the low-energy range, different terminal atoms do not make much difference in the shape of the curves of the optical constants for the same-width ASiCNR, and the optical constants of wider nanoribbons usually have higher peaks than that of the narrower ones in low energy range. We hope that our study helps in experimental technology of fabricating high-quality SiC-based nanoscale photoelectric device.

  16. Insights into PG-binding, conformational change, and dimerization of the OmpA C-terminal domains from Salmonella enterica serovar Typhimurium and Borrelia burgdorferi: Characterization of OmpA C-Terminal Domain

    Energy Technology Data Exchange (ETDEWEB)

    Tan, Kemin [Center for Structural Genomics of Infectious Diseases, University of Chicago, 5735 South Ellis Avenue Chicago Illinois 60637; Midwest Center for Structural Genomics, Argonne National Laboratory, Argonne Illinois 60439; Structural Biology Center, Biosciences, Argonne National Laboratory, Argonne Illinois 60439; Deatherage Kaiser, Brooke L. [National Security Directorate, Pacific Northwest National Laboratory, Richland Washington 99352; Wu, Ruiying [Midwest Center for Structural Genomics, Argonne National Laboratory, Argonne Illinois 60439; Cuff, Marianne [Midwest Center for Structural Genomics, Argonne National Laboratory, Argonne Illinois 60439; Fan, Yao [Midwest Center for Structural Genomics, Argonne National Laboratory, Argonne Illinois 60439; Bigelow, Lance [Midwest Center for Structural Genomics, Argonne National Laboratory, Argonne Illinois 60439; Jedrzejczak, Robert P. [Center for Structural Genomics of Infectious Diseases, University of Chicago, 5735 South Ellis Avenue Chicago Illinois 60637; Adkins, Joshua N. [Earth and Biological Sciences Directorate, Pacific Northwest National Laboratory, Richland Washington 99352; Cort, John R. [Earth and Biological Sciences Directorate, Pacific Northwest National Laboratory, Richland Washington 99352; Babnigg, Gyorgy [Center for Structural Genomics of Infectious Diseases, University of Chicago, 5735 South Ellis Avenue Chicago Illinois 60637; Midwest Center for Structural Genomics, Argonne National Laboratory, Argonne Illinois 60439; Joachimiak, Andrzej [Center for Structural Genomics of Infectious Diseases, University of Chicago, 5735 South Ellis Avenue Chicago Illinois 60637; Midwest Center for Structural Genomics, Argonne National Laboratory, Argonne Illinois 60439; Structural Biology Center, Biosciences, Argonne National Laboratory, Argonne Illinois 60439

    2017-06-19

    S. Typhimurium can induce both humoral and cell-mediated responses when establishing itself in the host. These responses are primarily stimulated against the lipopolysaccharide and major outer membrane (OM) proteins of the bacterium. OmpA is one of these major OM proteins. It comprises a N-terminal eight-stranded -barrel membrane domain and a C-terminal so-called OmpA C-terminal domain (OmpACTD). The OmpACTD and its homologs are believed to bind to peptidoglycan (PG) within the periplasm, maintaining bacterial osmotic homeostasis and modulating the permeability and integrity of the outer membrane. Here we present the structures of two forms of the OmpACTD of S. Typhimurium (STOmpACTD) and one structure of the less-studied OmpACTD of Borrelia burgdorferi (BbOmpACTD). In the open form of STOmpACTD, an aspartic acid residue from a long 2-3 loop points into the binding pocket, suggesting that an anion group such as a carboxylate group from PG is favored at the binding site. In the closed form of STOmpACTD and in the structure of BbOmpACTD, a sulfate group from the crystallization buffer is tightly bound at the equivalent site. The differences between the closed and open forms of STOmpACTD, suggest a large conformational change that includes an extension of 3 helix by ordering a part of 2-3 loop. We suggest that the sulfate anion observed in these structures mimics the carboxylate group of PG when bound to STOmpACTD. In addition, the binding of PG or a ligand mimic may enhance dimerization of STOmpACTD, or possibly that of full length STOmpA.

  17. Specific effects of c-Jun NH2-terminal kinase-interacting protein 1 in neuronal axons

    Directory of Open Access Journals (Sweden)

    Shu Tang

    2016-01-01

    Full Text Available c-Jun NH2-terminal kinase (JNK-interacting protein 3 plays an important role in brain-derived neurotrophic factor/tropomyosin-related kinase B (TrkB anterograde axonal transport. It remains unclear whether JNK-interacting protein 1 mediates similar effects, or whether JNK-interacting protein 1 affects the regulation of TrkB anterograde axonal transport. In this study, we isolated rat embryonic hippocampus and cultured hippocampal neurons in vitro. Coimmunoprecipitation results demonstrated that JNK-interacting protein 1 formed TrkB complexes in vitro and in vivo. Immunocytochemistry results showed that when JNK-interacting protein 1 was highly expressed, the distribution of TrkB gradually increased in axon terminals. However, the distribution of TrkB reduced in axon terminals after knocking out JNK-interacting protein 1. In addition, there were differences in distribution of TrkB after JNK-interacting protein 1 was knocked out compared with not. However, knockout of JNK-interacting protein 1 did not affect the distribution of TrkB in dendrites. These findings confirm that JNK-interacting protein 1 can interact with TrkB in neuronal cells, and can regulate the transport of TrkB in axons, but not in dendrites.

  18. 3.3 Å structure of Niemann–Pick C1 protein reveals insights into the function of the C-terminal luminal domain in cholesterol transport

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xiaochun; Lu, Feiran; Trinh, Michael N.; Schmiege, Philip; Seemann, Joachim; Wang, Jiawei; Blobel, Günter

    2017-08-07

    Niemann–Pick C1 (NPC1) and NPC2 proteins are indispensable for the export of LDL-derived cholesterol from late endosomes. Mutations in these proteins result in Niemann–Pick type C disease, a lysosomal storage disease. Despite recent reports of the NPC1 structure depicting its overall architecture, the function of its C-terminal luminal domain (CTD) remains poorly understood even though 45% of NPC disease-causing mutations are in this domain. Here, we report a crystal structure at 3.3 Å resolution of NPC1* (residues 314–1,278), which—in contrast to previous lower resolution structures—features the entire CTD well resolved. Notably, all eight cysteines of the CTD form four disulfide bonds, one of which (C909–C914) enforces a specific loop that in turn mediates an interaction with a loop of the N-terminal domain (NTD). Importantly, this loop and its interaction with the NTD were not observed in any previous structures due to the lower resolution. Our mutagenesis experiments highlight the physiological relevance of the CTD–NTD interaction, which might function to keep the NTD in the proper orientation for receiving cholesterol from NPC2. Additionally, this structure allows us to more precisely map all of the disease-causing mutations, allowing future molecular insights into the pathogenesis of NPC disease.

  19. Identification of a New Interaction Mode between the Src Homology 2 Domain of C-terminal Src Kinase (Csk) and Csk-binding Protein/Phosphoprotein Associated with Glycosphingolipid Microdomains♦

    Science.gov (United States)

    Tanaka, Hiroaki; Akagi, Ken-ichi; Oneyama, Chitose; Tanaka, Masakazu; Sasaki, Yuichi; Kanou, Takashi; Lee, Young-Ho; Yokogawa, Daisuke; Dobenecker, Marc-Werner; Nakagawa, Atsushi; Okada, Masato; Ikegami, Takahisa

    2013-01-01

    Proteins with Src homology 2 (SH2) domains play major roles in tyrosine kinase signaling. Structures of many SH2 domains have been studied, and the regions involved in their interactions with ligands have been elucidated. However, these analyses have been performed using short peptides consisting of phosphotyrosine followed by a few amino acids, which are described as the canonical recognition sites. Here, we report the solution structure of the SH2 domain of C-terminal Src kinase (Csk) in complex with a longer phosphopeptide from the Csk-binding protein (Cbp). This structure, together with biochemical experiments, revealed the existence of a novel binding region in addition to the canonical phosphotyrosine 314-binding site of Cbp. Mutational analysis of this second region in cells showed that both canonical and novel binding sites are required for tumor suppression through the Cbp-Csk interaction. Furthermore, the data indicate an allosteric connection between Cbp binding and Csk activation that arises from residues in the βB/βC loop of the SH2 domain. PMID:23548896

  20. Periostin shows increased evolutionary plasticity in its alternatively spliced region

    Directory of Open Access Journals (Sweden)

    Hoersch Sebastian

    2010-01-01

    Full Text Available Abstract Background Periostin (POSTN is a secreted extracellular matrix protein of poorly defined function that has been related to bone and heart development as well as to cancer. In human and mouse, it is known to undergo alternative splicing in its C-terminal region, which is devoid of known protein domains. Differential expression of periostin, sometimes of specific splicing isoforms, is observed in a broad range of human cancers, including breast, pancreatic, and colon cancer. Here, we combine genomic and transcriptomic sequence data from vertebrate organisms to study the evolution of periostin and particularly of its C-terminal region. Results We found that the C-terminal part of periostin is markedly more variable among vertebrates than the rest of periostin in terms of exon count, length, and splicing pattern, which we interpret as a consequence of neofunctionalization after the split between periostin and its paralog transforming growth factor, beta-induced (TGFBI. We also defined periostin's sequential 13-amino acid repeat units - well conserved in teleost fish, but more obscure in higher vertebrates - whose secondary structure is predicted to be consecutive beta strands. We suggest that these beta strands may mediate binding interactions with other proteins through an extended beta-zipper in a manner similar to the way repeat units in bacterial cell wall proteins have been reported to bind human fibronectin. Conclusions Our results, obtained with the help of the increasingly large collection of complete vertebrate genomes, document the evolutionary plasticity of periostin's C-terminal region, and for the first time suggest a basis for its functional role.

  1. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  2. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

  3. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  4. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

  5. Conserved Patterns of Microbial Immune Escape: Pathogenic Microbes of Diverse Origin Target the Human Terminal Complement Inhibitor Vitronectin via a Single Common Motif.

    Directory of Open Access Journals (Sweden)

    Teresia Hallström

    Full Text Available Pathogenicity of many microbes relies on their capacity to resist innate immunity, and to survive and persist in an immunocompetent human host microbes have developed highly efficient and sophisticated complement evasion strategies. Here we show that different human pathogens including Gram-negative and Gram-positive bacteria, as well as the fungal pathogen Candida albicans, acquire the human terminal complement regulator vitronectin to their surface. By using truncated vitronectin fragments we found that all analyzed microbial pathogens (n = 13 bound human vitronectin via the same C-terminal heparin-binding domain (amino acids 352-374. This specific interaction leaves the terminal complement complex (TCC regulatory region of vitronectin accessible, allowing inhibition of C5b-7 membrane insertion and C9 polymerization. Vitronectin complexed with the various microbes and corresponding proteins was thus functionally active and inhibited complement-mediated C5b-9 deposition. Taken together, diverse microbial pathogens expressing different structurally unrelated vitronectin-binding molecules interact with host vitronectin via the same conserved region to allow versatile control of the host innate immune response.

  6. Assessment of the PrPc Amino-Terminal Domain in Prion Species Barriers.

    Science.gov (United States)

    Davenport, Kristen A; Henderson, Davin M; Mathiason, Candace K; Hoover, Edward A

    2016-12-01

    Chronic wasting disease (CWD) in cervids and bovine spongiform encephalopathy (BSE) in cattle are prion diseases that are caused by the same protein-misfolding mechanism, but they appear to pose different risks to humans. We are interested in understanding the differences between the species barriers of CWD and BSE. We used real-time, quaking-induced conversion (RT-QuIC) to model the central molecular event in prion disease, the templated misfolding of the normal prion protein, PrP c , to a pathogenic, amyloid isoform, scrapie prion protein, PrP Sc We examined the role of the PrP c amino-terminal domain (N-terminal domain [NTD], amino acids [aa] 23 to 90) in cross-species conversion by comparing the conversion efficiency of various prion seeds in either full-length (aa 23 to 231) or truncated (aa 90 to 231) PrP c We demonstrate that the presence of white-tailed deer and bovine NTDs hindered seeded conversion of PrP c , but human and bank vole NTDs did the opposite. Additionally, full-length human and bank vole PrP c s were more likely to be converted to amyloid by CWD prions than were their truncated forms. A chimera with replacement of the human NTD by the bovine NTD resembled human PrP c The requirement for an NTD, but not for the specific human sequence, suggests that the NTD interacts with other regions of the human PrP c to increase promiscuity. These data contribute to the evidence that, in addition to primary sequence, prion species barriers are controlled by interactions of the substrate NTD with the rest of the substrate PrP c molecule. We demonstrate that the amino-terminal domain of the normal prion protein, PrP c , hinders seeded conversion of bovine and white-tailed deer PrP c s to the prion forms, but it facilitates conversion of the human and bank vole PrP c s to the prion forms. Additionally, we demonstrate that the amino-terminal domain of human and bank vole PrP c s requires interaction with the rest of the molecule to facilitate conversion by CWD

  7. Serum concentration of ubiquitin c-terminal hydrolase-L1 in detecting severity of traumatic brain injury

    Science.gov (United States)

    Siahaan, A. M. P.; Japardi, I.; Hakim, A. A.

    2018-03-01

    One of the main problems with ahead injury is assessing the severity. While physical examination and imaging had limitations, neuronal damage markers, ubiquitin C-terminal hydrolase-L1 (UCH-L1), released in theblood may provide valuable information about diagnosis the traumatic brain injury (TBI).Analyzing the concentrations of serum ubiquitin C-terminal hydrolase-L1 (UCH-L1), there must have a neuronal injury biomarker, in theTBI patients serum and their association with clinical characteristics and outcome. There were 80 TBI subjects, and there are mild, moderate, and severe involved in this study of case- control. By using ELISA, we studied the profile of serum UCH-L1 levels for TBI patients. TheUCH-L1 serum level of moderate and severe head injury is higher than in mild head injury (pinjury patients. There is no particular correlation found between serum UCH-L1 level and outcome. Serum levels of UCH-L1 appear to have potential clinical utility in diagnosing TBI but do not correlate with outcome.

