Santolla, Maria Francesca; Lappano, Rosamaria; Cirillo, Francesca; Rigiracciolo, Damiano Cosimo; Sebastiani, Anna; Abonante, Sergio; Tassone, Pierfrancesco; Tagliaferri, Pierosandro; Di Martino, Maria Teresa; Maggiolini, Marcello; Vivacqua, Adele
2018-05-02
MicroRNA (miRNAs) are non-coding small RNA molecules that regulate gene expression by inhibiting the translation of target mRNAs. Among several dysregulated miRNAs in human cancer, the up-regulation of miR-221 has been associated with development of a variety of hematologic and solid malignancies. In this study, we investigated the involvement of miR-221 in breast cancer. TaqMan microRNA assay was used to detect the miR-221 levels in normal cells and in MDA-MB 231 and SkBr3 breast cancer cells as well as in main players of the tumor microenvironment, namely cancer-associated fibroblasts (CAFs). miR-221 mimic sequence and locked nucleic acid (LNA)-i-miR-221 construct were used to induce or inhibit, respectively, the miR-221 expression in cells used. Quantitative PCR and western blotting analysis were performed to evaluate the levels of the miR-221 target gene A20 (TNFAIP3), as well as the member of the NF-kB complex namely c-Rel and the connective tissue growth factor (CTGF). Chromatin immunoprecipitation (ChIP) assay was performed to ascertain the recruitment of c-Rel to the CTFG promoter. Finally, the cell growth and migration in the presence of LNA-i-miR-221 or silencing c-Rel and CTGF by specific short hairpin were assessed by cell count, colony formation and boyden chambers assays. Statistical analysis was performed by ANOVA. We first demonstrated that LNA-i-miR-221 inhibits both endogenous and ectopic expression of miR-221 in our experimental models. Next, we found that the A20 down-regulation, as well as the up-regulation of c-Rel induced by miR-221 were no longer evident using LNA-i-miR-221. Moreover, we established that the miR-221 dependent recruitment of c-Rel to the NF-kB binding site located within the CTGF promoter region is prevented by using LNA-i-miR-221. Furthermore, we determined that the up-regulation of CTGF mRNA and protein levels by miR-221 is no longer evident using LNA-i-miR221 and silencing c-Rel. Finally, we assessed that cell growth and
Directory of Open Access Journals (Sweden)
Alexander Visekruna
2012-01-01
Full Text Available The transcription factors of the Rel/NF-κB family function as key regulators of innate and adoptive immunity. Tightly and temporally controlled activation of NF-κB-signalling pathways ensures prevention of harmful immune cell dysregulation, whereas a loss of control leads to pathological conditions such as severe inflammation, autoimmune disease, and inflammation-associated oncogenesis. Five family members have been identified in mammals: RelA (p65, c-Rel, RelB, and the precursor proteins NF-κB1 (p105 and NF-κB2 (p100, that are processed into p50 and p52, respectively. While RelA-containing dimers are present in most cell types, c-Rel complexes are predominately found in cells of hematopoietic origin. In T-cell lymphocytes, certain genes essential for immune function such as Il2 and Foxp3 are directly regulated by c-Rel. Additionally, c-Rel-dependent IL-12 and IL-23 transcription by macrophages and dendritic cells is crucial for T-cell differentiation and effector functions. Accordingly, c-Rel expression in T cells and antigen-presenting cells (APCs controls a delicate balance between tolerance and immunity. This review gives a selective overview on recent progress in understanding of diverse roles of c-Rel in regulating adaptive immunity.
Liu, Junfeng; Hua, Rong; Gong, Zhangbin; Shang, Bin; Huang, Yongyi; Guo, Lihe; Liu, Te; Xue, Jun
2017-01-01
In the pathogenesis of acute kidney injury (AKI), the release of multiple interleukins can lead to increased kidney damage. Human amniotic epithelial cells (HuAECs) can inhibit immune cell activation in vivo and in vitro. We hypothesized that HuAECs could weaken patient-derived peripheral blood CD4+ T-cell activation and decreasing the ability of these cells to express and release IL-2. -Cell proliferation assay revealed that under the same culture conditions, activated AKI patient-derived CD4+ T cells had a significantly reduced proliferation rate when were co-cultured with HuAECs. And the level of IL-2 released was also significantly reduced. Western blot and qRT-PCR assays showed that the expression of c-Rel in the CD4+ T cells was also significantly reduced. However, the expression level of endogenous miR-101 in the CD4+ T cells co-cultured with HuAECs was significantly increased. Luciferase reporter assay results suggested that miR-101 could bind to a specific site in the c-Rel 3' UTR and induce the post-transcriptional silencing of c-Rel. Subsequently, we over-expressed miR-101 in AKI patient-derived CD4+ T cells. The qRT-PCR and western blot assay results revealed that the expression of endogenous c-Rel was significantly reduced, while the ELISA results indicated that the level of IL-2 released was also significantly decreased. Finally, ChIP-PCR assay results showed that the miR-101-overexpressing CD4+ T-cell group and the HuAEC co-culture CD4+ T-cell group exhibited significantly decreased binding capacities between the 'c-Rel-NFκB' complex and the IL-2 gene promoter, and the transcriptional activity of IL-2 was also significantly decreased. Therefore, we confirmed that HuAECs can stimulate miR-101 expression in AKI patient-derived peripheral blood CD4+ T cells, thus inhibiting the expression of the miR-101 target gene c-Rel and leading to a reduction in IL-2 expression and release. Copyright © 2016 Elsevier Ltd. All rights reserved.
Impact of C-rel inhibition of cord blood-derived B-, T-, and NK cells.
Fallahi, Shirin; Mohammadi, Seyede Momeneh; Tayefi Nasrabadi, Hamid; Alihemmati, Alireza; Samadi, Naser; Gholami, Sanaz; Shanehbandi, Dariush; Nozad Charoudeh, Hojjatollah
2017-12-01
The c-Rel transcription factor is a unique member of the nuclear factor (NF)-κB family that has a role in curtailing the proliferation, differentiation, cytokine production, and overall activity of B- and T-cells. In addition, c-Rel is a key regulator of apoptosis in that it influences the expression of anti-apoptotic genes such as Bcl-2 and Bcl-xL; conversely, inhibition of c-Rel increases cell apoptosis. To better understand the relationship between c-Rel expression and effects on B- and T-cell expansion, the current study evaluated c-Rel expression in cord blood mononuclear cells. This particular source was selected as cord blood is an important source of cells used for transplantation and immunotherapy, primarily in treating leukemias. As stem cell factor (SCF) and FLT3 are important agents for hematopoietic stem cell expansion, and cytokines like interleukin (IL)-2, -7, and -15 are essential for T- and B- (and also NK) cell development and proliferation, the current study evaluated c-Rel expression in cord blood mononuclear cells and CD34 + cells, as well as effects on B-, T-, and NK cells associated with alterations in c-Rel expression, using flow cytometry and PCR. The results showed c-Rel expression increased among cells cultured in the presence of SCF and FLT3 but was reduced when IL-2, IL-7, and IL-15 were used all together. Further, inhibition of c-Rel expression by siRNA reduced cord blood-derived B-, T-, and NK cell differentiation and expansion. These results indicated that with cells isolated from cord blood, c-Rel has an important role in B-, T-, and NK cell differentiation and, further, that agents (select cytokines/growth factors) that could impact on its expression might not only affect immune cell profiles in a host but could potentially also limit apoptotic activities in (non-)immune cells in that host. In the context of cancer (immuno)therapy, in particular, when cord blood is used an important source in stem cell transplantation in
IRF-4 and c-Rel expression in antiviral-resistant adult T-cell leukemia/lymphoma
Ramos, Juan Carlos; Ruiz, Phillip; Ratner, Lee; Reis, Isildinha M.; Brites, Carlos; Pedroso, Celia; Byrne, Gerald E.; Toomey, Ngoc L.; Andela, Valentine; Harhaj, Edward W.; Lossos, Izidore S.
2007-01-01
Adult T-cell leukemia/lymphoma (ATLL) is a generally fatal malignancy. Most ATLL patients fare poorly with conventional chemotherapy; however, antiviral therapy with zidovudine (AZT) and interferon alpha (IFN-α) has produced long-term clinical remissions. We studied primary ATLL tumors and identified molecular features linked to sensitivity and resistance to antiviral therapy. Enhanced expression of the proto-oncogene c-Rel was noted in 9 of 27 tumors. Resistant tumors exhibited c-Rel (6 of 10; 60%) more often than did sensitive variants (1 of 9; 11%). This finding was independent of the disease form. Elevated expression of the putative c-Rel target, interferon regulatory factor-4 (IRF-4), was observed in 10 (91%) of 11 nonresponders and in all tested patients with c-Rel+ tumors and occurred in the absence of the HTLV-1 oncoprotein Tax. In contrast, tumors in complete responders did not express c-Rel or IRF-4. Gene rearrangement studies demonstrated the persistence of circulating T-cell clones in long-term survivors maintained on antiviral therapy. The expression of nuclear c-Rel and IRF-4 occurs in the absence of Tax in primary ATLL and is associated with antiviral resistance. These molecular features may help guide treatment. AZT and IFN-α is a suppressive rather than a curative regimen, and patients in clinical remission should remain on maintenance therapy indefinitely. PMID:17138822
p100, a precursor of NF-κB2, inhibits c-Rel and reduces the expression of IL-23 in dendritic cells
International Nuclear Information System (INIS)
Mise-Omata, Setsuko; Obata, Yuichi; Doi, Takahiro S.
2014-01-01
Highlights: • The deficiency of p100 enhances c-Rel-, not RelA-, dependent cytokine expression. • p100 associates with c-Rel in the steady state but dissociates after LPS stimulation. • The deficiency of p100 enhances the nuclear translocation of c-Rel. • p100 negatively regulates the c-Rel function. - Abstract: Nuclear factor κB regulates various genes involved in the immune response, inflammation, cell survival, and development. NF-κB activation is controlled by proteins possessing ankyrin repeats, such as IκBs. A precursor of the NF-κB2 (p52) subunit, p100, contains ankyrin repeats in its C-terminal portion and has been found to act as a cytoplasmic inhibitor of RelA in the canonical pathway of NF-κB activation. Here, we demonstrate that p100 also suppresses c-Rel function in dendritic cells. Expression of the p19 and p40 subunits of IL-23, a c-Rel-dependent cytokine, was enhanced in p100-deficient cells, although expression of a RelA-dependent cytokine, TNF-α, was reduced. Nuclear translocation of c-Rel was enhanced in p100-deficient cells. p100, and not the processed p52 form, associated with c-Rel in the steady state and dissociated immediately after lipopolysaccharide stimulation in wild-type dendritic cells. Four hours after the stimulation, p100 was newly synthesized and associated with c-Rel again. In cells expressing both c-Rel and RelA, c-Rel is preferentially suppressed by p100
Dutta, Jui; Fan, Gaofeng; Gélinas, Céline
2008-11-01
The Rel/NF-kappaB transcription factors are constitutively activated in many human cancers. The Rel proteins in this family are implicated in leukemia/lymphomagenesis, but the mechanism is not completely understood. Previous studies showed that the transcription activation domains (TADs) of the viral oncoprotein v-Rel and its cellular Rel/NF-kappaB homologues c-Rel and RelA are key determinants of their different transforming activities in primary lymphocytes. Substitution of a Rel TAD for that of RelA conferred a strong transforming phenotype upon RelA, which otherwise failed to transform cells. To gain insights into protein interactions that influence cell transformation by the Rel TADs, we identified factors that interact with the TAD of v-Rel, the most oncogenic member of the Rel/NF-kappaB family. We report that the coactivator for transcription factors AP-1 and estrogen receptors, CAPERalpha, interacts with the v-Rel TAD and potently synergizes v-Rel-mediated transactivation. Importantly, coexpression of CAPERalpha markedly reduced and delayed v-Rel's transforming activity in primary lymphocytes, whereas a dominant-negative mutant enhanced the kinetics of v-Rel-mediated transformation. Furthermore, small interfering RNA-mediated knockdown of CAPERalpha in v-Rel-transformed lymphocytes significantly enhanced colony formation in soft agar. Since the potency of Rel-mediated transactivation is an important determinant of lymphocyte transformation, as is Rel's ability to induce transcriptional repression, these data suggest that CAPERalpha's interaction with the Rel TAD could modulate Rel/NF-kappaB's transforming activity by facilitating expression or dampening repression of specific gene subsets important for oncogenesis. Overall, this study identifies CAPERalpha as a new transcriptional coregulator for v-Rel and reveals an important role in modulating Rel's oncogenic activity.
CRISPR/Cas9-mediated knockout of c-REL in HeLa cells results in profound defects of the cell cycle
Ruiz-Perera, Lucia M.; Kadhim, Hussamadin M.; Tertel, Tobias; Henkel, Elena; Hübner, Wolfgang; Huser, Thomas; Kaltschmidt, Barbara; Kaltschmidt, Christian
2017-01-01
Cervical cancer is the fourth common cancer in women resulting worldwide in 266,000 deaths per year. Belonging to the carcinomas, new insights into cervical cancer biology may also have great implications for finding new treatment strategies for other kinds of epithelial cancers. Although the transcription factor NF-κB is known as a key player in tumor formation, the relevance of its particular subunits is still underestimated. Here, we applied CRISPR/Cas9n-mediated genome editing to successfully knockout the NF-κB subunit c-REL in HeLa Kyoto cells as a model system for cervical cancers. We successfully generated a homozygous deletion in the c-REL gene, which we validated using sequencing, qPCR, immunocytochemistry, western blot analysis, EMSA and analysis of off-target effects. On the functional level, we observed the deletion of c-REL to result in a significantly decreased cell proliferation in comparison to wildtype (wt) without affecting apoptosis. The impaired proliferative behavior of c-REL-/- cells was accompanied by a strongly decreased amount of the H2B protein as well as a significant delay in the prometaphase of mitosis compared to c-REL+/+ HeLa Kyoto cells. c-REL-/- cells further showed significantly decreased expression levels of c-REL target genes in comparison to wt. In accordance to our proliferation data, we observed the c-REL knockout to result in a significantly increased resistance against the chemotherapeutic agents 5-Fluoro-2’-deoxyuridine (5-FUDR) and cisplatin. In summary, our findings emphasize the importance of c-REL signaling in a cellular model of cervical cancer with direct clinical implications for the development of new treatment strategies. PMID:28767691
IRF-4 and c-Rel expression in antiviral-resistant adult T-cell leukemia/lymphoma
Ramos, Juan Carlos; Ruiz, Phillip; Ratner, Lee; Reis, Isildinha M.; Brites, Carlos; Pedroso, Celia; Byrne, Gerald E.; Toomey, Ngoc L.; Andela, Valentine; Harhaj, Edward W.; Lossos, Izidore S.; Harrington, William J.
2007-01-01
Adult T-cell leukemia/lymphoma (ATLL) is a generally fatal malignancy. Most ATLL patients fare poorly with conventional chemotherapy; however, antiviral therapy with zidovudine (AZT) and interferon alpha (IFN-α) has produced long-term clinical remissions. We studied primary ATLL tumors and identified molecular features linked to sensitivity and resistance to antiviral therapy. Enhanced expression of the proto-oncogene c-Rel was noted in 9 of 27 tumors. Resistant tumors exhibited c-Rel (6 of 1...
Targeting NF-κB RelA/p65 phosphorylation overcomes RITA resistance.
Bu, Yiwen; Cai, Guoshuai; Shen, Yi; Huang, Chenfei; Zeng, Xi; Cao, Yu; Cai, Chuan; Wang, Yuhong; Huang, Dan; Liao, Duan-Fang; Cao, Deliang
2016-12-28
Inactivation of p53 occurs frequently in various cancers. RITA is a promising anticancer small molecule that dissociates p53-MDM2 interaction, reactivates p53 and induces exclusive apoptosis in cancer cells, but acquired RITA resistance remains a major drawback. This study found that the site-differential phosphorylation of nuclear factor-κB (NF-κB) RelA/p65 creates a barcode for RITA chemosensitivity in cancer cells. In naïve MCF7 and HCT116 cells where RITA triggered vast apoptosis, phosphorylation of RelA/p65 increased at Ser536, but decreased at Ser276 and Ser468; oppositely, in RITA-resistant cells, RelA/p65 phosphorylation decreased at Ser536, but increased at Ser276 and Ser468. A phosphomimetic mutation at Ser536 (p65/S536D) or silencing of endogenous RelA/p65 resensitized the RITA-resistant cells to RITA while the phosphomimetic mutant at Ser276 (p65/S276D) led to RITA resistance of naïve cells. In mouse xenografts, intratumoral delivery of the phosphomimetic p65/S536D mutant increased the antitumor activity of RITA. Furthermore, in the RITA-resistant cells ATP-binding cassette transporter ABCC6 was upregulated, and silencing of ABCC6 expression in these cells restored RITA sensitivity. In the naïve cells, ABCC6 delivery led to RITA resistance and blockage of p65/S536D mutant-induced RITA sensitivity. Taken together, these data suggest that the site-differential phosphorylation of RelA/p65 modulates RITA sensitivity in cancer cells, which may provide an avenue to manipulate RITA resistance. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Liang, Mei-Chih; Bardhan, Sujata; Porco, John A; Gilmore, Thomas D
2006-09-08
The NF-kappaB transcription factor signaling pathway is constitutively active in many human cancers, and inhibition of this pathway can often kill cancer cells by inducing apoptosis. In this study, we show that two synthetic epoxyquinoids, jesterone dimer (JD) and epoxyquinone A monomer (EqM), are equally effective at inhibiting the growth of two human lymphoma cell lines that have constitutively nuclear REL (human c-Rel) DNA-binding complexes, but either express (SUDHL-4 cells) or do not express (RC-K8 cells) the NF-kappaB inhibitor IkappaBalpha. Furthermore, in these cells, both JD and EqM dose-dependently induced apoptosis, inhibited REL DNA-binding activity, and converted REL to a high molecular weight form. In A293 cells, JD and EqM inhibited the DNA-binding activity of overexpressed REL, but not p50. Replacement of Cys-27 with Ser in REL reduced JD- and EqM-mediated inhibition of REL DNA-binding activity. These results suggest that JD and EqM can induce apoptosis in IkappaBalpha-deficient lymphoma cells through a mechanism involving direct inhibition of transcription factor REL.
Chapman, Neil R; Webster, Gill A; Gillespie, Peter J; Wilson, Brian J; Crouch, Dorothy H; Perkins, Neil D
2002-01-01
Members of both Myc and nuclear factor kappaB (NF-kappaB) families of transcription factors are found overexpressed or inappropriately activated in many forms of human cancer. Furthermore, NF-kappaB can induce c-Myc gene expression, suggesting that the activities of these factors are functionally linked. We have discovered that both c-Myc and v-Myc can induce a previously undescribed, truncated form of the RelA(p65) NF-kappaB subunit, RelA(p37). RelA(p37) encodes the N-terminal DNA binding and dimerization domain of RelA(p65) and would be expected to function as a trans-dominant negative inhibitor of NF-kappaB. Surprisingly, we found that RelA(p37) no longer binds to kappaB elements. This result is explained, however, by the observation that RelA(p37), but not RelA(p65), forms a high-molecular-mass complex with c-Myc. These results demonstrate a previously unknown functional and physical interaction between RelA and c-Myc with many significant implications for our understanding of the role that both proteins play in the molecular events underlying tumourigenesis. PMID:12027803
DEFF Research Database (Denmark)
Cherny, Izhack; Overgaard, Martin; Borch, Jonas
2007-01-01
on the folding and stability of the protein pair in solution. Here we structurally and thermodynamically characterize the RelBE system components from E. coli in solution, both separately and in their complexed state. The RelB antitoxin, an alpha-helical protein according to circular dichroism and infrared.......5 degrees C, and exhibits exceptional sensitivity to heat. Complex formation, accompanied by a structural transition, leads to a 12 degrees C increase in the TM and substantial heat resistance. Moreover, in vivo interaction and protein footprint experiments indicate that the C-terminal part of Rel...
DEFF Research Database (Denmark)
Overgaard, Martin; Borch, Jonas; Gerdes, Kenn
2009-01-01
RelB, the Ribbon-Helix-Helix (RHH) repressor encoded by the relBE toxin-antitoxin locus of Escherichia coli, forms a tight complex with RelE and thereby counteracts the mRNA cleavage activity of RelE. In addition, RelB dimers repress the strong relBE promoter and this repression by RelB is enhanced...... by RelE - that is - RelE functions as a transcriptional co-repressor. RelB is a Lon protease substrate and Lon is required both for activation of relBE transcription and for activation of the mRNA cleavage activity of RelE. Here we characterize the molecular interactions important for transcriptional...... motif recognizes four 6 bp repeats within the bipartite binding site. The spacing between each half-site was found to be essential for cooperative interactions between adjacently bound RelB dimers stabilized by the co-repressor RelE. Kinetic and stoichiometric measurements of the interaction between Rel...
Structural studies of the toxin-antitoxin proteins RelE and RelB from E. coli
DEFF Research Database (Denmark)
Andersen, Kasper Røjkjær; Overgaard, Martin; Gerdes, Kenn
the special tRNA-mRNA mimic, tmRNA [1]. Questions to be addressed Many questions remain to be answered in the bacterial toxin-antitoxin system. The crystal structure of RelBE from Pyrococcus horikoshii OT3 was previously solved at 2.3Å [2]. This structure shows the molecule in an inactive state, but OT3......The bacterial toxin-antitoxin system The relBE operon in E. coli encodes two small proteins: A toxin, RelE (12 kDa) and an antitoxin, RelB (9 kDa). RelE is activated under nutritional stress and is able to inhibit protein synthesis by cleaving the mRNA in the ribosomal A-site. This stress response...... serves to down-regulate metabolism in the cell when growth conditions are limited. RelB is expressed in excess over RelE during balanced growth, and inhibits the toxicity of RelE by forming an extremely stable toxin-antitoxin complex. The activation of RelE is induced when the labile RelB protein...
Messenger RNA Interferase RelE Controls relBE Transcription by Conditional Cooperativity
DEFF Research Database (Denmark)
Overgaard, Martin; Borch, Jonas; Jørgensen, Mikkel G
2008-01-01
Prokaryotic toxin-antitoxin (TA) loci consist of two genes in an operon that encodes a metabolically stable toxin and an unstable antitoxin. The antitoxin neutralises its cognate toxin by forming a tight complex with it. In all cases known, the antitoxin autoregulates TA operon transcription by b...... operator DNA. A mutational analysis of the operator-sites showed that RelE in excess counteracted cooperative binding of the RelB(2)*RelE complexes to the operator-sites. Thus, RelE controls relBE transcription by conditional cooperativity.......Prokaryotic toxin-antitoxin (TA) loci consist of two genes in an operon that encodes a metabolically stable toxin and an unstable antitoxin. The antitoxin neutralises its cognate toxin by forming a tight complex with it. In all cases known, the antitoxin autoregulates TA operon transcription...... by binding to one or more operators in the promoter region while the toxin functions as a co-repressor of transcription. Interestingly, the toxin can also stimulate TA operon transcription. Here we analyse mechanistic aspects of how RelE of Escherichia coli can function both as a co-repressor and derepressor...
DEFF Research Database (Denmark)
Worm, Jesper; Stenvang, Jan; Petri, Andreas
2009-01-01
microRNA-155 (miR-155) has been implicated as a central regulator of the immune system, but its function during acute inflammatory responses is still poorly understood. Here we show that exposure of cultured macrophages and mice to lipopolysaccharide (LPS) leads to up-regulation of miR-155......-stimulating factor (G-CSF), a central regulator of granulopoiesis during inflammatory responses. Consistent with these data, we show that silencing of miR-155 in LPS-treated mice by systemically administered LNA-antimiR results in derepression of the c/ebp Beta isoforms and down-regulation of G-CSF expression...
Tagalakis, Aristides D; Munye, Mustafa M; Ivanova, Rositsa; Chen, Hanpeng; Smith, Claire M; Aldossary, Ahmad M; Rosa, Luca Z; Moulding, Dale; Barnes, Josephine L; Kafetzis, Konstantinos N; Jones, Stuart A; Baines, Deborah L; Moss, Guy W J; O'Callaghan, Christopher; McAnulty, Robin J; Hart, Stephen L
2018-05-10
Loss of the cystic fibrosis transmembrane conductance regulator in cystic fibrosis (CF) leads to hyperabsorption of sodium and fluid from the airway due to upregulation of the epithelial sodium channel (ENaC). Thickened mucus and depleted airway surface liquid (ASL) then lead to impaired mucociliary clearance. ENaC regulation is thus a promising target for CF therapy. Our aim was to develop siRNA nanocomplexes that mediate effective silencing of airway epithelial ENaC in vitro and in vivo with functional correction of epithelial ion and fluid transport. We investigated translocation of nanocomplexes through mucus and their transfection efficiency in primary CF epithelial cells grown at air-liquid interface (ALI).Short interfering RNA (SiRNA)-mediated silencing was examined by quantitative RT-PCR and western analysis of ENaC. Transepithelial potential (V t ), short circuit current (I sc ), ASL depth and ciliary beat frequency (CBF) were measured for functional analysis. Inflammation was analysed by histological analysis of normal mouse lung tissue sections. Nanocomplexes translocated more rapidly than siRNA alone through mucus. Transfections of primary CF epithelial cells with nanocomplexes targeting αENaC siRNA, reduced αENaC and βENaC mRNA by 30%. Transfections reduced V t , the amiloride-sensitive I sc and mucus protein concentration while increasing ASL depth and CBF to normal levels. A single dose of siRNA in mouse lung silenced ENaC by approximately 30%, which persisted for at least 7 days. Three doses of siRNA increased silencing to approximately 50%. Nanoparticle-mediated delivery of ENaCsiRNA to ALI cultures corrected aspects of the mucociliary defect in human CF cells and offers effective delivery and silencing in vivo. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.
Silencing, positive selection and parallel evolution: busy history of primate cytochromes C.
Pierron, Denis; Opazo, Juan C; Heiske, Margit; Papper, Zack; Uddin, Monica; Chand, Gopi; Wildman, Derek E; Romero, Roberto; Goodman, Morris; Grossman, Lawrence I
2011-01-01
Cytochrome c (cyt c) participates in two crucial cellular processes, energy production and apoptosis, and unsurprisingly is a highly conserved protein. However, previous studies have reported for the primate lineage (i) loss of the paralogous testis isoform, (ii) an acceleration and then a deceleration of the amino acid replacement rate of the cyt c somatic isoform, and (iii) atypical biochemical behavior of human cyt c. To gain insight into the cause of these major evolutionary events, we have retraced the history of cyt c loci among primates. For testis cyt c, all primate sequences examined carry the same nonsense mutation, which suggests that silencing occurred before the primates diversified. For somatic cyt c, maximum parsimony, maximum likelihood, and Bayesian phylogenetic analyses yielded the same tree topology. The evolutionary analyses show that a fast accumulation of non-synonymous mutations (suggesting positive selection) occurred specifically on the anthropoid lineage root and then continued in parallel on the early catarrhini and platyrrhini stems. Analysis of evolutionary changes using the 3D structure suggests they are focused on the respiratory chain rather than on apoptosis or other cyt c functions. In agreement with previous biochemical studies, our results suggest that silencing of the cyt c testis isoform could be linked with the decrease of primate reproduction rate. Finally, the evolution of cyt c in the two sister anthropoid groups leads us to propose that somatic cyt c evolution may be related both to COX evolution and to the convergent brain and body mass enlargement in these two anthropoid clades.
Silencing, positive selection and parallel evolution: busy history of primate cytochromes C.
Directory of Open Access Journals (Sweden)
Denis Pierron
Full Text Available Cytochrome c (cyt c participates in two crucial cellular processes, energy production and apoptosis, and unsurprisingly is a highly conserved protein. However, previous studies have reported for the primate lineage (i loss of the paralogous testis isoform, (ii an acceleration and then a deceleration of the amino acid replacement rate of the cyt c somatic isoform, and (iii atypical biochemical behavior of human cyt c. To gain insight into the cause of these major evolutionary events, we have retraced the history of cyt c loci among primates. For testis cyt c, all primate sequences examined carry the same nonsense mutation, which suggests that silencing occurred before the primates diversified. For somatic cyt c, maximum parsimony, maximum likelihood, and Bayesian phylogenetic analyses yielded the same tree topology. The evolutionary analyses show that a fast accumulation of non-synonymous mutations (suggesting positive selection occurred specifically on the anthropoid lineage root and then continued in parallel on the early catarrhini and platyrrhini stems. Analysis of evolutionary changes using the 3D structure suggests they are focused on the respiratory chain rather than on apoptosis or other cyt c functions. In agreement with previous biochemical studies, our results suggest that silencing of the cyt c testis isoform could be linked with the decrease of primate reproduction rate. Finally, the evolution of cyt c in the two sister anthropoid groups leads us to propose that somatic cyt c evolution may be related both to COX evolution and to the convergent brain and body mass enlargement in these two anthropoid clades.
Regional Educational Laboratory Pacific, 2014
2014-01-01
REL Pacific at McREL, one of 10 Regional Educational Laboratories (RELs) funded by the Institute of Education Sciences (IES), serves educators in American Samoa, the Commonwealth of the Northern Mariana Islands, the Federated States of Micronesia (Chuuk, Kosrae, Pohnpei, and Yap), Guam, Hawai'i, the Republic of the Marshall Islands, and the…
Optical silencing of C. elegans cells with arch proton pump.
Directory of Open Access Journals (Sweden)
Ayako Okazaki
Full Text Available BACKGROUND: Optogenetic techniques using light-driven ion channels or ion pumps for controlling excitable cells have greatly facilitated the investigation of nervous systems in vivo. A model organism, C. elegans, with its small transparent body and well-characterized neural circuits, is especially suitable for optogenetic analyses. METHODOLOGY/PRINCIPAL FINDINGS: We describe the application of archaerhodopsin-3 (Arch, a recently reported optical neuronal silencer, to C. elegans. Arch::GFP expressed either in all neurons or body wall muscles of the entire body by means of transgenes were localized, at least partially, to the cell membrane without adverse effects, and caused locomotory paralysis of worms when illuminated by green light (550 nm. Pan-neuronal expression of Arch endowed worms with quick and sustained responsiveness to such light. Worms reliably responded to repeated periods of illumination and non-illumination, and remained paralyzed under continuous illumination for 30 seconds. Worms expressing Arch in different subsets of motor neurons exhibited distinct defects in the locomotory behavior under green light: selective silencing of A-type motor neurons affected backward movement while silencing of B-type motor neurons affected forward movement more severely. Our experiments using a heat-shock-mediated induction system also indicate that Arch becomes fully functional only 12 hours after induction and remains functional for more than 24 hour. CONCLUSIONS/SGNIFICANCE: Arch can be used for silencing neurons and muscles, and may be a useful alternative to currently widely used halorhodopsin (NpHR in optogenetic studies of C. elegans.
Regional Educational Laboratory Pacific, 2013
2013-01-01
REL Pacific at McREL, 1 of 10 Regional Educational Laboratories (RELs) funded by the Institute of Education Sciences (IES), serves educators in American Samoa, the Commonwealth of the Northern Mariana Islands, the Federated States of Micronesia (Chuuk, Kosrae, Pohnpei, and Yap), Guam, Hawai'i, the Republic of the Marshall Islands, and the Republic…
Regional Educational Laboratory Pacific, 2014
2014-01-01
REL Pacific at McREL, one of 10 Regional Educational Laboratories (RELs) funded by the U.S. Department of Education's Institute of Education Sciences (IES), serves educators in American Samoa, the Commonwealth of the Northern Mariana Islands, the Federated States of Micronesia (Chuuk, Kosrae, Pohnpei, and Yap), Guam, Hawai'i, the Republic of the…
Shen, Mo; Zhou, Lianlian; Zhou, Ping; Zhou, Wu; Lin, Xiangyang
2017-07-01
The role of inflammation in tumorigenesis and development is currently well established. Lymphotoxin β receptor (LTβR) activation induces canonical and noncanonical nuclear factor (NF)‑κB signaling pathways, which are linked to inflammation‑induced carcinogenesis. In the present study, 5,637 bladder cancer cells were cultured and the activation of LTβR was induced by functional ligand, lymphotoxin (LT) α1β2, and silencing with shRNA. Reverse transcription‑quantitative polymerase chain reaction was utilized to detect the mRNA expression levels of NF‑κB family members RelA and RelB, cytokines including LTα, LTβ, tumor necrosis factor (TNF)α, TNF superfamily member 14, interleukin (IL)‑6 and IL‑1β, and proliferation‑related genes including CyclinD1 and Survivin. The expression of phospho‑p65 was determined by western blotting. Activation of LTβR on bladder cancer 5,637 cells was demonstrated to upregulate the mRNA expression levels of the RELA proto‑oncogene, RelA, by 2.5‑fold compared with unstimulated cells, while no significant change was observed in the RELB proto‑oncogene NF‑κB member mRNA levels. Expression of pro‑inflammatory cytokines tumor necrosis factor (TNF)α and interleukin (IL)‑1β mRNA levels were significantly increased nearly 5‑fold and 1.5‑fold, respectively, following LTβR activation compared with unstimulated cells. The LTβR‑induced upregulation of RelA, TNFα and IL‑1β was decreased by ~33, 27, and 26% respectively when LTβR was silenced via short hairpin RNA. Activation of LTβR had no effect on 5,637 cell growth, despite CyclinD1 and Survivin mRNA levels increasing by ~2.7 and 1.3‑fold, respectively, compared with unstimulated cells. In conclusion, activation of LTβR induced the expression of RelA mRNA levels. LTβR activation might be an important mediator in promoting an inflammatory microenvironment in bladder cancer, via the upregulation of TNFα and IL‑1β mRNA levels. LTβR may
Tanaka, H; Sagisaka, A; Suzuki, N; Yamakawa, M
2016-10-01
E26 transformation-specific (Ets) family transcription factors are known to play roles in various biological phenomena, including immunity, in vertebrates. However, the mechanisms by which Ets proteins contribute to immunity in invertebrates remain poorly understood. In this study, we identified a cDNA encoding BmEts2, which is a putative orthologue of Drosophila Yan and human translocation-ets-leukemia/Ets-variant gene 6, from the silkworm Bombyx mori. Expression of the BmEts2 gene was significantly increased in the fat bodies of silkworm larvae in response to injection with Escherichia coli and Staphylococcus aureus. BmEts2 overexpression dramatically repressed B. mori Rels (BmRels)-mediated promoter activation of antimicrobial peptide genes in silkworm cells. Conversely, gene knockdown of BmEts2 significantly enhanced BmRels activity. In addition, two κB sites located on the 5' upstream region of cecropin B1 were found to be involved in the repression of BmRels-mediated promoter activation. Protein-competition analysis further demonstrated that BmEts2 competitively inhibited binding of BmRels to κB sites. Overall, BmEts2 acts as a repressor of BmRels-mediated transactivation of antimicrobial protein genes by inhibiting the binding of BmRels to κB sites. © 2016 The Royal Entomological Society.
Millenson, Michael L
2003-01-01
Despite several well-crafted Institute of Medicine (IOM) reports, there remains within health care a persistent refusal to confront providers' responsibility for severe quality problems. There is a silence of deed--failing to take corrective actions--and of word--failing to discuss openly the true consequences of that inertia. These silences distort public policy, delay change, and, by leading (albeit inadvertently) to thousands of patient deaths, undermine professionalism. The IOM quality committee, to retain its moral authority, should forgo issuing more reports and instead lead an emergency corrective-action campaign comparable to Flexner's crusade against charlatan medical schools.
Agarwal, Aditya Vikram; Singh, Deeksha; Dhar, Yogeshwar Vikram; Michael, Rahul; Gupta, Parul; Chandra, Deepak; Trivedi, Prabodh Kumar
2018-02-01
Withanolides are a collection of naturally occurring, pharmacologically active, secondary metabolites synthesized in the medicinally important plant, Withania somnifera. These bioactive molecules are C28-steroidal lactone triterpenoids and their synthesis is proposed to take place via the mevalonate (MVA) and 2-C-methyl-d-erythritol-4-phosphate (MEP) pathways through the sterol pathway using 24-methylene cholesterol as substrate flux. Although the phytochemical profiles as well as pharmaceutical activities of Withania extracts have been well studied, limited genomic information and difficult genetic transformation have been a major bottleneck towards understanding the participation of specific genes in withanolide biosynthesis. In this study, we used the Tobacco rattle virus (TRV)-mediated virus-induced gene silencing (VIGS) approach to study the participation of key genes from MVA, MEP and triterpenoid biosynthesis for their involvement in withanolide biosynthesis. TRV-infected W. somnifera plants displayed unique phenotypic characteristics and differential accumulation of total Chl as well as carotenoid content for each silenced gene suggesting a reduction in overall isoprenoid synthesis. Comprehensive expression analysis of putative genes of withanolide biosynthesis revealed transcriptional modulations conferring the presence of complex regulatory mechanisms leading to withanolide biosynthesis. In addition, silencing of genes exhibited modulated total and specific withanolide accumulation at different levels as compared with control plants. Comparative analysis also suggests a major role for the MVA pathway as compared with the MEP pathway in providing substrate flux for withanolide biosynthesis. These results demonstrate that transcriptional regulation of selected Withania genes of the triterpenoid biosynthetic pathway critically affects withanolide biosynthesis, providing new horizons to explore this process further, in planta.
Seth, Meetu; Shirayama, Masaki; Gu, Weifeng; Ishidate, Takao; Conte, Darryl; Mello, Craig C
2013-12-23
Organisms can develop adaptive sequence-specific immunity by reexpressing pathogen-specific small RNAs that guide gene silencing. For example, the C. elegans PIWI-Argonaute/piwi-interacting RNA (piRNA) pathway recruits RNA-dependent RNA polymerase (RdRP) to foreign sequences to amplify a transgenerational small-RNA-induced epigenetic silencing signal (termed RNAe). Here, we provide evidence that, in addition to an adaptive memory of silenced sequences, C. elegans can also develop an opposing adaptive memory of expressed/self-mRNAs. We refer to this mechanism, which can prevent or reverse RNAe, as RNA-induced epigenetic gene activation (RNAa). We show that CSR-1, which engages RdRP-amplified small RNAs complementary to germline-expressed mRNAs, is required for RNAa. We show that a transgene with RNAa activity also exhibits accumulation of cognate CSR-1 small RNAs. Our findings suggest that C. elegans adaptively acquires and maintains a transgenerational CSR-1 memory that recognizes and protects self-mRNAs, allowing piRNAs to recognize foreign sequences innately, without the need for prior exposure
Ishii, Tetsuro; Warabi, Eiji; Mann, Giovanni E
2018-05-01
Circadian clock genes regulate energy metabolism partly through neurotrophins in the body. The low affinity neurotrophin receptor p75 NTR is a clock component directly regulated by the transcriptional factor Clock:Bmal1 complex. Brain-derived neurotrophic factor (BDNF) is expressed in the brain and plays a key role in coordinating metabolic interactions between neurons and astrocytes. BDNF transduces signals through TrkB and p75 NTR receptors. This review highlights a novel molecular mechanism by which BDNF via circadian control of p75 NTR leads to daily resetting of glucose and glycogen metabolism in brain astrocytes to accommodate their functional interaction with neurons. Astrocytes store glycogen as an energy reservoir to provide active neurons with the glycolytic metabolite lactate. Astrocytes predominantly express the truncated receptor TrkB.T1 which lacks an intracellular receptor tyrosine kinase domain. TrkB.T1 retains the capacity to regulate cell morphology through regulation of Rho GTPases. In contrast, p75 NTR mediates generation of the bioactive lipid ceramide upon stimulation with BDNF and inhibits PKA activation. As ceramide directly activates PKCζ, we discuss the importance of the TrkB.T1-p75 NTR -ceramide-PKCζ signaling axis in the stimulation of glycogen and lipid synthesis and activation of RhoA. Ceramide-PKCζ-casein kinase 2 signaling activates Nrf2 to support oxidative phosphorylation via upregulation of antioxidant enzymes. In the absence of p75 NTR , TrkB.T1 functionally interacts with adenosine A 2A R and dopamine D1R receptors to enhance cAMP-PKA signaling and activate Rac1 and NF-κB c-Rel, favoring glycogen hydrolysis, gluconeogenesis and aerobic glycolysis. Thus, diurnal changes in p75 NTR levels in astrocytes resets energy metabolism via BDNF to accommodate their metabolic interaction with neurons. Copyright © 2018 Elsevier Inc. All rights reserved.
The role of relA and spoT in Yersinia pestis KIM5 pathogenicity.
Directory of Open Access Journals (Sweden)
Wei Sun
2009-08-01
Full Text Available The ppGpp molecule is part of a highly conserved regulatory system for mediating the growth response to various environmental conditions. This mechanism may represent a common strategy whereby pathogens such as Yersinia pestis, the causative agent of plague, regulate the virulence gene programs required for invasion, survival and persistence within host cells to match the capacity for growth. The products of the relA and spoT genes carry out ppGpp synthesis. To investigate the role of ppGpp on growth, protein synthesis, gene expression and virulence, we constructed a Delta relA Delta spoT Y. pestis mutant. The mutant was no longer able to synthesize ppGpp in response to amino acid or carbon starvation, as expected. We also found that it exhibited several novel phenotypes, including a reduced growth rate and autoaggregation at 26 degrees C. In addition, there was a reduction in the level of secretion of key virulence proteins and the mutant was > 1,000-fold less virulent than its wild-type parent strain. Mice vaccinated subcutaneously (s.c. with 2.5x10(4 CFU of the Delta relA Delta spoT mutant developed high anti-Y. pestis serum IgG titers, were completely protected against s.c. challenge with 1.5x10(5 CFU of virulent Y. pestis and partially protected (60% survival against pulmonary challenge with 2.0x10(4 CFU of virulent Y. pestis. Our results indicate that ppGpp represents an important virulence determinant in Y. pestis and the Delta relA Delta spoT mutant strain is a promising vaccine candidate to provide protection against plague.
Marie Nimier, au cœur du silence
Directory of Open Access Journals (Sweden)
Joëlle Papillon
2012-01-01
Full Text Available Dans La Reine du silence, Marie Nimier se confronte à la figure de son père, l’écrivain Roger Nimier, mort lorsqu’elle avait cinq ans. Elle y montre le poids qui pèse sur l’enfant d’écrivain, mais aussi celui de l’héritage du secret familial et de l’injonction au silence. La difficulté de l’élaboration de son récit de filiation se révèle dans les constants recommencements et reformulations, qui constituent la marque de la tension angoissante entre l’obligation de dire et celle de taire. In La Reine du silence, Marie Nimier confronts her father’s memory – the writer Roger Nimier, who died when she was five years old. The novel describes the burden of being a writer’s child, along with that of inheriting family secrets and submitting to a code of silence. The difficulty of recounting her relationship with her late father is evidenced by the narrator’s numerous “false starts” and her constant rewritings. The hesitant nature of the narration captures an anguish born of two irreconcilable obligations : the need to put things into words and the pressure to remain silent.
Silence in the Communication or Communicating through Silence: Silence in Psychoanalysis
Directory of Open Access Journals (Sweden)
Rita Marta
2014-10-01
Full Text Available This paper is a reflection upon the meaning and importance of silence in the psychoanalytical relationship. Beginning with the silence in the “normal” relationship between people, we show how silence can be experienced as confortable or unconfortable, and how it can be used to achieve a bigger proximity or distance in the relationship with others. We show these same aspects in the psychoanalytical relationship, and the evolution of the regard towards silence along the development of psychoanalysis. We end, presenting the Nacht’s thinking about silence, who emphasizes its integrative and fundamental role in the psychoanalytical relationship. Thus, only through silence certain affects can be born, and silence allows the patient to internalize the analyst.
Regulation of the activity of the promoter of RNA-induced silencing, C3PO.
Sahu, Shriya; Williams, Leo; Perez, Alberto; Philip, Finly; Caso, Giuseppe; Zurawsky, Walter; Scarlata, Suzanne
2017-09-01
RNA-induced silencing is a process which allows cells to regulate the synthesis of specific proteins. RNA silencing is promoted by the protein C3PO (component 3 of RISC). We have previously found that phospholipase Cβ, which increases intracellular calcium levels in response to specific G protein signals, inhibits C3PO activity towards certain genes. Understanding the parameters that control C3PO activity and which genes are impacted by G protein activation would help predict which genes are more vulnerable to downregulation. Here, using a library of 10 18 oligonucleotides, we show that C3PO binds oligonucleotides with structural specificity but little sequence specificity. Alternately, C3PO hydrolyzes oligonucleotides with a rate that is sensitive to substrate stability. Importantly, we find that oligonucleotides with higher Tm values are inhibited by bound PLCβ. This finding is supported by microarray analysis in cells over-expressing PLCβ1. Taken together, this study allows predictions of the genes whose post-transcriptional regulation is responsive to the G protein/phospholipase Cβ/calcium signaling pathway. © 2017 The Protein Society.
Ombuds’ corner: Employee silence
Vincent Vuillemin
2013-01-01
Although around a hundred cases a year are reported to the Ombuds, several issues may still not be disclosed due to employee silence*. The deliberate withholding of concerns, escalating misunderstandings or genuine conflicts can impede the global process of learning and development of a better respectful organizational workplace environment, and prevent the detection and correction of acts violating the CERN Code of Conduct. For the employee him/herself, such silence can lead to feelings of anger, resentment, helplessness and humiliation. These feelings will inevitably contaminate personal and interpersonal relations, and poison creativity and effectiveness. Employee silence can be explained by many factors; sometimes it is connected to organizational forces. In their published paper*, authors Michael Knoll and Rolf van Dick found four forms of employee silence. People may stay silent if they feel that their opinion is neither welcomed nor valued by their management. They have gi...
Directory of Open Access Journals (Sweden)
Luciano Marcondes Godoy
1999-01-01
Full Text Available Muitas são as vivências que se expressarão em SILÊNCIOS. Muitos são os silêncios. No Bloco A, o silêncio denuncia a retirada para um outro mundo, a queda num abismo. No bloco B, o silêncio é controlador, exigindo a fala do analista, um jogo em que o que é falado não tem a menor importância. Surge ainda como expressão da necessidade de discriminar-se do analista e, na sua evolução, como um enfrentamento a um estado sem sentido. No Bloco C, o silêncio é agressivo, e a sobrevivência do analisando e analista ao mesmo criará um espaço que propiciará sonhos que surgirão no Bloco D. Esses momentos de silêncio-sonho são situações em que não há discriminação eu-não eu.Many are the experiences which are expressed through silences. Many are the silences. In Block A, silence denounces a pretreatment to another world, a fall into an abysm. In Block B, silence is a controlling factor, demanding the words of the analyst, a game where what is said does not have any importance what so ever. It emerges also as an expression of the analyst's necessity to discriminate himself, and within his evolution the revision of a senseless state. In Block C, the silence is aggressive. As a response, the survival of the patient and of the analyst will create a place in which dreams will come up. Block D analyses these moments of dream-silence situations, where there aren't any forms of self-non self discrimination.
Rel/Nuclear factor-kappa B apoptosis pathways in human cervical cancer cells
Shehata, Marlene F
2005-01-01
Cervical cancer is considered a common yet preventable cause of death in women. It has been estimated that about 420 women out of the 1400 women diagnosed with cervical cancer will die during 5 years from diagnosis. This review addresses the pathogenesis of cervical cancer in humans with a special emphasis on the human papilloma virus as a predominant cause of cervical cancer in humans. The current understanding of apoptosis and regulators of apoptosis as well as their implication in carcinogenesis will follow. A special focus will be given to the role of Rel/NF-κB family of genes in the growth and chemotherapeutic treatment of the malignant HeLa cervical cells emphasizing on Xrel3, a cRel homologue. PMID:15857509
Calcium signalling silencing in atrial fibrillation.
Greiser, Maura
2017-06-15
Subcellular calcium signalling silencing is a novel and distinct cellular and molecular adaptive response to rapid cardiac activation. Calcium signalling silencing develops during short-term sustained rapid atrial activation as seen clinically during paroxysmal atrial fibrillation (AF). It is the first 'anti-arrhythmic' adaptive response in the setting of AF and appears to counteract the maladaptive changes that lead to intracellular Ca 2+ signalling instability and Ca 2+ -based arrhythmogenicity. Calcium signalling silencing results in a failed propagation of the [Ca 2+ ] i signal to the myocyte centre both in patients with AF and in a rabbit model. This adaptive mechanism leads to a substantial reduction in the expression levels of calcium release channels (ryanodine receptors, RyR2) in the sarcoplasmic reticulum, and the frequency of Ca 2+ sparks and arrhythmogenic Ca 2+ waves remains low. Less Ca 2+ release per [Ca 2+ ] i transient, increased fast Ca 2+ buffering strength, shortened action potentials and reduced L-type Ca 2+ current contribute to a substantial reduction of intracellular [Na + ]. These features of Ca 2+ signalling silencing are distinct and in contrast to the changes attributed to Ca 2+ -based arrhythmogenicity. Some features of Ca 2+ signalling silencing prevail in human AF suggesting that the Ca 2+ signalling 'phenotype' in AF is a sum of Ca 2+ stabilizing (Ca 2+ signalling silencing) and Ca 2+ destabilizing (arrhythmogenic unstable Ca 2+ signalling) factors. Calcium signalling silencing is a part of the mechanisms that contribute to the natural progression of AF and may limit the role of Ca 2+ -based arrhythmogenicity after the onset of AF. © 2017 The Authors. The Journal of Physiology © 2017 The Physiological Society.
Zalewski, Wojciech; Orczyk, Wacław; Gasparis, Sebastian; Nadolska-Orczyk, Anna
2012-11-07
CKX genes encode cytokinin dehydrogenase enzymes (CKX), which metabolize cytokinins in plants and influence developmental processes. The genes are expressed in different tissues and organs during development; however, their exact role in barley is poorly understood. It has already been proven that RNA interference (RNAi)-based silencing of HvCKX1 decreased the CKX level, especially in those organs which showed the highest expression, i.e. developing kernels and roots, leading to higher plant productivity and higher mass of the roots [1]. The same type of RNAi construct was applied to silence HvCKX2 and analyze the function of the gene. Two cultivars of barley were transformed with the same silencing and selection cassettes by two different methods: biolistic and via Agrobacterium. The mean Agrobacterium-mediated transformation efficiency of Golden Promise was 3.47% (±2.82). The transcript level of HvCKX2 in segregating progeny of T(1) lines was decreased to 34%. The reduction of the transcript in Agrobacterium-derived plants resulted in decreased CKX activity in the developing and developed leaves as well as in 7 DAP (days after pollination) spikes. The final phenotypic effect was increased productivity of T(0) plants and T(1) lines. Higher productivity was the result of the higher number of seeds and higher grain yield. It was also correlated with the higher 1000 grain weight, increased (by 7.5%) height of the plants and higher (from 0.5 to 2) numbers of spikes. The transformation efficiency of Golden Promise after biolistic transformation was more than twice as low compared to Agrobacterium. The transcript level in segregating progeny of T(1) lines was decreased to 24%. Otherwise, the enzyme activity found in the leaves of the lines after biolistic transformation, especially in cv. Golden Promise, was very high, exceeding the relative level of the control lines. These unbalanced ratios of the transcript level and the activity of the CKX enzyme negatively
Liu, Qian; Wang, Junguo; Miki, Daisuke; Xia, Ran; Yu, Wenxiang; He, Junna; Zheng, Zhimin; Zhu, Jian-Kang; Gonga, Zhizhong
2010-01-01
Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.
Liu, Qian
2010-07-01
Genetic screening identified a suppressor of ros1-1, a mutant of REPRESSOR OF SILENCING1 (ROS1; encoding a DNA demethylation protein). The suppressor is a mutation in the gene encoding the largest subunit of replication factor C (RFC1). This mutation of RFC1 reactivates the unlinked 35S-NPTII transgene, which is silenced in ros1 and also increases expression of the pericentromeric Athila retrotransposons named transcriptional silent information in a DNA methylationindependent manner. rfc1 is more sensitive than the wild type to the DNA-damaging agent methylmethane sulphonate and to the DNA inter- and intra- cross-linking agent cisplatin. The rfc1 mutant constitutively expresses the G2/M-specific cyclin CycB1;1 and other DNA repair-related genes. Treatment with DNA-damaging agents mimics the rfc1 mutation in releasing the silenced 35S-NPTII, suggesting that spontaneously induced genomic instability caused by the rfc1 mutation might partially contribute to the released transcriptional gene silencing (TGS). The frequency of somatic homologous recombination is significantly increased in the rfc1 mutant. Interestingly, ros1 mutants show increased telomere length, but rfc1 mutants show decreased telomere length and reduced expression of telomerase. Our results suggest that RFC1 helps mediate genomic stability and TGS in Arabidopsis thaliana. © 2010 American Society of Plant Biologists.
Two classes of silencing RNAs move between C. elegans tissues
Jose, Antony M; Garcia, Giancarlo A; Hunter, Craig P
2011-01-01
Summary Organism-wide RNA interference (RNAi) is due to the transport of mobile silencing RNA throughout the organism but the identities of these mobile RNA species in animals are unknown. Here we present genetic evidence that both the initial double-stranded RNA (dsRNA), which triggers RNAi, and at least one dsRNA intermediate produced during RNAi can act as or generate mobile silencing RNA in Caenorhabditis elegans. This dsRNA intermediate requires the long dsRNA-binding protein RDE-4, the endonuclease DCR-1, which cleaves long dsRNA into double-stranded short-interfering RNA (ds-siRNA), and the putative nucleotidyltransferase MUT-2 (RDE-3). However, single-stranded siRNA and downstream secondary siRNA produced upon amplification by the RNA-dependent RNA Polymerase RRF-1 do not generate mobile silencing RNA. Restricting inter-tissue transport to long dsRNA and directly processed siRNA intermediates rather than amplified siRNA may serve to modulate the extent of systemic silencing in proportion to available dsRNA. PMID:21984186
International Nuclear Information System (INIS)
Blaise, Patrick; Vidal, Jean-Francois; Santamarina, Alain
2009-01-01
This paper details the validation of Gd-poisoned 17x17 PWR lattices, through several configurations of the CAMELEON experimental program, by using the newly qualified REL2005 French code package. After a general presentation of the CAMELEON program that took place in the EOLE critical Facility in Cadarache, one describes the new REL2005 code package relying on the deterministic transport code APOLLO2.8 based on characteristics method (MOC), and its new CEA2005 library based on the latest JEFF-3.1.1 nuclear data evaluation. For critical masses, the average Calculation-to-Experiment C/E's on the k eff are (136 ± 80) pcm and (300 ± 76) pcm for the reference 281 groups MOC and optimized 26 groups MOC schemes respectively. These values include also a drastic improvement of about 250 pcm due to the change in the library from JEF2.2 to JEFF3.1. For pin-by-pin radial power distributions, reference and REL2005 results are very close, with maximum discrepancies of the order of 2%, i.e., in the experimental uncertainty limits. The Optimized REL2005 code package allows to predict the reactivity worth of the Gd-clusters (averaged on 9 experimental configurations) to be C/E Δρ(Gd clusters) = +1.3% ± 2.3%. (author)
Directory of Open Access Journals (Sweden)
Anja Döhler
2017-06-01
Full Text Available Thymus-derived natural Foxp3+ CD4+ regulatory T cells (nTregs play a key role in maintaining immune tolerance and preventing autoimmune disease. Several studies indicate that dendritic cells (DCs are critically involved in the maintenance and proliferation of nTregs. However, the mechanisms how DCs manage to keep the peripheral pool at constant levels remain poorly understood. Here, we describe that the NF-κB/Rel family transcription factor RelB controls the frequencies of steady-state migratory DCs (ssmDCs in peripheral lymph nodes and their numbers control peripheral nTreg homeostasis. DC-specific RelB depletion was investigated in CD11c-Cre × RelBfl/fl mice (RelBDCko, which showed normal frequencies of resident DCs in lymph nodes and spleen while the subsets of CD103− Langerin− dermal DCs (dDCs and Langerhans cells but not CD103+ Langerin+ dDC of the ssmDCs in skin-draining lymph nodes were increased. Enhanced frequencies and proliferation rates were also observed for nTregs and a small population of CD4+ CD44high CD25low memory-like T cells (Tml. Interestingly, only the Tml but not DCs showed an increase in IL-2-producing capacity in lymph nodes of RelBDCko mice. Blocking of IL-2 in vivo reduced the frequency of nTregs but increased the Tml frequencies, followed by a recovery of nTregs. Taken together, by employing RelBDCko mice with increased frequencies of ssmDCs our data indicate a critical role for specific ssmDC subsets for the peripheral nTreg and IL-2+ Tml frequencies during homeostasis.
DEFF Research Database (Denmark)
Sørensen, M.A.
2001-01-01
Escherichia coli strains mutated in the relA gene lack the ability to produce ppGpp during amino acid starvation. One consequence of this deficiency is a tenfold increase in misincorporation at starved codons compared to the wild-type. Previous work had shown that the charging levels of tRNAs were...... the same in Rel+ and Rel- strains and reduced, at most, two- to fivefold in both strains during starvation. The present reinvestigation of the charging levels of tRNA2Arg, tRNA1Thr, tRNA1Leu and tRNAHis during starvation of isogenic Rel+ and Rel- strains showed that starvation reduced charging levels...... tenfold to 40-fold. This reduction corresponds much better with the decreased rate of protein synthesis during starvation than that reported earlier. The determination of the charging levels of tRNA2Arg and tRNA1Thr during starvation were accurate enough to demonstrate that charging levels were at least...
Structural basis for (p)ppGpp synthesis by thesmall alarmone synthetase RelP
DEFF Research Database (Denmark)
Manav, Melek Cemre; Beljantseva, Jelena; Bojer, Martin S
2018-01-01
Q (SAS1) and RelP (SAS2). InBacillus subtilis, RelQ (SAS1) was shown to form a tetramer that is activated by pppGpp and inhibited by single-stranded RNA, but the structural and functional regulation of RelP (SAS2) is unexplored. Here, we present crystal structures ofS. aureusRelP in two major functional......The stringent response is a global reprogramming of bacterial physiology that renders cells more tolerant to antibiotics and induces virulence gene expression in pathogens in response to stress. This process is driven by accumulation of the intracellular alarmone guanosine-5'-di(tri)phosphate-3...
Ribosome•RelA structures reveal the mechanism of stringent response activation
Loveland, Anna B; Bah, Eugene; Madireddy, Rohini; Zhang, Ying; Brilot, Axel F; Grigorieff, Nikolaus; Korostelev, Andrei A
2016-01-01
Stringent response is a conserved bacterial stress response underlying virulence and antibiotic resistance. RelA/SpoT-homolog proteins synthesize transcriptional modulators (p)ppGpp, allowing bacteria to adapt to stress. RelA is activated during amino-acid starvation, when cognate deacyl-tRNA binds to the ribosomal A (aminoacyl-tRNA) site. We report four cryo-EM structures of E. coli RelA bound to the 70S ribosome, in the absence and presence of deacyl-tRNA accommodating in the 30S A site. The boomerang-shaped RelA with a wingspan of more than 100 Å wraps around the A/R (30S A-site/RelA-bound) tRNA. The CCA end of the A/R tRNA pins the central TGS domain against the 30S subunit, presenting the (p)ppGpp-synthetase domain near the 30S spur. The ribosome and A/R tRNA are captured in three conformations, revealing hitherto elusive states of tRNA engagement with the ribosomal decoding center. Decoding-center rearrangements are coupled with the step-wise 30S-subunit 'closure', providing insights into the dynamics of high-fidelity tRNA decoding. DOI: http://dx.doi.org/10.7554/eLife.17029.001 PMID:27434674
Yeo, Alan T; Chennamadhavuni, Spandan; Whitty, Adrian; Porco, John A; Gilmore, Thomas D
2015-04-23
Increased activity of transcription factor NF-κB has been implicated in many B-cell lymphomas. We investigated effects of synthetic compound calafianin monomer (CM101) on biochemical and biological properties of NF-κB. In human 293 cells, CM101 selectively inhibited DNA binding by overexpressed NF-κB subunits REL (human c-Rel) and p65 as compared to NF-κB p50, and inhibition of REL and p65 DNA binding by CM101 required a conserved cysteine residue. CM101 also inhibited DNA binding by REL in human B-lymphoma cell lines, and the sensitivity of several B-lymphoma cell lines to CM101-induced proliferation arrest and apoptosis correlated with levels of cellular and nuclear REL. CM101 treatment induced both phosphorylation and decreased expression of anti-apoptotic protein Bcl-XL, a REL target gene product, in sensitive B-lymphoma cell lines. Ectopic expression of Bcl-XL protected SUDHL-2 B-lymphoma cells against CM101-induced apoptosis, and overexpression of a transforming mutant of REL decreased the sensitivity of BJAB B-lymphoma cells to CM101-induced apoptosis. Lipopolysaccharide-induced activation of NF-κB signaling upstream components occurred in RAW264.7 macrophages at CM101 concentrations that blocked NF-κB DNA binding. Direct inhibitors of REL may be useful for treating B-cell lymphomas in which REL is active, and may inhibit B-lymphoma cell growth at doses that do not affect some immune-related responses in normal cells.
De Zoysa, Mahanama; Nikapitiya, Chamilani; Oh, Chulhong; Whang, Ilson; Lee, Jae-Seong; Jung, Sung-Ju; Choi, Cheol Young; Lee, Jehee
2010-01-01
The lipopolysaccharide-induced TNF-alpha factor (LITAF) and Rel family nuclear factor kappaB (Rel/NF-kB) are two important transcription factors which play major roles in the regulating inflammatory cytokine, apoptosis and immune related genes. Here, we report the discovery of disk abalone LITAF (AbLITAF) and Rel/NF-kB (AbRel/NF-kB) homologues and their immune responses. Full-length cDNA of AbLITAF consists of 441 bp open reading frame (ORF) that translates into putative peptide of 147 aa. Analysis of AbLITAF sequence showed it has characteristic LITAF (Zn(+2)) binding domain with two CXXC motifs. Phylogenetic analysis results further revealed that AbLITAF is a member of LITAF family. AbRel/NF-kB is 584 aa protein that contains several characteristic motifs including Rel homology domain (RHD), Rel protein signature, DNA binding motif, nuclear localization signal (NLS) and transcription factor immunoglobulin - like fold (TIG) similar to their invertebrate and vertebrate counterparts. Tissue specific analysis results showed that both AbLITAF and AbRel/NF-kB mRNA was expressed ubiquitously in all selected tissues in constitutive manner. However, constitutive expression of AbLITAF was higher than AbRel/NF-kB in all tissues except mantle. Upon immune challenge by bacteria (Vibrio alginolyticus, Vibrio parahemolyticus and Lysteria monocytogenes) and viral hemoragic septicemia virus (VHSV), AbLITAF showed the significant up-regulation in gills while AbRel/NF-kB transcription was not change significantly. Based on transcriptional response against immune challenge, we could suggest that regulation of TNF-alpha expression may have occurred mainly by LITAF activation rather than NF-kB in disk abalone. The cumulative data from other molluscs and our data with reference to TNF-alpha, LITAF and Rel/NF-kB from disk abalone provide strong evidence that LITAF and NF-kB are independent pathways likely to occur throughout the Phylum mollusca. 2010 Elsevier Ltd. All rights reserved.
Protein Cofactors Are Essential for High-Affinity DNA Binding by the Nuclear Factor κB RelA Subunit.
Mulero, Maria Carmen; Shahabi, Shandy; Ko, Myung Soo; Schiffer, Jamie M; Huang, De-Bin; Wang, Vivien Ya-Fan; Amaro, Rommie E; Huxford, Tom; Ghosh, Gourisankar
2018-05-22
Transcription activator proteins typically contain two functional domains: a DNA binding domain (DBD) that binds to DNA with sequence specificity and an activation domain (AD) whose established function is to recruit RNA polymerase. In this report, we show that purified recombinant nuclear factor κB (NF-κB) RelA dimers bind specific κB DNA sites with an affinity significantly lower than that of the same dimers from nuclear extracts of activated cells, suggesting that additional nuclear cofactors might facilitate DNA binding by the RelA dimers. Additionally, recombinant RelA binds DNA with relatively low affinity at a physiological salt concentration in vitro. The addition of p53 or RPS3 (ribosomal protein S3) increases RelA:DNA binding affinity 2- to >50-fold depending on the protein and ionic conditions. These cofactor proteins do not form stable ternary complexes, suggesting that they stabilize the RelA:DNA complex through dynamic interactions. Surprisingly, the RelA-DBD alone fails to bind DNA under the same solution conditions even in the presence of cofactors, suggesting an important role of the RelA-AD in DNA binding. Reduced RelA:DNA binding at a physiological ionic strength suggests that multiple cofactors might be acting simultaneously to mitigate the electrolyte effect and stabilize the RelA:DNA complex in vivo. Overall, our observations suggest that the RelA-AD and multiple cofactor proteins function cooperatively to prime the RelA-DBD and stabilize the RelA:DNA complex in cells. Our study provides a mechanism for nuclear cofactor proteins in NF-κB-dependent gene regulation.
DEFF Research Database (Denmark)
Søndergaard, Katia Dupret
The article highlights the importance of silences in the processes of innovation in organizations, and the claim is that silence and the absence of talk distribute authority, responsibility and decisions. The act of silencing is conceptualised as a central “configurating actor”. Using an Actor......-Network Theoretical approach to organization studies silence is conceptualised as both a means and an effect of innovative efforts. It is a way of ordering practices. Thus silencing is thought of as a central potential change agent both in composing a kind of specific organizational collectivity and in composing new...... working practices more generally. In line with the approach to destabilise the mundane, invisible and taken-for-granted aspects of innovative efforts in organisations (crucial for ANT and foucauldian post-structuralism more broadly), this article suggests to non-silence the silence and make...
Induction of C-Mip by IL-17 Plays an Important Role in Adriamycin-Induced Podocyte Damage
Directory of Open Access Journals (Sweden)
Yanbo Liu
2015-07-01
Full Text Available Background/Aims: Although the disturbance of T lymphocyte and glomerular podocyte exerts a crucial function in the pathogenesis of proteinuria, the potential link is still unclear. Methods: The balance of Treg and Th17 cells, and the expression of IL-17/IL-17R and c-mip were investigated in adrimycin-induced nephropathy (AN mice. The effect and mechanism of IL-17 on podocyte were explored in cultured podocytes. Results: The proportion of Th17 cells in peripheral blood mononuclear cells, the amount of IL-17 in serum and kidney cortical homogenates, and the expression of IL-17R and c-mip in glomerular podocyte were increased obviously in AN mice. In cultured podocytes, recombinant IL-17 led to an induction of apoptosis and cytoskeletal disorganization, an overproduction of c-mip while down-regulation of phosphor-nephrin, and an increased binding of c-mip to NF-κB/RelA. Silence of c-mip prevented podocyte apoptosis and reduction of phosphor-nephrin by prompting nuclear translocation of NF-κB/RelA in IL-17 treated cells. Persistent activation of NF-κB up-regulated pro-survival protein Bcl-2 and decreased podocyte apoptosis, but had no effect on phosphor-nephrin level. Conclusion: These findings demonstrated that induction of IL-17 released by Th17 cells plays a key role in podocytopathy most likely through down-regulation of phosphor-nephrin and Bcl-2 level via overproduction of c-mip.
Contribuições ao estudo de circuitos interruptores com relés polarizados
Jose Carlos Felizatti
1991-01-01
No presente trabalho estudam-se os circuitos interruptores com relés polarizados, enfocando-se quatro tópicos principais, a saber: a tecnologia e os comandos múltiplo, combinatório e seqüencial. Em relação à tecnologia, propõe-se um dispositivo eletromecânico de comando e chaveamento denominado quantor, com características construtiva e operacional superiores aos relés polarizados tradicionais. Os diversos sistemas desenvolvidos utilizando relés polarizados, mostram a extraordinária flexibili...
Optical silencing of C. elegans cells with light-driven proton pumps.
Okazaki, Ayako; Takahashi, Megumi; Toyoda, Naoya; Takagi, Shin
2014-08-01
Recent development of optogenetic techniques, which utilize light-driven ion channels or ion pumps for controlling the activity of excitable cells, has greatly facilitated the investigation of nervous systems in vivo. A new generation of optical silencers includes outward-directed proton pumps, such as Arch, which have several advantages over currently widely used halorhodopsin (NpHR). These advantages include the resistance to inactivation during prolonged illumination and the ability to generate a larger optical current from low intensity light. C. elegans, with its small transparent body and well-characterized neural circuits, is especially suitable for optogenetic analyses. In this article, we will outline the practical aspects of using of Arch and other proton pumps as optogenetic tools in C. elegans. Copyright © 2014 Elsevier Inc. All rights reserved.
Regulation of development and function of different T cell subtypes by Rel/NF-κB family members
International Nuclear Information System (INIS)
Vallabhapurapu, S.
2004-09-01
This study reveals the requirement of distinct members of the Rel/NF-κB family in both hematopoietic and non-hematopoietic cells for the development of thymic NKT cells. Activation of NF-κB via the classical IκBα-regulated pathway is required within the NKT precursors for their efficient maturation from NK1.1 - precursors to mature NK1.1 + NKT cells. The Rel/NF-κB family member RelB, on the other hand, is required in thymic stromal cells for the generation of very early NK1.1 - precursors. NF-κB-inducing kinase (NIK) has also been shown to be required in thymic stromal cells for NKT cell development and this study demonstrates that NIK specifically regulates both constitutive and signal-induced DNA binding of RelB, but not RelA. Moreover, NIK-induced DNA binding of RelB depends on the processing of inhibitory p100 to p52, revealing an alternate pathway of NF-κB induction. Thus, Rel/NF-κB complexes activated by the classical IκBα-regulated pathway in NKT precursors and an alternate NIK/p100/RelB pathway in thymic stromal cells regulate different stages of NKT cell development. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Vallabhapurapu, S.
2004-09-01
This study reveals the requirement of distinct members of the Rel/NF-{kappa}B family in both hematopoietic and non-hematopoietic cells for the development of thymic NKT cells. Activation of NF-{kappa}B via the classical I{kappa}B{alpha}-regulated pathway is required within the NKT precursors for their efficient maturation from NK1.1{sup -} precursors to mature NK1.1{sup +} NKT cells. The Rel/NF-{kappa}B family member RelB, on the other hand, is required in thymic stromal cells for the generation of very early NK1.1{sup -} precursors. NF-{kappa}B-inducing kinase (NIK) has also been shown to be required in thymic stromal cells for NKT cell development and this study demonstrates that NIK specifically regulates both constitutive and signal-induced DNA binding of RelB, but not RelA. Moreover, NIK-induced DNA binding of RelB depends on the processing of inhibitory p100 to p52, revealing an alternate pathway of NF-{kappa}B induction. Thus, Rel/NF-{kappa}B complexes activated by the classical I{kappa}B{alpha}-regulated pathway in NKT precursors and an alternate NIK/p100/RelB pathway in thymic stromal cells regulate different stages of NKT cell development. (orig.)