  8. Purification, crystallization and preliminary X-ray diffraction analysis of the C-terminal fragment of the MvfR protein from Pseudomonas aeruginosa

    International Nuclear Information System (INIS)

    Kefala, Katerina; Kotsifaki, Dina; Providaki, Mary; Kapetaniou, Evangelia G.; Rahme, Lawrence; Kokkinidis, Michael

    2012-01-01

    MvfRC87, a 242-residue C-terminal segment of the LysR-type transcriptional regulator MvfR, was produced in Escherichia coli, purified and crystallized. The LysR-type transcriptional regulator MvfR plays a critical role in Pseudomonas aeruginosa pathogenicity via the transcriptional regulation of multiple quorum-sensing-regulated virulence factors. The protein also controls pathogenic type VI secretion loci. MvfRC87, a 242-residue C-terminal segment of MvfR, was produced in Escherichia coli, purified and crystallized. X-ray diffraction data were collected using synchrotron radiation and crystallographic parameters were determined

  9. Unique players in the BMP pathway: Small C-terminal domain phosphatases dephosphorylate Smad1 to attenuate BMP signaling

    Science.gov (United States)

    Knockaert, Marie; Sapkota, Gopal; Alarcón, Claudio; Massagué, Joan; Brivanlou, Ali H.

    2006-01-01

    Smad transcription factors are key signal transducers for the TGF-β/bone morphogenetic protein (BMP) family of cytokines and morphogens. C-terminal serine phosphorylation by TGF-β and BMP membrane receptors drives Smads into the nucleus as transcriptional regulators. Dephosphorylation and recycling of activated Smads is an integral part of this process, which is critical for agonist sensing by the cell. However, the nuclear phosphatases involved have remained unknown. Here we provide functional, biochemical, and embryological evidence identifying the SCP (small C-terminal domain phosphatase) family of nuclear phosphatases as mediators of Smad1 dephosphorylation in the BMP signaling pathway in vertebrates. Xenopus SCP2/Os4 inhibits BMP activity in the presumptive ectoderm and leads to neuralization. In Xenopus embryos, SCP2/Os4 and human SCP1, 2, and 3 cause selective dephosphorylation of Smad1 compared with Smad2, inhibiting BMP- and Smad1-dependent transcription and leading to the induction of the secondary dorsal axis. In human cells, RNAi-mediated depletion of SCP1 and SCP2 increases the extent and duration of Smad1 phosphorylation in response to BMP, the transcriptional action of Smad1, and the strength of endogenous BMP gene responses. The present identification of the SCP family as Smad C-terminal phosphatases sheds light on the events that attenuate Smad signaling and reveals unexpected links to the essential phosphatases that control RNA polymerase II in eukaryotes. PMID:16882717

  10. 4-alkyl-L-(Dehydro)proline biosynthesis in actinobacteria involves N-terminal nucleophile-hydrolase activity of γ-glutamyltranspeptidase homolog for C-C bond cleavage

    Science.gov (United States)

    Zhong, Guannan; Zhao, Qunfei; Zhang, Qinglin; Liu, Wen

    2017-07-01

    γ-Glutamyltranspeptidases (γ-GTs), ubiquitous in glutathione metabolism for γ-glutamyl transfer/hydrolysis, are N-terminal nucleophile (Ntn)-hydrolase fold proteins that share an autoproteolytic process for self-activation. γ-GT homologues are widely present in Gram-positive actinobacteria where their Ntn-hydrolase activities, however, are not involved in glutathione metabolism. Herein, we demonstrate that the formation of 4-Alkyl-L-(dehydro)proline (ALDP) residues, the non-proteinogenic α-amino acids that serve as vital components of many bioactive metabolites found in actinobacteria, involves unprecedented Ntn-hydrolase activity of γ-GT homologue for C-C bond cleavage. The related enzymes share a key Thr residue, which acts as an internal nucleophile for protein hydrolysis and then as a newly released N-terminal nucleophile for carboxylate side-chain processing likely through the generation of an oxalyl-Thr enzyme intermediate. These findings provide mechanistic insights into the biosynthesis of various ALDP residues/associated natural products, highlight the versatile functions of Ntn-hydrolase fold proteins, and particularly generate interest in thus far less-appreciated γ-GT homologues in actinobacteria.

  11. Single amino acids in the carboxyl terminal domain of aquaporin-1 contribute to cGMP-dependent ion channel activation

    Directory of Open Access Journals (Sweden)

    Yool Andrea J

    2003-10-01

    Full Text Available Abstract Background Aquaporin-1 (AQP1 functions as an osmotic water channel and a gated cation channel. Activation of the AQP1 ion conductance by intracellular cGMP was hypothesized to involve the carboxyl (C- terminus, based on amino acid sequence alignments with cyclic-nucleotide-gated channels and cGMP-selective phosphodiesterases. Results Voltage clamp analyses of human AQP1 channels expressed in Xenopus oocytes demonstrated that the nitric oxide donor, sodium nitroprusside (SNP; 3–14 mM activated the ionic conductance response in a dose-dependent manner. Block of soluble guanylate cyclase prevented the response. Enzyme immunoassays confirmed a linear dose-dependent relationship between SNP and the resulting intracellular cGMP levels (up to 1700 fmol cGMP /oocyte at 14 mM SNP. Results here are the first to show that the efficacy of ion channel activation is decreased by mutations of AQP1 at conserved residues in the C-terminal domain (aspartate D237 and lysine K243. Conclusions These data support the idea that the limited amino acid sequence similarities found between three diverse classes of cGMP-binding proteins are significant to the function of AQP1 as a cGMP-gated ion channel, and provide direct evidence for the involvement of the AQP1 C-terminal domain in cGMP-mediated ion channel activation.

  12. Charge neutralization as the major factor for the assembly of nucleocapsid-like particles from C-terminal truncated hepatitis C virus core protein

    Directory of Open Access Journals (Sweden)

    Theo Luiz Ferraz de Souza

    2016-11-01

    Full Text Available Background Hepatitis C virus (HCV core protein, in addition to its structural role to form the nucleocapsid assembly, plays a critical role in HCV pathogenesis by interfering in several cellular processes, including microRNA and mRNA homeostasis. The C-terminal truncated HCV core protein (C124 is intrinsically unstructured in solution and is able to interact with unspecific nucleic acids, in the micromolar range, and to assemble into nucleocapsid-like particles (NLPs in vitro. The specificity and propensity of C124 to the assembly and its implications on HCV pathogenesis are not well understood. Methods Spectroscopic techniques, transmission electron microscopy and calorimetry were used to better understand the propensity of C124 to fold or to multimerize into NLPs when subjected to different conditions or in the presence of unspecific nucleic acids of equivalent size to cellular microRNAs. Results The structural analysis indicated that C124 has low propensity to self-folding. On the other hand, for the first time, we show that C124, in the absence of nucleic acids, multimerizes into empty NLPs when subjected to a pH close to its isoelectric point (pH ≈ 12, indicating that assembly is mainly driven by charge neutralization. Isothermal calorimetry data showed that the assembly of NLPs promoted by nucleic acids is enthalpy driven. Additionally, data obtained from fluorescence correlation spectroscopy show that C124, in nanomolar range, was able to interact and to sequester a large number of short unspecific nucleic acids into NLPs. Discussion Together, our data showed that the charge neutralization is the major factor for the nucleocapsid-like particles assembly from C-terminal truncated HCV core protein. This finding suggests that HCV core protein may physically interact with unspecific cellular polyanions, which may correspond to microRNAs and mRNAs in a host cell infected by HCV, triggering their confinement into infectious particles.

  13. A C-terminal PDZ domain-binding sequence is required for striatal distribution of the dopamine transporter

    DEFF Research Database (Denmark)

    Rickhag, Karl Mattias; Hansen, Freja Herborg; Sørensen, Gunnar

    2013-01-01

    believed to bind synaptic scaffolding proteins, but its functional significance is uncertain. Here we demonstrate that two different dopamine transporter knock-in mice with disrupted PDZ-binding motifs (dopamine transporter-AAA and dopamine transporter+Ala) are characterized by dramatic loss of dopamine......The dopamine transporter mediates reuptake of dopamine from the synaptic cleft. The cellular mechanisms controlling dopamine transporter levels in striatal nerve terminals remain poorly understood. The dopamine transporters contain a C-terminal PDZ (PSD-95/Discs-large/ZO-1) domain-binding sequence...... transporter expression in the striatum, causing hyperlocomotion and attenuated response to amphetamine. In cultured dopaminergic neurons and striatal slices from dopamine transporter-AAA mice, we find markedly reduced dopamine transporter surface levels and evidence for enhanced constitutive internalization...

  14. Structure of the C-terminal domain of lettuce necrotic yellows virus phosphoprotein.

    Science.gov (United States)

    Martinez, Nicolas; Ribeiro, Euripedes A; Leyrat, Cédric; Tarbouriech, Nicolas; Ruigrok, Rob W H; Jamin, Marc

    2013-09-01

    Lettuce necrotic yellows virus (LNYV) is a prototype of the plant-adapted cytorhabdoviruses. Through a meta-prediction of disorder, we localized a folded C-terminal domain in the amino acid sequence of its phosphoprotein. This domain consists of an autonomous folding unit that is monomeric in solution. Its structure, solved by X-ray crystallography, reveals a lollipop-shaped structure comprising five helices. The structure is different from that of the corresponding domains of other Rhabdoviridae, Filoviridae, and Paramyxovirinae; only the overall topology of the polypeptide chain seems to be conserved, suggesting that this domain evolved under weak selective pressure and varied in size by the acquisition or loss of functional modules.

  15. Decay accelerating factor of complement is anchored to cells by a C-terminal glycolipid

    International Nuclear Information System (INIS)

    Medof, M.E.; Walter, E.I.; Roberts, W.L.; Haas, R.; Rosenberry, T.L.

    1986-01-01

    Membrane-associated decay accelerating factor (DAF) of human erythrocytes (E/sup hu/) was analyzed for a C-terminal glycolipid anchoring structure. Automated amino acid analysis of DAF following reductive radiomethylation revealed ethanolamine and glucosamine residues in proportions identical with those present in the E/sup hu/ acetylcholinesterase (AChE) anchor. Cleavage of radiomethylated 70-kilodalton (kDa) DAF with papain released the labeled ethanolamine and glucosamine and generated 61- and 55-kDa DAF products that retained all labeled Lys and labeled N-terminal Asp. Incubation of intact E/sup hu/ with phosphatidylinositol-specific phospholipase C (PI-PLC), which cleaves the anchors in trypanosome membrane form variant surface glycoproteins (mfVSGs) and murine thymocyte Thy-1 antigen, released 15% of the cell-associated DAF antigen. The released 67-kDa PI-PLC DAF derivative retained its ability to decay the classical C3 convertase C4b2a but was unable to membrane-incorporate and displayed physicochemical properties similar to urine DAF, a hydrophilic DAF form that can be isolated for urine. Nitrous acid deamination cleavage of E/sup hu/ DAF at glucosamine following labeling with the lipophilic photoreagent 3-(trifluoromethyl)-3-(m-[ 125 I]iodophenyl)diazirine ([ 125 I]TID) released the [ 125 I]TID label in a parallel fashion as from [ 125 I]TID-labeled AChE. Biosynthetic labeling of HeLa cells with [ 3 H] ethanolamine resulted in rapid 3 H incorporation into both 48-kDa pro-DAF and 72-kDa mature epithelial cell DAF. The findings indicate that DAF and AChE are anchored in E/sup hu/ by the same or a similar glycolipid structure and that, like VSGs, this structure is incorporated into DAF early in DAF biosynthesis prior to processing of pro-DAF in the Golgi

  16. Functional Properties of a Newly Identified C-terminal Splice Variant of Cav1.3 L-type Ca2+ Channels*

    Science.gov (United States)

    Bock, Gabriella; Gebhart, Mathias; Scharinger, Anja; Jangsangthong, Wanchana; Busquet, Perrine; Poggiani, Chiara; Sartori, Simone; Mangoni, Matteo E.; Sinnegger-Brauns, Martina J.; Herzig, Stefan; Striessnig, Jörg; Koschak, Alexandra

    2011-01-01

    An intramolecular interaction between a distal (DCRD) and a proximal regulatory domain (PCRD) within the C terminus of long Cav1.3 L-type Ca2+ channels (Cav1.3L) is a major determinant of their voltage- and Ca2+-dependent gating kinetics. Removal of these regulatory domains by alternative splicing generates Cav1.342A channels that activate at a more negative voltage range and exhibit more pronounced Ca2+-dependent inactivation. Here we describe the discovery of a novel short splice variant (Cav1.343S) that is expressed at high levels in the brain but not in the heart. It lacks the DCRD but, in contrast to Cav1.342A, still contains PCRD. When expressed together with α2δ1 and β3 subunits in tsA-201 cells, Cav1.343S also activated at more negative voltages like Cav1.342A but Ca2+-dependent inactivation was less pronounced. Single channel recordings revealed much higher channel open probabilities for both short splice variants as compared with Cav1.3L. The presence of the proximal C terminus in Cav1.343S channels preserved their modulation by distal C terminus-containing Cav1.3- and Cav1.2-derived C-terminal peptides. Removal of the C-terminal modulation by alternative splicing also induced a faster decay of Ca2+ influx during electrical activities mimicking trains of neuronal action potentials. Our findings extend the spectrum of functionally diverse Cav1.3 L-type channels produced by tissue-specific alternative splicing. This diversity may help to fine tune Ca2+ channel signaling and, in the case of short variants lacking a functional C-terminal modulation, prevent excessive Ca2+ accumulation during burst firing in neurons. This may be especially important in neurons that are affected by Ca2+-induced neurodegenerative processes. PMID:21998310

  17. Molecular architecture of the nucleoprotein C-terminal domain from the Ebola and Marburg viruses.

    Science.gov (United States)

    Baker, Laura E; Ellena, Jeffrey F; Handing, Katarzyna B; Derewenda, Urszula; Utepbergenov, Darkhan; Engel, Daniel A; Derewenda, Zygmunt S

    2016-01-01

    The Filoviridae family of negative-sense, single-stranded RNA (ssRNA) viruses is comprised of two species of Marburgvirus (MARV and RAVV) and five species of Ebolavirus, i.e. Zaire (EBOV), Reston (RESTV), Sudan (SUDV), Taï Forest (TAFV) and Bundibugyo (BDBV). In each of these viruses the ssRNA encodes seven distinct proteins. One of them, the nucleoprotein (NP), is the most abundant viral protein in the infected cell and within the viral nucleocapsid. It is tightly associated with the viral RNA in the nucleocapsid, and during the lifecycle of the virus is essential for transcription, RNA replication, genome packaging and nucleocapsid assembly prior to membrane encapsulation. The structure of the unique C-terminal globular domain of the NP from EBOV has recently been determined and shown to be structurally unrelated to any other known protein [Dziubańska et al. (2014), Acta Cryst. D70, 2420-2429]. In this paper, a study of the C-terminal domains from the NP from the remaining four species of Ebolavirus, as well as from the MARV strain of Marburgvirus, is reported. As expected, the crystal structures of the BDBV and TAFV proteins show high structural similarity to that from EBOV, while the MARV protein behaves like a molten globule with a core residual structure that is significantly different from that of the EBOV protein.