Directory of Open Access Journals (Sweden)
Monika Mahajan
Full Text Available Flavonoids are synthesized by phenylpropanoid pathway. They are known to participate in large number of physiological and biochemical processes in plants. Parthenocarpy and male sterility has earlier been reported by silencing chalcone synthase (CHS encoding gene. Silencing of CHS has blocked the synthesis of most of useful flavonoids including flavan-3-ols and flavonols. Also, these studies could not identify whether parthenocarpy/male sterility were due to lack of flavan-3-ols or flavonols or both. Flavonol synthase (FLS is an important enzyme of flavonoid pathway that catalyzes the formation of flavonols. In this article, we propose a novel strategy towards the generation of seedless or less-seeded fruits by downregulation of flavonol biosynthesis in tobacco (Nicotiana tabacum cv Xanthi through post-transcriptional gene silencing (PTGS of FLS encoding mRNA. The FLS silenced lines were observed for 20-80% reduction in FLS encoding gene expression and 25-93% reduction in flavonol (quercetin content. Interestingly, these FLS silenced tobacco lines also showed reduction in their anthocyanidins content. While the content of flavan-3-ols (catechin, epi-catechin and epi-gallocatechin was found to be increased in FLS silenced lines. The delayed flowering in FLS silenced lines could be due to decrease in level of indole acetic acid (IAA at apical region of their shoots. Furthermore, the pollen germination was hampered and pollens were unable to produce functional pollen tube in FLS silenced tobacco lines. Pods of FLS silenced lines contained significantly less number of seeds. The in vitro and in vivo studies where 1 µM quercetin was supplied to germination media, documented the restoration of normal pollen germination and pollen tube growth. This finding identified the role of flavonols particularly quercetin in pollen germination as well as in the regulation of plant fertility. Results also suggest a novel approach towards generation of seedless
DEFF Research Database (Denmark)
Nielsen, Troels T; Nielsen, Jørgen E
2013-01-01
Since the first reports that double-stranded RNAs can efficiently silence gene expression in C. elegans, the technology of RNA interference (RNAi) has been intensively exploited as an experimental tool to study gene function. With the subsequent discovery that RNAi could also be applied...
Zhong, Xueting; Wang, Zhan Qi; Xiao, Ruyuan; Cao, Linge; Wang, Yaqin; Xie, Yan; Zhou, Xueping
2017-08-15
Phosphorylation of the βC1 protein encoded by the betasatellite of tomato yellow leaf curl China virus (TYLCCNB-βC1) by SNF1-related protein kinase 1 (SnRK1) plays a critical role in defense of host plants against geminivirus infection in Nicotiana benthamiana However, how phosphorylation of TYLCCNB-βC1 impacts its pathogenic functions during viral infection remains elusive. In this study, we identified two additional tyrosine residues in TYLCCNB-βC1 that are phosphorylated by SnRK1. The effects of TYLCCNB-βC1 phosphorylation on its functions as a viral suppressor of RNA silencing (VSR) and a symptom determinant were investigated via phosphorylation mimic mutants in N. benthamiana plants. Mutations that mimic phosphorylation of TYLCCNB-βC1 at tyrosine 5 and tyrosine 110 attenuated disease symptoms during viral infection. The phosphorylation mimics weakened the ability of TYLCCNB-βC1 to reverse transcriptional gene silencing and to suppress posttranscriptional gene silencing and abolished its interaction with N. benthamiana ASYMMETRIC LEAVES 1 in N. benthamiana leaves. The mimic phosphorylation of TYLCCNB-βC1 had no impact on its protein stability, subcellular localization, or self-association. Our data establish an inhibitory effect of phosphorylation of TYLCCNB-βC1 on its pathogenic functions as a VSR and a symptom determinant and provide a mechanistic explanation of how SnRK1 functions as a host defense factor. IMPORTANCE Tomato yellow leaf curl China virus (TYLCCNV), which causes a severe yellow leaf curl disease in China, is a monopartite geminivirus associated with the betasatellite (TYLCCNB). TYLCCNB encodes a single pathogenicity protein, βC1 (TYLCCNB-βC1), which functions as both a viral suppressor of RNA silencing (VSR) and a symptom determinant. Here, we show that mimicking phosphorylation of TYLCCNB-βC1 weakens its ability to reverse transcriptional gene silencing, to suppress posttranscriptional gene silencing, and to interact with N
Keogh, Ciara E; Scholz, Carsten C; Rodriguez, Javier; Selfridge, Andrew C; von Kriegsheim, Alexander; Cummins, Eoin P
2017-07-07
CO 2 is a physiological gas normally produced in the body during aerobic respiration. Hypercapnia (elevated blood pCO 2 >≈50 mm Hg) is a feature of several lung pathologies, e.g. chronic obstructive pulmonary disease. Hypercapnia is associated with increased susceptibility to bacterial infections and suppression of inflammatory signaling. The NF-κB pathway has been implicated in these effects; however, the molecular mechanisms underpinning cellular sensitivity of the NF-κB pathway to CO 2 are not fully elucidated. Here, we identify several novel CO 2 -dependent changes in the NF-κB pathway. NF-κB family members p100 and RelB translocate to the nucleus in response to CO 2 A cohort of RelB protein-protein interactions ( e.g. with Raf-1 and IκBα) are altered by CO 2 exposure, although others are maintained ( e.g. with p100). RelB is processed by CO 2 in a manner dependent on a key C-terminal domain located in its transactivation domain. Loss of the RelB transactivation domain alters NF-κB-dependent transcriptional activity, and loss of p100 alters sensitivity of RelB to CO 2 Thus, we provide molecular insight into the CO 2 sensitivity of the NF-κB pathway and implicate altered RelB/p100-dependent signaling in the CO 2 -dependent regulation of inflammatory signaling. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
McREL Leadership Responsibilities through the Lens of Data: The Critical Nine
Directory of Open Access Journals (Sweden)
Cheryl James-Ward
2015-09-01
Full Text Available In the United States, the beginning of the 21st century also ushered in a new era of school accountability and reform with the No Child Left Behind Act [NCLB] (US Department of Education, 2010. Although the law is no longer in effect, the district and school level accountability that it brought remains. The accountability and need for ongoing improvement rest squarely on the shoulders of school principals, many of whom have no skill sets or experience with the use of data to improve student outcomes. This article utilizes the research studies and findings from the Mid-Continent Research for Education and Learning (McREL lab, in order to examine those leadership responsibilities intertwined with the use of data to improve student achievement. McREL has identified 21 leadership responsibilities that describe the knowledge and skills school leaders need to positively impact student achievement. This analysis focuses on the McREL leadership responsibilities with an effect size of .25 or higher that require a focus on data. The use of hard and soft data to focus improvement is then analyzed and expanded upon through the McREL lens.
The rde-1 gene, RNA interference, and transposon silencing in C. elegans.
Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C
1999-10-15
Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.
Türkiye Ekonomisinde Sektörel Enerji Tüketiminin Ayrıştırma Yöntemiyle Analizi
Directory of Open Access Journals (Sweden)
Alper Yılmaz
2016-12-01
Full Text Available Bu çalışma 1970-2013 yılları arasında Türkiye ekonomisi için sektörel enerji tüketimini ayrıştırma yöntemiyle analiz etmeyi amaçlamaktadır. Çalışmanın sonuçlarına göre sektörel enerji tüketiminin çıktı ve yapısal etki nedeniyle arttığı, yoğunluk etkisi nedeniyle ise düştüğü görülür. Ayrıca diğer iki etkiye göre çıktı etkisi sektörel enerji tüketimi üzerinde en güçlü etkiye sahiptir. Sektörel enerji tüketiminin üretim artışı ile oldukça yakın ilişkili (doğrusal olduğu görülür. Benzer şekilde yapısal etkinin, Türkiye ekonomisindeki enerji yoğun sektörlerinin ağırlığının artmasına bağlı olarak sektörel enerji tüketimini arttırıcı yönde etki yaptığı görülür. Ancak yoğunluk etkisine bakıldığında 1980 sonrasında Türkiye ekonomisi enerji yoğunluğunun yavaş bir düşme eğilimi içinde olduğu görülür.
The RNA silencing pathway: the bits and pieces that matter.
Directory of Open Access Journals (Sweden)
2005-07-01
Full Text Available Cellular pathways are generally proposed on the basis of available experimental knowledge. The proposed pathways, however, may be inadequate to describe the phenomena they are supposed to explain. For instance, by means of concise mathematical models we are able to reveal shortcomings in the current description of the pathway of RNA silencing. The silencing pathway operates by cleaving siRNAs from dsRNA. siRNAs can associate with RISC, leading to the degradation of the target mRNA. We propose and analyze a few small extensions to the pathway: a siRNA degrading RNase, primed amplification of aberrant RNA pieces, and cooperation between aberrant RNA to trigger amplification. These extensions allow for a consistent explanation for various types of silencing phenomena, such as virus induced silencing, transgene and transposon induced silencing, and avoidance of self-reactivity, as well as for differences found between species groups.
Directory of Open Access Journals (Sweden)
Feilan Chen
Full Text Available Genome-wide association studies (GWAS and candidate gene studies have identified the REL and PRKCQ genes as risk loci for various autoimmune diseases. The purpose of the present study was to investigate the association of the REL and PRKCQ genes with Behcet's disease (BD in a Chinese Han population. A case-control study was conducted on three single nucleotide polymorphisms (SNPs, rs13031237, rs702873, and rs842647 of the REL gene and three SNPs (rs4750316, rs11258747, and rs947474 of the PRKCQ gene using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP in a total of 623 BD patients and 1,074 healthy controls. Multiple variables were assessed, including age, sex distribution, and extra-ocular findings. In the present study, the frequencies of rs842647 GG genotypes and rs842647 G alleles were significantly higher in patients than in controls and those of the rs842647 AG genotypes were lower in patients than in controls [GG genotype: Bonferroni corrected P-value for gender adjustment (Pc(a = 0.0074, odds ratio (OR = 1.63; G allele: Pc(a = 0.0072, OR = 1.57; AG genotype: Pc(a = 0.024, OR = 0.63, respectively]. No statistically significant differences in the frequencies of rs702873, rs13031237, rs4750316, rs11258747, and rs947474 between BD patients and controls were observed. Stratification analysis indicated that the REL rs842647 polymorphism was associated with BD patients with skin lesions. No significant association of the other five SNPs between BD patients with other extra-ocular findings, including genital ulcer, arthritis, and positive pathergy test results was found. The REL rs842647 polymorphism may be a susceptibility factor for BD pathogenesis and skin lesions, which indicate that c-Rel may be involved in the pathogenesis and skin lesions of BD through the NF-κB pathway.
Directory of Open Access Journals (Sweden)
Praveen Guleria
Full Text Available Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi based Agrobacterium mediated transient gene silencing (AMTS approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1 genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins.RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3 content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes.SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route.
Technique originale de relèvement enclouage à foyer fermé d'une ...
African Journals Online (AJOL)
Le relèvement enclouage à foyer fermé (R.E.F.F) est une technique originale de traitement des fractures thalamiques du calcanéum. Il s'agit d'un patient âgé de 40 ans sans antécédents, victime d'une chute domestique sur le talon droit, d'une hauteur de 3 mètres. Le patient présentait un 'dème et une ecchymose du talon ...
Silencing of the SlNAP7 gene influences plastid development and lycopene accumulation in tomato
Fu, Da-Qi; Meng, Lan-Huan; Zhu, Ben-Zhong; Zhu, Hong-Liang; Yan, Hua-Xue; Luo, Yun-Bo
2016-12-01
Ripening is an important stage of fruit development. To screen the genes associated with pigment formation in tomato fruit, a suppression subtractive hybridization (SSH) cDNA library was constructed by using tomato fruit in the green ripe and break ripe stages, and 129 differential genes were obtained. Using redness as a screening marker, virus-induced gene silencing (VIGS) of the differential genes was performed with a sprout vacuum-infiltration system (SVI). The results showed that silencing the SlNAP7 gene affected the chloroplast development of tomato leaves, manifesting as a photo-bleaching phenotype, and silenced fruit significantly affected the accumulation of lycopene, manifested as a yellow phenotype. In our study, we found that silencing the SlNAP7 gene downregulates the expression of the POR and PORA genes and destroys the normal development of the chloroplast. The expression of related genes included in the lycopene biosynthesis pathway was not significantly changed, but lycopene accumulation was significantly reduced in tomato fruit. Perhaps it was caused by the destruction of the chromoplast, which leads to the oxidation of lycopene. The results show that the SlNAP7 gene influences chloroplast development and lycopene accumulation in tomato.
Directory of Open Access Journals (Sweden)
Hanoch Goldshmidt
2010-01-01
Full Text Available Trypanosomes are parasites that cycle between the insect host (procyclic form and mammalian host (bloodstream form. These parasites lack conventional transcription regulation, including factors that induce the unfolded protein response (UPR. However, they possess a stress response mechanism, the spliced leader RNA silencing (SLS pathway. SLS elicits shut-off of spliced leader RNA (SL RNA transcription by perturbing the binding of the transcription factor tSNAP42 to its cognate promoter, thus eliminating trans-splicing of all mRNAs. Induction of endoplasmic reticulum (ER stress in procyclic trypanosomes elicits changes in the transcriptome similar to those induced by conventional UPR found in other eukaryotes. The mechanism of up-regulation under ER stress is dependent on differential stabilization of mRNAs. The transcriptome changes are accompanied by ER dilation and elevation in the ER chaperone, BiP. Prolonged ER stress induces SLS pathway. RNAi silencing of SEC63, a factor that participates in protein translocation across the ER membrane, or SEC61, the translocation channel, also induces SLS. Silencing of these genes or prolonged ER stress led to programmed cell death (PCD, evident by exposure of phosphatidyl serine, DNA laddering, increase in reactive oxygen species (ROS production, increase in cytoplasmic Ca(2+, and decrease in mitochondrial membrane potential, as well as typical morphological changes observed by transmission electron microscopy (TEM. ER stress response is also induced in the bloodstream form and if the stress persists it leads to SLS. We propose that prolonged ER stress induces SLS, which serves as a unique death pathway, replacing the conventional caspase-mediated PCD observed in higher eukaryotes.
Czech Academy of Sciences Publication Activity Database
Kudrin, P.; Varik, V.; Oliveira, S. R. A.; Beljantseva, J.; Del Peso Santos, T.; Dzhygyr, I.; Rejman, Dominik; Cava, F.; Tenson, T.; Hauryliuk, V.
2017-01-01
Roč. 61, č. 4 (2017), č. článku e02173-16. ISSN 0066-4804 R&D Projects: GA ČR GA15-11711S Institutional support: RVO:61388963 Keywords : beta-lactam * RelA * antibiotics * mupirocin * persistence * ppGpp Subject RIV: EE - Microbiology, Virology OBOR OECD: Microbiology Impact factor: 4.302, year: 2016 http://aac.asm.org/content/61/4/e02173-16.full
Guleria, Praveen; Yadav, Sudesh Kumar
2013-01-01
Background Steviol glycoside biosynthesis pathway has emerged as bifurcation from ent-kaurenoic acid, substrate of methyl erythritol phosphate pathway that also leads to gibberellin biosynthesis. However, the genetic regulation of steviol glycoside biosynthesis has not been studied. So, in present study RNA interference (RNAi) based Agrobacterium mediated transient gene silencing (AMTS) approach was followed. SrKA13H and three SrUGTs (SrUGT85C2, SrUGT74G1 and SrUGT76G1) genes encoding ent-kaurenoic acid-13 hydroxylase and three UDP glycosyltransferases of steviol glycoside biosynthesis pathway were silenced in Stevia rebaudiana to understand its molecular mechanism and association with gibberellins. Methodology/Principal Findings RNAi mediated AMTS of SrKA13H and three SrUGTs has significantly reduced the expression of targeted endogenous genes as well as total steviol glycoside accumulation. While gibberellins (GA3) content was significantly enhanced on AMTS of SrUGT85C2 and SrKA13H. Silencing of SrKA13H and SrUGT85C2 was found to block the metabolite flux of steviol glycoside pathway and shifted it towards GA3 biosynthesis. Further, molecular docking of three SrUGT proteins has documented highest affinity of SrUGT76G1 for the substrates of alternate pathways synthesizing steviol glycosides. This could be a plausible reason for maximum reduction in steviol glycoside content on silencing of SrUGT76G1 than other genes. Conclusions SrKA13H and SrUGT85C2 were identified as regulatory genes influencing carbon flux between steviol glycoside and gibberellin biosynthesis. This study has also documented the existence of alternate steviol glycoside biosynthesis route. PMID:24023961
Driving in unheard silence: Disability and the politics of shutting up.
Lourens, Heidi
2018-03-01
The politics of silence is central to disability experience and the field of disability studies. In this analytical autoethnography, I write about my silences as a visually impaired woman. I explore and make sense of personal life stories through a theoretical perspective. The analysis of these personal experiences lead me to argue that disability-related silences are mostly created through the confluence of inaccessible physical and social environments and the psychological internalisation of these worlds. I also discuss the ways in which I am currently regaining my voice. Further research on resistance by disabled persons is recommended.
DEFF Research Database (Denmark)
Dupret, Katia
2018-01-01
static nor neutral. It has performative effects. Silencing as an act, rather than a noun, is conceptualised as a central ‘configurating actor’ of change. Through the description of minute details from a videotaped supervision session in the mental healthcare sector, it is shown how different performative...... configurations of silence makes people relate to each other in new ways and influence new work practices. In spite of its somewhat immaterial connotations, using an Actor-Network Theory approach to organization studies, silencing is conceptualised as both a means and an effect of change efforts, which are socio...
Burbank, Lindsey P; Stenger, Drake C
2017-04-01
Xylella fastidiosa, the causal agent of Pierce's disease of grapes, is a slow-growing, xylem-limited, bacterial pathogen. Disease progression is characterized by systemic spread of the bacterium through xylem vessel networks, causing leaf-scorching symptoms, senescence, and vine decline. It appears to be advantageous to this pathogen to avoid excessive blockage of xylem vessels, because living bacterial cells are generally found in plant tissue with low bacterial cell density and minimal scorching symptoms. The DinJ/RelE toxin-antitoxin system is characterized here for a role in controlling bacterial proliferation and population size during plant colonization. The DinJ/RelE locus is transcribed from two separate promoters, allowing for coexpression of antitoxin DinJ with endoribonuclease toxin RelE, in addition to independent expression of RelE. The ratio of antitoxin/toxin expressed is dependent on bacterial growth conditions, with lower amounts of antitoxin present under conditions designed to mimic grapevine xylem sap. A knockout mutant of DinJ/RelE exhibits a hypervirulent phenotype, with higher bacterial populations and increased symptom development and plant decline. It is likely that DinJ/RelE acts to prevent excessive population growth, contributing to the ability of the pathogen to spread systemically without completely blocking the xylem vessels and increasing probability of acquisition by the insect vector.
Zheng, Min; Mitra, Rajendra N; Filonov, Nazar A; Han, Zongchao
2016-03-01
Previously, we compared the efficacy of nanoparticle (NP)-mediated intron-containing rhodopsin (sgRho) vs. intronless cDNA in ameliorating retinal disease phenotypes in a rhodopsin knockout (RKO) mouse model of retinitis pigmentosa. We showed that NP-mediated sgRho delivery achieved long-term expression and phenotypic improvement in RKO mice, but not NP housing cDNA. However, the protein level of the NP-sgRho construct was only 5-10% of wild-type at 8 mo postinjection. To have a better understanding of the reduced levels of long-term expression of the vectors, in the present study, we evaluated the epigenetic changes of subretinal delivering NP-cDNA vs. NP-sgRho in the RKO mouse eyes. Following the administration, DNA methylation and histone status of specific regions (bacteria plasmid backbone, promoter, rhodopsin gene, and scaffold/matrix attachment region) of the vectors were evaluated at various time points. We documented that epigenetic transgene silencing occurred in vector-mediated gene transfer, which were caused by the plasmid backbone and the cDNA of the transgene, but not the intron-containing transgene. No toxicity or inflammation was found in the treated eyes. Our results suggest that cDNA of the rhodopsin transgene and bacteria backbone interfered with the host defense mechanism of DNA methylation-mediated transgene silencing through heterochromatin-associated modifications. © FASEB.
DNA triplet repeats mediate heterochromatin-protein-1-sensitive variegated gene silencing.
Saveliev, Alexander; Everett, Christopher; Sharpe, Tammy; Webster, Zoë; Festenstein, Richard
2003-04-24
Gene repression is crucial to the maintenance of differentiated cell types in multicellular organisms, whereas aberrant silencing can lead to disease. The organization of DNA into chromatin and heterochromatin is implicated in gene silencing. In chromatin, DNA wraps around histones, creating nucleosomes. Further condensation of chromatin, associated with large blocks of repetitive DNA sequences, is known as heterochromatin. Position effect variegation (PEV) occurs when a gene is located abnormally close to heterochromatin, silencing the affected gene in a proportion of cells. Here we show that the relatively short triplet-repeat expansions found in myotonic dystrophy and Friedreich's ataxia confer variegation of expression on a linked transgene in mice. Silencing was correlated with a decrease in promoter accessibility and was enhanced by the classical PEV modifier heterochromatin protein 1 (HP1). Notably, triplet-repeat-associated variegation was not restricted to classical heterochromatic regions but occurred irrespective of chromosomal location. Because the phenomenon described here shares important features with PEV, the mechanisms underlying heterochromatin-mediated silencing might have a role in gene regulation at many sites throughout the mammalian genome and modulate the extent of gene silencing and hence severity in several triplet-repeat diseases.
Wang, Junjian; Wang, Haibin; Wang, Ling-Yu; Cai, Demin; Duan, Zhijian; Zhang, Yanhong; Chen, Peng; Zou, June X; Xu, Jianzhen; Chen, Xinbin; Kung, Hsing-Jien; Chen, Hong-Wu
2016-11-01
Recombinant TRAIL and agonistic antibodies to death receptors (DRs) have been in clinical trial but displayed limited anti-cancer efficacy. Lack of functional DR expression in tumors is a major limiting factor. We report here that chromatin regulator KDM4A/JMJD2A, not KDM4B, has a pivotal role in silencing tumor cell expression of both TRAIL and its receptor DR5. In TRAIL-sensitive and -resistant cancer cells of lung, breast and prostate, KDM4A small-molecule inhibitor compound-4 (C-4) or gene silencing strongly induces TRAIL and DR5 expression, and causes TRAIL-dependent apoptotic cell death. KDM4A inhibition also strongly sensitizes cells to TRAIL. C-4 alone potently inhibits tumor growth with marked induction of TRAIL and DR5 expression in the treated tumors and effectively sensitizes them to the newly developed TRAIL-inducer ONC201. Mechanistically, C-4 does not appear to act through the Akt-ERK-FOXO3a pathway. Instead, it switches histone modifying enzyme complexes at promoters of TRAIL and DR5 transcriptional activator CHOP gene by dissociating KDM4A and nuclear receptor corepressor (NCoR)-HDAC complex and inducing the recruitment of histone acetylase CBP. Thus, our results reveal KDM4A as a key epigenetic silencer of TRAIL and DR5 in tumors and establish inhibitors of KDM4A as a novel strategy for effectively sensitizing tumors to TRAIL pathway-based therapeutics.
Laldinsangi, C; Senthilkumaran, B
2018-04-03
C-kit receptor is a member of a family of growth factor receptors that have tyrosine kinase activity, and are involved in the transduction of growth regulatory signals across plasma membrane by activation of its ligand, kitl/scf. The present study analysed mRNA and protein expression profiles of c-kit in the gonads of catfish, Clarias gariepinus, using real time PCR, in situ hybridization and immunohistochemistry. Tissue distribution analysis revealed higher expression mainly in the catfish gonads. Ontogeny studies showed minimal expression during early developmental stages and highest during 50-75 days post hatch, and the dimorphic expression in gonads decreased gradually till adulthood, which might suggest an important role for this gene around later stages of sex differentiation and gonadal development. Expression of C-kit was analysed at various phases of gonadal cycle in both male and female, which showed minimal expression during the resting phase, and higher expression in male compared to females during the pre-spawning phase. In vitro and in vivo induction using human chorionic gonadotropin elevated the expression of c-kit indicating the regulatory influence of hypothalamo-hypophyseal axis. In vivo transient gene silencing using c-kit-esiRNA in adult catfish during gonadal recrudescence showed a decrease in c-kit expression, which affected the expression level of germ cell meiotic marker sycp3, as well as several factors and steroidogenic enzyme genes involved in germ cell development. Decrease in the levels of serum 11-KT and T were also observed after esiRNA silencing. The findings of this study suggest that c-kit has an important role in the process of germ cell proliferation, development and maturation during gonadal development and recrudescence in catfish. Copyright © 2018. Published by Elsevier Inc.
Tyč, Dimitrij; Nocarová, Eva; Sikorová, Lenka; Fischer, Lukáš
2017-08-01
Transient 5-azacytidine treatment of leaf explants from potato plants with transcriptionally silenced transgenes allows de novo regeneration of plants with restored transgene expression at the whole plant level. Transgenes introduced into plant genomes frequently become silenced either at the transcriptional or the posttranscriptional level. Transcriptional silencing is usually associated with DNA methylation in the promoter region. Treatments with inhibitors of maintenance DNA methylation were previously shown to allow reactivation of transcriptionally silenced transgenes in single cells or tissues, but not at the whole plant level. Here we analyzed the effect of DNA methylation inhibitor 5-azacytidine (AzaC) on the expression of two silenced reporter genes encoding green fluorescent protein (GFP) and neomycin phosphotransferase (NPTII) in potato plants. Whereas no obvious reactivation was observed in AzaC-treated stem cuttings, transient treatment of leaf segments with 10 μM AzaC and subsequent de novo regeneration of shoots on the selective medium with kanamycin resulted in the production of whole plants with clearly reactivated expression of previously silenced transgenes. Reactivation of nptII expression was accompanied by a decrease in cytosine methylation in the promoter region of the gene. Using the plants with reactivated GFP expression, we found that re-silencing of this transgene can be accidentally triggered by de novo regeneration. Thus, testing the incidence of transgene silencing during de novo regeneration could be a suitable procedure for negative selection of transgenic lines (insertion events) which have an inclination to be silenced. Based on our analysis of non-specific inhibitory effects of AzaC on growth of potato shoots in vitro, we estimated that AzaC half-life in the culture media is approximately 2 days.
Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing.
Hedil, Marcio; Sterken, Mark G; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard
2015-01-01
RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silencing has only been studied to a limited extent. Here, the NSs proteins of TSWV, groundnut ringspot virus (GRSV) and tomato yellow ring virus (TYRV), representatives for three distinct tospovirus species, have been studied on their ability and strength to suppress local and systemic silencing. A system has been developed to quantify suppression of GFP silencing in Nicotiana benthamiana 16C lines, to allow a comparison of relative RNA silencing suppressor strength. It is shown that NSs of all three tospoviruses are suppressors of local and systemic silencing. Unexpectedly, suppression of systemic RNA silencing by NSsTYRV was just as strong as those by NSsTSWV and NSsGRSV, even though NSsTYRV was expressed in lower amounts. Using the system established, a set of selected NSsTSWV gene constructs mutated in predicted RNA binding domains, as well as NSs from TSWV isolates 160 and 171 (resistance breakers of the Tsw resistance gene), were analyzed for their ability to suppress systemic GFP silencing. The results indicate another mode of RNA silencing suppression by NSs that acts further downstream the biogenesis of siRNAs and their sequestration. The findings are discussed in light of the affinity of NSs for small and long dsRNA, and recent mutant screen of NSsTSWV to map domains required for RSS activity and triggering of Tsw-governed resistance.
Organizational Silence in Universities as the Predictor of Organizational Culture
Directory of Open Access Journals (Sweden)
Erkan YAMAN
2014-04-01
Full Text Available The aim of this study is to determine the relationship between the sense of organizational silence and the organizational culture the instructors perceived. In this study, the scale for determining organizational culture developed by İpek (1999 and the scale for measuring organizational silence developed by Çakıcı (2007 and adapted by Soycan (2010 are used. No remarkable difference was found in the academic staff's sense of organizational silence degree according to their genders and educational backgrounds. It was seen that the instructors' sense of organizational silence had remarkable differences according to their age group, faculty, sense of administration type in their institutions, frequency of their face-to-face communication with their administrators and their thoughts of speaking clearly with their administrators. It was observed that research assistants had a significantly higher sense of organizational silence than the lecturers in the sense of ‘Lack of Experience'. It was seen that academicians who had 1-5 years of employment period had the highest sense of organizational silence while those who had 21 years or more employment period had the lowest sense of organizational silence in the sense of ‘Lack of Experience' of organizational silence. When the points that participant academicians got from organizational silence and organizational culture scales analyzed in the correlation table, it was found out that there was a remarkable relationship between the academicians' sense of organizational silence and sense of organizational culture. This relationship was a medium-level negative relationship between subdimensions of two scales. A medium-level negative relationship between the organizational silence (total and the organizational culture was also seen. Based on the findings, university administrators were proposed to create a participant culture in their institutions as well as to encourage instructors to speak clearly and
"Listening Silence" and Its Discursive Effects
Applebaum, Barbara
2016-01-01
While researchers have studied how white silence protects white innocence and white ignorance, in this essay Barbara Applebaum explores a form of white silence that she refers to as "listening silence" in which silence protects white innocence but does not necessarily promote resistance to learning. White listening silence can appear to…
Directory of Open Access Journals (Sweden)
Concha Nieto
2010-06-01
Full Text Available Type II (proteic chromosomal toxin-antitoxin systems (TAS are widespread in Bacteria and Archaea but their precise function is known only for a limited number of them. Out of the many TAS described, the relBE family is one of the most abundant, being present in the three first sequenced strains of Streptococcus pneumoniae (D39, TIGR4 and R6. To address the function of the pneumococcal relBE2Spn TAS in the bacterial physiology, we have compared the response of the R6-relBE2Spn wild type strain with that of an isogenic derivative, Delta relB2Spn under different stress conditions such as carbon and amino acid starvation and antibiotic exposure. Differences on viability between the wild type and mutant strains were found only when treatment directly impaired protein synthesis. As a criterion for the permanence of this locus in a variety of clinical strains, we checked whether the relBE2Spn locus was conserved in around 100 pneumococcal strains, including clinical isolates and strains with known genomes. All strains, although having various types of polymorphisms at the vicinity of the TA region, contained a functional relBE2Spn locus and the type of its structure correlated with the multilocus sequence type. Functionality of this TAS was maintained even in cases where severe rearrangements around the relBE2Spn region were found. We conclude that even though the relBE2Spn TAS is not essential for pneumococcus, it may provide additional advantages to the bacteria for colonization and/or infection.
Liivik, Olev, 1975-
2016-01-01
Ümberasustamise operatsiooni allikatest. Saksamaa ja NSV Liidu kokkuleppest välissakslaste järelümberasumise suhtes. Riigisakslastest ja rahvussakslastest, nende jagamisest ümberasujateks ja põgenikeks. Märtsi keskpaigaks 1941 oli enamik järelümberasujaid Saksamaale lahkunud. Järelümberasujate vastuvõtmisest ja käsitlemisest Saksa Reich'is. Mittesakslastest ümberasujad ei olnud Saksa Reich'is oodatud, kuid samal ajal tehti keeruliseks ka nende tagasipöördumine kodumaale
The Nuclear Cap-Binding Complex Mediates Meiotic Silencing by Unpaired DNA
Directory of Open Access Journals (Sweden)
Logan M. Decker
2017-04-01
Full Text Available In the filamentous fungus Neurospora crassa, cross walls between individual cells are normally incomplete, making the entire fungal network vulnerable to attack by viruses and selfish DNAs. Accordingly, several genome surveillance mechanisms are maintained to help the fungus combat these repetitive elements. One of these defense mechanisms is called meiotic silencing by unpaired DNA (MSUD, which identifies and silences unpaired genes during meiosis. Utilizing common RNA interference (RNAi proteins, such as Dicer and Argonaute, MSUD targets mRNAs homologous to the unpaired sequence to achieve silencing. In this study, we have identified an additional silencing component, namely the cap-binding complex (CBC. Made up of cap-binding proteins CBP20 and CBP80, CBC associates with the 5′ cap of mRNA transcripts in eukaryotes. The loss of CBC leads to a deficiency in MSUD activity, suggesting its role in mediating silencing. As confirmed in this study, CBC is predominantly nuclear, although it is known to travel in and out of the nucleus to facilitate RNA transport. As seen in animals but not in plants, CBP20’s robust nuclear import depends on CBP80 in Neurospora. CBC interacts with a component (Argonaute of the perinuclear meiotic silencing complex (MSC, directly linking the two cellular factors.
The oncoprotein gankyrin interacts with RelA and suppresses NF-κB activity
International Nuclear Information System (INIS)
Higashitsuji, Hiroaki; Higashitsuji, Hisako; Liu, Yu; Masuda, Tomoko; Fujita, Takanori; Abdel-Aziz, H. Ismail; Kongkham, Supranee; Dawson, Simon; John Mayer, R.; Itoh, Yoshito; Sakurai, Toshiharu; Itoh, Katsuhiko; Fujita, Jun
2007-01-01
Gankyrin is an oncoprotein commonly overexpressed in hepatocellular carcinomas. It interacts with multiple proteins and accelerates degradation of tumor suppressors Rb and p53. Since gankyrin consists of 7 ankyrin repeats and is structurally similar to IκBs, we investigated its interaction with NF-κB. We found that gankyrin directly binds to RelA. In HeLa and 293 cells, overexpression of gankyrin suppressed the basal as well as TNFα-induced transcriptional activity of NF-κB, whereas down-regulation of gankyrin increased it. Gankyrin did not affect the NF-κB DNA-binding activity or nuclear translocation of RelA induced by TNFα in these cells. Leptomycin B that inhibits nuclear export of RelA suppressed the NF-κB activity, which was further suppressed by gankyrin. The inhibitory effect of gankyrin was abrogated by nicotinamide as well as down-regulation of SIRT1, a class III histone deacetylase. Thus, gankyrin binds to NF-κB and suppresses its activity at the transcription level by modulating acetylation via SIRT1
Directory of Open Access Journals (Sweden)
Thibaut Josse
2007-09-01
Full Text Available The study of P-element repression in Drosophila melanogaster led to the discovery of the telomeric Trans-Silencing Effect (TSE, a repression mechanism by which a transposon or a transgene inserted in subtelomeric heterochromatin (Telomeric Associated Sequence or TAS has the capacity to repress in trans in the female germline, a homologous transposon, or transgene located in euchromatin. TSE shows variegation among egg chambers in ovaries when silencing is incomplete. Here, we report that TSE displays an epigenetic transmission through meiosis, which involves an extrachromosomal maternally transmitted factor. We show that this silencing is highly sensitive to mutations affecting both heterochromatin formation (Su(var205 encoding Heterochromatin Protein 1 and Su(var3-7 and the repeat-associated small interfering RNA (or rasiRNA silencing pathway (aubergine, homeless, armitage, and piwi. In contrast, TSE is not sensitive to mutations affecting r2d2, which is involved in the small interfering RNA (or siRNA silencing pathway, nor is it sensitive to a mutation in loquacious, which is involved in the micro RNA (or miRNA silencing pathway. These results, taken together with the recent discovery of TAS homologous small RNAs associated to PIWI proteins, support the proposition that TSE involves a repeat-associated small interfering RNA pathway linked to heterochromatin formation, which was co-opted by the P element to establish repression of its own transposition after its recent invasion of the D. melanogaster genome. Therefore, the study of TSE provides insight into the genetic properties of a germline-specific small RNA silencing pathway.
Simultaneous Silencing of Xylanase Genes in Botrytis cinerea
Directory of Open Access Journals (Sweden)
Néstor García
2017-12-01
Full Text Available The endo-β-1,4-xylanase BcXyn11A is one of several plant cell-wall degrading enzymes that the phytopathogenic fungus Botrytis cinerea secretes during interaction with its hosts. In addition to its enzymatic activity, this protein also acts as an elicitor of the defense response in plants and has been identified as a virulence factor. In the present work, other four endoxylanase coding genes (Bcxyn11B, Bcxyn11C, Bcxyn10A, and Bcxyn10B were identified in the B. cinerea genome and the expression of all five genes was analyzed by Q-RT- PCR in vitro and in planta. A cross-regulation between xylanase genes was identified analyzing their expression pattern in the ΔBcxyn11A mutant strain and a putative BcXyn11A-dependt induction of Bcxyn10B gene was found. In addition, multiple knockdown strains were obtained for the five endoxylanase genes by transformation of B. cinerea with a chimeric DNA construct composed of 50-nt sequences from the target genes. The silencing of each xylanase gene was analyzed in axenic cultures and during infection and the results showed that the efficiency of the multiple silencing depends on the growth conditions and on the cross-regulation between them. Although the simultaneous silencing of the five genes was observed by Q-RT-PCR when the silenced strains were grown on medium supplemented with tomato extract, the endoxylanase activity measured in the supernatants was reduced only by 40%. Unexpectedly, the silenced strains overexpressed the Bcxyn11A and Bcxyn11C genes during the infection of tomato leaves, making difficult the analysis of the role of the endo-β-1,4-xylanases in the virulence of the fungus.
RelA NF-κB subunit activation as a therapeutic target in diffuse large B-cell lymphoma
DEFF Research Database (Denmark)
Zhang, Mingzhi; Xu-Monette, Zijun Y; Li, Ling
2016-01-01
It has been well established that nuclear factor kappa-B (NF-κB) activation is important for tumor cell growth and survival. RelA/p65 and p50 are the most common NF-kB subunits and involved in the classical NF-kB pathway. However, the prognostic and biological significance of RelA/p65 is equivoca...
Cernilogar, Filippo M.
2013-06-13
Background:Beyond their role in post-transcriptional gene silencing, Dicer and Argonaute, two components of the RNA interference (RNAi) machinery, were shown to be involved in epigenetic regulation of centromeric heterochromatin and transcriptional gene silencing. In particular, RNAi mechanisms appear to play a role in repeat induced silencing and some aspects of Polycomb-mediated gene silencing. However, the functional interplay of RNAi mechanisms and Polycomb group (PcG) pathways at endogenous loci remains to be elucidated.Principal Findings:Here we show that the endogenous Dicer-2/Argonaute-2 RNAi pathway is dispensable for the PcG mediated silencing of the homeotic Bithorax Complex (BX-C). Although Dicer-2 depletion triggers mild transcriptional activation at Polycomb Response Elements (PREs), this does not induce transcriptional changes at PcG-repressed genes. Moreover, Dicer-2 is not needed to maintain global levels of methylation of lysine 27 of histone H3 and does not affect PRE-mediated higher order chromatin structures within the BX-C. Finally bioinformatic analysis, comparing published data sets of PcG targets with Argonaute-2-bound small RNAs reveals no enrichment of these small RNAs at promoter regions associated with PcG proteins.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.
Luco, Sophie; Delmas, Olivier; Vidalain, Pierre-Olivier; Tangy, Frédéric; Weil, Robert; Bourhy, Hervé
2012-01-01
NF-κB transcription factors are crucial for many cellular processes. NF-κB is activated by viral infections to induce expression of antiviral cytokines. Here, we identified a novel member of the human NF-κB family, denoted RelAp43, the nucleotide sequence of which contains several exons as well as an intron of the RelA gene. RelAp43 is expressed in all cell lines and tissues tested and exhibits all the properties of a NF-κB protein. Although its sequence does not include a transactivation domain, identifying it as a class I member of the NF-κB family, it is able to potentiate RelA-mediated transactivation and stabilize dimers comprising p50. Furthermore, RelAp43 stimulates the expression of HIAP1, IRF1, and IFN-β - three genes involved in cell immunity against viral infection. It is also targeted by the matrix protein of lyssaviruses, the agents of rabies, resulting in an inhibition of the NF-κB pathway. Taken together, our data provide the description of a novel functional member of the NF-κB family, which plays a key role in the induction of anti-viral innate immune response.
Directory of Open Access Journals (Sweden)
Sophie Luco
Full Text Available NF-κB transcription factors are crucial for many cellular processes. NF-κB is activated by viral infections to induce expression of antiviral cytokines. Here, we identified a novel member of the human NF-κB family, denoted RelAp43, the nucleotide sequence of which contains several exons as well as an intron of the RelA gene. RelAp43 is expressed in all cell lines and tissues tested and exhibits all the properties of a NF-κB protein. Although its sequence does not include a transactivation domain, identifying it as a class I member of the NF-κB family, it is able to potentiate RelA-mediated transactivation and stabilize dimers comprising p50. Furthermore, RelAp43 stimulates the expression of HIAP1, IRF1, and IFN-β - three genes involved in cell immunity against viral infection. It is also targeted by the matrix protein of lyssaviruses, the agents of rabies, resulting in an inhibition of the NF-κB pathway. Taken together, our data provide the description of a novel functional member of the NF-κB family, which plays a key role in the induction of anti-viral innate immune response.
Voice and silence in organizations
Directory of Open Access Journals (Sweden)
Moaşa, H.
2011-01-01
Full Text Available Unlike previous research on voice and silence, this article breaksthe distance between the two and declines to treat them as opposites. Voice and silence are interrelated and intertwined strategic forms ofcommunication which presuppose each other in such a way that the absence of one would minimize completely the other’s presence. Social actors are not voice, or silence. Social actors can have voice or silence, they can do both because they operate at multiple levels and deal with multiple issues at different moments in time.
RNAi-mediated silencing of enolase confirms its biological importance in Clonorchis sinensis.
Wang, Xiaoyun; Chen, Wenjun; Tian, Yanli; Huang, Yan; Li, Xuerong; Yu, Xinbing
2014-04-01
Clonorchis sinensis (C. sinensis) infection is still a common public health problem in freshwater fish consumption areas in Asian countries. More molecular evidence are required to speed up the prevention strategies to control this kind of infectious disease. In the present study, to confirm the biological importance of Csenolase followed by our previous observations of the key metabolic enzyme, we explored the RNA silence effect of the Csenolase-derived RNA interference (RNAi) in C. sinensis. The extramembranous region aa105-226 was selected as the target sequence of RNA silence. Csenolase-derived double strand RNA (dsRNA-Csenolase, 366 bp) was synthetized and delivered into C. sinensis by soaking approach. The penetration of dsRNA into adult worms and metacercariae was tracked using fluorescently labeled RNA. Western blotting and qRT-PCR experiments were performed to determine dsRNA-Csenolase-silencing effect. Our results showed that, after incubating for 120 h, dsRNA-Csenolase could effectively target and downregulate the expression of Csenolase in both adult worms (P sinensis adult worms (P sinensis, allowing further applications in identifying functional genes in C. sinensis.
Sun, Xiaowen; Wu, Hefang; Zhao, Genhai; Li, Zhemin; Wu, Xihua; Liu, Hui; Zheng, Zhiming
2018-04-02
The mycelial morphology of Aspergillus niger, a major filamentous fungus used for citric acid production, is important for citric acid synthesis during submerged fermentation. To investigate the involvement of the chitin synthase gene, chsC, in morphogenesis and citric acid production in A. niger, an RNAi system was constructed to silence chsC and the morphological mutants were screened after transformation. The compactness of the mycelial pellets was obviously reduced in the morphological mutants, with lower proportion of dispersed mycelia. These morphological changes have caused a decrease in viscosity and subsequent improvement in oxygen and mass transfer efficiency, which may be conducive for citric acid accumulation. All the transformants exhibited improvements in citric acid production; in particular, chsC-3 showed 42.6% higher production than the original strain in the shake flask. Moreover, the high-yield strain chsC-3 exhibited excellent citric acid production potential in the scale-up process.The citric acid yield and the conversion rate of glucose of chsC-3 were both improved by 3.6%, when compared with that of the original strain in the stirred tank bioreactor.
Mono-(2-Ethylhexyl Phthalate Promotes Pro-Labor Gene Expression in the Human Placenta.
Directory of Open Access Journals (Sweden)
Ximi K Wang
Full Text Available Women exposed to phthalates during pregnancy are at increased risk for delivering preterm, but the mechanism behind this relationship is unknown. Placental corticotropin-releasing hormone (CRH and cyclooxygenase-2 (COX-2 are key mediators of parturition and are regulated by the non-canonical NF-kB (RelB/p52 signaling pathway. In this study, we demonstrate that one of the major phthalate metabolites, mono-(2-ethylhexyl-phthalate (MEHP, increased CRH and COX-2 mRNA and protein abundance in a dose-dependent manner in primary cultures of cytotrophoblast. This was coupled with an increase in nuclear import of RelB/p52 and its association with the CRH and COX-2 promoters. Silencing of NF-kB inducing kinase, a central signaling component of the non-canonical NF-kB pathway, blocked MEHP-induced upregulation of CRH and COX-2. These results suggest a potential mechanism mediated by RelB/p52 by which phthalates could prematurely induce pro-labor gene activity and lead to preterm birth.
Directory of Open Access Journals (Sweden)
Mehdi Aghamohammadi
2017-04-01
Full Text Available One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not a mere theory, but rather a phenomenon from which we can get practical benefits. I believe silence is an eye, eye of knowledge. We can broaden our knowledge of the world through silence. To convey the idea that silence is an eye, I have concocted the word slence, where has replaced the letter i and stands for the eye. This means knowledge can enable us to see, thereby acquiring knowledge of, what used to be invisible, and accordingly unknowable. In other words, through silence, we can achieve a certain type of literacy. I substantiate this claim by exploring the Horus myth, Ojo de Dios, John Cage’s 4' 33", the nature of Expressionist paintings, Hinduism, thoughts of Hermes Trismegistus and Ibn al-Arabi, and practices of Mohammad, the prophet of Islam.
Deng, Changchun; Lipstein, Mark R; Scotto, Luigi; Jirau Serrano, Xavier O; Mangone, Michael A; Li, Shirong; Vendome, Jeremie; Hao, Yun; Xu, Xiaoming; Deng, Shi-Xian; Realubit, Ronald B; Tatonetti, Nicholas P; Karan, Charles; Lentzsch, Suzanne; Fruman, David A; Honig, Barry; Landry, Donald W; O'Connor, Owen A
2017-01-05
Phosphoinositide 3-kinase (PI3K) and the proteasome pathway are both involved in activating the mechanistic target of rapamycin (mTOR). Because mTOR signaling is required for initiation of messenger RNA translation, we hypothesized that cotargeting the PI3K and proteasome pathways might synergistically inhibit translation of c-Myc. We found that a novel PI3K δ isoform inhibitor TGR-1202, but not the approved PI3Kδ inhibitor idelalisib, was highly synergistic with the proteasome inhibitor carfilzomib in lymphoma, leukemia, and myeloma cell lines and primary lymphoma and leukemia cells. TGR-1202 and carfilzomib (TC) synergistically inhibited phosphorylation of the eukaryotic translation initiation factor 4E (eIF4E)-binding protein 1 (4E-BP1), leading to suppression of c-Myc translation and silencing of c-Myc-dependent transcription. The synergistic cytotoxicity of TC was rescued by overexpression of eIF4E or c-Myc. TGR-1202, but not other PI3Kδ inhibitors, inhibited casein kinase-1 ε (CK1ε). Targeting CK1ε using a selective chemical inhibitor or short hairpin RNA complements the effects of idelalisib, as a single agent or in combination with carfilzomib, in repressing phosphorylation of 4E-BP1 and the protein level of c-Myc. These results suggest that TGR-1202 is a dual PI3Kδ/CK1ε inhibitor, which may in part explain the clinical activity of TGR-1202 in aggressive lymphoma not found with idelalisib. Targeting CK1ε should become an integral part of therapeutic strategies targeting translation of oncogenes such as c-Myc. © 2017 by The American Society of Hematology.
RelEx: Visualization for Actively Changing Overlay Network Specifications.
Sedlmair, M; Frank, A; Munzner, T; Butz, A
2012-12-01
We present a network visualization design study focused on supporting automotive engineers who need to specify and optimize traffic patterns for in-car communication networks. The task and data abstractions that we derived support actively making changes to an overlay network, where logical communication specifications must be mapped to an underlying physical network. These abstractions are very different from the dominant use case in visual network analysis, namely identifying clusters and central nodes, that stems from the domain of social network analysis. Our visualization tool RelEx was created and iteratively refined through a full user-centered design process that included a full problem characterization phase before tool design began, paper prototyping, iterative refinement in close collaboration with expert users for formative evaluation, deployment in the field with real analysts using their own data, usability testing with non-expert users, and summative evaluation at the end of the deployment. In the summative post-deployment study, which entailed domain experts using the tool over several weeks in their daily practice, we documented many examples where the use of RelEx simplified or sped up their work compared to previous practices.
Lu, Sha; Yin, Xiaoyan; Spollen, William; Zhang, Ning; Xu, Dong; Schoelz, James; Bilyeu, Kristin; Zhang, Zhanyuan J
2015-01-01
In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.
Tagakiusamine ja kirjutamiskunst / Leo Strauss ; järelsõna Jüri Lipping
Strauss, Leo, 1899-1973
2000-01-01
Ajalooliste tekstide ridade vahele peidetud sõnumi lugemisest. Tsensuuri mõjust filosoofilistele tekstidele. Peidetud sõnumi lugemisest lähtuvast erinevusest eelmoodsate ja uusaegsete filosoofide teostes. Jüri Lipping'u järelsõna Leo Straussi filosoofilistest vaadetest.
Natürel Zeytinyağındaki Uçucu Aroma Bileşenleri ve Duyusal Kalite Üzerine Etkileri
Directory of Open Access Journals (Sweden)
Dilşat Bozdoğan Konuşkan
2015-02-01
Full Text Available Natürel zeytinyağında bulunan uçucu aroma bileşenlerinin, zeytinyağının lezzet ve aroması üzerine etkisi oldukça önemlidir. Zeytinyağında 280’e yakın uçucu bileşen tespit edilmiş olup, bunlardan 70 kadarının aromaya direkt etkisi olduğu belirlenmiş ve zeytinyağında lezzetten sorumlu grup olarak tanımlanmıştır. Zeytinyağındaki uçucu aroma bileşenlerinin kompozisyonu, başta enzimatik reaksiyonlar olmak üzere, çevresel ve teknolojik faktörlere bağlı olarak değişmektedir. Yüksek kalitedeki zeytinyağlarında bulunan 5 ve 6 karbonlu bileşenler ile özellikle 6 karbonlu uçucu bileşenler, toplam uçucu bileşenlerin % 60-80’ini oluşturmaktadır. Natürel zeytinyağında algılanan meyvemsi, acı-yakıcı (bitter ve keskin-buruk tatlar, duyusal kaliteyi olumlu yönde etkileyerek, tüketici beğenisini sağlamaktadır. Bu çalışmada, natürel zeytinyağında bulunan uçucu aroma bileşenleri ve oluşumları üzerinde etkili olan faktörler ile bunların yağın duyusal kalitesi üzerine olan etkileri üzerinde durulmuştur.
Insights on ornithine decarboxylase silencing as a potential strategy for targeting retinoblastoma.
Muthukumaran, Sivashanmugam; Bhuvanasundar, Renganathan; Umashankar, Vetrivel; Sulochana, K N
2018-02-01
Ornithine Decarboxylase (ODC) is a key enzyme involved in polyamine synthesis and is reported to be up regulated in several cancers. However, the effect of ODC gene silencing in retinoblastoma is to be understood for utilization in therapeutic applications. Hence, in this study, a novel siRNA (small interference RNA) targeting ODC was designed and validated in Human Y79 retinoblastoma cells for its effects on intracellular polyamine levels, Matrix Metalloproteinase 2 & 9 activity and Cell cycle. The designed siRNA showed efficient silencing of ODC mRNA expression and protein levels in Y79 cells. It also showed significant reduction of intracellular polyamine levels and altered levels of oncogenic LIN28b expression. By this study, a regulatory loop is proposed, wherein, ODC silencing in Y79 cells to result in decreased polyamine levels, thereby, leading to altered protein levels of Lin28b, MMP-2 and MMP-9, which falls in line with earlier studies in neuroblastoma. Thus, by this study, we propose ODC silencing as a prospective strategy for targeting retinoblastoma. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Phenotyping of VIGS-mediated gene silencing in rice using a vector derived from a DNA virus.
Kant, Ravi; Dasgupta, Indranil
2017-07-01
Target genes in rice can be optimally silenced if inserted in antisense or hairpin orientation in the RTBV-derived VIGS vector and plants grown at 28 °C and 80% humidity after inoculation. Virus induced gene silencing (VIGS) is a method used to transiently silence genes in dicot as well as monocot plants. For the important monocot species rice, the Rice tungro bacilliform virus (RTBV)-derived VIGS system (RTBV-VIGS), which uses agroinoculation to initiate silencing, has not been standardized for optimal use. Here, using RTBV-VIGS, three sets of conditions were tested to achieve optimal silencing of the rice marker gene phytoene desaturase (pds). The effect of orientation of the insert in the RTBV-VIGS plasmid (sense, antisense and hairpin) on the silencing of the target gene was then evaluated using rice magnesium chelatase subunit H (chlH). Finally, the rice Xa21 gene, conferring resistance against bacterial leaf blight disease (BLB) was silenced using RTBV-VIGS system. In each case, real-time PCR-based assessment indicated approximately 40-80% fall in the accumulation levels of the transcripts of pds, chlH and Xa21. In the case of pds, the appearance of white streaks in the emerging leaves, and for chlH, chlorophyll levels and F v /F m ratio were assessed as phenotypes for silencing. For Xa21, the resistance levels to BLB were assessed by measuring the lesion length and the percent diseased areas of leaves, following challenge inoculation with Xanthomonas oryzae. In each case, the RTBV-MVIGS system gave rise to a discernible phenotype indicating the silencing of the respective target gene using condition III (temperature 28 °C, humidity 80% and 1 mM MES and 20 µM acetosyringone in secondary agrobacterium culture), which revealed the robustness of this gene silencing system for rice.
Silencing cinema: film censorship around the world
Biltereyst, Daniël; Vande Winkel, Roel
2013-01-01
Why does oppression by censorship affect the film industry far more frequently than any other mass media? "Silencing Cinema" brings together the key issues and authors to examine instances of film censorship throughout the world. Including essays by some of today's leading film historians, the book offers groundbreaking historical research on film censorship in major film production countries, including the United States, the United Kingdom, Russia/Soviet Union, India, China, and Nigeria, amo...
Luo, X; Sando, J J
1997-05-02
Two tyrosine phosphoproteins in phorbol ester-sensitive EL4 (S-EL4) mouse thymoma cells have been identified as the p120 c-Cbl protooncogene product and the p85 subunit of phosphatidylinositol 3-kinase. Tyrosine phosphorylation of p120 and p85 increased rapidly after phorbol ester stimulation. Phorbol ester-resistant EL4 (R-EL4) cells expressed comparable amounts of c-Cbl and phosphatidylinositol 3-kinase protein but greatly diminished tyrosine phosphorylation. Co-immunoprecipitation experiments revealed complexes of c-Cbl with p85, and of p85 with the tyrosine kinase Lck in phorbol ester-stimulated S-EL4 but not in unstimulated S-EL4 or in R-EL4 cells. In vitro binding of c-Cbl with Lck SH2 or SH3 domains was detected in both S-EL4 and R-EL4 cells, suggesting that c-Cbl, p85, and Lck may form a ternary complex. In vitro kinase assays revealed phosphorylation of p85 by Lck only in phorbol ester-stimulated S-EL4 cells. Collectively, these results suggest that Cbl-p85 and Lck-p85 complexes may form in unstimulated S-EL4 and R-EL4 cells but were not detected due to absence of tyrosine phosphorylation of p85. Greatly decreased tyrosine phosphorylation of c-Cbl and p85 in the complexes may contribute to the failure of R-EL4 cells to respond to phorbol ester.
Li, Airong; Hooli, Basavaraj; Mullin, Kristina; Tate, Rebecca E; Bubnys, Adele; Kirchner, Rory; Chapman, Brad; Hofmann, Oliver; Hide, Winston; Tanzi, Rudolph E
2017-04-15
SOX5 encodes a transcription factor that is expressed in multiple tissues including heart, lung and brain. Mutations in SOX5 have been previously found in patients with amyotrophic lateral sclerosis (ALS) and developmental delay, intellectual disability and dysmorphic features. To characterize the neuronal role of SOX5, we silenced the Drosophila ortholog of SOX5, Sox102F, by RNAi in various neuronal subtypes in Drosophila. Silencing of Sox102F led to misorientated and disorganized michrochaetes, neurons with shorter dendritic arborization (DA) and reduced complexity, diminished larval peristaltic contractions, loss of neuromuscular junction bouton structures, impaired olfactory perception, and severe neurodegeneration in brain. Silencing of SOX5 in human SH-SY5Y neuroblastoma cells resulted in a significant repression of WNT signaling activity and altered expression of WNT-related genes. Genetic association and meta-analyses of the results in several large family-based and case-control late-onset familial Alzheimer's disease (LOAD) samples of SOX5 variants revealed several variants that show significant association with AD disease status. In addition, analysis for rare and highly penetrate functional variants revealed four novel variants/mutations in SOX5, which taken together with functional prediction analysis, suggests a strong role of SOX5 causing AD in the carrier families. Collectively, these findings indicate that SOX5 is a novel candidate gene for LOAD with an important role in neuronal function. The genetic findings warrant further studies to identify and characterize SOX5 variants that confer risk for AD, ALS and intellectual disability. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
How Silent is the Right to Silence?
Directory of Open Access Journals (Sweden)
Katherine Biber
2012-11-01
Full Text Available A long-held and fundamental principle of our criminal justice system is that people accused of crimes have a right to silence, arising from the presumption of innocence. Rules of evidence try to protect this ‘right’ during trial, by ensuring that juries understand that adverse inferences cannot be drawn from the silence of the accused. Silence, in court, can mean nothing, and we are not to speculate about what might motivate an accused person to remain silent, or what they might have said had they spoken. However, an examination of the jurisprudence in this area shows that the law is often not dealing with actual silence; sometimes when the law refers to the ‘right to silence’, it seems to mean a ‘refusal to hear’. In other instances, there is actual silence, and yet the law refuses to subject that silence to any critical interpretation, insisting that we cannot infer anything from it. While we have learned, from theatre, music, linguistics, religion and psychology, to develop sophisticated means for interpreting silence, the law demands that we set aside these interpretive tools, hearing silence that isn’t there, and inferring nothing about something.
Post-Translational Modifications of RelB NF-κB Subunit and Associated Functions
Directory of Open Access Journals (Sweden)
Véronique Baud
2016-05-01
Full Text Available The family of NF-κB transcription factors plays a key role in diverse biological processes, such as inflammatory and immune responses, cell survival and tumor development. Beyond the classical NF-κB activation pathway, a second NF-κB pathway has more recently been uncovered, the so-called alternative NF-κB activation pathway. It has been shown that this pathway mainly controls the activity of RelB, a member of the NF-κB family. Post-translational modifications, such as phosphorylation, acetylation, methylation, ubiquitination and SUMOylation, have recently emerged as a strategy for the fine-tuned regulation of NF-κB. Our review discusses recent progress in the understanding of RelB regulation by post-translational modifications and the associated functions in normal and pathological conditions.
Zago, Michela; Rico de Souza, Angela; Hecht, Emelia; Rousseau, Simon; Hamid, Qutayba; Eidelman, David H; Baglole, Carolyn J
2014-04-21
Diseases due to cigarette smoke exposure, including chronic obstructive pulmonary disease (COPD) and lung cancer, are associated with chronic inflammation typified by the increased expression of cyclooxygenase-2 (COX-2) protein. RelB is an NF-κB family member that suppresses cigarette smoke induction of COX-2 through an unknown mechanism. The ability of RelB to regulate COX-2 expression may be via miR-146a, a miRNA that attenuates COX-2 in lung fibroblasts. In this study we tested whether RelB attenuation of cigarette smoke-induced COX-2 protein is due to miR-146a. Utilizing pulmonary fibroblasts deficient in RelB expression, together with siRNA knock-down of RelB, we show the essential role of RelB in diminishing smoke-induced COX-2 protein expression despite robust activation of the canonical NF-κB pathway and subsequent induction of Cox-2 mRNA. RelB did not regulate COX-2 protein expression at the level of mRNA stability. Basal levels of miR-146a were significantly lower in Relb-deficient cells and cigarette smoke increased miR-146a expression only in Relb-expressing cells. Inhibition of miR-146a had no effects on Relb expression or induction of Cox-2 mRNA by cigarette smoke but significantly increased COX-2 protein. These data highlight the potential of a RelB-miR-146a axis as a novel regulatory pathway that attenuates inflammation in response to respiratory toxicants. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Gas turbine exhaust system silencing design
International Nuclear Information System (INIS)
Ozgur, D.
1991-01-01
Gas turbines are the preferred prime mover in many applications because of their high efficiency, fuel flexibility, and low environmental impact. A typical mid-size machine might have a power rating of 80 MW, a flow of about 1000 kg/hr, and an exhaust temperature of over 500C. The most powerful single source of noise is generally the exhaust, which may generate over a kilowatt of acoustic energy. This paper reports that there are two important ways in which exhaust systems can radiate noise. The first is through the discharge of the exhaust duct, with the exhaust gas. Because of the large quantity of hot gas, the duct exit is always oriented vertically; it may be fairly high in the air in order to promote dispersion of the exhaust plume. This source is almost always attenuated by means of a silencer located somewhere in the ductwork. The second source of noise is often called breakout; it is the radiation of exhaust noise through the walls of the ducting. Breakout is most important for those sections of the exhaust duct which lie upstream of the silencer, where sound levels inside the ducting are highest. Both exhaust duct exit noise and breakout noise can be calculated from the sound power level of the gas turbine exhaust and the sound transmission loss (TL) of the silencer and ducting
Directory of Open Access Journals (Sweden)
Philippe Lashermes
2016-09-01
Full Text Available Allopolyploidization is a biological process that has played a major role in plant speciation and evolution. Genomic changes are common consequences of polyploidization, but their dynamics over time are still poorly understood. Coffea arabica, a recently formed allotetraploid, was chosen to study genetic changes that accompany allopolyploid formation. Both RNA-seq and DNA-seq data were generated from two genetically distant C. arabica accessions. Genomic structural variation was investigated using C. canephora, one of its diploid progenitors, as reference genome. The fate of 9047 duplicate homeologous genes was inferred and compared between the accessions. The pattern of SNP density along the reference genome was consistent with the allopolyploid structure. Large genomic duplications or deletions were not detected. Two homeologous copies were retained and expressed in 96% of the genes analyzed. Nevertheless, duplicated genes were found to be affected by various genomic changes leading to homeolog loss or silencing. Genetic and epigenetic changes were evidenced that could have played a major role in the stabilization of the unique ancestral allotetraploid and its subsequent diversification. While the early evolution of C. arabica mainly involved homeologous crossover exchanges, the later stage appears to have relied on more gradual evolution involving gene conversion and homeolog silencing.
Judicial review of administrative silence
Directory of Open Access Journals (Sweden)
Radošević Ratko S.
2015-01-01
Full Text Available Administrative silence is a situation in which the competent authority, within the statutory deadline, has not issued an administrative act at the request of the party. In the case of administrative silence, given the fact that the citizens are unable to protect their rights and legal interests without an administrative act, they are provided with legal protection. In this case, the same legal relationship is created, directly on the basis of the statute, as in the situation in which the party's request is rejected. This means that the party may, under the conditions prescribed by the statute, initiate the procedure of judicial review of administrative silence. In the paper, the author explains the conditions under which the judicial review of administrative silence can be initiated and the role of the court in this judicial procedure.
Durability of timber silencers at Wairakei geothermal steam field
Energy Technology Data Exchange (ETDEWEB)
Hedley, M E
1979-02-01
After early failures of reinforced concrete silencers and because of high costs of concrete-lined steel structures, preliminary tests were undertaken to assess the suitability of timber for silencer construction. Tests indicated that radiata pine treated with pentachlorophenol/oil or untreated red beech had most potential for timber silencer fabrication. One prototype silencer of each material was constructed and both were installed on operational bores in 1965. The red beech silencer had a service life of 4 years. The radiata pine silencer operated for 12/sup 1///sub 2/ years, although replacement had been recommended 1 year before this time expired. The performance of this silencer encouraged the general use of timber for silencer construction and further units were built. Procurement of satisfactory grades of timber has proved difficult and has limited silencer fabrication. Ways of improving timber supply, which require modification of silencer design, are discussed.
Directory of Open Access Journals (Sweden)
Sha Lu
Full Text Available In the past decade, RNA silencing has gained significant attention because of its success in genomic scale research and also in the genetic improvement of crop plants. However, little is known about the molecular basis of siRNA processing in association with its target transcript. To reveal this process for improving hpRNA-mediated gene silencing in crop plants, the soybean GmFAD3 gene family was chosen as a test model. We analyzed RNAi mutant soybean lines in which three members of the GmFAD3 gene family were silenced. The silencing levels of FAD3A, FAD3B and FAD3C were correlated with the degrees of sequence homology between the inverted repeat of hpRNA and the GmFAD3 transcripts in the RNAi lines. Strikingly, transgenes in two of the three RNAi lines were heavily methylated, leading to a dramatic reduction of hpRNA-derived siRNAs. Small RNAs corresponding to the loop portion of the hairpin transcript were detected while much lower levels of siRNAs were found outside of the target region. siRNAs generated from the 318-bp inverted repeat were found to be diced much more frequently at stem sequences close to the loop and associated with the inferred cleavage sites on the target transcripts, manifesting "hot spots". The top candidate hpRNA-derived siRNA share certain sequence features with mature miRNA. This is the first comprehensive and detailed study revealing the siRNA-mediated gene silencing mechanism in crop plants using gene family GmFAD3 as a test model.
Guha, Manti; Fang, Ji-Kang; Monks, Robert; Birnbaum, Morris J; Avadhani, Narayan G
2010-10-15
Mitochondrial respiratory stress (also called mitochondrial retrograde signaling) activates a Ca(2+)/calcineurin-mediated signal that culminates in transcription activation/repression of a large number of nuclear genes. This signal is propagated through activation of the regulatory proteins NFκB c-Rel/p50, C/EBPδ, CREB, and NFAT. Additionally, the heterogeneous ribonucleoprotein A2 (hnRNPA2) functions as a coactivator in up-regulating the transcription of Cathepsin L, RyR1, and Glut-4, the target genes of stress signaling. Activation of IGF1R, which causes a metabolic switch to glycolysis, cell invasiveness, and resistance to apoptosis, is a phenotypic hallmark of C2C12 myoblasts subjected to mitochondrial stress. In this study, we report that mitochondrial stress leads to increased expression, activation, and nuclear localization of Akt1. Mitochondrial respiratory stress also activates Akt1-gene expression, which involves hnRNPA2 as a coactivator, indicating a complex interdependency of these two factors. Using Akt1(-/-) mouse embryonic fibroblasts and Akt1 mRNA-silenced C2C12 cells, we show that Akt1-mediated phosphorylation is crucial for the activation and recruitment of hnRNPA2 to the enhanceosome complex. Akt1 mRNA silencing in mtDNA-depleted cells resulted in reversal of the invasive phenotype, accompanied by sensitivity to apoptotic stimuli. These results show that Akt1 is an important regulator of the nuclear transcriptional response to mitochondrial stress.
Thermodynamic control of small RNA-mediated gene silencing
Directory of Open Access Journals (Sweden)
Kumiko eUi-Tei
2012-06-01
Full Text Available Small interfering RNAs (siRNAs and microRNAs (miRNAs are crucial regulators of posttranscriptional gene silencing, which is referred to as RNA interference (RNAi or RNA silencing. In RNAi, siRNA loaded onto the RNA-induced silencing complex (RISC downregulates target gene expression by cleaving mRNA whose sequence is perfectly complementary to the siRNA guide strand. We previously showed that highly functional siRNAs possessed the following characteristics: A or U residues at nucleotide position 1 measured from the 5’ terminal, four to seven A/Us in positions 1–7, and G or C residues at position 19. This finding indicated that an RNA strand with a thermodynamically unstable 5’ terminal is easily retained in the RISC and functions as a guide strand. In addition, it is clear that unintended genes with complementarities only in the seed region (positions 2–8 are also downregulated by off-target effects. siRNA efficiency is mainly determined by the Watson-Crick base-pairing stability formed between the siRNA seed region and target mRNA. siRNAs with a low seed-target duplex melting temperature (Tm have little or no seed-dependent off-target activity. Thus, important parts of the RNA silencing machinery may be regulated by nucleotide base-pairing thermodynamic stability. A mechanistic understanding of thermodynamic control may enable an efficient target gene-specific RNAi for functional genomics and safe therapeutic applications.
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...
International Nuclear Information System (INIS)
Hwang, Insun; Ha, Danbee; Ahn, Ginnae; Park, Eunjin; Joo, Haejin; Jee, Youngheun
2011-01-01
Highlights: → The phosphorylation of RelA's inhibitory factor IκB and subsequent RelA activation are important to the disease process of EAE. → The expression of RelA and phospho-IκB was markedly increased in the initiation and during the progression of EAE. → TPCK-treated EAE mice showed lower incidence of EAE with less severe symptoms and quicker recovery than vehicle-treated EAE mice. → TPCK significantly suppressed the MOG 35-55 -specific T cell proliferation by reducing the production of IFN-γ and IL-17 cytokines in EAE. → The NF-κB cascade's activity increased gradually with the development of symptoms and brain pathology of EAE. -- Abstract: Recently emerging evidence that the NF-κB family plays an important role in autoimmune disease has produced very broad and sometimes paradoxical conclusions. In the present study, we elucidated that the activation of RelA (p65) of NF-κB and IκB dissociation assumes a distinct role in experimental autoimmune encephalomyelitis (EAE) progression by altering IκB phosphorylation and/or degradation. In the present study of factors that govern EAE, the presence and immunoreactivity of nuclear RelA and phospho-IκB were recorded at the initiation and peak stage, and degradation of IκBα progressed rapidly at an early stage then stabilized during recovery. The immunoreactivity to RelA and phospho-IκB occurred mainly in inflammatory cells and microglial cells but only slightly in astrocytes. Subsequently, the blockade of IκB dissociation from NF-κB reduced the severity of disease by decreasing antigen-specific T cell response and production of IL-17 in EAE. Thus, blocking the dissociation of IκB from NF-κB can be utilized as a strategy to inhibit the NF-κB signal pathway thereby to reduce the initiation, progression, and severity of EAE.
Honsa, Erin S; Cooper, Vaughn S; Mhaissen, Mohammed N; Frank, Matthew; Shaker, Jessica; Iverson, Amy; Rubnitz, Jeffrey; Hayden, Randall T; Lee, Richard E; Rock, Charles O; Tuomanen, Elaine I; Wolf, Joshua; Rosch, Jason W
2017-01-03
Serious bacterial infections in immunocompromised patients require highly effective antibacterial therapy for cure, and thus, this setting may reveal novel mechanisms by which bacteria circumvent antibiotics in the absence of immune pressure. Here, an infant with leukemia developed vancomycin-resistant Enterococcus faecium (VRE) bacteremia that persisted for 26 days despite appropriate antibiotic therapy. Sequencing of 22 consecutive VRE isolates identified the emergence of a single missense mutation (L152F) in relA, which constitutively activated the stringent response, resulting in elevated baseline levels of the alarmone guanosine tetraphosphate (ppGpp). Although the mutant remained susceptible to both linezolid and daptomycin in clinical MIC testing and during planktonic growth, it demonstrated tolerance to high doses of both antibiotics when growing in a biofilm. This biofilm-specific gain in resistance was reflected in the broad shift in transcript levels caused by the mutation. Only an experimental biofilm-targeting ClpP-activating antibiotic was able to kill the mutant strain in an established biofilm. The relA mutation was associated with a fitness trade-off, forming smaller and less-well-populated biofilms on biological surfaces. We conclude that clinically relevant relA mutations can emerge during prolonged VRE infection, causing baseline activation of the stringent response, subsequent antibiotic tolerance, and delayed eradication in an immunocompromised state. The increasing prevalence of antibiotic-resistant bacterial pathogens is a major challenge currently facing the medical community. Such pathogens are of particular importance in immunocompromised patients as these individuals may favor emergence of novel resistance determinants due to lack of innate immune defenses and intensive antibiotic exposure. During the course of chemotherapy, a patient developed prolonged bacteremia with vancomycin-resistant Enterococcus faecium that failed to clear
Breaching cultural silence: enhancing resilience among Ugandan ...
African Journals Online (AJOL)
Cultural silence is frequently the outcome of deep-seated taboos regarding adults talking to children about sex and death. This paper examines the impact of cultural silence on the resilience of children orphaned by AIDS in Uganda. Cultural silence is often linked with denial. This article explores the complexities of cultural ...
Lanucara, Francesco; Lam, Connie; Mann, Jelena; Monie, Tom P; Colombo, Stefano A P; Holman, Stephen W; Boyd, James; Dange, Manohar C; Mann, Derek A; White, Michael R H; Eyers, Claire E
2016-07-01
The NF-κB signalling module controls transcription through a network of protein kinases such as the IKKs, as well as inhibitory proteins (IκBs) and transcription factors including RelA/p65. Phosphorylation of the NF-κB subunits is critical for dictating system dynamics. Using both non-targeted discovery and quantitative selected reaction monitoring-targeted proteomics, we show that the cytokine TNFα induces dynamic multisite phosphorylation of RelA at a number of previously unidentified residues. Putative roles for many of these phosphorylation sites on RelA were predicted by modelling of various crystal structures. Stoichiometry of phosphorylation determination of Ser45 and Ser42 revealed preferential early phosphorylation of Ser45 in response to TNFα. Quantitative analyses subsequently confirmed differential roles for pSer42 and pSer45 in promoter-specific DNA binding and a role for both of these phosphosites in regulating transcription from the IL-6 promoter. These temporal dynamics suggest that RelA-mediated transcription is likely to be controlled by functionally distinct NF-κB proteoforms carrying different combinations of modifications, rather than a simple 'one modification, one effect' system. © 2016 The Authors.
Directory of Open Access Journals (Sweden)
Laura Labonté
Full Text Available Chronic obstructive pulmonary disease (COPD exacerbations are acute events of worsened respiratory symptoms and enhanced inflammation partly mediated by NF-κB activation. RelB, an NF-κB family member, suppresses cigarette smoke-induced inflammation but its expression in COPD is unknown. Moreover, there is no information on its association with clinical features of COPD. The objectives of this study were to assess RelB expression relative to markers of inflammation as well as its association with cardiovascular and pulmonary features of COPD patients at stable-state and exacerbation.Data from 48 COPD patients were analyzed. Blood samples were collected from stable-state and exacerbating patients. After RNA isolation, quantitative real-time polymerase chain reaction (qRT-PCR was performed to assess RelB, Cox-2, IL-8 and IL-1β mRNA expression and their associations with measured clinical variables.Of the 48 COPD subjects, 18 were in stable-state and 30 were in exacerbation. RelB mRNA expression was lower than that of Cox-2, IL-8, and IL-1β in all cases (all p<0.001, except for IL-8 at exacerbation (p = 0.22. Cox-2, IL-8 and IL-1β were significantly associated with clinical features of patients in both stable-state and at exacerbation. There was no association with RelB expression and any clinical features in COPD subjects at stable-state. RelB mRNA levels were significantly associated with cardiovascular events such as systolic blood pressure during exacerbation.RelB mRNA expression is lower than that of the other inflammatory mediators. Expression of Cox-2, IL-8 and IL-1β were related to clinical features in both stable-state and at exacerbation. However, RelB expression was associated with clinical features of patients only during exacerbation, suggesting that RelB may represent a novel marker of health outcomes, in particular cardiovascular, during exacerbation in COPD.
Anu, K; Jessymol, K K; Chidambareswaren, M; Gayathri, G S; Manjula, S
2015-06-01
Piper colubrinum Link., a distant relative of Piper nigrum L., is immune to the oomycete pathogen Phytophthora capsici Leonian that causes 'quick wilt' in cultivated black pepper (P. nigrum). The osmotin, PR5 gene homologue, earlier identified from P. colubrinum, showed significant overexpression in response to pathogen and defense signalling molecules. The present study focuses on the functional validation of P. colubrinum osmotin (PcOSM) by virus induced gene silencing (VIGS) using Tobacco Rattle Virus (TRV)-based vector. P. colubrinum plants maintained under controlled growth conditions in a growth chamber were infiltrated with Agrobacterium carrying TRV empty vector (control) and TRV vector carrying PcOSM. Three weeks post infiltration, viral movement was confirmed in newly emerged leaves of infiltrated plants by RT-PCR using TRV RNA1 and TRV RNA2 primers. Semi-quantitative RT-PCR confirmed significant down-regulation of PcOSM gene in TRV-PcOSM infiltrated plant compared with the control plants. The control and silenced plants were challenged with Phytophthora capsici which demonstrated that knock-down of PcOSM in P. colubrinum leads to increased fungal mycelial growth in silenced plants compared to control plants, which was accompanied by decreased accumulation of H2O2 as indicated by 3,3'-diaminobenzidine (DAB) staining. Thus, in this study, we demonstrated that Piper colubrinum osmotin gene is required for resisting P. capsici infection and has possible role in hypersensitive cell death response and oxidative burst signaling during infection.
Organizational Silence in Sports Employees
Bastug, Gulsum; Pala, Adem; Yilmaz, Taner; Duyan, Mehdi; Gunel, Ilker
2016-01-01
Organizational silence can be defined as a way of behaviour belonging to men and women employees in the organization exhibited without reflecting their feelings, ideas, concerns and suggestions related with their workplaces, works for which they are responsible or other activities of the organization. In the period of organizational silence,…
Organizational Silence, from Roots to Solutions: A Case Study in Iran Petroleum Industry
Directory of Open Access Journals (Sweden)
Mehdi Afkhami Ardakani
2015-05-01
Full Text Available Organizational silence is defined as the lack of effective interactions among staff and it stands opposite to the concept of organizational voice. In the present research, the purpose is to measure the silence behavior among the Research Institute of Petroleum Industry (RIPI staff before and after the implementation of a comprehensive suggestion system. A suggestion system is an internal structure easily accessed by all the staff to state their suggestions in a pre-structured format. The roots of silence behavior are studied based on a deep literature review to find out possible solutions to improve organizational voice. To conduct the research, a self-structured questionnaire has been developed and distributed among all the staff. A quasi-experimental methodology has been adopted to compare pretest and post-test results of silence status before and after implementing the suggestion system. The results show that the silence behavior has been meaningfully reduced. This is based on a simple t-test performed by SPSS software, where there is a meaningful difference between the silence status of pre-test and post-test. In other words, a suggestion system could be a communication opportunity to encourage staff to provide suggestions and to cooperate for promoting the organization, which will finally reduce the organization silence. A major gap within the studies of Iranian scholars about organizational silence is the failure to introduce effective solutions to reduce it. However, this research is innovative in the sense that it fills the mentioned gap. This research shows that large scale organizations like RIPI need to consider methods like suggestion systems to break bureaucratic obstacles so that their staff can easily find open routes to share their ideas and suggestions in a prestructured format. This cooperating will lead to mutual benefits for both parts, since suggestions could be used to enhance organizational structure and performance and
Aghamohammadi, Mehdi
2017-01-01
One of the conspicuous features of the twentieth-century West was silence. This idea could be supported by examining reflections of Ludwig Wittgenstein, Fritz Mauthner, John Cage, Samuel Beckett, Ihab Hassan, Franz Kafka, Wassily Kandinsky, Jean-Paul Sartre, Virginia Woolf, Wolfgang Iser, Jacques Derrida, and Pierre Macherey. To me, silence is not…
International Nuclear Information System (INIS)
Fusaro, Adriana F.; Correa, Regis L.; Nakasugi, Kenlee; Jackson, Craig; Kawchuk, Lawrence; Vaslin, Maite F.S.; Waterhouse, Peter M.
2012-01-01
The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0 PE , in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0 PE has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0 PE destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.
Energy Technology Data Exchange (ETDEWEB)
Fusaro, Adriana F. [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Correa, Regis L. [CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia); Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Nakasugi, Kenlee; Jackson, Craig [University of Sydney, NSW 2006 (Australia); Kawchuk, Lawrence [Research Centre, Agriculture and Agri-Food Canada, Lethbridge, AB T1J4B1 (Canada); Vaslin, Maite F.S. [Depto. de Virologia, IMPPG, UFRJ, 21941-902 (Brazil); Waterhouse, Peter M., E-mail: peter.waterhouse@sydney.edu.au [University of Sydney, NSW 2006 (Australia); CSIRO Plant Industry, Canberra, P.O. Box 1600, ACT 2601 (Australia)
2012-05-10
The P0 protein of poleroviruses and P1 protein of sobemoviruses suppress the plant's RNA silencing machinery. Here we identified a silencing suppressor protein (SSP), P0{sup PE}, in the Enamovirus Pea enation mosaic virus-1 (PEMV-1) and showed that it and the P0s of poleroviruses Potato leaf roll virus and Cereal yellow dwarf virus have strong local and systemic SSP activity, while the P1 of Sobemovirus Southern bean mosaic virus supresses systemic silencing. The nuclear localized P0{sup PE} has no discernable sequence conservation with known SSPs, but proved to be a strong suppressor of local silencing and a moderate suppressor of systemic silencing. Like the P0s from poleroviruses, P0{sup PE} destabilizes AGO1 and this action is mediated by an F-box-like domain. Therefore, despite the lack of any sequence similarity, the poleroviral and enamoviral SSPs have a conserved mode of action upon the RNA silencing machinery.
Energy Technology Data Exchange (ETDEWEB)
Xu, Wei; Wang, Ting [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Hefei, Anhui, 230031 (China); Xu, Shaoxin [School of physics and materials science, Anhui University, Hefei, Anhui, 230601 (China); Li, Fanghua; Deng, Chenguang; Wu, Lijun; Wu, Yuejin [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Hefei, Anhui, 230031 (China); Bian, Po, E-mail: bianpo@ipp.ac.cn [Key Laboratory of Ion Beam Bio-engineering, Hefei Institutes of Physical Science, Chinese Academy of Sciences, P.O. Box 1138, Hefei, Anhui, 230031 (China)
2016-08-15
Highlights: • Transcriptional gene silencing (TGS) in plants can be epigenetically alleviated by volatile signals from UV-C- irradiated neighboring plants. • Alleviation of TGS can be induced by UV-C irradiation through plant–plant–plant communication. • JA and SA signals take part in interplant communication for alleviation of TGS. - Abstract: Plant stress responses at the epigenetic level are expected to allow more permanent changes of gene expression and potentially long-term adaptation. While it has been reported that plants subjected to adverse environments initiate various stress responses in their neighboring plants, little is known regarding epigenetic responses to external stresses mediated by plant–plant communication. In this study, we show that DNA repetitive elements of Arabidopsis thaliana, whose expression is inhibited epigenetically by transcriptional gene silencing (TGS) mechanism, are activated by UV-C irradiation through airborne plant–plant and plant–plant–plant communications, accompanied by DNA demethylation at CHH sites. Moreover, the TGS is alleviated by direct treatments with exogenous methyl jasmonate (MeJA) and methyl salicylate (MeSA). Further, the plant–plant and plant–plant–plant communications are blocked by mutations in the biosynthesis or signaling of jasmonic acid (JA) or salicylic acid (SA), indicating that JA and SA pathways are involved in the interplant communication for epigenetic responses. For the plant–plant–plant communication, stress cues are relayed to the last set of receiver plants by promoting the production of JA and SA signals in relaying plants, which exhibit upregulated expression of genes for JA and SA biosynthesis and enhanced emanation of MeJA and MeSA.
International Nuclear Information System (INIS)
Xu, Wei; Wang, Ting; Xu, Shaoxin; Li, Fanghua; Deng, Chenguang; Wu, Lijun; Wu, Yuejin; Bian, Po
2016-01-01
Highlights: • Transcriptional gene silencing (TGS) in plants can be epigenetically alleviated by volatile signals from UV-C- irradiated neighboring plants. • Alleviation of TGS can be induced by UV-C irradiation through plant–plant–plant communication. • JA and SA signals take part in interplant communication for alleviation of TGS. - Abstract: Plant stress responses at the epigenetic level are expected to allow more permanent changes of gene expression and potentially long-term adaptation. While it has been reported that plants subjected to adverse environments initiate various stress responses in their neighboring plants, little is known regarding epigenetic responses to external stresses mediated by plant–plant communication. In this study, we show that DNA repetitive elements of Arabidopsis thaliana, whose expression is inhibited epigenetically by transcriptional gene silencing (TGS) mechanism, are activated by UV-C irradiation through airborne plant–plant and plant–plant–plant communications, accompanied by DNA demethylation at CHH sites. Moreover, the TGS is alleviated by direct treatments with exogenous methyl jasmonate (MeJA) and methyl salicylate (MeSA). Further, the plant–plant and plant–plant–plant communications are blocked by mutations in the biosynthesis or signaling of jasmonic acid (JA) or salicylic acid (SA), indicating that JA and SA pathways are involved in the interplant communication for epigenetic responses. For the plant–plant–plant communication, stress cues are relayed to the last set of receiver plants by promoting the production of JA and SA signals in relaying plants, which exhibit upregulated expression of genes for JA and SA biosynthesis and enhanced emanation of MeJA and MeSA.
What Are Business Schools for? On Silence and Voice in Management Education.
Grey, Christopher
2002-01-01
The purpose of business schools seems not to be training effective managers but rather socializing them and legitimizing management, leading to silence about the reality of working conditions. Critical management education would expose students to problematic management issues related to gender, ethnicity, power, the environment, and others.…
Small RNA-Mediated Epigenetic Myostatin Silencing
Directory of Open Access Journals (Sweden)
Thomas C Roberts
2012-01-01
Full Text Available Myostatin (Mstn is a secreted growth factor that negatively regulates muscle mass and is therefore a potential pharmacological target for the treatment of muscle wasting disorders such as Duchenne muscular dystrophy. Here we describe a novel Mstn blockade approach in which small interfering RNAs (siRNAs complementary to a promoter-associated transcript induce transcriptional gene silencing (TGS in two differentiated mouse muscle cell lines. Silencing is sensitive to treatment with the histone deacetylase inhibitor trichostatin A, and the silent state chromatin mark H3K9me2 is enriched at the Mstn promoter following siRNA transfection, suggesting epigenetic remodeling underlies the silencing effect. These observations suggest that long-term epigenetic silencing may be feasible for Mstn and that TGS is a promising novel therapeutic strategy for the treatment of muscle wasting disorders.
Chinanteco children’s silences in different classroom situations
Directory of Open Access Journals (Sweden)
Valeria Rebolledo Angulo
2016-01-01
Full Text Available This article analyzes, from an ethnographic perspective and a sociocultural framework, the construction of silences in the interaction between students and teachers in a multilingual classroom situation in an indigenous community in méxico. the analysis reveals how the silence of the chinanteco speaking children when asked to answer certain questions in class is not always due to their failure to understand spoken and written spanish that is used in class. their silences are responses taking different meanings in specific situations. the silence of the children can be a way of resisting, a way of hiding, and, sometimes, their voices are silenced.
Yang, Guang; Hinson, Maurice D.; Bordner, Jessica E.; Lin, Qing S.; Fernando, Amal P.; La, Ping; Wright, Clyde J.
2011-01-01
Postnatal lung development requires proliferation and differentiation of specific cell types at precise times to promote proper alveolar formation. Hyperoxic exposure can disrupt alveolarization by inhibiting cell growth; however, it is not fully understood how this is mediated. The transcription factor CCAAT/enhancer binding protein-α (C/EBPα) is highly expressed in the lung and plays a role in cell proliferation and differentiation in many tissues. After 72 h of hyperoxia, C/EBPα expression was significantly enhanced in the lungs of newborn mice. The increased C/EBPα protein was predominantly located in alveolar type II cells. Silencing of C/EBPα with a transpulmonary injection of C/EBPα small interfering RNA (siRNA) prior to hyperoxic exposure reduced expression of markers of type I cell and differentiation typically observed after hyperoxia but did not rescue the altered lung morphology at 72 h. Nevertheless, when C/EBPα hyperoxia-exposed siRNA-injected mice were allowed to recover for 2 wk in room air, lung epithelial cell proliferation was increased and lung morphology was restored compared with hyperoxia-exposed control siRNA-injected mice. These data suggest that C/EBPα is an important regulator of postnatal alveolar epithelial cell proliferation and differentiation during injury and repair. PMID:21571903
Kültürel Farklılıkların Yönetiminde İnsan Kaynakları Stratejilerinin Rolü : IKEA Örneği
Helvacıoğlu, Nuray; Özutku, Hatice
2010-01-01
Günümüzde işletmelerin küreselleşme eğilimleri, işgören çeşitliliğinin ve kültürel farklılıkların artmasına neden olmaktadır. İşletmelerin rekabet üstünlüğü elde edebilmeleri için kültürel farklılıkların etkin bir biçimde yönetilmesi gerekmektedir. Bu çalışmanın amacı, kültürel farklılıkların yönetiminde insan kaynakları yönetiminin rolünün belirlenmesidir. Bu kapsamda, kültürel farklılıkların yönetiminde ön plana çıkan İsveç kökeni IKEA firmasını konu alan nitel bir araş...
Hope, Ronen; Egarmina, Katarina; Voloshin, Konstantin; Waldman Ben-Asher, Hiba; Carmi, Shai; Eliaz, Dror; Drori, Yaron; Michaeli, Shulamit
2016-10-01
Under persistent ER stress, Trypanosoma brucei parasites induce the spliced leader silencing (SLS) pathway. In SLS, transcription of the SL RNA gene, the SL donor to all mRNAs, is extinguished, arresting trans-splicing and leading to programmed cell death (PCD). In this study, we investigated the transcriptome following silencing of SEC63, a factor essential for protein translocation across the ER membrane, and whose silencing induces SLS. The proteome of SEC63-silenced cells was analyzed with an emphasis on SLS-specific alterations in protein expression, and modifications that do not directly result from perturbations in trans-splicing. One such protein identified is an atypical calpain SKCRP7.1/7.2. Co-silencing of SKCRP7.1/7.2 and SEC63 eliminated SLS induction due its role in translocating the PK3 kinase. This kinase initiates SLS by migrating to the nucleus and phosphorylating TRF4 leading to shut-off of SL RNA transcription. Thus, SKCRP7.1 is involved in SLS signaling and the accompanying PCD. The role of autophagy in SLS was also investigated; eliminating autophagy through VPS34 or ATG7 silencing demonstrated that autophagy is not essential for SLS induction, but is associated with PCD. Thus, this study identified factors that are used by the parasite to cope with ER stress and to induce SLS and PCD. © 2016 John Wiley & Sons Ltd.
Virus-induced gene silencing (VIGS) is a widely used tool for gene function studies in many plant species, though its use in monocots has been limited. Using a Brome mosaic virus (BMV) vector designed to silence the maize phytoene desaturase gene, a genetically diverse set of maize inbred lines was ...
Titration and hysteresis in epigenetic chromatin silencing
International Nuclear Information System (INIS)
Dayarian, Adel; Sengupta, Anirvan M
2013-01-01
Epigenetic mechanisms of silencing via heritable chromatin modifications play a major role in gene regulation and cell fate specification. We consider a model of epigenetic chromatin silencing in budding yeast and study the bifurcation diagram and characterize the bistable and the monostable regimes. The main focus of this paper is to examine how the perturbations altering the activity of histone modifying enzymes affect the epigenetic states. We analyze the implications of having the total number of silencing proteins, given by the sum of proteins bound to the nucleosomes and the ones available in the ambient, to be constant. This constraint couples different regions of chromatin through the shared reservoir of ambient silencing proteins. We show that the response of the system to perturbations depends dramatically on the titration effect caused by the above constraint. In particular, for a certain range of overall abundance of silencing proteins, the hysteresis loop changes qualitatively with certain jump replaced by continuous merger of different states. In addition, we find a nonmonotonic dependence of gene expression on the rate of histone deacetylation activity of Sir2. We discuss how these qualitative predictions of our model could be compared with experimental studies of the yeast system under anti-silencing drugs. (paper)
Galambos, A; Zok, A; Kuczmog, A; Oláh, R; Putnoky, P; Ream, W; Szegedi, E
2013-11-01
Grapevine rootstock transformed with an Agrobacterium oncogene-silencing transgene was resistant to certain Agrobacterium strains but sensitive to others. Thus, genetic diversity of Agrobacterium oncogenes may limit engineering crown gall resistance. Crown gall disease of grapevine induced by Agrobacterium vitis or Agrobacterium tumefaciens causes serious economic losses in viticulture. To establish crown gall-resistant lines, somatic proembryos of Vitis berlandieri × V. rupestris cv. 'Richter 110' rootstock were transformed with an oncogene-silencing transgene based on iaaM and ipt oncogene sequences from octopine-type, tumor-inducing (Ti) plasmid pTiA6. Twenty-one transgenic lines were selected, and their transgenic nature was confirmed by polymerase chain reaction (PCR). These lines were inoculated with two A. tumefaciens and three A. vitis strains. Eight lines showed resistance to octopine-type A. tumefaciens A348. Resistance correlated with the expression of the silencing genes. However, oncogene silencing was mostly sequence specific because these lines did not abolish tumorigenesis by A. vitis strains or nopaline-type A. tumefaciens C58.
Katastroofide järel heldelt lubatud abi pole alati kohale jõudnud / Kaivo Kopli
Kopli, Kaivo
2005-01-01
ÜRO peasekretär Kofi Annan kutsus üles täitma lubadusi anda abi Lõuna-Aasia tsunamis kannatanud riikidele. Artiklis tuuakse näiteid juhtumite kohta, kus looduskatastroofi järel on riikide abi jäänud lubatust väiksemaks
Choosing Silence for Equality in and through Schooling
Lees, Helen E.
2016-01-01
This article considers silences and equality as combined from a theoretical perspective. Equality in and through chosen, deliberate and regular silence experience is seen as an equaliser: if no one is speaking no one can dominate. The article uses a bifurcated concept of silence: weak, negative forms and strong, positive forms. Only the strong…
Delfosse, Verónica C; Agrofoglio, Yamila C; Casse, María F; Kresic, Iván Bonacic; Hopp, H Esteban; Ziegler-Graff, Véronique; Distéfano, Ana J
2014-02-13
Plants employ RNA silencing as a natural defense mechanism against viruses. As a counter-defense, viruses encode silencing suppressor proteins (SSPs) that suppress RNA silencing. Most, but not all, the P0 proteins encoded by poleroviruses have been identified as SSP. In this study, we demonstrated that cotton leafroll dwarf virus (CLRDV, genus Polerovirus) P0 protein suppressed local silencing that was induced by sense or inverted repeat transgenes in Agrobacterium co-infiltration assay in Nicotiana benthamiana plants. A CLRDV full-length infectious cDNA clone that is able to infect N. benthamiana through Agrobacterium-mediated inoculation also inhibited local silencing in co-infiltration assays, suggesting that the P0 protein exhibits similar RNA silencing suppression activity when expressed from the full-length viral genome. On the other hand, the P0 protein did not efficiently inhibit the spread of systemic silencing signals. Moreover, Northern blotting indicated that the P0 protein inhibits the generation of secondary but not primary small interfering RNAs. The study of CLRDV P0 suppression activity may contribute to understanding the molecular mechanisms involved in the induction of cotton blue disease by CLRDV infection. Copyright © 2013 Elsevier B.V. All rights reserved.
[E. M. Jellinek's silenced and silencing transgenerational story].
Kelemen, Gábor; Márk, Mónika
2013-01-01
Jellinek is a kind of archetypal character for future generations in the field of addiction studies. His implosion in the arena of alcoholism around the age of 50 was an unexpected challenge to medical science. We know very little about his own role models giving an intellectual and moral compass to his pragmatic creativity. More than 30 years has passed since Jellinek's death when an American sociologist Ron Roizen started unearthing his silent story. Roizen discerned that there are a lot of unsaid and muted issues in his personal Hungarian past. Our paper, based on the authors' research in Hungarian archives and other sources reveals that not just Jellinek's personal but his transgenerational narrative has been not-yet-said. This silenced and silencing history appears an unfinished business of acculturation of the family, which started prior to four generations. Authors have been concluding that the issue of religious conversion is a critical point in the process of acculturation. They examine the counter move of loyalty to family values and driving force of assimilation making their story unspeakable.
Directory of Open Access Journals (Sweden)
Đerić Gordana
2007-01-01
Full Text Available Wars of the last decade of the 20th century in former Yugoslavia have brought the whole region into the center of media attention and, accordingly, have aroused interest of the western academic theory. Since the latest ′discovery of the Balkans′ was brought into being precisely due to wars, one shouldn’t be surprised to find that many academic approaches to questions of Yugoslavia dismemberment are biased, superficial or exotic. On the other hand, Serbian academic auditorium was far from being active in elaborating questions of its own contemporality and closest past - for various reasons, but mostly because of its detachment from systematic explorations. Thus, acknowledgement and presentations of mentioned issues were left to be the job of media publicists, others outside of academic community or were left to be treated in the time to come. Domestic scholars were rarely intrigued to deal with these matters, despite the fact that images of recent wars were often built on stereotypes and propaganda and that the formed knowledge of the entire subject suffered from severe simplification. The themes of great violence were particularly avoided which left some of the crucial war events out of the academic focus - the reason being, very probably, the estimation that what made Serbia and the region worldwide known is best to be forgotten. Contemporary academic silence on recent wars, in retrospection, could easily be placed within the continuum of silence during the socialist period and war which preceded it. Having all mentioned in mind, this paper not only investigates reasons for avoiding the issues of the nearest past and influences of silence in socialism on what came afterwards, but also highlights the importance of exploring semantics and functions of silence and silencing in recent wars, as well as the relationship between silence and social memory constructions.
Directory of Open Access Journals (Sweden)
Vijayalakshmi H Nagaraj
Full Text Available In addition to gene network switches, local epigenetic modifications to DNA and histones play an important role in all-or-none cellular decision-making. Here, we study the dynamical design of a well-characterized epigenetic chromatin switch: the yeast SIR system, in order to understand the origin of the stability of epigenetic states. We study hysteresis in this system by perturbing it with a histone deacetylase inhibitor. We find that SIR silencing has many characteristics of a non-linear bistable system, as observed in conventional genetic switches, which are based on activities of a few promoters affecting each other through the abundance of their gene products. Quite remarkably, our experiments in yeast telomeric silencing show a very distinctive pattern when it comes to the transition from bistability to monostability. In particular, the loss of the stable silenced state, upon increasing the inhibitor concentration, does not seem to show the expected saddle node behavior, instead looking like a supercritical pitchfork bifurcation. In other words, the 'off' state merges with the 'on' state at a threshold concentration leading to a single state, as opposed to the two states remaining distinct up to the threshold and exhibiting a discontinuous jump from the 'off' to the 'on' state. We argue that this is an inevitable consequence of silenced and active regions coexisting with dynamic domain boundaries. The experimental observations in our study therefore have broad implications for the understanding of chromatin silencing in yeast and beyond.
Transcriptional Silencing of Retroviral Vectors
DEFF Research Database (Denmark)
Lund, Anders Henrik; Duch, M.; Pedersen, F.S.
1996-01-01
. Extinction of long-term vector expression has been observed after implantation of transduced hematopoietic cells as well as fibroblasts, myoblasts and hepatocytes. Here we review the influence of vector structure, integration site and cell type on transcriptional silencing. While down-regulation of proviral...... transcription is known from a number of cellular and animal models, major insight has been gained from studies in the germ line and embryonal cells of the mouse. Key elements for the transfer and expression of retroviral vectors, such as the viral transcriptional enhancer and the binding site for the t......RNA primer for reverse transcription may have a major influence on transcriptional silencing. Alterations of these elements of the vector backbone as well as the use of internal promoter elements from housekeeping genes may contribute to reduce transcriptional silencing. The use of cell culture and animal...
Flachowsky, Henryk; Halbwirth, Heidi; Treutter, Dieter; Richter, Klaus; Hanke, Magda-Viola; Szankowski, Iris; Gosch, Christian; Stich, Karl; Fischer, Thilo C
2012-02-01
Transgenic antisense flavanone-3-hydroxylase apple plants were produced to mimic the effect of the agrochemical prohexadione-Ca on apple leaves. This enzyme inhibitor for 2-oxoglutarate dependent dioxygenases is used as a growth retardant and for control of secondary fire blight of leaves. Like using the agent, silencing of flavanone-3-hydroxylase leads to an accumulation of flavanones in leaves, but in contrast not to the formation of 3-deoxyflavonoids. In prohexadione-Ca treated leaves the 3-deoxyflavonoid luteoforol is formed from accumulating flavanones, acting as an antimicrobial compound against the fire blight pathogen Erwinia amylovora. Seemingly, the silencing of just one of the 2-oxoglutarate dependent dioxygenases (in apple also flavonol synthase and anthocyanidin synthase take part downstream in the pathway) does not provide a sufficiently high ratio of flavanones to dihydroflavonols. This seems to be needed to let the dihydroflavonol-4-reductase/flavanone-4-reductase enzyme reduce flavanones to luteoforol, and to let this be reduced by the leucoanthocyanidin-4-reductase/3-deoxyleucoanthocyanidin-4-reductase, each acting with their respective weak secondary activities. Accordingly, also the intended inducible resistance to fire blight by prohexadione-Ca is not observed with the antisense flavanone-3-hydroxylase apple plants. On the other hand, for most transgenic lines with strong flavanone-4-reductase down-regulation, up-regulation of gene expression for the other flavonoid genes was found. This provides further evidence for the feedback regulation of flavonoid gene expression having been previously reported for the prohexadione-Ca inhibited apple plants. Copyright © 2011 Elsevier Masson SAS. All rights reserved.
Listen and the question of silence
DEFF Research Database (Denmark)
Doubinsky, Sebastien
2018-01-01
Listen is a film about words, but around words. The words become useless and are surrounded by silence. And the whole film is constructed on this silence, which builds up like an unbreakable wall. The question is thus: what are we listening to? What should we listen to? And maybe, even more crucial...
The ethics of silence: Does conflict of interest explain employee silence?
Anderson, James
2018-03-01
Employee silence constitutes a significant threat to organizational success. This article argues that silence is a by-product of a structural Conflict of Interest (COI) between employees and their employers. This argument turns on the claim, also defended here, that employees are in a privileged position vis-à-vis knowledge of their work and that leaders-whether they recognize it or not-are dependent on their employees for reliable information about the work they are doing. Employee voice, therefore, is an organizational necessity. It is also a moral achievement as it involves risking one's personal interests for the sake of the organization. Leaders must take steps to mitigate COI and encourage employee voice; this article provides several strategies for doing exactly that.
Silence as a Response to Everyday Violence
DEFF Research Database (Denmark)
Gammeltoft, Tine
2016-01-01
Across the world, existing research indicates that many women respond with silence to marital abuse. This article offers an ethnographic investigation of the social and psychic forces behind Vietnamese women’s silencing of violence and a theoretical exploration of how the psychoanalytic concept...... of fantasy—understood as unconscious or subconscious mental processes—may contribute to the analysis of everyday violence and psychic distress. Distinguishing between what I term deliberate and subconscious silence, I explore the role that fantasy plays when Vietnamese women silently endure intimate partner...
Down-Regulation of Gene Expression by RNA-Induced Gene Silencing
Travella, Silvia; Keller, Beat
Down-regulation of endogenous genes via post-transcriptional gene silencing (PTGS) is a key to the characterization of gene function in plants. Many RNA-based silencing mechanisms such as post-transcriptional gene silencing, co-suppression, quelling, and RNA interference (RNAi) have been discovered among species of different kingdoms (plants, fungi, and animals). One of the most interesting discoveries was RNAi, a sequence-specific gene-silencing mechanism initiated by the introduction of double-stranded RNA (dsRNA), homologous in sequence to the silenced gene, which triggers degradation of mRNA. Infection of plants with modified viruses can also induce RNA silencing and is referred to as virus-induced gene silencing (VIGS). In contrast to insertional mutagenesis, these emerging new reverse genetic approaches represent a powerful tool for exploring gene function and for manipulating gene expression experimentally in cereal species such as barley and wheat. We examined how RNAi and VIGS have been used to assess gene function in barley and wheat, including molecular mechanisms involved in the process and available methodological elements, such as vectors, inoculation procedures, and analysis of silenced phenotypes.
International Nuclear Information System (INIS)
Zhang, Shaojie; Patel, Ananddeep; Chu, Chun; Jiang, Weiwu; Wang, Lihua; Welty, Stephen E.; Moorthy, Bhagavatula; Shivanna, Binoy
2015-01-01
Hyperoxia contributes to the development of bronchopulmonary dysplasia (BPD) in premature infants. Activation of the aryl hydrocarbon receptor (AhR) protects adult and newborn mice against hyperoxic lung injury by mediating increases in the expression of phase I (cytochrome P450 (CYP) 1A) and phase II (NADP(H) quinone oxidoreductase (NQO1)) antioxidant enzymes (AOE). AhR positively regulates the expression of RelB, a component of the nuclear factor-kappaB (NF-κB) protein that contributes to anti-inflammatory processes in adult animals. Whether AhR regulates the expression of AOE and RelB, and protects fetal primary human lung cells against hyperoxic injury is unknown. Therefore, we tested the hypothesis that AhR-deficient fetal human pulmonary microvascular endothelial cells (HPMEC) will have decreased RelB activation and AOE, which will in turn predispose them to increased oxidative stress, inflammation, and cell death compared to AhR-sufficient HPMEC upon exposure to hyperoxia. AhR-deficient HPMEC showed increased hyperoxia-induced reactive oxygen species (ROS) generation, cleavage of poly(ADP-ribose) polymerase (PARP), and cell death compared to AhR-sufficient HPMEC. Additionally, AhR-deficient cell culture supernatants displayed increased macrophage inflammatory protein 1α and 1β, indicating a heightened inflammatory state. Interestingly, loss of AhR was associated with a significantly attenuated CYP1A1, NQO1, superoxide dismutase 1(SOD1), and nuclear RelB protein expression. These findings support the hypothesis that decreased RelB activation and AOE in AhR-deficient cells is associated with increased hyperoxic injury compared to AhR-sufficient cells. - Highlights: • AhR deficiency potentiates oxygen toxicity in human fetal lung cells. • Deficient AhR signaling increases hyperoxia-induced cell death. • AhR deficiency increases hyperoxia-induced ROS generation and inflammation. • Anti-oxidant enzyme levels are attenuated in AhR-deficient lung cells
Energy Technology Data Exchange (ETDEWEB)
Zhang, Shaojie; Patel, Ananddeep; Chu, Chun; Jiang, Weiwu; Wang, Lihua; Welty, Stephen E.; Moorthy, Bhagavatula; Shivanna, Binoy, E-mail: shivanna@bcm.edu
2015-07-15
Hyperoxia contributes to the development of bronchopulmonary dysplasia (BPD) in premature infants. Activation of the aryl hydrocarbon receptor (AhR) protects adult and newborn mice against hyperoxic lung injury by mediating increases in the expression of phase I (cytochrome P450 (CYP) 1A) and phase II (NADP(H) quinone oxidoreductase (NQO1)) antioxidant enzymes (AOE). AhR positively regulates the expression of RelB, a component of the nuclear factor-kappaB (NF-κB) protein that contributes to anti-inflammatory processes in adult animals. Whether AhR regulates the expression of AOE and RelB, and protects fetal primary human lung cells against hyperoxic injury is unknown. Therefore, we tested the hypothesis that AhR-deficient fetal human pulmonary microvascular endothelial cells (HPMEC) will have decreased RelB activation and AOE, which will in turn predispose them to increased oxidative stress, inflammation, and cell death compared to AhR-sufficient HPMEC upon exposure to hyperoxia. AhR-deficient HPMEC showed increased hyperoxia-induced reactive oxygen species (ROS) generation, cleavage of poly(ADP-ribose) polymerase (PARP), and cell death compared to AhR-sufficient HPMEC. Additionally, AhR-deficient cell culture supernatants displayed increased macrophage inflammatory protein 1α and 1β, indicating a heightened inflammatory state. Interestingly, loss of AhR was associated with a significantly attenuated CYP1A1, NQO1, superoxide dismutase 1(SOD1), and nuclear RelB protein expression. These findings support the hypothesis that decreased RelB activation and AOE in AhR-deficient cells is associated with increased hyperoxic injury compared to AhR-sufficient cells. - Highlights: • AhR deficiency potentiates oxygen toxicity in human fetal lung cells. • Deficient AhR signaling increases hyperoxia-induced cell death. • AhR deficiency increases hyperoxia-induced ROS generation and inflammation. • Anti-oxidant enzyme levels are attenuated in AhR-deficient lung cells
Mutuality, Self-Silencing, and Disordered Eating in College Women
Wechsler, Lisa S.; Riggs, Shelley A.; Stabb, Sally D.; Marshall, David M.
2006-01-01
The current study examined patterns of association among mutuality, self-silencing, and disordered eating in an ethnically diverse sample of college women (N = 149). Partner mutuality and overall self-silencing were negatively correlated and together were associated with six disordered eating indices. All four self-silencing subscales were…
After the Blackbird Whistles: Listening to Silence in Classrooms
Schultz, Katherine
2010-01-01
Background/Context: Students spend a large part of their time in schools in silence. However, teachers tend to spend most of their time attending to student talk. Anthropological and linguistic research has contributed to an understanding of silence in particular communities, offering explanations for students' silence in school. This research…
Directory of Open Access Journals (Sweden)
Sandra Patricia Arenas Grisales
2012-08-01
Full Text Available This article exposes the hypothesis that memory artifacts, created to commemorate the victims of armed conflict in Colombia, are an expression of the underground memories and a way of political action in the midst of war. We analyze three cases of creations of memory artifacts in Medellín, Colombia, as forms of suffering, perceiving and resisting the power of armed groups in Medellín. The silence, inherent in these objects, should not be treated as an absence of language, but as another form of expression of memory. Silence is a tactic used to overcome losses and reset everyday life in contexts of protracted violence.
Drosophila PAF1 Modulates PIWI/piRNA Silencing Capacity.
Clark, Josef P; Rahman, Reazur; Yang, Nachen; Yang, Linda H; Lau, Nelson C
2017-09-11
To test the directness of factors in initiating PIWI-directed gene silencing, we employed a Piwi-interacting RNA (piRNA)-targeted reporter assay in Drosophila ovary somatic sheet (OSS) cells [1]. This assay confirmed direct silencing roles for piRNA biogenesis factors and PIWI-associated factors [2-12] but suggested that chromatin-modifying proteins may act downstream of the initial silencing event. Our data also revealed that RNA-polymerase-II-associated proteins like PAF1 and RTF1 antagonize PIWI-directed silencing. PAF1 knockdown enhances PIWI silencing of reporters when piRNAs target the transcript region proximal to the promoter. Loss of PAF1 suppresses endogenous transposable element (TE) transcript maturation, whereas a subset of gene transcripts and long-non-coding RNAs adjacent to TE insertions are affected by PAF1 knockdown in a similar fashion to piRNA-targeted reporters. Additionally, transcription activation at specific TEs and TE-adjacent loci during PIWI knockdown is suppressed when PIWI and PAF1 levels are both reduced. Our study suggests a mechanistic conservation between fission yeast PAF1 repressing AGO1/small interfering RNA (siRNA)-directed silencing [13, 14] and Drosophila PAF1 opposing PIWI/piRNA-directed silencing. Copyright © 2017 Elsevier Ltd. All rights reserved.
Tospovirus : induction and suppression of RNA silencing
Hedil, Marcio
2016-01-01
While infecting their hosts, viruses must deal with host immunity. In plants the antiviral RNA silencing pathway is an important part of plant innate immunity. Tospoviruses are segmented negative-stranded RNA viruses of plants. To counteract the antiviral RNA silencing response in plants,
Gender Differences in Self-Silencing and Psychological Distress in Informal Cancer Carers
Ussher, Jane M.; Perz, Janette
2010-01-01
This study examined gender differences in self-silencing, the relationship between self-silencing and psychological distress, and reasons for self-silencing in informal cancer carers (329 women, 155 men), using a mixed-method design. Men reported greater self-silencing than women on the Silencing the Self Scale; however, women reported higher…
Conifers have a unique small RNA silencing signature
Dolgosheina, Elena V.; Morin, Ryan D.; Aksay, Gozde; Sahinalp, S. Cenk; Magrini, Vincent; Mardis, Elaine R.; Mattsson, Jim; Unrau, Peter J.
2008-01-01
Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an u...
Locus-specific ribosomal RNA gene silencing in nucleolar dominance.
Directory of Open Access Journals (Sweden)
Michelle S Lewis
2007-08-01
Full Text Available The silencing of one parental set of rRNA genes in a genetic hybrid is an epigenetic phenomenon known as nucleolar dominance. We showed previously that silencing is restricted to the nucleolus organizer regions (NORs, the loci where rRNA genes are tandemly arrayed, and does not spread to or from neighboring protein-coding genes. One hypothesis is that nucleolar dominance is the net result of hundreds of silencing events acting one rRNA gene at a time. A prediction of this hypothesis is that rRNA gene silencing should occur independent of chromosomal location. An alternative hypothesis is that the regulatory unit in nucleolar dominance is the NOR, rather than each individual rRNA gene, in which case NOR localization may be essential for rRNA gene silencing. To test these alternative hypotheses, we examined the fates of rRNA transgenes integrated at ectopic locations. The transgenes were accurately transcribed in all independent transgenic Arabidopsis thaliana lines tested, indicating that NOR localization is not required for rRNA gene expression. Upon crossing the transgenic A. thaliana lines as ovule parents with A. lyrata to form F1 hybrids, a new system for the study of nucleolar dominance, the endogenous rRNA genes located within the A. thaliana NORs are silenced. However, rRNA transgenes escaped silencing in multiple independent hybrids. Collectively, our data suggest that rRNA gene activation can occur in a gene-autonomous fashion, independent of chromosomal location, whereas rRNA gene silencing in nucleolar dominance is locus-dependent.
Silencing glypican-3 expression induces apoptosis in human hepatocellular carcinoma cells
Energy Technology Data Exchange (ETDEWEB)
Liu, Shiyuan [The Second Hospital of Lanzhou University, Lanzhou 730030, Gansu (China); Key Laboratory of Digestive System Tumors of Gansu Province, Lanzhou 730030, Gansu (China); Li, Yumin, E-mail: liym@lzu.edu.cn [The Second Hospital of Lanzhou University, Lanzhou 730030, Gansu (China); Key Laboratory of Digestive System Tumors of Gansu Province, Lanzhou 730030, Gansu (China); Chen, Wei [Department of Biochemistry and Molecular Biology, School of Basic Medical Science, Lanzhou University, Lanzhou 730000, Gansu (China); Zheng, Pengfei [The Second Hospital of Lanzhou University, Lanzhou 730030, Gansu (China); Key Laboratory of Digestive System Tumors of Gansu Province, Lanzhou 730030, Gansu (China); Liu, Tao; He, Wenting; Zhang, Junqiang; Zeng, Xiangting [Key Laboratory of Digestive System Tumors of Gansu Province, Lanzhou 730030, Gansu (China)
2012-03-23
Highlights: Black-Right-Pointing-Pointer RNA interference GPC3 induces apoptosis in human hepatocellular carcinoma cell. Black-Right-Pointing-Pointer Silencing GPC3 resulted in the release of cytochrome c and activation of caspase-3. Black-Right-Pointing-Pointer GPC3 modulates the Bax/Bcl-2/cytochrome c/caspase-3 apoptotic signaling pathway. Black-Right-Pointing-Pointer Knockdown of GPC3 is a novel approach to HCC treatment. -- Abstract: Hepatocellular carcinoma (HCC) is one of the most common internal malignant tumors. Glypican-3 (GPC3) is involved in the biological and molecular events in the tumorigenesis of HCC. We used RNA interference to evaluate the molecular effects of GPC3 suppression at the translational level and demonstrated for the first time that GPC3 silencing results in a significant elevation of the Bax/Bcl-2 ratio, the release of cytochrome c from mitochondria and the activation of caspase-3. The results suggest that GPC3 regulates cell proliferation by enhancing the resistance to apoptosis through the dysfunction of the Bax/Bcl-2/cytochrome c/caspase-3 signaling pathway and therefore plays a critical role in the tumorigenesis of HCC. Thus, the knockdown of GPC3 should be further investigated as an attractive novel approach for the targeted gene therapy of HCC.
The physics of chromatin silencing: Bi-stability and front propagation
Sedighi, Mohammad
A mean-field dynamical model of chromatin silencing in budding yeast is provided and the conditions giving rise to two states: one silenced and another un-silenced, is studied. Based on these conditions, the space of control parameters is divided into two distinct regions of mono-stable and bi-stable solutions (the bifurcation diagram). Then, considering both the discrete and continuous versions of the model, the formation of a stable boundary between the silenced and un-silenced areas on DNA is investigated. As a result, a richer phase diagram is provided. The dynamics of the boundary is also studied under different conditions. Consequently, assuming negative feedback due to possible depletion of silencing proteins, the model explains a paradoxical epigenetic behavior of yeast that happens under some mutation. A stochastic treatment of the model is also considered to verify the results of the mean-field approximation and also to understand the role of intrinsic noise at single cell level. This model could be used as a general guide to discuss chromatin silencing in many organisms.
Control of thermoacoustic instability with a drum-like silencer
Zhang, Guangyu; Wang, Xiaoyu; Li, Lei; Jing, Xiaodong; Sun, Xiaofeng
2017-10-01
Theoretical investigation is carried out by a novel method of controlling thermoacoustic instability with a drum-like silencer. It is shown that by decreasing the frequency of thermoacoustic system, the instability can be suppressed with the help of drum-like silencer. The purely reactive silencer, which is composed of a flexible membrane and a backing cavity, is usually known as a noise control device that works effectively in low frequency bandwidth without any aerodynamic loss. In present research, the silencer is exploited in a Rijke tube, as a means of decreasing the natural frequency of the system, and consequently changing the resonance period of the system. The "transfer element method" (TEM) is used to consider the interactions between the acoustic waves and the flexible membranes of the silencer. The effects of all possible properties of the silencer on the growth rate and resonance frequency of the thermoacoustic system are explored. According to the calculation results, it is found that for some properties of the silencer, the resonance frequencies are greatly decreased and then the phase difference between the unsteady heat release and the pressure fluctuation is increased. Consequently, the instability is suppressed with some dissipation that can not be able to control its onset in the original system. Therefore, when the damping is low, but not zero, it is effective to control thermoacoustic instability with this technique.
The Polerovirus F box protein P0 targets ARGONAUTE1 to suppress RNA silencing.
Bortolamiol, Diane; Pazhouhandeh, Maghsoud; Marrocco, Katia; Genschik, Pascal; Ziegler-Graff, Véronique
2007-09-18
Plants employ post-transcriptional gene silencing (PTGS) as an antiviral defense response. In this mechanism, viral-derived small RNAs are incorporated into the RNA-induced silencing complex (RISC) to guide degradation of the corresponding viral RNAs. ARGONAUTE1 (AGO1) is a key component of RISC: it carries the RNA slicer activity. As a counter-defense, viruses have evolved various proteins that suppress PTGS. Recently, we showed that the Polerovirus P0 protein carries an F box motif required to form an SCF-like complex, which is also essential for P0's silencing suppressor function. Here, we investigate the molecular mechanism by which P0 impairs PTGS. First we show that P0's expression does not affect the biogenesis of primary siRNAs in an inverted repeat-PTGS assay, but it does affect their activity. Moreover, P0's expression in transformed Arabidopsis plants leads to various developmental abnormalities reminiscent of mutants affected in miRNA pathways, which is accompanied by enhanced levels of several miRNA-target transcripts, suggesting that P0 acts at the level of RISC. Interestingly, ectopic expression of P0 triggered AGO1 protein decay in planta. Finally, we provide evidence that P0 physically interacts with AGO1. Based on these results, we propose that P0 hijacks the host SCF machinery to modulate gene silencing by destabilizing AGO1.
Energy Technology Data Exchange (ETDEWEB)
Ichida, Yu, E-mail: ichida-y@ncchd.go.jp; Utsunomiya, Yuko; Onodera, Masafumi
2016-03-18
Zinc finger protein 809 (ZFP809) belongs to the Kruppel-associated box-containing zinc finger protein (KRAB-ZFP) family and functions in repressing the expression of Moloney murine leukemia virus (MoMLV). ZFP809 binds to the primer-binding site (PBS)located downstream of the MoMLV-long terminal repeat (LTR) and induces epigenetic modifications at integration sites, such as repressive histone modifications and de novo DNA methylation. KRAB-ZFPs contain consensus TGEKP linkers between C2H2 zinc fingers. The phosphorylation of threonine residues within linkers leads to the inactivation of zinc finger binding to target sequences. ZFP809 also contains consensus linkers between zinc fingers. However, the function of ZFP809 linkers remains unknown. In the present study, we constructed ZFP809 proteins containing mutated linkers and examined their ability to silence transgene expression driven by MLV, binding ability to MLV PBS, and cellular localization. The results of the present study revealed that the linkers affected the ability of ZFP809 to silence transgene expression. Furthermore, this effect could be partly attributed to changes in the localization of ZFP809 proteins containing mutated linkers. Further characterization of ZFP809 linkers is required for understanding the functions and features of KRAB-ZFP-containing linkers. - Highlights: • ZFP809 has three consensus linkers between the zinc fingers. • Linkers are required for ZFP809 to silence transgene expression driven by MLV-LTR. • Linkers affect the precise nuclear localization of ZFP809.
Histone Methylation and Epigenetic Silencing in Breast Cancer
National Research Council Canada - National Science Library
Simon, Jeffrey A; Lange, Carol A
2008-01-01
.... EZH2 is a histone methyltransferase which modifies lysine-27 of histone H3 an epigenetic mark which is generally linked to gene silencing and is implicated in tumor suppressor silencing during breast cancer progression...
Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing
Hedil, M.; Sterken, M.G.; Ronde, de D.; Lohuis, D.; Kormelink, R.
2015-01-01
RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS.
Directory of Open Access Journals (Sweden)
Alcamí José
2008-12-01
Full Text Available Abstract Background Degradation of p65/RelA has been involved in both the inhibition of NF-κB-dependent activity and the onset of apoptosis. However, the mechanisms of NF-κB degradation are unclear and can vary depending on the cell type. Cleavage of p65/RelA can produce an amino-terminal fragment that was shown to act as a dominant-negative inhibitor of NF-κB, thereby promoting apoptosis. However, the opposite situation has also been described and the production of a carboxy-terminal fragment that contains two potent transactivation domains has also been related to the onset of apoptosis. In this context, a carboxy-terminal fragment of p65/RelA (ΔNH2p65, detected in non-apoptotic human T lymphocytes upon activation, has been studied. T cells constitute one of the long-lived cellular reservoirs of the human immunodeficiency virus type 1 (HIV-1. Because NF-κB is the most important inducible element involved in initiation of HIV-1 transcription, an adequate control of NF-κB response is of paramount importance for both T cell survival and viral spread. Its major inhibitor IκBα constitutes a master terminator of NF-κB response that is complemented by degradation of p65/RelA. Results and conclusions In this study, the function of a caspase-3-mediated carboxy-terminal fragment of p65/RelA, which was detected in activated human peripheral blood lymphocytes (PBLs, was analyzed. Cells producing this truncated p65/RelA did not undergo apoptosis but showed a high viability, in spite of caspase-3 activation. ΔNH2p65 lacked most of DNA-binding domain but retained the dimerization domain, NLS and transactivation domains. Consequently, it could translocate to the nucleus, associate with NF-κB1/p50 and IκBα, but could not bind -κB consensus sites. However, although ΔNH2p65 lacked transcriptional activity by itself, it could increase NF-κB activity in a dose-dependent manner by hijacking IκBα. Thus, its expression resulted in a persistent
No-Big-Silence teeb klubituuri / Urmas Hännile
Hännile, Urmas
2009-01-01
Rockansamblist No-Big-Silence ja dark-popansamblist Sinine, nende kontsertttuurist mööda Eestimaad, tutvustamisel bändide uued albumid (No-Big-Silence "Starstealer" ja Sinine "Butterflies"), Pärnus on kontsert 24. oktoobril klubis Sugar
Sproles, Darrell W.; Bavuso, Salvatore J.
1994-01-01
The Hybrid Automated Reliability Predictor (HARP) integrated Reliability (HiRel) tool system for reliability/availability prediction offers a toolbox of integrated reliability/availability programs that can be used to customize the user's application in a workstation or nonworkstation environment. HiRel consists of interactive graphical input/output programs and four reliability/availability modeling engines that provide analytical and simulative solutions to a wide host of highly reliable fault-tolerant system architectures and is also applicable to electronic systems in general. The tool system was designed at the outset to be compatible with most computing platforms and operating systems and some programs have been beta tested within the aerospace community for over 8 years. This document is a user's guide for the HiRel graphical postprocessor program HARPO (HARP Output). HARPO reads ASCII files generated by HARP. It provides an interactive plotting capability that can be used to display alternate model data for trade-off analyses. File data can also be imported to other commercial software programs.
DEFF Research Database (Denmark)
Konradsen, Hanne; Kirkevold, Marit; McCallin, Antoinette
2012-01-01
and individual interviews were analyzed using the grounded theory method. The findings revealed that the main concern of the patients was feeling isolated, which was resolved using a process of interactional integration. Interactional integration begins by breaking the silence to enable the progression from...
Toward a science of silence: The consequences of leaving a memory unsaid
DEFF Research Database (Denmark)
Stone, Charles; Coman, Alin; Brown, Adam
2012-01-01
of the silence—and listeners—those attending to the speaker. Although the topic of silence is widely discussed, it is rarely mentioned in the empirical literature on memory. Three factors are employed to classify silence into different types: whether a silence is accompanied by covert remembering, whether...... the silence is intentional or unintentional, and whether the silenced memory is related or unrelated to the memories emerging in a conversation. These factors appear to be critical when considering the mnemonic consequences. Moreover, the influence of silence on memory varies between speaker and listener...
Li, Airong; Ahsen, Osman O; Liu, Jonathan J; Du, Chuang; McKee, Mary L; Yang, Yan; Wasco, Wilma; Newton-Cheh, Christopher H; O'Donnell, Christopher J; Fujimoto, James G; Zhou, Chao; Tanzi, Rudolph E
2013-09-15
The SRY-related HMG-box 5 (SOX5) gene encodes a member of the SOX family of transcription factors. Recently, genome-wide association studies have implicated SOX5 as a candidate gene for susceptibility to four cardiac-related endophenotypes: higher resting heart rate (HR), the electrocardiographic PR interval, atrial fibrillation and left ventricular mass. We have determined that human SOX5 has a highly conserved Drosophila ortholog, Sox102F, and have employed transgenic Drosophila models to quantitatively measure cardiac function in adult flies. For this purpose, we have developed a high-speed and ultrahigh-resolution optical coherence tomography imaging system, which enables rapid cross-sectional imaging of the heart tube over various cardiac cycles for the measurement of cardiac structural and dynamical parameters such as HR, dimensions and areas of heart chambers, cardiac wall thickness and wall velocities. We have found that the silencing of Sox102F resulted in a significant decrease in HR, heart chamber size and cardiac wall velocities, and a significant increase in cardiac wall thickness that was accompanied by disrupted myofibril structure in adult flies. In addition, the silencing of Sox102F in the wing led to increased L2, L3 and wing marginal veins and increased and disorganized expression of wingless, the central component of the Wnt signaling pathway. Collectively, the silencing of Sox102F resulted in severe cardiac dysfunction and structural defects with disrupted Wnt signaling transduction in flies. This implicates an important functional role for SOX5 in heart and suggests that the alterations in SOX5 levels may contribute to the pathogenesis of multiple cardiac diseases or traits.
Specific oncogenic activity of the Src-family tyrosine kinase c-Yes in colon carcinoma cells.
Directory of Open Access Journals (Sweden)
Florence Sancier
Full Text Available c-Yes, a member of the Src tyrosine kinase family, is found highly activated in colon carcinoma but its importance relative to c-Src has remained unclear. Here we show that, in HT29 colon carcinoma cells, silencing of c-Yes, but not of c-Src, selectively leads to an increase of cell clustering associated with a localisation of β-catenin at cell membranes and a reduction of expression of β-catenin target genes. c-Yes silencing induced an increase in apoptosis, inhibition of growth in soft-agar and in mouse xenografts, inhibition of cell migration and loss of the capacity to generate liver metastases in mice. Re-introduction of c-Yes, but not c -Src, restores transforming properties of c-Yes depleted cells. Moreover, we found that c-Yes kinase activity is required for its role in β-catenin localisation and growth in soft agar, whereas kinase activity is dispensable for its role in cell migration. We conclude that c-Yes regulates specific oncogenic signalling pathways important for colon cancer progression that is not shared with c-Src.
CSN-associated USP48 confers stability to nuclear NF-κB/RelA by trimming K48-linked Ub-chains.
Schweitzer, Katrin; Naumann, Michael
2015-02-01
Diligent balance of nuclear factor kappa B (NF-κB) activity is essential owing to NF-κB's decisive role in cellular processes including inflammation, immunity and cell survival. Ubiquitin/proteasome-system (UPS)-dependent degradation of activated NF-κB/RelA involves the cullin-RING-ubiquitin-ligase (CRL) ECS(SOCS1). The COP9 signalosome (CSN) controls ubiquitin (Ub) ligation by CRLs through the removal of the CRL-activating Ub-like modifier NEDD8 from their cullin subunits and through deubiquitinase (DUB) activity of associated DUBs. However, knowledge about DUBs involved in the regulation of NF-κB activity within the nucleus is scarce. In this study we observed that USP48, a DUB of hitherto ill-defined function identified through a siRNA screen, associates with the CSN and RelA in the nucleus. We show that USP48 trims rather than completely disassembles long K48-linked free and substrate-anchored Ub-chains, a catalytic property only shared with ataxin-3 (Atx3) and otubain-1 (OTU1), and that USP48 Ub-chain-trimming activity is regulated by casein-kinase-2 (CK2)-mediated phosphorylation in response to cytokine-stimulation. Functionally, we demonstrate for the first time the CSN and USP48 to cooperatively stabilize the nuclear pool of RelA, thereby facilitating timely induction and shutoff of NF-κB target genes. In summary, this study demonstrates that USP48, a nuclear DUB regulated by CK2, controls the UPS-dependent turnover of activated NF-κB/RelA in the nucleus together with the CSN. Thereby USP48 contributes to a timely control of immune responses. Copyright © 2014 Elsevier B.V. All rights reserved.
Epigenetic Silencing and Resistance to Imatinib Mesylate in CML
National Research Council Canada - National Science Library
Issa, Jean-Pierre
2004-01-01
...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...
Epigenetic Silencing and Resistance to Imatinib Mesylate in CML
National Research Council Canada - National Science Library
Issa, Jean-Pierre
2005-01-01
...). In this project, we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases, and that reversal of silencing by decitabine...
Epigenetic Silencing and Resistance to Imatinib Mesylate in CML
National Research Council Canada - National Science Library
Issa, Jean-Pierre
2006-01-01
...). In this project we are exploring the hypothesis that epigenetic silencing associated with promoter DNA methylation mediates resistance in selected cases and that reversal of silencing by decitabine...
Singh, Anup Kumar; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Reddy, Sajjalavarahalli Gangireddy Eswara; Rao, Dodaghatta Krishnarao Venkata; Shasany, Ajit Kumar; Nagegowda, Dinesh A
2015-12-01
Withania somnifera (L.) Dunal is an important Indian medicinal plant that produces withanolides, which are triterpenoid steroidal lactones having diverse biological activities. To enable fast and efficient functional characterization of genes in this slow-growing and difficult-to-transform plant, a virus-induced gene silencing (VIGS) was established by silencing phytoene desaturase (PDS) and squalene synthase (SQS). VIGS of the gene encoding SQS, which provides precursors for triterpenoids, resulted in significant reduction of squalene and withanolides, demonstrating its application in studying withanolides biosynthesis in W. somnifera leaves. A comprehensive analysis of gene expression and sterol pathway intermediates in WsSQS-vigs plants revealed transcriptional modulation with positive feedback regulation of mevalonate pathway genes, and negative feed-forward regulation of downstream sterol pathway genes including DWF1 (delta-24-sterol reductase) and CYP710A1 (C-22-sterol desaturase), resulting in significant reduction of sitosterol, campesterol and stigmasterol. However, there was little effect of SQS silencing on cholesterol, indicating the contribution of sitosterol, campesterol and stigmasterol, but not of cholesterol, towards withanolides formation. Branch-point oxidosqualene synthases in WsSQS-vigs plants exhibited differential regulation with reduced CAS (cycloartenol synthase) and cycloartenol, and induced BAS (β-amyrin synthase) and β-amyrin. Moreover, SQS silencing also led to the down-regulation of brassinosteroid-6-oxidase-2 (BR6OX2), pathogenesis-related (PR) and nonexpressor of PR (NPR) genes, resulting in reduced tolerance to bacterial and fungal infection as well as to insect feeding. Taken together, SQS silencing negatively regulated sterol and defence-related genes leading to reduced phytosterols, withanolides and biotic stress tolerance, thus implicating the application of VIGS for functional analysis of genes related to withanolides
Smuggling gold nanoparticles across cell types - A new role for exosomes in gene silencing.
Roma-Rodrigues, Catarina; Pereira, Francisca; Alves de Matos, António P; Fernandes, Marta; Baptista, Pedro V; Fernandes, Alexandra R
2017-05-01
Once released to the extracellular space, exosomes enable the transfer of proteins, lipids and RNA between different cells, being able to modulate the recipient cells' phenotypes. Members of the Rab small GTP-binding protein family, such as RAB27A, are responsible for the coordination of several steps in vesicle trafficking, including budding, mobility, docking and fusion. The use of gold nanoparticles (AuNPs) for gene silencing is considered a cutting-edge technology. Here, AuNPs were functionalized with thiolated oligonucleotides anti-RAB27A (AuNP@PEG@anti-RAB27A) for selective silencing of the gene with a consequent decrease of exosomes´ release by MCF-7 and MDA-MB-453 cells. Furthermore, communication between tumor and normal cells was observed both in terms of alterations in c-Myc gene expression and transportation of the AuNPs, mediating gene silencing in secondary cells. Copyright © 2017 Elsevier Inc. All rights reserved.
Yamanaka, Yuki; Winardhi, Ricksen S; Yamauchi, Erika; Nishiyama, So-Ichiro; Sowa, Yoshiyuki; Yan, Jie; Kawagishi, Ikuro; Ishihama, Akira; Yamamoto, Kaneyoshi
2018-06-15
The bacterial nucleoid-associated protein H-NS is a DNA-binding protein, playing a major role in gene regulation. To regulate transcription, H-NS silences genes, including horizontally acquired foreign genes. Escherichia coli H-NS is 137 residues long and consists of two discrete and independent structural domains: an N-terminal oligomerization domain and a C-terminal DNA-binding domain, joined by a flexible linker. The N-terminal oligomerization domain is composed of two dimerization sites, dimerization sites 1 and 2, which are both required for H-NS oligomerization, but the exact role of dimerization site 2 in gene silencing is unclear. To this end, we constructed a whole set of single amino acid substitution variants spanning residues 2 to 137. Using a well-characterized H-NS target, the slp promoter of the glutamic acid-dependent acid resistance (GAD) cluster promoters, we screened for any variants defective in gene silencing. Focusing on the function of dimerization site 2, we analyzed four variants, I70C/I70A and L75C/L75A, which all could actively bind DNA but are defective in gene silencing. Atomic force microscopy analysis of DNA-H-NS complexes revealed that all of these four variants formed condensed complexes on DNA, whereas WT H-NS formed rigid and extended nucleoprotein filaments, a conformation required for gene silencing. Single-molecule stretching experiments confirmed that the four variants had lost the ability to form stiffened filaments. We conclude that dimerization site 2 of H-NS plays a key role in the formation of rigid H-NS nucleoprotein filament structures required for gene silencing. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
The SNF2-family member Fun30 promotes gene silencing in heterochromatic loci.
Directory of Open Access Journals (Sweden)
Ana Neves-Costa
2009-12-01
Full Text Available Chromatin regulates many key processes in the nucleus by controlling access to the underlying DNA. SNF2-like factors are ATP-driven enzymes that play key roles in the dynamics of chromatin by remodelling nucleosomes and other nucleoprotein complexes. Even simple eukaryotes such as yeast contain members of several subfamilies of SNF2-like factors. The FUN30/ETL1 subfamily of SNF2 remodellers is conserved from yeasts to humans, but is poorly characterized. We show that the deletion of FUN30 leads to sensitivity to the topoisomerase I poison camptothecin and to severe cell cycle progression defects when the Orc5 subunit is mutated. We demonstrate a role of FUN30 in promoting silencing in the heterochromatin-like mating type locus HMR, telomeres and the rDNA repeats. Chromatin immunoprecipitation experiments demonstrate that Fun30 binds at the boundary element of the silent HMR and within the silent HMR. Mapping of nucleosomes in vivo using micrococcal nuclease demonstrates that deletion of FUN30 leads to changes of the chromatin structure at the boundary element. A point mutation in the ATP-binding site abrogates the silencing function of Fun30 as well as its toxicity upon overexpression, indicating that the ATPase activity is essential for these roles of Fun30. We identify by amino acid sequence analysis a putative CUE motif as a feature of FUN30/ETL1 factors and show that this motif assists Fun30 activity. Our work suggests that Fun30 is directly involved in silencing by regulating the chromatin structure within or around silent loci.
Antiviral RNA silencing viral counter defense in plants
Bucher, E.C.
2006-01-01
The research described in this thesis centres around the mechanism of RNA silencing in relation to virus-host interaction, an area of increasing importance. It shows how this recently disclosed mechanism can be used to produce virus-resistant plants. Based on the activity of the RNA silencing
Anti-viral RNA silencing: do we look like plants ?
Directory of Open Access Journals (Sweden)
Lecellier Charles-Henri
2006-01-01
Full Text Available Abstract The anti-viral function of RNA silencing was first discovered in plants as a natural manifestation of the artificial 'co-suppression', which refers to the extinction of endogenous gene induced by homologous transgene. Because silencing components are conserved among most, if not all, eukaryotes, the question rapidly arose as to determine whether this process fulfils anti-viral functions in animals, such as insects and mammals. It appears that, whereas the anti-viral process seems to be similarly conserved from plants to insects, even in worms, RNA silencing does influence the replication of mammalian viruses but in a particular mode: micro(miRNAs, endogenous small RNAs naturally implicated in translational control, rather than virus-derived small interfering (siRNAs like in other organisms, are involved. In fact, these recent studies even suggest that RNA silencing may be beneficial for viral replication. Accordingly, several large DNA mammalian viruses have been shown to encode their own miRNAs. Here, we summarize the seminal studies that have implicated RNA silencing in viral infection and compare the different eukaryotic responses.
Donehower, Lawrence A.; Creighton, Chad J.; Schultz, Nikolaus; Shinbrot, Eve; Chang, Kyle; Gunaratne, Preethi H.; Muzny, Donna; Sander, Chris; Hamilton, Stanley R.; Gibbs, Richard A.; Wheeler, David
2014-01-01
Approximately 15% of colorectal carcinomas (CRC) exhibit a hypermutated genotype accompanied by high levels of microsatellite instability (MSI-H) and defects in DNA mismatch repair. These tumors, unlike the majority of colorectal carcinomas, are often diploid, exhibit frequent epigenetic silencing of the MLH1 DNA mismatch repair gene, and have a better clinical prognosis. As an adjunct study to The Cancer Genome Atlas consortium that recently analyzed 224 colorectal cancers by whole exome sequencing, we compared the 35 CRC (15.6%) with a hypermutated genotype to those with a non-hypermutated genotype. We found that 22 (63%) of hypermutated CRC exhibited transcriptional silencing of the MLH1 gene, a high frequency of BRAF V600E gene mutations and infrequent APC and KRAS mutations, a mutational pattern significantly different from their non-hypermutated counterparts. However, the remaining 13 (37%) hypermutated CRC lacked MLH1 silencing, contained tumors with the highest mutation rates (“ultramutated” CRC), and exhibited higher incidences of APC and KRAS mutations, but infrequent BRAF mutations. These patterns were confirmed in an independent validation set of 250 exome-sequenced CRC. Analysis of mRNA and microRNA expression signatures revealed that hypermutated CRC with MLH1 silencing had greatly reduced levels of WNT signaling and increased BRAF signaling relative non-hypermutated CRC. Our findings suggest that hypermutated CRC include one subgroup with fundamentally different pathways to malignancy than the majority of CRC. Examination of MLH1 expression status and frequencies of APC, KRAS, and BRAF mutation in CRC may provide a useful diagnostic tool that could supplement the standard microsatellite instability assays and influence therapeutic decisions. PMID:22899370
Bavuso, Salvatore J.; Rothmann, Elizabeth; Mittal, Nitin; Koppen, Sandra Howell
1994-01-01
The Hybrid Automated Reliability Predictor (HARP) integrated Reliability (HiRel) tool system for reliability/availability prediction offers a toolbox of integrated reliability/availability programs that can be used to customize the user's application in a workstation or nonworkstation environment. HiRel consists of interactive graphical input/output programs and four reliability/availability modeling engines that provide analytical and simulative solutions to a wide host of highly reliable fault-tolerant system architectures and is also applicable to electronic systems in general. The tool system was designed at the outset to be compatible with most computing platforms and operating systems, and some programs have been beta tested within the aerospace community for over 8 years. This document is a user's guide for the HiRel graphical preprocessor Graphics Oriented (GO) program. GO is a graphical user interface for the HARP engine that enables the drawing of reliability/availability models on a monitor. A mouse is used to select fault tree gates or Markov graphical symbols from a menu for drawing.