  18. Roles of the C-terminal domains of human dihydrodiol dehydrogenase isoforms in the binding of substrates and modulators: probing with chimaeric enzymes.

    Science.gov (United States)

    Matsuura, K; Hara, A; Deyashiki, Y; Iwasa, H; Kume, T; Ishikura, S; Shiraishi, H; Katagiri, Y

    1998-01-01

    Human liver dihydrodiol dehydrogenase (DD; EC 1.3.1.20) exists in isoforms (DD1, DD2 and DD4) composed of 323 amino acids. DD1 and DD2 share 98% amino acid sequence identity, but show lower identities (approx. 83%) with DD4, in which a marked difference is seen in the C-terminal ten amino acids. DD4 exhibits unique catalytic properties, such as the ability to oxidize both (R)- and (S)-alicyclic alcohols equally, high dehydrogenase activity for bile acids, potent inhibition by steroidal anti-inflammatory drugs and activation by sulphobromophthalein and clofibric acid derivatives. In this study, we have prepared chimaeric enzymes, in which we exchanged the C-terminal 39 residues between the two enzymes. Compared with DD1, CDD1-4 (DD1 with the C-terminal sequence of DD4) had increased kcat/Km values for 3alpha-hydroxy-5beta-androstanes and bile acids of 3-9-fold and decreased values for the other substrates by 5-100-fold. It also became highly sensitive to DD4 inhibitors such as phenolphthalein and hexoestrol. Another chimaeric enzyme, CDD4-1 (DD4 with the C-terminal sequence of DD1), showed the same (S)-stereospecificity for the alicyclic alcohols as DD1, had decreased kcat/Km values for bile acids with 7beta- or 12alpha-hydroxy groups by more than 120-fold and was resistant to inhibition by betamethasone. In addition, the activation effects of sulphobromophthalein and bezafibrate decreased or disappeared for CDD4-1. The recombinant DD4 with the His314-->Pro (the corresponding residue of DD1) mutation showed intermediate changes in the properties between those of wild-type DD4 and CDD4-1. The results indicate that the binding of substrates, inhibitors and activators to the enzymes is controlled by residues in their C-terminal domains; multiple residues co-ordinately act as determinants for substrate specificity and inhibitor sensitivity. PMID:9820821

  19. Synthesis of substituted mono- and diindole C-nucleoside analogues from sugar terminal alkynes by sequential sonogashira/heteroannulation reaction.

    Science.gov (United States)

    Zhang, Fuyi; Mu, Delong; Wang, Liming; Du, Pengfei; Han, Fen; Zhao, Yufen

    2014-10-17

    The synthesis of substituted mono- and diindole C-nucleoside analogues has been achieved in good to excellent yields by sequential Sonogashira coupling/NaAuCl4-catalyzed heteroannulation reactions of substituted 2-iodoanilines with various sugar terminal alkynes in one pot. The method is general, mild, and efficient and suitable for a wide range of sugar substrates, and 42 examples are given. The amino group of the substituted 2-iodoanilines is unprotected. The sugar terminal alkynes include furanosides, pyranosides, and acyclic glycosides with free hydroxyl groups, sensitive functional subtituents, and various protecting groups having different steric hindrance.

  20. The proapoptotic activity of C-terminal domain of apoptosis-inducing factor (AIF is separated from its N-terminal

    Directory of Open Access Journals (Sweden)

    YONG ZHANG

    2009-01-01

    Full Text Available Apoptosis-inducing factor (AIF is a mitochondrial flavoprotein that mediates both NADH-oxidizing and caspase-independent apoptosis. Further, the proapoptotic activity of AIF is located in the C-terminus of AIF, although the precise minimum sequence responsible for apoptosis induction remains to be investigated. In the present study, we generated two truncated AIFs, AIFΔ1-480-FLAG, which is a FLAG-tagged C-terminal peptide comprising amino acids from 481 to 613, and AIF360-480 containing amino acids from 360 to 480 of AIF. We used confocal microscopy to demonstrate that both the truncated proteins are expressed and located in the cytoplasm of transfected cells. AIFΔ1-480 but not AIF360-480 induces apoptosis in transfected cells. We also found that the expression of AIFΔ1-480 could initiate the release of cytochrome c from the mitochondria. The suppression of caspase-9 via siRNA blocked the proapoptotic activity of AIFΔ1-480. Therefore, AIFΔ 1-480 is sufficient for inducing caspase-9-dependent apoptotic signaling, probably by promoting the release of cytochrome c. At last, we generated a chimeric immuno-AIFΔ 1-480 protein, which comprised an HER2 antibody, a Pseudomonas exotoxin A translocation domain and AIFΔ 1-480. Human Jurkat cells transfected with the immuno-AIFΔl-480 gene could express and secrete the chimeric protein, which selectively recognize and kill HER2-overexpressing tumor cells. Our study demonstrates the feasibility of the immuno-AIFΔl-480 gene as a novel approach to treating HER2-overexpressing cancers.

  1. Structural implications of the C-terminal tail in the catalytic and stability properties of manganese peroxidases from ligninolytic fungi

    Energy Technology Data Exchange (ETDEWEB)

    Fernández-Fueyo, Elena [CSIC, Ramiro de Maeztu 9, 28040 Madrid (Spain); Acebes, Sandra [Barcelona Supercomputing Center, Jordi Girona 29, 08034 Barcelona (Spain); Ruiz-Dueñas, Francisco J.; Martínez, María Jesús; Romero, Antonio; Medrano, Francisco Javier, E-mail: fjmedrano@cib.csic.es [CSIC, Ramiro de Maeztu 9, 28040 Madrid (Spain); Guallar, Victor, E-mail: fjmedrano@cib.csic.es [Barcelona Supercomputing Center, Jordi Girona 29, 08034 Barcelona (Spain); ICREA, Passeig Lluís Companys 23, 08010 Barcelona (Spain); Martínez, Angel T., E-mail: fjmedrano@cib.csic.es [CSIC, Ramiro de Maeztu 9, 28040 Madrid (Spain)

    2014-12-01

    The variable C-terminal tail of manganese peroxidases, a group of enzymes involved in lignin degradation, is implicated in their catalytic and stability properties, as shown by new crystal structures, molecular-simulation and directed-mutagenesis data. Based on this structural–functional evaluation, short and long/extralong manganese peroxidase subfamilies have been accepted; the latter are characterized by exceptional stability, while it is shown for the first time that the former are able to oxidize other substrates at the same site where manganese(II) is oxidized. The genome of Ceriporiopsis subvermispora includes 13 manganese peroxidase (MnP) genes representative of the three subfamilies described in ligninolytic fungi, which share an Mn{sup 2+}-oxidation site and have varying lengths of the C-terminal tail. Short, long and extralong MnPs were heterologously expressed and biochemically characterized, and the first structure of an extralong MnP was solved. Its C-terminal tail surrounds the haem-propionate access channel, contributing to Mn{sup 2+} oxidation by the internal propionate, but prevents the oxidation of 2, 2′-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS), which is only oxidized by short MnPs and by shortened-tail variants from site-directed mutagenesis. The tail, which is anchored by numerous contacts, not only affects the catalytic properties of long/extralong MnPs but is also associated with their high acidic stability. Cd{sup 2+} binds at the Mn{sup 2+}-oxidation site and competitively inhibits oxidation of both Mn{sup 2+} and ABTS. Moreover, mutations blocking the haem-propionate channel prevent substrate oxidation. This agrees with molecular simulations that position ABTS at an electron-transfer distance from the haem propionates of an in silico shortened-tail form, while it cannot reach this position in the extralong MnP crystal structure. Only small differences exist between the long and the extralong MnPs, which do not justify their

  2. Basic amino acid residues located in the N-terminal region of BEND3 are essential for its nuclear localization

    Energy Technology Data Exchange (ETDEWEB)

    Shiheido, Hirokazu, E-mail: shiheido@ak.med.kyoto-u.ac.jp; Shimizu, Jun

    2015-02-20

    BEN domain-containing protein 3 (BEND3) has recently been reported to function as a heterochromatin-associated protein in transcriptional repression in the nucleus. BEND3 should have nuclear localization signals (NLSs) to localize to the nucleus in light of its molecular weight, which is higher than that allowed to pass through nuclear pore complexes. We here analyzed the subcellular localization of deletion/site-directed mutants of human BEND3 by an immunofluorescence assay in an attempt to identify the amino acids essential for its nuclear localization. We found that three basic amino acid residues located in the N-terminal region of BEND3 (BEND3{sub 56–58}, KRK) are essential, suggesting that these residues play a role as a functional NLS. These results provide valuable information for progressing research on BEND3. - Highlights: • BEND3 localizes to the nucleus. • The N-terminal 60 amino acids region of BEND3 contains NLS. • Amino acids located between 56 and 58 of BEND3 (KRK) are part of NLS. • KRK motif is highly conserved among BEND3 homologs.

  3. MCTS (Exams 70-640, 70-642 and 70-643)

    CERN Document Server

    Panek, William

    2011-01-01

    The must-have study guide for all three Windows Server 2008 R2 MCTS examsNetwork administrators boost their value to their employers with certification, and Microsoft?s three Windows Server 2008 exams offer certification specialties in configuring Active Directory, Network Infrastructure, and Applications Infrastructure. With complete coverage to prepare you for all three exams, this comprehensive study guide has three times the value. Real-world scenarios and hands-on exercises supplement the information to facilitate learning.The three Windows Server 2008 R2 exams (70-640, 70-642, and 70-643

  4. 32 CFR 37.640 - Must I include a provision for audits of for-profit participants?

    Science.gov (United States)

    2010-07-01

    ... OF DEFENSE DoD GRANT AND AGREEMENT REGULATIONS TECHNOLOGY INVESTMENT AGREEMENTS Award Terms Affecting Participants' Financial, Property, and Purchasing Systems Financial Matters § 37.640 Must I include a provision...

  5. The first N-terminal unprotected (Gly-Aib)n peptide: H-Gly-Aib-Gly-Aib-OtBu.

    Science.gov (United States)

    Gessmann, Renate; Brückner, Hans; Petratos, Kyriacos

    2015-12-01

    Glycine (Gly) is incorporated in roughly half of all known peptaibiotic (nonribosomally biosynthesized antibiotic peptides of fungal origin) sequences and is the residue with the greatest conformational flexibility. The conformational space of Aib (α-aminoisobutyric acid) is severely restricted by the second methyl group attached to the Cα atom. Most of the crystal structures containing Aib are N-terminal protected. Deprotection of the N- or C-terminus of peptides may alter the hydrogen-bonding scheme and/or the structure and may facilitate crystallization. The structure reported here for glycyl-α-aminoisobutyrylglycyl-α-aminoisobutyric acid tert-butyl ester, C16H30N4O5, describes the first N-terminal-unprotected (Gly-Aib)n peptide. The achiral peptide could form an intramolecular hydrogen bond between the C=O group of Gly1 and the N-H group of Aib4. This hydrogen bond is found in all tetrapeptides and N-terminal-protected tripeptides containing Aib, apart from one exception. In the present work, this hydrogen bond is not observed (N...O = 5.88 Å). Instead, every molecule is hydrogen bonded to six other symmetry-related molecules with a total of eight hydrogen bonds per molecule. The backbone conformation starts in the right-handed helical region (and the left-handed helical region for the inverted molecule) and reverses the screw sense in the last two residues.

  6. Ligand sphere conversions in terminal carbide complexes

    DEFF Research Database (Denmark)

    Morsing, Thorbjørn Juul; Reinholdt, Anders; Sauer, Stephan P. A.