Bartels, Josef; Rodenbach, Rachel; Ciesinski, Katherine; Gramling, Robert; Fiscella, Kevin; Epstein, Ronald
2016-10-01
Silences in doctor-patient communication can be "connectional" and communicative, in contrast to silences that indicate awkwardness or distraction. Musical and lexical analyses can identify and characterize connectional silences in consultations between oncologists and patients. Two medical students and a professor of voice screened all 1211 silences over 2s in length from 124 oncology office visits. We developed a "strength of connection" taxonomy and examined ten connectional silences for lexical and musical features including pitch, volume, and speaker turn-taking rhythm. We identified connectional silences with good reliability. Typical dialog rhythms surrounding connectional silences are characterized by relatively equal turn lengths and frequent short vocalizations. We found no pattern of volume and pitch variability around these silences. Connectional silences occurred in a wide variety of lexical contexts. Particular patterns of dialog rhythm mark connectional silences. Exploring structures of connectional silence extends our understanding of the audio-linguistic conditions that mark patient-clinician connection. Communicating with an awareness of pitch, rhythm, and silence - in addition to lexical content - can facilitate shared understanding and emotional connection. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Amanda Ackley
2013-01-01
Full Text Available Small noncoding antisense RNAs (sasRNAs guide epigenetic silencing complexes to target loci in human cells and modulate gene transcription. When these targeted loci are situated within a promoter, long-term, stable epigenetic silencing of transcription can occur. Recent studies suggest that there exists an endogenous form of such epigenetic regulation in human cells involving long noncoding RNAs. In this article, we present and validate an algorithm for the generation of highly effective sasRNAs that can mimic the endogenous noncoding RNAs involved in the epigenetic regulation of gene expression. We validate this algorithm by targeting several oncogenes including AKT-1, c-MYC, K-RAS, and H-RAS. We also target a long antisense RNA that mediates the epigenetic repression of the tumor suppressor gene DUSP6, silenced in pancreatic cancer. An algorithm that can efficiently design small noncoding RNAs for the epigenetic transcriptional silencing or activation of specific genes has potential therapeutic and experimental applications.
The dynamics and efficacy of antiviral RNA silencing: A model study
Directory of Open Access Journals (Sweden)
Hogeweg Paulien
2008-03-01
Full Text Available Abstract Background Mathematical modeling is important to provide insight in the complicated pathway of RNA silencing. RNA silencing is an RNA based mechanism that is widely used by eukaryotes to fight viruses, and to control gene expression. Results We here present the first mathematical model that combines viral growth with RNA silencing. The model involves a plus-strand RNA virus that replicates through a double-strand RNA intermediate. The model of the RNA silencing pathway consists of cleavage of viral RNA into siRNA by Dicer, target cleavage of viral RNA via the RISC complex, and a secondary response. We found that, depending on the strength of the silencing response, different viral growth patterns can occur. Silencing can decrease viral growth, cause oscillations, or clear the virus completely. Our model can explain various observed phenomena, even when they seem contradictory at first: the diverse responses to the removal of RNA dependent RNA polymerase; different viral growth curves; and the great diversity in observed siRNA ratios. Conclusion The model presented here is an important step in the understanding of the natural functioning of RNA silencing in viral infections.
The organisational silence of midwives and nurses: reasons and results.
Yurdakul, Mine; Beşen, Meltem Aydin; Erdoğan, Semra
2016-07-01
The study was conducted to determine the issues about which nurses and midwives remain silent and the reasons for it and the perceived results of silence. Organisational silence is a vitally important issue in the health sector, due to the risks and mistakes that are not reported, and proposals for improvement that are not made. The sample of this descriptive survey, which investigated a cause and effect relationship, was 159 nurses and midwives. The data were collected using a questionnaire and the organisational silence scale. Of the study participants, 84.9% were nurses and 15.1% were midwives. Of all participants 88.7% were women. 8.8% of participants stated that they never remained silent about issues related to work and the workplace. Respondents most often remained silent about issues related to ethics and responsibility. 'Limited improvement and development' was frequently mentioned as a perceived result of organisational silence. Our study determined that organisational silence is quite common among nurses and midwives. Activities that raise the awareness of hospital administrations and employees about preventing the factors that cause and maintain silence in hospitals should be planned. © 2016 John Wiley & Sons Ltd.
Antihelium-3 production in lead-lead collisions at 158 A GeV/c
International Nuclear Information System (INIS)
Arsenescu, R; Baglin, C; Beck, H P; Borer, K; Bussiere, A; Elsener, K; Gorodetzky, Ph; Guillaud, J P; Kabana, S; Klingenberg, R; Lehmann, G; Linden, T; Lohmann, K D; Mommsen, R; Moser, U; Pretzl, K; Schacher, J; Spiwoks, R; Tuominiemi, J; Weber, M
2003-01-01
The NA-52 experiment measured particle and antiparticle yields at 0 deg production angle over a wide range in rapidity in lead-lead (Pb-Pb) collisions at 158 A GeV/c with a minimum bias trigger. Besides O(10 6 ) antiprotons and O(10 3 ) antideuterons a total of five antihelium-3 were found. The resulting invariant differential production cross sections at p t ≅0 GeV/c turn out to be E (d 3 σ)/(dp 3 ) = (2.5 ± 1.8) x 10 -7 bc 3 GeV -2 at a rapidity of y = 3.4 in the laboratory system and (5.9 ± 3.4) x 10 -8 bc 3 GeV -2 at y = 4.0. The results are discussed in the framework of a simple coalescence model
Directory of Open Access Journals (Sweden)
Both Anton
2001-08-01
Full Text Available Abstract Background Activation of nuclear factor-κB (NF-κB is one of the key events in early atherosclerosis and restenosis. We hypothesized that tumor necrosis factor-α (TNF-α induced and NF-κB mediated expression of intercellular adhesion molecule-1 (ICAM-1 can be inhibited by antisense RelA p65 and NF-κB1 p50 oligonucleotides (RelA p65 and NF-κB1 p50. Results Smooth muscle cells (SMC from human coronary plaque material (HCPSMC, plaque material of 52 patients, SMC from the human coronary media (HCMSMC, human endothelial cells (EC from umbilical veins (HUVEC, and human coronary EC (HCAEC were successfully isolated (HCPSMC, HUVEC, identified and cultured (HCPSMC, HCMSMC, HUVEC, HCAEC. 12 hrs prior to TNF-α stimulus (20 ng/mL, 6 hrs RelA p65 and NF-κB1 p50 (1, 2, 4, 10, 20, and 30 μM and controls were added for a period of 18 hrs. In HUVEC and HCAEC there was a dose dependent inhibition of ICAM-1 expression after adding of both RelA p65 and NF-κB1 p50. No inhibitory effect was seen after incubation of HCMSMC with RelA p65 and NF-κB1 p50. A moderate inhibition of ICAM-1 expression was found after simultaneous addition of RelA p65 and NF-κB1 p50 to HCPSMC, no inhibitory effect was detected after individual addition of RelA p65 and NF-κB1 p50. Conclusions The data point out that differences exist in the NF-κB mediated expression of ICAM-1 between EC and SMC. Experimental antisense strategies directed against RelA p65 and NF-κB1 p50 in early atherosclerosis and restenosis are promising in HCAEC but will be confronted with redundant pathways in HCMSMC and HCPSMC.
Directory of Open Access Journals (Sweden)
Ximena Suárez
2017-10-01
Full Text Available Journalists and human rights defenders in Mexico are being attacked in an attempt to silence their criticism. Many are forced to flee or risk being assassinated. The consequences are both personal and of wider social significance.
Samuel, Glady Hazitha; Wiley, Michael R; Badawi, Atif; Adelman, Zach N; Myles, Kevin M
2016-11-29
Mosquito-borne flaviviruses, including yellow fever virus (YFV), Zika virus (ZIKV), and West Nile virus (WNV), profoundly affect human health. The successful transmission of these viruses to a human host depends on the pathogen's ability to overcome a potentially sterilizing immune response in the vector mosquito. Similar to other invertebrate animals and plants, the mosquito's RNA silencing pathway comprises its primary antiviral defense. Although a diverse range of plant and insect viruses has been found to encode suppressors of RNA silencing, the mechanisms by which flaviviruses antagonize antiviral small RNA pathways in disease vectors are unknown. Here we describe a viral suppressor of RNA silencing (VSR) encoded by the prototype flavivirus, YFV. We show that the YFV capsid (YFC) protein inhibits RNA silencing in the mosquito Aedes aegypti by interfering with Dicer. This VSR activity appears to be broadly conserved in the C proteins of other medically important flaviviruses, including that of ZIKV. These results suggest that a molecular "arms race" between vector and pathogen underlies the continued existence of flaviviruses in nature.
Khalil, Mohamed I; Foda, Bardees M; Suresh, Susmitha; Singh, Upinder
2016-03-01
Entamoeba histolytica has a robust endogenous RNA interference (RNAi) pathway. There are abundant 27 nucleotide (nt) anti-sense small RNAs (AS sRNAs) that target genes for silencing and the genome encodes many genes involved in the RNAi pathway such as Argonaute proteins. Importantly, an E. histolytica gene with numerous AS sRNAs can function as a "trigger" to induce silencing of a gene that is fused to the trigger. Thus, the amebic RNAi pathway regulates gene expression relevant to amebic biology and has additionally been harnessed as a tool for genetic manipulation. In this study we have further improved the trigger-induced gene silencing method. We demonstrate that rather than using the full-length gene, a short portion of the coding region fused to a trigger is sufficient to induce silencing; the first 537 bp of the E. histolytica rhomboid gene (EhROM1) fused in-frame to the trigger was sufficient to silence EhROM1. We also demonstrated that the trigger method could silence two amebic genes concomitantly; fusion of the coding regions of EhROM1 and transcription factor, EhMyb, in-frame to a trigger gene resulted in both genes being silenced. Alternatively, two genes can be silenced sequentially: EhROM1-silenced parasites with no drug selection plasmid were transfected with trigger-EhMyb, resulting in parasites with both EhROM1 and EhMyb silenced. With all approaches tested, the trigger-mediated silencing was substantive and silencing was maintained despite loss of the G418 selectable marker. All gene silencing was associated with generation of AS sRNAs to the silenced gene. We tested the reversibility of the trigger system using inhibitors of histone modifications but found that the silencing was highly stable. This work represents a technical advance in the trigger gene silencing method in E. histolytica. Approaches that readily silence multiple genes add significantly to the genetic toolkit available to the ameba research community. Copyright © 2016
Suppressors of RNA silencing encoded by tomato leaf curl ...
Indian Academy of Sciences (India)
2013-01-06
Jan 6, 2013 ... Virus encoded RNA-silencing suppressors (RSSs) are the key components evolved by the viruses to ... severe disease symptom in the host (Briddon et al. ..... Voinnet O 2001 RNA silencing as a plant immune system against.
Bejerman, Nicolás; Mann, Krin S; Dietzgen, Ralf G
2016-09-15
Plants employ RNA silencing as an innate defense mechanism against viruses. As a counter-defense, plant viruses have evolved to express RNA silencing suppressor proteins (RSS), which target one or more steps of the silencing pathway. In this study, we show that the phosphoprotein (P) encoded by the negative-sense RNA virus alfalfa dwarf virus (ADV), a species of the genus Cytorhabdovirus, family Rhabdoviridae, is a suppressor of RNA silencing. ADV P has a relatively weak local RSS activity, and does not prevent siRNA accumulation. On the other hand, ADV P strongly suppresses systemic RNA silencing, but does not interfere with the short-distance spread of silencing, which is consistent with its lack of inhibition of siRNA accumulation. The mechanism of suppression appears to involve ADV P binding to RNA-induced silencing complex proteins AGO1 and AGO4 as shown in protein-protein interaction assays when ectopically expressed. In planta, we demonstrate that ADV P likely functions by inhibiting miRNA-guided AGO1 cleavage and prevents transitive amplification by repressing the production of secondary siRNAs. As recently described for lettuce necrotic yellows cytorhabdovirus P, but in contrast to other viral RSS known to disrupt AGO activity, ADV P sequence does not contain any recognizable GW/WG or F-box motifs, which suggests that cytorhabdovirus P proteins may use alternative motifs to bind to AGO proteins. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.
Role of DNA methylation in miR-200c/141 cluster silencing in invasive breast cancer cells
Directory of Open Access Journals (Sweden)
Wernet Peter
2010-08-01
Full Text Available Abstract Background The miR-200c/141 cluster has recently been implicated in the epithelial to mesenchymal transition (EMT process. The expression of these two miRNAs is inversely correlated with tumorigenicity and invasiveness in several human cancers. The role of these miRNAs in cancer progression is based in part on their capacity to target the EMT activators ZEB1 and ZEB2, two transcription factors, which in turn repress expression of E-cadherin. Little is known about the regulation of the mir200c/141 cluster, whose targeting has been proposed as a promising new therapy for the most aggressive tumors. Findings We show that the miR-200c/141 cluster is repressed by DNA methylation of a CpG island located in the promoter region of these miRNAs. Whereas in vitro methylation of the miR-200c/141 promoter led to shutdown of promoter activity, treatment with a demethylating agent caused transcriptional reactivation in breast cancer cells formerly lacking expression of miR-200c and miR-141. More importantly, we observed that DNA methylation of the identified miR-200c/141 promoter was tightly correlated with phenotype and the invasive capacity in a panel of 8 human breast cancer cell lines. In line with this, in vitro induction of EMT by ectopic expression of the EMT transcription factor Twist in human immortalized mammary epithelial cells (HMLE was accompanied by increased DNA methylation and concomitant repression of the miR-200c/141 locus. Conclusions The present study demonstrates that expression of the miR-200c/141 cluster is regulated by DNA methylation, suggesting epigenetic regulation of this miRNA locus in aggressive breast cancer cell lines as well as untransformed mammary epithelial cells. This epigenetic silencing mechanism might represent a novel component of the regulatory circuit for the maintenance of EMT programs in cancer and normal cells.
Role of DNA methylation in miR-200c/141 cluster silencing in invasive breast cancer cells.
Neves, Rui; Scheel, Christina; Weinhold, Sandra; Honisch, Ellen; Iwaniuk, Katharina M; Trompeter, Hans-Ingo; Niederacher, Dieter; Wernet, Peter; Santourlidis, Simeon; Uhrberg, Markus
2010-08-03
The miR-200c/141 cluster has recently been implicated in the epithelial to mesenchymal transition (EMT) process. The expression of these two miRNAs is inversely correlated with tumorigenicity and invasiveness in several human cancers. The role of these miRNAs in cancer progression is based in part on their capacity to target the EMT activators ZEB1 and ZEB2, two transcription factors, which in turn repress expression of E-cadherin. Little is known about the regulation of the mir200c/141 cluster, whose targeting has been proposed as a promising new therapy for the most aggressive tumors. We show that the miR-200c/141 cluster is repressed by DNA methylation of a CpG island located in the promoter region of these miRNAs. Whereas in vitro methylation of the miR-200c/141 promoter led to shutdown of promoter activity, treatment with a demethylating agent caused transcriptional reactivation in breast cancer cells formerly lacking expression of miR-200c and miR-141. More importantly, we observed that DNA methylation of the identified miR-200c/141 promoter was tightly correlated with phenotype and the invasive capacity in a panel of 8 human breast cancer cell lines. In line with this, in vitro induction of EMT by ectopic expression of the EMT transcription factor Twist in human immortalized mammary epithelial cells (HMLE) was accompanied by increased DNA methylation and concomitant repression of the miR-200c/141 locus. The present study demonstrates that expression of the miR-200c/141 cluster is regulated by DNA methylation, suggesting epigenetic regulation of this miRNA locus in aggressive breast cancer cell lines as well as untransformed mammary epithelial cells. This epigenetic silencing mechanism might represent a novel component of the regulatory circuit for the maintenance of EMT programs in cancer and normal cells.
RNA Silencing in Plants: Mechanisms, Technologies and Applications in Horticultural Crops.
Guo, Qigao; Liu, Qing; Smith, Neil A; Liang, Guolu; Wang, Ming-Bo
2016-12-01
Understanding the fundamental nature of a molecular process or a biological pathway is often a catalyst for the development of new technologies in biology. Indeed, studies from late 1990s to early 2000s have uncovered multiple overlapping but functionally distinct RNA silencing pathways in plants, including the posttranscriptional microRNA and small interfering RNA pathways and the transcriptional RNA-directed DNA methylation pathway. These findings have in turn been exploited for developing artificial RNA silencing technologies such as hairpin RNA, artificial microRNA, intrinsic direct repeat, 3' UTR inverted repeat, artificial trans-acting siRNA, and virus-induced gene silencing technologies. Some of these RNA silencing technologies, such as the hairpin RNA technology, have already been widely used for genetic improvement of crop plants in agriculture. For horticultural plants, RNA silencing technologies have been used to increase disease and pest resistance, alter plant architecture and flowering time, improve commercial traits of fruits and flowers, enhance nutritional values, remove toxic compounds and allergens, and develop high-value industrial products. In this article we aim to provide an overview of the RNA silencing pathways in plants, summarize the existing RNA silencing technologies, and review the current progress in applying these technologies for the improvement of agricultural crops particularly horticultural crops.
Increasing the amylose content of durum wheat through silencing of the SBEIIa genes
Directory of Open Access Journals (Sweden)
Masci Stefania
2010-07-01
Full Text Available Abstract Background High amylose starch has attracted particular interest because of its correlation with the amount of Resistant Starch (RS in food. RS plays a role similar to fibre with beneficial effects for human health, providing protection from several diseases such as colon cancer, diabetes, obesity, osteoporosis and cardiovascular diseases. Amylose content can be modified by a targeted manipulation of the starch biosynthetic pathway. In particular, the inactivation of the enzymes involved in amylopectin synthesis can lead to the increase of amylose content. In this work, genes encoding starch branching enzymes of class II (SBEIIa were silenced using the RNA interference (RNAi technique in two cultivars of durum wheat, using two different methods of transformation (biolistic and Agrobacterium. Expression of RNAi transcripts was targeted to the seed endosperm using a tissue-specific promoter. Results Amylose content was markedly increased in the durum wheat transgenic lines exhibiting SBEIIa gene silencing. Moreover the starch granules in these lines were deformed, possessing an irregular and deflated shape and being smaller than those present in the untransformed controls. Two novel granule bound proteins, identified by SDS-PAGE in SBEIIa RNAi lines, were investigated by mass spectrometry and shown to have strong homologies to the waxy proteins. RVA analysis showed new pasting properties associated with high amylose lines in comparison with untransformed controls. Finally, pleiotropic effects on other starch genes were found by semi-quantitative and Real-Time reverse transcription-polymerase chain reaction (RT-PCR. Conclusion We have found that the silencing of SBEIIa genes in durum wheat causes obvious alterations in granule morphology and starch composition, leading to high amylose wheat. Results obtained with two different methods of transformation and in two durum wheat cultivars were comparable.
Directory of Open Access Journals (Sweden)
Lim Chee Liew
Full Text Available Epigenetics has been recognised to play vital roles in many plant developmental processes, including floral initiation through the epigenetic regulation of gene expression. The histone modifying proteins that mediate these modifications involve the SET domain-containing histone methyltransferases, JmjC domain-containing demethylase, acetylases and deacetylases. In addition, RNA interference (RNAi-associated genes are also involved in epigenetic regulation via RNA-directed DNA methylation and post-transcriptional gene silencing. Soybean, a major crop legume, requires a short day to induce flowering. How histone modifications regulate the plant response to external cues that initiate flowering is still largely unknown. Here, we used RNA-seq to address the dynamics of transcripts that are potentially involved in the epigenetic programming and RNAi mediated gene silencing during the floral initiation of soybean. Soybean is a paleopolyploid that has been subjected to at least two rounds of whole genome duplication events. We report that the expanded genomic repertoire of histone modifiers and RNA silencing genes in soybean includes 14 histone acetyltransferases, 24 histone deacetylases, 47 histone methyltransferases, 15 protein arginine methyltransferases, 24 JmjC domain-containing demethylases and 47 RNAi-associated genes. To investigate the role of these histone modifiers and RNA silencing genes during floral initiation, we compared the transcriptional dynamics of the leaf and shoot apical meristem at different time points after a short-day treatment. Our data reveal that the extensive activation of genes that are usually involved in the epigenetic programming and RNAi gene silencing in the soybean shoot apical meristem are reprogrammed for floral development following an exposure to inductive conditions.
Sebze Püresi ile Üretilen Yoğurtların Tekstürel ve Duyusal Özelliklerinin Belirlenmesi
Directory of Open Access Journals (Sweden)
Tülay Özcan
2016-07-01
Full Text Available Bu çalışmada kontrol (K; balkabağı (YBK, havuç (YHA, bezelye (YBE ve yeşil kabak püreli (YYK yoğurt olmak üzere 5 farklı set tipi yoğurt üretilmiştir. Sebzeli yoğurtlarda bulunan diyet liflerinin bakteri gelişmesini teşvik eden potansiyel etkisi sonucu Streptococcus thermophilus ile Lactobacillus delbrueckii subsp. bulgaricus sayılarının arttığı saptanmıştır. Yoğurtların sebze püreleri ile zenginleştirilmesinin pH, titrasyon asitliği, serum ayrılması, duyusal özelikler ile sertlik, iç yapışkanlık, konsistens ve viskozite indeksi gibi tekstürel özellikler üzerinde etkili olduğu gözlenmiştir. Havuç püresi ile üretilen yoğurtlarda viskozite, konsistens ve sertliğin yüksek olduğu saptanırken, yeşil kabak ilaveli olanlar daha zayıf tekstürel özellikler göstermiştir. Sonuç olarak sebze püresi ilavesinin set tipi yoğurtlarda tekstürel özelliklerinin iyileştirilmesi konusunda önemli rol oynadığı ve fonksiyonel süt ürünlerinin geliştirilmesinde kullanılabileceği belirlenmiştir.
Stability of RNA silencing-based traits after virus infection
DEFF Research Database (Denmark)
Jørgensen, Bodil; Albrechtsen, Merete
2007-01-01
with constructs based on virus coat protein (CP) genes or other viral genes has been successfully used to engineer PTGS-mediated virus resistance into a large number of crop plants and some transgenic lines have been commercially exploited. However the discovery that plant viruses encode suppressors of gene...... silencing has raised concerns that virus infection of crop plants might reverse the new silencing-based traits. Most studies of virus suppression of silencing have used model systems based on silencing of reporter genes. A few studies have analysed the effects of virus infections on plants with genetically...... engineered virus resistance based on either a simple sense or an inverted repeat construct. We decided to use genetically engineered virus resistance in potato as a model system for further studies of the effect of virus infection on genetically engineered traits. We present for the first time a comparison...
Huang, Chung-Hao; Hsiao, Weng-Rong; Huang, Ching-Wen; Chen, Kuan-Chun; Lin, Shih-Shun; Chen, Tsung-Chi; Raja, Joseph A J; Wu, Hui-Wen; Yeh, Shyi-Dong
2015-01-01
The NSs protein of Watermelon silver mottle virus (WSMoV) is the RNA silencing suppressor and pathogenicity determinant. In this study, serial deletion and point-mutation mutagenesis of conserved regions (CR) of NSs protein were performed, and the silencing suppression function was analyzed through agroinfiltration in Nicotiana benthamiana plants. We found two amino acid (aa) residues, H113 and Y398, are novel functional residues for RNA silencing suppression. Our further analyses demonstrated that H113 at the common epitope (CE) ((109)KFTMHNQ(117)), which is highly conserved in Asia type tospoviruses, and the benzene ring of Y398 at the C-terminal β-sheet motif ((397)IYFL(400)) affect NSs mRNA stability and protein stability, respectively, and are thus critical for NSs RNA silencing suppression. Additionally, protein expression of other six deleted (ΔCR1-ΔCR6) and five point-mutated (Y15A, Y27A, G180A, R181A and R212A) mutants were hampered and their silencing suppression ability was abolished. The accumulation of the mutant mRNAs and proteins, except Y398A, could be rescued or enhanced by co-infiltration with potyviral suppressor HC-Pro. When assayed with the attenuated Zucchini yellow mosaic virus vector in squash plants, the recombinants carrying individual seven point-mutated NSs proteins displayed symptoms much milder than the recombinant carrying the wild type NSs protein, suggesting that these aa residues also affect viral pathogenicity by suppressing the host silencing mechanism.
Lu, Yuhong; Wajapeyee, Narendra; Turker, Mitchell S.; Glazer, Peter M.
2014-01-01
SUMMARY Silencing of the MLH1 gene is frequently seen in sporadic cancers. We report that hypoxia causes decreased H3K4 methylation at the MLH1 promoter via the H3K4 demethylases, LSD1 and PLU-1, and promotes long-term silencing of the promoter in a pathway that requires LSD1. Knockdown of LSD1 or its co-repressor, CoREST, also prevents the re-silencing (and cytosine DNA methylation) of the endogenous MLH1 promoter in RKO colon cancer cells following transient reactivation by the DNA methyltransferase inhibitor 5-aza-2′-deoxycytidine (5-aza-dC). The results demonstrate that hypoxia is a critical driving force for silencing of MLH1 through chromatin modification and indicate that the LSD1/CoREST complex is essential for MLH1 silencing. PMID:25043185
Antiviral RNA silencing suppression activity of Tomato spotted wilt virus NSs protein.
Ocampo Ocampo, T; Gabriel Peralta, S M; Bacheller, N; Uiterwaal, S; Knapp, A; Hennen, A; Ochoa-Martinez, D L; Garcia-Ruiz, H
2016-06-17
In addition to regulating gene expression, RNA silencing is an essential antiviral defense system in plants. Triggered by double-stranded RNA, silencing results in degradation or translational repression of target transcripts. Viruses are inducers and targets of RNA silencing. To condition susceptibility, most plant viruses encode silencing suppressors that interfere with this process, such as the Tomato spotted wilt virus (TSWV) NSs protein. The mechanism by which NSs suppresses RNA silencing and its role in viral infection and movement remain to be determined. We cloned NSs from the Hawaii isolate of TSWV and using two independent assays show for the first time that this protein restored pathogenicity and supported the formation of local infection foci by suppressor-deficient Turnip mosaic virus and Turnip crinkle virus. Demonstrating the suppression of RNA silencing directed against heterologous viruses establishes the foundation to determine the means used by NSs to block this antiviral process.
MicroRNA-145 Aggravates Hypoxia-Induced Injury by Targeting Rac1 in H9c2 Cells.
Wang, Ximing; Zhang, Yanxia; Wang, Hongshan; Zhao, Genshang; Fa, Xianen
2017-01-01
Myocardial infarction (MI) is a leading cause of morbidity and mortality. Here, we sought to explore the potential role and underlying mechanism of miR-145 in MI. H9c2 cells were cultured under persistent hypoxia to simulate MI. The hypoxia-induced injury was assessed on the basis of cell viability, migration, invasion and apoptosis. The expression of miR-145 was evaluated by qRT-PCR and the influence of aberrantly expressed miR-145 on H9c2 cells under hypoxia was also estimated. Utilizing bioinformatics methods, the target genes of miR-145 were verified by luciferase reporter assay. Then, effects of abnormally expressed target gene on miR-145 silenced H9c2 cells were assessed. Finally, the phosphorylation levels of key kinases in the phosphatidylinositol-3-kinase (PI3K)/AKT and the mitogen-activated protein kinase (MAPK)/extracellular signal-regulated kinase (ERK) pathways were detected by Western blot analysis. Hypoxia remarkably lowered viability, migration and invasion but promoted cell apoptosis. Meantime, the miR-145 level was up-regulated in H9c2 cells under hypoxia. Following experiments suggested that hypoxia-induced injury was exacerbated by miR-145 overexpression while was alleviated by miR-145 silence. Rac1 was predicted and further validated to be a target gene of miR-145. The influence of miR-145 silencing on H9c2 cells under hypoxia could be reversed by down-regulation of Rac1. Additionally, the phosphorylation levels of PI3K, AKT, MAPK and ERK were all elevated in miR-145 silenced cells and these alterations were reversed by down-regulation of Rac1. miR-145 silencing could protect H9c2 cells against hypoxia-induced injury by targeting Rac1, in which PI3K/AKT and MAPK/ERK pathways might be involved. © 2017 The Author(s). Published by S. Karger AG, Basel.
C. elegans ADARs antagonize silencing of cellular dsRNAs by the antiviral RNAi pathway.
Reich, Daniel P; Tyc, Katarzyna M; Bass, Brenda L
2018-02-01
Cellular dsRNAs are edited by adenosine deaminases that act on RNA (ADARs). While editing can alter mRNA-coding potential, most editing occurs in noncoding sequences, the function of which is poorly understood. Using dsRNA immunoprecipitation (dsRIP) and RNA sequencing (RNA-seq), we identified 1523 regions of clustered A-to-I editing, termed editing-enriched regions (EERs), in four stages of Caenorhabditis elegans development, often with highest expression in embryos. Analyses of small RNA-seq data revealed 22- to 23-nucleotide (nt) siRNAs, reminiscent of viral siRNAs, that mapped to EERs and were abundant in adr-1;adr-2 mutant animals. Consistent with roles for these siRNAs in silencing, EER-associated genes (EAGs) were down-regulated in adr-1;adr-2 embryos, and this was dependent on associated EERs and the RNAi factor RDE-4. We observed that ADARs genetically interact with the 26G endogenous siRNA (endo-siRNA) pathway, which likely competes for RNAi components; deletion of factors required for this pathway ( rrf-3 or ergo-1 ) in adr-1;adr-2 mutant strains caused a synthetic phenotype that was rescued by deleting antiviral RNAi factors. Poly(A) + RNA-seq revealed EAG down-regulation and antiviral gene induction in adr-1;adr-2;rrf-3 embryos, and these expression changes were dependent on rde-1 and rde-4 Our data suggest that ADARs restrict antiviral silencing of cellular dsRNAs. © 2018 Reich et al.; Published by Cold Spring Harbor Laboratory Press.
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 4. Silence of the Genes - 2006 Nobel Prize in Physiology or Medicine. Utpal Nath Saumitra Das. General Article Volume 12 Issue 4 April 2007 pp 6-18. Fulltext. Click here to view fulltext PDF. Permanent link:
Maternal Silences: Motherhood and Voluntary Childlessness in Contemporary Christianity
Directory of Open Access Journals (Sweden)
Dawn Llewellyn
2016-06-01
Full Text Available In Christianity, there is an ideology of motherhood that pervades scripture, ritual, and doctrine, yet there is an academic silence that means relatively little space has been given to motherhood and mothering, and even less to voluntary childlessness, from a faith perspective. By drawing on qualitative in-depth interviews with Christian women living in Britain, narrating their experiences of motherhood and voluntary childlessness, I suggest there are also lived maternal silences encountered by women in contemporary Christianity. There is a maternal expectation produced through church teaching, liturgy and culture that constructs women as ‘maternal bodies’ (Gatrell 2008; this silences and marginalises women from articulating their complex relationship with religion, motherhood, and childlessness in ways that challenge their spiritual development. However, this article also introduces the everyday and intentional tactics women employ to disrupt the maternal expectation, and hereby interrupt the maternal silence.
SiC/SiC Leading Edge Turbine Airfoil Tested Under Simulated Gas Turbine Conditions
Robinson, R. Craig; Hatton, Kenneth S.
1999-01-01
Silicon-based ceramics have been proposed as component materials for use in gas turbine engine hot-sections. A high pressure burner rig was used to expose both a baseline metal airfoil and ceramic matrix composite leading edge airfoil to typical gas turbine conditions to comparatively evaluate the material response at high temperatures. To eliminate many of the concerns related to an entirely ceramic, rotating airfoil, this study has focused on equipping a stationary metal airfoil with a ceramic leading edge insert to demonstrate the feasibility and benefits of such a configuration. Here, the idea was to allow the SiC/SiC composite to be integrated as the airfoil's leading edge, operating in a "free-floating" or unrestrained manner. and provide temperature relief to the metal blade underneath. The test included cycling the airfoils between simulated idle, lift, and cruise flight conditions. In addition, the airfoils were air-cooled, uniquely instrumented, and exposed to the same internal and external conditions, which included gas temperatures in excess of 1370 C (2500 F). Results show the leading edge insert remained structurally intact after 200 simulated flight cycles with only a slightly oxidized surface. The instrumentation clearly suggested a significant reduction (approximately 600 F) in internal metal temperatures as a result of the ceramic leading edge. The object of this testing was to validate the design and analysis done by Materials Research and Design of Rosemont, PA and to determine the feasibility of this design for the intended application.
Bodies, Spaces, Voices, Silences
Directory of Open Access Journals (Sweden)
Donatella Mazzoleni
2013-07-01
Full Text Available A good architecture should not only allow functional, formal and technical quality for urban spaces, but also let the voice of the city be perceived, listened, enjoyed. Every city has got its specific sound identity, or “ISO” (R. O. Benenzon, made up of a complex texture of background noises and fluctuation of sound figures emerging and disappearing in a game of continuous fadings. For instance, the ISO of Naples is characterized by a spread need of hearing the sound return of one’s/others voices, by a hate of silence. Cities may fall ill: illness from noise, within super-crowded neighbourhoods, or illness from silence, in the forced isolation of peripheries. The proposal of an urban music therapy denotes an unpublished and innovative enlarged interdisciplinary research path, where architecture, music, medicine, psychology, communication science may converge, in order to work for rebalancing spaces and relation life of the urban collectivity, through the care of body and sound dimensions.
Seo, Gi Won; Jo, Yong Hun; Seong, Jeong Hwan; Park, Ki Beom; Patnaik, Bharat Bhusan; Tindwa, Hamisi; Kim, Sun-Am; Lee, Yong Seok; Kim, Yu Jung; Han, Yeon Soo
2016-08-20
The 14-3-3 family of phosphorylated serine-binding proteins acts as signaling molecules in biological processes such as metabolism, division, differentiation, autophagy, and apoptosis. Herein, we report the requirement of 14-3-3ɛ isoform from Tenebrio molitor (Tm14-3-3ɛ) in the hemocyte antimicrobial activity. The Tm14-3-3ɛ transcript is 771 nucleotides in length and encodes a polypeptide of 256 amino acid residues. The protein has the typical 14-3-3 domain, the nuclear export signal (NES) sequence, and the peptide binding residues. The Tm14-3-3ɛ transcript shows a significant three-fold expression in the hemocyte of T. molitor larvae when infected with Escherichia coli Tm14-3-3ɛ silenced larvae show significantly lower survival rates when infected with E. coli. Under Tm14-3-3ɛ silenced condition, a strong antimicrobial activity is elicited in the hemocyte of the host inoculated with E. coli. This suggests impaired secretion of antimicrobial peptides (AMP) into the hemolymph. Furthermore, a reduction in AMP secretion under Tm14-3-3ɛ silenced condition would be responsible for loss in the capacity to kill bacteria and might explain the reduced survivability of the larvae upon E. coli challenge. This shows that Tm14-3-3ɛ is required to maintain innate immunity in T. molitor by enabling antimicrobial secretion into the hemolymph and explains the functional specialization of the isoform.
Directory of Open Access Journals (Sweden)
Gi Won Seo
2016-08-01
Full Text Available The 14-3-3 family of phosphorylated serine-binding proteins acts as signaling molecules in biological processes such as metabolism, division, differentiation, autophagy, and apoptosis. Herein, we report the requirement of 14-3-3ɛ isoform from Tenebrio molitor (Tm14-3-3ɛ in the hemocyte antimicrobial activity. The Tm14-3-3ɛ transcript is 771 nucleotides in length and encodes a polypeptide of 256 amino acid residues. The protein has the typical 14-3-3 domain, the nuclear export signal (NES sequence, and the peptide binding residues. The Tm14-3-3ɛ transcript shows a significant three-fold expression in the hemocyte of T. molitor larvae when infected with Escherichia coli Tm14-3-3ɛ silenced larvae show significantly lower survival rates when infected with E. coli. Under Tm14-3-3ɛ silenced condition, a strong antimicrobial activity is elicited in the hemocyte of the host inoculated with E. coli. This suggests impaired secretion of antimicrobial peptides (AMP into the hemolymph. Furthermore, a reduction in AMP secretion under Tm14-3-3ɛ silenced condition would be responsible for loss in the capacity to kill bacteria and might explain the reduced survivability of the larvae upon E. coli challenge. This shows that Tm14-3-3ɛ is required to maintain innate immunity in T. molitor by enabling antimicrobial secretion into the hemolymph and explains the functional specialization of the isoform.
Analysis of Tospovirus NSs Proteins in Suppression of Systemic Silencing
Hedil, Marcio; Sterken, Mark G.; de Ronde, Dryas; Lohuis, Dick; Kormelink, Richard
2015-01-01
RNA silencing is a sequence-specific gene regulation mechanism that in plants also acts antiviral. In order to counteract antiviral RNA silencing, viruses have evolved RNA silencing suppressors (RSS). In the case of tospoviruses, the non-structural NSs protein has been identified as the RSS. Although the tomato spotted wilt virus (TSWV) tospovirus NSs protein has been shown to exhibit affinity to long and small dsRNA molecules, its ability to suppress the non-cell autonomous part of RNA silen...
DICER-LIKE2 plays a primary role in transitive silencing of transgenes in Arabidopsis.
Directory of Open Access Journals (Sweden)
Sizolwenkosi Mlotshwa
2008-03-01
Full Text Available Dicer-like (DCL enzymes play a pivotal role in RNA silencing in plants, processing the long double-stranded RNA (dsRNA that triggers silencing into the primary short interfering RNAs (siRNAs that mediate it. The siRNA population can be augmented and silencing amplified via transitivity, an RNA-dependent RNA polymerase (RDR-dependent pathway that uses the target RNA as substrate to generate secondary siRNAs. Here we report that Arabidopsis DCL2-but not DCL4-is required for transitivity in cell-autonomous, post-transcriptional silencing of transgenes. An insertion mutation in DCL2 blocked sense transgene-induced silencing and eliminated accumulation of the associated RDR-dependent siRNAs. In hairpin transgene-induced silencing, the dcl2 mutation likewise eliminated accumulation of secondary siRNAs and blocked transitive silencing, but did not block silencing mediated by primary siRNAs. Strikingly, in all cases, the dcl2 mutation eliminated accumulation of all secondary siRNAs, including those generated by other DCL enzymes. In contrast, mutations in DCL4 promoted a dramatic shift to transitive silencing in the case of the hairpin transgene and enhanced silencing induced by the sense transgene. Suppression of hairpin and sense transgene silencing by the P1/HC-Pro and P38 viral suppressors was associated with elimination of secondary siRNA accumulation, but the suppressors did not block processing of the stem of the hairpin transcript into primary siRNAs. Thus, these viral suppressors resemble the dcl2 mutation in their effects on siRNA biogenesis. We conclude that DCL2 plays an essential, as opposed to redundant, role in transitive silencing of transgenes and may play a more important role in silencing of viruses than currently thought.
Regional Educational Laboratory West, 2014
2014-01-01
To figure out better ways to serve their English language learner (ELL) students, the state departments of education in the West Region states of Arizona, Nevada, and Utah, who are members of the English Learner Alliance, asked REL West to help them put together a more detailed picture of two particular groups of K-12 ELL students who seem to…
Funcions del documentalista en un mitjà de comunicació audiovisual digital. Estudi de cas: RelTV
Directory of Open Access Journals (Sweden)
Rubio, Albert
2014-12-01
Full Text Available Es mostra un estudi de cas sobre la intervenció d'un documentalista en un nou mitjà de comunicació audiovisual a Internet, RelTV. Es presenten tres projectes diferents duts a terme pel documentalista en aquest context: una base de dades relacional, un pla de preservació digital i un exemple de producte periodístic-documental: un mapa interactiu de vídeos. Es presenta el disseny i desenvolupament dels tres productes, se n'analitza la repercussió i viabilitat, i es reflexiona sobre l'aportació del professional de la documentació en aquest àmbit.Se muestra un estudio de caso sobre la intervención de un documentalista en un nuevo medio de comunicación audiovisual en Internet, RelTV. Se presentan tres proyectos diferentes llevados a cabo por el documentalista en este contexto: una base de datos relacional, un plan de preservación digital y un ejemplo de producto periodístico-documental: un mapa interactivo de vídeos. Se presenta el diseño y desarrollo de los tres productos, se analiza su repercusión y viabilidad, y se reflexiona sobre la aportación del profesional de la documentación en este ámbito.This paper reports on three projects completed by a documentalist for the new audiovisual platform RelTV: a relational database, a digital preservation plan and an example of a journalistic-documental product in the form of an interactive map of videos. The paper reports on how the three projects were designed and developed and then analyzes the implications and viability of such initiatives, reflecting on the professional contribution that documentalists can make in this field.
Directory of Open Access Journals (Sweden)
Roebuck Kenneth A
2002-03-01
Full Text Available Abstract Background Respiratory syncytial virus (RSV infection of airway epithelial cells stimulates the expression and secretion of a variety of cytokines including the chemotactic cytokines interleukin-8 (IL-8, monocyte chemoattractant protein-1 (MCP-1, and RANTES (regulated upon activation, normal T cell expressed and secreted. Chemokines are important chemoattractants for the recruitment of distinct sets of leukocytes to airway sites of inflammation. Results We have shown previously that chemokine expression is regulated in airway epithelial cells (A549 in a stimulus-specific manner in part through the redox-responsive transcription factors AP-1 and NF-κB. In this study, we examined the NF-κB-mediated effects of RSV and the proinflammatory cytokine TNFα on the induction of IL-8, MCP-1 and RANTES chemokine gene expression in A549 epithelial cells. The results demonstrate that RSV induces chemokine expression with distinct kinetics that is associated with a specific pattern of NF-κB binding activity. This distinction was further demonstrated by the differential effects of the NF-κB inhibitors dexamethasone (DEX and N-acetyl-L-cysteine (NAC. NAC preferentially inhibited RSV induced chemokine expression, whereas DEX preferentially inhibited TNFα induced chemokine expression. DNA binding studies using NF-κB subunit specific binding ELISA demonstrated that RSV and TNFα induced different NF-κB binding complexes containing Rel A (p65 and NF-κB1 (p50. Both TNFα and RSV strongly induced Rel A the activation subunit of NF-κB, whereas only TNFα was able to substantially induce the p50 subunit. Consistent with the expression studies, RSV but not TNFα induction of Rel A and p50 were markedly inhibited by NAC, providing a mechanism by which TNFα and RSV can differentially activate chemokine gene expression via NF-κB. Conclusions These data suggest that RSV induction of chemokine gene expression, in contrast to TNFα, involves redox
Zhu, Yali; Cherukuri, Nil Celebi; Jackel, Jamie N; Wu, Zetang; Crary, Monica; Buckley, Kenneth J; Bisaro, David M; Parris, Deborah S
2012-03-01
Ebola virus (EBOV) causes a lethal hemorrhagic fever for which there is no approved effective treatment or prevention strategy. EBOV VP35 is a virulence factor that blocks innate antiviral host responses, including the induction of and response to alpha/beta interferon. VP35 is also an RNA silencing suppressor (RSS). By inhibiting microRNA-directed silencing, mammalian virus RSSs have the capacity to alter the cellular environment to benefit replication. A reporter gene containing specific microRNA target sequences was used to demonstrate that prior expression of wild-type VP35 was able to block establishment of microRNA silencing in mammalian cells. In addition, wild-type VP35 C-terminal domain (CTD) protein fusions were shown to bind small interfering RNA (siRNA). Analysis of mutant proteins demonstrated that reporter activity in RSS assays did not correlate with their ability to antagonize double-stranded RNA (dsRNA)-activated protein kinase R (PKR) or bind siRNA. The results suggest that enhanced reporter activity in the presence of VP35 is a composite of nonspecific translational enhancement and silencing suppression. Moreover, most of the specific RSS activity in mammalian cells is RNA binding independent, consistent with VP35's proposed role in sequestering one or more silencing complex proteins. To examine RSS activity in a system without interferon, VP35 was tested in well-characterized plant silencing suppression assays. VP35 was shown to possess potent plant RSS activity, and the activities of mutant proteins correlated strongly, but not exclusively, with RNA binding ability. The results suggest the importance of VP35-protein interactions in blocking silencing in a system (mammalian) that cannot amplify dsRNA.
The Curious Silence of the Dog and Paul of Tarsus; Revisiting The Argument from Silence
Directory of Open Access Journals (Sweden)
Michael Gary Duncan
2012-03-01
Full Text Available In this essay I propose an interpretative and explanatory structure for the so-called argumentum ex silento, or argument from silence (henceforth referred to as the AFS. To this end, I explore two examples, namely, Sherlock Holmes’s oft-quoted notice of the “curious incident of the dog in the night-time” from Arthur Conan Doyle’s short story “Silver Blaze,” and the historical question of Paul of Tarsus’s silence on biographical details of the historical Jesus. Through these cases, I conclude that the AFS serves as a dialogical topos best evaluated and understood through the perceived authority of the arguer and the willingness of the audience to accept that authority, due to the “curious” nature of the negative evidence that the argument employed.
Surprised by Bird, Bard, and Bach: Language, Silence, and Transcendence.
Suhor, Charles
1991-01-01
Argues the importance of the relationships among silence and literature, the arts, and other experiences that point toward transcendence. Suggests that English teachers can expand the repertoire of classroom activities and teaching techniques that make use of silence. (KEH)
Energy Technology Data Exchange (ETDEWEB)
Burmeister, Ingo
2017-07-01
This thesis presents the first measurement of the b-tagging efficiency ε{sub b} with the p{sub T}{sup rel}-method under Run 2 conditions at the ATLAS experiment. The measurement has been performed for semi-leptonically decaying b-hadrons with a muon in the final state. This has been achieved by selecting events with a muon associated to a jet by a cone based matching algorithm. The p{sub T}{sup rel}-variable is sensitive to the mass of the weakly decaying particle and is therefore sensitive to the jet-flavor. Exploiting this dependence, the flavor fractions are determined with a log-likelihood template fit to the p{sub T}{sup rel}-distribution in the tagged and untagged jet samples determined by the algorithm and operating point under study. The dataset used for this study corresponds to an integrated luminosity of 11.6 fb{sup -1} of proton-proton-collisions taken with the ATLAS detector at √(s)=13 TeV center of mass energy. In addition, ε{sub b} has been measured for algorithms on trigger level using the p{sub T}{sup rel}-method. This has been conducted in a set of proton-proton-collisions recorded at the ATLAS experiment at √(s)=8 TeV center of mass energy. Here, a conditional calibration depending on off-line tagger decisions has been utilized.
Bavuso, Salvatore J.; Rothmann, Elizabeth; Dugan, Joanne Bechta; Trivedi, Kishor S.; Mittal, Nitin; Boyd, Mark A.; Geist, Robert M.; Smotherman, Mark D.
1994-01-01
The Hybrid Automated Reliability Predictor (HARP) integrated Reliability (HiRel) tool system for reliability/availability prediction offers a toolbox of integrated reliability/availability programs that can be used to customize the user's application in a workstation or nonworkstation environment. HiRel consists of interactive graphical input/output programs and four reliability/availability modeling engines that provide analytical and simulative solutions to a wide host of reliable fault-tolerant system architectures and is also applicable to electronic systems in general. The tool system was designed to be compatible with most computing platforms and operating systems, and some programs have been beta tested, within the aerospace community for over 8 years. Volume 1 provides an introduction to the HARP program. Comprehensive information on HARP mathematical models can be found in the references.
Strategy of gene silencing in cassava for validation of resistance genes
International Nuclear Information System (INIS)
Cortes, Simon; Lopez, Camilo
2010-01-01
Cassava (Manihot esculenta) is a major source of food for more than 1000 million people in the world and constitutes an important staple crop. Cassava bacterial blight, caused by the gram negative bacterium Xanthomonas axonopodis pv. manihotis, is one of the most important constraints for this crop. A candidate resistance gene against cassava bacterial blight, named RXam1, has been identified previously. In this work, we employed the gene silencing approach using the African cassava mosaic virus (ACMV) to validate the function of the RXam1 gene. We used as positive control the su gen, which produce photo blanching in leaves when is silenced. Plants from the SG10735 variety were bombardment with the ACMV-A-SU+ACMV-B y ACMV-A-RXam1+ACMV-B constructions. The silencing efficiency employing the su gene was low, only one of seven plants showed photo blanching. In the putative silenced plants for the RXam1 gene, no presence of siRNAs corresponding to RXam1 was observed; although a low diminution of the RXam1 gene expression was obtained. The growth curves for the Xam strain CIO136 in cassava plants inoculated showing a little but no significance difference in the susceptibility in the silenced plants compared to not silenced
Arabidopsis HDA6 regulates locus-directed heterochromatin silencing in cooperation with MET1.
Taiko Kim To; Jong-Myong Kim; Akihiro Matsui; Yukio Kurihara; Taeko Morosawa; Junko Ishida; Maho Tanaka; Takaho Endo; Tetsuji Kakutani; Tetsuro Toyoda; Hiroshi Kimura; Shigeyuki Yokoyama; Kazuo Shinozaki; Motoaki Seki
2011-01-01
Heterochromatin silencing is pivotal for genome stability in eukaryotes. In Arabidopsis, a plant-specific mechanism called RNA–directed DNA methylation (RdDM) is involved in heterochromatin silencing. Histone deacetylase HDA6 has been identified as a component of such machineries; however, its endogenous targets and the silencing mechanisms have not been analyzed globally. In this study, we investigated the silencing mechanism mediated by HDA6. Genome-wide transcript profiling revealed that t...
Hammond, Thomas M.; Xiao, Hua; Boone, Erin C.; Perdue, Tony D.; Pukkila, Patricia J.; Shiu, Patrick K. T.
2011-01-01
In Neurospora crassa, genes lacking a pairing partner during meiosis are suppressed by a process known as meiotic silencing by unpaired DNA (MSUD). To identify novel MSUD components, we have developed a high-throughput reverse-genetic screen for use with the N. crassa knockout library. Here we describe the screening method and the characterization of a gene (sad-3) subsequently discovered. SAD-3 is a putative helicase required for MSUD and sexual spore production. It exists in a complex with other known MSUD proteins in the perinuclear region, a center for meiotic silencing activity. Orthologs of SAD-3 include Schizosaccharomyces pombe Hrr1, a helicase required for RNAi-induced heterochromatin formation. Both SAD-3 and Hrr1 interact with an RNA-directed RNA polymerase and an Argonaute, suggesting that certain aspects of silencing complex formation may be conserved between the two fungal species. PMID:22384347
Active compressor engine silencer reduces exhaust noise
International Nuclear Information System (INIS)
Denenberg, J.N.; Miller, S.K.; Jay, M.A.
1994-01-01
An active industrial silencer on a compressor engine at a Tenneco Gas station has reduced low-frequency 'rumbling' noise by 8 dB during trials while lowering backpressure about 90$. This 8 dB reduction of the piston firing frequency corresponds to a more than 80% decrease in emitted acoustic power. The silencing unit, installed on one of six engines at the station near Eden, N.Y., continues in operation. Based on the results, the manufacturer is identifying additional compressor sites for further tests. This paper reviews this project
Ding, Xin Shun; Schneider, William L; Chaluvadi, Srinivasa Rao; Mian, M A Rouf; Nelson, Richard S
2006-11-01
Virus-induced gene silencing (VIGS) is used to analyze gene function in dicotyledonous plants but less so in monocotyledonous plants (particularly rice and corn), partially due to the limited number of virus expression vectors available. Here, we report the cloning and modification for VIGS of a virus from Festuca arundinacea Schreb. (tall fescue) that caused systemic mosaic symptoms on barley, rice, and a specific cultivar of maize (Va35) under greenhouse conditions. Through sequencing, the virus was determined to be a strain of Brome mosaic virus (BMV). The virus was named F-BMV (F for Festuca), and genetic determinants that controlled the systemic infection of rice were mapped to RNAs 1 and 2 of the tripartite genome. cDNA from RNA 3 of the Russian strain of BMV (R-BMV) was modified to accept inserts from foreign genes. Coinoculation of RNAs 1 and 2 from F-BMV and RNA 3 from R-BMV expressing a portion of a plant gene to leaves of barley, rice, and maize plants resulted in visual silencing-like phenotypes. The visual phenotypes were correlated with decreased target host transcript levels in the corresponding leaves. The VIGS visual phenotype varied from maintained during silencing of actin 1 transcript expression to transient with incomplete penetration through affected tissue during silencing of phytoene desaturase expression. F-BMV RNA 3 was modified to allow greater accumulation of virus while minimizing virus pathogenicity. The modified vector C-BMV(A/G) (C for chimeric) was shown to be useful for VIGS. These BMV vectors will be useful for analysis of gene function in rice and maize for which no VIGS system is reported.
Bharti, Poonam; Jyoti, Poonam; Kapoor, Priya; Sharma, Vandana; Shanmugam, V; Yadav, Sudesh Kumar
2017-08-01
This study presents a novel approach of controlling vascular wilt in tomato by RNAi expression directed to pathogenicity genes of Fusarium oxysporum f. sp. lycopersici. Vascular wilt of tomato caused by Fusarium oxysporum f. sp. lycopersici leads to qualitative and quantitative loss of the crop. Limitation in the existing control measures necessitates the development of alternative strategies to increase resistance in the plants against pathogens. Recent findings paved way to RNAi, as a promising method for silencing of pathogenicity genes in fungus and provided effective resistance against fungal pathogens. Here, two important pathogenicity genes FOW2, a Zn(II)2Cys6 family putative transcription regulator, and chsV, a putative myosin motor and a chitin synthase domain, were used for host-induced gene silencing through hairpinRNA cassettes of these genes against Fusarium oxysporum f. sp. lycopersici. HairpinRNAs were assembled in appropriate binary vectors and transformed into tomato plant targeting FOW2 and chsV genes, for two highly pathogenic strains of Fusarium oxysporum viz. TOFOL-IHBT and TOFOL-IVRI. Transgenic tomatoes were analyzed for possible attainment of resistance in transgenic lines against fungal infection. Eight transgenic lines expressing hairpinRNA cassettes showed trivial disease symptoms after 6-8 weeks of infection. Hence, the host-induced posttranscriptional gene silencing of pathogenicity genes in transgenic tomato plants has enhanced their resistance to vascular wilt disease caused by Fusarium oxysporum.
Directory of Open Access Journals (Sweden)
Saeedeh Shafiee Nahrkhalaji
2013-05-01
Full Text Available This study examined naturally-occurring university classroominteractions at Iranian universities and provided an analysis ofsilence patterns as politeness strategies used by male andfemale students. Since empirical studies of silence inclassroom settings are scarce, this paper aimed to explainsuch phenomena using participant interviews, classroomobservation and detailed discourse analysis of classroominteraction. Silence patterns and their interpretations werescrutinized in these observations and were discussed inrelation to specific conceptualization of politeness anddevices employed to exercise it. The study found that femalesseem to be the most silent in the cross-sex classrooms, whilethe distribution of silence is more nearly equal in the same sexclassrooms. Based on the comments from follow-upinterviews, reasons for intentional silence as a politenessstrategy were categorized into four groups: silence as a face savingstrategy, silence as a ‘don’t do the FTA’ strategy,silence as a power strategy, and silence as an off-recordstrategy.
Datu bāzes struktūras un datu tranformācija no relāciju datu bāzes uz NoSQL datu bāzi
Jērāne, Austra
2013-01-01
Bakalaura darbā „Datu bāzes struktūras un datu tranformācija no relāciju datu bāzes uz NoSQL datu bāzi” ir apkopota informācija par relāciju datu bāzu un NoSQL datu bāzu īpašībām un uz šī pētījuma pamata ir veikta dokumentu vadības sistēmas datu bāzes daļas tranformācija uz NoSQL datu bāzi.
Communicative Silences: Forms and Functions
Bruneau, Thomas J.
1973-01-01
The nature of silence is discussed as an imposition of mind, as an interdependent signification ground for speech signs, as a relationship to mental time (as opposed to artificial time), and as it relates to sensation, perception and metaphorical movement. (Author)
ORGANIZATIONAL SILENCE: SUATU PENGHAMBAT DALAM MEWUJUDKAN KREATIFITAS ORGANISASIONAL
Directory of Open Access Journals (Sweden)
Berta Bekti Retnawati
2016-11-01
Full Text Available There are powerful forces in many organzations that cause widespread withholding of information about potential problems or issues by employess, this collective-level phenomenon as ‘organizational silence’. One significant effect of organizational silence relates to lack of organizational creativity.There are five major organizational factors that enhance creativity in a work environment: organizational climate, leadership style, organizational culture, resources and skills, the structure and system of an organization. Keywords: organizational silence, organizational creativity
Fang, Ling; Choudhary, Sanjeev; Zhao, Yingxin; Edeh, Chukwudi B; Yang, Chunying; Boldogh, Istvan; Brasier, Allan R.
2014-01-01
Ataxia-telangiectasia mutated (ATM), a member of the phosphatidylinositol 3 kinase-like kinase family, is a master regulator of the double strand DNA break-repair pathway after genotoxic stress. Here, we found ATM serves as an essential regulator of TNF-induced NF-kB pathway. We observed that TNF exposure of cells rapidly induced DNA double strand breaks and activates ATM. TNF-induced ROS promote nuclear IKKγ association with ubiquitin and its complex formation with ATM for nuclear export. Activated cytoplasmic ATM is involved in the selective recruitment of the E3-ubiquitin ligase β-TrCP to phospho-IκBα proteosomal degradation. Importantly, ATM binds and activates the catalytic subunit of protein kinase A (PKAc), ribosmal S6 kinase that controls RelA Ser 276 phosphorylation. In ATM knockdown cells, TNF-induced RelA Ser 276 phosphorylation is significantly decreased. We further observed decreased binding and recruitment of the transcriptional elongation complex containing cyclin dependent kinase-9 (CDK9; a kinase necessary for triggering transcriptional elongation) to promoters of NF-κB-dependent immediate-early cytokine genes, in ATM knockdown cells. We conclude that ATM is a nuclear damage-response signal modulator of TNF-induced NF-κB activation that plays a key scaffolding role in IκBα degradation and RelA Ser 276 phosphorylation. Our study provides a mechanistic explanation of decreased innate immune response associated with A-T mutation. PMID:24957606
Haskins, Cathleen
2011-01-01
Slowing down, quieting the mind and body, and experiencing silence nourishes the spirit. Montessori educators are mandated to cultivate not just the intellect but the whole child. They recognize that nurturing the spirit of the child is part of what makes this form of education work so well. This article discusses the benefits of stillness and…
Verhulst, Eveline C; Lynch, Jeremy A; Bopp, Daniel; Beukeboom, Leo W; van de Zande, Louis
2013-01-01
Although sex determination is a universal process in sexually reproducing organisms, sex determination pathways are among the most highly variable genetic systems found in nature. Nevertheless, general principles can be identified among the diversity, like the central role of transformer (tra) in insects. When a functional TRA protein is produced in early embryogenesis, the female sex determining route is activated, while prevention of TRA production leads to male development. In dipterans, male development is achieved by prevention of female-specific splicing of tra mRNA, either mediated by X-chromosome dose or masculinizing factors. In Hymenoptera, which have haplodiploid sex determination, complementary sex determination and maternal imprinting have been identified to regulate timely TRA production. In the parasitoid Nasonia, zygotic transformer (Nvtra) expression and splicing is regulated by a combination of maternal provision of Nvtra mRNA and silencing of Nvtra expression in unfertilized eggs. It is unclear, however, if this silencing is directly on the tra locus or whether it is mediated through maternal silencing of a trans-acting factor. Here we show that in Nasonia, female sex determination is dependent on zygotic activation of Nvtra expression by an as yet unknown factor. This factor, which we propose to term womanizer (wom), is maternally silenced during oogenesis to ensure male development in unfertilized eggs. This finding implicates the upstream recruitment of a novel gene in the Nasonia sex determining cascade and supports the notion that sex determining cascades can rapidly change by adding new components on top of existing regulators.
Bopp, Daniel; Beukeboom, Leo W.; van de Zande, Louis
2013-01-01
Although sex determination is a universal process in sexually reproducing organisms, sex determination pathways are among the most highly variable genetic systems found in nature. Nevertheless, general principles can be identified among the diversity, like the central role of transformer (tra) in insects. When a functional TRA protein is produced in early embryogenesis, the female sex determining route is activated, while prevention of TRA production leads to male development. In dipterans, male development is achieved by prevention of female-specific splicing of tra mRNA, either mediated by X-chromosome dose or masculinizing factors. In Hymenoptera, which have haplodiploid sex determination, complementary sex determination and maternal imprinting have been identified to regulate timely TRA production. In the parasitoid Nasonia, zygotic transformer (Nvtra) expression and splicing is regulated by a combination of maternal provision of Nvtra mRNA and silencing of Nvtra expression in unfertilized eggs. It is unclear, however, if this silencing is directly on the tra locus or whether it is mediated through maternal silencing of a trans-acting factor. Here we show that in Nasonia, female sex determination is dependent on zygotic activation of Nvtra expression by an as yet unknown factor. This factor, which we propose to term womanizer (wom), is maternally silenced during oogenesis to ensure male development in unfertilized eggs. This finding implicates the upstream recruitment of a novel gene in the Nasonia sex determining cascade and supports the notion that sex determining cascades can rapidly change by adding new components on top of existing regulators. PMID:23717455
Strategies underlying RNA silencing suppression by negative strand RNA viruses
Hemmes, J.C.
2007-01-01
The research described in this thesis focused on the strategies of negative strand RNA viruses to counteract antiviral RNA silencing. In plants and insects, RNA silencing has been shown to act as a sequence specific antiviral defence mechanism that is characterised by the processing of double
Le silence, ce cri qui résonne dans l’écriture de Viviane Forrester
Directory of Open Access Journals (Sweden)
Amelia Peral Crespo
2015-11-01
Full Text Available The Holocaust Literature is tied to Silence from its beginning as the writing to silence. Write about the Holocaust and relate the experiences lived in first person or transmit them to the coming generations means leaving the silence which, for years, was the ideal refuge. This research focuses on the literary production of Viviane Forrester. The different expressions of silence that characterize her writings are analyzed. Silence is the cry that underlies in the most profound of the human being that return from the concentration camps, as Lazarus from the dead. It is a silence that grows to a cry because Forrester’s writing, almost in parallel to the fragmentary writing of Blanchot, an-nounces livre à venir, expressing the cry in silence without the ending of the word
In C. elegans, high levels of dsRNA allow RNAi in the absence of RDE-4.
Habig, Jeffrey W; Aruscavage, P Joseph; Bass, Brenda L
2008-01-01
C. elegans Dicer requires an accessory double-stranded RNA binding protein, RDE-4, to enact the first step of RNA interference, the cleavage of dsRNA to produce siRNA. While RDE-4 is typically essential for RNAi, we report that in the presence of high concentrations of trigger dsRNA, rde-4 deficient animals are capable of silencing a transgene. By multiple criteria the silencing occurs by the canonical RNAi pathway. For example, silencing is RDE-1 dependent and exhibits a decrease in the targeted mRNA in response to an increase in siRNA. We also find that high concentrations of dsRNA trigger lead to increased accumulation of primary siRNAs, consistent with the existence of a rate-limiting step during the conversion of primary to secondary siRNAs. Our studies also revealed that transgene silencing occurs at low levels in the soma, even in the presence of ADARs, and that at least some siRNAs accumulate in a temperature-dependent manner. We conclude that an RNAi response varies with different conditions, and this may allow an organism to tailor a response to specific environmental signals.
In C. elegans, high levels of dsRNA allow RNAi in the absence of RDE-4.
Directory of Open Access Journals (Sweden)
Jeffrey W Habig
Full Text Available C. elegans Dicer requires an accessory double-stranded RNA binding protein, RDE-4, to enact the first step of RNA interference, the cleavage of dsRNA to produce siRNA. While RDE-4 is typically essential for RNAi, we report that in the presence of high concentrations of trigger dsRNA, rde-4 deficient animals are capable of silencing a transgene. By multiple criteria the silencing occurs by the canonical RNAi pathway. For example, silencing is RDE-1 dependent and exhibits a decrease in the targeted mRNA in response to an increase in siRNA. We also find that high concentrations of dsRNA trigger lead to increased accumulation of primary siRNAs, consistent with the existence of a rate-limiting step during the conversion of primary to secondary siRNAs. Our studies also revealed that transgene silencing occurs at low levels in the soma, even in the presence of ADARs, and that at least some siRNAs accumulate in a temperature-dependent manner. We conclude that an RNAi response varies with different conditions, and this may allow an organism to tailor a response to specific environmental signals.
Energy Technology Data Exchange (ETDEWEB)
Malek-Adamian, Elise; Guenther, Dale C.; Matsuda, Shigeo; Martínez-Montero, Saúl; Zlatev, Ivan; Harp, Joel; Patrascu, Mihai Burai; Foster, Donald J.; Fakhoury, Johans; Perkins, Lydia; Moitessier, Nicolas; Manoharan, Rajar M.; Taneja, Nate; Bisbe, Anna; Charisse, Klaus; Maier, Martin; Rajeev, Kallanthottathil G.; Egli, Martin; Manoharan, Muthiah; Damha, Masad J. (McGill); (Alnylam Pharm.); (Vanderbilt)
2017-10-06
We designed novel 4'-modified 2'-deoxy-2'-fluorouridine (2'-F U) analogues with the aim to improve nuclease resistance and potency of therapeutic siRNAs by introducing 4'-C-methoxy (4'-OMe) as the alpha (C4'α) or beta (C4'β) epimers. The C4'α epimer was synthesized by a stereoselective route in six steps; however, both α and β epimers could be obtained by a nonstereoselective approach starting from 2'-F U. 1H NMR analysis and computational investigation of the α-epimer revealed that the 4'-OMe imparts a conformational bias toward the North-East sugar pucker, due to intramolecular hydrogen bonding and hyperconjugation effects. The α-epimer generally conceded similar thermal stability as unmodified nucleotides, whereas the β-epimer led to significant destabilization. Both 4'-OMe epimers conferred increased nuclease resistance, which can be explained by the close proximity between 4'-OMe substituent and the vicinal 5'- and 3'-phosphate group, as seen in the X-ray crystal structure of modified RNA. siRNAs containing several C4'α-epimer monomers in the sense or antisense strands triggered RNAi-mediated gene silencing with efficiencies comparable to that of 2'-F U.
Giving Voice: Narrating silence, history and memory in André Brink ...
African Journals Online (AJOL)
Giving Voice: Narrating silence, history and memory in André Brink\\'s The Other Side of Silence and Before I Forget. ... Both narrators, though, draw attention to the problems associated with this reconstructive and potentially ... Article Metrics.
Self-Silencing, Emotional Awareness, and Eating Behaviors in College Women
Shouse, Sarah H.; Nilsson, Johanna
2011-01-01
Self-silencing (or the suppression of expressing one's thoughts, feelings, and needs) can have a negative impact on the mental health of women, from depression to disordered eating behaviors. The authors examined the relationship between self-silencing and disordered eating as well as intuitive eating. The authors also explored whether emotional…
L’architecture du silence de la Shoah dans les fictions de Sylvie Germain
Directory of Open Access Journals (Sweden)
José Luis Arráez Llobregat
2015-11-01
Full Text Available Silences concerning the Shoah constitute a leitmotiv in Sylvie Germain’s narrative work. Motive and motivation intentionally emerge as a proteiform phenomenon from the writer-philosopher’s genius and from the historical and ideological substance, which imbue the novelist in every sec-tion of her literary creation. The pur-pose of this study is to interpret those silences in a set of selected novels where the Shoah takes up either a primary or a secondary role, but in any case a relevant one. To this end this study carries out a detailed study of the silence coming from the narrator’s origin, the victims, the murderers or God. Beyond the silence in humans and supreme beings, this study also investigates the spatial silence in that apocalyptic world.
Assessment of RNAi-induced silencing in banana (Musa spp.).
Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge
2014-09-18
In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target
The molecular basis for stability of heterochromatin-mediated silencing in mammals.
Hiragami-Hamada, Kyoko; Xie, Sheila Q; Saveliev, Alexander; Uribe-Lewis, Santiago; Pombo, Ana; Festenstein, Richard
2009-11-04
The archetypal epigenetic phenomenon of position effect variegation (PEV) in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3), DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac) and lysine 4 di or tri methylation (H3K4me2/3) are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.
The molecular basis for stability of heterochromatin-mediated silencing in mammals
Directory of Open Access Journals (Sweden)
Hiragami-Hamada Kyoko
2009-11-01
Full Text Available Abstract The archetypal epigenetic phenomenon of position effect variegation (PEV in Drosophila occurs when a gene is brought abnormally close to heterochromatin, resulting in stochastic silencing of the affected gene in a proportion of cells that would normally express it. PEV has been instrumental in unraveling epigenetic mechanisms. Using an in vivo mammalian model for PEV we have extensively investigated the molecular basis for heterochromatin-mediated gene silencing. Here we distinguish 'epigenetic effects' from other cellular differences by studying ex vivo cells that are identical, apart from the expression of the variegating gene which is silenced in a proportion of the cells. By separating cells according to transgene expression we show here that silencing appears to be associated with histone H3 lysine 9 trimethylation (H3K9me3, DNA methylation and the localization of the silenced gene to a specific nuclear compartment enriched in these modifications. In contrast, histone H3 acetylation (H3Ac and lysine 4 di or tri methylation (H3K4me2/3 are the predominant modifications associated with expression where we see the gene in a euchromatic compartment. Interestingly, DNA methylation and inaccessibility, rather than H3K9me3, correlated most strongly with resistance to de-repression by cellular activation. These results have important implications for understanding the contribution of specific factors involved in the establishment and maintenance of gene silencing and activation in vivo.
Precedents and consequences of prosocial behaviors of voice and silence
Directory of Open Access Journals (Sweden)
Alicia Omar
2015-09-01
Full Text Available Prosocial behavior is that which that encourages solidarity and harmony in interpersonal relationships, and produce personal or collective benefits. Although early research on job prosociality was focused on the study of conventional behaviors such as help, courtesy and sportsmanship, the identification and operationalization of new dimensions is rapidly expanding this nomological network. Such is the case of prosocial voice and prosocial silence, recently introduced in the scientific literature. The aim of this study is to explore possible relationships between employee’s voice and employee’s silence, and their personality structure; and examine the role of interpersonal justice perceptions on such relationships. We worked with a sample of 316 employees- aged 37 years and holding a 4.2-year signority working at public and private companies in southern and central Rosario (Argentina. The subjects completed Colquitt’ Justice Organizational Scale, Eysenck Personality Questionnaire, and Van Dyne’s Prosocial Voice and Prosocial Silence Scales. Extraversion and neuroticism emerged as the strongest predictors of prosocial voice and prosocial silence, respectively. Interpersonal justice perceptions emerged as moderators of the ‘natural’ tendency of extraverted workers to engage in prosocial voice, and emotionally controlled workers to engage in prosocial silence. Such findings would indicate that the promotion of high levels of interpersonal justice on job contexts could help workers to engage in more prosocial behavior with positive effects for the organization.
RELATIONSHIP BETWEEN AFFECTIVE COMMITMENT ANDORGANIZATIONAL SILENCE: A CONCEPTUAL DISCUSSION
Directory of Open Access Journals (Sweden)
Fitnat Nazlı Sayğan
2011-07-01
Full Text Available In this study, the affective commitment that is oneof the components oforganizational commitment put forth by Allen and Meyer (Allen, Meyer 1996will be differentiated from the other commitment components. The importance ofcreating an emotional commitment to organizations will be examined and theorganizational factors needed to form organizational commitment will beinvestigated. Also, organizational silence is a situation that the company avoided.In the study, the reasons and the drawbacks of silence are focused on and thefactors that cause employees to remain silent are discussed.The aim of this study is intended to manifest the relationship of ‘organizationalsilence' with affective commitment’ which is one ofthe components of‘organizational commitment’ on the basis of literature. In this study, a negativecorrelation between affective commitment and organizational silence is suggested
Increased RNA-induced silencing complex (RISC) activity contributes to hepatocellular carcinoma.
Yoo, Byoung Kwon; Santhekadur, Prasanna K; Gredler, Rachel; Chen, Dong; Emdad, Luni; Bhutia, Sujit; Pannell, Lewis; Fisher, Paul B; Sarkar, Devanand
2011-05-01
There is virtually no effective treatment for advanced hepatocellular carcinoma (HCC) and novel targets need to be identified to develop effective treatment. We recently documented that the oncogene Astrocyte elevated gene-1 (AEG-1) plays a seminal role in hepatocarcinogenesis. Employing yeast two-hybrid assay and coimmunoprecipitation followed by mass spectrometry, we identified staphylococcal nuclease domain containing 1 (SND1), a nuclease in the RNA-induced silencing complex (RISC) facilitating RNAi-mediated gene silencing, as an AEG-1 interacting protein. Coimmunoprecipitation and colocalization studies confirmed that AEG-1 is also a component of RISC and both AEG-1 and SND1 are required for optimum RISC activity facilitating small interfering RNA (siRNA) and micro RNA (miRNA)-mediated silencing of luciferase reporter gene. In 109 human HCC samples SND1 was overexpressed in ≈74% cases compared to normal liver. Correspondingly, significantly higher RISC activity was observed in human HCC cells compared to immortal normal hepatocytes. Increased RISC activity, conferred by AEG-1 or SND1, resulted in increased degradation of tumor suppressor messenger RNAs (mRNAs) that are target of oncomiRs. Inhibition of enzymatic activity of SND1 significantly inhibited proliferation of human HCC cells. As a corollary, stable overexpression of SND1 augmented and siRNA-mediated inhibition of SND1 abrogated growth of human HCC cells in vitro and in vivo, thus revealing a potential role of SND1 in hepatocarcinogenesis. We unravel a novel mechanism that overexpression of AEG-1 and SND1 leading to increased RISC activity might contribute to hepatocarcinogenesis. Targeted inhibition of SND1 enzymatic activity might be developed as an effective therapy for HCC. Copyright © 2011 American Association for the Study of Liver Diseases.
HMGA1 silencing reduces stemness and temozolomide resistance in glioblastoma stem cells.
Colamaio, Marianna; Tosti, Nadia; Puca, Francesca; Mari, Alessia; Gattordo, Rosaria; Kuzay, Yalçın; Federico, Antonella; Pepe, Anna; Sarnataro, Daniela; Ragozzino, Elvira; Raia, Maddalena; Hirata, Hidenari; Gemei, Marica; Mimori, Koshi; Del Vecchio, Luigi; Battista, Sabrina; Fusco, Alfredo
2016-10-01
Glioblastoma multiforme (GBM) develops from a small subpopulation of stem-like cells, which are endowed with the ability to self-renew, proliferate and give rise to progeny of multiple neuroepithelial lineages. These cells are resistant to conventional chemo- and radiotherapy and are hence also responsible for tumor recurrence. HMGA1 overexpression has been shown to correlate with proliferation, invasion, and angiogenesis of GBMs and to affect self-renewal of cancer stem cells from colon cancer. The role of HMGA1 in GBM tumor stem cells is not completely understood. We have investigated the role of HMGA1 in brain tumor stem cell (BTSC) self-renewal, stemness and resistance to temozolomide by shRNA- mediated HMGA1 silencing. We first report that HMGA1 is overexpressed in a subset of BTSC lines from human GBMs. Then, we show that HMGA1 knockdown reduces self-renewal, sphere forming efficiency and stemness, and sensitizes BTSCs to temozolomide. Interestingly, HMGA1 silencing also leads to reduced tumor initiation ability in vivo. These results demonstrate a pivotal role of HMGA1 in cancer stem cell gliomagenesis and endorse HMGA1 as a suitable target for CSC-specific GBM therapy.
AGO/RISC-mediated antiviral RNA silencing in a plant in vitro system.
Schuck, Jana; Gursinsky, Torsten; Pantaleo, Vitantonio; Burgyán, Jozsef; Behrens, Sven-Erik
2013-05-01
AGO/RISC-mediated antiviral RNA silencing, an important component of the plant's immune response against RNA virus infections, was recapitulated in vitro. Cytoplasmic extracts of tobacco protoplasts were applied that supported Tombusvirus RNA replication, as well as the formation of RNA-induced silencing complexes (RISC) that could be functionally reconstituted with various plant ARGONAUTE (AGO) proteins. For example, when RISC containing AGO1, 2, 3 or 5 were programmed with exogenous siRNAs that specifically targeted the viral RNA, endonucleolytic cleavages occurred and viral replication was inhibited. Antiviral RNA silencing was disabled by the viral silencing suppressor p19 when this was present early during RISC formation. Notably, with replicating viral RNA, only (+)RNA molecules were accessible to RISC, whereas (-)RNA replication intermediates were not. The vulnerability of viral RNAs to RISC activity also depended on the RNA structure of the target sequence. This was most evident when we characterized viral siRNAs (vsiRNAs) that were particularly effective in silencing with AGO1- or AGO2/RISC. These vsiRNAs targeted similar sites, suggesting that accessible parts of the viral (+)RNA may be collectively attacked by different AGO/RISC. The in vitro system was, hence, established as a valuable tool to define and characterize individual molecular determinants of antiviral RNA silencing.
Hypoxia silences retrotrapezoid nucleus respiratory chemoreceptors via alkalosis.
Basting, Tyler M; Burke, Peter G R; Kanbar, Roy; Viar, Kenneth E; Stornetta, Daniel S; Stornetta, Ruth L; Guyenet, Patrice G
2015-01-14
In conscious mammals, hypoxia or hypercapnia stimulates breathing while theoretically exerting opposite effects on central respiratory chemoreceptors (CRCs). We tested this theory by examining how hypoxia and hypercapnia change the activity of the retrotrapezoid nucleus (RTN), a putative CRC and chemoreflex integrator. Archaerhodopsin-(Arch)-transduced RTN neurons were reversibly silenced by light in anesthetized rats. We bilaterally transduced RTN and nearby C1 neurons with Arch (PRSx8-ArchT-EYFP-LVV) and measured the cardiorespiratory consequences of Arch activation (10 s) in conscious rats during normoxia, hypoxia, or hyperoxia. RTN photoinhibition reduced breathing equally during non-REM sleep and quiet wake. Compared with normoxia, the breathing frequency reduction (Δf(R)) was larger in hyperoxia (65% FiO2), smaller in 15% FiO2, and absent in 12% FiO2. Tidal volume changes (ΔV(T)) followed the same trend. The effect of hypoxia on Δf(R) was not arousal-dependent but was reversed by reacidifying the blood (acetazolamide; 3% FiCO2). Δf(R) was highly correlated with arterial pH up to arterial pH (pHa) 7.5 with no frequency inhibition occurring above pHa 7.53. Blood pressure was minimally reduced suggesting that C1 neurons were very modestly inhibited. In conclusion, RTN neurons regulate eupneic breathing about equally during both sleep and wake. RTN neurons are the first putative CRCs demonstrably silenced by hypocapnic hypoxia in conscious mammals. RTN neurons are silent above pHa 7.5 and increasingly active below this value. During hyperoxia, RTN activation maintains breathing despite the inactivity of the carotid bodies. Finally, during hypocapnic hypoxia, carotid body stimulation increases breathing frequency via pathways that bypass RTN. Copyright © 2015 the authors 0270-6474/15/350527-17$15.00/0.
Co-evolution of transcriptional silencing proteins and the DNA elements specifying their assembly.
Directory of Open Access Journals (Sweden)
Oliver A Zill
Full Text Available Co-evolution of transcriptional regulatory proteins and their sites of action has been often hypothesized but rarely demonstrated. Here we provide experimental evidence of such co-evolution in yeast silent chromatin, a finding that emerged from studies of hybrids formed between two closely related Saccharomyces species. A unidirectional silencing incompatibility between S. cerevisiae and S. bayanus led to a key discovery: asymmetrical complementation of divergent orthologs of the silent chromatin component Sir4. In S. cerevisiae/S. bayanus interspecies hybrids, ChIP-Seq analysis revealed a restriction against S. cerevisiae Sir4 associating with most S. bayanus silenced regions; in contrast, S. bayanus Sir4 associated with S. cerevisiae silenced loci to an even greater degree than did S. cerevisiae's own Sir4. Functional changes in silencer sequences paralleled changes in Sir4 sequence and a reduction in Sir1 family members in S. cerevisiae. Critically, species-specific silencing of the S. bayanus HMR locus could be reconstituted in S. cerevisiae by co-transfer of the S. bayanus Sir4 and Kos3 (the ancestral relative of Sir1 proteins. As Sir1/Kos3 and Sir4 bind conserved silencer-binding proteins, but not specific DNA sequences, these rapidly evolving proteins served to interpret differences in the two species' silencers presumably involving emergent features created by the regulatory proteins that bind sequences within silencers. The results presented here, and in particular the high resolution ChIP-Seq localization of the Sir4 protein, provided unanticipated insights into the mechanism of silent chromatin assembly in yeast.
Moazeni, Maryam; Khoramizadeh, Mohammad Reza; Kordbacheh, Parivash; Sepehrizadeh, Zargham; Zeraati, Hojat; Noorbakhsh, Fatemeh; Teimoori-Toolabi, Ladan; Rezaie, Sassan
2012-09-01
The introduction of RNA silencing machinery in fungi has led to the promising application of RNAi methodology to knock down essential vital factor or virulence factor genes in the microorganisms. Efg1p is required for development of a true hyphal growth form which is known to be essential for interactions with human host cells and for the yeast's pathogenesis. In this paper, we describe the development of a system for presenting and studying the RNAi function on the EFG1 gene in C. albicans. The 19-nucleotide siRNA was designed on the basis of the cDNA sequence of the EFG1 gene in C. albicans and transfection was performed by use of a modified-PEG/LiAc method. To investigate EFG1 gene silencing in siRNA-treated cells, the yeasts were grown in human serum; to induce germ tubes a solid medium was used with the serum. Quantitative changes in expression of the EFG1 gene were analyzed by measuring the cognate EFG1 mRNA level by use of a quantitative real-time RT-PCR assay. Compared with the positive control, true hyphae formation was significantly reduced by siRNA at concentrations of 1 μM, 500 nM, and 100 nM (P < 0.05). In addition, siRNA at a concentration of 1 μM was revealed to inhibit expression of the EFG1 gene effectively (P < 0.05). On the basis of the potential of post-transcriptional gene silencing to control the expression of specific genes, these techniques may be regarded as promising means of drug discovery, with applications in biomedicine and functional genomics analysis.
Gu, Keyu; Tian, Dongsheng; Mao, Huizhu; Wu, Lifang; Yin, Zhongchao
2015-10-08
Jatropha curcas L. is a potential biofuel plant and its seed oil is suitable for biodiesel production. Despite this promising application, jatropha seeds contain two major toxic components, namely phorbol esters and curcins. These compounds would reduce commercial value of seed cake and raise safety and environment concerns on jatropha plantation and processing. Curcins are Type I ribosome inactivating proteins. Several curcin genes have been identified in the jatropha genome. Among which, the Curcin 1 (C1) gene is identified to be specifically expressed in endosperm, whereas the Curcin 2A (C2A) is mainly expressed in young leaves. A marker-free RNAi construct carrying a β-estradiol-regulated Cre/loxP system and a C1 promoter-driven RNAi cassette for C1 gene was made and used to generate marker-free transgenic RNAi plants to specifically silence the C1 gene in the endosperm of J. curcas. Plants of transgenic line L1, derived from T0-1, carry two copies of marker-free RNAi cassette, whereas plants of L35, derived from T0-35, harbored one copy of marker-free RNAi cassette and three copies of closely linked and yet truncated Hpt genes. The C1 protein content in endosperm of L1 and L35 seeds was greatly reduced or undetectable, while the C2A proteins in young leaves of T0-1 and T0-35 plants were unaffected. In addition, the C1 mRNA transcripts were undetectable in the endosperm of T3 seeds of L1 and L35. The results demonstrated that the expression of the C1 gene was specifically down-regulated or silenced by the double-stranded RNA-mediated RNA interference generated from the RNAi cassette. The C1 promoter-driven RNAi cassette for the C1 gene in transgenic plants was functional and heritable. Both C1 transcripts and C1 proteins were greatly down-regulated or silenced in the endosperm of transgenic J. curcas. The marker-free transgenic plants and curcin-deficient seeds developed in this study provided a solution for the toxicity of curcins in jatropha seeds and
Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins
Directory of Open Access Journals (Sweden)
Marcio Hedil
2016-07-01
Full Text Available The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.
Viral RNA Silencing Suppression: The Enigma of Bunyavirus NSs Proteins.
Hedil, Marcio; Kormelink, Richard
2016-07-23
The Bunyaviridae is a family of arboviruses including both plant- and vertebrate-infecting representatives. The Tospovirus genus accommodates plant-infecting bunyaviruses, which not only replicate in their plant host, but also in their insect thrips vector during persistent propagative transmission. For this reason, they are generally assumed to encounter antiviral RNA silencing in plants and insects. Here we present an overview on how tospovirus nonstructural NSs protein counteracts antiviral RNA silencing in plants and what is known so far in insects. Like tospoviruses, members of the related vertebrate-infecting bunyaviruses classified in the genera Orthobunyavirus, Hantavirus and Phlebovirus also code for a NSs protein. However, for none of them RNA silencing suppressor activity has been unambiguously demonstrated in neither vertebrate host nor arthropod vector. The second part of this review will briefly describe the role of these NSs proteins in modulation of innate immune responses in mammals and elaborate on a hypothetical scenario to explain if and how NSs proteins from vertebrate-infecting bunyaviruses affect RNA silencing. If so, why this discovery has been hampered so far.
Adaptation of the Four Forms of Employee Silence Scale in a Polish sample
Directory of Open Access Journals (Sweden)
Krystyna Adamska
2017-06-01
Full Text Available Background Silence is understood as a decision not to speak up in situations of observed irregularities both in productivity and ethics. The study examined the validity of the Four Forms of Employee Silence Scale (FFESS in the Polish population. The scale is a four-factor measure designed to capture differently motivated tendencies to be silent in organizations. The scale distinguishes acquiescent, quiescent, prosocial and opportunistic silence. Employee silence has been linked to many important individual outcomes: failure to react to ethical transgressions, stress and depression, and lower creativity and productivity. Participants and procedure A total of 1044 employees of various organizations working for at least six months at a given position provided the responses for the validation study. Results The results confirmed the superiority of the four-factor model shown by adequate fit indexes: The FFESS has adequate internal consistency at both the scale and item levels. The criterion-related validity of the scale was established by correlating four forms of silence with measures of emotional attitude toward organization, procedural justice, relational contract and turnover intention. Conclusions The four forms of employee silence are empirically distinct concepts in the Polish sample. The scale may be used as the measurement of individual differences. It can also serve as a tool for diagnosing a climate of silence in an organization.
Directory of Open Access Journals (Sweden)
Tahir Pekasil
2016-05-01
Full Text Available Theological - Cultural Framework of Memory in Mardin Syriacs Abstract In this article, “theological/ritual-cultural framework of memory”, "memory participation tools" "recall figures" will be examined in the case of Mardin Syriac Orthodox Church. "Ritual participation" and "rhythmic repetition" which enables "theological-social inclusion" and "integration", also mobilizes remembering instruments and guarantees protection, revival and transfer of cultural memory. This also ensures continuation of sense of belonging. Priests who are accepted as "vicarious memory" enable participation to memory in church which is a "memory space" mediating to the "transmission of blessing and grace by ritual representation". Priests also by institutionalizing ceremonies and rituals which integrated with music, makes cultural meanings functional. The theme is discussed from the perspective of cultural memory and supported by face to face interviews. Mardin Süryanilerinde Belleğin Teolojik-Kültürel Çerçevesi Öz Bu yazıda, Mardin Süryani Ortodoks Kilisesi örneğinden hareketle “belleğin teolojik/ritüel- kültürel çerçevesi”, “belleğe katılım araçları”, “hatırlama figürleri” ele alınacaktır. “Teolojik ve toplumsal katılımı”, “bütünleşmeyi” sağlayan “ritüel katılım” ve “ritmik tekrar”, hatırlama araçlarını harekete geçirerek kültürel belleğin korunmasını, canlandırılmasını ve aktarılmasını garanti etmekte, aidiyetin devamını sağlamaktadır. Belleğe katılımı sağlayan “vekil hafıza” olarak kabul edilen papazlar, bir “hafıza mekânı” olan kilisede, “inayetin ritüel temsille aktarımına” aracılık yapmakta; “ritüel tasarım” yoluyla müzikle bütünleştirdikleri ayin ve ritüelleri kurumsallaştırarak kültürel anlamlara işlerlik kazandırmaktadırlar. Çalışma konusu, kültürel bellek perspektifinden ele alınmış ve mülakat örnekleri ile desteklenmiştir.
Decreasing erucic acid level by RNAi-mediated silencing of fatty ...
African Journals Online (AJOL)
To develop low level of erucic acid in rapeseeds by intron-spliced hairpin RNA, an inverted repeat unit of a partial BnFAE1.1 gene interrupted by a spliceable intron ... In conclusion, the expression of endogenous BnFAE1.1 was efficiently silenced by the designed RNAi silencer, causing a significant down-regulation in the ...
Zhang, Nan-Nan; Sun, Qin-Sheng; Chen, Zhe; Liu, Feng; Jiang, Yu-Yang
2013-01-01
NF-κB consists of p50, p65 (RelA), p52, c-Rel, and RelB, and among them p65 is a representative protein to investigate the regulation and function of this signaling. NF-κB integrates inflammation and carcinogenesis and regulates the expression of a variety of genes in response to immunity, inflammation, and apoptosis. IκBα acts as an inhibitor of NF-κB through forming an inactive NF-κB/IκBα complex. Pokemon is a ubiquitous transcription factor involved in different signaling pathways, playing a pivotal role in cell proliferation, anti-apoptosis, embryonic development, and maintenance. In this study, we found that p65 and IκBα are both novel regulatory targets of Pokemon. Ectopic expression of Pokemon in immortalized liver cells HL7702 enhanced p65 and IκBα expression, whereas silencing of Pokemon in hepatocellular carcinoma cells QGY7703 reduced cellular p65 levels. ChIP assay and targeted mutagenesis revealed that Pokemon directly binds to the element of -434 to -430 bp in p65 promoter and of -453 to -448 bp in IκBα promoter and stimulates luciferase reporter gene expression. Co-transfection of Pokemon with p65 or IκBα promoter-reporter notably enhanced their promoter activity. These data suggest that Pokemon activates the expression of both p65 and IκBα by sequence-specific binding to their promoters and plays a dual role in regulating NF-κB signaling.
Amelioration of lead toxicity on rat liver with Vitamin C and silymarin supplements
International Nuclear Information System (INIS)
Shalan, M.G.; Mostafa, M.S.; Hassouna, M.M.; El-Nabi, S.E. Hassab; El-Refaie, A.
2005-01-01
The aim of the present study was to investigate the impact of the combined administration of Vitamin C and silymarin on lead toxicity. Male albino rats were subdivided into three groups: the first was a control group, the second received lead acetate in diet as 500 mg/kg diet daily, the third received the same lead acetate dose and supplemented with Vitamin C (1 mg/100 g body weight) and silymarin (1 mg/100 g body weight) by gastric tube three times per week. Blood samples were taken after 2, 4 and 6 weeks of treatment. Significant lead-induced elevations in serum ALT, AST, GGT and ALP activities were observed after different periods of treatment. However, serum LDLc was decreased. The intensities of RNA and apoptotic fragments of DNA were measured as optical density by Gel-pro program. Lead acetate decreased the intensity of DNA at 6 weeks and induced apoptotic DNA fragments reversibly with time. After 2 weeks of lead administration dilation and congestion of terminal hepatic veins and portal vein branches were observed. Lead also induced hepatocyte proliferation without any localized distribution among zones 1-3. Portal inflammatory infiltrate with disruption of the limiting plates (interface hepatitis), steatosis, apoptosis and mild fibrosis were detected especially by sixth week of lead administration. Combined treatment of lead-exposed animals with Vitamin C and silymarin showed marked improvement of the biochemical, molecular and histopathological findings. These experimental results strongly indicate the protective effect of Vitamin C and silymarin against toxic effects of lead on liver tissue
Amelioration of lead toxicity on rat liver with Vitamin C and silymarin supplements.
Shalan, M G; Mostafa, M S; Hassouna, M M; El-Nabi, S E Hassab; El-Refaie, A
2005-01-05
The aim of the present study was to investigate the impact of the combined administration of Vitamin C and silymarin on lead toxicity. Male albino rats were subdivided into three groups: the first was a control group, the second received lead acetate in diet as 500 mg/kg diet daily, the third received the same lead acetate dose and supplemented with Vitamin C (1 mg/100g body weight) and silymarin (1 mg/100g body weight) by gastric tube three times per week. Blood samples were taken after 2, 4 and 6 weeks of treatment. Significant lead-induced elevations in serum ALT, AST, GGT and ALP activities were observed after different periods of treatment. However, serum LDLc was decreased. The intensities of RNA and apoptotic fragments of DNA were measured as optical density by Gel-pro program. Lead acetate decreased the intensity of DNA at 6 weeks and induced apoptotic DNA fragments reversibly with time. After 2 weeks of lead administration dilation and congestion of terminal hepatic veins and portal vein branches were observed. Lead also induced hepatocyte proliferation without any localized distribution among zones 1-3. Portal inflammatory infiltrate with disruption of the limiting plates (interface hepatitis), steatosis, apoptosis and mild fibrosis were detected especially by sixth week of lead administration. Combined treatment of lead-exposed animals with Vitamin C and silymarin showed marked improvement of the biochemical, molecular and histopathological findings. These experimental results strongly indicate the protective effect of Vitamin C and silymarin against toxic effects of lead on liver tissue.
RNA silencing is required for Arabidopsis defence against Verticillium wilt disease
Ellendorff, U.; Fradin, E.F.; Jonge, de R.; Thomma, B.P.H.J.
2009-01-01
RNA silencing is a conserved mechanism in eukaryotes that plays an important role in various biological processes including regulation of gene expression. RNA silencing also plays a role in genome stability and protects plants against invading nucleic acids such as transgenes and viruses. Recently,
Directory of Open Access Journals (Sweden)
Guillaume Jannot
2016-12-01
Full Text Available MicroRNAs and Argonaute form the microRNA induced silencing complex or miRISC that recruits GW182, causing mRNA degradation and/or translational repression. Despite the clear conservation and molecular significance, it is unknown if miRISC-GW182 interaction is essential for gene silencing during animal development. Using Caenorhabditis elegans to explore this question, we examined the relationship and effect on gene silencing between the GW182 orthologs, AIN-1 and AIN-2, and the microRNA-specific Argonaute, ALG-1. Homology modeling based on human Argonaute structures indicated that ALG-1 possesses conserved Tryptophan-binding Pockets required for GW182 binding. We show in vitro and in vivo that their mutations severely altered the association with AIN-1 and AIN-2. ALG-1 tryptophan-binding pockets mutant animals retained microRNA-binding and processing ability, but were deficient in reporter silencing activity. Interestingly, the ALG-1 tryptophan-binding pockets mutant phenocopied the loss of alg-1 in worms during larval stages, yet was sufficient to rescue embryonic lethality, indicating the dispensability of AINs association with the miRISC at this developmental stage. The dispensability of AINs in miRNA regulation is further demonstrated by the capacity of ALG-1 tryptophan-binding pockets mutant to regulate a target of the embryonic mir-35 microRNA family. Thus, our results demonstrate that the microRNA pathway can act independently of GW182 proteins during C. elegans embryogenesis.
Piecing Together Past and Present in Bhutan: Narration, Silence and Forgetting in Conflict
Directory of Open Access Journals (Sweden)
Line Kikkenborg Christensen
2018-02-01
Full Text Available What happens when conflict is silenced in official narratives but not forgotten among a population? This article explores this question using interview data from anthropological fieldwork in Bhutan. In Bhutan, the ethnic conflict of the early 1990s is surrounded by silence and is not openly discussed. Despite this silence, young Bhutanese have formed a multiplicity of narratives about the conflict. The article highlights three different narratives of conflict, as well as the oblivion found among informants. The main argument is that the silence surrounding the conflict in Bhutan has contributed to two forms of societal rift: between the authorities and the people, and between people themselves. The article contributes to the discussion about what role social memories play in conflicts, by suggesting that silence may cause wariness and hinder processes that help societies to move past conflict in a constructive way.
Brescó de Luna, Ignacio
2018-05-04
This paper explores the role of silence in Spain's post-dictatorship memory politics. More specifically, the paper examines the forgotten Spanish colonial past in North Africa vis-à-vis the so-called pact of silence that accompanied Spain's transition to democracy after the Franco dictatorship. Drawing on various theoretical approaches in relation to collective memory, traditionally assumed associations between silence and forgetting are questioned. As is argued, silence may nurture and preserve memory just as it may also feed into forgetting. In the former case, silence typically enshrouds a living memory of a past that still weighs on the present, as the pact of silence in Spain clearly illustrates. In the latter case, silence signals a past perceived as already left behind and alien to society's current problems, as is the case of the Spanish colonial past in North Africa. In order to further explore the latter case, the notion of banal silence is introduced. Such notion points to cases where silence over certain contentious historical issues goes unnoticed by society, thus becoming naturalized. The paper concludes with some final reflexions on memory, banal silence and political change.
Synergistic inhibition of the APC/C by the removal of APC15 in HCT116 cells lacking UBE2C.
Garvanska, Dimitriya H; Larsen, Marie Sofie Yoo; Nilsson, Jakob
2016-10-15
The spindle assembly checkpoint (SAC) inhibits the anaphase-promoting complex/cyclosome (APC/C) in response to unattached kinetochores by generating a diffusible inhibitor termed the mitotic checkpoint complex (MCC). At metaphase, rapid activation of the APC/C requires removal of the MCC, a process that has been shown to depend on the APC/C E2 enzymes, UBE2C and UBE2S. Here we investigate the in vivo role of the APC/C E2 enzymes in SAC silencing using CRISPR/Cas9 genetically engineered HCT116 UBE2C or UBE2S null cell lines. Using live cell assays, we show that UBE2C and UBE2S make a minor contribution to SAC silencing in HCT116 cells. Strikingly, in cells specifically lacking UBE2C, we observe a strong synergistic inhibition of mitotic progression when we stabilize the MCC on the APC/C by depleting APC15, potentially reflecting increased competition between the MCC and the remaining initiating E2 enzyme UBE2D. In conclusion, we provide in vivo insight into the APC/C E2 module and its interplay with SAC silencing components. © 2016. Published by The Company of Biologists Ltd.
Silence in liturgy as the space for the Holy Ghost’s activity
Directory of Open Access Journals (Sweden)
Adelajda Sielepin
2006-06-01
Full Text Available The aim of this article is to clarify the essential and often neglected function of liturgical silence. In practice silence is usually intended to prepare the participants for listening or reflecting upon the word, especially when proclaimed by the minister. Whereas it is vital to know that silence constitutes a creative element of the liturgy, because the involvement of the Holy Spirit. In His action and cooperation with the participants He enables them to get into communion with Christ the Word and the Person and eventually to join effectively His mission. In that sense silence helps the Holy Ghost to fulfill His function in continuing the dialogue between God and man as well as in enhancing one’s spiritual skills for the fruitful participation in the Mystery of Christ and the Church.
The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing.
Fusaro, Adriana F; Barton, Deborah A; Nakasugi, Kenlee; Jackson, Craig; Kalischuk, Melanie L; Kawchuk, Lawrence M; Vaslin, Maite F S; Correa, Regis L; Waterhouse, Peter M
2017-10-10
The plant viral family Luteoviridae is divided into three genera: Luteovirus , Polerovirus and Enamovirus . Without assistance from another virus, members of the family are confined to the cells of the host plant's vascular system. The first open reading frame (ORF) of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs) against the plant's viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV), however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant's silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant's anti-viral defense.
Lei, Jih-Fen; Kiser, J. Douglas; Singh, Mrityunjay; Cuy, Mike; Blaha, Charles A.; Androjna, Drago
2000-01-01
An advanced thin film sensor system instrumented on silicon carbide (SiC) fiber reinforced SiC matrix ceramic matrix composites (SiC/SiC CMCs), was evaluated in a Mach 0.3 burner rig in order to determine its durability to monitor material/component surface temperature in harsh environments. The sensor system included thermocouples in a thin film form (5 microns thick), fine lead wires (75 microns diameter), and the bonds between these wires and the thin films. Other critical components of the overall system were the heavy, swaged lead wire cable (500 microns diameter) that contained the fine lead wires and was connected to the temperature readout, and ceramic attachments which were bonded onto the CMCs for the purpose of securing the lead wire cables, The newly developed ceramic attachment features a combination of hoops made of monolithic SiC or SiC/SiC CMC (which are joined to the test article) and high temperature ceramic cement. Two instrumented CMC panels were tested in a burner rig for a total of 40 cycles to 1150 C (2100 F). A cycle consisted of rapid heating to 1150 C (2100 F), a 5 minute hold at 1150 C (2100 F), and then cooling down to room temperature in 2 minutes. The thin film sensor systems provided repeatable temperature measurements for a maximum of 25 thermal cycles. Two of the monolithic SiC hoops debonded during the sensor fabrication process and two of the SiC/SiC CMC hoops failed during testing. The hoops filled with ceramic cement, however, showed no sign of detachment after 40 thermal cycle test. The primary failure mechanism of this sensor system was the loss of the fine lead wire-to-thin film connection, which either due to detachment of the fine lead wires from the thin film thermocouples or breakage of the fine wire.
Identification and characterization of two RNA silencing suppressors encoded by ophioviruses
Robles Luna, Gabriel; Reyes, Carina A.; Peña, Eduardo J.; Ocolotobiche, Eliana; Baeza, Cecilia; Borniego, Maria Belén; Kormelink, Richard; García, María Laura
2017-01-01
Citrus psorosis virus and Mirafiori lettuce big-vein virus are two members of the genus Ophiovirus, family Ophioviridae. So far, how these viruses can interfere in the antiviral RNA silencing pathway is not known. In this study, using a local GFP silencing assay on Nicotiana benthamiana, the
Directory of Open Access Journals (Sweden)
Cem KAHYA
2015-06-01
Full Text Available The concept of occupational self-efficacy means the efficacy perceptions of employees in their occupational fields, and the concept of organizational silence means the employees avoid to voice their ideas and suggestions about organizational issues. The main aim of this study is to examine the relationship between the concepts of occupational self-efficacy and organizational silence by revealing employees’ perceptions of occupational self-efficacy and organizational silence level. With this aim, the survey study was conducted on total 114 academicians who work in University of Bayburt. As a result of research, while the significant relationship was found between employees’ perceptions of occupational self-efficacy and organizational silence level, there was reached a result that this relationship incurred the negatively relationship between perceptions of occupational self-efficacy and negative silence.
Directory of Open Access Journals (Sweden)
Zeenia Jagga
Full Text Available Viral encoded RNA silencing suppressor proteins interfere with the host RNA silencing machinery, facilitating viral infection by evading host immunity. In plant hosts, the viral proteins have several basic science implications and biotechnology applications. However in silico identification of these proteins is limited by their high sequence diversity. In this study we developed supervised learning based classification models for plant viral RNA silencing suppressor proteins in plant viruses. We developed four classifiers based on supervised learning algorithms: J48, Random Forest, LibSVM and Naïve Bayes algorithms, with enriched model learning by correlation based feature selection. Structural and physicochemical features calculated for experimentally verified primary protein sequences were used to train the classifiers. The training features include amino acid composition; auto correlation coefficients; composition, transition, and distribution of various physicochemical properties; and pseudo amino acid composition. Performance analysis of predictive models based on 10 fold cross-validation and independent data testing revealed that the Random Forest based model was the best and achieved 86.11% overall accuracy and 86.22% balanced accuracy with a remarkably high area under the Receivers Operating Characteristic curve of 0.95 to predict viral RNA silencing suppressor proteins. The prediction models for plant viral RNA silencing suppressors can potentially aid identification of novel viral RNA silencing suppressors, which will provide valuable insights into the mechanism of RNA silencing and could be further explored as potential targets for designing novel antiviral therapeutics. Also, the key subset of identified optimal features may help in determining compositional patterns in the viral proteins which are important determinants for RNA silencing suppressor activities. The best prediction model developed in the study is available as a
Mobile gene silencing in Arabidopsis is regulated by hydrogen peroxide
Directory of Open Access Journals (Sweden)
Dacheng Liang
2014-12-01
Full Text Available In plants and nematodes, RNAi can spread from cells from which it is initiated to other cells in the organism. The underlying mechanism controlling the mobility of RNAi signals is not known, especially in the case of plants. A genetic screen designed to recover plants impaired in the movement but not the production or effectiveness of the RNAi signal identified RCI3, which encodes a hydrogen peroxide (H2O2-producing type III peroxidase, as a key regulator of silencing mobility in Arabidopsis thaliana. Silencing initiated in the roots of rci3 plants failed to spread into leaf tissue or floral tissue. Application of exogenous H2O2 reinstated the spread in rci3 plants and accelerated it in wild-type plants. The addition of catalase or MnO2, which breaks down H2O2, slowed the spread of silencing in wild-type plants. We propose that endogenous H2O2, under the control of peroxidases, regulates the spread of gene silencing by altering plasmodesmata permeability through remodelling of local cell wall structure, and may play a role in regulating systemic viral defence.
Epigenetic Silencing of CXCR4 Promotes Loss of Cell Adhesion in Cervical Cancer
Directory of Open Access Journals (Sweden)
Suresh Singh Yadav
2014-01-01
Full Text Available In the network of chemokine signaling pathways, recent reports have described the SDF-1α/CXCR4 axis and its role in cancer progression and metastasis. Interestingly, we found downregulation of CXCR4 at both transcript and protein level in cervical cancer cell lines and primary tumors. We also found CXCR4 promoter hypermethylation in cervical cancer cell lines and primary biopsy samples. DNA hypomethylating drug 5-AZA-2′-deoxycytidine and histone deacetylase inhibitor Trichostatin A treatments in cell lines reactivate both CXCR4 transcription and protein expression. Cell adhesion assay demonstrated that autocrine SDF-1α promotes the loss of cell adhesion while paracrine SDF-1α predominantly protects the normal cervical cells from loss of cell adhesion. Cervical cancer cell line C-33A having increased expression of CXCR4 after TSA treatment showed increased cell adhesion by paracrine source of SDF-1α in comparison to untreated C-33A. These findings demonstrate the first evidence that epigenetic silencing of CXCR4 makes the cells inefficient to respond to the paracrine source of SDF-1α leading to loss of cell adhesion, one of the key events in metastases and progression of the disease. Our results provide novel insight of SDF-1α/CXCR4 signaling in tumor microenvironment which may be promising to further delineate molecular mechanism of cervical carcinogenesis.
Directory of Open Access Journals (Sweden)
Morad Rafi
2013-12-01
Full Text Available Digital Rights Management (DRM allows controlling the access, the use and the diffusion of digital contents produced by the rights holders. With this intention, a right expression language is necessary. The MPEG-21 REL is a standardized language used to express the licenses. In this paper, we propose an improvement of the security policy and expressivity of MPEG-21 REL by introducing concepts based on the Or-BAC (Organization Based Access Control data model. This improvement will be illustrated by some use cases
ARF1 recruits RAC1 to leading edge in neutrophil chemotaxis.
Mazaki, Yuichi; Onodera, Yasuhito; Higashi, Tsunehito; Horinouchi, Takahiro; Oikawa, Tsukasa; Sabe, Hisataka
2017-10-02
The small GTPase ARF1 mediates membrane trafficking mostly from the Golgi, and is essential for the G protein-coupled receptor (GPCR)-mediated chemotaxis of neutrophils. In this process, ARF1 is activated by the guanine nucleotide exchanger GBF1, and is inactivated by the GTPase-activating protein GIT2. Neutrophils generate the Gβγ-PAK1-αPIX-GIT2 linear complex during GPCR-induced chemotaxis, in which αPIX activates RAC1/CDC42, which then employs PAK1. However, it has remained unclear as to why GIT2 is included in this complex. We investigated the association between ARF1 and RAC1/CDC42 during the fMLP-stimulated chemotaxis of HL60 cells. We found that the silencing of GBF1 significantly impaired the recruitment of RAC1 to the leading edges, but not PAK1, αPIX, RAC2, or CDC42. A significant population of RAC1 colocalized with ARF1 at the leading edges in stimulated cells, whereas fMLP activated both ARF1 and ARF5. Consistently, the silencing of ARF1, but not ARF5, impaired the recruitment of RAC1, whereas the silencing of RAC1 did not affect the recruitment of ARF1 to the leading edges. Our results indicated that the activation of ARF1 triggers the plasma membrane recruitment of RAC1 in GPCR-mediated chemotaxis, which is essential for cortical actin remodeling. Thus, membrane remodeling at the leading edges appears to precede actin remodeling in chemotaxis. Together with the fact that GIT2, which inactivates ARF1, is an integral component of the machinery activating RAC1, we proposed a model in which the ARF1-RAC1 linkage enables the regulation of ARF1 by repetitive on/off cycles during GPCR-mediated neutrophil chemotaxis.
Identifying Silence Climate in Organizations in the Framework of Contemporary Management Approaches
Directory of Open Access Journals (Sweden)
Mustafa Emre Civelek
2015-10-01
Full Text Available Dynamic competition conditions in present day, bring about the consequence for businesses to face varied problems with each passing day. At this point, current management approaches include studies that would shed light on the new problems of businesses. Organizational Silence, a concept that has recently been being voiced in business world, has come up in such context. Organizational silence could be expressed as the employee behavior of keeping silent about certain negativities due to various reasons in an organization. Since knowledge sharing in modern organizations is of capital importance in terms of responding hastily to the changes in a competitive environment, spread of this behavior of employees to organization culture and climate presents a threat of indifference. In this study, the concept of Organizational Silence is defined and the effects of conceived silence climate on management of organizations are discussed.
Identifying Silence Climate in Organizations in the Framework of Contemporary Management Approaches
Directory of Open Access Journals (Sweden)
Mustafa Emre Civelek
2015-12-01
Full Text Available Dynamic competition conditions in present day bring about the consequence for businesses to face varied problems with each passing day. At this point, current management approaches include studies that would shed light on the new problems of businesses. Organizational Silence, a concept that has recently been being voiced in business world, has come up in such context. Organizational silence could be expressed as the employee behavior of keeping silent about certain negativities due to various reasons in an organization. Since knowledge sharing in modern organizations is of capital importance in terms of responding hastily to the changes in a competitive environment, spread of this behavior of employees to organization culture and climate presents a threat of indifference. In this study, the concept of Organizational Silence is defined and the effects of conceived silence climate on management of organizations are discussed.
A conversation analysis of the function of silence in writing conferences
Directory of Open Access Journals (Sweden)
Milad Mirzaee
2016-07-01
Full Text Available One of the recent issues in English as a Second/Foreign Language (ESL/EFL writing instruction has been the quest for a more effective way to give feedback to L2 learners’ writing drafts. Although teacher- learner writing conferences have been increasingly used for providing ample opportunity for negotiating revisions, relatively little attention has been given to actual teacher-learner conversation. Drawing on sociocultural theory, which holds that all cognitive developments are results of ‘social interactions’, and drawing on conversation analysis as an analytical tool, this study attempts to explore the different functions of ‘silence’ in writing conferences during teacher-learner conversation. The data comes from transcripts of six 1-hour writing conferences video-recorded in a graduate program with 7 candidates in Iran. During the writing conferences, learners’ drafts were discussed. Findings of the study demonstrated that teacher’s silence can play a key role in the management of turns in writing conferences, thereby providing the parties with various opportunities for accomplishing intersubjectivity: the teacher used silence to rethink the information provided during writing conferences, and the learner exploited silence to revise the writing draft. The current study, reporting a range of functions of silence in writing conferences, offers an extension to the existing literature and draws language teachers’, specifically writing instructors’, attention to different functions of silence in writing conferences.
Csorba, Tibor; Lózsa, Rita; Hutvágner, György; Burgyán, József
2010-05-01
RNA silencing plays an important role in plants in defence against viruses. To overcome this defence, plant viruses encode suppressors of RNA silencing. The most common mode of silencing suppression is sequestration of double-stranded RNAs involved in the antiviral silencing pathways. Viral suppressors can also overcome silencing responses through protein-protein interaction. The poleroviral P0 silencing suppressor protein targets ARGONAUTE (AGO) proteins for degradation. AGO proteins are the core component of the RNA-induced silencing complex (RISC). We found that P0 does not interfere with the slicer activity of pre-programmed siRNA/miRNA containing AGO1, but prevents de novo formation of siRNA/miRNA containing AGO1. We show that the AGO1 protein is part of a high-molecular-weight complex, suggesting the existence of a multi-protein RISC in plants. We propose that P0 prevents RISC assembly by interacting with one of its protein components, thus inhibiting formation of siRNA/miRNA-RISC, and ultimately leading to AGO1 degradation. Our findings also suggest that siRNAs enhance the stability of co-expressed AGO1 in both the presence and absence of P0.
Synergistic inhibition of the APC/C by the removal of APC15 in HCT116 cells lacking UBE2C
DEFF Research Database (Denmark)
Garvanska, Dimitriya H; Larsen, Marie Sofie Yoo; Nilsson, Jakob
2016-01-01
that has been shown to depend on the APC/C E2 enzymes, UBE2C and UBE2S. Here we investigate the in vivo role of the APC/C E2 enzymes in SAC silencing using CRISPR/Cas9 genetically engineered HCT116 UBE2C or UBE2S null cell lines. Using live cell assays, we show that UBE2C and UBE2S make a minor...... contribution to SAC silencing in HCT116 cells. Strikingly in cells specifically lacking UBE2C, we observe a strong synergistic inhibition of mitotic progression when we stabilize the MCC on the APC/C by depleting APC15, potentially reflecting increased competition between the MCC and the remaining initiating E...
Regional Educational Laboratory Mid-Atlantic, 2013
2013-01-01
In this REL Mid-Atlantic webinar, Dr. Ross Wiener, Vice President and Executive Director of the Education and Society Program, Aspen Institute, discussed strategies for integrating the Common Core State Standards (CCSS) into teacher effectiveness systems, including ways in which the CCSS can support professional growth and inform teacher…
Overview of the ID, EPI and REL tasks of BioNLP Shared Task 2011
Directory of Open Access Journals (Sweden)
Pyysalo Sampo
2012-06-01
Full Text Available Abstract We present the preparation, resources, results and analysis of three tasks of the BioNLP Shared Task 2011: the main tasks on Infectious Diseases (ID and Epigenetics and Post-translational Modifications (EPI, and the supporting task on Entity Relations (REL. The two main tasks represent extensions of the event extraction model introduced in the BioNLP Shared Task 2009 (ST'09 to two new areas of biomedical scientific literature, each motivated by the needs of specific biocuration tasks. The ID task concerns the molecular mechanisms of infection, virulence and resistance, focusing in particular on the functions of a class of signaling systems that are ubiquitous in bacteria. The EPI task is dedicated to the extraction of statements regarding chemical modifications of DNA and proteins, with particular emphasis on changes relating to the epigenetic control of gene expression. By contrast to these two application-oriented main tasks, the REL task seeks to support extraction in general by separating challenges relating to part-of relations into a subproblem that can be addressed by independent systems. Seven groups participated in each of the two main tasks and four groups in the supporting task. The participating systems indicated advances in the capability of event extraction methods and demonstrated generalization in many aspects: from abstracts to full texts, from previously considered subdomains to new ones, and from the ST'09 extraction targets to other entities and events. The highest performance achieved in the supporting task REL, 58% F-score, is broadly comparable with levels reported for other relation extraction tasks. For the ID task, the highest-performing system achieved 56% F-score, comparable to the state-of-the-art performance at the established ST'09 task. In the EPI task, the best result was 53% F-score for the full set of extraction targets and 69% F-score for a reduced set of core extraction targets, approaching a level
DEFF Research Database (Denmark)
Bengtsson, Tea Torbenfeldt; Fynbo, Lars
2017-01-01
In this article we analyse the significance of silence in qualitative interviews with 36 individuals interviewed about high-risk, illegal activities. We describe how silence expresses a dynamic power relationship between interviewer and interviewee. In the analysis, we focus on two different types...... significant data. We conclude that silence constitutes possibilities for interviewees and interviewers to handle the complex power at play in qualitative interviewing either by maintaining or by losing control of the situation....
The Luteovirus P4 Movement Protein Is a Suppressor of Systemic RNA Silencing
Directory of Open Access Journals (Sweden)
Adriana F. Fusaro
2017-10-01
Full Text Available The plant viral family Luteoviridae is divided into three genera: Luteovirus, Polerovirus and Enamovirus. Without assistance from another virus, members of the family are confined to the cells of the host plant’s vascular system. The first open reading frame (ORF of poleroviruses and enamoviruses encodes P0 proteins which act as silencing suppressor proteins (VSRs against the plant’s viral defense-mediating RNA silencing machinery. Luteoviruses, such as barley yellow dwarf virus-PAV (BYDV-PAV, however, have no P0 to carry out the VSR role, so we investigated whether other proteins or RNAs encoded by BYDV-PAV confer protection against the plant’s silencing machinery. Deep-sequencing of small RNAs from plants infected with BYDV-PAV revealed that the virus is subjected to RNA silencing in the phloem tissues and there was no evidence of protection afforded by a possible decoy effect of the highly abundant subgenomic RNA3. However, analysis of VSR activity among the BYDV-PAV ORFs revealed systemic silencing suppression by the P4 movement protein, and a similar, but weaker, activity by P6. The closely related BYDV-PAS P4, but not the polerovirus potato leafroll virus P4, also displayed systemic VSR activity. Both luteovirus and the polerovirus P4 proteins also showed transient, weak local silencing suppression. This suggests that systemic silencing suppression is the principal mechanism by which the luteoviruses BYDV-PAV and BYDV-PAS minimize the effects of the plant’s anti-viral defense.
Is our knowledge of voice and silence in organizations growing?
DEFF Research Database (Denmark)
Knoll, Michael; Wegge, Jürgen; Unterrainer, Christine
2016-01-01
This article has three objectives. Firstly, we seek to demonstrate the relevance of voice and silence – that is, whether employees contribute or withhold information, ideas, views and/or concerns at work – for the sustainable development of individuals, organizations and societies. Our second...... objective is to identify emerging (and enduring) issues – conceptual, theoretical and methodological – that have not yet been adequately addressed in voice and silence research. These issues include the relationship between voice and silence, how they may manifest in organizations, their manifold...... antecedents inside and beyond organizational boundaries, their potentially positive and negative effects for internal and external stakeholders, and methodological questions. The third objective is to propose opportunities for addressing these issues with the ultimate aim to build a broader and more...
Schnettler, Esther; Hemmes, Hans; Huismann, Rik; Goldbach, Rob; Prins, Marcel; Kormelink, Richard
2010-11-01
The tospovirus NSs protein was previously shown to suppress the antiviral RNA silencing mechanism in plants. Here the biochemical analysis of NSs proteins from different tospoviruses, using purified NSs or NSs containing cell extracts, is described. The results showed that all tospoviral NSs proteins analyzed exhibited affinity to small double-stranded RNA molecules, i.e., small interfering RNAs (siRNAs) and micro-RNA (miRNA)/miRNA* duplexes. Interestingly, the NSs proteins from tomato spotted wilt virus (TSWV), impatiens necrotic spot virus (INSV), and groundnut ringspot virus (GRSV) also showed affinity to long double-stranded RNA (dsRNA), whereas tomato yellow ring virus (TYRV) NSs did not. The TSWV NSs protein was shown to be capable of inhibiting Dicer-mediated cleavage of long dsRNA in vitro. In addition, it suppressed the accumulation of green fluorescent protein (GFP)-specific siRNAs during coinfiltration with an inverted-repeat-GFP RNA construct in Nicotiana benthamiana. In vivo interference of TSWV NSs in the miRNA pathway was shown by suppression of an enhanced GFP (eGFP) miRNA sensor construct. The ability to stabilize miRNA/miRNA* by different tospovirus NSs proteins in vivo was demonstrated by increased accumulation and detection of both miRNA171c and miRNA171c* in tospovirus-infected N. benthamiana. All together, these data suggest that tospoviruses interfere in the RNA silencing pathway by sequestering siRNA and miRNA/miRNA* molecules before they are uploaded into their respective RNA-induced silencing complexes. The observed affinity to long dsRNA for only a subset of the tospoviruses studied is discussed in light of evolutional divergence and their ancestral relation to the animal-infecting members of the Bunyaviridae.
Directory of Open Access Journals (Sweden)
Tanurdzic Milos
2004-04-01
Full Text Available Abstract Background Ceratopteris richardii is a useful experimental system for studying gametophyte development and sexual reproduction in plants. However, few tools for cloning mutant genes or disrupting gene function exist for this species. The feasibility of systemic gene silencing as a reverse genetics tool was examined in this study. Results Several DNA constructs targeting a Ceratopteris protoporphyrin IX magnesium chelatase (CrChlI gene that is required for chlorophyll biosynthesis were each introduced into young gametophytes by biolistic delivery. Their transient expression in individual cells resulted in a colorless cell phenotype that affected most cells of the mature gametophyte, including the meristem and gametangia. The colorless phenotype was associated with a 7-fold decrease in the abundance of the endogenous transcript. While a construct designed to promote the transient expression of a CrChlI double stranded, potentially hairpin-forming RNA was found to be the most efficient in systemically silencing the endogenous gene, a plasmid containing the CrChlI cDNA insert alone was sufficient to induce silencing. Bombarded, colorless hermaphroditic gametophytes produced colorless embryos following self-fertilization, demonstrating that the silencing signal could be transmitted through gametogenesis and fertilization. Bombardment of young gametophytes with constructs targeting the Ceratopteris filamentous temperature sensitive (CrFtsZ and uroporphyrin dehydrogenase (CrUrod genes also produced the expected mutant phenotypes. Conclusion A method that induces the systemic silencing of target genes in the Ceratopteris gametophyte is described. It provides a simple, inexpensive and rapid means to test the functions of genes involved in gametophyte development, especially those involved in cellular processes common to all plants.
Directory of Open Access Journals (Sweden)
Yu Hong
2007-02-01
Full Text Available Abstract Background Despite several effective treatment options available for prostate cancer, it remains the second leading cause of cancer death in American men. Thus, there is a great need for new treatments to improve outcomes. One such strategy is to eliminate cancer through the expression of cytotoxic genes specifically in prostate cells by gene therapy vectored delivery. To prevent systemic toxicity, tissue- and/or cancer-specific gene expression is required. However, the use of tissue- or cancer-specific promoters to target transgene expression has been hampered by their weak activity. Results To address this issue, we have developed a regulation strategy that includes feedback amplification of gene expression along with a differentially suppressible tetracycline regulated expression system (DiSTRES. By differentially suppressing expression of the tetracycline-regulated transcriptional activator (tTA and silencer (tTS genes based on the cell origin, this leads to the activation and silencing of the TRE promoter, respectively. In vitro transduction of LNCaP cells with Ad/GFPDiSTRES lead to GFP expression levels that were over 30-fold higher than Ad/CMV-GFP. Furthermore, Ad/FasL-GFPDiSTRES demonstrated cytotoxic effects in prostate cancer cells known to be resistant to Fas-mediated apoptosis. Conclusion Prostate-specific regulation from the DiSTRES system, therefore, serves as a promising new regulation strategy for future applications in the field of cancer gene therapy and gene therapy as a whole.
Directory of Open Access Journals (Sweden)
Wang Haibo
2010-09-01
Full Text Available Abstract Background RhoA and RhoC have been proved to be over-expressed in many solid cancers, including colorectal cancer. The reduction of RhoA and RhoC expression by RNA interference (RNAi resulted growth inhibition of cancer cells. The present study was to evaluate the effect of silencing of RhoA and RhoC expression by RNAi on growth of human colorectal carcinoma (CRC in tumor-bearing nude mice in vivo. Methods To establish HCT116 cell transplantable model, the nude mice were subcutaneously inoculated with 1.0 × 107 HCT116 cells and kept growing till the tumor xenografts reached 5-7 mm in diameter. Then the mice were randomly assigned to three groups(seven mice in each group: (1 normal saline(NS group, (2replication-defective recombinant adenovirus carrying the negative control shRNA (Ad-HK group and (3replication-defective recombinant adenovirus carrying the 4-tandem linked RhoA and RhoC shRNAs (Ad-RhoA-RhoC group. Ad-HK (4 × 108 pfu, 30 ul/mouse, Ad-RhoA-RhoC (4 × 108 pfu, 30 ul/mouse or PBS (30 ul/mouse was injected intratumorally four times once every other day. The weight and volumes of tumor xenografts were recorded. The levels of RhoA and RhoC mRNA transcripts and proteins in tumor xenografts were detected by reverse quantitative transcription polymerase chain reaction (QRT-PCR and immunohistochemical staining respectively. The terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL assay was used to detect the death of cells. Results The xenografts in mice could be seen at 5th day from the implantation of HCT116 cells and all had reached 5-7 mm in size at 9th day. After injection intratumorally, the growth speed of tumor xenografts in Ad-RhoA-RhoC group was significantly delayed compared with those in NS and Ad-HK group(P RhoA and RhoC reduced more in Ad-RhoA-RhoC group than those in NS and Ad-HK group. The relative RhoA and RhoC mRNA transcripts were decreased to 48% and 43% respectively (P RhoA and RhoC
Clements, Margaret; Pazzaglia, Angela M.; Stafford, Erin
2015-01-01
This "Stated Briefly" report is a companion piece that summarizes the results of another report of the same name. The purpose of the study conducted by REL Midwest in partnership with the Midwest Virtual Education Research Alliance was to develop and administer a survey to describe online course use in Iowa and Wisconsin brick-and-mortar…
Giving Voice: Narrating silence, history and memory in André Brink ...
African Journals Online (AJOL)
This essay examines André Brink's two most recent novels, The Other Side of Silence (2002) and Before I Forget (2004), in terms of their voicing of silence and the rewriting of history and memory. Each has a theme familiar to Brink's readers – an historical story of colonial violence and violation avenged; and the recounting ...
Hai-Ying, Chi; Nagano, Kiori; Ezzikouri, Sayeh; Yamaguchi, Chiho; Kayesh, Mohammad Enamul Hoque; Rebbani, Khadija; Kitab, Bouchra; Nakano, Hirohumi; Kouji, Hiroyuki; Kohara, Michinori; Tsukiyama-Kohara, Kyoko
2016-01-01
Previous studies have shown that intermittent cold stress (ICS) induces depression-like behaviors in mammals. Tupaia belangeri (the tree shrew) is the only experimental animal other than the chimpanzee that has been shown to be susceptible to infection by hepatitis B and C viruses. Moreover, full genome sequence analysis has revealed strong homology between host proteins in Tupaia and in humans and other primates. Tupaia neuromodulator receptor proteins are also known to have a high degree of homology with their corresponding primate proteins. Based on these similarities, we hypothesized that induction of ICS in Tupaia would provide a useful animal model of stress responses. We exposed young adult Tupaia to ICS and observed decreases in body temperature and body weight in both female and male Tupaia, suggesting that Tupaia are an appropriate animal model for ICS studies. We further examined the efficacy of a new small-molecule compound, C737, against the effects of ICS. C737 mimics the helical structure of neuron-restrictive silencer factor (NRSF/REST), which regulates a wide range of target genes involved in neuronal function and pain modulation. Treatment with C737 significantly reduced stress-induced weight loss in female Tupaia; these effects were stronger than those elicited by the antidepressant agomelatine. These results suggest that Tupaia represents a useful non-rodent ICS model. Our data also provide new insights into the function of NRSF/REST in stress-induced depression and other disorders with epigenetic influences or those with high prevalence in women. PMID:27041457
DEFF Research Database (Denmark)
Foote, Jonathan
2016-01-01
In one of the many anecdotes about Michelangelo, the master neared completion of his colossal Moses, tapped him on the knee with his hammer and exclaimed,"Perché non parli?" As an act that liberates latent thoughts or material potentials, his cadenced hammer spoke through careful, repetitive, and...... and distractive, instead activate a contemplative place of silence. Perhaps more than merely a tool for removing stone, the hammer was an instrument for sonorous meditation with materials and thinking....
Wauchope, Bronwyn; Terlich, Alissa; Lee, Stuart
2016-06-01
As community mental health services integrate recovery-oriented practices, treatments that focus on skills development and social integration are desirable. This study aimed to examine the feasibility of implementing "Rel8", an 8-week social skills training group adapted to suit a public community mental health setting. A retrospective audit was conducted of quantitative and qualitative data from four groups run between 2011 and 2013. Pre- and post-group measures were collected, assessing self-rated friendships and confidence with social skills and clinician-rated social skill performance. Qualitative feedback about group participation was also collected through use of a developed questionnaire. Analysis revealed significant improvements in participants' confidence with their social skills following group participation, with a trend also found for improved social skill performance. "Rel8", an adapted 8-week social skills training group, is a feasible program in the context of community mental health services. The program added to the recovery-centred practice of the community mental health service while also adding to the diversity of clinician skills for psychosocial-oriented practice. © The Royal Australian and New Zealand College of Psychiatrists 2015.
Gene silencing activity of siRNA polyplexes based on thiolated N,N,N-trimethylated chitosan.
Varkouhi, Amir K; Verheul, Rolf J; Schiffelers, Raymond M; Lammers, Twan; Storm, Gert; Hennink, Wim E
2010-12-15
N,N,N-Trimethylated chitosan (TMC) is a biodegradable polymer emerging as a promising nonviral vector for nucleic acid and protein delivery. In the present study, we investigated whether the introduction of thiol groups in TMC enhances the extracellular stability of the complexes based on this polymer and promotes the intracellular release of siRNA. The gene silencing activity and the cellular cytotoxicity of polyplexes based on thiolated TMC were compared with those based on the nonthiolated counterpart and the regularly used lipidic transfection agent Lipofectamine. Incubation of H1299 human lung cancer cells expressing firefly luciferase with siRNA/thiolated TMC polyplexes resulted in 60-80% gene silencing activity, whereas complexes based on nonthiolated TMC showed less silencing (40%). The silencing activity of the complexes based on Lipofectamine 2000 was about 60-70%. Importantly, the TMC-SH polyplexes retained their silencing activity in the presence of hyaluronic acid, while nonthiolated TMC polyplexes hardly showed any silencing activity, demonstrating their stability against competing anionic macromolecules. Under the experimental conditions tested, the cytotoxicity of the thiolated and nonthiolated siRNA complexes was lower than those based on Lipofectamine. Given the good extracellular stability and good silencing activity, it is concluded that polyplexes based on TMC-SH are attractive systems for further in vivo evaluations.
Transient degradation of NF-κB proteins in macrophages after interaction with mast cell granules
Directory of Open Access Journals (Sweden)
Noriko Ito
1998-01-01
Full Text Available The exposure of the macrophage cell line, J774 to mast cell granules (MCG led to the form ation of altered nuclear transcription factor proteins (NFκBx, which had faster electrophoretic mobility than the p50 homodimer of NF-κB, but retained comparable DNA binding capacity. Antibodies to N-terminal peptides of p50, p52, p65 or c-Rel supershifted only a fraction of NF-κBx. Western blot analyses revealed that nuclear p65 and c-Rel were progressively degraded after exposure to MCG, whereas nuclear p50 appeared to be unaffected. In contrast, cytoplasmic p50, p65, c-Rel as well as IkBα remained intact after MCG treatment, although p52 was clearly degraded. In comparison to J774 cells, incubation of m ouse peritoneal macrophages with MCG resulted in more extensive alterations to NF-κB proteins. The alterations in NF-κB proteins did not affect the expression of inducible nitric oxide synthase (iNOS or TNF-α mRNA in J774 cells. These data indicate that exposure of J774 cells to MCG leads to generation of altered nuclear p52, p65 and c-Rel, which retain intact N-terminal peptides, specific oligonucleotide binding and transactivating activity. On the other hand, in peritoneal macrophages, MCG induce more extensive modifications to NF-κB proteins with associated inhibition of iNOS or TNF-α mRNA expression.
Veiled Word(s) – Sacred Silence
DEFF Research Database (Denmark)
Isar, Nicoletta
2014-01-01
or secret prayer, and divine silence, which are at the very centre of the Byzantine altar. The main focus is to investigate the liminal nature of the Mystery, manifested through concealing-revealing devices, which are thresholds in the liturgical participation of the Byzantine subject. Fear and secrecy...
Marsollier, Anne-Charlotte; Ciszewski, Lukasz; Mariot, Virginie; Popplewell, Linda; Voit, Thomas; Dickson, George; Dumonceaux, Julie
2016-04-15
Defects in mRNA 3'end formation have been described to alter transcription termination, transport of the mRNA from the nucleus to the cytoplasm, stability of the mRNA and translation efficiency. Therefore, inhibition of polyadenylation may lead to gene silencing. Here, we choose facioscapulohumeral dystrophy (FSHD) as a model to determine whether or not targeting key 3' end elements involved in mRNA processing using antisense oligonucleotide drugs can be used as a strategy for gene silencing within a potentially therapeutic context. FSHD is a gain-of-function disease characterized by the aberrant expression of the Double homeobox 4 (DUX4) transcription factor leading to altered pathogenic deregulation of multiple genes in muscles. Here, we demonstrate that targeting either the mRNA polyadenylation signal and/or cleavage site is an efficient strategy to down-regulate DUX4 expression and to decrease the abnormally high-pathological expression of genes downstream of DUX4. We conclude that targeting key functional 3' end elements involved in pre-mRNA to mRNA maturation with antisense drugs can lead to efficient gene silencing and is thus a potentially effective therapeutic strategy for at least FSHD. Moreover, polyadenylation is a crucial step in the maturation of almost all eukaryotic mRNAs, and thus all mRNAs are virtually eligible for this antisense-mediated knockdown strategy. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Homology-dependent Gene Silencing in Paramecium
Ruiz, Françoise; Vayssié, Laurence; Klotz, Catherine; Sperling, Linda; Madeddu, Luisa
1998-01-01
Microinjection at high copy number of plasmids containing only the coding region of a gene into the Paramecium somatic macronucleus led to a marked reduction in the expression of the corresponding endogenous gene(s). The silencing effect, which is stably maintained throughout vegetative growth, has been observed for all Paramecium genes examined so far: a single-copy gene (ND7), as well as members of multigene families (centrin genes and trichocyst matrix protein genes) in which all closely related paralogous genes appeared to be affected. This phenomenon may be related to posttranscriptional gene silencing in transgenic plants and quelling in Neurospora and allows the efficient creation of specific mutant phenotypes thus providing a potentially powerful tool to study gene function in Paramecium. For the two multigene families that encode proteins that coassemble to build up complex subcellular structures the analysis presented herein provides the first experimental evidence that the members of these gene families are not functionally redundant. PMID:9529389
Directory of Open Access Journals (Sweden)
Rocco Piazza
2013-05-01
Full Text Available BIM is a proapoptotic member of the Bcl-2 family. Here, we investigated the epigenetic status of the BIM locus in NPM/ALK+ anaplastic large cell lymphoma (ALCL cell lines and in lymph node biopsies from NPM/ALK+ ALCL patients. We show that BIM is epigenetically silenced in cell lines and lymph node specimens and that treatment with the deacetylase inhibitor trichostatin A restores the histone acetylation, strongly upregulates BIM expression, and induces cell death. BIM silencing occurs through recruitment of MeCP2 and the SIN3a/histone deacetylase 1/2 (HDAC1/2 corepressor complex. This event requires BIM CpG methylation/demethylation with 5-azacytidine that leads to detachment of the MeCP2 corepressor complex and reacetylation of the histone tails. Treatment with the ALK inhibitor PF2341066 or with an inducible shRNA targeting NPM/ALK does not restore BIM locus reacetylation; however, enforced expression of NPM/ALK in an NPM/ALK-negative cell line significantly increases the methylation at the BIM locus. This study demonstrates that BIM is epigenetically silenced in NPM/ALK-positive cells through recruitment of the SIN3a/HDAC1/2 corepressor complex and that NPM/ALK is dispensable to maintain BIM epigenetic silencing but is able to act as an inducer of BIM methylation.
Macaire, Héloïse; Riquet, Aurélien; Moncollin, Vincent; Biémont-Trescol, Marie-Claude; Duc Dodon, Madeleine; Hermine, Olivier; Debaud, Anne-Laure; Mahieux, Renaud; Mesnard, Jean-Michel; Pierre, Marlène; Gazzolo, Louis; Bonnefoy, Nathalie; Valentin, Hélène
2012-01-01
Human T lymphotropic virus type 1 (HTLV-1) is the etiologic agent of adult T-cell leukemia/lymphoma (ATLL). ATLL is a severe malignancy with no effective treatment. HTLV-1 regulatory proteins Tax and HTLV-1 basic leucine zipper factor (HBZ) play a major role in ATLL development, by interfering with cellular functions such as CD4+ T-cell survival. In this study, we observed that the expression of Bfl-1, an antiapoptotic protein of the Bcl-2 family, is restricted to HTLV-1-infected T-cell lines and to T-cells expressing both Tax and HBZ proteins. We showed that Tax-induced bfl-1 transcription through the canonical NF-κB pathway. Moreover, we demonstrated that Tax cooperated with c-Jun or JunD, but not JunB, transcription factors of the AP-1 family to stimulate bfl-1 gene activation. By contrast, HBZ inhibited c-Jun-induced bfl-1 gene activation, whereas it increased JunD-induced bfl-1 gene activation. We identified one NF-κB, targeted by RelA, c-Rel, RelB, p105/p50, and p100/p52, and two AP-1, targeted by both c-Jun and JunD, binding sites in the bfl-1 promoter of T-cells expressing both Tax and HBZ. Analyzing the potential role of antiapoptotic Bcl-2 proteins in HTLV-1-infected T-cell survival, we demonstrated that these cells are differentially sensitive to silencing of Bfl-1, Bcl-xL, and Bcl-2. Indeed, both Bfl-1 and Bcl-xL knockdowns decreased the survival of HTLV-1-infected T-cell lines, although no cell death was observed after Bcl-2 knockdown. Furthermore, we demonstrated that Bfl-1 knockdown sensitizes HTLV-1-infected T-cells to ABT-737 or etoposide treatment. Our results directly implicate Bfl-1 and Bcl-xL in HTLV-1-infected T-cell survival and suggest that both Bfl-1 and Bcl-xL represent potential therapeutic targets for ATLL treatment. PMID:22553204
The effects of sedative music, arousal music, and silence on electrocardiography signals.
Dousty, Mehdy; Daneshvar, Sabalan; Haghjoo, Majid
2011-01-01
Research indicates that music can affect heart rate, blood pressure, and skin conductance. Music can stimulate central emotions in the brain and release biochemical materials that change the physiologic state. We sought to compare changes in the electrical function of the heart in response to music. Subjects were asked to listen to 2 types of music, namely, sedative and arousal music, in conjunction with two 30-second periods of complete silence. The experiment was conducted in 4 segments: the first and third parts were silence, and the second and fourth parts were music. First, the response to each type of music was compared with that to the preceding period of silence. Next, the responses to both types of music were compared. Finally, the response to music regardless of the type was compared with that to silence. The amplitude of polarization and depolarization changed in response to different kinds of music. The electrical function of the heart in response to music, irrespective of the music type, differed from that in response to silence. The 2 types of music impacted the electrical function of the heart in different ways: the arousal music influenced T-wave maximum amplitude, whereas no such change was recorded in response to the sedative music. The bandwidth of the polarization and depolarization of the heart rate and R-wave amplitude increased in response to music by comparison with silence. In addition, the heart did not seem to try to synchronize with music. The mean R-wave amplitude in sedative music is higher than the arousal music, so our heart works differently when different types of music are heard. Copyright © 2011 Elsevier Inc. All rights reserved.
Genome-wide methylation analysis identifies genes silenced in non-seminoma cell lines.
Noor, Dzul Azri Mohamed; Jeyapalan, Jennie N; Alhazmi, Safiah; Carr, Matthew; Squibb, Benjamin; Wallace, Claire; Tan, Christopher; Cusack, Martin; Hughes, Jaime; Reader, Tom; Shipley, Janet; Sheer, Denise; Scotting, Paul J
2016-01-01
Silencing of genes by DNA methylation is a common phenomenon in many types of cancer. However, the genome-wide effect of DNA methylation on gene expression has been analysed in relatively few cancers. Germ cell tumours (GCTs) are a complex group of malignancies. They are unique in developing from a pluripotent progenitor cell. Previous analyses have suggested that non-seminomas exhibit much higher levels of DNA methylation than seminomas. The genomic targets that are methylated, the extent to which this results in gene silencing and the identity of the silenced genes most likely to play a role in the tumours' biology have not yet been established. In this study, genome-wide methylation and expression analysis of GCT cell lines was combined with gene expression data from primary tumours to address this question. Genome methylation was analysed using the Illumina infinium HumanMethylome450 bead chip system and gene expression was analysed using Affymetrix GeneChip Human Genome U133 Plus 2.0 arrays. Regulation by methylation was confirmed by demethylation using 5-aza-2-deoxycytidine and reverse transcription-quantitative PCR. Large differences in the level of methylation of the CpG islands of individual genes between tumour cell lines correlated well with differential gene expression. Treatment of non-seminoma cells with 5-aza-2-deoxycytidine verified that methylation of all genes tested played a role in their silencing in yolk sac tumour cells and many of these genes were also differentially expressed in primary tumours. Genes silenced by methylation in the various GCT cell lines were identified. Several pluripotency-associated genes were identified as a major functional group of silenced genes.
Directory of Open Access Journals (Sweden)
Tatsuya eKon
2014-11-01
Full Text Available Apple latent spherical virus (ALSV is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the CaMV 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation 0 plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification.
Nicotinamide clearance by Pnc1 directly regulates Sir2-mediated silencing and longevity.
Gallo, Christopher M; Smith, Daniel L; Smith, Jeffrey S
2004-02-01
The Saccharomyces cerevisiae Sir2 protein is an NAD(+)-dependent histone deacetylase (HDAC) that functions in transcriptional silencing and longevity. The NAD(+) salvage pathway protein, Npt1, regulates Sir2-mediated processes by maintaining a sufficiently high intracellular NAD(+) concentration. However, another NAD(+) salvage pathway component, Pnc1, modulates silencing independently of the NAD(+) concentration. Nicotinamide (NAM) is a by-product of the Sir2 deacetylase reaction and is a natural Sir2 inhibitor. Pnc1 is a nicotinamidase that converts NAM to nicotinic acid. Here we show that recombinant Pnc1 stimulates Sir2 HDAC activity in vitro by preventing the accumulation of NAM produced by Sir2. In vivo, telomeric, rDNA, and HM silencing are differentially sensitive to inhibition by NAM. Furthermore, PNC1 overexpression suppresses the inhibitory effect of exogenously added NAM on silencing, life span, and Hst1-mediated transcriptional repression. Finally, we show that stress suppresses the inhibitory effect of NAM through the induction of PNC1 expression. Pnc1, therefore, positively regulates Sir2-mediated silencing and longevity by preventing the accumulation of intracellular NAM during times of stress.