    2016-01-01

    Metathesis is introduced as a preparative route to terminal carbide complexes. The chloride ligands of the terminal carbide complex [RuC(Cl)2(PCy3)2] (RuC) can be exchanged, paving the way for a systematic variation of the ligand sphere. A series of substituted complexes, including the first...... example of a cationic terminal carbide complex, [RuC(Cl)(CH3CN)(PCy3)2]+, is described and characterized by NMR, MS, X-ray crystallography, and computational studies. The experimentally observed irregular variation of the carbide 13C chemical shift is shown to be accurately reproduced by DFT, which also...... demonstrates that details of the coordination geometry affect the carbide chemical shift equally as much as variations in the nature of the auxiliary ligands. Furthermore, the kinetics of formation of the sqaure pyramidal dicyano complex, trans-[RuC(CN)2(PCy3)2], from RuC has been examined and the reaction...

  7. cDNA encoding a polypeptide including a hev ein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  8. Human IgG is produced in a pro-form that requires clipping of C-terminal lysines for maximal complement activation

    DEFF Research Database (Denmark)

    van den Bremer, E. T. J.; Beurskens, F. J.; Voorhorst, M.

    2015-01-01

    Human IgG is produced with C-terminal lysines that are cleaved off in circulation. The function of this modification was unknown and generally thought not to affect antibody function. We recently reported that efficient C1q binding and complement-dependent cytotoxicity (CDC) requires IgG hexameri...

  9. C-Terminally modified peptides via cleavage of the HMBA linker by O-, N- or S-nucleophiles

    DEFF Research Database (Denmark)

    Hansen, Jonas; Diness, Frederik; Meldal, Morten Peter

    2016-01-01

    A large variety of C-terminally modified peptides was obtained by nucleophilic cleavage of the ester bond in solid phase linked peptide esters of 4-hydroxymethyl benzamide (HMBA). The developed methods provided peptides, C-terminally functionalized as esters, amides and thioesters, with high purity...... directly from the resin in a single reaction step. A comprehensive screening of the reaction conditions and scope for nucleophilic cleavage of peptides from the HMBA linker was performed....

  10. Expression, purification, and DNA-binding activity of the solubilized NtrC protein of Herbaspirillum seropedicae.

    Science.gov (United States)

    Twerdochlib, Adriana L; Chubatsu, Leda S; Souza, Emanuel M; Pedrosa, Fábio O; Steffens, M Berenice R; Yates, M Geoffrey; Rigo, Liu U

    2003-07-01

    NtrC is a bacterial enhancer-binding protein (EBP) that activates transcription by the sigma54 RNA polymerase holoenzyme. NtrC has a three domain structure typical of EBP family. In Herbaspirillum seropedicae, an endophytic diazotroph, NtrC regulates several operons involved in nitrogen assimilation, including glnAntrBC. In order to over-express and purify the NtrC protein, DNA fragments containing the complete structural gene for the whole protein, and for the N-terminal+Central and Central+C-terminal domains were cloned into expression vectors. The NtrC and NtrC(N-terminal+Central) proteins were over-expressed as His-tag fusion proteins upon IPTG addition, solubilized using N-lauryl-sarcosyl and purified by metal affinity chromatography. The over-expressed His-tag-NtrC(Central+C-terminal) fusion protein was partially soluble and was also purified by affinity chromatography. DNA band-shift assays showed that the NtrC protein and the Central+C-terminal domains bound specifically to the H. seropedicae glnA promoter region. The C-terminal domain is presumably necessary for DNA-protein interaction and DNA-binding does not require a phosphorylated protein.

  11. Fast rate of evolution in alternatively spliced coding regions of mammalian genes

    Directory of Open Access Journals (Sweden)

    Nurtdinov Ramil N

    2006-04-01

    Full Text Available Abstract Background At least half of mammalian genes are alternatively spliced. Alternative isoforms are often genome-specific and it has been suggested that alternative splicing is one of the major mechanisms for generating protein diversity in the course of evolution. Another way of looking at alternative splicing is to consider sequence evolution of constitutive and alternative regions of protein-coding genes. Indeed, it turns out that constitutive and alternative regions evolve in different ways. Results A set of 3029 orthologous pairs of human and mouse alternatively spliced genes was considered. The rate of nonsynonymous substitutions (dN, the rate of synonymous substitutions (dS, and their ratio (ω = dN/dS appear to be significantly higher in alternatively spliced coding regions compared to constitutive regions. When N-terminal, internal and C-terminal alternatives are analysed separately, C-terminal alternatives appear to make the main contribution to the observed difference. The effects become even more pronounced in a subset of fast evolving genes. Conclusion These results provide evidence of weaker purifying selection and/or stronger positive selection in alternative regions and thus one more confirmation of accelerated evolution in alternative regions. This study corroborates the theory that alternative splicing serves as a testing ground for molecular evolution.

  12. A protein kinase binds the C-terminal domain of the readthrough protein of Turnip yellows virus and regulates virus accumulation

    Energy Technology Data Exchange (ETDEWEB)

    Rodriguez-Medina, Caren; Boissinot, Sylvaine [UMR 1131 SVQV INRA-UDS, 28 rue de Herrlisheim, 68021 Colmar (France); Chapuis, Sophie [Institut de Biologie Moléculaire des Plantes, Laboratoire propre du CNRS conventionné avec l’Université de Strasbourg, 12 rue du Général Zimmer, 67084 Strasbourg (France); Gereige, Dalya; Rastegar, Maryam; Erdinger, Monique [UMR 1131 SVQV INRA-UDS, 28 rue de Herrlisheim, 68021 Colmar (France); Revers, Frédéric [INRA, Université de Bordeaux, UMR 1332 de Biologie du Fruit et Pathologie, 33882 Villenave d’Ornon (France); Ziegler-Graff, Véronique [Institut de Biologie Moléculaire des Plantes, Laboratoire propre du CNRS conventionné avec l’Université de Strasbourg, 12 rue du Général Zimmer, 67084 Strasbourg (France); Brault, Véronique, E-mail: veronique.brault@colmar.inra.fr [UMR 1131 SVQV INRA-UDS, 28 rue de Herrlisheim, 68021 Colmar (France)

    2015-12-15

    Turnip yellows virus (TuYV), a phloem-limited virus, encodes a 74 kDa protein known as the readthrough protein (RT) involved in virus movement. We show here that a TuYV mutant deleted of the C-terminal part of the RT protein (TuYV-∆RT{sub Cter}) was affected in long-distance trafficking in a host-specific manner. By using the C-terminal domain of the RT protein as a bait in a yeast two-hybrid screen of a phloem cDNA library from Arabidopsis thaliana we identified the calcineurin B-like protein-interacting protein kinase-7 (AtCIPK7). Transient expression of a GFP:CIPK7 fusion protein in virus-inoculated Nicotiana benthamiana leaves led to local increase of wild-type TuYV accumulation, but not that of TuYV-∆RT{sub Cter}. Surprisingly, elevated virus titer in inoculated leaves did not result in higher TuYV accumulation in systemic leaves, which indicates that virus long-distance movement was not affected. Since GFP:CIPK7 was localized in or near plasmodesmata, CIPK7 could negatively regulate TuYV export from infected cells. - Highlights: • The C-terminal domain of TuYV-RT is required for long-distance movement. • CIPK7 from Arabidopsis interacts with RT{sub Cter} in yeast and in plants. • CIPK7 overexpression increases virus titer locally but not virus systemic movement. • CIPK7 localizes to plasmodesmata. • CIPK7 could be a defense protein regulating virus export.

  13. Crystal Structure of the N-terminal Domain of the Group B Streptococcus Alpha C Protein

    Energy Technology Data Exchange (ETDEWEB)

    Auperin,T.; Bolduc, G.; Baron, M.; Heroux, A.; Filman, D.; Madoff, L.; Hogle, J.

    2005-01-01

    Group B Streptococcus (GBS) is the leading cause of bacterial pneumonia, sepsis, and meningitis among neonates and an important cause of morbidity among pregnant women and immunocompromised adults. Invasive diseases due to GBS are attributed to the ability of the pathogen to translocate across human epithelial surfaces. The alpha C protein (ACP) has been identified as an invasin that plays a role in internalization and translocation of GBS across epithelial cells. The soluble N-terminal domain of ACP (NtACP) blocks the internalization of GBS. We determined the 1.86-{angstrom} resolution crystal structure of NtACP comprising residues Ser{sup 52} through Leu{sup 225} of the full-length ACP. NtACP has two domains, an N-terminal {beta}-sandwich and a C-terminal three-helix bundle. Structural and topological alignments reveal that the {beta}-sandwich shares structural elements with the type III fibronectin fold (FnIII), but includes structural elaborations that make it unique. We have identified a potential integrin-binding motif consisting of Lys-Thr-Asp{sup 146}, Arg{sup 110}, and Asp{sup 118}. A similar arrangement of charged residues has been described in other invasins. ACP shows a heparin binding activity that requires NtACP. We propose a possible heparin-binding site, including one surface of the three-helix bundle, and nearby portions of the sandwich and repeat domains. We have validated this prediction using assays of the heparin binding and cell-adhesion properties of engineered fragments of ACP. This is the first crystal structure of a member of the highly conserved Gram-positive surface alpha-like protein family, and it will enable the internalization mechanism of GBS to be dissected at the atomic level.

  14. The N-terminal region of eukaryotic translation initiation factor 5A signals to nuclear localization of the protein

    International Nuclear Information System (INIS)

    Parreiras-e-Silva, Lucas T.; Gomes, Marcelo D.; Oliveira, Eduardo B.; Costa-Neto, Claudio M.

    2007-01-01

    The eukaryotic translation initiation factor 5A (eIF5A) is a ubiquitous protein of eukaryotic and archaeal organisms which undergoes hypusination, a unique post-translational modification. We have generated a polyclonal antibody against murine eIF5A, which in immunocytochemical assays in B16-F10 cells revealed that the endogenous protein is preferentially localized to the nuclear region. We therefore analyzed possible structural features present in eIF5A proteins that could be responsible for that characteristic. Multiple sequence alignment analysis of eIF5A proteins from different eukaryotic and archaeal organisms showed that the former sequences have an extended N-terminal segment. We have then performed in silico prediction analyses and constructed different truncated forms of murine eIF5A to verify any possible role that the N-terminal extension might have in determining the subcellular localization of the eIF5A in eukaryotic organisms. Our results indicate that the N-terminal extension of the eukaryotic eIF5A contributes in signaling this protein to nuclear localization, despite of bearing no structural similarity with classical nuclear localization signals

  15. Structure of the C-Terminal Domain of Lettuce Necrotic Yellows Virus Phosphoprotein

    Science.gov (United States)

    Martinez, Nicolas; Ribeiro, Euripedes A.; Leyrat, Cédric; Tarbouriech, Nicolas; Ruigrok, Rob W. H.

    2013-01-01

    Lettuce necrotic yellows virus (LNYV) is a prototype of the plant-adapted cytorhabdoviruses. Through a meta-prediction of disorder, we localized a folded C-terminal domain in the amino acid sequence of its phosphoprotein. This domain consists of an autonomous folding unit that is monomeric in solution. Its structure, solved by X-ray crystallography, reveals a lollipop-shaped structure comprising five helices. The structure is different from that of the corresponding domains of other Rhabdoviridae, Filoviridae, and Paramyxovirinae; only the overall topology of the polypeptide chain seems to be conserved, suggesting that this domain evolved under weak selective pressure and varied in size by the acquisition or loss of functional modules. PMID:23785215

  16. Cloning of a cDNA encoding the human cation-dependent mannose 6-phosphate-specific receptor

    International Nuclear Information System (INIS)

    Pohlmann, R.; Nagel, G.; Schmidt, B.

    1987-01-01

    Complementary DNA clones for the human cation-dependent mannose 6-phosphate-specific receptor have been isolated from a human placenta library in λgt11. The nucleotide sequence of the 2463-base-pair cDNA insert includes a 145-base-pair 5' untranslated region, an open reading frame of 831 base pairs corresponding to 277 amino acids, and a 1487-base-pair 3' untranslated region. The deduced amino acid sequence is colinear with that determined by amino acid sequencing of the N-terminus peptide (41 residues) and nine tryptic peptides (93 additional residues). The receptor is synthesized as a precursor with a signal peptide of 20 amino acids. The hydrophobicity profile of the receptor indicates a single membrane-spanning domain, which separates an N-terminal region containing five potential N-glycosylation sites from a C-terminal region lacking N-glycosylation sites. Thus the N-terminal (M/sub r/ = 18,299) and C-terminal (M/sub r/ ≤ 7648) segments of the mature receptor are assumed to be exposed to the extracytosolic and cytosolic sides of the membrane, respectively. Analysis of a panel of somatic cell (mouse-human) hybrids shows that the gene for the receptor is located on human chromosome 12

  17. 640 Gbit/s RZ-to-NRZ format conversion based on optical phase filtering

    DEFF Research Database (Denmark)

    Maram, Reza; Kong, Deming; Galili, Michael

    2014-01-01

    We propose a novel approach for all optical RZ-to-NRZ conversion based on optical phase filtering. The proposed concept is experimentally validated through format conversion of a 640 Gbit/s coherent RZ signal to NRZ signal using a simple phase filter implemented by a commercial optical waveshaper....

  18. Keratin 8 phosphorylation in vitro by cAMP-dependent protein kinase occurs within the amino- and carboxyl-terminal end domains.

    Science.gov (United States)

    Ando, S; Tokui, T; Yano, T; Inagaki, M

    1996-04-05

    We reported earlier that phosphorylation in vitro of keratin filaments reconstituted from rat type I keratin 18 and type II keratin 8 by cAPM-dependent protein kinase induces disassembly of the keratin filament structure. Keratin 8 rather than keratin 18 was the major target of the kinase. We have now identified the sites on rat keratin 8 for cAMP-dependent protein kinase. Sequential analysis of the purified phosphoropeptides, together with the known primary sequence, revealed that four major sites, Ser-12, Ser-23, Ser-36, and Ser-50, and three minor sites, Ser-8, Ser-33, Ser-42, are located in the amino-terminal head domain, while three minor sites, Ser-416, Ser-423 and Ser-425 locate in the carboxyl-terminal tail domain.