Burzichelli, Claudia; Mackey, Philip E.; Bausmith, Jennifer
2011-01-01
The current study replicates work of Regional Educational Laboratory (REL) Northeast and Islands. It describes dropout prevention programs in nine Mid-Atlantic Region (Delaware, the District of Columbia, Maryland, New Jersey, and Pennsylvania) school districts serving communities with populations of 24,742-107,250 (as of July 2008). All nine…
The Role of Silence at the Retreats of a Buddhist Community
Directory of Open Access Journals (Sweden)
Orsolya Huszár
2016-12-01
Full Text Available The purpose of the study is to establish that the definition of silence as simply an absence of something or as the background of communication proves to be inadequate in a number of communicative instances. The interpretation of silence is culturally determined, and the underappreciation of its role is typical in low-context Western cultures; this is also evinced by the neglect of the topic in the literature. The present study will describe the communicative functions of silence through the findings of field work conducted at the retreats of a Buddhist community in Hungary, providing empirical input for the relevant theoretical constructs. The research findings show that silence is accorded a central role in essentially every component of the retreat (meditations, relaxation, ceremonies, teachings, small-group sharings, meals and rest; and while each event at the retreat focuses primarily on a different specific function of communication, the entire retreat does involve the linkage, affecting, revelational and – to a certain extent – activating functions (to follow the five-element typology of J. Vernon Jensen, as well as – to a lesser extent – the judgmental function. The research also shows that it requires time for individuals in a low-context culture to recognize the “point” of silence – something that the retreats provide the right opportunity for. In fact, the insights the individuals arrived at through these occasions could be put to use in their daily lives, helping their problem-solving and social relationships and in general improving their quality of life.
The Application of Coconut Fiber as Dissipative Silencer
Madlan, M. A.; Ghazali, M. I.; Zaman, I.; Kasron, M. Z.; Ying, T. C.
2017-01-01
Heat ventilation air conditioning system (HVAC) is one of the ducting systems that broadly applied in the building. There are HVAC silencers in the market, however the sound absorptive material commonly used is mineral wool. In this research study, a sound absorptive material made of coconut fiber was tested to identify its performance as a potential replacement of green material for ducting silencer. The experiment was carried out in a testing apparatus that follows the BS EN ISO 11691:2009 standard. Different configurations of sound absorptive material and contents of coconut fiber were investigated in the study. The trend of insertion loss at 1/3 octave frequency was identified where at frequency below 3000Hz, the insertion loss of dissipative silencer is observed high at certain frequency with a very narrow range. At 3000Hz, the insertion loss of 4dB to 6dB is constant until 4000Hz and drops until 5000Hz before it increases again steadily up to 13dB at 10000Hz. A similar trend was observed for different configuration of sound absorptive material. Despite the configuration different, the outcome shows that the insertion loss is increasing with higher content of coconut fiber.
Silencing Deafness: Displacing Disability in the Nineteenth Century
Directory of Open Access Journals (Sweden)
Esme Cleall
2015-03-01
Full Text Available This article traces the way in which the language of displacement and silence were used in nineteenth-century discussions of deafness and connects this tendency to the marginalised place deaf experience occupies historically. Throughout the nineteenth century, a period which saw the consolidation of ‘the deaf and dumb’ as a social category, the word ‘forgetting’ crept into numerous discussions of deafness by both deaf and hearing commentators. Some, such as the educationalist Alexander Graeme Bell, were overt in their desire to forget deafness, demanding disability was ‘bred out’ and deaf culture condemned to the forgotten past. Others used the term ambivalently and sometimes metaphorically discussing the deaf as ‘forgotten’ by society, and ‘children of silence’. Some even pleaded that people who were deaf were not forgotten. But, though varied, the use of the imagery of forgetting and silence to evoke deafness is recurrent, and may, therefore, be seen to reveal something about how deaf experience can be approached as a displacement where deafness was spatially and imaginatively marginalised. I argue that one of the consequences of the conceptual framing of deafness through the language of forgetting was actively to silence deafness and to neutralise the idea that disability should be marginal and could be forgotten.
Friction coefficient measurements of silencers on specialized duct tract
Directory of Open Access Journals (Sweden)
Sehnalek Stanislav
2016-01-01
Full Text Available This article describes test methods on air duct track in Laboratory of Environmental Engineering. It focuses on measurement of silencer parameter like is pressure loss coeffcient. Firstly, the paper describe the measurement apparatus with description of calculation method by standard ISO 7235 and energy equation. Then the paper presents three ways how to accomplish measurement because such way is not covered by procedure in standard. Then follows the evaluation of results of measurements on three types of silencer designed for HVAC applications. The article is concluded with discussion over measured data with outline for further research.
Energy Technology Data Exchange (ETDEWEB)
Curry, Merril C.; Peters, Amelia A. [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia); Kenny, Paraic A. [Department of Developmental and Molecular Biology, Albert Einstein College of Medicine, Bronx, New York 10461 (United States); Roberts-Thomson, Sarah J. [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia); Monteith, Gregory R., E-mail: gregm@uq.edu.au [School of Pharmacy, The University of Queensland, Brisbane, Queensland 4072 (Australia)
2013-05-10
Highlights: •Some clinical breast cancers are associated with MCU overexpression. •MCU silencing did not alter cell death initiated with the Bcl-2 inhibitor ABT-263. •MCU silencing potentiated caspase-independent cell death initiated by ionomycin. •MCU silencing promoted ionomycin-mediated cell death without changes in bulk Ca{sup 2+}. -- Abstract: The mitochondrial calcium uniporter (MCU) transports free ionic Ca{sup 2+} into the mitochondrial matrix. We assessed MCU expression in clinical breast cancer samples using microarray analysis and the consequences of MCU silencing in a breast cancer cell line. Our results indicate that estrogen receptor negative and basal-like breast cancers are characterized by elevated levels of MCU. Silencing of MCU expression in the basal-like MDA-MB-231 breast cancer cell line produced no change in proliferation or cell viability. However, distinct consequences of MCU silencing were seen on cell death pathways. Caspase-dependent cell death initiated by the Bcl-2 inhibitor ABT-263 was not altered by MCU silencing; whereas caspase-independent cell death induced by the calcium ionophore ionomycin was potentiated by MCU silencing. Measurement of cytosolic Ca{sup 2+} levels showed that the promotion of ionomycin-induced cell death by MCU silencing occurs independently of changes in bulk cytosolic Ca{sup 2+} levels. This study demonstrates that MCU overexpression is a feature of some breast cancers and that MCU overexpression may offer a survival advantage against some cell death pathways. MCU inhibitors may be a strategy to increase the effectiveness of therapies that act through the induction of caspase-independent cell death pathways in estrogen receptor negative and basal-like breast cancers.
Liu, Ying; Tan, Huiling; Tian, Hui; Liang, Chunyang; Chen, She; Liu, Qinghua
2011-11-04
The effector of RNA interference (RNAi) is the RNA-induced silencing complex (RISC). C3PO promotes the activation of RISC by degrading the Argonaute2 (Ago2)-nicked passenger strand of duplex siRNA. Active RISC is a multiple-turnover enzyme that uses the guide strand of siRNA to direct the Ago2-mediated sequence-specific cleavage of complementary mRNA. How this effector step of RNAi is regulated is currently unknown. Here, we used the human Ago2 minimal RISC system to purify Sjögren's syndrome antigen B (SSB)/autoantigen La as an activator of the RISC-mediated mRNA cleavage activity. Our reconstitution studies showed that La could promote multiple-turnover RISC catalysis by facilitating the release of cleaved mRNA from RISC. Moreover, we demonstrated that La was required for efficient RNAi, antiviral defense, and transposon silencing in vivo. Taken together, the findings of C3PO and La reveal a general concept that regulatory factors are required to remove Ago2-cleaved products to assemble or restore active RISC. Copyright © 2011 Elsevier Inc. All rights reserved.
Fabrication of lithium/C-103 alloy heat pipes for sharp leading edge cooling
Ai, Bangcheng; Chen, Siyuan; Yu, Jijun; Lu, Qin; Han, Hantao; Hu, Longfei
2018-05-01
In this study, lithium/C-103 alloys heat pipes are proposed for sharp leading edge cooling. Three models of lithium/C-103 alloy heat pipes were fabricated. And their startup properties were tested by radiant heat tests and aerothermal tests. It is found that the startup temperature of lithium heat pipe was about 860 °C. At 1000 °C radiant heat tests, the operating temperature of lithium/C-103 alloy heat pipe is lower than 860 °C. Thus, startup failure occurs. At 1100 °C radiant heat tests and aerothermal tests, the operating temperature of lithium/C-103 alloy heat pipe is higher than 860 °C, and the heat pipe starts up successfully. The startup of lithium/C-103 alloy heat pipe decreases the leading edge temperature effectively, which endows itself good ablation resistance. After radiant heat tests and aerothermal tests, all the heat pipe models are severely oxidized because of the C-103 poor oxidation resistance. Therefore, protective coatings are required for further applications of lithium/C-103 alloy heat pipes.
Silence in the second language classroom
King, J
2013-01-01
Why are second language learners in Japan's universities so silent? This book investigates the perplexing but intriguing phenomenon of classroom silence and draws on ideas from psychology, sociolinguistics and anthropology to offer a unique insight into the reasons why some learners are either unable or unwilling to speak in a foreign language.
A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes
Jin, Hailing; Zhu, Jian-Kang
2010-01-01
RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host's essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.
Yu-Wai-Man, Cynthia; Tagalakis, Aristides D; Manunta, Maria D; Hart, Stephen L; Khaw, Peng T
2016-02-24
There is increasing evidence that the Myocardin-related transcription factor/Serum response factor (MRTF/SRF) pathway plays a key role in fibroblast activation and that knocking down MRTF can lead to reduced scarring and fibrosis. Here, we have developed a receptor-targeted liposome-peptide-siRNA nanoparticle as a non-viral delivery system for MRTF-B siRNA in conjunctival fibrosis. Using 50 nM siRNA, the MRTF-B gene was efficiently silenced by 76% and 72% with LYR and LER nanoparticles, respectively. The silencing efficiency was low when non-targeting peptides or siRNA alone or liposome-siRNA alone were used. LYR and LER nanoparticles also showed higher silencing efficiency than PEGylated LYR-P and LER-P nanoparticles. The nanoparticles were not cytotoxic using different liposomes, targeting peptides, and 50 nM siRNA. Three-dimensional fibroblast-populated collagen matrices were also used as a functional assay to measure contraction in vitro, and showed that MRTF-B LYR nanoparticles completely blocked matrix contraction after a single transfection treatment. In conclusion, this is the first study to develop and show that receptor-targeted liposome-peptide-siRNA nanoparticles represent an efficient and safe non-viral siRNA delivery system that could be used to prevent fibrosis after glaucoma filtration surgery and other contractile scarring conditions in the eye.
Transgene-induced gene silencing is not affected by a change in ploidy level.
Directory of Open Access Journals (Sweden)
Daniela Pignatta
Full Text Available BACKGROUND: Whole genome duplication, which results in polyploidy, is a common feature of plant populations and a recurring event in the evolution of flowering plants. Polyploidy can result in changes to gene expression and epigenetic instability. Several epigenetic phenomena, occurring at the transcriptional or post-transcriptional level, have been documented in allopolyploids (polyploids derived from species hybrids of Arabidopsis thaliana, yet findings in autopolyploids (polyploids derived from the duplication of the genome of a single species are limited. Here, we tested the hypothesis that an increase in ploidy enhances transgene-induced post-transcriptional gene silencing using autopolyploids of A. thaliana. METHODOLOGY/PRINCIPAL FINDINGS: Diploid and tetraploid individuals of four independent homozygous transgenic lines of A. thaliana transformed with chalcone synthase (CHS inverted repeat (hairpin constructs were generated. For each line diploids and tetraploids were compared for efficiency in post-transcriptional silencing of the endogenous CHS gene. The four lines differed substantially in their silencing efficiency. Yet, diploid and tetraploid plants derived from these plants and containing therefore identical transgene insertions showed no difference in the efficiency silencing CHS as assayed by visual scoring, anthocyanin assays and quantification of CHS mRNA. CONCLUSIONS/SIGNIFICANCE: Our results in A. thaliana indicated that there is no effect of ploidy level on transgene-induced post-transcriptional gene silencing. Our findings that post-transcriptional mechanisms were equally effective in diploids and tetraploids supports the use of transgene-driven post-transcriptional gene silencing as a useful mechanism to modify gene expression in polyploid species.
Yuan, Bifeng; Zhang, Jing; Wang, Hongxia; Xiong, Lei; Cai, Qian; Wang, Tina; Jacobsen, Steven; Pradhan, Sriharsa; Wang, Yinsheng
2011-01-01
Thiopurines including 6-thioguanine (SG), 6-mercaptopurine and azathioprine are effective anticancer agents with remarkable success in clinical practice, especially in effective treatment of acute lymphoblastic leukemia (ALL). SG is understood to act as a DNA hypomethylating agent in ALL cells, however, the underlying mechanism leading to global cytosine demethylation remains unclear. Here we report that SG treatment results in reactivation of epigenetically silenced genes in T leukemia cells...
Cernilogar, Filippo M.; Burroughs, A. Maxwell; Lanzuolo, Chiara; Breiling, Achim; Imhof, Axel; Orlando, Valerio
2013-01-01
.Conclusions:We conclude that the Dicer-2/Argonaute-2 RNAi pathway, despite its role in pairing sensitive gene silencing of transgenes, does not have a role in PcG dependent silencing of major homeotic gene cluster loci in Drosophila. © 2013 Cernilogar et al.
Directory of Open Access Journals (Sweden)
Noreen F Rizvi
Full Text Available The Catharanthus roseus plant is the source of many valuable terpenoid indole alkaloids (TIAs, including the anticancer compounds vinblastine and vincristine. Transcription factors (TFs are promising metabolic engineering targets due to their ability to regulate multiple biosynthetic pathway genes. To increase TIA biosynthesis, we elicited the TIA transcriptional activators (ORCAs and other unidentified TFs with the plant hormone, methyl jasmonate (MJ, while simultaneously silencing the expression of the transcriptional repressor ZCT1. To silence ZCT1, we developed transgenic hairy root cultures of C. roseus that expressed an estrogen-inducible Zct1 hairpin for activating RNA interference. The presence of 17β-estradiol (5μM effectively depleted Zct1 in hairy root cultures elicited with MJ dosages that either optimize or inhibit TIA production (250 or 1000μM. However, silencing Zct1 was not sufficient to increase TIA production or the expression of the TIA biosynthetic genes (G10h, Tdc, and Str, illustrating the tight regulation of TIA biosynthesis. The repression of the TIA biosynthetic genes at the inhibitory MJ dosage does not appear to be solely regulated by ZCT1. For instance, while Zct1 and Zct2 levels decreased through activating the Zct1 hairpin, Zct3 levels remained elevated. Since ZCT repressors have redundant yet distinct functions, silencing all three ZCTs may be necessary to relieve their repression of alkaloid biosynthesis.
He, J; Cooper, H M; Reyes, A; Di Re, M; Kazak, L; Wood, S R; Mao, C C; Fearnley, I M; Walker, J E; Holt, I J
2012-07-01
The bacterial homologue of C4orf14, YqeH, has been linked to assembly of the small ribosomal subunit. Here, recombinant C4orf14 isolated from human cells, co-purified with the small, 28S subunit of the mitochondrial ribosome and the endogenous protein co-fractionated with the 28S subunit in sucrose gradients. Gene silencing of C4orf14 specifically affected components of the small subunit, leading to decreased protein synthesis in the organelle. The GTPase of C4orf14 was critical to its interaction with the 28S subunit, as was GTP. Therefore, we propose that C4orf14, with bound GTP, binds to components of the 28S subunit facilitating its assembly, and GTP hydrolysis acts as the release mechanism. C4orf14 was also found to be associated with human mitochondrial nucleoids, and C4orf14 gene silencing caused mitochondrial DNA depletion. In vitro C4orf14 is capable of binding to DNA. The association of C4orf14 with mitochondrial translation factors and the mitochondrial nucleoid suggests that the 28S subunit is assembled at the mitochondrial nucleoid, enabling the direct transfer of messenger RNA from the nucleoid to the ribosome in the organelle.
Identification of Novel Fibrosis Modifiers by In Vivo siRNA Silencing
Directory of Open Access Journals (Sweden)
Elisabeth H. Vollmann
2017-06-01
Full Text Available Fibrotic diseases contribute to 45% of deaths in the industrialized world, and therefore a better understanding of the pathophysiological mechanisms underlying tissue fibrosis is sorely needed. We aimed to identify novel modifiers of tissue fibrosis expressed by myofibroblasts and their progenitors in their disease microenvironment through RNA silencing in vivo. We leveraged novel biology, targeting genes upregulated during liver and kidney fibrosis in this cell lineage, and employed small interfering RNA (siRNA-formulated lipid nanoparticles technology to silence these genes in carbon-tetrachloride-induced liver fibrosis in mice. We identified five genes, Egr2, Atp1a2, Fkbp10, Fstl1, and Has2, which modified fibrogenesis based on their silencing, resulting in reduced Col1a1 mRNA levels and collagen accumulation in the liver. These genes fell into different groups based on the effects of their silencing on a transcriptional mini-array and histological outcomes. Silencing of Egr2 had the broadest effects in vivo and also reduced fibrogenic gene expression in a human fibroblast cell line. Prior to our study, Egr2, Atp1a2, and Fkbp10 had not been functionally validated in fibrosis in vivo. Thus, our results provide a major advance over the existing knowledge of fibrogenic pathways. Our study is the first example of a targeted siRNA assay to identify novel fibrosis modifiers in vivo.
Strategies for Improving siRNA-Induced Gene Silencing Efficiency.
Safari, Fatemeh; Rahmani Barouji, Solmaz; Tamaddon, Ali Mohammad
2017-12-01
Purpose: Human telomerase reverse transcriptase (hTERT) plays a crucial role in tumorigenesis and progression of cancers. Gene silencing of hTERT by short interfering RNA (siRNA) is considered as a promising strategy for cancer gene therapy. Various algorithms have been devised for designing a high efficient siRNA which is a significant issue in the clinical usage. Thereby, in the present study, the relation of siRNA designing criteria and the gene silencing efficiency was evaluated. Methods: The siRNA sequences were designed and characterized by using on line soft wares. Cationic co-polymer (polyethylene glycol-g-polyethylene imine (PEG-g-PEI)) was used for the construction of polyelectrolyte complexes (PECs) containing siRNAs. The cellular uptake of the PECs was evaluated. The gene silencing efficiency of different siRNA sequences was investigated and the effect of observing the rational designing on the functionality of siRNAs was assessed. Results: The size of PEG-g-PEI siRNA with N/P (Nitrogen/Phosphate) ratio of 2.5 was 114 ± 0.645 nm. The transfection efficiency of PECs was desirable (95.5% ± 2.4%.). The results of Real-Time PCR showed that main sequence (MS) reduced the hTERT expression up to 90% and control positive sequence (CPS) up to 63%. These findings demonstrated that the accessibility to the target site has priority than the other criteria such as sequence preferences and thermodynamic features. Conclusion: siRNA opens a hopeful window in cancer therapy which provides a convenient and tolerable therapeutic approach. Thereby, using the set of criteria and rational algorithms in the designing of siRNA remarkably affect the gene silencing efficiency.
A viral suppressor protein inhibits host RNA silencing by hooking up with Argonautes
Jin, Hailing
2010-05-01
RNA viruses are particularly vulnerable to RNAi-based defenses in the host, and thus have evolved specific proteins, known as viral suppressors of RNA silencing (VSRs), as a counterdefense. In this issue of Genes & Development, Azevedo and colleagues (pp. 904-915) discovered that P38, the VSR of Turnip crinkle virus, uses its glycine/tryptophane (GW) motifs as an ARGONAUTE (AGO) hook to attract and disarm the host\\'s essential effector of RNA silencing. Several GW motif-containing cellular proteins are known to be important partners of AGOs in RNA silencing effector complexes in yeast, plants, and animals. The GW motif appears to be a versatile and effective tool for regulating the activities of RNA silencing pathways, and the use of GW mimicry to compete for and inhibit host AGOs may be a strategy used by many pathogens to counteract host RNAi-based defenses. © 2010 by Cold Spring Harbor Laboratory Press.
MicroRNA-Mediated Myostatin Silencing in Caprine Fetal Fibroblasts
Zhong, Bushuai; Zhang, Yanli; Yan, Yibo; Wang, Ziyu; Ying, Shijia; Huang, Mingrui; Wang, Feng
2014-01-01
Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi) mediated by microRNAs (miRNAs) is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF) was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN) response genes, such as interferon beta (IFN-β) and 2′-5′-oligoadenylate synthetase 2 (OAS2), were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats. PMID:25244645
MicroRNA-mediated myostatin silencing in caprine fetal fibroblasts.
Directory of Open Access Journals (Sweden)
Bushuai Zhong
Full Text Available Myostatin functions as a negative regulator of skeletal muscle growth by suppressing proliferation and differentiation of myoblasts. Dysfunction of the myostatin gene, either due to natural mutation or genetic manipulations such as knockout or knockdown, has been reported to increase muscle mass in mammalian species. RNA interference (RNAi mediated by microRNAs (miRNAs is a promising method for gene knockdown studies. In the present study, transient and stable silencing of the myostatin gene in caprine fetal fibroblasts (CFF was evaluated using the two most effective constructs selected from four different miRNA expression constructs screened in 293FT cells. Using these two miRNA constructs, we achieved up to 84% silencing of myostatin mRNA in transiently transfected CFF cells and up to 31% silencing in stably transfected CFF cells. Moreover, off-target effects due to induction of interferon (IFN response genes, such as interferon beta (IFN-β and 2'-5'-oligoadenylate synthetase 2 (OAS2, were markedly fewer in stably transfected CFF cells than in transiently transfected cells. Stable expression of anti-myostatin miRNA with minimal induction of interferon shows great promise for increasing muscle mass in transgenic goats.
Strain Specific Factors Control Effector Gene Silencing in Phytophthora sojae.
Directory of Open Access Journals (Sweden)
Sirjana Devi Shrestha
Full Text Available The Phytophthora sojae avirulence gene Avr3a encodes an effector that is capable of triggering immunity on soybean plants carrying the resistance gene Rps3a. P. sojae strains that express Avr3a are avirulent to Rps3a plants, while strains that do not are virulent. To study the inheritance of Avr3a expression and virulence towards Rps3a, genetic crosses and self-fertilizations were performed. A cross between P. sojae strains ACR10 X P7076 causes transgenerational gene silencing of Avr3a allele, and this effect is meiotically stable up to the F5 generation. However, test-crosses of F1 progeny (ACR10 X P7076 with strain P6497 result in the release of silencing of Avr3a. Expression of Avr3a in the progeny is variable and correlates with the phenotypic penetrance of the avirulence trait. The F1 progeny from a direct cross of P6497 X ACR10 segregate for inheritance for Avr3a expression, a result that could not be explained by parental imprinting or heterozygosity. Analysis of small RNA arising from the Avr3a gene sequence in the parental strains and hybrid progeny suggests that the presence of small RNA is necessary but not sufficient for gene silencing. Overall, we conclude that inheritance of the Avr3a gene silenced phenotype relies on factors that are variable among P. sojae strains.
Energy Technology Data Exchange (ETDEWEB)
Wang, Yi; Nguyen, Truong Son; Wang, Xin [School of Chemical and Biomedical Engineering, Nanyang Technological University, Singapore 639798 (Singapore); Liu, Xuewei [School of Physical and Mathematical Sciences, Nanyang Technological University, Singapore 639798 (Singapore)
2010-05-01
Carbon-supported bimetallic palladium-lead (Pd-Pb/C) catalysts with different amounts of lead are prepared using a co-reduction method. The catalysts are characterized by various techniques, which reveal the formation of an alloy nanoparticle structure. The electrochemical activities of the catalysts towards ethanol oxidation in alkaline media are examined by cyclic voltammetry, linear sweep voltammetry and chronoamperometry methods. The results show that the Pd-Pb(4:1)/C catalyst exhibits a better catalytic activity than the Pd/C catalyst. From carbon monoxide (CO) stripping results, the addition of lead also facilitates the oxidative removal of adsorbed CO. The promoting effect of lead is explained by a bi-functional mechanism and d-band theory. (author)
Burzichelli, Claudia; Mackey, Philip E.; Bausmith, Jennifer
2011-01-01
The current study replicates work of Regional Educational Laboratory (REL) Northeast and Islands. It describes dropout prevention programs in nine Mid-Atlantic Region (Delaware, the District of Columbia, Maryland, New Jersey, and Pennsylvania) school districts serving communities with populations of 24,742-107,250 (as of July 2008). All nine…
Polycomb complexes and silencing mechanisms
DEFF Research Database (Denmark)
Lund, Anders H; van Lohuizen, Maarten
2004-01-01
Advances in the past couple of years have brought important new knowledge on the mechanisms by which Polycomb-group proteins regulate gene expression and on the consequences of their actions. The discovery of histone methylation imprints specific for Polycomb and Trithorax complexes has provided...... mechanistic insight on how this ancient epigenetic memory system acts to repress and indicates that it may share mechanistic aspects with other silencing and genome-protective processes, such as RNA interference....
Development of a gene silencing DNA vector derived from a broad host range geminivirus
Directory of Open Access Journals (Sweden)
Hancock Leandria C
2009-07-01
Full Text Available Abstract Background Gene silencing is proving to be a powerful tool for genetic, developmental, and physiological analyses. The use of viral induced gene silencing (VIGS offers advantages to transgenic approaches as it can be potentially applied to non-model systems for which transgenic techniques are not readily available. However, many VIGS vectors are derived from Gemini viruses that have limited host ranges. We present a new, unipartite vector that is derived from a curtovirus that has a broad host range and will be amenable to use in many non-model systems. Results The construction of a gene silencing vector derived from the geminivirus Beet curly top virus (BCTV, named pWSRi, is reported. Two versions of the vector have been developed to allow application by biolistic techniques or by agro-infiltration. We demonstrate its ability to silence nuclear genes including ribulose bisphosphate carboxylase small subunit (rbcS, transketolase, the sulfur allele of magnesium chelatase (ChlI, and two homeotic transcription factors in spinach or tomato by generating gene-specific knock-down phenotypes. Onset of phenotypes occurred 3 to 12 weeks post-inoculation, depending on the target gene, in organs that developed after the application. The vector lacks movement genes and we found no evidence for significant spread from the site of inoculation. However, viral amplification in inoculated tissue was detected and is necessary for systemic silencing, suggesting that signals generated from active viral replicons are efficiently transported within the plant. Conclusion The unique properties of the pWSRi vector, the ability to silence genes in meristem tissue, the separation of virus and silencing phenotypes, and the broad natural host range of BCTV, suggest that it will have wide utility.
PPAR-γ Silencing Inhibits the Apoptosis of A549 Cells by Upregulating Bcl-2
Directory of Open Access Journals (Sweden)
Jingyu YANG
2013-03-01
Full Text Available Background and objective Drug resistance is the one of primary causes of death in patients with lung cancer, PPAR-γ could induce the apoptosis and reverse drug resistance. The aim of this study is to investigate the expression of PPAR-γ on cisplatin sensitivity and apoptosis response of human lung cancer cell line A549. Methods Reconstruction of PPAR-γ silencing A549 cells (A549/PPAR-γ(- by siRNA. MTT assay was employed to determine the effect of cisplatin on the proliferation of A549/PPAR-γ(-, flow cytometry to determine the effect of cisplatin on the cell apoptosis, Western blot to determine the change of phosphorylation of Akt, caspase-3 and expression of bcl-2/bax. Finally, RT-PCR was employed to determine the transcriptional level of bcl-2. Results Two PPAR-γ silencing A549 cell clones were established successfully, and the expression of PPAR-γ was downregulated significantly as confirmed by RT-PCR and Western blot. After PPAR-γ silencing, the resistance of these two A549 clones to cisplatin was increased by 1.29-fold and 1.60-fold respectively. Flow cytometry showed that the apoptosis rate was decreased, and Western Blot showed that the phosphorylation of Akt and expression of bcl-2/bax were upregulated, caspase-3 was downregulated. Finally, RT-PCR showed that the transcriptional level of bcl-2 was upregulated as well. Conclusion Downregulation of PPAR-γ in A549 cells led to increase of cisplatin resistance. One of the mechanisms was upregulatin of phosphorylation of Akt and expression of bcl-2, which inhibited the apoptosis of cells. The downregulation of PPAR-γ is a possible mechanism that leads to the clinical drug resistance of cancer.
Yell, Mitchell L.; Katsiyannis, Antonis; Losinski, Mickey; Marshall, Kelsey
2016-01-01
This article examines a case out of the U.S. Court of Appeals for the Third Circuit: "Ridley School District v. M.R and J.R. ex rel. E.R." (2012). The case is the first circuit court case in which the Individuals with Disabilities Education Improvement Act requirement that special education services be based on peer-reviewed research…
Tsitaat : [luuletused] / Bertolt Brecht ; saksa k. tlk. ja järelsõna: Märt Väljataga
Brecht, Bertolt, 1898-1956
2002-01-01
Järelsõna, lk. 14-15. Sisu: Tsitaat ; Kõikidest asjadest ; Unenägu suurest virisejast : (Kartulipuuduse ajal) ; Sõnad, mida füürer ei kannata ; "Svenborgi luuletuste" moto ; Mõtted maapao kestvusest I-II ; Kevad 1938 I-II ; Kirsivaras ; 1941 ; Põgenik W. B. vabasurma puhul ; Hollywoodi eleegiad I-VI ; Hollywood ; Aia kastmisest ; E. P. L'Election de Son Sépulchre ; Mina, ellujäänu ; Suured ajad, raisku lastud ; Samad kombed nagu ikka ; Palav päev ; Suits ; Kuused ; Kaheksa aastat tagasi ; Ma ei vaja hauakivi ; Rasked ajad ; Asjade vaheldumine I-II ; Charité valges palatis ; Ja ma arvasin ikka
[Effects of ezrin silencing on pancreatic cancer cell line Panc-1].
Meng, Yun-xiao; Yu, Shuang-ni; Lu, Zhao-hui; Chen, Jie
2012-12-01
To explore the effects of ezrin silencing on pancreatic cancer cell line Panc-1. Pancreatic cancer cell line Panc-1 was transfected with ezrin silencing plasmid. The proliferation and the cell cycle status were determined by CCK-8 assay and flow cytometry analysis, respectively. Cellular membrane protrusions/microvilli formation were visualized by scanning election microscopy. Colony formation assay was used to determine the cell anchor-independent growth ability in vitro. Trans-filter migration and invasion assays were performed with 8 µm pore inserts in a 24-well BioCoat chamber with/without Matrigel. Ezrin silencing decreased cellular protrusions/microvilli formation, anchorage-independent growth, cell migration and invasion, but had no effects on cell proliferation in vitro and cell cycle, in pancreatic cancer cell line Panc-1. Ezrin expression affects the cellular protrusions/microvilli formation, anchorage-independent growth, cell migration and invasion in pancreatic cancer cell line Panc-1.
Kim, Soonhyang; Ates, Burcu; Grigsby, Yurimi; Kraker, Stefani; Micek, Timothy A.
2016-01-01
The authors explored the role of silence and deciphered its meaning and usefulness as a teaching and learning strategy for Japanese students through a survey of Japanese university students in their home country. This study has revealed that participant responses were evenly divided among comfortable with silence, uncomfortable with silence, and…
Uncertainty assessing of measure result of tungsten in U3O8 by ICP-AES
International Nuclear Information System (INIS)
Du Guirong; Nie Jie; Tang Lilei
2011-01-01
According as the determining method and the assessing criterion,the uncertainty assessing of measure result of tungsten in U 3 O 8 by ICP-AES is researched. With the assessment of each component in detail, the result shows that u rel (sc)> u rel (c)> u rel (F)> u rel (m) by uncertainty contribution. Other uncertainty is random, calculated by repetition. u rel (sc) is contributed to uncertainty mainly. So the general uncertainty is reduced with strict operation to reduce u rel (sc). (authors)
Charged residues in the H-NS linker drive DNA binding and gene silencing in single cells.
Gao, Yunfeng; Foo, Yong Hwee; Winardhi, Ricksen S; Tang, Qingnan; Yan, Jie; Kenney, Linda J
2017-11-21
Nucleoid-associated proteins (NAPs) facilitate chromosome organization in bacteria, but the precise mechanism remains elusive. H-NS is a NAP that also plays a major role in silencing pathogen genes. We used genetics, single-particle tracking in live cells, superresolution microscopy, atomic force microscopy, and molecular dynamics simulations to examine H-NS/DNA interactions in single cells. We discovered a role for the unstructured linker region connecting the N-terminal oligomerization and C-terminal DNA binding domains. In the present work we demonstrate that linker amino acids promote engagement with DNA. In the absence of linker contacts, H-NS binding is significantly reduced, although no change in chromosome compaction is observed. H-NS is not localized to two distinct foci; rather, it is scattered all around the nucleoid. The linker makes DNA contacts that are required for gene silencing, while chromosome compaction does not appear to be an important H-NS function.
SU-E-T-592: OSL Response of Al2O3:C Detectors Exposed to Therapeutic Proton Beams
Energy Technology Data Exchange (ETDEWEB)
Granville, DA [Carleton Laboratory for Radiotherapy Physics, Carleton University, Ottawa, ON (Canada); Flint, DB; Sawakuchi, GO [The University of Texas MD Anderson Cancer Center, Houston, TX (United States)
2015-06-15
Purpose: To characterize the response of Al{sub 2}O{sub 3}:C optically stimulated luminescence (OSL) detectors (OSLDs) exposed to therapeutic proton beams of differing beam quality. Methods: We prepared Al{sub 2}O{sub 3}:C OSLDs from the same material as commercially available nanoDot dosimeters (Landauer, Inc). We irradiated the OSLDs in modulated proton beams of varying quality, as defined by the residual range. An absorbed dose to water of 0.2 Gy was delivered to all OSLDs with the residual range values varying from 0.5 to 23.5 cm (average LET in water from ∼0.5 to 2.5 keV/µm). To investigate the beam quality dependence of different emission bands within the OSL spectrum, we performed OSLD readouts using both continuous-wave stimulation (CW-OSL) and pulsed stimulation (P-OSL) with two sets of optical filters (Hoya U-340 and Kopp 5113). For all readout modes, the relative absorbed dose sensitivity (S{sub rel}) for each beam quality was calculated using OSLDs irradiated in a 6 MV photon beam as a reference. Results: We found that the relative absorbed dose sensitivity was highly dependent on both readout mode and integration time of the OSL signal. For CW-OSL signals containing only the blue emission band, S{sub rel} was between 0.85 and 0.94 for 1 s readouts and between 0.82 and 0.93 for 10 s readouts. Similarly, for P-OSL readouts containing only the blue emission band S{sub rel} ranged from 0.86 to 0.91, and 0.82 to 0.93 for 1 s and 10 s readouts, respectively. For OSLD signals containing only the UV emission band, S{sub rel} ranged from 1.00 to 1.46, and 0.97 to 1.30 for P-OSL readouts of 1 s and 10 s, respectively. Conclusion: For measurements of absorbed dose using Al{sub 2}O{sub 3}:C OSLDs in therapeutic proton beams, dependence on beam quality was smallest for readout protocols that selected the blue emission band with small integration times. DA Granville received financial support from the Natural Sciences and Engineering
Resnick, M S; Luo, X; Vinton, E G; Sando, J J
1997-06-01
Stimulation of sensitive EL4 mouse thymoma cells (s-EL4) with phorbol esters results in production of interleukin 2 (IL-2), adherence to a plastic substrate, and growth inhibition, whereas a phorbol ester-resistant variant (r-EL4) fails to respond. Previous studies revealed substantially decreased expression of protein kinase C (PKC) epsilon in the r-EL4 versus s-EL4 cells. This work has been extended to examine the more recently described PKC isozymes. Western and Northern analyses revealed a marked decrease in PKC eta and theta in r-EL4 as compared to s-EL4 cells. Treatment of these lines with phorbol ester for 24 h resulted in down-regulation of all PKC isozymes examined except PKC eta, which was up-regulated in the s-EL4 cells at the time of maximal IL-2 production. Two newly isolated EL4 clones, resistant to phorbol ester-induced growth inhibition but still exhibiting the phorbol ester-induced adherence and IL-2 production, both expressed PKC eta and theta. Collectively, these observations suggest a dissociation of growth inhibition from adherence and IL-2 production pathways and a potential role for PKC eta in the latter.
International Nuclear Information System (INIS)
Rückert, Felix; Samm, Nicole; Lehner, Anne-Kathrin; Saeger, Hans-Detlev; Grützmann, Robert; Pilarsky, Christian
2010-01-01
Pancreatic ductal adenocarcinoma shows a distinct apoptosis resistance, which contributes significantly to the aggressive nature of this tumor and constrains the effectiveness of new therapeutic strategies. Apoptosis resistance is determined by the net balance of the cells pro-and anti-apoptotic 'control mechanisms'. Numerous dysregulated anti-apoptotic genes have been identified in pancreatic cancer and seem to contribute to the high anti-apoptotic buffering capacity. We aimed to compare the benefit of simultaneous gene silencing (SGS) of several candidate genes with conventional gene silencing of single genes. From literature search we identified the anti-apoptotic genes XIAP, Survivin and Bcl-2 as commonly upregulated in pancreatic cancer. We performed SGS and silencing of single candidate genes using siRNA molecules in two pancreatic cancer cell lines. Effectiveness of SGS was assessed by qRT-PCR and western blotting. Apoptosis induction was measured by flow cytometry and caspase activation. Simultaneous gene silencing reduced expression of the three target genes effectively. Compared to silencing of a single target or control, SGS of these genes resulted in a significant higher induction of apoptosis in pancreatic cancer cells. In the present study we performed a subliminal silencing of different anti-apoptotic target genes simultaneously. Compared to silencing of single target genes, SGS had a significant higher impact on apoptosis induction in pancreatic cancer cells. Thereby, we give further evidence for the concept of an anti-apoptotic buffering capacity of pancreatic cancer cells
PhOBF1, a petunia ocs element binding factor, plays an important role in antiviral RNA silencing.
Sun, Daoyang; Li, Shaohua; Niu, Lixin; Reid, Michael S; Zhang, Yanlong; Jiang, Cai-Zhong
2017-02-01
Virus-induced gene silencing (VIGS) is a common reverse genetics strategy for characterizing the function of genes in plants. The detailed mechanism governing RNA silencing efficiency triggered by viruses is largely unclear. Here, we reveal that a petunia (Petunia hybrida) ocs element binding factor, PhOBF1, one of the basic leucine zipper (bZIP) transcription factors, was up-regulated by Tobacco rattle virus (TRV) infection. Simultaneous silencing of PhOBF1 and a reporter gene, phytoene desaturase (PDS) or chalcone synthase (CHS), by TRV-based VIGS led to a failure of the development of leaf photobleaching or the white-corollas phenotype. PhOBF1 silencing caused down-regulation of RNA silencing-related genes, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonautes (AGOs). After inoculation with the TRV-PhPDS, PhOBF1-RNAi lines exhibited a substantially impaired PDS silencing efficiency, whereas overexpression of PhOBF1 resulted in a recovery of the silencing phenotype (photobleaching) in systemic leaves. A compromised resistance to TRV and Tobacco mosaic virus was found in PhOBF1-RNAi lines, while PhOBF1-overexpressing lines displayed an enhanced resistance to their infections. Compared with wild-type plants, PhOBF1-silenced plants accumulated lower levels of free salicylic acid (SA), salicylic acid glucoside, and phenylalanine, contrarily to higher levels of those in plants overexpressing PhOBF1. Furthermore, transcripts of a number of genes associated with the shikimate and phenylpropanoid pathways were decreased or increased in PhOBF1-RNAi or PhOBF1-overexpressing lines, respectively. Taken together, the data suggest that PhOBF1 regulates TRV-induced RNA silencing efficiency through modulation of RDRs, DCLs, and AGOs mediated by the SA biosynthesis pathway. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Sun, Daoyang; Nandety, Raja Sekhar; Zhang, Yanlong; Reid, Michael S; Niu, Lixin; Jiang, Cai-Zhong
2016-05-01
Virus-induced RNA silencing is involved in plant antiviral defense and requires key enzyme components, including RNA-dependent RNA polymerases (RDRs), Dicer-like RNase III enzymes (DCLs), and Argonaute proteins (AGOs). However, the transcriptional regulation of these critical components is largely unknown. In petunia (Petunia hybrida), an ethylene-responsive element binding factor, PhERF2, is induced by Tobacco rattle virus (TRV) infection. Inclusion of a PhERF2 fragment in a TRV silencing construct containing reporter fragments of phytoene desaturase (PDS) or chalcone synthase (CHS) substantially impaired silencing efficiency of both the PDS and CHS reporters. Silencing was also impaired in PhERF2- RNAi lines, where TRV-PhPDS infection did not show the expected silencing phenotype (photobleaching). In contrast, photobleaching in response to infiltration with the TRV-PhPDS construct was enhanced in plants overexpressing PhERF2 Transcript abundance of the RNA silencing-related genes RDR2, RDR6, DCL2, and AGO2 was lower in PhERF2-silenced plants but higher in PhERF2-overexpressing plants. Moreover, PhERF2-silenced lines showed higher susceptibility to Cucumber mosaic virus (CMV) than wild-type (WT) plants, while plants overexpressing PhERF2 exhibited increased resistance. Interestingly, growth and development of PhERF2-RNAi lines were substantially slower, whereas the overexpressing lines were more vigorous than the controls. Taken together, our results indicate that PhERF2 functions as a positive regulator in antiviral RNA silencing. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Epigenetic silencing of CYP24 in the tumor microenvironment
Johnson, Candace S.; Chung, Ivy; Trump, Donald L.
2010-01-01
Calcitriol (1,25 dihydroxycholecalciferol) has significant antitumor activity in vitro and in vivo in a number of tumor model systems. We developed a system for isolation of fresh endothelial cells from tumors and Matrigel environments which demonstrate that CYP24, the catabolic enzyme involved in vitamin D signaling, is epigenetically silenced selectively in tumor-derived endothelial cells (TDEC). TDEC maintain phenotypic characteristics which are distinct from endothelial cells isolated from normal tissues and from Matrigel plugs (MDEC). In TDEC, calcitriol induces G0/G1 arrest, modulates p27 and p21, and induces apoptotic cell death and decreases P-Erk and P-Akt. In contrast, endothelial cells isolated from normal tissues and MDEC are unresponsive to calcitriol-mediated anti-proliferative effects despite intact signaling through the vitamin D receptor (VDR). In TDEC, which is sensitive to calcitriol, the CYP24 promoter is hypermethylated in two CpG island regions located at the 5′end; this hypermethylation may contribute to gene silencing of CYP24. The extent of methylation in these two regions is significantly less in MDEC. Lastly, treatment of TDEC with a DNA methyltransferase inhibitor restores calcitriol-mediated induction of CYP24 and resistance to calcitriol. These data suggest that epigenetic silencing of CYP24 modulates cellular responses to calcitriol. PMID:20304059
F-box-like domain in the polerovirus protein P0 is required for silencing suppressor function
Pazhouhandeh, Maghsoud; Dieterle, Monika; Marrocco, Katia; Lechner, Esther; Berry, Bassam; Brault, Véronique; Hemmer, Odile; Kretsch, Thomas; Richards, Kenneth E.; Genschik, Pascal; Ziegler-Graff, Véronique
2006-01-01
Plants employ small RNA-mediated posttranscriptional gene silencing as a virus defense mechanism. In response, plant viruses encode proteins that can suppress RNA silencing, but the mode of action of most such proteins is poorly understood. Here, we show that the silencing suppressor protein P0 of two Arabidopsis-infecting poleroviruses interacts by means of a conserved minimal F-box motif with Arabidopsis thaliana orthologs of S-phase kinase-related protein 1 (SKP1), a component of the SCF family of ubiquitin E3 ligases. Point mutations in the F-box-like motif abolished the P0–SKP1 ortholog interaction, diminished virus pathogenicity, and inhibited the silencing suppressor activity of P0. Knockdown of expression of a SKP1 ortholog in Nicotiana benthamiana rendered the plants resistant to polerovirus infection. Together, the results support a model in which P0 acts as an F-box protein that targets an essential component of the host posttranscriptional gene silencing machinery. PMID:16446454
Klotho gene silencing promotes pathology in the mdx mouse model of Duchenne muscular dystrophy
Wehling-Henricks, Michelle; Li, Zhenzhi; Lindsey, Catherine; Wang, Ying; Welc, Steven S.; Ramos, Julian N.; Khanlou, Négar; Kuro-o, Makoto; Tidball, James G.
2016-01-01
Duchenne muscular dystrophy (DMD) is a lethal muscle disease involving progressive loss of muscle regenerative capacity and increased fibrosis. We tested whether epigenetic silencing of the klotho gene occurs in the mdx mouse model of DMD and whether klotho silencing is an important feature of the disease. Our findings show that klotho undergoes muscle-specific silencing at the acute onset of mdx pathology. Klotho experiences increased methylation of CpG sites in its promoter region, which is associated with gene silencing, and increases in a repressive histone mark, H3K9me2. Expression of a klotho transgene in mdx mice restored their longevity, reduced muscle wasting, improved function and greatly increased the pool of muscle-resident stem cells required for regeneration. Reductions of fibrosis in late, progressive stages of the mdx pathology achieved by transgene expression were paralleled by reduced expression of Wnt target genes (axin-2), transforming growth factor-beta (TGF-β1) and collagens types 1 and 3, indicating that Klotho inhibition of the profibrotic Wnt/TGFβ axis underlies its anti-fibrotic effect in aging, dystrophic muscle. Thus, epigenetic silencing of klotho during muscular dystrophy contributes substantially to lost regenerative capacity and increased fibrosis of dystrophic muscle during late progressive stages of the disease. PMID:27154199
Silencing of the rotavirus NSP4 protein decreases the incidence of biliary atresia in murine model.
Directory of Open Access Journals (Sweden)
Jiexiong Feng
Full Text Available Biliary atresia is a common disease in neonates which causes obstructive jaundice and progressive hepatic fibrosis. Our previous studies indicate that rotavirus infection is an initiator in the pathogenesis of experimental biliary atresia (BA through the induction of increased nuclear factor-kappaB and abnormal activation of the osteopontin inflammation pathway. In the setting of rotavirus infection, rotavirus nonstructural protein 4 (NSP4 serves as an important immunogen, viral protein 7 (VP7 is necessary in rotavirus maturity and viral protein 4 (VP4 is a virulence determiner. The purpose of the current study is to clarify the roles of NSP4, VP7 and VP4 in the pathogenesis of experimental BA. Primary cultured extrahepatic biliary epithelia were infected with Rotavirus (mmu18006. Small interfering RNA targeting NSP4, VP7 or VP4 was transfected before rotavirus infection both in vitro and in vivo. We analyzed the incidence of BA, morphological change, morphogenesis of viral particles and viral mRNA and protein expression. The in vitro experiments showed NSP4 silencing decreased the levels of VP7 and VP4, reduced viral particles and decreased cytopathic effect. NSP4-positive cells had strongly positive expression of integrin subunit α2. Silencing of VP7 or VP4 partially decreased epithelial injury. Animal experiments indicated after NSP4 silencing, mouse pups had lower incidence of BA than after VP7 or VP4 silencing. However, 33.3% of VP4-silenced pups (N = 6 suffered BA and 50% of pups (N = 6 suffered biliary injury after VP7 silencing. Hepatic injury was decreased after NSP4 or VP4 silencing. Neither VP4 nor VP7 were detected in the biliary ducts after NSP4. All together, NSP4 silencing down-regulates VP7 and VP4, resulting in decreased incidence of BA.
Excavating silences and tensions of agency|passivity in science education reform
Rivera Maulucci, Maria S.
2010-12-01
I reflect on studies by Rodriguez and Carlone, Haun-Frank, and Kimmel to emphasize the ways in which they excavate silences in the science education literature related to linguistic and cultural diversity and situating the problem of reform in teachers rather than contextual factors, such as traditional schooling discourses and forces that serve to marginalize science. I propose that the current push for top-down reform and accountability diminishes opportunities for receptivity, learning with and from students in order to transform teachers' practices and promote equity in science education. I discuss tensions of agency and passivity in science education reform and argue that attention to authentic caring constitutes another silence in the science education literature. I conclude that the current policy context positions teachers and science education researchers as tempered radicals struggling against opp(reg)ressive reforms and that there is a need for more studies to excavate these and other silences.
Impact of target mRNA structure on siRNA silencing efficiency: A large-scale study.
Gredell, Joseph A; Berger, Angela K; Walton, S Patrick
2008-07-01
The selection of active siRNAs is generally based on identifying siRNAs with certain sequence and structural properties. However, the efficiency of RNA interference has also been shown to depend on the structure of the target mRNA, primarily through studies using exogenous transcripts with well-defined secondary structures in the vicinity of the target sequence. While these studies provide a means for examining the impact of target sequence and structure independently, the predicted secondary structures for these transcripts are often not reflective of structures that form in full-length, native mRNAs where interactions can occur between relatively remote segments of the mRNAs. Here, using a combination of experimental results and analysis of a large dataset, we demonstrate that the accessibility of certain local target structures on the mRNA is an important determinant in the gene silencing ability of siRNAs. siRNAs targeting the enhanced green fluorescent protein were chosen using a minimal siRNA selection algorithm followed by classification based on the predicted minimum free energy structures of the target transcripts. Transfection into HeLa and HepG2 cells revealed that siRNAs targeting regions of the mRNA predicted to have unpaired 5'- and 3'-ends resulted in greater gene silencing than regions predicted to have other types of secondary structure. These results were confirmed by analysis of gene silencing data from previously published siRNAs, which showed that mRNA target regions unpaired at either the 5'-end or 3'-end were silenced, on average, approximately 10% more strongly than target regions unpaired in the center or primarily paired throughout. We found this effect to be independent of the structure of the siRNA guide strand. Taken together, these results suggest minimal requirements for nucleation of hybridization between the siRNA guide strand and mRNA and that both mRNA and guide strand structure should be considered when choosing candidate si
Bibby, Chris; Hodgson, Murray
2017-01-01
The work reported here, part of a study on the performance and optimal design of interior natural-ventilation openings and silencers ("ventilators"), discusses the prediction of the acoustical performance of such ventilators, and the factors that affect it. A wave-based numerical approach-the finite-element method (FEM)-is applied. The development of a FEM technique for the prediction of ventilator diffuse-field transmission loss is presented. Model convergence is studied with respect to mesh, frequency-sampling and diffuse-field convergence. The modeling technique is validated by way of predictions and the comparison of them to analytical and experimental results. The transmission-loss performance of crosstalk silencers of four shapes, and the factors that affect it, are predicted and discussed. Performance increases with flow-path length for all silencer types. Adding elbows significantly increases high-frequency transmission loss, but does not increase overall silencer performance which is controlled by low-to-mid-frequency transmission loss.
Valli, Adrian; Busnadiego, Idoia; Maliogka, Varvara; Ferrero, Diego; Castón, José R; Rodríguez, José Francisco; García, Juan Antonio
2012-01-01
RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV) displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.
Directory of Open Access Journals (Sweden)
Yuh Chwen G Lee
2015-06-01
Full Text Available The piwi-interacting RNAs (piRNA are small RNAs that target selfish transposable elements (TEs in many animal genomes. Until now, piRNAs' role in TE population dynamics has only been discussed in the context of their suppression of TE transposition, which alone is not sufficient to account for the skewed frequency spectrum and stable containment of TEs. On the other hand, euchromatic TEs can be epigenetically silenced via piRNA-dependent heterochromatin formation and, similar to the widely known "Position-effect variegation", heterochromatin induced by TEs can "spread" into nearby genes. We hypothesized that the piRNA-mediated spread of heterochromatin from TEs into adjacent genes has deleterious functional effects and leads to selection against individual TEs. Unlike previously identified deleterious effects of TEs due to the physical disruption of DNA, the functional effect we investigated here is mediated through the epigenetic influences of TEs. We found that the repressive chromatin mark, H3K9me, is elevated in sequences adjacent to euchromatic TEs at multiple developmental stages in Drosophila melanogaster. Furthermore, the heterochromatic states of genes depend not only on the number of and distance from adjacent TEs, but also on the likelihood that their nearest TEs are targeted by piRNAs. These variations in chromatin status probably have functional consequences, causing genes near TEs to have lower expression. Importantly, we found stronger selection against TEs that lead to higher H3K9me enrichment of adjacent genes, demonstrating the pervasive evolutionary consequences of TE-induced epigenetic silencing. Because of the intrinsic biological mechanism of piRNA amplification, spread of TE heterochromatin could result in the theoretically required synergistic deleterious effects of TE insertions for stable containment of TE copy number. The indirect deleterious impact of piRNA-mediated epigenetic silencing of TEs is a previously
Directory of Open Access Journals (Sweden)
Ebrahim Parcham
2017-01-01
Full Text Available Introduction: Organizational Culture is one of the most important factors that can change the climate of silence. The main aim of this research was to investigate the influence of organizational culture on employees’ organizational silence in Shiraz University of Medical Sciences. Method: This research was a descriptive-correlation one. The target population was chosen from 1900 staff of the University of Medical sciences and Health Care headquarter in Shiraz. Thus 311 employees were selected using the Krejcie and Morgan sampling table. The instrument used in this research was Denison (2006 organizational culture questionnaire and Dimitris Buratas and Maria Vacula (2007 organizational culture. Cornbrash’s alpha method was used to calculate the reliability. The Item analysis and expert consensus were applied to calculate the validity of instruments. All gathered data analyzed with PLS software. Results: The results showed that the four dimensions of organizational culture include organizational involvement, organizational adaptability, organizational concistency and organizational mission was moderate and the mean scores obtained for each factor were 2.85, 2.82, 2.94 and 2.93 respectively. Structural equation model showed Organizational culture has a significant positive impact on organizational silence (β=0.68; P<.001. Conclusion: Based on the results and impact of organizational culture on organizational silence that is positive and significant; The organization further efforts to strengthen various aspects of organizational culture, especially the employees’ involvement in decision making; Employees can better express their opinions and thus reduced their organizational silence. In other words strengthening corporate culture is combined with the reduction of organizational silence. Medical organizations can establish appropriate reward system for creative ideas and suggestions to encourage people express their ideas As a result, reduced
Nomura, M; Tsujimura, A; Begum, N A; Matsumoto, M; Wabiko, H; Toyoshima, K; Seya, T
2000-01-01
The murine membrane cofactor protein (CD46) gene is expressed exclusively in testis, in contrast to human CD46, which is expressed ubiquitously. To elucidate the mechanism of differential CD46 gene expression among species, we cloned entire murine CD46 genomic DNA and possible regulatory regions were placed in the flanking region of the luciferase reporter gene. The reporter gene assay revealed a silencing activity not in the promoter, but in the 3'-flanking region of the gene and the silencer-like element was identified within a 0.2-kb region between 0.6 and 0.8 kb downstream of the stop codon. This silencer-like element was highly similar to that of the pig MHC class-I gene. The introduction of a mutation into this putative silencer element of murine CD46 resulted in an abrogation of the silencing effect. Electrophoretic mobility-shift assay indicated the presence of the binding molecule(s) for this silencer sequence in murine cell lines and tissues. A size difference of the protein-silencer-element complex was observed depending upon the solubilizers used for preparation of the nuclear extracts. A mutated silencer sequence failed to interact with the binding molecules. The level of the binding factor was lower in the testicular germ cells compared with other organs. Thus the silencer element and its binding factor may play a role in transcriptional regulation of murine CD46 gene expression. These results imply that the effects of the CD46 silencer element encompass the innate immune and reproductive systems, and in mice may determine the testicular germ-cell-dominant expression of CD46. PMID:11023821
Directory of Open Access Journals (Sweden)
Francis Kevin P
2011-08-01
Full Text Available Abstract Background Transient expression of proteins in plants has become a favoured method over the production of stably transformed plants because, in addition to enabling high protein yields, it is both fast and easy to apply. An enhancement of transient protein expression can be achieved by plant virus-encoded RNA silencing suppressor proteins. Since viral suppressor proteins differ in their efficiency to enhance transient protein expression in plants, we developed a whole-leaf green fluorescent protein (GFP-based imaging assay to quantitatively assess suppressor protein activity. Results In a transient GFP-expression assay using wild-type and GFP-transgenic N. benthamiana, addition of the plant viral suppressors Beet mild yellowing virus (BMYV-IPP P0 or Plum pox virus (PPV HC-Pro was shown to increase fluorescent protein expression 3-4-fold, 7 days post inoculation (dpi when compared to control plants. In contrast, in agroinfiltrated patches without suppressor activity, near complete silencing of the GFP transgene was observed in the transgenic N. benthamiana at 21 dpi. Both co-infiltrated suppressors significantly enhanced GFP expression over time, with HC-Pro co-infiltrations leading to higher short term GFP fluorescence (at 7 dpi and P0 giving higher long term GFP fluorescence (at 21 dpi. Additionally, in contrast to HC-Pro co-infiltrations, an area of complete GFP silencing was observed at the edge of P0 co-infiltrated areas. Conclusions Fluorescence imaging of whole intact leaves proved to be an easy and effective method for spatially and quantitatively observing viral suppressor efficiency in plants. This suppressor assay demonstrates that plant viral suppressors greatly enhanced transient GFP expression, with P0 showing a more prolonged suppressor activity over time than HC-Pro. Both suppressors could prove to be ideal candidates for enhancing target protein expression in plants.
Nucleases as a barrier to gene silencing in the cotton boll weevil, Anthonomus grandis.
Almeida Garcia, Rayssa; Lima Pepino Macedo, Leonardo; Cabral do Nascimento, Danila; Gillet, François-Xavier; Moreira-Pinto, Clidia Eduarda; Faheem, Muhammad; Moreschi Basso, Angelina Maria; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima
2017-01-01
RNA interference (RNAi) approaches have been applied as a biotechnological tool for controlling plant insect pests via selective gene down regulation. However, the inefficiency of RNAi mechanism in insects is associated with several barriers, including dsRNA delivery and uptake by the cell, dsRNA interaction with the cellular membrane receptor and dsRNA exposure to insect gut nucleases during feeding. The cotton boll weevil (Anthonomus grandis) is a coleopteran in which RNAi-mediated gene silencing does not function efficiently through dsRNA feeding, and the factors involved in the mechanism remain unknown. Herein, we identified three nucleases in the cotton boll weevil transcriptome denoted AgraNuc1, AgraNuc2, and AgraNuc3, and the influences of these nucleases on the gene silencing of A. grandis chitin synthase II (AgraChSII) were evaluated through oral dsRNA feeding trials. A phylogenetic analysis showed that all three nucleases share high similarity with the DNA/RNA non-specific endonuclease family of other insects. These nucleases were found to be mainly expressed in the posterior midgut region of the insect. Two days after nuclease RNAi-mediated gene silencing, dsRNA degradation by the gut juice was substantially reduced. Notably, after nucleases gene silencing, the orally delivered dsRNA against the AgraChSII gene resulted in improved gene silencing efficiency when compared to the control (non-silenced nucleases). The data presented here demonstrates that A. grandis midgut nucleases are effectively one of the main barriers to dsRNA delivery and emphasize the need to develop novel RNAi delivery strategies focusing on protecting the dsRNA from gut nucleases and enhancing its oral delivery and uptake to crop insect pests.
Stemp, W James; Chung, Steven
2011-01-01
This pilot study tests the reliability of laser scanning confocal microscopy (LSCM) to quantitatively measure wear on experimental obsidian tools. To our knowledge, this is the first use of confocal microscopy to study wear on stone flakes made from an amorphous silicate like obsidian. Three-dimensional surface roughness or texture area scans on three obsidian flakes used on different contact materials (hide, shell, wood) were documented using the LSCM to determine whether the worn surfaces could be discriminated using area-scale analysis, specifically relative area (RelA). When coupled with the F-test, this scale-sensitive fractal analysis could not only discriminate the used from unused surfaces on individual tools, but was also capable of discriminating the wear histories of tools used on different contact materials. Results indicate that such discriminations occur at different scales. Confidence levels for the discriminations at different scales were established using the F-test (mean square ratios or MSRs). In instances where discrimination of surface roughness or texture was not possible above the established confidence level based on MSRs, photomicrographs and RelA assisted in hypothesizing why this was so. Copyright © 2011 Wiley Periodicals, Inc.
The great silence science and philosophy of Fermi's paradox
Cirkovic, Milan M
2018-01-01
The Great Silence explores the multifaceted problem named after the great Italian physicist Enrico Fermi and his legendary 1950 lunchtime question "Where is everybody?" In many respects, Fermi's paradox is the richest and the most challenging problem for the entire field of astrobiology and the Search for ExtraTerrestrial Intelligence (SETI) studies. This book shows how Fermi's paradox is intricately connected with many fields of learning, technology, arts, and even everyday life. It aims to establish the strongest possible version of the problem, to dispel many related confusions, obfuscations, and prejudices, as well as to offer a novel point of entry to the many solutions proposed in existing literature. Cirkovic argues that any evolutionary worldview cannot avoid resolving the Great Silence problem in one guise or another.
Directory of Open Access Journals (Sweden)
Juan M. Leyva-Moral
2008-03-01
Full Text Available Justificación: el silencio dentro del lugar de trabajo se asocia con diversas causas, siendo el miedo, la desvinculación y la cooperación las principales razones que llevan al empleado a permanecer en silencio. Objetivo: explorar el significado que tiene el silencio entre los profesionales de la salud. Metodología: estudio cualitativo basado en la Teoría Fundamentada. Se utilizó la entrevista semi-estructurada y un cuestionario con preguntas abiertas. Resultados: tres categorías emergen del análisis de los textos: a Silencio como "un arma de doble filo" ya que se le asocian efectos positivos pero también negativos. b "prevención de consecuencias venideras" explora las situaciones y los motivos en los que los participantes consideran que es mejor permanecer en silencio. C "¡Yo no me callo!" aparece como resultado del análisis de aquellos participantes que siempre dicen lo que piensan. Conclusión: el silencio en el ámbito laboral genera sentimientos perjudiciales a nivel individual, tales como baja autoestima, frustración o rabia, mientras que a nivel grupal puede producir mayor cohesión por no haber discusiones de ningún tipo. No obstante, la calidad de la producción puede verse mermada ya que las personas se dedican a "seguir la corriente".Justification: silence in the workplace is associated with many causes, such as fear, deattachement and cooperation. Aim: to explore the meaning of silence among the healthcare professionals. Methodology: qualitative stuyd based on Grounded Theory. Semi-structured interviews were used as well as a questionnaire with open ended questions. Findings: three main domains emerge from the data anlysis: a Silence as a double-sided argument, b prevention of future consequences; c I don’t keep silent! Conclusion: silence within the workplace generates negative feelings at an individual level, such as low self-steem, frustration or anger. In a grupal level, silence can produce higher cohesi
Basquin, Denis; Spierer, Anne; Begeot, Flora; Koryakov, Dmitry E; Todeschini, Anne-Laure; Ronsseray, Stéphane; Vieira, Cristina; Spierer, Pierre; Delattre, Marion
2014-01-01
Heterochromatin is made of repetitive sequences, mainly transposable elements (TEs), the regulation of which is critical for genome stability. We have analyzed the role of the heterochromatin-associated Su(var)3-7 protein in Drosophila ovaries. We present evidences that Su(var)3-7 is required for correct oogenesis and female fertility. It accumulates in heterochromatic domains of ovarian germline and somatic cells nuclei, where it co-localizes with HP1. Homozygous mutant females display ovaries with frequent degenerating egg-chambers. Absence of Su(var)3-7 in embryos leads to defects in meiosis and first mitotic divisions due to chromatin fragmentation or chromosome loss, showing that Su(var)3-7 is required for genome integrity. Females homozygous for Su(var)3-7 mutations strongly impair repression of P-transposable element induced gonadal dysgenesis but have minor effects on other TEs. Su(var)3-7 mutations reduce piRNA cluster transcription and slightly impact ovarian piRNA production. However, this modest piRNA reduction does not correlate with transposon de-silencing, suggesting that the moderate effect of Su(var)3-7 on some TE repression is not linked to piRNA production. Strikingly, Su(var)3-7 genetically interacts with the piwi and aubergine genes, key components of the piRNA pathway, by strongly impacting female fertility without impairing transposon silencing. These results lead us to propose that the interaction between Su(var)3-7 and piwi or aubergine controls important developmental processes independently of transposon silencing.
Surface functionalisation of PLGA nanoparticles for gene silencing
DEFF Research Database (Denmark)
Andersen, Morten Østergaard; Lichawska, Agata; Arpanaei, Ayyoob
2010-01-01
. In addition, particles containing cetylated-PEI achieved 64% silencing of TNFα in J774.1 cells. This rapid method for surface modification of PLGA nanoparticles promotes its application for alternative cetylated functional derivatives as a strategy to control specific biological properties of nanoparticles....
Stabilization of high T(sub c) phase in bismuth cuprate superconductor by lead doping
Gupta, Ram. P.; Pachauri, J. P.; Khokle, W. S.; Nagpal, K. C.; Date, S. K.
1990-01-01
It has widely been ascertained that doping of lead in Bi:Sr:Ca:Cu:O systems promotes the growth of high T(sub c) (110 K) phase, improves critical current density, and lowers processing temperature. A systematic investigation is undertaken to determine optimum lead content and processing conditions to achieve these. A large number of samples with cationic compositions of Bi(2-x)Pb(x)Sr2Ca2Cu3 (x = 0.2 to 2.0) were prepared by conventional solid state reaction technique. Samples of all compositions were annealed together at a temperature and characterized through resistance-temperature (R-T) measurements and x ray diffraction (XRD) to determine the zero resistance temperature, T(sub c)(0) and to identify presence of phases, respectively. The annealing temperature was varied between 790 C to optimize processing parameters. Results are given. In brief, an optimum process is reported along with composition of leaded bismuth cuprate superconductor which yields nearly a high T(sub c) single phase with highly stable superconducting properties.
Directory of Open Access Journals (Sweden)
Adrian Valli
Full Text Available RNA silencing is directly involved in antiviral defense in a wide variety of eukaryotic organisms, including plants, fungi, invertebrates, and presumably vertebrate animals. The study of RNA silencing-mediated antiviral defences in vertebrates is hampered by the overlap with other antiviral mechanisms; thus, heterologous systems are often used to study the interplay between RNA silencing and vertebrate-infecting viruses. In this report we show that the VP3 protein of the avian birnavirus Infectious bursal disease virus (IBDV displays, in addition to its capacity to bind long double-stranded RNA, the ability to interact with double-stranded small RNA molecules. We also demonstrate that IBDV VP3 prevents the silencing mediated degradation of a reporter mRNA, and that this silencing suppression activity depends on its RNA binding ability. Furthermore, we find that the anti-silencing activity of IBDV VP3 is shared with the homologous proteins expressed by both insect- and fish-infecting birnaviruses. Finally, we show that IBDV VP3 can functionally replace the well-characterized HCPro silencing suppressor of Plum pox virus, a potyvirus that is unable to infect plants in the absence of an active silencing suppressor. Altogether, our results support the idea that VP3 protects the viral genome from host sentinels, including those of the RNA silencing machinery.
Directory of Open Access Journals (Sweden)
Sajad Zare
2017-08-01
Full Text Available Background One of the most common harmful factors in the workplace is noise. Noise control is a factor beneficial for health and safety in the workplace. Objectives The current study aimed to design and manufacture a silencer for the cooling tower pump of Sarcheshmeh Copper power station in order to control noise. Methods In this study, sound pressure level was measured by the use of a sound level meter (B & K 2260. Measurement was carried out in the light of ISO 1996 standard. After studying technical and acoustic features of the noise source, a dispersive-absorptive silencer was designed to control noise pollution generated by the cooling tower pump of the thermal station. After analyzing the frequencies of sound pressure level and using available data, a cylindrical silencer (with a diameter of 1.5 m and height of 3 m was designed and manufactured. The internal part of the silencer was filled with different columns of absorbent material covered with punched metal. Therefore, the silencer consisted of (1 acoustic diffuser, (2 acoustic chamber, and (3 acoustic channels. Results Measurements showed that, at a distance of 1 m from the source, sound pressure level reduced from 127 dBA before installing the silencer to 79 dBA after the installation, resulting in a reduction of 48 dBA. Conclusions Using a silencer with absorbent material (glass wool is very effective in reducing the noise generated by the pump.
An investigation of noise produced by unsteady gas flow through silencer elements
Mawhinney, Graeme Hugh
This thesis presents an investigation of the noise produced by unsteady gas flow through silencer elements. The central aim of the research project was to produce a tool for assistance in the design of the exhaust systems of diesel powered electrical generator sets, with the modelling techniques developed having a much wider application in reciprocating internal combustion engine exhaust systems. An automotive cylinder head was incorporated in a purpose built test rig to supply exhaust pulses, typical of those found in the exhaust system of four stroke diesel engines, to various experimental exhaust systems. Exhaust silencer elements evaluated included expansion, re- entrant, concentric tube resonator and absorptive elements. Measurements taken on the test rig included, unsteady superposition pressure in the exhaust ducting, cyclically averaged mass flow rate through the system and exhaust noise levels radiated into a semi-anechoic measurement chamber. The entire test rig was modelled using the 1D finite volume method developed previously developed at Queen's University Belfast. Various boundary conditions, developed over the years, were used to model the various silencer elements being evaluated. The 1D gas dynamic simulation thus estimated the mass flux history at the open end of the exhaust system. The mass flux history was then broken into its harmonic components and an acoustic radiation model was developed to model the sound pressure level produced by an acoustic monopole over a reflecting plane. The accuracy of the simulation technique was evaluated by correlation of measured and simulated superposition pressure and noise data. In general correlation of superposition pressure was excellent for all of the silencer elements tested. Predicted sound pressure level radiated from the open end of the exhaust tailpipe was seen to be accurate in the 100 Hz to 1 kHz frequency range for all of the silencer elements tested.
Conifers have a unique small RNA silencing signature.
Dolgosheina, Elena V; Morin, Ryan D; Aksay, Gozde; Sahinalp, S Cenk; Magrini, Vincent; Mardis, Elaine R; Mattsson, Jim; Unrau, Peter J
2008-08-01
Plants produce small RNAs to negatively regulate genes, viral nucleic acids, and repetitive elements at either the transcriptional or post-transcriptional level in a process that is referred to as RNA silencing. While RNA silencing has been extensively studied across the different phyla of the animal kingdom (e.g., mouse, fly, worm), similar studies in the plant kingdom have focused primarily on angiosperms, thus limiting evolutionary studies of RNA silencing in plants. Here we report on an unexpected phylogenetic difference in the size distribution of small RNAs among the vascular plants. By extracting total RNA from freshly growing shoot tissue, we conducted a survey of small RNAs in 24 vascular plant species. We find that conifers, which radiated from the other seed-bearing plants approximately 260 million years ago, fail to produce significant amounts of 24-nucleotide (nt) RNAs that are known to guide DNA methylation and heterochromatin formation in angiosperms. Instead, they synthesize a diverse population of small RNAs that are exactly 21-nt long. This finding was confirmed by high-throughput sequencing of the small RNA sequences from a conifer, Pinus contorta. A conifer EST search revealed the presence of a novel Dicer-like (DCL) family, which may be responsible for the observed change in small RNA expression. No evidence for DCL3, an enzyme that matures 24-nt RNAs in angiosperms, was found. We hypothesize that the diverse class of 21-nt RNAs found in conifers may help to maintain organization of their unusually large genomes.