  19. Distal loop flexibility of a regulatory domain modulates dynamics and activity of C-terminal SRC kinase (csk.

    Directory of Open Access Journals (Sweden)

    Sulyman Barkho

    Full Text Available The Src family of tyrosine kinases (SFKs regulate numerous aspects of cell growth and differentiation and are under the principal control of the C-terminal Src Kinase (Csk. Csk and SFKs share a modular design with the kinase domain downstream of the N-terminal SH2 and SH3 domains that regulate catalytic function and membrane localization. While the function of interfacial segments in these multidomain kinases are well-investigated, little is known about how surface sites and long-range, allosteric coupling control protein dynamics and catalytic function. The SH2 domain of Csk is an essential component for the down-regulation of all SFKs. A unique feature of the SH2 domain of Csk is the tight turn in place of the canonical CD loop in a surface site far removed from kinase domain interactions. In this study, we used a combination of experimental and computational methods to probe the importance of this difference by constructing a Csk variant with a longer SH2 CD loop to mimic the flexibility found in homologous kinase SH2 domains. Our results indicate that while the fold and function of the isolated domain and the full-length kinase are not affected by loop elongation, native protein dynamics that are essential for efficient catalysis are perturbed. We also identify key motifs and routes through which the distal SH2 site might influence catalysis at the active site. This study underscores the sensitivity of intramolecular signaling and catalysis to native protein dynamics that arise from modest changes in allosteric regions while providing a potential strategy to alter intrinsic activity and signaling modulation.

  20. The differences in heparin binding for the C-terminal basic-sequence-rich peptides of HPV-16 and HPV-18 capsid protein L1

    International Nuclear Information System (INIS)

    Sun Jian; Yu Jisheng; Yu Zhiwu; Zha Xiao; Wu Yuqing

    2012-01-01

    Graphial abstract: The differences in heparin binding for the C-terminal basic-sequence-rich peptides of HPV-16 and HPV-18 capsid protein L1. Highlights: ► Several driving forces contribute to the interaction between heparin and peptides. ► C-terminal of HPV L1 is a potential candidate for the attachment to host cells. ► The C-terminal peptides of HPV-16 and -18 L1 have different heparin-binding. ► The different heparin-binding provides an explanation for the distinct prevalences. - Abstract: The high-risk types of human papillomaviruses (HPV) HPV-16 and -18 are the predominant types associated with cervical cancer. HPV-16 and -18 account for about 50% and 20%, respectively, of cervical cancers worldwide. While the reason and molecular mechanism of the distinct prevalence and distributions between them remain poorly understood, the binding affinity of cell surface receptor with capsid proteins, especially L1, may be involved. We examined heparin binding with two synthetic peptides corresponding to the 14 amino acid C-terminal peptides of HPV-16 and -18 L1 with the goal of comparing the equivalent residues in different HPV types. Using isothermal titration calorimetry (ITC) and static right-angle light scattering (SLS), we determined the binding constant K, reaction enthalpy ΔH, and other thermodynamic parameters in the interaction. Especially, we assessed the role of specific residues in binding with heparin by comparing the NMR spectra of free and heparin-bound peptides.

  1. Preparation of C-terminally modified chemokines by expressed protein ligation.

    Science.gov (United States)

    Baumann, Lars; Steinhagen, Max; Beck-Sickinger, Annette G

    2013-01-01

    In order to link structural features on a molecular level to the function of chemokines, site-specific modification strategies are strongly required. These can be used to incorporate fluorescent dyes and/or physical probes to allow investigations in a wide range of biological and physical techniques, e.g., nuclear magnetic resonance (NMR) spectroscopy, fluorescence microscopy, fluorescence resonance energy transfer (FRET), or fluorescence correlation spectroscopy (FCS). Only a limited number of functional groups within the 20 canonical amino acids allow ligation strategies that can be helpful to introduce novel functionalities, which in turn expand the scope of chemoselective and orthogonal reactivity of (semi)synthetic chemokines. In the present chapter we mainly focus on the fabulous history of native chemical ligation (NCL) and provide a general protocol for the preparation of C-terminally modified SDF-1α including tips and tricks for practical work. We believe that this protocol can be easily adapted to other chemokines and many proteins in general.

  2. Assembly of human C-terminal binding protein (CtBP) into tetramers.

    Science.gov (United States)

    Bellesis, Andrew G; Jecrois, Anne M; Hayes, Janelle A; Schiffer, Celia A; Royer, William E

    2018-06-08

    C-terminal binding protein 1 (CtBP1) and CtBP2 are transcriptional coregulators that repress numerous cellular processes, such as apoptosis, by binding transcription factors and recruiting chromatin-remodeling enzymes to gene promoters. The NAD(H)-linked oligomerization of human CtBP is coupled to its co-transcriptional activity, which is implicated in cancer progression. However, the biologically relevant level of CtBP assembly has not been firmly established; nor has the stereochemical arrangement of the subunits above that of a dimer. Here, multi-angle light scattering (MALS) data established the NAD + - and NADH-dependent assembly of CtBP1 and CtBP2 into tetramers. An examination of subunit interactions within CtBP1 and CtBP2 crystal lattices revealed that both share a very similar tetrameric arrangement resulting from assembly of two dimeric pairs, with specific interactions probably being sensitive to NAD(H) binding. Creating a series of mutants of both CtBP1 and CtBP2, we tested the hypothesis that the crystallographically observed interdimer pairing stabilizes the solution tetramer. MALS data confirmed that these mutants disrupt both CtBP1 and CtBP2 tetramers, with the dimer generally remaining intact, providing the first stereochemical models for tetrameric assemblies of CtBP1 and CtBP2. The crystal structure of a subtle destabilizing mutant suggested that small structural perturbations of the hinge region linking the substrate- and NAD-binding domains are sufficient to weaken the CtBP1 tetramer. These results strongly suggest that the tetramer is important in CtBP function, and the series of CtBP mutants reported here can be used to investigate the physiological role of the tetramer. © 2018 Bellesis et al.

  3. The C-terminal amino acid of the MHC-I heavy chain is critical for binding to Derlin-1 in human cytomegalovirus US11-induced MHC-I degradation.

    Science.gov (United States)

    Cho, Sunglim; Kim, Bo Young; Ahn, Kwangseog; Jun, Youngsoo

    2013-01-01

    Derlin-1 plays a critical role in endoplasmic reticulum-associated protein degradation (ERAD) of a particular subset of proteins. Although it is generally accepted that Derlin-1 mediates the export of ERAD substrates from the ER to the cytosol, little is known about how Derlin-1 interacts with these substrates. Human cytomegalovirus (HCMV) US11 exploits Derlin-1-dependent ERAD to degrade major histocompatibility complex class I (MHC-I) molecules and evade immune surveillance. US11 requires the cytosolic tail of the MHC-I heavy chain to divert MHC-I molecules into the ERAD pathway for degradation; however, the underlying mechanisms remain unknown. Here, we show that the cytosolic tail of the MHC-I heavy chain, although not required for interaction with US11, is required for tight binding to Derlin-1 and thus for US11-induced dislocation of the MHC-I heavy chain to the cytosol for proteasomal degradation. Surprisingly, deletion of a single C-terminal amino acid from the cytosolic tail disrupted the interaction between MHC-I molecules and Derlin-1, rendering mutant MHC-I molecules resistant to US11-induced degradation. Consistently, deleting the C-terminal cytosolic region of Derlin-1 prevented it from binding to MHC-I molecules. Taken together, these results suggest that the cytosolic region of Derlin-1 is involved in ERAD substrate binding and that this interaction is critical for the Derlin-1-mediated dislocation of the MHC-I heavy chain to the cytosol during US11-induced MHC-I degradation.

  4. Tumor suppressor BLU inhibits proliferation of nasopharyngeal carcinoma cells by regulation of cell cycle, c-Jun N-terminal kinase and the cyclin D1 promoter

    International Nuclear Information System (INIS)

    Zhang, Xiangning; Liu, Hui; Li, Binbin; Huang, Peichun; Shao, Jianyong; He, Zhiwei

    2012-01-01

    Tumor suppressor genes function to regulate and block tumor cell proliferation. To explore the mechanisms underlying the tumor suppression of BLU/ZMYND10 gene on a frequently lost human chromosomal region, an adenoviral vector with BLU cDNA insert was constructed. BLU was re-expressed in nasopharyngeal carcinoma cells by transfection or viral infection. Clonogenic growth was assayed; cell cycle was analyzed by flow cytometry-based DNA content detection; c-Jun N-terminal kinase (JNK) and cyclin D1 promoter activities were measured by reporter gene assay, and phosphorylation was measured by immunoblotting. The data for each pair of groups were compared with Student t tests. BLU inhibits clonogenic growth of nasopharyngeal carcinoma cells, arrests cell cycle at G1 phase, downregulates JNK and cyclin D1 promoter activities, and inhibits phosphorylation of c-Jun. BLU inhibits growth of nasopharyngeal carcinoma cells by regulation of the JNK-cyclin D1 axis to exert tumor suppression

  5. 78 FR 23331 - Ballard Terminal Railroad Company, L.L.C.-Lease Exemption-Line of Eastside Community Rail, LLC

    Science.gov (United States)

    2013-04-18

    ... residual common carrier rights and obligations, including the right to reinstitute rail service, over the... resume providing common carrier rail service over this trackage. These filings will be addressed by the... Railroad Company, L.L.C.--Lease Exemption--Line of Eastside Community Rail, LLC Ballard Terminal Railroad...

  6. Highly acidic C-terminal domain of pp32 is required for the interaction with histone chaperone, TAF-Ibeta.

    Science.gov (United States)

    Lee, In-Seon; Oh, Sang-Min; Kim, Sung-Mi; Lee, Dong-Seok; Seo, Sang-Beom

    2006-12-01

    We have previously reported that INHAT (inhibitor of acetyltransferases) complex subunits, TAF (template activating factor)-Ialpha, TAF-Ibeta and pp32 can inhibit histone acetylation and HAT (histone acetyltransferase)-dependent transcription by binding to histones. Evidences are accumulating that INHAT complex subunits have important regulatory roles in various cellular activities such as replication, transcription, and apoptosis etc. However, how these subunits interact each other remains largely unknown. Using immunoprecipitation (IP) and protein-protein interaction assays with TAF-Ibeta and pp32 deletion mutant proteins, we identify INHAT complex subunits, TAF-Ibeta and pp32 interaction requires highly acidic C-terminal domain of pp32. We also show that the interaction between the INHAT complex subunits is stronger in the presence of histones. In this study, we report that the synergistic inhibition of HAT-mediated transcription by TAF-Ibeta and pp32 is dependent on the highly acidic C-terminal domain of pp32.

  7. C-terminal truncations in human 3'-5' DNA exonuclease TREX1 cause autosomal dominant retinal vasculopathy with cerebral leukodystrophy

    NARCIS (Netherlands)

    Richards, Anna; van den Maagdenberg, Arn M. J. M.; Jen, Joanna C.; Kavanagh, David; Bertram, Paula; Spitzer, Dirk; Liszewski, M. Kathryn; Barilla-LaBarca, Maria-Louise; Terwindt, Gisela M.; Kasai, Yumi; McLellan, Mike; Grand, Mark Gilbert; Vanmolkot, Kaate R. J.; de Vries, Boukje; Wan, Jijun; Kane, Michael J.; Mamsa, Hafsa; Schäfer, Ruth; Stam, Anine H.; Haan, Joost; de Jong, Paulus T. V. M.; Storimans, Caroline W.; van Schooneveld, Mary J.; Oosterhuis, Jendo A.; Gschwendter, Andreas; Dichgans, Martin; Kotschet, Katya E.; Hodgkinson, Suzanne; Hardy, Todd A.; Delatycki, Martin B.; Hajj-Ali, Rula A.; Kothari, Parul H.; Nelson, Stanley F.; Frants, Rune R.; Baloh, Robert W.; Ferrari, Michel D.; Atkinson, John P.

    2007-01-01

    Autosomal dominant retinal vasculopathy with cerebral leukodystrophy is a microvascular endotheliopathy with middle-age onset. In nine families, we identified heterozygous C-terminal frameshift mutations in TREX1, which encodes a 3'-5' exonuclease. These truncated proteins retain exonuclease

  8. C-terminal truncations in human 3 '-5 ' DNA exonuclease TREX1 cause autosomal dominant retinal vasculopathy with cerebral leukodystrophy

    NARCIS (Netherlands)

    Richards, Anna; van den Maagdenberg, Arn M. J. M.; Jen, Joanna C.; Kavanagh, David; Bertram, Paula; Spitzer, Dirk; Liszewski, M. Kathryn; Barilla-LaBarca, Maria-Louise; Terwindt, Gisela M.; Kasai, Yumi; McLellan, Mike; Grand, Mark Gilbert; Vanmolkot, Kaate R. J.; de Vries, Boukje; Wan, Jijun; Kane, Michael J.; Mamsa, Hafsa; Schaefer, Ruth; Stam, Anine H.; Haan, Joost; Paulus, T. V. M. de Jong; Storimans, Caroline W.; van Schooneveld, Mary J.; Oosterhuis, Jendo A.; Gschwendter, Andreas; Dichgans, Martin; Kotschet, Katya E.; Hodgkinson, Suzanne; Hardy, Todd A.; Delatycki, Martin B.; Hajj-Ali, Rula A.; Kothari, Parul H.; Nelson, Stanley F.; Frants, Rune R.; Baloh, Robert W.; Ferrari, Michel D.; Atkinson, John P.