International Nuclear Information System (INIS)
Ji, Guoping; Liu, Dongxu; Liu, Jing; Gao, Hui; Yuan, Xiao; Shen, Gang
2010-01-01
p38 MAPK and nuclear factor-B (NF-B) signaling pathways play an indispensable role in the control of skeletal myogenesis. The specific contribution of these signaling pathways to the response of myoblast to the mechanical stimulation and the molecular mechanisms underlying this response remain unresolved. Using an established in vitro model, we now show that p38 MAP kinase activity regulates the transcriptional activation of NF-κB in response to mechanical stimulation of myoblasts. Furthermore, SB203580 blocked stretch-induced NF-κB activation during myogenesis, not through down-regulation of degradation of IκB-α, and consequent translocation of the p65 subunit of NF-κB to the nucleus. It is likely that stretch-induced NF-κB activation by phosphorylation of p65 NF-κB. Moreover, depletion of p38α using siRNA significantly reduces stretch-induced phosphorylation of RelA and NF-κB activity. These results provides the first evidence of a cross-talk between p38 MAPK and NF-κB signaling pathways during stretch-induced myogenesis, with phosphorylation of RelA being one of the effectors of this promyogenic mechanism. The α isoform of p38MAP kinase regulates the transcriptional activation of NF-κB following stimulation with cyclic stretch.
Energy Technology Data Exchange (ETDEWEB)
Ji, Guoping [Department of Orthodontics, College of Stomatology, Ninth People' s Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai Research Institute of Stomatology, Shanghai 200011 (China); Liu, Dongxu [Department of Orthodontics, College of Stomatology, Shandong University, Jinan, Shandong Province 250012 (China); Liu, Jing [Department of Orthodontics, The Affiliated Qingdao Municipal Hospital, Qingdao University, Qingdao, Shandong Province 266075 (China); Gao, Hui [Department of Orthodontics, Tianjin Stomatological Hospital, Tianjin 300041 (China); Yuan, Xiao, E-mail: yuanxiaoqd@163.com [Department of Orthodontics, The Affiliated Qingdao Municipal Hospital, Qingdao University, Qingdao, Shandong Province 266075 (China); Shen, Gang, E-mail: ganshen2007@163.com [Department of Orthodontics, College of Stomatology, Ninth People' s Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai Research Institute of Stomatology, Shanghai 200011 (China)
2010-01-01
p38 MAPK and nuclear factor-B (NF-B) signaling pathways play an indispensable role in the control of skeletal myogenesis. The specific contribution of these signaling pathways to the response of myoblast to the mechanical stimulation and the molecular mechanisms underlying this response remain unresolved. Using an established in vitro model, we now show that p38 MAP kinase activity regulates the transcriptional activation of NF-{kappa}B in response to mechanical stimulation of myoblasts. Furthermore, SB203580 blocked stretch-induced NF-{kappa}B activation during myogenesis, not through down-regulation of degradation of I{kappa}B-{alpha}, and consequent translocation of the p65 subunit of NF-{kappa}B to the nucleus. It is likely that stretch-induced NF-{kappa}B activation by phosphorylation of p65 NF-{kappa}B. Moreover, depletion of p38{alpha} using siRNA significantly reduces stretch-induced phosphorylation of RelA and NF-{kappa}B activity. These results provides the first evidence of a cross-talk between p38 MAPK and NF-{kappa}B signaling pathways during stretch-induced myogenesis, with phosphorylation of RelA being one of the effectors of this promyogenic mechanism. The {alpha} isoform of p38MAP kinase regulates the transcriptional activation of NF-{kappa}B following stimulation with cyclic stretch.
A Novel AT-Rich DNA Recognition Mechanism for Bacterial Xenogeneic Silencer MvaT.
Directory of Open Access Journals (Sweden)
Pengfei Ding
2015-06-01
Full Text Available Bacterial xenogeneic silencing proteins selectively bind to and silence expression from many AT rich regions of the chromosome. They serve as master regulators of horizontally acquired DNA, including a large number of virulence genes. To date, three distinct families of xenogeneic silencers have been identified: H-NS of Proteobacteria, Lsr2 of the Actinomycetes, and MvaT of Pseudomonas sp. Although H-NS and Lsr2 family proteins are structurally different, they all recognize the AT-rich DNA minor groove through a common AT-hook-like motif, which is absent in the MvaT family. Thus, the DNA binding mechanism of MvaT has not been determined. Here, we report the characteristics of DNA sequences targeted by MvaT with protein binding microarrays, which indicates that MvaT prefers binding flexible DNA sequences with multiple TpA steps. We demonstrate that there are clear differences in sequence preferences between MvaT and the other two xenogeneic silencer families. We also determined the structure of the DNA-binding domain of MvaT in complex with a high affinity DNA dodecamer using solution NMR. This is the first experimental structure of a xenogeneic silencer in complex with DNA, which reveals that MvaT recognizes the AT-rich DNA both through base readout by an "AT-pincer" motif inserted into the minor groove and through shape readout by multiple lysine side chains interacting with the DNA sugar-phosphate backbone. Mutations of key MvaT residues for DNA binding confirm their importance with both in vitro and in vivo assays. This novel DNA binding mode enables MvaT to better tolerate GC-base pair interruptions in the binding site and less prefer A tract DNA when compared to H-NS and Lsr2. Comparison of MvaT with other bacterial xenogeneic silencers provides a clear picture that nature has evolved unique solutions for different bacterial genera to distinguish foreign from self DNA.
Tacit Authorization : A Legal Solution for Administrative Silence
Hoogstra, Nicole; de Graaf, K.J.
2016-01-01
This article discusses one of the current legal instruments to stimulate timely decision-making by administrative authorities, namely the ‘Lex silencio positivo’ or the ‘Silence is Consent’ rule. Tacit authorization prescribes that the license sought by the applicant will be granted automatically if
The Shadow of Silence on the Sexual Rights of Married Iranian Women
Directory of Open Access Journals (Sweden)
Roksana Janghorban
2015-01-01
Full Text Available There has been a recent shift in the field of sexual health, representing a move away from biomedical concerns to sexual rights frameworks. However, few studies on sexuality are based on a rights framework. The unspoken nature of sexuality in Iranian culture has led to a lack of national studies on the topic. The objective of this study was to explore the perceptions and experiences of married Iranian women on sexual rights in their sexual relationships. In this grounded theory study, 37 participants (25 married women, 5 husbands, and 7 midwives were selected. Data were collected through in-depth interviews and analyzed through open, axial, and selective coding using MAXQDA software version 2007. The analysis revealed the core category of “sexual interaction in the shadow of silence.” The interrelated categories subsumed under the core category included adopting a strategy of silence, trying to negotiate sex, seeking help, and sexual adjustment. The silence originating from women’s interactions with their families and society, from girlhood to womanhood, was identified as the core concept in Iranian women’s experiences of sexual rights. A focus on husbands’ roles seems salient because they can direct or alter some learned feminine roles, especially silence regarding sexual matters, which then affects the realization of women’s sexual rights.
PhCESA3 silencing inhibits elongation and stimulates radial expansion in petunia.
Yang, Weiyuan; Cai, Yuanping; Hu, Li; Wei, Qian; Chen, Guoju; Bai, Mei; Wu, Hong; Liu, Juanxu; Yu, Yixun
2017-02-02
Cellulose synthase catalytic subunits (CESAs) play important roles in plant growth, development and disease resistance. Previous studies have shown an essential role of Arabidopsis thaliana CESA3 in plant growth. However, little is known about the role of CESA3 in species other than A. thaliana. To gain a better understanding of CESA3, the petunia (Petunia hybrida) PhCESA3 gene was isolated, and the role of PhCESA3 in plant growth was analyzed in a wide range of plants. PhCESA3 mRNA was present at varying levels in tissues examined. VIGS-mediated PhCESA3 silencing resulted in dwarfing of plant height, which was consistent with the phenotype of the A. thaliana rsw1 mutant (a temperature-sensitive allele of AtCESA1), the A. thaliana cev1 mutant (the AtCESA3 mild mutant), and the antisense AtCESA3 line. However, PhCESA3 silencing led to swollen stems, pedicels, filaments, styles and epidermal hairs as well as thickened leaves and corollas, which were not observed in the A. thaliana cev1 mutant, the rsw1 mutant and the antisense AtCESA3 line. Further micrographs showed that PhCESA3 silencing reduced the length and increased the width of cells, suggesting that PhCESA3 silencing inhibits elongation and stimulates radial expansion in petunia.
Uudised : Rannap sai raha lõpuks kätte. No Big Silence esitleb uut heliplaati
2000-01-01
Pärnus toimunud lühima öö laulukonkursil võitis peaauhinna R. Rannap. Ans. No-Big-Silence on soojendusbändiks 2. juulil Tallinna Lauluväljakul toimuval Iron Maideni kontserdil. Ans. No-Big-Silence esitleb oma uut heliplaati "successful, bitch and beautiful"
Directory of Open Access Journals (Sweden)
Yixiang Han
Full Text Available RNA-binding protein Musashi-2 (Msi2 is known to play a critical role in leukemogenesis and contributes to poor clinical prognosis in acute myeloid leukemia (AML. However, the effect of Msi2 silencing on treatment for AML still remains poorly understood. In this study, we used lentivirus-mediated RNA interference targeting Msi2 to investigate the resulting changes in cellular processes and the underlying mechanisms in AML cell lines as well as primary AML cells isolated from AML patients. We found that Msi2 was highly expressed in AML cells, and its depletion inhibited Ki-67 expression and resulted in decreased in vitro and in vivo proliferation. Msi2 silencing induced cell cycle arrest in G0/G1 phase, with decreased Cyclin D1 and increased p21 expression. Msi2 silencing induced apoptosis through down-regulation of Bcl-2 expression and up-regulation of Bax expression. Suppression of Akt, Erk1/2 and p38 phosphorylation also contributed to apoptosis mediated by Msi2 silencing. Finally, Msi2 silencing in AML cells also enhanced their chemosensitivity to daunorubicin. Conclusively, our data suggest that Msi2 is a promising target for gene therapy to optimize conventional chemotherapeutics in AML treatment.
Exposure to low doses (20 cGy) of Hze results in spatial memory impairment in rats.
Britten, Richard; Johnson, Angela; Davis, Leslie; Green-Mitchell, Shamina; Chabriol, Olivia; Sanford, Larry; Drake, Richard
INTRODUCTION. Current models predict that the astronauts on a mission to a deep space destination, such as Mars, will be exposed to 25 cGy of Galactic cosmic radiation (GCR). The long-term consequence of exposure to such doses is largely unknown, but given that 1.3 Gy of X-rays has been reported to lead to long-term cognitive deficits (Shore et al, 1976) and that CGR have an RBE of 2-5, it is likely that the predicted 25 cGy of GCR will lead to defects in the cognitive ability of the astronauts during and after the mission. Our studies are designed to help define the GCR dose that will lead to defects in complex working memory, and also to elucidate the mechanisms whereby hadronic radiation diminishes neurocognitive function. The identification of such processes would provide an opportunity for post-mission surveillance, and hopefully will lead to intervention strategies that will ameliorate or attenuate GCR-induced neurocognitive deficits. MATERIALS METHODS. Four-week old male Wistar rats were exposed to either X-rays or 1 GeV 56Fe. At three or six months post exposure the performance of the rats in the Barnes' Maze (Spatial memory) was established. The duration and frequency of REM sleep was also monitored to determine if the neurocognitive deficits arose due to reduced memory consolidation as a result of diminished REM sleep. We used a novel, but maturing technique, called MALDI-MS imaging (or MALDI-MSI), to identify specific regions of the brain where the neuroproteome differs in rats that have developed spatial memory impairments. RESULTS. 11.5 Gy of X-rays led to reduced performance in the Barnes's maze. In contrast, exposure to 20 cGy of Hze (1 GeV 56Fe) resulted in a significant impairment of spatial memory performance as measured in the Barnes' Maze, which was manifested by an increase in relative escape latency REL over a 5 day testing period. Such an increase in REL could arise from the rats becoming less able, or perhaps less willing, to locate the
What does it take to break the silence in teams: Authentic leadership or proactive followership?
Günter, Hannes; Schreurs, Bert; van Emmerik, Hetty; Sun, Shuhua
2017-01-01
Leadership may help break the silence in teams, but this may not be equally true for all employees. Using behavioral plasticity theory, we propose that authentic leadership—a set of leadership behaviors through which leaders enact their true selves—reduces silence and motivates speaking up in
LNA-antisense rivals siRNA for gene silencing
DEFF Research Database (Denmark)
Jepsen, Jan Stenvang; Wengel, Jesper; Stenvang, Jan
2004-01-01
Locked nucleic acid (LNA) is a class of nucleic acid analogs possessing unprecedented binding affinity toward complementary DNA and RNA while obeying the Watson-Crick base-pairing rules. For efficient gene silencing in vitro and in vivo, fully modified or chimeric LNA oligonucleotides have been a...
Resounding Silences : Subtle Norm Regulation in Everyday Interactions
Koudenburg, Namkje; Postmes, Tom; Gordijn, Ernestine H.
In this article we suggest a mechanism for norm regulation that does not rely on explicit information exchange or costly reinforcement, but rather on the sensitivity of group members to social cues in their environment. We examine whether brief conversational silences can (a) signal a threat to
Lu, Xingwen; Ning, Xun-An; Chen, Da; Chuang, Kui-Hao; Shih, Kaimin; Wang, Fei
2018-06-01
This study quantitatively determined the extraction of lead from CRT funnel glass and examined the mechanisms of thermally reducing lead in the products of sintering Pb-glass with carbon in the pre-heated furnace. The experimentally derived results indicate that a 90.3 wt% lead extraction efficiency can be achieved with 20 wt% of C addition at 950 °C for 3 min under air. The formation of viscous semi-liquid glass blocked the oxygen supply between the interaction of C and Pb-glass, and was highly effective for the extraction of metallic Pb. A maximum of 87.3% lead recover was obtained with a C to Na 2 CO 3 ratio of 1/3 at 1200 °C. The decrease of C/Na 2 CO 3 ratio enhanced the metallic lead recovery by increasing the glass viscosity for effective sedimentation of metallic lead in the bottom. However, with the further increase of temperature and treatment time, re-vitrification of lead back to silicate-glass matrix was detected in both Pb-glass/C and Pb-glass/C/Na 2 CO 3 systems. The findings indicated that with proper controls, using C as an inexpensive reagent can effectively reduce treatment time and energy, which is crucial to a waste-to-resource technology for economically recovering lead from the waste CRT glass. Copyright © 2018 Elsevier Ltd. All rights reserved.
Systemic RNAi-mediated Gene Silencing in Nonhuman Primate and Rodent Myeloid Cells
Directory of Open Access Journals (Sweden)
Tatiana I Novobrantseva
2012-01-01
Full Text Available Leukocytes are central regulators of inflammation and the target cells of therapies for key diseases, including autoimmune, cardiovascular, and malignant disorders. Efficient in vivo delivery of small interfering RNA (siRNA to immune cells could thus enable novel treatment strategies with broad applicability. In this report, we develop systemic delivery methods of siRNA encapsulated in lipid nanoparticles (LNP for durable and potent in vivo RNA interference (RNAi-mediated silencing in myeloid cells. This work provides the first demonstration of siRNA-mediated silencing in myeloid cell types of nonhuman primates (NHPs and establishes the feasibility of targeting multiple gene targets in rodent myeloid cells. The therapeutic potential of these formulations was demonstrated using siRNA targeting tumor necrosis factor-α (TNFα which induced substantial attenuation of disease progression comparable to a potent antibody treatment in a mouse model of rheumatoid arthritis (RA. In summary, we demonstrate a broadly applicable and therapeutically relevant platform for silencing disease genes in immune cells.
Epigenetic silencing of nucleolar rRNA genes in Alzheimer's disease.
Directory of Open Access Journals (Sweden)
Maciej Pietrzak
Full Text Available Ribosomal deficits are documented in mild cognitive impairment (MCI, which often represents an early stage Alzheimer's disease (AD, as well as in advanced AD. The nucleolar rRNA genes (rDNA, transcription of which is critical for ribosomal biogenesis, are regulated by epigenetic silencing including promoter CpG methylation.To assess whether CpG methylation of the rDNA promoter was dysregulated across the AD spectrum, we analyzed brain samples from 10 MCI-, 23 AD-, and, 24 age-matched control individuals using bisulfite mapping. The rDNA promoter became hypermethylated in cerebro-cortical samples from MCI and AD groups. In parietal cortex, the rDNA promoter was hypermethylated more in MCI than in advanced AD. The cytosine methylation of total genomic DNA was similar in AD, MCI, and control samples. Consistent with a notion that hypermethylation-mediated silencing of the nucleolar chromatin stabilizes rDNA loci, preventing their senescence-associated loss, genomic rDNA content was elevated in cerebrocortical samples from MCI and AD groups.In conclusion, rDNA hypermethylation could be a new epigenetic marker of AD. Moreover, silencing of nucleolar chromatin may occur during early stages of AD pathology and play a role in AD-related ribosomal deficits and, ultimately, dementia.
Sumoylation of Sir2 differentially regulates transcriptional silencing in yeast.
Hannan, Abdul; Abraham, Neethu Maria; Goyal, Siddharth; Jamir, Imlitoshi; Priyakumar, U Deva; Mishra, Krishnaveni
2015-12-02
Silent information regulator 2 (Sir2), the founding member of the conserved sirtuin family of NAD(+)-dependent histone deacetylase, regulates several physiological processes including genome stability, gene silencing, metabolism and life span in yeast. Within the nucleus, Sir2 is associated with telomere clusters in the nuclear periphery and rDNA in the nucleolus and regulates gene silencing at these genomic sites. How distribution of Sir2 between telomere and rDNA is regulated is not known. Here we show that Sir2 is sumoylated and this modification modulates the intra-nuclear distribution of Sir2. We identify Siz2 as the key SUMO ligase and show that multiple lysines in Sir2 are subject to this sumoylation activity. Mutating K215 alone counteracts the inhibitory effect of Siz2 on telomeric silencing. SUMO modification of Sir2 impairs interaction with Sir4 but not Net1 and, furthermore, SUMO modified Sir2 shows predominant nucleolar localization. Our findings demonstrate that sumoylation of Sir2 modulates distribution between telomeres and rDNA and this is likely to have implications for Sir2 function in other loci as well. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Miller, Robert James; Goddard, Roger D.; Kim, Minjung; Jacob, Robin; Goddard, Yvonne; Schroeder, Patricia
2016-01-01
Purpose: This multiyear experimental study was designed to examine (1) the causal impact of McREL International's Balanced Leadership® Professional Development (BLPD) program on school principals' learning, beliefs, and behaviors and (2) whether there were differences in the types of outcomes the professional development influenced. Outcomes…
Sidorenko, Lyudmila; Dorweiler, Jane E; Cigan, A Mark; Arteaga-Vazquez, Mario; Vyas, Meenal; Kermicle, Jerry; Jurcin, Diane; Brzeski, Jan; Cai, Yu; Chandler, Vicki L
2009-11-01
Paramutation involves homologous sequence communication that leads to meiotically heritable transcriptional silencing. We demonstrate that mop2 (mediator of paramutation2), which alters paramutation at multiple loci, encodes a gene similar to Arabidopsis NRPD2/E2, the second-largest subunit of plant-specific RNA polymerases IV and V. In Arabidopsis, Pol-IV and Pol-V play major roles in RNA-mediated silencing and a single second-largest subunit is shared between Pol-IV and Pol-V. Maize encodes three second-largest subunit genes: all three genes potentially encode full length proteins with highly conserved polymerase domains, and each are expressed in multiple overlapping tissues. The isolation of a recessive paramutation mutation in mop2 from a forward genetic screen suggests limited or no functional redundancy of these three genes. Potential alternative Pol-IV/Pol-V-like complexes could provide maize with a greater diversification of RNA-mediated transcriptional silencing machinery relative to Arabidopsis. Mop2-1 disrupts paramutation at multiple loci when heterozygous, whereas previously silenced alleles are only up-regulated when Mop2-1 is homozygous. The dramatic reduction in b1 tandem repeat siRNAs, but no disruption of silencing in Mop2-1 heterozygotes, suggests the major role for tandem repeat siRNAs is not to maintain silencing. Instead, we hypothesize the tandem repeat siRNAs mediate the establishment of the heritable silent state-a process fully disrupted in Mop2-1 heterozygotes. The dominant Mop2-1 mutation, which has a single nucleotide change in a domain highly conserved among all polymerases (E. coli to eukaryotes), disrupts both siRNA biogenesis (Pol-IV-like) and potentially processes downstream (Pol-V-like). These results suggest either the wild-type protein is a subunit in both complexes or the dominant mutant protein disrupts both complexes. Dominant mutations in the same domain in E. coli RNA polymerase suggest a model for Mop2-1 dominance
PCA3 Silencing Sensitizes Prostate Cancer Cells to Enzalutamide-mediated Androgen Receptor Blockade.
Özgür, Emre; Celik, Ayca Iribas; Darendeliler, Emin; Gezer, Ugur
2017-07-01
Prostate cancer (PCa) is an androgen-dependent disease. Novel anti-androgens (i.e. enzalutamide) have recently been developed for the treatment of patients with metastatic castration-resistant prostate cancer (CRPC). Evidence is accumulating that prostate cancer antigen 3 (PCA3) is involved in androgen receptor (AR) signaling. Here, in combination with enzalutamide-mediated AR blockade, we investigated the effect of PCA3 targeting on the viability of PCa cells. In hormone-sensitive LNCaP cells, AR-overexpressing LNCaP-AR + cells and VCaP cells (representing CRPC), PCA3 was silenced using siRNA oligonucleotides. Gene expression and cell viability was assessed in PCA3-silenced and/or AR-blocked cells. PCA3 targeting reduced the expression of AR-related genes (i.e. prostate-specific antigen (PSA) and prostate-specific transcript 1 (non-protein coding) (PCGEM1)) and potentiated the effect of enzalutamide. Proliferation of PCa cells was suppressed upon PCA3 silencing with a greater effect in LNCaP-AR + cells. Furthermore, PCA3 silencing sensitized PCa cells to enzalutamide-induced loss of cell growth. PCA3, as a therapeutic target in PCa, might be used to potentiate AR antagonists. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Directory of Open Access Journals (Sweden)
Pizzichini Daniele
2007-03-01
Full Text Available Abstract Background Beta-carotene is the main dietary precursor of vitamin A. Potato tubers contain low levels of carotenoids, composed mainly of the xanthophylls lutein (in the beta-epsilon branch and violaxanthin (in the beta-beta branch. None of these carotenoids have provitamin A activity. We have previously shown that tuber-specific silencing of the first step in the epsilon-beta branch, LCY-e, redirects metabolic flux towards beta-beta carotenoids, increases total carotenoids up to 2.5-fold and beta-carotene up to 14-fold. Results In this work, we silenced the non-heme beta-carotene hydroxylases CHY1 and CHY2 in the tuber. Real Time RT-PCR measurements confirmed the tuber-specific silencing of both genes . CHY silenced tubers showed more dramatic changes in carotenoid content than LCY-e silenced tubers, with beta-carotene increasing up to 38-fold and total carotenoids up to 4.5-fold. These changes were accompanied by a decrease in the immediate product of beta-carotene hydroxylation, zeaxanthin, but not of the downstream xanthophylls, viola- and neoxanthin. Changes in endogenous gene expression were extensive and partially overlapping with those of LCY-e silenced tubers: CrtISO, LCY-b and ZEP were induced in both cases, indicating that they may respond to the balance between individual carotenoid species. Conclusion Together with epsilon-cyclization of lycopene, beta-carotene hydroxylation is another regulatory step in potato tuber carotenogenesis. The data are consistent with a prevalent role of CHY2, which is highly expressed in tubers, in the control of this step. Combination of different engineering strategies holds good promise for the manipulation of tuber carotenoid content.
Breaking Classroom Silences: A View from Linguistic Ethnography
Rampton, Ben; Charalambous, Constadina
2016-01-01
This paper addresses potentially problematic classroom episodes in which someone foregrounds a social division that is normally taken for granted. It illustrates the way in which linguistic ethnography can unpack the layered processes that collide in the breaking of silence, showing how linguistic form and practice, individual positioning, local…
Breaking the Silence Surrounding Mental Health on Campus
Roper, Larry D.
2013-01-01
Mentally ill students are able to participate in higher education at unprecedented rates. While colleges and universities have been responsive to the therapeutic needs, we have failed to successfully create supportive campus climates. Campus leaders are challenged to demonstrate ethical leadership that breaks the silence and confronts the stigma…
An intronic microRNA silences genes that are functionally antagonistic to its host gene.
Barik, Sailen
2008-09-01
MicroRNAs (miRNAs) are short noncoding RNAs that down-regulate gene expression by silencing specific target mRNAs. While many miRNAs are transcribed from their own genes, nearly half map within introns of 'host' genes, the significance of which remains unclear. We report that transcriptional activation of apoptosis-associated tyrosine kinase (AATK), essential for neuronal differentiation, also generates miR-338 from an AATK gene intron that silences a family of mRNAs whose protein products are negative regulators of neuronal differentiation. We conclude that an intronic miRNA, transcribed together with the host gene mRNA, may serve the interest of its host gene by silencing a cohort of genes that are functionally antagonistic to the host gene itself.
Development of a virus-induced gene silencing (VIGS) system for Spinacia oleracea L
DEFF Research Database (Denmark)
Lee, Jungmin; Cao, Dang Viet; Kim, Jiwon
2017-01-01
Virus-induced gene silencing (VIGS) is known as a rapid and efficient system for studying functions of interesting genes in plants. Tobacco rattle virus (TRV) is widely applied for the gene silencing of many plants. Although spinach is a TRV-susceptible plant, a TRV-based VIGS system has not yet ...
Fitzgerald, A.; Kan, van J.A.L.; Plummer, K.M.
2004-01-01
RNA-mediated gene silencing has been demonstrated in plants, animals, and more recently in filamentous fungi. Here, we report high frequency, RNA-mediated gene silencing in the apple scab fungus, Venturia inaequalis. The green fluorescent protein (GFP) transgene was silenced in a GFP-expressing
Underground laboratories: Cosmic silence, loud science
Energy Technology Data Exchange (ETDEWEB)
Coccia, Eugenio, E-mail: coccia@lngs.infn.i [Department of Physics, University of Rome ' Tor Vergata' and INFN Gran Sasso National Laboratory (Italy)
2010-01-01
Underground laboratories provide the low radioactive background environment necessary to host key experiments in the field of particle and astroparticle physics, nuclear astrophysics and other disciplines that can profit of their characteristics and of their infrastructures. The cosmic silence condition existing in these laboratories allows the search for extremely rare phenomena and the exploration of the highest energy scales that cannot be reached with accelerators. I briefly describe all the facilities that are presently in operation around the world.
Yu, Li; Sun, Yifan; Li, Jingjing; Wang, Yan; Zhu, Yuxing; Shi, Yong; Fan, Xiaojun; Zhou, Jianda; Bao, Ying; Xiao, Jie; Cao, Ke; Cao, Peiguo
2017-08-15
Radiotherapy has been used increasingly to treat primary hepatocellular carcinoma. Clinically, the main cause of radiotherapy failure is cellular radioresistance, conferred via glycolytic metabolism. Our previous study demonstrated that Girdin is upregulated in primary hepatocellular carcinoma and promotes the invasion and metastasis of tumor cells. However, whether Girdin underlies the radio-sensitivity of hepatocellular carcinoma remains unclear. A short hairpin RNA (shRNA) was used to silence CCDC88A (encoding Girdin), and real-time PCR was performed to determine CCDC88A mRNA expression. Then, cell proliferation, colony formation, flow cytometric, scratch, and transwell assays were to examine the influence of Girdin silencing on cellular radiosensitivity. Glycolysis assays were conducted to exam cell glycolysis process. Western blotting was performed to explore the signaling pathway downstream of Girdin. Finally, animal experiments were performed to demonstrate the effect of CCDC88A silencing on the radiosensitivity of hepatoma in vivo. shRNA-induced Girdin silencing suppressed glycolysis and enhanced the radio-sensitivity of hepatic cell lines, HepG2 and Huh-7. Furthermore, silencing of Girdin inhibited the PI3K/AKT/HIF-1α signaling pathway, which is a central regulator of glycolysis. Girdin can regulate glycolysis in hepatocellular carcinoma cells through the PI3K/AKT/HIF-1α signaling pathway, which decreases the sensitivity of tumor cells to radiotherapy.
McClure, Julie M; Gallo, Christopher M; Smith, Daniel L; Matecic, Mirela; Hontz, Robert D; Buck, Stephen W; Racette, Frances G; Smith, Jeffrey S
2008-10-01
The histone deacetylase activity of Sir2p is dependent on NAD(+) and inhibited by nicotinamide (NAM). As a result, Sir2p-regulated processes in Saccharomyces cerevisiae such as silencing and replicative aging are susceptible to alterations in cellular NAD(+) and NAM levels. We have determined that high concentrations of NAM in the growth medium elevate the intracellular NAD(+) concentration through a mechanism that is partially dependent on NPT1, an important gene in the Preiss-Handler NAD(+) salvage pathway. Overexpression of the nicotinamidase, Pnc1p, prevents inhibition of Sir2p by the excess NAM while maintaining the elevated NAD(+) concentration. This growth condition alters the epigenetics of rDNA silencing, such that repression of a URA3 reporter gene located at the rDNA induces growth on media that either lacks uracil or contains 5-fluoroorotic acid (5-FOA), an unusual dual phenotype that is reminiscent of telomeric silencing (TPE) of URA3. Despite the similarities to TPE, the modified rDNA silencing phenotype does not require the SIR complex. Instead, it retains key characteristics of typical rDNA silencing, including RENT and Pol I dependence, as well as a requirement for the Preiss-Handler NAD(+) salvage pathway. Exogenous nicotinamide can therefore have negative or positive impacts on rDNA silencing, depending on the PNC1 expression level.
Interplays between soil-borne plant viruses and RNA silencing-mediated antiviral defense in roots
Directory of Open Access Journals (Sweden)
Ida Bagus Andika
2016-09-01
Full Text Available Although the majority of plant viruses are transmitted by arthropod vectors and invade the host plants through the aerial parts, there is a considerable number of plant viruses that infect roots via soil-inhabiting vectors such as plasmodiophorids, chytrids, and nematodes. These soil-borne viruses belong to diverse families, and many of them cause serious diseases in major crop plants. Thus, roots are important organs for the life cycle of many viruses. Compared to shoots, roots have a distinct metabolism and particular physiological characteristics due to the differences in development, cell composition, gene expression patterns, and surrounding environmental conditions. RNA silencing is an important innate defense mechanism to combat virus infection in plants, but the specific information on the activities and molecular mechanism of RNA silencing-mediated viral defense in root tissue is still limited. In this review, we summarize and discuss the current knowledge regarding RNA silencing aspects of the interactions between soil-borne viruses and host plants. Overall, research evidence suggests that soil-borne viruses have evolved to adapt to the distinct mechanism of antiviral RNA silencing in roots.
Silence and Memories of War: An Autoethnographic Exploration of Family Secrecy.
Rober, Peter; Rosenblatt, Paul C
2017-03-01
A personal journey and a scientific challenge, this is an autoethnographic study about my own family's secrecy. I knew my grandfather had been a German prisoner of war during World War II. We all knew. But nobody talked about it. Then one day I decided I wanted to do systematic research on the issue of family secrecy around my grandfather's war experiences. Researching one's own family can be called autoethnography. It could be said that autoethnography is an approach to research that aims to describe and systemically analyze (graphy) personal experience (auto) to understand social and cultural phenomena (ethno). This scientific approach is quite new in the field of family therapy. This study has been an important personal quest, but it also led to important reflections on silences in families, on my own professional development, and on methodological issues concerning autoethnographical research. For one thing, it highlights some of the positive aspects of family secrecy and silences, and invites us-when confronted with family secrecy in clinical practice-to carefully consider the potential destructive and life-giving aspects of the silence. © 2015 Family Process Institute.
47 CFR 80.304 - Watch requirement during silence periods.
2010-10-01
....304 Section 80.304 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) SAFETY AND SPECIAL RADIO SERVICES STATIONS IN THE MARITIME SERVICES Safety Watch Requirements and Procedures Ship Station Safety Watches § 80.304 Watch requirement during silence periods. Each ship station operating on...
Vetukuri, Ramesh R; Tian, Zhendong; Avrova, Anna O; Savenkov, Eugene I; Dixelius, Christina; Whisson, Stephen C
2011-12-01
Phytophthora infestans is the notorious oomycete causing late blight of potato and tomato. A large proportion of the P. infestans genome is composed of transposable elements, the activity of which may be controlled by RNA silencing. Accumulation of small RNAs is one of the hallmarks of RNA silencing. Here we demonstrate the presence of small RNAs corresponding to the sequence of a short interspersed retrotransposable element (SINE) suggesting that small RNAs might be involved in silencing of SINEs in P. infestans. This notion was exploited to develop novel tools for gene silencing in P. infestans by engineering transcriptional fusions of the PiAvr3a gene, encoding an RXLR avirulence effector, to the infSINEm retroelement. Transgenic P. infestans lines expressing either 5'-infSINEm::PiAvr3a-3' or 5'-PiAvr3a::SINEm-3' chimeric transcripts initially exhibited partial silencing of PiAvr3a. Over time, PiAvr3a either recovered wild type transcript levels in some lines, or became fully silenced in others. Introduction of an inverted repeat construct was also successful in yielding P. infestans transgenic lines silenced for PiAvr3a. In contrast, constructs expressing antisense or aberrant RNA transcripts failed to initiate silencing of PiAvr3a. Lines exhibiting the most effective silencing of PiAvr3a were either weakly or non-pathogenic on susceptible potato cv. Bintje. This study expands the repertoire of reverse genetics tools available for P. infestans research, and provides insights into a possible mode of variation in effector expression through spread of silencing from adjacent retroelements. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.
Cummings, A.; Chang, I.-J.
1988-11-01
Internal mean flow within the pores of a bulk-reacting porous acoustic absorbent, driven by mean static pressure gradients, is shown here to be an important feature of the acoustics of dissipative silencers in flow ducts, particularly in the case of internal combustion engine exhaust silencers. Theoretical treatments are presented here, both to describe the effect of internal flow on the bulk acoustic perties of the porous medium and to find the effect of the absorbent in situ, in the form of the sound transmission loss of the silencer. The measured transmission loss of an experimental silencer is compared to predicted data and good agreement between the two is obtained. The effects of mean fluid flow in the central passage and internal flow in the absorbent are separately demonstrated.
Moll, Sandra E; Patten, Scott; Stuart, Heather; MacDermid, Joy C; Kirsh, Bonnie
2018-01-01
This study sought to evaluate whether a contact-based workplace education program was more effective than standard mental health literacy training in promoting early intervention and support for healthcare employees with mental health issues. A parallel-group, randomised trial was conducted with employees in 2 multi-site Ontario hospitals with the evaluators blinded to the groups. Participants were randomly assigned to 1 of 2 group-based education programs: Beyond Silence (comprising 6 in-person, 2-h sessions plus 5 online sessions co-led by employees who personally experienced mental health issues) or Mental Health First Aid (a standardised 2-day training program led by a trained facilitator). Participants completed baseline, post-group, and 3-mo follow-up surveys to explore perceived changes in mental health knowledge, stigmatized beliefs, and help-seeking/help-outreach behaviours. An intent-to-treat analysis was completed with 192 participants. Differences were assessed using multi-level mixed models accounting for site, group, and repeated measurement. Neither program led to significant increases in help-seeking or help-outreach behaviours. Both programs increased mental health literacy, improved attitudes towards seeking treatment, and decreased stigmatized beliefs, with sustained changes in stigmatized beliefs more prominent in the Beyond Silence group. Beyond Silence, a new contact-based education program customised for healthcare workers was not superior to standard mental health literacy training in improving mental health help-seeking or help-outreach behaviours in the workplace. The only difference was a reduction in stigmatized beliefs over time. Additional research is needed to explore the factors that lead to behaviour change.
Directory of Open Access Journals (Sweden)
Takanori Kanazawa
2015-09-01
Full Text Available The small interfering RNA (siRNA is suggested to offer a novel means of treating atopic dermatitis (AD because it allows the specific silencing of genes related to AD pathogenesis. In our previous study, we found that siRNA targeted against RelA, an important nuclear factor-kappa B (NF-κB subdomain, with functional peptides, showed therapeutic effects in a mouse model of AD. In the present study, to develop a topical skin application against AD, we prepared a hydrogel containing anti-RelA siRNA and functional peptides and determined the intradermal permeation and the anti-AD effects in an AD mouse model. We selected the silk protein, sericin (SC, which is a versatile biocompatible biomaterial to prepare hydrogel as an aqueous gel base. We found that the siRNA was more widely delivered to the site of application in AD-induced ear skin of mice after topical application via the hydrogel containing functional peptides than via the preparation without functional peptides. In addition, the ear thickness and clinical skin severity of the AD-induced mice treated with hydrogel containing anti-RelA siRNA with functional peptides improved more than that of mice treated with the preparation formulated with negative siRNA.
Deletion of an X-inactivation boundary disrupts adjacent gene silencing.
Directory of Open Access Journals (Sweden)
Lindsay M Horvath
2013-11-01
Full Text Available In mammalian females, genes on one X are largely silenced by X-chromosome inactivation (XCI, although some "escape" XCI and are expressed from both Xs. Escapees can closely juxtapose X-inactivated genes and provide a tractable model for assessing boundary function at epigenetically regulated loci. To delimit sequences at an XCI boundary, we examined female mouse embryonic stem cells carrying X-linked BAC transgenes derived from an endogenous escape locus. Previously we determined that large BACs carrying escapee Kdm5c and flanking X-inactivated transcripts are properly regulated. Here we identify two lines with truncated BACs that partially and completely delete the distal Kdm5c XCI boundary. This boundary is not required for escape, since despite integrating into regions that are normally X inactivated, transgenic Kdm5c escapes XCI, as determined by RNA FISH and by structurally adopting an active conformation that facilitates long-range preferential association with other escapees. Yet, XCI regulation is disrupted in the transgene fully lacking the distal boundary; integration site genes up to 350 kb downstream of the transgene now inappropriately escape XCI. Altogether, these results reveal two genetically separable XCI regulatory activities at Kdm5c. XCI escape is driven by a dominant element(s retained in the shortest transgene that therefore lies within or upstream of the Kdm5c locus. Additionally, the distal XCI boundary normally plays an essential role in preventing nearby genes from escaping XCI.
A poetic of silence: trauma, representation and language in Escape from Death, by Paul Celan
Directory of Open Access Journals (Sweden)
Maria Esther Torinho
2014-10-01
Paul Celan’s poem Escape from death presents situations lived by himself in a Nazi concentration camp, which inserts the poem in the context of the literature of testimony; it is a poem fulfilled with high amount of drama, in which content and structure combine to offer a dense reading, loaded with meaning. One can see, in the poem, that silence dominates the scenery, expressing, through the many gaps left by a fragmentary language, what is difficult for the poet to express, the feelings which are impossible to talk about, what leads the reader to an astonishing feeling, making contact with the meaning only through stages and amid the gaps. This article approaches the poem starting from concepts related to Literature of testimony and the impossibility of representing the real (Roland Barthes; in what concern the formal aspects, beside the Bakhtin’s ideas about polyphony, and Barros and Fiorin’s studies about dialogism, polyphony and interdiscursivity; furthermore, starting from the musical concept of escape, as suggested by the title of the poem and highlighted in the text, we discuss figurative language – metaphor and metonymy, irony and ellipses, as the author's strategies to face the hesitation between trauma and representation so one have a silence poetic, in which the ellipses and metaphors play an essential role.
Kosanovich, Marcia; Foorman, Barbara
2016-01-01
The Regional Educational Laboratory (REL) Southeast developed a Professional Learning Community (PLC) Facilitators Guide to support educators in the implementation of recommendations from the What Works Clearinghouse's. The practice guide focuses on the foundational reading skills that enable students to read words, relate those words to their…
Fazal, Fabeha; Bijli, Kaiser M; Minhajuddin, Mohd; Rein, Theo; Finkelstein, Jacob N; Rahman, Arshad
2009-07-31
Activation of RhoA/Rho-associated kinase (ROCK) pathway and the associated changes in actin cytoskeleton induced by thrombin are crucial for activation of NF-kappaB and expression of its target gene ICAM-1 in endothelial cells. However, the events acting downstream of RhoA/ROCK to mediate these responses remain unclear. Here, we show a central role of cofilin-1, an actin-binding protein that promotes actin depolymerization, in linking RhoA/ROCK pathway to dynamic alterations in actin cytoskeleton that are necessary for activation of NF-kappaB and thereby expression of ICAM-1 in these cells. Stimulation of human umbilical vein endothelial cells with thrombin resulted in Ser(3) phosphorylation/inactivation of cofilin and formation of actin stress fibers in a ROCK-dependent manner. RNA interference knockdown of cofilin-1 stabilized the actin filaments and inhibited thrombin- and RhoA-induced NF-kappaB activity. Similarly, constitutively inactive mutant of cofilin-1 (Cof1-S3D), known to stabilize the actin cytoskeleton, inhibited NF-kappaB activity by thrombin. Overexpression of wild type cofilin-1 or constitutively active cofilin-1 mutant (Cof1-S3A), known to destabilize the actin cytoskeleton, also impaired thrombin-induced NF-kappaB activity. Additionally, depletion of cofilin-1 was associated with a marked reduction in ICAM-1 expression induced by thrombin. The effect of cofilin-1 depletion on NF-kappaB activity and ICAM-1 expression occurred downstream of IkappaBalpha degradation and was a result of impaired RelA/p65 nuclear translocation and consequently, RelA/p65 binding to DNA. Together, these data show that cofilin-1 occupies a central position in RhoA-actin pathway mediating nuclear translocation of RelA/p65 and expression of ICAM-1 in endothelial cells.
Fazal, Fabeha; Bijli, Kaiser M.; Minhajuddin, Mohd; Rein, Theo; Finkelstein, Jacob N.; Rahman, Arshad
2009-01-01
Activation of RhoA/Rho-associated kinase (ROCK) pathway and the associated changes in actin cytoskeleton induced by thrombin are crucial for activation of NF-κB and expression of its target gene ICAM-1 in endothelial cells. However, the events acting downstream of RhoA/ROCK to mediate these responses remain unclear. Here, we show a central role of cofilin-1, an actin-binding protein that promotes actin depolymerization, in linking RhoA/ROCK pathway to dynamic alterations in actin cytoskeleton that are necessary for activation of NF-κB and thereby expression of ICAM-1 in these cells. Stimulation of human umbilical vein endothelial cells with thrombin resulted in Ser3 phosphorylation/inactivation of cofilin and formation of actin stress fibers in a ROCK-dependent manner. RNA interference knockdown of cofilin-1 stabilized the actin filaments and inhibited thrombin- and RhoA-induced NF-κB activity. Similarly, constitutively inactive mutant of cofilin-1 (Cof1-S3D), known to stabilize the actin cytoskeleton, inhibited NF-κB activity by thrombin. Overexpression of wild type cofilin-1 or constitutively active cofilin-1 mutant (Cof1-S3A), known to destabilize the actin cytoskeleton, also impaired thrombin-induced NF-κB activity. Additionally, depletion of cofilin-1 was associated with a marked reduction in ICAM-1 expression induced by thrombin. The effect of cofilin-1 depletion on NF-κB activity and ICAM-1 expression occurred downstream of IκBα degradation and was a result of impaired RelA/p65 nuclear translocation and consequently, RelA/p65 binding to DNA. Together, these data show that cofilin-1 occupies a central position in RhoA-actin pathway mediating nuclear translocation of RelA/p65 and expression of ICAM-1 in endothelial cells. PMID:19483084
The Alternative NF-κB Pathway in Regulatory T Cell Homeostasis and Suppressive Function.
Grinberg-Bleyer, Yenkel; Caron, Rachel; Seeley, John J; De Silva, Nilushi S; Schindler, Christian W; Hayden, Matthew S; Klein, Ulf; Ghosh, Sankar
2018-04-01
CD4 + Foxp3 + regulatory T cells (Tregs) are essential regulators of immune responses. Perturbation of Treg homeostasis or function can lead to uncontrolled inflammation and autoimmunity. Therefore, understanding the molecular mechanisms involved in Treg biology remains an active area of investigation. It has been shown previously that the NF-κB family of transcription factors, in particular, the canonical pathway subunits, c-Rel and p65, are crucial for the development, maintenance, and function of Tregs. However, the role of the alternative NF-κB pathway components, p100 and RelB, in Treg biology remains unclear. In this article, we show that conditional deletion of the p100 gene, nfkb2 , in Tregs, resulted in massive inflammation because of impaired suppressive function of nfkb2 -deficient Tregs. Surprisingly, mice lacking RelB in Tregs did not exhibit the same phenotype. Instead, deletion of both relb and nfkb2 rescued the inflammatory phenotype, demonstrating an essential role for p100 as an inhibitor of RelB in Tregs. Our data therefore illustrate a new role for the alternative NF-κB signaling pathway in Tregs that has implications for the understanding of molecular pathways driving tolerance and immunity. Copyright © 2018 by The American Association of Immunologists, Inc.
Directory of Open Access Journals (Sweden)
Fangfang Li
2017-09-01
Full Text Available RNA silencing has an important role in defending against virus infection in plants. Plants with the deficiency of RNA silencing components often show enhanced susceptibility to viral infections. RNA-dependent RNA polymerase (RDRs mediated-antiviral defense has a pivotal role in resistance to many plant viruses. In RDR6-mediated defense against viral infection, a plant-specific RNA binding protein, Suppressor of Gene Silencing 3 (SGS3, was also found to fight against some viruses in Arabidopsis. In this study, we showed that SGS3 from Nicotiana benthamiana (NbSGS3 is required for sense-RNA induced post-transcriptional gene silencing (S-PTGS and initiating sense-RNA-triggered systemic silencing. Further, the deficiency of NbSGS3 inhibited geminivirus-induced endogenous gene silencing (GIEGS and promoted geminivirus infection. During TRV-mediated NbSGS3 or N. benthamiana RDR6 (NbRDR6 silencing process, we found that their expression can be effectively fine-tuned. Plants with the knock-down of both NbSGS3 and NbRDR6 almost totally blocked GIEGS, and were more susceptible to geminivirus infection. These data suggest that NbSGS3 cooperates with NbRDR6 against GIEGS and geminivirus infection in N. benthamiana, which provides valuable information for breeding geminivirus-resistant plants.
c-Myc is essential to prevent endothelial pro-inflammatory senescent phenotype.
Directory of Open Access Journals (Sweden)
Victoria Florea
Full Text Available The proto-oncogene c-Myc is vital for vascular development and promotes tumor angiogenesis, but the mechanisms by which it controls blood vessel growth remain unclear. In the present work we investigated the effects of c-Myc knockdown in endothelial cell functions essential for angiogenesis to define its role in the vasculature. We provide the first evidence that reduction in c-Myc expression in endothelial cells leads to a pro-inflammatory senescent phenotype, features typically observed during vascular aging and pathologies associated with endothelial dysfunction. c-Myc knockdown in human umbilical vein endothelial cells using lentivirus expressing specific anti-c-Myc shRNA reduced proliferation and tube formation. These functional defects were associated with morphological changes, increase in senescence-associated-β-galactosidase activity, upregulation of cell cycle inhibitors and accumulation of c-Myc-deficient cells in G1-phase, indicating that c-Myc knockdown in endothelial cells induces senescence. Gene expression analysis of c-Myc-deficient endothelial cells showed that senescent phenotype was accompanied by significant upregulation of growth factors, adhesion molecules, extracellular-matrix components and remodeling proteins, and a cluster of pro-inflammatory mediators, which include Angptl4, Cxcl12, Mdk, Tgfb2 and Tnfsf15. At the peak of expression of these cytokines, transcription factors known to be involved in growth control (E2f1, Id1 and Myb were downregulated, while those involved in inflammatory responses (RelB, Stat1, Stat2 and Stat4 were upregulated. Our results demonstrate a novel role for c-Myc in the prevention of vascular pro-inflammatory phenotype, supporting an important physiological function as a central regulator of inflammation and endothelial dysfunction.
Begeot, Flora; Koryakov, Dmitry E.; Todeschini, Anne-Laure; Ronsseray, Stéphane; Vieira, Cristina; Spierer, Pierre; Delattre, Marion
2014-01-01
Heterochromatin is made of repetitive sequences, mainly transposable elements (TEs), the regulation of which is critical for genome stability. We have analyzed the role of the heterochromatin-associated Su(var)3–7 protein in Drosophila ovaries. We present evidences that Su(var)3–7 is required for correct oogenesis and female fertility. It accumulates in heterochromatic domains of ovarian germline and somatic cells nuclei, where it co-localizes with HP1. Homozygous mutant females display ovaries with frequent degenerating egg-chambers. Absence of Su(var)3–7 in embryos leads to defects in meiosis and first mitotic divisions due to chromatin fragmentation or chromosome loss, showing that Su(var)3–7 is required for genome integrity. Females homozygous for Su(var)3–7 mutations strongly impair repression of P-transposable element induced gonadal dysgenesis but have minor effects on other TEs. Su(var)3–7 mutations reduce piRNA cluster transcription and slightly impact ovarian piRNA production. However, this modest piRNA reduction does not correlate with transposon de-silencing, suggesting that the moderate effect of Su(var)3–7 on some TE repression is not linked to piRNA production. Strikingly, Su(var)3–7 genetically interacts with the piwi and aubergine genes, key components of the piRNA pathway, by strongly impacting female fertility without impairing transposon silencing. These results lead us to propose that the interaction between Su(var)3–7 and piwi or aubergine controls important developmental processes independently of transposon silencing. PMID:24820312
Kim, Soo Gon; Jo, Yong Hun; Seong, Jeong Hwan; Park, Ki Beom; Noh, Mi Young; Cho, Jun Ho; Ko, Hye Jin; Kim, Chang Eun; Tindwa, Hamisi; Patnaik, Bharat Bhusan; Bang, In Seok; Lee, Yong Seok; Han, Yeon Soo
2017-10-01
Scavenger receptors (SRs) constitute a family of membrane-bound receptors that bind to multiple ligands. The SR family of proteins is involved in removing cellular debris, oxidized low-density lipoproteins, and pathogens. Specifically, class C scavenger receptors (SR-C) have also been reported to be involved in phagocytosis of gram-positive and -negative bacteria in Drosophila and viruses in shrimp. However, reports are unavailable regarding the role of SR-C in antifungal immune mechanisms in insects. In this study, a full-length Tenebrio molitor SR-C (TmSR-C) sequence was obtained by 5'- and 3'-Rapid amplification of cDNA ends-polymerase chain reaction (RACE-PCR). The TmSR-C full-length cDNA comprised 1671 bp with 5'- and 3'-untranslated regions of 23- and 107-bp, respectively. TmSR-C encodes a putative protein of 556 amino acid residues that is constitutively expressed in all tissues of late instar larvae and 2-day-old adults, with the highest transcript levels observed in hemocytes of larvae and adults. TmSR-C mRNA showed a 2.5-fold and 3-fold increase at 24 and 6 h after infection with Candida albicans and β-glucan, respectively. Immunoassay with TmSR-C polyclonal antibody showed induction of the putative protein in the cytosols of hemocytes at 3 h after inoculation of C. albicans. RNA interference (RNAi)-based gene silencing and phagocytosis assays were used to understand the role of TmSR-C in antifungal immunity. Silencing of TmSR-C transcripts reduced the survivability of late instar larvae at 2 days post-inoculation of C. albicans, Escherichia coli, or Staphylococcus aureus. Furthermore, in TmSR-C-silenced larvae, there was a decline in the rate of microorganism phagocytosis. Taken together, results of this study suggest that TmSR-C plays a pivotal role in phagocytosing not only fungi but also gram-negative and -positive bacteria in T. molitor. Copyright © 2017. Published by Elsevier Ltd.
Study of Baryon and Antibaryon Spectra in Lead Lead Interactions at 160 GeV/c per Nucleon
2002-01-01
% WA97 \\\\ \\\\ Hyperons are expected to be a useful probe for the dynamics of hadronic matter under extreme conditions. In particular the onset of a Quark-Gluon Plasma phase in a heavy ion collision is expected to enhance the hyperon yield with respect to normal hadronic interactions. \\\\ \\\\WA97 aims to measure the spectra of strange particles and in particular of hyperons and antihyperons produced in ultrarelativistic lead-lead interactions and to compare them with those from proton initiated reactions. The experiment covers central rapidity down to transverse momenta of a few hundred MeV/c. The experimental setup consists of: an array of multiplicity counters, a silicon based decay detector made of pixels, located in the CERN-OMEGA Spectrometer, an array of pad cathode MWPCs used as lever arm detectors and a zero degree hadron calorimeter. \\\\ \\\\
On the Threshold: Time and the Speaking Subject in Harold Pinter’s Silence
Directory of Open Access Journals (Sweden)
Beatrice Nori
2017-07-01
Full Text Available The article investigates Harold Pinter’s play Silence from a linguistic and phenomenological point of view. Silence is probably one of the least studied – though one of the most difficult and compelling – of Pinter’s plays. The author identifies the broken syntax and the combination of utterances and silences as indicators of time and space shifts. She claims that the patchwork which appears from the structure of the play depicts the loss of logic, and that the abandonment of chronological time in linguistic terms conveys the subjective, circular, and illogical element of the human experience of time. Characters’ bodies and utterances materialize both their own past recollections and their present experiences. The present work may be useful to theatre scholars as an example of drama as a portrayal of philosophical and linguistic theories about time and discourse.
Diana, Alis Nur; I’tishom, Reny; Sudjarwo, Sri Agus
2017-01-01
Lead that enters the body may lead to increased production of ROS (Reactive Oxygen Species) that may affect reproductive system. Black cumin (Nigella sativa) extract contains high antioxidant, tymoquinone, that may be used to suppress oxidative stress induced by lead in animal experiments. This study aimed to prove that black cumin (Nigella sativa) extract improves the thickness of seminiferous tubular epithelium in Balb/c mice exposed to lead (Pb) acetate. This study used post-test only cont...
García-Arenas, Guadalupe; Ramírez-Amaya, Victor; Balderas, Israela; Sandoval, Jimena; Escobar, Martha L; Ríos, Camilo; Bermúdez-Rattoni, Federico
2004-02-04
It is well known that lead can affect several cognitive abilities in developing animals. In this work, we investigate the effects of different sub-chronic lead doses (0, 65, 125, 250 and 500 ppm of lead acetate in their drinking water for 14 days) in the performance of male adult rats in a water maze, cue maze and inhibitory avoidance tasks. We found that the acquisition of these tasks was not affected by lead, however, the highest dosage of lead (500 ppm) impaired memory consolidation in spatial and inhibitory avoidance tasks, but not in cue maze task while the 250 ppm dose only affected retrieval of spatial memory. Additionally, hippocampal long-term potentiation (LTP) induction in the perforant path after exposing adult rats to different doses of lead was studied. LTP induction was affected in a dose-dependent manner, and treatments of 250 and 500 ppm completely blocked LTP. We investigated the effects of lead intoxication on the activity of constitutive nitric oxide synthase (cNOS) in different brain regions of adult animals. The activity of cNOS was significantly inhibited in the hippocampus and cerebellum but not in the frontal cortex and brain stem, although lead had accumulated in all brain regions. These results suggest that lead intoxication can impair memory in adult animals and this impairment might be related with region-specific effects on cNOS activity.
Directory of Open Access Journals (Sweden)
Satoshi Iizuka
Full Text Available Head and neck squamous cell carcinoma (HNSCC exhibits increased expression of cyclin D1 (CCND1. Previous studies have shown a correlation between poor prognosis of HNSCC and cyclin D1 overexpression. tRNase ZL-utilizing efficacious gene silencing (TRUE gene silencing is one of the RNA-mediated gene expression control technologies that have therapeutic potential. This technology is based on a unique enzymatic property of mammalian tRNase ZL, which is that it can cleave any target RNA at any desired site by recognizing a pre-tRNA-like complex formed between the target RNA and an artificial small guide RNA (sgRNA. In this study, we designed several sgRNAs targeting human cyclin D1 mRNA to examine growth inhibition of HNSCC cells. Transfection of certain sgRNAs decreased levels of cyclin D1 mRNA and protein in HSC-2 and HSC-3 cells, and also inhibited their proliferation. The combination of these sgRNAs and cisplatin showed more than additive inhibition of cancer cell growth. These findings demonstrate that TRUE gene silencing of cyclin D1 leads to inhibition of the growth of HNSCC cells and suggest that these sgRNAs alone or combined with cisplatin may be a useful new therapy for HNSCCs.
Cieplak-Rotowska, Maja K.; Tarnowski, Krzysztof; Rubin, Marcin; Fabian, Marc R.; Sonenberg, Nahum; Dadlez, Michal; Niedzwiecka, Anna
2018-01-01
The human GW182 protein plays an essential role in micro(mi)RNA-dependent gene silencing. miRNA silencing is mediated, in part, by a GW182 C-terminal region called the silencing domain, which interacts with the poly(A) binding protein and the CCR4-NOT deadenylase complex to repress protein synthesis. Structural studies of this GW182 fragment are challenging due to its predicted intrinsically disordered character, except for its RRM domain. However, detailed insights into the properties of proteins containing disordered regions can be provided by hydrogen-deuterium exchange mass spectrometry (HDX/MS). In this work, we applied HDX/MS to define the structural state of the GW182 silencing domain. HDX/MS analysis revealed that this domain is clearly divided into a natively unstructured part, including the CCR4-NOT interacting motif 1, and a distinct RRM domain. The GW182 RRM has a very dynamic structure, since water molecules can penetrate the whole domain in 2 h. The finding of this high structural dynamics sheds new light on the RRM structure. Though this domain is one of the most frequently occurring canonical protein domains in eukaryotes, these results are - to our knowledge - the first HDX/MS characteristics of an RRM. The HDX/MS studies show also that the α2 helix of the RRM can display EX1 behavior after a freezing-thawing cycle. This means that the RRM structure is sensitive to environmental conditions and can change its conformation, which suggests that the state of the RRM containing proteins should be checked by HDX/MS in regard of the conformational uniformity. [Figure not available: see fulltext.
Flachowsky, Henryk; Tränkner, Conny; Szankowski, Iris; Waidmann, Sascha; Hanke, Magda-Viola; Treutter, Dieter; Fischer, Thilo C
2012-01-01
RNA silencing describes the sequence specific degradation of RNA targets. Silencing is a non-cell autonomous event that is graft transmissible in different plant species. The present study is the first report on systemic acquired dsRNA-mediated gene silencing of transgenic and endogenous gene sequences in a woody plant like apple. Transgenic apple plants overexpressing a hairpin gene construct of the gusA reporter gene were produced. These plants were used as rootstocks and grafted with scions of the gusA overexpressing transgenic apple clone T355. After grafting, we observed a reduction of the gusA gene expression in T355 scions in vitro, but not in T355 scions grown in the greenhouse. Similar results were obtained after silencing of the endogenous Mdans gene in apple that is responsible for anthocyanin biosynthesis. Subsequently, we performed grafting experiments with Mdans silenced rootstocks and red leaf scions of TNR31-35 in order to evaluate graft transmitted silencing of the endogenous Mdans. The results obtained suggested a graft transmission of silencing signals in in vitro shoots. In contrast, no graft transmission of dsRNA-mediated gene silencing signals was detectable in greenhouse-grown plants and in plants grown in an insect protection tent.
Directory of Open Access Journals (Sweden)
Jinhuan Pang
Full Text Available Gossypiumbarbadense is a cultivated cotton species and possesses many desirable traits, including high fiber quality and resistance to pathogens, especially Verticilliumdahliae (a devastating pathogen of Gossypium hirsutum, the main cultivated species. These elite traits are difficult to be introduced into G. hirsutum through classical breeding methods. In addition, genetic transformation of G. barbadense has not been successfully performed. It is therefore important to develop methods for evaluating the function and molecular mechanism of genes in G. barbadense. In this study, we had successfully introduced a virus-induced gene silencing (VIGS system into three cultivars of G. barbadense by inserting marker genes into the tobacco rattle virus (TRV vector. After we optimized the VIGS conditions, including light intensity, photoperiod, seedling age and Agrobacterium strain, 100% of plants agroinfiltrated with the GaPDS silencing vector showed white colored leaves. Three other marker genes, GaCLA1, GaANS and GaANR, were employed to further test this VIGS system in G. barbadense. The transcript levels of the endogenous genes in the silenced plants were reduced by more than 99% compared to control plants; these plants presented phenotypic symptoms 2 weeks after inoculation. We introduced a fusing sequence fragment of GaPDS and GaANR gene silencing vectors into a single plant, which resulted in both photobleaching and brownish coloration. The extent of silencing in plants agroinfiltrated with fusing two-gene-silencing vector was consistent with plants harboring a single gene silencing vector. The development of this VIGS system should promote analysis of gene function in G. barbadense, and help to contribute desirable traits for breeding of G. barbadense and G. hirsutum.
Kosanovich, Marcia; Foorman, Barbara
2016-01-01
The Regional Educational Laboratory (REL) Southeast developed a Professional Learning Community (PLC) Facilitators Guide to support educators in the implementation of recommendations from the What Works Clearinghouse's. The practice guide focuses on the foundational reading skills that enable students to read words, relate those words to their…
Speaking of Silence: Comments from an Irish Studies Perspective
DEFF Research Database (Denmark)
McQuaid, Sara Dybris; Beville, Maria
2012-01-01
argue that silence in its own right is a unique and important route to understanding the complexities of modern Ireland in cultural, contemporary and historical terms. This is true, not least in the case of Northern Ireland where the difficult struggle to construct a unified political consciousness...
Bureaucratic Constructions of Sexual Diversity: "Sensitive", "Controversial" and Silencing
Ullman, Jacqueline; Ferfolja, Tania
2015-01-01
National research illustrates the high degree of discrimination that prevails against lesbian, gay, bisexual, transgender and queer (LGBTQ) students resulting in diminished educational outcomes, both academic and social. This phenomenon is influenced by the prevalence of whole-school silences around LGBTQ topics in many Australian schools. This…
Takahashi, Yuki; Nishikawa, Makiya; Suehara, Tetsuya; Takiguchi, Naomi; Takakura, Yoshinobu
2008-11-15
Altered expression of beta-catenin, a key component of the Wnt signaling pathway, is involved in a variety of cancers because increased levels of beta-catenin protein are frequently associated with enhanced cellular proliferation. Although our previous study demonstrated that gene silencing of beta-catenin in melanoma B16-BL6 cells by plasmid DNA (pDNA) expressing short-hairpin RNA targeting the gene (pshbeta-catenin) markedly suppressed their growth in vivo, gene silencing of beta-catenin could promote tumor metastasis by the rearranging cell adhesion complex. In this study, we investigated how silencing of beta-catenin affects metastatic aspects of melanoma cells. Transfection of B16-BL6 cells with pshbeta-catenin significantly reduced the amount of cadherin protein, a cell adhesion molecule binding to beta-catenin, with little change in its mRNA level. Cadherin-derived fragments were detected in culture media of B16-BL6 cells transfected with pshbeta-catenin, suggesting that cadherin is shed from the cell surface when the expression of beta-catenin is reduced. The mobility of B16-BL6 cells transfected with pshbeta-catenin was greater than that of cells transfected with any of the control pDNAs. B16-BL6 cells stably transfected with pshbeta-catenin (B16/pshbeta-catenin) formed less or an equal number of tumor nodules in the lung than cells stably transfected with other plasmids when injected into mice via the tail vein. However, when subcutaneously inoculated, B16/pshbeta-catenin cells formed more nodules in the lung than the other stably transfected cells. These results raise concerns about the gene silencing of beta-catenin for inhibiting tumor growth, because it promotes tumor metastasis by reducing the amount of cadherin in tumor cells. (c) 2008 Wiley-Liss, Inc.
Directory of Open Access Journals (Sweden)
Yujing YIN
2017-12-01
Full Text Available Background and objective It has been proven that circular RNAs (circRNAs play an important role on the process of many types cancer and circUBAP2 was a cancer-promoting circRNA, however, the role and mechanism in lung cancer was not clear. The aim of this study is to investigate the effects of circUBAP2 on cell proliferation and invasion of human lung cancer A549 cells. Methods CCK-8 assay was employed to detect the effect of circUBAP2 sliencing on cell proliferation of A549 cells. Fow cytometry was applied to detect the impact of circUBAP2 sliencing on cell cycle and cell anoikis, and Transwell invasion assay was applied to determine cell invasion of A549 cells. We also employed Western blot and Real-time PCR to determine the expressions of CDK6, cyclin D1, p27 and c-IAP1, Bcl-2, Survivin, Bax, FAK, Rac1 and MMP2, and the activities of JNK and ERK1/2, luciferase report gene assay was used to detect the targets. Results CCK-8 assay showed that the inhibition of cell proliferation in the circUBAP2-siRNA group compared to untreated group and siRNA control group. Results of cell cycle detected by flow cytometry showed that cell cycle arrestd at G0/G1 after circUBAP2 silencing, cell apoptosis rate increased also. We also found that after circUBAP2 silencing, cell invasion of A549 cells was significantly inhibited. Western blot and Real-time PCR results showed that expression of CDK6, cyclin D1, c-IAP1, Bcl-2, Survivin, FAK, Rac1 and MMP2 were down-regulated, and the expression of p27 and Bax were up-regulated. Moreover, the activities of JNK and ERK1/2 were inhibited because of circUBAP2 silencing, the target genes were miR-339-5p, miR-96-3p and miR-135b-3p. Conclusion CircUBAP2 plays an important role in the proliferation and invasion of human lung cancer. Silencing of circUBAP2 might be a novel target for molecular targeted therapy of patients with lung cancer.
Teacher Leadership: Teacher Self-Assessment Tool
American Institutes for Research, 2017
2017-01-01
As interest in teacher leadership has grown, many leading organizations have developed tools and guidance to support schools, districts, and teacher leaders themselves. In collaboration and consultation with the Regional Educational Laboratory (REL) Midwest Educator Effectiveness Research Alliance, REL Midwest and the Center on Great Teachers and…
Small silencing RNAs: an expanding universe.
Ghildiyal, Megha; Zamore, Phillip D
2009-02-01
Since the discovery in 1993 of the first small silencing RNA, a dizzying number of small RNA classes have been identified, including microRNAs (miRNAs), small interfering RNAs (siRNAs) and Piwi-interacting RNAs (piRNAs). These classes differ in their biogenesis, their modes of target regulation and in the biological pathways they regulate. There is a growing realization that, despite their differences, these distinct small RNA pathways are interconnected, and that small RNA pathways compete and collaborate as they regulate genes and protect the genome from external and internal threats.
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
2016-11-09
Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...
Ma, Hong-Zhen; Liu, Guo-Qin; Li, Cheng-Wei; Kang, Guo-Zhang; Guo, Tian-Cai
2012-10-05
The full-length cDNA (882bp) and DNA (1742bp) sequences encoding a basic transcription factor 3, designated as TaBTF3, were first isolated from common wheat (Triticum aestivum L.). Subcellular localization studies revealed that the TaBTF3 protein was mainly located in the cytoplasm and nucleus. In TaBTF3-silenced transgenic wheat seedlings obtained using the Virus-induced gene silencing (VIGS) method, the chlorophyll pigment content was markedly reduced. However, the malonaldehyde (MDA) and H(2)O(2) contents were enhanced, and the structure of the wheat mesophyll cell was seriously damaged. Furthermore, transcripts of the chloroplast- and mitochondrial-encoded genes were significantly reduced in TaBTF3-silenced transgenic wheat plants. These results suggest that the TaBTF3 gene might function in the development of the wheat chloroplast, mitochondria and mesophyll cell. This paper is the first report to describe the involvement of TaBTF3 in maintaining the normal plant mesophyll cell structure. Copyright © 2012 Elsevier Inc. All rights reserved.
FXR silencing in human colon cancer by DNA methylation and KRAS signaling.
Bailey, Ann M; Zhan, Le; Maru, Dipen; Shureiqi, Imad; Pickering, Curtis R; Kiriakova, Galina; Izzo, Julie; He, Nan; Wei, Caimiao; Baladandayuthapani, Veerabhadran; Liang, Han; Kopetz, Scott; Powis, Garth; Guo, Grace L
2014-01-01
Farnesoid X receptor (FXR) is a bile acid nuclear receptor described through mouse knockout studies as a tumor suppressor for the development of colon adenocarcinomas. This study investigates the regulation of FXR in the development of human colon cancer. We used immunohistochemistry of FXR in normal tissue (n = 238), polyps (n = 32), and adenocarcinomas, staged I-IV (n = 43, 39, 68, and 9), of the colon; RT-quantitative PCR, reverse-phase protein array, and Western blot analysis in 15 colon cancer cell lines; NR1H4 promoter methylation and mRNA expression in colon cancer samples from The Cancer Genome Atlas; DNA methyltransferase inhibition; methyl-DNA immunoprecipitation (MeDIP); bisulfite sequencing; and V-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog (KRAS) knockdown assessment to investigate FXR regulation in colon cancer development. Immunohistochemistry and quantitative RT-PCR revealed that expression and function of FXR was reduced in precancerous lesions and silenced in a majority of stage I-IV tumors. FXR expression negatively correlated with phosphatidylinositol-4, 5-bisphosphate 3 kinase signaling and the epithelial-to-mesenchymal transition. The NR1H4 promoter is methylated in ~12% colon cancer The Cancer Genome Atlas samples, and methylation patterns segregate with tumor subtypes. Inhibition of DNA methylation and KRAS silencing both increased FXR expression. FXR expression is decreased early in human colon cancer progression, and both DNA methylation and KRAS signaling may be contributing factors to FXR silencing. FXR potentially suppresses epithelial-to-mesenchymal transition and other oncogenic signaling cascades, and restoration of FXR activity, by blocking silencing mechanisms or increasing residual FXR activity, represents promising therapeutic options for the treatment of colon cancer.