    Autosomal dominant retinal vasculopathy with cerebral leukodystrophy is a microvascular endotheliopathy with middle- age onset. In nine families, we identified heterozygous C- terminal frameshift mutations in TREX1, which encodes a 3'-5' exonuclease. These truncated proteins retain exonuclease

  9. The 18-kilodalton Chlamydia trachomatis histone H1-like protein (Hc1) contains a potential N-terminal dimerization site and a C-terminal nucleic acid-binding domain

    DEFF Research Database (Denmark)

    Pedersen, Lotte Bang; Birkelund, S; Holm, A

    1996-01-01

    The Chlamydia trachomatis histone H1-like protein (Hc1) is a DNA-binding protein specific for the metabolically inactive chlamydial developmental form, the elementary body. Hc1 induces DNA condensation in Escherichia coli and is a strong inhibitor of transcription and translation. These effects may......-hydroxysuccinimide ester), purified recombinant Hc1 was found to form dimers. The dimerization site was located in the N-terminal part of Hc1 (Hc1(2-57)). Moreover, circular dichroism measurements indicated an overall alpha-helical structure of this region. By using limited proteolysis, Southwestern blotting, and gel...... retardation assays, Hc1(53-125) was shown to contain a domain capable of binding both DNA and RNA. Under the same conditions, Hc1(2-57) had no nucleic acid-binding activity. Electron microscopy of Hc1-DNA and Hc1(53-125)-DNA complexes revealed differences suggesting that the N-terminal part of Hc1 may affect...

  10. Problem-Solving Test: The Mechanism of Transcription Termination by the Rho Factor

    Science.gov (United States)

    Szeberenyi, Jozsef

    2012-01-01

    Transcription termination comes in two forms in "E. coli" cells. Rho-dependent termination requires the binding of a termination protein called Rho factor to the transcriptional machinery at the terminator region, whereas Rho-independent termination is achieved by conformational changes in the transcript itself. This article presents a test…

  11. Cavity-less sub-picosecond pulse generation for the demultiplexing of a 640 Gbaud OTDM signal

    DEFF Research Database (Denmark)

    Kong, Deming; Guan, Pengyu; Hu, Hao

    2015-01-01

    A 703 fs cavity-less pulse source based on pulse carving and pulse compression is demonstrated and utilized for demultiplexing a 640 Gbaud OTDM signal. Timing jitter is found to be the main limiting factor....

  12. Study of 4H-SiC junction barrier Schottky diode using field guard ring termination

    International Nuclear Information System (INIS)

    Feng-Ping, Chen; Yu-Ming, Zhang; Hong-Liang, Lü; Yi-Men, Zhang; Jian-Hua, Huang

    2010-01-01

    This paper reports that the 4H-SiC Schottky barrier diode, PiN diode and junction barrier Schottky diode terminated by field guard rings are designed, fabricated and characterised. The measurements for forward and reverse characteristics have been done, and by comparison with each other, it shows that junction barrier Schottky diode has a lower reverse current density than that of the Schottky barrier diode and a higher forward drop than that of the PiN diode. High-temperature annealing is presented in this paper as well to figure out an optimised processing. The barrier height of 0.79 eV is formed with Ti in this work, the forward drop for the Schottky diode is 2.1 V, with an ideality factor of 3.2, and junction barrier Schottky diode with blocking voltage higher than 400 V was achieved by using field guard ring termination. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

  13. Changes in Cytokines and Aggrecan ARGS Neoepitope in Synovial Fluid and Serum and in C-Terminal Crosslinking Telopeptide of Type II Collagen and N-Terminal Crosslinking Telopeptide of Type I Collagen in Urine Over Five Years After Anterior Cruciate Ligament Rupture

    DEFF Research Database (Denmark)

    Struglics, André; Larsson, Staffan; Kumahashi, Nobuyuki

    2015-01-01

    OBJECTIVE: To prospectively monitor levels of proinflammatory cytokines and aggrecan ARGS neoepitope in synovial fluid and serum as well as levels of C-terminal crosslinking telopeptide of type II collagen (CTX-II) and N-terminal crosslinking telopeptide of type I collagen (NTX-I) in urine after ...

  14. Transfer of C-terminal residues of human apolipoprotein A-I to insect apolipophorin III creates a two-domain chimeric protein with enhanced lipid binding activity.

    Science.gov (United States)

    Horn, James V C; Ellena, Rachel A; Tran, Jesse J; Beck, Wendy H J; Narayanaswami, Vasanthy; Weers, Paul M M

    2017-08-01

    Apolipophorin III (apoLp-III) is an insect apolipoprotein (18kDa) that comprises a single five-helix bundle domain. In contrast, human apolipoprotein A-I (apoA-I) is a 28kDa two-domain protein: an α-helical N-terminal domain (residues 1-189) and a less structured C-terminal domain (residues 190-243). To better understand the apolipoprotein domain organization, a novel chimeric protein was engineered by attaching residues 179 to 243 of apoA-I to the C-terminal end of apoLp-III. The apoLp-III/apoA-I chimera was successfully expressed and purified in E. coli. Western blot analysis and mass spectrometry confirmed the presence of the C-terminal domain of apoA-I within the chimera. While parent apoLp-III did not self-associate, the chimera formed oligomers similar to apoA-I. The chimera displayed a lower α-helical content, but the stability remained similar compared to apoLp-III, consistent with the addition of a less structured domain. The chimera was able to solubilize phospholipid vesicles at a significantly higher rate compared to apoLp-III, approaching that of apoA-I. The chimera was more effective in protecting phospholipase C-treated low density lipoprotein from aggregation compared to apoLp-III. In addition, binding interaction of the chimera with phosphatidylglycerol vesicles and lipopolysaccharides was considerably improved compared to apoLp-III. Thus, addition of the C-terminal domain of apoA-I to apoLp-III created a two-domain protein, with self-association, lipid and lipopolysaccharide binding properties similar to apoA-I. The apoA-I like behavior of the chimera indicate that these properties are independent from residues residing in the N-terminal domain of apoA-I, and that they can be transferred from apoA-I to apoLp-III. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Characterization and photoconductivity study of well-defined C60 terminated poly(tert-butyl acrylate-b-styrene)

    International Nuclear Information System (INIS)

    Yang Dong; Li Lang; Wang Changchun

    2004-01-01

    Atom transfer radical polymerization (ATRP) catalyzed by N,N',N',N'',N''-pentamethyldiethylenetriamine (PMDETA)/CuBr was performed to synthesize poly (tert-butyl acrylate) (PtBA-Br) with predesigned molecular weight and narrow polydispersity. Using the PtBA-Br as macroinitiator, the PtBA-block-PS copolymer was prepared through ATRP. After terminated bromine atom was converted to end-functional azide group (P(tBA-b-St)-N 3 ), C 60 end-capped PtBA-PS block copolymers (P(tBA-b-St)-C 60 ) were synthesized by reacting C 60 with P(tBA-b-St)-N 3 . GPC characterizations showed that C 60 was chemically bonded to the end of P(tBA-b-St) chain and the products were mono-substituted. FT-IR, UV-Vis measurements confirmed that hydrolysis of P(tBA-b-St)-C 60 resulted in amphiphilic C 60 end-capped PAA-PS block copolymers. In additional, the photoconductivity of P(tBA-b-St)-C 60 was measured

  16. Sol–gel immobilization of Alcalase from Bacillus licheniformis for application in the synthesis of C-terminal peptide amides

    NARCIS (Netherlands)

    Corici, L.N.; Frissen, A.E.; Zoelen, van D.J.; Eggen, I.F.; Peter, F.; Davidescu, C.M.; Boeriu, C.G.

    2011-01-01

    Alcalase 2.4L FG, a commercial preparation of Subtilisin A, was physically entrapped in glass sol–gel matrices using alkoxysilanes of different types mixed with tetramethoxysilane (TMOS). The materials were used for catalyzing C-terminal amidation of Z-Ala-Phe-OMe in a mixture of tert-butanol/DMF.

  17. Functional properties of a newly identified C-terminal splice variant of Cav1.3 L-type Ca2+ channels.

    Science.gov (United States)

    Bock, Gabriella; Gebhart, Mathias; Scharinger, Anja; Jangsangthong, Wanchana; Busquet, Perrine; Poggiani, Chiara; Sartori, Simone; Mangoni, Matteo E; Sinnegger-Brauns, Martina J; Herzig, Stefan; Striessnig, Jörg; Koschak, Alexandra

    2011-12-09

    An intramolecular interaction between a distal (DCRD) and a proximal regulatory domain (PCRD) within the C terminus of long Ca(v)1.3 L-type Ca(2+) channels (Ca(v)1.3(L)) is a major determinant of their voltage- and Ca(2+)-dependent gating kinetics. Removal of these regulatory domains by alternative splicing generates Ca(v)1.3(42A) channels that activate at a more negative voltage range and exhibit more pronounced Ca(2+)-dependent inactivation. Here we describe the discovery of a novel short splice variant (Ca(v)1.3(43S)) that is expressed at high levels in the brain but not in the heart. It lacks the DCRD but, in contrast to Ca(v)1.3(42A), still contains PCRD. When expressed together with α2δ1 and β3 subunits in tsA-201 cells, Ca(v)1.3(43S) also activated at more negative voltages like Ca(v)1.3(42A) but Ca(2+)-dependent inactivation was less pronounced. Single channel recordings revealed much higher channel open probabilities for both short splice variants as compared with Ca(v)1.3(L). The presence of the proximal C terminus in Ca(v)1.3(43S) channels preserved their modulation by distal C terminus-containing Ca(v)1.3- and Ca(v)1.2-derived C-terminal peptides. Removal of the C-terminal modulation by alternative splicing also induced a faster decay of Ca(2+) influx during electrical activities mimicking trains of neuronal action potentials. Our findings extend the spectrum of functionally diverse Ca(v)1.3 L-type channels produced by tissue-specific alternative splicing. This diversity may help to fine tune Ca(2+) channel signaling and, in the case of short variants lacking a functional C-terminal modulation, prevent excessive Ca(2+) accumulation during burst firing in neurons. This may be especially important in neurons that are affected by Ca(2+)-induced neurodegenerative processes.

  18. Crystallization of the C-terminal head domain of the avian adenovirus CELO long fibre

    Energy Technology Data Exchange (ETDEWEB)

    Guardado Calvo, Pablo [Departamento de Bioquímica y Biología Molecular, Facultad de Farmacia, Universidad de Santiago de Compostela, Campus Sur, E-15782 Santiago de Compostela (Spain); Llamas-Saiz, Antonio L. [Unidad de Difracción de Rayos X, Laboratorio Integral de Dinámica y Estructura de Biomoléculas José R. Carracido, Edificio CACTUS, Universidad de Santiago de Compostela, Campus Sur, E-15782 Santiago de Compostela (Spain); Langlois, Patrick [Agence Francaise de Securité Sanitaire des Aliments, Unité Génétique Virale et Biosecurité, Site Les Croix, BP 53, F-22440 Ploufragan (France); Raaij, Mark J. van, E-mail: vanraaij@usc.es [Departamento de Bioquímica y Biología Molecular, Facultad de Farmacia, Universidad de Santiago de Compostela, Campus Sur, E-15782 Santiago de Compostela (Spain); Unidad de Difracción de Rayos X, Laboratorio Integral de Dinámica y Estructura de Biomoléculas José R. Carracido, Edificio CACTUS, Universidad de Santiago de Compostela, Campus Sur, E-15782 Santiago de Compostela (Spain)

    2006-05-01

    Avian adenovirus long-fibre head trimers were expressed, purified and crystallized. The crystals belong to space group C2 (unit-cell parameters a = 216.5, b = 59.2, c = 57.5 Å, β = 101.3°). A complete highly redundant data set was collected to 2.2 Å resolution at 100 K using a rotating-anode X-ray source. Avian adenovirus CELO contains two different fibres: fibre 1, the long fibre, and fibre 2, the short fibre. The short fibre is responsible for binding to an unknown avian receptor and is essential for infection of birds. The long fibre is not essential, but is known to bind the coxsackievirus and adenovirus receptor protein. Both trimeric fibres are attached to the same penton base, of which each icosahedral virus contains 12 copies. The short fibre extends straight outwards, while the long fibre emerges at an angle. The carboxy-terminal amino acids 579–793 of the avian adenovirus long fibre have been expressed with an amino-terminal hexahistidine tag and the expressed trimeric protein has been purified by nickel-affinity chromatography and crystallized. Crystals were grown at low pH using PEG 10 000 as precipitant and belonged to space group C2. The crystals diffracted rotating-anode Cu Kα radiation to at least 1.9 Å resolution and a complete data set was collected from a single crystal to 2.2 Å resolution. Unit-cell parameters were a = 216.5, b = 59.2, c = 57.5 Å, β = 101.3°, suggesting one trimer per asymmetric unit and a solvent content of 46%. The long fibre head does not have significant sequence homology to any other protein of known structure and molecular-replacement attempts with known fibre-head structures were unsuccessful. However, a map calculated using SIRAS phasing shows a clear trimer with a shape similar to known adenovirus fibre-head structures. Structure solution is in progress.