Zhuo, Tao; Li, Yuan-Yuan; Xiang, Hai-Ying; Wu, Zhan-Yu; Wang, Xian-Bin; Wang, Ying; Zhang, Yong-Liang; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui
2014-06-01
Polerovirus P0 suppressors of host gene silencing contain a consensus F-box-like motif with Leu/Pro (L/P) requirements for suppressor activity. The Inner Mongolian Potato leafroll virus (PLRV) P0 protein (P0(PL-IM)) has an unusual F-box-like motif that contains a Trp/Gly (W/G) sequence and an additional GW/WG-like motif (G139/W140/G141) that is lacking in other P0 proteins. We used Agrobacterium infiltration-mediated RNA silencing assays to establish that P0(PL-IM) has a strong suppressor activity. Mutagenesis experiments demonstrated that the P0(PL-IM) F-box-like motif encompasses amino acids 76-LPRHLHYECLEWGLLCG THP-95, and that the suppressor activity is abolished by L76A, W87A, or G88A substitution. The suppressor activity is also weakened substantially by mutations within the G139/W140/G141 region and is eliminated by a mutation (F220R) in a C-terminal conserved sequence of P0(PL-IM). As has been observed with other P0 proteins, P0(PL-IM) suppression is correlated with reduced accumulation of the host AGO1-silencing complex protein. However, P0(PL-IM) fails to bind SKP1, which functions in a proteasome pathway that may be involved in AGO1 degradation. These results suggest that P0(PL-IM) may suppress RNA silencing by using an alternative pathway to target AGO1 for degradation. Our results help improve our understanding of the molecular mechanisms involved in PLRV infection.
Duplication of an upstream silencer of FZP increases grain yield in rice.
Bai, Xufeng; Huang, Yong; Hu, Yong; Liu, Haiyang; Zhang, Bo; Smaczniak, Cezary; Hu, Gang; Han, Zhongmin; Xing, Yongzhong
2017-11-01
Transcriptional silencer and copy number variants (CNVs) are associated with gene expression. However, their roles in generating phenotypes have not been well studied. Here we identified a rice quantitative trait locus, SGDP7 (Small Grain and Dense Panicle 7). SGDP7 is identical to FZP (FRIZZY PANICLE), which represses the formation of axillary meristems. The causal mutation of SGDP7 is an 18-bp fragment, named CNV-18bp, which was inserted ~5.3 kb upstream of FZP and resulted in a tandem duplication in the cultivar Chuan 7. The CNV-18bp duplication repressed FZP expression, prolonged the panicle branching period and increased grain yield by more than 15% through substantially increasing the number of spikelets per panicle (SPP) and slightly decreasing the 1,000-grain weight (TGW). The transcription repressor OsBZR1 binds the CGTG motifs in CNV-18bp and thereby represses FZP expression, indicating that CNV-18bp is the upstream silencer of FZP. These findings showed that the silencer CNVs coordinate a trade-off between SPP and TGW by fine-tuning FZP expression, and balancing the trade-off could enhance yield potential.
Xu, Wei; Wang, Ting; Xu, Shaoxin; Li, Fanghua; Deng, Chenguang; Wu, Lijun; Wu, Yuejin; Bian, Po
2016-08-01
Plant stress responses at the epigenetic level are expected to allow more permanent changes of gene expression and potentially long-term adaptation. While it has been reported that plants subjected to adverse environments initiate various stress responses in their neighboring plants, little is known regarding epigenetic responses to external stresses mediated by plant-plant communication. In this study, we show that DNA repetitive elements of Arabidopsis thaliana, whose expression is inhibited epigenetically by transcriptional gene silencing (TGS) mechanism, are activated by UV-C irradiation through airborne plant-plant and plant-plant-plant communications, accompanied by DNA demethylation at CHH sites. Moreover, the TGS is alleviated by direct treatments with exogenous methyl jasmonate (MeJA) and methyl salicylate (MeSA). Further, the plant-plant and plant-plant-plant communications are blocked by mutations in the biosynthesis or signaling of jasmonic acid (JA) or salicylic acid (SA), indicating that JA and SA pathways are involved in the interplant communication for epigenetic responses. For the plant-plant-plant communication, stress cues are relayed to the last set of receiver plants by promoting the production of JA and SA signals in relaying plants, which exhibit upregulated expression of genes for JA and SA biosynthesis and enhanced emanation of MeJA and MeSA. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Dashuai Mu
Full Text Available Ganoderma lucidum is one of the most important medicinal mushrooms; however, molecular genetics research on this species has been limited due to a lack of reliable reverse genetic tools. In this study, the endogenous orotidine 5'-monophosphate decarboxylase gene (URA3 was cloned as a silencing reporter, and four gene-silencing methods using hairpin, sense, antisense, and dual promoter constructs, were introduced into G. lucidum through a simple electroporation procedure. A comparison and evaluation of silencing efficiency demonstrated that all of the four methods differentially suppressed the expression of URA3. Our data unequivocally indicate that the dual promoter silencing vector yields the highest rate of URA3 silencing compared with other vectors (up to 81.9%. To highlight the advantages of the dual promoter system, we constructed a co-silencing system based on the dual promoter method and succeeded in co-silencing URA3 and laccase in G. lucidum. The reduction of the mRNA levels of the two genes were correlated. Thus, the screening efficiency for RNAi knockdown of multiple genes may be improved by the co-silencing of an endogenous reporter gene. The molecular tools developed in this study should facilitate the isolation of genes and the characterization of the functions of multiple genes in this pharmaceutically important species, and these tools should be highly useful for the study of other basidiomycetes.
Directory of Open Access Journals (Sweden)
Gyöngyi Munkácsy
2016-01-01
Full Text Available No independent cross-validation of success rate for studies utilizing small interfering RNA (siRNA for gene silencing has been completed before. To assess the influence of experimental parameters like cell line, transfection technique, validation method, and type of control, we have to validate these in a large set of studies. We utilized gene chip data published for siRNA experiments to assess success rate and to compare methods used in these experiments. We searched NCBI GEO for samples with whole transcriptome analysis before and after gene silencing and evaluated the efficiency for the target and off-target genes using the array-based expression data. Wilcoxon signed-rank test was used to assess silencing efficacy and Kruskal–Wallis tests and Spearman rank correlation were used to evaluate study parameters. All together 1,643 samples representing 429 experiments published in 207 studies were evaluated. The fold change (FC of down-regulation of the target gene was above 0.7 in 18.5% and was above 0.5 in 38.7% of experiments. Silencing efficiency was lowest in MCF7 and highest in SW480 cells (FC = 0.59 and FC = 0.30, respectively, P = 9.3E−06. Studies utilizing Western blot for validation performed better than those with quantitative polymerase chain reaction (qPCR or microarray (FC = 0.43, FC = 0.47, and FC = 0.55, respectively, P = 2.8E−04. There was no correlation between type of control, transfection method, publication year, and silencing efficiency. Although gene silencing is a robust feature successfully cross-validated in the majority of experiments, efficiency remained insufficient in a significant proportion of studies. Selection of cell line model and validation method had the highest influence on silencing proficiency.
Li, Zhiyuan; Zhang, Zhanxiu; Zhao, Lili; Li, Hui; Wang, Suxia; Shen, Yong
2014-01-01
We hypothesized that RNA interference to silence Nogo-66 receptor gene expression in bone marrow mesenchymal stem cells before transplantation might further improve neurological function in rats with spinal cord transection injury. After 2 weeks, the number of neurons and BrdU-positive cells in the Nogo-66 receptor gene silencing group was higher than in the bone marrow mesenchymal stem cell group, and significantly greater compared with the model group. After 4 weeks, behavioral performance was significantly enhanced in the model group. After 8 weeks, the number of horseradish peroxidase-labeled nerve fibers was higher in the Nogo-66 receptor gene silencing group than in the bone marrow mesenchymal stem cell group, and significantly higher than in the model group. The newly formed nerve fibers and myelinated nerve fibers were detectable in the central transverse plane section in the bone marrow mesenchymal stem cell group and in the Nogo-66 receptor gene silencing group. PMID:25206893
The Mechanism of the Silencing of a Transgene, NCED3‐LUC, in Arabidopsis Thaliana
Zhao, Junsong
2011-06-20
The Arabidopsis thaliana NCED3‐LUC transgenic line was constructed by several groups to study the regulatory network of the NCED3 gene, the protein of which catalyzes the rate‐limiting step of ABA biosynthesis under drought. The transgenic luciferase gene is expressed when the plants encounter drought stress. Intriguingly, this transgenic luciferase gene is silenced after propagation for several generations. To determine the mechanism of this gene silencing, we used a forward genetics approach. The seeds of NCED3‐LUC (referred as the ‘wild type’) were mutagenized by ethane methyl sulfonate (EMS). One mutant line, denoted as #73, with recovered luciferase activity was selected for further study. Analysis of the methylation status by bisulfite sequencing revealed that the transgenic NCED3 promoter in the #73 mutant had less methylation than the wild type. Demethylation was also evident for the endogenous NCED3 promoter and retrotransposon AtSN1 in the #73 mutant. The phenotype of #73 mutant includes small size, rapid dehydration rate, altered morphology, and a thin epicuticular wax layer. By use of map‐based cloning, the region containing the mutated gene was delimited to a contig of two BAC clones, F11F19 and F9C22, on chromosome 2. Our results indicate that NCED3‐LUC gene silencing results from hypermethylation of its promoter region, but additional study is required to determine the exact position of the mutated gene and to fully understand the mechanism of NCED3‐LUC silencing. 4 ACKNOWLEDGEMENTS I would like to take this opportunity to thank my committee chair, Professor Jian‐Kang Zhu, who is also the supervisor of my master’s thesis, for his guidance throughout the course of this research. I also would like to thank my committee members, Professor Liming Xiong and Professor Samir Hamdan, for their patience and support in reviewing my thesis. My appreciation also goes to Dr. Zhenyu Wang for taking time to teach me basic experimental skills and
Asgeirsdóttir, Sigridur A; Talman, Eduard G; de Graaf, Inge A; Kamps, Jan A A M; Satchell, Simon C; Mathieson, Peter W; Ruiters, Marcel H J; Molema, Grietje
2010-01-25
Applications of small-interfering RNA (siRNA) call for specific and efficient delivery of siRNA into particular cell types. We developed a novel, non-viral targeting system to deliver siRNA specifically into inflammation-activated endothelial cells. This was achieved by conjugating the cationic amphiphilic lipid SAINT to antibodies recognizing the inflammatory cell adhesion molecule E-selectin. These anti-E-selectin-SAINT lipoplexes (SAINTarg) maintained antigen recognition capacity of the parental antibody in vitro, and ex vivo in human kidney tissue slices subjected to inflammatory conditions. Regular SAINT mediated transfection resulted in efficient gene silencing in human microvascular endothelial cells (HMEC-1) and conditionally immortalized glomerular endothelial cells (ciGEnC). However, primary human umbilical vein endothelial cells (HUVEC) transfected poorly, a phenomenon that we could quantitatively correlate with a cell-type specific capacity to facilitate siRNA uptake. Importantly, SAINTarg increased siRNA uptake and transfection specificity for activated endothelial cells. Transfection with SAINTarg delivered significantly more siRNA into activated HUVEC, compared to transfection with non-targeted SAINT. The enhanced uptake of siRNA was corroborated by improved silencing of both gene- and protein expression of VE-cadherin in activated HUVEC, indicating that SAINTarg delivered functionally active siRNA into endothelial cells. The obtained results demonstrate a successful design of a small nucleotide carrier system with improved and specific siRNA delivery into otherwise difficult-to-transfect primary endothelial cells, which in addition reduced considerably the amount of siRNA needed for gene silencing. Copyright 2009 Elsevier B.V. All rights reserved.
Lead- or Lead-bismuth-cooled fast reactors
International Nuclear Information System (INIS)
Bouchter, J.C.; Courouau, J.L.; Dufour, P.; Guidez, J.; Latge, C.; Martinelli, L.; Renault, C.; Rimpault, G.
2014-01-01
Lead-cooled fast reactors are one of the 6 concepts retained for the 4. generation of nuclear reactors. So far no lead-cooled reactors have existed in the world except lead-bismuth-cooled reactors in soviet submarines. Some problems linked to the use of the lead-bismuth eutectic appeared but were satisfactorily solved by a more rigorous monitoring of the chemistry of the lead-bismuth coolant. Lead presents various advantages as a coolant: no reactivity with water and the air,a high boiling temperature and low contamination when irradiated. The main asset of the lead-bismuth alloy is the drop of the fusion temperature from 327 C degrees to 125 C degrees. The main drawback of using lead (or lead-bismuth) is its high corrosiveness with metals like iron, chromium and nickel. The high corrosiveness of the coolant implies low flow velocities which means a bigger core and consequently a bigger reactor containment. Different research programs in the world (in Europe, Russia and the USA) are reviewed in the article but it appears that the development of this type of reactor requires technological breakthroughs concerning materials and the resistance to corrosion. Furthermore the concept of lead-cooled reactors seems to be associated to a range of low output power because of the compromise between the size of the reactor and its resistance to earthquakes. (A.C.)
Smith, Matthew; Mallin, Daniel R.; Simon, Jeffrey A.; Courey, Albert J.
2011-01-01
The Drosophila protein Sex Comb on Midleg (Scm) is a member of the Polycomb group (PcG), a set of transcriptional repressors that maintain silencing of homeotic genes during development. Recent findings have identified PcG proteins both as targets for modification by the small ubiquitin-like modifier (SUMO) protein and as catalytic components of the SUMO conjugation pathway. We have found that the SUMO-conjugating enzyme Ubc9 binds to Scm and that this interaction, which requires the Scm C-te...
Performances of Student Activism: Sound, Silence, Gender, and Dis/ability
Pasque, Penny A.; Vargas, Juanita Gamez
2014-01-01
This chapter explores the various performances of activism by students through sound, silence, gender, and dis/ability and how these performances connect to social change efforts around issues such as human trafficking, homeless children, hunger, and children with varying abilities.
Protective Role of Complement C3 Against Cytokine-Mediated beta-Cell Apoptosis
DEFF Research Database (Denmark)
Dos Santos, Reinaldo S.; Marroqui, Laura; Grieco, Fabio A.
2017-01-01
silencing exacerbates apoptosis under both basal condition and following exposure to cytokines, and it increases chemokine expression upon cytokine treatment. C3 exerts its prosurvival effects via AKT activation and c-Jun N-terminal kinase inhibition. Exogenously added C3 also protects against cytokine...
International Nuclear Information System (INIS)
Béaslas, Olivier; Vihervaara, Terhi; Li, Jiwei; Laurila, Pirkka-Pekka; Yan, Daoguang; Olkkonen, Vesa M.
2012-01-01
ORP8 is an oxysterol/cholesterol binding protein anchored to the endoplasmic reticulum and the nuclear envelope, and is abundantly expressed in the macrophage. We created and characterized mouse RAW264.7 macrophages with ORP8 stably silenced using shRNA lentiviruses. A microarray transcriptome and gene ontology pathway analysis revealed significant alterations in several nuclear pathways and ones associated with centrosome and microtubule organization. ORP8 knockdown resulted in increased expression and altered subcellular distribution of an interaction partner of ORP8, nucleoporin NUP62, with an intranuclear localization aspect and association with cytoplasmic vesicular structures and lamellipodial edges of the cells. Moreover, ORP8 silenced cells displayed enhanced migration, and a more pronounced microtubule cytoskeleton than controls expressing a non-targeting shRNA. ORP8 was shown to compete with Exo70 for interaction with NUP62, and NUP62 knockdown abolished the migration enhancement of ORP8-silenced cells, suggesting that the endogenous ORP8 suppresses migration via binding to NUP62. As a conclusion, the present study reveals new, unexpected aspects of ORP8 function in macrophages not directly involving lipid metabolism, but rather associated with nuclear functions, microtubule organization, and migration capacity. -- Highlights: ► The phenotype of Raw264.7 macrophage with ORP8 silenced is characterized. ► ORP8 silencing alters mRNA levels of nuclear and microtubule/centrosome pathways. ► ORP8 silencing results in increased expression and altered distribution of NUP62. ► ORP8 silenced macrophages show enhanced migration and altered microtubule cytoskeleton. ► ORP8 competes in vitro with Exo70 for binding to NUP62.
Directory of Open Access Journals (Sweden)
Maíra Rossetto
2017-01-01
Full Text Available Objetivo : describir la utilización de la metodología The Silences Framework en una investigación en el área de la salud, involucrando la temática de la co-infección Tuberculosis/VIH/SIDA. Método : la metodología fue originalmente utilizada para estudiar decisiones y silencios de hombres negros del Caribe que vivían en Inglaterra, problematizándose los temas ‘salud sexual’ y ‘etnicidad’ y resultando en una teoría para la investigación de cuestiones sensibles y de cuidados de la salud de las poblaciones marginadas. The Silences Framework define áreas de investigación y experiencias que son poco investigadas, comprendidas o silenciadas. Resultados: los “silencios” pueden reflejar aspectos no compartidos de cómo las creencias, valores y experiencias de algunos grupos influencian su salud. Este referencial prevé la aplicación de cuatro etapas complementarias: trabajando los silencios, oyendo los silencios, dando voz a los silencios y trabajando con los silencios. El análisis ocurre de modo cíclico y puede ser repetido mientras los silencios no se desvelan. Conclusión : este artículo presenta la noción de “sonidos del silencio”, mapeando un cuadro teórico anti-esencialista para su utilización en investigaciones sensibles en el área de la salud y de la enfermería, pudiendo ser referencia para otros investigadores en estudios involucrando poblaciones marginadas.
Relationship between Organizational Mobbing and Silence Behavior among Teachers
Hüsrevsahi, Selda Polat
2015-01-01
This study mainly aims to investigate the correlation between teachers' exposure to mobbing in their workplaces and their display of the act of silence. This study is based on a survey design where data from 312 teachers were collected and analyzed using correlation and regression analyses. Specifically, "The Structure and Dimensions of…
Dare, Andrew P; Tomes, Sumathi; Jones, Midori; McGhie, Tony K; Stevenson, David E; Johnson, Ross A; Greenwood, David R; Hellens, Roger P
2013-05-01
We have identified in apple (Malus × domestica) three chalcone synthase (CHS) genes. In order to understand the functional redundancy of this gene family RNA interference knockout lines were generated where all three of these genes were down-regulated. These lines had no detectable anthocyanins and radically reduced concentrations of dihydrochalcones and flavonoids. Surprisingly, down-regulation of CHS also led to major changes in plant development, resulting in plants with shortened internode lengths, smaller leaves and a greatly reduced growth rate. Microscopic analysis revealed that these phenotypic changes extended down to the cellular level, with CHS-silenced lines showing aberrant cellular organisation in the leaves. Fruit collected from one CHS-silenced line was smaller than the 'Royal Gala' controls, lacked flavonoids in the skin and flesh and also had changes in cell morphology. Auxin transport experiments showed increased rates of auxin transport in a CHS-silenced line compared with the 'Royal Gala' control. As flavonoids are well known to be key modulators of auxin transport, we hypothesise that the removal of almost all flavonoids from the plant by CHS silencing creates a vastly altered environment for auxin transport to occur and results in the observed changes in growth and development. © 2013 The Authors The Plant Journal © 2013 Blackwell Publishing Ltd.
Reexamining the P-Element Invasion of Drosophila melanogaster Through the Lens of piRNA Silencing
Kelleher, Erin S.
2016-01-01
Transposable elements (TEs) are both important drivers of genome evolution and genetic parasites with potentially dramatic consequences for host fitness. The recent explosion of research on regulatory RNAs reveals that small RNA-mediated silencing is a conserved genetic mechanism through which hosts repress TE activity. The invasion of the Drosophila melanogaster genome by P elements, which happened on a historical timescale, represents an incomparable opportunity to understand how small RNA-mediated silencing of TEs evolves. Repression of P-element transposition emerged almost concurrently with its invasion. Recent studies suggest that this repression is implemented in part, and perhaps predominantly, by the Piwi-interacting RNA (piRNA) pathway, a small RNA-mediated silencing pathway that regulates TE activity in many metazoan germlines. In this review, I consider the P-element invasion from both a molecular and evolutionary genetic perspective, reconciling classic studies of P-element regulation with the new mechanistic framework provided by the piRNA pathway. I further explore the utility of the P-element invasion as an exemplar of the evolution of piRNA-mediated silencing. In light of the highly-conserved role for piRNAs in regulating TEs, discoveries from this system have taxonomically broad implications for the evolution of repression. PMID:27516614
Organizational Silence: suatu Penghambat dalam Mewujudkan Kreatifitas Organisasional
Retnawati, Berta Bekti
2003-01-01
There are powerful forces in many organzations that cause widespread withholding of information about potential problems or issues by employess, this collective-level phenomenon as ‘organizational silence’. One significant effect of organizational silence relates to lack of organizational creativity.There are five major organizational factors that enhance creativity in a work environment: organizational climate, leadership style, organizational culture, resources and skills, the structure and...
van der Linde, Karina; Doehlemann, Gunther
2013-01-01
While in dicotyledonous plants virus-induced gene silencing (VIGS) is well established to study plant-pathogen interaction, in monocots only few examples of efficient VIGS have been reported so far. One of the available systems is based on the brome mosaic virus (BMV) which allows gene silencing in different cereals including barley (Hordeum vulgare), wheat (Triticum aestivum), and maize (Zea mays).Infection of maize plants by the corn smut fungus Ustilago maydis leads to the formation of large tumors on stem, leaves, and inflorescences. During this biotrophic interaction, plant defense responses are actively suppressed by the pathogen, and previous transcriptome analyses of infected maize plants showed comprehensive and stage-specific changes in host gene expression during disease progression.To identify maize genes that are functionally involved in the interaction with U. maydis, we adapted a VIGS system based on the Brome mosaic virus (BMV) to maize at conditions that allow successful U. maydis infection of BMV pre-infected maize plants. This setup enables quantification of VIGS and its impact on U. maydis infection using a quantitative real-time PCR (q(RT)-PCR)-based readout.
High-Throughput Screening of a Luciferase Reporter of Gene Silencing on the Inactive X Chromosome.
Keegan, Alissa; Plath, Kathrin; Damoiseaux, Robert
2018-01-01
Assays of luciferase gene activity are a sensitive and quantitative reporter system suited to high-throughput screening. We adapted a luciferase assay to a screening strategy for identifying factors that reactivate epigenetically silenced genes. This epigenetic luciferase reporter is subject to endogenous gene silencing mechanisms on the inactive X chromosome (Xi) in primary mouse cells and thus captures the multilayered nature of chromatin silencing in development. Here, we describe the optimization of an Xi-linked luciferase reactivation assay in 384-well format and adaptation of the assay for high-throughput siRNA and chemical screening. Xi-luciferase reactivation screening has applications in stem cell biology and cancer therapy. We have used the approach described here to identify chromatin-modifying proteins and to identify drug combinations that enhance the gene reactivation activity of the DNA demethylating drug 5-aza-2'-deoxycytidine.
APC/C-mediated degradation of dsRNA-binding protein 4 (DRB4 involved in RNA silencing.
Directory of Open Access Journals (Sweden)
Katia Marrocco
Full Text Available Selective protein degradation via the ubiquitin-26S proteasome is a major mechanism underlying DNA replication and cell division in all Eukaryotes. In particular, the APC/C (Anaphase Promoting Complex or Cyclosome is a master ubiquitin protein ligase (E3 that targets regulatory proteins for degradation allowing sister chromatid separation and exit from mitosis. Interestingly, recent work also indicates that the APC/C remains active in differentiated animal and plant cells. However, its role in post-mitotic cells remains elusive and only a few substrates have been characterized.In order to identify novel APC/C substrates, we performed a yeast two-hybrid screen using as the bait Arabidopsis APC10/DOC1, one core subunit of the APC/C, which is required for substrate recruitment. This screen identified DRB4, a double-stranded RNA binding protein involved in the biogenesis of different classes of small RNA (sRNA. This protein interaction was further confirmed in vitro and in plant cells. Moreover, APC10 interacts with DRB4 through the second dsRNA binding motif (dsRBD2 of DRB4, which is also required for its homodimerization and binding to its Dicer partner DCL4. We further showed that DRB4 protein accumulates when the proteasome is inactivated and, most importantly, we found that DRB4 stability depends on APC/C activity. Hence, depletion of Arabidopsis APC/C activity by RNAi leads to a strong accumulation of endogenous DRB4, far beyond its normal level of accumulation. However, we could not detect any defects in sRNA production in lines where DRB4 was overexpressed.Our work identified a first plant substrate of the APC/C, which is not a regulator of the cell cycle. Though we cannot exclude that APC/C-dependent degradation of DRB4 has some regulatory roles under specific growth conditions, our work rather points to a housekeeping function of APC/C in maintaining precise cellular-protein concentrations and homeostasis of DRB4.
Directory of Open Access Journals (Sweden)
Jérôme Meizoz
2009-10-01
Full Text Available Après la parution de Postures littéraires (2007 cet article revient sur la visée méthodologique de la notion de « posture », en la confrontant à deux notions voisines, celles d’« ethos » et d’« image d’auteur ». Il propose de hiérarchiser ces trois notions dans un ensemble conceptuel. Une brève analyse du Silence de la mer (1942 de Vercors illustre cette réflexion.After the publication of Literary postures (2007, this article revisits the methodological approach based on the notion of “posture” by comparing it with two related notions, “ethos” and “author’s image”. It shows how these three notions can be organized into a hierarchy inside an integrated conceptual whole. A brief analysis of Vercors’ TheSilence of the Sea (1942 illustrates this proposition.
Swamy, Lakshmi; Amulic, Borko; Deitsch, Kirk W.
2011-01-01
Antigenic variation in the human malaria parasite Plasmodium falciparum depends on the transcriptional regulation of the var gene family. In each individual parasite, mRNA is expressed exclusively from 1 var gene out of ∼60, while the rest of the genes are transcriptionally silenced. Both modifications to chromatin structure and DNA regulatory elements associated with each var gene have been implicated in the organization and maintenance of the silent state. Whether silencing is established at the level of entire chromosomal regions via heterochromatin spreading or at the level of individual var promoters through the action of a silencing element within each var intron has been debated. Here, we consider both possibilities, using clonal parasite lines carrying chromosomally integrated transgenes. We confirm a previous finding that the loss of an adjacent var intron results in var promoter activation and further show that transcriptional activation of a var promoter within a cluster does not affect the transcriptional activity of neighboring var promoters. Our results provide more evidence for the hypothesis that var genes are primarily silenced at the level of an individual gene, rather than by heterochromatin spreading. We also tested the intrinsic directionality of an intron's silencing effect on upstream or downstream var promoters. We found that an intron is capable of silencing in either direction and that, once established, a var promoter-intron pair is stably maintained through many generations, suggesting a possible role in epigenetic memory. This study provides insights into the regulation of endogenous var gene clusters. PMID:21317310
flp-32 Ligand/receptor silencing phenocopy faster plant pathogenic nematodes.
Atkinson, Louise E; Stevenson, Michael; McCoy, Ciaran J; Marks, Nikki J; Fleming, Colin; Zamanian, Mostafa; Day, Tim A; Kimber, Michael J; Maule, Aaron G; Mousley, Angela
2013-02-01
Restrictions on nematicide usage underscore the need for novel control strategies for plant pathogenic nematodes such as Globodera pallida (potato cyst nematode) that impose a significant economic burden on plant cultivation activities. The nematode neuropeptide signalling system is an attractive resource for novel control targets as it plays a critical role in sensory and motor functions. The FMRFamide-like peptides (FLPs) form the largest and most diverse family of neuropeptides in invertebrates, and are structurally conserved across nematode species, highlighting the utility of the FLPergic system as a broad-spectrum control target. flp-32 is expressed widely across nematode species. This study investigates the role of flp-32 in G. pallida and shows that: (i) Gp-flp-32 encodes the peptide AMRNALVRFamide; (ii) Gp-flp-32 is expressed in the brain and ventral nerve cord of G. pallida; (iii) migration rate increases in Gp-flp-32-silenced worms; (iv) the ability of G. pallida to infect potato plant root systems is enhanced in Gp-flp-32-silenced worms; (v) a novel putative Gp-flp-32 receptor (Gp-flp-32R) is expressed in G. pallida; and, (vi) Gp-flp-32R-silenced worms also display an increase in migration rate. This work demonstrates that Gp-flp-32 plays an intrinsic role in the modulation of locomotory behaviour in G. pallida and putatively interacts with at least one novel G-protein coupled receptor (Gp-flp-32R). This is the first functional characterisation of a parasitic nematode FLP-GPCR.
flp-32 Ligand/receptor silencing phenocopy faster plant pathogenic nematodes.
Directory of Open Access Journals (Sweden)
Louise E Atkinson
2013-02-01
Full Text Available Restrictions on nematicide usage underscore the need for novel control strategies for plant pathogenic nematodes such as Globodera pallida (potato cyst nematode that impose a significant economic burden on plant cultivation activities. The nematode neuropeptide signalling system is an attractive resource for novel control targets as it plays a critical role in sensory and motor functions. The FMRFamide-like peptides (FLPs form the largest and most diverse family of neuropeptides in invertebrates, and are structurally conserved across nematode species, highlighting the utility of the FLPergic system as a broad-spectrum control target. flp-32 is expressed widely across nematode species. This study investigates the role of flp-32 in G. pallida and shows that: (i Gp-flp-32 encodes the peptide AMRNALVRFamide; (ii Gp-flp-32 is expressed in the brain and ventral nerve cord of G. pallida; (iii migration rate increases in Gp-flp-32-silenced worms; (iv the ability of G. pallida to infect potato plant root systems is enhanced in Gp-flp-32-silenced worms; (v a novel putative Gp-flp-32 receptor (Gp-flp-32R is expressed in G. pallida; and, (vi Gp-flp-32R-silenced worms also display an increase in migration rate. This work demonstrates that Gp-flp-32 plays an intrinsic role in the modulation of locomotory behaviour in G. pallida and putatively interacts with at least one novel G-protein coupled receptor (Gp-flp-32R. This is the first functional characterisation of a parasitic nematode FLP-GPCR.
Exon silencing by UAGG motifs in response to neuronal excitation.
Directory of Open Access Journals (Sweden)
Ping An
2007-02-01
Full Text Available Alternative pre-mRNA splicing plays fundamental roles in neurons by generating functional diversity in proteins associated with the communication and connectivity of the synapse. The CI cassette of the NMDA R1 receptor is one of a variety of exons that show an increase in exon skipping in response to cell excitation, but the molecular nature of this splicing responsiveness is not yet understood. Here we investigate the molecular basis for the induced changes in splicing of the CI cassette exon in primary rat cortical cultures in response to KCl-induced depolarization using an expression assay with a tight neuron-specific readout. In this system, exon silencing in response to neuronal excitation was mediated by multiple UAGG-type silencing motifs, and transfer of the motifs to a constitutive exon conferred a similar responsiveness by gain of function. Biochemical analysis of protein binding to UAGG motifs in extracts prepared from treated and mock-treated cortical cultures showed an increase in nuclear hnRNP A1-RNA binding activity in parallel with excitation. Evidence for the role of the NMDA receptor and calcium signaling in the induced splicing response was shown by the use of specific antagonists, as well as cell-permeable inhibitors of signaling pathways. Finally, a wider role for exon-skipping responsiveness is shown to involve additional exons with UAGG-related silencing motifs, and transcripts involved in synaptic functions. These results suggest that, at the post-transcriptional level, excitable exons such as the CI cassette may be involved in strategies by which neurons mount adaptive responses to hyperstimulation.
van Bemmel, Dana M.; Brank, Adam S.; Eritja, Ramon; Marquez, Victor E.; Christman, Judith K.
2009-01-01
Aberrant cytosine methylation in promoter regions leads to gene silencing associated with cancer progression. A number of DNA methyltransferase inhibitors are known to reactivate silenced genes; including 5-azacytidine and 2-(1H)-pyrimidinone riboside (zebularine). Zebularine is a more stable, less cytotoxic inhibitor compared to 5-azacytidine. To determine the mechanistic basis for this difference, we carried out a detailed comparisons of the interaction between purified DNA methyltransferas...
DEFF Research Database (Denmark)
Riviere, M.P.; Marais, A.; Ponchet, M.
2008-01-01
silenced. Plants lacking extracellular PR-1s were more susceptible than wild-type plants to the oomycete Phytophthora parasitica but displayed unaffected systemic acquired resistance and developmental resistance to this pathogen. Treatment with salicylic acid up-regulates the PR-1g gene, encoding a basic...... protein of the PR-1 family, in PR-1-deficient tobacco, indicating that PR-1 expression may repress that of PR-1g. This shows that acidic PR-1s are dispensable for expression of salicylic acid-dependent acquired resistances against P. parasitica and may reveal a functional overlap in tobacco defence......The class 1 pathogenesis-related (PR) proteins are thought to be involved in plant defence responses, but their molecular functions are unknown. The function of PR-1 was investigated in tobacco by generating stable PR-1a-silenced lines in which other acidic PR-1 genes (PR-1b and PR-1c) were...
ABCE1 is a highly conserved RNA silencing suppressor.
Directory of Open Access Journals (Sweden)
Kairi Kärblane
Full Text Available ATP-binding cassette sub-family E member 1 (ABCE1 is a highly conserved protein among eukaryotes and archaea. Recent studies have identified ABCE1 as a ribosome-recycling factor important for translation termination in mammalian cells, yeast and also archaea. Here we report another conserved function of ABCE1. We have previously described AtRLI2, the homolog of ABCE1 in the plant Arabidopsis thaliana, as an endogenous suppressor of RNA silencing. In this study we show that this function is conserved: human ABCE1 is able to suppress RNA silencing in Nicotiana benthamiana plants, in mammalian HEK293 cells and in the worm Caenorhabditis elegans. Using co-immunoprecipitation and mass spectrometry, we found a number of potential ABCE1-interacting proteins that might support its function as an endogenous suppressor of RNA interference. The interactor candidates are associated with epigenetic regulation, transcription, RNA processing and mRNA surveillance. In addition, one of the identified proteins is translin, which together with its binding partner TRAX supports RNA interference.
A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize.
Mei, Yu; Zhang, Chunquan; Kernodle, Bliss M; Hill, John H; Whitham, Steven A
2016-06-01
Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. © 2016 American Society of Plant Biologists. All Rights Reserved.
Paul Leni’s Waxworks: Writing Images from Silence, through Media and Philosophy
Directory of Open Access Journals (Sweden)
Marcondes Ciro Inácio
2016-12-01
Full Text Available The so-called German Weimar Cinema encompasses a profusion of films that used frame narratives. In the case of Paul Leni’s Waxworks (Das Wachsfigurenkabinett, 1924, as the framing stems from a literary act (the stories are framed by the act of narration, the film proposes the mise-en-abyme technique as a sort of immersion into the intermedial when it deals with notions like speaking, writing, silence, image and cinema. In the case of silent cinema, and especially in Waxworks, the presence of a perverse relation with the medium of writing becomes noticeable (producing a fantasy of writing, since every effort to represent the literary act on film results in an infinite production of silent images, creating a parody effect and even postulating an act of aggression against writing. This confrontational relation between the writing code and the code of the mute image in silent cinema allows us to suggest that there is an inherent inflexibility in the language of silent cinema which does not allow the coexistence of written and spoken word as complementary codes. On the contrary, in silent cinema, the image and the silence of the film seem to work against the word, the spoken word being set forth against silence, and the written word against images.
Directory of Open Access Journals (Sweden)
Belal Panahi
2012-04-01
Full Text Available Today, there is no doubt that in many organizations, many employees refuse to provide their opinions and comments about the organizational problems. In fact, in many organizations there is a created climate, which often makes employees feel their opinion is not valued. This phenomenon is examined as an organizational silence that by identifying the factors affecting on it we can effectively take steps to eliminate barriers to commenting staff in organizations. In this regard, this paper presents an empirical work conducted on data obtained from 260 employees Payame Noor University of East Azerbaijan Province. These data are analyzed by SPSS software and regression and path analysis tests. The results showed that there is a significant relationship between silence climate dimensions and employee organizational commitment with silence behavior employee. In addition, there is a positive correlation between higher management attitudes and supervisor’s attitudes with workers silent behavior. We have also observed that there is a negative correlation between communication opportunities and organizational commitment with employee silence behavior of employees.
Energy Technology Data Exchange (ETDEWEB)
Beaslas, Olivier; Vihervaara, Terhi [Minerva Foundation Institute for Medical Research, FI-00290 Helsinki (Finland); Li, Jiwei [Department of Biology, Jinan University, Guangzhou 510632 (China); Laurila, Pirkka-Pekka [FIMM, Institute for Molecular Medicine Finland, FI-00290 Helsinki (Finland); National Institute for Health and Welfare, Public Health Genomics Unit, FI-00290 Helsinki (Finland); Yan, Daoguang [Department of Biology, Jinan University, Guangzhou 510632 (China); Olkkonen, Vesa M., E-mail: vesa.olkkonen@helsinki.fi [Minerva Foundation Institute for Medical Research, FI-00290 Helsinki (Finland); Institute of Biomedicine, Anatomy, University of Helsinki, FI-00014 (Finland)
2012-09-10
ORP8 is an oxysterol/cholesterol binding protein anchored to the endoplasmic reticulum and the nuclear envelope, and is abundantly expressed in the macrophage. We created and characterized mouse RAW264.7 macrophages with ORP8 stably silenced using shRNA lentiviruses. A microarray transcriptome and gene ontology pathway analysis revealed significant alterations in several nuclear pathways and ones associated with centrosome and microtubule organization. ORP8 knockdown resulted in increased expression and altered subcellular distribution of an interaction partner of ORP8, nucleoporin NUP62, with an intranuclear localization aspect and association with cytoplasmic vesicular structures and lamellipodial edges of the cells. Moreover, ORP8 silenced cells displayed enhanced migration, and a more pronounced microtubule cytoskeleton than controls expressing a non-targeting shRNA. ORP8 was shown to compete with Exo70 for interaction with NUP62, and NUP62 knockdown abolished the migration enhancement of ORP8-silenced cells, suggesting that the endogenous ORP8 suppresses migration via binding to NUP62. As a conclusion, the present study reveals new, unexpected aspects of ORP8 function in macrophages not directly involving lipid metabolism, but rather associated with nuclear functions, microtubule organization, and migration capacity. -- Highlights: Black-Right-Pointing-Pointer The phenotype of Raw264.7 macrophage with ORP8 silenced is characterized. Black-Right-Pointing-Pointer ORP8 silencing alters mRNA levels of nuclear and microtubule/centrosome pathways. Black-Right-Pointing-Pointer ORP8 silencing results in increased expression and altered distribution of NUP62. Black-Right-Pointing-Pointer ORP8 silenced macrophages show enhanced migration and altered microtubule cytoskeleton. Black-Right-Pointing-Pointer ORP8 competes in vitro with Exo70 for binding to NUP62.
Nolin, James D; Tully, Jane E; Hoffman, Sidra M; Guala, Amy S; van der Velden, Jos L; Poynter, Matthew E; van der Vliet, Albert; Anathy, Vikas; Janssen-Heininger, Yvonne M W
2014-08-01
Interleukin-17A (IL-17A) is a newly emerging player in the pathogenesis of chronic lung diseases that amplifies inflammatory responses and promotes tissue remodeling. Stimulation of lung epithelial cells with IL-17A leads to activation of the transcription factor nuclear factor κB (NF-κB), a key player in the orchestration of lung inflammation. We have previously demonstrated the importance of the redox-dependent posttranslational modification S-glutathionylation in limiting activation of NF-κB and downstream gene induction. Under physiological conditions, the enzyme glutaredoxin 1 (Grx1) acts to deglutathionylate NF-κB proteins, which restores functional activity. In this study, we sought to determine the impact of S-glutathionylation on IL-17A-induced NF-κB activation and expression of proinflammatory mediators. C10 mouse lung alveolar epithelial cells or primary mouse tracheal epithelial cells exposed to IL-17A show rapid activation of NF-κB and the induction of proinflammatory genes. Upon IL-17A exposure, sulfenic acid formation and S-glutathionylated proteins increased. Assessment of S-glutathionylation of NF-κB pathway components revealed S-glutathionylation of RelA (RelA-SSG) and inhibitory κB kinase α (IKKα-SSG) after stimulation with IL-17A. SiRNA-mediated ablation of Grx1 increased both RelA-SSG and IKKα-SSG and acutely increased nuclear content of RelA and tended to decrease nuclear RelB. SiRNA-mediated ablation or genetic ablation of Glrx1 decreased the expression of the NF-κB-regulated genes KC and CCL20 in response to IL-17A, but conversely increased the expression of IL-6. Last, siRNA-mediated ablation of IKKα attenuated nuclear RelA and RelB content and decreased expression of KC and CCL20 in response to IL-17A. Together, these data demonstrate a critical role for the S-glutathionylation/Grx1 redox axis in regulating IKKα and RelA S-glutathionylation and the responsiveness of epithelial cells to IL-17A. Copyright © 2014 Elsevier Inc
Chen, W; Gao, B; Hao, L; Zhu, G; Jules, J; MacDougall, M J; Wang, J; Han, X; Zhou, X; Li, Y-P
2016-10-01
Periodontitis is a severe chronic inflammatory disease and one of the most prevalent non-communicable chronic diseases that affects the majority of the world's adult population. While great efforts have been devoted toward understanding the pathogenesis of periodontitis, there remains a pressing need for developing potent therapeutic strategies for targeting this dreadful disease. In this study, we utilized adeno-associated virus (AAV) expressing cathepsin K (Ctsk) small hairpin (sh)RNA (AAV-sh-Ctsk) to silence Ctsk in vivo and subsequently evaluated its impact in periodontitis as a potential therapeutic strategy for this disease. We used a known mouse model of periodontitis, in which wild-type BALB/cJ mice were infected with Porphyromonas gingivalis W50 in the maxillary and mandibular periodontium to induce the disease. AAV-sh-Ctsk was then administrated locally into the periodontal tissues in vivo, followed by analyses to assess progression of the disease. AAV-mediated Ctsk silencing drastically protected mice (> 80%) from P. gingivalis-induced bone resorption by osteoclasts. In addition, AAV-sh-Ctsk administration drastically reduced inflammation by impacting the expression of many inflammatory cytokines as well as T-cell and dendritic cell numbers in periodontal lesions. AAV-mediated Ctsk silencing can simultaneously target both the inflammation and bone resorption associated with periodontitis through its inhibitory effect on immune cells and osteoclast function. Thereby, AAV-sh-Ctsk administration can efficiently protect against periodontal tissue damage and alveolar bone loss, establishing this AAV-mediated local silencing of Ctsk as an important therapeutic strategy for effectively treating periodontal disease. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Mercedes Diaz-Mendoza
2017-09-01
Full Text Available Co-evolutionary processes in plant–pathogen/herbivore systems indicate that protease inhibitors have a particular value in biotic interactions. However, little is known about the defensive role of their targets, the plant proteases. C1A cysteine proteases are the most abundant enzymes responsible for the proteolytic activity during different processes like germination, development and senescence in plants. To identify and characterize C1A cysteine proteases of barley with a potential role in defense, mRNA and protein expression patterns were analyzed in response to biotics stresses. A barley cysteine protease, HvPap-1, previously related to abiotic stresses and grain germination, was particularly induced by flagellin or chitosan elicitation, and biotic stresses such as the phytopathogenic fungus Magnaporthe oryzae or the phytophagous mite Tetranychus urticae. To elucidate the in vivo participation of this enzyme in defense, transformed barley plants overexpressing or silencing HvPap-1 encoding gene were subjected to M. oryzae infection or T. urticae infestation. Whereas overexpressing plants were less susceptible to the fungus than silencing plants, the opposite behavior occurred to the mite. This unexpected result highlights the complexity of the regulatory events leading to the response to a particular biotic stress.
E(y)2/Sus1 is required for blocking PRE silencing by the Wari insulator in Drosophila melanogaster.
Erokhin, Maksim; Parshikov, Alexander; Georgiev, Pavel; Chetverina, Darya
2010-06-01
Chromatin insulators affect interactions between promoters and enhancers/silencers and function as barriers to the spread of repressive chromatin. Recently, we have found an insulator, named Wari, located on the 3' side of the white gene. Here, we show that the previously identified 368-bp core of this insulator is sufficient for blocking Polycomb response element-mediated silencing. Although Wari does not contain binding sites for known insulator proteins, the E(y)2 and CP190 proteins bind to Wari as well as to the Su(Hw)-containing insulators in vivo. It may well be that these proteins are recruited to the insulator by as yet unidentified DNA-binding protein. Partial inactivation of E(y)2 in a weak e(y)2 ( u1 ) mutation impairs only the anti-silencing but not the enhancer-blocking activity of the Wari insulator. Thus, the E(y)2 protein in different Drosophila insulators serves to protect gene expression from silencing.
A New Testing Method for Lifetime Prediction of Automotive Exhaust Silencers
Directory of Open Access Journals (Sweden)
Muhammad Yasir
2011-01-01
Full Text Available The purpose of this paper is to highlight the problems associated with daily routine corrosion tests performed in an automotive exhaust industry. Estimation of the life time of a complete system under real conditions is always uncertain and often leads to a disagreement. A new testing setup was built in which simulation of external and internal corrosion with additional thermal cycles can be performed simultaneously. Simulation of all real conditions makes this test totally versatile and unique among all the existing testing methods. All test results were investigated quantitatively and a direct comparison was made between some field systems with different mileage and total life. Conformity was accomplished between the results from corrosion tests and parts from the vehicles. Studies carried out on the silencers have shown that the new component testing method could be used for life time estimation of parts having different material and design combinations. On the basis of obtained results it can be stated that the new testing setup can be applied for different materials and design rankings.
Shame and Silence | Janz | South African Journal of Philosophy
African Journals Online (AJOL)
Samantha Vice's proposal on how to live in 'this strange place' of contemporary South Africa, includes an appeal to the concepts of shame and silence. In this paper, I use Emmanuel Levinas and Giorgio Agamben to move the discussion of shame from a moral to an existential question. The issue is not about how one ...
Rocchigiani, Luca; Fernandez-Cestau, Julio; Budzelaar, Peter H M; Bochmann, Manfred
2018-06-21
The factors affecting the rates of reductive C-C cross-coupling reactions in gold(III) aryls were studied by using complexes that allow easy access to a series of electronically modified aryl ligands, as well as to gold methyl and vinyl complexes, by using the pincer compounds [(C^N^C)AuR] (R=C 6 F 5 , CH=CMe 2 , Me and p-C 6 H 4 X, where X=OMe, F, H, tBu, Cl, CF 3 , or NO 2 ) as starting materials (C^N^C=2,6-(4'-tBuC 6 H 3 ) 2 pyridine dianion). Protodeauration followed by addition of one equivalent SMe 2 leads to the quantitative generation of the thioether complexes [(C^N-CH)AuR(SMe 2 )] + . Upon addition of a second SMe 2 pyridine is displaced, which triggers the reductive aryl-R elimination. The rates for these cross-couplings increase in the sequence k(vinyl)>k(aryl)≫k(C 6 F 5 )>k(Me). Vinyl-aryl coupling is particularly fast, 1.15×10 -3 L mol -1 s -1 at 221 K, whereas both C 6 F 5 and Me couplings encountered higher barriers for the C-C bond forming step. The use of P(p-tol) 3 in place of SMe 2 greatly accelerates the C-C couplings. Computational modelling shows that in the C^N-bonded compounds displacement of N by a donor L is required before the aryl ligands can adopt a conformation suitable for C-C bond formation, so that elimination takes place from a four-coordinate intermediate. The C-C bond formation is the rate-limiting step. In the non-chelating case, reductive C(sp 2 )-C(sp 2 ) elimination from three-coordinate ions [(Ar 1 )(Ar 2 )AuL] + is almost barrier-free, particularly if L=phosphine. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Bienk, Konrad; Hvam, Michael Lykke; Pakula, Malgorzata Maria; Dagnæs-Hansen, Frederik; Wengel, Jesper; Malle, Birgitte Mølholm; Kragh-Hansen, Ulrich; Cameron, Jason; Bukrinski, Jens Thostrup; Howard, Kenneth A
2016-06-28
Major challenges for the clinical translation of small interfering RNA (siRNA) include overcoming the poor plasma half-life, site-specific delivery and modulation of gene silencing. In this work, we exploit the intrinsic transport properties of human serum albumin to tune the blood circulatory half-life, hepatic accumulation and gene silencing; based on the number of siRNA cholesteryl modifications. We demonstrate by a gel shift assay a strong and specific affinity of recombinant human serum albumin (rHSA) towards cholesteryl-modified siRNA (Kd>1×10(-7)M) dependent on number of modifications. The rHSA/siRNA complex exhibited reduced nuclease degradation and reduced induction of TNF-α production by human peripheral blood mononuclear cells. The increased solubility of heavily cholesteryl modified siRNA in the presence of rHSA facilitated duplex annealing and consequent interaction that allowed in vivo studies using multiple cholesteryl modifications. A structural-activity-based screen of in vitro EGFP-silencing was used to select optimal siRNA designs containing cholesteryl modifications within the sense strand that were used for in vivo studies. We demonstrate plasma half-life extension in NMRI mice from t1/2 12min (naked) to t1/2 45min (single cholesteryl) and t1/2 71min (double cholesteryl) using fluorescent live bioimaging. The biodistribution showed increased accumulation in the liver for the double cholesteryl modified siRNA that correlated with an increase in hepatic Factor VII gene silencing of 28% (rHSA/siRNA) compared to 4% (naked siRNA) 6days post-injection. This work presents a novel albumin-mediated cholesteryl design-based strategy for tuning pharmacokinetics and systemic gene silencing. Copyright © 2016 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Nielsen, Inga Sig; Nielsen, Olaf; Murray, Johanne M
2002-01-01
Genes transcribed by RNA polymerase II are silenced when introduced near the mat2 or mat3 mating-type loci of the fission yeast Schizosaccharomyces pombe. Silencing is mediated by a number of gene products and cis-acting elements. We report here the finding of novel trans-acting factors identified...... was not suppressed by a mutation in the 26S proteasome, suggesting that loss of silencing is not due to an increased degradation of silencing factors but rather to the posttranslational modification of proteins by ubiquitination. We discuss the implications of these results for the possible modes of action of UbcP3...
The effects of thinking in silence on creativity and innovation
de Vet, A.J.
2007-01-01
This dissertation consists of three empirical studies on the effects of thinking in silence on creativity and innovation. In these studies I use a social psychology and cognitive psychology lens to study creativity and innovation at the individual and at the team level of analysis, using randomized
Directory of Open Access Journals (Sweden)
Marianna Feretzaki
2016-03-01
Full Text Available RNAi is a ubiquitous pathway that serves central functions throughout eukaryotes, including maintenance of genome stability and repression of transposon expression and movement. However, a number of organisms have lost their RNAi pathways, including the model yeast Saccharomyces cerevisiae, the maize pathogen Ustilago maydis, the human pathogen Cryptococcus deuterogattii, and some human parasite pathogens, suggesting there may be adaptive benefits associated with both retention and loss of RNAi. By comparing the RNAi-deficient genome of the Pacific Northwest Outbreak C. deuterogattii strain R265 with the RNAi-proficient genomes of the Cryptococcus pathogenic species complex, we identified a set of conserved genes that were lost in R265 and all other C. deuterogattii isolates examined. Genetic and molecular analyses reveal several of these lost genes play roles in RNAi pathways. Four novel components were examined further. Znf3 (a zinc finger protein and Qip1 (a homolog of N. crassa Qip were found to be essential for RNAi, while Cpr2 (a constitutive pheromone receptor and Fzc28 (a transcription factor are involved in sex-induced but not mitosis-induced silencing. Our results demonstrate that the mitotic and sex-induced RNAi pathways rely on the same core components, but sex-induced silencing may be a more specific, highly induced variant that involves additional specialized or regulatory components. Our studies further illustrate how gene network polymorphisms involving known components of key cellular pathways can inform identification of novel elements and suggest that RNAi loss may have been a core event in the speciation of C. deuterogattii and possibly contributed to its pathogenic trajectory.
Directory of Open Access Journals (Sweden)
Alireza AYOUBI
2015-01-01
Full Text Available The aim of this study was to investigate the protective effects of vitamin C against lead toxicity by measuring the blood parameters and studying histopathology of testis in diabetic male rats. Wister rats (42 were randomly assigned into7 groups: I healthy; II fed lead acetate only; III vitamin C administered only; IV diabetic; V diabetic rats administered by vitamin C; VI diabetic rats given lead acetate and VII diabetic rats received lead acetate and vitamin C. The diabetic and lead groups had higher glucose, cholesterol, LDL, triglycerides and lower insulin and HDL concentration than the control group. It was found that vitamin C administration led to a lower level of blood glucose, cholesterol, LDL and triglycerides and higher HDL concentration in diabetic rats significantly. It was concluded that the antioxidant property of vitamin C resulted in reducing the oxidative stress complications of toxic levels of lead acetate in diabetic rats.
Raman, Pravrutha; Zaghab, Soriayah M; Traver, Edward C; Jose, Antony M
2017-08-21
Long double-stranded RNA (dsRNA) can silence genes of matching sequence upon ingestion in many invertebrates and is therefore being developed as a pesticide. Such feeding RNA interference (RNAi) is best understood in the worm Caenorhabditis elegans, where the dsRNA-binding protein RDE-4 initiates silencing by recruiting an endonuclease to process long dsRNA into short dsRNA. These short dsRNAs are thought to move between cells because muscle-specific rescue of rde-4 using repetitive transgenes enables silencing in other tissues. Here, we extend this observation using additional promoters, report an inhibitory effect of repetitive transgenes, and discover conditions for cell-autonomous silencing in animals with tissue-specific rescue of rde-4. While expression of rde-4(+) in intestine, hypodermis, or neurons using a repetitive transgene can enable silencing also in unrescued tissues, silencing can be inhibited wihin tissues that express a repetitive transgene. Single-copy transgenes that express rde-4(+) in body-wall muscles or hypodermis, however, enable silencing selectively in the rescued tissue but not in other tissues. These results suggest that silencing by the movement of short dsRNA between cells is not an obligatory feature of feeding RNAi in C. elegans. We speculate that similar control of dsRNA movement could modulate tissue-specific silencing by feeding RNAi in other invertebrates. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
High-throughput sequencing of RNA silencing-associated small RNAs in olive (Olea europaea L..
Directory of Open Access Journals (Sweden)
Livia Donaire
Full Text Available Small RNAs (sRNAs of 20 to 25 nucleotides (nt in length maintain genome integrity and control gene expression in a multitude of developmental and physiological processes. Despite RNA silencing has been primarily studied in model plants, the advent of high-throughput sequencing technologies has enabled profiling of the sRNA component of more than 40 plant species. Here, we used deep sequencing and molecular methods to report the first inventory of sRNAs in olive (Olea europaea L.. sRNA libraries prepared from juvenile and adult shoots revealed that the 24-nt class dominates the sRNA transcriptome and atypically accumulates to levels never seen in other plant species, suggesting an active role of heterochromatin silencing in the maintenance and integrity of its large genome. A total of 18 known miRNA families were identified in the libraries. Also, 5 other sRNAs derived from potential hairpin-like precursors remain as plausible miRNA candidates. RNA blots confirmed miRNA expression and suggested tissue- and/or developmental-specific expression patterns. Target mRNAs of conserved miRNAs were computationally predicted among the olive cDNA collection and experimentally validated through endonucleolytic cleavage assays. Finally, we use expression data to uncover genetic components of the miR156, miR172 and miR390/TAS3-derived trans-acting small interfering RNA (tasiRNA regulatory nodes, suggesting that these interactive networks controlling developmental transitions are fully operational in olive.
Highly reversible lead-carbon battery anode with lead grafting on the carbon surface
Yin, Jian; Lin, Nan; Zhang, Wenli; Lin, Zheqi; Zhang, Ziqing; Wang, Yue; Shi, Jun; Bao, Jinpeng; Lin, Haibo
2018-01-01
A novel C/Pb composite has been successfully prepared by electroless plating to reduce the hydrogen evolution and achieve the high reversibility of the anode of lead-carbon battery (LCB). The deposited lead on the surface of C/Pb composite was found to be uniform and adherent to carbon surface. Because lead has been stuck on the surface of C/Pb composite, the embedded structure suppresses the hydrogen evolution of lead-carbon anode and strengthens the connection between carbon additive and sponge lead. Compared with the blank anode, the lead-carbon anode with C/Pb composite displays excellent charge–discharge reversibility, which is attributed to the good connection between carbon additives and lead that has been stuck on the surface of C/Pb composite during the preparation process. The addition of C/Pb composite maintains a solid anode structure with high specific surface area and power volume, and thereby, it plays a significant role in the highly reversible lead-carbon anode.
Highly reversible lead-carbon battery anode with lead grafting on the carbon surface
Yin, Jian
2018-03-27
A novel C/Pb composite has been successfully prepared by electroless plating to reduce the hydrogen evolution and achieve the high reversibility of the anode of lead-carbon battery (LCB). The deposited lead on the surface of C/Pb composite was found to be uniform and adherent to carbon surface. Because lead has been stuck on the surface of C/Pb composite, the embedded structure suppresses the hydrogen evolution of lead-carbon anode and strengthens the connection between carbon additive and sponge lead. Compared with the blank anode, the lead-carbon anode with C/Pb composite displays excellent charge–discharge reversibility, which is attributed to the good connection between carbon additives and lead that has been stuck on the surface of C/Pb composite during the preparation process. The addition of C/Pb composite maintains a solid anode structure with high specific surface area and power volume, and thereby, it plays a significant role in the highly reversible lead-carbon anode.
Energy Technology Data Exchange (ETDEWEB)
Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)
2014-11-14
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
Liu, Xiaoxia; Sun, Guiling; Sun, Xiuju
2016-01-01
This study aimed to investigate the effects of silencing the speckle-type POZ protein (SPOP) gene on renal cell cancer (RCC) cells and to explore its possible mechanism. The A498 and ACHN RCC cells were transfected with small interference RNA (siRNA)-SPOP by lipofection methods. The silencing efficiency was monitored by quantitative real-time polymerase chain reaction and Western blot. The effects of SPOP silencing on cell apoptosis, cell viability, colony formation ability, cell migration ability, and chemosensitivity to Sorafenib were assessed by flow cytometry, an MTT assay, a colony formation assay, a trans-well migration assay, and a CCK-8 assay, respectively. Its effects on the expression of several cytokines were determined by a protein microarray. Relevant signaling pathways were also analyzed. Compared with the control group, the cell apoptosis rate was significantly higher; the cell viability, the colony formation, and migration ability were significantly decreased in the siRNA-SPOP group. The protein microarray screening showed that the expression of vascular endothelial growth factor receptor, matrix metallopeptidase-9, vascular cell adhesion molecule-1, and stromal cell-derived factor-1 in the siRNA group was significantly decreased and that the expression of granulocyte-macrophage colony-stimulating factor and E-cadherin was significantly increased (Pmatrix organization signal pathway. SPOP gene silencing induced cell apoptosis, decreased cell viability, colony formation, and migration ability, and elevated the drug sensitivity in the RCC cells. A possible mechanism is that silencing SPOP induces the differential expression of E-cadherin, vascular endothelial growth factor receptor, matrix metallopeptidase-9, and vascular cell adhesion molecule, which are related to the integrin-mediated cell surface interactions and extracellular matrix organization signaling pathway.
Directory of Open Access Journals (Sweden)
Yan Liang
2013-11-01
Full Text Available Drought is a major threat to agriculture production worldwide. Mitogen-activated protein kinases (MAPKs play a pivotal role in sensing and converting stress signals into appropriate responses so that plants can adapt and survive. To examine the function of MAPKs in the drought tolerance of tomato plants, we silenced the SpMPK1, SpMPK2, and SpMPK3 genes in wild-type plants using the virus-induced gene silencing (VIGS method. The results indicate that silencing the individual genes or co-silencing SpMPK1, SpMPK2, and SpMPK3 reduced the drought tolerance of tomato plants by varying degrees. Co-silencing SpMPK1 and SpMPK2 impaired abscisic acid (ABA-induced and hydrogen peroxide (H2O2-induced stomatal closure and enhanced ABA-induced H2O2 production. Similar results were observed when silencing SpMPK3 alone, but not when SpMPK1 and SpMPK2 were individually silenced. These data suggest that the functions of SpMPK1 and SpMPK2 are redundant, and they overlap with that of SpMPK3 in drought stress signaling pathways. In addition, we found that SpMPK3 may regulate H2O2 levels by mediating the expression of CAT1. Hence, SpMPK1, SpMPK2, and SpMPK3 may play crucial roles in enhancing tomato plants’ drought tolerance by influencing stomatal activity and H2O2 production via the ABA-H2O2 pathway.
RNA interference silencing of CHS greatly alters the growth pattern of apple (Malus x domestica).
Dare, Andrew P; Hellens, Roger P
2013-08-01
Plants produce a vast array of phenolic compounds which are essential for their survival on land. One major class of polyphenols are the flavonoids and their formation is dependent on the enzyme chalcone synthase (CHS). In a recent study we silenced the CHS genes of apple (Malus × domestica Borkh.) and observed a loss of pigmentation in the fruit skin, flowers and stems. More surprisingly, highly silenced lines were significantly reduced in size, with small leaves and shortened internode lengths. Chemical analysis also revealed that the transgenic shoots contained greatly reduced concentrations of flavonoids which are known to modulate auxin flow. An auxin transport study verified this, with an increased auxin transport in the CHS-silenced lines. Overall, these findings suggest that auxin transport in apple has adapted to take place in the presence of high endogenous concentrations of flavonoids. Removal of these compounds therefore results in abnormal auxin movement and a highly disrupted growth pattern.
Directory of Open Access Journals (Sweden)
Jingbo Zhang
2018-01-01
Full Text Available In the field of cognitive radio spectrum sensing, the adaptive silence period management mechanism (ASPM has improved the problem of the low time-resource utilization rate of the traditional silence period management mechanism (TSPM. However, in the case of the low signal-to-noise ratio (SNR, the ASPM algorithm will increase the probability of missed detection for the primary user (PU. Focusing on this problem, this paper proposes an improved adaptive silence period management (IA-SPM algorithm which can adaptively adjust the sensing parameters of the current period in combination with the feedback information from the data communication with the sensing results of the previous period. The feedback information in the channel is achieved with frequency resources rather than time resources in order to adapt to the parameter change in the time-varying channel. The Monte Carlo simulation results show that the detection probability of the IA-SPM is 10–15% higher than that of the ASPM under low SNR conditions.
International Nuclear Information System (INIS)
Liu Xiaoqun; Qiao Tiankui
2014-01-01
Objective: To investigate the effect of silencing of ataxia-telangiectasia mutated (ATM) expression by plasmid-mediated RNA interference on the radiosensitivity of human lung adenocarcinoma A 549 cells. Methods: Eukaryotic expression plasmid containing ATM small interfering RNA (siRNA) (pSilencer2.1-ATM), as well as pSilencer2.1-nonspecific, was constructed.Lung adenocarcinoma A 549 cells were divided into positive group, negative group,and control group to be transfected with pSilencer2.1-ATM, pSilencer2.1-nonspecific, and no plasmid, respectively. The mRNA and protein expression of ATM was measured by RT-PCR and Western blot, respectively. The change in cell radiosensitivity was observed by colony-forming assay. Cell cycle and cell apoptosis were analyzed by flow cytometry. Results: The eukaryotic expression plasmid containing ATM siRNA was successfully constructed. The RT-PCR and Western blot demonstrated that the expression of ATM was down-regulated in the positive group. The sensitization enhancement ratios (D 0 ratios) for the positive group and negative group were 1.50 and 1.01, respectively. The flow cytometry revealed that the proportions of A 549 cells in G 1 and G 2 /M phases were significantly lower in the positive group than in the control group (51.27% vs 61.85%, P = 0.012; 6.34% vs 10.91%, P = 0.008) and that the apoptosis rate was significantly higher in the positive group than in the control group and negative group (49.31% vs 13.58%, P = 0.000; 49.31% vs 13.17%, P = 0.000). Conclusions: Silencing of ATM expression may increase the radiosensitivity of human lung adenocarcinoma A 549 cells, probably by affecting the cell cycle and promoting cell apoptosis. (authors)
Wu, H; Zhang, J; Shi, H
2016-01-01
Effect of the tumor suppression gene p16 on the biological characteristics of HeLa cervical carcinoma cells was explored. The expression of p16 protein was increased in HeLa tumor sphere cells, and no significant difference in tumor spheres from the first to the fourth passages. Compared with those of parental HeLa cells, the proportion of CD44+/CD24- and ABCG2+ cells increased significantly in tumor spheres. However after the cells were silenced by the p16-sh289 vector, expression of P16 protein and the cell number of CD44+/CD24- and ABCG2+ decreased. Moreover, HeLa cells with p16 gene silencing showed decreased abilities of sphere formation and matrigel invasion. More HeLa cells with p16 gene silence were needed for tumor formation in nude mice. Tumor size and weight in mouse model established with p16 gene silenced HeLa cells were less than those with HeLa parental cell model. The present results indicate that silencing of the p16 gene inhibits expression of cancer stem cell markers and tumorigenic ability of HeLa cells.
Rajagopalan, Vishal; Vaidyanathan, Muthukumar; Janardhanam, Vanisree Arambakkam; Bradner, James E
2014-10-01
Glioblastoma Multiforme (GBM) is an aggressive form of brain Tumor that has few cures. In this study, we analyze the anti-proliferative effects of a new molecule JQ1 against GBMs induced in Wistar Rats. JQ1 is essentially a Myc inhibitor. c-Myc is also known for altering the biochemistry of a tumor cell. Therefore, the study is intended to analyze certain other oncogenes associated with c-Myc and also the change in cellular biochemistry upon c-Myc inhibition. The quantitative analysis of gene expression gave a co-expressive pattern for all the three genes involved namely; c-Myc, Bcl-2, and Akt. The cellular biochemistry analysis by transmission electron microscopy revealed high glycogen and lipid aggregation in Myc inhibited cells and excessive autophagy. The study demonstrates the role of c-Myc as a central metabolic regulator and Bcl-2 and Akt assisting in extending c-Myc half-life as well as in regulation of autophagy, so as to regulate cell survival on the whole. The study also demonstrates that transient treatment by JQ1 leads to aggressive development of tumor and therefore, accelerating death, emphasizing the importance of dosage fixation, and duration for clinical use in future.
Li, Liwen; Han, Lei; Sun, Fan; Zhou, Jingjiao; Ohaegbulam, Kim C; Tang, Xudong; Zang, Xingxing; Steinbrecher, Kris A; Qu, Zhaoxia; Xiao, Gutian
2018-01-01
Activation of the inflammatory transcription factor NF-κB in tumor-associated macrophages (TAMs) is assumed to contribute to tumor promotion. However, whether and how NF-κB drives the antitumor macrophages to become pro-tumorigenic have not been determined in any cancer type yet. Similarly, how TAMs repress CD8 + cytotoxic T lymphocytes (CTLs) remains largely unknown, although their importance in regulatory T (Treg) cell regulation and tumor promotion has been well appreciated. Here, using an endogenous lung cancer model we uncover a direct crosstalk between TAMs and CTLs. TAMs suppress CTLs through the T-cell inhibitory molecule B7x (B7-H4/B7S1) in a cell-cell contact manner, whereas CTLs kill TAMs in a tumor antigen-specific manner. Remarkably, TAMs secrete the known T-cell suppressive cytokine interleukin-10 (IL-10) to activate, but not to repress, CTLs. Notably, one major role of cell-intrinsic NF-κB RelA is to drive TAMs to suppress CTLs for tumor promotion. It induces B7x expression in TAMs directly, and restricts IL-10 expression indirectly by repressing expression of the NF-κB cofactor Bcl3 and subsequent Bcl3/NF-κB1-mediated transcription of IL-10. It also renders TAMs resistant to CTLs by up-regulating anti-apoptotic genes. These studies help understand how immunity is shaped in lung tumorigenesis, and suggest a RelA-targeted immunotherapy for this deadliest cancer.
Landeo-Ríos, Yazmín; Navas-Castillo, Jesús; Moriones, Enrique; Cañizares, M. Carmen
2017-11-24
To counteract host antiviral RNA silencing, plant viruses express suppressor proteins that function as pathogenicity enhancers. The genome of the Tomato chlorosis virus (ToCV) (genus Crinivirus , family Closteroviridae ) encodes an RNA silencing suppressor, the protein p22, that has been described as having one of the longest lasting local suppressor activities when assayed in Nicotiana benthamiana . Since suppression of RNA silencing and the ability to enhance disease severity are closely associated, we analyzed the effect of expressing p22 in heterologous viral contexts. Thus, we studied the effect of the expression of ToCV p22 from viral vectors Tobacco rattle virus (TRV) and Potato virus X (PVX), and from attenuated suppressor mutants in N. benthamiana plants. Our results show that although an exacerbation of disease symptoms leading to plant death was observed in the heterologous expression of ToCV p22 from both viruses, only in the case of TRV did increased viral accumulation occur. The heterologous expression of ToCV p22 could not complement suppressor-defective mutant viruses.
Identification of a maize chlorotic dwarf virus silencing suppressor protein
Maize chlorotic dwarf virus (MCDV), a member of the genus Waikavirus, family Secoviridae, has a 11784 nt (+)ssRNA genome that encodes a 389 kDa proteolytically processed polyprotein. We show that an N-terminal 78kDa polyprotein (R78) has silencing suppressor activity, that it is cleaved by the viral...
Novel RNA Duplex Locks HIV-1 in a Latent State via Chromatin-mediated Transcriptional Silencing
Directory of Open Access Journals (Sweden)
Chantelle Ahlenstiel
2015-01-01
Full Text Available Transcriptional gene silencing (TGS of mammalian genes can be induced by short interfering RNA (siRNA targeting promoter regions. We previously reported potent TGS of HIV-1 by siRNA (PromA, which targets tandem NF-κB motifs within the viral 5′LTR. In this study, we screened a siRNA panel with the aim of identifying novel 5′LTR targets, to provide multiplexing potential with enhanced viral silencing and application toward developing alternate therapeutic strategies. Systematic examination identified a novel siRNA target, si143, confirmed to induce TGS as the silencing mechanism. TGS was prolonged with virus suppression >12 days, despite a limited ability to induce post- TGS. Epigenetic changes associated with silencing were suggested by partial reversal by histone deacetylase inhibitors and confirmed by chromatin immunoprecipitation analyses, which showed induction of H3K27me3 and H3K9me3, reduction in H3K9Ac, and recruitment of argonaute-1, all characteristic marks of heterochromatin and TGS. Together, these epigenetic changes mimic those associated with HIV-1 latency. Further, robust resistance to reactivation was observed in the J-Lat 9.2 cell latency model, when transduced with shPromA and/or sh143. These data support si/shRNA-mediated TGS approaches to HIV-1 and provide alternate targets to pursue a functional cure, whereby the viral reservoir is locked in latency following antiretroviral therapy cessation.
Cataplexy leading to the diagnosis of Niemann-Pick disease type C.
Smit, Liesbeth S; Lammers, Gert Jan; Catsman-Berrevoets, Coriene E
2006-07-01
Cataplexy in childhood is a rare and often misdiagnosed symptom. It is described as a brief episode of bilateral loss of muscle tone with intact consciousness, triggered by a variety of strong emotions and in particular with unexpected laughter. This report presents a 9-year old male with progressive cerebellar and pyramidal symptoms and a cognitive decline since the age of 4. His recently developed "drop attacks" on laughter were recognized as cataplexy and led to the diagnosis of Niemann-Pick type C disease. With biochemical studies this diagnosis, a lysosomal storage disease, was confirmed. With cataplexy narcolepsy, Niemann-Pick type C disease, Norrie disease, Prader-Willi syndrome, and Coffin-Lowry syndrome are associated disorders. Recognition of cataplexy in children with concomitant neurologic symptoms may lead to an early and straight diagnosis of one of these disorders.