  19. Carboxy terminal region of the Fanconi anemia protein, FANCG/XRCC9, is required for functional activity.

    Science.gov (United States)

    Kuang, Y; Garcia-Higuera, I; Moran, A; Mondoux, M; Digweed, M; D'Andrea, A D

    2000-09-01

    Fanconi anemia (FA) is an autosomal recessive cancer susceptibility syndrome with eight complementation groups. Four of the FA genes have been cloned, and at least three of the encoded proteins, FANCA, FANCC, and FANCG/XRCC9, interact in a nuclear complex, required for the maintenance of normal chromosome stability. In the current study, mutant forms of the FANCA and FANCG proteins have been generated and analyzed with respect to protein complex formation, nuclear translocation, and functional activity. The results demonstrate that the amino terminal two-thirds of FANCG (FANCG amino acids 1-428) binds to the amino terminal nuclear localization signal (NLS) of the FANCA protein. On the basis of 2-hybrid analysis, the FANCA/FANCG binding is a direct protein-protein interaction. Interestingly, a truncated mutant form of the FANCG protein, lacking the carboxy terminus, binds in a complex with FANCA and translocates to the nucleus; however, this mutant protein fails to bind to FANCC and fails to correct the mitomycin C sensitivity of an FA-G cell line. Taken together, these results demonstrate that binding of FANCG to the amino terminal FANCA NLS sequence is necessary but not sufficient for the functional activity of FANCG. Additional amino acid sequences at the carboxy terminus of FANCG are required for the binding of FANCC in the complex. (Blood. 2000;96:1625-1632)

  20. Investigation of functional aspects of the N-terminal region of elongation factor Tu from Escherichia coli using a protein engineering approach

    DEFF Research Database (Denmark)

    Laurberg, M; Mansilla, Francisco; Clark, Brian F. C.

    1998-01-01

    The function of the N-terminal region of elongation factor Tu is still unexplained. Until recently, it has not been visible in electron density maps from x-ray crystallography studies, but the presence of several well conserved basic residues suggest that this part of the molecule is of structural...

  1. Transcriptional organization of the DNA region controlling expression of the K99 gene cluster.

    Science.gov (United States)

    Roosendaal, B; Damoiseaux, J; Jordi, W; de Graaf, F K

    1989-01-01

    The transcriptional organization of the K99 gene cluster was investigated in two ways. First, the DNA region, containing the transcriptional signals was analyzed using a transcription vector system with Escherichia coli galactokinase (GalK) as assayable marker and second, an in vitro transcription system was employed. A detailed analysis of the transcription signals revealed that a strong promoter PA and a moderate promoter PB are located upstream of fanA and fanB, respectively. No promoter activity was detected in the intercistronic region between fanB and fanC. Factor-dependent terminators of transcription were detected and are probably located in the intercistronic region between fanA and fanB (T1), and between fanB and fanC (T2). A third terminator (T3) was observed between fanC and fanD and has an efficiency of 90%. Analysis of the regulatory region in an in vitro transcription system confirmed the location of the respective transcription signals. A model for the transcriptional organization of the K99 cluster is presented. Indications were obtained that the trans-acting regulatory polypeptides FanA and FanB both function as anti-terminators. A model for the regulation of expression of the K99 gene cluster is postulated.

  2. Activation of PI3K/Akt signaling by n-terminal SH2 domain mutants of the p85α regulatory subunit of PI3K is enhanced by deletion of its c-terminal SH2 domain.

    Science.gov (United States)

    Hofmann, Bianca T; Jücker, Manfred

    2012-10-01

    The phosphoinositide 3-kinase (PI3K) is frequently activated in human cancer cells due to gain of function mutations in the catalytic (p110) and the regulatory (p85) subunits. The regulatory subunit consists of an SH3 domain and two SH2 domains. An oncogenic form of p85α named p65 lacking the c-terminal SH2 domain (cSH2) has been cloned from an irradiation-induced murine thymic lymphoma and transgenic mice expressing p65 in T lymphocytes develop a lymphoproliferative disorder. We have recently detected a c-terminal truncated form of p85α named p76α in a human lymphoma cell line lacking most of the cSH2 domain due to a frame shift mutation. Here, we report that the deletion of the cSH2 domain enhances the activating effects of the n-terminal SH2 domain (nSH2) mutants K379E and R340E on the PI3K/Akt pathway and micro tumor formation in a focus assay. Further analysis revealed that this transforming effect is mediated by activation of the catalytic PI3K isoform p110α and downstream signaling through mTOR. Our data further support a mechanistic model in which mutations of the cSH2 domain of p85α can abrogate its negative regulatory function on PI3K activity via the nSH2 domain of p85α. Copyright © 2012 Elsevier Inc. All rights reserved.

  3. The expression pattern of the C-terminal kinesin gene kifc1 during the spermatogenesis of Sepiella maindroni.

    Science.gov (United States)

    Tan, Fu-Qing; Ma, Xiao-Xin; Zhu, Jun-Quan; Yang, Wan-Xi

    2013-12-10

    In this study, we investigated the gene sequence and characteristic of kifc1 in Sepiella maindroni through PCR and RACE technology. Our research aimed particularly at the spatio-temporal expression pattern of kifc1 in the developmental testis through in situ hybridization. The particular role of kifc1 in the spermatogenesis of S. maindroni was our particular interest. Based on multiple protein sequence alignments of KIFC1 homologues, kifc1 gene from the testis of S. maindroni was identified, which consisted of 2432bp including a 2109 in-frame ORF corresponding to 703 continuous amino acids. The encoded polypeptide shared highest similarity with Octopus tankahkeei. Through the prediction of the secondary and tertiary structures, the motor domain of KIFC1 was conserved at the C-terminal, having putative ATP-binding and microtubule-binding motifs, while the N-terminal was more specific to bind various cargoes for cellular events. The stalk domain connecting between the C-terminal and N-terminal determined the direction of movement. According to RT-PCR results, the kifc1 gene is not tissue-specific, commonly detected in different tissues, for example, the testis, liver, stomach, muscle, caecum and gills. Through an in situ hybridization method, the expression pattern of KIFC1 protein mimics in the spermatogenesis of S. maindroni. During the primary stage of the spermatogenesis, the kifc1 mRNA signal was barely detectable. At the early spermatids, the signal started to be present. With the elongation of spermatids, the signals increased substantially. It peaked and gathered around the acrosome area when the spermatids began to transform to spindle shape. As the spermatids developed into mature sperm, the signal vanished. In summary, the expression of kfic1 at specific stages during spermiogenesis and its distribution shed light on the potential functions of this motor in major cytological transformations. The KIFC1 homologue may provide a direct shaping force to the

  4. Termination in cognitive-behavioral therapy with children, adolescents, and parents.

    Science.gov (United States)

    Vidair, Hilary B; Feyijinmi, Grace O; Feindler, Eva L

    2017-03-01

    The process of terminating cognitive-behavioral therapy (CBT) with families has been largely neglected in the literature, with the limited research focused on premature termination. This article describes the natural termination process in CBT with children, adolescents, and their parents. Based on existing theories, we describe a cognitive-behavioral model for: (a) initiating and engaging in discussion of termination, (b) processing the termination of treatment and the therapeutic relationship, (c) key aspects of the termination process in the final session, and (d) the very end of the final session (saying goodbye). For each of the 4 components, we review relevant theories, provide clinical exchanges to demonstrate techniques, and provide related research support. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  5. Downstream signaling mechanism of the C-terminal activation domain of transcriptional coactivator CoCoA

    OpenAIRE

    Kim, Jeong Hoon; Yang, Catherine K.; Stallcup, Michael R.

    2006-01-01

    The coiled-coil coactivator (CoCoA) is a transcriptional coactivator for nuclear receptors and enhances nuclear receptor function by the interaction with the bHLH-PAS domain (AD3) of p160 coactivators. The C-terminal activation domain (AD) of CoCoA possesses strong transactivation activity and is required for the coactivator function of CoCoA with nuclear receptors. To understand how CoCoA AD transmits its activating signal to the transcription machinery, we defined specific subregions, amino...

  6. Isobaric Quantification of Cerebrospinal Fluid Amyloid-β Peptides in Alzheimer's Disease: C-Terminal Truncation Relates to Early Measures of Neurodegeneration.

    Science.gov (United States)

    Rogeberg, Magnus; Almdahl, Ina Selseth; Wettergreen, Marianne; Nilsson, Lars N G; Fladby, Tormod

    2015-11-06

    The amyloid beta (Aβ) peptide is the main constituent of the plaques characteristic of Alzheimer's disease (AD). Measurement of Aβ1-42 in cerebrospinal fluid (CSF) is a valuable marker in AD research, where low levels indicate AD. Although the use of immunoassays measuring Aβ1-38 and Aβ1-40 in addition to Aβ1-42 has increased, quantitative assays of other Aβ peptides remain rarely explored. We recently discovered novel Aβ peptides in CSF using antibodies recognizing the Aβ mid-domain region. Here we have developed a method using both Aβ N-terminal and mid-domain antibodies for immunoprecipitation in combination with isobaric labeling and liquid chromatography-tandem mass spectrometry (LC-MS/MS) for relative quantification of endogenous Aβ peptides in CSF. The developed method was used in a pilot study to produce Aβ peptide profiles from 38 CSF samples. Statistical comparison between CSF samples from 19 AD patients and 19 cognitively healthy controls revealed no significant differences at group level. A significant correlation was found between several larger C-terminally truncated Aβ peptides and protein biomarkers for neuronal damage, particularly prominent in the control group. Comparison of the isobaric quantification with immunoassays measuring Aβ1-38 or Aβ1-40 showed good correlation (r(2) = 0.84 and 0.85, respectively) between the two analysis methods. The developed method could be used to assess disease-modifying therapies directed at Aβ production or degradation.

  7. An overlapping region between the two terminal folding units of the outer surface protein A (OspA) controls its folding behavior.

    Science.gov (United States)

    Makabe, Koki; Nakamura, Takashi; Dhar, Debanjan; Ikura, Teikichi; Koide, Shohei; Kuwajima, Kunihiro

    2018-04-27

    Although many naturally occurring proteins consist of multiple domains, most studies on protein folding to date deal with single-domain proteins or isolated domains of multi-domain proteins. Studies of multi-domain protein folding are required for further advancing our understanding of protein folding mechanisms. Borrelia outer surface protein A (OspA) is a β-rich two-domain protein, in which two globular domains are connected by a rigid and stable single-layer β-sheet. Thus, OspA is particularly suited as a model system for studying the interplays of domains in protein folding. Here, we studied the equilibria and kinetics of the urea-induced folding-unfolding reactions of OspA probed with tryptophan fluorescence and ultraviolet circular dichroism. Global analysis of the experimental data revealed compelling lines of evidence for accumulation of an on-pathway intermediate during kinetic refolding and for the identity between the kinetic intermediate and a previously described equilibrium unfolding intermediate. The results suggest that the intermediate has the fully native structure in the N-terminal domain and the single layer β-sheet, with the C-terminal domain still unfolded. The observation of the productive on-pathway folding intermediate clearly indicates substantial interactions between the two domains mediated by the single-layer β-sheet. We propose that a rigid and stable intervening region between two domains creates an overlap between two folding units and can energetically couple their folding reactions. Copyright © 2018. Published by Elsevier Ltd.

  8. Structural diversity and evolution of the N-terminal isoform-specific region of ecdysone receptor-A and -B1 isoforms in insects

    Directory of Open Access Journals (Sweden)

    Kubo Takeo

    2010-02-01

    Full Text Available Abstract Background The ecdysone receptor (EcR regulates various cellular responses to ecdysteroids during insect development. Insects have multiple EcR isoforms with different N-terminal A/B domains that contain the isoform-specific activation function (AF-1 region. Although distinct physiologic functions of the EcR isoforms have been characterized in higher holometabolous insects, they remain unclear in basal direct-developing insects, in which only A isoform has been identified. To examine the structural basis of the EcR isoform-specific AF-1 regions, we performed a comprehensive structural comparison of the isoform-specific region of the EcR-A and -B1 isoforms in insects. Results The EcR isoforms were newly identified in 51 species of insects and non-insect arthropods, including direct-developing ametabolous and hemimetabolous insects. The comprehensive structural comparison revealed that the isoform-specific region of each EcR isoform contained evolutionally conserved microdomain structures and insect subgroup-specific structural modifications. The A isoform-specific region generally contained four conserved microdomains, including the SUMOylation motif and the nuclear localization signal, whereas the B1 isoform-specific region contained three conserved microdomains, including an acidic activator domain-like motif. In addition, the EcR-B1 isoform of holometabolous insects had a novel microdomain at the N-terminal end. Conclusions Given that the nuclear receptor AF-1 is involved in cofactor recruitment and transcriptional regulation, the microdomain structures identified in the isoform-specific A/B domains might function as signature motifs and/or as targets for cofactor proteins that play essential roles in the EcR isoform-specific AF-1 regions. Moreover, the novel microdomain in the isoform-specific region of the holometabolous insect EcR-B1 isoform suggests that the holometabolous insect EcR-B1 acquired additional transcriptional

  9. THE CAPACITY AND CIRCULATION OF PASSENGER TERMINAL BUILDING IN REGIONAL AIRPORT (CASE: MINANGKABAU AND ADISUTJIPTO INTERNATIONAL AIRPORTS OF INDONESIA

    Directory of Open Access Journals (Sweden)

    Amalia Defiani

    2013-05-01

    Full Text Available The dissertation explains about capacity and flow inside terminal buildings in two regional airports in Indonesia: Minangkabau and Adisutjipto International Airports. Both airports have similar characteristics of passengers’ number and locations as tourism areas. Secondary data in the form of existing terminal layouts and air traffic numbers were gained from both airports authorities in Indonesia. The analysis was carried out using the formulas from Japan International Cooperation Agency – Directorate General of Civil Aviation of Indonesia(JICA-DGCA studies in 1996 for significant areas in the terminal building, Ashford and Wright formula for calculating aircraft movement per hour, Microsoft Excel for calculating the 10-year passenger growth rate, and SPSS for determining the linear equation for domestic departure resulted in the forecasted saturation in the near 2020 for both of airports, especially on passengers’ handling areas such as boarding lounge (for departure and baggage claim area (for arrival. The research resulted in ideas to overcome problems related to the increasing capacity by adding areas (if possible and changing layouts. Some other options such as implementation of more effective signage and the suggestion of centralizing security checking areas also are being brought—though needed further research. There should be an addition of numbers of security check lines, appropriately to the increasing number of passengers. If a single queuing line creates delays, then the need for extra line(s is a necessity Keywords: Airport, Terminal Building, Capacity, Flow, Minangkabau, Adisutjipto

  10. Ab initio study of 3C-SiC/M (M = Ti or Al) nano-hetero interfaces

    International Nuclear Information System (INIS)

    Tanaka, Shingo; Kohyama, Masanori

    2003-01-01

    Ab initio pseudopotential calculation of 3C-SiC(1 1 1)/Al nano-hetero interfaces have been performed and interface atom species dependence (IASD) and interface orientation dependence (IOD) of nano-hetero interfaces between 3C-SiC ((1 1 1) or (0 0 1) orientation) and metal (Ti or Al) have been studied systematically. Stable atomic configurations of the 3C-SiC(1 1 1)/Al interfaces are quite different from those of the 3C-SiC(1 1 1)/Ti interfaces. Two terminated, Si-terminated (Si-TERM) and C-terminated (C-TERM), 3C-SiC(1 1 1)/Al interfaces have covalent bonding nature. In 3C-SiC/M (M = Ti or Al) nano-hetero interfaces, the C-terminated interface has relative strong, covalent and ionic C-Ti or C-Al bonds as TiC or SiC while the Si-terminated interface has various type of bonding nature, relative weak Si-Ti or Si-Al bonds from metallic character at the (0 0 1) interface to covalent character at the (1 1 1) interface. Adhesive energy (AE) shows strong IASD and IOD. The AE of the C-terminated interface is larger than that of the Si-terminated one. In the C-terminated interface, the AE of the (1 1 1) interface is smaller than that of the (0 0 1) one while in the Si-terminated interface there exists opposite interrelation. Schottky barrier height (SBH) also shows strong IASD and IOD. The SBH of the C-terminated interface is smaller than that of the Si-terminated one. The C-terminated SiC/Al interfaces have extremely small SBHs. In comparison with some experimental SBH, the present result is reliable as the difference of SBH between the two terminated interfaces and qualitative properties

  11. Restricted N-terminal truncation of cardiac troponin T: a novel mechanism for functional adaptation to energetic crisis.

    Science.gov (United States)

    Feng, Han-Zhong; Biesiadecki, Brandon J; Yu, Zhi-Bin; Hossain, M Moazzem; Jin, J-P

    2008-07-15

    The N-terminal variable region of cardiac troponin T (TnT) is a regulatory structure that can be selectively removed during myocardial ischaemia reperfusion by mu-calpain proteolysis. Here we investigated the pathophysiological significance of this post-translational modification that removes amino acids 1-71 of cardiac TnT. Working heart preparations were employed to study rat acute myocardial infarction and transgenic mouse hearts over-expressing the N-terminal truncated cardiac TnT (cTnT-ND). Ex vivo myocardial infarction by ligation of the left anterior descending coronary artery induced heart failure and produced cTnT-ND not only in the infarct but also in remote zones, including the right ventricular free wall, indicating a whole organ response in the absence of systemic neurohumoral mechanisms. Left ventricular pressure overload in mouse working hearts produced increased cTnT-ND in both ventricles, suggesting a role of haemodynamic stress in triggering an acute whole organ proteolytic regulation. Transgenic mouse hearts in which the endogenous intact cardiac TnT was partially replaced by cTnT-ND showed lowered contractile velocity. When afterload increased from 55 mmHg to 90 mmHg, stroke volume decreased in the wild type but not in the transgenic mouse hearts. Correspondingly, the left ventricular rapid-ejection time of the transgenic mouse hearts was significantly longer than that of wild type hearts, especially at high afterload. The restricted deletion of the N-terminal variable region of cardiac troponin T demonstrates a novel mechanism by which the thin filament regulation adapts to sustain cardiac function under stress conditions.

  12. Role of the teneurins, teneurin C-terminal associated peptides (TCAP) in reproduction: clinical perspectives.

    Science.gov (United States)

    Lovejoy, David A; Pavlović, Téa

    2015-11-01

    In humans, the teneurin gene family consists of four highly conserved paralogous genes that are the result of early vertebrate gene duplications arising from a gene introduced into multicellular organisms from a bacterial ancestor. In vertebrates and humans, the teneurins have become integrated into a number of critical physiological systems including several aspects of reproductive physiology. Structurally complex, these genes possess a sequence in their terminal exon that encodes for a bioactive peptide sequence termed the 'teneurin C-terminal associated peptide' (TCAP). The teneurin/TCAP protein forms an intercellular adhesive unit with its receptor, latrophilin, an Adhesion family G-protein coupled receptor. It is present in numerous cell types and has been implicated in gamete migration and gonadal morphology. Moreover, TCAP is highly effective at reducing the corticotropin-releasing factor (CRF) stress response. As a result, TCAP may also play a role in regulating the stress-associated inhibition of reproduction. In addition, the teneurins and TCAP have been implicated in tumorigenesis associated with reproductive tissues. Therefore, the teneurin/TCAP system may offer clinicians a novel biomarker system upon which to diagnose some reproductive pathologies.

  13. Efficient farnesylation of an extended C-terminal C(x)3X sequence motif expands the scope of the prenylated proteome.

    Science.gov (United States)

    Blanden, Melanie J; Suazo, Kiall F; Hildebrandt, Emily R; Hardgrove, Daniel S; Patel, Meet; Saunders, William P; Distefano, Mark D; Schmidt, Walter K; Hougland, James L

    2018-02-23

    Protein prenylation is a post-translational modification that has been most commonly associated with enabling protein trafficking to and interaction with cellular membranes. In this process, an isoprenoid group is attached to a cysteine near the C terminus of a substrate protein by protein farnesyltransferase (FTase) or protein geranylgeranyltransferase type I or II (GGTase-I and GGTase-II). FTase and GGTase-I have long been proposed to specifically recognize a four-amino acid C AAX C-terminal sequence within their substrates. Surprisingly, genetic screening reveals that yeast FTase can modify sequences longer than the canonical C AAX sequence, specifically C( x ) 3 X sequences with four amino acids downstream of the cysteine. Biochemical and cell-based studies using both peptide and protein substrates reveal that mammalian FTase orthologs can also prenylate C( x ) 3 X sequences. As the search to identify physiologically relevant C( x ) 3 X proteins begins, this new prenylation motif nearly doubles the number of proteins within the yeast and human proteomes that can be explored as potential FTase substrates. This work expands our understanding of prenylation's impact within the proteome, establishes the biologically relevant reactivity possible with this new motif, and opens new frontiers in determining the impact of non-canonically prenylated proteins on cell function. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Dicty_cDB: SLH268 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SL (Link to library) SLH268 (Link to dictyBase) - - - - SLH268Z (Link to Original site) - - SLH2...68Z 640 - - - - Show SLH268 Library SL (Link to library) Clone ID SLH268 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-C/SLH2...68Q.Seq.d/ Representative seq. ID SLH268Z (Link to Original site) R...epresentative DNA sequence >SLH268 (SLH268Q) /CSM/SL/SLH2-C/SLH268Q.Seq.d/ XXXXXXXXXXCTGGTGGTTATATTTCTCGTACT

  15. LARGE-scale forest fuel supply solution trough a regional terminal network; Terminaalitoimintoihin perustuvan metsaepolttoaineen hankintalogistiikkajaerjestelmaen kehittaeminen

    Energy Technology Data Exchange (ETDEWEB)

    Leppaenen, T. [Etelae-Savon Energia Oy, Mikkeli (Finland)

    2006-12-19

    The aim of the study is to develop logistic systems for supply of forest fuel where a terminal is part of the supply chain. Operations in the terminal, supply chains of the forest fuel and joining them to the terminal network are testing and following p. Also operation and business models are under analyzing. Costs, cost factors, benefits and space requirement of the terminal and cost-effectiveness of the entrepreneurship of the terminal are carried out. (orig.)

  16. Health-related Quality of life in 640 head and neck cancer survivors after radiotherapy using EORTC QLQ-C30 and QLQ-H&N35 questionnaires

    International Nuclear Information System (INIS)

    Wan Leung, Stephen; Lee, Tsair-Fwu; Chien, Chih-Yen; Chao, Pei-Ju; Tsai, Wen-Ling; Fang, Fu-Min

    2011-01-01

    With the advances in modern radiotherapy (RT), many patients with head and neck cancer (HNC) can be effectively cured, and their health-related quality of life (HR-QoL) has become an important issue. In this study, we evaluated the prognosticators of HR-QoL in a large cohort of HNC patients, with a focus on the result from technological advances in RT. A cross-sectional investigation was conducted to assess the HR-QoL of 640 HNC patients with cancer-free survival of more than 2 years. Among them, 371 patients were treated by two-dimensional RT (2DRT), 127 by three-dimensional conformal RT (3DCRT), and 142 by intensity-modulated RT (IMRT). The EORTC QLQ-C30 questionnaire and QLQ-H&N35 module were used. A general linear model multivariate analysis of variance was used to analyze the prognosticators of HR-QoL. By multivariate analysis, the variables of gender, annual family income, tumor site, AJCC stage, treatment methods, and RT technique were prognosticators for QLQ-C30 results, so were tumor site and RT technique for H&N35. Significant difference (p < 0.05) of HR-QoL outcome by different RT techniques was observed at 2 of the 15 scales in QLQ-C30 and 10 of the 13 scales in H&N35. Compared with 2DRT, IMRT had significant better outcome in the scales of global QoL, physical functioning, swallowing, senses (taste/smell), speech, social eating, social contact, teeth, opening mouth, dry mouth, sticky saliva, and feeling ill. The technological advance of RT substantially improves the head-and-neck related symptoms and broad aspects of HR-QoL for HNC survivors

  17. Development of 10 kV 4H-SiC JBS diode with FGR termination

    International Nuclear Information System (INIS)

    Huang Runhua; Tao Yonghong; Cao Pengfei; Wang Ling; Li Rui; Chen Gang; Bai Song; Li Yun; Zhao Zhifei

    2014-01-01

    The design, fabrication, and electrical characteristics of the 4H-SiC JBS diode with a breakdown voltage higher than 10 kV are presented. 60 floating guard rings have been used in the fabrication. Numerical simulations have been performed to select the doping level and thickness of the drift layer and the effectiveness of the edge termination technique. The n-type epilayer is 100 μm in thickness with a doping of 6 × 10 14 cm −3 . The on-state voltage was 2.7 V at J F = 13 A/cm 2 . (semiconductor devices)

  18. The heparin-binding site in tetranectin is located in the N-terminal region and binding does not involve the carbohydrate recognition domain.

    Science.gov (United States)

    Lorentsen, R H; Graversen, J H; Caterer, N R; Thogersen, H C; Etzerodt, M

    2000-04-01

    Tetranectin is a homotrimeric plasma and extracellular-matrix protein that binds plasminogen and complex sulphated polysaccharides including heparin. In terms of primary and tertiary structure, tetranectin is related to the collectin family of Ca(2+)-binding C-type lectins. Tetranectin is encoded in three exons. Exon 3 encodes the carbohydrate recognition domain, which binds to kringle 4 in plasminogen at low levels of Ca(2+). Exon 2 encodes an alpha-helix, which is necessary and sufficient to govern the trimerization of tetranectin by assembling into a triple-helical coiled-coil structural element. Here we show that the heparin-binding site in tetranectin resides not in the carbohydrate recognition domain but within the N-terminal region, comprising the 16 amino acid residues encoded by exon 1. In particular, the lysine residues in the decapeptide segment KPKKIVNAKK (tetranectin residues 6-15) are shown to be of primary importance in heparin binding.

  19. The C-terminal domain of the Arabidopsis AtMBD7 protein confers strong chromatin binding activity

    International Nuclear Information System (INIS)

    Zemach, Assaf; Paul, Laju K.; Stambolsky, Perry; Efroni, Idan; Rotter, Varda; Grafi, Gideon

    2009-01-01

    The Arabidopsis MBD7 (AtMBD7) - a naturally occurring poly MBD protein - was previously found to be functional in binding methylated-CpG dinucleotides in vitro and localized to highly methylated chromocenters in vivo. Furthermore, AtMBD7 has significantly lower mobility within the nucleus conferred by cooperative activity of its three MBD motifs. Here we show that besides the MBD motifs, AtMBD7 possesses a strong chromatin binding domain located at its C-terminus designated sticky-C (StkC). Mutational analysis showed that a glutamic acid residue near the C-terminus is essential though not sufficient for the StkC function. Further analysis demonstrated that this motif can render nuclear proteins highly immobile both in plant and animal cells, without affecting their native subnuclear localization. Thus, the C-terminal, StkC motif plays an important role in fastening AtMBD7 to its chromosomal, CpG-methylated sites. It may be possible to utilize this motif for fastening nuclear proteins to their chromosomal sites both in plant and animal cells for research and gene therapy applications.

  20. The 18-kilodalton Chlamydia trachomatis histone H1-like protein (Hc1) contains a potential N-terminal dimerization site and a C-terminal nucleic acid-binding domain

    DEFF Research Database (Denmark)

    Pedersen, LB; Birkelund, Svend; Holm, A

    1996-01-01

    The Chlamydia trachomatis histone H1-like protein (Hc1) is a DNA-binding protein specific for the metabolically inactive chlamydial developmental form, the elementary body. Hc1 induces DNA condensation in Escherichia coli and is a strong inhibitor of transcription and translation. These effects may......-hydroxysuccinimide ester), purified recombinant Hc1 was found to form dimers. The dimerization site was located in the N-terminal part of Hc1 (Hc1(2-57)). Moreover, circular dichroism measurements indicated an overall alpha-helical structure of this region. By using limited proteolysis, Southwestern blotting, and gel...